Sample records for acid rna synthesis

  1. Antibacterial activity of lichen secondary metabolite usnic acid is primarily caused by inhibition of RNA and DNA synthesis.

    PubMed

    Maciąg-Dorszyńska, Monika; Węgrzyn, Grzegorz; Guzow-Krzemińska, Beata

    2014-04-01

    Usnic acid, a compound produced by various lichen species, has been demonstrated previously to inhibit growth of different bacteria and fungi; however, mechanism of its antimicrobial activity remained unknown. In this report, we demonstrate that usnic acid causes rapid and strong inhibition of RNA and DNA synthesis in Gram-positive bacteria, represented by Bacillus subtilis and Staphylococcus aureus, while it does not inhibit production of macromolecules (DNA, RNA, and proteins) in Escherichia coli, which is resistant to even high doses of this compound. However, we also observed slight inhibition of RNA synthesis in a Gram-negative bacterium, Vibrio harveyi. Inhibition of protein synthesis in B. subtilis and S. aureus was delayed, which suggest indirect action (possibly through impairment of transcription) of usnic acid on translation. Interestingly, DNA synthesis was halted rapidly in B. subtilis and S. aureus, suggesting interference of usnic acid with elongation of DNA replication. We propose that inhibition of RNA synthesis may be a general mechanism of antibacterial action of usnic acid, with additional direct mechanisms, such as impairment of DNA replication in B. subtilis and S. aureus. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  2. Synthesis of RNA oligomers on heterogeneous templates

    NASA Technical Reports Server (NTRS)

    Ertem, G.; Ferris, J. P.

    1996-01-01

    The concept of an RNA world in the chemical origin of life is appealing, as nucleic acids are capable of both information storage and acting as templates that catalyse the synthesis of complementary molecules. Template-directed synthesis has been demonstrated for homogeneous oligonucleotides that, like natural nucleic acids, have 3',5' linkages between the nucleotide monomers. But it seems likely that prebiotic routes to RNA-like molecules would have produced heterogeneous molecules with various kinds of phosphodiester linkages and both linear and cyclic nucleotide chains. Here we show that such heterogeneity need be no obstacle to the templating of complementary molecules. Specifically, we show that heterogeneous oligocytidylates, formed by the montmorillonite clay-catalysed condensation of actuated monomers, can serve as templates for the synthesis of oligoguanylates. Furthermore, we show that oligocytidylates that are exclusively 2',5'-linked can also direct synthesis of oligoguanylates. Such heterogeneous templating reactions could have increased the diversity of the pool of protonucleic acids from which life ultimately emerged.

  3. Bacteriophage phi 6 RNA-dependent RNA polymerase: molecular details of initiating nucleic acid synthesis without primer.

    PubMed

    Laurila, Minni R L; Makeyev, Eugene V; Bamford, Dennis H

    2002-05-10

    Like most RNA polymerases, the polymerase of double-strand RNA bacteriophage phi6 (phi6pol) is capable of primer-independent initiation. Based on the recently solved phi6pol initiation complex structure, a four-amino acid-long loop (amino acids 630-633) has been suggested to stabilize the first two incoming NTPs through stacking interactions with tyrosine, Tyr(630). A similar loop is also present in the hepatitis C virus polymerase, another enzyme capable of de novo initiation. Here, we use a series of phi6pol mutants to address the role of this element. As predicted, mutants at the Tyr(630) position are inefficient in initiation de novo. Unexpectedly, when the loop is disordered by changing Tyr(630)-Lys(631)-Trp(632) to GSG, phi6pol becomes a primer-dependent enzyme, either extending complementary oligonucleotide or, when the template 3' terminus can adopt a hairpin-like conformation, utilizing a "copy-back" initiation mechanism. In contrast to the wild-type phi6pol, the GSG mutant does not require high GTP concentration for its optimal activity. These findings suggest a general model for the initiation of de novo RNA synthesis.

  4. Amino Acid Control over Deoxyribonucleic Acid Synthesis in Escherichia coli Infected With T-Even Bacteriophage

    PubMed Central

    Donini, Pierluigi

    1970-01-01

    Starvation for a required amino acid of normal or RCstrEscherichia coli infected with T-even phages arrests further synthesis of phage deoxyribonucleic acid (DNA). This amino acid control over phage DNA synthesis does not occur in RCrelE. coli mutants. Heat inactivation of a temperature-sensitive aminoacyl-transfer ribonucleic acid (RNA) synthetase similarly causes an arrest of phage DNA synthesis in infected cells of RCstr phenotype but not in cells of RCrel phenotype. Inhibition of phage DNA synthesis in amino acid-starved RCstr host cells can be reversed by addition of chloramphenicol to the culture. Thus, the general features of amino acid control over T-even phage DNA synthesis are entirely analogous to those known for amino acid control over net RNA synthesis of uninfected bacteria. This analogy shows that the bacterial rel locus controls a wider range of macromolecular syntheses than had been previously thought. PMID:4914067

  5. Nonenzymatic synthesis of RNA and DNA oligomers on hexitol nucleic acid templates: the importance of the A structure

    NASA Technical Reports Server (NTRS)

    Kozlov, I. A.; Politis, P. K.; Van Aerschot, A.; Busson, R.; Herdewijn, P.; Orgel, L. E.; Bada, J. L. (Principal Investigator); Dolan, M. (Principal Investigator)

    1999-01-01

    Hexitol nucleic acid (HNA) is an analogue of DNA containing the standard nucleoside bases, but with a phosphorylated 1,5-anhydrohexitol backbone. HNA oligomers form duplexes having the nucleic acid A structure with complementary DNA or RNA oligomers. The HNA decacytidylate oligomer is an efficient template for the oligomerization of the 5'-phosphoroimidazolides of guanosine or deoxyguanosine. Comparison of the oligomerization efficiencies on HNA, RNA, and DNA decacytidylate templates under various conditions suggests strongly that only nucleic acid double helices with the A structure support efficient template-directed synthesis when 5'-phosphoroimidazolides of nucleosides are used as substrates.

  6. Effects of branched-chain volatile fatty acids on lactation performance and mRNA expression of genes related to fatty acid synthesis in mammary gland of dairy cows.

    PubMed

    Liu, Q; Wang, C; Guo, G; Huo, W J; Zhang, S L; Pei, C X; Zhang, Y L; Wang, H

    2018-02-12

    Branched-chain volatile fatty acids (BCVFA) supplements could promote lactation performance and milk quality by improving ruminal fermentation and milk fatty acid synthesis. This study was conducted to evaluate the effects of BCVFA supplementation on milk performance, ruminal fermentation, nutrient digestibility and mRNA expression of genes related to fatty acid synthesis in mammary gland of dairy cows. A total of 36 multiparous Chinese Holstein cows averaging 606±4.7 kg of BW, 65±5.2 day in milk (DIM) with daily milk production of 30.6±0.72 kg were assigned to one of four groups blocked by lactation number, milk yield and DIM. The treatments were control, low-BCVFA (LBCVFA), medium-BCVFA (MBCVFA) and high-BCVFA (HBCVFA) with 0, 30, 60 and 90 g BCVFA per cow per day, respectively. Experimental periods were 105 days with 15 days of adaptation and 90 days of data collection. Dry matter (DM) intake tended to increase, but BW changes were similar among treatments. Yields of actual milk, 4% fat corrected milk, milk fat and true protein linearly increased, but feed conversion ratio (FCR) linearly decreased with increasing BCVFA supplementation. Milk fat content linearly increased, but true protein content tended to increase. Contents of C4:0, C6:0, C8:0, C10:0, C12:0, C14:0 and C15:0 fatty acids in milk fat linearly increased, whereas other fatty acids were not affected with increasing BCVFA supplementation. Ruminal pH, ammonia N concentration and propionate molar proportion linearly decreased, but total VFA production and molar proportions of acetate and butyrate linearly increased with increasing BCVFA supplementation. Consequently, acetate to propionate ratios linearly increased. Digestibilities of DM, organic matter, CP, NDF and ADF also linearly increased. In addition, mRNA expressions of peroxisome proliferator-activated receptor γ, sterol regulatory element-binding factor 1 and fatty acid-binding protein 3 linearly increased, mRNA expressions of acetyl

  7. [Effect of metalaxyl on the synthesis of RNA, DNA and protein in Phytophthora nicotianae].

    PubMed

    Wollgiehn, R; Bräutigam, E; Schumann, B; Erge, D

    1984-01-01

    Metalaxyl is used to control diseases caused by fungi of the order of the Perenosporales. We investigated the action of this fungicid eon nucleic acid and protein synthesis in liquid cultures of Phytophthora nicotianae. The uptake of 32P, 3H-uridine, 3H-thymidine and 14C-leucine as precursors of nuclei acid and protein synthesis by the mycelium was not inhibited by metalaxyl. RNA synthesis as indicated by 3H-uridine incorporation was strongly inhibited (about 80%) by 0.5 micrograms/ml of metalaxyl. The inhibition was visible already few minutes after addition of the toxicant. Since the inhibition of incorporation of 3H-thymidine into DNA and of 14C-leucine into protein became significant 2-3 hours later, we conclude that metalaxyl primarily interfers with RNA synthesis. Synthesis of ribosomal RNA is more affected (more than 90%) than that of tRNA (about 55%) and poly(A)-containing RNA. Since in the presence of actinomycin, in contrast to metalaxyl, protein synthesis is inhibited immediately as a consequence of complete inhibition of RNA synthesis and of the short life-time of mRNA, it is also evident that mRNA synthesis is less strongly inhibited, at least during the early period of metalaxyl action. The molecular mechanism of metalaxyl inhibition of the transcription process remains open. The fungicide did not inhibit the activity of a partially purified RNA polymerase isolated from the fungus. On the other hand, the RNA synthesis (14C-UTP-incorporation) by a cell homogenate and by isolated nuclear fractions was inhibited significantly. Possibilities of the molecular action of metalaxyl are discussed. The RNA synthesis of some plant systems (cell cultures of Lycopersicon peruvianum, isolated nuclei from the same cell cultures, purified RNA polymerase from Spinacia oleracea chloroplasts) was not inhibited by metalaxyl, not even at high concentrations.

  8. Effect of tannic acid on the synthesis of protein and nucleic acid by rat liver

    PubMed Central

    Badawy, A. A.-B.; White, Audrey E.; Lathe, G. H.

    1969-01-01

    1. As early as 1hr. after the intraperitoneal administration of tannic acid to rats, it could be demonstrated in the liver. At 3hr. the nuclear fraction contained the largest amount of tannic acid. 2. Nuclear RNA synthesis was inhibited in vivo 2hr. after the administration of tannic acid. Induction by cortisol of tryptophan pyrrolase was 90% inhibited at 24hr. 3. Incorporation of [1-14C]leucine into protein by liver slices from treated rats was decreased by 50% after 24hr. Its incorporation into postmitochondrial supernatant from treated animals was not inhibited. Incorporation into slices and postmitochondrial supernatants were inhibited in vitro by tannic acid. 4. The sequence of events: concentration of tannic acid in nuclei, inhibition of nuclear RNA synthesis, inhibition of protein synthesis and production of necrosis, is discussed. PMID:5808319

  9. Origins of tmRNA: the missing link in the birth of protein synthesis?

    PubMed

    Macé, Kevin; Gillet, Reynald

    2016-09-30

    The RNA world hypothesis refers to the early period on earth in which RNA was central in assuring both genetic continuity and catalysis. The end of this era coincided with the development of the genetic code and protein synthesis, symbolized by the apparition of the first non-random messenger RNA (mRNA). Modern transfer-messenger RNA (tmRNA) is a unique hybrid molecule which has the properties of both mRNA and transfer RNA (tRNA). It acts as a key molecule during trans-translation, a major quality control pathway of modern bacterial protein synthesis. tmRNA shares many common characteristics with ancestral RNA. Here, we present a model in which proto-tmRNAs were the first molecules on earth to support non-random protein synthesis, explaining the emergence of early genetic code. In this way, proto-tmRNA could be the missing link between the first mRNA and tRNA molecules and modern ribosome-mediated protein synthesis. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. Age-related changes in cyclic phosphatidic acid-induced hyaluronic acid synthesis in human fibroblasts.

    PubMed

    Sano, Katsura; Gotoh, Mari; Dodo, Kyoko; Tajima, Noriaki; Shimizu, Yoshibumi; Murakami-Murofushi, Kimiko

    2018-01-01

    Hyaluronic acid is a major component of the extracellular matrix, which is important for skin hydration. As aging brings skin dehydration, we aimed to clarify the mRNA expression of hyaluronic acid-related proteins in human skin fibroblasts from donors of various ages (range 0.7-69 years). Previously, we reported that cyclic phosphatidic acid (cPA), a unique phospholipid mediator, stimulated the expression of HAS2 and increased hyaluronic acid synthesis in human skin fibroblasts (donor age: 3 days). In this study, we measured the mRNA expression of hyaluronic acid-related proteins: hyaluronan synthase (HAS) 1-3, hyaluronidase-1, -2, and hyaluronic acid-binding protein (versican). In addition, we tested whether cPA could increase hyaluronic acid synthesis in skin fibroblasts derived from donors of various ages. The expression of HAS1, 3, hyaluronidase-1, and -2 did not change with aging. However, the mRNA expression of versican decreased with aging. Although it is thought that the amount of hyaluronic acid in the dermis decreases with aging, the mRNA expression of HAS2 was increased. But the amount of hyaluronic acid secreted by fibroblasts did not increase with aging. This suggests that the activity and/or protein expression of HAS2 decrease with aging. Furthermore, we observed that cPA caused the increase of hyaluronic acid synthesis at any age, and this effect was increased with aging. These results suggest that aging made the fibroblasts more sensitive to cPA treatment. Therefore, cPA represents a suitable candidate for the health maintenance and improvement of the skin by increasing the level of hyaluronic acid in the dermis.

  11. Flavivirus RNA Synthesis in vitro

    PubMed Central

    Padmanabhan, Radhakrishnan; Takhampunya, Ratree; Teramoto, Tadahisa; Choi, Kyung H.

    2015-01-01

    Summary Establishment of in vitro systems to study mechanisms of RNA synthesis for positive strand RNA viruses have been very useful in the past and have shed light on the composition of protein and RNA components, optimum conditions, the nature of the products formed, cis-acting RNA elements and trans-acting protein factors required for efficient synthesis. In this review, we summarize our current understanding regarding the requirements for flavivirus RNA synthesis in vitro. We describe details of reaction conditions, the specificity of template used by either the multi-component membrane-bound viral replicase complex or by purified, recombinant RNA-dependent RNA polymerase. We also discuss future perspectives to extend the boundaries of our knowledge. PMID:26272247

  12. Regulation of early mRNA synthesis after bacteriophage T4 infection of Escherichia coli.

    PubMed Central

    Linder, C H; Fast, R

    1975-01-01

    Regulation of T4-specific mRNA synthesis was studied during leucine starvation of a leucine-requiring stringent Escherichia coli B strain. This was done by imposing starvation prior to T4 infection and then letting RNA synthesis proceed for different time periods. Rifampin or streptolydigin was added to stop further RNA synthesis, and protein synthesis was restored by addition of leucine. Samples were withdrawn at different times, and the enzyme-forming capacities found that, during conditions which elicit the stringent response in uninfected bacteria, immediate early mRNA is not stringently regulated. This conclusion contradicts the earlier conclusion of others, obtained by measuring incorporation of radioactive uracil; this is explained by the observation of Edlin and Neuhard (1967), confirmed and extended by us to the T4-infected cell, that the incorporation of uracil into RNA of a stringent strain is virtually blocked by amino acid starvation, whereas that of adenine continues at 30 to 50% of the rate seen in the presence of the required amino acid. PMID:1099229

  13. Ribonucleic Acid Synthesis and Glutamate Excretion in Escherichia coli

    PubMed Central

    Broda, Paul

    1968-01-01

    Cultures of Escherichia coli excreted glutamate into the medium when protein synthesis was blocked in RCrel strains or when it was blocked with chloramphenicol in either RCstr or RCrel strains. Both of these conditions resulted in continued ribonucleic acid (RNA) synthesis in the absence of protein synthesis. Glutamate was also excreted by both RCstr and RCrel strains when RNA synthesis was inhibited by uracil starvation or by treatment with actinomycin D. It is proposed that, in each of these cases, glutamate excretion resulted from an increase in the permeability of the cell membrane. PMID:4973126

  14. How Amino Acids and Peptides Shaped the RNA World

    PubMed Central

    van der Gulik, Peter T.S.; Speijer, Dave

    2015-01-01

    The “RNA world” hypothesis is seen as one of the main contenders for a viable theory on the origin of life. Relatively small RNAs have catalytic power, RNA is everywhere in present-day life, the ribosome is seen as a ribozyme, and rRNA and tRNA are crucial for modern protein synthesis. However, this view is incomplete at best. The modern protein-RNA ribosome most probably is not a distorted form of a “pure RNA ribosome” evolution started out with. Though the oldest center of the ribosome seems “RNA only”, we cannot conclude from this that it ever functioned in an environment without amino acids and/or peptides. Very small RNAs (versatile and stable due to basepairing) and amino acids, as well as dipeptides, coevolved. Remember, it is the amino group of aminoacylated tRNA that attacks peptidyl-tRNA, destroying the bond between peptide and tRNA. This activity of the amino acid part of aminoacyl-tRNA illustrates the centrality of amino acids in life. With the rise of the “RNA world” view of early life, the pendulum seems to have swung too much towards the ribozymatic part of early biochemistry. The necessary presence and activity of amino acids and peptides is in need of highlighting. In this article, we try to bring the role of the peptide component of early life back into focus. We argue that an RNA world completely independent of amino acids never existed. PMID:25607813

  15. Rewiring protein synthesis: From natural to synthetic amino acids.

    PubMed

    Fan, Yongqiang; Evans, Christopher R; Ling, Jiqiang

    2017-11-01

    The protein synthesis machinery uses 22 natural amino acids as building blocks that faithfully decode the genetic information. Such fidelity is controlled at multiple steps and can be compromised in nature and in the laboratory to rewire protein synthesis with natural and synthetic amino acids. This review summarizes the major quality control mechanisms during protein synthesis, including aminoacyl-tRNA synthetases, elongation factors, and the ribosome. We will discuss evolution and engineering of such components that allow incorporation of natural and synthetic amino acids at positions that deviate from the standard genetic code. The protein synthesis machinery is highly selective, yet not fixed, for the correct amino acids that match the mRNA codons. Ambiguous translation of a codon with multiple amino acids or complete reassignment of a codon with a synthetic amino acid diversifies the proteome. Expanding the genetic code with synthetic amino acids through rewiring protein synthesis has broad applications in synthetic biology and chemical biology. Biochemical, structural, and genetic studies of the translational quality control mechanisms are not only crucial to understand the physiological role of translational fidelity and evolution of the genetic code, but also enable us to better design biological parts to expand the proteomes of synthetic organisms. This article is part of a Special Issue entitled "Biochemistry of Synthetic Biology - Recent Developments" Guest Editor: Dr. Ilka Heinemann and Dr. Patrick O'Donoghue. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Inhibition of rotavirus replication by downregulation of fatty acid synthesis.

    PubMed

    Gaunt, Eleanor R; Cheung, Winsome; Richards, James E; Lever, Andrew; Desselberger, Ulrich

    2013-06-01

    Recently the recruitment of lipid droplets (LDs) to sites of rotavirus (RV) replication was reported. LDs are polymorphic organelles that store triacylglycerols, cholesterol and cholesterol esters. The neutral fats are derived from palmitoyl-CoA, synthesized via the fatty acid biosynthetic pathway. RV-infected cells were treated with chemical inhibitors of the fatty acid biosynthetic pathway, and the effects on viral replication kinetics were assessed. Treatment with compound C75, an inhibitor of the fatty acid synthase enzyme complex (FASN), reduced RV infectivity 3.2-fold (P = 0.07) and modestly reduced viral RNA synthesis (1.2-fold). Acting earlier in the fatty acid synthesis pathway, TOFA [5-(Tetradecyloxy)-2-furoic acid] inhibits the enzyme acetyl-CoA carboxylase 1 (ACC1). TOFA reduced the infectivity of progeny RV 31-fold and viral RNA production 6-fold. The effect of TOFA on RV infectivity and RNA replication was dose-dependent, and infectivity was reduced by administering TOFA up to 4 h post-infection. Co-treatment of RV-infected cells with C75 and TOFA synergistically reduced viral infectivity. Knockdown by siRNA of FASN and ACC1 produced findings similar to those observed by inhibiting these proteins with the chemical compounds. Inhibition of fatty acid synthesis using a range of approaches uniformly had a more marked impact on viral infectivity than on viral RNA yield, inferring a role for LDs in virus assembly and/or egress. Specific inhibitors of fatty acid metabolism may help pinpoint the critical structural and biochemical features of LDs that are essential for RV replication, and facilitate the development of antiviral therapies.

  17. Effect of Thymine Starvation on Messenger Ribonucleic Acid Synthesis in Escherichia coli

    PubMed Central

    Luzzati, Denise

    1966-01-01

    Luzzati, Denise (Institut de Biologie Physico-Chimique, Paris, France). Effect of thymine starvation on messenger ribonucleic acid synthesis in Escherichia coli. J. Bacteriol. 92:1435–1446. 1966.—During the course of thymine starvation, the rate of synthesis of messenger ribonucleic acid (mRNA, the rapidly labeled fraction of the RNA which decays in the presence of dinitrophenol or which hybridizes with deoxyribonucleic acid) decreases exponentially, in parallel with the viability of the thymine-starved bacteria. The ability of cell-free extracts of starved bacteria to incorporate ribonucleoside triphosphates into RNA was determined; it was found to be inferior to that of extracts from control cells. The analysis of the properties of cell-free extracts of starved cells shows that their decreased RNA polymerase activity is the consequence of a modification of their deoxyribonucleic acid, the ability of which to serve as a template for RNA polymerase decreases during starvation. PMID:5332402

  18. Improved deoxyribozymes for synthesis of covalently branched DNA and RNA.

    PubMed

    Lee, Christine S; Mui, Timothy P; Silverman, Scott K

    2011-01-01

    A covalently branched nucleic acid can be synthesized by joining the 2'-hydroxyl of the branch-site ribonucleotide of a DNA or RNA strand to the activated 5'-phosphorus of a separate DNA or RNA strand. We have previously used deoxyribozymes to synthesize several types of branched nucleic acids for experiments in biotechnology and biochemistry. Here, we report in vitro selection experiments to identify improved deoxyribozymes for synthesis of branched DNA and RNA. Each of the new deoxyribozymes requires Mn²(+) as a cofactor, rather than Mg²(+) as used by our previous branch-forming deoxyribozymes, and each has an initially random region of 40 rather than 22 or fewer combined nucleotides. The deoxyribozymes all function by forming a three-helix-junction (3HJ) complex with their two oligonucleotide substrates. For synthesis of branched DNA, the best new deoxyribozyme, 8LV13, has k(obs) on the order of 0.1 min⁻¹, which is about two orders of magnitude faster than our previously identified 15HA9 deoxyribozyme. 8LV13 also functions at closer-to-neutral pH than does 15HA9 (pH 7.5 versus 9.0) and has useful tolerance for many DNA substrate sequences. For synthesis of branched RNA, two new deoxyribozymes, 8LX1 and 8LX6, were identified with broad sequence tolerances and substantial activity at pH 7.5, versus pH 9.0 for many of our previous deoxyribozymes that form branched RNA. These experiments provide new, and in key aspects improved, practical catalysts for preparation of synthetic branched DNA and RNA.

  19. Heat shock represses rRNA synthesis by inactivation of TIF-IA and lncRNA-dependent changes in nucleosome positioning.

    PubMed

    Zhao, Zhongliang; Dammert, Marcel A; Hoppe, Sven; Bierhoff, Holger; Grummt, Ingrid

    2016-09-30

    Attenuation of ribosome biogenesis in suboptimal growth environments is crucial for cellular homeostasis and genetic integrity. Here, we show that shutdown of rRNA synthesis in response to elevated temperature is brought about by mechanisms that target both the RNA polymerase I (Pol I) transcription machinery and the epigenetic signature of the rDNA promoter. Upon heat shock, the basal transcription factor TIF-IA is inactivated by inhibition of CK2-dependent phosphorylations at Ser170/172. Attenuation of pre-rRNA synthesis in response to heat stress is accompanied by upregulation of PAPAS, a long non-coding RNA (lncRNA) that is transcribed in antisense orientation to pre-rRNA. PAPAS interacts with CHD4, the adenosine triphosphatase subunit of NuRD, leading to deacetylation of histones and movement of the promoter-bound nucleosome into a position that is refractory to transcription initiation. The results exemplify how stress-induced inactivation of TIF-IA and lncRNA-dependent changes of chromatin structure ensure repression of rRNA synthesis in response to thermo-stress. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. Studies on the Role of RNA Synthesis in Auxin Induction of Cell Enlargement 1

    PubMed Central

    Nooden, Larry D.

    1968-01-01

    Selective inhibitors were used to study the connection between nucleic acid synthesis and indoleacetic acid (IAA) induction of cell enlargement. Actinomycin D (act D) and azaguanine (azaG) almost completely inhibit IAA-induced growth in aged artichoke tuber disks when they are added simultaneously with IAA. In contrast, when they are added 24 hours after the hormone, these inhibitors have little or no effect on the induced growth which continues for 48 hours or more with little or no inhibition. Inhibitors of protein synthesis still stop growth when applied 24 hours after the IAA, thus protein synthesis and presumably supporting metabolism are still essential. In corn coleoptile sections auxin-induced growth did not show any pronounced tendency to become less sensitive to act D as the IAA treatment progressed. Act D did not completely inhibit the response to IAA unless the sections were pretreated with act D for 6 hours. In contrast to act D, cordycepin produced almost complete inhibition of IAA-induced growth when added with the IAA. Although IAA has a very large and very rapid stimulatory effect (within 10 min) on incorporation of 32P-orthophosphate into RNA in disks, it did not cause a detectable change in the base composition of the RNA synthesized. Furthermore, the promotive effect could be accounted for through increased uptake of the 32P. That much of the RNA synthesis in these tissues is not necessary for auxin action is indicated by the results with fluorouracil (FU). FU strongly inhibits RNA synthesis, probably acting preferentially on ribosomal RNA synthesis, without inhibiting auxin-induced growth in the disks or coleoptile sections. FU also strongly inhibited respiration in auxin-treated disks indicating that the large promotion of respiration by auxin likewise may not be entirely necessary for growth. At least in the artichoke disks, RNA synthesis is required for auxin induction of cell enlargement and not for cell enlargement itself. The possible

  1. RNA turnover and protein synthesis in fish cells.

    PubMed

    Smith, R W; Palmer, R M; Houlihan, D F

    2000-03-01

    Protein synthesis in fish has been previously correlated with RNA content. The present study investigates whether protein and RNA synthesis rates are similarly related. Protein and RNA synthesis rates were determined from 3H-phenylalanine and 3H-uridine incorporation, respectively, and expressed as % x day(-1) and half-lives, respectively. Three fibroblast cell lines were used: BF-2, RTP, CHSE 214, which are derived from the bluegill, rainbow trout and Chinook salmon, respectively. These cells contained similar RNA concentrations (approximately 175 microg RNA x mg(-1) cell protein). Therefore differences in protein synthesis rates, BF-2 (31.3 +/- 1.8)>RTP (25.1 +/- 1.7)>CHSE 214 (17.6 +/-1.1), were attributable to RNA translational efficiency. The most translationally efficient RNA (BF-2 cells), 1.8 mg protein synthesised x microg(-1) RNA x day(-1), corresponded to the lowest RNA half-life, 75.4 +/- 6.4 h. Translationally efficient RNA was also energetically efficient with BF-2 cells exploiting the least costly route of nucleotide supply (i.e. exogenous salvage) 3.5-6.0 times more than the least translationally efficient RNA (CHSE 214 cells). These data suggest that differential nucleotide supply, between intracellular synthesis and exogenous salvage, constitutes the area of pre-translational flexibility exploited to maintain RNA synthesis as a fixed energetic cost component of protein synthesis.

  2. DECOUPLING OF PROTEIN AND RNA SYNTHESIS DURING DEUTERIUM PARTHENOGENESIS IN SEA URCHIN EGGS

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gross, P.R.; Spindel, W.; Cousineau, G.H.

    1963-10-29

    The parthenogenetic activation of cell division and suppression of nucleic acid synthesis by deuterium in eggs of sea urchins was investigated. D/ sub 2/O treatment was found to evoke a high rate of protein synthesis in the eggs that was maintained for several hours. However, eggs whose protein synthesis was activated and that were making labeled cytasters showed no increment in RNA synthesis over controls. (P.C.H.)

  3. Synthesis and biological activity of artificial mRNA prepared with novel phosphorylating reagents

    PubMed Central

    Nagata, Seigo; Hamasaki, Tomohiro; Uetake, Koichi; Masuda, Hirofumi; Takagaki, Kazuchika; Oka, Natsuhisa; Wada, Takeshi; Ohgi, Tadaaki; Yano, Junichi

    2010-01-01

    Though medicines that target mRNA are under active investigation, there has been little or no effort to develop mRNA itself as a medicine. Here, we report the synthesis of a 130-nt mRNA sequence encoding a 33-amino-acid peptide that includes the sequence of glucagon-like peptide-1, a peptide that stimulates glucose-dependent insulin secretion from the pancreas. The synthesis method used, which had previously been developed in our laboratory, was based on the use of 2-cyanoethoxymethyl as the 2′-hydroxy protecting group. We also developed novel, highly reactive phosphotriester pyrophosphorylating reagents to pyrophosphorylate the 5′-end of the 130-mer RNA in preparation for capping. We completed the synthesis of the artificial mRNA by the enzymatic addition of a 5′-cap and a 3′-poly(A) tail to the pyrophosphorylated 130-mer and showed that the resulting mRNA supported protein synthesis in a cell-free system and in whole cells. As far as we know, this is the first time that mRNA has been prepared from a chemically synthesized RNA sequence. As well as providing a research tool for the intracellular expression of peptides, the technology described here may be used for the production of mRNA for medical applications. PMID:20660478

  4. TIF-IA and Ebp1 regulate RNA synthesis in T cells.

    PubMed

    Saudemont, Aurore

    2015-04-16

    In this issue of Blood, Nguyen et al show that mycophenolic acid (MPA) induces GTP depletion, which inhibits the function of transcription initiation factor I (TIF-IA) and impacts the interaction of TIF-IA with ErbB3-binding protein 1 (Ebp1), a key in regulating proliferating cell nuclear antigen (PCNA) expression and ribosomal RNA (rRNA) synthesis in T cells during activation.

  5. RNA-primed complementary-sense DNA synthesis of the geminivirus African cassava mosaic virus.

    PubMed Central

    Saunders, K; Lucy, A; Stanley, J

    1992-01-01

    The plant DNA virus African cassava mosaic virus (ACMV) is believed to replicate by a rolling circle mechanism. To investigate complementary-sense DNA (lagging strand) synthesis, we have analysed the heterogenous form of complementary-sense DNA (H3 DNA) from infected Nicotiana benthamiana by two-dimensional agarose gel electrophoresis and blot hybridisation. The presence of an RNA moeity is demonstrated by comparison of results for nucleic acids resolved on neutral/alkaline and neutral/formamide gels, suggesting that complementary-sense DNA synthesis on the virus-sense single-stranded DNA template is preceded by the synthesis of an RNA primer. Hybridisation with probes to specific parts of ACMV DNA A genome indicates that synthesis of the putative RNA primer initiates between nucleotides 2581-221, a region that includes intergenic sequences that have been implicated in geminivirus DNA replication and the control of gene expression. Images PMID:1475192

  6. Regulation of Flavivirus RNA synthesis and replication

    PubMed Central

    Selisko, Barbara; Wang, Chunling; Harris, Eva; Canard, Bruno

    2014-01-01

    RNA synthesis and replication of the members of the Flavivirus genus (including dengue, West Nile and Japanese encephalitis viruses) is regulated by a wide variety of mechanisms and actors. These include the sequestration of the RNA-dependent RNA polymerase (RdRp) for functions other than RNA synthesis, regulatory interactions with other viral and host proteins within the replication complex (RC), and regulatory elements within the RNA genome itself. In this review, we discuss our current knowledge of the multiple levels at which Flavivirus RNA synthesis is controlled. We aim to bring together two active research fields: the structural and functional biology of individual proteins of the RC and the impressive wealth of knowledge acquired regarding the viral genomic RNA. PMID:25462437

  7. Synthesis and antisense properties of fluoro cyclohexenyl nucleic acid (F-CeNA), a nuclease stable mimic of 2'-fluoro RNA.

    PubMed

    Seth, Punit P; Yu, Jinghua; Jazayeri, Ali; Pallan, Pradeep S; Allerson, Charles R; Østergaard, Michael E; Liu, Fengwu; Herdewijn, Piet; Egli, Martin; Swayze, Eric E

    2012-06-01

    We report the design and synthesis of 2'-fluoro cyclohexenyl nucleic acid (F-CeNA) pyrimidine phosphoramidites and the synthesis and biophysical, structural, and biological evaluation of modified oligonucleotides. The synthesis of the nucleoside phosphoramidites was accomplished in multigram quantities starting from commercially available methyl-D-mannose pyranoside. Installation of the fluorine atom was accomplished using nonafluorobutanesulfonyl fluoride, and the cyclohexenyl ring system was assembled by means of a palladium-catalyzed Ferrier rearrangement. Installation of the nucleobase was carried out under Mitsunobu conditions followed by standard protecting group manipulations to provide the desired pyrimidine phosphoramidites. Biophysical evaluation indicated that F-CeNA shows behavior similar to that of a 2'-modified nucleotide, and duplexes with RNA showed slightly lower duplex thermostability as compared to that of the more rigid 3'-fluoro hexitol nucleic acid (FHNA). However, F-CeNA modified oligonucleotides were significantly more stable against digestion by snake venom phosphodiesterases (SVPD) as compared to unmodified DNA, 2'-fluoro RNA (FRNA), 2'-methoxyethyl RNA (MOE), and FHNA modified oligonucleotides. Examination of crystal structures of a modified DNA heptamer duplex d(GCG)-T*-d(GCG):d(CGCACGC) by X-ray crystallography indicated that the cyclohexenyl ring system exhibits both the (3)H(2) and (2)H(3) conformations, similar to the C3'-endo/C2'-endo conformation equilibrium seen in natural furanose nucleosides. In the (2)H(3) conformation, the equatorial fluorine engages in a relatively close contact with C8 (2.94 Å) of the 3'-adjacent dG nucleotide that may represent a pseudo hydrogen bond. In contrast, the cyclohexenyl ring of F-CeNA was found to exist exclusively in the (3)H(2) (C3'-endo like) conformation in the crystal structure of the modified A-form DNA decamer duplex [d(GCGTA)-T*-d(ACGC)](2.) In an animal experiment, a 16-mer F

  8. Effects of S-adenosylmethionine decarboxylase, polyamines, amino acids, and weak bases (amines and ammonia) on development and ribosomal RNA synthesis in Xenopus embryos.

    PubMed

    Shiokawa, Koichiro; Aso, Mai; Kondo, Takeshi; Takai, Jun-Ichi; Yoshida, Junki; Mishina, Takamichi; Fuchimukai, Kota; Ogasawara, Tsukasa; Kariya, Taro; Tashiro, Kosuke; Igarashi, Kazuei

    2010-02-01

    We have been studying control mechanisms of gene expression in early embryogenesis in a South African clawed toad Xenopus laevis, especially during the period of midblastula transition (MBT), or the transition from the phase of active cell division (cleavage stage) to the phase of extensive morphogenesis (post-blastular stages). We first found that ribosomal RNA synthesis is initiated shortly after MBT in Xenopus embryos and those weak bases, such as amines and ammonium ion, selectively inhibit the initiation and subsequent activation of rRNA synthesis. We then found that rapidly labeled heterogeneous mRNA-like RNA is synthesized in embryos at pre-MBT stage. We then performed cloning and expression studies of several genes, such as those for activin receptors, follistatin and aldolases, and then reached the studies of S-adenosylmethionine decarboxylase (SAMDC), a key enzyme in polyamine metabolism. Here, we cloned a Xenopus SAMDC cDNA and performed experiments to overexpress the in vitro-synthesized SAMDC mRNA in Xenopus early embryos, and found that the maternally preset program of apoptosis occurs in cleavage stage embryos, which is executed when embryos reach the stage of MBT. In the present article, we first summarize results on SAMDC and the maternal program of apoptosis, and then describe our studies on small-molecular-weight substances like polyamines, amino acids, and amines in Xenopus embryos. Finally, we summarize our studies on weak bases, especially on ammonium ion, as the specific inhibitor of ribosomal RNA synthesis in Xenopus embryonic cells.

  9. Cyclophilin B stimulates RNA synthesis by the HCV RNA dependent RNA polymerase.

    PubMed

    Heck, Julie A; Meng, Xiao; Frick, David N

    2009-04-01

    Cyclophilins are cellular peptidyl isomerases that have been implicated in regulating hepatitis C virus (HCV) replication. Cyclophilin B (CypB) is a target of cyclosporin A (CsA), an immunosuppressive drug recently shown to suppress HCV replication in cell culture. Watashi et al. recently demonstrated that CypB is important for efficient HCV replication, and proposed that it mediates the anti-HCV effects of CsA through an interaction with NS5B [Watashi K, Ishii N, Hijikata M, Inoue D, Murata T, Miyanari Y, et al. Cyclophilin B is a functional regulator of hepatitis C virus RNA polymerase. Mol Cell 2005;19:111-22]. We examined the effects of purified CypB proteins on the enzymatic activity of NS5B. Recombinant CypB purified from insect cells directly stimulated NS5B-catalyzed RNA synthesis. CypB increased RNA synthesis by NS5B derived from genotype 1a, 1b, and 2a HCV strains. Stimulation appears to arise from an increase in productive RNA binding. NS5B residue Pro540, a previously proposed target of CypB peptidyl-prolyl isomerase activity, is not required for stimulation of RNA synthesis.

  10. Synthesis of acid-soluble spore proteins by Bacillus subtilis.

    PubMed

    Leventhal, J M; Chambliss, G H

    1982-12-01

    The major acid-soluble spore proteins (ASSPs) of Bacillus subtilis were detected by immunoprecipitation of radioactively labeled in vitro- and in vivo-synthesized proteins. ASSP synthesis in vivo began 2 h after the initiation of sporulation (t2) and reached its maximum rate at t7. This corresponded to the time of synthesis of mRNA that stimulated the maximum rate of ASSP synthesis in vitro. Under the set of conditions used in these experiments, protease synthesis began near t0, alkaline phosphatase synthesis began at about t2, and refractile spores were first observed between t7 and t8. In vivo- and in vitro-synthesized ASSPs comigrated in sodium dodecyl sulfate-polyacrylamide gels. Their molecular weights were 4,600 (alpha and beta) and 11,000 (gamma). The average half-life of the ASSP messages was 11 min when either rifampin (10 micrograms/ml) or actinomycin D (1 microgram/ml) was used to inhibit RNA synthesis.

  11. Regulation of protein synthesis by amino acids in muscle of neonates

    PubMed Central

    Suryawan, Agus; Davis, Teresa A.

    2011-01-01

    The marked increase in skeletal muscle mass during the neonatal period is largely due to a high rate of postprandial protein synthesis that is modulated by an enhanced sensitivity to insulin and amino acids. The amino acid signaling pathway leading to the stimulation of protein synthesis has not been fully elucidated. Among the amino acids, leucine is considered to be a principal anabolic agent that regulates protein synthesis. mTORC1, which controls protein synthesis, has been implicated as a target for leucine. Until recently, there have been few studies exploring the role of amino acids in enhancing muscle protein synthesis in vivo. In this review, we discuss amino acid-induced protein synthesis in muscle in the neonate, focusing on current knowledge of the role of amino acids in the activation of mTORC1 leading to mRNA translation. The role of the amino acid transporters, SNAT2, LAT1, and PAT, in the modulation of mTORC1 activation and the role of amino acids in the activation of putative regulators of mTORC1, i.e., raptor, Rheb, MAP4K3, Vps34, and Rag GTPases, are discussed. PMID:21196241

  12. Cyclophilin B stimulates RNA synthesis by the HCV RNA dependent RNA polymerase

    PubMed Central

    Heck, Julie A.; Meng, Xiao; Frick, David N.

    2009-01-01

    Cyclophilins are cellular peptidyl isomerases that have been implicated in regulating hepatitis C virus (HCV) replication. Cyclophilin B (CypB) is a target of cyclosporin A (CsA), an immunosuppressive drug recently shown to suppress HCV replication in cell culture. Watashi et al. recently demonstrated that CypB is important for efficient HCV replication, and proposed that it mediates the anti-HCV effects of CsA through an interaction with NS5B (Mol. Cell 19:111). We examined the effects of purified CypB proteins on the enzymatic activity of NS5B. Recombinant CypB purified from insect cells directly stimulated NS5B-catalyzed RNA synthesis. CypB increased RNA synthesis by NS5B derived from genotype 1a, 1b, and 2a HCV strains. Stimulation appears to arise from an increase in productive RNA binding. NS5B residue Pro540, a previously proposed target of CypB peptidyl-prolyl isomerase activity, is not required for stimulation of RNA synthesis. PMID:19174155

  13. Virus-Specific RNA Synthesis in Cells Infected by Infectious Pancreatic Necrosis Virus

    PubMed Central

    Somogyi, Paul; Dobos, Peter

    1980-01-01

    Pulse-labeling experiments with [3H]uridine revealed that the rate of infections pancreatic necrosis virus-specific RNA synthesis was maximal at 8 to 10 h after infection and was completely diminished by 12 to 14 h. Three forms of RNA intermediates were detected: (i) a putative transcription intermediate (TRI) which comigrated in acrylamide gels with virion double-stranded RNA (dsRNA) after RNase treatment; (ii) a 24S genome length mRNA which could be resolved into two bands by polyacrylamide gel electrophoresis; and (iii) a 14S dsRNA component indistinguishable from virion RNA by gradient centrifugation and gel electrophoresis. The TRI (i) was LiCl precipitable; (ii) sedimented slightly faster and broader (14 to 16S) than the 14S virion dsRNA; (iii) had a lower electrophoretic mobility in acrylamide gels than dsRNA, barely entering acrylamide gels as a heterogenous component; (iv) yielded genome-sized pieces of dsRNA after RNase digestion; and (v) was the most abundant RNA form early in the infectious cycle. The 24S single-stranded RNA was thought to be the viral mRNA since it: (i) became labeled during short pulses; (ii) was found in the polysomal fraction of infected cells; and (iii) hybridized to denatured viral RNA, forming two segments of RNase-resistant RNA that comigrated with virion dsRNA in gels. The 24S mRNA component was formed before the synthesis of dsRNA, and radioactivity could be chased from 24S single-stranded RNA to dsRNA, indicating that 24S RNA may serve as template for the synthesis of complementary strands to form dsRNA. Similar to reovirus, infectious pancreatic necrosis viral 24S mRNA contained no polyadenylic acid tracts. Images PMID:16789184

  14. DNA polymerase-α regulates type I interferon activation through cytosolic RNA:DNA synthesis

    PubMed Central

    Starokadomskyy, Petro; Gemelli, Terry; Rios, Jonathan J.; Xing, Chao; Wang, Richard C.; Li, Haiying; Pokatayev, Vladislav; Dozmorov, Igor; Khan, Shaheen; Miyata, Naoteru; Fraile, Guadalupe; Raj, Prithvi; Xu, Zhe; Xu, Zigang; Ma, Lin; Lin, Zhimiao; Wang, Huijun; Yang, Yong; Ben-Amitai, Dan; Orenstein, Naama; Mussaffi, Huda; Baselga, Eulalia; Tadini, Gianluca; Grunebaum, Eyal; Sarajlija, Adrijan; Krzewski, Konrad; Wakeland, Edward K.; Yan, Nan; de la Morena, Maria Teresa; Zinn, Andrew R.; Burstein, Ezra

    2016-01-01

    Aberrant nucleic acids generated during viral replication are the main trigger for antiviral immunity, and mutations disrupting nucleic acid metabolism can lead to autoinflammatory disorders. Here we investigated the etiology of X-linked reticulate pigmentary disorder (XLPDR), a primary immunodeficiency with autoinflammatory features. We discovered that XLPDR is caused by an intronic mutation that disrupts expression of POLA1, the gene encoding the catalytic subunit of DNA polymerase-α. Unexpectedly, POLA1 deficiency results in increased type I interferon production. This enzyme is necessary for RNA:DNA primer synthesis during DNA replication and strikingly, POLA1 is also required for the synthesis of cytosolic RNA:DNA, which directly modulates interferon activation. Altogether, this work identified POLA1 as a critical regulator of the type I interferon response. PMID:27019227

  15. The RNA synthesis machinery of negative-stranded RNA viruses

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ortín, Juan, E-mail: jortin@cnb.csic.es; Martín-Benito, Jaime, E-mail: jmartinb@cnb.csic.es

    The group of Negative-Stranded RNA Viruses (NSVs) includes many human pathogens, like the influenza, measles, mumps, respiratory syncytial or Ebola viruses, which produce frequent epidemics of disease and occasional, high mortality outbreaks by transmission from animal reservoirs. The genome of NSVs consists of one to several single-stranded, negative-polarity RNA molecules that are always assembled into mega Dalton-sized complexes by association to many nucleoprotein monomers. These RNA-protein complexes or ribonucleoproteins function as templates for transcription and replication by action of the viral RNA polymerase and accessory proteins. Here we review our knowledge on these large RNA-synthesis machines, including the structure ofmore » their components, the interactions among them and their enzymatic activities, and we discuss models showing how they perform the virus transcription and replication programmes. - Highlights: • Overall organisation of NSV RNA synthesis machines. • Structure and function of the ribonucleoprotein components: Atomic structure of the RNA polymerase complex. • Commonalities and differences between segmented- and non-segmented NSVs. • Transcription versus replication programmes.« less

  16. Increasing the fidelity of noncanonical amino acid incorporation in cell-free protein synthesis.

    PubMed

    Gan, Qinglei; Fan, Chenguang

    2017-11-01

    Cell-free protein synthesis provides a robust platform for co-translational incorporation of noncanonical amino acid (ncAA) into proteins to facilitate biological studies and biotechnological applications. Recently, eliminating the activity of release factor 1 has been shown to increase ncAA incorporation in response to amber codons. However, this approach could promote mis-incorporation of canonical amino acids by near cognate suppression. We performed a facile protocol to remove near cognate tRNA isoacceptors of the amber codon from total tRNAs, and used the phosphoserine (Sep) incorporation system as validation. By manipulating codon usage of target genes and tRNA species introduced into the cell-free protein synthesis system, we increased the fidelity of Sep incorporation at a specific position. By removing three near cognate tRNA isoacceptors of the amber stop codon [tRNA Lys , tRNA Tyr , and tRNA Gln (CUG)] from the total tRNA, the near cognate suppression decreased by 5-fold without impairing normal protein synthesis in the cell-free protein synthesis system. Mass spectrometry analyses indicated that the fidelity of ncAA incorporation was improved. Removal of near cognate tRNA isoacceptors of the amber codon could increase ncAA incorporation fidelity towards the amber stop codon in release factor deficiency systems. We provide a general strategy to improve fidelity of ncAA incorporation towards stop, quadruplet and sense codons in cell-free protein synthesis systems. This article is part of a Special Issue entitled "Biochemistry of Synthetic Biology - Recent Developments" Guest Editor: Dr. Ilka Heinemann and Dr. Patrick O'Donoghue. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Enhancement of RNA Synthesis, Protein Synthesis, and Abscission by Ethylene

    PubMed Central

    Abeles, F. B.; Holm, R. E.

    1966-01-01

    Ethylene stimulated RNA and protein synthesis in bean (Phaseolus vulgaris L. var. Red Kidney) abscission zone explants prior to abscission. The effect of ethylene on RNA synthesis and abscission was blocked by actinomycin D. Carbon dioxide, which inhibits the effect of ethylene on abscission, also inhibited the influence of ethylene on protein synthesis. An aging period appears to be essential before bean explants respond to ethylene. Stimulation of protein synthesis by ethylene occurred only in receptive or senescent explants. Treatment of juvenile explants with ethylene, which has no effect on abscission also has no effect on protein synthesis. Evidence in favor of a hormonal role for ethylene during abscission is discussed. PMID:16656405

  18. Poliovirus RNA synthesis in vitro: structural elements and antibody inhibition

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Semler, B.L.; Hanecak, R.; Dorner, L.F.

    1983-01-01

    The poliovirus RNA polymerase complex has been analyzed by immunoautoradiography using antibody probes derived from purified replicase (P3) region viral polypeptides. Antibody preparations made against the polio RNA polymerase, P3-4b, detected a previously unreported cellular protein that copurifies with the RNA polymerase. An IgG fraction purified from rabbit antiserum to polypeptide P3-2, a precursor fo the RNA polymerase, specifically inhibits poliovirus RNA synthesis in vitro. The authors have also immunoprecipitated a 60,000-dalton protein (P3-4a) with antiserum to protein P3-4b and have determined the precise genomic map position of this protein by automated Edman degradation. Protein P3-4a originates by cleavage ofmore » the RNA polymerase precursor at a glutamine-glucine amino acid pair not previously reported to be a viral cleavage site.« less

  19. Increased sensitivity to protein synthesis inhibitors in cells lacking tmRNA.

    PubMed Central

    de la Cruz, J; Vioque, A

    2001-01-01

    tmRNA (also known as SsrA or 10Sa RNA) is involved in a trans-translation reaction that contributes to the recycling of stalled ribosomes at the 3' end of an mRNA lacking a stop codon or at an internal mRNA cluster of rare codons. Inactivation of the ssrA gene in most bacteria results in viable cells bearing subtle phenotypes, such as temperature-sensitive growth. Herein, we report on the functional characterization of the ssrA gene in the cyanobacterium Synechocystis sp. strain PCC6803. Deletion of the ssrA gene in Synechocystis resulted in viable cells with a growth rate identical to wild-type cells. However, null ssrA cells (deltassrA) were not viable in the presence of the protein synthesis inhibitors chloramphenicol, lincomycin, spiramycin, tylosin, erythromycin, and spectinomycin at low doses that do not significantly affect the growth of wild-type cells. Sensitivity of deltassrA cells similar to wild-type cells was observed with kasugamycin, fusidic acid, thiostrepton, and puromycin. Antibiotics unrelated to protein synthesis, such as ampicillin or rifampicin, had no differential effect on the deltassrA strain. Furthermore, deletion of the ssrA gene is sufficient to impair global protein synthesis when chloramphenicol is added at sublethal concentrations for the wild-type strain. These results indicate that ribosomes stalled by some protein synthesis inhibitors can be recycled by tmRNA. In addition, this suggests that the first elongation cycle with tmRNA, which incorporates a noncoded alanine on the growing peptide chain, may have mechanistic differences with the normal elongation cycles that bypasses the block produced by these specific antibiotics. tmRNA inactivation could be an useful therapeutic target to increase the sensitivity of pathogenic bacteria against antibiotics. PMID:11780628

  20. Content and synthesis of nucleic acids in the cartilage in chondromalacia patellae.

    PubMed

    Lund, F; Telhag, H

    1978-12-01

    The content and the synthesis of nucleic acids in chondromalacian, osteoarthritis and normal cartilage was compared. The chondromalacian cartilage differed from osteoarthritis in that the content of nucleic acids was less. Also, the cell density was less in chondromalacian than in normal cartilage as opposed to previous findings in osteoarthritis. The synthesis of DNA was greater in chondromalacian than in normal cartilage but less than in osteoarthritis. With regard to the RNA synthesis, however, the chondromalacian cartilage showed a higher rate than both normal and osteoarthritic cartilage.

  1. [Control of RNA biosynthesis in rat liver. Some features of RNA biosynthesis during prolonged protein synthesis inhibition].

    PubMed

    Todorov, I N; Shen, R A; Zheliabovskaia, S M; Galkin, A P

    1976-10-01

    A drastic inhibition of protein biosynthesis in rat liver in vivo by cycloheximide (CHI) (0.3 mg/100 g of body weight) first caused an increase of RNA synthesis (after 1 hour), which was then followed by its decrease. Partial gradual restoration of the protein synthesis level was shown to be accompanied by a repeated increase of RNA synthesis (12 hs) and its normalisation after 24 hs. The first maximum of RNA synthesis increase in the isolated nuclei system was AU-type RNA synthesis (sensitive to alpha-amanitine), the second one was due to GC-type RNA synthesis (resistant to this toxin). Purified chromatine template activity in the system with E. coli RNA polymerase (by 14%) an hour after CHI treatment, but 3 hrs later was decreased and subsequently restored (12 hrs after CHI injection). The changes of RNA biosynthesis induced by prolonged protein synthesis inhibition suggest the existence of continuous RNA synthesis control in nuclei. This control is realized by translation system using the feed back principle.

  2. Fluctuations and synchrony of RNA synthesis in nucleoli.

    PubMed

    Pliss, Artem; Kuzmin, Andrey N; Kachynski, Aliaksandr V; Baev, Alexander; Berezney, Ronald; Prasad, Paras N

    2015-06-01

    Ribosomal RNA (rRNA) sequences are synthesized at exceptionally high rates and, together with ribosomal proteins (r-proteins), are utilized as building blocks for the assembly of pre-ribosomal particles. Although it is widely acknowledged that tight regulation and coordination of rRNA and r-protein production are fundamentally important for the maintenance of cellular homeostasis, still little is known about the real-time kinetics of the ribosome component synthesis in individual cells. In this communication we introduce a label-free MicroRaman spectrometric approach for monitoring rRNA synthesis in live cultured cells. Remarkably high and rapid fluctuations of rRNA production rates were revealed by this technique. Strikingly, the changes in the rRNA output were synchronous for ribosomal genes located in separate nucleoli of the same cell. Our findings call for the development of new concepts to elucidate the coordination of ribosomal components production. In this regard, numerical modeling further demonstrated that the production of rRNA and r-proteins can be coordinated, regardless of the fluctuations in rRNA synthesis. Overall, our quantitative data reveal a spectacular interplay of inherently stochastic rates of RNA synthesis and the coordination of gene expression.

  3. Effects of Abscisic Acid and Ethylene on the Gibberellic Acid-Induced Synthesis of α-Amylase by Isolated Wheat Aleurone Layers 1

    PubMed Central

    Varty, Keith; Arreguín, Barbarín L.; Gómez, Miguel T.; López, Pablo Jaime T.; Gómez, Miguel Angel L.

    1983-01-01

    Gibberellic acid-induced α-amylase synthesis in wheat aleurone layers (Triticum aestivum L. var Potam S-70) escaped from transcriptional control 30 h after addition of the hormone, as evidenced by the tissue's loss of susceptibility to cordycepin. Abscisic acid inhibited the accumulation of α-amylase activity when added to the tissue during this cordycepin-insensitive phase of enzyme induction. α-Amylase synthesis was not restored by the addition of cordycepin, indicating that the response to abscisic acid was not dependent upon the continuous synthesis of a short lived RNA. When ethylene was added simultaneously or some time after abscisic acid, the accumulation of α-amylase activity was sustained or quickly restored. The loss of susceptibility to cordycepin was completely prevented when aleurone layers were incubated with a combination of gibberellic and abscisic acids from the start of the induction period. This effect of abscisic acid was not reversed by ethylene. On the basis of these observations, it is suggested that abscisic acid inhibits both the transcription and translation of α-amylase mRNA, and that only the latter site of action is susceptible to reversal by ethylene. The rate of incorporation of [methyl-14C]choline into phospholipids was also inhibited by abscisic acid. Ethylene reversed this effect. The effects of abscisic acid and ethylene on phospholipid synthesis were not dependent upon the presence of gibberellic acid. No direct relationship was found between the control of α-amylase synthesis and membrane formation by abscisic acid and ethylene. PMID:16663284

  4. Hydrocortisone Stimulation of RNA Synthesis in Induction of Hepatic Enzymes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kenney, Francis T.; Wicks, Wesley D.; Greenman, David L.

    Increased synthesis of hepatic enzymes due to hydrocortisone is preceded by an increase in the rate of synthesis of nuclear RNA. Pulse-labeled RNA from liver nuclei was fractionated by a differential thermal phenol procedures, and the labeled RNA of each fraction was characterized by sucrose gradient centrifugation and base composition analysis. Hormone treatment increases the rate of synthesis of three types of RNA: (1) the nuclear precursor to ribosomal RNA, (2) a rapid turnover component with base composition similar to the tissue DNA, and (3) transfer RNA. Much of the total isotope incorporation into transfer RNA can be traced tomore » turnover of the terminal adenylate residue, but this type of labeling is insensitive to the hormone. The steroid also stimulates isotope incorporation into tissue precursor pools. The effect is abolished by actinomycin and thus is secondary to the hormonal stimulation of RNA synthesis. Growth hormone stimulates RNA synthesis in both intact and adrenalectomized rats, but induces the rapid turnover enzymes (tyrosine transaminase and tryptophan pyrrolase) only in the presence of functional adrenals. It therefore seems that glucocorticoids initiate both a generalized increase in synthesis of RNA and a selective induction of specific enzymes.« less

  5. When contemporary aminoacyl-tRNA synthetases invent their cognate amino acid metabolism

    PubMed Central

    Roy, Hervé; Becker, Hubert Dominique; Reinbolt, Joseph; Kern, Daniel

    2003-01-01

    Faithful protein synthesis relies on a family of essential enzymes called aminoacyl-tRNA synthetases, assembled in a piecewise fashion. Analysis of the completed archaeal genomes reveals that all archaea that possess asparaginyl-tRNA synthetase (AsnRS) also display a second ORF encoding an AsnRS truncated from its anticodon binding-domain (AsnRS2). We show herein that Pyrococcus abyssi AsnRS2, in contrast to AsnRS, does not sustain asparaginyl-tRNAAsn synthesis but is instead capable of converting aspartic acid into asparagine. Functional analysis and complementation of an Escherichia coli asparagine auxotrophic strain show that AsnRS2 constitutes the archaeal homologue of the bacterial ammonia-dependent asparagine synthetase A (AS-A), therefore named archaeal asparagine synthetase A (AS-AR). Primary sequence- and 3D-based phylogeny shows that an archaeal AspRS ancestor originated AS-AR, which was subsequently transferred into bacteria by lateral gene transfer in which it underwent structural changes producing AS-A. This study provides evidence that a contemporary aminoacyl-tRNA synthetase can be recruited to sustain amino acid metabolism. PMID:12874385

  6. Gene activity during germination of spores of the fern, Onoclea sensibilis: RNA and protein synthesis and the role of stored mRNA

    NASA Technical Reports Server (NTRS)

    Raghavan, V.

    1991-01-01

    Pattern of 3H-uridine incorporation into RNA of spores of Onoclea sensibilis imbibed in complete darkness (non-germinating conditions) and induced to germinate in red light was followed by oligo-dT cellulose chromatography, gel electrophoresis coupled with fluorography and autoradiography. In dark-imbibed spores, RNA synthesis was initiated about 24 h after sowing, with most of the label accumulating in the high mol. wt. poly(A) -RNA fraction. There was no incorporation of the label into poly(A) +RNA until 48 h after sowing. In contrast, photo-induced spores began to synthesize all fractions of RNA within 12 h after sowing and by 24 h, incorporation of 3H-uridine into RNA of irradiated spores was nearly 70-fold higher than that into dark-imbibed spores. Protein synthesis, as monitored by 3H-arginine incorporation into the acid-insoluble fraction and by autoradiography, was initiated in spores within 1-2 h after sowing under both conditions. Autoradiographic experiments also showed that onset of protein synthesis in the cytoplasm of the germinating spore is independent of the transport of newly synthesized nuclear RNA. One-dimensional sodium dodecyl sulphate-polyacrylamide gel electrophoresis of 35S-methionine-labelled proteins revealed a good correspondence between proteins synthesized in a cell-free translation system directed by poly(A) +RNA of dormant spores and those synthesized in vivo by dark-imbibed and photo-induced spores. These results indicate that stored mRNAs of O. sensibilis spores are functionally competent and provide templates for the synthesis of proteins during dark-imbibition and germination.

  7. Cyclic phosphatidic acid and lysophosphatidic acid induce hyaluronic acid synthesis via CREB transcription factor regulation in human skin fibroblasts.

    PubMed

    Maeda-Sano, Katsura; Gotoh, Mari; Morohoshi, Toshiro; Someya, Takao; Murofushi, Hiromu; Murakami-Murofushi, Kimiko

    2014-09-01

    Cyclic phosphatidic acid (cPA) is a naturally occurring phospholipid mediator and an analog of the growth factor-like phospholipid lysophosphatidic acid (LPA). cPA has a unique cyclic phosphate ring at the sn-2 and sn-3 positions of its glycerol backbone. We showed before that a metabolically stabilized cPA derivative, 2-carba-cPA, relieved osteoarthritis pathogenesis in vivo and induced hyaluronic acid synthesis in human osteoarthritis synoviocytes in vitro. This study focused on hyaluronic acid synthesis in human fibroblasts, which retain moisture and maintain health in the dermis. We investigated the effects of cPA and LPA on hyaluronic acid synthesis in human fibroblasts (NB1RGB cells). Using particle exclusion and enzyme-linked immunosorbent assays, we found that both cPA and LPA dose-dependently induced hyaluronic acid synthesis. We revealed that the expression of hyaluronan synthase 2 messenger RNA and protein is up-regulated by cPA and LPA treatment time dependently. We then characterized the signaling pathways up-regulating hyaluronic acid synthesis mediated by cPA and LPA in NB1RGB cells. Pharmacological inhibition and reporter gene assays revealed that the activation of the LPA receptor LPAR1, Gi/o protein, phosphatidylinositol-3 kinase (PI3K), extracellular-signal-regulated kinase (ERK), and cyclic adenosine monophosphate response element-binding protein (CREB) but not nuclear factor κB induced hyaluronic acid synthesis by the treatment with cPA and LPA in NB1RGB cells. These results demonstrate for the first time that cPA and LPA induce hyaluronic acid synthesis in human skin fibroblasts mainly through the activation of LPAR1-Gi/o followed by the PI3K, ERK, and CREB signaling pathway. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.

  8. Enzymatic synthesis of random sequences of RNA and RNA analogues by DNA polymerase theta mutants for the generation of aptamer libraries.

    PubMed

    Randrianjatovo-Gbalou, Irina; Rosario, Sandrine; Sismeiro, Odile; Varet, Hugo; Legendre, Rachel; Coppée, Jean-Yves; Huteau, Valérie; Pochet, Sylvie; Delarue, Marc

    2018-05-21

    Nucleic acid aptamers, especially RNA, exhibit valuable advantages compared to protein therapeutics in terms of size, affinity and specificity. However, the synthesis of libraries of large random RNAs is still difficult and expensive. The engineering of polymerases able to directly generate these libraries has the potential to replace the chemical synthesis approach. Here, we start with a DNA polymerase that already displays a significant template-free nucleotidyltransferase activity, human DNA polymerase theta, and we mutate it based on the knowledge of its three-dimensional structure as well as previous mutational studies on members of the same polA family. One mutant exhibited a high tolerance towards ribonucleotides (NTPs) and displayed an efficient ribonucleotidyltransferase activity that resulted in the assembly of long RNA polymers. HPLC analysis and RNA sequencing of the products were used to quantify the incorporation of the four NTPs as a function of initial NTP concentrations and established the randomness of each generated nucleic acid sequence. The same mutant revealed a propensity to accept other modified nucleotides and to extend them in long fragments. Hence, this mutant can deliver random natural and modified RNA polymers libraries ready to use for SELEX, with custom lengths and balanced or unbalanced ratios.

  9. Catalysis and prebiotic RNA synthesis

    NASA Technical Reports Server (NTRS)

    Ferris, James P.

    1993-01-01

    The essential role of catalysis for the origins of life is discussed. The status of the prebiotic synthesis of 2',5'- and 3'5'-linked oligomers of RNA is reviewed. Examples of the role of metal ion and mineral catalysis in RNA oligomer formation are discussed.

  10. Fate of mRNA following disaggregation of brain polysomes after administration of (+)-lysergic acid diethylamide in vivo.

    PubMed

    Mahony, J B; Brown, I R

    1979-11-22

    Intravenous injection of (+)-lysergic acid diethylamide into young rabbits induced a transient brain-specific disaggregation of polysomes to monosomes. Investigation of the fate of mRNA revealed that brain poly(A+)mRNA was conserved. In particular, mRNA coding for brain-specific S100 protein was not degraded, nor was it released into free ribonucleoprotein particles. Following the (+)-lysergic acid diethylamide-induced disaggregation of polysomes, mRNA shifted from polysomes and accumulated on monosomes. Formation of a blocked monosome complex, which contained intact mRNA and 40-S plus 60-S ribosomal subunits but lacked nascent peptide chains, suggested that (+)-lysergic acid diethylamide inhibited brain protein synthesis at a specific stage of late initiation or early elongation.

  11. RNA Synthesis by in Vitro Selected Ribozymes for Recreating an RNA World

    PubMed Central

    Martin, Lyssa L.; Unrau, Peter J.; Müller, Ulrich F.

    2015-01-01

    The RNA world hypothesis states that during an early stage of life, RNA molecules functioned as genome and as the only genome-encoded catalyst. This hypothesis is supported by several lines of evidence, one of which is the in vitro selection of catalytic RNAs (ribozymes) in the laboratory for a wide range of reactions that might have been used by RNA world organisms. This review focuses on three types of ribozymes that could have been involved in the synthesis of RNA, the core activity in the self-replication of RNA world organisms. These ribozyme classes catalyze nucleoside synthesis, triphosphorylation, and the polymerization of nucleoside triphosphates. The strengths and weaknesses regarding each ribozyme’s possible function in a self-replicating RNA network are described, together with the obstacles that need to be overcome before an RNA world organism can be generated in the laboratory. PMID:25610978

  12. Montmorillonite Clay-Catalyzed Synthesis of RNA Oligomers

    NASA Astrophysics Data System (ADS)

    Ferris, J. P.; Miyakawa, S.; Huang, W.; Joshi, P.

    2005-12-01

    It is proposed that catalysis had a central role in the origins of life. This will be illustrated using the montmorillonite clay-catalyzed synthesis of oligomers of RNA from activated monomers, (Ferris and Ertem, 1993) a possible step in the origin of the RNA world (Ferris, 2005). Structural analysis of oligomers formed in the reaction of the activated monomer of 5'-AMP with that of 5'-CMP demonstrated that the oligomers formed were not produced by random synthesis but rather the sequences observed were directed by the montmorillonite catalyst (Miyakawa and Ferris, 2003). RNA oligomers containing up to 40 mers have been synthesized in reactions performed in water at 25 oC in the presence of montmorillonite (Huang and Ferris, 2003). Analysis of the structure elements in these oligomers from the 7 to 39 mers showed that they did not vary. Reaction of D, L-mixtures of the activated monomers of A and U resulted in the formation of greater amounts of the homochiral amounts of dimers and trimers of A than would be expected if there was no selectivity in the reaction. A limited number of the dimers and trimers of U were also formed but here the selectivity was for the formation of an excess of heterochiral products (Joshi et al., 2000). A postulate that explains why homochiral trimers of U are not formed and the significance of catalysis in prebiotic synthesis will be discussed. Ferris, J.P. (2005) Origins of life, molecular basis of. In R.A. Meyers, Ed. Encyclopedia of Molecular Cell Biology and Molecular Medicine, 10. Wiley-VCH Verlag, Weinheim, Germany. Ferris, J.P., and Ertem, G. (1993) Montmorillonite catalysis of RNA oligomer formation in aqueous solution. A model for the prebiotic formation of RNA. J. Am. Chem. Soc., 115, 12270-12275. Huang, W., and Ferris, J.P. (2003) Synthesis of 35-40 mers of RNA oligomers from unblocked monomers. A simple approach to the RNA world. Chem. Commun., 1458-1459. Joshi, P.C., Pitsch, S., and Ferris, J.P. (2000) Homochiral selection

  13. RNA-Dependent DNA Polymerase Activity of RNA Tumor Viruses II. Directing Influence of RNA in the Reaction

    PubMed Central

    Leis, Jonathan P.; Hurwitz, Jerard

    1972-01-01

    The role of ribonucleic acid (RNA) in deoxyribonucleic acid (DNA) synthesis with the purified DNA polymerase from the avian myeloblastosis virus has been studied. The polymerase catalyzes the synthesis of DNA in the presence of four deoxynucleoside triphosphates, Mg2+, and a variety of RNA templates including those isolated from avian myeloblastosis, Rous sarcoma, and Rauscher leukemia viruses; phages f2, MS2, and Qβ; and synthetic homopolymers such as polyadenylate·polyuridylic acid. The enzyme does not initiate the synthesis of new chains but incorporates deoxynucleotides at 3′ hydroxyl ends of primer strands. The product is an RNA·DNA hybrid in which the two polynucleotide components are covalently linked. Free DNA has not been detected among the products formed with the purified enzyme in vitro. The DNA synthesized with avian myeloblastosis virus RNA after alkaline hydrolysis has a sedimentation coefficient of 6 to 7S. PMID:4333539

  14. Double mimicry evades tRNA synthetase editing by toxic vegetable-sourced non-proteinogenic amino acid.

    PubMed

    Song, Youngzee; Zhou, Huihao; Vo, My-Nuong; Shi, Yi; Nawaz, Mir Hussain; Vargas-Rodriguez, Oscar; Diedrich, Jolene K; Yates, John R; Kishi, Shuji; Musier-Forsyth, Karin; Schimmel, Paul

    2017-12-22

    Hundreds of non-proteinogenic (np) amino acids (AA) are found in plants and can in principle enter human protein synthesis through foods. While aminoacyl-tRNA synthetase (AARS) editing potentially provides a mechanism to reject np AAs, some have pathological associations. Co-crystal structures show that vegetable-sourced azetidine-2-carboxylic acid (Aze), a dual mimic of proline and alanine, is activated by both human prolyl- and alanyl-tRNA synthetases. However, it inserts into proteins as proline, with toxic consequences in vivo. Thus, dual mimicry increases odds for mistranslation through evasion of one but not both tRNA synthetase editing systems.

  15. Comparative Studies of Effect of Auxin and Ethylene on Permeability and Synthesis of RNA and Protein 1

    PubMed Central

    Sacher, Joseph A.; Salminen, Seppo O.

    1969-01-01

    The effects of ethylene on permeability and RNA and protein synthesis were assayed over a 6 to 26 hr period in tissue sections from avocado (Persea gratissima Gaertn. F., var. Fuerte), both pulp and peel of banana (Musa sapientum L., var. Gros Michel), bean endocarp (Phaseolus vulgaris L., var. Kentucky Wonder Pole beans) and leaves of Rhoeo discolor. Ethylene had no effect on permeability in 4 of the 5 tissues, but sometimes enhanced solute uptake in banana peel; it had either no effect or an inhibitory effect on synthesis of RNA and protein in sections from fruits of avocado and banana. Auxin (α-naphthalene acetic acid) stimulated synthesis of RNA and protein in bean endocarp and Rhoeo leaf sections, whereas ethylene inhibited both basal and auxin-induced synthesis. It is concluded that in these tissues the auxin effect is not an ethylene effect. PMID:16657212

  16. RNA.

    ERIC Educational Resources Information Center

    Darnell, James E., Jr.

    1985-01-01

    Ribonucleic acid (RNA) converts genetic information into protein and usually must be processed to serve its function. RNA types, chemical structure, protein synthesis, translation, manufacture, and processing are discussed. Concludes that the first genes might have been spliced RNA and that humans might be closer than bacteria to primitive…

  17. Ribozyme-catalysed RNA synthesis using triplet building blocks.

    PubMed

    Attwater, James; Raguram, Aditya; Morgunov, Alexey S; Gianni, Edoardo; Holliger, Philipp

    2018-05-15

    RNA-catalyzed RNA replication is widely believed to have supported a primordial biology. However, RNA catalysis is dependent upon RNA folding, and this yields structures that can block replication of such RNAs. To address this apparent paradox we have re-examined the building blocks used for RNA replication. We report RNA-catalysed RNA synthesis on structured templates when using trinucleotide triphosphates (triplets) as substrates, catalysed by a general and accurate triplet polymerase ribozyme that emerged from in vitro evolution as a mutualistic RNA heterodimer. The triplets cooperatively invaded and unraveled even highly stable RNA secondary structures, and support non-canonical primer-free and bidirectional modes of RNA synthesis and replication. Triplet substrates thus resolve a central incongruity of RNA replication, and here allow the ribozyme to synthesise its own catalytic subunit '+' and '-' strands in segments and assemble them into a new active ribozyme. © 2018, Attwater et al.

  18. Synthesis, base pairing and structure studies of geranylated RNA.

    PubMed

    Wang, Rui; Vangaveti, Sweta; Ranganathan, Srivathsan V; Basanta-Sanchez, Maria; Haruehanroengra, Phensinee; Chen, Alan; Sheng, Jia

    2016-07-27

    Natural RNAs utilize extensive chemical modifications to diversify their structures and functions. 2-Thiouridine geranylation is a special hydrophobic tRNA modification that has been discovered very recently in several bacteria, such as Escherichia coli, Enterobacter aerogenes, Pseudomonas aeruginosa and Salmonella Typhimurium The geranylated residues are located in the first anticodon position of tRNAs specific for lysine, glutamine and glutamic acid. This big hydrophobic terpene functional group affects the codon recognition patterns and reduces frameshifting errors during translation. We aimed to systematically study the structure, function and biosynthesis mechanism of this geranylation pathway, as well as answer the question of why nature uses such a hydrophobic modification in hydrophilic RNA systems. Recently, we have synthesized the deoxy-analog of S-geranyluridine and showed the geranylated T-G pair is much stronger than the geranylated T-A pair and other mismatched pairs in the B-form DNA duplex context, which is consistent with the observation that the geranylated tRNA(Glu) UUC recognizes GAG more efficiently than GAA. In this manuscript we report the synthesis and base pairing specificity studies of geranylated RNA oligos. We also report extensive molecular simulation studies to explore the structural features of the geranyl group in the context of A-form RNA and its effect on codon-anticodon interaction during ribosome binding. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. Peptide nucleic acids rather than RNA may have been the first genetic molecule

    NASA Technical Reports Server (NTRS)

    Nelson, K. E.; Levy, M.; Miller, S. L.

    2000-01-01

    Numerous problems exist with the current thinking of RNA as the first genetic material. No plausible prebiotic processes have yet been demonstrated to produce the nucleosides or nucleotides or for efficient two-way nonenzymatic replication. Peptide nucleic acid (PNA) is a promising precursor to RNA, consisting of N-(2-aminoethyl)glycine (AEG) and the adenine, uracil, guanine, and cytosine-N-acetic acids. However, PNA has not yet been demonstrated to be prebiotic. We show here that AEG is produced directly in electric discharge reactions from CH(4), N(2), NH(3), and H(2)O. Electric discharges also produce ethylenediamine, as do NH(4)CN polymerizations. AEG is produced from the robust Strecker synthesis with ethylenediamine. The NH(4)CN polymerization in the presence of glycine leads to the adenine and guanine-N(9)-acetic acids, and the cytosine and uracil-N(1)-acetic acids are produced in high yield from the reaction of cyanoacetaldehyde with hydantoic acid, rather than urea. Preliminary experiments suggest that AEG may polymerize rapidly at 100 degrees C to give the polypeptide backbone of PNA. The ease of synthesis of the components of PNA and possibility of polymerization of AEG reinforce the possibility that PNA may have been the first genetic material.

  20. Effects of guanosine tetraphosphate on cell-free synthesis of Escherichia coli ribosomal RNA and other gene products.

    PubMed Central

    Reiness, G; Yang, H L; Zubay, G; Cashel, M

    1975-01-01

    A cell-free system derived from E. coli is described in which mature-sized 16S and 23S ribosomal RNAs (rRNA) are synthesized at a high relative rate, comprising 17-25% of the total transcription. The addition of guanosine tetraphosphate (ppGpp) to this system results in up to a 5-fold selective inhibition of rRNA accumulation. This effect is exerted at the level of synthesis rather than degradation. It is concluded that ppGpp, which is produced in large amounts by E. coli during amino-acid deprivation, could mediate the decrease in rRNA synthesis that accompanies such deprivation. The expression of other genes has also been investigated. No selective reduction of transfer RNA synthesis by ppGpp is observed. The trp and lac operons are found to be stimulated at the transcriptional level by the presence of this nucleotide. It is hypothesized that ppGpp interacts with the RNA polymerase in such a manner as to alter the affinity of the enzyme for promoters in an operon-specific fashion. PMID:1103124

  1. Guanosine 3'-diphosphate 5'-diphosphate is not required for growth rate-dependent control of rRNA synthesis in Escherichia coli.

    PubMed Central

    Gaal, T; Gourse, R L

    1990-01-01

    rRNA synthesis in Escherichia coli is subject to at least two regulation systems, growth rate-dependent control and stringent control. The inverse correlation between rRNA synthesis rates and guanosine 3'-diphosphate 5'-diphosphate (ppGpp) levels under various physiological conditions has led to the supposition that ppGpp is the mediator of both control mechanisms by inhibiting transcription from rrn P1 promoters. Recently, relA- spoT- strains have been constructed in which both ppGpp synthesis pathways most likely have been removed (M. Cashel, personal communication). We have confirmed that such strains produce no detectable ppGpp and therefore offer a direct means for testing the involvement of ppGpp in the regulation of rRNA synthesis in vivo. Stringent control was determined by measurement of rRNA synthesis after amino acid starvation, while growth rate control was determined by measurement of rRNA synthesis under different nutritional conditions. As expected, the relA- spoT- strain is relaxed for stringent control. However, growth rate-dependent regulation is unimpaired. These results indicate that growth rate regulation can occur in the absence of ppGpp and imply that ppGpp is not the mediator, or at least is not the sole mediator, of growth rate-dependent control. Therefore, growth rate-dependent control and stringent control may utilize different mechanisms for regulating stable RNA synthesis. PMID:2196571

  2. Cystoviral polymerase complex protein P7 uses its acidic C-terminal tail to regulate the RNA-directed RNA polymerase P2.

    PubMed

    Alphonse, Sébastien; Arnold, Jamie J; Bhattacharya, Shibani; Wang, Hsin; Kloss, Brian; Cameron, Craig E; Ghose, Ranajeet

    2014-07-15

    In bacteriophages of the cystovirus family, the polymerase complex (PX) encodes a 75-kDa RNA-directed RNA polymerase (P2) that transcribes the double-stranded RNA genome. Also a constituent of the PX is the essential protein P7 that, in addition to accelerating PX assembly and facilitating genome packaging, plays a regulatory role in transcription. Deletion of P7 from the PX leads to aberrant plus-strand synthesis suggesting its influence on the transcriptase activity of P2. Here, using solution NMR techniques and the P2 and P7 proteins from cystovirus ϕ12, we demonstrate their largely electrostatic interaction in vitro. Chemical shift perturbations on P7 in the presence of P2 suggest that this interaction involves the dynamic C-terminal tail of P7, more specifically an acidic cluster therein. Patterns of chemical shift changes induced on P2 by the P7 C-terminus resemble those seen in the presence of single-stranded RNA suggesting similarities in binding. This association between P2 and P7 reduces the affinity of the former toward template RNA and results in its decreased activity both in de novo RNA synthesis and in extending a short primer. Given the presence of C-terminal acidic tracts on all cystoviral P7 proteins, the electrostatic nature of the P2/P7 interaction is likely conserved within the family and could constitute a mechanism through which P7 regulates transcription in cystoviruses. Copyright © 2014 Elsevier Ltd. All rights reserved.

  3. THE ACTION OF α-AMANITIN ON RNA SYNTHESIS IN CHINESE HAMSTER OVARY CELLS

    PubMed Central

    Kedinger, Claude; Simard, Rene

    1974-01-01

    α-Amanitin acts in vitro as a selective inhibitor of the nucleoplasmic form B RNA polymerases. Treatment of Chinese hamster ovary (CHO) cells with this drug leads principally to a severe fragmentation of the nucleoli. While the ultrastructural lesions induced by α-amanitin in CHO cells and in rat or mouse liver are quite similar, the results diverge concerning the effect on RNA synthesis. It has been shown that in rat or mouse liver α-amanitin blocks both extranucleolar and nucleolar RNA synthesis. Our autoradiographic and biochemical evidence indicates that in CHO cells high molecular weight extranucleolar RNA synthesis (HnRNA) is blocked by the α-amanitin treatment, whereas nucleolar RNA (preribosomal RNA) synthesis remains unaffected even several hours after the inhibition of extranucleolar RNA synthesis. Furthermore, the processing of this RNA as well as its transport to the cytoplasm seem only slightly affected by the treatment. Finally, under these conditions, the synthesis of the low molecular RNA species (4–5S) still occurs, though less actively. The results are interpreted as evidence for a selective impairment of HnRNA synthesis by α-amanitin in CHO cells. PMID:4474178

  4. PROTEASOME INHIBITOR TREATMENT REDUCED FATTY ACID, TRIACYLGLYCEROL AND CHOLESTEROL SYNTHESIS

    PubMed Central

    Oliva, Joan; French, Samuel W.; Li, Jun; Bardag-Gorce, Fawzia

    2014-01-01

    In the present study, the beneficial effects of proteasome inhibitor treatment in reducing ethanol-induced steatosis were investigated. A microarray analysis was performed on the liver of rats injected with PS-341 (Bortezomib, Velcade®), and the results showed that proteasome inhibitor treatment significantly reduced the mRNA expression of SREBP-1c, and the downstream lipogenic enzymes, such as fatty acid synthase (FAS) and acetyl-CoA carboxylase (ACC), which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ELOVL6, which is responsible for fatty acids long chain elongation, was also significantly down regulated by proteasome inhibitor treatment. Moreover, PS-341 administration significantly reduced the expression of acyl-glycerol-3-phosphate acyltransferase (AGPAT), and diacylglycerol acyltransferase (DGAT), enzyme involved in triacylglycerol (TAG) synthesis. Finally, PS-341 was found to down regulate the enzymes 3-hydroxy-3-methylglutaryl-CoenzymeA synthase (HMG-CoA synthase) that is responsible for cholesterol synthesis. Proteasome inhibitor was also found to play a role in intestinal lipid adsorption because apolipoproteins A (apoA-I, apoAII, apoA-IV and ApoCIII) were down regulated by proteasome inhibitor treatment, especially ApoA-II that is known to be a marker of alcohol consumption. Proteasome inhibitor treatment also decreased apobec-1 complementation factor (ACF) leading to lower level of editing and production of ApoB protein. Moreover apolipoprotein C-III, a major component of chylomicrons was significantly down regulated. However, lipoprotein lipase (Lpl) and High density lipoprotein binding protein (Hdlbp) mRNA levels were increased by proteasome inhibitor treatment. These results suggested that proteasome inhibitor treatment could be used to reduce the alcohol-enhanced lipogenesis and alcohol-induced liver steatosis. A morphologic analysis, performed on the liver of rats fed ethanol for one

  5. Nuclear Synthesis of Cytoplasmic Ribonucleic Acid in Amoeba proteus

    PubMed Central

    Prescott, David M.

