Science.gov

Sample records for acid rna synthesis

  1. [Effect of gibberellic acid on RNA synthesis in dwarf peas].

    PubMed

    Kilev, S N; Kholodar', A V; Chekurov, V M; Mertvetsov, N P

    1982-04-01

    The effect of gibberellic acid (GA) on total RNA and polysomal poly-[A]+-RNA synthesis in epicotylia and embryos of dwarf pea of two varieties differing in their physiological sensitivity to GA was studied. It was found that incubation with GA increases the accumulation of total RNA in pea epicotylia, var. "Pioner" and "Polzunok". The maximal stimulation of RNA accumulation makes up to 40% for the low sensitivity variety "Polzunok" and 150% for the highly sensitive variety "Pioner". GA increases the synthesis of polysomal poly (A)+-mRNA in 5-year-old pea sprouts and that of newly synthesized poly (A)+-mRNA in epicotylian polysomes of both varieties 5, 24, 48 and 72 hrs after incubation with GA. GA at concentrations of 10(-6) and 10(-5) stimulates the incorporation of [3H]uridine into polysomal mRNA during the first 1--3 hours after treatment and enhances the accumulation of newly synthesized mRNA in pea embryonic polyribosomes. The stimulating effect is directly proportional to the dose of the hormone. The mechanisms of GA effect on the transcription and translation in pea plant cells are discussed. PMID:6177351

  2. Enhancement of Polyribosome Formation and RNA Synthesis of Gibberellic Acid in Wounded Potato Tuber Tissue 1

    PubMed Central

    Wielgat, Bernard; Kahl, Günter

    1979-01-01

    As part of a more detailed study on plant tumorigenesis, the action of gibberellic acid (GA3) in wounded potato tuber tissues as a model system has been evaluated. GA3 stimulates total RNA synthesis in wounded tissues, the optimal concentration being 0.1 micromolar. The responsiveness of the tissue toward the hormone develops with time after wounding. Whereas freshly wounded tissue does not respond at all to the hormone, it becomes competent after about 6 hours, the competence being maximal after 1 day of wound healing. GA3 enhances the formation of polyribosomes in wounded tissues and stimulates the synthesis of both ribosomal RNAs, transfer RNAs, 5S RNA, and a fraction, which in sucrose density gradients sediments between 18S rRNA and 5S RNA. This fraction contains presumptive mRNA. The hormone, then, is somehow recognized by wounded potato tissue in a time-specific way; the signal is transferred to the genome and triggers the synthesis of various RNA species. PMID:16661070

  3. Intersection of RNA Processing and the Type II Fatty Acid Synthesis Pathway in Yeast Mitochondria▿

    PubMed Central

    Schonauer, Melissa S.; Kastaniotis, Alexander J.; Hiltunen, J. Kalervo; Dieckmann, Carol L.

    2008-01-01

    Distinct metabolic pathways can intersect in ways that allow hierarchical or reciprocal regulation. In a screen of respiration-deficient Saccharomyces cerevisiae gene deletion strains for defects in mitochondrial RNA processing, we found that lack of any enzyme in the mitochondrial fatty acid type II biosynthetic pathway (FAS II) led to inefficient 5′ processing of mitochondrial precursor tRNAs by RNase P. In particular, the precursor containing both RNase P RNA (RPM1) and tRNAPro accumulated dramatically. Subsequent Pet127-driven 5′ processing of RPM1 was blocked. The FAS II pathway defects resulted in the loss of lipoic acid attachment to subunits of three key mitochondrial enzymes, which suggests that the octanoic acid produced by the pathway is the sole precursor for lipoic acid synthesis and attachment. The protein component of yeast mitochondrial RNase P, Rpm2, is not modified by lipoic acid in the wild-type strain, and it is imported in FAS II mutant strains. Thus, a product of the FAS II pathway is required for RNase P RNA maturation, which positively affects RNase P activity. In addition, a product is required for lipoic acid production, which is needed for the activity of pyruvate dehydrogenase, which feeds acetyl-coenzyme A into the FAS II pathway. These two positive feedback cycles may provide switch-like control of mitochondrial gene expression in response to the metabolic state of the cell. PMID:18779316

  4. Antibacterial activity of lichen secondary metabolite usnic acid is primarily caused by inhibition of RNA and DNA synthesis.

    PubMed

    Maciąg-Dorszyńska, Monika; Węgrzyn, Grzegorz; Guzow-Krzemińska, Beata

    2014-04-01

    Usnic acid, a compound produced by various lichen species, has been demonstrated previously to inhibit growth of different bacteria and fungi; however, mechanism of its antimicrobial activity remained unknown. In this report, we demonstrate that usnic acid causes rapid and strong inhibition of RNA and DNA synthesis in Gram-positive bacteria, represented by Bacillus subtilis and Staphylococcus aureus, while it does not inhibit production of macromolecules (DNA, RNA, and proteins) in Escherichia coli, which is resistant to even high doses of this compound. However, we also observed slight inhibition of RNA synthesis in a Gram-negative bacterium, Vibrio harveyi. Inhibition of protein synthesis in B. subtilis and S. aureus was delayed, which suggest indirect action (possibly through impairment of transcription) of usnic acid on translation. Interestingly, DNA synthesis was halted rapidly in B. subtilis and S. aureus, suggesting interference of usnic acid with elongation of DNA replication. We propose that inhibition of RNA synthesis may be a general mechanism of antibacterial action of usnic acid, with additional direct mechanisms, such as impairment of DNA replication in B. subtilis and S. aureus. PMID:24571086

  5. Circular RNA oligonucleotides. Synthesis, nucleic acid binding properties, and a comparison with circular DNAs.

    PubMed Central

    Wang, S; Kool, E T

    1994-01-01

    We report the synthesis and nucleic acid binding properties of two cyclic RNA oligonucleotides designed to bind single-stranded nucleic acids by pyr.pur.pyr-type triple helix formation. The circular RNAs are 34 nucleotides in size and were cyclized using a template-directed nonenzymatic ligation. To ensure isomeric 3'-5' purity in the ligation reaction, one nucleotide at the ligation site is a 2'-deoxyribose. One circle (1) is complementary to the sequence 5'-A12, and the second (2) is complementary to 5'-AAGAAAGAAAAG. Results of thermal denaturation experiments and mixing studies show that both circles bind complementary single-stranded DNA or RNA substrates by triple helix formation, in which two domains in a pyrimidine-rich circle sandwich a central purine-rich substrate. The affinities of these circles with their purine complements are much higher than the affinities of either the linear precursors or simple Watson-Crick DNA complements. For example, circle 1 binds rA12 (pH 7.0, 10 mM MgCl2, 100 mM NaCl) with a Tm of 48 degrees C and a Kd (37 degrees C) of 4.1 x 10(-9) M, while the linear precursor of the circle binds with a Tm of 34 degrees C and a Kd of 1.2 x 10(-6) M. The complexes of circle 2 are pH-dependent, as expected for triple helical complexes involving C(+)G.C triads, and mixing plots for both circles reveal one-to-one stoichiometry of binding either to RNA or DNA substrates. Comparison of circular RNAs with previously synthesized circular DNA oligonucleotides of the same sequence reveals similar behavior in the binding of DNA, but strikingly different behavior in the binding of RNA. The cyclic DNAs show high DNA-binding selectivity, giving relatively weaker duplex-type binding with complementary RNAs. The relative order of thermodynamic stability for the four types of triplex studied here is found to be DDD >> RRR > RDR >> DRD. The results are discussed in the context of recent reports of strong triplex dependence on RNA versus DNA backbones

  6. Circular RNA oligonucleotides. Synthesis, nucleic acid binding properties, and a comparison with circular DNAs.

    PubMed

    Wang, S; Kool, E T

    1994-06-25

    We report the synthesis and nucleic acid binding properties of two cyclic RNA oligonucleotides designed to bind single-stranded nucleic acids by pyr.pur.pyr-type triple helix formation. The circular RNAs are 34 nucleotides in size and were cyclized using a template-directed nonenzymatic ligation. To ensure isomeric 3'-5' purity in the ligation reaction, one nucleotide at the ligation site is a 2'-deoxyribose. One circle (1) is complementary to the sequence 5'-A12, and the second (2) is complementary to 5'-AAGAAAGAAAAG. Results of thermal denaturation experiments and mixing studies show that both circles bind complementary single-stranded DNA or RNA substrates by triple helix formation, in which two domains in a pyrimidine-rich circle sandwich a central purine-rich substrate. The affinities of these circles with their purine complements are much higher than the affinities of either the linear precursors or simple Watson-Crick DNA complements. For example, circle 1 binds rA12 (pH 7.0, 10 mM MgCl2, 100 mM NaCl) with a Tm of 48 degrees C and a Kd (37 degrees C) of 4.1 x 10(-9) M, while the linear precursor of the circle binds with a Tm of 34 degrees C and a Kd of 1.2 x 10(-6) M. The complexes of circle 2 are pH-dependent, as expected for triple helical complexes involving C(+)G.C triads, and mixing plots for both circles reveal one-to-one stoichiometry of binding either to RNA or DNA substrates. Comparison of circular RNAs with previously synthesized circular DNA oligonucleotides of the same sequence reveals similar behavior in the binding of DNA, but strikingly different behavior in the binding of RNA. The cyclic DNAs show high DNA-binding selectivity, giving relatively weaker duplex-type binding with complementary RNAs. The relative order of thermodynamic stability for the four types of triplex studied here is found to be DDD > RRR > RDR > DRD. The results are discussed in the context of recent reports of strong triplex dependence on RNA versus DNA backbones. Triplex

  7. Nonenzymatic synthesis of RNA and DNA oligomers on hexitol nucleic acid templates: the importance of the A structure

    NASA Technical Reports Server (NTRS)

    Kozlov, I. A.; Politis, P. K.; Van Aerschot, A.; Busson, R.; Herdewijn, P.; Orgel, L. E.; Bada, J. L. (Principal Investigator); Dolan, M. (Principal Investigator)

    1999-01-01

    Hexitol nucleic acid (HNA) is an analogue of DNA containing the standard nucleoside bases, but with a phosphorylated 1,5-anhydrohexitol backbone. HNA oligomers form duplexes having the nucleic acid A structure with complementary DNA or RNA oligomers. The HNA decacytidylate oligomer is an efficient template for the oligomerization of the 5'-phosphoroimidazolides of guanosine or deoxyguanosine. Comparison of the oligomerization efficiencies on HNA, RNA, and DNA decacytidylate templates under various conditions suggests strongly that only nucleic acid double helices with the A structure support efficient template-directed synthesis when 5'-phosphoroimidazolides of nucleosides are used as substrates.

  8. Influenza virion transcriptase: synthesis in vitro of large, polyadenylic acid-containing complementary RNA.

    PubMed Central

    Plotch, S J; Krug, R M

    1977-01-01

    The influenza virion transcriptase is capable of synthesizing in vitro complementary RNA (cRNA) that is similar in several characteristics to the cRNA synthesized in the infected cell, which is the viral mRNA. Most of the in vitro cRNA is large (approximately 2.5 X 10(5) to 10(6) daltons), similar in size to in vivo cRNA. The in vitro transcripts initiate in adenosine (A) or guanosine (G) at the 5' end, as also appears to be the case with in vivo cRNA (R.M. Krug et al., 1976). The in vitro transcripts contain covalently linked polyadenylate [poly(A)] sequences, which are longer and more heterogeneous than the poly(A) sequences found on in vivo cRNA. The synthesis in vitro of cRNA with these characteristics requires both the proper divalent cation, Mg2+, and a specific dinulceside monophosphage (DNMP), ApG or GpG. These DNMPs stimulate cRNA synthesis about 100-fold in the presence of Mg2+ and act as primers to initiate RNA chains, as demonstrated by the fact that the 5'-phosphorylated derivatives of these DNMP's, 32pApG or 32pGpG, are incroporated at the 5' end of the product RNA. The RNA synthesized in vitro differs from in vivo cRNA in that neither capping nor methylation of the in vitro transcripts has been detected. The virion does contain a methylase activity, as shown by its ability to methylate exogenous methyl-deficient Escherichia coli tRNA. PMID:833924

  9. MicroRNA-24 can control triacylglycerol synthesis in goat mammary epithelial cells by targeting the fatty acid synthase gene.

    PubMed

    Wang, H; Luo, J; Chen, Z; Cao, W T; Xu, H F; Gou, D M; Zhu, J J

    2015-12-01

    In nonruminants it has been demonstrated that microRNA-24 (miR-24) is involved in preadipocyte differentiation, hepatic lipid, and plasma triacylglycerol synthesis. However, its role in ruminant mammary gland remains unclear. In this study we measured miR-24 expression in goat mammary gland tissue at 4 different stages of lactation and observed that it had highest expression at peak lactation when compared with the dry period. Overexpression or downregulation of miR-24 in goat mammary epithelial cells (GMEC) strongly affected fatty acid profiles; in particular, miR-24 enhanced unsaturated fatty acid concentration. Additional effects of miR-24 included changes in triacylglycerol content and the expression of fatty acid synthase, sterol regulatory element binding transcription protein 1, stearoyl-CoA desaturase, glycerol-3-phosphate acyltransferase mitochondrial, and acetyl-CoA carboxylase. Luciferase reporter assay confirmed that fatty acid synthase is a target of miR-24. Taken together, these results not only highlight the physiological importance of miR-24 in fatty acid metabolism in GMEC, but also laid the foundation for further research on regulatory mechanisms among miR-24 and other microRNA expressed in GMEC. PMID:26476938

  10. Flavivirus RNA synthesis in vitro.

    PubMed

    Padmanabhan, Radhakrishnan; Takhampunya, Ratree; Teramoto, Tadahisa; Choi, Kyung H

    2015-12-01

    Establishment of in vitro systems to study mechanisms of RNA synthesis for positive strand RNA viruses have been very useful in the past and have shed light on the composition of protein and RNA components, optimum conditions, the nature of the products formed, cis-acting RNA elements and trans-acting protein factors required for efficient synthesis. In this review, we summarize our current understanding regarding the requirements for flavivirus RNA synthesis in vitro. We describe details of reaction conditions, the specificity of template used by either the multi-component membrane-bound viral replicase complex or by purified, recombinant RNA-dependent RNA polymerase. We also discuss future perspectives to extend the boundaries of our knowledge. PMID:26272247

  11. Ribonucleic Acid Synthesis in Cells Infected with Herpes Simplex Virus: Controls of Transcription and of RNA Abundance*

    PubMed Central

    Frenkel, Niza; Roizman, Bernard

    1972-01-01

    Analysis of the kinetics of hybridization in liquid of labeled herpes simplex virus-1 DNA and excess viral RNA revealed the following: (i) Cells infected by herpes simplex virus-1 for 2 hr (before DNA synthesis) contain two classes of RNA molecules differing 140-fold in molar concentrations. The abundant and scarce RNAs are transcribed from 14 and 30% of the DNA, respectively. RNA extracted at 8 hr after infection (late RNA) also contains abundant and scarce classes differing 40-fold in molar concentrations; these are transcribed from 19 and 28% of viral DNA, respectively. Abundance competition hybridization tests indicate that the abundant RNA at 2 hr is a subset of the 8-hr abundant RNA. (ii) The abundant RNAs probably specify structural proteins, as indicated by estimates of DNA template required for structural proteins and by experiments showing that 19 of 24 proteins (corresponding to 68% of genetic information for structural proteins) are already made between 0.5 and 2 hr after infection. We conclude that there are two types of transcriptional controls, i.e., on-off and abundance controls, and that the synthesis of most structural components is an early viral function. PMID:4341703

  12. Catalysis and prebiotic RNA synthesis

    NASA Technical Reports Server (NTRS)

    Ferris, James P.

    1993-01-01

    The essential role of catalysis for the origins of life is discussed. The status of the prebiotic synthesis of 2',5'- and 3'5'-linked oligomers of RNA is reviewed. Examples of the role of metal ion and mineral catalysis in RNA oligomer formation are discussed.

  13. Synthesis of RNA oligomers on heterogeneous templates

    NASA Technical Reports Server (NTRS)

    Ertem, G.; Ferris, J. P.

    1996-01-01

    The concept of an RNA world in the chemical origin of life is appealing, as nucleic acids are capable of both information storage and acting as templates that catalyse the synthesis of complementary molecules. Template-directed synthesis has been demonstrated for homogeneous oligonucleotides that, like natural nucleic acids, have 3',5' linkages between the nucleotide monomers. But it seems likely that prebiotic routes to RNA-like molecules would have produced heterogeneous molecules with various kinds of phosphodiester linkages and both linear and cyclic nucleotide chains. Here we show that such heterogeneity need be no obstacle to the templating of complementary molecules. Specifically, we show that heterogeneous oligocytidylates, formed by the montmorillonite clay-catalysed condensation of actuated monomers, can serve as templates for the synthesis of oligoguanylates. Furthermore, we show that oligocytidylates that are exclusively 2',5'-linked can also direct synthesis of oligoguanylates. Such heterogeneous templating reactions could have increased the diversity of the pool of protonucleic acids from which life ultimately emerged.

  14. Ribonucleic acid (RNA) biosynthesis in human cancer.

    PubMed

    Hajjawi, Omar S

    2015-01-01

    In many respects, the most remarkable chemical substances within the genome of eukaryotic cells are remarkable proteins which are the critical structural and functional units of living cells. The specifications for everything that goes in the cell are natural digital-to-digital decoding process in an archive sequence by deoxyribonucleic acid (DNA) and an articulate construction by ribonucleic acid (RNA). The products of DNA transcription are long polymers of ribonucleotides rather than deoxyribonucleotides and are termed ribonucleic acids. Certain deoxyribonucleotide sequences, or genes, give rise to transfer RNA (tRNA) and other ribosomal RNA (rRNA) when transcribed. The ribonucleotide sequences fold extensively and rRNA is associated with specific proteins to yield the essential cell components, ribosomes. Transcription of other special sequences yields messenger RNAs (mRNAs) that contain ribonucleotide sequences that will be ultimately translated into new types of amino acid sequences of functional cellular protein molecules. This switch to a different variety of cellular molecular sequences is complex, but each sequence of the three ribonucleotides specifies the insertion of one particular amino acid into the polypeptide chain under production. Whilst mRNA is considered the vehicle by which genetic information is transmitted from the genome and allocated in the appropriate cytoplasmic sites for translation into protein via cap-dependent mechanism, the actual translation depends also on the presence of other so-called household and luxury protein molecules. Recent evidence suggests RNA species are required at initiation, because treatment of cells with antibiotics or drugs that inhibit RNA synthesis cause a decrease in protein synthesis. The rRNA is necessary as a structural constituent of the ribosomes upon which translation takes place, whereas tRNA is necessary as an adaptor in amino acid activation and elongation protein chains to ribosomes. In this article

  15. Initiation of minus-strand RNA synthesis by the brome mosaicvirus RNA-dependent RNA polymerase: use of oligoribonucleotide primers.

    PubMed Central

    Kao, C C; Sun, J H

    1996-01-01

    Various DNA- and RNA-dependent RNA polymerases have been reported to use oligoribonucleotide primers to initiate nucleic acid synthesis. For the brome mosaic virus RNA-dependent RNA polymerase (RdRp), we determined that in reactions performed with limited GTP concentrations, minus-strand RNA synthesis can be stimulated by the inclusion of guanosine monophosphate or specific oligoribonucleotides. Furthermore, guanylyl-3',5'-guanosine (GpG) was incorporated into minus-strand RNA and increased the rate of minus-strand RNA synthesis. In the presence of GpG, RdRp's Km for GTP decreased from 50 microM to approximately 3 microM while the Kms for other nucleotides were unaffected. These results have implications for the mechanism of initiation by RdRp. PMID:8794323

  16. Synthesis and antisense properties of fluoro cyclohexenyl nucleic acid (F-CeNA), a nuclease stable mimic of 2'-fluoro RNA.

    PubMed

    Seth, Punit P; Yu, Jinghua; Jazayeri, Ali; Pallan, Pradeep S; Allerson, Charles R; Østergaard, Michael E; Liu, Fengwu; Herdewijn, Piet; Egli, Martin; Swayze, Eric E

    2012-06-01

    We report the design and synthesis of 2'-fluoro cyclohexenyl nucleic acid (F-CeNA) pyrimidine phosphoramidites and the synthesis and biophysical, structural, and biological evaluation of modified oligonucleotides. The synthesis of the nucleoside phosphoramidites was accomplished in multigram quantities starting from commercially available methyl-D-mannose pyranoside. Installation of the fluorine atom was accomplished using nonafluorobutanesulfonyl fluoride, and the cyclohexenyl ring system was assembled by means of a palladium-catalyzed Ferrier rearrangement. Installation of the nucleobase was carried out under Mitsunobu conditions followed by standard protecting group manipulations to provide the desired pyrimidine phosphoramidites. Biophysical evaluation indicated that F-CeNA shows behavior similar to that of a 2'-modified nucleotide, and duplexes with RNA showed slightly lower duplex thermostability as compared to that of the more rigid 3'-fluoro hexitol nucleic acid (FHNA). However, F-CeNA modified oligonucleotides were significantly more stable against digestion by snake venom phosphodiesterases (SVPD) as compared to unmodified DNA, 2'-fluoro RNA (FRNA), 2'-methoxyethyl RNA (MOE), and FHNA modified oligonucleotides. Examination of crystal structures of a modified DNA heptamer duplex d(GCG)-T*-d(GCG):d(CGCACGC) by X-ray crystallography indicated that the cyclohexenyl ring system exhibits both the (3)H(2) and (2)H(3) conformations, similar to the C3'-endo/C2'-endo conformation equilibrium seen in natural furanose nucleosides. In the (2)H(3) conformation, the equatorial fluorine engages in a relatively close contact with C8 (2.94 Å) of the 3'-adjacent dG nucleotide that may represent a pseudo hydrogen bond. In contrast, the cyclohexenyl ring of F-CeNA was found to exist exclusively in the (3)H(2) (C3'-endo like) conformation in the crystal structure of the modified A-form DNA decamer duplex [d(GCGTA)-T*-d(ACGC)](2.) In an animal experiment, a 16-mer F

  17. Synthesis of amino acids

    DOEpatents

    Davis, J.W. Jr.

    1979-09-21

    A method is described for synthesizing amino acids preceding through novel intermediates of the formulas: R/sub 1/R/sub 2/C(OSOC1)CN, R/sub 1/R/sub 2/C(C1)CN and (R/sub 1/R/sub 2/C(CN)O)/sub 2/SO wherein R/sub 1/ and R/sub 2/ are each selected from hydrogen and monovalent hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  18. RNA.

    ERIC Educational Resources Information Center

    Darnell, James E., Jr.

    1985-01-01

    Ribonucleic acid (RNA) converts genetic information into protein and usually must be processed to serve its function. RNA types, chemical structure, protein synthesis, translation, manufacture, and processing are discussed. Concludes that the first genes might have been spliced RNA and that humans might be closer than bacteria to primitive…

  19. Synthesis of (+)-Coronafacic Acid

    PubMed Central

    Taber, Douglass F.; Sheth, Ritesh B.; Tian, Weiwei

    2009-01-01

    An enantioselective synthesis of (+)-coronafacic acid has been achieved. Rhodium catalyzed cyclization of an α-diazoester provided the intermediate cyclopentanone in high enantiomeric purity. Subsequent Fe-mediated cyclocarbonylation of a derived alkenyl cyclopropane gave a bicyclic enone, that then was hydrogenated and carried on to the natural product. PMID:19231870

  20. Regulation of Flavivirus RNA synthesis and replication.

    PubMed

    Selisko, Barbara; Wang, Chunling; Harris, Eva; Canard, Bruno

    2014-12-01

    RNA synthesis and replication of the members of the Flavivirus genus (including dengue, West Nile and Japanese encephalitis viruses) is regulated by a wide variety of mechanisms and actors. These include the sequestration of the RNA-dependent RNA polymerase (RdRp) for functions other than RNA synthesis, regulatory interactions with other viral and host proteins within the replication complex (RC), and regulatory elements within the RNA genome itself. In this review, we discuss our current knowledge of the multiple levels at which Flavivirus RNA synthesis is controlled. We aim to bring together two active research fields: the structural and functional biology of individual proteins of the RC and the impressive wealth of knowledge acquired regarding the viral genomic RNA. PMID:25462437

  1. Regulation of Flavivirus RNA synthesis and replication

    PubMed Central

    Selisko, Barbara; Wang, Chunling; Harris, Eva; Canard, Bruno

    2014-01-01

    RNA synthesis and replication of the members of the Flavivirus genus (including dengue, West Nile and Japanese encephalitis viruses) is regulated by a wide variety of mechanisms and actors. These include the sequestration of the RNA-dependent RNA polymerase (RdRp) for functions other than RNA synthesis, regulatory interactions with other viral and host proteins within the replication complex (RC), and regulatory elements within the RNA genome itself. In this review, we discuss our current knowledge of the multiple levels at which Flavivirus RNA synthesis is controlled. We aim to bring together two active research fields: the structural and functional biology of individual proteins of the RC and the impressive wealth of knowledge acquired regarding the viral genomic RNA. PMID:25462437

  2. Synthesis, improved antisense activity and structural rationale for the divergent RNA affinities of 3'-fluoro hexitol nucleic acid (FHNA and Ara-FHNA) modified oligonucleotides.

    PubMed

    Egli, Martin; Pallan, Pradeep S; Allerson, Charles R; Prakash, Thazha P; Berdeja, Andres; Yu, Jinghua; Lee, Sam; Watt, Andrew; Gaus, Hans; Bhat, Balkrishen; Swayze, Eric E; Seth, Punit P

    2011-10-19

    The synthesis, biophysical, structural, and biological properties of both isomers of 3'-fluoro hexitol nucleic acid (FHNA and Ara-FHNA) modified oligonucleotides are reported. Synthesis of the FHNA and Ara-FHNA thymine phosphoramidites was efficiently accomplished starting from known sugar precursors. Optimal RNA affinities were observed with a 3'-fluorine atom and nucleobase in a trans-diaxial orientation. The Ara-FHNA analog with an equatorial fluorine was found to be destabilizing. However, the magnitude of destabilization was sequence-dependent. Thus, the loss of stability is sharply reduced when Ara-FHNA residues were inserted at pyrimidine-purine (Py-Pu) steps compared to placement within a stretch of pyrimidines (Py-Py). Crystal structures of A-type DNA duplexes modified with either monomer provide a rationalization for the opposing stability effects and point to a steric origin of the destabilization caused by the Ara-FHNA analog. The sequence dependent effect can be explained by the formation of an internucleotide C-F···H-C pseudo hydrogen bond between F3' of Ara-FHNA and C8-H of the nucleobase from the 3'-adjacent adenosine that is absent at Py-Py steps. In animal experiments, FHNA-modified antisense oligonucleotides formulated in saline showed a potent downregulation of gene expression in liver tissue without producing hepatotoxicity. Our data establish FHNA as a useful modification for antisense therapeutics and also confirm the stabilizing influence of F(Py)···H-C(Pu) pseudo hydrogen bonds in nucleic acid structures. PMID:21919455

  3. Synthesis, Improved Antisense Activity and Structural Rationale for the Divergent RNA Affinities of 3;#8242;-Fluoro Hexitol Nucleic Acid (FHNA and Ara-FHNA) Modified Oligonucleotides

    SciTech Connect

    Egli, Martin; Pallan, Pradeep S.; Allerson, Charles R.; Prakash, Thazha P.; Berdeja, Andres; Yu, Jinghua; Lee, Sam; Watt, Andrew; Gaus, Hans; Bhat, Balkrishen; Swayze, Eric E.; Seth, Punit P.