    1959-01-01

    The enucleation technique has been applied to Amoeba proteus by several laboratories in attempts to determine whether the cytoplasm is capable of nucleus-independent ribonucleic acid synthesis. This cell is very convenient for micrurgy, but its use requires a thorough starvation period to eliminate the possibility of metabolic influence by food vacuoles and frequent washings and medium renewal to maintain asepsis. In the experiments described here, amoebae were starved for periods of 24 to 96 hours, cut into nucleated and enucleated halves, and exposed to either C-14 uracil, C-14 adenine, C-14 orotic acid, or a mixture of all three. When the starvation period was short (less than 72 hours), organisms (especially yeast cells) contained within amoeba food vacuoles frequently showed RNA synthesis in both nucleated and enucleated amoebae. When the preperiod of starvation was longer than 72 hours, food vacuole influence was apparently negligible, and a more meaningful comparison between enucleated and nucleated amoebae was possible. Nucleated cells incorporated all three precursors into RNA; enucleated cells were incapable of such incorporation. The experiments indicate a complete dependence on the nucleus for RNA synthesis. The conflict with the experimental results of others on this problem could possibly stem from differences in culture conditions, starvation treatment, or experimental conditions. For an unequivocal answer in experiments of this design, ideally the cells should be capable of growth on an entirely synthetic medium under aseptic conditions. The use of a synthetic medium (experiments with A. proteus are done under starvation conditions) would permit, moreover, a more realistic comparison of metabolic capacities of nucleated and enucleated cells. PMID:14434750

  6. Nuclear synthesis of cytoplasmic ribonucleic acid in Amoeba proteus.

    PubMed

    PRESCOTT, D M

    1959-10-01

    The enucleation technique has been applied to Amoeba proteus by several laboratories in attempts to determine whether the cytoplasm is capable of nucleus-independent ribonucleic acid synthesis. This cell is very convenient for micrurgy, but its use requires a thorough starvation period to eliminate the possibility of metabolic influence by food vacuoles and frequent washings and medium renewal to maintain asepsis. In the experiments described here, amoebae were starved for periods of 24 to 96 hours, cut into nucleated and enucleated halves, and exposed to either C-14 uracil, C-14 adenine, C-14 orotic acid, or a mixture of all three. When the starvation period was short (less than 72 hours), organisms (especially yeast cells) contained within amoeba food vacuoles frequently showed RNA synthesis in both nucleated and enucleated amoebae. When the preperiod of starvation was longer than 72 hours, food vacuole influence was apparently negligible, and a more meaningful comparison between enucleated and nucleated amoebae was possible. Nucleated cells incorporated all three precursors into RNA; enucleated cells were incapable of such incorporation. The experiments indicate a complete dependence on the nucleus for RNA synthesis. The conflict with the experimental results of others on this problem could possibly stem from differences in culture conditions, starvation treatment, or experimental conditions. For an unequivocal answer in experiments of this design, ideally the cells should be capable of growth on an entirely synthetic medium under aseptic conditions. The use of a synthetic medium (experiments with A. proteus are done under starvation conditions) would permit, moreover, a more realistic comparison of metabolic capacities of nucleated and enucleated cells.

  7. Specific Effect of Guanidine in the Programming of Poliovirus Inhibition of Deoxyribonucleic Acid Synthesis

    PubMed Central

    Powers, C. D.; Miller, B. A.; Kurtz, H.; Ackermann, W. W.

    1969-01-01

    Inhibition of HeLa cell deoxyribonucleic acid (DNA) synthesis, which occurred by the 4th to 5th hr after infection with poliovirus, could be blocked completely by guanidine only when it was present before the 2nd hr. At the 2nd hr, there was no significant ribonucleic acid (RNA)-replicase activity, and addition of guanidine inhibited all production of virus but allowed 57% of maximal DNA inhibition to develop. Maximum DNA inhibition developed in cells infected for 4 hr in the presence of guanidine when the guanidine was removed for a 10-min interval. RNA-replicase activity was not enzymatically detectable and viral multiplication did not develop in these cells unless the interval without guanidine was extended to 60 min. The interpretation of the data was that the effect of guanidine on viral-induced inhibition of DNA synthesis was distinct and not a consequence of the inhibition of RNA-replicase. PMID:4305675

  8. Pre-mRNA Processing Factor Prp18 Is a Stimulatory Factor of Influenza Virus RNA Synthesis and Possesses Nucleoprotein Chaperone Activity.

    PubMed

    Minakuchi, M; Sugiyama, K; Kato, Y; Naito, T; Okuwaki, M; Kawaguchi, A; Nagata, K

    2017-02-01

    The genome of influenza virus (viral RNA [vRNA]) is associated with the nucleoprotein (NP) and viral RNA-dependent RNA polymerases and forms helical viral ribonucleoprotein (vRNP) complexes. The NP-vRNA complex is the biologically active template for RNA synthesis by the viral polymerase. Previously, we identified human pre-mRNA processing factor 18 (Prp18) as a stimulatory factor for viral RNA synthesis using a Saccharomyces cerevisiae replicon system and a single-gene deletion library of Saccharomyces cerevisiae (T. Naito, Y. Kiyasu, K. Sugiyama, A. Kimura, R. Nakano, A. Matsukage, and K. Nagata, Proc Natl Acad Sci USA, 104:18235-18240, 2007, https://doi.org/10.1073/pnas.0705856104). In infected Prp18 knockdown (KD) cells, the synthesis of vRNA, cRNA, and viral mRNAs was reduced. Prp18 was found to stimulate in vitro viral RNA synthesis through its interaction with NP. Analyses using in vitro RNA synthesis reactions revealed that Prp18 dissociates newly synthesized RNA from the template after the early elongation step to stimulate the elongation reaction. We found that Prp18 functions as a chaperone for NP to facilitate the formation of NP-RNA complexes. Based on these results, it is suggested that Prp18 accelerates influenza virus RNA synthesis as an NP chaperone for the processive elongation reaction. Templates for viral RNA synthesis of negative-stranded RNA viruses are not naked RNA but rather RNA encapsidated by viral nucleocapsid proteins forming vRNP complexes. However, viral basic proteins tend to aggregate under physiological ionic strength without chaperones. We identified the pre-mRNA processing factor Prp18 as a stimulatory factor for influenza virus RNA synthesis. We found that one of the targets of Prp18 is NP. Prp18 facilitates the elongation reaction of viral polymerases by preventing the deleterious annealing of newly synthesized RNA to the template. Prp18 functions as a chaperone for NP to stimulate the formation of NP-RNA complexes. Based on

  9. Control of RNA synthesis in Escherichia coli after a shift to higher temperature.

    PubMed Central

    Ryals, J; Little, R; Bremer, H

    1982-01-01

    Parameters of RNA synthesis were measured after a temperature upshift in a pair of Escherichia coli B/r strains that are isogenic except for having relA and relA+ loci, to examine the cause for a reported anomaly in the correlation between guanosine tetraphosphate (ppGpp) and stable RNA (rRNA, tRNA) synthesis under such conditions. Two main results were: (i) the specific stable RNA gene activity (stable RNA per total RNA synthesis) correlated in the conventionally expected fashion with the level of ppGpp but was obscured by a nonspecific increase in the RNA chain elongation rate due to the higher temperature; (ii) the temperature upshift caused a transient reduction in the RNA polymerase activity (transcribing per total enzyme) that accounts for the previously observed oscillating RNA synthesis rate after a temperature shift. PMID:6179925

  10. Nucleic acid and protein synthesis during lateral root initiation in Marsilea quadrifolia (Marsileaceae)

    NASA Technical Reports Server (NTRS)

    Lin, B. L.; Raghavan, V.

    1991-01-01

    The pattern of DNA, RNA, and protein synthesis during lateral root initiation in Marsilea quadrifolia L. was monitored by autoradiography of incorporated of 3H-thymidine, 3H-uridine, and 3H-leucine, respectively. DNA synthesis was associated with the enlargement of the lateral root initial prior to its division. Consistent with histological studies, derivatives of the lateral root initial as well as the cells of the adjacent inner cortex and pericycle of the parent root also continued to synthesize DNA. RNA and protein synthetic activities were found to be higher in the lateral root initials than in the endodermal initials of the same longitudinal layer. The data suggest a role for nucleic acid and protein synthesis during cytodifferentiation of a potential endodermal cell into a lateral root initial.

  11. Decreased hepatotoxic bile acid composition and altered synthesis in progressive human nonalcoholic fatty liver disease

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lake, April D.; Novak, Petr; Shipkova, Petia

    2013-04-15

    Bile acids (BAs) have many physiological roles and exhibit both toxic and protective influences within the liver. Alterations in the BA profile may be the result of disease induced liver injury. Nonalcoholic fatty liver disease (NAFLD) is a prevalent form of chronic liver disease characterized by the pathophysiological progression from simple steatosis to nonalcoholic steatohepatitis (NASH). The hypothesis of this study is that the ‘classical’ (neutral) and ‘alternative’ (acidic) BA synthesis pathways are altered together with hepatic BA composition during progression of human NAFLD. This study employed the use of transcriptomic and metabolomic assays to study the hepatic toxicologic BAmore » profile in progressive human NAFLD. Individual human liver samples diagnosed as normal, steatosis, and NASH were utilized in the assays. The transcriptomic analysis of 70 BA genes revealed an enrichment of downregulated BA metabolism and transcription factor/receptor genes in livers diagnosed as NASH. Increased mRNA expression of BAAT and CYP7B1 was observed in contrast to decreased CYP8B1 expression in NASH samples. The BA metabolomic profile of NASH livers exhibited an increase in taurine together with elevated levels of conjugated BA species, taurocholic acid (TCA) and taurodeoxycholic acid (TDCA). Conversely, cholic acid (CA) and glycodeoxycholic acid (GDCA) were decreased in NASH liver. These findings reveal a potential shift toward the alternative pathway of BA synthesis during NASH, mediated by increased mRNA and protein expression of CYP7B1. Overall, the transcriptomic changes of BA synthesis pathway enzymes together with altered hepatic BA composition signify an attempt by the liver to reduce hepatotoxicity during disease progression to NASH. - Highlights: ► Altered hepatic bile acid composition is observed in progressive NAFLD. ► Bile acid synthesis enzymes are transcriptionally altered in NASH livers. ► Increased levels of taurine and conjugated bile

  12. NUCLEAR ENVELOPE-ASSOCIATED RESUMPTION OF RNA SYNTHESIS IN LATE MITOSIS OF HELA CELLS

    PubMed Central

    Simmons, T.; Heywood, P.; Hodge, L.

    1973-01-01

    The restitution of RNA synthesis in cultures progressing from metaphase into interphase (G1) has been investigated in synchronized HeLa S3 cells by using inhibitors of macro-molecular synthesis and the technique of electron microscope autoradiography. The rate of incorporation of radioactive uridine into RNA approached interphase levels in the absence of renewed protein synthesis. In contrast, maintenance of this rate in G1 was dependent upon renewed protein synthesis. Restoration of synthesis of heterogeneous nuclear RNA occurred under conditions that inhibited production of ribosomal precursor RNA. In autoradiographs of individual cells exposed to radioactive uridine, silver grains were first detected after nuclear envelope reformation at the periphery of the chromosome mass but before chromosomal decondensation. These data are consistent with the following interpretation. Multiple RNA polymerase activities persist through mitosis and are involved in the initiation of RNA synthesis in early telophase at sites on the nuclear envelope. PMID:4752403

  13. Ursolic Acid Inhibits Na+/K+-ATPase Activity and Prevents TNF-α-Induced Gene Expression by Blocking Amino Acid Transport and Cellular Protein Synthesis

    PubMed Central

    Yokomichi, Tomonobu; Morimoto, Kyoko; Oshima, Nana; Yamada, Yuriko; Fu, Liwei; Taketani, Shigeru; Ando, Masayoshi; Kataoka, Takao

    2011-01-01

    Pro-inflammatory cytokines, such as tumor necrosis factor (TNF)-α, induce the expression of a wide variety of genes, including intercellular adhesion molecule-1 (ICAM-1). Ursolic acid (3β-hydroxy-urs-12-en-28-oic acid) was identified to inhibit the cell-surface ICAM-1 expression induced by pro-inflammatory cytokines in human lung carcinoma A549 cells. Ursolic acid was found to inhibit the TNF-α-induced ICAM-1 protein expression almost completely, whereas the TNF-α-induced ICAM-1 mRNA expression and NF-κB signaling pathway were decreased only partially by ursolic acid. In line with these findings, ursolic acid prevented cellular protein synthesis as well as amino acid uptake, but did not obviously affect nucleoside uptake and the subsequent DNA/RNA syntheses. This inhibitory profile of ursolic acid was similar to that of the Na+/K+-ATPase inhibitor, ouabain, but not the translation inhibitor, cycloheximide. Consistent with this notion, ursolic acid was found to inhibit the catalytic activity of Na+/K+-ATPase. Thus, our present study reveals a novel molecular mechanism in which ursolic acid inhibits Na+/K+-ATPase activity and prevents the TNF-α-induced gene expression by blocking amino acid transport and cellular protein synthesis. PMID:24970122

  14. Two distinct sets of NS2A molecules are responsible for dengue virus RNA synthesis and virion assembly.

    PubMed

    Xie, Xuping; Zou, Jing; Puttikhunt, Chunya; Yuan, Zhiming; Shi, Pei-Yong

    2015-01-15

    Flavivirus nonstructural protein 2A (NS2A) plays important roles in both viral RNA synthesis and virion assembly. The molecular details of how the NS2A protein modulates the two distinct events have not been defined. To address this question, we have performed a systematic mutagenesis of NS2A using dengue virus (DENV) serotype 2 (DENV-2) as a model. We identified two sets of NS2A mutations with distinct defects during a viral infection cycle. One set of NS2A mutations (D125A and G200A) selectively abolished viral RNA synthesis. Mechanistically, the D125A mutation abolished viral RNA synthesis through blocking the N-terminal cleavage of the NS2A protein, leading to an unprocessed NS1-NS2A protein; this result suggests that amino acid D125 (far downstream of the N terminus of NS2A) may contribute to the recognition of host protease at the NS1-NS2A junction. The other set of NS2A mutations (G11A, E20A, E100A, Q187A, and K188A) specifically impaired virion assembly without significantly affecting viral RNA synthesis. Remarkably, mutants defective in virion assembly could be rescued by supplying in trans wild-type NS2A molecules expressed from a replicative replicon, by wild-type NS2A protein expressed alone, by a mutant NS2A (G200A) that is lethal for viral RNA synthesis, or by a different mutant NS2A that is defective in virion assembly. In contrast, none of the mutants defective in viral RNA synthesis could be rescued by trans-complementation. Collectively, the results indicate that two distinct sets of NS2A molecules are responsible for DENV RNA synthesis and virion assembly. Dengue virus (DENV) represents the most prevalent mosquito-borne human pathogen. Understanding the replication of DENV is essential for development of vaccines and therapeutics. Here we characterized the function of DENV-2 NS2A using a systematic mutagenesis approach. The mutagenesis results revealed two distinct sets of NS2A mutations: one set of mutations that result in defects in viral RNA

  15. Enzymatic Synthesis of Self-assembled Dicer Substrate RNA Nanostructures for Programmable Gene Silencing.

    PubMed

    Jang, Bora; Kim, Boyoung; Kim, Hyunsook; Kwon, Hyokyoung; Kim, Minjeong; Seo, Yunmi; Colas, Marion; Jeong, Hansaem; Jeong, Eun Hye; Lee, Kyuri; Lee, Hyukjin

    2018-06-08

    Enzymatic synthesis of RNA nanostructures is achieved by isothermal rolling circle transcription (RCT). Each arm of RNA nanostructures provides a functional role of Dicer substrate RNA inducing sequence specific RNA interference (RNAi). Three different RNAi sequences (GFP, RFP, and BFP) are incorporated within the three-arm junction RNA nanostructures (Y-RNA). The template and helper DNA strands are designed for the large-scale in vitro synthesis of RNA strands to prepare self-assembled Y-RNA. Interestingly, Dicer processing of Y-RNA is highly influenced by its physical structure and different gene silencing activity is achieved depending on its arm length and overhang. In addition, enzymatic synthesis allows the preparation of various Y-RNA structures using a single DNA template offering on demand regulation of multiple target genes.

  16. Ribonucleic Acid Synthesis by Cucumber Chromatin

    PubMed Central

    Johnson, Kenneth D.; Purves, William K.

    1970-01-01

    When intact etiolated 2-day cucumber (Cucumis sativus) embryos were treated with indoleacetic acid (IAA), gibberellin A7 (GA7), or kinetin, chromatin derived from the embryonic axes exhibited an increased capacity to support RNA synthesis in either the presence or the absence of bacterial RNA polymerase. An IAA effect on cucumber RNA polymerase activity was evident after 4 hours of hormone treatment; the IAA effect on DNA template activity (bacterial RNA polymerase added) occurred after longer treatments (12 hours). GA7 also promoted template activity, but again only after a prior stimulation of endogenous chromatin activity. After 12 hours of kinetin treatment, both endogenous chromatin and DNA template activities were substantially above control values, but longer kinetin treatments caused these activities to decline in magnitude. When chromatin was prepared from hypocotyl segments that were floated on a GA7 solution, a GA-induced increase in endogenous chromatin activity occurred, but only if cotyledon tissue was left attached to the segments during the period of hormone treatment. Age of the seedling tissue had a profound influence on the chromatin characteristics. With progression of development from the 2-day to the 4-day stage, the endogenous chromatin activity declined while the DNA template activity increased. PMID:16657509

  17. Growth and Synthesis of Nucleic Acid and Protein by Excised Radish Cotyledons 1

    PubMed Central

    Nieman, R. H.; Poulsen, L. L.

    1967-01-01

    Nutritional and light requirements for growth and synthesis of RNA, DNA, and protein by cotyledons excised from 5-day-old seedlings of Raphanus sativus L. were investigated, and the course of synthesis was followed through the cell cycle. The minimum requirements for a net increase in nucleic acid and protein were sugar, nitrate, and light. The cotyledons used nitrite at low concentration, but not ammonium ion. Light was required for preliminary steps in synthesis of RNA, DNA, and protein, but the actual polymerization reactions occurred in the dark. The cotyledons contained sufficient endogenous growth factors for about half of the cells to complete 1 cycle on a medium of 1% sucrose, 80 mm KNO3. The increase in DNA was limited to about 50% and was accompanied by a comparable increase in cell number. Fresh weight, RNA, and protein tended to increase in proportion to DNA. Growth of the isolated cotyledons commenced with cell enlargement. RNA began to increase after about 4 hours, DNA after about 12. The major increase in protein also began at about 12 hours. The maximum rate of increase for all 3 occurred between 12 and 16 hours. Cell counts indicated that by 28 hours most of the cells which had replicated DNA had also completed cell division. PMID:16656601

  18. Differences in acid tolerance between Bifidobacterium breve BB8 and its acid-resistant derivative B. breve BB8dpH, revealed by RNA-sequencing and physiological analysis.

    PubMed

    Yang, Xu; Hang, Xiaomin; Tan, Jing; Yang, Hong

    2015-06-01

    Bifidobacteria are common inhabitants of the human gastrointestinal tract, and their application has increased dramatically in recent years due to their health-promoting effects. The ability of bifidobacteria to tolerate acidic environments is particularly important for their function as probiotics because they encounter such environments in food products and during passage through the gastrointestinal tract. In this study, we generated a derivative, Bifidobacterium breve BB8dpH, which displayed a stable, acid-resistant phenotype. To investigate the possible reasons for the higher acid tolerance of B. breve BB8dpH, as compared with its parental strain B. breve BB8, a combined transcriptome and physiological approach was used to characterize differences between the two strains. An analysis of the transcriptome by RNA-sequencing indicated that the expression of 121 genes was increased by more than 2-fold, while the expression of 146 genes was reduced more than 2-fold, in B. breve BB8dpH. Validation of the RNA-sequencing data using real-time quantitative PCR analysis demonstrated that the RNA-sequencing results were highly reliable. The comparison analysis, based on differentially expressed genes, suggested that the acid tolerance of B. breve BB8dpH was enhanced by regulating the expression of genes involved in carbohydrate transport and metabolism, energy production, synthesis of cell envelope components (peptidoglycan and exopolysaccharide), synthesis and transport of glutamate and glutamine, and histidine synthesis. Furthermore, an analysis of physiological data showed that B. breve BB8dpH displayed higher production of exopolysaccharide and lower H(+)-ATPase activity than B. breve BB8. The results presented here will improve our understanding of acid tolerance in bifidobacteria, and they will lead to the development of new strategies to enhance the acid tolerance of bifidobacterial strains. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. Physiological effects of γ-linolenic acid and sesamin on hepatic fatty acid synthesis and oxidation.

    PubMed

    Ide, Takashi; Iwase, Haruka; Amano, Saaya; Sunahara, Saki; Tachihara, Ayuka; Yagi, Minako; Watanabe, Tsuyoshi

    2017-03-01

    Interrelated effects of γ-linolenic acid (GLA) and sesamin, a sesame lignan, on hepatic fatty acid synthesis and oxidation were examined. Rats were fed experimental diets supplemented with 0 or 2 g/kg sesamin (1:1 mixture of sesamin and episesamin) and containing 100 g/kg of palm oil (saturated fat), safflower oil rich in linoleic acid, or oil of evening primrose origin containing 43% GLA (GLA oil) for 18 days. In rats fed sesamin-free diets, GLA oil, compared with other oils, increased the activity and mRNA levels of various enzymes involved in fatty acid oxidation, except for some instances. Sesamin greatly increased these parameters, and the enhancing effects of sesamin on peroxisomal fatty acid oxidation rate and acyl-CoA oxidase, enoyl-CoA hydratase and acyl-CoA thioesterase activities were more exaggerated in rats fed GLA oil than in the animals fed other oils. The combination of sesamin and GLA oil also synergistically increased the mRNA levels of some peroxisomal fatty acid oxidation enzymes and of several enzymes involved in fatty acid metabolism located in other cell organelles. In the groups fed sesamin-free diets, GLA oil, compared with other oils, markedly reduced the activity and mRNA levels of various lipogenic enzymes. Sesamin reduced all these parameters, except for malic enzyme, in rats fed palm and safflower oils, but the effects were attenuated in the animals fed GLA oil. These changes by sesamin and fat type accompanied profound alterations in serum lipid levels. This may be ascribable to the changes in apolipoprotein-B-containing lipoproteins. Copyright © 2016 Elsevier Inc. All rights reserved.

  20. Impact of folic acid supplementation on single- and double-stranded RNA degradation in human colostrum and mature milk.

    PubMed

    Kocic, Gordana; Bjelakovic, Ljiljana; Bjelakovic, Bojko; Jevtoci-Stoimenov, Tatjana; Sokolovic, Dusan; Cvetkovic, Tatjana; Kocic, Hristina; Stojanovic, Svetlana; Langerholc, Tomaz; Jonovic, Marina

    2014-07-01

    Sufficient intake of folic acid is necessary for normal embryogenesis, fetal, and neonatal development. Folic acid facilitates nucleic acid internalization, and protects cellular DNA from nuclease degradation. Human milk contains enzymes, antimicrobial proteins, and antibodies, along with macrophages, that protect against infections and allergies. However, little to no information is available on the effects of folic acid supplementation on degradation of nucleic acids in human milk. In the present study, we aimed to determine the RNase activity (free and inhibitor-bound) in colostrum and mature milk, following folic acid supplementation. The study design included a total of 59 women, 27 of whom received 400 μg of folic acid daily periconceptionally and after. Folic acid supplementation increased the free RNase and polyadenylase activity following lactation. However, the increased RNase activity was not due to de novo enzyme synthesis, as the inhibitor-bound (latent) RNase activity was significantly lower and disappeared after one month. Folic acid reduced RNase activity by using double-stranded RNA as substrate. Data suggests that folic acid supplementation may improve viral RNAs degradation and mRNA degradation, but not dsRNA degradation, preserving in this way the antiviral defense.

  1. Synthesis, base pairing and structure studies of geranylated RNA

    PubMed Central

    Wang, Rui; Vangaveti, Sweta; Ranganathan, Srivathsan V.; Basanta-Sanchez, Maria; Haruehanroengra, Phensinee; Chen, Alan; Sheng, Jia

    2016-01-01

    Natural RNAs utilize extensive chemical modifications to diversify their structures and functions. 2-Thiouridine geranylation is a special hydrophobic tRNA modification that has been discovered very recently in several bacteria, such as Escherichia coli, Enterobacter aerogenes, Pseudomonas aeruginosa and Salmonella Typhimurium. The geranylated residues are located in the first anticodon position of tRNAs specific for lysine, glutamine and glutamic acid. This big hydrophobic terpene functional group affects the codon recognition patterns and reduces frameshifting errors during translation. We aimed to systematically study the structure, function and biosynthesis mechanism of this geranylation pathway, as well as answer the question of why nature uses such a hydrophobic modification in hydrophilic RNA systems. Recently, we have synthesized the deoxy-analog of S-geranyluridine and showed the geranylated T-G pair is much stronger than the geranylated T-A pair and other mismatched pairs in the B-form DNA duplex context, which is consistent with the observation that the geranylated tRNAGluUUC recognizes GAG more efficiently than GAA. In this manuscript we report the synthesis and base pairing specificity studies of geranylated RNA oligos. We also report extensive molecular simulation studies to explore the structural features of the geranyl group in the context of A-form RNA and its effect on codon–anticodon interaction during ribosome binding. PMID:27307604

  2. [Influence of antisense RNA and sequences of viral transactivators traps on RNA synthesis of HTLV-1 virus].

    PubMed

    Borisenko, A S; Kotus, E V; Kaloshin, A A

    2008-01-01

    Significant number of scientific publications devoted to inhibition of viral replication by antisense RNA (asRNA) genes shows that this approach is useful for gene therapy of viral infections. To investigate the possibility of suppression of HTLV-1 virus reproduction by asRNA we constructed recombinant plasmids containing asRNA genes against U3 long terminal repeats region and X gene under the control of promoter of myeloproliferative sarcoma virus (MPSV) or without such promoter. Using stable calcium-phosphate transfection method with subsequent selection in the presence of G-418, RaHOS line-based cell clones carrying both asRNA genes and sequences able to bind HTLV-1 transactivator proteins (i.e. "traps" of viral transactivators, TVT) were obtained. Data from dot-hybridization analysis of viral RNA extracted from RaHOS cell clones showed that TVT sequences are able to suppress the viral RNA synthesis on 90% and asRNA against X gene synthesis--on 50%.

  3. Recombinant viral RdRps can initiate RNA synthesis from circular templates

    PubMed Central

    RANJITH-KUMAR, C.T.; KAO, C.C.

    2006-01-01

    The crystal structure of the recombinant hepatitis C virus (HCV) RNA-dependent RNA polymerase (RdRp) revealed extensive interactions between the fingers and the thumb subdomains, resulting in a closed conformation with an established template channel that should specifically accept single-stranded templates. We made circularized RNA templates and found that they were efficiently used by the HCV RdRp to synthesize product RNAs that are significantly longer than the template, suggesting that RdRp could exist in an open conformation prior to template binding. RNA synthesis using circular RNA templates had properties similar to those previously documented for linear RNA, including a need for higher GTP concentration for initiation, usage of GTP analogs, sensitivity to salt, and involvement of active-site residues for product formation. Some products were resistant to challenge with the template competitor heparin, indicating that the elongation complexes remain bound to template and are competent for RNA synthesis. Other products were not elongated in the presence of heparin, indicating that the elongation complex was terminated. Lastly, recombinant RdRps from two other flaviviruses and from the Pseudomonas phage φ6 also could use circular RNA templates for RNA-dependent RNA synthesis, although the φ6 RdRp could only use circular RNAs made from the 3′-terminal sequence of the φ6 genome. PMID:16373481

  4. The origin of polynucleotide-directed protein synthesis

    NASA Technical Reports Server (NTRS)

    Orgel, Leslie E.

    1989-01-01

    If protein synthesis evolved in an RNA world it was probably preceded by simpler processes by means of which interaction with amino acids conferred selective advantage on replicating RNA molecules. It is suggested that at first the simple attachment of amino acids to the 2'(3') termini of RNA templates favored initiation of replication at the end of the template rather than at internal positions. The second stage in the evolution of protein synthesis would probably have been the association of pairs of charged RNA adaptors in such a way as to favor noncoded formation of peptides. Only after this process had become efficient could coded synthesis have begun.

  5. Orotidine-Containing RNA: Implications for the Hierarchical Selection (Systems Chemistry Emergence) of RNA.

    PubMed

    Kim, Eun-Kyong; Martin, Vincent; Krishnamurthy, Ramanarayanan

    2017-09-12

    The prebiotic synthesis of canonical nucleobases from HCN is a cornerstone for the RNA world hypothesis. However, their role in the primordial pathways to RNA is still debated. The very same process starting from HCN also gives rise to orotic acid, which (via orotidine) plays a crucial role in extant biology in the de novo synthesis of uridine and cytidine, the informational base-pairs in RNA. However, orotidine itself is absent in RNA. Given the prebiotic and biological relevance of orotic acid vis-à-vis uracil, we investigated orotidine-containing RNA oligonucleotides and show that they have severely compromised base-pairing properties. While not unexpected, these results suggest that the emergence of extant RNA cannot just be a consequence of the plausible prebiotic formation of its chemical constituents/building blocks. In combination with other investigations on alternative prebiotic nucleobases, sugars, and linkers, these findings imply that the selection of the components of extant RNA occurred at a higher hierarchical level of an oligomer/polymer based on its functional properties-pointing to a systems chemistry emergence of RNA from a library of precursors. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. The synthesis of polyadenylated messenger RNA in herpes simplex type I virus infected BHK cells.

    PubMed

    Harris, T J; Wildy, P

    1975-09-01

    The pattern of polyadenylated messenger RNA (mRNA) synthesis in BHK cell monolayers, infected under defined conditions with herpes simplex type I virus has been investigated by polyacrylamide gel electrophoresis or pulse-labelled RNA isolated by oligo dT-cellulose chromatography. Two classes of mRNA molecules were synthesized in infected cells; these were not detected in uninfected cells. The rate of synthesis of the larger, 18 to 30S RNA class reached a maximum soon after injection and then declined, whereas the rate of synthesis of the 7 to 11 S RNA class did not reach a maximum until much later and did not decline. In the presence of cytosine arabinoside, the rate of mRNA synthesis in infected cells was reduced but the electrophoretic pattern remained the same.

  7. Pimelic acid, the first precursor of the Bacillus subtilis biotin synthesis pathway, exists as the free acid and is assembled by fatty acid synthesis.

    PubMed

    Manandhar, Miglena; Cronan, John E

    2017-05-01

    Biotin synthetic pathways are readily separated into two stages, synthesis of the seven carbon α, ω-dicarboxylic acid pimelate moiety and assembly of the fused heterocyclic rings. The biotin pathway genes responsible for pimelate moiety synthesis vary widely among bacteria whereas the ring synthesis genes are highly conserved. Bacillus subtilis seems to have redundant genes, bioI and bioW, for generation of the pimelate intermediate. Largely consistent with previous genetic studies it was found that deletion of bioW caused a biotin auxotrophic phenotype whereas deletion of bioI did not. BioW is a pimeloyl-CoA synthetase that converts pimelic acid to pimeloyl-CoA. The essentiality of BioW for biotin synthesis indicates that the free form of pimelic acid is an intermediate in biotin synthesis although this is not the case in E. coli. Since the origin of pimelic acid in Bacillus subtilis is unknown, 13 C-NMR studies were carried out to decipher the pathway for its generation. The data provided evidence for the role of free pimelate in biotin synthesis and the involvement of fatty acid synthesis in pimelate production. Cerulenin, an inhibitor of the key fatty acid elongation enzyme, FabF, markedly decreased biotin production by B. subtilis resting cells whereas a strain having a cerulenin-resistant FabF mutant produced more biotin. In addition, supplementation with pimelic acid fully restored biotin production in cerulenin-treated cells. These results indicate that pimelic acid originating from fatty acid synthesis pathway is a bona fide precursor of biotin in B. subtilis. © 2017 John Wiley & Sons Ltd.

  8. Fed levels of amino acids are required for the somatotropin-induced increase in muscle protein synthesis.

    PubMed

    Wilson, Fiona A; Suryawan, Agus; Orellana, Renán A; Nguyen, Hanh V; Jeyapalan, Asumthia S; Gazzaneo, Maria C; Davis, Teresa A

    2008-10-01

    Chronic somatotropin (pST) treatment in pigs increases muscle protein synthesis and circulating insulin, a known promoter of protein synthesis. Previously, we showed that the pST-mediated rise in insulin could not account for the pST-induced increase in muscle protein synthesis when amino acids were maintained at fasting levels. This study aimed to determine whether the pST-induced increase in insulin promotes skeletal muscle protein synthesis when amino acids are provided at fed levels and whether the response is associated with enhanced translation initiation factor activation. Growing pigs were treated with pST (0 or 180 microg x kg(-1) x day(-1)) for 7 days, and then pancreatic-glucose-amino acid clamps were performed. Amino acids were raised to fed levels in the presence of either fasted or fed insulin concentrations; glucose was maintained at fasting throughout. Muscle protein synthesis was increased by pST treatment and by amino acids (with or without insulin) (P<0.001). In pST-treated pigs, fed, but not fasting, amino acid concentrations further increased muscle protein synthesis rates irrespective of insulin level (P<0.02). Fed amino acids, with or without raised insulin concentrations, increased the phosphorylation of S6 kinase (S6K1) and eukaryotic initiation factor (eIF) 4E-binding protein 1 (4EBP1), decreased inactive 4EBP1.eIF4E complex association, and increased active eIF4E.eIF4G complex formation (P<0.02). pST treatment did not alter translation initiation factor activation. We conclude that the pST-induced stimulation of muscle protein synthesis requires fed amino acid levels, but not fed insulin levels. However, under the current conditions, the response to amino acids is not mediated by the activation of translation initiation factors that regulate mRNA binding to the ribosomal complex.

  9. Serine Metabolism Supports the Methionine Cycle and DNA/RNA Methylation through De Novo ATP Synthesis in Cancer Cells

    PubMed Central

    Maddocks, Oliver D.K.; Labuschagne, Christiaan F.; Adams, Peter D.; Vousden, Karen H.

    2016-01-01

    Summary Crosstalk between cellular metabolism and the epigenome regulates epigenetic and metabolic homeostasis and normal cell behavior. Changes in cancer cell metabolism can directly impact epigenetic regulation and promote transformation. Here we analyzed the contribution of methionine and serine metabolism to methylation of DNA and RNA. Serine can contribute to this pathway by providing one-carbon units to regenerate methionine from homocysteine. While we observed this contribution under methionine-depleted conditions, unexpectedly, we found that serine supported the methionine cycle in the presence and absence of methionine through de novo ATP synthesis. Serine starvation increased the methionine/S-adenosyl methionine ratio, decreasing the transfer of methyl groups to DNA and RNA. While serine starvation dramatically decreased ATP levels, this was accompanied by lower AMP and did not activate AMPK. This work highlights the difference between ATP turnover and new ATP synthesis and defines a vital function of nucleotide synthesis beyond making nucleic acids. PMID:26774282

  10. Serine Metabolism Supports the Methionine Cycle and DNA/RNA Methylation through De Novo ATP Synthesis in Cancer Cells.

    PubMed

    Maddocks, Oliver D K; Labuschagne, Christiaan F; Adams, Peter D; Vousden, Karen H

    2016-01-21

    Crosstalk between cellular metabolism and the epigenome regulates epigenetic and metabolic homeostasis and normal cell behavior. Changes in cancer cell metabolism can directly impact epigenetic regulation and promote transformation. Here we analyzed the contribution of methionine and serine metabolism to methylation of DNA and RNA. Serine can contribute to this pathway by providing one-carbon units to regenerate methionine from homocysteine. While we observed this contribution under methionine-depleted conditions, unexpectedly, we found that serine supported the methionine cycle in the presence and absence of methionine through de novo ATP synthesis. Serine starvation increased the methionine/S-adenosyl methionine ratio, decreasing the transfer of methyl groups to DNA and RNA. While serine starvation dramatically decreased ATP levels, this was accompanied by lower AMP and did not activate AMPK. This work highlights the difference between ATP turnover and new ATP synthesis and defines a vital function of nucleotide synthesis beyond making nucleic acids. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  11. Chiral Sugars Drive Enantioenrichment in Prebiotic Amino Acid Synthesis.

    PubMed

    Wagner, Alexander J; Zubarev, Dmitry Yu; Aspuru-Guzik, Alán; Blackmond, Donna G

    2017-04-26

    Chiral pentose sugars mediate the enantioselective synthesis of amino acid precursors, with the magnitude of the chiral induction dictated by a subtle cooperativity between sugar hydroxyl groups. Ribose and lyxose give opposite chiral preferences, and theoretical calculations reveal the pseudoenantiomeric nature of transition state structures from the two sugars. Prebiotically plausible mixtures of natural d-sugars lead to enantioenrichment of natural l-amino acid precursors. Temporal monitoring and kinetic modeling of the reaction reveal an unusual dynamic kinetic resolution that shifts toward an enantioselective pathway over time, providing an amplification mechanism for the transfer of chiral information. This work adds to growing evidence for synergy in the etiology of the single chirality of the two most important classes of biological molecules, the sugars that make up DNA and RNA and the amino acids that form proteins.

  12. Chiral Sugars Drive Enantioenrichment in Prebiotic Amino Acid Synthesis

    PubMed Central

    2017-01-01

    Chiral pentose sugars mediate the enantioselective synthesis of amino acid precursors, with the magnitude of the chiral induction dictated by a subtle cooperativity between sugar hydroxyl groups. Ribose and lyxose give opposite chiral preferences, and theoretical calculations reveal the pseudoenantiomeric nature of transition state structures from the two sugars. Prebiotically plausible mixtures of natural d-sugars lead to enantioenrichment of natural l-amino acid precursors. Temporal monitoring and kinetic modeling of the reaction reveal an unusual dynamic kinetic resolution that shifts toward an enantioselective pathway over time, providing an amplification mechanism for the transfer of chiral information. This work adds to growing evidence for synergy in the etiology of the single chirality of the two most important classes of biological molecules, the sugars that make up DNA and RNA and the amino acids that form proteins. PMID:28470050

  13. Kinetics of Nucleic Acid Synthesis in Human Embryonic Kidney Cultures Infected with Adenovirus 2 or 12: Inhibition of Cellular Deoxyribonucleic Acid Synthesis

    PubMed Central

    Ledinko, Nada; Fong, Caroline K. Y.

    1969-01-01

    Infection of human embryonic kidney (HEK) cell cultures with adenovirus types 2 or 12 resulted in an initial drop in the rate of incorporation of 3H-thymidine into deoxyribonucleic acid (DNA) during the early latent period of virus growth, followed by a marked rise in label uptake. It was shown by cesium chloride isopycnic centrifugation that, after adenovirus 2 infection, there was a decrease in the rate of incorporation of thymidine into cellular DNA. Moreover, DNA-DNA hybridization experiments revealed that, by 28 to 32 hr after infection with either adenovirus 2 or 12, the amount of isolated pulse-labeled DNA capable of hybridizing with HEK cell DNA was reduced by approximately 60 to 70%. Autoradiographic measurements showed that the inhibition of cellular DNA synthesis was due to a decrease in the ability of an infected cell to synthesize DNA. The adenovirus-induced inhibition of host cell DNA synthesis was not due to degradation of cellular DNA. 3H-thymidine incorporated into cellular DNA at the time of infection remained acid-precipitable, and labeled material was not incorporated into viral DNA. Furthermore, when zone sedimentation through neutral or alkaline sucrose density gradients was employed, no detectable change was observed in the sedimentation rate of this cellular DNA at various times after infection with adenovirus 2 or 12. In addition, there was no increase in deoxyribonuclease activity in cells infected with either virus. Cultures infected for 38 hr with adenovirus 2 or 12 incorporated three to four times as much 3H-uridine into ribonucleic acid (RNA) as did non-infected cultures. Furthermore, the net RNA synthesized by infected cultures substantially exceeded that of control cultures. The activity of thymidine kinase was induced, but there was no stimulation of uridine kinase. PMID:5806981

  14. The mechanism of montmorillonite catalysis in RNA synthesis

    NASA Astrophysics Data System (ADS)

    Joshi, Prakash

    The formation of complex prebiotic molecules on the early Earth is likely to have involved a component of mineral catalysis. Amongst the variety of clay minerals that have been investigated by us for their ability to catalyze the formation of RNA oligomers is montmorillonite. These are 2:1 layer silicates that have a wide range of chemical compositions [(Na,Ca)0.33(Al,Fe,Mg)2(Si,Al)4O10(OH)2.nH2O]. They are commonly produced by the weathering of silicic volcanic ashes to form Bentonite. Once formed, montmorillonites gradually transform to Illites at a modest pressure and temperature. Of the many samples of montmorillonite that we have experimentally examined, a selected subset has been observed to be catalytic for RNA synthesis (Joshi et. al., 2009; Aldersley et al., 2011). Those that have been observed to be excellent catalysts come from a restricted range of elemental compositions. The recent identification of phyllosilicates including montmorillonite on Mars (Bishop et al., 2008) raises the possibility that such processes may have taken place there too. The extent of catalysis depended not only upon the magnitude of the negative charge on the montmorillonite lattice and the number of cations associated with it, but also on the pH at which the reaction is promoted. The isotherm and catalysis studies were extended to provide binding information and catalytic outcomes over a wide pH range. When cations in raw montmorillonite are completely replaced by sodium ions, the resulting Na+-montmorillonite does not catalyze oligomer formation because the ions saturate the interlayer between the platelets of montmorillonite, which blocks the binding of the activated monomers. Acid washed montmorillonite titrated to pH 6-8 with alkali metal ions, serves as the model catalyst for this RNA synthesis (Aldersley et. al., 2011). The optimal binding occurred in the region of maximal oligomer formation. X-ray diffraction studies revealed changes in layer separations of

  15. Synthesis of guanidinoacetate and creatine from amino acids by rat pancreas.

    PubMed

    da Silva, Robin P; Clow, Kathy; Brosnan, John T; Brosnan, Margaret E

    2014-02-01

    Creatine is an important molecule involved in cellular energy metabolism. Creatine is spontaneously converted to creatinine at a rate of 1·7% per d; creatinine is lost in the urine. Creatine can be obtained from the diet or synthesised from endogenous amino acids via the enzymes arginine:glycine amidinotransferase (AGAT) and guanidinoacetate N-methyltransferase (GAMT). The liver has high GAMT activity and the kidney has high AGAT activity. Although the pancreas has both AGAT and GAMT activities, its possible role in creatine synthesis has not been characterised. In the present study, we examined the enzymes involved in creatine synthesis in the pancreas as well as the synthesis of guanidinoacetate (GAA) and creatine by isolated pancreatic acini. We found significant AGAT activity and somewhat lower GAMT activity in the pancreas and that pancreatic acini had measurable activities of both AGAT and GAMT and the capacity to synthesise GAA and creatine from amino acids. Creatine supplementation led to a decrease in AGAT activity in the pancreas, though it did not affect its mRNA or protein abundance. This was in contrast with the reduction of AGAT activity and mRNA and protein abundance in the kidney, suggesting that the regulatory mechanisms that control the expression of this enzyme in the pancreas are different from those in the kidney. Dietary creatine increased the concentrations of GAA, creatine and phosphocreatine in the pancreas. Unexpectedly, creatine supplementation decreased the concentrations of S-adenosylmethionine, while those of S-adenosylhomocysteine were not altered significantly.

  16. An intrinsically disordered peptide from Ebola virus VP35 controls viral RNA synthesis by modulating nucleoprotein-RNA interactions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Leung, Daisy  W.; Borek, Dominika; Luthra, Priya

    During viral RNA synthesis, Ebola virus (EBOV) nucleoprotein (NP) alternates between an RNA-template-bound form and a template-free form to provide the viral polymerase access to the RNA template. In addition, newly synthesized NP must be prevented from indiscriminately binding to noncognate RNAs. Here, we investigate the molecular bases for these critical processes. We identify an intrinsically disordered peptide derived from EBOV VP35 (NPBP, residues 20–48) that binds NP with high affinity and specificity, inhibits NP oligomerization, and releases RNA from NP-RNA complexes in vitro. The structure of the NPBP/ΔNP NTD complex, solved to 3.7 Å resolution, reveals how NPBP peptidemore » occludes a large surface area that is important for NP-NP and NP-RNA interactions and for viral RNA synthesis. Together, our results identify a highly conserved viral interface that is important for EBOV replication and can be targeted for therapeutic development.« less

  17. An intrinsically disordered peptide from Ebola virus VP35 controls viral RNA synthesis by modulating nucleoprotein-RNA interactions

    DOE PAGES

    Leung, Daisy  W.; Borek, Dominika; Luthra, Priya; ...

    2015-04-01

    During viral RNA synthesis, Ebola virus (EBOV) nucleoprotein (NP) alternates between an RNA-template-bound form and a template-free form to provide the viral polymerase access to the RNA template. In addition, newly synthesized NP must be prevented from indiscriminately binding to noncognate RNAs. Here, we investigate the molecular bases for these critical processes. We identify an intrinsically disordered peptide derived from EBOV VP35 (NPBP, residues 20–48) that binds NP with high affinity and specificity, inhibits NP oligomerization, and releases RNA from NP-RNA complexes in vitro. The structure of the NPBP/ΔNP NTD complex, solved to 3.7 Å resolution, reveals how NPBP peptidemore » occludes a large surface area that is important for NP-NP and NP-RNA interactions and for viral RNA synthesis. Together, our results identify a highly conserved viral interface that is important for EBOV replication and can be targeted for therapeutic development.« less

  18. An Intrinsically Disordered Peptide from Ebola Virus VP35 Controls Viral RNA Synthesis by Modulating Nucleoprotein-RNA Interactions.

    PubMed

    Leung, Daisy W; Borek, Dominika; Luthra, Priya; Binning, Jennifer M; Anantpadma, Manu; Liu, Gai; Harvey, Ian B; Su, Zhaoming; Endlich-Frazier, Ariel; Pan, Juanli; Shabman, Reed S; Chiu, Wah; Davey, Robert A; Otwinowski, Zbyszek; Basler, Christopher F; Amarasinghe, Gaya K

    2015-04-21

    During viral RNA synthesis, Ebola virus (EBOV) nucleoprotein (NP) alternates between an RNA-template-bound form and a template-free form to provide the viral polymerase access to the RNA template. In addition, newly synthesized NP must be prevented from indiscriminately binding to noncognate RNAs. Here, we investigate the molecular bases for these critical processes. We identify an intrinsically disordered peptide derived from EBOV VP35 (NPBP, residues 20-48) that binds NP with high affinity and specificity, inhibits NP oligomerization, and releases RNA from NP-RNA complexes in vitro. The structure of the NPBP/ΔNPNTD complex, solved to 3.7 Å resolution, reveals how NPBP peptide occludes a large surface area that is important for NP-NP and NP-RNA interactions and for viral RNA synthesis. Together, our results identify a highly conserved viral interface that is important for EBOV replication and can be targeted for therapeutic development. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  19. Engineering Sialic Acid Synthesis Ability in Insect Cells.

    PubMed

    Viswanathan, Karthik; Narang, Someet; Betenbaugh, Michael J

    2015-01-01

    Insect cells lack the ability to synthesize the sialic acid donor molecule CMP-sialic acid or its precursor, sialic acid. In this chapter, we describe a method to engineer CMP-sialic acid synthesis capability into Spodoptera frugiperda (Sf9) cells, a prototypical insect cell line, by recombinant expression of sialic acid synthesis pathway genes using baculovirus technology. Co-expression of a sialuria mutant UDP-GlcNAc-2-epimerase/ManNAc kinase (EKR263L), wild-type sialic acid 9-phosphate synthase (SAS), and wild-type CMP-sialic acid synthetase (CSAS) in the presence of GlcNAc leads to synthesis of CMP-sialic acids synthesis to support sialylation of N-glycans on glycoproteins.

  20. The Murine Norovirus Core Subgenomic RNA Promoter Consists of a Stable Stem-Loop That Can Direct Accurate Initiation of RNA Synthesis

    PubMed Central

    Yunus, Muhammad Amir; Lin, Xiaoyan; Bailey, Dalan; Karakasiliotis, Ioannis; Chaudhry, Yasmin; Vashist, Surender; Zhang, Guo; Thorne, Lucy; Kao, C. Cheng

    2014-01-01

    ABSTRACT All members of the Caliciviridae family of viruses produce a subgenomic RNA during infection. The subgenomic RNA typically encodes only the major and minor capsid proteins, but in murine norovirus (MNV), the subgenomic RNA also encodes the VF1 protein, which functions to suppress host innate immune responses. To date, the mechanism of norovirus subgenomic RNA synthesis has not been characterized. We have previously described the presence of an evolutionarily conserved RNA stem-loop structure on the negative-sense RNA, the complementary sequence of which codes for the viral RNA-dependent RNA polymerase (NS7). The conserved stem-loop is positioned 6 nucleotides 3′ of the start site of the subgenomic RNA in all caliciviruses. We demonstrate that the conserved stem-loop is essential for MNV viability. Mutant MNV RNAs with substitutions in the stem-loop replicated poorly until they accumulated mutations that revert to restore the stem-loop sequence and/or structure. The stem-loop sequence functions in a noncoding context, as it was possible to restore the replication of an MNV mutant by introducing an additional copy of the stem-loop between the NS7- and VP1-coding regions. Finally, in vitro biochemical data suggest that the stem-loop sequence is sufficient for the initiation of viral RNA synthesis by the recombinant MNV RNA-dependent RNA polymerase, confirming that the stem-loop forms the core of the norovirus subgenomic promoter. IMPORTANCE Noroviruses are a significant cause of viral gastroenteritis, and it is important to understand the mechanism of norovirus RNA synthesis. Here we describe the identification of an RNA stem-loop structure that functions as the core of the norovirus subgenomic RNA promoter in cells and in vitro. This work provides new insights into the molecular mechanisms of norovirus RNA synthesis and the sequences that determine the recognition of viral RNA by the RNA-dependent RNA polymerase. PMID:25392209

  1. The murine norovirus core subgenomic RNA promoter consists of a stable stem-loop that can direct accurate initiation of RNA synthesis.

    PubMed

    Yunus, Muhammad Amir; Lin, Xiaoyan; Bailey, Dalan; Karakasiliotis, Ioannis; Chaudhry, Yasmin; Vashist, Surender; Zhang, Guo; Thorne, Lucy; Kao, C Cheng; Goodfellow, Ian

    2015-01-15

    All members of the Caliciviridae family of viruses produce a subgenomic RNA during infection. The subgenomic RNA typically encodes only the major and minor capsid proteins, but in murine norovirus (MNV), the subgenomic RNA also encodes the VF1 protein, which functions to suppress host innate immune responses. To date, the mechanism of norovirus subgenomic RNA synthesis has not been characterized. We have previously described the presence of an evolutionarily conserved RNA stem-loop structure on the negative-sense RNA, the complementary sequence of which codes for the viral RNA-dependent RNA polymerase (NS7). The conserved stem-loop is positioned 6 nucleotides 3' of the start site of the subgenomic RNA in all caliciviruses. We demonstrate that the conserved stem-loop is essential for MNV viability. Mutant MNV RNAs with substitutions in the stem-loop replicated poorly until they accumulated mutations that revert to restore the stem-loop sequence and/or structure. The stem-loop sequence functions in a noncoding context, as it was possible to restore the replication of an MNV mutant by introducing an additional copy of the stem-loop between the NS7- and VP1-coding regions. Finally, in vitro biochemical data suggest that the stem-loop sequence is sufficient for the initiation of viral RNA synthesis by the recombinant MNV RNA-dependent RNA polymerase, confirming that the stem-loop forms the core of the norovirus subgenomic promoter. Noroviruses are a significant cause of viral gastroenteritis, and it is important to understand the mechanism of norovirus RNA synthesis. Here we describe the identification of an RNA stem-loop structure that functions as the core of the norovirus subgenomic RNA promoter in cells and in vitro. This work provides new insights into the molecular mechanisms of norovirus RNA synthesis and the sequences that determine the recognition of viral RNA by the RNA-dependent RNA polymerase. Copyright © 2015, American Society for Microbiology. All Rights

  2. Amino acid substrates impose polyamine, eIF5A, or hypusine requirement for peptide synthesis.

    PubMed

    Shin, Byung-Sik; Katoh, Takayuki; Gutierrez, Erik; Kim, Joo-Ran; Suga, Hiroaki; Dever, Thomas E

    2017-08-21

    Whereas ribosomes efficiently catalyze peptide bond synthesis by most amino acids, the imino acid proline is a poor substrate for protein synthesis. Previous studies have shown that the translation factor eIF5A and its bacterial ortholog EF-P bind in the E site of the ribosome where they contact the peptidyl-tRNA in the P site and play a critical role in promoting the synthesis of polyproline peptides. Using misacylated Pro-tRNAPhe and Phe-tRNAPro, we show that the imino acid proline and not tRNAPro imposes the primary eIF5A requirement for polyproline synthesis. Though most proline analogs require eIF5A for efficient peptide synthesis, azetidine-2-caboxylic acid, a more flexible four-membered ring derivative of proline, shows relaxed eIF5A dependency, indicating that the structural rigidity of proline might contribute to the requirement for eIF5A. Finally, we examine the interplay between eIF5A and polyamines in promoting translation elongation. We show that eIF5A can obviate the polyamine requirement for general translation elongation, and that this activity is independent of the conserved hypusine modification on eIF5A. Thus, we propose that the body of eIF5A functionally substitutes for polyamines to promote general protein synthesis and that the hypusine modification on eIF5A is critically important for poor substrates like proline. Published by Oxford University Press on behalf of Nucleic Acids Research 2017.

  3. RNA SYNTHESIS IN THE MOUSE OOCYTE

    PubMed Central

    Moore, G. P. M.; Lintern-Moore, Sue; Peters, Hannah; Faber, M.

    1974-01-01

    RNA synthesis in the oocyte and granulosa cell nuclei of growing follicles has been studied in the mouse ovary. The RNA precursor [3H]uridine was administered intraperitoneally to adult mice and the amount of label incorporated into ovarian RNA was quantitated autoradiographically using grain-counting procedures. Uridine incorporation into the nucleus is low in oocytes of small, resting follicles but increases during follicle growth and reaches a peak prior to the beginning of antrum formation. Thereafter uptake rapidly declines and is very low in the oocytes of maturing follicles. Uridine incorporation into granulosa cell nuclei, in contrast to that found in the oocyte, increases gradually during most of the period of follicle growth. Qualitative studies of the activity of endogenous, DNA-dependent RNA polymerases have also been made in fixed oocytes isolated from follicles at different stages of growth. Polymerase activity is demonstrable in the nucleolus and nucleoplasm of oocytes from growing follicles, but is absent from maturing oocytes of large follicles. PMID:4813213

  4. The effect of ethionine on ribonucleic acid synthesis in rat liver.

    PubMed Central

    Swann, P F

    1975-01-01

    1. By 1h after administration of ethionine to the female rat the appearance of newly synthesized 18SrRNA in the cytoplasm is completely inhibited. This is not caused by inhibition of RNA synthesis, for the synthesis of the large ribosomal precursor RNA (45S) and of tRNA continues. Cleavage of 45S RNA to 32S RNA also occurs, but there was no evidence for the accumulation of mature or immature rRNA in the nucleus. 2. The effect of ethionine on the maturation of rRNA was not mimicked by an inhibitor of protein synthesis (cycloheximide) or an inhibitor of polyamine synthesis [methylglyoxal bis(guanylhydrazone)]. 3. Unlike the ethionine-induced inhibition of protein synthesis, this effect was not prevented by concurrent administration of inosine. A similar effect could be induced in HeLa cells by incubation for 1h in a medium lacking methionine. The ATP concentration in these cells was normal. From these two observations it was concluded that the effect of etionine on rRNA maturation is not caused by an ethionine-induced lack of ATP. It is suggested that ethionine, by lowering the hepatic concentration of S-adenosylmethionine, prevents methylation of the ribosomal precursor. The methylation is essential for the correct maturation of the molecule; without methylation complete degradation occurs. PMID:1212195

  5. Replication of tobacco mosaic virus RNA.

    PubMed Central

    Buck, K W

    1999-01-01

    The replication of tobacco mosaic virus (TMV) RNA involves synthesis of a negative-strand RNA using the genomic positive-strand RNA as a template, followed by the synthesis of positive-strand RNA on the negative-strand RNA templates. Intermediates of replication isolated from infected cells include completely double-stranded RNA (replicative form) and partly double-stranded and partly single-stranded RNA (replicative intermediate), but it is not known whether these structures are double-stranded or largely single-stranded in vivo. The synthesis of negative strands ceases before that of positive strands, and positive and negative strands may be synthesized by two different polymerases. The genomic-length negative strand also serves as a template for the synthesis of subgenomic mRNAs for the virus movement and coat proteins. Both the virus-encoded 126-kDa protein, which has amino-acid sequence motifs typical of methyltransferases and helicases, and the 183-kDa protein, which has additional motifs characteristic of RNA-dependent RNA polymerases, are required for efficient TMV RNA replication. Purified TMV RNA polymerase also contains a host protein serologically related to the RNA-binding subunit of the yeast translational initiation factor, eIF3. Study of Arabidopsis mutants defective in RNA replication indicates that at least two host proteins are needed for TMV RNA replication. The tomato resistance gene Tm-1 may also encode a mutant form of a host protein component of the TMV replicase. TMV replicase complexes are located on the endoplasmic reticulum in close association with the cytoskeleton in cytoplasmic bodies called viroplasms, which mature to produce 'X bodies'. Viroplasms are sites of both RNA replication and protein synthesis, and may provide compartments in which the various stages of the virus mutiplication cycle (protein synthesis, RNA replication, virus movement, encapsidation) are localized and coordinated. Membranes may also be important for the

  6. Amino acid substrates impose polyamine, eIF5A, or hypusine requirement for peptide synthesis

    PubMed Central

    Shin, Byung-Sik; Katoh, Takayuki; Gutierrez, Erik; Kim, Joo-Ran; Suga, Hiroaki

    2017-01-01

    Abstract Whereas ribosomes efficiently catalyze peptide bond synthesis by most amino acids, the imino acid proline is a poor substrate for protein synthesis. Previous studies have shown that the translation factor eIF5A and its bacterial ortholog EF-P bind in the E site of the ribosome where they contact the peptidyl-tRNA in the P site and play a critical role in promoting the synthesis of polyproline peptides. Using misacylated Pro-tRNAPhe and Phe-tRNAPro, we show that the imino acid proline and not tRNAPro imposes the primary eIF5A requirement for polyproline synthesis. Though most proline analogs require eIF5A for efficient peptide synthesis, azetidine-2-caboxylic acid, a more flexible four-membered ring derivative of proline, shows relaxed eIF5A dependency, indicating that the structural rigidity of proline might contribute to the requirement for eIF5A. Finally, we examine the interplay between eIF5A and polyamines in promoting translation elongation. We show that eIF5A can obviate the polyamine requirement for general translation elongation, and that this activity is independent of the conserved hypusine modification on eIF5A. Thus, we propose that the body of eIF5A functionally substitutes for polyamines to promote general protein synthesis and that the hypusine modification on eIF5A is critically important for poor substrates like proline. PMID:28637321

  7. Synthesis and characterization of amino acid-functionalized calcium phosphate nanoparticles for siRNA delivery.

    PubMed

    Bakan, Feray; Kara, Goknur; Cokol Cakmak, Melike; Cokol, Murat; Denkbas, Emir Baki

    2017-10-01

    Small interfering RNAs (siRNA) are short nucleic acid fragments of about 20-27 nucleotides, which can inhibit the expression of specific genes. siRNA based RNAi technology has emerged as a promising method for the treatment of a variety of diseases. However, a major limitation in the therapeutic use of siRNA is its rapid degradation in plasma and cellular cytoplasm, resulting in short half-life. In addition, as siRNA molecules cannot penetrate into the cell efficiently, it is required to use a carrier system for its delivery. In this work, chemically and morphologically different calcium phosphate (CaP) nanoparticles, including spherical-like hydroxyapatite (HA-s), needle-like hydroxyapatite (HA-n) and calcium deficient hydroxyapatite (CDHA) nanoparticles were synthesized by the sol-gel technique and the effects of particle characteristics on the binding capacity of siRNA were investigated. In order to enhance the gene loading efficiency, the nanoparticles were functionalized with arginine and the morphological and their structural characteristics were analyzed. The addition of arginine did not significantly change the particle sizes; however, it provided a significantly increased binding of siRNA for all types of CaP nanoparticles, as revealed by spectrophotometric measurements analysis. Arginine functionalized HA-n nanoparticles showed the best binding behavior with siRNA among the other nanoparticles due to its high, positive zeta potential (+18.8mV) and high surface area of Ca ++ rich "c" plane. MTT cytotoxicity assays demonstrated that all the nanoparticles tested herein were biocompatible. Our results suggest that high siRNA entrapment in each of the three modified non-toxic CaP nanoparticles make them promising candidates as a non-viral vector for delivering therapeutic siRNA molecules to treat cancer. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Regulation of nucleic acid and protein synthesis: a background study related to the biological effects of radiation. Final report on research activities

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Not Available

    The existence of an intricate interplay of nucleic acids and nucleotides in the chain of events leading from free amino acid to completed polypeptide chain has been determined. To this was added another participant to the nucleotides in protein synthesis - diadenosine-5', 5''', p'p/sup 4/-tetraphosphate (Ap4A). Ap/sub 4/A serves as an initiation primer for DNA synthesis in a eukaryotic system catalyzed by DNA polymerase ..cap alpha... Thus the initial step in protein synthesis is linked to the first step in DNA synthesis by a small molecular weight, unique dinucleotide signal. Advances in the methodology of nucleic acid sequencing have mademore » it possible to examine the relationship between specific short segments of DNA and RNA and their function in the metabolism of the living cell. The triester method of synthesizing deoxynucleotide polymers has made it feasible to synthesize and use specific oligomeric deoxynucleotide sequences as probes of genetic function and potential viral inhibitors. The synthesis of ribonucleotide polymers has been more difficult, due almost entirely to the presence of the 2' ribosyl hydroxyl group. The possibility is now emerging, however, of employing ribonucleotide polymers as specific RNA-virus inhibitors.« less

  9. In vitro synthesis of minus-strand RNA by an isolated cereal yellow dwarf virus RNA-dependent RNA polymerase requires VPg and a stem-loop structure at the 3' end of the virus RNA.

    PubMed

    Osman, Toba A M; Coutts, Robert H A; Buck, Kenneth W

    2006-11-01

    Cereal yellow dwarf virus (CYDV) RNA has a 5'-terminal genome-linked protein (VPg). We have expressed the VPg region of the CYDV genome in bacteria and used the purified protein (bVPg) to raise an antiserum which was able to detect free VPg in extracts of CYDV-infected oat plants. A template-dependent RNA-dependent RNA polymerase (RdRp) has been produced from a CYDV membrane-bound RNA polymerase by treatment with BAL 31 nuclease. The RdRp was template specific, being able to utilize templates from CYDV plus- and minus-strand RNAs but not those of three unrelated viruses, Red clover necrotic mosaic virus, Cucumber mosaic virus, and Tobacco mosaic virus. RNA synthesis catalyzed by the RdRp required a 3'-terminal GU sequence and the presence of bVPg. Additionally, synthesis of minus-strand RNA on a plus-strand RNA template required the presence of a putative stem-loop structure near the 3' terminus of CYDV RNA. The base-paired stem, a single-nucleotide (A) bulge in the stem, and the sequence of a tetraloop were all required for the template activity. Evidence was produced showing that minus-strand synthesis in vitro was initiated by priming by bVPg at the 3' end of the template. The data are consistent with a model in which the RdRp binds to the stem-loop structure which positions the active site to recognize the 3'-terminal GU sequence for initiation of RNA synthesis by the addition of an A residue to VPg.

  10. Tethering of human Ago proteins to mRNA mimics the miRNA-mediated repression of protein synthesis.

    PubMed

    Pillai, Ramesh S; Artus, Caroline G; Filipowicz, Witold

    2004-10-01

    MicroRNAs (miRNAs) are approximately 21-nt-long RNAs involved in regulating development, differentiation, and other processes in eukaryotes. In metazoa, nearly all miRNAs control gene expression by imperfectly base-pairing with the 3'-untranslated region (3'-UTR) of target mRNAs and repressing protein synthesis by an unknown mechanism. It is also unknown whether miRNA-mRNA duplexes containing mismatches and bulges provide specific features that are recognized by factors mediating the repression. miRNAs form part of ribonucleoprotein complexes, miRNPs, that contain Argonaute (Ago) and other proteins. Here we demonstrate that effects of miRNAs on translation can be mimicked in human HeLa cells by the miRNA-independent tethering of Ago proteins to the 3'-UTR of a reporter mRNA. Inhibition of protein synthesis occurred without a change in the reporter mRNA level and was dependent on the number, but not the position, of the hairpins tethering hAgo2 to the 3'-UTR. These findings indicate that a primary function of miRNAs is to guide their associated proteins to the mRNA. Copyright 2004 RNA Society

  11. Synthesis and properties of 2'-O-methyl-4'-thioRNA.

    PubMed

    Takahashi, Mayumi; Inoue, Naonori; Minakawa, Noriaki; Matsuda, Akira

    2005-01-01

    In this presentation, we will discuss the synthesis and properties of 2'-O-methyl-4'-thioRNA, an RNA molecule consisting of 2'-O-methyl-4'-thionucleosides. We first synthesized 2'-O-methyl-4'-thiouridine and -cytidine derivatives via 2,2'-O-anhydro-4'-thiouridine. The RNA consisting of 2'-O-methyl-4'-thiopyrimidine nucleosides and 2'-O-methylpurine nucleosides, 2'-OMe-4'-thioRNA, was synthesized on a DNA synthesizer according to the standard phosphoramidite protocol.

  12. Fed levels of amino acids are required for the somatotropin-induced increase in muscle protein synthesis

    PubMed Central

    Wilson, Fiona A.; Suryawan, Agus; Orellana, Renán A.; Nguyen, Hanh V.; Jeyapalan, Asumthia S.; Gazzaneo, Maria C.; Davis, Teresa A.

    2008-01-01

    Chronic somatotropin (pST) treatment in pigs increases muscle protein synthesis and circulating insulin, a known promoter of protein synthesis. Previously, we showed that the pST-mediated rise in insulin could not account for the pST-induced increase in muscle protein synthesis when amino acids were maintained at fasting levels. This study aimed to determine whether the pST-induced increase in insulin promotes skeletal muscle protein synthesis when amino acids are provided at fed levels and whether the response is associated with enhanced translation initiation factor activation. Growing pigs were treated with pST (0 or 180 μg·kg−1·day−1) for 7 days, and then pancreatic-glucose-amino acid clamps were performed. Amino acids were raised to fed levels in the presence of either fasted or fed insulin concentrations; glucose was maintained at fasting throughout. Muscle protein synthesis was increased by pST treatment and by amino acids (with or without insulin) (P < 0.001). In pST-treated pigs, fed, but not fasting, amino acid concentrations further increased muscle protein synthesis rates irrespective of insulin level (P < 0.02). Fed amino acids, with or without raised insulin concentrations, increased the phosphorylation of S6 kinase (S6K1) and eukaryotic initiation factor (eIF) 4E-binding protein 1 (4EBP1), decreased inactive 4EBP1·eIF4E complex association, and increased active eIF4E·eIF4G complex formation (P < 0.02). pST treatment did not alter translation initiation factor activation. We conclude that the pST-induced stimulation of muscle protein synthesis requires fed amino acid levels, but not fed insulin levels. However, under the current conditions, the response to amino acids is not mediated by the activation of translation initiation factors that regulate mRNA binding to the ribosomal complex. PMID:18682537

  13. Akt activation enhances ribosomal RNA synthesis through casein kinase II and TIF-IA.

    PubMed

    Nguyen, Le Xuan Truong; Mitchell, Beverly S

    2013-12-17

    Transcription initiation factor I (TIF-IA) plays an essential role in regulating ribosomal RNA (rRNA) synthesis by tethering RNA polymerase I (Pol I) to the rDNA promoter. We have found that activated Akt enhances rRNA synthesis through the phosphorylation of casein kinase IIα (CK2α) on a threonine residue near its N terminus. CK2 in turn phosphorylates TIF-IA, thereby increasing rDNA transcription. Activated Akt also stabilizes TIF-IA, induces its translocation to the nucleolus, and enhances its interaction with Pol I. Treatment with AZD8055, an inhibitor of both Akt and mammalian target of rapamycin phosphorylation, but not with rapamycin, disrupts Akt-mediated TIF-IA stability, translocation, and activity. These data support a model in which activated Akt enhances rRNA synthesis both by preventing TIF-IA degradation and phosphorylating CK2α, which in turn phosphorylates TIF-IA. This model provides an explanation for the ability of activated Akt to promote cell proliferation and, potentially, transformation.

  14. Prebiotic Amino Acid Thioester Synthesis: Thiol-Dependent Amino Acid Synthesis from Formose substrates (Formaldehyde and Glycolaldehyde) and Ammonia

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1998-01-01

    Formaldehyde and glycolaldehyde (substrates of the formose autocatalytic cycle) were shown to react with ammonia yielding alanine and homoserine under mild aqueous conditions in the presence of thiol catalysts. Since similar reactions carried out without ammonia yielded alpha-hydroxy acid thioesters, the thiol-dependent synthesis of alanine and homoserine is presumed to occur via amino acid thioesters-intermediates capable of forming peptides. A pH 5.2 solution of 20 mM formaldehyde, 20 mM glycolaldehyde, 20 mM ammonium chloride, 23 mM 3-mercaptopropionic acid, and 23 mM acetic acid that reacted for 35 days at 40 C yielded (based on initial formaldehyde) 1.8% alanine and 0.08% homoserine. In the absence of thiol catalyst, the synthesis of alanine and homoserine was negligible. Alanine synthesis required both formaldehyde and glycolaldehyde, but homoserine synthesis required only glycolaldehyde. At 25 days the efficiency of alanine synthesis calculated from the ratio of alanine synthesized to formaldehyde reacted was 2.1%, and the yield (based on initial formaldehyde) of triose and tetrose intermediates involved in alanine and homoserine synthesis was 0.3 and 2.1%, respectively. Alanine synthesis was also seen in similar reactions containing only 10 mM each of aldehyde substrates, ammonia, and thiol. The prebiotic significance of these reactions that use the formose reaction to generate sugar intermediates that are converted to reactive amino acid thioesters is discussed.

  15. 2'-O-methylation in mRNA disrupts tRNA decoding during translation elongation.

    PubMed

    Choi, Junhong; Indrisiunaite, Gabriele; DeMirci, Hasan; Ieong, Ka-Weng; Wang, Jinfan; Petrov, Alexey; Prabhakar, Arjun; Rechavi, Gideon; Dominissini, Dan; He, Chuan; Ehrenberg, Måns; Puglisi, Joseph D

    2018-03-01

    Chemical modifications of mRNA may regulate many aspects of mRNA processing and protein synthesis. Recently, 2'-O-methylation of nucleotides was identified as a frequent modification in translated regions of human mRNA, showing enrichment in codons for certain amino acids. Here, using single-molecule, bulk kinetics and structural methods, we show that 2'-O-methylation within coding regions of mRNA disrupts key steps in codon reading during cognate tRNA selection. Our results suggest that 2'-O-methylation sterically perturbs interactions of ribosomal-monitoring bases (G530, A1492 and A1493) with cognate codon-anticodon helices, thereby inhibiting downstream GTP hydrolysis by elongation factor Tu (EF-Tu) and A-site tRNA accommodation, leading to excessive rejection of cognate aminoacylated tRNAs in initial selection and proofreading. Our current and prior findings highlight how chemical modifications of mRNA tune the dynamics of protein synthesis at different steps of translation elongation.

  16. Fine-Tuning of the Fatty Acid Pathway by Synthetic Antisense RNA for Enhanced (2S)-Naringenin Production from l-Tyrosine in Escherichia coli

    PubMed Central

    Wu, Junjun; Yu, Oliver; Du, Guocheng

    2014-01-01

    Malonyl coenzyme A (malonyl-CoA) is an important precursor for the synthesis of natural products, such as polyketides and flavonoids. The majority of this cofactor often is consumed for producing fatty acids and phospholipids, leaving only a small amount of cellular malonyl-CoA available for producing the target compound. The tuning of malonyl-CoA into heterologous pathways yields significant phenotypic effects, such as growth retardation and even cell death. In this study, fine-tuning of the fatty acid pathway in Escherichia coli with antisense RNA (asRNA) to balance the demands on malonyl-CoA for target-product synthesis and cell health was proposed. To establish an efficient asRNA system, the relationship between sequence and function for asRNA was explored. It was demonstrated that the gene-silencing effect of asRNA could be tuned by directing asRNA to different positions in the 5′-UTR (untranslated region) of the target gene. Based on this principle, the activity of asRNA was quantitatively tailored to balance the need for malonyl-CoA in cell growth and the production of the main flavonoid precursor, (2S)-naringenin. Appropriate inhibitory efficiency of the anti-fabB/fabF asRNA improved the production titer by 431% (391 mg/liter). Therefore, the strategy presented in this study provided a useful tool for the fine-tuning of endogenous gene expression in bacteria. PMID:25239896

  17. Fine-Tuning of the Fatty Acid Pathway by Synthetic Antisense RNA for Enhanced (2S)-Naringenin Production from l-Tyrosine in Escherichia coli.

    PubMed

    Wu, Junjun; Yu, Oliver; Du, Guocheng; Zhou, Jingwen; Chen, Jian

    2014-12-01

    Malonyl coenzyme A (malonyl-CoA) is an important precursor for the synthesis of natural products, such as polyketides and flavonoids. The majority of this cofactor often is consumed for producing fatty acids and phospholipids, leaving only a small amount of cellular malonyl-CoA available for producing the target compound. The tuning of malonyl-CoA into heterologous pathways yields significant phenotypic effects, such as growth retardation and even cell death. In this study, fine-tuning of the fatty acid pathway in Escherichia coli with antisense RNA (asRNA) to balance the demands on malonyl-CoA for target-product synthesis and cell health was proposed. To establish an efficient asRNA system, the relationship between sequence and function for asRNA was explored. It was demonstrated that the gene-silencing effect of asRNA could be tuned by directing asRNA to different positions in the 5'-UTR (untranslated region) of the target gene. Based on this principle, the activity of asRNA was quantitatively tailored to balance the need for malonyl-CoA in cell growth and the production of the main flavonoid precursor, (2S)-naringenin. Appropriate inhibitory efficiency of the anti-fabB/fabF asRNA improved the production titer by 431% (391 mg/liter). Therefore, the strategy presented in this study provided a useful tool for the fine-tuning of endogenous gene expression in bacteria. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  18. Upregulation of capacity for glutathione synthesis in response to amino acid deprivation: regulation of glutamate-cysteine ligase subunits

    PubMed Central

    Sikalidis, Angelos K.; Mazor, Kevin M.; Lee, Jeong-In; Roman, Heather B.; Hirschberger, Lawrence L.; Stipanuk, Martha H.

    2014-01-01

    Using HepG2/C3A cells and MEFs, we investigated whether induction of GSH synthesis in response to sulfur amino acid deficiency is mediated by the decrease in cysteine levels or whether it requires a decrease in GSH levels per se. Both the glutamate-cysteine ligase catalytic (GCLC) and modifier (GCLM) subunit mRNA levels were upregulated in response to a lack of cysteine or other essential amino acids, independent of GSH levels. This upregulation did not occur in MEFs lacking GCN2 (general control non-derepressible 2, also known as eIF2α kinase 4) or in cells expressing mutant eIF2α lacking the eIF2α kinase Ser51 phosphorylation site, indicating that expression of both GCLC and GCLM was mediated by the GCN2/ATF4 stress response pathway. Only the increase in GCLM mRNA level, however, was accompanied by a parallel increase in protein expression, suggesting that the enhanced capacity for GSH synthesis depended largely on increased association of GCLC with its regulatory subunit. Upregulation of both GCLC and GLCM mRNA levels in response to cysteine deprivation was dependent on new protein synthesis, which is consistent with expression of GCLC and GCLM being mediated by proteins whose synthesis depends on activation of the GCN2/ATF4 pathway. Our data suggest that the regulation of GCLC expression may be mediated by changes in the abundance of transcriptional regulators, whereas the regulation of GCLM expression may be mediated by changes in the abundance of mRNA stabilizing or destabilizing proteins. Upregulation of GCLM levels in response to low cysteine levels may serve to protect the cell in the face of a future stress requiring GSH as an antioxidant or conjugating/detoxifying agent. PMID:24557597

  19. Regulation of peroxisome proliferator-activated receptor gamma on milk fat synthesis in dairy cow mammary epithelial cells.

    PubMed

    Liu, Lili; Lin, Ye; Liu, Lixin; Wang, Lina; Bian, Yanjie; Gao, Xuejun; Li, Qingzhang

    2016-12-01

    Peroxisome proliferator-activated receptor gamma (PPARγ) participates in lipogenesis in rats, goats, and humans. However, the exact mechanism of PPARγ regulation on milk fat synthesis in dairy cow mammary epithelial cells (DCMECs) remains largely unexplored. The aim of this study was to investigate the role of PPARγ regarding milk fat synthesis in DCMECs and to ascertain whether milk fat precursor acetic acid and palmitic acid could interact with PPARγ signaling to regulate milk fat synthesis. For this study, we examined the effects of PPARγ overexpression and gene silencing on cell growth, triacylglycerol synthesis, and the messenger RNA (mRNA) and protein expression levels of genes involved in milk fat synthesis in DCMECs. In addition, we investigated the influences of acetic acid and palmitic acid on the mRNA and protein levels of milk lipogenic genes and triacylglycerol synthesis in DCMECs transfected with PPARγ small interfering RNA (siRNA) and PPARγ expression vector. The results showed that when PPARγ was silenced, cell viability, proliferation, and triacylglycerol secretion were obviously reduced. Gene silencing of PPARγ significantly downregulated the expression levels of milk fat synthesis-related genes in DCMECs. PPARγ overexpression improved cell viability, proliferation, and triacylglycerol secretion. The expression levels of milk lipogenic genes were significantly increased when PPARγ was overexpressed. Acetic acid and palmitic acid could markedly improve triacylglycerol synthesis and upregulate the expression levels of PPARγ and other lipogenic genes in DCMECs. These results suggest that PPARγ is a positive regulator of milk fat synthesis in DCMECs and that acetic acid and palmitic acid could partly regulate milk fat synthesis in DCMECs via PPARγ signaling.

  20. Evaluating the involvement and interaction of abscisic acid and miRNA156 in the induction of anthocyanin biosynthesis in drought-stressed plants.

    PubMed

    González-Villagra, Jorge; Kurepin, Leonid V; Reyes-Díaz, Marjorie M

    2017-08-01

    ABA is involved in anthocyanin synthesis through the regulation of microRNA156, augmenting the level of expression of anthocyanin synthesis-related genes and, therefore, increasing anthocyanin level. Drought stress is the main cause of agricultural crop loss in the world. However, plants have developed mechanisms that allow them to tolerate drought stress conditions. At cellular level, drought stress induces changes in metabolite accumulation, including increases in anthocyanin levels due to upregulation of the anthocyanin biosynthetic pathway. Recent studies suggest that the higher anthocyanin content observed under drought stress conditions could be a consequence of a rise in the abscisic acid (ABA) concentration. This plant hormone crosses the plasma membrane by specific transporters, and it is recognized at the cytosolic level by receptors known as pyrabactin resistance (PYR)/regulatory component of ABA receptors (PYR/RCARs) that regulate downstream components. In this review, we discuss the hypothesis regarding the involvement of ABA in the regulation of microRNA156 (miRNA156), which is upregulated as part of dehydration stress responsiveness in different species. The miRNA156 upregulation produces a greater level of anthocyanin gene expression, forming the multienzyme complex that will synthesize an increased level of anthocyanins at the cytosolic face of the rough endoplasmic reticulum (RER). After synthesis, anthocyanins are transported from the RER to the vacuole by two possible models of transport: (1) membrane vesicle-mediated transport, or (2) membrane transporter-mediated transport. Thus, the aim was to analyze the recent findings on synthesis, transport and the possible mechanism by which ABA could increase anthocyanin synthesis under drought stress conditions potentially throughout microRNA156 (miRNA156).

  1. Control of rRNA and tRNA syntheses in Escherichia coli by guanosine tetraphosphate.

    PubMed Central

    Ryals, J; Little, R; Bremer, H

    1982-01-01

    The expression of stable RNA (rRNA and tRNA) genes and the concentration of guanosine tetraphosphate (ppGpp) were measured in an isogenic pair of relA+ and relA derivatives of Escherichia coli B/r. The cells were either growing exponentially at different rates or subject to amino acid starvation when they were measured. The specific stable RNA gene activity (rs/rt, the rate of rRNA and tRNA synthesis relative to the total instantaneous rate of RNA synthesis) was found to decrease from 1.0 at a ppGpp concentration of 0 (extrapolated value) to 0.24 at saturating concentrations of ppGpp (above 100 pmoles per optical density at 460 nm unit of cell mass). The same relationship between the rs/rt ratio and ppGpp concentration was obtained independent of the physiological state of the bacteria (i.e., independent of the growth rate or of amino acid starvation) and independent of the relA allele. It can be concluded that ppGpp is an effector for stable RNA gene control and that stable RNA genes are not controlled by factors other than the ppGpp-mediated system. The results were shown to be qualitatively and quantitatively consistent with data on in vitro rRNA gene control by ppGpp, and they were interpreted in the light of reported ideas derived from those in vitro experiments. PMID:6179924

  2. [RNA-synthesizing activity in the liver of rats after a flight on the Kosmos 1667 biosatellite].