    2012-03-16

    The synthesis, biophysical, structural, and biological properties of both isomers of 3'-fluoro hexitol nucleic acid (FHNA and Ara-FHNA) modified oligonucleotides are reported. Synthesis of the FHNA and Ara-FHNA thymine phosphoramidites was efficiently accomplished starting from known sugar precursors. Optimal RNA affinities were observed with a 3'-fluorine atom and nucleobase in a trans-diaxial orientation. The Ara-FHNA analog with an equatorial fluorine was found to be destabilizing. However, the magnitude of destabilization was sequence-dependent. Thus, the loss of stability is sharply reduced when Ara-FHNA residues were inserted at pyrimidine-purine (Py-Pu) steps compared to placement within a stretch of pyrimidines (Py-Py). Crystal structures of A-type DNA duplexes modified with either monomer provide a rationalization for the opposing stability effects and point to a steric origin of the destabilization caused by the Ara-FHNA analog. The sequence dependent effect can be explained by the formation of an internucleotide C-F {hor_ellipsis} H-C pseudo hydrogen bond between F3' of Ara-FHNA and C8-H of the nucleobase from the 3'-adjacent adenosine that is absent at Py-Py steps. In animal experiments, FHNA-modified antisense oligonucleotides formulated in saline showed a potent downregulation of gene expression in liver tissue without producing hepatotoxicity. Our data establish FHNA as a useful modification for antisense therapeutics and also confirm the stabilizing influence of F(Py) {hor_ellipsis} H-C(Pu) pseudo hydrogen bonds in nucleic acid structures.

  4. Enhancement of RNA Synthesis, Protein Synthesis, and Abscission by Ethylene

    PubMed Central

    Abeles, F. B.; Holm, R. E.

    1966-01-01

    Ethylene stimulated RNA and protein synthesis in bean (Phaseolus vulgaris L. var. Red Kidney) abscission zone explants prior to abscission. The effect of ethylene on RNA synthesis and abscission was blocked by actinomycin D. Carbon dioxide, which inhibits the effect of ethylene on abscission, also inhibited the influence of ethylene on protein synthesis. An aging period appears to be essential before bean explants respond to ethylene. Stimulation of protein synthesis by ethylene occurred only in receptive or senescent explants. Treatment of juvenile explants with ethylene, which has no effect on abscission also has no effect on protein synthesis. Evidence in favor of a hormonal role for ethylene during abscission is discussed. PMID:16656405

  5. Prebiotic RNA Synthesis by Montmorillonite Catalysis

    NASA Astrophysics Data System (ADS)

    Jheeta, Sohan; Joshi, Prakash C.

    2014-08-01

    This review summarizes our recent findings on the role of mineral salts in prebiotic RNA synthesis, which is catalyzed by montmorillonite clay minerals. The clay minerals not only catalyze the synthesis of RNA but also facilitate homochiral selection. Preliminary data of these findings have been presented at the "Horizontal Gene Transfer and the Last Universal Common Ancestor (LUCA)" conference at the Open University, Milton Keynes, UK, 5-6 September 2013. The objective of this meeting was to recognize the significance of RNA in LUCA. We believe that the prebiotic RNA synthesis from its monomers must have been a simple process. As a first step, it may have required activation of the 5'-end of the mononucleotide with a leaving group, e.g., imidazole in our model reaction (Figure 1). Wide ranges of activating groups are produced from HCN under plausible prebiotic Earth conditions. The final step is clay mineral catalysis in the presence of mineral salts to facilitate selective production of functional RNA. Both the clay minerals and mineral salts would have been abundant on early Earth. We have demonstrated that while montmorillonite (pH 7) produced only dimers from its monomers in water, addition of sodium chloride (1 M) enhanced the chain length multifold, as detected by HPLC. The effect of monovalent cations on RNA synthesis was of the following order: Li+ > Na+ > K+. A similar effect was observed with the anions, enhancing catalysis in the following order: Cl- > Br- > I-. The montmorillonite-catalyzed RNA synthesis was not affected by hydrophobic or hydrophilic interactions. We thus show that prebiotic synthesis of RNA from its monomers was a simple process requiring only clay minerals and a small amount of salt.

  6. Prebiotic RNA Synthesis by Montmorillonite Catalysis

    PubMed Central

    Jheeta, Sohan; Joshi, Prakash C.

    2014-01-01

    This review summarizes our recent findings on the role of mineral salts in prebiotic RNA synthesis, which is catalyzed by montmorillonite clay minerals. The clay minerals not only catalyze the synthesis of RNA but also facilitate homochiral selection. Preliminary data of these findings have been presented at the “Horizontal Gene Transfer and the Last Universal Common Ancestor (LUCA)” conference at the Open University, Milton Keynes, UK, 5–6 September 2013. The objective of this meeting was to recognize the significance of RNA in LUCA. We believe that the prebiotic RNA synthesis from its monomers must have been a simple process. As a first step, it may have required activation of the 5'-end of the mononucleotide with a leaving group, e.g., imidazole in our model reaction (Figure 1). Wide ranges of activating groups are produced from HCN under plausible prebiotic Earth conditions. The final step is clay mineral catalysis in the presence of mineral salts to facilitate selective production of functional RNA. Both the clay minerals and mineral salts would have been abundant on early Earth. We have demonstrated that while montmorillonite (pH 7) produced only dimers from its monomers in water, addition of sodium chloride (1 M) enhanced the chain length multifold, as detected by HPLC. The effect of monovalent cations on RNA synthesis was of the following order: Li+ > Na+ > K+. A similar effect was observed with the anions, enhancing catalysis in the following order: Cl− > Br− > I−. The montmorillonite-catalyzed RNA synthesis was not affected by hydrophobic or hydrophilic interactions. We thus show that prebiotic synthesis of RNA from its monomers was a simple process requiring only clay minerals and a small amount of salt. PMID:25370375

  7. How Amino Acids and Peptides Shaped the RNA World

    PubMed Central

    van der Gulik, Peter T.S.; Speijer, Dave

    2015-01-01

    The “RNA world” hypothesis is seen as one of the main contenders for a viable theory on the origin of life. Relatively small RNAs have catalytic power, RNA is everywhere in present-day life, the ribosome is seen as a ribozyme, and rRNA and tRNA are crucial for modern protein synthesis. However, this view is incomplete at best. The modern protein-RNA ribosome most probably is not a distorted form of a “pure RNA ribosome” evolution started out with. Though the oldest center of the ribosome seems “RNA only”, we cannot conclude from this that it ever functioned in an environment without amino acids and/or peptides. Very small RNAs (versatile and stable due to basepairing) and amino acids, as well as dipeptides, coevolved. Remember, it is the amino group of aminoacylated tRNA that attacks peptidyl-tRNA, destroying the bond between peptide and tRNA. This activity of the amino acid part of aminoacyl-tRNA illustrates the centrality of amino acids in life. With the rise of the “RNA world” view of early life, the pendulum seems to have swung too much towards the ribozymatic part of early biochemistry. The necessary presence and activity of amino acids and peptides is in need of highlighting. In this article, we try to bring the role of the peptide component of early life back into focus. We argue that an RNA world completely independent of amino acids never existed. PMID:25607813

  8. Initiator RNA in Discontinuous Polyoma DNA Synthesis*

    PubMed Central

    Reichard, Peter; Eliasson, Rolf; Söderman, Gunilla

    1974-01-01

    During replication of polyoma DNA in isolated nuclei, RNA was found attached to the 5′ ends of growing progeny strands. This RNA starts with either ATP or GTP and can be labeled at its 5′ end with 32P from β-labeled nucleotides. Digestion of progeny strands with pancreatic DNase released 32P-labeled RNA that, on gel electrophoresis, gave a distinct peak in the position expected for a decanucleotide. We believe that this short RNA is involved in the initiation of the discontinuous synthesis of DNA and propose the name “initiator RNA” for it. The covalent linkage of initiator RNA to 5′ ends of growing DNA chains was substantiated by the finding that 32P was transferred to ribonucleotides by alkaline hydrolysis of purified initiator RNA obtained by DNase digestion of polyoma progeny strands synthesized from [α-32P]dTTP. While initiator RNA was quite homogeneous in size, it had no unique base sequence since digestion with pancreatic RNase of initiator RNA labeled at its 5′ end with 32P released a variety of different [32P]oligonucleotides. The switch from RNA to DNA synthesis during strand elongation may thus depend on the size of initiator RNA rather than on a specific base sequence. PMID:4373733

  9. The RNA synthesis machinery of negative-stranded RNA viruses

    SciTech Connect

    Ortín, Juan; Martín-Benito, Jaime

    2015-05-15

    The group of Negative-Stranded RNA Viruses (NSVs) includes many human pathogens, like the influenza, measles, mumps, respiratory syncytial or Ebola viruses, which produce frequent epidemics of disease and occasional, high mortality outbreaks by transmission from animal reservoirs. The genome of NSVs consists of one to several single-stranded, negative-polarity RNA molecules that are always assembled into mega Dalton-sized complexes by association to many nucleoprotein monomers. These RNA-protein complexes or ribonucleoproteins function as templates for transcription and replication by action of the viral RNA polymerase and accessory proteins. Here we review our knowledge on these large RNA-synthesis machines, including the structure of their components, the interactions among them and their enzymatic activities, and we discuss models showing how they perform the virus transcription and replication programmes. - Highlights: • Overall organisation of NSV RNA synthesis machines. • Structure and function of the ribonucleoprotein components: Atomic structure of the RNA polymerase complex. • Commonalities and differences between segmented- and non-segmented NSVs. • Transcription versus replication programmes.

  10. Cumulus expansion, nuclear maturation and connexin 43, cyclooxygenase-2 and FSH receptor mRNA expression in equine cumulus-oocyte complexes cultured in vitro in the presence of FSH and precursors for hyaluronic acid synthesis

    PubMed Central

    Dell'Aquila, Maria Elena; Caillaud, Maud; Maritato, Filippo; Martoriati, Alain; Gérard, Nadine; Aiudi, Giulio; Minoia, Paolo; Goudet, Ghylène

    2004-01-01

    The aim of this study was to investigate cumulus expansion, nuclear maturation and expression of connexin 43, cyclooxygenase-2 and FSH receptor transcripts in equine cumuli oophori during in vivo and in vitro maturation in the presence of equine FSH (eFSH) and precursors for hyaluronic acid synthesis. Equine cumulus-oocyte complexes (COC) were cultured in a control defined medium supplemented with eFSH (0 to 5 micrograms/ml), Fetal Calf Serum (FCS), precursors for hyaluronic acid synthesis or glutamine according to the experiments. After in vitro maturation, the cumulus expansion rate was increased with 1 microgram/ml eFSH, and was the highest with 20% FCS. It was not influenced by precursors for hyaluronic acid synthesis or glutamine. The expression of transcripts related to cumulus expansion was analyzed in equine cumulus cells before maturation, and after in vivo and in vitro maturation, by using reverse transcription-polymerase chain reaction (RT-PCR) with specific primers. Connexin 43, cyclooxygenase-2 (COX-2) and FSH receptor (FSHr) mRNA were detected in equine cumulus cells before and after maturation. Their level did not vary during in vivo or in vitro maturation and was influenced neither by FSH nor by precursors for hyaluronic acid synthesis. Results indicate that previously reported regulation of connexin 43 and COX-2 proteins during equine COC maturation may involve post-transcriptional mechanisms. PMID:15212696

  11. Investigation of the prebiotic synthesis of amino acids and RNA bases from CO2 using FeS/H2S as a reducing agent.

    PubMed Central

    Keefe, A D; Miller, S L; McDonald, G; Bada, J

    1995-01-01

    An autotrophic theory of the origin of metabolism and life has been proposed in which carbon dioxide is reduced by ferrous sulfide and hydrogen sulfide by means of a reversed citric acid cycle, leading to the production of amino acids. Similar processes have been proposed for purine synthesis. Ferrous sulfide is a strong reducing agent in the presence of hydrogen sulfide and can produce hydrogen as well as reduce alkenes, alkynes, and thiols to saturated hydrocarbons and reduce ketones to thiols. However, the reduction of carbon dioxide has not been demonstrated. We show here that no amino acids, purines, or pyrimidines are produced from carbon dioxide with the ferrous sulfide and hydrogen sulfide system. Furthermore, this system does not produce amino acids from carboxylic acids by reductive amination and carboxylation. Thus, the proposed autotrophic theory, using carbon dioxide, ferrous sulfide, and hydrogen sulfide, lacks the robustness needed to be a geological process and is, therefore, unlikely to have played a role in the origin of metabolism or the origin of life. PMID:8524872

  12. Investigation of the Prebiotic Synthesis of Amino Acids and RNA Bases from CO2 using FeS/H2S as a Reducing Agent

    NASA Technical Reports Server (NTRS)

    Keefe, Anthony D.; Miller, Stanley L.; McDonald, Gene; Bada, Jeffrey

    1995-01-01

    An autotrophic theory of the origin of metabolism and life has been proposed in which carbon dioxide is reduced by ferrous sulfide and hydrogen sulfide by means of a reversed citric acid cycle, leading to the production of amino acids. Similar processes have been proposed for purine synthesis. Ferrous sulfide is a strong reducing agent in the presence of hydrogen sulfide and can produce hydrogen as well as reduce alkenes, alkynes, and thiols to saturated hydrocarbons and reduce ketones to thiols. However, the reduction of carbon dioxide has not been demonstrated. We show here that no amino acids, purines, or pyrimidines are produced from carbon dioxide with the ferrous sulfide and hydrogen sulfide system. Furthermore, this system does not produce amino acids from carboxylic acids by reductive amination and carboxylation. Thus, the proposed autotrophic theory, using carbon dioxide, ferrous sulfide, and hydrogen sulfide, lacks the robustness needed to be a geological process and is, therefore, unlikely to have played a role in the origin of metabolism or the origin of life.

  13. Investigation of the Prebiotic Synthesis of Amino Acids and RNA Bases from CO2 Using FeS/H2S As a Reducing Agent

    NASA Technical Reports Server (NTRS)

    Keefe, Anthony D.; Miller, Stanley L.; McDonald, Gene; Bada, Jeffrey

    1995-01-01

    An autotrophic theory of the origin of metabolism and life has been proposed in which carbon dioxide is reduced by ferrous sulfide and hydrogen sulfide by means of a reversed citric acid cycle, leading to the production of amino acids. Similar processes have been proposed for purine synthesis. Ferrous sulfide is a strong reducing agent in the presence of hydrogen sulfide and can produce hydrogen as well as reduce alkenes, alkynes, and thiols to saturated hydrocarbons and reduce ketones to thiols. However, the reduction of carbon dioxide has not been demonstrated. We show here that no amino acids, purities, or pyrimidines are produced from carbon dioxide with the ferrous sulfide and hydrogen sulfide system. Furthermore, this system does not produce amino acids from carboxylic acids by reductive amination and carboxylation. Thus, the proposed autotrophic theory, using carbon dioxide, ferrous sulfide, and hydrogen sulfide, lacks the robustness needed to be a geological process and is, therefore, unlikely to have played a role In the origin of metabolism or the origin of life.

  14. RNA template-directed RNA synthesis by T7 RNA polymerase.

    PubMed Central

    Cazenave, C; Uhlenbeck, O C

    1994-01-01

    In an attempt to synthesize an oligoribonucleotide by run-off transcription by bacteriophage T7 RNA polymerase, a major transcript was produced that was much longer than expected. Analysis of the reaction indicated that the product resulted from initial DNA-directed run-off transcription followed by RNA template-directed RNA synthesis. This reaction occurred because the RNA made from the DNA template displayed self-complementarity at its 3' end and therefore could form an intra- or intermolecular primed template. In reactions containing only an RNA template, the rate of incorporation of NTPs was quite comparable to DNA-dependent transcription. RNA template-directed RNA synthesis has been found to occur with a great number of oligoribonucleotides, even with primed templates that are only marginally stable. In one instance, we observed a multistep extension reaction converting the oligonucleotide into a final product longer than twice its original length. Presumably, such a process could have generated some of the RNAs found to be efficiently replicated by T7 RNA polymerase. Images PMID:7518923

  15. Membrane Requirements for Uridylylation of the Poliovirus VPg Protein and Viral RNA Synthesis In Vitro

    PubMed Central

    Fogg, Mark H.; Teterina, Natalya L.; Ehrenfeld, Ellie

    2003-01-01

    Efficient translation of poliovirus (PV) RNA in uninfected HeLa cell extracts generates all of the viral proteins required to carry out viral RNA replication and encapsidation and to produce infectious virus in vitro. In infected cells, viral RNA replication occurs in ribonucleoprotein complexes associated with clusters of vesicles that are formed from preexisting intracellular organelles, which serve as a scaffold for the viral RNA replication complex. In this study, we have examined the role of membranes in viral RNA replication in vitro. Electron microscopic and biochemical examination of extracts actively engaged in viral RNA replication failed to reveal a significant increase in vesicular membrane structures or the protective aggregation of vesicles observed in PV-infected cells. Viral, nonstructural replication proteins, however, bind to heterogeneous membrane fragments in the extract. Treatment of the extracts with nonionic detergents, a membrane-altering inhibitor of fatty acid synthesis (cerulenin), or an inhibitor of intracellular membrane trafficking (brefeldin A) prevents the formation of active replication complexes in vitro, under conditions in which polyprotein synthesis and processing occur normally. Under all three of these conditions, synthesis of uridylylated VPg to form the primer for initiation of viral RNA synthesis, as well as subsequent viral RNA replication, was inhibited. Thus, although organized membranous structures morphologically similar to the vesicles observed in infected cells do not appear to form in vitro, intact membranes are required for viral RNA synthesis, including the first step of forming the uridylylated VPg primer for RNA chain elongation. PMID:14557626

  16. Synthesis, base pairing and structure studies of geranylated RNA.

    PubMed

    Wang, Rui; Vangaveti, Sweta; Ranganathan, Srivathsan V; Basanta-Sanchez, Maria; Haruehanroengra, Phensinee; Chen, Alan; Sheng, Jia

    2016-07-27

    Natural RNAs utilize extensive chemical modifications to diversify their structures and functions. 2-Thiouridine geranylation is a special hydrophobic tRNA modification that has been discovered very recently in several bacteria, such as Escherichia coli, Enterobacter aerogenes, Pseudomonas aeruginosa and Salmonella Typhimurium The geranylated residues are located in the first anticodon position of tRNAs specific for lysine, glutamine and glutamic acid. This big hydrophobic terpene functional group affects the codon recognition patterns and reduces frameshifting errors during translation. We aimed to systematically study the structure, function and biosynthesis mechanism of this geranylation pathway, as well as answer the question of why nature uses such a hydrophobic modification in hydrophilic RNA systems. Recently, we have synthesized the deoxy-analog of S-geranyluridine and showed the geranylated T-G pair is much stronger than the geranylated T-A pair and other mismatched pairs in the B-form DNA duplex context, which is consistent with the observation that the geranylated tRNA(Glu) UUC recognizes GAG more efficiently than GAA. In this manuscript we report the synthesis and base pairing specificity studies of geranylated RNA oligos. We also report extensive molecular simulation studies to explore the structural features of the geranyl group in the context of A-form RNA and its effect on codon-anticodon interaction during ribosome binding. PMID:27307604

  17. Regulation of the Nucleolar DNA-Dependent RNA Polymerase by Amino Acids in Ehrlich Ascites Tumor Cells

    PubMed Central

    Franze-Fernández, M. T.; Pogo, A. O.

    1971-01-01

    Experiments were performed to ascertain the degree to which the amount of amino acids might be one of the regulatory factors that control the activity of the nucleolar RNA polymerase. Assays of the enzymatic activity were done with isolated nuclei from cells incubated with low and high concentrations of amino acids. Soon after the cells were exposed to a medium enriched in amino acids, a rapid increase of nucleolar RNA polymerase activity occurred. A similar result was obtained in cells incubated with lower concentrations of amino acids. However, the rate of ribosomal RNA synthesized was regularly much higher in cells incubated in a medium enriched with amino acids than in a medium low in amino acids. Apparently, the amino acids only controlled ribosomal RNA synthesis. Thus, neither maturation, processing, and transport of nuclear precursors into cytoplasmic ribosomal RNA, nor the synthesis of rapidly labeled RNA was affected. PMID:4108870

  18. Role of RNA and Protein Synthesis in Abscission

    PubMed Central

    Abeles, F. B.

    1968-01-01

    The cell separation aspect of abscission is thought to involve the action of specific cell wall degrading enzymes. Enzymes represent synthesis which in turn is preceded by the synthesis of specific RNA molecules, and it follows that inhibition of either of these processes would also block abscission. Since abscission is a localized phenomenon usually involving 2 or 3 cell layers, RNA and protein synthesis should also be localized. Manipulations of plant material which either accelerate or retard abscission may be due to the regulation of RNA and protein synthesis. This paper is a review of literature concerned with these and related questions. Images PMID:16657020

  19. Abiotic synthesis of fatty acids

    NASA Technical Reports Server (NTRS)

    Leach, W. W.; Nooner, D. W.; Oro, J.

    1978-01-01

    The formation of fatty acids by Fischer-Tropsch-type synthesis was investigated with ferric oxide, ammonium carbonate, potassium carbonate, powdered Pueblito de Allende carbonaceous chondrite, and filings from the Canyon Diablo meteorite used as catalysts. Products were separated and identified by gas chromatography and mass spectrometry. Iron oxide, Pueblito de Allende chondrite, and Canyon Diablo filings in an oxidized catalyst form yielded no fatty acids. Canyon Diablo filings heated overnight at 500 C while undergoing slow purging by deuterium produced fatty acids only when potassium carbonate was admixed; potassium carbonate alone also produced these compounds. The active catalytic combinations gave relatively high yields of aliphatic and aromatic hydrocarbons; substantial amounts of n-alkenes were almost invariably observed when fatty acids were produced; the latter were in the range C6 to C18, with maximum yield in C9 or 10.

  20. A Model for the Origin of Protein Synthesis as Coreplicational Scanning of Nascent RNA

    NASA Astrophysics Data System (ADS)

    Yakhnin, Alexander V.

    2007-12-01

    The origin of protein synthesis is one of the major riddles of molecular biology. It was proposed a decade ago that the ribosomal RNA evolved from an earlier RNA-replisome (a ribozyme fulfilling RNA replication) while transfer RNA (tRNA) evolved from a genomic replication origin. Applying these hypotheses, I suggest that protein synthesis arose for the purpose of segregating copy and template RNA during replication through the conventional formation of a complementary strand. Nascent RNA was scanned in 5' to 3' direction following the progress of replication. The base pairing of several tRNA-like molecules with nascent RNA released the replication intermediates trapped in duplex. Synthesis of random peptides evolved to fuel the turnover of tRNAs. Then the combination of replication-coupled peptide formation and the independent development of amino acid-specific tRNA aminoacylation resulted in template-based protein synthesis. Therefore, the positioning of tRNAs adjacent to each other developed for the purpose of replication rather than peptide synthesis. This hypothesis does not include either selection for useful peptides or specific recognition of amino acids at the initial evolution of translation. It does, however, explain a number of features of modern translation apparatus, such as the relative flexibility of genetic code, the number of proteins shared by the transcription and translation machines, the universal participation of an RNA subunit in co-translational protein secretion, ‘unscheduled translation’, and factor-independent translocation. Assistance of original ribosomes in keeping apart the nascent transcript from its template is still widely explored by modern bacteria and perhaps by other domains of life.

  1. Metabolic Labeling in the Study of Mammalian Ribosomal RNA Synthesis.

    PubMed

    Stefanovsky, Victor Y; Moss, Tom

    2016-01-01

    RNA metabolic labeling is a method of choice in the study of dynamic changes in the rate of gene transcription and RNA processing. It is particularly applicable to transcription of the ribosomal RNA genes and their processing products due to the very high levels of ribosomal RNA synthesis. Metabolic labeling can detect changes in ribosomal RNA transcription that occur within a few minutes as opposed to the still widely used RT-PCR or Northern blot procedures that measure RNA pool sizes and at best are able to detect changes occurring over several hours or several days. Here, we describe a metabolic labeling technique applicable to the measurement of ribosomal RNA synthesis and processing rates, as well as to the determination of RNA Polymerase I transcription elongation rates. PMID:27576716

  2. Effect of the “Ribonucleic Acid Control” Locus in Escherichia coli on T4 Bacteriophage-Specific Ribonucleic Acid Synthesis

    PubMed Central

    Sköld, Ola

    1970-01-01

    Amino acid control of ribonucleic acid (RNA) synthesis in bacteria is known to be governed genetically by the rel locus. We investigated whether the rel gene of the host would also exert its effect on the regulation of phage-specific RNA synthesis in T4 phage-infected Escherichia coli cells. Since T-even phage infection completely shuts off host macromolecular synthesis, phage RNA synthesis could be followed specifically by the cumulative incorporation of radioactivity from labeled precursors into RNA of infected cells. Labeled uracil was shown to accumulate in phage-specific RNA for 30 to 35 min after infection, a phenomenon which probably reflects an expansion of the labile phage-RNA pool. Amino acid starvation was effected by the use of auxotrophic bacterial strains or thienylalanine. The latter substance is an amino acid analogue which induces a chemical auxotrophy by inhibiting the biosynthesis of phenylalanine, tyrosine, and tryptophan. Phage RNA synthesis was strictly dependent on the presence of amino acids, whereas phage deoxyribonucleic acid synthesis was not. By the use of several pairs of bacterial strains which were isogenic except for the rel gene, it was demonstrated that amino acid dependence was related to the allelic state of this gene. If the rel gene was mutated, amino acid starvation did not restrict phage RNA synthesis. PMID:4914097

  3. A cis-acting mutation in the Sindbis virus junction region which affects subgenomic RNA synthesis.

    PubMed Central

    Grakoui, A; Levis, R; Raju, R; Huang, H V; Rice, C M

    1989-01-01

    The synthesis of Sindbis virus minus-strand and genomic and subgenomic RNAs is believed to require specific cis-acting sequences or structures in the template RNAs and a combination of virus-specific proteins and host components which act in trans. A conserved sequence of about 21 nucleotides in the junction region and encompassing the start site for the subgenomic RNA has been proposed to function as the promoter on the minus-strand template for synthesis of the subgenomic RNA (J.-H. Ou, C. M. Rice, L. Dalgarno, E. G. Strauss, and J. H. Strauss, Proc. Natl. Acad. Sci. USA 79:5235-5239, 1982). We introduced a three-base insertion in this sequence, which also inserts a single amino acid near the COOH terminus of nsP4, in a cDNA clone of Sindbis virus from which infectious RNA transcripts can be generated. The phenotype of this mutant, called Toto1100CR4.1, was studied after RNA transfection of chicken embryo fibroblasts or BHK cells. The mutation leads to a drastic reduction in the level of the subgenomic RNA but does not alter the start site of the RNA. Probably as a consequence of depressed structural-protein synthesis, very few progeny virions are released and the mutant makes tiny or indistinct plaques even after prolonged incubation. The cis-acting effect of this mutation was demonstrated by incorporating either a wild-type or mutant junction region into a defective-interfering RNA and examining the relative synthesis of defective-interfering RNA-derived subgenomic RNA in vivo in the presence of wild-type helper virus. These results show that the junction region is recognized by yet unidentified viral trans-acting components for subgenomic RNA synthesis. When the Toto1100CR4.1 mutant was passaged in culture, plaque morphology variants readily arose. A total of 24 independent revertants were isolated, and 16 were characterized in detail. All revertants analyzed showed an increase in the level of subgenomic RNA synthesis. Sequence analysis of the junction region

  4. Genetics Home Reference: congenital bile acid synthesis defect type 1

    MedlinePlus

    ... bile acid synthesis defect type 1 congenital bile acid synthesis defect type 1 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 1 is a disorder characterized ...