    PubMed

    Makeeva, V F; Komolova, G S

    1987-01-01

    The effect of a short-term flight (7 days) on the RNA synthetic activity in isolated nuclei of the rat liver and its content of nucleic acids was investigated. Postflight the activity of RNA-polymerase, the key enzyme of RNA synthesis, increased. The endogenous synthesis of RNA in nuclei grew, probably, due to the change in the activity of RNA-polymerase. Conversely, the concentration of nucleic acids in the liver tended to decrease. The results obtained give evidence that the changes in the RNA synthetic apparatus of hepatocytes in short-term flights are similar in sign to those seen in long-term flights.

  3. Interaction of TIF-90 and filamin A in the regulation of rRNA synthesis in leukemic cells.

    PubMed

    Nguyen, Le Xuan Truong; Chan, Steven M; Ngo, Tri Duc; Raval, Aparna; Kim, Kyeong Kyu; Majeti, Ravindra; Mitchell, Beverly S

    2014-07-24

    The transcription initiation factor I (TIF-IA) is an important regulator of the synthesis of ribosomal RNA (rRNA) through its facilitation of the recruitment of RNA polymerase I (Pol I) to the ribosomal DNA promoter. Activation of the phosphoinositide 3-kinase (PI3K)/protein kinase B (Akt) pathway, which occurs commonly in acute myelogenous leukemia, enhances rRNA synthesis through TIF-IA stabilization and phosphorylation. We have discovered that TIF-IA coexists with a splicing isoform, TIF-90, which is expressed preferentially in the nucleolus and at higher levels in proliferating and transformed hematopoietic cells. TIF-90 interacts directly with Pol I to increase rRNA synthesis as a consequence of Akt activation. Furthermore, TIF-90 binds preferentially to a 90-kDa cleavage product of the actin binding protein filamin A (FLNA) that inhibits rRNA synthesis. Increased expression of TIF-90 overcomes the inhibitory effect of this cleavage product and stimulates rRNA synthesis. Because activated Akt also reduces FLNA cleavage, these results indicate that activated Akt and TIF-90 function in parallel to increase rRNA synthesis and, as a consequence, cell proliferation in leukemic cells. These results provide evidence that the direct targeting of Akt would be an effective therapy in acute leukemias in which Akt is activated. © 2014 by The American Society of Hematology.

  4. Evolution of Protein Synthesis from an RNA World

    PubMed Central

    Noller, Harry F.

    2012-01-01

    SUMMARY Because of the molecular complexity of the ribosome and protein synthesis, it is a challenge to imagine how translation could have evolved from a primitive RNA World. Two specific suggestions are made here to help to address this, involving separate evolution of the peptidyl transferase and decoding functions. First, it is proposed that translation originally arose not to synthesize functional proteins, but to provide simple (perhaps random) peptides that bound to RNA, increasing its available structure space, and therefore its functional capabilities. Second, it is proposed that the decoding site of the ribosome evolved from a mechanism for duplication of RNA. This process involved homodimeric “duplicator RNAs,” resembling the anticodon arms of tRNAs, which directed ligation of trinucleotides in response to an RNA template. PMID:20610545

  5. Boron Stress Activates the General Amino Acid Control Mechanism and Inhibits Protein Synthesis

    PubMed Central

    Uluisik, Irem; Kaya, Alaattin; Fomenko, Dmitri E.; Karakaya, Huseyin C.; Carlson, Bradley A.; Gladyshev, Vadim N.; Koc, Ahmet

    2011-01-01

    Boron is an essential micronutrient for plants, and it is beneficial for animals. However, at high concentrations boron is toxic to cells although the mechanism of this toxicity is not known. Atr1 has recently been identified as a boron efflux pump whose expression is upregulated in response to boron treatment. Here, we found that the expression of ATR1 is associated with expression of genes involved in amino acid biosynthesis. These mechanisms are strictly controlled by the transcription factor Gcn4 in response to boron treatment. Further analyses have shown that boron impaired protein synthesis by promoting phosphorylation of eIF2α in a Gcn2 kinase dependent manner. The uncharged tRNA binding domain (HisRS) of Gcn2 is necessary for the phosphorylation of eIF2α in the presence of boron. We postulate that boron exerts its toxic effect through activation of the general amino acid control system and inhibition of protein synthesis. Since the general amino acid control pathway is conserved among eukaryotes, this mechanism of boron toxicity may be of general importance. PMID:22114689

  6. Effects of inhibitors on early protein, RNA, and lipid synthesis in germinating vesicular-arbuscular mycorrhizal fungal spores of Glomus caledonium.

    PubMed

    Beilby, J P

    1983-05-01

    The incorporation of isotopically labelled precursors, [1-14C]leucine, [2-14C]uracil and [1-14C]acetate, by germinating spores of the vesicular-arbuscular mycorrhizal fungus Glomus caledonium was investigated after prior incubation with several metabolic inhibitors. Inhibition of isotope incorporation was greatest with ethidium bromide and cycloheximide and least with chloramphenicol and actinomycin D. The incorporation of [1-14C]leucine into protein was reduced by 92% within 60 min of incubation in either ethidium bromide at 5 micrograms/mL or cycloheximide at 100 micrograms/mL. For these studies time zero was coincident with dry quiescent spores being first wet. Lipid synthesis during germination of the spores was detected at 120 min by following the incorporation of [1-14C]acetate. At 51 h, incorporation was greater in the triacylglycerides and diacylglycerides than in the free sterols, phospholipids, or free fatty acid. Spores exposed to cycloheximide for 60 min after imbibition showed very little phospholipid synthesis and no free fatty acid synthesis. The synthesis of RNA after spore imbibition is also discussed.

  7. Energetics of amino acid synthesis in hydrothermal ecosystems

    NASA Technical Reports Server (NTRS)

    Amend, J. P.; Shock, E. L.

    1998-01-01

    Thermodynamic calculations showed that the autotrophic synthesis of all 20 protein-forming amino acids was energetically favored in hot (100 degrees C), moderately reduced, submarine hydrothermal solutions relative to the synthesis in cold (18 degrees C), oxidized, surface seawater. The net synthesis reactions of 11 amino acids were exergonic in the hydrothermal solution, but all were endergonic in surface seawater. The synthesis of the requisite amino acids of nine thermophilic and hyperthermophilic proteins in a 100 degreesC hydrothermal solution yielded between 600 and 8000 kilojoules per mole of protein, which is energy that is available to drive the intracellular synthesis of enzymes and other biopolymers in hyperthermophiles thriving in these ecosystems.

  8. Individual bile acids have differential effects on bile acid signaling in mice

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Song, Peizhen, E-mail: songacad@gmail.com; Rockwell, Cheryl E., E-mail: rockwelc@msu.edu; Cui, Julia Yue, E-mail: juliacui@uw.edu

    2015-02-15

    Bile acids (BAs) are known to regulate BA synthesis and transport by the farnesoid X receptor in the liver (FXR-SHP) and intestine (FXR-Fgf15). However, the relative importance of individual BAs in regulating these processes is not known. Therefore, mice were fed various doses of five individual BAs, including cholic acid (CA), chenodeoxycholic acid (CDCA), deoxoycholic acid (DCA), lithocholic acid (LCA), and ursodeoxycholic acid (UDCA) in their diets at various concentrations for one week to increase the concentration of one BA in the enterohepatic circulation. The mRNA of BA synthesis and transporting genes in liver and ileum were quantified. In themore » liver, the mRNA of SHP, which is the prototypical target gene of FXR, increased in mice fed all concentrations of BAs. In the ileum, the mRNA of the intestinal FXR target gene Fgf15 was increased at lower doses and to a higher extent by CA and DCA than by CDCA and LCA. Cyp7a1, the rate-limiting enzyme in BA synthesis, was decreased more by CA and DCA than CDCA and LCA. Cyp8b1, the enzyme that 12-hydroxylates BAs and is thus responsible for the synthesis of CA, was decreased much more by CA and DCA than CDCA and LCA. Surprisingly, neither a decrease in the conjugated BA uptake transporter (Ntcp) nor increase in BA efflux transporter (Bsep) was observed by FXR activation, but an increase in the cholesterol efflux transporter (Abcg5/Abcg8) was observed with FXR activation. Thus in conclusion, CA and DCA are more potent FXR activators than CDCA and LCA when fed to mice, and thus they are more effective in decreasing the expression of the rate limiting gene in BA synthesis Cyp7a1 and the 12-hydroxylation of BAs Cyp8b1, and are also more effective in increasing the expression of Abcg5/Abcg8, which is responsible for biliary cholesterol excretion. However, feeding BAs do not alter the mRNA or protein levels of Ntcp or Bsep, suggesting that the uptake or efflux of BAs is not regulated by FXR at physiological and

  9. Regulation of Viral RNA Synthesis by the V Protein of Parainfluenza Virus 5

    PubMed Central

    Yang, Yang; Zengel, James; Sun, Minghao; Sleeman, Katrina; Timani, Khalid Amine; Aligo, Jason; Rota, Paul

    2015-01-01

    ABSTRACT Paramyxoviruses include many important animal and human pathogens. The genome of parainfluenza virus 5 (PIV5), a prototypical paramyxovirus, encodes a V protein that inhibits viral RNA synthesis. In this work, the mechanism of inhibition was investigated. Using mutational analysis and a minigenome system, we identified regions in the N and C termini of the V protein that inhibit viral RNA synthesis: one at the very N terminus of V and the second at the C terminus of V. Furthermore, we determined that residues L16 and I17 are critical for the inhibitory function of the N-terminal region of the V protein. Both regions interact with the nucleocapsid protein (NP), an essential component of the viral RNA genome complex (RNP). Mutations at L16 and I17 abolished the interaction between NP and the N-terminal domain of V. This suggests that the interaction between NP and the N-terminal domain plays a critical role in V inhibition of viral RNA synthesis by the N-terminal domain. Both the N- and C-terminal regions inhibited viral RNA replication. The C terminus inhibited viral RNA transcription, while the N-terminal domain enhanced viral RNA transcription, suggesting that the two domains affect viral RNA through different mechanisms. Interestingly, V also inhibited the synthesis of the RNA of other paramyxoviruses, such as Nipah virus (NiV), human parainfluenza virus 3 (HPIV3), measles virus (MeV), mumps virus (MuV), and respiratory syncytial virus (RSV). This suggests that a common host factor may be involved in the replication of these paramyxoviruses. IMPORTANCE We identified two regions of the V protein that interact with NP and determined that one of these regions enhances viral RNA transcription via its interaction with NP. Our data suggest that a common host factor may be involved in the regulation of paramyxovirus replication and could be a target for broad antiviral drug development. Understanding the regulation of paramyxovirus replication will enable the

  10. Inhibition of Dengue Virus RNA Synthesis by an Adenosine Nucleoside ▿ †

    PubMed Central

    Chen, Yen-Liang; Yin, Zheng; Duraiswamy, Jeyaraj; Schul, Wouter; Lim, Chin Chin; Liu, Boping; Xu, Hao Ying; Qing, Min; Yip, Andy; Wang, Gang; Chan, Wai Ling; Tan, Hui Pen; Lo, Melissa; Liung, Sarah; Kondreddi, Ravinder Reddy; Rao, Ranga; Gu, Helen; He, Handan; Keller, Thomas H.; Shi, Pei-Yong

    2010-01-01

    We recently reported that (2R,3R,4R,5R)-2-(4-amino-pyrrolo[2,3-d]pyrimidin-7-yl)-3-ethynyl-5-hydroxy-methyl-tetrahydro-furan-3,4-diol is a potent inhibitor of dengue virus (DENV), with 50% effective concentration (EC50) and cytotoxic concentration (CC50) values of 0.7 μM and >100 μM, respectively. Here we describe the synthesis, structure-activity relationship, and antiviral characterization of the inhibitor. In an AG129 mouse model, a single-dose treatment of DENV-infected mice with the compound suppressed peak viremia and completely prevented death. Mode-of-action analysis using a DENV replicon indicated that the compound blocks viral RNA synthesis. Recombinant adenosine kinase could convert the compound to a monophosphate form. Suppression of host adenosine kinase, using a specific inhibitor (iodotubercidin) or small interfering RNA (siRNA), abolished or reduced the compound's antiviral activity in cell culture. Studies of rats showed that 14C-labeled compound was converted to mono-, di-, and triphosphate metabolites in vivo. Collectively, the results suggest that this adenosine inhibitor is phosphorylated to an active (triphosphate) form which functions as a chain terminator for viral RNA synthesis. PMID:20457821

  11. Identification of cis-acting elements on positive-strand subgenomic mRNA required for the synthesis of negative-strand counterpart in bovine coronavirus.

    PubMed

    Yeh, Po-Yuan; Wu, Hung-Yi

    2014-07-30

    It has been demonstrated that, in addition to genomic RNA, sgmRNA is able to serve as a template for the synthesis of the negative-strand [(-)-strand] complement. However, the cis-acting elements on the positive-strand [(+)-strand] sgmRNA required for (-)-strand sgmRNA synthesis have not yet been systematically identified. In this study, we employed real-time quantitative reverse transcription polymerase chain reaction to analyze the cis-acting elements on bovine coronavirus (BCoV) sgmRNA 7 required for the synthesis of its (-)-strand counterpart by deletion mutagenesis. The major findings are as follows. (1) Deletion of the 5'-terminal leader sequence on sgmRNA 7 decreased the synthesis of the (-)-strand sgmRNA complement. (2) Deletions of the 3' untranslated region (UTR) bulged stem-loop showed no effect on (-)-strand sgmRNA synthesis; however, deletion of the 3' UTR pseudoknot decreased the yield of (-)-strand sgmRNA. (3) Nucleotides positioned from -15 to -34 of the sgmRNA 7 3'-terminal region are required for efficient (-)-strand sgmRNA synthesis. (4) Nucleotide species at the 3'-most position (-1) of sgmRNA 7 is correlated to the efficiency of (-)-strand sgmRNA synthesis. These results together suggest, in principle, that the 5'- and 3'-terminal sequences on sgmRNA 7 harbor cis-acting elements are critical for efficient (-)-strand sgmRNA synthesis in BCoV.

  12. Influence of virgin coconut oil-enriched diet on the transcriptional regulation of fatty acid synthesis and oxidation in rats - a comparative study.

    PubMed

    Arunima, Sakunthala; Rajamohan, Thankappan

    2014-05-28

    The present study was carried out to evaluate the effects of virgin coconut oil (VCO) compared with copra oil, olive oil and sunflower-seed oil on the synthesis and oxidation of fatty acids and the molecular regulation of fatty acid metabolism in normal rats. Male Sprague-Dawley rats were fed the test oils at 8 % for 45 d along with a synthetic diet. Dietary supplementation of VCO decreased tissue lipid levels and reduced the activity of the enzymes involved in lipogenesis, namely acyl CoA carboxylase and fatty acid synthase (FAS) (P< 0·05). Moreover, VCO significantly (P< 0·05) reduced the de novo synthesis of fatty acids by down-regulating the mRNA expression of FAS and its transcription factor, sterol regulatory element-binding protein-1c, compared with the other oils. VCO significantly (P< 0·05) increased the mitochondrial and peroxisomal β-oxidation of fatty acids, which was evident from the increased activities of carnitine palmitoyl transferase I, acyl CoA oxidase and the enzymes involved in mitochondrial β-oxidation; this was accomplished by up-regulating the mRNA expression of PPARα and its target genes involved in fatty acid oxidation. In conclusion, the present results confirmed that supplementation of VCO has beneficial effects on lipid parameters by reducing lipogenesis and enhancing the rate of fatty acid catabolism; this effect was mediated at least in part via PPARα-dependent pathways. Thus, dietary VCO reduces the risk for CHD by beneficially modulating the synthesis and degradation of fatty acids.

  13. Synthesis of amino acids

    DOEpatents

    Davis, J.W. Jr.

    1979-09-21

    A method is described for synthesizing amino acids preceding through novel intermediates of the formulas: R/sub 1/R/sub 2/C(OSOC1)CN, R/sub 1/R/sub 2/C(C1)CN and (R/sub 1/R/sub 2/C(CN)O)/sub 2/SO wherein R/sub 1/ and R/sub 2/ are each selected from hydrogen and monovalent hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  14. Induction of vitellogenin synthesis by estrogen in avian liver: relationship between level of vitellogenin mRNA and vitellogenin synthesis.

    PubMed Central

    Mullinix, K P; Wetekam, W; Deeley, R G; Gordon, J I; Meyers, M; Kent, K A; Goldberger, R F

    1976-01-01

    We have investigated the estrogen-mediated induction of vitellogenin synthesis in rooster liver. We compared the concentrations of vitellogenin messenger RNA (mRNA) in the liver with the concentrations of vitellogenin in the sera of roosters that had recieved various treatments with estrogen. We found no vitellogenin mRNA in the livers of the unstimulated roosters. An initial injection of estrogen was attended by de novo synthesis of vitellogenin mRNA in the liver and accumulation of vitellogenin in the serum. When vitellogenin was no longer present in the serum or liver (the "post-estrogen-serum-negative" state), the liver was found to contain appreciable amounts of vitellogenin mRNA. This mRNA was of the same size as that found in the liver of the rooster actively synthesizing vitellogenin in response to estrogen. Whereas vitellogenin mRNA was in large polysomes in the livers of the roosters actively synthesizing vitellogenin, the vitellogenin mRNA in the liver of the post-estrogen-serum-negative rooster was not associated with polysomes. The possible relevance of these findings to the fact that the rooster responds differently to a primary stimulation with estrogen than to subsequent stimulations is discussed. PMID:1064017

  15. Chromophore-assisted light inactivation of pKi-67 leads to inhibition of ribosomal RNA synthesis.

    PubMed

    Rahmanzadeh, R; Hüttmann, G; Gerdes, J; Scholzen, T

    2007-06-01

    Expression of the nuclear Ki-67 protein (pKi-67) is strongly associated with cell proliferation. For this reason, antibodies against this protein are widely used as prognostic tools for the assessment of cell proliferation in biopsies from cancer patients. Despite this broad application in histopathology, functional evidence for the physiological role of pKi-67 is still missing. Recently, we proposed a function of pKi-67 in the early steps of ribosomal RNA (rRNA) synthesis. Here, we have examined the involvement of pKi-67 in this process by photochemical inhibition using chromophore-assisted light inactivation (CALI). Anti-pKi-67 antibodies were labelled with the fluorochrome fluorescein 5(6)-isothiocyanate and were irradiated after binding to their target protein. Performing CALI in vitro on cell lysates led to specific cross-linking of pKi-67. Moreover, the upstream binding factor (UBF) necessary for rRNA transcription was also partly subjected to cross-link formation, indicating a close spatial proximity of UBF and pKi-67. CALI in living cells, using micro-injected antibody, caused a striking relocalization of UBF from foci within the nucleoli to spots located at the nucleolar rim or within the nucleoplasm. pKi-67-CALI resulted in dramatic inhibition of RNA polymerase I-dependent nucleolar rRNA synthesis, whereas RNA polymerase II-dependent nucleoplasmic RNA synthesis remained almost unaltered. Our data presented here argue for a crucial role of pKi-67 in RNA polymerase I-dependent nucleolar rRNA synthesis.

  16. A mitochondrial locus is necessary for the synthesis of mitochondrial tRNA in the yeast Saccharomyces cerevisiae.

    PubMed Central

    Martin, N C; Underbrink-Lyon, K

    1981-01-01

    We have used a cloned yeast mitochondrial tRNAUCNSer gene as a probe to detect RNA species that are transcripts from this gene in wild-type Saccharomyces cerevisiae and in petite deletion mutants. In RNA from wild-type cells, the tRNA is the most prominent transcript of the gene. In RNA from deletion mutants that retain this gene but have lost other regions of mtDNA, high molecular weight transcripts containing the tRNAUCNSer sequences accumulate but tRNAUCNSer is not made. tRNAUCNSer synthesis can be restored in these mutants when they are mated to other deletion mutants that retain a different portion of the mitochondrial genome. Protein synthesis is not necessary for the restoration, and the restoration is not due to a nuclear effect or to an effect of mating alone, because strains without mtDNA are not able to restore tRNA synthesis. These results definitively demonstrate the existence of a yeast mitochondrial locus that is necessary for tRNA synthesis and, because the restoration of tRNAUCNSer synthesis appears to result from intergenic complementation, not recombination, indicate that this locus acts in trans. Images PMID:6795621

  17. Skeletal muscle plasticity induced by seasonal acclimatization in carp involves differential expression of rRNA and molecules that epigenetically regulate its synthesis.

    PubMed

    Fuentes, Eduardo N; Zuloaga, Rodrigo; Nardocci, Gino; Fernandez de la Reguera, Catalina; Simonet, Nicolas; Fumeron, Robinson; Valdes, Juan Antonio; Molina, Alfredo; Alvarez, Marco

    2014-01-01

    Ribosomal biogenesis controls cellular growth in living organisms, with the rate-limiting step of this process being the transcription of ribosomal DNA (rDNA). Considering that epigenetic mechanisms allow an organism to respond to environmental changes, the expression in muscle of several molecules that regulate epigenetic rRNA synthesis, as well as rDNA transcription, were evaluated during the seasonal acclimatization of the carp. First, the nucleotide sequences encoding the components forming the NoRC (ttf-I, tip5) and eNoSC (sirt1, nml, suv39h1), two chromatin remodeling complexes that silence rRNA synthesis, as well as the sequence of ubf1, a key regulator of rDNA transcription, were obtained. Subsequently the transcriptional regulation of the aforementioned molecules, and other key molecules involved in rRNA synthesis (mh2a1, mh2a2, h2a.z, h2a.z.7, nuc, p80), was assessed. The carp sequences for TTF-I, TIP5, SIRT1, NML, SUV39H1, and UBF1 showed a high conservation of domains and key amino acids in comparison with other fish and higher vertebrates. The mRNA contents in muscle for ttf-I, tip5, sirt1, nml, suv39h1, mh2a1, mh2a.z, and nuc were up-regulated during winter in comparison with summer, whereas the mRNA levels of mh2a2, ubf1, and p80 were down-regulated. Also, the contents of molecules involved in processing the rRNA (snoRNAs) and pRNA, a stabilizer of NoRC complex, were analyzed, finding that these non-coding RNAs were not affected by seasonal acclimatization. These results suggest that variations in the expression of rRNA and the molecules that epigenetically regulate its synthesis are contributing to the muscle plasticity induced by seasonal acclimatization in carp. Copyright © 2014 Elsevier Inc. All rights reserved.

  18. A genetically encoded fluorescent tRNA is active in live-cell protein synthesis

    PubMed Central

    Masuda, Isao; Igarashi, Takao; Sakaguchi, Reiko; Nitharwal, Ram G.; Takase, Ryuichi; Han, Kyu Young; Leslie, Benjamin J.; Liu, Cuiping; Gamper, Howard; Ha, Taekjip; Sanyal, Suparna

    2017-01-01

    Abstract Transfer RNAs (tRNAs) perform essential tasks for all living cells. They are major components of the ribosomal machinery for protein synthesis and they also serve in non-ribosomal pathways for regulation and signaling metabolism. We describe the development of a genetically encoded fluorescent tRNA fusion with the potential for imaging in live Escherichia coli cells. This tRNA fusion carries a Spinach aptamer that becomes fluorescent upon binding of a cell-permeable and non-toxic fluorophore. We show that, despite having a structural framework significantly larger than any natural tRNA species, this fusion is a viable probe for monitoring tRNA stability in a cellular quality control mechanism that degrades structurally damaged tRNA. Importantly, this fusion is active in E. coli live-cell protein synthesis allowing peptidyl transfer at a rate sufficient to support cell growth, indicating that it is accommodated by translating ribosomes. Imaging analysis shows that this fusion and ribosomes are both excluded from the nucleoid, indicating that the fusion and ribosomes are in the cytosol together possibly engaged in protein synthesis. This fusion methodology has the potential for developing new tools for live-cell imaging of tRNA with the unique advantage of both stoichiometric labeling and broader application to all cells amenable to genetic engineering. PMID:27956502

  19. Lipase-catalyzed synthesis of fatty acid amide (erucamide) using fatty acid and urea.

    PubMed

    Awasthi, Neeraj Praphulla; Singh, R P

    2007-01-01

    Ammonolysis of fatty acids to the corresponding fatty acid amides is efficiently catalysed by Candida antartica lipase (Novozym 435). In the present paper lipase-catalysed synthesis of erucamide by ammonolysis of erucic acid and urea in organic solvent medium was studied and optimal conditions for fatty amides synthesis were established. In this process erucic acid gave 88.74 % pure erucamide after 48 hour and 250 rpm at 60 degrees C with 1:4 molar ratio of erucic acid and urea, the organic solvent media is 50 ml tert-butyl alcohol (2-methyl-2-propanol). This process for synthesis is economical as we used urea in place of ammonia or other amidation reactant at atmospheric pressure. The amount of catalyst used is 3 %.

  20. [Lipid synthesis by an acidic acid tolerant Rhodotorula glutinis].

    PubMed

    Lin, Zhangnan; Liu, Hongjuan; Zhang, Jian'an; Wang, Gehua

    2016-03-01

    Acetic acid, as a main by-product generated in the pretreatment process of lignocellulose hydrolysis, significantly affects cell growth and lipid synthesis of oleaginous microorganisms. Therefore, we studied the tolerance of Rhodotorula glutinis to acetic acid and its lipid synthesis from substrate containing acetic acid. In the mixed sugar medium containing 6 g/L glucose and 44 g/L xylose, and supplemented with acetic acid, the cell growth was not:inhibited when the acetic acid concentration was below 10 g/L. Compared with the control, the biomass, lipid concentration and lipid content of R. glutinis increased 21.5%, 171% and 122% respectively when acetic acid concentration was 10 g/L. Furthermore, R. glutinis could accumulate lipid with acetate as the sole carbon source. Lipid concentration and lipid yield reached 3.20 g/L and 13% respectively with the initial acetic acid concentration of 25 g/L. The lipid composition was analyzed by gas chromatograph. The main composition of lipid produced with acetic acid was palmitic acid, stearic acid, oleic acid, linoleic acid and linolenic acid, including 40.9% saturated fatty acids and 59.1% unsaturated fatty acids. The lipid composition was similar to that of plant oil, indicating that lipid from oleaginous yeast R. glutinis had potential as the feedstock of biodiesel production. These results demonstrated that a certain concentration of acetic acid need not to be removed in the detoxification process when using lignocelluloses hydrolysate to produce microbial lipid by R. glutinis.

  1. Asphalt, water, and the prebiotic synthesis of ribose, ribonucleosides, and RNA.

    PubMed

    Benner, Steven A; Kim, Hyo-Joong; Carrigan, Matthew A

    2012-12-18

    RNA has been called a "prebiotic chemist's nightmare" because of its combination of large size, carbohydrate building blocks, bonds that are thermodynamically unstable in water, and overall intrinsic instability. However, a discontinuous synthesis model is well-supported by experimental work that might produce RNA from atmospheric CO(2), H(2)O, and N(2). For example, electrical discharge in such atmospheres gives formaldehyde (HCHO) in large amounts and glycolaldehyde (HOCH(2)CHO) in small amounts. When rained into alkaline aquifers generated by serpentinizing rocks, these substances were undoubtedly converted to carbohydrates including ribose. Likewise, atmospherically generated HCN was undoubtedly converted in these aquifers to formamide and ammonium formate, precursors for RNA nucleobases. Finally, high reduction potentials maintained by mantle-derived rocks and minerals would allow phosphite to be present in equilibrium with phosphate, mobilizing otherwise insoluble phosphorus for the prebiotic synthesis of phosphite and phosphate esters after oxidation. So why does the community not view this discontinuous synthesis model as compelling evidence for the RNA-first hypothesis for the origin of life? In part, the model is deficient because no experiments have joined together those steps without human intervention. Further, many steps in the model have problems. Some are successful only if reactive compounds are presented in a specific order in large amounts. Failing controlled addition, the result produces complex mixtures that are inauspicious precursors for biology, a situation described as the "asphalt problem". Many bonds in RNA are thermodynamically unstable with respect to hydrolysis in water, creating a "water problem". Finally, some bonds in RNA appear to be "impossible" to form under any conditions considered plausible for early Earth. To get a community-acceptable "RNA first" model for the origin of life, the discontinuous synthesis model must be

  2. Transcription of exogenous and endogenous deoxyribonucleic acid templates in cold-shocked Bacillus subtilis.

    PubMed Central

    Kuhl, S J; Brown, L R

    1980-01-01

    Ribonucleic acid (RNA) synthesis was examined in cold-shocked Bacillus subtilis cells. The cells were grown to mid-log stage, harvested, and cold shocked. RNA synthesis was monitored by the incorporation of [3H]uridine triphosphate or [alpha 32P]adenosine triphosphate into trichloroacetic acid-precipitable material in the presence of all four nucleoside triphosphates. The inhibition of RNA synthesis in cold-shocked cells by lipiarmycin, ethidium bromide, rifampin. or streptolydigin was analyzed using mutant or wild-type cells. Also examined were the effects of temperature, salt concentration, and the addition of polyamines or highly phosphorylated nucleotides. In ultraviolet-irradiated and cold-shocked cells, RNA wynthesis decreased to low levels. The addition of exogenous phi 29 or TSP-1 template to these cells caused a 13- to 20-fold increase in RNA synthesis, as monitored by trichloroacetic acid-precipitable counts. RNA synthesized in the presence of phi 29 deoxyribonucleic acid (DNA) hybridizes mainly to EcoRI fragments A and C of phi 29 DBA, These two fragments direct transcription by purified RNA polymerase in vitro and hybridize to early phi 29 DNA produced in vivo. Our results with TSP-1 DNA in this system indicated that the RNA produced hybridizes to the same fragments as early RNA produced in vivo. Plasmic pUB110 DNA was not transcribed in this system. Images PMID:6157674

  3. The Battle of RNA Synthesis: Virus versus Host.

    PubMed

    Harwig, Alex; Landick, Robert; Berkhout, Ben

    2017-10-21

    Transcription control is the foundation of gene regulation. Whereas a cell is fully equipped for this task, viruses often depend on the host to supply tools for their transcription program. Over the course of evolution and adaptation, viruses have found diverse ways to optimally exploit cellular host processes such as transcription to their own benefit. Just as cells are increasingly understood to employ nascent RNAs in transcription regulation, recent discoveries are revealing how viruses use nascent RNAs to benefit their own gene expression. In this review, we first outline the two different transcription programs used by viruses, i.e., transcription (DNA-dependent) and RNA-dependent RNA synthesis. Subsequently, we use the distinct stages (initiation, elongation, termination) to describe the latest insights into nascent RNA-mediated regulation in the context of each relevant stage.

  4. Genome-wide mRNA processing in methanogenic archaea reveals post-transcriptional regulation of ribosomal protein synthesis.

    PubMed

    Qi, Lei; Yue, Lei; Feng, Deqin; Qi, Fengxia; Li, Jie; Dong, Xiuzhu

    2017-07-07

    Unlike stable RNAs that require processing for maturation, prokaryotic cellular mRNAs generally follow an 'all-or-none' pattern. Herein, we used a 5΄ monophosphate transcript sequencing (5΄P-seq) that specifically captured the 5΄-end of processed transcripts and mapped the genome-wide RNA processing sites (PSSs) in a methanogenic archaeon. Following statistical analysis and stringent filtration, we identified 1429 PSSs, among which 23.5% and 5.4% were located in 5΄ untranslated region (uPSS) and intergenic region (iPSS), respectively. A predominant uridine downstream PSSs served as a processing signature. Remarkably, 5΄P-seq detected overrepresented uPSS and iPSS in the polycistronic operons encoding ribosomal proteins, and the majority upstream and proximal ribosome binding sites, suggesting a regulatory role of processing on translation initiation. The processed transcripts showed increased stability and translation efficiency. Particularly, processing within the tricistronic transcript of rplA-rplJ-rplL enhanced the translation of rplL, which can provide a driving force for the 1:4 stoichiometry of L10 to L12 in the ribosome. Growth-associated mRNA processing intensities were also correlated with the cellular ribosomal protein levels, thereby suggesting that mRNA processing is involved in tuning growth-dependent ribosome synthesis. In conclusion, our findings suggest that mRNA processing-mediated post-transcriptional regulation is a potential mechanism of ribosomal protein synthesis and stoichiometry. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. Increased Long Chain acyl-Coa Synthetase Activity and Fatty Acid Import Is Linked to Membrane Synthesis for Development of Picornavirus Replication Organelles

    PubMed Central

    Scott, Alison J.; Ford, Lauren A.; Pei, Zhengtong; Watkins, Paul A.; Ernst, Robert K.; Belov, George A.

    2013-01-01

    All positive strand (+RNA) viruses of eukaryotes replicate their genomes in association with membranes. The mechanisms of membrane remodeling in infected cells represent attractive targets for designing future therapeutics, but our understanding of this process is very limited. Elements of autophagy and/or the secretory pathway were proposed to be hijacked for building of picornavirus replication organelles. However, even closely related viruses differ significantly in their requirements for components of these pathways. We demonstrate here that infection with diverse picornaviruses rapidly activates import of long chain fatty acids. While in non-infected cells the imported fatty acids are channeled to lipid droplets, in infected cells the synthesis of neutral lipids is shut down and the fatty acids are utilized in highly up-regulated phosphatidylcholine synthesis. Thus the replication organelles are likely built from de novo synthesized membrane material, rather than from the remodeled pre-existing membranes. We show that activation of fatty acid import is linked to the up-regulation of cellular long chain acyl-CoA synthetase activity and identify the long chain acyl-CoA syntheatse3 (Acsl3) as a novel host factor required for polio replication. Poliovirus protein 2A is required to trigger the activation of import of fatty acids independent of its protease activity. Shift in fatty acid import preferences by infected cells results in synthesis of phosphatidylcholines different from those in uninfected cells, arguing that the viral replication organelles possess unique properties compared to the pre-existing membranes. Our data show how poliovirus can change the overall cellular membrane homeostasis by targeting one critical process. They explain earlier observations of increased phospholipid synthesis in infected cells and suggest a simple model of the structural development of the membranous scaffold of replication complexes of picorna-like viruses, that may be

  6. Valproate induced hepatic steatosis by enhanced fatty acid uptake and triglyceride synthesis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bai, Xupeng; Hong, Weipeng; Cai, Peiheng

    Steatosis is the characteristic type of VPA-induced hepatotoxicity and may result in life-threatening hepatic lesion. Approximately 61% of patients treated with VPA have been diagnosed with hepatic steatosis through ultrasound examination. However, the mechanisms underlying VPA-induced intracellular fat accumulation are not yet fully understood. Here we demonstrated the involvement of fatty acid uptake and lipogenesis in VPA-induced hepatic steatosis in vitro and in vivo by using quantitative real-time PCR (qRT-PCR) analysis, western blotting analysis, fatty acid uptake assays, Nile Red staining assays, and Oil Red O staining assays. Specifically, we found that the expression of cluster of differentiation 36 (CD36),more » an important fatty acid transport, and diacylglycerol acyltransferase 2 (DGAT2) were significantly up-regulated in HepG2 cells and livers of C57B/6J mice after treatment with VPA. Furthermore, VPA treatment remarkably enhanced the efficiency of fatty acid uptake mediated by CD36, while this effect was abolished by the interference with CD36-specific siRNA. Also, VPA treatment significantly increased DGAT2 expression as a result of the inhibition of mitogen-activated protein kinase kinase (MEK) – extracellular regulated kinase (ERK) pathway; however, DGAT2 knockdown significantly alleviated VPA-induced intracellular lipid accumulation. Additionally, we also found that sterol regulatory element binding protein-1c (SREBP-1c)-mediated fatty acid synthesis may be not involved in VPA-induced hepatic steatosis. Overall, VPA-triggered over-regulation of CD36 and DGAT2 could be helpful for a better understanding of the mechanisms underlying VPA-induced hepatic steatosis and may offer novel therapeutic strategies to combat VPA-induced hepatotoxicity. - Highlights: • VPA induced hepatic steatosis and modulated genes associated with lipid metabolism. • CD36-mediated fatty acid uptake contributed to VPA-induced lipid accumulation. • PA increased the

  7. The Prebiotic Synthesis of Ethylenediamine Monoacetic Acid, The Repeating Unit of Peptide Nucleic Acids

    NASA Technical Reports Server (NTRS)

    Nelson, Kevin E.; Miller, Stanley L.

    1992-01-01

    The polymerization of ribonucleic acids or their precursors constitutes an important event in prebiotic chemistry. The various problems using ribonucleotides to make RNA suggest that there may have been a precursor. An attractive possibility are the peptide nucleic acids (PNA). PNAs are nucleotide analogs that make use of a polymer of ethylenediamine monoacetic acid (EDMA or 2-amninoethyl glycine) with the bases attached by an acetic acid. EDMA is an especially attractive alternative to the ribose phosphate or deoxyribose phosphate backbone because it contains no chiral centers and is potentially prebiotic, but there is no reported prebiotic synthesis. We have synthesized both EDMA and ethylenediamine diacetic acid (EDDA) from the prebiotic compounds ethylenediamine, formaldehyde, and hydrogen cyanide. The yields of EDMA range from 11 to 79% along with some sEDDA and uEDDA. These reactions work with concentrations of 10(exp -1)M and as low as 10(exp -4)M, and the reaction is likely to be effective at even lower concentrations. Ethylenediamine is a likely prebiotic compound, but it has not yet been demonstrated, although compounds such as ethanolamine and cysteamine have been proven to be prebiotic. Under neutral pH and heating at l00 C, EDMA is converted to the lactam, monoketopiperazine (MKP). The cyclization occurs and has an approximate ratio of MKP/EDMA = 3 at equilibrium. We have measured the solubilities of EDMA center dot H20 as 6.4 m, EDMA center dot HCl center dot H20 as 13.7 m, and EDMA center dot 2HCl center dot H20 as 3.4 m. These syntheses together with the high solubility of EDMA suggest that EDMA would concentrate in drying lagoons and might efficiently form polymers. Given the instability of ribose and the poor polymerizability of nucleotides, the prebiotic presence of EDMA and the possibility of its polymerization raises the possibility that PNAs are the progenitors of present day nucleic acids. A pre-RNA world may have existed in which PNAs or

  8. Identification of antisense nucleic acid hybridization sites in mRNA molecules with self-quenching fluorescent reporter molecules

    PubMed Central

    Gifford, Lida K.; Opalinska, Joanna B.; Jordan, David; Pattanayak, Vikram; Greenham, Paul; Kalota, Anna; Robbins, Michelle; Vernovsky, Kathy; Rodriguez, Lesbeth C.; Do, Bao T.; Lu, Ponzy; Gewirtz, Alan M.

    2005-01-01

    We describe a physical mRNA mapping strategy employing fluorescent self-quenching reporter molecules (SQRMs) that facilitates the identification of mRNA sequence accessible for hybridization with antisense nucleic acids in vitro and in vivo, real time. SQRMs are 20–30 base oligodeoxynucleotides with 5–6 bp complementary ends to which a 5′ fluorophore and 3′ quenching group are attached. Alone, the SQRM complementary ends form a stem that holds the fluorophore and quencher in contact. When the SQRM forms base pairs with its target, the structure separates the fluorophore from the quencher. This event can be reported by fluorescence emission when the fluorophore is excited. The stem–loop of the SQRM suggests that SQRM be made to target natural stem–loop structures formed during mRNA synthesis. The general utility of this method is demonstrated by SQRM identification of targetable sequence within c-myb and bcl-6 mRNA. Corresponding antisense oligonucleotides reduce these gene products in cells. PMID:15718294

  9. Photolithographic Synthesis of High-Density DNA and RNA Arrays on Flexible, Transparent, and Easily Subdivided Plastic Substrates.

    PubMed

    Holden, Matthew T; Carter, Matthew C D; Wu, Cheng-Hsien; Wolfer, Jamison; Codner, Eric; Sussman, Michael R; Lynn, David M; Smith, Lloyd M

    2015-11-17

    The photolithographic fabrication of high-density DNA and RNA arrays on flexible and transparent plastic substrates is reported. The substrates are thin sheets of poly(ethylene terephthalate) (PET) coated with cross-linked polymer multilayers that present hydroxyl groups suitable for conventional phosphoramidite-based nucleic acid synthesis. We demonstrate that by modifying array synthesis procedures to accommodate the physical and chemical properties of these materials, it is possible to synthesize plastic-backed oligonucleotide arrays with feature sizes as small as 14 μm × 14 μm and feature densities in excess of 125 000/cm(2), similar to specifications attainable using rigid substrates such as glass or glassy carbon. These plastic-backed arrays are tolerant to a wide range of hybridization temperatures, and improved synthetic procedures are described that enable the fabrication of arrays with sequences up to 50 nucleotides in length. These arrays hybridize with S/N ratios comparable to those fabricated on otherwise identical arrays prepared on glass or glassy carbon. This platform supports the enzymatic synthesis of RNA arrays and proof-of-concept experiments are presented showing that the arrays can be readily subdivided into smaller arrays (or "millichips") using common laboratory-scale laser cutting tools. These results expand the utility of oligonucleotide arrays fabricated on plastic substrates and open the door to new applications for these important bioanalytical tools.

  10. relA-dependent RNA polymerase activity in Escherichia coli.

    PubMed Central

    Ryals, J; Bremer, H

    1982-01-01

    Parameters relating to RNA synthesis were measured after a temperature shift from 30 to 42 degrees C, in a relA+ and relA- isogenic pair of Escherichia coli strains containing a temperature-sensitive valyl tRNA synthetase. The following results were obtained: (i) the rRNA chain growth rate increased 2-fold in both strains; (ii) newly synthesized rRNA became unstable in both strains; (iii) the stable RNA gene activity (rRNA and tRNA, measured as stable RNA synthesis rate relative to the total instantaneous rate of RNA synthesis) decreased 1.7-fold in the relA+ strain and increased 1.9-fold in the relA mutant; and (iv) the RNA polymerase activity (measured by the percentage of total RNA polymerase enzyme active in transcription an any instant) decreased from 20 to 3.6% in the relA+ strain and remained unchanged (or increased at most to 22%) in the relA mutant. It is suggested that both rRNA gene activity and the RNA polymerase activity depend on the intracellular concentration of guanosine tetraphosphate, whereas the altered chain elongation rate and stability of rRNA are temperature or amino acid starvation effects, respectively, without involvement of relA function. PMID:6174501

  11. In Vitro Synthesis of Minus-Strand RNA by an Isolated Cereal Yellow Dwarf Virus RNA-Dependent RNA Polymerase Requires VPg and a Stem-Loop Structure at the 3′ End of the Virus RNA▿

    PubMed Central

    Osman, Toba A. M.; Coutts, Robert H. A.; Buck, Kenneth W.

    2006-01-01

    Cereal yellow dwarf virus (CYDV) RNA has a 5′-terminal genome-linked protein (VPg). We have expressed the VPg region of the CYDV genome in bacteria and used the purified protein (bVPg) to raise an antiserum which was able to detect free VPg in extracts of CYDV-infected oat plants. A template-dependent RNA-dependent RNA polymerase (RdRp) has been produced from a CYDV membrane-bound RNA polymerase by treatment with BAL 31 nuclease. The RdRp was template specific, being able to utilize templates from CYDV plus- and minus-strand RNAs but not those of three unrelated viruses, Red clover necrotic mosaic virus, Cucumber mosaic virus, and Tobacco mosaic virus. RNA synthesis catalyzed by the RdRp required a 3′-terminal GU sequence and the presence of bVPg. Additionally, synthesis of minus-strand RNA on a plus-strand RNA template required the presence of a putative stem-loop structure near the 3′ terminus of CYDV RNA. The base-paired stem, a single-nucleotide (A) bulge in the stem, and the sequence of a tetraloop were all required for the template activity. Evidence was produced showing that minus-strand synthesis in vitro was initiated by priming by bVPg at the 3′ end of the template. The data are consistent with a model in which the RdRp binds to the stem-loop structure which positions the active site to recognize the 3′-terminal GU sequence for initiation of RNA synthesis by the addition of an A residue to VPg. PMID:16928757

  12. Increased GAD67 mRNA levels are correlated with in vivo GABA synthesis in the MPTP-treated catecholamine-depleted goldfish brain.

    PubMed

    Hibbert, Benjamin; Fung, Irene; McAuley, Rebecca; Larivière, Katherine; MacNeil, Brian; Bafi-Yeboa, Nana; Livesey, John; Trudeau, Vance

    2004-09-28

    The role of catecholamine neuronal input on GABAergic activity in the hypothalamus, telencephalon, optic tectum, and cerebellum was investigated in early recrudescent female goldfish (Carassius auratus). A new quantitative technique was developed and validated, permitting concomitant quantification and correlational analysis of glutamic acid decarboxylase 65 (GAD65), GAD67, and GAD3 mRNA levels and in vivo GABA synthesis. Catecholamine depletion was achieved by the administration of 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP; 50 microg/g body weight) and dopamine (DA) depletion verified by HPLC. Endogenous GABA levels were increased by intraperitoneal administration of gamma-vinyl GABA (GVG; 300 microg/g body weight), an inhibitor of the GABA catabolic enzyme GABA transaminase. Treatment with MPTP resulted in a greater than twofold increase in GABA synthesis rate in the optic tectum and telencephalon. The increase in GABA synthesis rate was highly correlated with an increase in GAD67, but not GAD65 or GAD3 mRNA levels. These results suggest that catecholaminergic input exerts inhibitory effects on GABA synthesis rates through the modulation of GAD67 in the optic tectum and telencephalon. Together with previously published observations in rodents and primates, it is suggested that catecholaminergic control of GABA synthesis must have evolved more than 200 million years ago, before the emergence of the teleost fishes.

  13. Functional expansion of human tRNA synthetases achieved by structural inventions

    PubMed Central

    Guo, Min; Schimmel, Paul; Yang, Xiang-Lei

    2010-01-01

    Known as an essential component of the translational apparatus, the aminoacyl-tRNA synthetase family catalyzes the first step reaction in protein synthesis, that is, to specifically attach each amino acid to its cognate tRNA. While preserving this essential role, tRNA synthetases developed other roles during evolution. Human tRNA synthetases, in particular, have diverse functions in different pathways involving angiogenesis, inflammation and apoptosis. The functional diversity is further illustrated in the association with various diseases through genetic mutations that do not affect aminoacylation or protein synthesis. Here we review the accumulated knowledge on how human tRNA synthetases used structural inventions to achieve functional expansions. PMID:19932696

  14. Synthesis of capped RNA using a DMT group as a purification handle.

    PubMed

    Veliath, Elizabeth; Gaffney, Barbara L; Jones, Roger A

    2014-01-01

    We report a new method for synthesis of capped RNA or 2'-OMe RNA that uses a N(2-)4,4'-dimethoxytrityl (DMT) group as a lipophilic purification handle to allow convenient isolation and purification of the capped RNA. The DMT group is easily removed under mild conditions without degradation of the cap. We have used this approach to prepare capped 10- and 20-mers. This method is compatible with the many condensation reactions that have been reported for preparation of capped RNA or cap analogues.

  15. Catalysis of the Carbonylation of Alcohols to Carboxylic Acids Including Acetic Acid Synthesis from Methanol.

    ERIC Educational Resources Information Center

    Forster, Denis; DeKleva, Thomas W.

    1986-01-01

    Monsanto's highly successful synthesis of acetic acid from methanol and carbon monoxide illustrates use of new starting materials to replace pretroleum-derived ethylene. Outlines the fundamental aspects of the acetic acid process and suggests ways of extending the synthesis to higher carboxylic acids. (JN)

  16. Current Research on Non-Coding Ribonucleic Acid (RNA).

    PubMed

    Wang, Jing; Samuels, David C; Zhao, Shilin; Xiang, Yu; Zhao, Ying-Yong; Guo, Yan

    2017-12-05

    Non-coding ribonucleic acid (RNA) has without a doubt captured the interest of biomedical researchers. The ability to screen the entire human genome with high-throughput sequencing technology has greatly enhanced the identification, annotation and prediction of the functionality of non-coding RNAs. In this review, we discuss the current landscape of non-coding RNA research and quantitative analysis. Non-coding RNA will be categorized into two major groups by size: long non-coding RNAs and small RNAs. In long non-coding RNA, we discuss regular long non-coding RNA, pseudogenes and circular RNA. In small RNA, we discuss miRNA, transfer RNA, piwi-interacting RNA, small nucleolar RNA, small nuclear RNA, Y RNA, single recognition particle RNA, and 7SK RNA. We elaborate on the origin, detection method, and potential association with disease, putative functional mechanisms, and public resources for these non-coding RNAs. We aim to provide readers with a complete overview of non-coding RNAs and incite additional interest in non-coding RNA research.

  17. Base modifications affecting RNA polymerase and reverse transcriptase fidelity.

    PubMed

    Potapov, Vladimir; Fu, Xiaoqing; Dai, Nan; Corrêa, Ivan R; Tanner, Nathan A; Ong, Jennifer L

    2018-06-20

    Ribonucleic acid (RNA) is capable of hosting a variety of chemically diverse modifications, in both naturally-occurring post-transcriptional modifications and artificial chemical modifications used to expand the functionality of RNA. However, few studies have addressed how base modifications affect RNA polymerase and reverse transcriptase activity and fidelity. Here, we describe the fidelity of RNA synthesis and reverse transcription of modified ribonucleotides using an assay based on Pacific Biosciences Single Molecule Real-Time sequencing. Several modified bases, including methylated (m6A, m5C and m5U), hydroxymethylated (hm5U) and isomeric bases (pseudouridine), were examined. By comparing each modified base to the equivalent unmodified RNA base, we can determine how the modification affected cumulative RNA polymerase and reverse transcriptase fidelity. 5-hydroxymethyluridine and N6-methyladenosine both increased the combined error rate of T7 RNA polymerase and reverse transcriptases, while pseudouridine specifically increased the error rate of RNA synthesis by T7 RNA polymerase. In addition, we examined the frequency, mutational spectrum and sequence context of reverse transcription errors on DNA templates from an analysis of second strand DNA synthesis.

  18. Synthesis, Improved Antisense Activity and Structural Rationale for the Divergent RNA Affinities of 3;#8242;-Fluoro Hexitol Nucleic Acid (FHNA and Ara-FHNA) Modified Oligonucleotides

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Egli, Martin; Pallan, Pradeep S.; Allerson, Charles R.

    The synthesis, biophysical, structural, and biological properties of both isomers of 3'-fluoro hexitol nucleic acid (FHNA and Ara-FHNA) modified oligonucleotides are reported. Synthesis of the FHNA and Ara-FHNA thymine phosphoramidites was efficiently accomplished starting from known sugar precursors. Optimal RNA affinities were observed with a 3'-fluorine atom and nucleobase in a trans-diaxial orientation. The Ara-FHNA analog with an equatorial fluorine was found to be destabilizing. However, the magnitude of destabilization was sequence-dependent. Thus, the loss of stability is sharply reduced when Ara-FHNA residues were inserted at pyrimidine-purine (Py-Pu) steps compared to placement within a stretch of pyrimidines (Py-Py). Crystal structuresmore » of A-type DNA duplexes modified with either monomer provide a rationalization for the opposing stability effects and point to a steric origin of the destabilization caused by the Ara-FHNA analog. The sequence dependent effect can be explained by the formation of an internucleotide C-F {hor_ellipsis} H-C pseudo hydrogen bond between F3' of Ara-FHNA and C8-H of the nucleobase from the 3'-adjacent adenosine that is absent at Py-Py steps. In animal experiments, FHNA-modified antisense oligonucleotides formulated in saline showed a potent downregulation of gene expression in liver tissue without producing hepatotoxicity. Our data establish FHNA as a useful modification for antisense therapeutics and also confirm the stabilizing influence of F(Py) {hor_ellipsis} H-C(Pu) pseudo hydrogen bonds in nucleic acid structures.« less

  19. Role of fatty-acid synthesis in dendritic cell generation and function.

    PubMed

    Rehman, Adeel; Hemmert, Keith C; Ochi, Atsuo; Jamal, Mohsin; Henning, Justin R; Barilla, Rocky; Quesada, Juan P; Zambirinis, Constantinos P; Tang, Kerry; Ego-Osuala, Melvin; Rao, Raghavendra S; Greco, Stephanie; Deutsch, Michael; Narayan, Suchithra; Pachter, H Leon; Graffeo, Christopher S; Acehan, Devrim; Miller, George

    2013-05-01

    Dendritic cells (DC) are professional APCs that regulate innate and adaptive immunity. The role of fatty-acid synthesis in DC development and function is uncertain. We found that blockade of fatty-acid synthesis markedly decreases dendropoiesis in the liver and in primary and secondary lymphoid organs in mice. Human DC development from PBMC precursors was also diminished by blockade of fatty-acid synthesis. This was associated with higher rates of apoptosis in precursor cells and increased expression of cleaved caspase-3 and BCL-xL and downregulation of cyclin B1. Further, blockade of fatty-acid synthesis decreased DC expression of MHC class II, ICAM-1, B7-1, and B7-2 but increased their production of selected proinflammatory cytokines including IL-12 and MCP-1. Accordingly, inhibition of fatty-acid synthesis enhanced DC capacity to activate allogeneic as well as Ag-restricted CD4(+) and CD8(+) T cells and induce CTL responses. Further, blockade of fatty-acid synthesis increased DC expression of Notch ligands and enhanced their ability to activate NK cell immune phenotype and IFN-γ production. Because endoplasmic reticulum (ER) stress can augment the immunogenic function of APC, we postulated that this may account for the higher DC immunogenicity. We found that inhibition of fatty-acid synthesis resulted in elevated expression of numerous markers of ER stress in humans and mice and was associated with increased MAPK and Akt signaling. Further, lowering ER stress by 4-phenylbutyrate mitigated the enhanced immune stimulation associated with fatty-acid synthesis blockade. Our findings elucidate the role of fatty-acid synthesis in DC development and function and have implications to the design of DC vaccines for immunotherapy.

  20. Solid-Phase Synthesis of RNA Analogs Containing Phosphorodithioate Linkages.

    PubMed

    Yang, Xianbin

    2017-09-18

    The oligoribonucleotide phosphorodithioate (PS2-RNA) modification uses two sulfur atoms to replace two non-bridging oxygen atoms at an internucleotide phosphorodiester backbone linkage. Like a natural phosphodiester RNA backbone linkage, a PS2-modified backbone linkage is achiral at phosphorus. PS2-RNAs are highly stable to nucleases and several in vitro assays have demonstrated their biological activity. For example, PS2-RNAs silenced mRNA in vitro and bound to protein targets in the form of PS2-aptamers (thioaptamers). Thus, the interest in and promise of PS2-RNAs has drawn attention to synthesizing, isolating, and characterizing these compounds. RNA-thiophosphoramidite monomers are commercially available from AM Biotechnologies and this unit describes an effective methodology for solid-phase synthesis, deprotection, and purification of RNAs having PS2 internucleotide linkages. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.

  1. Template switching between PNA and RNA oligonucleotides

    NASA Technical Reports Server (NTRS)

    Bohler, C.; Nielsen, P. E.; Orgel, L. E.; Miller, S. L. (Principal Investigator)

    1995-01-01

    The origin of the RNA world is not easily understood, as effective prebiotic syntheses of the components of RNA, the beta-ribofuranoside-5'-phosphates, are hard to envisage. Recognition of this difficulty has led to the proposal that other genetic systems, the components of which are more easily formed, may have preceded RNA. This raises the question of how transitions between one genetic system and another could occur. Peptide nucleic acid (PNA) resembles RNA in its ability to form double-helical complexes stabilized by Watson-Crick hydrogen bonding between adenine and thymine and between cytosine and guanine, but has a backbone that is held together by amide rather than by phosphodiester bonds. Oligonucleotides bases on RNA are known to act as templates that catalyse the non-enzymatic synthesis of their complements from activated mononucleotides, we now show that RNA oligonucleotides facilitate the synthesis of complementary PNA strands and vice versa. This suggests that a transition between different genetic systems can occur without loss of information.

  2. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  3. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  4. Quantitative identification of proteins that influence miRNA biogenesis by RNA pull-down-SILAC mass spectrometry (RP-SMS).

    PubMed

    Choudhury, Nila Roy; Michlewski, Gracjan

    2018-06-08

    RNA-binding proteins mediate and control gene expression. As some examples, they regulate pre-mRNA synthesis and processing; mRNA localisation, translation and decay; and microRNA (miRNA) biogenesis and function. Here, we present a detailed protocol for RNA pull-down coupled to stable isotope labelling by amino acids in cell culture (SILAC) mass spectrometry (RP-SMS) that enables quantitative, fast and specific detection of RNA-binding proteins that regulate miRNA biogenesis. In general, this method allows for the identification of RNA-protein complexes formed using in vitro or chemically synthesized RNAs and protein extracts derived from cultured cells. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

  5. Synthesis of new kojic acid based unnatural α-amino acid derivatives.

    PubMed

    Balakrishna, C; Payili, Nagaraju; Yennam, Satyanarayana; Uma Devi, P; Behera, Manoranjan

    2015-11-01

    An efficient method for the preparation of kojic acid based α-amino acid derivatives by alkylation of glycinate schiff base with bromokojic acids have been described. Using this method, mono as well as di alkylated kojic acid-amino acid conjugates have been prepared. This is the first synthesis of C-linked kojic acid-amino acid conjugate where kojic acid is directly linked to amino acid through a C-C bond. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. Primordial soup or vinaigrette: did the RNA world evolve at acidic pH?

    PubMed Central

    2012-01-01

    Background The RNA world concept has wide, though certainly not unanimous, support within the origin-of-life scientific community. One view is that life may have emerged as early as the Hadean Eon 4.3-3.8 billion years ago with an atmosphere of high CO2 producing an acidic ocean of the order of pH 3.5-6. Compatible with this scenario is the intriguing proposal that life arose within alkaline (pH 9-11) deep-sea hydrothermal vents like those of the 'Lost City', with the interface with the acidic ocean creating a proton gradient sufficient to drive the first metabolism. However, RNA is most stable at pH 4-5 and is unstable at alkaline pH, raising the possibility that RNA may have first arisen in the acidic ocean itself (possibly near an acidic hydrothermal vent), acidic volcanic lake or comet pond. As the Hadean Eon progressed, the ocean pH is inferred to have gradually risen to near neutral as atmospheric CO2 levels decreased. Presentation of the hypothesis We propose that RNA is well suited for a world evolving at acidic pH. This is supported by the enhanced stability at acidic pH of not only the RNA phosphodiester bond but also of the aminoacyl-(t)RNA and peptide bonds. Examples of in vitro-selected ribozymes with activities at acid pH have recently been documented. The subsequent transition to a DNA genome could have been partly driven by the gradual rise in ocean pH, since DNA has greater stability than RNA at alkaline pH, but not at acidic pH. Testing the hypothesis We have proposed mechanisms for two key RNA world activities that are compatible with an acidic milieu: (i) non-enzymatic RNA replication of a hemi-protonated cytosine-rich oligonucleotide, and (ii) specific aminoacylation of tRNA/hairpins through triple helix interactions between the helical aminoacyl stem and a single-stranded aminoacylating ribozyme. Implications of the hypothesis Our hypothesis casts doubt on the hypothesis that RNA evolved in the vicinity of alkaline hydrothermal vents. The

  7. Synthesis of 4'-Selenoribonucleosides, the Building Blocks of 4'-SelenoRNA, Using a Hypervalent Iodine.

    PubMed

    Saito-Tarashima, Noriko; Ota, Masashi; Minakawa, Noriaki

    2017-09-18

    Herein is described a detailed protocol for the synthesis of 4'-selenoribonucleoside derivatives that involves the use of a hypervalent iodine species. These derivatives are versatile units for the preparation of 4'-selenoRNA. Large-scale synthesis of a 4-selenosugar starting from D-ribose is achieved in eight steps, including a final chromatographic purification. The resulting 4-selenosugar is then subjected to the one-pot Pummerer-like reaction using hypervalent iodine in the presence of silylated nucleobases. The reaction with silylated uracil affords the desired 4'-selenouridine derivatives with excellent β-selectivity and in good yield. Conversely, when purine nucleobases are used in the Pummerer-like reaction, N7 4'-selenoribonucleoside isomers are obtained alongside the desired N9 isomers. However, the undesired N7 isomers can be converted to the desired N9 ones under acidic conditions. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.

  8. MXD1 localizes in the nucleolus, binds UBF and impairs rRNA synthesis.

    PubMed

    Lafita-Navarro, Maria Del Carmen; Blanco, Rosa; Mata-Garrido, Jorge; Liaño-Pons, Judit; Tapia, Olga; García-Gutiérrez, Lucía; García-Alegría, Eva; Berciano, María T; Lafarga, Miguel; León, Javier

    2016-10-25

    MXD1 is a protein that interacts with MAX, to form a repressive transcription factor. MXD1-MAX binds E-boxes. MXD1-MAX antagonizes the transcriptional activity of the MYC oncoprotein in most models. It has been reported that MYC overexpression leads to augmented RNA synthesis and ribosome biogenesis, which is a relevant activity in MYC-mediated tumorigenesis. Here we describe that MXD1, but not MYC or MNT, localizes to the nucleolus in a wide array of cell lines derived from different tissues (carcinoma, leukemia) as well as in embryonic stem cells. MXD1 also localizes in the nucleolus of primary tissue cells as neurons and Sertoli cells. The nucleolar localization of MXD1 was confirmed by co-localization with UBF. Co-immunoprecipitation experiments showed that MXD1 interacted with UBF and proximity ligase assays revealed that this interaction takes place in the nucleolus. Furthermore, chromatin immunoprecipitation assays showed that MXD1 was bound in the transcribed rDNA chromatin, where it co-localizes with UBF, but also in the ribosomal intergenic regions. The MXD1 involvement in rRNA synthesis was also suggested by the nucleolar segregation upon rRNA synthesis inhibition by actinomycin D. Silencing of MXD1 with siRNAs resulted in increased synthesis of pre-rRNA while enforced MXD1 expression reduces it. The results suggest a new role for MXD1, which is the control of ribosome biogenesis. This new MXD1 function would be important to curb MYC activity in tumor cells.

  9. MXD1 localizes in the nucleolus, binds UBF and impairs rRNA synthesis

    PubMed Central

    Lafita-Navarro, Maria del Carmen; Blanco, Rosa; Mata-Garrido, Jorge; Liaño-Pons, Judit; Tapia, Olga; García-Gutiérrez, Lucía; García-Alegría, Eva; Berciano, María T.; Lafarga, Miguel; León, Javier

    2016-01-01

    MXD1 is a protein that interacts with MAX, to form a repressive transcription factor. MXD1-MAX binds E-boxes. MXD1-MAX antagonizes the transcriptional activity of the MYC oncoprotein in most models. It has been reported that MYC overexpression leads to augmented RNA synthesis and ribosome biogenesis, which is a relevant activity in MYC-mediated tumorigenesis. Here we describe that MXD1, but not MYC or MNT, localizes to the nucleolus in a wide array of cell lines derived from different tissues (carcinoma, leukemia) as well as in embryonic stem cells. MXD1 also localizes in the nucleolus of primary tissue cells as neurons and Sertoli cells. The nucleolar localization of MXD1 was confirmed by co-localization with UBF. Co-immunoprecipitation experiments showed that MXD1 interacted with UBF and proximity ligase assays revealed that this interaction takes place in the nucleolus. Furthermore, chromatin immunoprecipitation assays showed that MXD1 was bound in the transcribed rDNA chromatin, where it co-localizes with UBF, but also in the ribosomal intergenic regions. The MXD1 involvement in rRNA synthesis was also suggested by the nucleolar segregation upon rRNA synthesis inhibition by actinomycin D. Silencing of MXD1 with siRNAs resulted in increased synthesis of pre-rRNA while enforced MXD1 expression reduces it. The results suggest a new role for MXD1, which is the control of ribosome biogenesis. This new MXD1 function would be important to curb MYC activity in tumor cells. PMID:27588501

  10. RNA synthesis is modulated by G-quadruplex formation in Hepatitis C virus negative RNA strand.

    PubMed

    Chloé, Jaubert; Amina, Bedrat; Laura, Bartolucci; Carmelo, Di Primo; Michel, Ventura; Jean-Louis, Mergny; Samir, Amrane; Marie-Line, Andreola

    2018-05-25

    DNA and RNA guanine-rich oligonucleotides can form non-canonical structures called G-quadruplexes or "G4" that are based on the stacking of G-quartets. The role of DNA and RNA G4 is documented in eukaryotic cells and in pathogens such as viruses. Yet, G4 have been identified only in a few RNA viruses, including the Flaviviridae family. In this study, we analysed the last 157 nucleotides at the 3'end of the HCV (-) strand. This sequence is known to be the minimal sequence required for an efficient RNA replication. Using bioinformatics and biophysics, we identified a highly conserved G4-prone sequence located in the stem-loop IIy' of the negative strand. We also showed that the formation of this G-quadruplex inhibits the in vitro RNA synthesis by the RdRp. Furthermore, Phen-DC3, a specific G-quadruplex binder, is able to inhibit HCV viral replication in cells in conditions where no cytotoxicity was measured. Considering that this domain of the negative RNA strand is well conserved among HCV genotypes, G4 ligands could be of interest for new antiviral therapies.

  11. Aminoacyl-tRNA synthetases: versatile players in the changing theater of translation.

    PubMed Central

    Francklyn, Christopher; Perona, John J; Puetz, Joern; Hou, Ya-Ming

    2002-01-01

    Aminoacyl-tRNA synthetases attach amino acids to the 3' termini of cognate tRNAs to establish the specificity of protein synthesis. A recent Asilomar conference (California, January 13-18, 2002) discussed new research into the structure-function relationship of these crucial enzymes, as well as a multitude of novel functions, including participation in amino acid biosynthesis, cell cycle control, RNA splicing, and export of tRNAs from nucleus to cytoplasm in eukaryotic cells. Together with the discovery of their role in the cellular synthesis of proteins to incorporate selenocysteine and pyrrolysine, these diverse functions of aminoacyl-tRNA synthetases underscore the flexibility and adaptability of these ancient enzymes and stimulate the development of new concepts and methods for expanding the genetic code. PMID:12458790

  12. Role of Fatty-acid Synthesis in Dendritic Cell Generation and Function

    PubMed Central

    Rehman, Adeel; Hemmert, Keith C.; Ochi, Atsuo; Jamal, Mohsin; Henning, Justin R.; Barilla, Rocky; Quesada, Juan P.; Zambirinis, Constantinos P.; Tang, Kerry; Ego-Osuala, Melvin; Rao, Raghavendra S.; Greco, Stephanie; Deutsch, Michael; Narayan, Suchithra; Pachter, H. Leon; Graffeo, Christopher S.; Acehan, Devrim; Miller, George

    2013-01-01

    Dendritic cells (DC) are professional antigen presenting cells that regulate innate and adaptive immunity. The role of fatty-acid synthesis in DC development and function is uncertain. We found that blockade of fatty-acid synthesis markedly decreases dendropoiesis in the liver and in primary and secondary lymphoid organs in mice. Human DC development from PBMC precursors was also diminished by blockade of fatty-acid synthesis. This was associated with higher rates of apoptosis in precursor cells and increased expression of Cleaved Caspase 3 and BCL-xL, and down-regulation of Cyclin B1. Further, blockade of fatty-acid synthesis decreased DC expression of MHCII, ICAM-1, B7-1, B7-2 but increased their production of selected pro-inflammatory cytokines including IL-12 and MCP-1. Accordingly, inhibition of fatty-acid synthesis enhanced DC capacityto activate allogeneic as well as antigen-restricted CD4+ and CD8+ T cells and induce CTL responses. Further, blockade of fatty-acid synthesis increased DC expression of Notch ligands and enhanced their ability to activate NK cell immune-phenotype and IFN-γ production. Since endoplasmic reticular (ER)-stress can augment the immunogenic function of APC, we postulated that this may account for the higher DC immunogenicity. We found that inhibition of fatty-acid synthesis resulted in elevated expression of numerous markers of ER stress in humans and mice and was associated with increased MAP kinase and Akt signaling. Further, lowering ER-stress by 4-phenylbutyrate mitigated the enhanced immune-stimulation associated with fatty-acid synthesis blockade. Our findings elucidate the role of fatty-acid synthesis in DC development and function and have implications to the design of DC vaccines for immunotherapy. PMID:23536633

  13. Transaminases for the synthesis of enantiopure beta-amino acids

    PubMed Central

    2012-01-01

    Optically pure β-amino acids constitute interesting building blocks for peptidomimetics and a great variety of pharmaceutically important compounds. Their efficient synthesis still poses a major challenge. Transaminases (also known as aminotransferases) possess a great potential for the synthesis of optically pure β-amino acids. These pyridoxal 5'-dependent enzymes catalyze the transfer of an amino group from a donor substrate to an acceptor, thus enabling the synthesis of a wide variety of chiral amines and amino acids. Transaminases can be applied either for the kinetic resolution of racemic compounds or the asymmetric synthesis starting from a prochiral substrate. This review gives an overview over microbial transaminases with activity towards β-amino acids and their substrate spectra. It also outlines current strategies for the screening of new biocatalysts. Particular emphasis is placed on activity assays which are applicable to high-throughput screening. PMID:22293122

  14. Genetics Home Reference: congenital bile acid synthesis defect type 1

    MedlinePlus

    ... type 1 Congenital bile acid synthesis defect type 1 Printable PDF Open All Close All Enable Javascript to view the expand/collapse boxes. Description Congenital bile acid synthesis defect type 1 ...

  15. Synthesis of alpha-amino acids

    DOEpatents

    Davis, J.W. Jr.

    1983-01-25

    A method is described for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R[sub 1]R[sub 2]C(OSOCl)CN, R[sub 1]R[sub 2]C(Cl)CN and [R[sub 1]R[sub 2]C(CN)O][sub 2]SO wherein R[sub 1] and R[sub 2] are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art. No Drawings

  16. The "Speedy" Synthesis of Atom-Specific (15)N Imino/Amido-Labeled RNA.

    PubMed

    Neuner, Sandro; Santner, Tobias; Kreutz, Christoph; Micura, Ronald

    2015-08-10

    Although numerous reports on the synthesis of atom-specific (15)N-labeled nucleosides exist, fast and facile access to the corresponding phosphoramidites for RNA solid-phase synthesis is still lacking. This situation represents a severe bottleneck for NMR spectroscopic investigations on functional RNAs. Here, we present optimized procedures to speed up the synthesis of (15)N(1) adenosine and (15)N(1) guanosine amidites, which are the much needed counterparts of the more straightforward-to-achieve (15)N(3) uridine and (15)N(3) cytidine amidites in order to tap full potential of (1)H/(15)N/(15)N-COSY experiments for directly monitoring individual Watson-Crick base pairs in RNA. Demonstrated for two preQ1 riboswitch systems, we exemplify a versatile concept for individual base-pair labeling in the analysis of conformationally flexible RNAs when competing structures and conformational dynamics are encountered. © 2015 WILEY‐VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Antimycobacterial action of thiolactomycin: an inhibitor of fatty acid and mycolic acid synthesis.

    PubMed Central

    Slayden, R A; Lee, R E; Armour, J W; Cooper, A M; Orme, I M; Brennan, P J; Besra, G S

    1996-01-01

    Thiolactomycin (TLM) possesses in vivo antimycobacterial activity against the saprophytic strain Mycobacterium smegmatis mc2155 and the virulent strain M. tuberculosis Erdman, resulting in complete inhibition of growth on solid media at 75 and 25 micrograms/ml, respectively. Use of an in vitro murine macrophage model also demonstrated the killing of viable intracellular M. tuberculosis in a dose-dependent manner. Through the use of in vivo [1,2-14C]acetate labeling of M. smegmatis, TLM was shown to inhibit the synthesis of both fatty acids and mycolic acids. However, synthesis of the shorter-chain alpha'-mycolates of M. smegmatis was not inhibited by TLM, whereas synthesis of the characteristic longer-chain alpha-mycolates and epoxymycolates was almost completely inhibited at 75 micrograms/ml. The use of M. smegmatis cell extracts demonstrated that TLM specifically inhibited the mycobacterial acyl carrier protein-dependent type II fatty acid synthase (FAS-II) but not the multifunctional type I fatty acid synthase (FAS-I). In addition, selective inhibition of long-chain mycolate synthesis by TLM was demonstrated in a dose-response manner in purified, cell wall-containing extracts of M. smegmatis cells. The in vivo and in vitro data and knowledge of the mechanism of TLM resistance in Escherichia coli suggest that two distinct TLM targets exist in mycobacteria, the beta-ketoacyl-acyl carrier protein synthases involved in FAS-II and the elongation steps leading to the synthesis of the alpha-mycolates and oxygenated mycolates. The efficacy of TLM against M. smegmatis and M. tuberculosis provides the prospects of identifying fatty acid and mycolic acid biosynthetic genes and revealing a novel range of chemotherapeutic agents directed against M. tuberculosis. PMID:9124847

  18. RNA synthesis in the pancreatic acinar cells of aging mice as revealed by electron microscopic radioautography.

    PubMed

    Nagata, Tetsuji

    2012-01-01

    For the purpose of studying the aging changes of macromolecular synthesis in the pancreatic acinar cells of experimental animals, we studied 10 groups of aging mice during development and aging from fetal day 19 to postnatal month 24. They were injected with 3H-uridine, a precursor for RNA synthesis, sacrificed and the pancreatic tissues were taken out, fixed and processed for light and electron microscopic radioautography. On many radioautograms the localization of silver grains demonstrating RNA synthesis in pancreatic acinar cells in respective aging groups were analyzed qualitatively. The number of mitochondria per cell, the number of labeled mitochondria with silver grains and the number of silver grains in each cell in respective aging groups were analyzed quantitatively in relation to the aging of animals. The results revealed that the RNA synthetic activity as expressed by the incorporations of RNA precursor, i.e., the number of silver grains in cell nuclei, cell organelles, changed due to the aging of animals. The number of mitochondria, the number of labeled mitochondria and the mitochondrial labeling index labeled with silver grains were counted in each pancreatic acinar cell. It was demonstrated that the number of mitochondria, the number of labeled mitochondria and the labeling indices showing RNA synthesis at various ages increased from embryonic day 19 to postnatal newborn day 1, 3, 9, 14, adult month 1, 2 and 6, reaching the maxima, then decreased to senile stage at postnatal year 1 to 2, indicating the aging changes. Based upon our findings, available literature on macromolecular synthesis in mitochondria of various cells are reviewed.

  19. Boron modulates extracellular matrix and TNF alpha synthesis in human fibroblasts.

    PubMed

    Benderdour, M; Hess, K; Dzondo-Gadet, M; Nabet, P; Belleville, F; Dousset, B

    1998-05-29

    Boric acid was not mitogenic for human fibroblasts and it did not change cell viability until 0.5% (w/v). Boric acid treatment affected the metabolism of human dermal fibroblasts in culture, decreasing the synthesis of extracellular matrix macromolecules such as proteoglycans, collagen, and total proteins. It also increased the release of these molecules into the culture medium. The principal proteins secreted into the medium after boric acid treatment had molecular masses of 90, 70, 58, 49, and 43 kDa and faint bands were detected by electrophoresis between 14 and 30 kDa. hsp 70 and TNF alpha were detected among the secreted proteins by immunoblotting, and the amount of TNF alpha released was quantified by radioimmunoassay. Total mRNA levels were higher after boric acid treatment and peaked after 6 h of treatment. TNF alpha mRNA was undetectable in unstimulated fibroblasts and two TNF alpha mRNA bands were detected after stimulation: immature mRNA (4.8 kb) and mature TNF alpha mRNA (1.9 kb). Thus, the effects of boric acid observed in wound repair in vivo may be due to TNF alpha synthesis and secretion.

  20. An efficient synthesis of tetramic acid derivatives with extended conjugation from L-Ascorbic Acid

    PubMed Central

    Singh, Biswajit K; Bisht, Surendra S; Tripathi, Rama P

    2006-01-01

    Background Tetramic acids with polyenyl substituents are an important class of compounds in medicinal chemistry. Both solid and solution phase syntheses of such molecules have been reported recently. Thiolactomycin, a clinical candidate for treatment of tuberculosis has led to further explorations in this class. We have recently developed an efficient synthesis of tetramic acids derivatives from L- ascorbic acid. In continuation of this work, we have synthesised dienyl tetramic acid derivatives. Results 5,6-O-Isopropylidene-ascorbic acid on reaction with DBU led to the formation of tetronolactonyl allyl alcohol, which on oxidation with pyridinium chlorochromate gave the respective tetranolactonyl allylic aldehydes. Wittig olefination followed by reaction of the resulting tetranolactonyl dienyl esters with different amines resulted in the respective 5-hydroxy lactams. Subsequent dehydration of the hydroxy lactams with p-toluene sulphonic acid afforded the dienyl tetramic acid derivatives. All reactions were performed at ambient temperature and the yields are good. Conclusion An efficient and practical method for the synthesis of dienyl tetramic acid derivatives from inexpensive and easily accessible ascorbic acid has been developed. The compounds bear structural similarities to the tetramic acid based polyenic antibiotics and thus this method offers a new and short route for the synthesis of tetramic acid derivatives of biological significance. PMID:17147830

  1. An efficient synthesis of tetramic acid derivatives with extended conjugation from L-ascorbic acid.

    PubMed

    Singh, Biswajit K; Bisht, Surendra S; Tripathi, Rama P

    2006-12-06

    Tetramic acids with polyenyl substituents are an important class of compounds in medicinal chemistry. Both solid and solution phase syntheses of such molecules have been reported recently. Thiolactomycin, a clinical candidate for treatment of tuberculosis has led to further explorations in this class. We have recently developed an efficient synthesis of tetramic acids derivatives from L-ascorbic acid. In continuation of this work, we have synthesised dienyl tetramic acid derivatives. 5,6-O-isopropylidene-ascorbic acid on reaction with DBU led to the formation of tetronolactonyl allyl alcohol, which on oxidation with pyridinium chlorochromate gave the respective tetranolactonyl allylic aldehydes. Wittig olefination followed by reaction of the resulting tetranolactonyl dienyl esters with different amines resulted in the respective 5-hydroxy lactams. Subsequent dehydration of the hydroxy lactams with p-toluene sulphonic acid afforded the dienyl tetramic acid derivatives. All reactions were performed at ambient temperature and the yields are good. An efficient and practical method for the synthesis of dienyl tetramic acid derivatives from inexpensive and easily accessible ascorbic acid has been developed. The compounds bear structural similarities to the tetramic acid based polyenic antibiotics and thus this method offers a new and short route for the synthesis of tetramic acid derivatives of biological significance.

  2. Obeticholic acid, a selective farnesoid X receptor agonist, regulates bile acid homeostasis in sandwich-cultured human hepatocytes.

    PubMed

    Zhang, Yuanyuan; Jackson, Jonathan P; St Claire, Robert L; Freeman, Kimberly; Brouwer, Kenneth R; Edwards, Jeffrey E

    2017-08-01

    Farnesoid X receptor (FXR) is a master regulator of bile acid homeostasis through transcriptional regulation of genes involved in bile acid synthesis and cellular membrane transport. Impairment of bile acid efflux due to cholangiopathies results in chronic cholestasis leading to abnormal elevation of intrahepatic and systemic bile acid levels. Obeticholic acid (OCA) is a potent and selective FXR agonist that is 100-fold more potent than the endogenous ligand chenodeoxycholic acid (CDCA). The effects of OCA on genes involved in bile acid homeostasis were investigated using sandwich-cultured human hepatocytes. Gene expression was determined by measuring mRNA levels. OCA dose-dependently increased fibroblast growth factor-19 (FGF-19) and small heterodimer partner (SHP) which, in turn, suppress mRNA levels of cholesterol 7-alpha-hydroxylase (CYP7A1), the rate-limiting enzyme for de novo synthesis of bile acids. Consistent with CYP7A1 suppression, total bile acid content was decreased by OCA (1 μmol/L) to 42.7 ± 20.5% relative to control. In addition to suppressing de novo bile acids synthesis, OCA significantly increased the mRNA levels of transporters involved in bile acid homeostasis. The bile salt excretory pump (BSEP), a canalicular efflux transporter, increased by 6.4 ± 0.8-fold, and the basolateral efflux heterodimer transporters, organic solute transporter α (OST α ) and OST β increased by 6.4 ± 0.2-fold and 42.9 ± 7.9-fold, respectively. The upregulation of BSEP and OST α and OST β, by OCA reduced the intracellular concentrations of d 8 -TCA, a model bile acid, to 39.6 ± 8.9% relative to control. These data demonstrate that OCA does suppress bile acid synthesis and reduce hepatocellular bile acid levels, supporting the use of OCA to treat bile acid-induced toxicity observed in cholestatic diseases. © 2017 Intercept Pharmaceuticals. Pharmacology Research & Perspectives published by John Wiley & Sons Ltd, British Pharmacological Society and

  3. Protein migration from transplanted nuclei in Amoeba proteus. I. The relation to the cell cycle and RNA migration, as studied by autoradiography

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mills, K.I.; Bell, L.G.