  5. Genetics Home Reference: congenital bile acid synthesis defect type 2

    MedlinePlus

    ... bile acid synthesis defect type 2 congenital bile acid synthesis defect type 2 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 2 is a disorder characterized ...

  6. Hydroxamic acids in asymmetric synthesis.

    PubMed

    Li, Zhi; Yamamoto, Hisashi

    2013-02-19

    Metal-catalyzed stereoselective reactions are a central theme in organic chemistry research. In these reactions, the stereoselection is achieved predominantly by introducing chiral ligands at the metal catalyst's center. For decades, researchers have sought better chiral ligands for asymmetric catalysis and have made great progress. Nevertheless, to achieve optimal stereoselectivity and to catalyze new reactions, new chiral ligands are needed. Because of their high metal affinity, hydroxamic acids play major roles across a broad spectrum of fields from biochemistry to metal extraction. Dr. K. Barry Sharpless first revealed their potential as chiral ligands for asymmetric synthesis in 1977: He published the chiral vanadium-hydroxamic-acid-catalyzed, enantioselective epoxidation of allylic alcohols before his discovery of Sharpless asymmetric epoxidation, which uses the titanium-tartrate complex as the chiral reagent. However, researchers have reported few highly enantioselective reactions using metal-hydroxamic acid as catalysts since then. This Account summarizes our research on metal-catalyzed asymmetric epoxidation using hydroxamic acids as chiral ligands. We designed and synthesized a series of new hydroxamic acids, most notably the C2-symmetric bis-hydroxamic acid (BHA) family. V-BHA-catalyzed epoxidation of allylic and homoallylic alcohols achieved higher activity and stereoselectivity than Sharpless asymmetric epoxidation in many cases. Changing the metal species led to a series of unprecedented asymmetric epoxidation reactions, such as (i) single olefins and sulfides with Mo-BHA, (ii) homoallylic and bishomoallylic alcohols with Zr- and Hf-BHA, and (iii) N-alkenyl sulfonamides and N-sulfonyl imines with Hf-BHA. These reactions produce uniquely functionalized chiral epoxides with good yields and enantioselectivities. PMID:23157425

  7. Hydroxamic Acids in Asymmetric Synthesis

    PubMed Central

    Li, Zhi; Yamamoto, Hisashi

    2012-01-01

    Metal-catalyzed stereoselective reactions are a central theme in organic chemistry research. In these reactions, the stereoselection is achieved predominantly by introducing chiral ligands at the metal catalyst’s center. For decades, researchers have sought better chiral ligands for asymmetric catalysis and have made great progress. Nevertheless, to achieve optimal stereoselectivity and to catalyze new reactions, new chiral ligands are needed. Due to their high metal affinity, hydroxamic acids play major roles across a broad spectrum of fields from biochemistry to metal extraction. Dr. K. Barry Sharpless first revealed their potential as chiral ligands for asymmetric synthesis in 1977: He published the chiral vanadium-hydroxamic-acid-catalyzed, enantioselective epoxidation of allylic alcohols before his discovery of Sharpless Asymmetric Epoxidation, which uses titanium-tartrate complex as the chiral reagent. However, researchers have reported few highly enantioselective reactions using metal-hydroxamic acid as catalysts since then. This Account summarizes our research on metal-catalyzed asymmetric epoxidation using hydroxamic acids as chiral ligands. We designed and synthesized a series of new hydroxamic acids, most notably the C2-symmetric bis-hydroxamic acid (BHA) family. V-BHA-catalyzed epoxidation of allylic and homoallylic alcohols achieved higher activity and stereoselectivity than Sharpless Asymmetric Epoxidation in many cases. Changing the metal species led to a series of unprecedented asymmetric epoxidation reactions, such as (i) single olefins and sulfides with Mo-BHA, (ii) homoallylic and bishomoallylic alcohols with Zr- and Hf-BHA, and (iii) N-alkenyl sulfonamides and N-sulfonyl imines with Hf-BHA. These reactions produce uniquely functionalized chiral epoxides with good yields and enantioselectivities. PMID:23157425

  8. Phosphatidic Acid Synthesis in Bacteria

    PubMed Central

    Yao, Jiangwei; Rock, Charles O.

    2012-01-01

    Membrane phospholipid synthesis is a vital facet of bacterial physiology. Although the spectrum of phospholipid headgroup structures produced by bacteria is large, the key precursor to all of these molecules is phosphatidic acid (PtdOH). Glycerol-3-phosphate derived from the glycolysis via glycerol-phosphate synthase is the universal source for the glycerol backbone of PtdOH. There are two distinct families of enzymes responsible for the acylation of the 1-position of glycerol-3-phosphate. The PlsB acyltransferase was discovered in Escherichia coli, and homologs are present in many eukaryotes. This protein family primarily uses acyl-acyl carrier protein (ACP) endproducts of fatty acid synthesis as acyl donors, but may also use acyl-CoA derived from exogenous fatty acids. The second protein family, PlsY, is more widely distributed in bacteria and utilizes the unique acyl donor, acyl-phosphate, which is produced from acyl-ACP by the enzyme PlsX. The acylation of the 2-position is carried out by members of the PlsC protein family. All PlsCs use acyl-ACP as the acyl donor, although the PlsCs of the γ-proteobacteria also may use acyl-CoA. Phospholipid headgroups are precursors in the biosynthesis of other membrane-associated molecules and the diacylglycerol product of these reactions is converted to PtdOH by one of two distinct families of lipid kinases. The central importance of the de novo and recycling pathways to PtdOH in cell physiology suggest these enzymes are suitable targets for the development of antibacterial therapeutics in Gram-positive pathogens. This article is part of a Special Issue entitled Phospholipids and Phospholipid Metabolism. PMID:22981714

  9. RNA Synthesis by in Vitro Selected Ribozymes for Recreating an RNA World

    PubMed Central

    Martin, Lyssa L.; Unrau, Peter J.; Müller, Ulrich F.

    2015-01-01

    The RNA world hypothesis states that during an early stage of life, RNA molecules functioned as genome and as the only genome-encoded catalyst. This hypothesis is supported by several lines of evidence, one of which is the in vitro selection of catalytic RNAs (ribozymes) in the laboratory for a wide range of reactions that might have been used by RNA world organisms. This review focuses on three types of ribozymes that could have been involved in the synthesis of RNA, the core activity in the self-replication of RNA world organisms. These ribozyme classes catalyze nucleoside synthesis, triphosphorylation, and the polymerization of nucleoside triphosphates. The strengths and weaknesses regarding each ribozyme’s possible function in a self-replicating RNA network are described, together with the obstacles that need to be overcome before an RNA world organism can be generated in the laboratory. PMID:25610978

  10. Abscisic Acid Synthesis and Response

    PubMed Central

    Finkelstein, Ruth

    2013-01-01

    Abscisic acid (ABA) is one of the “classical” plant hormones, i.e. discovered at least 50 years ago, that regulates many aspects of plant growth and development. This chapter reviews our current understanding of ABA synthesis, metabolism, transport, and signal transduction, emphasizing knowledge gained from studies of Arabidopsis. A combination of genetic, molecular and biochemical studies has identified nearly all of the enzymes involved in ABA metabolism, almost 200 loci regulating ABA response, and thousands of genes regulated by ABA in various contexts. Some of these regulators are implicated in cross-talk with other developmental, environmental or hormonal signals. Specific details of the ABA signaling mechanisms vary among tissues or developmental stages; these are discussed in the context of ABA effects on seed maturation, germination, seedling growth, vegetative stress responses, stomatal regulation, pathogen response, flowering, and senescence. PMID:24273463

  11. Synthesis of Amplified DNA That Codes for Ribosomal RNA

    PubMed Central

    Crippa, Marco; Tocchini-Valentini, Glauco P.

    1971-01-01

    During the amplification stage in ovaries, the complete repetitive unit of the DNA that codes for ribosomal RNA in Xenopus appears to be transcribed. This large RNA transcript is found in a complex with DNA. Substitution experiments with 5-bromodeoxyuridine do not show any evidence that a complete amplified cistron is used as a template for further amplification. A derivative of rifampicin, 2′,5′-dimethyl-N(4′)benzyl-N(4′)[desmethyl] rifampicin, preferentially inhibits the DNA synthesis responsible for ribosomal gene amplification. These results are consistent with the hypothesis that RNA-dependent DNA synthesis is involved in gene amplification. PMID:5288254

  12. [The first steps of chlorophyll synthesis: RNA involvement and regulation

    SciTech Connect

    Soell, D.

    1992-01-01

    Glu-tRNA[sup Glu] is synthesized from glutamate and tRNA[sup Glu] by glutamyl-tRNA synthetase (GluRS). Recent work has demonstrated that Glu-tRNA[sup Glu] has dual functions and is a precursor for protein and 5-aminolevulinate (ALA) synthesis. Current data does not provide compelling evidence for the notion that GluRS is regulated by chlorophyll precursors or in concert with the other enzymes of ALA synthesis. We have redefined the C5-pathway as a two-step route to ALA starting with Glu-tRNA[sup Glu]. Only two enzymes, Glu-tRNA reductase (GluTR) and GSA-2,1-amino-mutase (GSA-AM), are specifically involved in ALA synthesis. We have purified these enzymatic activities from Chlamydomonas and demonstrated that the two purified proteins in the presence of their cofactors NADPH and pyridoxal phosphate are sufficient for the in vitro Glu-tRNA [yields] ALA conversion. We have cloned the genes encoding GluTR. The sequences of the GluTR proteins deduced from these genes share highly conserved regions with those of bacterial origin. We havealso cloned and analyzed the gene encoding GSA-AM from Arabidopsis. As in Salmonella typhimurium, there are indications of the existence of an additional pathway for ALA formation in E. coli. To shed light on the recognition of the single tRNA[sup Glu] by the chloroplast enzymes GluTR, GluRS we characterized a chlorophyll-deficient mutant of Euglena having tRNA[sup Glu] with a point mutation in the T[Psi]C-loop. The altered tRNA supports protein but not ALA synthesis.

  13. In vitro RNA synthesis by infectious pancreatic necrosis virus-associated RNA polymerase.

    PubMed

    Mertens, P P; Jamieson, P B; Dobos, P

    1982-03-01

    The presence of an RNA-dependent RNA polymerase was demonstrated in purified infectious pancreatic necrosis virus (IPNV). The enzyme was active in vitro without any pretreatment of the virus. Optimum activity was shown at 30 degrees C, pH 8 and in the presence of 6 mM-magnesium ions. Approx. 50% of the polymerase product remained associated with the dsRNA template of the virions. The remainder was found as extravirion ssRNA broken down to 5S to 7S fragments by virus-associated RNase(s). Although the addition of bentonite considerably reduced the amount of RNA synthesized, it protected the ssRNA product from degradation. This, in turn, permitted the synthesis of small amounts of ssRNA, which when analysed by sucrose gradient centrifugation or polyacrylamide gel electrophoresis behaved identically to the 24S single-stranded virus mRNA produced in infected cells. The virion polymerase was not stimulated by S-adenosyl-L-methionine or the addition of cellular or capped reovirus ssRNA. Several other modifications of the assay system were tried in an attempt to increase 24S RNA synthesis, but with little success. When [3H]uridine-labelled virus was used in the polymerase reaction, some labelled 24S ssRNA was obtained, indicating that in vitro transcription may proceed by a semi-conservative (displacement) mechanism. PMID:6175731

  14. Cyclic phosphatidic acid and lysophosphatidic acid induce hyaluronic acid synthesis via CREB transcription factor regulation in human skin fibroblasts.

    PubMed

    Maeda-Sano, Katsura; Gotoh, Mari; Morohoshi, Toshiro; Someya, Takao; Murofushi, Hiromu; Murakami-Murofushi, Kimiko

    2014-09-01

    Cyclic phosphatidic acid (cPA) is a naturally occurring phospholipid mediator and an analog of the growth factor-like phospholipid lysophosphatidic acid (LPA). cPA has a unique cyclic phosphate ring at the sn-2 and sn-3 positions of its glycerol backbone. We showed before that a metabolically stabilized cPA derivative, 2-carba-cPA, relieved osteoarthritis pathogenesis in vivo and induced hyaluronic acid synthesis in human osteoarthritis synoviocytes in vitro. This study focused on hyaluronic acid synthesis in human fibroblasts, which retain moisture and maintain health in the dermis. We investigated the effects of cPA and LPA on hyaluronic acid synthesis in human fibroblasts (NB1RGB cells). Using particle exclusion and enzyme-linked immunosorbent assays, we found that both cPA and LPA dose-dependently induced hyaluronic acid synthesis. We revealed that the expression of hyaluronan synthase 2 messenger RNA and protein is up-regulated by cPA and LPA treatment time dependently. We then characterized the signaling pathways up-regulating hyaluronic acid synthesis mediated by cPA and LPA in NB1RGB cells. Pharmacological inhibition and reporter gene assays revealed that the activation of the LPA receptor LPAR1, Gi/o protein, phosphatidylinositol-3 kinase (PI3K), extracellular-signal-regulated kinase (ERK), and cyclic adenosine monophosphate response element-binding protein (CREB) but not nuclear factor κB induced hyaluronic acid synthesis by the treatment with cPA and LPA in NB1RGB cells. These results demonstrate for the first time that cPA and LPA induce hyaluronic acid synthesis in human skin fibroblasts mainly through the activation of LPAR1-Gi/o followed by the PI3K, ERK, and CREB signaling pathway. PMID:24845645

  15. The mechanism of montmorillonite catalysis in RNA synthesis

    NASA Astrophysics Data System (ADS)

    Joshi, Prakash

    The formation of complex prebiotic molecules on the early Earth is likely to have involved a component of mineral catalysis. Amongst the variety of clay minerals that have been investigated by us for their ability to catalyze the formation of RNA oligomers is montmorillonite. These are 2:1 layer silicates that have a wide range of chemical compositions [(Na,Ca)0.33(Al,Fe,Mg)2(Si,Al)4O10(OH)2.nH2O]. They are commonly produced by the weathering of silicic volcanic ashes to form Bentonite. Once formed, montmorillonites gradually transform to Illites at a modest pressure and temperature. Of the many samples of montmorillonite that we have experimentally examined, a selected subset has been observed to be catalytic for RNA synthesis (Joshi et. al., 2009; Aldersley et al., 2011). Those that have been observed to be excellent catalysts come from a restricted range of elemental compositions. The recent identification of phyllosilicates including montmorillonite on Mars (Bishop et al., 2008) raises the possibility that such processes may have taken place there too. The extent of catalysis depended not only upon the magnitude of the negative charge on the montmorillonite lattice and the number of cations associated with it, but also on the pH at which the reaction is promoted. The isotherm and catalysis studies were extended to provide binding information and catalytic outcomes over a wide pH range. When cations in raw montmorillonite are completely replaced by sodium ions, the resulting Na+-montmorillonite does not catalyze oligomer formation because the ions saturate the interlayer between the platelets of montmorillonite, which blocks the binding of the activated monomers. Acid washed montmorillonite titrated to pH 6-8 with alkali metal ions, serves as the model catalyst for this RNA synthesis (Aldersley et. al., 2011). The optimal binding occurred in the region of maximal oligomer formation. X-ray diffraction studies revealed changes in layer separations of

  16. Synthesis of new polysialic acid derivatives.

    PubMed

    Su, Yi; Kasper, Cornelia; Kirschning, Andreas; Dräger, Gerald; Berski, Silke

    2010-09-01

    In this paper we report the first synthesis of novel polysialic acid derivatives which is initiated by treatment of polysialic acid with EDC-HCl to yield the inter-residual delta-lactone. Subsequent reaction with amines or hydrazine gives the corresponding polysialic acid amides and hydrazide. Alkylation of the tetrabutylammonium salt of polysialic acid yields polysialic acid esters. In contrast a variety of N-derivatives of polysialic acid can be prepared starting from deacetylated polysialic acid. The N-derivatives prepared in this communication can be used for the Cu-catalyzed as well as Cu-free "click" chemistry. PMID:20602419

  17. Studies on the Role of RNA Synthesis in Auxin Induction of Cell Enlargement 1

    PubMed Central

    Nooden, Larry D.

    1968-01-01

    Selective inhibitors were used to study the connection between nucleic acid synthesis and indoleacetic acid (IAA) induction of cell enlargement. Actinomycin D (act D) and azaguanine (azaG) almost completely inhibit IAA-induced growth in aged artichoke tuber disks when they are added simultaneously with IAA. In contrast, when they are added 24 hours after the hormone, these inhibitors have little or no effect on the induced growth which continues for 48 hours or more with little or no inhibition. Inhibitors of protein synthesis still stop growth when applied 24 hours after the IAA, thus protein synthesis and presumably supporting metabolism are still essential. In corn coleoptile sections auxin-induced growth did not show any pronounced tendency to become less sensitive to act D as the IAA treatment progressed. Act D did not completely inhibit the response to IAA unless the sections were pretreated with act D for 6 hours. In contrast to act D, cordycepin produced almost complete inhibition of IAA-induced growth when added with the IAA. Although IAA has a very large and very rapid stimulatory effect (within 10 min) on incorporation of 32P-orthophosphate into RNA in disks, it did not cause a detectable change in the base composition of the RNA synthesized. Furthermore, the promotive effect could be accounted for through increased uptake of the 32P. That much of the RNA synthesis in these tissues is not necessary for auxin action is indicated by the results with fluorouracil (FU). FU strongly inhibits RNA synthesis, probably acting preferentially on ribosomal RNA synthesis, without inhibiting auxin-induced growth in the disks or coleoptile sections. FU also strongly inhibited respiration in auxin-treated disks indicating that the large promotion of respiration by auxin likewise may not be entirely necessary for growth. At least in the artichoke disks, RNA synthesis is required for auxin induction of cell enlargement and not for cell enlargement itself. The possible

  18. Ribonucleic acid synthesis in normal and immune macrophages after antigenic stimulus.

    PubMed

    Soderberg, L S; Tewari, R P; Solotorovsky, M

    1976-06-01

    Macrophage ribonucleic acid (RNA) synthesis is an important metabolic process intimately related to the function of these cells. Mouse peritoneal macrophage RNA was extracted with phenol in the presence of bentonite and electrophoresed on composite agarose-polyacrylamide gels. The pulse-chase technique was used to follow the precursor relationships in macrophage ribosomal RNA (rRNA) maturation. The rRNA species at 18S and 28S appeared at 15 and 45 min, respectively, after RNA synthesis was halted. Their appearance corresponded closely to decreases in the rRNA precursors at 45S, 36S, and 34S. Studies of RNA methylation aided in confirming the identity of these ribosomal species. Unmethylated RNA species appeared as messenger RNA between 5S and 15S, and at about 55S probably represented heterodisperse nuclear RNA. When normal macrophages were incubated with heat-killed Salmonella enteritidis, an acceleration in the maturation of RNA was observed. The accelerated maturation was indicated by the earlier appearance of 28S rRNA and the more rapid development of an equilibrium state, where further labeling did not change the RNA profile. In macrophage RNA from mice immunized with S. enteritidis, rRNA species appeared rapidly but did not accumulate to the same extent as observed for normal macrophages. Precursor rRNA and other RNA species developed as usual, suggesting specific degradation of mature rRNA. Such rRNA wastage could indicate a mechanism controlling ribosome assembly in the non-proliferating activated macrophage. The pattern of RNA synthesis in immune macrophages was essentially unchanged by the presence of heat-killed S. enteritidis in vitro. PMID:971940

  19. Guanosine tetraphosphate as a global regulator of bacterial RNA synthesis: a model involving RNA polymerase pausing and queuing.

    PubMed

    Bremer, H; Ehrenberg, M

    1995-05-17

    A recently reported comparison of stable RNA (rRNA, tRNA) and mRNA synthesis rates in ppGpp-synthesizing and ppGpp-deficient (delta relA delta spoT) bacteria has suggested that ppGpp inhibits transcription initiation from stable RNA promoters, as well as synthesis of (bulk) mRNA. Inhibition of stable RNA synthesis occurs mainly during slow growth of bacteria when cytoplasmic levels of ppGpp are high. In contrast, inhibition of mRNA occurs mainly during fast growth when ppGpp levels are low, and it is associated with a partial inactivation of RNA polymerase. To explain these observations it has been proposed that ppGpp causes transcriptional pausing and queuing during the synthesis of mRNA. Polymerase queuing requires high rates of transcription initiation in addition to polymerase pausing, and therefore high concentrations of free RNA polymerase. These conditions are found in fast growing bacteria. Furthermore, the RNA polymerase queues lead to a promoter blocking when RNA polymerase molecules stack up from the pause site back to the (mRNA) promoter. This occurs most frequently at pause sites close to the promoter. Blocking of mRNA promoters diverts RNA polymerase to stable RNA promoters. In this manner ppGpp could indirectly stimulate synthesis of stable RNA at high growth rates. In the present work a mathematical analysis, based on the theory of queuing, is presented and applied to the global control of transcription in bacteria. This model predicts the in vivo distribution of RNA polymerase over stable RNA and mRNA genes for both ppGpp-synthesizing and ppGpp-deficient bacteria in response to different environmental conditions. It also shows how small changes in basal ppGpp concentrations can produce large changes in the rate of stable RNA synthesis. PMID:7539631

  20. Chloramphenicol-induced changes in the synthesis of ribosomal, transfer, and messenger ribonucleic acids in Escherichia coli B/r.

    PubMed

    Shen, V; Bremer, H

    1977-06-01

    The synthesis of ribosomal ribonucleic acid (rRNA), transfer RNA (tRNA) and messenger RNA (mRNA) was measured in Escherichia coli B/r after the addition of 100 mug of chloramphenicol (CAM) per ml to cultures growing either in one of three minimal media (succinate, glycerol, or glucose) or in one of the same three media supplemented with 20 amino acids. (i) During CAM treatment, rRNA and tRNA were synthesized in the same relative proportions (85:15) as during exponential growth. The faster accumulation of tRNA relative to rRNA in CAM was due to a decreased stability of rRNA that is synthesized in the presence of or immediately before the addition of CAM. (ii) CAM stimulated the synthesis of rRNA and tRNA two- to eightfold. The results fell into two groups; one group was from studies done in minimal media and the other was from amino acid-supplemented media. In each group the stimulation decreased with increasing growth rate of the culture during exponential growth before the addition of CAM; however, the stimulation in minimal media was lower than that in amino acid-supplemented media. (iii) CAM caused an increase in the proportion of rRNA and tRNA synthesis and a corresponding decrease in the proportion of mRNA synthesis. In minimal media, the residual proportion of mRNA synthesis after CAM treatment was 10 to 15% of total RNA synthesis; in amino acid-supplemented media this proportion was 0 to 10%. In either case, the residual proportion of mRNA synthesis was independent of the proportions observed during exponential growth in these media. (iv) The absolute rate of mRNA synthesis decreased severalfold with the addition of CAM; i.e., the rate of synthesis of rRNA and tRNA was increased at the expense of mRNA synthesis. (v) During exponential growth, the fraction of the instantaneous rate of total RNA synthesis that corresponds to mRNA is a function of both the growth rate and the presence or absence of amino acids in the growth medium: in the absence of amino acids

  1. Nonenzymatic template-directed RNA synthesis inside model protocells.

    PubMed

    Adamala, Katarzyna; Szostak, Jack W

    2013-11-29

    Efforts to recreate a prebiotically plausible protocell, in which RNA replication occurs within a fatty acid vesicle, have been stalled by the destabilizing effect of Mg(2+) on fatty acid membranes. Here we report that the presence of citrate protects fatty acid membranes from the disruptive effects of high Mg(2+) ion concentrations while allowing RNA copying to proceed, while also protecting single-stranded RNA from Mg(2+)-catalyzed degradation. This combination of properties has allowed us to demonstrate the chemical copying of RNA templates inside fatty acid vesicles, which in turn allows for an increase in copying efficiency by bathing the vesicles in a continuously refreshed solution of activated nucleotides. PMID:24288333

  2. Montmorillonite Clay-Catalyzed Synthesis of RNA Oligomers

    NASA Astrophysics Data System (ADS)

    Ferris, J. P.; Miyakawa, S.; Huang, W.; Joshi, P.

    2005-12-01

    It is proposed that catalysis had a central role in the origins of life. This will be illustrated using the montmorillonite clay-catalyzed synthesis of oligomers of RNA from activated monomers, (Ferris and Ertem, 1993) a possible step in the origin of the RNA world (Ferris, 2005). Structural analysis of oligomers formed in the reaction of the activated monomer of 5'-AMP with that of 5'-CMP demonstrated that the oligomers formed were not produced by random synthesis but rather the sequences observed were directed by the montmorillonite catalyst (Miyakawa and Ferris, 2003). RNA oligomers containing up to 40 mers have been synthesized in reactions performed in water at 25 oC in the presence of montmorillonite (Huang and Ferris, 2003). Analysis of the structure elements in these oligomers from the 7 to 39 mers showed that they did not vary. Reaction of D, L-mixtures of the activated monomers of A and U resulted in the formation of greater amounts of the homochiral amounts of dimers and trimers of A than would be expected if there was no selectivity in the reaction. A limited number of the dimers and trimers of U were also formed but here the selectivity was for the formation of an excess of heterochiral products (Joshi et al., 2000). A postulate that explains why homochiral trimers of U are not formed and the significance of catalysis in prebiotic synthesis will be discussed. Ferris, J.P. (2005) Origins of life, molecular basis of. In R.A. Meyers, Ed. Encyclopedia of Molecular Cell Biology and Molecular Medicine, 10. Wiley-VCH Verlag, Weinheim, Germany. Ferris, J.P., and Ertem, G. (1993) Montmorillonite catalysis of RNA oligomer formation in aqueous solution. A model for the prebiotic formation of RNA. J. Am. Chem. Soc., 115, 12270-12275. Huang, W., and Ferris, J.P. (2003) Synthesis of 35-40 mers of RNA oligomers from unblocked monomers. A simple approach to the RNA world. Chem. Commun., 1458-1459. Joshi, P.C., Pitsch, S., and Ferris, J.P. (2000) Homochiral selection

  3. Inhibition of vaccinia mRNA methylation by 2',5'-linked oligo(adenylic acid) triphosphate

    SciTech Connect

    Sharma, O.K.; Goswami, B.B.

    1981-04-01

    Extracts of interferon-treated cells synthesize unique 2',5'-linked oligo(adenylic acid) 5'-phosphates in the presence of ATP and double-stranded RNA. 2',5'-linked oligo(adenylic acid) 5'-triphosphate inhibits protein synthesis at nanomolar concentrations by activating RNase. We have observed that oligo(adenylic acid) 5'-monophosphate and 5'-triphosphate are potent inhibitors of vaccinia mRNA methylation in vitro. Both the methylation of the 5'-terminal guanine at the 7 position and the 2'-O-ribose methylation of the penultimate nucleoside are inhibited. Such inhibition of mRNA methylation is not due to degradation of the mRNA. Inhibition of the requisite modification of the 5' terminus of mRNA by 2',5'-linked oligo(adenylic acids) may be a mechanism of interferon action against both DNA and RNA viruses in which mRNAs derived from them are capped.