    1982-11-01

    Autoradiography has been used to examine the migration of proteins from a radioactivity labelled amoeba nucleus following transplantation into an unlabelled homophasic amoeba. Nuclei were transferred at three times in the cell cycle coinciding with DNA synthesis (4 h post-division); a peak of RNA synthesis (25 h); and a relative lull in synthetic activity (43 h). Six amino acids were added individually to the culture medium to label the nuclear proteins. Migration of the proteins from the donor nucleui and least with proteins labelled with the basic amino acids. All amino acids exhibited the greatest extent of migration following themore » 25-h transfers, i.e., coinciding with a peak of RNA synthesis at 26-27.5 h. Actinomycin D (actD) inhibition of RNA synthesis reduced, but did not eliminate the extent of protein migration from the transplanted nucleus, thus indicating the existence of two classes of migratory proteins. Firstly, proteins, associated with RNA transport, which migrated mainly into the host cytoplasm. The second class migrated into the host nucleus from the transplanted nucleus, irrespective of RNA synthesis. The shuttling character of the latter class of proteins is consistent with a role of regulation of nuclear activity.« less

  4. One-pot synthesis of pH-responsive hybrid nanogel particles for the intracellular delivery of small interfering RNA

    PubMed Central

    Parodi, Alessandro; Evangelopoulos, Michael; Corbo, Claudia; Scaria, Shilpa; Hu, Ye; Haddix, Seth G.; Corradetti, Bruna; Salvatore, Francesco; Tasciotti, Ennio

    2016-01-01

    This report describes a novel, one-pot synthesis of hybrid nanoparticles formed by a nanostructured inorganic silica core and an organic pH-responsive hydrogel shell. This easy-to-perform, oil-in-water emulsion process synthesizes fluorescently-doped silica nanoparticles wrapped within a tunable coating of cationic poly(2-diethylaminoethyl methacrylate) hydrogel in one step. Transmission electron microscopy and dynamic light scattering analysis demonstrated that the hydrogel-coated nanoparticles are uniformly dispersed in the aqueous phase. The formation of covalent chemical bonds between the silica and the polymer increases the stability of the organic phase around the inorganic core as demonstrated by thermogravimetric analysis. The cationic nature of the hydrogel is responsible for the pH buffering properties of the nanostructured system and was evaluated by titration experiments. Zeta-potential analysis demonstrated that the charge of the system was reversed when transitioned from acidic to basic pH and vice versa. Consequently, small interfering RNA (siRNA) can be loaded and released in an acidic pH environment thereby enabling the hybrid particles and their payload to avoid endosomal sequestration and enzymatic degradation. These nanoparticles, loaded with specific siRNA molecules directed towards the transcript of the membrane receptor CXCR4, significantly decreased the expression of this protein in a human breast cancer cell line (i.e., MDA-MB-231). Moreover, intravenous administration of siRNA-loaded nanoparticles demonstrated a preferential accumulation at the tumor site that resulted in a reduction of CXCR4 expression. PMID:26901429

  5. Insights into RNA synthesis, capping, and proofreading mechanisms of SARS-coronavirus.

    PubMed

    Sevajol, Marion; Subissi, Lorenzo; Decroly, Etienne; Canard, Bruno; Imbert, Isabelle

    2014-12-19

    The successive emergence of highly pathogenic coronaviruses (CoVs) such as the Severe Acute Respiratory Syndrome (SARS-CoV) in 2003 and the Middle East Respiratory Syndrome Coronavirus (MERS-CoV) in 2012 has stimulated a number of studies on the molecular biology. This research has provided significant new insight into functions and activities of the replication/transcription multi-protein complex. The latter directs both continuous and discontinuous RNA synthesis to replicate and transcribe the large coronavirus genome made of a single-stranded, positive-sense RNA of ∼30 kb. In this review, we summarize our current understanding of SARS-CoV enzymes involved in RNA biochemistry, such as the in vitro characterization of a highly active and processive RNA polymerase complex which can associate with methyltransferase and 3'-5' exoribonuclease activities involved in RNA capping, and RNA proofreading, respectively. The recent discoveries reveal fascinating RNA-synthesizing machinery, highlighting the unique position of coronaviruses in the RNA virus world. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. Isolation and characterization of nonhistone chromosomal protein C-14 which stimulates RNA synthesis.

    PubMed

    James, G T; Yeoman, L C; Matsui, S i; Goldberg, A H; Busch, H

    1977-05-31

    The nonhistone chromatin protein, C-14, was extracted from chromatin of Novikoff hepatoma ascites cells and isolated in high purity as shown by its migration as a single dense spot on two-dimensional polyacrylamide gels. Its mobility on sodium dodecyl sulfate gels is consistent with a molecular weight of approximately 70 000. The amino acid composition shows that protein C-14 has an acidic:basic amino acid ratio of 1.8. Its amino terminal amino acid is lysine. Protein C-14 stimulated the incorporation of [3H]UMP into RNA by approximately 30% when added to naked DNA and homologous RNA polymerase I. A 30% stimulation of [3H]UMP incorporation into RNA was also found when protein C-14 was added to an E. coli RNA polymerase system containing either E. coli or Novikoff hepatoma DNA.

  7. Functional interactions of nucleocapsid protein of feline immunodeficiency virus and cellular prion protein with the viral RNA.

    PubMed

    Moscardini, Mila; Pistello, Mauro; Bendinelli, M; Ficheux, Damien; Miller, Jennifer T; Gabus, Caroline; Le Grice, Stuart F J; Surewicz, Witold K; Darlix, Jean-Luc

    2002-04-19

    All lentiviruses and oncoretroviruses examined so far encode a major nucleic-acid binding protein (nucleocapsid or NC* protein), approximately 2500 molecules of which coat the dimeric RNA genome. Studies on HIV-1 and MoMuLV using in vitro model systems and in vivo have shown that NC protein is required to chaperone viral RNA dimerization and packaging during virus assembly, and proviral DNA synthesis by reverse transcriptase (RT) during infection. The human cellular prion protein (PrP), thought to be the major component of the agent causing transmissible spongiform encephalopathies (TSE), was recently found to possess a strong affinity for nucleic acids and to exhibit chaperone properties very similar to HIV-1 NC protein in the HIV-1 context in vitro. Tight binding of PrP to nucleic acids is proposed to participate directly in the prion disease process. To extend our understanding of lentiviruses and of the unexpected nucleic acid chaperone properties of the human prion protein, we set up an in vitro system to investigate replication of the feline immunodeficiency virus (FIV), which is functionally and phylogenetically distant from HIV-1. The results show that in the FIV model system, NC protein chaperones viral RNA dimerization, primer tRNA(Lys,3) annealing to the genomic primer-binding site (PBS) and minus strand DNA synthesis by the homologous FIV RT. FIV NC protein is able to trigger specific viral DNA synthesis by inhibiting self-priming of reverse transcription. The human prion protein was found to mimic the properties of FIV NC with respect to primer tRNA annealing to the viral RNA and chaperoning minus strand DNA synthesis. Copyright 2002 Elsevier Science Ltd.

  8. The “Speedy” Synthesis of Atom-Specific 15N Imino/Amido-Labeled RNA

    PubMed Central

    Kreutz, Christoph; Micura, Ronald

    2016-01-01

    Although numerous reports on the synthesis of atom-specific 15N-labeled nucleosides exist, fast and facile access to the corresponding phosphoramidites for RNA solid-phase synthesis is still lacking. This situation represents a severe bottleneck for NMR spectroscopic investigations on functional RNAs. Here, we present optimized procedures to speed up the synthesis of 15N(1) adenosine and 15N(1) guanosine amidites, which are the much needed counterparts of the more straightforward-to-achieve 15N(3) uridine and 15N(3) cytidine amidites in order to tap full potential of 1H/15N/15N-COSY experiments for directly monitoring individual Watson–Crick base pairs in RNA. Demonstrated for two preQ1 riboswitch systems, we exemplify a versatile concept for individual base-pair labeling in the analysis of conformationally flexible RNAs when competing structures and conformational dynamics are encountered. PMID:26237536

  9. RNA-Seq-based transcriptome analysis of methicillin-resistant Staphylococcus aureus biofilm inhibition by ursolic acid and resveratrol

    PubMed Central

    Qin, Nan; Tan, Xiaojuan; Jiao, Yinming; Liu, Lin; Zhao, Wangsheng; Yang, Shuang; Jia, Aiqun

    2014-01-01

    Bacterial biofilms are particularly problematic since they become resistant to most available antibiotics. Hence, novel potential antagonists to inhibit biofilm formation are urgent. Here the influences of two natural products, ursolic acid and resveratrol, on biofilm of the clinical methicillin-resistant Staphylococcus aureus (MRSA) isolate were investigated using RNA-seq, and the differentially expressed genes were analyzed using Cuffdiff. The results showed that ursolic acid inhibition of biofilm formation may reduce amino acids metabolism and adhesins expression and resveratrol may disturb quorum sensing (QS) and the synthesis of surface proteins and capsular polysaccharides. In addition, the transcriptome analysis of resveratrol and the combination of resveratrol with vancomycin inhibition of established biofilm revealed that resveratrol would disturb the expression of genes related to QS, surface and secreted proteins, and capsular polysaccharides. These findings suggest that ursolic acid and resveratrol could be useful to be adjunct therapies for the treatment of MRSA biofilm-involved infections. PMID:24970710

  10. Rapid RNase L-driven arrest of protein synthesis in the dsRNA response without degradation of translation machinery.

    PubMed

    Donovan, Jesse; Rath, Sneha; Kolet-Mandrikov, David; Korennykh, Alexei

    2017-11-01

    Mammalian cells respond to double-stranded RNA (dsRNA) by activating a translation-inhibiting endoribonuclease, RNase L. Consensus in the field indicates that RNase L arrests protein synthesis by degrading ribosomal RNAs (rRNAs) and messenger RNAs (mRNAs). However, here we provide evidence for a different and far more efficient mechanism. By sequencing abundant RNA fragments generated by RNase L in human cells, we identify site-specific cleavage of two groups of noncoding RNAs: Y-RNAs, whose function is poorly understood, and cytosolic tRNAs, which are essential for translation. Quantitative analysis of human RNA cleavage versus nascent protein synthesis in lung carcinoma cells shows that RNase L stops global translation when tRNAs, as well as rRNAs and mRNAs, are still intact. Therefore, RNase L does not have to degrade the translation machinery to stop protein synthesis. Our data point to a rapid mechanism that transforms a subtle RNA cleavage into a cell-wide translation arrest. © 2017 Donovan et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  11. Non-nucleoside building blocks for copper-assisted and copper-free click chemistry for the efficient synthesis of RNA conjugates.

    PubMed

    Jayaprakash, K N; Peng, Chang Geng; Butler, David; Varghese, Jos P; Maier, Martin A; Rajeev, Kallanthottathil G; Manoharan, Muthiah

    2010-12-03

    Novel non-nucleoside alkyne monomers compatible with oligonucleotide synthesis were designed, synthesized, and efficiently incorporated into RNA and RNA analogues during solid-phase synthesis. These modifications allowed site-specific conjugation of ligands to the RNA oligonucleotides through copper-assisted (CuAAC) and copper-free strain-promoted azide-alkyne cycloaddition (SPAAC) reactions. The SPAAC click reactions of cyclooctyne-oligonucleotides with various classes of azido-functionalized ligands in solution phase and on solid phase were efficient and quantitative and occurred under mild reaction conditions. The SPAAC reaction provides a method for the synthesis of oligonucleotide-ligand conjugates uncontaminated with copper ions.

  12. Macromolecular Synthesis During the Germination of Saccharomyces cerevisiae Spores

    PubMed Central

    Rousseau, Paul; Halvorson, Harlyn O.

    1973-01-01

    After the dormancy of Saccharomyces cerevisiae ascospores had been broken, the synthesis of proteins was observed first, followed rapidly by synthesis of ribonucleic acid (RNA) and much later by deoxyribonucleic acid (DNA) synthesis. Phosphoglucomutase activity increased in a periodic (step) fashion, whereas the activity of five other enzymes increased linearly during germination and outgrowth. The rate of synthesis of these enzymes was highest at about the period of DNA replication. The amino acid pools of dormant spores contained high levels of proline, glutamic acid, and histidine. At 2 h after onset of germination, the pools of phenylalanine and methionine had disappeared and the other components had decreased significantly. By 3.5 h, with the exception of proline and cystine, most amino acid pool components had significantly increased. PMID:4570780

  13. The parable of the caveman and the Ferrari: protein synthesis and the RNA world

    PubMed Central

    Noller, Harry F.

    2017-01-01

    The basic steps of protein synthesis are carried out by the ribosome, a very large and complex ribonucleoprotein particle. In keeping with its proposed emergence from an RNA world, all three of its core mechanisms—aminoacyl-tRNA selection, catalysis of peptide bond formation and coupled translocation of mRNA and tRNA—are embodied in the properties of ribosomal RNA, while its proteins play a supportive role. This article is part of the themed issue ‘Perspectives on the ribosome’. PMID:28138073

  14. LKB1 promotes cell survival by modulating TIF-IA-mediated pre-ribosomal RNA synthesis under uridine downregulated conditions

    PubMed Central

    Liu, Xiuju; Huang, Henry; Wilkinson, Scott C.; Zhong, Diansheng; Khuri, Fadlo R.; Fu, Haian; Marcus, Adam; He, Yulong; Zhou, Wei

    2016-01-01

    We analyzed the mechanism underlying 5-aminoimidazole-4-carboxamide riboside (AICAR) mediated apoptosis in LKB1-null non-small cell lung cancer (NSCLC) cells. Metabolic profile analysis revealed depletion of the intracellular pyrimidine pool after AICAR treatment, but uridine was the only nucleotide precursor capable of rescuing this apoptosis, suggesting the involvement of RNA metabolism. Because half of RNA transcription in cancer is for pre-ribosomal RNA (rRNA) synthesis, which is suppressed by over 90% after AICAR treatment, we evaluated the role of TIF-IA-mediated rRNA synthesis. While the depletion of TIF-IA by RNAi alone promoted apoptosis in LKB1-null cells, the overexpression of a wild-type or a S636A TIF-IA mutant, but not a S636D mutant, attenuated AICAR-induced apoptosis. In LKB1-null H157 cells, pre-rRNA synthesis was not suppressed by AICAR when wild-type LKB1 was present, and cellular fractionation analysis indicated that TIF-IA quickly accumulated in the nucleus in the presence of a wild-type LKB1 but not a kinase-dead mutant. Furthermore, ectopic expression of LKB1 was capable of attenuating AICAR-induced death in AMPK-null cells. Because LKB1 promotes cell survival by modulating TIF-IA-mediated pre-rRNA synthesis, this discovery suggested that targeted depletion of uridine related metabolites may be exploited in the clinic to eliminate LKB1-null cancer cells. PMID:26506235

  15. LKB1 promotes cell survival by modulating TIF-IA-mediated pre-ribosomal RNA synthesis under uridine downregulated conditions.

    PubMed

    Liu, Fakeng; Jin, Rui; Liu, Xiuju; Huang, Henry; Wilkinson, Scott C; Zhong, Diansheng; Khuri, Fadlo R; Fu, Haian; Marcus, Adam; He, Yulong; Zhou, Wei

    2016-01-19

    We analyzed the mechanism underlying 5-aminoimidazole-4-carboxamide riboside (AICAR) mediated apoptosis in LKB1-null non-small cell lung cancer (NSCLC) cells. Metabolic profile analysis revealed depletion of the intracellular pyrimidine pool after AICAR treatment, but uridine was the only nucleotide precursor capable of rescuing this apoptosis, suggesting the involvement of RNA metabolism. Because half of RNA transcription in cancer is for pre-ribosomal RNA (rRNA) synthesis, which is suppressed by over 90% after AICAR treatment, we evaluated the role of TIF-IA-mediated rRNA synthesis. While the depletion of TIF-IA by RNAi alone promoted apoptosis in LKB1-null cells, the overexpression of a wild-type or a S636A TIF-IA mutant, but not a S636D mutant, attenuated AICAR-induced apoptosis. In LKB1-null H157 cells, pre-rRNA synthesis was not suppressed by AICAR when wild-type LKB1 was present, and cellular fractionation analysis indicated that TIF-IA quickly accumulated in the nucleus in the presence of a wild-type LKB1 but not a kinase-dead mutant. Furthermore, ectopic expression of LKB1 was capable of attenuating AICAR-induced death in AMPK-null cells. Because LKB1 promotes cell survival by modulating TIF-IA-mediated pre-rRNA synthesis, this discovery suggested that targeted depletion of uridine related metabolites may be exploited in the clinic to eliminate LKB1-null cancer cells.

  16. Nucleic acid and nucleotide-mediated synthesis of inorganic nanoparticles

    NASA Astrophysics Data System (ADS)

    Berti, Lorenzo; Burley, Glenn A.

    2008-02-01

    Since the advent of practical methods for achieving DNA metallization, the use of nucleic acids as templates for the synthesis of inorganic nanoparticles (NPs) has become an active area of study. It is now widely recognized that nucleic acids have the ability to control the growth and morphology of inorganic NPs. These biopolymers are particularly appealing as templating agents as their ease of synthesis in conjunction with the possibility of screening nucleotide composition, sequence and length, provides the means to modulate the physico-chemical properties of the resulting NPs. Several synthetic procedures leading to NPs with interesting photophysical properties as well as studies aimed at rationalizing the mechanism of nucleic acid-templated NP synthesis are now being reported. This progress article will outline the current understanding of the nucleic acid-templated process and provides an up to date reference in this nascent field.

  17. The synthesis of glutamic acid in the absence of enzymes: Implications for biogenesis

    NASA Technical Reports Server (NTRS)

    Morowitz, Harold; Peterson, Eta; Chang, Sherwood

    1995-01-01

    This paper reports on the non-enzymatic aqueous phase synthesis of amino acids from keto acids, ammonia and reducing agents. The facile synthesis of key metabolic intermediates, particularly in the glycolytic pathway, the citric acid cycle, and the first step of amino acid synthesis, lead to new ways of looking at the problem of biogenesis.

  18. Leucine-Enriched Essential Amino Acids Augment Mixed Protein Synthesis, But Not Collagen Protein Synthesis, in Rat Skeletal Muscle after Downhill Running

    PubMed Central

    Kato, Hiroyuki; Suzuki, Hiromi; Inoue, Yoshiko; Suzuki, Katsuya; Kobayashi, Hisamine

    2016-01-01

    Mixed and collagen protein synthesis is elevated for as many as 3 days following exercise. Immediately after exercise, enhanced amino acid availability increases synthesis of mixed muscle protein, but not muscle collagen protein. However, the potential for synergic effects of amino acid ingestion with exercise on both mixed and collagen protein synthesis remains unclear. We investigated muscle collagen protein synthesis in rats following post-exercise ingestion of leucine-enriched essential amino acids. We determined fractional protein synthesis rates (FSR) at different time points following exercise. Mixed protein and collagen protein FSRs in skeletal muscle were determined by measuring protein-bound enrichments of hydroxyproline and proline, and by measuring the intracellular enrichment of proline, using injections of flooding d3-proline doses. A leucine-enriched mixture of essential amino acids (or distilled water as a control) was administrated 30 min or 1 day post-exercise. The collagen protein synthesis in the vastus lateralis was elevated for 2 days after exercise. Although amino acid administration did not increase muscle collagen protein synthesis, it did lead to augmented mixed muscle protein synthesis 1 day following exercise. Thus, contrary to the regulation of mixed muscle protein synthesis, muscle collagen protein synthesis is not affected by amino acid availability after damage-inducing exercise. PMID:27367725

  19. The control of paramyxovirus genome hexamer length and mRNA editing.

    PubMed

    Matsumoto, Yusuke; Ohta, Keisuke; Kolakofsky, Daniel; Nishio, Machiko

    2018-04-01

    The unusual ability of a human parainfluenza virus type 2 (hPIV2) nucleoprotein point mutation (NP Q202A ) to strongly enhance minigenome replication was found to depend on the absence of a functional, internal element of the bipartite replication promoter (CRII). This point mutation allows relatively robust CRII-minus minigenome replication in a CRII-independent manner, under conditions in which NP wt is essentially inactive. The nature of the amino acid at position 202 apparently controls whether viral RNA-dependent RNA polymerase (vRdRp) can, or cannot, initiate RNA synthesis in a CRII-independent manner. By repressing genome synthesis when vRdRp cannot correctly interact with CRII, gln 202 of N, the only residue of the RNA-binding groove that contacts a nucleotide base in the N-RNA, acts as a gatekeeper for wild-type (CRII-dependent) RNA synthesis. This ensures that only hexamer-length genomes are replicated, and that the critical hexamer phase of the cis -acting mRNA editing sequence is maintained. © 2018 Matsumoto et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  20. Interaction between the cellular protein eEF1A and the 3'-terminal stem-loop of West Nile virus genomic RNA facilitates viral minus-strand RNA synthesis.

    PubMed

    Davis, William G; Blackwell, Jerry L; Shi, Pei-Yong; Brinton, Margo A

    2007-09-01

    RNase footprinting and nitrocellulose filter binding assays were previously used to map one major and two minor binding sites for the cell protein eEF1A on the 3'(+) stem-loop (SL) RNA of West Nile virus (WNV) (3). Base substitutions in the major eEF1A binding site or adjacent areas of the 3'(+) SL were engineered into a WNV infectious clone. Mutations that decreased, as well as ones that increased, eEF1A binding in in vitro assays had a negative effect on viral growth. None of these mutations affected the efficiency of translation of the viral polyprotein from the genomic RNA, but all of the mutations that decreased in vitro eEF1A binding to the 3' SL RNA also decreased viral minus-strand RNA synthesis in transfected cells. Also, a mutation that increased the efficiency of eEF1A binding to the 3' SL RNA increased minus-strand RNA synthesis in transfected cells, which resulted in decreased synthesis of genomic RNA. These results strongly suggest that the interaction between eEF1A and the WNV 3' SL facilitates viral minus-strand synthesis. eEF1A colocalized with viral replication complexes (RC) in infected cells and antibody to eEF1A coimmunoprecipitated viral RC proteins, suggesting that eEF1A facilitates an interaction between the 3' end of the genome and the RC. eEF1A bound with similar efficiencies to the 3'-terminal SL RNAs of four divergent flaviviruses, including a tick-borne flavivirus, and colocalized with dengue virus RC in infected cells. These results suggest that eEF1A plays a similar role in RNA replication for all flaviviruses.

  1. Site-specific incorporation of probes into RNA polymerase by unnatural-amino-acid mutagenesis and Staudinger-Bertozzi ligation

    PubMed Central

    Chakraborty, Anirban; Mazumder, Abhishek; Lin, Miaoxin; Hasemeyer, Adam; Xu, Qumiao; Wang, Dongye; Ebright, Yon W.; Ebright, Richard H.

    2015-01-01

    Summary A three-step procedure comprising (i) unnatural-amino-acid mutagenesis with 4-azido-phenylalanine, (ii) Staudinger-Bertozzi ligation with a probe-phosphine derivative, and (iii) in vitro reconstitution of RNA polymerase (RNAP) enables the efficient site-specific incorporation of a fluorescent probe, a spin label, a crosslinking agent, a cleaving agent, an affinity tag, or any other biochemical or biophysical probe, at any site of interest in RNAP. Straightforward extensions of the procedure enable the efficient site-specific incorporation of two or more different probes in two or more different subunits of RNAP. We present protocols for synthesis of probe-phosphine derivatives, preparation of RNAP subunits and the transcription initiation factor σ, unnatural amino acid mutagenesis of RNAP subunits and σ, Staudinger ligation with unnatural-amino-acid-containing RNAP subunits and σ, quantitation of labelling efficiency and labelling specificity, and reconstitution of RNAP. PMID:25665560

  2. The replisome uses mRNA as a primer after colliding with RNA polymerase.

    PubMed

    Pomerantz, Richard T; O'Donnell, Mike

    2008-12-11

    Replication forks are impeded by DNA damage and protein-nucleic acid complexes such as transcribing RNA polymerase. For example, head-on collision of the replisome with RNA polymerase results in replication fork arrest. However, co-directional collision of the replisome with RNA polymerase has little or no effect on fork progression. Here we examine co-directional collisions between a replisome and RNA polymerase in vitro. We show that the Escherichia coli replisome uses the RNA transcript as a primer to continue leading-strand synthesis after the collision with RNA polymerase that is displaced from the DNA. This action results in a discontinuity in the leading strand, yet the replisome remains intact and bound to DNA during the entire process. These findings underscore the notable plasticity by which the replisome operates to circumvent obstacles in its path and may explain why the leading strand is synthesized discontinuously in vivo.

  3. A comparison of RNA with DNA in template-directed synthesis

    NASA Technical Reports Server (NTRS)

    Zielinski, M.; Kozlov, I. A.; Orgel, L. E.; Bada, J. L. (Principal Investigator)

    2000-01-01

    Nonenzymatic template-directed copying of RNA sequences rich in cytidylic acid using nucleoside 5'-(2-methylimidazol-1-yl phosphates) as substrates is substantially more efficient than the copying of corresponding DNA sequences. However, many sequences cannot be copied, and the prospect of replication in this system is remote, even for RNA. Surprisingly, wobble-pairing leads to much more efficient incorporation of G opposite U on RNA templates than of G opposite T on DNA templates.

  4. Hydrolysis of tRNA(sup Phe) on Suspensions of Amino Acids

    NASA Technical Reports Server (NTRS)

    Gao, Kui; Orgel, Leslie E.

    2001-01-01

    RNA is adsorbed strongly on suspensions of many moderately soluble organic solids. In some cases, the hydrolysis of tRNA(sup Phe) is greatly accelerated by adsorption, and the major sites of hydrolysis are changed from those that are important in homogeneous solution. Here we show that the hydrolysis is greatly accelerated by suspensions of aspartic acid and beta-glutamic acid but not by suspensions of alpha-glutamic acid, asparagine, or glutamine. The non-enzymatic hydrolysis of RNA has been studied extensively, especially because of its relevance to the mechanisms of action of ribozymes and to biotechnology and therapy. Many ribonucleases, ribozymes, and non-biological catalysts function via acid-base catalysis of an intramolecular transesterification mechanism in which the 2'-OH group attacks the adjacent phosphate group. The pentacoordinated phosphorane intermediate may collapse back to starting material, or yield isomerized or cleaved products.

  5. Synthesis and RNA polymerase incorporation of the degenerate ribonucleotide analogue rPTP.

    PubMed Central

    Moriyama, K; Negishi, K; Briggs, M S; Smith, C L; Hill, F; Churcher, M J; Brown, D M; Loakes, D

    1998-01-01

    The synthesis and enzymatic incorporation into RNA of the hydrogen bond degenerate nucleoside analogue 6-(beta-d-ribofuranosyl)-3, 4-dihydro-8H-pyrimido[4,5-c]-[1,2]oxazin-7-one (P) is described. The 5'-triphosphate of this analogue is readily incorporated by T3, T7 and SP6 RNA polymerases into RNA transcripts, being best incorporated in place of UTP, but also in place of CTP. When all the uridine residues in an HIV-1 TAR RNA transcript are replaced by P the transcript has similar characteristics to the wild-type TAR RNA, as demonstrated by similar melting temperatures and CD spectra. The P-substituted TAR transcript binds to the Tat peptide ADP-1 with only 4-fold lowered efficiency compared with wild-type TAR. PMID:9547267

  6. Synthesis and RNA polymerase incorporation of the degenerate ribonucleotide analogue rPTP.

    PubMed

    Moriyama, K; Negishi, K; Briggs, M S; Smith, C L; Hill, F; Churcher, M J; Brown, D M; Loakes, D

    1998-05-01

    The synthesis and enzymatic incorporation into RNA of the hydrogen bond degenerate nucleoside analogue 6-(beta-d-ribofuranosyl)-3, 4-dihydro-8H-pyrimido[4,5-c]-[1,2]oxazin-7-one (P) is described. The 5'-triphosphate of this analogue is readily incorporated by T3, T7 and SP6 RNA polymerases into RNA transcripts, being best incorporated in place of UTP, but also in place of CTP. When all the uridine residues in an HIV-1 TAR RNA transcript are replaced by P the transcript has similar characteristics to the wild-type TAR RNA, as demonstrated by similar melting temperatures and CD spectra. The P-substituted TAR transcript binds to the Tat peptide ADP-1 with only 4-fold lowered efficiency compared with wild-type TAR.

  7. A Contemporary, Laboratory-Intensive Course on Messenger RNA Transcription and Processing

    ERIC Educational Resources Information Center

    Carson, Sue; Miller, Heather

    2012-01-01

    Messenger ribonucleic acid (mRNA) plays a pivotal role in the central dogma of molecular biology. Importantly, molecular events occurring during and after mRNA synthesis have the potential to create multiple proteins from one gene, leading to some of the remarkable protein diversity that genomes hold. The North Carolina State University…

  8. Growth, oxygen consumption, and protein and RNA synthesis rates in the yolk sac larvae of the African catfish (Clarias gariepinus).

    PubMed

    Smith, Richard W; Ottema, Colin

    2006-03-01

    Rapidly growing African catfish yolk sac larvae were investigated during the first 22 h after hatching. Body compartment protein concentration increased fourfold yet oxygen consumption remained constant (mean=21.3 +/- 3.2 nmol O2 mg(-1) protein h(-1)), suggesting fast growth results mainly from yolk sac protein absorption. The protein synthesis rates at 1-2 and 5-6 h also equaled the highest conceivable rates of muscle protein synthesis; 11.6-11.9% and 7.4-7.9% day(-1), respectively. Therefore the corresponding energetic costs of protein synthesis were almost the theoretical minimum; 13.0 +/- 1.7-16.3 +/- 2.8 micromol O2 mg(-1) protein synthesised. Total protein synthesis expenditure (74.5-77.7 micromol O2 g(-1) protein h(-1)) was also less than other yolk sac larvae. These protein synthesis rates resulted from high RNA concentrations (113.2 +/- 3.4 microg RNA mg(-1) protein) and were also correlated with RNA translational efficiency. High translational efficiency (1 h; 1.2+/-0.1 mg protein synthesised microg(-1) RNA day(-1)) equaled high synthesis rate (36.8 +/- 5.4 microg RNA microg(-1) DNA day(-1)) and both declined over 22 h. This investigation suggests rapid growth combines growth efficiency and compensatory energy partitioning. This accommodates the ontogenetic and phylogenetic standpoints imposed by energy budget limitations.

  9. Protocol for the Solid-phase Synthesis of Oligomers of RNA Containing a 2'-O-thiophenylmethyl Modification and Characterization via Circular Dichroism.

    PubMed

    Francis, Andrew J; Resendiz, Marino J E

    2017-07-28

    Solid-phase synthesis has been used to obtain canonical and modified polymers of nucleic acids, specifically of DNA or RNA, which has made it a popular methodology for applications in various fields and for different research purposes. The procedure described herein focuses on the synthesis, purification, and characterization of dodecamers of RNA 5'-[CUA CGG AAU CAU]-3' containing zero, one, or two modifications located at the C2'-O-position. The probes are based on 2-thiophenylmethyl groups, incorporated into RNA nucleotides via standard organic synthesis and introduced into the corresponding oligonucleotides via their respective phosphoramidites. This report makes use of phosphoramidite chemistry via the four canonical nucleobases (Uridine (U), Cytosine (C), Guanosine (G), Adenosine (A)), as well as 2-thiophenylmethyl functionalized nucleotides modified at the 2'-O-position; however, the methodology is amenable for a large variety of modifications that have been developed over the years. The oligonucleotides were synthesized on a controlled-pore glass (CPG) support followed by cleavage from the resin and deprotection under standard conditions, i.e., a mixture of ammonia and methylamine (AMA) followed by hydrogen fluoride/triethylamine/N-methylpyrrolidinone. The corresponding oligonucleotides were purified via polyacrylamide electrophoresis (20% denaturing) followed by elution, desalting, and isolation via reversed-phase chromatography (Sep-pak, C18-column). Quantification and structural parameters were assessed via ultraviolet-visible (UV-vis) and circular dichroism (CD) photometric analysis, respectively. This report aims to serve as a resource and guide for beginner and expert researchers interested in embarking in this field. It is expected to serve as a work-in-progress as new technologies and methodologies are developed. The description of the methodologies and techniques within this document correspond to a DNA/RNA synthesizer (refurbished and purchased in

  10. Thermodynamics of RNA duplexes modified with unlocked nucleic acid nucleotides

    PubMed Central

    Pasternak, Anna; Wengel, Jesper

    2010-01-01

    Thermodynamics provides insights into the influence of modified nucleotide residues on stability of nucleic acids and is crucial for designing duplexes with given properties. In this article, we introduce detailed thermodynamic analysis of RNA duplexes modified with unlocked nucleic acid (UNA) nucleotide residues. We investigate UNA single substitutions as well as model mismatch and dangling end effects. UNA residues placed in a central position makes RNA duplex structure less favourable by 4.0–6.6 kcal/mol. Slight destabilization, by ∼0.5–1.5 kcal/mol, is observed for 5′- or 3′-terminal UNA residues. Furthermore, thermodynamic effects caused by UNA residues are extremely additive with ΔG°37 conformity up to 98%. Direct mismatches involving UNA residues decrease the thermodynamic stability less than unmodified mismatches in RNA duplexes. Additionally, the presence of UNA residues adjacent to unpaired RNA residues reduces mismatch discrimination. Thermodynamic analysis of UNA 5′- and 3′-dangling ends revealed that stacking interactions of UNA residues are always less favourable than that of RNA residues. Finally, circular dichroism spectra imply no changes in overall A-form structure of UNA–RNA/RNA duplexes relative to the unmodified RNA duplexes. PMID:20562222

  11. Abscisic acid is involved in the iron-induced synthesis of maize ferritin.

    PubMed Central

    Lobréaux, S; Hardy, T; Briat, J F

    1993-01-01

    The ubiquitous iron storage protein ferritin has a highly conserved structure in plants and animals, but a distinct cytological location and a different level of control in response to iron excess. Plant ferritins are plastid-localized and transcriptionally regulated in response to iron, while animal ferritins are found in the cytoplasm and have their expression mainly controlled at the translational level. In order to understand the basis of these differences, we developed hydroponic cultures of maize plantlets which allowed an increase in the intracellular iron concentration, leading to a transient accumulation of ferritin mRNA and protein (Lobréaux,S., Massenet,O. and Briat,J.F., 1992, Plant Mol. Biol., 19, 563-575). Here, it is shown that iron induces ferritin and RAB (Responsive to Abscisic Acid) mRNA accumulation relatively with abscisic acid (ABA) accumulation. Ferritin mRNA also accumulates in response to exogenous ABA. Synergistic experiments demonstrate that the ABA and iron responses are linked, although full expression of the ferritin genes cannot be entirely explained by an increase in ABA concentration. Inducibility of ferritin mRNA accumulation by iron is dramatically decreased in the maize ABA-deficient mutant vp2 and can be rescued by addition of exogenous ABA, confirming the involvement of ABA in the iron response in plants. Therefore, it is concluded that a major part of the iron-induced biosynthesis of ferritin is achieved through a pathway involving an increase in the level of the plant hormone ABA. The general conclusion of this work is that the synthesis of the same protein in response to the same environmental signal can be controlled by separate and distinct mechanisms in plants and animals. Images PMID:8440255

  12. tRNA acceptor-stem and anticodon bases embed separate features of amino acid chemistry

    PubMed Central

    Carter, Charles W.; Wolfenden, Richard

    2016-01-01

    abstract The universal genetic code is a translation table by which nucleic acid sequences can be interpreted as polypeptides with a wide range of biological functions. That information is used by aminoacyl-tRNA synthetases to translate the code. Moreover, amino acid properties dictate protein folding. We recently reported that digital correlation techniques could identify patterns in tRNA identity elements that govern recognition by synthetases. Our analysis, and the functionality of truncated synthetases that cannot recognize the tRNA anticodon, support the conclusion that the tRNA acceptor stem houses an independent code for the same 20 amino acids that likely functioned earlier in the emergence of genetics. The acceptor-stem code, related to amino acid size, is distinct from a code in the anticodon that is related to amino acid polarity. Details of the acceptor-stem code suggest that it was useful in preserving key properties of stereochemically-encoded peptides that had developed the capacity to interact catalytically with RNA. The quantitative embedding of the chemical properties of amino acids into tRNA bases has implications for the origins of molecular biology. PMID:26595350

  13. The spark discharge synthesis of amino acids from various hydrocarbons

    NASA Technical Reports Server (NTRS)

    Ring, D.; Miller, S. L.

    1984-01-01

    The spark discharge synthesis of amino acids using an atmosphere of CH4+N2+H2O+NH3 has been investigated with variable pNH3. The amino acids produced using higher hydrocarbons (ethane, ethylene, acetylene, propane, butane, and isobutane) instead of CH4 were also investigated. There was considerable range in the absolute yields of amino acids, but the yields relative to glycine (or alpha-amino-n-butyric acid) were more uniform. The relative yields of the C3 to C6 aliphatic alpha-amino acids are nearly the same (with a few exceptions) with all the hydrocarbons. The glycine yields are more variable. The precursors to the C3-C6 aliphatic amino acids seem to be produced in the same process, which is separate from the synthesis of glycine precursors. It may be possible to use these relative yields as a signature for a spark discharge synthesis provided corrections can be made for subsequent decomposition events (e.g. in the Murchison meteorite).

  14. Synthesis of coronavirus mRNAs: kinetics of inactivation of infectious bronchitis virus RNA synthesis by UV light. [Chickens

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stern, D.F.; Sefton, B.M.

    Infection of cells with the avian coronavirus infectious bronchitis virus results in the synthesis of five major subgenomic RNAs. These RNAs and the viral genome form a 3' coterminal nested set. We found that the rates of inactivation of synthesis of the RNAs by UV light were different and increased with the length of the transcript. These results show that each RNA is transcribed from a unique promoter and that extensive processing of the primary transcripts probably does not occur.

  15. Crystal structures and biochemical analyses suggest a unique mechanism and role for human glycyl-tRNA synthetase in Ap4A homeostasis.

    PubMed

    Guo, Rey-Ting; Chong, Yeeting E; Guo, Min; Yang, Xiang-Lei

    2009-10-16

    Aminoacyl-tRNA synthetases catalyze the attachment of amino acids to their cognate tRNAs for protein synthesis. However, the aminoacylation reaction can be diverted to produce diadenosine tetraphosphate (Ap4A), a universal pleiotropic signaling molecule needed for cell regulation pathways. The only known mechanism for Ap4A production by a tRNA synthetase is through the aminoacylation reaction intermediate aminoacyl-AMP, thus making Ap4A synthesis amino acid-dependent. Here, we demonstrate a new mechanism for Ap4A synthesis. Crystal structures and biochemical analyses show that human glycyl-tRNA synthetase (GlyRS) produces Ap4A by direct condensation of two ATPs, independent of glycine concentration. Interestingly, whereas the first ATP-binding pocket is conserved for all class II tRNA synthetases, the second ATP pocket is formed by an insertion domain that is unique to GlyRS, suggesting that GlyRS is the only tRNA synthetase catalyzing direct Ap4A synthesis. A special role for GlyRS in Ap4A homeostasis is proposed.

  16. Crystal Structures and Biochemical Analyses Suggest a Unique Mechanism and Role for Human Glycyl-tRNA Synthetase in Ap4A Homeostasis*

    PubMed Central

    Guo, Rey-Ting; Chong, Yeeting E.; Guo, Min; Yang, Xiang-Lei

    2009-01-01

    Aminoacyl-tRNA synthetases catalyze the attachment of amino acids to their cognate tRNAs for protein synthesis. However, the aminoacylation reaction can be diverted to produce diadenosine tetraphosphate (Ap4A), a universal pleiotropic signaling molecule needed for cell regulation pathways. The only known mechanism for Ap4A production by a tRNA synthetase is through the aminoacylation reaction intermediate aminoacyl-AMP, thus making Ap4A synthesis amino acid-dependent. Here, we demonstrate a new mechanism for Ap4A synthesis. Crystal structures and biochemical analyses show that human glycyl-tRNA synthetase (GlyRS) produces Ap4A by direct condensation of two ATPs, independent of glycine concentration. Interestingly, whereas the first ATP-binding pocket is conserved for all class II tRNA synthetases, the second ATP pocket is formed by an insertion domain that is unique to GlyRS, suggesting that GlyRS is the only tRNA synthetase catalyzing direct Ap4A synthesis. A special role for GlyRS in Ap4A homeostasis is proposed. PMID:19710017

  17. Changes in isoprenoid lipid synthesis by gemfibrozil and clofibric acid in rat hepatocytes.

    PubMed

    Hashimoto, F; Taira, S; Hayashi, H

    2000-05-15

    We studied whether gemfibrozil and clofibric acid alter isoprenoid lipid synthesis in rat hepatocytes. After incubation of the cells with the agent for 74 hr, [(14)C]acetate or [(3)H]mevalonate was added, and the cells were further incubated for 4 hr. Gemfibrozil and clofibric acid increased ubiquinone synthesis from [(14)C]acetate and [(3)H]mevalonate. The effect of gemfibrozil was greater than that of clofibric acid. Also, gemfibrozil decreased dolichol synthesis from [(14)C]acetate and [(3)H]mevalonate. However, clofibric acid increased dolichol synthesis from [(3)H]mevalonate. Gemfibrozil decreased cholesterol synthesis from [(14)C]acetate and [(3)H]mevalonate. Clofibric acid decreased cholesterol synthesis from [(14)C]acetate, but did not affect synthesis from [(3)H]mevalonate. These results suggest that both agents, at different rates, activate the synthetic pathway of ubiquinone, at least from mevalonate. Gemfibrozil may inhibit the synthetic pathway of dolichol, at least from mevalonate. Contrary to gemfibrozil, clofibric acid may activate the synthetic pathway of dolichol from mevalonate. Gemfibrozil may inhibit the synthetic pathway of cholesterol from mevalonate in addition to the pathway from acetate to mevalonate inhibited by both agents.

  18. Induction of phytic acid synthesis by abscisic acid in suspension-cultured cells of rice.

    PubMed

    Matsuno, Koya; Fujimura, Tatsuhito

    2014-03-01

    A pathway of phytic acid (PA) synthesis in plants has been revealed via investigations of low phytic acid mutants. However, the regulation of this pathway is not well understood because it is difficult to control the environments of cells in the seeds, where PA is mainly synthesized. We modified a rice suspension culture system in order to study the regulation of PA synthesis. Rice cells cultured with abscisic acid (ABA) accumulate PA at higher levels than cells cultured without ABA, and PA accumulation levels increase with ABA concentration. On the other hand, higher concentrations of sucrose or inorganic phosphorus do not affect PA accumulation. Mutations in the genes RINO1, OsMIK, OsIPK1 and OsLPA1 have each been reported to confer low phytic acid phenotypes in seeds. Each of these genes is upregulated in cells cultured with ABA. OsITPK4 and OsITPK6 are upregulated in cells cultured with ABA and in developing seeds. These results suggest that the regulation of PA synthesis is similar between developing seeds and cells in this suspension culture system. This system will be a powerful tool for elucidating the regulation of PA synthesis. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  19. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the snythesis methods of the prior art.

  20. Is Bacterial Fatty Acid Synthesis a Valid Target for Antibacterial Drug Discovery?

    PubMed Central

    Parsons, Joshua B.; Rock, Charles O.

    2011-01-01

    The emergence of resistance against most current drugs emphasizes the need to develop new approaches to control bacterial pathogens, particularly Staphylococcus aureus. Bacterial fatty acid synthesis is one such target that is being actively pursued by several research groups to develop anti-Staphylococcal agents. Recently, the wisdom of this approach has been challenged based on the ability of a Gram-positive bacterium to incorporate extracellular fatty acids and thus circumvent the inhibition of de novo fatty acid synthesis. The generality of this conclusion has been challenged, and there is enough diversity in the enzymes and regulation of fatty acid synthesis in bacteria to conclude that there isn’t a single organism that can be considered typical and representative of bacteria as a whole. We are left without a clear resolution to this ongoing debate and await new basic research to define the pathways for fatty acid uptake and that determine the biochemical and genetic mechanisms for the regulation of fatty acid synthesis in Gram-positive bacteria. These crucial experiments will determine whether diversity in the control of this important pathway accounts for the apparently different responses of Gram-positive bacteria to the inhibition of de novo fatty acid synthesis in presence of extracellular fatty acid supplements. PMID:21862391

  1. Mutational analysis reveals a noncontractile but interactive role of actin and profilin in viral RNA-dependent RNA synthesis.

    PubMed

    Harpen, Mary; Barik, Tiasha; Musiyenko, Alla; Barik, Sailen

    2009-11-01

    As obligatory parasites, viruses co-opt a variety of cellular functions for robust replication. The expression of the nonsegmented negative-strand RNA genome of respiratory syncytial virus (RSV), a significant pediatric pathogen, absolutely requires actin and is stimulated by the actin-regulatory protein profilin. As actin is a major contractile protein, it was important to determine whether the known functional domains of actin and profilin were important for their ability to activate RSV transcription. Analyses of recombinant mutants in a reconstituted RSV transcription system suggested that the divalent-cation-binding domain of actin is critically needed for binding to the RSV genome template and for the activation of viral RNA synthesis. In contrast, the nucleotide-binding domain and the N-terminal acidic domain were needed neither for template binding nor for transcription. Specific surface residues of actin, required for actin-actin contact during filamentation, were also nonessential for viral transcription. Unlike actin, profilin did not directly bind to the viral template but was recruited by actin. Mutation of the interactive residues of actin or profilin, resulting in the loss of actin-profilin binding, also abolished profilin's ability to stimulate viral transcription. Together, these results suggest that actin acts as a classical transcription factor for the virus by divalent-cation-dependent binding to the viral template and that profilin acts as a transcriptional cofactor, in part by associating with actin. This essential viral role of actin is independent of its contractile cellular role.

  2. Synthesis of dicationic diaryltriazines nucleic acid binding agents

    PubMed Central

    Spychala, J; Wilson, WD; Zhao, M; Tidwell, RR; Dykstra, CC; Hall, JE; Jones, SK; Schinazi, RF

    2010-01-01

    Summary — The synthesis of 2,4-bis[4-(4,5-dihydro-1H-imidazol-2-yl)phenyl]-1,3,5-triazine 6a and 2,4-bis[4-(1,4,5,6-tetrahydropyrimidin-2-yl)phenyl]-1,3,5-triazine 6b in 3 steps from either 4-bromobenzamidine or 4-(carbamoyl)benzamidine is reported. The synthesis of 4,6-bis[4-(4,5-dihydro-1H-imidazol-2-yl)phenyl]-2-dimethylamino-1,3,5-triazine 9a and 4,6-bis[4-(1,4,5,6-tetrahydropyrimidin-2-yl)phenyl]-2-dimethylamino-1,3,5-triazine 9b in 2 steps from 1,4-dicyanobenzene is also described. The compounds 6b and 9b bind strongly to DNA model sequences and inhibit topoisomerase II from 2 microbial sources. Compounds 6a and 9a bind to both DNA and RNA model sequences whereas 6b and 9b essentially do not bind to the RNA model. PMID:21556310

  3. Osteoblast fibronectin mRNA, protein synthesis, and matrix are unchanged after exposure to microgravity

    NASA Technical Reports Server (NTRS)

    Hughes-Fulford, M.; Gilbertson, V.

    1999-01-01

    The well-defined osteoblast line, MC3T3-E1 was used to examine fibronectin (FN) mRNA levels, protein synthesis, and extracellular FN matrix accumulation after growth activation in spaceflight. These osteoblasts produce FN extracellular matrix (ECM) known to regulate adhesion, differentiation, and function in adherent cells. Changes in bone ECM and osteoblast cell shape occur in spaceflight. To determine whether altered FN matrix is a factor in causing these changes in spaceflight, quiescent osteoblasts were launched into microgravity and were then sera activated with and without a 1-gravity field. Synthesis of FN mRNA, protein, and matrix were measured after activation in microgravity. FN mRNA synthesis is significantly reduced in microgravity (0-G) when compared to ground (GR) osteoblasts flown in a centrifuge simulating earth's gravity (1-G) field 2.5 h after activation. However, 27.5 h after activation there were no significant differences in mRNA synthesis. A small but significant reduction of FN protein was found in the 0-G samples 2.5 h after activation. Total FN protein 27.5 h after activation showed no significant difference between any of the gravity conditions, however, there was a fourfold increase in absolute amount of protein synthesized during the incubation. Using immunofluorescence, we found no significant differences in the amount or in the orientation of the FN matrix after 27.5 h in microgravity. These results demonstrate that FN is made by sera-activated osteoblasts even during exposure to microgravity. These data also suggest that after a total period of 43 h of spaceflight FN transcription, translation, or altered matrix assembly is not responsible for the altered cell shape or altered matrix formation of osteoblasts.

  4. Effect of insulin on human skeletal muscle mitochondrial ATP production, protein synthesis, and mRNA transcripts

    NASA Astrophysics Data System (ADS)

    Stump, Craig S.; Short, Kevin R.; Bigelow, Maureen L.; Schimke, Jill M.; Sreekumaran Nair, K.

    2003-06-01

    Mitochondria are the primary site of skeletal muscle fuel metabolism and ATP production. Although insulin is a major regulator of fuel metabolism, its effect on mitochondrial ATP production is not known. Here we report increases in vastus lateralis muscle mitochondrial ATP production capacity (32-42%) in healthy humans (P < 0.01) i.v. infused with insulin (1.5 milliunits/kg of fat-free mass per min) while clamping glucose, amino acids, glucagon, and growth hormone. Increased ATP production occurred in association with increased mRNA levels from both mitochondrial (NADH dehydrogenase subunit IV) and nuclear [cytochrome c oxidase (COX) subunit IV] genes (164-180%) encoding mitochondrial proteins (P < 0.05). In addition, muscle mitochondrial protein synthesis, and COX and citrate synthase enzyme activities were increased by insulin (P < 0.05). Further studies demonstrated no effect of low to high insulin levels on muscle mitochondrial ATP production for people with type 2 diabetes mellitus, whereas matched nondiabetic controls increased 16-26% (P < 0.02) when four different substrate combinations were used. In conclusion, insulin stimulates mitochondrial oxidative phosphorylation in skeletal muscle along with synthesis of gene transcripts and mitochondrial protein in human subjects. Skeletal muscle of type 2 diabetic patients has a reduced capacity to increase ATP production with high insulin levels. cytochrome c oxidase | NADH dehydrogenase subunit IV | amino acids | citrate synthase

  5. Podoscyphic acid, a new inhibitor of avian myeloblastosis virus and Moloney murine leukemia virus reverse transcriptase from a Podoscypha species.

    PubMed

    Erkel, G; Anke, T; Velten, R; Steglich, W

    1991-01-01

    A novel enzyme inhibitor of RNA-directed DNA-polymerases of avian myeloblastosis and murine leukemia virus was isolated from fermentations of an tasmanian Podoscypha species. Its structure was elucidated by spectroscopic methods and oxidative degradation as (E)-4,5-dioxo-2-hexadecenoic acid (1). The enzyme inhibitor, which was named podoscyphic acid, did not inhibit DNA and RNA synthesis in permeabilized L 1210 cells nor did it affect RNA synthesis in isolated nuclei of L 1210 cells. 1 inhibits protein synthesis in whole L 1210 cells and rabbit reticulocyte lysate and shows very weak antimicrobial and cytotoxic properties. The testing of ethyl (E)-4,5-dioxo-2-hexadecenoate (2) and (E)-4-oxo-2-tetradecenoic acid (11) revealed the importance of the free gamma-oxoacrylic acid unit for the biological activities of 1.

  6. Identification of a broad-spectrum inhibitor of virus RNA synthesis: validation of a prototype virus-based approach

    PubMed Central

    Filone, Claire Marie; Hodges, Erin N.; Honeyman, Brian; Bushkin, G. Guy; Boyd, Karla; Platt, Andrew; Ni, Feng; Strom, Kyle; Hensley, Lisa; Snyder, John K.; Connor, John H.

    2013-01-01

    There are no approved therapeutics for the most deadly nonsegmented negative-strand (NNS) RNA viruses, including Ebola (EBOV). To identify new chemical scaffolds for development of broad-spectrum antivirals, we undertook a prototype-based lead identification screen. Using the prototype NNS virus, vesicular stomatitis virus (VSV), multiple inhibitory compounds were identified. Three compounds were investigated for broad-spectrum activity, and inhibited EBOV infection. The most potent, CMLDBU3402, was selected for further study. CMLDBU3402 did not show significant activity against segmented negative-strand RNA viruses suggesting proscribed broad-spectrum activity. Mechanistic analysis indicated that CMLDBU3402 blocked VSV viral RNA synthesis and inhibited EBOV RNA transcription, demonstrating a consistent mechanism of action against genetically distinct viruses. The identification of this chemical backbone as a broad-spectrum inhibitor of viral RNA synthesis offers significant potential for the development of new therapies for highly pathogenic viruses. PMID:23521799

  7. Biotin and Lipoic Acid: Synthesis, Attachment and Regulation

    PubMed Central

    Cronan, John E.

    2014-01-01

    Summary Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as “swinging arms” that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well-described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like “arm” of biotin were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise and the BioH esterase for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl-ACP of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyl transferase followed by sulfur insertion at carbons C6 and C8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized and thus there is no transcriptional control of the synthetic genes. In contrast transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system, exerted through BirA a dual function protein that both represses

  8. Distribution, industrial applications, and enzymatic synthesis of D-amino acids.

    PubMed

    Gao, Xiuzhen; Ma, Qinyuan; Zhu, Hailiang

    2015-04-01

    D-Amino acids exist widely in microbes, plants, animals, and food and can be applied in pharmaceutical, food, and cosmetics. Because of their widespread applications in industry, D-amino acids have recently received more and more attention. Enzymes including D-hydantoinase, N-acyl-D-amino acid amidohydrolase, D-amino acid amidase, D-aminopeptidase, D-peptidase, L-amino acid oxidase, D-amino acid aminotransferase, and D-amino acid dehydrogenase can be used for D-amino acids synthesis by kinetic resolution or asymmetric amination. In this review, the distribution, industrial applications, and enzymatic synthesis methods are summarized. And, among all the current enzymatic methods, D-amino acid dehydrogenase method not only produces D-amino acid by a one-step reaction but also takes environment and atom economics into consideration; therefore, it is deserved to be paid more attention.

  9. Conjugated linoleic acid synthesis-related protein proteasome subunit α 5 (PSMA5) is increased by vaccenic acid treatment in goat mammary tissue.

    PubMed

    Jin, Y C; Li, Z H; Hong, Z S; Xu, C X; Han, J A; Choi, S H; Yin, J L; Zhang, Q K; Lee, K B; Kang, S K; Song, M K; Kim, Y J; Kang, H S; Choi, Y J; Lee, H G

    2012-08-01

    This study was conducted to identify proteins associated with the endogenous synthesis of conjugated linoleic acid (CLA) from trans-vaccenic acid (TVA; trans-11 C18:1, a precursor for CLA endogenous synthesis) in mammary tissues. Six lactating goats were divided into 2 groups. One group was given an intravenous bolus injection of TVA (150mg) twice daily over 4 d; the other group received saline injections. Treatment with TVA increased the concentration of cis-9,trans-11 CLA and TVA in goat milk. Additionally, TVA treatment increased the expression of stearoyl-CoA desaturase (SCD) in mammary tissue. Using 2-dimensional gel electrophoresis and electrospray ionization quadrupole time-of-flight mass spectrometry, 3 proteins affected by infusions of TVA were identified. Proteasome (prosome, macropain) subunit α type 5 (PSMA5) was upregulated, whereas peroxiredoxin-1 and translationally controlled tumor protein 1 were downregulated in TVA-treated animals compared with the vehicle-injected controls. Only the effect of TVA on PSMA5 could be confirmed by Western blot analysis. To further explore the regulation of PSMA5 in mammary epithelial cells when TVA is converted into CLA, we used a differentiated bovine mammary epithelial cell line treated with TVA for 6h. Changes in cis-9,trans-11 CLA concentrations and mRNA expression patterns of both SCD and PSMA5 were monitored. The concentration of cis-9,trans-11 CLA increased after TVA treatment. The mRNA expression level of PSMA5 was significantly elevated to 6h, but SCD mRNA expression only increased in 2h after TVA treatment. These results indicate that PSMA5 is highly expressed in goat mammary tissue and bovine mammary epithelial cells when TVA is converted into CLA. Our data suggest that PSMA5 protein is associated with CLA biosynthesis in mammary tissue. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  10. α-Amanitin-Resistant Viral RNA Synthesis in Nuclei Isolated from Nuclear Polyhedrosis Virus-Infected Heliothis zea Larvae and Spodoptera frugiperda Cells

    PubMed Central

    Grula, Marjori A.; Buller, Patricia L.; Weaver, Robert F.

    1981-01-01

    [3H]RNA was synthesized in nuclei isolated at various times postinfection from the fat bodies of Heliothis zea larvae infected with H. zea nuclear polyhedrosis virus and from cultured Spodoptera frugiperda cells infected with Autographa californica nuclear polyhedrosis virus. To detect virus-specific RNA synthesis, the [3H]RNA was hybridized to denatured viral DNA immobilized on nitrocellulose filters. Nuclear polyhedrosis virus-specific RNA synthesis in the infected nuclei isolated from H. zea larval fat bodies and S. frugiperda cells was only inhibited 20 to 25% by concentrations of α-amanitin sufficient to inhibit the host RNA polymerase II. In addition, a productive nuclear polyhedrosis virus infection was obtained in S. frugiperda cells grown in the presence of an α-amanitin concentration that inhibited 90% of the cellular RNA polymerase II activity. The cellular RNA polymerase II enzyme remained sensitive to α-amanitin during infection, and there was no evidence that a virus-coded, α-amanitin-resistant enzyme was synthesized after the onset of infection. The data suggest that the bulk of nuclear polyhedrosis virus-specific RNA synthesis in isolated nuclei is transcribed by an enzyme other than the host RNA polymerase II. PMID:16789208

  11. Chitosan/Hyaluronic Acid Nanoparticles: Rational Design Revisited for RNA Delivery.

    PubMed

    Lallana, Enrique; Rios de la Rosa, Julio M; Tirella, Annalisa; Pelliccia, Maria; Gennari, Arianna; Stratford, Ian J; Puri, Sanyogitta; Ashford, Marianne; Tirelli, Nicola

    2017-07-03

    Chitosan/hyaluronic acid (HA) nanoparticles can be used to deliver an RNA/DNA cargo to cells overexpressing HA receptors such as CD44. For these systems, unequivocal links have not been established yet between chitosan macromolecular (molecular weight; degree of deacetylation, i.e., charge density) and nanoparticle variables (complexation strength, i.e., stability; nucleic acid protection; internalization rate) on one hand, and transfection efficiency on the other hand. Here, we have focused on the role of avidity on transfection efficiency in the CD44-expressing HCT-116 as a cellular model; we have employed two differently sized payloads (a large luciferase-encoding mRNA and a much smaller anti-Luc siRNA), and a small library of chitosans (variable molecular weight and degree of deactylation). The RNA avidity for chitosan showed-as expected-an inverse relationship: higher avidity-higher polyplex stability-lower transfection efficiency. The avidity of chitosan for RNA appears to lead to opposite effects: higher avidity-higher polyplex stability but also higher transfection efficiency. Surprisingly, the best transfecting particles were those with the lowest propensity for RNA release, although this might be a misleading relationship: for example, the same macromolecular parameters that increase avidity can also boost chitosan's endosomolytic activity, with a strong enhancement in transfection. The performance of these nonviral vectors appears therefore difficult to predict simply on the basis of carrier- or payload-related variables, and a more holistic consideration of the journey of the nanoparticle, from cell uptake to cytosolic bioavailability of payload, is needed. It is also noteworthy that the nanoparticles used in this study showed optimal performance under slightly acidic conditions (pH 6.4), which is promising for applications in a tumoral extracellular environment. It is also worth pointing out that under these conditions we have for the first time

  12. trans-10,cis-12 conjugated linoleic acid alters lipid metabolism of goat mammary epithelial cells by regulation of de novo synthesis and the AMPK signaling pathway.

    PubMed

    Zhang, T Y; Huang, J T; Tian, H B; Ma, Y; Chen, Z; Wang, J J; Shi, H P; Luo, J

    2018-06-01

    The trans-10,cis-12 isomer of conjugated linoleic acid (t10c12-CLA) is a biohydrogenation intermediate in the rumen and has been shown to cause milk fat depression in dairy goats. However, few studies have focused on the in vitro molecular mechanisms involved in the response of the goat mammary gland to t10c12-CLA. In the present study, RNA sequencing technology was used to investigate the effects of t10c12-CLA on goat mammary epithelial cells. From the data, 25,153 annotated transcripts were obtained, and differentially expressed genes were selected based on a false discovery rate <0.05. Candidate genes and potent cellular signaling pathways were identified through Gene Ontology (GO) and pathway analysis. Next, real-time quantitative PCR and Western blot analyses were used to verify the results of the RNA sequencing data. The results indicated that t10c12-CLA inhibits fatty acid synthesis through downregulation of genes involved in de novo fatty acid synthesis, and this process is likely correlated with the activation of the AMP-activated protein kinase signaling pathways. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  13. Derivatives of diphosphonic acids: synthesis and biological activity

    NASA Astrophysics Data System (ADS)

    Zolotukhina, M. M.; Krutikov, V. I.; Lavrent'ev, A. N.

    1993-07-01

    The scientific-technical and patent literature on the synthesis of derivatives of diphosphonic acids is surveyed. Various methods of synthesis of diphosphonate, phosphonylphosphinyl, and phosphonophosphate compounds are described. The principal aspects of the use of the above compounds in medicine, biochemistry, and agriculture are examined. The bibliography includes 174 references.

  14. NUCLEIC ACID AND PROTEIN METABOLISM DURING THE MITOTIC CYCLE IN VICIA FABA

    PubMed Central

    Woodard, John; Rasch, Ellen; Swift, Hewson

    1961-01-01

    In order to investigate some of the cytochemical processes involved in interphase growth and culminating in cell division, a combined autoradiographic and microphotometric study of nucleic acids and proteins was undertaken on statistically seriated cells of Vicia faba root meristems. Adenine-8-C14 and uridine-H3 were used as ribonucleic acid (RNA) precursors, thymidine-H3 as a deoxyribonucleic acid (DNA) precursor, and phenylalanine-3-C14 as a protein precursor. Stains used in microphotometry were Feulgen (DNA), azure B (RNA), pH 2.0 fast green (total protein), and pH 8.1 fast green (histone). The autoradiographic data (representing rate of incorporation per organelle) and the microphotometric data (representing changes in amounts of the various components) indicate that the mitotic cycle may be divided into several metabolic phases, three predominantly anabolic (net increase), and a fourth phase predominantly catabolic (net decrease). The anabolic periods are: 1. Telophase to post-telophase during which there are high rates of accumulation of cytoplasmic and nucleolar RNA and nucleolar and chromosomal total protein. 2. Post-telophase to preprophase characterized by histone synthesis and a diphasic synthesis of DNA with the peak of synthesis at mid-interphase and a minor peak just preceding prophase. The minor peak is coincident with a relatively localized DNA synthesis in several chromosomal regions. This period is also characterized by minimal accumulations of cytoplasmic RNA and chromosomal and nucleolar total protein and RNA. 3. Preprophase to prophase in which there are again high rates of accumulation of cytoplasmic RNA, and nucleolar and chromosomal total protein and RNA. The catabolic phase is: 4. The mitotic division during which there are marked losses of cytoplasmic RNA and chromosomal and nucleolar total protein and RNA. PMID:13786522

  15. Initiation of viral RNA-dependent RNA polymerization.

    PubMed

    van Dijk, Alberdina A; Makeyev, Eugene V; Bamford, Dennis H

    2004-05-01

    This review summarizes the combined insights from recent structural and functional studies of viral RNA-dependent RNA polymerases (RdRPs) with the primary focus on the mechanisms of initiation of RNA synthesis. Replication of RNA viruses has traditionally been approached using a combination of biochemical and genetic methods. Recently, high-resolution structures of six viral RdRPs have been determined. For three RdRPs, enzyme complexes with metal ions, single-stranded RNA and/or nucleoside triphosphates have also been solved. These advances have expanded our understanding of the molecular mechanisms of viral RNA synthesis and facilitated further RdRP studies by informed site-directed mutagenesis. What transpires is that the basic polymerase right hand shape provides the correct geometrical arrangement of substrate molecules and metal ions at the active site for the nucleotidyl transfer catalysis, while distinct structural elements have evolved in the different systems to ensure efficient initiation of RNA synthesis. These elements feed the template, NTPs and ions into the catalytic cavity, correctly position the template 3' terminus, transfer the products out of the catalytic site and orchestrate the transition from initiation to elongation.

  16. Effects of single amino acid deficiency on mRNA translation are markedly different for methionine versus leucine.

    PubMed

    Mazor, Kevin M; Dong, Leiming; Mao, Yuanhui; Swanda, Robert V; Qian, Shu-Bing; Stipanuk, Martha H

    2018-05-24

    Although amino acids are known regulators of translation, the unique contributions of specific amino acids are not well understood. We compared effects of culturing HEK293T cells in medium lacking either leucine, methionine, histidine, or arginine on eIF2 and 4EBP1 phosphorylation and measures of mRNA translation. Methionine starvation caused the most drastic decrease in translation as assessed by polysome formation, ribosome profiling, and a measure of protein synthesis (puromycin-labeled polypeptides) but had no significant effect on eIF2 phosphorylation, 4EBP1 hyperphosphorylation or 4EBP1 binding to eIF4E. Leucine starvation suppressed polysome formation and was the only tested condition that caused a significant decrease in 4EBP1 phosphorylation or increase in 4EBP1 binding to eIF4E, but effects of leucine starvation were not replicated by overexpressing nonphosphorylatable 4EBP1. This suggests the binding of 4EBP1 to eIF4E may not by itself explain the suppression of mRNA translation under conditions of leucine starvation. Ribosome profiling suggested that leucine deprivation may primarily inhibit ribosome loading, whereas methionine deprivation may primarily impair start site recognition. These data underscore our lack of a full understanding of how mRNA translation is regulated and point to a unique regulatory role of methionine status on translation initiation that is not dependent upon eIF2 phosphorylation.

  17. Identification of influenza A nucleoprotein body domain residues essential for viral RNA expression expose antiviral target.

    PubMed

    Davis, Alicia M; Ramirez, Jose; Newcomb, Laura L

    2017-02-07

    Influenza A virus is controlled with yearly vaccination while emerging global pandemics are kept at bay with antiviral medications. Unfortunately, influenza A viruses have emerged resistance to approved influenza antivirals. Accordingly, there is an urgent need for novel antivirals to combat emerging influenza A viruses resistant to current treatments. Conserved viral proteins are ideal targets because conserved protein domains are present in most, if not all, influenza subtypes, and are presumed less prone to evolve viable resistant versions. The threat of an antiviral resistant influenza pandemic justifies our study to identify and characterize antiviral targets within influenza proteins that are highly conserved. Influenza A nucleoprotein (NP) is highly conserved and plays essential roles throughout the viral lifecycle, including viral RNA synthesis. Using NP crystal structure, we targeted accessible amino acids for substitution. To characterize the NP proteins, reconstituted viral ribonucleoproteins (vRNPs) were expressed in 293 T cells, RNA was isolated, and reverse transcription - quantitative PCR (RT-qPCR) was employed to assess viral RNA expressed from reconstituted vRNPs. Location was confirmed using cellular fractionation and western blot, along with observation of NP-GFP fusion proteins. Nucleic acid binding, oligomerization, and vRNP formation, were each assessed with native gel electrophoresis. Here we report characterization of an accessible and conserved five amino acid region within the NP body domain that plays a redundant but essential role in viral RNA synthesis. Our data demonstrate substitutions in this domain did not alter NP localization, oligomerization, or ability to bind nucleic acids, yet resulted in a defect in viral RNA expression. To define this region further, single and double amino acid substitutions were constructed and investigated. All NP single substitutions were functional, suggesting redundancy, yet different combinations of

  18. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  19. A new regulatory mechanism for bacterial lipoic acid synthesis.

    PubMed

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-22

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. © 2015

  20. Effects of postprandial starvation on mRNA expression of endocrine-, amino acid and peptide transporter-, and metabolic enzyme-related genes in zebrafish (Danio rerio).

    PubMed

    Tian, Juan; He, Gen; Mai, Kangsen; Liu, Chengdong

    2015-06-01

    The goal of this study was to systematically evaluate the molecular activities of endocrine-, amino acid and peptide transporters-, and metabolic enzyme-related genes in 35-day-old mixed-sex zebrafish (Danio rerio) after feeding . Zebrafish with initial body weights ranging from 9 to 11 mg were fasted for 384 h in a controlled indoor environment. Fish were sampled at 0, 3, 6, 12, 24, 48, 96, 192, and 384 h after fed. Overall, the present study results show that the regulatory mechanism that insulin-like growth factor I negative feedback regulated growth hormone is conserved in zebrafish, as it is in mammals, but that regulation of growth hormone receptors is highly intricate. Leptin and cholecystokinin are time-dependent negative feedback signals, and neuropeptide Y may be an important positive neuropeptide for food intake in zebrafish. The amino acid/carnitine transporters B(0,+) (ATB(0,+)) and broad neutral (0) amino acid transporter 1(B(0)AT1) mRNA levels measured in our study suggest that protein may be utilized during 24-96 h of fasting in zebrafish. Glutamine synthetase mRNA levels were downregulated, and glutamate dehydrogenase, alanine aminotransferase, aspartate transaminase, and trypsin mRNA levels were upregulated after longtime fasting in this study. The mRNA expression levels of fatty acid synthetase decreased significantly (P < 0.05), whereas those of lipoprotein lipase rapidly increased after 96 h of fasting. Fasting activated the expression of glucose synthesis genes when fasting for short periods of time; when fasting is prolonged, the mRNA levels of glucose breakdown enzymes and pentose phosphate shunt genes decreased.

  1. Covalent Strategies for Targeting Messenger and Non-Coding RNAs: An Updated Review on siRNA, miRNA and antimiR Conjugates

    PubMed Central

    Grijalvo, Santiago; Alagia, Adele

    2018-01-01

    Oligonucleotide-based therapy has become an alternative to classical approaches in the search of novel therapeutics involving gene-related diseases. Several mechanisms have been described in which demonstrate the pivotal role of oligonucleotide for modulating gene expression. Antisense oligonucleotides (ASOs) and more recently siRNAs and miRNAs have made important contributions either in reducing aberrant protein levels by sequence-specific targeting messenger RNAs (mRNAs) or restoring the anomalous levels of non-coding RNAs (ncRNAs) that are involved in a good number of diseases including cancer. In addition to formulation approaches which have contributed to accelerate the presence of ASOs, siRNAs and miRNAs in clinical trials; the covalent linkage between non-viral vectors and nucleic acids has also added value and opened new perspectives to the development of promising nucleic acid-based therapeutics. This review article is mainly focused on the strategies carried out for covalently modifying siRNA and miRNA molecules. Examples involving cell-penetrating peptides (CPPs), carbohydrates, polymers, lipids and aptamers are discussed for the synthesis of siRNA conjugates whereas in the case of miRNA-based drugs, this review article makes special emphasis in using antagomiRs, locked nucleic acids (LNAs), peptide nucleic acids (PNAs) as well as nanoparticles. The biomedical applications of siRNA and miRNA conjugates are also discussed. PMID:29415514

  2. PlsX deletion impacts fatty acid synthesis and acid adaptation in Streptococcus mutans.

    PubMed

    Cross, Benjamin; Garcia, Ariana; Faustoferri, Roberta; Quivey, Robert G

    2016-04-01

    Streptococcus mutans, one of the primary causative agents of dental caries in humans, ferments dietary sugars in the mouth to produce organic acids. These acids lower local pH values, resulting in demineralization of the tooth enamel, leading to caries. To survive acidic environments, Strep. mutans employs several adaptive mechanisms, including a shift from saturated to unsaturated fatty acids in membrane phospholipids. PlsX is an acyl-ACP : phosphate transacylase that links the fatty acid synthase II (FASII) pathway to the phospholipid synthesis pathway, and is therefore central to the movement of unsaturated fatty acids into the membrane. Recently, we discovered that plsX is not essential in Strep. mutans. A plsX deletion mutant was not a fatty acid or phospholipid auxotroph. Gas chromatography of fatty acid methyl esters indicated that membrane fatty acid chain length in the plsX deletion strain differed from those detected in the parent strain, UA159. The deletion strain displayed a fatty acid shift similar to WT, but had a higher percentage of unsaturated fatty acids at low pH. The deletion strain survived significantly longer than the parent strain when cultures were subjected to an acid challenge of pH 2.5.The ΔplsX strain also exhibited elevated F-ATPase activity at pH 5.2, compared with the parent. These results indicate that the loss of plsX affects both the fatty acid synthesis pathway and the acid-adaptive response of Strep. mutans.

  3. Abiotic synthesis of fatty acids

    NASA Technical Reports Server (NTRS)

    Leach, W. W.; Nooner, D. W.; Oro, J.

    1978-01-01

    The formation of fatty acids by Fischer-Tropsch-type synthesis was investigated with ferric oxide, ammonium carbonate, potassium carbonate, powdered Pueblito de Allende carbonaceous chondrite, and filings from the Canyon Diablo meteorite used as catalysts. Products were separated and identified by gas chromatography and mass spectrometry. Iron oxide, Pueblito de Allende chondrite, and Canyon Diablo filings in an oxidized catalyst form yielded no fatty acids. Canyon Diablo filings heated overnight at 500 C while undergoing slow purging by deuterium produced fatty acids only when potassium carbonate was admixed; potassium carbonate alone also produced these compounds. The active catalytic combinations gave relatively high yields of aliphatic and aromatic hydrocarbons; substantial amounts of n-alkenes were almost invariably observed when fatty acids were produced; the latter were in the range C6 to C18, with maximum yield in C9 or 10.

  4. Effects of exogenous fatty acids and inhibition of de novo fatty acid synthesis on disaturated phosphatidylcholine production by fetal lung cells and adult type II cells.

    PubMed

    Maniscalco, W M; Finkelstein, J N; Parkhurst, A B

    1989-05-01

    De novo fatty acid synthesis may be an important source of saturated fatty acids for fetal lung disaturated phosphatidylcholine (DSPC) production. To investigate the roles of de novo fatty acid synthesis and exogenous fatty acids, we incubated dispersed fetal lung cells and freshly isolated adult type II cells with exogenous palmitate and oleate and measured DSPC synthesis. Unlike adult type II cells, fetal lung cells did not increase DSPC synthesis when exogenous palmitate was available; adult type II cells increased DSPC synthesis by 70% in the presence of palmitate. Exogenous oleate decreased DSPC synthesis by 48% in fetal cells but not in adult type II cells. Incubation of fetal lung cells with TOFA [2-furancarboxylate, 5-(tetradecyloxy)-sodium], a metabolic inhibitor of fatty acid synthesis, decreased fatty acid synthesis by 65%. There was a simultaneous 56% inhibition of DSPC production, but no effect on protein, DNA, or glyceride-glycerol production, measured by precursor incorporation. The inhibition of DSPC synthesis associated with TOFA was partially prevented by exogenous palmitate but not oleate. Fetal cells prepared from explants that had been cultured in dexamethasone also had TOFA-associated inhibition of DSPC synthesis that was similar to non-dexamethasone-exposed cells. These studies suggest that under baseline conditions of low fatty acid availability, such as in the fetus, de novo fatty acid synthesis in fetal cells, but not in adult type II cells, provides sufficient saturated fatty acids to support maximal DSPC production. Inhibition of de novo fatty acid synthesis resulting in decreased DSPC production in fetal lung cells in conditions of low fatty acid availability suggests that fatty acid synthesis may be central to maintain DSPC synthesis in the fetus.

  5. AKAP3 synthesis is mediated by RNA binding proteins and PKA signaling during mouse spermiogenesis.

    PubMed

    Xu, Kaibiao; Yang, Lele; Zhao, Danyun; Wu, Yaoyao; Qi, Huayu

    2014-06-01

    Mammalian spermatogenesis is regulated by coordinated gene expression in a spatiotemporal manner. The spatiotemporal regulation of major sperm proteins plays important roles during normal development of the male gamete, of which the underlying molecular mechanisms are poorly understood. A-kinase anchoring protein 3 (AKAP3) is one of the major components of the fibrous sheath of the sperm tail that is formed during spermiogenesis. In the present study, we analyzed the expression of sperm-specific Akap3 and the potential regulatory factors of its protein synthesis during mouse spermiogenesis. Results showed that the transcription of Akap3 precedes its protein synthesis by about 2 wk. Nascent AKAP3 was found to form protein complex with PKA and RNA binding proteins (RBPs), including PIWIL1, PABPC1, and NONO, as revealed by coimmunoprecipitation and protein mass spectrometry. RNA electrophoretic gel mobility shift assay showed that these RBPs bind sperm-specific mRNAs, of which proteins are synthesized during the elongating stage of spermiogenesis. Biochemical and cell biological experiments demonstrated that PIWIL1, PABPC1, and NONO interact with each other and colocalize in spermatids' RNA granule, the chromatoid body. In addition, NONO was found in extracytoplasmic granules in round spermatids, whereas PIWIL1 and PABPC1 were diffusely localized in cytoplasm of elongating spermatids, indicating their participation at different steps of mRNA metabolism during spermatogenesis. Interestingly, type I PKA subunits colocalize with PIWIL1 and PABPC1 in the cytoplasm of elongating spermatids and cosediment with the RBPs in polysomal fractions on sucrose gradients. Further biochemical analyses revealed that activation of PKA positively regulates AKAP3 protein synthesis without changing its mRNA level in elongating spermatids. Taken together, these results indicate that PKA signaling directly participates in the regulation of protein translation in postmeiotic male germ cells

  6. West nile virus infections suppress early viral RNA synthesis and avoid inducing the cell stress granule response.

    PubMed

    Courtney, S C; Scherbik, S V; Stockman, B M; Brinton, M A

    2012-04-01

    West Nile virus (WNV) recently became endemic in the United States and is a significant cause of human morbidity and mortality. Natural WNV strain infections do not induce stress granules (SGs), while W956IC (a lineage 2/1 chimeric WNV infectious clone) virus infections produce high levels of early viral RNA and efficiently induce SGs through protein kinase R (PKR) activation. Additional WNV chimeric viruses made by replacing one or more W956IC genes with the lineage 1 Eg101 equivalent in the W956IC backbone were analyzed. The Eg-NS4b+5, Eg-NS1+3+4a, and Eg-NS1+4b+5 chimeras produced low levels of viral RNA at early times of infection and inefficiently induced SGs, suggesting the possibility that interactions between viral nonstructural proteins and/or between viral nonstructural proteins and cell proteins are involved in suppressing early viral RNA synthesis and membrane remodeling during natural WNV strain infections. Detection of exposed viral double-stranded RNA (dsRNA) in W956IC-infected cells suggested that the enhanced early viral RNA synthesis surpassed the available virus-induced membrane protection and allowed viral dsRNA to activate PKR.

  7. Rigid 2',4'-difluororibonucleosides: synthesis, conformational analysis, and incorporation into nascent RNA by HCV polymerase.

    PubMed

    Martínez-Montero, Saúl; Deleavey, Glen F; Kulkarni, Anupriya; Martín-Pintado, Nerea; Lindovska, Petra; Thomson, Michael; González, Carlos; Götte, Matthias; Damha, Masad J

    2014-06-20

    We report on the synthesis and conformational properties of 2'-deoxy-2',4'-difluorouridine (2',4'-diF-rU) and cytidine (2',4'-diF-rC) nucleosides. NMR analysis and quantum mechanical calculations show that the strong stereoelectronic effects induced by the two fluorines essentially "lock" the conformation of the sugar in the North region of the pseudorotational cycle. Our studies also demonstrate that NS5B HCV RNA polymerase was able to accommodate 2',4'-diF-rU 5'-triphosphate (2',4'-diF-rUTP) and to link the monophosphate to the RNA primer strand. 2',4'-diF-rUTP inhibited RNA synthesis in dinucleotide-primed reactions, although with relatively high half-maximal inhibitory concentrations (IC50 > 50 μM). 2',4'-diF-rU/C represents rare examples of "locked" ribonucleoside mimics that lack a bicyclic ring structure.

  8. Anti-influenza virus activity of a salcomine derivative mediated by inhibition of viral RNA synthesis.

    PubMed

    Takizawa, Naoki; Kimura, Tomoyuki; Watanabe, Takumi; Shibasaki, Masakatsu

    2018-06-01

    Influenza virus infection is a major threat to global health. Although vaccines and anti-influenza virus drugs are available, annual influenza virus epidemics result in severe illness, and an influenza pandemic occurs every 20-30 years. To identify candidate anti-influenza virus compounds, we screened approximately 5,000 compounds in an in-house library. We identified MZ7465, a salcomine derivative, as a potent inhibitor of influenza virus propagation. We analyzed the antiviral propagation mechanism of the hit compound by determining the amounts of viral proteins and RNA in infected cells treated with or without the hit compound. Treatment of infected cells with MZ7465 decreased both viral protein and RNA synthesis. In addition, an in vitro assay showed that viral RNA synthesis was directly inhibited by MZ7465. These results suggest that salcomine and its derivatives are potential candidates for the treatment of influenza virus infections.

  9. Enzymatic routes for the synthesis of ursodeoxycholic acid.

    PubMed

    Eggert, Thorsten; Bakonyi, Daniel; Hummel, Werner

    2014-12-10

    Ursodeoxycholic acid, a secondary bile acid, is used as a drug for the treatment of various liver diseases, the optimal dose comprises the range of 8-10mg/kg/day. For industrial syntheses, the structural complexity of this bile acid requires the use of an appropriate starting material as well as the application of regio- and enantio-selective enzymes for its derivatization. Most strategies for the synthesis start from cholic acid or chenodeoxycholic acid. The latter requires the conversion of the hydroxyl group at C-7 from α- into β-position in order to obtain ursodeoxycholic acid. Cholic acid on the other hand does not only require the same epimerization reaction at C-7 but the removal of the hydroxyl group at C-12 as well. There are several bacterial regio- and enantio-selective hydroxysteroid dehydrogenases (HSDHs) to carry out the desired reactions, for example 7α-HSDHs from strains of Clostridium, Bacteroides or Xanthomonas, 7β-HSDHs from Clostridium, Collinsella, or Ruminococcus, or 12α-HSDH from Clostridium or from Eggerthella. However, all these bioconversion reactions need additional steps for the regeneration of the coenzymes. Selected multi-step reaction systems for the synthesis of ursodeoxycholic acid are presented in this review. Copyright © 2014 Elsevier B.V. All rights reserved.

  10. The Hypothesis that the Genetic Code Originated in Coupled Synthesis of Proteins and the Evolutionary Predecessors of Nucleic Acids in Primitive Cells

    PubMed Central

    Francis, Brian R.