  4. Aminoacylation of tRNA with phosphoserine for synthesis of cysteinyl-tRNA(Cys).

    PubMed

    Zhang, Chun-Mei; Liu, Cuiping; Slater, Simon; Hou, Ya-Ming

    2008-05-01

    Cysteinyl-tRNA(Cys) (Cys-tRNA(Cys)) is required for translation and is typically synthesized by cysteinyl-tRNA synthetase (CysRS). However, Methanocaldococcus jannaschii synthesizes Cys-tRNA(Cys) by an indirect pathway, whereby O-phosphoseryl-tRNA synthetase (SepRS) acylates tRNA(Cys) with phosphoserine (Sep), and Sep-tRNA-Cys-tRNA synthase (SepCysS) converts the tRNA-bound phosphoserine to cysteine. We show here that M. jannaschii SepRS differs from CysRS by recruiting the m1G37 modification as a determinant for aminoacylation, and in showing limited discrimination against mutations of conserved nucleotides. Kinetic and binding measurements show that both SepRS and SepCysS bind the reaction intermediate Sep-tRNA(Cys) tightly, and these two enzymes form a stable binary complex that promotes conversion of the intermediate to the product and sequesters the intermediate from binding to elongation factor EF-1alpha or infiltrating into the ribosome. These results highlight the importance of the protein binary complex for efficient synthesis of Cys-tRNA(Cys). PMID:18425141

  5. Total synthesis of (+)-zaragozic acid C.

    PubMed

    Armstrong, A; Barsanti, P A; Jones, L H; Ahmed, G

    2000-10-20

    A total synthesis of (+)-zaragozic acid C is described. Key features of the synthesis are the use of a double Sharpless asymmetric dihydroxylation reaction of diene 6 to control stereochemistry at four contiguous stereocenters from C3 to C6; the introduction of the C1-side chain by reaction between the anion derived from the dithiane monosulfoxide 27 and the core aldehyde 12; a high yielding, acid-mediated simultaneous acetonide deprotection-dithiane removal-ketalization procedure leading exclusively to the 2, 8-dioxabicyclo[3.2.1]octane core 34; and a novel triple oxidation procedure allowing installation of the tricarboxylic acid. PMID:11031024

  6. Mutation in human selenocysteine transfer RNA selectively disrupts selenoprotein synthesis.

    PubMed

    Schoenmakers, Erik; Carlson, Bradley; Agostini, Maura; Moran, Carla; Rajanayagam, Odelia; Bochukova, Elena; Tobe, Ryuta; Peat, Rachel; Gevers, Evelien; Muntoni, Francesco; Guicheney, Pascale; Schoenmakers, Nadia; Farooqi, Sadaf; Lyons, Greta; Hatfield, Dolph; Chatterjee, Krishna

    2016-03-01

    Selenium is a trace element that is essential for human health and is incorporated into more than 25 human selenocysteine-containing (Sec-containing) proteins via unique Sec-insertion machinery that includes a specific, nuclear genome-encoded, transfer RNA (tRNA[Ser]Sec). Here, we have identified a human tRNA[Ser]Sec mutation in a proband who presented with a variety of symptoms, including abdominal pain, fatigue, muscle weakness, and low plasma levels of selenium. This mutation resulted in a marked reduction in expression of stress-related, but not housekeeping, selenoproteins. Evaluation of primary cells from the homozygous proband and a heterozygous parent indicated that the observed deficit in stress-related selenoprotein production is likely mediated by reduced expression and diminished 2'-O-methylribosylation at uridine 34 in mutant tRNA[Ser]Sec. Moreover, this methylribosylation defect was restored by cellular complementation with normal tRNA[Ser]Sec. This study identifies a tRNA mutation that selectively impairs synthesis of stress-related selenoproteins and demonstrates the importance of tRNA modification for normal selenoprotein synthesis. PMID:26854926

  7. Mutation in human selenocysteine transfer RNA selectively disrupts selenoprotein synthesis

    PubMed Central

    Schoenmakers, Erik; Carlson, Bradley; Agostini, Maura; Moran, Carla; Rajanayagam, Odelia; Bochukova, Elena; Tobe, Ryuta; Peat, Rachel; Gevers, Evelien; Muntoni, Francesco; Guicheney, Pascale; Schoenmakers, Nadia; Farooqi, Sadaf; Lyons, Greta; Hatfield, Dolph; Chatterjee, Krishna

    2016-01-01

    Selenium is a trace element that is essential for human health and is incorporated into more than 25 human selenocysteine-containing (Sec-containing) proteins via unique Sec-insertion machinery that includes a specific, nuclear genome–encoded, transfer RNA (tRNA[Ser]Sec). Here, we have identified a human tRNA[Ser]Sec mutation in a proband who presented with a variety of symptoms, including abdominal pain, fatigue, muscle weakness, and low plasma levels of selenium. This mutation resulted in a marked reduction in expression of stress-related, but not housekeeping, selenoproteins. Evaluation of primary cells from the homozygous proband and a heterozygous parent indicated that the observed deficit in stress-related selenoprotein production is likely mediated by reduced expression and diminished 2′-O-methylribosylation at uridine 34 in mutant tRNA[Ser]Sec. Moreover, this methylribosylation defect was restored by cellular complementation with normal tRNA[Ser]Sec. This study identifies a tRNA mutation that selectively impairs synthesis of stress-related selenoproteins and demonstrates the importance of tRNA modification for normal selenoprotein synthesis. PMID:26854926

  8. Amino acid metabolism and protein synthesis in malarial parasites*

    PubMed Central

    Sherman, I. W.

    1977-01-01

    amino acid sources for parasite protein synthesis; purification and characterization of plasmodial proteinases; and in vitro translation of parasite messenger RNA. PMID:338183

  9. Abiotic synthesis of RNA in water: a common goal of prebiotic chemistry and bottom-up synthetic biology.

    PubMed

    Cafferty, Brian J; Hud, Nicholas V

    2014-10-01

    For more than half a century chemists have searched for a plausible prebiotic synthesis of RNA. The initial advances of the 1960s and 1970s were followed by decades of measured progress and a growing pessimism about overcoming remaining challenges. Fortunately, the past few years have provided a number of important advances, including new abiotic routes for the synthesis of nucleobases, nucleosides, and nucleotides. Recent discoveries also provide additional support for the hypothesis that RNA is the product of evolution, being preceded by ancestral genetic polymers, or pre-RNAs, that are synthesized more easily than RNA. In some cases, parallel searches for plausible prebiotic routes to RNA and pre-RNAs have provided more than one experimentally verified synthesis of RNA substructures and possible predecessors. Just as the synthesis of a contemporary biological molecule cannot be understood without knowledge of cellular metabolism, it is likely that an integrated approach that takes into account both plausible prebiotic reactions and plausible prebiotic environments will ultimately provide the most satisfactory and unifying chemical scenarios for the origin of nucleic acids. In this context, recent advances towards the abiotic synthesis of RNA and candidates for pre-RNAs are beginning to suggest that some molecules (e.g., urea) were multi-faceted contributors to the origin of nucleic acids, and the origin of life. PMID:25438801

  10. Prolonged stimulation of muscle protein synthesis by leucine in neonates is dependent on amino acid availability

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The rise in amino acids and insulin after a meal independently stimulate protein synthesis in skeletal muscle of neonates by activating the intracellular signalling pathways that regulate mRNA translation. Leucine, in particular, is important in mediating the response to amino acids. Previously, w...

  11. The 5' untranslated region of alfalfa mosaic virus RNA 1 is involved in negative-strand RNA synthesis.

    PubMed

    Vlot, A Corina; Bol, John F

    2003-10-01

    The three genomic RNAs of alfalfa mosaic virus each contain a unique 5' untranslated region (5' UTR). Replacement of the 5' UTR of RNA 1 by that of RNA 2 or 3 yielded infectious replicons. The sequence of a putative 5' stem-loop structure in RNA 1 was found to be required for negative-strand RNA synthesis. A similar putative 5' stem-loop structure is present in RNA 2 but not in RNA 3. PMID:14512577

  12. Nitrated fatty acids: Synthesis and measurement

    PubMed Central

    Woodcock, Steven R.; Bonacci, Gustavo; Gelhaus, Stacy L.; Schopfer, Francisco J.

    2012-01-01

    Nitrated fatty acids are the product of nitrogen dioxide reaction with unsaturated fatty acids. The discovery of peroxynitrite and peroxidase-induced nitration of biomolecules led to the initial reports of endogenous nitrated fatty acids. These species increase during ischemia reperfusion, but concentrations are often at or near the limits of detection. Here, we describe multiple methods for nitrated fatty acid synthesis, sample extraction from complex biological matrices, and a rigorous method of qualitative and quantitative detection of nitrated fatty acids by LC-MS. In addition, optimized instrument conditions and caveats regarding data interpretation are discussed. PMID:23200809

  13. Glucocorticoid-mediated induction of alpha 1-acid glycoprotein: evidence for hormone-regulated RNA processing.

    PubMed Central

    Vannice, J L; Taylor, J M; Ringold, G M

    1984-01-01

    We have studied the glucocorticoid-mediated accumulation of alpha 1-acid glycoprotein (AGP) in mRNA in HTC rat hepatoma cells. In contrast to the well-characterized primary response of mouse mammary tumor virus, in vitro transcription assays in isolated nuclei show that the rate of transcription of the AGP gene is high even in the absence of hormone. Despite the constitutive transcription of the AGP gene, no detectable AGP RNA can be found in either the cytoplasm or the nuclei of untreated cells. Previous experiments have shown that the glucocorticoid induction of AGP RNA requires ongoing protein synthesis. In conjunction with the present study, our data suggest that glucocorticoids stimulate accumulation of AGP RNA by inducing an RNA processing factor that allows production of stable transcripts. Images PMID:6205392

  14. Rubella virus capsid protein modulation of viral genomic and subgenomic RNA synthesis

    SciTech Connect

    Tzeng, W.-P.; Frey, Teryl K. . E-mail: tfrey@gsu.edu

    2005-07-05

    The ratio of the subgenomic (SG) to genome RNA synthesized by rubella virus (RUB) replicons expressing the green fluorescent protein reporter gene (RUBrep/GFP) is substantially higher than the ratio of these species synthesized by RUB (4.3 for RUBrep/GFP vs. 1.3-1.4 for RUB). It was hypothesized that this modulation of the viral RNA synthesis was by one of the virus structural protein genes and it was found that introduction of the capsid (C) protein gene into the replicons as an in-frame fusion with GFP resulted in an increase of genomic RNA production (reducing the SG/genome RNA ratio), confirming the hypothesis and showing that the C gene was the moiety responsible for the modulation effect. The N-terminal one-third of the C gene was required for the effect of be exhibited. A similar phenomenon was not observed with the replicons of Sindbis virus, a related Alphavirus. Interestingly, modulation was not observed when RUBrep/GFP was co-transfected with either other RUBrep or plasmid constructs expressing the C gene, demonstrating that modulation could occur only when the C gene was provided in cis. Mutations that prevented translation of the C protein failed to modulate RNA synthesis, indicating that the C protein was the moiety responsible for modulation; consistent with this conclusion, modulation of RNA synthesis was maintained when synonymous codon mutations were introduced at the 5' end of the C gene that changed the C gene sequence without altering the amino acid sequence of the C protein. These results indicate that C protein translated in proximity of viral replication complexes, possibly from newly synthesized SG RNA, participate in regulating the replication of viral RNA.

  15. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  16. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  17. Folic acid binds DNA and RNA at different locations.

    PubMed

    Bourassa, P; Tajmir-Riahi, H A

    2015-03-01

    We located multiple binding sites for folic acid on DNA and tRNA at physiological conditions, using FTIR, CD, fluorescence spectroscopic methods and molecular modeling. Structural analysis revealed that folic acid binds DNA and tRNA at multiple sites via hydrophilic, hydrophobic and H-bonding contacts with overall binding constants of Kfolic acid-DNA=1.1 (±0.3)×10(4) M(-1) and Kfolic acid-tRNA=6.4 (±0.5)×10(3) M(-1). Molecular modeling showed the participation of several nucleobases in folic acid complexes with DNA and tRNA, stabilized by H-bonding network. Two types of complexes were located for folic acid-tRNA adducts, one at the major groove and the other with TΨC loop, while acid binding occurs at major and minor grooves of DNA duplex. Folic acid complexation induced more alterations of DNA structure than tRNA. PMID:25555838

  18. Polyamines in the Synthesis of Bacteriophage Deoxyribonucleic Acid. I. Lack of Dependence of Polyamine Synthesis on Bacteriophage Deoxyribonucleic Acid Synthesis

    PubMed Central

    Dion, Arnold S.; Cohen, Seymour S.

    1972-01-01

    To determine whether polyamine synthesis is dependent on deoxyribonucleic acid (DNA) synthesis, polyamine levels were estimated after infection of bacterial cells with ultraviolet-irradiated T4 or T4 am N 122, a DNA-negative mutant. Although phage DNA accumulation was restricted to various degrees in comparison to cells infected with T4D, nearly commensurate levels of putrescine and spermidine synthesis were observed after infection, regardless of the rate of phage DNA synthesis. We conclude from these data that polyamine synthesis after infection is independent of phage DNA synthesis. PMID:4552549

  19. Enantioselective Total Synthesis of Secalonic Acid E.

    PubMed

    Ganapathy, Dhandapani; Reiner, Johannes R; Löffler, Lorenz E; Ma, Ling; Gnanaprakasam, Boopathy; Niepötter, Benedikt; Koehne, Ingo; Tietze, Lutz F

    2015-11-16

    The first enantioselective synthesis of a secalonic acid containing a dimeric tetrahydroxanthenone skeleton is described, using a Wacker-type cyclization of a methoxyphenolic compound to form a chiral chroman with a quaternary carbon stereogenic center with >99% ee. Further steps are a Sharpless dihydroxylation and a Dieckmann condensation to give a tetrahydroxanthenone. A late-stage one-pot palladium-catalyzed Suzuki-dimerization reaction leads to the 2,2'-biphenol linkage to complete the enantioselective total synthesis of secalonic acid E in 18 steps with 8% overall yield. PMID:26447631

  20. [Lipid synthesis by an acidic acid tolerant Rhodotorula glutinis].