    2015-01-01

    Although analysis of the genetic code has allowed explanations for its evolution to be proposed, little evidence exists in biochemistry and molecular biology to offer an explanation for the origin of the genetic code. In particular, two features of biology make the origin of the genetic code difficult to understand. First, nucleic acids are highly complicated polymers requiring numerous enzymes for biosynthesis. Secondly, proteins have a simple backbone with a set of 20 different amino acid side chains synthesized by a highly complicated ribosomal process in which mRNA sequences are read in triplets. Apparently, both nucleic acid and protein syntheses have extensive evolutionary histories. Supporting these processes is a complex metabolism and at the hub of metabolism are the carboxylic acid cycles. This paper advances the hypothesis that the earliest predecessor of the nucleic acids was a β-linked polyester made from malic acid, a highly conserved metabolite in the carboxylic acid cycles. In the β-linked polyester, the side chains are carboxylic acid groups capable of forming interstrand double hydrogen bonds. Evolution of the nucleic acids involved changes to the backbone and side chain of poly(β-d-malic acid). Conversion of the side chain carboxylic acid into a carboxamide or a longer side chain bearing a carboxamide group, allowed information polymers to form amide pairs between polyester chains. Aminoacylation of the hydroxyl groups of malic acid and its derivatives with simple amino acids such as glycine and alanine allowed coupling of polyester synthesis and protein synthesis. Use of polypeptides containing glycine and l-alanine for activation of two different monomers with either glycine or l-alanine allowed simple coded autocatalytic synthesis of polyesters and polypeptides and established the first genetic code. A primitive cell capable of supporting electron transport, thioester synthesis, reduction reactions, and synthesis of polyesters and

  11. The synthesis of mycosporine-like amino acids (MAAs) by cultured, symbiotic dinoflagellates.

    PubMed

    T Banaszak1 A; LaJeunesse; Trench

    2000-06-28

    We tested the hypothesis that there is a relation between phylotypes (phylogenetic types, as determined by restriction fragment length polymorphism (RFLP) and partial sequence analysis of the small subunit ribosomal RNA gene (SSUrDNA)) and the synthesis of mycosporine-like amino acids (MAAs) by symbiotic dinoflagellates under the influence of ultraviolet radiation (UV-B/A) and photosynthetically active radiation (PAR). We exposed 27 isolates of symbiotic dinoflagellates simultaneously to UV-B/A and PAR, and subsequently determined the MAAs present in cell extracts and in the media. The algae used included 24 isolates of Symbiodinium spp. originating from jellyfishes, sea anemones, zoanthids, scleractinians, octocorals, and bivalves, and three others in the genera Gymnodinium, Gloeodinium and Amphidinium from a jellyfish, an hydrocoral and a flatworm, respectively. In this study, all of the phylotype A Symbiodinium spp. synthesized up to three identified MAAs. None of the 11 cultured phylotypes B and C Symbiodinium spp. synthesized MAAs. The three non-Symbiodinium symbionts also synthesized up to three MAAs. The results support a conclusion that phylotype A Symbiodinium spp. have a high predilection for the synthesis of MAAs, while phylotypes B and C do not. Synthesis of MAAs by symbiotic dinoflagellates in culture does not appear to relate directly to depths or to the UV exposure regimes from which the consortia were collected.

  12. Nanocarriers for delivery of siRNA and co-delivery of siRNA and other therapeutic agents.

    PubMed

    Zhao, Jing; Feng, Si-Shen

    2015-07-01

    A major problem in cancer treatment is the multidrug resistance. siRNA inhibitors have great advantages to solve the problem, if the bottleneck of their delivery could be well addressed by the various nanocarriers. Moreover, co-delivery of siRNA together with the various anticancer agents in one nanocarrier may maximize their additive or synergistic effect. This review provides a comprehensive summary on the state-of-the-art of the nanocarriers, which may include prodrugs, micelles, liposomes, dendrimers, nanohydrogels, solid lipid nanoparticles, nanoparticles of biodegradable polymers and nucleic acid nanocarriers for delivery of siRNA and co-delivery of siRNA together with anticancer agents with focus on synthesis of the nanocarrier materials, design and characterization, in vitro and in vivo evaluation, and prospect and challenges of nanocarriers.

  13. Porcine Reproductive and Respiratory Syndrome Virus Nucleocapsid Protein Interacts with Nsp9 and Cellular DHX9 To Regulate Viral RNA Synthesis.

    PubMed

    Liu, Long; Tian, Jiao; Nan, Hao; Tian, Mengmeng; Li, Yuan; Xu, Xiaodong; Huang, Baicheng; Zhou, Enmin; Hiscox, Julian A; Chen, Hongying

    2016-06-01

    Porcine reproductive and respiratory syndrome virus (PRRSV) nucleocapsid (N) protein is the main component of the viral capsid to encapsulate viral RNA, and it is also a multifunctional protein involved in the regulation of host cell processes. Nonstructural protein 9 (Nsp9) is the RNA-dependent RNA polymerase that plays a critical role in viral RNA transcription and replication. In this study, we demonstrate that PRRSV N protein is bound to Nsp9 by protein-protein interaction and that the contacting surface on Nsp9 is located in the two predicted α-helixes formed by 48 residues at the C-terminal end of the protein. Mutagenesis analyses identified E646, E608, and E611 on Nsp9 and Q85 on the N protein as the pivotal residues participating in the N-Nsp9 interaction. By overexpressing the N protein binding fragment of Nsp9 in infected Marc-145 cells, the synthesis of viral RNAs, as well as the production of infectious progeny viruses, was dramatically inhibited, suggesting that Nsp9-N protein association is involved in the process of viral RNA production. In addition, we show that PRRSV N interacts with cellular RNA helicase DHX9 and redistributes the protein into the cytoplasm. Knockdown of DHX9 increased the ratio of short subgenomic mRNAs (sgmRNAs); in contrast, DHX9 overexpression benefited the synthesis of longer sgmRNAs and the viral genomic RNA (gRNA). These results imply that DHX9 is recruited by the N protein in PRRSV infection to regulate viral RNA synthesis. We postulate that N and DHX9 may act as antiattenuation factors for the continuous elongation of nascent transcript during negative-strand RNA synthesis. It is unclear whether the N protein of PRRSV is involved in regulation of the viral RNA production process. In this report, we demonstrate that the N protein of the arterivirus PRRSV participates in viral RNA replication and transcription through interacting with Nsp9 and its RdRp and recruiting cellular RNA helicase to promote the production of

  14. Process parameter optimization for hydantoinase-mediated synthesis of optically pure carbamoyl amino acids of industrial value using Pseudomonas aeruginosa resting cells.

    PubMed

    Engineer, Anupama S; Dhakephalkar, Anita P; Gaikaiwari, Raghavendra P; Dhakephalkar, Prashant K

    2013-12-01

    Hydantoinase-mediated enzymatic synthesis of optically pure carbamoyl amino acids was investigated as an environmentally friendly, energy-efficient alternative to the otherwise energy-intensive, polluting chemical synthesis. Hydantoinase-producing bacterial strain was identified as Pseudomonas aeruginosa by 16S rRNA gene sequencing and biochemical profiling using the BIOLOG Microbial Identification System. Hydantoinase activity was assessed using hydantoin analogs and 5-monosubstituted hydantoins as substrates in a colorimetric assay. The hydantoinase gene was PCR amplified using gene-specific primers and sequenced on an automated gene analyzer. Hydantoinase gene sequence of P. aeruginosa MCM B-887 revealed maximum homology of only 87 % with proven hydantoinase gene sequences in GenBank. MCM B-887 resting cells converted >99 % of substrate into N-carbamoyl amino acids under optimized condition at 42 °C, pH 8.0, and 100 mM substrate concentration in <120 min. Hydantoin hydrolyzing activity was D-selective and included broad substrate profile of 5-methyl hydantoin, 5-phenyl hydantoin, 5-hydroxyphenyl hydantoin, o-chlorophenyl hydantoin, as well as hydantoin analogs such as allantoin, dihydrouracil, etc. MCM B-887 resting cells may thus be suitable for bio-transformations leading to the synthesis of optically pure, unnatural carbamoyl amino acids of industrial importance.

  15. Loss of Topoisomerase I leads to R-loop-mediated transcriptional blocks during ribosomal RNA synthesis

    PubMed Central

    El Hage, Aziz; French, Sarah L.; Beyer, Ann L.; Tollervey, David

    2010-01-01

    Pre-rRNA transcription by RNA Polymerase I (Pol I) is very robust on active rDNA repeats. Loss of yeast Topoisomerase I (Top1) generated truncated pre-rRNA fragments, which were stabilized in strains lacking TRAMP (Trf4/Trf5–Air1/Air2–Mtr4 polyadenylation complexes) or exosome degradation activities. Loss of both Top1 and Top2 blocked pre-rRNA synthesis, with pre-rRNAs truncated predominately in the 18S 5′ region. Positive supercoils in front of Pol I are predicted to slow elongation, while rDNA opening in its wake might cause R-loop formation. Chromatin immunoprecipitation analysis showed substantial levels of RNA/DNA hybrids in the wild type, particularly over the 18S 5′ region. The absence of RNase H1 and H2 in cells depleted of Top1 increased the accumulation of RNA/DNA hybrids and reduced pre-rRNA truncation and pre-rRNA synthesis. Hybrid accumulation over the rDNA was greatly exacerbated when Top1, Top2, and RNase H were all absent. Electron microscopy (EM) analysis revealed Pol I pileups in the wild type, particularly over the 18S. Pileups were longer and more frequent in the absence of Top1, and their frequency was exacerbated when RNase H activity was also lacking. We conclude that the loss of Top1 enhances inherent R-loop formation, particularly over the 5′ region of the rDNA, imposing persistent transcription blocks when RNase H is limiting. PMID:20634320

  16. Suppression of Murine Retrovirus Polypeptide Termination: Effect of Amber Suppressor tRNA on the Cell-Free Translation of Rauscher Murine Leukemia Virus, Moloney Murine Leukemia Virus, and Moloney Murine Sarcoma Virus 124 RNA

    PubMed Central

    Murphy, Edwin C.; Wills, Norma; Arlinghaus, Ralph B.

    1980-01-01

    The effect of suppressor tRNA's on the cell-free translation of several leukemia and sarcoma virus RNAs was examined. Yeast amber suppressor tRNA (amber tRNA) enhanced the synthesis of the Rauscher murine leukemia virus and clone 1 Moloney murine leukemia virus Pr200gag-pol polypeptides by 10- to 45-fold, but at the same time depressed the synthesis of Rauscher murine leukemia virus Pr65gag and Moloney murine leukemia virus Pr63gag. Under suppressor-minus conditions, Moloney murine leukemia virus Pr70gag was present as a closely spaced doublet. Amber tRNA stimulated the synthesis of the “upper” Moloney murine leukemia virus Pr70gag polypeptide. Yeast ochre suppressor tRNA appeared to be ineffective. Quantitative analyses of the kinetics of viral precursor polypeptide accumulation in the presence of amber tRNA showed that during linear protein synthesis, the increase in accumulated Moloney murine leukemia virus Pr200gag-pol coincided closely with the molar loss of Pr63gag. Enhancement of Pr200gag-pol and Pr70gag by amber tRNA persisted in the presence of pactamycin, a drug which blocks the initiation of protein synthesis, thus arguing for the addition of amino acids to the C terminus of Pr63gag as the mechanism behind the amber tRNA effect. Moloney murine sarcoma virus 124 30S RNA was translated into four major polypeptides, Pr63gag, P42, P38, and P23. In the presence of amber tRNA, a new polypeptide, Pr67gag, appeared, whereas Pr63gag synthesis was decreased. Quantitative estimates indicated that for every 1 mol of Pr67gag which appeared, 1 mol of Pr63gag was lost. Images PMID:7373716

  17. Amino acid signature enables proteins to recognize modified tRNA.

    PubMed

    Spears, Jessica L; Xiao, Xingqing; Hall, Carol K; Agris, Paul F

    2014-02-25

    Human tRNA(Lys3)UUU is the primer for HIV replication. The HIV-1 nucleocapsid protein, NCp7, facilitates htRNA(Lys3)UUU recruitment from the host cell by binding to and remodeling the tRNA structure. Human tRNA(Lys3)UUU is post-transcriptionally modified, but until recently, the importance of those modifications in tRNA recognition by NCp7 was unknown. Modifications such as the 5-methoxycarbonylmethyl-2-thiouridine at anticodon wobble position-34 and 2-methylthio-N(6)-threonylcarbamoyladenosine, adjacent to the anticodon at position-37, are important to the recognition of htRNA(Lys3)UUU by NCp7. Several short peptides selected from phage display libraries were found to also preferentially recognize these modifications. Evolutionary algorithms (Monte Carlo and self-consistent mean field) and assisted model building with energy refinement were used to optimize the peptide sequence in silico, while fluorescence assays were developed and conducted to verify the in silico results and elucidate a 15-amino acid signature sequence (R-W-Q/N-H-X2-F-Pho-X-G/A-W-R-X2-G, where X can be most amino acids, and Pho is hydrophobic) that recognized the tRNA's fully modified anticodon stem and loop domain, hASL(Lys3)UUU. Peptides of this sequence specifically recognized and bound modified htRNA(Lys3)UUU with an affinity 10-fold higher than that of the starting sequence. Thus, this approach provides an effective means of predicting sequences of RNA binding peptides that have better binding properties. Such peptides can be used in cell and molecular biology as well as biochemistry to explore RNA binding proteins and to inhibit those protein functions.

  18. Inhibition of fatty acid synthesis in isolated adipocytes by 5-(tetradecyloxy)-2-furoic acid.

    PubMed

    Halvorson, D L; McCune, S A

    1984-11-01

    The compound 5-(tetradecyloxy)-2-furoic acid (TOFA), a hypolipidemic agent, inhibits fatty acid synthesis, lactate and pyruvate accumulation and CO2 release in isolated rat adipocytes. TOFA stimulates the accumulation of citrate. ATP levels are not lowered by TOFA. In comparison with the natural fatty acid, oleate, TOFA exhibited a much greater inhibitory effect on lipogenesis. TOFyl-CoA formation within intact adipocytes was demonstrated. Although not inhibited by TOFA, acetyl-CoA carboxylase is inhibited by TOFyl-CoA. It is proposed that many of the metabolic effects of TOFA in isolated adipocytes can be explained by TOFyl-CoA inhibition of acetyl-CoA carboxylase. TOFA inhibits glycolysis as a secondary event with the primary event of inhibition of fatty acid synthesis causing an accumulation of citrate which is an inhibitor of phosphofructokinase.

  19. Glutamic Acid as Enhancer of Protein Synthesis Kinetics in Hepatocytes from Old Rats.

    PubMed

    Brodsky, V Y; Malchenko, L A; Butorina, N N; Lazarev Konchenko, D S; Zvezdina, N D; Dubovaya, T K

    2017-08-01

    Dense cultures of hepatocytes from old rats (~2 years old, body weight 530-610 g) are different from similar cultures of hepatocytes from young rats by the low amplitude of protein synthesis rhythm. Addition of glutamic acid (0.2, 0.4, or 0.6 mg/ml) into the culture medium with hepatocytes of old rats resulted in increase in the oscillation amplitudes of the protein synthesis rhythm to the level of young rats. A similar action of glutamic acid on the protein synthesis kinetics was observed in vivo after feeding old rats with glutamic acid. Inhibition of metabotropic receptors of glutamic acid with α-methyl-4-carboxyphenylglycine (0.01 mg/ml) abolished the effect of glutamic acid. The amplitude of oscillation of the protein synthesis rhythm in a cell population characterizes synchronization of individual oscillations caused by direct cell-cell communications. Hence, glutamic acid, acting as a receptor-dependent transmitter, enhanced direct cell-cell communications of hepatocytes that were decreased with aging. As differentiated from other known membrane signaling factors (gangliosides, norepinephrine, serotonin, dopamine), glutamic acid can penetrate into the brain and thus influence the communications and protein synthesis kinetics that are disturbed with aging not only in hepatocytes, but also in neurons.

  20. Nucleolar TRF2 attenuated nucleolus stress-induced HCC cell-cycle arrest by altering rRNA synthesis.

    PubMed

    Yuan, Fuwen; Xu, Chenzhong; Li, Guodong; Tong, Tanjun

    2018-05-03

    The nucleolus is an important organelle that is responsible for the biogenesis of ribosome RNA (rRNA) and ribosomal subunits assembly. It is also deemed to be the center of metabolic control, considering the critical role of ribosomes in protein translation. Perturbations of rRNA synthesis are closely related to cell proliferation and tumor progression. Telomeric repeat-binding factor 2 (TRF2) is a member of shelterin complex that is responsible for telomere DNA protection. Interestingly, it was recently reported to localize in the nucleolus of human cells in a cell-cycle-dependent manner, while the underlying mechanism and its role on the nucleolus remained unclear. In this study, we found that nucleolar and coiled-body phosphoprotein 1 (NOLC1), a nucleolar protein that is responsible for the nucleolus construction and rRNA synthesis, interacted with TRF2 and mediated the shuttle of TRF2 between the nucleolus and nucleus. Abating the expression of NOLC1 decreased the nucleolar-resident TRF2. Besides, the nucleolar TRF2 could bind rDNA and promoted rRNA transcription. Furthermore, in hepatocellular carcinoma (HCC) cell lines HepG2 and SMMC7721, TRF2 overexpression participated in the nucleolus stress-induced rRNA inhibition and cell-cycle arrest.

  1. The Ebola Virus VP30-NP Interaction Is a Regulator of Viral RNA Synthesis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kirchdoerfer, Robert N.; Moyer, Crystal L.; Abelson, Dafna M.

    Filoviruses are capable of causing deadly hemorrhagic fevers. All nonsegmented negative-sense RNA-virus nucleocapsids are composed of a nucleoprotein (NP), a phosphoprotein (VP35) and a polymerase (L). However, the VP30 RNA-synthesis co-factor is unique to the filoviruses. The assembly, structure, and function of the filovirus RNA replication complex remain unclear. Here, we have characterized the interactions of Ebola, Sudan and Marburg virus VP30 with NP using in vitro biochemistry, structural biology and cell-based mini-replicon assays. We have found that the VP30 C-terminal domain interacts with a short peptide in the C-terminal region of NP. Further, we have solved crystal structures ofmore » the VP30-NP complex for both Ebola and Marburg viruses. These structures reveal that a conserved, proline-rich NP peptide binds a shallow hydrophobic cleft on the VP30 C-terminal domain. Structure-guided Ebola virus VP30 mutants have altered affinities for the NP peptide. Correlation of these VP30-NP affinities with the activity for each of these mutants in a cell-based mini-replicon assay suggests that the VP30-NP interaction plays both essential and inhibitory roles in Ebola virus RNA synthesis.« less

  2. Glutamic Acid - Amino Acid, Neurotransmitter, and Drug - Is Responsible for Protein Synthesis Rhythm in Hepatocyte Populations in vitro and in vivo.

    PubMed

    Brodsky, V Y; Malchenko, L A; Konchenko, D S; Zvezdina, N D; Dubovaya, T K

    2016-08-01

    Primary cultures of rat hepatocytes were studied in serum-free media. Ultradian protein synthesis rhythm was used as a marker of cell synchronization in the population. Addition of glutamic acid (0.2 mg/ml) to the medium of nonsynchronous sparse cultures resulted in detection of a common protein synthesis rhythm, hence in synchronization of the cells. The antagonist of glutamic acid metabotropic receptors MCPG (0.01 mg/ml) added together with glutamic acid abolished the synchronization effect; in sparse cultures, no rhythm was detected. Feeding rats with glutamic acid (30 mg with food) resulted in protein synthesis rhythm in sparse cultures obtained from the rats. After feeding without glutamic acid, linear kinetics of protein synthesis was revealed. Thus, glutamic acid, a component of blood as a non-neural transmitter, can synchronize the activity of hepatocytes and can form common rhythm of protein synthesis in vitro and in vivo. This effect is realized via receptors. Mechanisms of cell-cell communication are discussed on analyzing effects of non-neural functions of neurotransmitters. Glutamic acid is used clinically in humans. Hence, a previously unknown function of this drug is revealed.

  3. Parameters on plant absortion of double-stranded Ribonucleic acid, dsRNA

    USDA-ARS?s Scientific Manuscript database

    Efficient absorption of double-stranded Ribonucleic acid, dsRNA, into citrus is critical for effective psyllid management by RNA interference, RNAi. Parameters which might affect absorption into citrus trees and subsequent ingestion by Asian citrus psyllid were evaluated. Age of leaves, variety of c...

  4. PNA containing isocytidine nucleobase: synthesis and recognition of double helical RNA

    PubMed Central

    Zengeya, Thomas; Li, Ming; Rozners, Eriks

    2011-01-01

    Peptide nucleic acid (PNA1) containing a 5-methylisocytidine (iC) nucleobase has been synthesized. Triple helix formation between PNA1 and RNA hairpins having variable base pairs interacting with iC was studied using isothermal titration calorimetry. The iC nucleobase recognized the proposed target, C-G inversion in polypurine tract of RNA, with slightly higher affinity than the natural nucleobases, though the sequence selectivity of recognition was low. Compared to non-modified PNA, PNA1 had lower affinity for its RNA target. PMID:21333533

  5. A growth-dependent transcription initiation factor (TIF-IA) interacting with RNA polymerase I regulates mouse ribosomal RNA synthesis.

    PubMed

    Schnapp, A; Pfleiderer, C; Rosenbauer, H; Grummt, I

    1990-09-01

    Control of mouse ribosomal RNA synthesis in response to extracellular signals is mediated by TIF-IA, a regulatory factor whose amount or activity correlates with cell proliferation. Factor TIF-IA interacts with RNA polymerase I (pol I), thus converting it into a transcriptionally active holoenzyme, which is able to initiate specifically at the rDNA promoter in the presence of the other auxiliary transcription initiation factors, designated TIF-IB, TIF-IC and UBF. With regard to several criteria, the growth-dependent factor TIF-IA behaves like a bacterial sigma factor: (i) it associates physically with pol I, (ii) it is required for initiation of transcription, (iii) it is present in limiting amounts and (iv) under certain salt conditions, it is chromatographically separable from the polymerase. In addition, evidence is presented that dephosphorylation of pol I abolishes in vitro transcription initiation from the ribosomal gene promoter without significantly affecting the polymerizing activity of the enzyme at nonspecific templates. The involvement of both a regulatory factor and post-translational modification of the transcribing enzyme provides an efficient and versatile mechanism of rDNA transcription regulation which enables the cell to adapt ribosome synthesis rapidly to a variety of extracellular signals.

  6. Inhibition of pyrimidine synthesis reverses viral virulence factor-mediated block of mRNA nuclear export

    PubMed Central

    Zhang, Liang; Das, Priyabrata; Schmolke, Mirco; Manicassamy, Balaji; Wang, Yaming; Deng, Xiaoyi; Cai, Ling; Tu, Benjamin P.; Forst, Christian V.; Roth, Michael G.; Levy, David E.; García-Sastre, Adolfo; de Brabander, Jef; Phillips, Margaret A.

    2012-01-01

    The NS1 protein of influenza virus is a major virulence factor essential for virus replication, as it redirects the host cell to promote viral protein expression. NS1 inhibits cellular messenger ribonucleic acid (mRNA) processing and export, down-regulating host gene expression and enhancing viral gene expression. We report in this paper the identification of a nontoxic quinoline carboxylic acid that reverts the inhibition of mRNA nuclear export by NS1, in the absence or presence of the virus. This quinoline carboxylic acid directly inhibited dihydroorotate dehydrogenase (DHODH), a host enzyme required for de novo pyrimidine biosynthesis, and partially reduced pyrimidine levels. This effect induced NXF1 expression, which promoted mRNA nuclear export in the presence of NS1. The release of NS1-mediated mRNA export block by DHODH inhibition also occurred in the presence of vesicular stomatitis virus M (matrix) protein, another viral inhibitor of mRNA export. This reversal of mRNA export block allowed expression of antiviral factors. Thus, pyrimidines play a necessary role in the inhibition of mRNA nuclear export by virulence factors. PMID:22312003

  7. 227 Views of RNA: Is RNA Unique in Its Chemical Isomer Space?

    PubMed Central

    Meringer, Markus; Goodwin, Jay

    2015-01-01

    Abstract Ribonucleic acid (RNA) is one of the two nucleic acids used by extant biochemistry and plays a central role as the intermediary carrier of genetic information in transcription and translation. If RNA was involved in the origin of life, it should have a facile prebiotic synthesis. A wide variety of such syntheses have been explored. However, to date no one-pot reaction has been shown capable of yielding RNA monomers from likely prebiotically abundant starting materials, though this does not rule out the possibility that simpler, more easily prebiotically accessible nucleic acids may have preceded RNA. Given structural constraints, such as the ability to form complementary base pairs and a linear covalent polymer, a variety of structural isomers of RNA could potentially function as genetic platforms. By using structure-generation software, all the potential structural isomers of the ribosides (BC5H9O4, where B is nucleobase), as well as a set of simpler minimal analogues derived from them, that can potentially serve as monomeric building blocks of nucleic acid–like molecules are enumerated. Molecules are selected based on their likely stability under biochemically relevant conditions (e.g., moderate pH and temperature) and the presence of at least two functional groups allowing the monomers to be incorporated into linear polymers. The resulting structures are then evaluated by using molecular descriptors typically applied in quantitative structure–property relationship (QSPR) studies and predicted physicochemical properties. Several databases have been queried to determine whether any of the computed isomers had been synthesized previously. Very few of the molecules that emerge from this structure set have been previously described. We conclude that ribonucleosides may have competed with a multitude of alternative structures whose potential proto-biochemical roles and abiotic syntheses remain to be explored. Key Words: Evolution—Chemical evolution

  8. Stereoselective synthesis of conformationally constrained omega-amino acid analogues from pyroglutamic acid.

    PubMed

    Bentz, Emilie L; Goswami, Rajesh; Moloney, Mark G; Westaway, Susan M

    2005-08-07

    Bicyclic lactams derived from pyroglutamic acid provide a useful scaffold for synthesis of conformationally restricted analogues of lysine, ornithine and glutamine, as well as an Ala-Ala dipeptide analogue. Amino alcohol and carboxylic acid derivatives are accessible from a common intermediate. In this strategy, the bicyclic lactam system not only controls, but also facilitates the determination of the stereochemistry of the synthetic intermediates.

  9. A direct method for the synthesis of orthogonally protected furyl- and thienyl- amino acids.

    PubMed

    Hudson, Alex S; Caron, Laurent; Colgin, Neil; Cobb, Steven L

    2015-04-01

    The synthesis of unnatural amino acids plays a key part in expanding the potential application of peptide-based drugs and in the total synthesis of peptide natural products. Herein, we report a direct method for the synthesis of orthogonally protected 5-membered heteroaromatic amino acids.

  10. "Dark matter" worlds of unstable RNA and protein.

    PubMed

    Baboo, Sabyasachi; Cook, Peter R

    2014-01-01

    Astrophysicists use the term "dark matter" to describe the majority of the matter and/or energy in the universe that is hidden from view, and biologists now apply it to the new families of RNA they are uncovering. We review evidence for an analogous hidden world containing peptides. The critical experiments involved pulse-labeling human cells with tagged amino acids for periods as short as five seconds. Results are extraordinary in two respects: both nucleus and cytoplasm become labeled, and most signals disappear with a half-life of less than one minute. Just as the synthesis of each mature mRNA is regulated by the abortive production of hundreds of shorter transcripts that are quickly degraded, it seems that the synthesis of each full-length protein in the stable proteome is regulated by an apparently wasteful production and degradation of shorter peptides. Some of the nuclear synthesis is probably a byproduct of nuclear ribosomes proofreading newly-made RNA for inappropriately-placed termination codons (a process that triggers "nonsense-mediated decay"). We speculate that some "dark-matter" peptides will play other important roles in the cell.

  11. A non-catalytic role for inositol 1,3,4,5,6-pentakisphosphate 2-kinase in the synthesis of ribosomal RNA

    PubMed Central

    Brehm, Maria A.; Wundenberg, Torsten; Williams, Jason; Mayr, Georg W.; Shears, Stephen B.

    2013-01-01

    Summary Fundamental to the life and destiny of every cell is the regulation of protein synthesis through ribosome biogenesis, which begins in the nucleolus with the production of ribosomal RNA (rRNA). Nucleolar organization is a highly dynamic and tightly regulated process; the structural factors that direct nucleolar assembly and disassembly are just as important in controlling rRNA synthesis as are the catalytic activities that synthesize rRNA. Here, we report that a signaling enzyme, inositol 1,3,4,5,6-pentakisphosphate 2-kinase (IP5K) is also a structural component in the nucleolus. We demonstrate that IP5K has functionally significant interactions with three proteins that regulate rRNA synthesis: protein kinase CK2, TCOF1 and upstream-binding-factor (UBF). Through molecular modeling and mutagenic studies, we identified an Arg-Lys-Lys tripeptide located on the surface of IP5K that mediates its association with UBF. Nucleolar IP5K spatial dynamics were sensitive to experimental procedures (serum starvation or addition of actinomycin D) that inhibited rRNA production. We show that IP5K makes stoichiometrically sensitive contributions to the architecture of the nucleoli in intact cells, thereby influencing the degree of rRNA synthesis. Our study adds significantly to the biological significance of IP5K; previously, it was the kinase activity of this protein that had attracted attention. Our demonstration that IP5K ‘moonlights’ as a molecular scaffold offers an unexpected new example of how the biological sophistication of higher organisms can arise from gene products acquiring multiple functions, rather than by an increase in gene number. PMID:23203802

  12. A non-catalytic role for inositol 1,3,4,5,6-pentakisphosphate 2-kinase in the synthesis of ribosomal RNA.

    PubMed

    Brehm, Maria A; Wundenberg, Torsten; Williams, Jason; Mayr, Georg W; Shears, Stephen B

    2013-01-15

    Fundamental to the life and destiny of every cell is the regulation of protein synthesis through ribosome biogenesis, which begins in the nucleolus with the production of ribosomal RNA (rRNA). Nucleolar organization is a highly dynamic and tightly regulated process; the structural factors that direct nucleolar assembly and disassembly are just as important in controlling rRNA synthesis as are the catalytic activities that synthesize rRNA. Here, we report that a signaling enzyme, inositol 1,3,4,5,6-pentakisphosphate 2-kinase (IP5K) is also a structural component in the nucleolus. We demonstrate that IP5K has functionally significant interactions with three proteins that regulate rRNA synthesis: protein kinase CK2, TCOF1 and upstream-binding-factor (UBF). Through molecular modeling and mutagenic studies, we identified an Arg-Lys-Lys tripeptide located on the surface of IP5K that mediates its association with UBF. Nucleolar IP5K spatial dynamics were sensitive to experimental procedures (serum starvation or addition of actinomycin D) that inhibited rRNA production. We show that IP5K makes stoichiometrically sensitive contributions to the architecture of the nucleoli in intact cells, thereby influencing the degree of rRNA synthesis. Our study adds significantly to the biological significance of IP5K; previously, it was the kinase activity of this protein that had attracted attention. Our demonstration that IP5K 'moonlights' as a molecular scaffold offers an unexpected new example of how the biological sophistication of higher organisms can arise from gene products acquiring multiple functions, rather than by an increase in gene number.

  13. Synthesis and chirality of amino acids under interstellar conditions.

    PubMed

    Giri, Chaitanya; Goesmann, Fred; Meinert, Cornelia; Evans, Amanda C; Meierhenrich, Uwe J

    2013-01-01

    Amino acids are the fundamental building blocks of proteins, the biomolecules that provide cellular structure and function in all living organisms. A majority of amino acids utilized within living systems possess pre-specified orientation geometry (chirality); however the original source for this specific orientation remains uncertain. In order to trace the chemical evolution of life, an appreciation of the synthetic and evolutional origins of the first chiral amino acids must first be gained. Given that the amino acids in our universe are likely to have been synthesized in molecular clouds in interstellar space, it is necessary to understand where and how the first synthesis might have occurred. The asymmetry of the original amino acid synthesis was probably the result of exposure to chiral photons in the form of circularly polarized light (CPL), which has been detected in interstellar molecular clouds. This chirality transfer event, from photons to amino acids, has been successfully recreated experimentally and is likely a combination of both asymmetric synthesis and enantioselective photolysis. A series of innovative studies have reported successful simulation of these environments and afforded production of chiral amino acids under realistic circumstellar and interstellar conditions: irradiation of interstellar ice analogues (CO, CO2, NH3, CH3OH, and H2O) with circularly polarized ultraviolet photons at low temperatures does result in enantiomer enriched amino acid structures (up to 1.3% ee). This topical review summarizes current knowledge and recent discoveries about the simulated interstellar environments within which amino acids were probably formed. A synopsis of the COSAC experiment onboard the ESA cometary mission ROSETTA concludes this review: the ROSETTA mission will soft-land on the nucleus of the comet 67P/Churyumov-Gerasimenko in November 2014, anticipating the first in situ detection of asymmetric organic molecules in cometary ices.

  14. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, A. L.

    1986-01-01

    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20% for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  15. Nucleic Acid Engineering: RNA Following the Trail of DNA.

    PubMed

    Kim, Hyejin; Park, Yongkuk; Kim, Jieun; Jeong, Jaepil; Han, Sangwoo; Lee, Jae Sung; Lee, Jong Bum

    2016-02-08

    The self-assembly feature of the naturally occurring biopolymer, DNA, has fascinated researchers in the fields of materials science and bioengineering. With the improved understanding of the chemical and structural nature of DNA, DNA-based constructs have been designed and fabricated from two-dimensional arbitrary shapes to reconfigurable three-dimensional nanodevices. Although DNA has been used successfully as a building block in a finely organized and controlled manner, its applications need to be explored. Hence, with the myriad of biological functions, RNA has recently attracted considerable attention to further the application of nucleic acid-based structures. This Review categorizes different approaches of engineering nucleic acid-based structures and introduces the concepts, principles, and applications of each technique, focusing on how DNA engineering is applied as a guide to RNA engineering.

  16. Purification and properties of poliovirus RNA polymerase expressed in Escherichia coli

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Plotch, S.J.; Palant, O.; Gluzman, Y.

    1989-01-01

    A cDNA clone encoding the RNA polymerase of poliovirus has been expressed in Escherichia coli under the transcriptional control of a T7 bacteriophage promoter. This poliovirus enzyme was designed to contain only a single additional amino acid, the N-terminal methionine. The recombinant enzyme has been purified to near homogeneity, and polyclonal antibodies have been prepared against it. The enzyme exhibits poly(A)-dependent oligo(U)-primed ply(U) polymerase activity as well as RNA polymerase activity. In the presence of an oligo(U) primer, the enzyme catalyzes the synthesis of a full-length copy of either poliovirus or globin RNA templates. In the absence of added primer,more » RNA products up to twice the length of the template are synthesized. When incubated in the presence of a single nucleoside triphosphate, (..cap alpha..-/sup 32/P)UTP, the enzyme catalyzes the incorporation of radioactive label into template RNA. These results are discussed in light of previously proposed models of poliovirus RNA synthesis in vitro.« less

  17. Salicylic acid derivatives: synthesis, features and usage as therapeutic tools.

    PubMed

    Ekinci, Deniz; Sentürk, Murat; Küfrevioğlu, Ömer İrfan

    2011-12-01

    In the field of medicinal chemistry, there is a growing interest in the use of small molecules. Although acetyl salicylic acid is well known for medical applications, little is known about other salicylic acid derivatives, and there is serious lack of data and information on the effects and biological evaluation that connect them. This review covers the synthesis and drug potencies of salicylic acid derivatives. After a brief overview of the information on salicylic acid and its features, a detailed review of salicylic acids as drugs and prodrugs, usage as cyclooxygenase inhibitors, properties in plants, synthesis and recent patents, is developed. Salicylic acid research is still an important area and innovations continue to arise, which offer hope for new therapeutics in related fields. It is anticipated that this review will guide the direction of long-term drug/nutraceutical safety trials and stimulate ideas for future research.

  18. Nucleotide Sequence Analysis of RNA Synthesized from Rabbit Globin Complementary DNA

    PubMed Central

    Poon, Raymond; Paddock, Gary V.; Heindell, Howard; Whitcome, Philip; Salser, Winston; Kacian, Dan; Bank, Arthur; Gambino, Roberto; Ramirez, Francesco

    1974-01-01

    Rabbit globin complementary DNA made with RNA-dependent DNA polymerase (reverse transcriptase) was used as template for in vitro synthesis of 32P-labeled RNA. The sequences of the nucleotides in most of the fragments resulting from combined ribonuclease T1 and alkaline phosphatase digestion have been determined. Several fragments were long enough to fit uniquely with the α or β globin amino-acid sequences. These data demonstrate that the cDNA was copied from globin mRNA and contained no detectable contaminants. Images PMID:4139714

  19. Whole-body DHA synthesis-secretion kinetics from plasma eicosapentaenoic acid and alpha-linolenic acid in the free-living rat.

    PubMed

    Metherel, Adam H; Domenichiello, Anthony F; Kitson, Alex P; Hopperton, Kathryn E; Bazinet, Richard P

    2016-09-01

    Whole body docosahexaenoic acid (DHA, 22:6n-3) synthesis from α-linolenic acid (ALA, 18:3n-3) is considered to be very low, however, the daily synthesis-secretion of DHA may be sufficient to supply the adult brain. The current study aims to assess whether whole body DHA synthesis-secretion kinetics are different when comparing plasma ALA versus eicosapentaenoic acid (EPA, 20:5n-3) as the precursor. Male Long Evans rats (n=6) were fed a 2% ALA in total fat diet for eight weeks, followed by surgery to implant a catheter into each of the jugular vein and carotid artery and 3h of steady-state infusion with a known amount of (2)H-ALA and (13)C-eicosapentaenoic acid (EPA, 20:5n3). Blood samples were collected at thirty-minute intervals and plasma enrichment of (2)H- and (13)C EPA, n-3 docosapentaenoic acid (DPAn-3, 22:5n-3) and DHA were determined for assessment of synthesis-secretion kinetic parameters. Results indicate a 13-fold higher synthesis-secretion coefficient for DHA from EPA as compared to ALA. However, after correcting for the 6.6 fold higher endogenous plasma ALA concentration, no significant differences in daily synthesis-secretion (nmol/day) of DHA (97.6±28.2 and 172±62), DPAn-3 (853±279 and 1139±484) or EPA (1587±592 and 1628±366) were observed from plasma unesterified ALA and EPA sources, respectively. These results suggest that typical diets which are significantly higher in ALA compared to EPA yield similar daily DHA synthesis-secretion despite a significantly higher synthesis-secretion coefficient from EPA. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  20. RNA Crystallization

    NASA Technical Reports Server (NTRS)

    Golden, Barbara L.; Kundrot, Craig E.

    2003-01-01

    RNA molecules may be crystallized using variations of the methods developed for protein crystallography. As the technology has become available to syntheisize and purify RNA molecules in the quantities and with the quality that is required for crystallography, the field of RNA structure has exploded. The first consideration when crystallizing an RNA is the sequence, which may be varied in a rational way to enhance crystallizability or prevent formation of alternate structures. Once a sequence has been designed, the RNA may be synthesized chemically by solid-state synthesis, or it may be produced enzymatically using RNA polymerase and an appropriate DNA template. Purification of milligram quantities of RNA can be accomplished by HPLC or gel electrophoresis. As with proteins, crystallization of RNA is usually accomplished by vapor diffusion techniques. There are several considerations that are either unique to RNA crystallization or more important for RNA crystallization. Techniques for design, synthesis, purification, and crystallization of RNAs will be reviewed here.

  1. RNA-dependent RNA polymerase 1 in potato (Solanum tuberosum) and its relationship to other plant RNA-dependent RNA polymerases

    PubMed Central

    Hunter, Lydia J. R.; Brockington, Samuel F.; Murphy, Alex M.; Pate, Adrienne E.; Gruden, Kristina; MacFarlane, Stuart A.; Palukaitis, Peter; Carr, John P.

    2016-01-01

    Cellular RNA-dependent RNA polymerases (RDRs) catalyze synthesis of double-stranded RNAs that can serve to initiate or amplify RNA silencing. Arabidopsis thaliana has six RDR genes; RDRs 1, 2 and 6 have roles in anti-viral RNA silencing. RDR6 is constitutively expressed but RDR1 expression is elevated following plant treatment with defensive phytohormones. RDR1 also contributes to basal virus resistance. RDR1 has been studied in several species including A. thaliana, tobacco (Nicotiana tabacum), N. benthamiana, N. attenuata and tomato (Solanum lycopersicum) but not to our knowledge in potato (S. tuberosum). StRDR1 was identified and shown to be salicylic acid-responsive. StRDR1 transcript accumulation decreased in transgenic potato plants constitutively expressing a hairpin construct and these plants were challenged with three viruses: potato virus Y, potato virus X, and tobacco mosaic virus. Suppression of StRDR1 gene expression did not increase the susceptibility of potato to these viruses. Phylogenetic analysis of RDR genes present in potato and in a range of other plant species identified a new RDR gene family, not present in potato and found only in Rosids (but apparently lost in the Rosid A. thaliana) for which we propose the name RDR7. PMID:26979928

  2. RNA-dependent RNA polymerase 1 in potato (Solanum tuberosum) and its relationship to other plant RNA-dependent RNA polymerases.

    PubMed

    Hunter, Lydia J R; Brockington, Samuel F; Murphy, Alex M; Pate, Adrienne E; Gruden, Kristina; MacFarlane, Stuart A; Palukaitis, Peter; Carr, John P

    2016-03-16

    Cellular RNA-dependent RNA polymerases (RDRs) catalyze synthesis of double-stranded RNAs that can serve to initiate or amplify RNA silencing. Arabidopsis thaliana has six RDR genes; RDRs 1, 2 and 6 have roles in anti-viral RNA silencing. RDR6 is constitutively expressed but RDR1 expression is elevated following plant treatment with defensive phytohormones. RDR1 also contributes to basal virus resistance. RDR1 has been studied in several species including A. thaliana, tobacco (Nicotiana tabacum), N. benthamiana, N. attenuata and tomato (Solanum lycopersicum) but not to our knowledge in potato (S. tuberosum). StRDR1 was identified and shown to be salicylic acid-responsive. StRDR1 transcript accumulation decreased in transgenic potato plants constitutively expressing a hairpin construct and these plants were challenged with three viruses: potato virus Y, potato virus X, and tobacco mosaic virus. Suppression of StRDR1 gene expression did not increase the susceptibility of potato to these viruses. Phylogenetic analysis of RDR genes present in potato and in a range of other plant species identified a new RDR gene family, not present in potato and found only in Rosids (but apparently lost in the Rosid A. thaliana) for which we propose the name RDR7.

  3. Phosphatidic Acid Produced by Phospholipase D Promotes RNA Replication of a Plant RNA Virus

    PubMed Central

    Hyodo, Kiwamu; Taniguchi, Takako; Manabe, Yuki; Kaido, Masanori; Mise, Kazuyuki; Sugawara, Tatsuya; Taniguchi, Hisaaki; Okuno, Tetsuro

    2015-01-01

    Eukaryotic positive-strand RNA [(+)RNA] viruses are intracellular obligate parasites replicate using the membrane-bound replicase complexes that contain multiple viral and host components. To replicate, (+)RNA viruses exploit host resources and modify host metabolism and membrane organization. Phospholipase D (PLD) is a phosphatidylcholine- and phosphatidylethanolamine-hydrolyzing enzyme that catalyzes the production of phosphatidic acid (PA), a lipid second messenger that modulates diverse intracellular signaling in various organisms. PA is normally present in small amounts (less than 1% of total phospholipids), but rapidly and transiently accumulates in lipid bilayers in response to different environmental cues such as biotic and abiotic stresses in plants. However, the precise functions of PLD and PA remain unknown. Here, we report the roles of PLD and PA in genomic RNA replication of a plant (+)RNA virus, Red clover necrotic mosaic virus (RCNMV). We found that RCNMV RNA replication complexes formed in Nicotiana benthamiana contained PLDα and PLDβ. Gene-silencing and pharmacological inhibition approaches showed that PLDs and PLDs-derived PA are required for viral RNA replication. Consistent with this, exogenous application of PA enhanced viral RNA replication in plant cells and plant-derived cell-free extracts. We also found that a viral auxiliary replication protein bound to PA in vitro, and that the amount of PA increased in RCNMV-infected plant leaves. Together, our findings suggest that RCNMV hijacks host PA-producing enzymes to replicate. PMID:26020241

  4. Rice yellow stunt rhabdovirus protein 6 suppresses systemic RNA silencing by blocking RDR6-mediated secondary siRNA synthesis.

    PubMed

    Guo, Hongyan; Song, Xiaoguang; Xie, Chuanmiao; Huo, Yan; Zhang, Fujie; Chen, Xiaoying; Geng, Yunfeng; Fang, Rongxiang

    2013-08-01

    The P6 protein of Rice yellow stunt rhabdovirus (RYSV) is a virion structural protein that can be phosphorylated in vitro. However its exact function remains elusive. We found that P6 enhanced the virulence of Potato virus X (PVX) in Nicotiana benthamiana and N. tabacum plants, suggesting that it might function as a suppressor of RNA silencing. We examined the mechanism of P6-mediated silencing suppression by transiently expressing P6 in both N. benthamiana leaves and rice protoplasts. Our results showed that P6 could repress the production of secondary siRNAs and inhibit systemic green fluorescent protein RNA silencing but did not interfere with local RNA silencing in N. benthamiana plants or in rice protoplasts. Intriguingly, P6 and RDR6 had overlapping subcellular localization and P6 bound both rice and Arabidopsis RDR6 in vivo. Furthermore, transgenic rice plants expressing P6 showed enhanced susceptibility to infection by Rice stripe virus. Hence, we propose that P6 is part of the RYSV's counter-defense machinery against the plant RNA silencing system and plays a role mainly in affecting RDR6-mediated secondary siRNA synthesis. Our work provides a new perspective on how a plant-infecting nucleorhabdovirus may counteract host RNA silencing-mediated antiviral defense.

  5. Genetic Assay for Transcription Errors: Methods to Monitor Treatments or Chemicals that Increase the Error Rate of RNA synthesis | NCI Technology Transfer Center | TTC

    Cancer.gov

    Researchers at the National Cancer Institute (NCI) developed a genetic assay for detecting transcription errors in RNA synthesis. This new assay extends the familiar concept of an Ames test which monitors DNA damage and synthesis errors to the previously inaccessible issue of RNA synthesis fidelity. The FDA requires genetic DNA focused tests for all drug approval as it assesses the in vivo mutagenic and carcinogenic potential of a drug. The new assay will open an approach to monitoring the impact of treatments on the accuracy of RNA synthesis. Errors in transcription have been hypothesized to be a component of aging and age-related diseases. The National Cancer Institute (NCI) seeks licensing partners for the genetic assay.

  6. Initiation of poliovirus plus-strand RNA synthesis in a membrane complex of infected HeLa cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Takeda, N.; Kuhn, R.J.; Yang, C.F.

    1986-10-01

    An in vitro poliovirus RNA-synthesizing system derived from a crude membrance fraction of infected HeLa cells was used to analyze the mechanism of initiation of poliovirus plus-strand RNA synthesis. This system contains an activity that synthesizes the nucleotidyl proteins VPg-pU and VPg-pUpU. These molecules represent the 5'-terminal structure of nascent RNA molecules and of virion RNA. The membranous replication complex is also capable of synthesizing mucleotidyl proteins containing nine or more of the poliovirus 5'-proximal nucleotides as assayed by the formation of the RNase T/sub 1/-resistant oligonucleotide VPg-pUUAAAACAGp or by fingerprint analysis of the in vitro-synthesized /sup 32/P-RNA. Incubation ofmore » preformed VPg-pUpU with unlabeled nucleoside triphosphates resulted in the formation of VPg-pUUAAAACAGp. This reaction, which appeared to be an elongation of VPg-pUpU, was stimulated by the addition of a soluble fraction (S-10) obtained from uninfected HeLa cells. Preformed VPg-pU could be chased into VPg-pUpU in the presence of UTP. The data are consistent with a model that VPg-pU can function as a primer for poliovirus plus-strand RNA synthesis in the membranous replication complex and that the elongation reaction may be stimulated by a host cellular factor.« less

  7. Targeting Membrane-Bound Viral RNA Synthesis Reveals Potent Inhibition of Diverse Coronaviruses Including the Middle East Respiratory Syndrome Virus

    PubMed Central

    Bergström, Tomas; Kann, Nina; Adamiak, Beata; Hannoun, Charles; Kindler, Eveline; Jónsdóttir, Hulda R.; Muth, Doreen; Kint, Joeri; Forlenza, Maria; Müller, Marcel A.; Drosten, Christian; Thiel, Volker; Trybala, Edward

    2014-01-01

    Coronaviruses raise serious concerns as emerging zoonotic viruses without specific antiviral drugs available. Here we screened a collection of 16671 diverse compounds for anti-human coronavirus 229E activity and identified an inhibitor, designated K22, that specifically targets membrane-bound coronaviral RNA synthesis. K22 exerts most potent antiviral activity after virus entry during an early step of the viral life cycle. Specifically, the formation of double membrane vesicles (DMVs), a hallmark of coronavirus replication, was greatly impaired upon K22 treatment accompanied by near-complete inhibition of viral RNA synthesis. K22-resistant viruses contained substitutions in non-structural protein 6 (nsp6), a membrane-spanning integral component of the viral replication complex implicated in DMV formation, corroborating that K22 targets membrane bound viral RNA synthesis. Besides K22 resistance, the nsp6 mutants induced a reduced number of DMVs, displayed decreased specific infectivity, while RNA synthesis was not affected. Importantly, K22 inhibits a broad range of coronaviruses, including Middle East respiratory syndrome coronavirus (MERS–CoV), and efficient inhibition was achieved in primary human epithelia cultures representing the entry port of human coronavirus infection. Collectively, this study proposes an evolutionary conserved step in the life cycle of positive-stranded RNA viruses, the recruitment of cellular membranes for viral replication, as vulnerable and, most importantly, druggable target for antiviral intervention. We expect this mode of action to serve as a paradigm for the development of potent antiviral drugs to combat many animal and human virus infections. PMID:24874215

  8. Catalysis in prebiotic chemistry RNA synthesis

    NASA Astrophysics Data System (ADS)

    Ferris, J.; Joshi, P.; Wang, K.; Huang, W.; Miyakawa, S.

    It is proposed that catalysis by minerals and metal ions had a central role in the steps that led to the origins of life. In particular, the formation of biopolymers in the presence of water requires catalysis to compete with hydrolytic processes. Catalysis is required to limit the number of isomers generated so that the longer polymers necessary for the origins of life formed. Montmorillonite clay catalyzes the formation of 6 14 mers of RNA from activated monomers of A, G, U and C in- aqueous solution. Daily addition of activated monomers to a 10 mer primer results in the formation of 40-50 mers of adenylic acid and 30 mers of uridylic acid. The sequence selectivity and regioselectivity in phosphodiester bond formation results from the montmorillonite catalysis. Reaction of D, L-activated monomers of A and U leads to the preferential formation of homochiral dimers (eg. D, D and L, L-- pApA). These data and any more recent developments will be discussed.

  9. Designing synthetic RNA for delivery by nanoparticles

    NASA Astrophysics Data System (ADS)

    Jedrzejczyk, Dominika; Gendaszewska-Darmach, Edyta; Pawlowska, Roza; Chworos, Arkadiusz

    2017-03-01

    The rapid development of synthetic biology and nanobiotechnology has led to the construction of various synthetic RNA nanoparticles of different functionalities and potential applications. As they occur naturally, nucleic acids are an attractive construction material for biocompatible nanoscaffold and nanomachine design. In this review, we provide an overview of the types of RNA and nucleic acid’s nanoparticle design, with the focus on relevant nanostructures utilized for gene-expression regulation in cellular models. Structural analysis and modeling is addressed along with the tools available for RNA structural prediction. The functionalization of RNA-based nanoparticles leading to prospective applications of such constructs in potential therapies is shown. The route from the nanoparticle design and modeling through synthesis and functionalization to cellular application is also described. For a better understanding of the fate of targeted RNA after delivery, an overview of RNA processing inside the cell is also provided.

  10. DNA and RNA Synthesis in Animal Cells in Culture--Methods for Use in Schools

    ERIC Educational Resources Information Center

    Godsell, P. M.; Balls, M.

    1973-01-01

    Describes the experimental procedures used for detecting DNA and RNA synthesis in xenopus cells by autoradiography. The method described is suitable for senior high school laboratory classes or biology projects, if supervised by a teacher qualified to handle radioisotopes. (JR)

  11. MicroRNA and Transcriptomic Profiling Showed miRNA-Dependent Impairment of Systemic Regulation and Synthesis of Biomolecules in Rag2 KO Mice.

    PubMed

    Reza, Abu Musa Md Talimur; Choi, Yun-Jung; Kim, Jin-Hoi

    2018-02-27

    The Rag2 knockout (KO) mouse is a well-established immune-compromised animal model for biomedical research. A comparative study identified the deregulated expression of microRNAs (miRNAs) and messenger RNAs (mRNAs) in Rag2 KO mice. However, the interaction between deregulated genes and miRNAs in the alteration of systemic (cardiac, renal, hepatic, nervous, and hematopoietic) regulations and the synthesis of biomolecules (such as l-tryptophan, serotonin, melatonin, dopamine, alcohol, noradrenaline, putrescine, and acetate) are unclear. In this study, we analyzed both miRNA and mRNA expression microarray data from Rag2 KO and wild type mice to investigate the possible role of miRNAs in systemic regulation and biomolecule synthesis. A notable finding obtained from this analysis is that the upregulation of several genes which are target molecules of the downregulated miRNAs in Rag2 KO mice, can potentially trigger the degradation of l-tryptophan, thereby leading to the systemic impairment and alteration of biomolecules synthesis as well as changes in behavioral patterns (such as stress and fear responses, and social recognition memory) in Rag2 gene-depleted mice. These findings were either not observed or not explicitly described in other published Rag2 KO transcriptome analyses. In conclusion, we have provided an indication of miRNA-dependent regulations of clinical and pathological conditions in cardiac, renal, hepatic, nervous, and hematopoietic systems in Rag2 KO mice. These results may significantly contribute to the prediction of clinical disease caused by Rag2 deficiency.

  12. Determining miRNA Expression Levels in Degraded RNA Samples Using Real-Time RT-qPCR and Microarray Technologies

    PubMed Central

    Tighe, S.; Holbrook, J.; Nadella, V.; Carmical, R.; Sol-Church, K.; Yueng, A.T.; Chittur, S.

    2011-01-01

    The Nucleic Acid Research Group (NARG) has previously conducted studies evaluating the impact of RNA integrity and priming strategies on cDNA synthesis and real-time RT-qPCR. The results of last year's field study as it relates to degraded RNA will be presented. In continuation of the RNA integrity theme, this year's study was designed to evaluate the impact of RNA integrity on the analysis of miRNA expression using real-time RT-qPCR. Target section was based on data obtained by the Microarray Research Group (MARG) and other published data from next gen sequencing. These 9 miRNAs represent three groups of miRNA that are expressed at low, medium or high levels in the First Choice human brain reference RNA sample. Two popular RT priming strategies tested in this study include the Megaplex miRNA TaqMan assay (ABI) and the RT2 miRNA qPCR assay (Qiagen/SA Biosciences). The basis for the ABI assay design is a target-specific stem-loop structure and reverse-transcription primer, while the Qiagen design combines poly(A) tailing and a universal reverse transcription in one cDNA synthesis reaction. For this study, the human brain reference RNA was subject to controlled degradation using RNase A to RIN (RNA Integrity Number) values of 7 (good), 4 (moderately degraded), and 2 (severely degraded).These templates were then used to assess both RT methods. In addition to this real-time RT-qPCR data, the same RNA templates were further analyzed using universal poly(A) tailing and hybridization to Affymetrix miRNA GeneChips. This talk will provide insights into RT priming strategies for miRNA and contrast the qPCR results obtained using different technologies.

  13. All-trans retinoic acid regulates hepatic bile acid homeostasis

    PubMed Central

    Yang, Fan; He, Yuqi; Liu, Hui-Xin; Tsuei, Jessica; Jiang, Xiaoyue; Yang, Li; Wang, Zheng-Tao; Wan, Yu-Jui Yvonne

    2014-01-01

    Retinoic acid (RA) and bile acids share common roles in regulating lipid homeostasis and insulin sensitivity. In addition, the receptor for RA (retinoid x receptor) is a permissive partner of the receptor for bile acids, farnesoid x receptor (FXR/NR1H4). Thus, RA can activate the FXR-mediated pathway as well. The current study was designed to understand the effect of all-trans RA on bile acid homeostasis. Mice were fed an all-trans RA-supplemented diet and the expression of 46 genes that participate in regulating bile acid homeostasis was studied. The data showed that all-trans RA has a profound effect in regulating genes involved in synthesis and transport of bile acids. All-trans RA treatment reduced the gene expression levels of Cyp7a1, Cyp8b1, and Akr1d1, which are involved in bile acid synthesis. All-trans RA also decreased the hepatic mRNA levels of Lrh-1 (Nr5a2) and Hnf4α (Nr2a1), which positively regulate the gene expression of Cyp7a1 and Cyp8b1. Moreover, all-trans RA induced the gene expression levels of negative regulators of bile acid synthesis including hepatic Fgfr4, Fxr, and Shp (Nr0b2) as well as ileal Fgf15. All-trans RA also decreased the expression of Abcb11 and Slc51b, which have a role in bile acid transport. Consistently, all-trans RA reduced hepatic bile acid levels and the ratio of CA/CDCA, as demonstrated by liquid chromatography-mass spectrometry. The data suggest that all-trans RA-induced SHP may contribute to the inhibition of CYP7A1 and CYP8B1, which in turn reduces bile acid synthesis and affects lipid absorption in the gastrointestinal tract. PMID:25175738

  14. An In Vitro RNA Synthesis Assay for Rabies Virus Defines Ribonucleoprotein Interactions Critical for Polymerase Activity.

    PubMed

    Morin, Benjamin; Liang, Bo; Gardner, Erica; Ross, Robin A; Whelan, Sean P J

    2017-01-01

    We report an in vitro RNA synthesis assay for the RNA-dependent RNA polymerase (RdRP) of rabies virus (RABV). We expressed RABV large polymerase protein (L) in insect cells from a recombinant baculovirus vector and the phosphoprotein cofactor (P) in Escherichia coli and purified the resulting proteins by affinity and size exclusion chromatography. Using chemically synthesized short RNA corresponding to the first 19 nucleotides (nt) of the rabies virus genome, we demonstrate that L alone initiates synthesis on naked RNA and that P serves to enhance the initiation and processivity of the RdRP. The L-P complex lacks full processivity, which we interpret to reflect the lack of the viral nucleocapsid protein (N) on the template. Using this assay, we define the requirements in P for stimulation of RdRP activity as residues 11 to 50 of P and formally demonstrate that ribavirin triphosphate (RTP) inhibits the RdRP. By comparing the properties of RABV RdRP with those of the related rhabdovirus, vesicular stomatitis virus (VSV), we demonstrate that both polymerases can copy the heterologous promoter sequence. The requirements for engagement of the N-RNA template of VSV by its polymerase are provided by the C-terminal domain (CTD) of P. A chimeric RABV P protein in which the oligomerization domain (OD) and the CTD were replaced by those of VSV P stimulated RABV RdRP activity on naked RNA but was insufficient to permit initiation on the VSV N-RNA template. This result implies that interactions between L and the template N are also required for initiation of RNA synthesis, extending our knowledge of ribonucleoprotein interactions that are critical for gene expression. The current understanding of the structural and functional significance of the components of the rabies virus replication machinery is incomplete. Although structures are available for the nucleocapsid protein in complex with RNA, and also for portions of P, information on both the structure and function of the L

  15. Abscisic acid negatively regulates elicitor-induced synthesis of capsidiol in wild tobacco.

    PubMed

    Mialoundama, Alexis Samba; Heintz, Dimitri; Debayle, Delphine; Rahier, Alain; Camara, Bilal; Bouvier, Florence

    2009-07-01

    In the Solanaceae, biotic and abiotic elicitors induce de novo synthesis of sesquiterpenoid stress metabolites known as phytoalexins. Because plant hormones play critical roles in the induction of defense-responsive genes, we have explored the effect of abscisic acid (ABA) on the synthesis of capsidiol, the major wild tobacco (Nicotiana plumbaginifolia) sesquiterpenoid phytoalexin, using wild-type plants versus nonallelic mutants Npaba2 and Npaba1 that are deficient in ABA synthesis. Npaba2 and Npaba1 mutants exhibited a 2-fold higher synthesis of capsidiol than wild-type plants when elicited with either cellulase or arachidonic acid or when infected by Botrytis cinerea. The same trend was observed for the expression of the capsidiol biosynthetic genes 5-epi-aristolochene synthase and 5-epi-aristolochene hydroxylase. Treatment of wild-type plants with fluridone, an inhibitor of the upstream ABA pathway, recapitulated the behavior of Npaba2 and Npaba1 mutants, while the application of exogenous ABA reversed the enhanced synthesis of capsidiol in Npaba2 and Npaba1 mutants. Concomitant with the production of capsidiol, we observed the induction of ABA 8'-hydroxylase in elicited plants. In wild-type plants, the induction of ABA 8'-hydroxylase coincided with a decrease in ABA content and with the accumulation of ABA catabolic products such as phaseic acid and dihydrophaseic acid, suggesting a negative regulation exerted by ABA on capsidiol synthesis. Collectively, our data indicate that ABA is not required per se for the induction of capsidiol synthesis but is essentially implicated in a stress-response checkpoint to fine-tune the amplification of capsidiol synthesis in challenged plants.

  16. Role of the Pepino mosaic virus 3'-untranslated region elements in negative-strand RNA synthesis in vitro.

    PubMed

    Osman, Toba A M; Olsthoorn, René C L; Livieratos, Ioannis C

    2014-09-22

    Pepino mosaic virus (PepMV) is a mechanically-transmitted positive-strand RNA potexvirus, with a 6410 nt long single-stranded (ss) RNA genome flanked by a 5'-methylguanosine cap and a 3' poly-A tail. Computer-assisted folding of the 64 nt long PepMV 3'-untranslated region (UTR) resulted in the prediction of three stem-loop structures (hp1, hp2, and hp3 in the 3'-5' direction). The importance of these structures and/or sequences for promotion of negative-strand RNA synthesis and binding to the RNA dependent RNA polymerase (RdRp) was tested in vitro using a specific RdRp assay. Hp1, which is highly variable among different PepMV isolates, appeared dispensable for negative-strand synthesis. Hp2, which is characterized by a large U-rich loop, tolerated base-pair changes in its stem as long as they maintained the stem integrity but was very sensitive to changes in the U-rich loop. Hp3, which harbours the conserved potexvirus ACUUAA hexamer motif, was essential for template activity. Template-RNA polymerase binding competition experiments showed that the ACUUAA sequence represents a high-affinity RdRp binding element. Copyright © 2014 Elsevier B.V. All rights reserved.

  17. Nucleic Acid Templated Reactions for Chemical Biology.

    PubMed

    Di Pisa, Margherita; Seitz, Oliver

    2017-06-21

    Nucleic acid directed bioorthogonal reactions offer the fascinating opportunity to unveil and redirect a plethora of intracellular mechanisms. Nano- to picomolar amounts of specific RNA molecules serve as templates and catalyze the selective formation of molecules that 1) exert biological effects, or 2) provide measurable signals for RNA detection. Turnover of reactants on the template is a valuable asset when concentrations of RNA templates are low. The idea is to use RNA-templated reactions to fully control the biodistribution of drugs and to push the detection limits of DNA or RNA analytes to extraordinary sensitivities. Herein we review recent and instructive examples of conditional synthesis or release of compounds for in cellulo protein interference and intracellular nucleic acid imaging. © 2017 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.

  18. Structural and Functional Basis of the Fidelity of Nucleotide Selection by Flavivirus RNA-Dependent RNA Polymerases

    PubMed Central

    Canard, Bruno

    2018-01-01

    Viral RNA-dependent RNA polymerases (RdRps) play a central role not only in viral replication, but also in the genetic evolution of viral RNAs. After binding to an RNA template and selecting 5′-triphosphate ribonucleosides, viral RdRps synthesize an RNA copy according to Watson-Crick base-pairing rules. The copy process sometimes deviates from both the base-pairing rules specified by the template and the natural ribose selectivity and, thus, the process is error-prone due to the intrinsic (in)fidelity of viral RdRps. These enzymes share a number of conserved amino-acid sequence strings, called motifs A–G, which can be defined from a structural and functional point-of-view. A co-relation is gradually emerging between mutations in these motifs and viral genome evolution or observed mutation rates. Here, we review our current knowledge on these motifs and their role on the structural and mechanistic basis of the fidelity of nucleotide selection and RNA synthesis by Flavivirus RdRps. PMID:29385764

  19. New hydrazones of ferulic acid: synthesis, characterization and biological activity.

    PubMed

    Wolszleger, Maria; Stan, Cătălina Daniela; Apotrosoaei, Maria; Vasincu, Ioana; Pânzariu, Andreea; Profire, Lenuţa

    2014-01-01

    The ferulic acid (4-hydroxy-3-methoxy-cinnamic acid) is a phenolic compound with important antioxidant effects and which nowadays is being extensively studied for his potential indications in inflammatory and neurodegenerative diseases, hypertension, atherosclerosis, etc. The synthesis of new ferulic acid compounds with potential antioxidant activity. The synthesis of the designed compounds was performed in several steps: (i) the obtaining of ferulic acid chloride by reacting of ferulic acid with thionyl chloride; (ii) the reaction between the ferulic acid chloride and hydrazine hydrate 98% to obtain the ferulic acid hydrazide; (iii) the condensation of ferrulic acid hydrazide with various benzaldehydes (2-hydroxy/3-hydroxy/4-hydroxy/2-nitro/3-nitro/4-nitro/2-methoxi/ 4-chloro/4-fluoro/4-bromo-benzaldehyde) resulting the correspond- ing hydrazones. The structure of the synthesized compounds was confirmed by FT-IR spectroscopy and the evaluation of antioxidant potential was achieved by determining the total antioxidant capacity and reducing power. In this study new hydrazones of ferulic acid have been synthesized, physic-chemical and spectral characterized. The evaluation of antioxidant potential using in vitro methods showed the favorable influence of the structural modulation on the antioxidant effects of ferulic acid.

  20. RNA:DNA Ratio and Other Nucleic Acid Derived Indices in Marine Ecology

    PubMed Central

    Chícharo, Maria Alexandra; Chícharo, Luis

    2008-01-01

    Some of most used indicators in marine ecology are nucleic acid-derived indices. They can be divided by target levels in three groups: 1) at the organism level as ecophysiologic indicators, indicators such as RNA:DNA ratios, DNA:dry weight and RNA:protein, 2) at the population level, indicators such as growth rate, starvation incidence or fisheries impact indicators, and 3) at the community level, indicators such as trophic interactions, exergy indices and prey identification. The nucleic acids derived indices, especially RNA:DNA ratio, have been applied with success as indicators of nutritional condition, well been and growth in marine organisms. They are also useful as indicators of natural or anthropogenic impacts in marine population and communities, such as upwelling or dredge fisheries, respectively. They can help in understanding important issues of marine ecology such as trophic interactions in marine environment, fish and invertebrate recruitment failure and biodiversity changes, without laborious work of counting, measuring and identification of small marine organisms. Besides the objective of integrate nucleic acid derived indices across levels of organization, the paper will also include a general characterization of most used nucleic acid derived indices in marine ecology and also advantages and limitations of them. We can conclude that using indicators, such RNA:DNA ratios and other nucleic acids derived indices concomitantly with organism and ecosystems measures of responses to climate change (distribution, abundance, activity, metabolic rate, survival) will allow for the development of more rigorous and realistic predictions of the effects of anthropogenic climate change on marine systems. PMID:19325815

  1. Control of Fur synthesis by the non-coding RNA RyhB and iron-responsive decoding.

    PubMed

    Vecerek, Branislav; Moll, Isabella; Bläsi, Udo

    2007-02-21

    The Fe2+-dependent Fur protein serves as a negative regulator of iron uptake in bacteria. As only metallo-Fur acts as an autogeneous repressor, Fe2+scarcity would direct fur expression when continued supply is not obviously required. We show that in Escherichia coli post-transcriptional regulatory mechanisms ensure that Fur synthesis remains steady in iron limitation. Our studies revealed that fur translation is coupled to that of an upstream open reading frame (uof), translation of which is downregulated by the non-coding RNA (ncRNA) RyhB. As RyhB transcription is negatively controlled by metallo-Fur, iron depletion creates a negative feedback loop. RyhB-mediated regulation of uof-fur provides the first example for indirect translational regulation by a trans-encoded ncRNA. In addition, we present evidence for an iron-responsive decoding mechanism of the uof-fur entity. It could serve as a backup mechanism of the RyhB circuitry, and represents the first link between iron availability and synthesis of an iron-containing protein.

  2. Expeditious Synthesis of Dianionic-Headed 4-Sulfoalkanoic Acid Surfactants.

    PubMed

    Jiang, Jianghui; Xu, Jiaxi

    2017-04-16

    4-Sulfoalkanoic acids are a class of important dianionic-headed surfactants. Various 4-sulfoalkanoic acids with straight C8, C10, C12, C14, C16, and C18 chains were synthesized expeditiously through the radical addition of methyl 2-((ethoxycarbonothioyl)thio)acetate to linear terminal olefins and subsequent oxidation with peroxyformic acid. This is a useful and convenient strategy for the synthesis of dianionic-headed surfactants with a carboxylic acid and sulfonic acid functionalities in the head group region.

  3. Synthesis of monomethyl 5,5'-dehydrodiferulic acid

    USDA-ARS?s Scientific Manuscript database

    Synthesis of the internal reference compound, monomethyl 5,5’-dehydrodiferulic acid, is described. The synthetic scheme relies on a selective monomethylation of the known compound 5,5-dehydrodivanillin, followed by elaboration into the dehydrodiferulic framework through a dual Horner-Emmons-Wadswort...

  4. Engineering CRISPR interference system in Klebsiella pneumoniae for attenuating lactic acid synthesis.

    PubMed

    Wang, Jingxuan; Zhao, Peng; Li, Ying; Xu, Lida; Tian, Pingfang

    2018-04-05

    Klebsiella pneumoniae is a promising industrial species for bioproduction of bulk chemicals such as 1,3-propanediol, 2,3-butanediol and 3-hydroxypropionic acid (3-HP). However, lactic acid is a troublesome by-product when optimizing for 3-HP production. Therefore, it is highly desirable to minimize lactic acid. Here, we show that lactic acid synthesis can be largely blocked by an engineered CRISPR interference (CRISPRi) system in K. pneumoniae. EGFP was recruited as a reporter of this CRISPRi system. Fluorescence assay of this CRISPRi system showed that enhanced green fluorescent protein (EGFP) expression level was repressed by 85-90%. To further test this CRISPRi system, guide RNAs were designed to individually or simultaneously target four lactate-producing enzyme genes. Results showed that all lactate-producing enzyme genes were significantly repressed. Notably, D-lactate dehydrogenase (ldhA) was shown to be the most influential enzyme for lactic acid formation in micro-aerobic conditions, as inhibiting ldhA alone led to lactic acid level similar to simultaneously repressing four genes. In shake flask cultivation, the strain coexpressing puuC (an aldehyde dehydrogenase catalyzing 3-hydroxypropionaldehyde to 3-HP) and dCas9-sgRNA inhibiting ldhA produced 1.37-fold 3-HP relative to the reference strain. Furthermore, in bioreactor cultivation, this CRISPRi strain inhibiting ldhA produced 36.7 g/L 3-HP, but only generated 1 g/L lactic acid. Clearly, this engineered CRISPRi system largely simplified downstream separation of 3-HP from its isomer lactic acid, an extreme challenge for 3-HP bioprocess. This study offers a deep understanding of lactic acid metabolism in diverse species, and we believe that this CRISPRi system will facilitate biomanufacturing and functional genome studies of K. pneumoniae or beyond.

  5. An improved synthesis for the (Z)-14-methyl-9-pentadecenoic acid and its topoisomerase I inhibitory activity

    PubMed Central

    Carballeira, Néstor M.; Sanabria, David; Oyola, Delise

    2006-01-01

    An improved synthesis for the (Z)-14-methyl-9-pentadecenoic acid was developed based on the appropriate use of (trimethylsilyl)acetylene as the key reagent in the synthesis. The reported synthesis started with commercially available 8-bromo-1-octanol and furnished the desired acid in seven steps and in a 16% overall yield, a significant improvement over the previous reported synthesis for this fatty acid. The synthesis reported herein afforded sufficient amounts to study the acid topoisomerase I inhibitory potential and it was found that the title acid inhibits the human placenta DNA topoisomerase I enzyme at concentrations of 500 μM. PMID:17680032

  6. Effect of the quality of dietary amino acids composition on the urea synthesis in rats.

    PubMed

    Tujioka, Kazuyo; Ohsumi, Miho; Hayase, Kazutoshi; Yokogoshi, Hidehiko

    2011-01-01

    We have shown that urinary urea excretion increased in rats given a lower quality protein. The purpose of present study was to determine whether the composition of dietary amino acids affects urea synthesis. Experiments were done on three groups of rats given diets containing a 10% gluten amino acid mix diet or 10% casein amino acid mix diet or 10% whole egg protein amino acids mix diet for 10 d. The urinary excretion of urea, the liver concentration of N-acetylglutamate, and the liver concentration of free serine, glutamic acids and alanine were greater in the group given the amino acid mix diet of lower quality. The fractional and absolute rates of protein synthesis in tissues declined with a decrease in quality of dietary amino acids. The hepatic concentration of ornithine and the activities of hepatic urea-cycle enzymes were not related to the urea excretion. These results suggest that the increased concentrations of amino acids and N-acetylglutamate seen in the liver of rats given the amino acid mix diets of lower quality are likely among the factors stimulating urea synthesis. The protein synthesis in tissues is at least partly related to hepatic concentrations of amino acids. The composition of dietary amino acids is likely to be one of the factors regulating urea synthesis when the quality of dietary protein is manipulated.

  7. Did the Pre-RNA World Rest Upon DNA Molecules?

    NASA Technical Reports Server (NTRS)

    Lazcano, Antonio; Dworkin, Jason P.; Miller, Stanley L.

    2004-01-01

    The isolation of a DNA sequence that catalyzes the ligation of oligodeoxynucleotides via the formation of 3' - 5' phosphodiester linkage significance in selection experiments has been reported. Ball recently used this to discuss the possibility that natural DNA molecules may have formed in the primitive Earth leading to the origin of life. As noted by Ferris and Usher, if metabolic pathways evolved backwards, it could be argued that the biosynthesis of 2-deoxyribose from ribose suggests that RNA came from DNA. As summarized elsewhere, there are several properties of deoxyribose which could be interpreted to support the possibility that DNA-like molecules arose prior to the RNA world. For example, 2-deoxyribose is slightly more soluble than ribose (which may have been an advantage in a drying pool scenario), may have been more reactive under possible prebiotic conditions (it forms a nucleoside approx. 150 times faster than ribose with the alternative base urazole at 25 C), while it decomposes in solution (approximately 2.6 times more slowly than ribose at 100 C). Other advantages of DNA over RNA are that it has one fewer chiral center, has a greater stability at the 8.2 pH value of the current oceans, and does not has the 2'5' and 3'5' ambiguity in polymerizations. Yet, there is strong molecular biological and biochemical evidence that RNA was featured in the biology well before the last common ancestor. The presence of sugar acids, including both ribo- and deoxysugar acids, in the 4.6 Ga old Murchison meteorite suggest that both may have been available in the primitive Earth, derived from the accretion of extraterrestrial sources and/or from endogenous processes involving formaldehyde and its derivatives. However, the abiotic synthesis of deoxyribose, ribose, and other sugars from glyceraldehyde and acetaldehyde under alkaline conditions is inefficient and unespecific. Although sugars are labile compounds, the role of cyanamide or borate minerals in the

  8. Synthesis of double-stranded RNA in a virus-enriched fraction from Agaricus bisporus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sriskantha, A.; Wach, P.; Schlagnhaufer, B.

    Partially purified virus preparations from sporophores of Agaricus bisporus affected with LaFrance disease had up to a 15-fold-higher RNA-dependent RNA polymerase activity than did comparable preparations from health sporophores. Enzyme activity was dependent upon the presence of Mg/sup 2 +/ and the four nucleoside triphosphates and was insensitive to actinomycin D, ..cap alpha..-amanitin, and rifampin. The /sup 3/H-labeled enzyme reaction products were double-stranded RNA (dsRNA) as indicated by CF-11 cellulose column chromatography and by their ionic-strength-dependent sensitivity to hydrolysis by RNase A. The principal dsRNA products had estimated molecular weights of 4.3 /times/ 10/sup 6/ and 1.4 /times/ 10/sup 6/.more » Cs/sub 2/SO/sub 4/ equilibrium centrifugation of the virus preparation resolved a single peak of RNA polymerase activity that banded with a 35-nm spherical virus particle containing dsRNAs with molecular weights of 4.3 /times/ 10/sup 6/ and 1.4 /times/ 10/sup 6/. The data suggest that the RNA-dependent RNA polymerase associated with the 35-nm spherical virus is a replicase which catalyzes the synthesis of the genomic dsRNAs.« less

  9. “Dark matter” worlds of unstable RNA and protein

    PubMed Central

    Baboo, Sabyasachi; Cook, Peter R

    2014-01-01

    Astrophysicists use the term “dark matter” to describe the majority of the matter and/or energy in the universe that is hidden from view, and biologists now apply it to the new families of RNA they are uncovering. We review evidence for an analogous hidden world containing peptides. The critical experiments involved pulse-labeling human cells with tagged amino acids for periods as short as five seconds. Results are extraordinary in two respects: both nucleus and cytoplasm become labeled, and most signals disappear with a half-life of less than one minute. Just as the synthesis of each mature mRNA is regulated by the abortive production of hundreds of shorter transcripts that are quickly degraded, it seems that the synthesis of each full-length protein in the stable proteome is regulated by an apparently wasteful production and degradation of shorter peptides. Some of the nuclear synthesis is probably a byproduct of nuclear ribosomes proofreading newly-made RNA for inappropriately-placed termination codons (a process that triggers “nonsense-mediated decay”). We speculate that some “dark-matter” peptides will play other important roles in the cell. PMID:25482115

  10. Total amino acid stabilization during cell-free protein synthesis reactions.

    PubMed

    Calhoun, Kara A; Swartz, James R

    2006-05-17

    Limitations in amino acid supply have been recognized as a substantial problem in cell-free protein synthesis reactions. Although enzymatic inhibitors and fed-batch techniques have been beneficial, the most robust way to stabilize amino acids is to remove the responsible enzymatic activities by genetically modifying the source strain used for cell extract preparation. Previous work showed this was possible for arginine, serine, and tryptophan, but cysteine degradation remained a major limitation in obtaining high protein synthesis yields. Through radiolabel techniques, we confirmed that cysteine degradation was caused by the activity of glutamate-cysteine ligase (gene gshA) in the cell extract. Next, we created Escherichia coli strain KC6 that combines a gshA deletion with previously described deletions for arginine, serine, and tryptophan stabilization. Strain KC6 grows well, and active cell extract can be produced from it for cell-free protein synthesis reactions. The extract from strain KC6 maintains stable amino acid concentrations of all 20 amino acids in a 3-h batch reaction. Yields for three different proteins improved 75-250% relative to cell-free expression using the control extract.

  11. Stereoselective synthesis of unsaturated α-amino acids.

    PubMed

    Fanelli, Roberto; Jeanne-Julien, Louis; René, Adeline; Martinez, Jean; Cavelier, Florine

    2015-06-01

    Stereoselective synthesis of unsaturated α-amino acids was performed by asymmetric alkylation. Two methods were investigated and their enantiomeric excess measured and compared. The first route consisted of an enantioselective approach induced by the Corey-Lygo catalyst under chiral phase transfer conditions while the second one involved the hydroxypinanone chiral auxiliary, both implicating Schiff bases as substrate. In all cases, the use of a prochiral Schiff base gave higher enantiomeric excess and yield in the final desired amino acid.

  12. DNA methyltransferase homologue TRDMT1 in Plasmodium falciparum specifically methylates endogenous aspartic acid tRNA.

    PubMed

    Govindaraju, Gayathri; Jabeena, C A; Sethumadhavan, Devadathan Valiyamangalath; Rajaram, Nivethika; Rajavelu, Arumugam

    2017-10-01

    In eukaryotes, cytosine methylation regulates diverse biological processes such as gene expression, development and maintenance of genomic integrity. However, cytosine methylation and its functions in pathogenic apicomplexan protozoans remain enigmatic. To address this, here we investigated the presence of cytosine methylation in the nucleic acids of the protozoan Plasmodium falciparum. Interestingly, P. falciparum has TRDMT1, a conserved homologue of DNA methyltransferase DNMT2. However, we found that TRDMT1 did not methylate DNA, in vitro. We demonstrate that TRDMT1 methylates cytosine in the endogenous aspartic acid tRNA of P. falciparum. Through RNA bisulfite sequencing, we mapped the position of 5-methyl cytosine in aspartic acid tRNA and found methylation only at C38 position. P. falciparum proteome has significantly higher aspartic acid content and a higher proportion of proteins with poly aspartic acid repeats than other apicomplexan pathogenic protozoans. Proteins with such repeats are functionally important, with significant roles in host-pathogen interactions. Therefore, TRDMT1 mediated C38 methylation of aspartic acid tRNA might play a critical role by translational regulation of important proteins and modulate the pathogenicity of the malarial parasite. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Mutants of Escherichia coli defective in membrane phospholipid synthesis: macromolecular synthesis in an sn-glycerol 3-phosphate acyltransferase Km mutant.

    PubMed

    Bell, R M

    1974-03-01

    sn-Glycerol 3-phosphate (G3P) auxotrophs of Escherichia coli have been selected from a strain which cannot aerobically catabolize G3P. The auxotrophy resulted from loss of the biosynthetic G3P dehydrogenase (EC 1.1.1.8) or from a defective membranous G3P acyltransferase. The apparent K(m) of the acyltransferase for G3P was 11- to 14-fold higher (from about 90 mum to 1,000 to 1,250 mum) in membrane preparations from the mutants than those of the parent. All extracts prepared from revertants of the G3P dehydrogenase mutants showed G3P dehydrogenase activity, but most contained less than 10% of the wild-type level. Membrane preparations from revertants of the acyltransferase mutants had apparent K(m)'s for G3P similar to that of the parent. Strains have been derived in which the G3P requirement can be satisfied with glycerol in the presence of glucose, presumably because the glycerol kinase was desensitized to inhibition by fructose 1,6-diphosphate. Investigations on the growth and macromolecular synthesis in a G3P acyltransferase K(m) mutant revealed that upon glycerol deprivation, net phospholipid synthesis stopped immediately; growth continued for about one doubling; net ribonucleic acid (RNA), deoxyribonucleic acid (DNA), and protein nearly doubled paralleling the growth curve; the rate of phospholipid synthesis assessed by labeling cells with (32)P-phosphate, (14)C-acetate, or (3)H-serine was reduced greater than 90%; the rates of RNA and DNA synthesis increased as the cells grew and then decreased as the cells stopped growing; the rate of protein synthesis showed no increase and declined more slowly than the rates of RNA and DNA synthesis when the cells stopped growing. The cells retained and gained in the capacity to synthesize phospholipids upon glycerol deprivation. These data indicate that net phospholipid synthesis is not required for continued macromolecular synthesis for about one doubling, and that the rates of these processes are not coupled during this

  14. Synthesis and radiolabeling of chelator-RNA aptamer bioconjugates with copper-64 for targeted molecular imaging

    PubMed Central

    Rockey, William M.; Huang, Ling; Kloepping, Kyle C.; Baumhover, Nicholas J.; Giangrande, Paloma H.; Schultz, Michael K.

    2014-01-01

    Ribonucleic acid (RNA) aptamers with high affinity and specificity for cancer-specific cell-surface antigens are promising reagents for targeted molecular imaging of cancer using positron emission tomography (PET). For this application, aptamers must be conjugated to chelators capable of coordinating PET-radionuclides (e.g. copper-64, 64Cu) to enable radiolabeling for in vivo imaging of tumors. This study investigates the choice of chelator and radiolabeling parameters such as pH and temperature for the development of 64Cu-labeled RNA-based targeted agents for PET imaging. The characterization and optimization of labeling conditions are described for four chelator-aptamer complexes. Three commercially available bifunctional macrocyclic chelators (1,4,7,10-tetraazacyclododecane-1,4,7-triacetic acid mono N-hydroxysuccinimide [DOTA-NHS]; S-2-(4-isothiocyanatobenzyl)-1,4,7-triazacyclononane-1,4,7-triacetic acid [p-SCN-Bn-NOTA]; and p-SCN-Bn-3,6,9,15-tetraazabicyclo [9.3.1]pentadeca-1(15),11,13-triene-3,6,9-triacetic acid [p-SCN-Bn-PCTA]), as well as the polyamino-macrocyclic diAmSar (3,6,10,13,16,19-hexaazabicyclo[6.6.6] icosane-1,8-diamine) were conjugated to A10–3.2, a RNA aptamer which has been shown to bind specifically to a prostate cancer-specific cell-surface antigen (PSMA). Although a commercial bifunctional version of diAmSar was not available, RNA conjugation with this chelator was achieved in a two-step reaction by the addition of a disuccinimidyl suberate linker. Radiolabeling parameters (e.g. pH, temperature, and time) for each chelator-RNA conjugate were assessed in order to optimize specific activity and RNA stability. Furthermore, the radiolabeled chelator-coupled RNA aptamers were evaluated for binding specificity to their target antigen. In summary, key parameters were established for optimal radiolabeling of RNA aptamers for eventual PET imaging with 64Cu. PMID:21658962

  15. Regulation of ribonucleic acid synthesis by polyamines. Reversal by spermine of inhibition by methylglyoxal bis(guanylhydrazone) of ribonucleic acid synthesis and histone acetylation in rabbit heart.

    PubMed

    Caldarera, C M; Casti, A; Guarnier, C; Moruzzi, G

    1975-10-01

    The relationship between polyamines and RNA synthesis was studied by considering the action of spermine on histone acetylation in perfused heart. In addition, the effect of methylglyoxal bis(guanylhydrazone), inhibitor of putrescine-activated S-adenosylmethionine decarboxylase activity, on RNA and polyamine specific radioactivity and on acetylation of histone fractions was also investigated in perfused heart. Different concentrations of spermine and/or methylglyoxas bis(guanylhydrazone) were injected into the heart, 15 min after beginning the perfusion. The results demonstrate that spermine stimulates the specific radioactivity of RNA of subcellular fractions. Acetylation of the arginine-rich histone fractions, involved in the regulation of RNA transcription, is enhanced by spermine. The perfusion with methylglyoxal bis(guanylhydrazone) causes a decrease in the specific radioactivity of polyamines and RNA, and in acetylation of histone fractions. However, spermine is able to reverse the methylglyoxal bis(guanylhydrazone) inhibition when injected simultaneously. From these results we may assume a possible role for spermine in the regulation of RNA transcription.

  16. Regulation of ribonucleic acid synthesis by polyamines. Reversal by spermine of inhibition by methylglyoxal bis(guanylhydrazone) of ribonucleic acid synthesis and histone acetylation in rabbit heart.

    PubMed Central

    Caldarera, C M; Casti, A; Guarnier, C; Moruzzi, G

    1975-01-01

    The relationship between polyamines and RNA synthesis was studied by considering the action of spermine on histone acetylation in perfused heart. In addition, the effect of methylglyoxal bis(guanylhydrazone), inhibitor of putrescine-activated S-adenosylmethionine decarboxylase activity, on RNA and polyamine specific radioactivity and on acetylation of histone fractions was also investigated in perfused heart. Different concentrations of spermine and/or methylglyoxas bis(guanylhydrazone) were injected into the heart, 15 min after beginning the perfusion. The results demonstrate that spermine stimulates the specific radioactivity of RNA of subcellular fractions. Acetylation of the arginine-rich histone fractions, involved in the regulation of RNA transcription, is enhanced by spermine. The perfusion with methylglyoxal bis(guanylhydrazone) causes a decrease in the specific radioactivity of polyamines and RNA, and in acetylation of histone fractions. However, spermine is able to reverse the methylglyoxal bis(guanylhydrazone) inhibition when injected simultaneously. From these results we may assume a possible role for spermine in the regulation of RNA transcription. PMID:1212228

  17. Deoxyribonucleic Acid Replication and Expression of Early and Late Bacteriophage Functions in Bacillus subtilis

    PubMed Central

    Pène, Jacques J.; Marmur, Julius

    1967-01-01

    The role of deoxyribonucleic acid (DNA) replication in the control of the synthesis of deoxycytidylate (dCMP) deaminase and lysozyme in Bacillus subtilis infected with bacteriophage 2C has been studied. These phage-induced enzymes are synthesized at different times during the latent period. It was shown by actinomycin inhibition that the formation of the late enzyme (lysozyme) required messenger ribonucleic acid (mRNA) synthesized de novo after the initiation of translation of mRNA which specifies the early function (dCMP deaminase). The inhibition of phage DNA synthesis by mitomycin C prevented the synthesis of lysozyme only when added before the onset of phage DNA replication, but it did not affect the synthesis or action of dCMP deaminase when added at any time during the latent period. Treatment of infected cells with mitomycin C after phage DNA synthesis had reached 8 to 10% of its maximal rate resulted in the production of normal amounts of lysozyme. These observations suggest that mRNA specifying early enzymes can be transcribed from parental (and probably also from progeny) DNA, whereas late functional messengers can be transcribed only after the formation of progeny DNA. PMID:4990039

  18. Retinoic acid stimulates interstitial collagenase messenger ribonucleic acid in osteosarcoma cells

    NASA Technical Reports Server (NTRS)

    Connolly, T. J.; Clohisy, J. C.; Shilt, J. S.; Bergman, K. D.; Partridge, N. C.; Quinn, C. O.

    1994-01-01

    The rat osteoblastic osteosarcoma cell line UMR 106-01 secretes interstitial collagenase in response to retinoic acid (RA). The present study demonstrates by Northern blot analysis that RA causes an increase in collagenase messenger RNA (mRNA) at 6 h, which is maximal at 24 h (20.5 times basal) and declines toward basal level by 72 h. This stimulation is dose dependent, with a maximal response at 5 x 10(-7) M RA. Nuclear run-on assays show a greater than 20-fold increase in the rate of collagenase mRNA transcription between 12-24 h after RA treatment. Cycloheximide blocks RA stimulation of collagenase mRNA, demonstrating the need for de novo protein synthesis. RA not only causes an increase in collagenase secretion, but is known to decrease collagen synthesis in UMR 106-01 cells. In this study, the increase in collagenase mRNA is accompanied by a concomitant decrease in the level of alpha 1(I) procollagen mRNA, which is maximal at 24 h (70% decrease), with a return to near-control levels by 72 h. Nuclear run-on assays demonstrated that the decrease in alpha 1 (I) procollagen expression does not have a statistically significant transcriptional component. RA did not statistically decrease the stability of alpha 1 (I) procollagen mRNA (calculated t1/2 = 8.06 +/- 0.30 and 9.01 +/- 0.62 h in the presence and absence of RA, respectively). However, transcription and stability together probably contribute to the major decrease in stable alpha 1 (I) procollagen mRNA observed. Cycloheximide treatment inhibits basal level alpha 1 (I) procollagen mRNA accumulation, demonstrating the need for on-going protein synthesis to maintain basal expression of this gene.

  19. Salutary effect of Aurintricarboxylic acid (ATA) on endotoxin- and sepsis-induced changes in muscle protein synthesis and inflammation

    PubMed Central

    Laufenberg, Lacee; Kazi, Abid A.; Lang, Charles H.

    2014-01-01

    Small molecule nonpeptidyl molecules are potentially attractive drug candidates as adjunct therapies in the treatment of sepsis-induced metabolic complications. As such, the current study investigates the use of aurintricarboxylic acid (ATA), which stimulates insulin-like growth factor (IGF)-I receptor and AKT signaling, for its ability to ameliorate the protein metabolic effects of endotoxin (LPS) + interferon (IFN)γ in C2C12 myotubes and sepsis in skeletal muscle. ATA dose- and time-dependently increases mTOR-dependent protein synthesis. Pretreatment with ATA prevents the LPS/IFNγ-induced decrease in protein synthesis at least in part by maintaining mTOR kinase activity, while post-treatment with ATA is able to increase protein synthesis when added up to 6 h after LPS/IFNγ. ATA also reverses the amino acid resistance which is detected in response to nutrient deprivation. Conversely, ATA decreases the basal rate of protein degradation and prevents the LPS/IFNγ-increase in proteolysis, and the latter change is associated reduced atrogin-1 and MuRF1 mRNA. The ability of ATA to antagonize LPS/IFNγ-induced changes in protein metabolism were associated with its ability to prevent the increases in IL-6 and NOS2 and decreases in IGF-I. In vivo studies indicate ATA acutely increases skeletal muscle, but not cardiac, protein synthesis, and attenuates the loss of lean body mass over 5 days. These data suggest ATA and other small molecule agonists of endogenous anabolic hormones may prove beneficial in treating sepsis by decreasing the inflammatory response and improving muscle protein balance. PMID:24430547

  20. Effects of nonesterified fatty acids on the synthesis and assembly of very low density lipoprotein in bovine hepatocytes in vitro.

    PubMed

    Liu, Lei; Li, Xinwei; Li, Yu; Guan, Yuan; Song, Yuxiang; Yin, Liheng; Chen, Hui; Lei, Liancheng; Liu, Juxiong; Li, Xiaobing; Wang, Zhe; Yang, Xiaoyu; Liu, Guowen

    2014-03-01

    High serum concentrations of nonesterified fatty acids (NEFA), which may affect the synthesis and assembly of very low density lipoproteins (VLDL), are associated with fatty liver during the early lactation period. Therefore, the objective of this study was to investigate the effects of NEFA on the synthesis and assembly of VLDL in bovine hepatocytes. Bovine hepatocytes were cultured and treated with different concentrations of NEFA. The mRNA expression of apolipoprotein B100 (ApoB100) and apolipoprotein E (ApoE) was significantly lower in the NEFA treatment groups than in the control group (0mM NEFA). The abundance of mRNA from microsomal triglyceride transfer protein (MTP) and the low density lipoprotein receptor (LDLR) was significantly lower in the medium- and high-dose NEFA treatment groups. The protein expression of ApoB100, ApoE, MTP, and LDLR was found to be significantly and dose-dependently decreased in groups of NEFA-treated hepatocytes. The VLDL content was also significantly decreased in the NEFA-treated hepatocytes. Large amounts of triglycerides accumulated in the hepatocytes. These results indicate that NEFA significantly inhibits the expression of ApoB100, ApoE, MTP, and LDLR, thereby decreasing the synthesis and assembly of VLDL and inducing TG accumulation in bovine hepatocytes. Copyright © 2014 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  1. Tannic acid-mediated green synthesis of antibacterial silver nanoparticles.

    PubMed

    Kim, Tae Yoon; Cha, Song-Hyun; Cho, Seonho; Park, Youmie

    2016-04-01

    The search for novel antibacterial agents is necessary to combat microbial resistance to current antibiotics. Silver nanoparticles (AgNPs) have been reported to be effective antibacterial agents. Tannic acid is a polyphenol compound from plants with antioxidant and antibacterial activities. In this report, AgNPs were prepared from silver ions by tannic acid-mediated green synthesis (TA-AgNPs). The reaction process was facile and involved mixing both silver ions and tannic acid. The absorbance at 423 nm in the UV-Visible spectra demonstrated that tannic acid underwent a reduction reaction to produce TA-AgNPs from silver ions. The synthetic yield of TA-AgNPs was 90.5% based on inductively coupled plasma mass spectrometry analysis. High-resolution transmission electron microscopy and atomic force microscopy images indicated that spherical-shaped TA-AgNPs with a mean particle size of 27.7-46.7 nm were obtained. Powder high-resolution X-ray diffraction analysis indicated that the TA-AgNP structure was face-centered cubic with a zeta potential of -27.56 mV. The hydroxyl functional groups of tannic acid contributed to the synthesis of TA-AgNPs, which was confirmed by Fourier transform infrared spectroscopy. The in vitro antibacterial activity was measured using the minimum inhibitory concentration (MIC) method. The TA-AgNPs were more effective against Gram-negative bacteria than Gram-positive bacteria. The MIC for the TA-AgNPs in all of the tested strains was in a silver concentration range of 6.74-13.48 μg/mL. The tannic acid-mediated synthesis of AgNPs afforded biocompatible nanocomposites for antibacterial applications.

  2. An amino acid depleted cell-free protein synthesis system for the incorporation of non-canonical amino acid analogs into proteins.

    PubMed

    Singh-Blom, Amrita; Hughes, Randall A; Ellington, Andrew D

    2014-05-20

    Residue-specific incorporation of non-canonical amino acids into proteins is usually performed in vivo using amino acid auxotrophic strains and replacing the natural amino acid with an unnatural amino acid analog. Herein, we present an efficient amino acid depleted cell-free protein synthesis system that can be used to study residue-specific replacement of a natural amino acid by an unnatural amino acid analog. This system combines a simple methodology and high protein expression titers with a high-efficiency analog substitution into a target protein. To demonstrate the productivity and efficacy of a cell-free synthesis system for residue-specific incorporation of unnatural amino acids in vitro, we use this system to show that 5-fluorotryptophan and 6-fluorotryptophan substituted streptavidin retain the ability to bind biotin despite protein-wide replacement of a natural amino acid for the amino acid analog. We envisage this amino acid depleted cell-free synthesis system being an economical and convenient format for the high-throughput screening of a myriad of amino acid analogs with a variety of protein targets for the study and functional characterization of proteins substituted with unnatural amino acids when compared to the currently employed in vivo methodologies. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. Microwave-Assisted Rapid Enzymatic Synthesis of Nucleic Acids.

    PubMed

    Hari Das, Rakha; Ahirwar, Rajesh; Kumar, Saroj; Nahar, Pradip

    2016-07-02

    Herein we report microwave-induced enhancement of the reactions catalyzed by Escherichia coli DNA polymerase I and avian myeloblastosis virus-reverse transcriptase. The reactions induced by microwaves result in a highly selective synthesis of nucleic acids in 10-50 seconds. In contrast, same reactions failed to give desired reaction products when carried out in the same time periods, but without microwave irradiation. Each of the reactions was carried out for different duration of microwave exposure time to find the optimum reaction time. The products produced by the respective enzyme upon microwave irradiation of the reaction mixtures were identical to that produced by the conventional procedures. As the microwave-assisted reactions are rapid, microwave could be a useful alternative to the conventional and time consuming procedures of enzymatic synthesis of nucleic acids.

  4. Functional Evolution in Orthologous Cell-encoded RNA-dependent RNA Polymerases*

    PubMed Central

    Qian, Xinlei; Hamid, Fursham M.; El Sahili, Abbas; Darwis, Dina Amallia; Wong, Yee Hwa; Bhushan, Shashi; Makeyev, Eugene V.; Lescar, Julien

    2016-01-01

    Many eukaryotic organisms encode more than one RNA-dependent RNA polymerase (RdRP) that probably emerged as a result of gene duplication. Such RdRP paralogs often participate in distinct RNA silencing pathways and show characteristic repertoires of enzymatic activities in vitro. However, to what extent members of individual paralogous groups can undergo functional changes during speciation remains an open question. We show that orthologs of QDE-1, an RdRP component of the quelling pathway in Neurospora crassa, have rapidly diverged in evolution at the amino acid sequence level. Analyses of purified QDE-1 polymerases from N. crassa (QDE-1Ncr) and related fungi, Thielavia terrestris (QDE-1Tte) and Myceliophthora thermophila (QDE-1Mth), show that all three enzymes can synthesize RNA, but the precise modes of their action differ considerably. Unlike their QDE-1Ncr counterpart favoring processive RNA synthesis, QDE-1Tte and QDE-1Mth produce predominantly short RNA copies via primer-independent initiation. Surprisingly, a 3.19 Å resolution crystal structure of QDE-1Tte reveals a quasisymmetric dimer similar to QDE-1Ncr. Further electron microscopy analyses confirm that QDE-1Tte occurs as a dimer in solution and retains this status upon interaction with a template. We conclude that divergence of orthologous RdRPs can result in functional innovation while retaining overall protein fold and quaternary structure. PMID:26907693

  5. Dibutyryl Adenosine Cyclic 3′:5′-Monophosphate Effects on Goldfish Behavior and Brain RNA Metabolism

    PubMed Central

    Shashoua, Victor E.

    1971-01-01

    Intraventricular administration of dibutyryl adenosine cyclic 3′:5′-monophosphate into goldfish brains produced hyperactive animals. A study of the effects of the drug (25-50 mg/kg) on the incorporation of [5-3H] orotic acid, as a precursor of labeled uridine and cytidine, into newly synthesized RNA showed the formation of an RNA with a uridine to cytidine ratio 20-50% higher than that of the control. In double-labeling experiments with uridine as the labeled precursor, the synthesis of a nuclear RNA fraction (not produced in the absence of drug) was demonstrated. Some of this RNA was found to migrate into the cytoplasmic fraction and to become associated with polysomes. The results suggest that cyclic AMP might function as a “metabolic demand signal” for eliciting new RNA synthesis in goldfish brain. PMID:4330944

  6. Revisiting the operational RNA code for amino acids: Ensemble attributes and their implications.

    PubMed

    Shaul, Shaul; Berel, Dror; Benjamini, Yoav; Graur, Dan

    2010-01-01

    It has been suggested that tRNA acceptor stems specify an operational RNA code for amino acids. In the last 20 years several attributes of the putative code have been elucidated for a small number of model organisms. To gain insight about the ensemble attributes of the code, we analyzed 4925 tRNA sequences from 102 bacterial and 21 archaeal species. Here, we used a classification and regression tree (CART) methodology, and we found that the degrees of degeneracy or specificity of the RNA codes in both Archaea and Bacteria differ from those of the genetic code. We found instances of taxon-specific alternative codes, i.e., identical acceptor stem determinants encrypting different amino acids in different species, as well as instances of ambiguity, i.e., identical acceptor stem determinants encrypting two or more amino acids in the same species. When partitioning the data by class of synthetase, the degree of code ambiguity was significantly reduced. In cryptographic terms, a plausible interpretation of this result is that the class distinction in synthetases is an essential part of the decryption rules for resolving the subset of RNA code ambiguities enciphered by identical acceptor stem determinants of tRNAs acylated by enzymes belonging to the two classes. In evolutionary terms, our findings lend support to the notion that in the pre-DNA world, interactions between tRNA acceptor stems and synthetases formed the basis for the distinction between the two classes; hence, ambiguities in the ancient RNA code were pivotal for the fixation of these enzymes in the genomes of ancestral prokaryotes.

  7. Revisiting the operational RNA code for amino acids: Ensemble attributes and their implications

    PubMed Central

    Shaul, Shaul; Berel, Dror; Benjamini, Yoav; Graur, Dan

    2010-01-01

    It has been suggested that tRNA acceptor stems specify an operational RNA code for amino acids. In the last 20 years several attributes of the putative code have been elucidated for a small number of model organisms. To gain insight about the ensemble attributes of the code, we analyzed 4925 tRNA sequences from 102 bacterial and 21 archaeal species. Here, we used a classification and regression tree (CART) methodology, and we found that the degrees of degeneracy or specificity of the RNA codes in both Archaea and Bacteria differ from those of the genetic code. We found instances of taxon-specific alternative codes, i.e., identical acceptor stem determinants encrypting different amino acids in different species, as well as instances of ambiguity, i.e., identical acceptor stem determinants encrypting two or more amino acids in the same species. When partitioning the data by class of synthetase, the degree of code ambiguity was significantly reduced. In cryptographic terms, a plausible interpretation of this result is that the class distinction in synthetases is an essential part of the decryption rules for resolving the subset of RNA code ambiguities enciphered by identical acceptor stem determinants of tRNAs acylated by enzymes belonging to the two classes. In evolutionary terms, our findings lend support to the notion that in the pre-DNA world, interactions between tRNA acceptor stems and synthetases formed the basis for the distinction between the two classes; hence, ambiguities in the ancient RNA code were pivotal for the fixation of these enzymes in the genomes of ancestral prokaryotes. PMID:19952117

  8. RNA metabolism in the regulation of protein synthesis in plants. Progress report, 1975-1979

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Key, J L

    1979-01-01

    The major objectives of the research for the contract period covered by this report were (1) to gain an insight into the sequence organization of the DNA of soybean, emphasizing the arrangement of single copy or unique sequences and repetitive sequences of DNA throughout the genome, (2) to characterize soybean RNAs relative to nucleotide sequence complexity and kinetics of synthesis and turnover of poly A/sup +/ mRNA, and (3) to study ribosomal proteins directed to an analysis of possible changes in proteins which relate to the activation of 80S ribosomes and thus mRNA utilization and protein synthesis in response tomore » environmental stimuli. Even with greatly reduced funding compared to that requested, objectives 1 and 2 were substantially accomplished. Because of reduced funding and the 20-month no cost extension, relatively little progress was made on objective 3. Accordingly objectives 1 and 2 will be summarized in some detail; a brief account of progress is presented on objective 3.« less

  9. Inhibition of host protein synthesis by Sindbis virus: correlation with viral RNA replication and release of nuclear proteins to the cytoplasm.

    PubMed

    Sanz, Miguel A; García-Moreno, Manuel; Carrasco, Luis

    2015-04-01

    Infection of mammalian cells by Sindbis virus (SINV) profoundly blocks cellular mRNA translation. Experimental evidence points to viral non-structural proteins (nsPs), in particular nsP2, as the mediator of this inhibition. However, individual expression of nsP1, nsP2, nsP3 or nsP1-4 does not block cellular protein synthesis in BHK cells. Trans-complementation of a defective SINV replicon lacking most of the coding region for nsPs by the co-expression of nsP1-4 propitiates viral RNA replication at low levels, and inhibition of cellular translation is not observed. Exit of nuclear proteins including T-cell intracellular antigen and polypyrimidine tract-binding protein is clearly detected in SINV-infected cells, but not upon the expression of nsPs, even when the defective replicon was complemented. Analysis of a SINV variant with a point mutation in nsP2, exhibiting defects in the shut-off of host protein synthesis, indicates that both viral RNA replication and the release of nuclear proteins to the cytoplasm are greatly inhibited. Furthermore, nucleoside analogues that inhibit cellular and viral RNA synthesis impede the blockade of host mRNA translation, in addition to the release of nuclear proteins. Prevention of the shut-off of host mRNA translation by nucleoside analogues is not due to the inhibition of eIF2α phosphorylation, as this prevention is also observed in PKR(-/-) mouse embryonic fibroblasts that do not phosphorylate eIF2α after SINV infection. Collectively, our observations are consistent with the concept that for the inhibition of cellular protein synthesis to occur, viral RNA replication must take place at control levels, leading to the release of nuclear proteins to the cytoplasm. © 2014 John Wiley & Sons Ltd.

  10. Pyroglutamic acid stimulates DNA synthesis in rat primary hepatocytes through the mitogen-activated protein kinase pathway.

    PubMed

    Inoue, Shinjiro; Okita, Yoichi; de Toledo, Andreia; Miyazaki, Hiroyuki; Hirano, Eiichi; Morinaga, Tetsuo

    2015-01-01

    We purified pyroglutamic acid from human placental extract and identified it as a potent stimulator of rat primary hepatocyte DNA synthesis. Pyroglutamic acid dose-dependently stimulated DNA synthesis, and this effect was inhibited by PD98059, a dual specificity mitogen-activated protein kinase kinase 1 (MAP2K1) inhibitor. Therefore, pyroglutamic acid stimulated DNA synthesis in rat primary hepatocytes via MAPK signaling.

  11. Phosphatidic Acid Synthesis in Bacteria

    PubMed Central

    Yao, Jiangwei; Rock, Charles O.

    2012-01-01

    Membrane phospholipid synthesis is a vital facet of bacterial physiology. Although the spectrum of phospholipid headgroup structures produced by bacteria is large, the key precursor to all of these molecules is phosphatidic acid (PtdOH). Glycerol-3-phosphate derived from the glycolysis via glycerol-phosphate synthase is the universal source for the glycerol backbone of PtdOH. There are two distinct families of enzymes responsible for the acylation of the 1-position of glycerol-3-phosphate. The PlsB acyltransferase was discovered in Escherichia coli, and homologs are present in many eukaryotes. This protein family primarily uses acyl-acyl carrier protein (ACP) endproducts of fatty acid synthesis as acyl donors, but may also use acyl-CoA derived from exogenous fatty acids. The second protein family, PlsY, is more widely distributed in bacteria and utilizes the unique acyl donor, acyl-phosphate, which is produced from acyl-ACP by the enzyme PlsX. The acylation of the 2-position is carried out by members of the PlsC protein family. All PlsCs use acyl-ACP as the acyl donor, although the PlsCs of the γ-proteobacteria also may use acyl-CoA. Phospholipid headgroups are precursors in the biosynthesis of other membrane-associated molecules and the diacylglycerol product of these reactions is converted to PtdOH by one of two distinct families of lipid kinases. The central importance of the de novo and recycling pathways to PtdOH in cell physiology suggest these enzymes are suitable targets for the development of antibacterial therapeutics in Gram-positive pathogens. This article is part of a Special Issue entitled Phospholipids and Phospholipid Metabolism. PMID:22981714

  12. Ravynic acid, an antibiotic polyeneyne tetramic acid from Penicillium sp. elucidated through synthesis.

    PubMed

    Myrtle, J D; Beekman, A M; Barrow, R A

    2016-09-21

    A new antibiotic natural product, ravynic acid, has been isolated from a Penicillium sp. of fungus, collected from Ravensbourne National Park. The 3-acylpolyenyne tetramic acid structure was definitively elucidated via synthesis. Highlights of the synthetic method include the heat induced formation of the 3-acylphosphorane tetramic acid and a selective Wittig cross-coupling to efficiently prepare the natural compounds carbon skeleton. The natural compound was shown to inhibit the growth of Staphylococcus aureus down to concentrations of 2.5 µg mL(-1).

  13. A method for detecting genetic toxicity using the RNA synthesis response to DNA damage.

    PubMed

    Morita, Yoko; Iwai, Shigenori; Kuraoka, Isao

    2011-10-01

    To date, biological risk assessment studies of chemicals that induce DNA lesions have been primarily based on the action of DNA polymerases during replication. However, DNA lesions interfere not only with replication but also with transcription. Therefore, detecting the damaging effects of DNA lesions during transcription might be important for estimating the safety of chemical mutagens and carcinogens. However, methods to address these effects have not been developed. Here, we report a simple, non-isotopic method for determining the toxicity of chemical agents by visualizing transcription in a mammalian cell system. The method is based on the measurement of the incorporation of bromouridine (as the uridine analogue) into the nascent RNA during RNA synthesis inhibition (RSI) induced by the stalling of RNA polymerases at DNA lesions on the transcribed DNA strand, which triggers transcription-coupled nucleotide excision repair (TC-NER). When we tested chemical agents (camptothecin, etoposide, 4-nitroquinoline-1-oxide, mitomycin C, methyl methanesulfonate, and cisplatin) in HeLa cells by the method, RSI indicative of genomic toxicity was observed in the nucleoli of the tested cells. This procedure provides the following advantages: 1) it uses common, affordable mammalian cells (HeLa cells, WI38VA13 cells, human dermal fibroblasts, or Chinese hamster ovary cells) rather than genetically modified microorganisms; 2) it can be completed within approximately 8 hr after the cells are prepared because RNA polymerase responses during TC-NER are faster than other DNA damage responses (replication, recombination, and apoptosis); and 3) it is safe because it uses non-radioactive bromouridine and antibodies to detect RNA synthesis on undamaged transcribed DNA strands.

  14. Duodenal prostaglandin synthesis and acid load in health and in duodenal ulcer disease

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ahlquist, D.A.; Dozois, R.R.; Zinsmeister, A.R.

    1983-09-01

    We sought to test the hypothesis that duodenal ulcer disease results from an imbalance between duodenal acid load, an injurious force, and mucosal prostaglandin generation, a protective factor. Ten patients with duodenal ulcer and 8 healthy controls were studied. The duodenal acid load after an amino acid soup was quantified by a double-marker technique. Mucosal biopsy specimens were taken endoscopically from the duodenal bulb before and after the test meal. Prostaglandin synthesis activity was measured by incubating biopsy homogenates in excess (/sup 14/C)arachidonic acid. Although mean duodenal acid load was higher in duodenal ulcer, ranges overlapped. Neither the qualitative normore » quantitative profile of mucosal prostaglandin synthesis activities differed significantly between test groups. Prostaglandin synthesis activities, however, tended to increase post cibum in controls, but change little or decrease in duodenal ulcer. Only by comparing the responses with a meal of both parameters together (duodenal acid load and the change in prostaglandin synthesis activities) was there complete or nearly complete separation of duodenal ulcer from controls. Greatest discrimination was observed with prostacyclin (6-keto-PGF1 alpha). We conclude that in health, mucosal prostaglandin generation in the duodenum is induced post cibum in relation to duodenal acid load; this may be a physiologic example of adaptive cytoprotection. In duodenal ulcer there may be a defect in such a mechanism.« less

  15. Template-directed synthesis using the heterogeneous templates produced by montmorillonite catalysis. A possible bridge between the prebiotic and RNA worlds

    NASA Technical Reports Server (NTRS)

    Ertem, G.; Ferris, J. P.

    1997-01-01

    The synthesis of oligoguanylates [oligo(G)s] is catalyzed by a template of oligocytidylates [oligo(C)s] containing 2',5'- and 3',5'-linked phosphodiester bonds with and without incorporated C5'ppC groupings. An oligo(C) template containing exclusively 2',5'-phosphodiester bonds also serves as a template for the synthesis of complementary oligo(G)s. The oligo(C) template was prepared by the condensation of the 5'-phosphorimidazolide of cytidine on montmorillonite clay. These studies establish that RNA oligomers prepared by mineral catalysis, or other routes on the primitive earth, did not have to be exclusively 3',5'-linked to catalyze template-directed synthesis, since oligo(C)s containing a variety of linkage isomers serve as templates for the formation of complementary oligo(G)s. These findings support the postulate that origin of the RNA world was initiated by the RNA oligomers produced by polymerization of activated monomers formed by prebiotic processes.

  16. Wheat DNA Primase (RNA Primer Synthesis in Vitro, Structural Studies by Photochemical Cross-Linking, and Modulation of Primase Activity by DNA Polymerases).

    PubMed Central

    Laquel, P.; Litvak, S.; Castroviejo, M.

    1994-01-01

    DNA primase synthesizes short RNA primers used by DNA polymerases to initiate DNA synthesis. Two proteins of approximately 60 and 50 kD were recognized by specific antibodies raised against yeast primase subunits, suggesting a high degree of analogy between wheat and yeast primase subunits. Gel-filtration chromatography of wheat primase showed two active forms of 60 and 110 to 120 kD. Ultraviolet-induced cross-linking with radioactive oligothymidilate revealed a highly labeled protein of 60 kD. After limited trypsin digestion of wheat (Triticum aestivum L.) primase, a major band of 48 kD and two minor bands of 38 and 17 kD were observed. In the absence of DNA polymerases, the purified primase synthesizes long RNA products. The size of the RNA product synthesized by wheat primase is considerably reduced by the presence of DNA polymerases, suggesting a modulatory effect of the association between these two enzymes. Lowering the primase concentration in the assay also favored short RNA primer synthesis. Several properties of the wheat DNA primase using oligoadenylate [oligo(rA)]-primed or unprimed polythymidilate templates were studied. The ability of wheat primase, without DNA polymerases, to elongate an oligo(rA) primer to long RNA products depends on the primer size, temperature, and the divalent cation concentration. Thus, Mn2+ ions led to long RNA products in a very wide range of concentrations, whereas with Mg2+ long products were observed around 15 mM. We studied the ability of purified wheat DNA polymerases to initiate DNA synthesis from an RNA primer: wheat DNA polymerase A showed the highest activity, followed by DNA polymerases B and CII, whereas DNA polymerase CI was unable to initiate DNA synthesis from an RNA primer. Results are discussed in terms of understanding the role of these polymerases in DNA replication in plants. PMID:12232187

  17. A role for PPARα in the regulation of arginine metabolism and nitric oxide synthesis.

    PubMed

    Guelzim, Najoua; Mariotti, François; Martin, Pascal G P; Lasserre, Frédéric; Pineau, Thierry; Hermier, Dominique

    2011-10-01

    The pleiotropic effects of PPARα may include the regulation of amino acid metabolism. Nitric oxide (NO) is a key player in vascular homeostasis. NO synthesis may be jeopardized by a differential channeling of arginine toward urea (via arginase) versus NO (via NO synthase, NOS). This was studied in wild-type (WT) and PPARα-null (KO) mice fed diets containing either saturated fatty acids (COCO diet) or 18:3 n-3 (LIN diet). Metabolic markers of arginine metabolism were assayed in urine and plasma. mRNA levels of arginases and NOS were determined in liver. Whole-body NO synthesis and the conversion of systemic arginine into urea were assessed by using (15)N(2)-guanido-arginine and measuring urinary (15)NO(3) and [(15)N]-urea. PPARα deficiency resulted in a markedly lower whole-body NO synthesis, whereas the conversion of systemic arginine into urea remained unaffected. PPARα deficiency also increased plasma arginine and decreased citrulline concentration in plasma. These changes could not be ascribed to a direct effect on hepatic target genes, since NOS mRNA levels were unaffected, and arginase mRNA levels decreased in KO mice. Despite the low level in the diet, the nature of the fatty acids modulated some effects of PPARα deficiency, including plasma arginine and urea, which increased more in KO mice fed the LIN diet than in those fed the COCO diet. In conclusion, PPARα is largely involved in normal whole-body NO synthesis. This warrants further study on the potential of PPARα activation to maintain NO synthesis in the initiation of the metabolic syndrome.

  18. Interactions between fatty acid synthesis, oxidation, and esterification in the production of triglyceride-rich lipoproteins by the liver.

    PubMed

    Fukuda, N; Ontko, J A

    1984-08-01

    In a series of experiments with male rat livers perfused with or without 5-tetradecyloxy-2-furoic acid (TOFA) in the presence and absence of oleate, the relationships between fatty acid synthesis, oxidation, and esterification from newly synthesized and exogenous fatty acid substrates have been examined. When livers from fed rats were perfused without exogenous fatty acid substrate, 20% of the triglyceride secreted was derived from de novo fatty acid synthesis. Addition of TOFA caused immediate and nearly complete inhibition of fatty acid synthesis, measured by incorporation of 3H2O into fatty acids. Concurrently, ketone body production increased 140% and triglyceride secretion decreased 84%. These marked reciprocal alterations in fatty acid synthesis and oxidation in the liver almost completely abolished the production of very low density lipoproteins (VLDL). Cholesterol synthesis was also depressed by TOFA, suggesting that this drug also inhibited lipid synthesis at a site other than acetyl-CoA carboxylase. When livers from fed rats were supplied with a continuous infusion of [1-14C]oleate as exogenous substrate, similar proportions, about 45-47%, of both ketone bodies and triglyceride in the perfusate were derived from the infused [1-14C]oleate. The production of ketone bodies was markedly increased by TOFA; the secretion of triglyceride and cholesterol were decreased. Altered conversion of [1-14C]oleate into these products occurred in parallel. While TOFA decreased esterification of oleate into triglyceride, incorporation of [1-14C]oleate into liver phospholipid was increased, indicating that TOFA also affected glycerolipid synthesis at the stage of diglyceride processing. The decreased secretion of triglyceride and cholesterol following TOFA treatment was localized almost exclusively in VLDL. The specific activities of 3H and of 14C fatty acids in triglyceride of the perfusate were greater than those of liver triglyceride, indicating preferential secretion of

  19. In vivo production of RNA nanostructures via programmed folding of single-stranded RNAs.

    PubMed

    Li, Mo; Zheng, Mengxi; Wu, Siyu; Tian, Cheng; Liu, Di; Weizmann, Yossi; Jiang, Wen; Wang, Guansong; Mao, Chengde

    2018-06-06

    Programmed self-assembly of nucleic acids is a powerful approach for nano-constructions. The assembled nanostructures have been explored for various applications. However, nucleic acid assembly often requires chemical or in vitro enzymatical synthesis of DNA or RNA, which is not a cost-effective production method on a large scale. In addition, the difficulty of cellular delivery limits the in vivo applications. Herein we report a strategy that mimics protein production. Gene-encoded DNA duplexes are transcribed into single-stranded RNAs, which self-fold into well-defined RNA nanostructures in the same way as polypeptide chains fold into proteins. The resulting nanostructure contains only one component RNA molecule. This approach allows both in vitro and in vivo production of RNA nanostructures. In vivo synthesized RNA strands can fold into designed nanostructures inside cells. This work not only suggests a way to synthesize RNA nanostructures on a large scale and at a low cost but also facilitates the in vivo applications.

  20. Differential regulation of protein synthesis by amino acids and insulin in peripheral and visceral tissues of neonatal pigs

    PubMed Central

    Suryawan, Agus; O’Connor, Pamela M. J.; Bush, Jill A.; Nguyen, Hanh V.

    2009-01-01

    The high efficiency of protein deposition during the neonatal period is driven by high rates of protein synthesis, which are maximally stimulated after feeding. In the current study, we examined the individual roles of amino acids and insulin in the regulation of protein synthesis in peripheral and visceral tissues of the neonate by performing pancreatic glucose–amino acid clamps in overnight-fasted 7-day-old pigs. We infused pigs (n = 8–12/group) with insulin at 0, 10, 22, and 110 ng kg−0.66 min−1 to achieve ~0, 2, 6 and 30 μU ml−1 insulin so as to simulate below fasting, fasting, intermediate, and fed insulin levels, respectively. At each insulin dose, amino acids were maintained at the fasting or fed level. In conjunction with the highest insulin dose, amino acids were also allowed to fall below the fasting level. Tissue protein synthesis was measured using a flooding dose of L-[4-3H] phenylalanine. Both insulin and amino acids increased fractional rates of protein synthesis in longissimus dorsi, gastrocnemius, masseter, and diaphragm muscles. Insulin, but not amino acids, increased protein synthesis in the skin. Amino acids, but not insulin, increased protein synthesis in the liver, pancreas, spleen, and lung and tended to increase protein synthesis in the jejunum and kidney. Neither insulin nor amino acids altered protein synthesis in the stomach. The results suggest that the stimulation of protein synthesis by feeding in most tissues of the neonate is regulated by the post-prandial rise in amino acids. However, the feeding-induced stimulation of protein synthesis in skeletal muscles is independently mediated by insulin as well as amino acids. PMID:18683020

  1. Reaction of cytidine nucleotides with cyanoacetylene: support for the intermediacy of nucleoside-2',3'-cyclic phosphates in the prebiotic synthesis of RNA.

    PubMed

    Crowe, Michael A; Sutherland, John D

    2006-06-01

    A robust and prebiotically plausible synthesis of RNA is a key requirement of the "RNA World" hypothesis, but, to date, no such synthesis has been demonstrated. Monomer synthesis strategies involving attachment of preformed nucleobases to sugars have failed, and, even if activated 5'-nucleotides could be made, the hydrolysis of these intermediates in water makes their efficient oligomerisation appear unlikely. We recently reported a synthesis of cytidine-2',3'-cyclic phosphate 1 (C>p) in which the nucleobase was assembled in stages on a sugar-phosphate template. However, 2',3'-cyclic nucleotides (N>p's) also undergo hydrolysis, in this case giving a mixture of the 2'- and 3'-monophosphates. This hydrolysis has previously been seen as making the, otherwise promising, oligomerisation of N>p's seem as unlikely as that of the 5'-activated nucleotides. We now find that cyanoacetylene, the reagent used for the second stage of nucleobase assembly in the synthesis of C>p, also reverses the effect of the hydrolysis by driving efficient cyclisation of C2'p and C3'p back to C>p. Excess cyanoacetylene also derivatises the nucleobase, but this modification is reversible at neutral pH. These findings significantly strengthen the case for N>p's in a prebiotic synthesis of RNA.

  2. By-products of electrochemical synthesis of suberic acid

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shirobokova, O.I.; Adamov, A.A.; Freidlin, G.N.

    By-products of the electrochemical synthesis of dimethyl suberate from glutaric anhydride were studied. This is isolated by thermal dehydration of a mixture of lower dicarboxylic acids that are wastes from the production of adipic acid. To isolate the by-products, they used the methods of vacuum rectification and preparative gas-liquid chromatography, and for their identification, PMR, IR spectroscopy, gas-liquid chromatography, and other known physicochemical methods of investigation.

  3. Amino acids augment muscle protein synthesis in neonatal pigs during acute endotoxemia by stimulating mTOR-dependent translation initiation.

    PubMed

    Orellana, Renán A; Jeyapalan, Asumthia; Escobar, Jeffery; Frank, Jason W; Nguyen, Hanh V; Suryawan, Agus; Davis, Teresa A

    2007-11-01

    In skeletal muscle of adults, sepsis reduces protein synthesis by depressing translation initiation and induces resistance to branched-chain amino acid stimulation. Normal neonates maintain a high basal muscle protein synthesis rate that is sensitive to amino acid stimulation. In the present study, we determined the effect of amino acids on protein synthesis in skeletal muscle and other tissues in septic neonates. Overnight-fasted neonatal pigs were infused with endotoxin (LPS, 0 and 10 microg.kg(-1).h(-1)), whereas glucose and insulin were maintained at fasting levels; amino acids were clamped at fasting or fed levels. In the presence of fasting insulin and amino acids, LPS reduced protein synthesis in longissimus dorsi (LD) and gastrocnemius muscles and increased protein synthesis in the diaphragm, but had no effect in masseter and heart muscles. Increasing amino acids to fed levels accelerated muscle protein synthesis in LD, gastrocnemius, masseter, and diaphragm. LPS stimulated protein synthesis in liver, lung, spleen, pancreas, and kidney in fasted animals. Raising amino acids to fed levels increased protein synthesis in liver of controls, but not LPS-treated animals. The increase in muscle protein synthesis in response to amino acids was associated with increased mTOR, 4E-BP1, and S6K1 phosphorylation and eIF4G-eIF4E association in control and LPS-infused animals. These findings suggest that amino acids stimulate skeletal muscle protein synthesis during acute endotoxemia via mTOR-dependent ribosomal assembly despite reduced basal protein synthesis rates in neonatal pigs. However, provision of amino acids does not further enhance the LPS-induced increase in liver protein synthesis.

  4. Fatty acid synthesis in Escherichia coli

    PubMed Central

    Knivett, V. A.; Cullen, Julia

    1967-01-01

    1. Fatty acid formation by cells of a strain of Escherichia coli has been studied in the exponential, post-exponential and stationary phases of growth. 2. During the exponential phase of growth, the metabolic quotient (mμmoles of fatty acid synthesized/mg. dry wt. of cells/hr.) for each fatty acid in the extractable lipid was constant. 3. The newly synthesized fatty acid mixtures produced during this phase contained hexadecanoic acid (41%), hexadecenoic acid (31%), octadecenoic acid (21%) and the C17-cyclopropane acid, methylenehexadecanoic acid (4%). 4. As the proportion of newly synthesized material increased, changes in the fatty acid composition of the cells during this period were towards this constant composition. 5. Abrupt changes in fatty acid synthesis occurred when exponential growth ceased. 6. In media in which glycerol, or SO42− or Mg2+, was growth-limiting there was a small accumulation of C17-cyclopropane acid in cells growing in the post-exponential phase of growth. 7. Where either NH4+ or PO43− was growth-limiting and there were adequate supplies of glycerol, Mg2+ and SO42−, there was a marked accumulation of C17-cyclopropane acid and C19-cyclopropane acid appeared. 8. Under appropriate conditions the metabolic quotient for C17-cyclopropane acid increased up to sevenfold at the end of exponential growth. Simultaneously the metabolic quotients of the other acids fell. 9. A mixture of glycerol, Mg2+ and SO42− stimulated cyclopropane acid formation in resting cells. PMID:5340364

  5. Racemic synthesis and solid phase peptide synthesis application of the chimeric valine/leucine derivative 2-amino-3,3,4-trimethyl-pentanoic acid.

    PubMed

    Pelà, M; Del Zoppo, L; Allegri, L; Marzola, E; Ruzza, C; Calo, G; Perissutti, E; Frecentese, F; Salvadori, S; Guerrini, R

    2014-07-01

    The synthesis of non natural amino acid 2-amino-3,3,4-trimethyl-pentanoic acid (Ipv) ready for solid phase peptide synthesis has been developed. Copper (I) chloride Michael addition, followed by a Curtius rearrangement are the key steps for the lpv synthesis. The racemic valine/leucine chimeric amino acid was then successfully inserted in position 5 of neuropeptide S (NPS) and the diastereomeric mixture separated by reverse phase HPLC. The two diastereomeric NPS derivatives were tested for intracellular calcium mobilization using HEK293 cells stably expressing the mouse NPS receptor where they behaved as partial agonist and pure antagonist.

  6. Natural and artificial binders of polyriboadenylic acid and their effect on RNA structure.

    PubMed

    Roviello, Giovanni N; Musumeci, Domenica; Roviello, Valentina; Pirtskhalava, Marina; Egoyan, Alexander; Mirtskhulava, Merab

    2015-01-01

    The employment of molecular tools with nucleic acid binding ability to specifically control crucial cellular functions represents an important scientific area at the border between biochemistry and pharmaceutical chemistry. In this review we describe several molecular systems of natural or artificial origin, which are able to bind polyriboadenylic acid (poly(rA)) both in its single-stranded or structured forms. Due to the fundamental role played by the poly(rA) tail in the maturation and stability of mRNA, as well as in the initiation of the translation process, compounds able to bind this RNA tract, influencing the mRNA fate, are of special interest for developing innovative biomedical strategies mainly in the field of anticancer therapy.

  7. A novel small RNA S042 increases acid tolerance in Lactococcus lactis F44.

    PubMed

    Wu, Hao; Song, Shunyi; Tian, Kairen; Zhou, Dandan; Wang, Binbin; Liu, Jiaheng; Zhu, Hongji; Qiao, Jianjun

    2018-06-07

    Lactococcus lactis, a gram-positive bacterium, encounters various environmental stresses, especially acid stress, during fermentation. Small RNAs (sRNAs) that serve as regulators at post-transcriptional level play important roles in acid stress response. Here, a novel sRNA S042 was identified by RNA-Seq, RT-PCR and Northern blot. The transcription level of s042 was upregulated 2.29-fold under acid stress by Quantitative RT-PCR (qRT-PCR) analysis. Acid tolerance assay showed that overexpressing s042 increased the survival rate of L. lactis F44 and deleting s042 significantly inhibited the viability under acidic conditions. Moreover, the targets were predicted by online software and four genes were chosen as candidates. Among them, argR (arginine regulator) and accD (acetyl-CoA carboxylase carboxyl transferase subunit beta) were validated to be the direct targets activated by S042 through reporter fusion assay. The regulatory mechanism between S042 and its targets was further investigated through Bioinformatics and qRT-PCR. This study served to highlight the role of the novel sRNA S042 in acid resistance of L. lactis and provided new insights into the response mechanism of acid stress. Copyright © 2018 Elsevier Inc. All rights reserved.

  8. Roles of Fe-S proteins: from cofactor synthesis to iron homeostasis to protein synthesis.

    PubMed

    Pain, Debkumar; Dancis, Andrew

    2016-06-01

    Fe-S cluster assembly is an essential process for all cells. Impairment of Fe-S cluster assembly creates diseases in diverse and surprising ways. In one scenario, the loss of function of lipoic acid synthase, an enzyme with Fe-S cluster cofactor in mitochondria, impairs activity of various lipoamide-dependent enzymes with drastic consequences for metabolism. In a second scenario, the heme biosynthetic pathway in red cell precursors is specifically targeted, and iron homeostasis is perturbed, but lipoic acid synthesis is unaffected. In a third scenario, tRNA modifications arising from action of the cysteine desulfurase and/or Fe-S cluster proteins are lost, which may lead to impaired protein synthesis. These defects can then result in cancer, neurologic dysfunction or type 2 diabetes. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. A Mutation in the Bacillus subtilis rsbU Gene That Limits RNA Synthesis during Sporulation.

    PubMed

    Rothstein, David M; Lazinski, David; Osburne, Marcia S; Sonenshein, Abraham L

    2017-07-15

    Mutants of Bacillis subtilis that are temperature sensitive for RNA synthesis during sporulation were isolated after selection with a 32 P suicide agent. Whole-genome sequencing revealed that two of the mutants carried an identical lesion in the rsbU gene, which encodes a phosphatase that indirectly activates SigB, the stress-responsive RNA polymerase sigma factor. The mutation appeared to cause RsbU to be hyperactive, because the mutants were more resistant than the parent strain to ethanol stress. In support of this hypothesis, pseudorevertants that regained wild-type levels of sporulation at high temperature had secondary mutations that prevented expression of the mutant rsbU gene. The properties of these RsbU mutants support the idea that activation of SigB diminishes the bacterium's ability to sporulate. IMPORTANCE Most bacterial species encode multiple RNA polymerase promoter recognition subunits (sigma factors). Each sigma factor directs RNA polymerase to different sets of genes; each gene set typically encodes proteins important for responses to specific environmental conditions, such as changes in temperature, salt concentration, and nutrient availability. A selection for mutants of Bacillus subtilis that are temperature sensitive for RNA synthesis during sporulation unexpectedly yielded strains with a point mutation in rsbU , a gene that encodes a protein that normally activates sigma factor B (SigB) under conditions of salt stress. The mutation appears to cause RsbU, and therefore SigB, to be active inappropriately, thereby inhibiting, directly or indirectly, the ability of the cells to transcribe sporulation genes. Copyright © 2017 American Society for Microbiology.

  10. Pulse labeling of RNA of mammalian cells.

    PubMed

    Rovera, G; Berman, S; Baserga, R

    1970-04-01

    When cells from a hypotetraploid strain of Ehrlich ascites tumor are exposed to uridine-(3)H either in vivo or in vitro, the amount of radioactivity incorporated into RNA reaches a maximum within ten minutes, after which any further incorporation stops. (3)H-uridine triphosphate disappears from the acid soluble pool within 30 minutes and the findings indicate that the RNA of these cells can be pulse labeled without the use of any antibiotic or the need of a "chase." The stability of the pulse labeled RNA in the presence of pentobarbital (an inhibitor of RNA synthesis) indicates the virtual absence of RNA breakdown. However, actinomycin D, at a dosage of 250 mug/mouse in vivo and 10 mug/ml in vitro produces breakdown of labeled RNA, thus confirming earlier observations that the drug is not a suitable tool for RNA kinetics determinations. The pulse-labeled RNA leaves the nucleus slowly and some radioactive RNA is still present in the nuclear fraction after 24 hours. Radioactivity begins to appear in cytoplasmic ribosomal RNA after 20 minutes and continues to increase up to six hours.

  11. Pore-expanded SBA-15 sulfonic acid silicas for biodiesel synthesis.

    PubMed

    Dacquin, J P; Lee, A F; Pirez, C; Wilson, K

    2012-01-07

    Here we present the first application of pore-expanded SBA-15 in heterogeneous catalysis. Pore expansion over the range 6-14 nm confers a striking activity enhancement towards fatty acid methyl ester (FAME) synthesis from triglycerides (TAG), and free fatty acid (FFA), attributed to improved mass transport and acid site accessibility. This journal is © The Royal Society of Chemistry 2012

  12. Prebiotic synthesis of carboxylic acids, amino acids and nucleic acid bases from formamide under photochemical conditions⋆

    NASA Astrophysics Data System (ADS)

    Botta, Lorenzo; Mattia Bizzarri, Bruno; Piccinino, Davide; Fornaro, Teresa; Robert Brucato, John; Saladino, Raffaele

    2017-07-01

    The photochemical transformation of formamide in the presence of a mixture of TiO2 and ZnO metal oxides as catalysts afforded a large panel of molecules of biological relevance, including carboxylic acids, amino acids and nucleic acid bases. The reaction was less effective when performed in the presence of only one mineral, highlighting the role of synergic effects between the photoactive catalysts. Taken together, these results suggest that the synthesis of chemical precursors for both the genetic and the metabolic apparatuses might have occurred in a simple environment, consisting of formamide, photoactive metal oxides and UV-radiation.

  13. Methylated nucleosides in tRNA and tRNA methyltransferases

    PubMed Central

    Hori, Hiroyuki

    2014-01-01

    To date, more than 90 modified nucleosides have been found in tRNA and the biosynthetic pathways of the majority of tRNA modifications include a methylation step(s). Recent studies of the biosynthetic pathways have demonstrated that the availability of methyl group donors for the methylation in tRNA is important for correct and efficient protein synthesis. In this review, I focus on the methylated nucleosides and tRNA methyltransferases. The primary functions of tRNA methylations are linked to the different steps of protein synthesis, such as the stabilization of tRNA structure, reinforcement of the codon-anticodon interaction, regulation of wobble base pairing, and prevention of frameshift errors. However, beyond these basic functions, recent studies have demonstrated that tRNA methylations are also involved in the RNA quality control system and regulation of tRNA localization in the cell. In a thermophilic eubacterium, tRNA modifications and the modification enzymes form a network that responses to temperature changes. Furthermore, several modifications are involved in genetic diseases, infections, and the immune response. Moreover, structural, biochemical, and bioinformatics studies of tRNA methyltransferases have been clarifying the details of tRNA methyltransferases and have enabled these enzymes to be classified. In the final section, the evolution of modification enzymes is discussed. PMID:24904644

  14. Transcription and translation in an RNA world

    PubMed Central

    Taylor, William R

    2006-01-01

    The RNA world hypothesis requires a ribozyme that was an RNA-directed RNA polymerase (ribopolymerase). If such a replicase makes a reverse complementary copy of any sequence (including itself), in a simple RNA world, there is no mechanism to prevent self-hybridization. It is proposed that this can be avoided through the synthesis of a parallel complementary copy. The logical consequences of this are pursued and developed in a computer simulation, where the behaviour of the parallel copy is compared to the conventional reverse complementary copy. It is found that the parallel copy is more efficient at higher temperatures (up to 90°C). A model for the ribopolymerase, based on the core of the large subunit (LSU) of the ribosome, is described. The geometry of a potential active site for this ribopolymerase suggests that it contained a cavity (now occupied by the aminoacyl-tRNA) and that an amino acid binding in this might have ‘poisoned’ the ribopolymerase by cross-reacting with the nucleoside-triphosphate before polymerization could occur. Based on a similarity to the active site components of the class-I tRNA synthetase enzymes, it is proposed that the amino acid could become attached to the nascent RNA transcript producing a variety of aminoacylated tRNA-like products. Using base-pairing interactions, some of these molecules might cross-link two ribopolymerases, giving rise to a precursor of the modern ribosome. A hybrid dimer, half polymerase and half proto-ribosome, could account for mRNA translocation before the advent of protein elongation factors. PMID:17008216

  15. Enzymes involved in plastid-targeted phosphatidic acid synthesis are essential for Plasmodium yoelii liver stage development

    PubMed Central

    Lindner, Scott E.; Sartain, Mark J.; Hayes, Kiera; Harupa, Anke; Moritz, Robert L.; Kappe, Stefan H. I.; Vaughan, Ashley M.

    2014-01-01

    SUMMARY Malaria parasites scavenge nutrients from their host but also harbor enzymatic pathways for de novo macromolecule synthesis. One such pathway is apicoplast-targeted type II fatty acid synthesis, which is essential for late liver stage development in rodent malaria. It is likely that fatty acids synthesized in the apicoplast are ultimately incorporated into membrane phospholipids necessary for exoerythrocytic merozoite formation. We hypothesized that these synthesized fatty acids are being utilized for apicoplast-targeted phosphatidic acid synthesis, the phospholipid precursor. Phosphatidic acid is typically synthesized in a three-step reaction utilizing three enzymes: glycerol 3-phosphate dehydrogenase, glycerol 3-phosphate acyltransferase and lysophosphatidic acid acyltransferase. The Plasmodium genome is predicted to harbor genes for both apicoplast- and cytosol/endoplasmic reticulum-targeted phosphatidic synthesis. Our research shows that apicoplast-targeted P. yoelii glycerol 3-phosphate dehydrogenase and glycerol 3-phosphate acyltransferase are expressed only during liver stage development and deletion of the encoding genes resulted in late liver stage growth arrest and lack of merozoite differentiation. However, the predicted apicoplast-targeted lysophosphatidic acid acyltransferase gene was refractory to deletion and was expressed solely in the endoplasmic reticulum throughout the parasite lifecycle. Our results suggest that P. yoelii has an incomplete apicoplast-targeted phosphatidic acid synthesis pathway that is essential for liver stage maturation. PMID:24330260

  16. Multiple interactions between RNA polymerase I, TIF-IA and TAF(I) subunits regulate preinitiation complex assembly at the ribosomal gene promoter.

    PubMed

    Yuan, Xuejun; Zhao, Jian; Zentgraf, Hanswalter; Hoffmann-Rohrer, Urs; Grummt, Ingrid

    2002-11-01

    In mammals, growth-dependent regulation of rRNA synthesis is brought about by the transcription initiation factor TIF-IA. TIF-IA is associated with a fraction of the TBP-containing factor TIF-IB/SL1 and the initiation-competent form of RNA polymerase I (Pol I). We investigated the mechanisms that down-regulate cellular pre-rRNA synthesis and demonstrate that nutrient starvation, density arrest and protein synthesis inhibitors inactivate TIF-IA and impair the association of TIF-IA with Pol I. Moreover, we used a panel of TIF-IA deletion mutants to map the domains that mediate the interaction of TIF-IA with Pol I and TIF-IB/SL1. We found that amino acids 512-609 interact with two subunits of Pol I, RPA43 and PAF67, whereas a short, conserved motif (LARAK, amino acids 411-415) is required for the association of TIF-IA with TAF(I)95 and TAF(I)68. The results uncover an interphase for essential protein-protein interactions that facilitate Pol I preinitiation complex formation.

  17. WRINKLED1 Rescues Feedback Inhibition of Fatty Acid Synthesis in Hydroxylase-Expressing Seeds1[OPEN

    PubMed Central

    Browse, John

    2016-01-01

    Previous attempts at engineering Arabidopsis (Arabidopsis thaliana) to produce seed oils containing hydroxy fatty acids (HFA) have resulted in low yields of HFA compared with the native castor (Ricinus communis) plant and caused undesirable effects, including reduced total oil content. Recent studies have led to an understanding of problems involved in the accumulation of HFA in oils of transgenic plants, which include metabolic bottlenecks and a decrease in the rate of fatty acid synthesis. Focusing on engineering the triacylglycerol assembly mechanisms led to modest increases in the HFA content of seed oil, but much room for improvement still remains. We hypothesized that engineering fatty acid synthesis in the plastids to increase flux would facilitate enhanced total incorporation of fatty acids, including HFA, into seed oil. The transcription factor WRINKLED1 (WRI1) positively regulates the expression of genes involved in fatty acid synthesis and controls seed oil levels. We overexpressed Arabidopsis WRI1 in seeds of a transgenic line expressing the castor fatty acid hydroxylase. The proportion of HFA in the oil, the total HFA per seed, and the total oil content of seeds increased to an average of 20.9%, 1.26 µg, and 32.2%, respectively, across five independent lines, compared with 17.6%, 0.83 µg, and 27.9%, respectively, for isogenic segregants. WRI1 and WRI1-regulated genes involved in fatty acid synthesis were up-regulated, providing for a corresponding increase in the rate of fatty acid synthesis. PMID:27208047

  18. Initiation, extension, and termination of RNA synthesis by a paramyxovirus polymerase.

    PubMed

    Jordan, Paul C; Liu, Cheng; Raynaud, Pauline; Lo, Michael K; Spiropoulou, Christina F; Symons, Julian A; Beigelman, Leo; Deval, Jerome

    2018-02-01

    Paramyxoviruses represent a family of RNA viruses causing significant human diseases. These include measles virus, the most infectious virus ever reported, in addition to parainfluenza virus, and other emerging viruses. Paramyxoviruses likely share common replication machinery but their mechanisms of RNA biosynthesis activities and details of their complex polymerase structures are unknown. Mechanistic and functional details of a paramyxovirus polymerase would have sweeping implications for understanding RNA virus replication and for the development of new antiviral medicines. To study paramyxovirus polymerase structure and function, we expressed an active recombinant Nipah virus (NiV) polymerase complex assembled from the multifunctional NiV L protein bound to its phosphoprotein cofactor. NiV is an emerging highly pathogenic virus that causes severe encephalitis and has been declared a global public health concern due to its high mortality rate. Using negative-stain electron microscopy, we demonstrated NiV polymerase forms ring-like particles resembling related RNA polymerases. We identified conserved sequence elements driving recognition of the 3'-terminal genomic promoter by NiV polymerase, and leading to initiation of RNA synthesis, primer extension, and transition to elongation mode. Polyadenylation resulting from NiV polymerase stuttering provides a mechanistic basis for transcription termination. It also suggests a divergent adaptation in promoter recognition between pneumo- and paramyxoviruses. The lack of available antiviral therapy for NiV prompted us to identify the triphosphate forms of R1479 and GS-5734, two clinically relevant nucleotide analogs, as substrates and inhibitors of NiV polymerase activity by delayed chain termination. Overall, these findings provide low-resolution structural details and the mechanism of an RNA polymerase from a previously uncharacterized virus family. This work illustrates important functional differences yet remarkable

  19. Enzymes involved in plastid-targeted phosphatidic acid synthesis are essential for Plasmodium yoelii liver-stage development.

    PubMed

    Lindner, Scott E; Sartain, Mark J; Hayes, Kiera; Harupa, Anke; Moritz, Robert L; Kappe, Stefan H I; Vaughan, Ashley M

    2014-02-01

    Malaria parasites scavenge nutrients from their host but also harbour enzymatic pathways for de novo macromolecule synthesis. One such pathway is apicoplast-targeted type II fatty acid synthesis, which is essential for late liver-stage development in rodent malaria. It is likely that fatty acids synthesized in the apicoplast are ultimately incorporated into membrane phospholipids necessary for exoerythrocytic merozoite formation. We hypothesized that these synthesized fatty acids are being utilized for apicoplast-targeted phosphatidic acid synthesis, the phospholipid precursor. Phosphatidic acid is typically synthesized in a three-step reaction utilizing three enzymes: glycerol 3-phosphate dehydrogenase, glycerol 3-phosphate acyltransferase and lysophosphatidic acid acyltransferase. The Plasmodium genome is predicted to harbour genes for both apicoplast- and cytosol/endoplasmic reticulum-targeted phosphatidic acid synthesis. Our research shows that apicoplast-targeted Plasmodium yoelii glycerol 3-phosphate dehydrogenase and glycerol 3-phosphate acyltransferase are expressed only during liver-stage development and deletion of the encoding genes resulted in late liver-stage growth arrest and lack of merozoite differentiation. However, the predicted apicoplast-targeted lysophosphatidic acid acyltransferase gene was refractory to deletion and was expressed solely in the endoplasmic reticulum throughout the parasite life cycle. Our results suggest that P. yoelii has an incomplete apicoplast-targeted phosphatidic acid synthesis pathway that is essential for liver-stage maturation. © 2013 John Wiley & Sons Ltd.

  20. Therapeutic nucleic acids: current clinical status

    PubMed Central

    Sridharan, Kannan

    2016-01-01

    Abstract Deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) are simple linear polymers that have been the subject of considerable research in the last two decades and have now moved into the realm of being stand‐alone therapeutic agents. Much of this has stemmed from the appreciation that they carry out myriad functions that go beyond mere storage of genetic information and protein synthesis. Therapy with nucleic acids either uses unmodified DNA or RNA or closely related compounds. From both a development and regulatory perspective, they fall somewhere between small molecules and biologics. Several of these compounds are in clinical development and many have received regulatory approval for human use. This review addresses therapeutic uses of DNA based on antisense oligonucleotides, DNA aptamers and gene therapy; and therapeutic uses of RNA including micro RNAs, short interfering RNAs, ribozymes, RNA decoys and circular RNAs. With their specificity, functional diversity and limited toxicity, therapeutic nucleic acids hold enormous promise. However, challenges that need to be addressed include targeted delivery, mass production at low cost, sustaining efficacy and minimizing off‐target toxicity. Technological developments will hold the key to this and help accelerate drug approvals in the years to come. PMID:27111518

  1. Green synthesis of gold-chitosan nanocomposites for caffeic acid sensing.

    PubMed

    Di Carlo, Gabriella; Curulli, Antonella; Toro, Roberta G; Bianchini, Chiara; De Caro, Tilde; Padeletti, Giuseppina; Zane, Daniela; Ingo, Gabriel M

    2012-03-27

    In this work, colloidal gold nanoparticles (AuNPs) stabilized into a chitosan matrix were prepared using a green route. The synthesis was carried out by reducing Au(III) to Au(0) in an aqueous solution of chitosan and different organic acids (i.e., acetic, malonic, or oxalic acid). We have demonstrated that by varying the nature of the acid it is possible to tune the reduction rate of the gold precursor (HAuCl(4)) and to modify the morphology of the resulting metal nanoparticles. The use of chitosan, a biocompatible and biodegradable polymer with a large number of amino and hydroxyl functional groups, enables the simultaneous synthesis and surface modification of AuNPs in one pot. Because of the excellent film-forming capability of this polymer, AuNPs-chitosan solutions were used to obtain hybrid nanocomposite films that combine highly conductive AuNPs with a large number of organic functional groups. Herein, Au-chitosan nanocomposites are successfully proposed as sensitive and selective electrochemical sensors for the determination of caffeic acid, an antioxidant that has recently attracted much attention because of its benefits to human health. A linear response was obtained over a wide range of concentration from 5.00 × 10(-8) M to 2.00 × 10(-3) M, and the limit of detection (LOD) was estimated to be 2.50 × 10(-8) M. Moreover, further analyses have demonstrated that a high selectivity toward caffeic acid can be achieved without interference from catechin or ascorbic acid (flavonoid and nonphenolic antioxidants, respectively). This novel synthesis approach and the high performances of Au-chitosan hybrid materials in the determination of caffeic acid open up new routes in the design of highly efficient sensors, which are of great interest for the analysis of complex matrices such as wine, soft drinks, and fruit beverages. © 2012 American Chemical Society

  2. RNA binding and replication by the poliovirus RNA polymerase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Oberste, M.S.

    1988-01-01

    RNA binding and RNA synthesis by the poliovirus RNA-dependent RNA polymerase were studied in vitro using purified polymerase. Templates for binding and RNA synthesis studies were natural RNAs, homopolymeric RNAs, or subgenomic poliovirus-specific RNAs synthesized in vitro from cDNA clones using SP6 or T7 RNA polymerases. The binding of the purified polymerase to poliovirion and other RNAs was studied using a protein-RNA nitrocellulose filter binding assay. A cellular poly(A)-binding protein was found in the viral polymerase preparations, but was easily separated from the polymerase by chromatography on poly(A) Sepharose. The binding of purified polymerase to {sup 32}P-labeled ribohomopolymeric RNAs wasmore » examined, and the order of binding observed was poly(G) >>> poly(U) > poly(C) > poly(A). The K{sub a} for polymerase binding to poliovirion RNA and to a full-length negative strand transcript was about 1 {times} 10{sup 9} M{sup {minus}1}. The polymerase binds to a subgenomic RNAs which contain the 3{prime} end of the genome with a K{sub a} similar to that for virion RNA, but binds less well to 18S rRNA, globin mRNA, and subgenomic RNAs which lack portions of the 3{prime} noncoding region.« less

  3. Synthesis of new Cα-tetrasubstituted α-amino acids

    PubMed Central

    Grauer, Andreas A

    2009-01-01

    Summary Cα-Tetrasubstituted α-amino acids are important building blocks for the synthesis of peptidemimetics with stabilized secondary structure, because of their ability to rigidify the peptide backbone. Recently our group reported a new class of cyclic Cα-tetrasubstituted tetrahydrofuran α-amino acids prepared from methionine and aromatic aldehydes. We now report the extension of this methodology to aliphatic aldehydes. Although such aldehydes are prone to give aldol products under the reaction conditions used, we were able to obtain the target cyclic amino acids in low to moderate yields and in some cases with good diastereoselectivity. PMID:19259341

  4. A Study on Amino Acids: Synthesis of Alpha-Aminophenylacetic Acid (Phenylglycine) and Determination of its Isoelectric Point.

    ERIC Educational Resources Information Center

    Barrelle, M.; And Others

    1983-01-01

    Background information and procedures are provided for an experimental study on aminophenylacetic acid (phenylglycine). These include physical chemistry (determination of isoelectric point by pH measurement) and organic chemistry (synthesis of an amino acid in racemic form) experiments. (JN)

  5. Three-Dimensional Algebraic Models of the tRNA Code and 12 Graphs for Representing the Amino Acids.

    PubMed

    José, Marco V; Morgado, Eberto R; Guimarães, Romeu Cardoso; Zamudio, Gabriel S; de Farías, Sávio Torres; Bobadilla, Juan R; Sosa, Daniela

    2014-08-11

    Three-dimensional algebraic models, also called Genetic Hotels, are developed to represent the Standard Genetic Code, the Standard tRNA Code (S-tRNA-C), and the Human tRNA code (H-tRNA-C). New algebraic concepts are introduced to be able to describe these models, to wit, the generalization of the 2n-Klein Group and the concept of a subgroup coset with a tail. We found that the H-tRNA-C displayed broken symmetries in regard to the S-tRNA-C, which is highly symmetric. We also show that there are only 12 ways to represent each of the corresponding phenotypic graphs of amino acids. The averages of statistical centrality measures of the 12 graphs for each of the three codes are carried out and they are statistically compared. The phenotypic graphs of the S-tRNA-C display a common triangular prism of amino acids in 10 out of the 12 graphs, whilst the corresponding graphs for the H-tRNA-C display only two triangular prisms. The graphs exhibit disjoint clusters of amino acids when their polar requirement values are used. We contend that the S-tRNA-C is in a frozen-like state, whereas the H-tRNA-C may be in an evolving state.

  6. Functional Evolution in Orthologous Cell-encoded RNA-dependent RNA Polymerases.

    PubMed

    Qian, Xinlei; Hamid, Fursham M; El Sahili, Abbas; Darwis, Dina Amallia; Wong, Yee Hwa; Bhushan, Shashi; Makeyev, Eugene V; Lescar, Julien

    2016-04-22

    Many eukaryotic organisms encode more than one RNA-dependent RNA polymerase (RdRP) that probably emerged as a result of gene duplication. Such RdRP paralogs often participate in distinct RNA silencing pathways and show characteristic repertoires of enzymatic activities in vitro However, to what extent members of individual paralogous groups can undergo functional changes during speciation remains an open question. We show that orthologs of QDE-1, an RdRP component of the quelling pathway in Neurospora crassa, have rapidly diverged in evolution at the amino acid sequence level. Analyses of purified QDE-1 polymerases from N. crassa (QDE-1(Ncr)) and related fungi, Thielavia terrestris (QDE-1(Tte)) and Myceliophthora thermophila (QDE-1(Mth)), show that all three enzymes can synthesize RNA, but the precise modes of their action differ considerably. Unlike their QDE-1(Ncr) counterpart favoring processive RNA synthesis, QDE-1(Tte) and QDE-1(Mth) produce predominantly short RNA copies via primer-independent initiation. Surprisingly, a 3.19 Å resolution crystal structure of QDE-1(Tte) reveals a quasisymmetric dimer similar to QDE-1(Ncr) Further electron microscopy analyses confirm that QDE-1(Tte) occurs as a dimer in solution and retains this status upon interaction with a template. We conclude that divergence of orthologous RdRPs can result in functional innovation while retaining overall protein fold and quaternary structure. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  7. Synthesis of Amino Acid Precursors with Organic Solids in Planetesimals with Liquid Water

    NASA Technical Reports Server (NTRS)

    Kebukawa, Y; Misawa, S.; Matsukuma, J.; Chan, Q. H. S.; Kobayashi, J.; Tachibana, S.; Zolensky, M. E.

    2017-01-01

    Amino acids are important ingredients of life that would have been delivered to Earth by extraterrestrial sources, e.g., comets and meteorites. Amino acids are found in aqueously altered carbonaceous chondrites in good part in the form of precursors that release amino acids after acid hydrolysis. Meanwhile, most of the organic carbon (greater than 70 weight %) in carbonaceous chondrites exists in the form of solvent insoluble organic matter (IOM) with complex macromolecular structures. Complex macromolecular organic matter can be produced by either photolysis of interstellar ices or aqueous chemistry in planetesimals. We focused on the synthesis of amino acids during aqueous alteration, and demonstrated one-pot synthesis of a complex suite of amino acids simultaneously with IOM via hydrothermal experiments simulating the aqueous processing

  8. Acid Gradient across Plasma Membrane Can Drive Phosphate Bond Synthesis in Cancer Cells: Acidic Tumor Milieu as a Potential Energy Source

    PubMed Central

    Dhar, Gautam; Sen, Suvajit; Chaudhuri, Gautam

    2015-01-01

    Aggressive cancers exhibit an efficient conversion of high amounts of glucose to lactate accompanied by acid secretion, a phenomenon popularly known as the Warburg effect. The acidic microenvironment and the alkaline cytosol create a proton-gradient (acid gradient) across the plasma membrane that represents proton-motive energy. Increasing experimental data from physiological relevant models suggest that acid gradient stimulates tumor proliferation, and can also support its energy needs. However, direct biochemical evidence linking extracellular acid gradient to generation of intracellular ATP are missing. In this work, we demonstrate that cancer cells can synthesize significant amounts of phosphate-bonds from phosphate in response to acid gradient across plasma membrane. The noted phenomenon exists in absence of glycolysis and mitochondrial ATP synthesis, and is unique to cancer. Biochemical assays using viable cancer cells, and purified plasma membrane vesicles utilizing radioactive phosphate, confirmed phosphate-bond synthesis from free phosphate (Pi), and also localization of this activity to the plasma membrane. In addition to ATP, predominant formation of pyrophosphate (PPi) from Pi was also observed when plasma membrane vesicles from cancer cells were subjected to trans-membrane acid gradient. Cancer cytosols were found capable of converting PPi to ATP, and also stimulate ATP synthesis from Pi from the vesicles. Acid gradient created through glucose metabolism by cancer cells, as observed in tumors, also proved critical for phosphate-bond synthesis. In brief, these observations reveal a role of acidic tumor milieu as a potential energy source and may offer a novel therapeutic target. PMID:25874623

  9. Synthesis of novel acid electrolytes for phosphoric acid fuel cells

    NASA Astrophysics Data System (ADS)

    Adcock, James L.

    1988-11-01

    A 40 millimole per hour scale aerosol direct fluorination reactor was constructed. F-Methyl F-4-methoxybutanoate and F-4-methoxybutanoyl fluoride were synthesized by aerosol direct fluorination of methyl 4-methoxybutanoate. Basic hydrolysis of the perfluorinated derivatives produce sodium F-4 methoxybutanoate which was pyrolyzed to F-3-methoxy-1-propene. Purification and shipment of 33 grams of F-3-methoxy-1-propene followed. Syntheses by analogous methods allowed production and shipment of 5 grams of F-3-ethoxy 1-propene, 18 grams of F-3-(2-methoxy.ethoxy) 1-propene, and 37 grams of F-3,3-dimethyl 1-butene. Eighteen grams of F-2,2-dimethyl 1-chloropropane was produced directly and shipped. As suggested by other contractors, 5 grams of F-3-methoxy 1-iodopropane, and 5 grams of F-3-(2-methoxy.ethoxy) 1-iodopropane were produced by converting the respective precursor acid sodium salts produced for olefin synthesis to the silver salts and pyrolyzing them with iodine. Each of these compounds was prepared for the first time by the aerosol fluorination process during the course of the contract. These samples were provided to other Gas Research Institute (GRI) contractors for synthesis of perfluorinated sulfur (VI) and phosphorous (V) acids.

  10. Sequence and structure-specific elements of HERG mRNA determine channel synthesis and trafficking efficiency

    PubMed Central

    Sroubek, Jakub; Krishnan, Yamini; McDonald, Thomas V.

    2013-01-01

    Human ether-á-gogo-related gene (HERG) encodes a potassium channel that is highly susceptible to deleterious mutations resulting in susceptibility to fatal cardiac arrhythmias. Most mutations adversely affect HERG channel assembly and trafficking. Why the channel is so vulnerable to missense mutations is not well understood. Since nothing is known of how mRNA structural elements factor in channel processing, we synthesized a codon-modified HERG cDNA (HERG-CM) where the codons were synonymously changed to reduce GC content, secondary structure, and rare codon usage. HERG-CM produced typical IKr-like currents; however, channel synthesis and processing were markedly different. Translation efficiency was reduced for HERG-CM, as determined by heterologous expression, in vitro translation, and polysomal profiling. Trafficking efficiency to the cell surface was greatly enhanced, as assayed by immunofluorescence, subcellular fractionation, and surface labeling. Chimeras of HERG-NT/CM indicated that trafficking efficiency was largely dependent on 5′ sequences, while translation efficiency involved multiple areas. These results suggest that HERG translation and trafficking rates are independently governed by noncoding information in various regions of the mRNA molecule. Noncoding information embedded within the mRNA may play a role in the pathogenesis of hereditary arrhythmia syndromes and could provide an avenue for targeted therapeutics.—Sroubek, J., Krishnan, Y., McDonald, T V. Sequence- and structure-specific elements of HERG mRNA determine channel synthesis and trafficking efficiency. PMID:23608144

  11. Docosahexaenoic acid antagonizes the boosting effect of palmitic acid on LPS inflammatory signaling by inhibiting gene transcription and ceramide synthesis

    PubMed Central

    Jin, Junfei; Lu, Zhongyang; Li, Yanchun; Cowart, L. Ashley; Lopes-Virella, Maria F.

    2018-01-01

    It is well known that saturated fatty acids (SFAs) and unsaturated fatty acid, in particular omega-3 polyunsaturated fatty acids (n-3 PUFAs), have different effects on inflammatory signaling: SFAs are pro-inflammatory but n-3 PUFAs have strong anti-inflammatory properties. We have reported that palmitic acid (PA), a saturated fatty acid, robustly amplifies lipopolysaccharide (LPS) signaling to upregulate proinflammatory gene expression in macrophages. We also reported that the increased production of ceramide (CER) via sphingomyelin (SM) hydrolysis and CER de novo synthesis plays a key role in the synergistic effect of LPS and PA on proinflammatory gene expression. However, it remains unclear if n-3 PUFAs are capable of antagonizing the synergistic effect of LPS and PA on gene expression and CER production. In this study, we employed the above macrophage culture system and lipidomical analysis to assess the effect of n-3 PUFAs on proinflammatory gene expression and CER production stimulated by LPS and PA. Results showed that DHA strongly inhibited the synergistic effect of LPS and PA on proinflammatory gene expression by targeting nuclear factor kappa B (NFκB)-dependent gene transcription. Results also showed that DHA inhibited the cooperative effect of LPS and PA on CER production by targeting CER de novo synthesis, but not SM hydrolysis. Furthermore, results showed that myriocin, a specific inhibitor of serine palmitoyltransferase, strongly inhibited both LPS-PA-stimulated CER synthesis and proinflammatory gene expression, indicating that CER synthesis is associated with proinflammatory gene expression and that inhibition of CER synthesis contributes to DHA-inhibited proinflammatory gene expression. Taken together, this study demonstrates that DHA antagonizes the boosting effect of PA on LPS signaling on proinflammatory gene expression by targeting both NFκB-dependent transcription and CER de novo synthesis in macrophages. PMID:29474492

  12. Docosahexaenoic acid antagonizes the boosting effect of palmitic acid on LPS inflammatory signaling by inhibiting gene transcription and ceramide synthesis.

    PubMed

    Jin, Junfei; Lu, Zhongyang; Li, Yanchun; Cowart, L Ashley; Lopes-Virella, Maria F; Huang, Yan

    2018-01-01

    It is well known that saturated fatty acids (SFAs) and unsaturated fatty acid, in particular omega-3 polyunsaturated fatty acids (n-3 PUFAs), have different effects on inflammatory signaling: SFAs are pro-inflammatory but n-3 PUFAs have strong anti-inflammatory properties. We have reported that palmitic acid (PA), a saturated fatty acid, robustly amplifies lipopolysaccharide (LPS) signaling to upregulate proinflammatory gene expression in macrophages. We also reported that the increased production of ceramide (CER) via sphingomyelin (SM) hydrolysis and CER de novo synthesis plays a key role in the synergistic effect of LPS and PA on proinflammatory gene expression. However, it remains unclear if n-3 PUFAs are capable of antagonizing the synergistic effect of LPS and PA on gene expression and CER production. In this study, we employed the above macrophage culture system and lipidomical analysis to assess the effect of n-3 PUFAs on proinflammatory gene expression and CER production stimulated by LPS and PA. Results showed that DHA strongly inhibited the synergistic effect of LPS and PA on proinflammatory gene expression by targeting nuclear factor kappa B (NFκB)-dependent gene transcription. Results also showed that DHA inhibited the cooperative effect of LPS and PA on CER production by targeting CER de novo synthesis, but not SM hydrolysis. Furthermore, results showed that myriocin, a specific inhibitor of serine palmitoyltransferase, strongly inhibited both LPS-PA-stimulated CER synthesis and proinflammatory gene expression, indicating that CER synthesis is associated with proinflammatory gene expression and that inhibition of CER synthesis contributes to DHA-inhibited proinflammatory gene expression. Taken together, this study demonstrates that DHA antagonizes the boosting effect of PA on LPS signaling on proinflammatory gene expression by targeting both NFκB-dependent transcription and CER de novo synthesis in macrophages.

  13. From the Primitive Atmosphere to the Prebiotic Soup to the Pre-RNA World

    NASA Technical Reports Server (NTRS)

    Miller, Stanley L.

    1996-01-01

    Organic compounds would have been produced in an earth's atmosphere that was reducing. The soup would contain amino and hydroxy acids, together with smaller amounts of purines and pyrimidines. The presence' of sugars is less likely, although they can be produced by the formose reaction from formaldehyde. However, the prebiotic synthesis of RNA has not been demonstrated. One problem is that ribose is not produced selectively over other pentoses and hexoses, except under special conditions. The second problem is that ribose is unstable, with a half-life at pH7 and 100 C of 73 minutes (44 years at 0 C). Other sugars are similarly unstable. Another problem is that there is no efficient prebiotic synthesis of polyphosphates, nor the glycosidic bond of nucleosides. This suggests that there may have been an informational macromolecule that preceded RNA. The RNA world refers to the time when RNA carried both the genetic information and the catalytic activity, and was subsequently converted to the DNA/protein world when protein synthesis began. Preceeding the RNA world was the Pre-RNA world, where a backbone different from ribose phosphate was used, and the bases may have been different from adenine, uracil, guanine and cytosine. We have shown recently that cytosine and uracil can be synthesized efficiently under prebiotic conditions using a dried lagoon model instead of the usual dilute ocean hypothesis. In addition, we have shown that uracil adds formaldehyde efficiently to give 5- hydroxymethyl uracil, which in turn adds various nucleophiles to give uracil analogs of most of the amino acids that occur in proteins. For example, the ammonia, guanidine and imidazole adducts from the analogs of lysine, arginine and histidine. This suggests that the catalytic potential of RNA may have been much more extensive than previously assumed. The major problem is finding out what was the precursor to the ribose phosphate backbone. This will be the key to developing prebiotic self

  14. In vitro selection of functional nucleic acids

    NASA Technical Reports Server (NTRS)

    Wilson, D. S.; Szostak, J. W.

    1999-01-01

    In vitro selection allows rare functional RNA or DNA molecules to be isolated from pools of over 10(15) different sequences. This approach has been used to identify RNA and DNA ligands for numerous small molecules, and recent three-dimensional structure solutions have revealed the basis for ligand recognition in several cases. By selecting high-affinity and -specificity nucleic acid ligands for proteins, promising new therapeutic and diagnostic reagents have been identified. Selection experiments have also been carried out to identify ribozymes that catalyze a variety of chemical transformations, including RNA cleavage, ligation, and synthesis, as well as alkylation and acyl-transfer reactions and N-glycosidic and peptide bond formation. The existence of such RNA enzymes supports the notion that ribozymes could have directed a primitive metabolism before the evolution of protein synthesis. New in vitro protein selection techniques should allow for a direct comparison of the frequency of ligand binding and catalytic structures in pools of random sequence polynucleotides versus polypeptides.

  15. Exogenous fatty acids affect CDP-choline pathway to increase phosphatidylcholine synthesis in granular pneumocytes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chander, A.; Gullo, J.; Reicherter, J.

    1987-05-01

    Regulation of phosphatidylcholine (PC) synthesis in rat granular pneumocytes isolated by tryptic digestion of lungs and maintained in primary culture for 24 h was investigated by following effects of exogenous fatty acids on (/sup 3/H-methyl)choline incorporation into PC and disaturated PC (DSPC). At 0.1 mM choline, the rate of choline incorporation into PC and DSPC was 440 +/- and 380 +/- 50 pmol/h/ug Pi (mean +/- SE, n=3-5), respectively, and was linear for up to 3 h. PC synthesis was significantly increased by 0.1 mM each of palmitic, oleic, linoleic, or linolenic acid. However, synthesis of DSPC was increased onlymore » by palmitic acid and this increase was prevented by addition of oleic acid suggesting lack of effect on the remodeling pathway. Pulse-chase experiments with choline in absence or presence of palmitic or oleic acid showed that the label declined in choline phosphate and increased in PC more rapidly in presence of either of the fatty acids, suggesting rapid conversion of choline phosphate to PC. Microsomal choline phosphate cytidyltransferase activity in cells preincubated without or with palmitic acid for 3 h was 0.81 +/- 0.07 and 1.81 +/- 0.09 nmol choline phosphate converted/min/mg protein (n=4). These results suggest that in granular pneumocytes, exogenous fatty acids modulate PC synthesis by increasing choline phosphate cytidyltransferase activity.« less

  16. Synthesis and antituberculosis activity of new fatty acid amides.

    PubMed

    D'Oca, Caroline Da Ros Montes; Coelho, Tatiane; Marinho, Tamara Germani; Hack, Carolina Rosa Lopes; Duarte, Rodrigo da Costa; da Silva, Pedro Almeida; D'Oca, Marcelo Gonçalves Montes

    2010-09-01

    This work reports the synthesis of new fatty acid amides from C16:0, 18:0, 18:1, 18:1 (OH), and 18:2 fatty acids families with cyclic and acyclic amines and demonstrate for the first time the activity of these compounds as antituberculosis agents against Mycobacterium tuberculosis H(37)Rv, M. tuberculosis rifampicin resistance (ATCC 35338), and M. tuberculosis isoniazid resistance (ATCC 35822). The fatty acid amides derivate from ricinoleic acid were the most potent one among a series of tested compounds, with a MIC 6.25 microg/mL for resistance strains. Copyright 2010 Elsevier Ltd. All rights reserved.

  17. Pulmonary fatty acid synthesis. I. Mitochondrial acetyl transfer by rat lung in vitro.

    PubMed

    Evans, R M; Scholz, R W

    1977-04-01

    Incorporation of tritiated water into fatty acids by rat adipose tissue and lung tissue slices incubated with 5 mM glucose indicated a level of fatty acid synthesis in rat lung approximately 15% that observed in adipose tissue in vitro. (-)-Hydroxycitrate, and inhibitor of ATP citrate lyase, markedly reduced tritiated water incorporation into fatty acids by lung tissue slices. The effects of (-)-hydroxycitrate and n-butymalonate on the incorporation of 14C-labeled glucose, pyruvate, acetate, and citrate suggested that citrate is a major acetyl carrier for de novo fatty acid synthesis in lung tissue. Alternative mechanisms to citrate as an acetyl carrier were also considered. Lung mitochondrial preparations formed significant levels of acetylcarnitine in the presence of pyruvate and carnitine. However, the effect of carnitine on the incorporation of 14C-labeled glucose, pyruvate, acetate, and citrate into fatty acids by lung tissue slices indicated that acetylcarnitine may not be a significant acetyl carrier for fatty acid synthesis but may serve as an acetyl "buffer" in the control of mitochondrial acetyl-CoA levels. Additionally, it appears unlikely that either acetylaspartate or acetoacetate are of major importance in acetyl transfer in lung tissue.

  18. RNA-dependent RNA polymerases of dsRNA bacteriophages.

    PubMed

    Makeyev, Eugene V; Grimes, Jonathan M

    2004-04-01

    Genome replication and transcription of riboviruses are catalyzed by an RNA-dependent RNA polymerase (RdRP). RdRPs are normally associated with other virus- or/and host-encoded proteins that modulate RNA polymerization activity and template specificity. The polymerase complex of double-stranded dsRNA viruses is a large icosahedral particle (inner core) containing RdRP as a minor constituent. In phi6 and other dsRNA bacteriophages from the Cystoviridae family, the inner core is composed of four virus-specific proteins. Of these, protein P2, or Pol subunit, has been tentatively identified as RdRP by sequence comparisons, but the role of this protein in viral RNA synthesis has not been studied until recently. Here, we overview the work on the Pol subunits of phi6 and related viruses from the standpoints of function, structure and evolution.

  19. Synthesis of the sulfur amino acids: cysteine and methionine.

    PubMed

    Wirtz, Markus; Droux, Michel

    2005-12-01

    This review will assess new features reported for the molecular and biochemical aspects of cysteine and methionine biosynthesis in Arabidopsis thaliana with regards to early published data from other taxa including crop plants and bacteria (Escherichia coli as a model). By contrast to bacteria and fungi, plant cells present a complex organization, in which the sulfur network takes place in multiple sites. Particularly, the impact of sulfur amino-acid biosynthesis compartmentalization will be addressed in respect to localization of sulfur reduction. To this end, the review will focus on regulation of sulfate reduction by synthesis of cysteine through the cysteine synthase complex and the synthesis of methionine and its derivatives. Finally, regulatory aspects of sulfur amino-acid biosynthesis will be explored with regards to interlacing processes such as photosynthesis, carbon and nitrogen assimilation.

  20. Abscisic Acid Negatively Regulates Elicitor-Induced Synthesis of Capsidiol in Wild Tobacco1[W

    PubMed Central

    Mialoundama, Alexis Samba; Heintz, Dimitri; Debayle, Delphine; Rahier, Alain; Camara, Bilal; Bouvier, Florence

    2009-01-01

    In the Solanaceae, biotic and abiotic elicitors induce de novo synthesis of sesquiterpenoid stress metabolites known as phytoalexins. Because plant hormones play critical roles in the induction of defense-responsive genes, we have explored the effect of abscisic acid (ABA) on the synthesis of capsidiol, the major wild tobacco (Nicotiana plumbaginifolia) sesquiterpenoid phytoalexin, using wild-type plants versus nonallelic mutants Npaba2 and Npaba1 that are deficient in ABA synthesis. Npaba2 and Npaba1 mutants exhibited a 2-fold higher synthesis of capsidiol than wild-type plants when elicited with either cellulase or arachidonic acid or when infected by Botrytis cinerea. The same trend was observed for the expression of the capsidiol biosynthetic genes 5-epi-aristolochene synthase and 5-epi-aristolochene hydroxylase. Treatment of wild-type plants with fluridone, an inhibitor of the upstream ABA pathway, recapitulated the behavior of Npaba2 and Npaba1 mutants, while the application of exogenous ABA reversed the enhanced synthesis of capsidiol in Npaba2 and Npaba1 mutants. Concomitant with the production of capsidiol, we observed the induction of ABA 8′-hydroxylase in elicited plants. In wild-type plants, the induction of ABA 8′-hydroxylase coincided with a decrease in ABA content and with the accumulation of ABA catabolic products such as phaseic acid and dihydrophaseic acid, suggesting a negative regulation exerted by ABA on capsidiol synthesis. Collectively, our data indicate that ABA is not required per se for the induction of capsidiol synthesis but is essentially implicated in a stress-response checkpoint to fine-tune the amplification of capsidiol synthesis in challenged plants. PMID:19420326

  1. Self-assembling complexes between binary mixtures of lipids with different linkers and nucleic acids promote universal mRNA, DNA and siRNA delivery.

    PubMed

    Colombani, Thibault; Peuziat, Pauline; Dallet, Laurence; Haudebourg, Thomas; Mével, Mathieu; Berchel, Mathieu; Lambert, Olivier; Habrant, Damien; Pitard, Bruno

    2017-03-10

    Protein expression and RNA interference require efficient delivery of DNA or mRNA and small double stranded RNA into cells, respectively. Although cationic lipids are the most commonly used synthetic delivery vectors, a clear need still exists for a better delivery of various types of nucleic acids molecules to improve their biological activity. To optimize the transfection efficiency, a molecular approach consisting in modifying the chemical structure of a given cationic lipid is usually performed, but an alternative strategy could rely on modulating the supramolecular assembly of lipidic lamellar phases sandwiching the nucleic acids molecules. To validate this new concept, we synthesized on one hand two paromomycin-based cationic lipids, with either an amide or a phosphoramide linker, and on the other hand two imidazole-based neutral lipids, having as well either an amide or a phosphoramide function as linker. Combinations of cationic and helper lipids containing the same amide or phosphoramide linkers led to the formation of homogeneous lamellar phases, while hybrid lamellar phases were obtained when the linkers on the cationic and helper lipids were different. Cryo-transmission electron microscopy and fluorescence experiments showed that liposomes/nucleic acids complexes resulting from the association of nucleic acids with hybrid lamellar phases led to complexes that were more stable in the extracellular compartment compared to those obtained with homogeneous systems. In addition, we observed that the most active supramolecular assemblies for the delivery of DNA, mRNA and siRNA were obtained when the cationic and helper lipids possess linkers of different natures. The results clearly show that this supramolecular strategy modulating the property of the lipidic lamellar phase constitutes a new approach for increasing the delivery of various types of nucleic acid molecules. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Increased expression of glutamic acid decarboxylase mRNA in rat substantia nigra after an ibotenic acid lesion in the caudate-putamen.

    PubMed

    Lindefors, N; Brené, S; Persson, H

    1990-04-01

    In situ hybridization histochemistry and RNA blots were used to study expression of glutamic acid decarboxylase (GAD) mRNA in rat caudate-nucleus and substantia nigra. In situ hybridization combined with computerized image analysis revealed that in the intact substantia nigra reticulata the cross-section area of GAD mRNA positive neurons were 25% larger in the dorsolateral part as compared with the ventromedial part. A unilateral ibotenic acid injection in caudate-putamen lesioned neurons, some of which project to the ipsilateral substantia nigra. An increased level of GAD mRNA was observed in substantia nigra ipsilateral to the lesion. Computerized image analysis of sections from in situ hybridization revealed an increase in the number of silver grains over GAD mRNA positive neurons in the dorsolateral substantia nigra reticulata ipsilateral to the lesion. However, no change was observed in the ventromedial part suggesting that GAD mRNA expression in this part of the nigra is less sensitive to inhibition by caudate-putamen afferents. In agreement with in situ experiments, RNA blots showed a 2-fold increased level of GAD mRNA in substantia nigra ipsilateral to the lesion. The increased GAD mRNA expression in the deafferented substantia nigra suggests a disinhibition of nigral GABA neurons, resulting in an increased utilization of GABA in these substantia nigra neurons.

  3. RNA synthetic mechanisms employed by diverse families of RNA viruses.

    PubMed

    McDonald, Sarah M

    2013-01-01

    RNA viruses are ubiquitous in nature, infecting every known organism on the planet. These viruses can also be notorious human pathogens with significant medical and economic burdens. Central to the lifecycle of an RNA virus is the synthesis of new RNA molecules, a process that is mediated by specialized virally encoded enzymes called RNA-dependent RNA polymerases (RdRps). RdRps directly catalyze phosphodiester bond formation between nucleoside triphosphates in an RNA-templated manner. These enzymes are strikingly conserved in their structural and functional features, even among diverse RNA viruses belonging to different families. During host cell infection, the activities of viral RdRps are often regulated by viral cofactor proteins. Cofactors can modulate the type and timing of RNA synthesis by directly engaging the RdRp and/or by indirectly affecting its capacity to recognize template RNA. High-resolution structures of RdRps as apoenzymes, bound to RNA templates, in the midst of catalysis, and/or interacting with regulatory cofactor proteins, have dramatically increased our understanding of viral RNA synthetic mechanisms. Combined with elegant biochemical studies, such structures are providing a scientific platform for the rational design of antiviral agents aimed at preventing and treating RNA virus-induced diseases. Copyright © 2013 John Wiley & Sons, Ltd.

  4. Intracellular synthesis of glutamic acid in Bacillus methylotrophicus SK19.001, a glutamate-independent poly(γ-glutamic acid)-producing strain.

    PubMed

    Peng, Yingyun; Zhang, Tao; Mu, Wanmeng; Miao, Ming; Jiang, Bo

    2016-01-15

    Bacillus methylotrophicus SK19.001 is a glutamate-independent strain that produces poly(γ-glutamic acid) (γ-PGA), a polymer of D- and L-glutamic acids that possesses applications in food, the environment, agriculture, etc. This study was undertaken to explore the synthetic pathway of intracellular L- and D-glutamic acid in SK19.001 by investigating the effects of tricarboxylic acid cycle intermediates and different amino acids as metabolic precursors on the production of γ-PGA and analyzing the activities of the enzymes involved in the synthesis of L- and D-glutamate. Tricarboxylic acid cycle intermediates and amino acids could participate in the synthesis of γ-PGA via independent pathways in SK19.001. L-Aspartate aminotransferase, L-glutaminase and L-glutamate synthase were the enzymatic sources of L-glutamate. Glutamate racemase was responsible for the formation of D-glutamate for the synthesis of γ-PGA, and the synthetase had stereoselectivity for glutamate substrate. The enzymatic sources of L-glutamate were investigated for the first time in the glutamate-independent γ-PGA-producing strain, and multiple enzymatic sources of L-glutamate were verified in SK19.001, which will benefit efforts to improve production of γ-PGA with metabolic engineering strategies. © 2015 Society of Chemical Industry.

  5. A two-way street: regulatory interplay between RNA polymerase and nascent RNA structure

    PubMed Central

    Zhang, Jinwei; Landick, Robert

    2016-01-01

    The vectorial (5′-to-3′ at varying velocity) synthesis of RNA by cellular RNA polymerases creates a rugged kinetic landscape, demarcated by frequent, sometimes long-lived pauses. In addition to myriad gene-regulatory roles, these pauses temporally and spatially program the co-transcriptional, hierarchical folding of biologically active RNAs. Conversely, these RNA structures, which form inside or near the RNA exit channel, interact with the polymerase and adjacent protein factors to influence RNA synthesis by modulating pausing, termination, antitermination, and slippage. Here we review the evolutionary origin, mechanistic underpinnings, and regulatory consequences of this interplay between RNA polymerase and nascent RNA structure. We categorize and attempt to rationalize the extensive linkage between the transcriptional machinery and its product, and provide a framework for future studies. PMID:26822487

  6. Synthesis of 6-phosphofructose aspartic acid and some related Amadori compounds.

    PubMed

    Hansen, Alexandar L; Behrman, Edward J

    2016-08-05

    We describe the synthesis and characterization of 6-phosphofructose-aspartic acid, an intermediate in the metabolism of fructose-asparagine by Salmonella. We also report improved syntheses of fructose-asparagine itself and of fructose-aspartic acid. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Three-Dimensional Algebraic Models of the tRNA Code and 12 Graphs for Representing the Amino Acids

    PubMed Central

    José, Marco V.; Morgado, Eberto R.; Guimarães, Romeu Cardoso; Zamudio, Gabriel S.; de Farías, Sávio Torres; Bobadilla, Juan R.; Sosa, Daniela

    2014-01-01

    Three-dimensional algebraic models, also called Genetic Hotels, are developed to represent the Standard Genetic Code, the Standard tRNA Code (S-tRNA-C), and the Human tRNA code (H-tRNA-C). New algebraic concepts are introduced to be able to describe these models, to wit, the generalization of the 2n-Klein Group and the concept of a subgroup coset with a tail. We found that the H-tRNA-C displayed broken symmetries in regard to the S-tRNA-C, which is highly symmetric. We also show that there are only 12 ways to represent each of the corresponding phenotypic graphs of amino acids. The averages of statistical centrality measures of the 12 graphs for each of the three codes are carried out and they are statistically compared. The phenotypic graphs of the S-tRNA-C display a common triangular prism of amino acids in 10 out of the 12 graphs, whilst the corresponding graphs for the H-tRNA-C display only two triangular prisms. The graphs exhibit disjoint clusters of amino acids when their polar requirement values are used. We contend that the S-tRNA-C is in a frozen-like state, whereas the H-tRNA-C may be in an evolving state. PMID:25370377

  8. Stereoselective Synthesis of α-Amino-C-phosphinic Acids and Derivatives.

    PubMed

    Viveros-Ceballos, José Luis; Ordóñez, Mario; Sayago, Francisco J; Cativiela, Carlos

    2016-08-29

    α-Amino-C-phosphinic acids and derivatives are an important group of compounds of synthetic and medicinal interest and particular attention has been dedicated to their stereoselective synthesis in recent years. Among these, phosphinic pseudopeptides have acquired pharmacological importance in influencing physiologic and pathologic processes, primarily acting as inhibitors for proteolytic enzymes where molecular stereochemistry has proven to be critical. This review summarizes the latest developments in the asymmetric synthesis of acyclic and phosphacyclic α-amino-C-phosphinic acids and derivatives, following in the first case an order according to the strategy used, whereas for cyclic compounds the nitrogen embedding in the heterocyclic core is considered. In addition selected examples of pharmacological implications of title compounds are also disclosed.

  9. Synthesis of aspartyl-tRNA(Asp) in Escherichia coli--a snapshot of the second step.

    PubMed Central

    Eiler, S; Dock-Bregeon, A; Moulinier, L; Thierry, J C; Moras, D

    1999-01-01

    The 2.4 A crystal structure of the Escherichia coli aspartyl-tRNA synthetase (AspRS)-tRNA(Asp)-aspartyl-adenylate complex shows the two substrates poised for the transfer of the aspartic acid moiety from the adenylate to the 3'-hydroxyl of the terminal adenosine of the tRNA. A general molecular mechanism is proposed for the second step of the aspartylation reaction that accounts for the observed conformational changes, notably in the active site pocket. The stabilization of the transition state is mediated essentially by two amino acids: the class II invariant arginine of motif 2 and the eubacterial-specific Gln231, which in eukaryotes and archaea is replaced by a structurally non-homologous serine. Two archetypal RNA-protein modes of interactions are observed: the anticodon stem-loop, including the wobble base Q, binds to the N-terminal beta-barrel domain through direct protein-RNA interactions, while the binding of the acceptor stem involves both direct and water-mediated hydrogen bonds in an original recognition scheme. PMID:10562565

  10. Synthesis and characterization of 3-ketohexadecanoic acid-1-14-C, DL-3-hydroxyhexadecanoic acid-1-14-C, and trans-2-hexadecenoic acid-1-14-C.

    PubMed

    Jones, J A; Blecher, M

    1966-05-01

    The chemical synthesis and characterization of three intermediates in the Beta oxidation of palmitic acid-1-(14)C by rat liver mitochondria, namely, 3-ketohexadecanoic acid-1-(14)C, DL-3-hydroxyhexadecanoic acid-1-(14)C, and trans-2-hexadecenoic acid-1-(14)C, are described.

  11. Synthesis, characterization, and evaluation of ionizable lysine-based lipids for siRNA delivery.

    PubMed

    Walsh, Colin L; Nguyen, Juliane; Tiffany, Matthew R; Szoka, Francis C

    2013-01-16

    We report the synthesis and characterization of a series of ionizable lysine-based lipids (ILL), novel lipids containing a lysine headgroup linked to a long-chain dialkylamine through an amide linkage at the lysine α-amine. These ILLs contain two ionizable amines and a carboxylate, and exhibit pH-dependent lipid ionization that varies with lipid structure. The synthetic scheme employed allows for the simple, orthogonal manipulation of lipids. This provides a method for the development of a compositionally diverse library with varying ionizable headgroups, tail structures, and linker regions. A focused library of four ILLs was synthesized to determine the impact of hydrophobic fluidity, lipid net charge, and lipid pK(a) on the biophysical and siRNA transfection characteristics of this new class of lipids. We found that manipulation of lipid structure impacts the protonation behavior, electrostatically driven membrane disruption, and ability to promote siRNA mediated knockdown in vitro. ILL-siRNA liposomal formulations were tested in a murine Factor VII model; however, no significant siRNA-mediated knockdown was observed. These results indicate that ILL may be useful in vitro transfection reagents, but further optimization of this new class of lipids is required to develop an effective in vivo siRNA delivery system.

  12. Inhibition of Fatty Acid Synthesis Induces Apoptosis of Human Pancreatic Cancer Cells.

    PubMed

    Nishi, Koji; Suzuki, Kenta; Sawamoto, Junpei; Tokizawa, Yuma; Iwase, Yumiko; Yumita, Nagahiko; Ikeda, Toshihiko

    2016-09-01

    Cancer cells tend to have a high requirement for lipids, including fatty acids, cholesterol and triglyceride, because of their rapid proliferative rate compared to normal cells. In this study, we investigated the effects of inhibition of lipid synthesis on the proliferation and viability of human pancreatic cancer cells. Of the inhibitors of lipid synthesis that were tested, 5-(tetradecyloxy)-2-furoic acid (TOFA), which is an inhibitor of acetyl-CoA carboxylase, and the fatty acid synthase (FAS) inhibitors cerulenin and irgasan, significantly suppressed the proliferation of MiaPaCa-2 and AsPC-1 cells. Treatment of MiaPaCa-2 cells with these inhibitors significantly increased the number of apoptotic cells. In addition, TOFA increased caspase-3 activity and induced cleavage of poly (ADP-ribose) polymerase in MiaPaCa-2 cells. Moreover, addition of palmitate to MiaPaCa-2 cells treated with TOFA rescued cells from apoptotic cell death. These results suggest that TOFA induces apoptosis via depletion of fatty acids and that, among the various aspects of lipid metabolism, inhibition of fatty acid synthesis may be a notable target for the treatment of human pancreatic cancer cells. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  13. α-Ketophosphonic Acid Esters — Synthesis, Structure, and Reactions

    NASA Astrophysics Data System (ADS)

    Zhdanov, Yu A.; Uzlova, L. A.; Glebova, Z. I.

    1980-09-01

    Studies on the synthesis and properties of α-ketophosphonic acid esters (KPE) — a class of highly reactive organophosphorus compounds — are surveyed. Data are presented concerning instances of the anomalous course of the process in the synthesis of KPE by the Arbuzov reaction. The reactions of KPE with nucleophiles, including those which lead to the rupture of the phosphorus-carbon bond, are examined in detail. The problems of the stereochemistry of KPE are dealt with briefly. The bibliography includes 162 references.

  14. Synthesis, characterization and reactivity of 3-mercaptopyruvic acid.

    PubMed

    Galardon, Erwan; Lec, Jean-Chrstophe

    2018-05-20

    A synthesis of the sulfur metabolic compound 3-mercaptopyruvic acid (3-MPH) is reported and allowed its isolation and characterization for the first time. Detailed kinetic, thermodynamic and spectroscopic studies of its complex behaviour in solution are discussed. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. The effect of synthetic homopolymer poly I:C on the synthesis of nucleic acids, protein and interferon in spleen cells normally and with radiation

    NASA Technical Reports Server (NTRS)

    Antropova, Y. N.; Konstantinova, I. V.; Fuks, B. B.; Talosh, M. Y.; Veysfeyler, Y. K.

    1974-01-01

    A comparative study is reported of the effect of the synthetic homopolymer poly I:C and Newcastle Disease virus on the synthesis of RNA, DNA, total protein and interferon in the spleen of nonradiated and radiated mice. In radiated animals, poly I:C and NDV had no stimulating effect on the synthesis of RNA; administration of both inducers to radiated mice did not significantly affect the content of lymphoid cellular elements in the spleen. However, while reduction of RNA synthesis, caused by radiation, also increases slightly under the effect of poly I:C and the virus, the synthesis of interferon in spleen cells and in the entire body is activated.

  16. Improved nucleic acid descriptors for siRNA efficacy prediction.

    PubMed

    Sciabola, Simone; Cao, Qing; Orozco, Modesto; Faustino, Ignacio; Stanton, Robert V

    2013-02-01

    Although considerable progress has been made recently in understanding how gene silencing is mediated by the RNAi pathway, the rational design of effective sequences is still a challenging task. In this article, we demonstrate that including three-dimensional descriptors improved the discrimination between active and inactive small interfering RNAs (siRNAs) in a statistical model. Five descriptor types were used: (i) nucleotide position along the siRNA sequence, (ii) nucleotide composition in terms of presence/absence of specific combinations of di- and trinucleotides, (iii) nucleotide interactions by means of a modified auto- and cross-covariance function, (iv) nucleotide thermodynamic stability derived by the nearest neighbor model representation and (v) nucleic acid structure flexibility. The duplex flexibility descriptors are derived from extended molecular dynamics simulations, which are able to describe the sequence-dependent elastic properties of RNA duplexes, even for non-standard oligonucleotides. The matrix of descriptors was analysed using three statistical packages in R (partial least squares, random forest, and support vector machine), and the most predictive model was implemented in a modeling tool we have made publicly available through SourceForge. Our implementation of new RNA descriptors coupled with appropriate statistical algorithms resulted in improved model performance for the selection of siRNA candidates when compared with publicly available siRNA prediction tools and previously published test sets. Additional validation studies based on in-house RNA interference projects confirmed the robustness of the scoring procedure in prospective studies.

  17. Non-standard amino acid recognition by Escherichia coli leucyl-tRNA synthetase

    NASA Technical Reports Server (NTRS)

    Martinis, S. A.; Fox, G. E.

    1997-01-01

    Recombinant E. coli leucyl-tRNA synthetase was screened for amino acid-dependent pyrophosphate exchange activity using noncognate aliphatic amino acids including norvaline, homocysteine, norleucine, methionine, and homoserine. [32P]-labeled reaction products were separated by thin layer chromatography using a novel solvent system and then quantified by phosphorimaging. Norvaline which differs from leucine by only one methyl group stimulated pyrophosphate exchange activity as did both homocysteine and norleucine to a lesser extent. The KM parameters for leucine and norvaline were measured to be 10 micromoles and 1.5 mM, respectively. Experiments are in progress to determine if norvaline is transferred to tRNA(Leu) and/or edited by a pre- or post-transfer mechanism.

  18. Glass-ionomer cement formulations. II. The synthesis of novel polycarobxylic acids.

    PubMed

    Crisp, S; Kent, B E; Lewis, B G; Ferner, A J; Wilson, A D

    1980-06-01

    The synthesis of many polycarboxylic acids is reported. An account is given of their stability in aqueous solution and the properties of cements formed by their reaction with ion-leachable glasses. A copolymer of acrylic and itaconic acids was found to combine several favorable characteristics.

  19. Acidic Residues in the Hfq Chaperone Increase the Selectivity of sRNA Binding and Annealing.

    PubMed

    Panja, Subrata; Santiago-Frangos, Andrew; Schu, Daniel J; Gottesman, Susan; Woodson, Sarah A

    2015-11-06

    Hfq facilitates gene regulation by small non-coding RNAs (sRNAs), thereby affecting bacterial attributes such as biofilm formation and virulence. Escherichia coli Hfq recognizes specific U-rich and AAN motifs in sRNAs and target mRNAs, after which an arginine patch on the rim promotes base pairing between their complementary sequences. In the cell, Hfq must discriminate between many similar RNAs. Here, we report that acidic amino acids lining the sRNA binding channel between the inner pore and rim of the Hfq hexamer contribute to the selectivity of Hfq's chaperone activity. RNase footprinting, in vitro binding and stopped-flow fluorescence annealing assays showed that alanine substitution of D9, E18 or E37 strengthened RNA interactions with the rim of Hfq and increased annealing of non-specific or U-tailed RNA oligomers. Although the mutants were less able than wild-type Hfq to anneal sRNAs with wild-type rpoS mRNA, the D9A mutation bypassed recruitment of Hfq to an (AAN)4 motif in rpoS, both in vitro and in vivo. These results suggest that acidic residues normally modulate access of RNAs to the arginine patch. We propose that this selectivity limits indiscriminate target selection by E. coli Hfq and enforces binding modes that favor genuine sRNA and mRNA pairs. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. A focus on polarity: Investigating the role of orientation cues in mediating student performance on mRNA synthesis tasks in an introductory cell and molecular biology course.

    PubMed

    Olimpo, Jeffrey T; Quijas, Daniel A; Quintana, Anita M

    2017-11-01

    The central dogma has served as a foundational model for information flow, exchange, and storage in the biological sciences for several decades. Despite its continued importance, however, recent research suggests that novices in the domain possess several misconceptions regarding the aforementioned processes, including those pertaining specifically to the formation of messenger ribonucleic acid (mRNA) transcripts. In the present study, we sought to expand upon these observations through exploration of the influence of orientation cues on students' aptitude at synthesizing mRNAs from provided deoxyribonucleic acid (DNA) template strands. Data indicated that participants (n = 45) were proficient at solving tasks of this nature when the DNA template strand and the mRNA molecule were represented in an antiparallel orientation. In contrast, participants' performance decreased significantly on items in which the mRNA was depicted in a parallel orientation relative to the DNA template strand. Furthermore, participants' Grade Point Average, self-reported confidence in understanding the transcriptional process, and spatial ability were found to mediate their performance on the mRNA synthesis tasks. Collectively, these data reaffirm the need for future research and pedagogical interventions designed to enhance students' comprehension of the central dogma in a manner that makes transparent its relevance to real-world scientific phenomena. © 2017 by The International Union of Biochemistry and Molecular Biology, 45(6):501-508, 2017. © 2017 The International Union of Biochemistry and Molecular Biology.

  1. Synthesis of medium-chain fatty acids and their incorporation into triacylglycerols by cell-free fractions from Cuphea embryos.

    PubMed

    Deerberg, S; von Twickel, J; Förster, H H; Cole, T; Fuhrmann, J; Heise, K P

    1990-02-01

    During their rapid maturation period, seeds of Cuphea wrightii A. Gray mainly accumulate medium-chain fatty acids (C8 to C14) in their storage lipids. The rate of lipid deposition (40-50 mg·d(-1)·(g fresh weight)(-1)) is fourfold higher than in seeds of Cuphea racemosa (L. f.) Spreng, which accumulate long-chain fatty acids (C16 to C18). Measurements of the key enzymes of fatty-acid synthesis in cell-free extracts of seeds of different maturities from Cuphea wrightii show that malonyl-CoA synthesis may be a triggering factor for the observed high capacity for fatty-acid synthesis. Experiments on the incorporation of [1-(14)C]acetate into fatty acids by purified plastid preparations from embryos of Cuphea wrightii have demonstrated that the biosynthesis of medium-chain fatty acids (C8 to C14) is localized in the plastid. Thus, in the presence of cofactors for lipid synthesis (ATP, NADPH, NADH, acyl carrier protein, and sn-glycerol-3-phosphate), purified plastid fractions predominantly synthesized free fatty acids, 30% of which were of medium chain length. Transesterification of the freshly synthesized fatty acids to coenzyme A and recombination with the microsomal fraction of the embryo homogenate induced triacylglycerol synthesis. It also stimulated fatty-acid synthesis by a factor 2-3 and increased the relative amount of medium-chain fatty acids bound to triacylglycerols, which corresponded to about 60-80% in this lipid fraction.

  2. Acid-Sensitive Sheddable PEGylated PLGA Nanoparticles Increase the Delivery of TNF-α siRNA in Chronic Inflammation Sites

    PubMed Central

    Aldayel, Abdulaziz M; Naguib, Youssef W; O'Mary, Hannah L; Li, Xu; Niu, Mengmeng; Ruwona, Tinashe B; Cui, Zhengrong

    2016-01-01

    There has been growing interest in utilizing small interfering RNA (siRNA) specific to pro-inflammatory cytokines, such as tumor necrosis factor-α ( TNF-α), in chronic inflammation therapy. However, delivery systems that can increase the distribution of the siRNA in chronic inflammation sites after intravenous administration are needed. Herein we report that innovative functionalization of the surface of siRNA-incorporated poly (lactic-co-glycolic) acid (PLGA) nanoparticles significantly increases the delivery of the siRNA in the chronic inflammation sites in a mouse model. The TNF-α siRNA incorporated PLGA nanoparticles were prepared by the standard double emulsion method, but using stearoyl-hydrazone-polyethylene glycol 2000, a unique acid-sensitive surface active agent, as the emulsifying agent, which renders (i) the nanoparticles PEGylated and (ii) the PEGylation sheddable in low pH environment such as that in chronic inflammation sites. In a mouse model of lipopolysaccharide-induced chronic inflammation, the acid-sensitive sheddable PEGylated PLGA nanoparticles showed significantly higher accumulation or distribution in chronic inflammation sites than PLGA nanoparticles prepared with an acid-insensitive emulsifying agent (i.e., stearoyl-amide-polyethylene glycol 2000) and significantly increased the distribution of the TNF-α siRNA incorporated into the nanoparticles in inflamed mouse foot. PMID:27434685

  3. Valproate induced hepatic steatosis by enhanced fatty acid uptake and triglyceride synthesis.

    PubMed

    Bai, Xupeng; Hong, Weipeng; Cai, Peiheng; Chen, Yibei; Xu, Chuncao; Cao, Di; Yu, Weibang; Zhao, Zhongxiang; Huang, Min; Jin, Jing

    2017-06-01

    Steatosis is the characteristic type of VPA-induced hepatotoxicity and may result in life-threatening hepatic lesion. Approximately 61% of patients treated with VPA have been diagnosed with hepatic steatosis through ultrasound examination. However, the mechanisms underlying VPA-induced intracellular fat accumulation are not yet fully understood. Here we demonstrated the involvement of fatty acid uptake and lipogenesis in VPA-induced hepatic steatosis in vitro and in vivo by using quantitative real-time PCR (qRT-PCR) analysis, western blotting analysis, fatty acid uptake assays, Nile Red staining assays, and Oil Red O staining assays. Specifically, we found that the expression of cluster of differentiation 36 (CD36), an important fatty acid transport, and diacylglycerol acyltransferase 2 (DGAT2) were significantly up-regulated in HepG2 cells and livers of C57B/6J mice after treatment with VPA. Furthermore, VPA treatment remarkably enhanced the efficiency of fatty acid uptake mediated by CD36, while this effect was abolished by the interference with CD36-specific siRNA. Also, VPA treatment significantly increased DGAT2 expression as a result of the inhibition of mitogen-activated protein kinase kinase (MEK) - extracellular regulated kinase (ERK) pathway; however, DGAT2 knockdown significantly alleviated VPA-induced intracellular lipid accumulation. Additionally, we also found that sterol regulatory element binding protein-1c (SREBP-1c)-mediated fatty acid synthesis may be not involved in VPA-induced hepatic steatosis. Overall, VPA-triggered over-regulation of CD36 and DGAT2 could be helpful for a better understanding of the mechanisms underlying VPA-induced hepatic steatosis and may offer novel therapeutic strategies to combat VPA-induced hepatotoxicity. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. The prion protein has RNA binding and chaperoning properties characteristic of nucleocapsid protein NCP7 of HIV-1.

    PubMed

    Gabus, C; Derrington, E; Leblanc, P; Chnaiderman, J; Dormont, D; Swietnicki, W; Morillas, M; Surewicz, W K; Marc, D; Nandi, P; Darlix, J L

    2001-06-01

    Transmissible spongiform encephalopathies are fatal neurodegenerative diseases associated with the accumulation of a protease-resistant form of the prion protein (PrP). Although PrP is conserved in vertebrates, its function remains to be identified. In vitro PrP binds large nucleic acids causing the formation of nucleoprotein complexes resembling human immunodeficiency virus type 1 (HIV-1) nucleocapsid-RNA complexes and in vivo MuLV replication accelerates the scrapie infectious process, suggesting possible interactions between retroviruses and PrP. Retroviruses, including HIV-1 encode a major nucleic acid binding protein (NC protein) found within the virus where 2000 NC protein molecules coat the dimeric genome. NC is required in virus assembly and infection to chaperone RNA dimerization and packaging and in proviral DNA synthesis by reverse transcriptase (RT). In HIV-1, 5'-leader RNA/NC interactions appear to control these viral processes. This prompted us to compare and contrast the interactions of human and ovine PrP and HIV-1 NCp7 with HIV-1 5'-leader RNA. Results show that PrP has properties characteristic of NCp7 with respect to viral RNA dimerization and proviral DNA synthesis by RT. The NC-like properties of huPrP map to the N-terminal region of huPrP. Interestingly, PrP localizes in the membrane and cytoplasm of PrP-expressing cells. These findings suggest that PrP is a multifunctional protein possibly participating in nucleic acid metabolism.

  5. Interferon Action on Parental Semliki Forest Virus Ribonucleic Acid

    PubMed Central

    Friedman, Robert M.; Fantes, Karl H.; Levy, Hilton B.; Carter, William B.

    1967-01-01

    Actinomycin D-treated chick fibroblasts were infected with purified 32P-labeled Semliki forest virus, and ribonucleic acid (RNA) was extracted after 1 or 2 hr. Within 1 hr, viral RNA forms sedimenting in sucrose gradients at 42S, 30S, and 16S were present. The 42S form corresponded to the RNA of the virion. The 16S form appeared to be a double-stranded template for the formation of new viral RNA, since nascent RNA was associated with it and the molecule could be heat-denatured and subsequently reannealed by slow cooling. Interferon treatment before infection, or puromycin (50 μg/ml) or cycloheximide (200 μg/ml) added at the time of virus infection, had no effect on the formation of the 30S RNA but inhibited the production of the 16S form. Several findings made it unlikely that these results were due to breakdown of parental RNA and reincorporation of 32P into progeny structures. The results suggested that the mechanism of interferon action involves inhibition of protein synthesis by parental viral RNA, since a specific viral RNA polymerase had previously been demonstrated to be necessary for production of 16S RNA. No protein synthesis appears necessary for formation of 30S RNA from parental virus RNA. PMID:5621488

  6. Properties of Native High-Density Lipoproteins Inspire Synthesis of Actively Targeted In Vivo siRNA Delivery Vehicles.

    PubMed

    McMahon, Kaylin M; Plebanek, Michael P; Thaxton, C Shad

    2016-11-15

    Efficient systemic administration of therapeutic short interfering RNA (siRNA) is challenging. High-density lipoproteins (HDL) are natural in vivo RNA delivery vehicles. Specifically, native HDLs: 1) Load single-stranded RNA; 2) Are anionic, which requires charge reconciliation between the RNA and HDL, and 3) Actively target scavenger receptor type B-1 (SR-B1) to deliver RNA. Emphasizing these particular parameters, we employed templated lipoprotein particles (TLP), mimics of spherical HDLs, and self-assembled them with single-stranded complements of, presumably, any highly unmodified siRNA duplex pair after formulation with a cationic lipid. Resulting siRNA templated lipoprotein particles (siRNA-TLP) are anionic and tunable with regard to RNA assembly and function. Data demonstrate that the siRNA-TLPs actively target SR-B1 to potently reduce androgen receptor (AR) and enhancer of zeste homolog 2 (EZH2) proteins in multiple cancer cell lines. Systemic administration of siRNA-TLPs demonstrated no off-target toxicity and significantly reduced the growth of prostate cancer xenografts. Thus, native HDLs inspired the synthesis of a hybrid siRNA delivery vehicle that can modularly load single-stranded RNA complements after charge reconciliation with a cationic lipid, and that function due to active targeting of SR-B1.

  7. Copper-catalyzed formic acid synthesis from CO2 with hydrosilanes and H2O.

    PubMed

    Motokura, Ken; Kashiwame, Daiki; Miyaji, Akimitsu; Baba, Toshihide

    2012-05-18

    A copper-catalyzed formic acid synthesis from CO2 with hydrosilanes has been accomplished. The Cu(OAc)2·H2O-1,2-bis(diphenylphosphino)benzene system is highly effective for the formic acid synthesis under 1 atm of CO2. The TON value approached 8100 in 6 h. The reaction pathway was revealed by in situ NMR analysis and isotopic experiments.

  8. How to Tackle the Challenge of siRNA Delivery with Sequence-Defined Oligoamino Amides.

    PubMed

    Reinhard, Sören; Wagner, Ernst

    2017-01-01

    RNA interference (RNAi) as a mechanism of gene regulation provides exciting opportunities for medical applications. Synthetic small interfering RNA (siRNA) triggers the knockdown of complementary mRNA sequences in a catalytic fashion and has to be delivered into the cytosol of the targeted cells. The design of adequate carrier systems to overcome multiple extracellular and intracellular roadblocks within the delivery process has utmost importance. Cationic polymers form polyplexes through electrostatic interaction with negatively charged nucleic acids and present a promising class of carriers. Issues of polycations regarding toxicity, heterogeneity, and polydispersity can be overcome by solid-phase-assisted synthesis of sequence-defined cationic oligomers. These medium-sized highly versatile nucleic acid carriers display low cytotoxicity and can be modified and tailored in multiple ways to meet specific requirements of nucleic acid binding, polyplex size, shielding, targeting, and intracellular release of the cargo. In this way, sequence-defined cationic oligomers can mimic the dynamic and bioresponsive behavior of viruses. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. A Two-Way Street: Regulatory Interplay between RNA Polymerase and Nascent RNA Structure.

    PubMed

    Zhang, Jinwei; Landick, Robert

    2016-04-01

    The vectorial (5'-to-3' at varying velocity) synthesis of RNA by cellular RNA polymerases (RNAPs) creates a rugged kinetic landscape, demarcated by frequent, sometimes long-lived, pauses. In addition to myriad gene-regulatory roles, these pauses temporally and spatially program the co-transcriptional, hierarchical folding of biologically active RNAs. Conversely, these RNA structures, which form inside or near the RNA exit channel, interact with the polymerase and adjacent protein factors to influence RNA synthesis by modulating pausing, termination, antitermination, and slippage. Here, we review the evolutionary origin, mechanistic underpinnings, and regulatory consequences of this interplay between RNAP and nascent RNA structure. We categorize and rationalize the extensive linkage between the transcriptional machinery and its product, and provide a framework for future studies. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. Lipid sensing by mTOR complexes via de novo synthesis of phosphatidic acid

    PubMed Central

    Menon, Deepak; Salloum, Darin; Bernfeld, Elyssa; Gorodetsky, Elizabeth; Akselrod, Alla; Frias, Maria A.; Sudderth, Jessica; Chen, Pei-Hsuan; DeBerardinis, Ralph; Foster, David A.

    2017-01-01

    mTOR, the mammalian target of rapamycin, integrates growth factor and nutrient signals to promote a transformation from catabolic to anabolic metabolism, cell growth, and cell cycle progression. Phosphatidic acid (PA) interacts with the FK506-binding protein–12-rapamycin-binding (FRB) domain of mTOR, which stabilizes both mTOR complexes: mTORC1 and mTORC2. We report here that mTORC1 and mTORC2 are activated in response to exogenously supplied fatty acids via the de novo synthesis of PA, a central metabolite for membrane phospholipid biosynthesis. We examined the impact of exogenously supplied fatty acids on mTOR in KRas-driven cancer cells, which are programmed to utilize exogenous lipids. The induction of mTOR by oleic acid was dependent upon the enzymes responsible for de novo synthesis of PA. Suppression of the de novo synthesis of PA resulted in G1 cell cycle arrest. Although it has long been appreciated that mTOR is a sensor of amino acids and glucose, this study reveals that mTOR also senses the presence of lipids via production of PA. PMID:28223357

  11. Lipid sensing by mTOR complexes via de novo synthesis of phosphatidic acid.

    PubMed

    Menon, Deepak; Salloum, Darin; Bernfeld, Elyssa; Gorodetsky, Elizabeth; Akselrod, Alla; Frias, Maria A; Sudderth, Jessica; Chen, Pei-Hsuan; DeBerardinis, Ralph; Foster, David A

    2017-04-14

    mTOR, the mammalian target of rapamycin, integrates growth factor and nutrient signals to promote a transformation from catabolic to anabolic metabolism, cell growth, and cell cycle progression. Phosphatidic acid (PA) interacts with the FK506-binding protein-12-rapamycin-binding (FRB) domain of mTOR, which stabilizes both mTOR complexes: mTORC1 and mTORC2. We report here that mTORC1 and mTORC2 are activated in response to exogenously supplied fatty acids via the de novo synthesis of PA, a central metabolite for membrane phospholipid biosynthesis. We examined the impact of exogenously supplied fatty acids on mTOR in KRas-driven cancer cells, which are programmed to utilize exogenous lipids. The induction of mTOR by oleic acid was dependent upon the enzymes responsible for de novo synthesis of PA. Suppression of the de novo synthesis of PA resulted in G 1 cell cycle arrest. Although it has long been appreciated that mTOR is a sensor of amino acids and glucose, this study reveals that mTOR also senses the presence of lipids via production of PA. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  12. Synthesis and characterization of bis-thiourea having amino acid derivatives

    NASA Astrophysics Data System (ADS)

    Fakhar, Imran; Yamin, Bohari M.; Hasbullah, Siti Aishah

    2016-11-01

    In this article four new symmetric bis-thiourea derivatives having amino acid linkers were reported with good yield. Isophthaloyl dichloride was used as spacer and L-alanine, L-aspartic acid, L-phenylalanine and L-glutamic acid were used as linkers. Bis-thiourea derivatives were prepared from relatively stable isophthaloyl isothiocyanate intermediate. Newly synthesized bis-thiourea derivatives were characterized by FTIR, H-NMR, 13C-NMR and CHNS-O elemental analysis techniques. Characterization data was in good agreement with the expected derivatives, hence confirmed the synthesis of four new derivatives of bis-thiourea having amino acids.

  13. Screening and Characterization of a Novel RNA Aptamer That Specifically Binds to Human Prostatic Acid Phosphatase and Human Prostate Cancer Cells

    PubMed Central

    Kong, Hoon Young; Byun, Jonghoe

    2015-01-01

    Prostatic acid phosphatase (PAP) expression increases proportionally with prostate cancer progression, making it useful in prognosticating intermediate to high-risk prostate cancers. A novel ligand that can specifically bind to PAP would be very helpful for guiding prostate cancer therapy. RNA aptamers bind to target molecules with high specificity and have key advantages such as low immunogenicity and easy synthesis. Here, human PAP-specific aptamers were screened from a 2′-fluoropyrimidine (FY)-modified RNA library by SELEX. The candidate aptamer families were identified within six rounds followed by analysis of their sequences and PAP-specific binding. A gel shift assay was used to identify PAP binding aptamers and the 6N aptamer specifically bound to PAP with a Kd value of 118 nM. RT-PCR and fluorescence labeling analyses revealed that the 6N aptamer bound to PAP-positive mammalian cells, such as PC-3 and LNCaP. IMR-90 negative control cells did not bind the 6N aptamer. Systematic minimization analyses revealed that 50 nucleotide sequences and their two hairpin structures in the 6N 2′-FY RNA aptamer were equally important for PAP binding. Renewed interest in PAP combined with the versatility of RNA aptamers, including conjugation of anti-cancer drugs and nano-imaging probes, could open up a new route for early theragnosis of prostate cancer. PMID:25591398

  14. From N-triisopropylsilylpyrrole to an optically active C-4 substituted pyroglutamic acid: total synthesis of penmacric acid.

    PubMed

    Berini, Christophe; Pelloux-Léon, Nadia; Minassian, Frédéric; Denis, Jean-Noël

    2009-11-07

    The stereoselective synthesis of penmacric acid, an optically active C-4 substituted pyroglutamic acid, has been efficiently achieved through an unusual 11-step sequence starting from simple N-triisopropylsilylpyrrole. The key-steps are the initial addition of the pyrrole nucleus onto a chiral nitrone and the obtention of the pyroglutamic acid moiety by reductive hydrogenation of the pyrrole followed by oxidation of the corresponding pyrrolidine into pyrrolidinone.

  15. Versatile RNA tetra-U helix linking motif as a toolkit for nucleic acid nanotechnology.

    PubMed

    Bui, My N; Brittany Johnson, M; Viard, Mathias; Satterwhite, Emily; Martins, Angelica N; Li, Zhihai; Marriott, Ian; Afonin, Kirill A; Khisamutdinov, Emil F

    2017-04-01

    RNA nanotechnology employs synthetically modified ribonucleic acid (RNA) to engineer highly stable nanostructures in one, two, and three dimensions for medical applications. Despite the tremendous advantages in RNA nanotechnology, unmodified RNA itself is fragile and prone to enzymatic degradation. In contrast to use traditionally modified RNA strands e.g. 2'-fluorine, 2'-amine, 2'-methyl, we studied the effect of RNA/DNA hybrid approach utilizing a computer-assisted RNA tetra-uracil (tetra-U) motif as a toolkit to address questions related to assembly efficiency, versatility, stability, and the production costs of hybrid RNA/DNA nanoparticles. The tetra-U RNA motif was implemented to construct four functional triangles using RNA, DNA and RNA/DNA mixtures, resulting in fine-tunable enzymatic and thermodynamic stabilities, immunostimulatory activity and RNAi capability. Moreover, the tetra-U toolkit has great potential in the fabrication of rectangular, pentagonal, and hexagonal NPs, representing the power of simplicity of RNA/DNA approach for RNA nanotechnology and nanomedicine community. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Genome-wide mRNA processing in methanogenic archaea reveals post-transcriptional regulation of ribosomal protein synthesis

    PubMed Central

    Qi, Lei; Yue, Lei; Feng, Deqin; Qi, Fengxia

    2017-01-01

    Abstract Unlike stable RNAs that require processing for maturation, prokaryotic cellular mRNAs generally follow an ‘all-or-none’ pattern. Herein, we used a 5΄ monophosphate transcript sequencing (5΄P-seq) that specifically captured the 5΄-end of processed transcripts and mapped the genome-wide RNA processing sites (PSSs) in a methanogenic archaeon. Following statistical analysis and stringent filtration, we identified 1429 PSSs, among which 23.5% and 5.4% were located in 5΄ untranslated region (uPSS) and intergenic region (iPSS), respectively. A predominant uridine downstream PSSs served as a processing signature. Remarkably, 5΄P-seq detected overrepresented uPSS and iPSS in the polycistronic operons encoding ribosomal proteins, and the majority upstream and proximal ribosome binding sites, suggesting a regulatory role of processing on translation initiation. The processed transcripts showed increased stability and translation efficiency. Particularly, processing within the tricistronic transcript of rplA-rplJ-rplL enhanced the translation of rplL, which can provide a driving force for the 1:4 stoichiometry of L10 to L12 in the ribosome. Growth-associated mRNA processing intensities were also correlated with the cellular ribosomal protein levels, thereby suggesting that mRNA processing is involved in tuning growth-dependent ribosome synthesis. In conclusion, our findings suggest that mRNA processing-mediated post-transcriptional regulation is a potential mechanism of ribosomal protein synthesis and stoichiometry. PMID:28520982

  17. Synthesis of 1-O-methylchlorogenic acid: reassignment of structure for MCGA3 isolated from bamboo (Phyllostachys edulis) leaves

    USDA-ARS?s Scientific Manuscript database

    The first synthesis of 1-O-methylchlorogenic acid is described. The short and efficient synthesis of this compound provides laboratory-scale quantities of the material to investigate its biological properties. The synthesis involved C-1 alkylation of the known (-)-4,5-cyclohexylidenequinic acid lact...

  18. Chemoselective synthesis of sialic acid 1,7-lactones.

    PubMed

    Allevi, Pietro; Rota, Paola; Scaringi, Raffaella; Colombo, Raffaele; Anastasia, Mario

    2010-08-20

    The chemoselective synthesis of the 1,7-lactones of N-acetylneuraminic acid, N-glycolylneuraminic acid, and 3-deoxy-d-glycero-d-galacto-nononic acid is accomplished in two steps: a simple treatment of the corresponding free sialic acid with benzyloxycarbonyl chloride and a successive hydrogenolysis of the formed 2-benzyloxycarbonyl 1,7-lactone. The instability of the 1,7-lactones to protic solvents has been also evidenced together with the rationalization of the mechanism of their formation under acylation conditions. The results permit to dispose of authentic 1,7-sialolactones to be used as reference standards and of a procedure useful for the preparation of their isotopologues to be used as inner standards in improved analytical procedures for the gas liquid chromatography-mass spectrometry (GLC-MS) analysis of 1,7-sialolactones in biological media.

  19. Automated synthesis of N-(2-[18 F]Fluoropropionyl)-l-glutamic acid as an amino acid tracer for tumor imaging on a modified [18 F]FDG synthesis module.

    PubMed

    Liu, Shaoyu; Sun, Aixia; Zhang, Zhanwen; Tang, Xiaolan; Nie, Dahong; Ma, Hui; Jiang, Shende; Tang, Ganghua

    2017-06-15

    N-(2-[ 18 F]Fluoropropionyl)-l-glutamic acid ([ 18 F]FPGLU) is a potential amino acid tracer for tumor imaging with positron emission tomography. However, due to the complicated multistep synthesis, the routine production of [ 18 F]FPGLU presents many challenging laboratory requirements. To simplify the synthesis process of this interesting radiopharmaceutical, an efficient automated synthesis of [ 18 F]FPGLU was performed on a modified commercial fluorodeoxyglucose synthesizer via a 2-step on-column hydrolysis procedure, including 18 F-fluorination and on-column hydrolysis reaction. [ 18 F]FPGLU was synthesized in 12 ± 2% (n = 10, uncorrected) radiochemical yield based on [ 18 F]fluoride using the tosylated precursor 2. The radiochemical purity was ≥98%, and the overall synthesis time was 35 minutes. To further optimize the radiosynthesis conditions of [ 18 F]FPGLU, a brominated precursor 3 was also used for the preparation of [ 18 F]FPGLU, and the improved radiochemical yield was up to 20 ± 3% (n = 10, uncorrected) in 35 minutes. Moreover, all these results were achieved using the similar on-column hydrolysis procedure on the modified fluorodeoxyglucose synthesis module. Copyright © 2017 John Wiley & Sons, Ltd.

  20. Synthesis of Triamino Acid Building Blocks with Different Lipophilicities

    PubMed Central

    Maity, Jyotirmoy; Honcharenko, Dmytro; Strömberg, Roger

    2015-01-01

    To obtain different amino acids with varying lipophilicity and that can carry up to three positive charges we have developed a number of new triamino acid building blocks. One set of building blocks was achieved by aminoethyl extension, via reductive amination, of the side chain of ortnithine, diaminopropanoic and diaminobutanoic acid. A second set of triamino acids with the aminoethyl extension having hydrocarbon side chains was synthesized from diaminobutanoic acid. The aldehydes needed for the extension by reductive amination were synthesized from the corresponding Fmoc-L-2-amino fatty acids in two steps. Reductive amination of these compounds with Boc-L-Dab-OH gave the C4-C8 alkyl-branched triamino acids. All triamino acids were subsequently Boc-protected at the formed secondary amine to make the monomers appropriate for the N-terminus position when performing Fmoc-based solid-phase peptide synthesis. PMID:25876040

  1. Accumulation of Polyhydroxyalkanoic Acid Containing Large Amounts of Unsaturated Monomers in Pseudomonas fluorescens BM07 Utilizing Saccharides and Its Inhibition by 2-Bromooctanoic Acid

    PubMed Central

    Lee, Ho-Joo; Choi, Mun Hwan; Kim, Tae-Un; Yoon, Sung Chul

    2001-01-01

    A psychrotrophic bacterium, Pseudomonas fluorescens BM07, which is able to accumulate polyhydroxyalkanoic acid (PHA) containing large amounts of 3-hydroxy-cis-5-dodecenoate unit up to 35 mol% in the cell from unrelated substrates such as fructose, succinate, etc., was isolated from an activated sludge in a municipal wastewater treatment plant. When it was grown on heptanoic acid (C7) to hexadecanoic acid (C16) as the sole carbon source, the monomer compositional characteristics of the synthesized PHA were similar to those observed in other fluorescent pseudomonads belonging to rRNA homology group I. However, growth on stearic acid (C18) led to no PHA accumulation, but instead free stearic acid was stored in the cell. The existence of the linkage between fatty acid de novo synthesis and PHA synthesis was confirmed by using inhibitors such as acrylic acid and two other compounds, 2-bromooctanoic acid and 4-pentenoic acid, which are known to inhibit β-oxidation enzymes in animal cells. Acrylic acid completely inhibited PHA synthesis at a concentration of 4 mM in 40 mM octanoate-grown cells, but no inhibition of PHA synthesis occurred in 70 mM fructose-grown cells in the presence of 1 to 5 mM acrylic acid. 2-Bromooctanoic acid and 4-pentenoic acid were found to much inhibit PHA synthesis much more strongly in fructose-grown cells than in octanoate-grown cells over concentrations ranging from 1 to 5 mM. However, 2-bromooctanoic acid and 4-pentenoic acid did not inhibit cell growth at all in the fructose media. Especially, with the cells grown on fructose, 2-bromooctanoic acid exhibited a steep rise in the percent PHA synthesis inhibition over a small range of concentrations below 100 μM, a finding indicative of a very specific inhibition, whereas 4-pentenoic acid showed a broad, featureless concentration dependence, suggesting a rather nonspecific inhibition. The apparent inhibition constant Ki (the concentration for 50% inhibition of PHA synthesis) for 2

  2. CRM1 and its ribosome export adaptor NMD3 localize to the nucleolus and affect rRNA synthesis.

    PubMed

    Bai, Baoyan; Moore, Henna M; Laiho, Marikki

    2013-01-01

    CRM1 is an export factor that together with its adaptor NMD3 transports numerous cargo molecules from the nucleus to cytoplasm through the nuclear pore. Previous studies have suggested that CRM1 and NMD3 are detected in the nucleolus. However, their localization with subnucleolar domains or participation in the activities of the nucleolus are unclear. We demonstrate here biochemically and using imaging analyses that CRM1 and NMD3 co-localize with nucleolar marker proteins in the nucleolus. In particular, their nucleolar localization is markedly increased by inhibition of RNA polymerase I (Pol I) transcription by actinomycin D or by silencing Pol I catalytic subunit, RPA194. We show that CRM1 nucleolar localization is dependent on its activity and the expression of NMD3, whereas NMD3 nucleolar localization is independent of CRM1. This suggests that NMD3 provides nucleolar tethering of CRM1. While inhibition of CRM1 by leptomycin B inhibited processing of 28S ribosomal (r) RNA, depletion of NMD3 did not, suggesting that their effects on 28S rRNA processing are distinct. Markedly, depletion of NMD3 and inhibition of CRM1 reduced the rate of pre-47S rRNA synthesis. However, their inactivation did not lead to nucleolar disintegration, a hallmark of Pol I transcription stress, suggesting that they do not directly regulate transcription. These results indicate that CRM1 and NMD3 have complex functions in pathways that couple rRNA synthetic and processing engines and that the rRNA synthesis rate may be adjusted according to proficiency in rRNA processing and export.

  3. Enhanced Synthesis of Alkyl Amino Acids in Miller's 1958 H2S Experiment

    NASA Technical Reports Server (NTRS)

    Parker, Eric T.; Cleaves, H. James; Callahan, Michael P.; Dworkin, James P.; Glavin, Daniel P.; Lazcano, Antonio; Bada, Jeffrey L.

    2011-01-01

    Stanley Miller's 1958 H2S-containing experiment, which included a simulated prebiotic atmosphere of methane (CH4), ammonia (NH3), carbon dioxide (CO2), and hydrogen sulfide (H2S) produced several alkyl amino acids, including the alpha-, beta-, and gamma-isomers of aminobutyric acid (ABA) in greater relative yields than had previously been reported from his spark discharge experiments. In the presence of H2S, aspariic and glutamic acids could yield alkyl amino acids via the formation of thioimide intermediates. Radical chemistry initiated by passing H2S through a spark discharge could have also enhanced alkyl amino acid synthesis by generating alkyl radicals that can help form the aldehyde and ketone precursors to these amino acids. We propose mechanisms that may have influenced the synthesis of certain amino acids in localized environments rich in H2S and lightning discharges, similar to conditions near volcanic systems on the early Earth, thus contributing to the prebiotic chemical inventory of the primordial Earth.

  4. Promoter for Sindbis virus RNA-dependent subgenomic RNA transcription.

    PubMed

    Levis, R; Schlesinger, S; Huang, H V

    1990-04-01

    Sindbis virus is a positive-strand RNA enveloped virus, a member of the Alphavirus genus of the Togaviridae family. Two species of mRNA are synthesized in cells infected with Sindbis virus; one, the 49S RNA, is the genomic RNA; the other, the 26S RNA, is a subgenomic RNA that is identical in sequence to the 3' one-third of the genomic RNA. Ou et al. (J.-H. Ou, C. M. Rice, L. Dalgarno, E. G. Strauss, and J. H. Strauss, Proc. Natl. Acad. Sci. USA 79:5235-5239, 1982) identified a highly conserved region 19 nucleotides upstream and 2 nucleotides downstream from the start of the 26S RNA and proposed that in the negative-strand template, these nucleotides compose the promoter for directing the synthesis of the subgenomic RNA. Defective interfering (DI) RNAs of Sindbis virus were used to test this proposal. A 227-nucleotide sequence encompassing 98 nucleotides upstream and 117 nucleotides downstream from the start site of the Sindbis virus subgenomic RNA was inserted into a DI genome. The DI RNA containing the insert was replicated and packaged in the presence of helper virus, and cells infected with these DI particles produced a subgenomic RNA of the size and sequence expected if the promoter was functional. The initiating nucleotide was identical to that used for Sindbis virus subgenomic mRNA synthesis. Deletion analysis showed that the minimal region required to detect transcription of a subgenomic RNA from the negative-strand template of a DI RNA was 18 or 19 nucleotides upstream and 5 nucleotides downstream from the start of the subgenomic RNA.

  5. Promoter for Sindbis virus RNA-dependent subgenomic RNA transcription.

    PubMed Central

    Levis, R; Schlesinger, S; Huang, H V

    1990-01-01

    Sindbis virus is a positive-strand RNA enveloped virus, a member of the Alphavirus genus of the Togaviridae family. Two species of mRNA are synthesized in cells infected with Sindbis virus; one, the 49S RNA, is the genomic RNA; the other, the 26S RNA, is a subgenomic RNA that is identical in sequence to the 3' one-third of the genomic RNA. Ou et al. (J.-H. Ou, C. M. Rice, L. Dalgarno, E. G. Strauss, and J. H. Strauss, Proc. Natl. Acad. Sci. USA 79:5235-5239, 1982) identified a highly conserved region 19 nucleotides upstream and 2 nucleotides downstream from the start of the 26S RNA and proposed that in the negative-strand template, these nucleotides compose the promoter for directing the synthesis of the subgenomic RNA. Defective interfering (DI) RNAs of Sindbis virus were used to test this proposal. A 227-nucleotide sequence encompassing 98 nucleotides upstream and 117 nucleotides downstream from the start site of the Sindbis virus subgenomic RNA was inserted into a DI genome. The DI RNA containing the insert was replicated and packaged in the presence of helper virus, and cells infected with these DI particles produced a subgenomic RNA of the size and sequence expected if the promoter was functional. The initiating nucleotide was identical to that used for Sindbis virus subgenomic mRNA synthesis. Deletion analysis showed that the minimal region required to detect transcription of a subgenomic RNA from the negative-strand template of a DI RNA was 18 or 19 nucleotides upstream and 5 nucleotides downstream from the start of the subgenomic RNA. Images PMID:2319651

  6. Activation of Exogenous Fatty Acids to Acyl-Acyl Carrier Protein Cannot Bypass FabI Inhibition in Neisseria*

    PubMed Central

    Yao, Jiangwei; Bruhn, David F.; Frank, Matthew W.; Lee, Richard E.; Rock, Charles O.

    2016-01-01

    Neisseria is a Gram-negative pathogen with phospholipids composed of straight chain saturated and monounsaturated fatty acids, the ability to incorporate exogenous fatty acids, and lipopolysaccharides that are not essential. The FabI inhibitor, AFN-1252, was deployed as a chemical biology tool to determine whether Neisseria can bypass the inhibition of fatty acid synthesis by incorporating exogenous fatty acids. Neisseria encodes a functional FabI that was potently inhibited by AFN-1252. AFN-1252 caused a dose-dependent inhibition of fatty acid synthesis in growing Neisseria, a delayed inhibition of growth phenotype, and minimal inhibition of DNA, RNA, and protein synthesis, showing that its mode of action is through inhibiting fatty acid synthesis. Isotopic fatty acid labeling experiments showed that Neisseria encodes the ability to incorporate exogenous fatty acids into its phospholipids by an acyl-acyl carrier protein-dependent pathway. However, AFN-1252 remained an effective antibacterial when Neisseria were supplemented with exogenous fatty acids. These results demonstrate that extracellular fatty acids are activated by an acyl-acyl carrier protein synthetase (AasN) and validate type II fatty acid synthesis (FabI) as a therapeutic target against Neisseria. PMID:26567338

  7. Preparation, characterization and catalytic properties of MCM-48 supported tungstophosphoric acid mesoporous materials for green synthesis of benzoic acid

    NASA Astrophysics Data System (ADS)

    Wu, Hai-Yan; Zhang, Xiao-Li; Chen, Xi; Chen, Ya; Zheng, Xiu-Cheng

    2014-03-01

    MCM-48 and tungstophosphoric acid (HPW) were prepared and applied for the synthesis of HPW/MCM-48 mesoporous materials. The characterization results showed that HPW/MCM-48 obtained retained the typical mesopore structure of MCM-48, and the textural parameters decreased with the increase loading of HPW. The catalytic oxidation results of benzyl alcohol and benzaldehyde with 30% H2O2 indicated that HPW/MCM-48 was an efficient catalyst for the green synthesis of benzoic acid. Furthermore, 35 wt% HPW/MCM-48 sample showed the highest activity under the reaction conditions.

  8. Ethylene-Regulated Floral Volatile Synthesis in Petunia Corollas1[w

    PubMed Central

    Underwood, Beverly A.; Tieman, Denise M.; Shibuya, Kenichi; Dexter, Richard J.; Loucas, Holly M.; Simkin, Andrew J.; Sims, Charles A.; Schmelz, Eric A.; Klee, Harry J.; Clark, David G.

    2005-01-01

    In many flowering plants, such as petunia (Petunia × hybrida), ethylene produced in floral organs after pollination elicits a series of physiological and biochemical events, ultimately leading to senescence of petals and successful fertilization. Here, we demonstrate, using transgenic ethylene insensitive (44568) and Mitchell Diploid petunias, that multiple components of emission of volatile organic compounds (VOCs) are regulated by ethylene. Expression of benzoic acid/salicylic acid carboxyl methyltransferase (PhBSMT1 and 2) mRNA is temporally and spatially down-regulated in floral organs in a manner consistent with current models for postpollination ethylene synthesis in petunia corollas. Emission of methylbenzoate and other VOCs after pollination and exogenous ethylene treatment parallels a reduction in PhBSMT1 and 2 mRNA levels. Under cyclic light conditions (day/night), PhBSMT mRNA levels are rhythmic and precede emission of methylbenzoate by approximately 6 h. When shifted into constant dark or light conditions, PhBSMT mRNA levels and subsequent methylbenzoate emission correspondingly decrease or increase to minimum or maximum levels observed during normal conditions, thus suggesting that light may be a more critical influence on cyclic emission of methylbenzoate than a circadian clock. Transgenic PhBSMT RNAi flowers with reduced PhBSMT mRNA levels show a 75% to 99% decrease in methylbenzoate emission, with minimal changes in other petunia VOCs. These results implicate PhBSMT1 and 2 as genes responsible for synthesis of methylbenzoate in petunia. PMID:15849311

  9. Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway

    PubMed Central

    Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z.; Yazdani, Syed Shams

    2016-01-01

    Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817

  10. Aldo-keto reductase family 1 B10 affects fatty acid synthesis by regulating the stability of acetyl-CoA carboxylase-alpha in breast cancer cells.

    PubMed

    Ma, Jun; Yan, Ruilan; Zu, Xuyu; Cheng, Ji-Ming; Rao, Krishna; Liao, Duan-Fang; Cao, Deliang

    2008-02-08

    Recent studies have demonstrated that aldo-keto reductase family 1 B10 (AKR1B10), a novel protein overexpressed in human hepatocellular carcinoma and non-small cell lung carcinoma, may facilitate cancer cell growth by detoxifying intracellular reactive carbonyls. This study presents a novel function of AKR1B10 in tumorigenic mammary epithelial cells (RAO-3), regulating fatty acid synthesis. In RAO-3 cells, Sephacryl-S 300 gel filtration and DEAE-Sepharose ion exchange chromatography demonstrated that AKR1B10 exists in two distinct forms, monomers (approximately 40 kDa) bound to DEAE-Sepharose column and protein complexes (approximately 300 kDa) remaining in flow-through. Co-immunoprecipitation with AKR1B10 antibody and protein mass spectrometry analysis identified that AKR1B10 associates with acetyl-CoA carboxylase-alpha (ACCA), a rate-limiting enzyme of de novo fatty acid synthesis. This association between AKR1B10 and ACCA proteins was further confirmed by co-immunoprecipitation with ACCA antibody and pulldown assays with recombinant AKR1B10 protein. Intracellular fluorescent studies showed that AKR1B10 and ACCA proteins co-localize in the cytoplasm of RAO-3 cells. More interestingly, small interfering RNA-mediated AKR1B10 knock down increased ACCA degradation through ubiquitination-proteasome pathway and resulted in >50% decrease of fatty acid synthesis in RAO-3 cells. These data suggest that AKR1B10 is a novel regulator of the biosynthesis of fatty acid, an essential component of the cell membrane, in breast cancer cells.

  11. Yaba Tumor Poxvirus Synthesis In Vitro I. Cytopathological, Histochemical, and Immunofluorescent Studies

    PubMed Central

    Yohn, David S.; Haendiges, Victoria A.; Grace, James T.

    1966-01-01

    Yohn, David S. (Roswell Park Memorial Institute, Buffalo, N.Y.), Victoria A. Haendiges, and James T. Grace, Jr. Yaba tumor poxvirus synthesis in vitro. I. Cytopathological, histochemical, and immunofluorescent studies. J. Bacteriol. 91:1977–1985. 1966.—Yaba tumor poxvirus synthesis in BSC-1 cell culture was followed sequentially with light microscopy, immunofluorescent microscopy, and various histochemical stains. The first evidence of infection was detected at 24 hr when nucleoli became hypertrophic, reflecting enhanced ribonucleic acid (RNA) synthesis. At 36 hr, deoxyribonucleic acid synthesis was detected in the cytoplasm. This was immediately followed by or associated with antigen synthesis at paranuclear sites and enhanced RNA synthesis in the cytoplasm. Cytoplasmic inclusions were readily apparent at 4 days in initially infected cells. Contiguous spread of virus was judged to have occurred around the third day of infection. The time required to complete the synthetic cycle from time of infection to production of infectious progeny was estimated to be of the order of 60 hr. This cycle is 6 to 10 times longer than for vaccinia virus. By light microscopy, cytopathic effects (CPE) were detectable in 5 days in heavily infected cultures. With 100 units or less of infectious virus, CPE was not readily detected until the 10th to 14th day. At this time, focal areas of infection classified either as microtumors or microplaques were present. Secondary foci appeared during the 4th week of incubation. Images PMID:4287080

  12. Thyroid hormone reduces PCSK9 and stimulates bile acid synthesis in humans[S

    PubMed Central

    Bonde, Ylva; Breuer, Olof; Lütjohann, Dieter; Sjöberg, Stefan; Angelin, Bo; Rudling, Mats

    2014-01-01

    Reduced plasma LDL-cholesterol is a hallmark of hyperthyroidism and is caused by transcriptional stimulation of LDL receptors in the liver. Here, we investigated whether thyroid hormone (TH) actions involve other mechanisms that may also account for the reduction in LDL-cholesterol, including effects on proprotein convertase subtilisin/kexin type 9 (PCSK9) and bile acid synthesis. Twenty hyperthyroid patients were studied before and after clinical normalization, and the responses to hyperthyroidism were compared with those in 14 healthy individuals after 14 days of treatment with the liver-selective TH analog eprotirome. Both hyperthyroidism and eprotirome treatment reduced circulating PCSK9, lipoprotein cholesterol, apoB and AI, and lipoprotein(a), while cholesterol synthesis was stable. Hyperthyroidism, but not eprotirome treatment, markedly increased bile acid synthesis and reduced fibroblast growth factor (FGF) 19 and dietary cholesterol absorption. Eprotirome treatment, but not hyperthyroidism, reduced plasma triglycerides. Neither hyperthyroidism nor eprotirome treatment altered insulin, glucose, or FGF21 levels. TH reduces circulating PSCK9, thereby likely contributing to lower plasma LDL-cholesterol in hyperthyroidism. TH also stimulates bile acid synthesis, although this response is not critical for its LDL-lowering effect. PMID:25172631

  13. Mitochondrial fatty acid synthesis, fatty acids and mitochondrial physiology.

    PubMed

    Kastaniotis, Alexander J; Autio, Kaija J; Kerätär, Juha M; Monteuuis, Geoffray; Mäkelä, Anne M; Nair, Remya R; Pietikäinen, Laura P; Shvetsova, Antonina; Chen, Zhijun; Hiltunen, J Kalervo

    2017-01-01

    Mitochondria and fatty acids are tightly connected to a multiplicity of cellular processes that go far beyond mitochondrial fatty acid metabolism. In line with this view, there is hardly any common metabolic disorder that is not associated with disturbed mitochondrial lipid handling. Among other aspects of mitochondrial lipid metabolism, apparently all eukaryotes are capable of carrying out de novo fatty acid synthesis (FAS) in this cellular compartment in an acyl carrier protein (ACP)-dependent manner. The dual localization of FAS in eukaryotic cells raises the questions why eukaryotes have maintained the FAS in mitochondria in addition to the "classic" cytoplasmic FAS and what the products are that cannot be substituted by delivery of fatty acids of extramitochondrial origin. The current evidence indicates that mitochondrial FAS is essential for cellular respiration and mitochondrial biogenesis. Although both β-oxidation and FAS utilize thioester chemistry, CoA acts as acyl-group carrier in the breakdown pathway whereas ACP assumes this role in the synthetic direction. This arrangement metabolically separates these two pathways running towards opposite directions and prevents futile cycling. A role of this pathway in mitochondrial metabolic sensing has recently been proposed. This article is part of a Special Issue entitled: Lipids of Mitochondria edited by Guenther Daum. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Fatty acid metabolism in breast cancer subtypes

    PubMed Central

    Monaco, Marie E.

    2017-01-01

    Dysregulation of fatty acid metabolism is recognized as a component of malignant transformation in many different cancers, including breast; yet the potential for targeting this pathway for prevention and/or treatment of cancer remains unrealized. Evidence indicates that proteins involved in both synthesis and oxidation of fatty acids play a pivotal role in the proliferation, migration and invasion of breast cancer cells. The following essay summarizes data implicating specific fatty acid metabolic enzymes in the genesis and progression of breast cancer, and further categorizes the relevance of specific metabolic pathways to individual intrinsic molecular subtypes of breast cancer. Based on mRNA expression data, the less aggressive luminal subtypes appear to rely on a balance between de novo fatty acid synthesis and oxidation as sources for both biomass and energy requirements, while basal-like, receptor negative subtypes overexpress genes involved in the utilization of exogenous fatty acids. With these differences in mind, treatments may need to be tailored to individual subtypes. PMID:28412757

  15. A Generalized Michaelis-Menten Equation in Protein Synthesis: Effects of Mis-Charged Cognate tRNA and Mis-Reading of Codon.

    PubMed

    Dutta, Annwesha; Chowdhury, Debashish

    2017-05-01

    The sequence of amino acid monomers in the primary structure of a protein is decided by the corresponding sequence of codons (triplets of nucleic acid monomers) on the template messenger RNA (mRNA). The polymerization of a protein, by incorporation of the successive amino acid monomers, is carried out by a molecular machine called ribosome. We develop a stochastic kinetic model that captures the possibilities of mis-reading of mRNA codon and prior mis-charging of a tRNA. By a combination of analytical and numerical methods, we obtain the distribution of the times taken for incorporation of the successive amino acids in the growing protein in this mathematical model. The corresponding exact analytical expression for the average rate of elongation of a nascent protein is a 'biologically motivated' generalization of the Michaelis-Menten formula for the average rate of enzymatic reactions. This generalized Michaelis-Menten-like formula (and the exact analytical expressions for a few other quantities) that we report here display the interplay of four different branched pathways corresponding to selection of four different types of tRNA.

  16. Detergents with different chemical properties induce variable degree of cytotoxicity and mRNA expression of lipid-metabolizing enzymes and differentiation markers in cultured keratinocytes.

    PubMed

    Wei, Tianling; Geijer, Sophia; Lindberg, Magnus; Berne, Berit; Törmä, Hans

    2006-12-01

    The knowledge how detergents with different chemical properties influence epidermal keratinocytes is sparse. In the present study, the effects of five detergents were examined with respect to cell-toxicity and mRNA expression of key-enzymes in barrier lipid production and keratinocyte differentiation markers. First, the LD(50) for each detergent were determined. Secondly, keratinocytes were exposed to sub-toxic concentrations and the mRNA expression was analysed by real-time PCR after 24 h exposure to the detergents. SLS and CAPB induced a concentration-dependent increase in the expression of enzymes producing cholesterol and ceramides, while transcripts of enzymes producing fatty acids were unaffected. SLES and cocoglucoside increased the expression of certain enzymes involved in cholesterol and fatty acid synthesis while sodium cocoamphoacetate (SCAA) stimulated expression of transcripts involved in fatty acid synthesis. The expression of differentiation markers were increased by SLS, SLES and CAPB, while SCAA and cocoglucoside exhibited no effect. The present findings show that detergents have variable effects on lipid synthesis and keratinocyte differentiation, which could partly explain their barrier destruction potential in vivo.

  17. Hydrolytic Glycosidic Bond Cleavage in RNA Nucleosides: Effects of the 2'-Hydroxy Group and Acid-Base Catalysis.

    PubMed

    Lenz, Stefan A P; Kohout, Johnathan D; Wetmore, Stacey D

    2016-12-22

    Despite the inherent stability of glycosidic linkages in nucleic acids that connect the nucleobases to sugar-phosphate backbones, cleavage of these bonds is often essential for organism survival. The current study uses DFT (B3LYP) to provide a fundamental understanding of the hydrolytic deglycosylation of the natural RNA nucleosides (A, C, G, and U), offers a comparison to DNA hydrolysis, and examines the effects of acid, base, or simultaneous acid-base catalysis on RNA deglycosylation. By initially examining HCOO - ···H 2 O mediated deglycosylation, the barriers for RNA hydrolysis were determined to be 30-38 kJ mol -1 higher than the corresponding DNA barriers, indicating that the 2'-OH group stabilizes the glycosidic bond. Although the presence of HCOO - as the base (i.e., to activate the water nucleophile) reduces the barrier for uncatalyzed RNA hydrolysis (i.e., unactivated H 2 O nucleophile) by ∼15-20 kJ mol -1 , the extreme of base catalysis as modeled using a fully deprotonated water molecule (i.e., OH - nucleophile) decreases the uncatalyzed barriers by up to 65 kJ mol -1 . Acid catalysis was subsequently examined by selectively protonating the hydrogen-bond acceptor sites of the RNA nucleobases, which results in an up to ∼80 kJ mol -1 barrier reduction relative to the corresponding uncatalyzed pathway. Interestingly, the nucleobase proton acceptor sites that result in the greatest barrier reductions match sites typically targeted in enzyme-catalyzed reactions. Nevertheless, simultaneous acid and base catalysis is the most beneficial way to enhance the reactivity of the glycosidic bonds in RNA, with the individual effects of each catalytic approach being weakened, additive, or synergistic depending on the strength of the base (i.e., degree of water nucleophile activation), the nucleobase, and the hydrogen-bonding acceptor site on the nucleobase. Together, the current contribution provides a greater understanding of the reactivity of the glycosidic

  18. Investigation of the Prebiotic Synthesis of Amino Acids and RNA Bases from CO2 Using FeS/H2S As a Reducing Agent

    NASA Technical Reports Server (NTRS)

    Keefe, Anthony D.; Miller, Stanley L.; McDonald, Gene; Bada, Jeffrey

    1995-01-01

    An autotrophic theory of the origin of metabolism and life has been proposed in which carbon dioxide is reduced by ferrous sulfide and hydrogen sulfide by means of a reversed citric acid cycle, leading to the production of amino acids. Similar processes have been proposed for purine synthesis. Ferrous sulfide is a strong reducing agent in the presence of hydrogen sulfide and can produce hydrogen as well as reduce alkenes, alkynes, and thiols to saturated hydrocarbons and reduce ketones to thiols. However, the reduction of carbon dioxide has not been demonstrated. We show here that no amino acids, purities, or pyrimidines are produced from carbon dioxide with the ferrous sulfide and hydrogen sulfide system. Furthermore, this system does not produce amino acids from carboxylic acids by reductive amination and carboxylation. Thus, the proposed autotrophic theory, using carbon dioxide, ferrous sulfide, and hydrogen sulfide, lacks the robustness needed to be a geological process and is, therefore, unlikely to have played a role In the origin of metabolism or the origin of life.

  19. Investigation of the Prebiotic Synthesis of Amino Acids and RNA Bases from CO2 using FeS/H2S as a Reducing Agent

    NASA Technical Reports Server (NTRS)

    Keefe, Anthony D.; Miller, Stanley L.; McDonald, Gene; Bada, Jeffrey

    1995-01-01

    An autotrophic theory of the origin of metabolism and life has been proposed in which carbon dioxide is reduced by ferrous sulfide and hydrogen sulfide by means of a reversed citric acid cycle, leading to the production of amino acids. Similar processes have been proposed for purine synthesis. Ferrous sulfide is a strong reducing agent in the presence of hydrogen sulfide and can produce hydrogen as well as reduce alkenes, alkynes, and thiols to saturated hydrocarbons and reduce ketones to thiols. However, the reduction of carbon dioxide has not been demonstrated. We show here that no amino acids, purines, or pyrimidines are produced from carbon dioxide with the ferrous sulfide and hydrogen sulfide system. Furthermore, this system does not produce amino acids from carboxylic acids by reductive amination and carboxylation. Thus, the proposed autotrophic theory, using carbon dioxide, ferrous sulfide, and hydrogen sulfide, lacks the robustness needed to be a geological process and is, therefore, unlikely to have played a role in the origin of metabolism or the origin of life.

  20. Suppression of glycosaminoglycan synthesis by articular cartilage, but not of hyaluronic acid synthesis by synovium, after exposure to radiation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hugenberg, S.T.; Myers, S.L.; Brandt, K.D.

    1989-04-01

    We recently found that injection of 2 mCi of yttrium 90 (90Y; approximately 23,000 rads) into normal canine knees stimulated glycosaminoglycan (GAG) synthesis by femoral condylar cartilage. The present investigation was conducted to determine whether radiation affects cartilage metabolism directly. Rates of GAG synthesis and degradation in normal canine articular cartilage were studied following irradiation. Cultured synovium from the same knees was treated similarly, to determine the effects of irradiation on hyaluronic acid synthesis. Twenty-four hours after exposure to 1,000 rads, 10,000 rads, or 50,000 rads, 35S-GAG synthesis by the cartilage was 93%, 69%, and 37%, respectively, of that inmore » control, nonirradiated cartilage. The effect was not rapidly reversible: 120 hours after exposure to 50,000 rads, GAG synthesis remained at only 28% of the control level. Autoradiography showed marked suppression of 35S uptake by chondrocytes after irradiation. Cartilage GAG degradation was also increased following irradiation: 4 hours and 8 hours after exposure to 50,000 rads, the cartilage GAG concentration was only 66% and 54%, respectively, of that at time 0, while corresponding values for control, nonirradiated cartilage were 90% and 87%. In contrast to its effects on cartilage GAG metabolism, radiation at these levels had no effect on synovial hyaluronic acid synthesis.« less

  1. Synthesis of Rosin Acid Starch Catalyzed by Lipase

    PubMed Central

    Lin, Rihui; Li, He; Long, Han; Su, Jiating; Huang, Wenqin

    2014-01-01

    Rosin, an abundant raw material from pine trees, was used as a starting material directly for the synthesis of rosin acid starch. The esterification reaction was catalyzed by lipase (Novozym 435) under mild conditions. Based on single factor experimentation, the optimal esterification conditions were obtained as follows: rosin acid/anhydrous glucose unit in the molar ratio 2 : 1, reaction time 4 h at 45°C, and 15% of lipase dosage. The degree of substitution (DS) reaches 0.098. Product from esterification of cassava starch with rosin acid was confirmed by FTIR spectroscopy and iodine coloration analysis. Scanning electron microscopy and X-ray diffraction analysis showed that the morphology and crystallinity of the cassava starch were largely destroyed. Thermogravimetric analysis indicated that thermal stability of rosin acid starch decreased compared with native starch. PMID:24977156

  2. Cdk7 mediates RPB1-driven mRNA synthesis in Toxoplasma gondii

    PubMed Central

    Deshmukh, Abhijit S.; Mitra, Pallabi; Maruthi, Mulaka

    2016-01-01

    Cyclin-dependent kinase 7 in conjunction with CyclinH and Mat1 activates cell cycle CDKs and is a part of the general transcription factor TFIIH. Role of Cdk7 is well characterized in model eukaryotes however its relevance in protozoan parasites has not been investigated. This important regulator of key processes warrants closer examination particularly in this parasite given its unique cell cycle progression and flexible mode of replication. We report functional characterization of TgCdk7 and its partners TgCyclinH and TgMat1. Recombinant Cdk7 displays kinase activity upon binding its cyclin partner and this activity is further enhanced in presence of Mat1. The activated kinase phosphorylates C-terminal domain of TgRPB1 suggesting its role in parasite transcription. Therefore, the function of Cdk7 in CTD phosphorylation and RPB1 mediated transcription was investigated using Cdk7 inhibitor. Unphosphorylated CTD binds promoter DNA while phosphorylation by Cdk7 triggers its dissociation from DNA with implications for transcription initiation. Inhibition of Cdk7 in the parasite led to strong reduction in Serine 5 phosphorylation of TgRPB1-CTD at the promoters of constitutively expressed actin1 and sag1 genes with concomitant reduction of both nascent RNA synthesis and 5′-capped transcripts. Therefore, we provide compelling evidence for crucial role of TgCdk7 kinase activity in mRNA synthesis. PMID:27759017

  3. Inhibition of protein synthesis and malaria parasite development by drug targeting of methionyl-tRNA synthetases.

    PubMed

    Hussain, Tahir; Yogavel, Manickam; Sharma, Amit

    2015-04-01

    Aminoacyl-tRNA synthetases (aaRSs) are housekeeping enzymes that couple cognate tRNAs with amino acids to transmit genomic information for protein translation. The Plasmodium falciparum nuclear genome encodes two P. falciparum methionyl-tRNA synthetases (PfMRS), termed PfMRS(cyt) and PfMRS(api). Phylogenetic analyses revealed that the two proteins are of primitive origin and are related to heterokonts (PfMRS(cyt)) or proteobacteria/primitive bacteria (PfMRS(api)). We show that PfMRS(cyt) localizes in parasite cytoplasm, while PfMRS(api) localizes to apicoplasts in asexual stages of malaria parasites. Two known bacterial MRS inhibitors, REP3123 and REP8839, hampered Plasmodium growth very effectively in the early and late stages of parasite development. Small-molecule drug-like libraries were screened against modeled PfMRS structures, and several "hit" compounds showed significant effects on parasite growth. We then tested the effects of the hit compounds on protein translation by labeling nascent proteins with (35)S-labeled cysteine and methionine. Three of the tested compounds reduced protein synthesis and also blocked parasite growth progression from the ring stage to the trophozoite stage. Drug docking studies suggested distinct modes of binding for the three compounds, compared with the enzyme product methionyl adenylate. Therefore, this study provides new targets (PfMRSs) and hit compounds that can be explored for development as antimalarial drugs. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  4. Fluorescent carbon dots as an efficient siRNA nanocarrier for its interference therapy in gastric cancer cells.

    PubMed

    Wang, Qing; Zhang, Chunlei; Shen, Guangxia; Liu, Huiyang; Fu, Hualin; Cui, Daxiang

    2014-12-30

    Fluorescent carbon dots (Cdots) have attracted increasing attention due to their potential applications in sensing, catalysis, and biomedicine. Currently, intensive research has been concentrated on the synthesis and imaging-guided therapy of these benign photoluminescent materials. Meanwhile, Cdots have been explored as nonviral vector for nucleic acid or drug delivery by chemical modification on purpose. We have developed a microwave assisted one-step synthesis of Cdots with citric acid as carbon source and tryptophan (Trp) as both nitrogen source and passivation agent. The Cdots with uniform size show superior water solubility, excellent biocompatibility, and high quantum yield. Afterwards, the PEI (polyethylenimine)-adsorbed Cdots nanoparticles (Cdots@PEI) were applied to deliver Survivin siRNA into human gastric cancer cell line MGC-803. The results have confirmed the nanocarrier exhibited excellent biocompatibility and a significant increase in cellular delivery of siRNA, inducing efficient knockdown for Survivin protein to 6.1%. In addition, PEI@Cdots complexes mediated Survivin silencing, the arrested cell cycle progression in G1 phase as well as cell apoptosis was observed. The Cdots-based and PEI-adsorbed complexes both as imaging agents and siRNA nanocarriers have been developed for Survivin siRNA delivery. And the results indicate that Cdots-based nanocarriers could be utilized in a broad range of siRNA delivery systems for cancer therapy.

  5. Boric acid reversibly inhibits the second step of pre-mRNA splicing.

    PubMed

    Shomron, Noam; Ast, Gil

    2003-09-25

    Several approaches have been used to identify the factors involved in mRNA splicing. None of them, however, comprises a straightforward reversible method for inhibiting the second step of splicing using an external reagent other than a chelator. This investigation demonstrates that the addition of boric acid to an in vitro pre-mRNA splicing reaction causes a dose-dependent reversible inhibition effect on the second step of splicing. The mechanism of action does not involve chelation of several metal ions; hindrance of 3' splice-site; or binding to hSlu7. This study presents a novel method for specific reversible inhibition of the second step of pre-mRNA splicing.

  6. Synthesis and properties of fatty acid starch esters.

    PubMed

    Winkler, Henning; Vorwerg, Waltraud; Wetzel, Hendrik

    2013-10-15

    Being completely bio-based, fatty acid starch esters (FASEs) are attractive materials that represent an alternative to crude oil-based plastics. In this study, two synthesis methods were compared in terms of their efficiency, toxicity and, especially, product solubility with starch laurate (C12) as model compound. Laurates (DS>2) were obtained through transesterification of fatty acid vinylesters in DMSO or reaction with fatty acid chlorides in pyridine. The latter lead to higher DS-values in a shorter reaction time. But due to the much better solubility of the products compared to lauroyl chloride esterified ones, vinylester-transesterification was preferred to optimize reaction parameters, where reaction time could be shortened to 2h. FASEs C6-C18 were also successfully prepared via transesterification. To determine the DS of the resulting starch laurates, the efficient ATR-IR method was compared with common methods (elementary analysis, (1)H NMR). Molar masses (Mw) of the highly soluble starch laurates were analyzed using SEC-MALLS (THF). High recovery rates (>80%) attest to the outstanding solubility of products obtained through transesterification, caused by a slight disintegration during synthesis. Particle size distributions (DLS) demonstrated stable dissolutions in CHCl3 of vinyl laurate esterified - contrary to lauroyl chloride esterified starch. For all highly soluble FASEs (C6-C18), formation of concentrated solutions (10 wt%) is feasible. Copyright © 2013 Elsevier Ltd. All rights reserved.

  7. Information transfer from peptide nucleic acids to RNA by template-directed syntheses

    NASA Technical Reports Server (NTRS)

    Schmidt, J. G.; Nielsen, P. E.; Orgel, L. E.; Bada, J. L. (Principal Investigator)

    1997-01-01

    Peptide nucleic acids (PNAs) are uncharged analogs of DNA and RNA in which the ribose-phosphate backbone is substituted by a backbone held together by amide bonds. PNAs are interesting as models of alternative genetic systems because they form potentially informational base paired helical structures. A PNA C10 oligomer has been shown to act as template for efficient formation of oligoguanylates from activated guanosine ribonucleotides. In a previous paper we used heterosequences of DNA as templates in sequence-dependent polymerization of PNA dimers. In this paper we show that information can be transferred from PNA to RNA. We describe the reactions of activated mononucleotides on heterosequences of PNA. Adenylic, cytidylic and guanylic acids were incorporated into the products opposite their complement on PNA, although less efficiently than on DNA templates.

  8. Treatment with bindarit, an inhibitor of MCP-1 synthesis, protects mice against trinitrobenzene sulfonic acid-induced colitis.

    PubMed

    Bhatia, M; Landolfi, C; Basta, F; Bovi, G; Ramnath, R Devi; de Joannon, A Capezzone; Guglielmotti, A

    2008-10-01

    Chemokines play a fundamental role in trafficking and activation of leukocytes in colonic inflammation. We investigated the ability of bindarit, an inhibitor of monocyte chemoattractant protein-1 (MCP-1/CCL2) synthesis, to inhibit chemokine production by human intestinal epithelial cells (HT-29) and its effect in trinitro-benzene sulfonic acid (TNBS)-induced colitis in mice. HT-29 cells were incubated with bindarit in the presence of TNF-alpha/IFN-gamma and 24 h later supernatants were collected for MCP-1, IL-8 and RANTES measurement. A 1 mg enema of TNBS was given to BALB/c mice, and bindarit (100 mg/kg) was orally administered twice daily starting from two days before colitis induction. Weight loss, histology, and MCP-1 level and myeloperoxidase (MPO) activity in colon extracts were assessed. In HT-29 cells, bindarit concentration-dependently and selectively inhibited MCP-1 secretion (as well as mRNA expression) primed by TNF-alpha/IFN-gamma. Moreover treatment with bindarit reduced clinical and histopathological severity of TNBS-induced colitis. These effects were associated with significant inhibition of MCP-1 and MPO in colon extracts. Bindarit exhibits a potent bioactivity in reducing leukocyte infiltration, down-regulating MCP-1 synthesis, and preventing the development of severe colitis in a mice model of TNBS-induced colitis. These observations suggest a potential use of MCP-1 synthesis blockers in intestinal inflammation in humans.

  9. RNA and ribosomal protein patterns during aerial spore germination in Streptomyces granaticolor.

    PubMed

    Mikulík, K; Janda, I; Weiser, J; Stastná, J; Jiránová, A

    1984-12-03

    Disruption of the external sheath of Streptomyces granaticolor aerial spores and subsequent cultivation in a rich medium result in a synchronous germination. This method was used to analyze RNA and protein patterns during the germination. The germination process took place through a sequence of time-ordered events. RNA and protein synthesis started during the first 5 min and net DNA synthesis at 60-70 min of germination. Within the first 10 min of germination, synthesis of RNA was not sensitive to the inhibitory effect of rifamycin. During this period rRNA and other species including 4-5-S RNA were synthesized. Dormant spores contained populations of ribosomes or ribosomal precursors that were structurally and functionally defective. The ribosomal particles bound a sporulation pigment(s) of the melanine type. The ribosomal proteins complexed to the pigments formed insoluble aggregates which were easily removed from the ribosomes by one wash with 1 M NH4Cl. During the first 10 min of germination, pigment(s) were liberated from the complexes with the ribosomes and protein extracts of the washed ribosomes had essentially the same pattern as the extracts of ribosomes of vegetative cells. These structural alterations were accompanied by enhancement of the ribosome activities in polypeptide synthesis in vivo and in vitro. When the spores were incubated with a 14C-labelled amino acid mixture in the presence of rifamycin, only three proteins (GS1, GL1 and GS9) were identified to be radiolabelled in the extracts from the washed ribosomes. These experiments indicate that liberation of the sporulation pigment(s) from the complexes with ribosomal proteins and assembly of de novo synthesized proteins and proteins from a preexisting pool in the spore are involved in the reactivation of the ribosomes of dormant spores of S. granaticolor.

  10. Comparison of commercial systems for extraction of nucleic acids from DNA/RNA respiratory pathogens.

    PubMed

    Yang, Genyan; Erdman, Dean E; Kodani, Maja; Kools, John; Bowen, Michael D; Fields, Barry S

    2011-01-01

    This study compared six automated nucleic acid extraction systems and one manual kit for their ability to recover nucleic acids from human nasal wash specimens spiked with five respiratory pathogens, representing Gram-positive bacteria (Streptococcus pyogenes), Gram-negative bacteria (Legionella pneumophila), DNA viruses (adenovirus), segmented RNA viruses (human influenza virus A), and non-segmented RNA viruses (respiratory syncytial virus). The robots and kit evaluated represent major commercially available methods that are capable of simultaneous extraction of DNA and RNA from respiratory specimens, and included platforms based on magnetic-bead technology (KingFisher mL, Biorobot EZ1, easyMAG, KingFisher Flex, and MagNA Pure Compact) or glass fiber filter technology (Biorobot MDX and the manual kit Allprep). All methods yielded extracts free of cross-contamination and RT-PCR inhibition. All automated systems recovered L. pneumophila and adenovirus DNA equivalently. However, the MagNA Pure protocol demonstrated more than 4-fold higher DNA recovery from the S. pyogenes than other methods. The KingFisher mL and easyMAG protocols provided 1- to 3-log wider linearity and extracted 3- to 4-fold more RNA from the human influenza virus and respiratory syncytial virus. These findings suggest that systems differed in nucleic acid recovery, reproducibility, and linearity in a pathogen specific manner. Published by Elsevier B.V.

  11. Glutamate dehydrogenase (RocG) in Bacillus licheniformis WX-02: Enzymatic properties and specific functions in glutamic acid synthesis for poly-γ-glutamic acid production.

    PubMed

    Tian, Guangming; Wang, Qin; Wei, Xuetuan; Ma, Xin; Chen, Shouwen

    2017-04-01

    Poly-γ-glutamic acid (γ-PGA), a natural biopolymer, is widely used in cosmetics, medicine, food, water treatment, and agriculture owing to its features of moisture sequestration, cation chelation, non-toxicity and biodegradability. Intracellular glutamic acid, the substrate of γ-PGA, is a limiting factor for high yield in γ-PGA production. Bacillus subtilis and Bacillus licheniformis are both important γ-PGA producing strains, and B. subtilis synthesizes glutamic acid in vivo using the unique GOGAT/GS pathway. However, little is known about the glutamate synthesis pathway in B. licheniformis. The aim of this work was to characterize the glutamate dehydrogenase (RocG) in glutamic acid synthesis from B. licheniformis with both in vivo and in vitro experiments. By re-directing the carbon flux distribution, the rocG gene deletion mutant WX-02ΔrocG produced intracellular glutamic acid with a concentration of 90ng/log(CFU), which was only 23.7% that of the wild-type WX-02 (380ng/log(CFU)). Furthermore, the γ-PGA yield of mutant WX-02ΔrocG was 5.37g/L, a decrease of 45.3% compared to the wild type (9.82g/L). In vitro enzymatic assays of RocG showed that RocG has higher affinity for 2-oxoglutarate than glutamate, and the glutamate synthesis rate was far above degradation. This is probably the first study to reveal the glutamic acid synthesis pathway and the specific functions of RocG in B. licheniformis. The results indicate that γ-PGA production can be enhanced through improving intracellular glutamic acid synthesis. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Interconnections between mRNA degradation and RDR-dependent siRNA production in mRNA turnover in plants.

    PubMed

    Tsuzuki, Masayuki; Motomura, Kazuki; Kumakura, Naoyoshi; Takeda, Atsushi

    2017-03-01

    Accumulation of an mRNA species is determined by the balance between the synthesis and the degradation of the mRNA. Individual mRNA molecules are selectively and actively degraded through RNA degradation pathways, which include 5'-3' mRNA degradation pathway, 3'-5' mRNA degradation pathway, and RNA-dependent RNA polymerase-mediated mRNA degradation pathway. Recent studies have revealed that these RNA degradation pathways compete with each other in mRNA turnover in plants and that plants have a hidden layer of non-coding small-interfering RNA production from a set of mRNAs. In this review, we summarize the current information about plant mRNA degradation pathways in mRNA turnover and discuss the potential roles of a novel class of the endogenous siRNAs derived from plant mRNAs.

  13. The tRNA methyltransferase Dnmt2 is required for accurate polypeptide synthesis during haematopoiesis.

    PubMed

    Tuorto, Francesca; Herbst, Friederike; Alerasool, Nader; Bender, Sebastian; Popp, Oliver; Federico, Giuseppina; Reitter, Sonja; Liebers, Reinhard; Stoecklin, Georg; Gröne, Hermann-Josef; Dittmar, Gunnar; Glimm, Hanno; Lyko, Frank

    2015-09-14

    The Dnmt2 enzyme utilizes the catalytic mechanism of eukaryotic DNA methyltransferases to methylate several tRNAs at cytosine 38. Dnmt2 mutant mice, flies, and plants were reported to be viable and fertile, and the biological function of Dnmt2 has remained elusive. Here, we show that endochondral ossification is delayed in newborn Dnmt2-deficient mice, which is accompanied by a reduction of the haematopoietic stem and progenitor cell population and a cell-autonomous defect in their differentiation. RNA bisulfite sequencing revealed that Dnmt2 methylates C38 of tRNA Asp(GTC), Gly(GCC), and Val(AAC), thus preventing tRNA fragmentation. Proteomic analyses from primary bone marrow cells uncovered systematic differences in protein expression that are due to specific codon mistranslation by tRNAs lacking Dnmt2-dependent methylation. Our observations demonstrate that Dnmt2 plays an important role in haematopoiesis and define a novel function of C38 tRNA methylation in the discrimination of near-cognate codons, thereby ensuring accurate polypeptide synthesis. © 2015 The Authors. Published under the terms of the CC BY NC ND 4.0 license.

  14. The antiviral protein Viperin suppresses T7 promoter dependent RNA synthesis-possible implications for its antiviral activity.

    PubMed

    Dukhovny, Anna; Shlomai, Amir; Sklan, Ella H

    2018-05-25

    Viperin is a multifunctional interferon-inducible broad-spectrum antiviral protein. Viperin belongs to the S-Adenosylmethionine (SAM) superfamily of enzymes known to catalyze a wide variety of radical-mediated reactions. However, the exact mechanism by which viperin exerts its functions is still unclear. Interestingly, for many RNA viruses viperin was shown to inhibit viral RNA accumulation by interacting with different viral non-structural proteins. Here, we show that viperin inhibits RNA synthesis by bacteriophage T7 polymerase in mammalian cells. This inhibition is specific and occurs at the RNA level. Viperin expression significantly reduced T7-mediated cytoplasmic RNA levels. The data showing that viperin inhibits the bacteriophage T7 polymerase supports the conservation of viperin's antiviral activity between species. These results highlight the possibility that viperin might utilize a broader mechanism of inhibition. Accordingly, our results suggest a novel mechanism involving polymerase inhibition and provides a tractable system for future mechanistic studies of viperin.

  15. Roles of tRNA in cell wall biosynthesis

    PubMed Central

    Dare, Kiley; Ibba, Michael

    2013-01-01

    Recent research into various aspects of bacterial metabolism such as cell wall and antibiotic synthesis, degradation pathways, cellular stress, and amino acid biosynthesis has elucidated roles of aminoacyl-transfer ribonucleic acid (aa-tRNA) outside of translation. Although the two enzyme families responsible for cell wall modifications, aminoacyl-phosphatidylglycerol synthases (aaPGSs) and Fem, were discovered some time ago, they have recently become of intense interest for their roles in the antimicrobial resistance of pathogenic microorganisms. The addition of positively charged amino acids to phosphatidylglycerol (PG) by aaPGSs neutralizes the lipid bilayer making the bacteria less susceptible to positively charged antimicrobial agents. Fem transferases utilize aa-tRNA to form peptide bridges that link strands of peptidoglycan. These bridges vary among the bacterial species in which they are present and play a role in resistance to antibiotics that target the cell wall. Additionally, the formation of truncated peptides results in shorter peptide bridges and loss of branched linkages which makes bacteria more susceptible to antimicrobials. A greater understanding of the structure and substrate specificity of this diverse enzymatic family is necessary to aid current efforts in designing potential bactericidal agents. These two enzyme families are linked only by the substrate with which they modify the cell wall, aa-tRNA; their structure, cell wall modification processes and the physiological changes they impart on the bacterium differ greatly. PMID:22262511

  16. Emergence of a replicating species from an in vitro RNA evolution reaction

    NASA Technical Reports Server (NTRS)

    Breaker, R. R.; Joyce, G. F.

    1994-01-01

    The technique of self-sustained sequence replication allows isothermal amplification of DNA and RNA molecules in vitro. This method relies on the activities of a reverse transcriptase and a DNA-dependent RNA polymerase to amplify specific nucleic acid sequences. We have modified this protocol to allow selective amplification of RNAs that catalyze a particular chemical reaction. During an in vitro RNA evolution experiment employing this modified system, a unique class of "selfish" RNAs emerged and replicated to the exclusion of the intended RNAs. Members of this class of selfish molecules, termed RNA Z, amplify efficiently despite their inability to catalyze the target chemical reaction. Their amplification requires the action of both reverse transcriptase and RNA polymerase and involves the synthesis of both DNA and RNA replication intermediates. The proposed amplification mechanism for RNA Z involves the formation of a DNA hairpin that functions as a template for transcription by RNA polymerase. This arrangement links the two strands of the DNA, resulting in the production of RNA transcripts that contain an embedded RNA polymerase promoter sequence.

  17. One-pot synthesis of bioactive cyclopentenones from α-linolenic acid and docosahexaenoic acid.

    PubMed

    Maynard, Daniel; Müller, Sara Mareike; Hahmeier, Monika; Löwe, Jana; Feussner, Ivo; Gröger, Harald; Viehhauser, Andrea; Dietz, Karl-Josef

    2018-04-01

    Oxidation products of the poly-unsaturated fatty acids (PUFAs) arachidonic acid, α-linolenic acid and docosahexaenoic acid are bioactive in plants and animals as shown for the cyclopentenones prostaglandin 15d-PGJ 2 and PGA 2 , cis-(+)-12-oxophytodienoic acid (12-OPDA), and 14-A-4 neuroprostane. In this study an inexpensive and simple enzymatic multi-step one-pot synthesis is presented for 12-OPDA, which is derived from α-linolenic acid, and the analogous docosahexaenoic acid (DHA)-derived cyclopentenone [(4Z,7Z,10Z)-12-[[-(1S,5S)-4-oxo-5-(2Z)-pent-2-en-1yl]-cyclopent-2-en-1yl] dodeca-4,7,10-trienoic acid, OCPD]. The three enzymes utilized in this multi-step cascade were crude soybean lipoxygenase or a recombinant lipoxygenase, allene oxide synthase and allene oxide cyclase from Arabidopsis thaliana. The DHA-derived 12-OPDA analog OCPD is predicted to have medicinal potential and signaling properties in planta. With OCPD in hand, it is shown that this compound interacts with chloroplast cyclophilin 20-3 and can be metabolized by 12-oxophytodienoic acid reductase (OPR3) which is an enzyme relevant for substrate bioactivity modulation in planta. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Long-term leucine induced stimulation of muscle protein synthesis is amino acid dependent

    USDA-ARS?s Scientific Manuscript database

    Infusing leucine for 1 h increases skeletal muscle protein synthesis in the neonate, but this is not sustained for 2 h unless the corresponding fall in amino acids is prevented. This study aimed to determine whether a continuous leucine infusion can stimulate protein synthesis for a prolonged period...

  19. SYNTHESIS OF MIXED FULL AND SEMIESTERS OF PHOSPHOROUS ACID AS ORGANIC MOTOR OIL ADDITIVES,

    DTIC Science & Technology

    The synthesis of mixed full and semiesters of phosphonic acid was effected using alkylphenols produced by the chemical industry. By condensation of...industrial alkylphenol or the condensation of acid chloride of di-(alkylphenyl)-phosphorous acid with diethylamine, the corresponding mixed full and semiesters

  20. Synthesis of fatty acids from [1-14C]acetylcoenzyme A in subcellular particles of rat epididymal adipose tissue

    PubMed Central

    Kanoh, H.; Lindsay, D. B.

    1972-01-01

    1. Mitochondrial and microsomal fractions of rat epididymal adipose tissue incorporated [1-14C]acetyl-CoA equally well into various fatty acids by a chain-elongation mechanism. C18 and C20 fatty acids were the two major products, and comprised about 80% of the total fatty acids synthesized in both particles. 2. When incubated in air, mitochondria synthesized stearic acid, octadecenoic acid and eicosamonoenoic acid in almost equal amounts (about 20% each), whereas in microsomal fractions, the synthesis of octadecenoic acid was more than fivefold the stearic acid formation. In both fractions, major components of synthesized monoenoic fatty acids were the Δ11:12 isomers. Hexadecenoic acid and octadecenoic acid from whole adipose tissue contained approx. 11 and 14% of the Δ11:12 isomer respectively. 3. When mitochondria or microsomal fractions were incubated in nitrogen, there was increased synthesis of stearic acid and palmitic acid and less of C16 and C18 monoenoic acids; synthesis of C20 acids remained predominantly of the monoenoic acids. Determination of the position of the double bond in the monoenoic acids supported the view that the synthesis of hexadecenoic acid and octadecenoic acid involves a desaturase activity, whereas eicosamonoenoic acid and eicosadienoic acid are formed only by elongation of endogenous fatty acids. 4. Most of the radioactivity was found in free fatty acids (63%) and the phospholipid (26%) fraction. In phospholipids, phosphatidylcholine and phosphatidylethanolamine were the two major components. 5. Most of the fatty acids synthesized, including those not normally found in particle lipids (arachidic acid, eicosamonoenoic acid and eicosadienoic acid) were distributed fairly evenly in the phospholipid and free fatty acid fractions. However, stearic acid was found predominantly in the phospholipid fraction. PMID:4638795

  1. Advances in the synthesis of α-quaternary α-ethynyl α-amino acids.

    PubMed

    Boibessot, Thibaut; Bénimélis, David; Meffre, Patrick; Benfodda, Zohra

    2016-09-01

    α-Quaternary α-ethynyl α-amino acids are an important class of non-proteinogenic amino acids that play an important role in the development of peptides and peptidomimetics as therapeutic agents and in the inhibition of enzyme activities. This review provides an overview of the literature concerning synthesis and applications of α-quaternary α-ethynyl α-amino acids covering the period from 1977 to 2015.

  2. Ribosomal synthesis and folding of peptide-helical aromatic foldamer hybrids

    NASA Astrophysics Data System (ADS)

    Rogers, Joseph M.; Kwon, Sunbum; Dawson, Simon J.; Mandal, Pradeep K.; Suga, Hiroaki; Huc, Ivan

    2018-03-01

    Translation, the mRNA-templated synthesis of peptides by the ribosome, can be manipulated to incorporate variants of the 20 cognate amino acids. Such approaches for expanding the range of chemical entities that can be produced by the ribosome may accelerate the discovery of molecules that can perform functions for which poorly folded, short peptidic sequences are ill suited. Here, we show that the ribosome tolerates some artificial helical aromatic oligomers, so-called foldamers. Using a flexible tRNA-acylation ribozyme—flexizyme—foldamers were attached to tRNA, and the resulting acylated tRNAs were delivered to the ribosome to initiate the synthesis of non-cyclic and cyclic foldamer-peptide hybrid molecules. Passing through the ribosome exit tunnel requires the foldamers to unfold. Yet foldamers encode sufficient folding information to influence the peptide structure once translation is completed. We also show that in cyclic hybrids, the foldamer portion can fold into a helix and force the peptide segment to adopt a constrained and stretched conformation.

  3. Early effects of oestradiol-17β on the chromatin and activity of the deoxyribonucleic acid-dependent ribonucleic acid polymerases (I and II) of the rat uterus

    PubMed Central

    Glasser, S. R.; Chytil, F.; Spelsberg, T. C.

    1972-01-01

    Oestradiol-17β (1.0μg) was injected intravenously into ovariectomized rats. The earliest detectable hormonal response in isolated uterine nuclei was an increase (10–15min) in RNA polymerase II activity (DNA-like RNA synthesis), which reached a peak at 30min and then decreased to control values (by 1–2h) before displaying a second increase over control activity from 2 to 12h. The next response to oestradiol-17β was an increase (30–60min) in polymerase I activity (rRNA synthesis) and template capacity of the chromatin. The concentrations of acidic chromatin proteins did not begin to increase until 1h after injection of oestradiol-17β and histone concentrations showed no significant changes during the 8h period after administration. The early (15min) increase in RNA synthesis in `high-salt conditions' can be completely eliminated by α-amanitin, an inhibitor of the RNA polymerase II. The exact nature of this early increase in endogenous polymerase II activity remains to be determined, e.g. whether it is caused by the increased availability of transcribable DNA of the chromatin or via direct hormonal activation of the enzyme per se. PMID:4656807

  4. Morphokinetic Reaction of Cells of Streptococcus faecalis (ATCC 9790) to Specific Inhibition of Macromolecular Synthesis: Dependence of Mesosome Growth on Deoxyribonucleic Acid Synthesis

    PubMed Central

    Higgins, Michael L.; Daneo-Moore, Lolita

    1972-01-01

    The application of quantitative electron microscopy to thin sections of cells of Streptococcus faecalis specifically inhibited for deoxyribonucleic acid (DNA), ribonucleic acid, and protein synthesis shows that septal mesosomes (i) increase in size when protein synthesis is inhibited by at least 80% while DNA synthesis proceeds at no less than 50% of the control rate and (ii) decrease in size when DNA synthesis is inhibited 50% or more during the initial 10 min of treatment. This indicates that fluctuations in mesosome size are dependent on the extent of DNA synthesis. The fluctuations in mesosome areas observed on treatment do not correlate with the kinetics of glycerol incorporation per milliliter of a culture. However, when glycerol incorporation is placed on a per cell basis, a strong correlation is observed between increases in (i) the thickness of the electron-transparent layer of the cytoplasmic membrane and (ii) the amount of glycerol incorporated per cell. It seems that the electron-transparent membrane layer may thicken to accommodate changes in lipid content when protein and lipid synthesis are uncoupled. Images PMID:4110926

  5. In vitro synthesis of 9,10-dihydroxyhexadecanoic acid using recombinant Escherichia coli.

    PubMed

    Kaprakkaden, Anees; Srivastava, Preeti; Bisaria, Virendra Swarup

    2017-05-18

    Hydroxy fatty acids are widely used in food, chemical and cosmetic industries. A variety of dihydroxy fatty acids have been synthesized so far; however, no studies have been done on the synthesis of 9,10-dihydroxyhexadecanoic acid. In the present study recombinant E. coli has been used for the heterologous expression of fatty acid hydroxylating enzymes and the whole cell lysate of the induced culture was used for in vitro production of 9,10-dihydroxyhexadecanoic acid. A first of its kind proof of principle has been successfully demonstrated for the production of 9,10-dihydroxyhexadecanoic acid using three different enzymes viz. fatty acid desaturase (FAD) from Saccharomyces cerevisiae, epoxide hydrolase (EH) from Caenorhabditis elegance and epoxygenase (EPOX) from Stokasia laevis. The genes for these proteins were codon-optimised, synthesised and cloned in pET 28a (+) vector. The culture conditions for induction of these three proteins in E. coli were optimised in shake flask. The induced cell lysates were used both singly and in combination along with the trans-supply of hexadecanoic acid and 9-hexadecenoic acid, followed by product profiling by GC-MS. Formation of 9,10-dihydroxyhexadecanoic acid was successfully achieved when combination of induced cell lysates of recombinant E. coli containing FAD, EH, and EPOX were incubated with 9-hexadecenoic acid. The in vitro production of 9,10-dihydroxyhexadecanoic acid synthesis using three fatty acid modification genes from different sources has been successfully demonstrated. The strategy adopted can be used for the production of similar compounds.

  6. Proline Coordination with Fatty Acid Synthesis and Redox Metabolism of Chloroplast and Mitochondria.

    PubMed

    Shinde, Suhas; Villamor, Joji Grace; Lin, Wendar; Sharma, Sandeep; Verslues, Paul E

    2016-10-01

    Proline (Pro) accumulation is one of the most prominent changes in plant metabolism during drought and low water potential; however, the regulation and function of Pro metabolism remain unclear. We used a combination of forward genetic screening based on a Proline Dehydrogenase1 (PDH1) promoter-luciferase reporter (PDH1 pro :LUC2) and RNA sequencing of the Pro synthesis mutant p5cs1-4 to identify multiple loci affecting Pro accumulation in Arabidopsis (Arabidopsis thaliana). Two mutants having high PDH1 pro :LUC2 expression and increased Pro accumulation at low water potential were found to be alleles of Cytochrome P450, Family 86, Subfamily A, Polypeptide2 (CYP86A2) and Long Chain Acyl Synthetase2 (LACS2), which catalyze two successive steps in very-long-chain fatty acid (VLCFA) synthesis. Reverse genetic experiments found additional VLCFA and lipid metabolism-related mutants with increased Pro accumulation. Altered cellular redox status is a key factor in the coordination of Pro and VLCFA metabolism. The NADPH oxidase inhibitor diphenyleneiodonium (DPI) induced high levels of Pro accumulation and strongly repressed PDH1 pro :LUC2 expression. cyp86a2 and lacs2 mutants were hypersensitive to diphenyleneiodonium but could be reverted to wild-type Pro and PDH1 pro :LUC2 expression by reactive oxygen species scavengers. The coordination of Pro and redox metabolism also was indicated by the altered expression of chloroplast and mitochondria electron transport genes in p5cs1-4 These results show that Pro metabolism is both influenced by and influences cellular redox status via previously unknown coordination with several metabolic pathways. In particular, Pro and VLCFA synthesis share dual roles to help buffer cellular redox status while producing products useful for stress resistance, namely the compatible solute Pro and cuticle lipids. © 2016 American Society of Plant Biologists. All Rights Reserved.

  7. Antisense RNA: effect of ribosome binding sites, target location, size, and concentration on the translation of specific mRNA molecules.

    PubMed

    Daugherty, B L; Hotta, K; Kumar, C; Ahn, Y H; Zhu, J D; Pestka, S

    1989-01-01

    A series of plasmids were constructed to generate RNA complementary to the beta-galactosidase messenger RNA under control of the phage lambda PL promoter. These plasmids generate anti-lacZ mRNA bearing or lacking a synthetic ribosome binding site adjacent to the lambda PL promoter and/or the lacZ ribosome binding site in reverse orientation. Fragments of lacZ DNA from the 5' and/or the 3' region were used in these constructions. When these anti-mRNA molecules were produced in Escherichia coli 294, maximal inhibition of beta-galactosidase synthesis occurred when a functional ribosome binding site was present near the 5' end of the anti-mRNA and the anti-mRNA synthesized was complementary to the 5' region of the mRNA corresponding to the lacZ ribosome binding site and/or the 5'-coding sequence. Anti-mRNAs producing maximal inhibition of beta-galactosidase synthesis exhibited an anti-lacZ mRNA:normal lacZ mRNA ratio of 100:1 or higher. Those showing lower levels of inhibition exhibited much lower anti-lacZ mRNA:normal lacZ mRNA ratios. A functional ribosome binding site at the 5'-end was found to decrease the decay rate of the anti-lacZ mRNAs. In addition, the incorporation of a transcription terminator just downstream of the antisense segment provided for more efficient inhibition of lacZ mRNA translation due to synthesis of smaller and more abundant anti-lacZ mRNAs. The optimal constructions produced undetectable levels of beta-galactosidase synthesis.

  8. Ebola Virus VP35 Interaction with Dynein LC8 Regulates Viral RNA Synthesis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Luthra, Priya; Jordan, David S.; Leung, Daisy W.

    2015-03-04

    Ebola virus VP35 inhibits alpha/beta interferon production and functions as a viral polymerase cofactor. Previously, the 8-kDa cytoplasmic dynein light chain (LC8) was demonstrated to interact with VP35, but the functional consequences were unclear. Here we demonstrate that the interaction is direct and of high affinity and that binding stabilizes the VP35 N-terminal oligomerization domain and enhances viral RNA synthesis. Mutational analysis demonstrates that VP35 interaction is required for the functional effects of LC8.

  9. Activation and reactivation of the RNA polymerase II trigger loop for intrinsic RNA cleavage and catalysis

    PubMed Central

    Čabart, Pavel; Jin, Huiyan; Li, Liangtao; Kaplan, Craig D

    2014-01-01

    In addition to RNA synthesis, multisubunit RNA polymerases (msRNAPs) support enzymatic reactions such as intrinsic transcript cleavage. msRNAP active sites from different species appear to exhibit differential intrinsic transcript cleavage efficiency and have likely evolved to allow fine-tuning of the transcription process. Here we show that a single amino-acid substitution in the trigger loop (TL) of Saccharomyces RNAP II, Rpb1 H1085Y, engenders a gain of intrinsic cleavage activity where the substituted tyrosine appears to participate in acid-base chemistry at alkaline pH for both intrinsic cleavage and nucleotidyl transfer. We extensively characterize this TL substitution for each of these reactions by examining the responses RNAP II enzymes to catalytic metals, altered pH, and factor inputs. We demonstrate that TFIIF stimulation of the first phosphodiester bond formation by RNAP II requires wild type TL function and that H1085Y substitution within the TL compromises or alters RNAP II responsiveness to both TFIIB and TFIIF. Finally, Mn2+ stimulation of H1085Y RNAP II reveals possible allosteric effects of TFIIB on the active center and cooperation between TFIIB and TFIIF. PMID:25764335

  10. Synthesis of 14C-labeled perfluorooctanoic and perfluorodecanoic acids; Purification of perfluorodecanoic acid

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Reich, I.L.; Reich, H.J.; Menahan, L.A.

    1987-01-01

    Perfluorooctanoic and -decanoic acids are representative of a series of perfluorinated acids that have been used for a variety of industrial purposes primarily due to their surfactant properties. The toxicity of these compounds is being investigated in a number of laboratories. 14C-labeled materials would be useful in these studies but are not commercially available. Johncock prepared unlabeled PFOA in low yield by carbonation of the unstable perfluoroheptyllithium at -90 degrees Centigrade. We anticipated several problems in applying this procedure to the synthesis of the 14C-labeled material. Johncock's procedure was run on a fairly large scale (10 mmol) with excess CO2.

  11. Synthesis and Multiple Incorporations of 2′‐O‐Methyl‐5‐hydroxymethylcytidine, 5‐Hydroxymethylcytidine and 5‐Formylcytidine Monomers into RNA Oligonucleotides

    PubMed Central

    Tanpure, Arun A.

    2017-01-01

    Abstract The synthesis of 2′‐O‐methyl‐5‐hydroxymethylcytidine (hm5Cm), 5‐hydroxymethylcytidine (hm5C) and 5‐formylcytidine (f5C) phosphoramidite monomers has been developed. Optimisation of mild post‐synthetic deprotection conditions enabled the synthesis of RNA containing all four naturally occurring cytosine modifications (hm5Cm, hm5C, f5C plus 5‐methylcytosine). Given the considerable interest in RNA modifications and epitranscriptomics, the availability of synthetic monomers and RNAs containing these modifications will be valuable for elucidating their biological function(s). PMID:28901692

  12. (-)-Epigallocatechin gallate but not chlorogenic acid upregulates osteoprotegerin synthesis through regulation of bone morphogenetic protein-4 in osteoblasts.

    PubMed

    Fujita, Kazuhiko; Otsuka, Takanobu; Yamamoto, Naohiro; Kainuma, Shingo; Ohguchi, Reou; Kawabata, Tetsu; Sakai, Go; Kuroyanagi, Gen; Matsushima-Nishiwaki, Rie; Kozawa, Osamu; Tokuda, Haruhiko

    2017-07-01

    Chlorogenic acid (CGA) is a primary phenolic component of coffee and (-)-epigallocatechin gallate (EGCG) is a primary flavonoid component of green tea, both of which have been documented to possess beneficial health properties. A previous study by the present authors demonstrated that p38 mitogen-activated protein kinase (MAPK) may be associated with osteoprotegerin synthesis stimulated by bone morphogenetic protein-4 (BMP-4) in osteoblast-like MC3T3-E1 cells. In the present study, the effects of CGA and EGCG on BMP-4-stimulated osteoprotegerin synthesis in MC3T3-E1 cells were investigated. It was observed that CGA had no effect on osteoprotegerin release stimulated by BMP-4, whereas EGCG significantly enhanced BMP-4-stimulated osteoprotegerin release (P=0.003). Levels of osteoprotegerin mRNA expression induced by BMP-4 were also significantly increased by EGCG (P=0.03). By contrast, EGCG had no significant effect on phosphorylation of Smad1 or p38 MAPK induced by BMP-4. In addition, EGCG had little effect on BMP-induced phosphorylation of p70 S6 kinase; however rapamycin, as an inhibitor of p70 S6 kinase, significantly suppressed osteoprotegerin release (P=0.007). These data suggest that EGCG but not CGA may upregulate the synthesis of osteoprotegerin induced by BMP-4 in osteoblasts.

  13. Synthesis oftrans-3-hexadecenoic acid and oftrans-3-hexadecenoic-1-C(14) acid.

    PubMed

    Knipprath, W G; Stein, R A

    1966-01-01

    Thetrans-3-hexadecenoic acid has been synthesized. Physical properties and chemical degradation prove its identity with the acid earlier isolated from several plant lipids. In the sequence of the synthesis, the introduction of a terminal triple bond into commercially available 1-tetradecene was performed by bromination and debromination with KOH and NaNH(2). Chain elongation by a Grignard reaction with CO(2) gave a carboxylic acid with a triple bond in the 2-position. Reduction with LiAlH(4) yielded the corresponding alcohol, and reduction of the triple to thetrans double bond was accomplished with Na in ethanol. Bromination of the alcohol with PBr(3) and conversion of the bromide to the nitrile with KCN or KC(14)N elongated the carbon chain to the desired length. Methanolysis with HCl in methanol and saponification with KOH formed the acid with acceptable yields, and in the case of the C(14)-labeled carboxyl, group, with high specific activity.

  14. Sensitivity of whole body protein synthesis to amino acid administration during short-term bed rest.

    PubMed

    Biolo, Gianni; Ciocchi, Beniamino; Lebenstedt, Marion; Heer, Martina; Guarnieri, Gianfranco

    2002-07-01

    We tested the hypothesis that a reduced stimulation of whole-body protein synthesis by amino acid administration represents a major mechanism for the bed rest-induced loss of lean body mass. Healthy young subjects and matched controls were studied on the last day of a 14-day bed rest or ambulatory period, as part of the overall protocol "Short-term Bed Rest - Integrated Physiology" set up by the German Aerospace Centre (DLR) in co-operation with the European Space Agency. A balanced mixture of essential and non-essential amino acids was intravenously infused in the postabsorptive state for 3 hours at the rate of 0.1 g/kg/hour. The oxidative and non-oxidative (i.e., to protein synthesis) disposal of the infused leucine was determined by stable isotope and mass spectrometry techniques. The clearance of total infused amino acids tended to be greater (P=0.07) in the ambulatory group than in the bed rest group. When leucine clearance was partitioned between its oxidative and non-oxidative (i.e., to protein synthesis) components, the results indicated that the oxidative disposal was not statistically different in the bed rest and in the ambulatory groups. In contrast, the non-oxidative leucine disposal (i.e., to protein synthesis) was about 20% greater (P<0.01) in the ambulatory group than in the bed rest group. In conclusion, these preliminary data suggest that 14-day bed rest impairs the ability to utilise exogenous amino acids for protein synthesis.

  15. Kinetic resolution and stereoselective synthesis of 3-substituted aspartic acids by using engineered methylaspartate ammonia lyases.

    PubMed

    Raj, Hans; Szymanski, Wiktor; de Villiers, Jandré; Puthan Veetil, Vinod; Quax, Wim J; Shimamoto, Keiko; Janssen, Dick B; Feringa, Ben L; Poelarends, Gerrit J

    2013-08-19

    Enzymatic amino acid synthesis: Kinetic resolution and asymmetric synthesis of various valuable 3-substituted aspartic acids, which were obtained in fair to good yields with diastereomeric ratio values of up to >98:2 and enantiomeric excess values of up to >99 %, by using engineered methylaspartate ammonia lyases are described. These biocatalytic methodologies for the selective preparation of aspartic acid derivatives appear to be attractive alternatives for existing chemical methods. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Synthesis and preliminary biological evaluations of (+)-isocampholenic acid-derived amides.

    PubMed

    Grošelj, Uroš; Golobič, Amalija; Knez, Damijan; Hrast, Martina; Gobec, Stanislav; Ričko, Sebastijan; Svete, Jurij

    2016-08-01

    The synthesis of two novel (+)-isocampholenic acid-derived amines has been realized starting from commercially available (1S)-(+)-10-camphorsulfonic acid. The novel amines as well as (+)-isocampholenic acid have been used as building blocks in the construction of a library of amides using various aliphatic, aromatic, and amino acid-derived coupling partners using BPC and CDI as activating agents. Amide derivatives have been assayed against several enzymes that hold potential for the development of new drugs to battle bacterial infections and Alzheimer's disease. Compounds 20c and 20e showed promising selective sub-micromolar inhibition of human butyrylcholinesterase [Formula: see text] ([Formula: see text] values [Formula: see text] and [Formula: see text], respectively).

  17. Orthogonal use of a human tRNA synthetase active site to achieve multifunctionality.

    PubMed

    Zhou, Quansheng; Kapoor, Mili; Guo, Min; Belani, Rajesh; Xu, Xiaoling; Kiosses, William B; Hanan, Melanie; Park, Chulho; Armour, Eva; Do, Minh-Ha; Nangle, Leslie A; Schimmel, Paul; Yang, Xiang-Lei

    2010-01-01

    Protein multifunctionality is an emerging explanation for the complexity of higher organisms. In this regard, aminoacyl tRNA synthetases catalyze amino acid activation for protein synthesis, but some also act in pathways for inflammation, angiogenesis and apoptosis. It is unclear how these multiple functions evolved and how they relate to the active site. Here structural modeling analysis, mutagenesis and cell-based functional studies show that the potent angiostatic, natural fragment of human tryptophanyl-tRNA synthetase (TrpRS) associates via tryptophan side chains that protrude from its cognate cellular receptor vascular endothelial cadherin (VE-cadherin). VE-cadherin's tryptophan side chains fit into the tryptophan-specific active site of the synthetase. Thus, specific side chains of the receptor mimic amino acid substrates and expand the functionality of the active site of the synthetase. We propose that orthogonal use of the same active site may be a general way to develop multifunctionality of human tRNA synthetases and other proteins.

  18. Spin labeled amino acid nitrosourea derivatives--synthesis and antitumour activity.

    PubMed

    Zheleva, A; Raikov, Z; Ilarionova, M; Todorov, D

    1995-01-01

    The synthesis of three spin labeled derivatives of N-[N'-(chloroethyl)-N'-nitrosocarbamoyl] amino acids is reported. The new nitrosoureas are obtained by condensation of the corresponding N-[N'-(2-chloroethyl)-N'-nitrosocarbamoyl] amino acid with 2,2,6,6-tetramethyl-1-oxyl-4-aminopiperidine using dicyclohexylcarbodiimide. Their chemical structures are confirmed by elemental analysis, IR, MS, and EPR spectroscopy. All newly synthesized compounds showed high antitumour activity against the lymphoid leukemia L1210 in BDF1 mice.

  19. The HIV-1 transcriptional activator Tat has potent nucleic acid chaperoning activities in vitro.

    PubMed

    Kuciak, Monika; Gabus, Caroline; Ivanyi-Nagy, Roland; Semrad, Katharina; Storchak, Roman; Chaloin, Olivier; Muller, Sylviane; Mély, Yves; Darlix, Jean-Luc

    2008-06-01

    The human immunodeficiency virus type 1 (HIV-1) is a primate lentivirus that causes the acquired immunodeficiency syndrome (AIDS). In addition to the virion structural proteins and enzyme precursors, that are Gag, Env and Pol, HIV-1 encodes several regulatory proteins, notably a small nuclear transcriptional activator named Tat. The Tat protein is absolutely required for virus replication since it controls proviral DNA transcription to generate the full-length viral mRNA. Tat can also regulate mRNA capping and splicing and was recently found to interfere with the cellular mi- and siRNA machinery. Because of its extensive interplay with nucleic acids, and its basic and disordered nature we speculated that Tat had nucleic acid-chaperoning properties. This prompted us to examine in vitro the nucleic acid-chaperoning activities of Tat and Tat peptides made by chemical synthesis. Here we report that Tat has potent nucleic acid-chaperoning activities according to the standard DNA annealing, DNA and RNA strand exchange, RNA ribozyme cleavage and trans-splicing assays. The active Tat(44-61) peptide identified here corresponds to the smallest known sequence with DNA/RNA chaperoning properties.

  20. The HIV-1 transcriptional activator Tat has potent nucleic acid chaperoning activities in vitro

    PubMed Central

    Kuciak, Monika; Gabus, Caroline; Ivanyi-Nagy, Roland; Semrad, Katharina; Storchak, Roman; Chaloin, Olivier; Muller, Sylviane; Mély, Yves; Darlix, Jean-Luc

    2008-01-01

    The human immunodeficiency virus type 1 (HIV-1) is a primate lentivirus that causes the acquired immunodeficiency syndrome (AIDS). In addition to the virion structural proteins and enzyme precursors, that are Gag, Env and Pol, HIV-1 encodes several regulatory proteins, notably a small nuclear transcriptional activator named Tat. The Tat protein is absolutely required for virus replication since it controls proviral DNA transcription to generate the full-length viral mRNA. Tat can also regulate mRNA capping and splicing and was recently found to interfere with the cellular mi- and siRNA machinery. Because of its extensive interplay with nucleic acids, and its basic and disordered nature we speculated that Tat had nucleic acid-chaperoning properties. This prompted us to examine in vitro the nucleic acid-chaperoning activities of Tat and Tat peptides made by chemical synthesis. Here we report that Tat has potent nucleic acid-chaperoning activities according to the standard DNA annealing, DNA and RNA strand exchange, RNA ribozyme cleavage and trans-splicing assays. The active Tat(44–61) peptide identified here corresponds to the smallest known sequence with DNA/RNA chaperoning properties. PMID:18442994

  1. Inhibition of selenocysteine tRNA[Ser]Sec aminoacylation provides evidence that aminoacylation is required for regulatory methylation of this tRNA

    PubMed Central

    Kim, Jin Young; Carlson, Bradley A.; Xu, Xue-Ming; Zeng, Yu; Chen, Shawn; Gladyshev, Vadim N.; Lee, Byeong Jae; Hatfield, Dolph L.

    2011-01-01

    There are two isoforms of selenocysteine (Sec) tRNA[Ser]Sec that differ by a single methyl group, Um34. The non-Um34 isoform supports the synthesis of a subclass of selenoproteins, designated housekeeping, while the Um34 isoform supports the expression of another subclass, designated stress-related selenoproteins. Herein, we investigated the relationship between tRNA[Ser]Sec aminoacylation and Um34 synthesis which is the last step in the maturation of this tRNA. Mutation of the discriminator base at position 73 in tRNA[Ser]Sec dramatically reduced aminoacylation with serine, as did an inhibitor of seryl-tRNA synthetase, SB-217452. Although both the mutation and the inhibitor prevented Um34 synthesis, neither precluded the synthesis of any other of the known base modifications on tRNA[Ser]Sec following microinjection and incubation of the mutant tRNA[Ser]Sec transcript, or the wild type transcript along with inhibitor, in Xenopus oocytes. The data demonstrate that Sec tRNA[Ser]Sec must be aminoacylated for Um34 addition. The fact that selenium is required for Um34 methylation suggests that Sec must be attached to its tRNA for Um34 methylation. This would explain why selenium is essential for the function of Um34 methylase and provides further insights into the hierarchy of selenoprotein expression. PMID:21624347

  2. Lactic acid as an invaluable green solvent for ultrasound-assisted scalable synthesis of pyrrole derivatives.

    PubMed

    Wang, Shi-Fan; Guo, Chao-Lun; Cui, Ke-Ke; Zhu, Yan-Ting; Ding, Jun-Xiong; Zou, Xin-Yue; Li, Yi-Hang

    2015-09-01

    Lactic acid has been used as a bio-based green solvent to study the ultrasound-assisted scale-up synthesis. We report here, for the first time, on the novel and scalable process for synthesis of pyrrole derivatives in lactic acid solvent under ultrasonic radiation. Eighteen pyrrole derivatives have been synthesized in lactic acid solvent under ultrasonic radiation and characterized by (1)H NMR, IR, ESI MS. The results show, under ultrasonic radiation, lactic acid solvent can overcome the scale-up challenges and exhibited many advantages, such as bio-based origin, shorter reaction time, lower volatility, higher yields, and ease of isolating the products. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. A non-isotopic assay uses bromouridine and RNA synthesis to detect DNA damage responses.

    PubMed

    Hasegawa, Mayu; Iwai, Shigenori; Kuraoka, Isao

    2010-06-17

    Individuals with inherited xeroderma pigmentosum (XP) disorder and Cockayne syndrome (CS) are deficient in nucleotide excision repair and experience hypersensitivity to sunlight. Although there are several diagnostic assays for these disorders, the recovery of RNA synthesis (RRS) assay that can discriminate between XP cells and CS cells is very laborious. Here, we report on a novel non-radioisotope RRS assay that uses bromouridine (a uridine analog) as an alternative to (3)H-uridine. This assay can easily detect RNA polymerase I transcription in nucleoli and RNA polymerase II transcription in nuclei. The non-RI RSS assay also can rapidly detect normal RRS activity in HeLa cells. Thus, this assay is useful as a novel and easy technique for CS diagnosis. Because RRS is thought to be related to transcription-coupled DNA repair, which is triggered by the blockage of transcriptional machinery by DNA lesions, this assay may be of use for analysis of DNA repair, transcription, and/or genetic toxicity. Copyright 2010 Elsevier B.V. All rights reserved.

  4. Synthesis of peptides from amino acids and ATP with lysine-rich proteinoid

    NASA Technical Reports Server (NTRS)

    Nakashima, T.; Fox, S. W.

    1980-01-01

    The paper examines the synthesis of peptides from aminoacids and ATP with a lysine-rich protenoid. The latter in aqueous solution catalyzes the formation of peptides from free amino acids and ATP; this catalytic activity is not found in acidic protenoids, even though the latter contain a basic aminoacid. The pH optimum for the synthesis is about 11, but it is appreciable below 8 and above 13. Temperature data indicate an optimum at 20 C or above, with little increase in rate up to 60 C. Pyrophosphate can be used instead of ATP, but the yields are lower. The ATP-aided syntheses of peptides in aqueous solution occur with several types of proteinous aminoacids.

  5. Strain of Escherichia coli with a temperature-sensitive mutation affecting ribosomal ribonucleic acid accumulation.

    PubMed Central

    Frey, T; Newlin, L L; Atherly, A G

    1975-01-01

    A mutant of Escherichia coli has been isolated that has a temperature-sensitive mutation that results in specific loss of ribosomal ribonucleic acid (RNA) synthesis and some reduction in messenger RNA synthesis. When the strain was grown in glucose medium at a restrictive temperature, RNA accumulation ceased, but both messenger RNA and protein synthesis continued for an extended time. Because carbon metabolism was slowed drastically when strain AA-157 was placed at the restrictive temperature, this phenotype can be compared with carbon depletion conditions present during diauxic lag. However, the phenotype of mutant AA-157 differs from shift-down conditions in that guanosine-3',5'-tetraphosphate levels are unaffected; therefore, a different site is affected. This mutant strain (AA-157) thus shows many characteristics similar to an aldolase mutant previously reported (Böck and Neidhardt, 1966). However, the mutation occurred in a different position on the E. coli genetic map, and furthermore, aldolase was not temperature sensitive in strain AA-157. In this paper we present a study of macromolecular biosynthesis in this mutant. PMID:1090609

  6. Experiment K-6-11. Actin mRNA and cytochrome c mRNA concentrations in the tricepts brachia muscle of rats

    NASA Technical Reports Server (NTRS)

    Booth, F. W.; Morrison, P. R.; Thomason, D. B.; Oganov, V. S.

    1990-01-01

    It is well known that some skeletal muscles atrophy as a result of weightlessness (Steffen and Musacchia 1986) and as a result of hindlimb suspension (Tischler et al., 1985, Thomason et al., 1987). Because the content of protein is determined by the rates of protein synthesis and degradation, a decrease in protein synthesis rate, or an increase in the protein degradation, or changes in both could produce the atrophy. Indeed, an increased protein degradation (Tischler et al., 1985) and a decreased protein synthesis (Thomason et al., 1988) have been observed in skeletal muscles of suspended hindlimbs of rats. Any decrease in protein synthesis rate could be caused by decreases in mRNA concentrations. Such decreases in the concentration and content of alpha-actin mRNA and cytochrome c mRNA have been noted in skeletal muscles of hindlimb suspended rats (Babij and Booth, 1988). From these findings researchers hypothesized that alpha-actin mRNA and cytochrome c mRNA would decrease in the triceps brachia muscle of Cosmos 1887 rats.

  7. The nucleolus as a stress sensor: JNK2 inactivates the transcription factor TIF-IA and down-regulates rRNA synthesis.

    PubMed

    Mayer, Christine; Bierhoff, Holger; Grummt, Ingrid

    2005-04-15

    Cells respond to a variety of extracellular and intracellular forms of stress by down-regulating rRNA synthesis. We have investigated the mechanism underlying stress-dependent inhibition of RNA polymerase I (Pol I) transcription and show that the Pol I-specific transcription factor TIF-IA is inactivated upon stress. Inactivation is due to phosphorylation of TIF-IA by c-Jun N-terminal kinase (JNK) at a single threonine residue (Thr 200). Phosphorylation at Thr 200 impairs the interaction of TIF-IA with Pol I and the TBP-containing factor TIF-IB/SL1, thereby abrogating initiation complex formation. Moreover, TIF-IA is translocated from the nucleolus into the nucleoplasm. Substitution of Thr 200 by valine as well as knock-out of Jnk2 prevent inactivation and translocation of TIF-IA, leading to stress-resistance of Pol I transcription. Our data identify TIF-IA as a downstream target of the JNK pathway and suggest a critical role of JNK2 to protect rRNA synthesis against the harmful consequences of cellular stress.

  8. Coordinated modulation of albumin synthesis and mRNA levels in cultured hepatoma cells by hydrocortisone and cyclic AMP analogs

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Brown, P.C.; Papaconstantinou, J.

    The treatment of Hepa-2 cells, a permanent mouse hepatoma cell line, for 72 h with hydrocortisone (10/sup -6/ M), N/sup 6/,O/sup 2/-dibutyryl cyclic AMP (10/sup -3/ M), or 8-bromo cyclic AMP(10/sup -3/ M) results in a 2-, 3-, or 4-fold increase, respectively, in rates of synthesis and secretion of mouse serum albumin. Simultaneous treatment with hydrocortisone and N/sup 6/,O/sup 2/-dibutyryl cyclic AMP results in a 10-fold stimulation in these parameters, an effect that is significantly more than additive for the two compounds tested. The number of albumin mRNA sequences, determined by hybridization of total cell RNA to albumin complementary DNA,more » was increased in direct proportion to the increases in albumin synthesis in all experiments. The relative rate of albumin synthesis approaches in vivo levels in cells treated simultaneously with hydrocortisone and N/sup 6/,O/sup 2/-dibutyryl cyclic AMP. We propose that these factors may be necessary to maintain the maximal level of differentiated function in the continuous culture of Hepa-2 cells.« less

  9. MicroRNA-134 plasma levels before and after treatment with valproic acid for epilepsy patients

    PubMed Central

    Wang, Xiaofeng; Luo, Yifeng; Liu, Shuangxi; Tan, Liming; Wang, Sanhu; Man, Rongyong

    2017-01-01

    Background Temporal lobe epilepsy is the second most common neurological disorders characterized by recurrent spontaneous seizures. MicroRNAs play a vital role in regulating synaptic plasticity, brain development and post-transcriptional expression of proteins. In both animal models of epilepsy and human patients, miR-134, a brain-specific microRNA has recently been identified as a potential regulator of epileptogenesis. Methods microRNA identified as targets for the actions of valproic acid (VPA) are known to have important effects in brain function. In this study, 59 new-onset epilepsy patients and 20 controls matched by sex and age were enrolled. Patients with a score < 3 were allocated into the mild group, 3-5 into the moderate group and >5 into the severe group. The plasma miRNA-134 level was quantitatively measured using real-time PCR. Results Plasma miRNA-134 level in new-onset epilepsy patients was significantly up-regulated when compared with that in healthy controls, and then considerably down-regulated after oral intake of valproic acid medication. The up-regulated plasma miRNA-134 levels may be directly associated with the pathophysiology and severity of epilepsy. Conclusion Plasma miRNA-134 in epilepsy may be considered as a potential peripheral biomarker that responds to the incidence of epilepsy and associates with use of anti-epilepsy drugs. PMID:29069823

  10. (+/-)-3-[4-(2-dimethylamino-1-methylethoxy)-phenyl]-1H-pyrazolo[3,4- B]pyridine-1-acetic acid (Y-25510) stimulates production of IL-1 beta and IL-6 at the level of messenger RNA expression in cultured human monocytes.

    PubMed

    Kusuhara, H; Komatsu, H; Hisadome, M; Ikeda, Y

    1996-12-01

    (+/-)-3-[4-(2-Dimethylamino-1-methylethoxy)phenyl]-1H-pyrazolo[3, 4-b]pyridine-1-acetic acid (Y-25510) stimulated the mRNA expression for interleukin-1 beta (IL-1 beta), and enhanced the expression induced by lipopolysaccharide (LPS) in cultured human peripheral blood mononuclear cells (PBMC) and THP-1 cells, a cell-line derived from human monocytic leukemia. Y-25510 also stimulated the mRNA expression for IL-6 in both types of the cells, however, the stimulation required the presence of LPS. In THP-1 cells, the stimulation of IL-1 beta mRNA expression by Y-25510 was suppressed by cycloheximide, an inhibitor of protein synthesis. This phenomenon indicates that the stimulation requires de norv protein synthesis. In contrast, the stimulation of mRNA expression for IL-6 by Y-25510 was not suppressed by cycloheximide but suppressed by N alpha-p-tosyl-L-phenylalanine chloromethyl ketone (TPCK), an inhibitor of nuclear transcription factor-kappa B (NF-kappa B) activation, in the presence of LPS, suggesting that the stimulation requires NF-kappa activation. These results demonstrate that Y-25510 stimulates the mRNA expression for IL-1 beta and IL-6 by different mechanisms. Dexamethasone suppressed the LPS-induced expression of mRNA for IL-1 beta and IL-6 in THP-1 cells, whereas the drug never suppressed the mRNA expression for these cytokines in the presence of Y-25510. The result indicates that Y-25510 stimulates the mRNA expression for IL-1 beta and IL-6 by different mechanisms from those of LPS.

  11. Fitness advantages conferred by the L20-interacting RNA cis-regulator of ribosomal protein synthesis in Bacillus subtilis.

    PubMed

    Babina, Arianne M; Parker, Darren J; Li, Gene-Wei; Meyer, Michelle M

    2018-06-20

    In many bacteria, ribosomal proteins autogenously repress their own expression by interacting with RNA structures typically located in the 5'-UTRs of their mRNA transcripts. This regulation is necessary to maintain a balance between ribosomal proteins and rRNA to ensure proper ribosome production. Despite advances in non-coding RNA discovery and validation of RNA-protein regulatory interactions, the selective pressures that govern the formation and maintenance of such RNA cis-regulators in the context of an organism remain largely undetermined. To examine the impact disruptions to this regulation have on bacterial fitness, we introduced point mutations that abolish ribosomal protein binding and regulation into the RNA structure that controls expression of ribosomal proteins L20 and L35 within the Bacillus subtilis genome. Our studies indicate that removing this regulation results in reduced log phase growth, improper rRNA maturation, and the accumulation of a kinetically trapped or mis-assembled ribosomal particle at low temperatures, suggesting defects in ribosome synthesis. Such work emphasizes the important role regulatory RNAs play in the stoichiometric production of ribosomal components for proper ribosome composition and overall organism viability and reinforces the potential of targeting ribosomal protein production and ribosome assembly with novel antimicrobials. Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  12. Continuous in vitro evolution of bacteriophage RNA polymerase promoters

    NASA Technical Reports Server (NTRS)

    Breaker, R. R.; Banerji, A.; Joyce, G. F.

    1994-01-01

    Rapid in vitro evolution of bacteriophage T7, T3, and SP6 RNA polymerase promoters was achieved by a method that allows continuous enrichment of DNAs that contain functional promoter elements. This method exploits the ability of a special class of nucleic acid molecules to replicate continuously in the presence of both a reverse transcriptase and a DNA-dependent RNA polymerase. Replication involves the synthesis of both RNA and cDNA intermediates. The cDNA strand contains an embedded promoter sequence, which becomes converted to a functional double-stranded promoter element, leading to the production of RNA transcripts. Synthetic cDNAs, including those that contain randomized promoter sequences, can be used to initiate the amplification cycle. However, only those cDNAs that contain functional promoter sequences are able to produce RNA transcripts. Furthermore, each RNA transcript encodes the RNA polymerase promoter sequence that was responsible for initiation of its own transcription. Thus, the population of amplifying molecules quickly becomes enriched for those templates that encode functional promoters. Optimal promoter sequences for phage T7, T3, and SP6 RNA polymerase were identified after a 2-h amplification reaction, initiated in each case with a pool of synthetic cDNAs encoding greater than 10(10) promoter sequence variants.

  13. Tuning of acyl-ACP thioesterase activity directed for tailored fatty acid synthesis.

    PubMed

    Feng, Yanbin; Zhang, Yunxiu; Wang, Yayue; Liu, Jiao; Liu, Yinghui; Cao, Xupeng; Xue, Song

    2018-04-01

    Medium-chain fatty acids have attracted significant attention as sources of biofuels in recent years. Acyl-ACP thioesterase, which is considered as the key enzyme to determine the carbon chain length, catalyzes the termination of de novo fatty acid synthesis. Although recombinant medium-chain acyl-ACP thioesterase (TE) affects the fatty acid profile in heterologous cells, tailoring of the fatty acid composition merely by engineering a specific TE is still intractable. In this study, the activity of a C8-C10-specific thioesterase FatB2 from Cuphea hookeriana on C10-ACP was quantified twice as high as that on C8-ACP based on a synthetic C8-C16 acyl-ACP pool in vitro. Whereas in vivo, it was demonstrated that ChFatB2 preferred to accumulate C8 fatty acids with 84.9% composition in the ChFatB2-engineered E. coli strain. To achieve C10 fatty acid production, ChFatB2 was rationally tuned based on structural investigation and enzymatic analysis. An I198E mutant was identified to redistribute the C8-ACP flow, resulting in C10 fatty acid being produced as the principal component at 57.6% of total fatty acids in vivo. It was demonstrated that the activity of TE relative to β-ketoacyl-ACP synthases (KAS) directly determined the fatty acid composition. Our results provide a prospective strategy in tailoring fatty acid synthesis by tuning of TE activities based on TE-ACP interaction.

  14. A viscous solvent enables information transfer from gene-length nucleic acids in a model prebiotic replication cycle

    NASA Astrophysics Data System (ADS)

    He, Christine; Gállego, Isaac; Laughlin, Brandon; Grover, Martha A.; Hud, Nicholas V.

    2017-04-01

    Many hypotheses concerning the nature of early life assume that genetic information was once transferred through the template-directed synthesis of RNA, before the emergence of coded enzymes. However, attempts to demonstrate enzyme-free, template-directed synthesis of nucleic acids have been limited by 'strand inhibition', whereby transferring information from a template strand in the presence of its complementary strand is inhibited by the stability of the template duplex. Here, we use solvent viscosity to circumvent strand inhibition, demonstrating information transfer from a gene-length template (>300 nt) within a longer (545 bp or 3 kb) duplex. These results suggest that viscous environments on the prebiotic Earth, generated periodically by water evaporation, could have facilitated nucleic acid replication—particularly of long, structured sequences such as ribozymes. Our approach works with DNA and RNA, suggesting that viscosity-mediated replication is possible for a range of genetic polymers, perhaps even for informational polymers that may have preceded RNA.

  15. Fed levels of amino acids are required for the somatotropin-induced increase in muscle protein synthesis

    USDA-ARS?s Scientific Manuscript database

    Chronic somatotropin (pST) treatment in pigs increases muscle protein synthesis and circulating insulin, a known promoter of protein synthesis. Previously, we showed that the pST-mediated rise in insulin could not account for the pST-induced increase in muscle protein synthesis when amino acids were...

  16. Analysis of porcine adipose tissue transcriptome reveals differences in de novo fatty acid synthesis in pigs with divergent muscle fatty acid composition.

    PubMed

    Corominas, Jordi; Ramayo-Caldas, Yuliaxis; Puig-Oliveras, Anna; Estellé, Jordi; Castelló, Anna; Alves, Estefania; Pena, Ramona N; Ballester, Maria; Folch, Josep M

    2013-12-01

    In pigs, adipose tissue is one of the principal organs involved in the regulation of lipid metabolism. It is particularly involved in the overall fatty acid synthesis with consequences in other lipid-target organs such as muscles and the liver. With this in mind, we have used massive, parallel high-throughput sequencing technologies to characterize the porcine adipose tissue transcriptome architecture in six Iberian x Landrace crossbred pigs showing extreme phenotypes for intramuscular fatty acid composition (three per group). High-throughput RNA sequencing was used to generate a whole characterization of adipose tissue (backfat) transcriptome. A total of 4,130 putative unannotated protein-coding sequences were identified in the 20% of reads which mapped in intergenic regions. Furthermore, 36% of the unmapped reads were represented by interspersed repeats, SINEs being the most abundant elements. Differential expression analyses identified 396 candidate genes among divergent animals for intramuscular fatty acid composition. Sixty-two percent of these genes (247/396) presented higher expression in the group of pigs with higher content of intramuscular SFA and MUFA, while the remaining 149 showed higher expression in the group with higher content of PUFA. Pathway analysis related these genes to biological functions and canonical pathways controlling lipid and fatty acid metabolisms. In concordance with the phenotypic classification of animals, the major metabolic pathway differentially modulated between groups was de novo lipogenesis, the group with more PUFA being the one that showed lower expression of lipogenic genes. These results will help in the identification of genetic variants at loci that affect fatty acid composition traits. The implications of these results range from the improvement of porcine meat quality traits to the application of the pig as an animal model of human metabolic diseases.

  17. Formal synthesis of berkelic acid: a lesson in α-alkylation chemistry.

    PubMed

    McLeod, Michael C; Wilson, Zoe E; Brimble, Margaret A

    2012-01-06

    The full details of our enantioselective formal synthesis of the biologically active natural product berkelic acid are described. The insertion of the C-18 methyl group proved challenging, with three different approaches investigated to install the correct stereochemistry. Our initial Horner-Wadsworth-Emmons/oxa-Michael approach to the berkelic acid core proved unsuccessful upon translation to the natural product itself. However, addition of a silyl enol ether to an oxonium ion, followed by a one-pot debenzylation/spiroketalisation/thermodynamic equilibration procedure, afforded the tetracyclic structure of the berkelic acid core as a single diastereoisomer.

  18. Probing RNA Native Conformational Ensembles with Structural Constraints.

    PubMed

    Fonseca, Rasmus; van den Bedem, Henry; Bernauer, Julie

    2016-05-01

    Noncoding ribonucleic acids (RNA) play a critical role in a wide variety of cellular processes, ranging from regulating gene expression to post-translational modification and protein synthesis. Their activity is modulated by highly dynamic exchanges between three-dimensional conformational substates, which are difficult to characterize experimentally and computationally. Here, we present an innovative, entirely kinematic computational procedure to efficiently explore the native ensemble of RNA molecules. Our procedure projects degrees of freedom onto a subspace of conformation space defined by distance constraints in the tertiary structure. The dimensionality reduction enables efficient exploration of conformational space. We show that the conformational distributions obtained with our method broadly sample the conformational landscape observed in NMR experiments. Compared to normal mode analysis-based exploration, our procedure diffuses faster through the experimental ensemble while also accessing conformational substates to greater precision. Our results suggest that conformational sampling with a highly reduced but fully atomistic representation of noncoding RNA expresses key features of their dynamic nature.

  19. Defects in Mitochondrial Fatty Acid Synthesis Result in Failure of Multiple Aspects of Mitochondrial Biogenesis in Saccharomyces cerevisiae

    PubMed Central

    Kursu, V. A. Samuli; Pietikäinen, Laura P.; Fontanesi, Flavia; Aaltonen, Mari J.; Suomi, Fumi; Nair, Remya Raghavan; Schonauer, Melissa S.; Dieckmann, Carol L.; Barrientos, Antoni; Hiltunen, J. Kalervo; Kastaniotis, Alexander J.

    2014-01-01

    Summary Mitochondrial fatty acid synthesis (mtFAS) shares acetyl-CoA with the Krebs cycle as a common substrate and is required for the production of octanoic acid (C8) precursors of lipoic acid (LA) in mitochondria. MtFAS is a conserved pathway essential for respiration. In a genetic screen in Saccharomyces cerevisiae designed to further elucidate the physiological role of mtFAS, we isolated mutants with defects in mitochondrial post-translational gene expression processes, indicating a novel link to mitochondrial gene expression and respiratory chain biogenesis. In our ensuing analysis, we show that mtFAS, but not lipoylation per se, is required for respiratory competence. We demonstrate that mtFAS is required for mRNA splicing, mitochondrial translation and respiratory complex assembly, and provide evidence that not LA per se, but fatty acids longer than C8 play a role in these processes. We also show that mtFAS- and LA-deficient strains suffer from a mild heme deficiency that may contribute to the respiratory complex assembly defect. Based on our data and previously published information, we propose a model implicating mtFAS as a sensor for mitochondrial acetyl-CoA availability and a coordinator of nuclear and mitochondrial gene expression by adapting the mitochondrial compartment to changes in the metabolic status of the cell. PMID:24102902

  20. Defects in mitochondrial fatty acid synthesis result in failure of multiple aspects of mitochondrial biogenesis in Saccharomyces cerevisiae.

    PubMed

    Kursu, V A Samuli; Pietikäinen, Laura P; Fontanesi, Flavia; Aaltonen, Mari J; Suomi, Fumi; Raghavan Nair, Remya; Schonauer, Melissa S; Dieckmann, Carol L; Barrientos, Antoni; Hiltunen, J Kalervo; Kastaniotis, Alexander J

    2013-11-01

    Mitochondrial fatty acid synthesis (mtFAS) shares acetyl-CoA with the Krebs cycle as a common substrate and is required for the production of octanoic acid (C8) precursors of lipoic acid (LA) in mitochondria. MtFAS is a conserved pathway essential for respiration. In a genetic screen in Saccharomyces cerevisiae designed to further elucidate the physiological role of mtFAS, we isolated mutants with defects in mitochondrial post-translational gene expression processes, indicating a novel link to mitochondrial gene expression and respiratory chain biogenesis. In our ensuing analysis, we show that mtFAS, but not lipoylation per se, is required for respiratory competence. We demonstrate that mtFAS is required for mRNA splicing, mitochondrial translation and respiratory complex assembly, and provide evidence that not LA per se, but fatty acids longer than C8 play a role in these processes. We also show that mtFAS- and LA-deficient strains suffer from a mild haem deficiency that may contribute to the respiratory complex assembly defect. Based on our data and previously published information, we propose a model implicating mtFAS as a sensor for mitochondrial acetyl-CoA availability and a co-ordinator of nuclear and mitochondrial gene expression by adapting the mitochondrial compartment to changes in the metabolic status of the cell. © 2013 John Wiley & Sons Ltd.