    PubMed

    Lin, Zhangnan; Liu, Hongjuan; Zhang, Jian'an; Wang, Gehua

    2016-03-01

    Acetic acid, as a main by-product generated in the pretreatment process of lignocellulose hydrolysis, significantly affects cell growth and lipid synthesis of oleaginous microorganisms. Therefore, we studied the tolerance of Rhodotorula glutinis to acetic acid and its lipid synthesis from substrate containing acetic acid. In the mixed sugar medium containing 6 g/L glucose and 44 g/L xylose, and supplemented with acetic acid, the cell growth was not:inhibited when the acetic acid concentration was below 10 g/L. Compared with the control, the biomass, lipid concentration and lipid content of R. glutinis increased 21.5%, 171% and 122% respectively when acetic acid concentration was 10 g/L. Furthermore, R. glutinis could accumulate lipid with acetate as the sole carbon source. Lipid concentration and lipid yield reached 3.20 g/L and 13% respectively with the initial acetic acid concentration of 25 g/L. The lipid composition was analyzed by gas chromatograph. The main composition of lipid produced with acetic acid was palmitic acid, stearic acid, oleic acid, linoleic acid and linolenic acid, including 40.9% saturated fatty acids and 59.1% unsaturated fatty acids. The lipid composition was similar to that of plant oil, indicating that lipid from oleaginous yeast R. glutinis had potential as the feedstock of biodiesel production. These results demonstrated that a certain concentration of acetic acid need not to be removed in the detoxification process when using lignocelluloses hydrolysate to produce microbial lipid by R. glutinis. PMID:27349116

  1. Evolution of Protein Synthesis from an RNA World

    PubMed Central

    Noller, Harry F.

    2012-01-01

    SUMMARY Because of the molecular complexity of the ribosome and protein synthesis, it is a challenge to imagine how translation could have evolved from a primitive RNA World. Two specific suggestions are made here to help to address this, involving separate evolution of the peptidyl transferase and decoding functions. First, it is proposed that translation originally arose not to synthesize functional proteins, but to provide simple (perhaps random) peptides that bound to RNA, increasing its available structure space, and therefore its functional capabilities. Second, it is proposed that the decoding site of the ribosome evolved from a mechanism for duplication of RNA. This process involved homodimeric “duplicator RNAs,” resembling the anticodon arms of tRNAs, which directed ligation of trinucleotides in response to an RNA template. PMID:20610545

  2. Hyaluronic acid-siRNA conjugate/reducible polyethylenimine complexes for targeted siRNA delivery.

    PubMed

    Jang, Yeon Lim; Ku, Sook Hee; Jin, So; Park, Jae Hyung; Kim, Won Jong; Kwon, Ick Chan; Kim, Sun Hwa; Jeong, Ji Hoon

    2014-10-01

    The clinical applications of therapeutic siRNA remain as a challenge due to the lack of efficient delivery system. In the present study, hyaluronic acid-siRNA conjugate (HA-SS-siRNA)/reducible polyethylenimine (BPEI1.2k-SS) complexes were developed to efficiently deliver the siRNA to HA receptor abundant region with the improved siRNA stability. HA and siRNA were conjugated with disulfide bonds, which are cleavable in cytoplasm. The synthesized HA-SS-siRNA was further complexed with BPEI1.2k-SS, resulting in the formation of spherical nanostructures with approximately 190 nm of size and neutral surface charge. HA-SS-siRNA/BPEI1.2k-SS complexes exhibited the improved stability against serum proteins or polyanions. These complexes were successfully translocated into intracellular region via HA receptor-mediated endocytosis, and silenced target gene expression. PMID:25942799

  3. Nuclear Localization of Flavivirus RNA Synthesis in Infected Cells

    PubMed Central

    Uchil, Pradeep Devappa; Kumar, Anil V. A.; Satchidanandam, Vijaya

    2006-01-01

    Flaviviral replication is believed to be exclusively cytoplasmic, occurring within virus-induced membrane-bound replication complexes in the host cytoplasm. Here we show that a significant proportion (20%) of the total RNA-dependent RNA polymerase (RdRp) activity from cells infected with West Nile virus, Japanese encephalitis virus (JEV), and dengue virus is resident within the nucleus. Consistent with this, the major replicase proteins NS3 and NS5 of JEV also localized within the nucleus. NS5 was found distributed throughout the nucleoplasm, but NS3 was present at sites of active flaviviral RNA synthesis, colocalizing with NS5, and visible as distinct foci along the inner periphery of the nucleus by confocal and immunoelectron microscopy. Both these viral replicase proteins were also present in the nuclear matrix, colocalizing with the peripheral lamina, and revealed a well-entrenched nuclear location for the viral replication complex. In keeping with this observation, antibodies to either NS3 or NS5 coimmunoprecipitated the other protein from isolated nuclei along with newly synthesized viral RNA. Taken together these data suggest an absolute requirement for both of the replicase proteins for nucleus-localized synthesis of flavivirus RNA. Thus, we conclusively demonstrate for the first time that the host cell nucleus functions as an additional site for the presence of functionally active flaviviral replicase complex. PMID:16699025

  4. Ribonucleic acid synthesis during fruiting body formation in Myxococcus xanthus.

    PubMed

    Smith, B A; Dworkin, M

    1981-04-01

    A method has been devised that allowed us, for the first time, to pulse-label M. xanthus cells with precursors for ribonucleic acid biosynthesis while they were undergoing fruiting body formation. Using this method, we examined patterns of ribonucleic acid (RNA) accumulation throughout the process of fruiting body formation. As development proceeded, the rate of RNA accumulation increased at two periods of the developmental cycle: once just before aggregation and once late in the cycle, when sporulation was essentially completed. In contrast to vegetatively growing cells, in which only stable RNA species are labeled during a 30-min pulse, the majority of radioactivity found in RNA from 30-min pulse-labeled developing cells was found in an unstable heterodisperse fraction that migrated to the 5S to 16S region of sucrose density gradients and sodium dodecyl sulfate-polyacrylamide gels. This pattern of incorporation could not be induced (i) by a shift down of vegetatively growing cells to a nutritionally poor medium, in which the generation time was increased to that of developing cells during the growth phase, or (ii) by plating of vegetative cells onto the same solid-surface environment as that of developing cells, but which surface supported vegetative growth rather than fruiting body formation. Thus, the RNA synthesis pattern observed appeared to be related to development per se rather than to nutritional depletion or growth on a solid surface alone. The radioactivity incorporated into the unstable 5S to 16S RNA fraction accumulated as the pulse length was increased from 10 to 30 min; in contrast, an analogous unstable fraction from vegetative cells decreased as pulse length was increased. This suggested that developmental 5S to 16S RNA was more stable than vegetative cell 5S to 16S RNA (presumptive messenger RNA). However, during a 45-min chase period, radioactivity in 30-min-pulse-labeled developmental 5S to 16S RNA decayed to an extent twice that of

  5. Inhibition of poliovirus RNA synthesis by brefeldin A.

    PubMed Central

    Maynell, L A; Kirkegaard, K; Klymkowsky, M W

    1992-01-01

    Brefeldin A (BFA), a fungal metabolite that blocks transport of newly synthesized proteins from the endoplasmic reticulum, was found to inhibit poliovirus replication 10(5)- to 10(6)-fold. BFA does not inhibit entry of poliovirus into the cell or translation of viral RNA. Poliovirus RNA synthesis, however, is completely inhibited by BFA. A specific class of membranous vesicles, with which the poliovirus replication complex is physically associated, is known to proliferate in poliovirus-infected cells. BFA may inhibit poliovirus replication by preventing the formation of these vesicles. Images PMID:1312615

  6. Synthesis of (+) and (-)-phaselic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    (2S)-Phaselic acid (2S-O-caffeoylmalate) is a common plant metabolite belonging to the o-diphenol subclass of phenolic secondary metabolites. Our interest in this metabolite stems from previous studies showing that the presence of (2S)-phaselic acid in red clover is crucial to the preservation of ut...

  7. Synthesis of (+)- and (-)-phaselic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    (2S)-Phaselic acid (2S-O-caffeoylmalate) is a common plant metabolite belonging to the o-diphenol subclass of phenolic secondary metabolites. Our interest in this metabolite stems from previous studies showing that the presence of (2S)-phaselic acid in red clover is crucial to the preservation of ut...

  8. Synthesis of pyromellitic acid esters

    NASA Technical Reports Server (NTRS)

    Fedorova, V. A.; Donchak, V. A.; Martynyuk-Lototskaya, A. N.

    1985-01-01

    The ester acids necessary for studyng the thermochemical properties of pyromellitic acid (PMK)-based peroxides were investigated. Obtaining a tetramethyl ester of a PMK was described. The mechanism of an esterification reaction is discussed, as is the complete esterification of PMK with primary alcohol.

  9. Synthesis of higher monocarboxylic acids

    SciTech Connect

    Taikov, B.F.; Novakovskii, E.M.; Zhelkovskaya, V.P.; Shadrova, V.N.; Shcherbik, P.K.

    1981-01-01

    Brown-coal and peat waxes contain higher monocarboxylic acids, alcohols and esters of them as their main components. In view of this, considerable interest is presented by the preparation of individual compounds among those mentioned above, which is particularly important in the study of the composition and development of the optimum variants of the chemical processing of the waxes. In laboratory practice, to obtain higher monocarboxylic acids use is generally made of electrosynthesis according to Kolbe which permits unbranched higher aliphatic acids with given lengths of the hydrocarbon chain to be obtained. The aim of the present work was to synthesize higher monocarboxylic acids: arachidic, behenic, lignoceric, pentacosanoic, erotic, heptacosanoic, montanic, nonacosanoic, melissic, dotriacontanoic and tetratriacontanoic, which are present in waxes. Characteristics of synthesized acids are tabulated. 20 refs.

  10. Synthesis of nucleic acid methylphosphonothioates.

    PubMed Central

    Roelen, H C; de Vroom, E; van der Marel, G A; van Boom, J H

    1988-01-01

    The reagent obtained in situ by treating methylphosphonothioic dichloride with 1-hydroxy-6-trifluoromethylbenzotriazole could be used for the introduction of methylphosphonothioate linkages. The individual diastereomers of the protected dimer d-Tp(S,Me)A were applied in the synthesis of the chiral pure (R or S) hexamers d-[CpCpTp(S,Me)ApGpG]. The reagent showed also to be very effective for the preparation of the 3',5'-cyclic methylphosphonothioate of uridine. PMID:3412896

  11. Ribosomal Synthesis of Peptides with Multiple β-Amino Acids.

    PubMed

    Fujino, Tomoshige; Goto, Yuki; Suga, Hiroaki; Murakami, Hiroshi

    2016-02-17

    The compatibility of β-amino acids with ribosomal translation was studied for decades, but it has been still unclear whether the ribosome can accept various β-amino acids, and whether the ribosome can introduce multiple β-amino acids in a peptide. In the present study, by using the Escherichia coli reconstituted cell-free translation system with a reprogramed genetic code, we screened β-amino acids that give high single incorporation efficiency and used them to synthesize peptides containing multiple β-amino acids. The experiments of single β-amino acid incorporation into a peptide revealed that 13 β-amino acids are compatible with ribosomal translation. Six of the tested β-amino acids (βhGly, l-βhAla, l-βhGln, l-βhPhg, l-βhMet, and d-βhPhg) showed high incorporation efficiencies, and seven (l-βhLeu, l-βhIle, l-βhAsn, l-βhPhe, l-βhLys, d-βhAla, and d-βhLeu) showed moderate incorporation efficiencies; whereas no full-length peptide was produced using other β-amino acids (l-βhPro, l-βhTrp, and l-βhGlu). Subsequent double-incorporation experiments using β-amino acids with high single incorporation efficiency revealed that elongation of peptides with successive β-amino acids is prohibited. Efficiency of the double-incorporation of the β-amino acids was restored by the insertion of Tyr or Ile between the two β-amino acids. On the basis of these experiments, we also designed mRNA sequences of peptides, and demonstrated the ribosomal synthesis of peptides containing different types of β-amino acids at multiple positions. PMID:26807980

  12. Primer-Dependent and Primer-Independent Initiation of Double Stranded RNA Synthesis by Purified Arabidopsis RNA-Dependent RNA Polymerases RDR2 and RDR6

    PubMed Central

    Devert, Anthony; Fabre, Nicolas; Floris, Maïna; Canard, Bruno; Robaglia, Christophe; Crété, Patrice

    2015-01-01

    Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA) targeted by RNA silencing. The dsRNA is subsequently cleaved by the ribonuclease DICER-like into secondary small interfering RNAs (siRNAs) that reinforce and/or maintain the silenced state of the target RNA. Models of RNA silencing propose that RDRs could use primer-independent and primer-dependent initiation to generate dsRNA from a transcript targeted by primary siRNA or microRNA (miRNA). However, the biochemical activities of RDR proteins are still partly understood. Here, we obtained active recombinant RDR2 and RDR6 in a purified form. We demonstrate that RDR2 and RDR6 have primer-independent and primer-dependent RNA polymerase activities with different efficiencies. We further show that RDR2 and RDR6 can initiate dsRNA synthesis either by elongation of 21- to 24- nucleotides RNAs hybridized to complementary RNA template or by elongation of self-primed RNA template. These findings provide new insights into our understanding of the molecular mechanisms of RNA silencing in plants. PMID:25793874

  13. Primer-dependent and primer-independent initiation of double stranded RNA synthesis by purified Arabidopsis RNA-dependent RNA polymerases RDR2 and RDR6.

    PubMed

    Devert, Anthony; Fabre, Nicolas; Floris, Maïna; Canard, Bruno; Robaglia, Christophe; Crété, Patrice

    2015-01-01

    Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA) targeted by RNA silencing. The dsRNA is subsequently cleaved by the ribonuclease DICER-like into secondary small interfering RNAs (siRNAs) that reinforce and/or maintain the silenced state of the target RNA. Models of RNA silencing propose that RDRs could use primer-independent and primer-dependent initiation to generate dsRNA from a transcript targeted by primary siRNA or microRNA (miRNA). However, the biochemical activities of RDR proteins are still partly understood. Here, we obtained active recombinant RDR2 and RDR6 in a purified form. We demonstrate that RDR2 and RDR6 have primer-independent and primer-dependent RNA polymerase activities with different efficiencies. We further show that RDR2 and RDR6 can initiate dsRNA synthesis either by elongation of 21- to 24- nucleotides RNAs hybridized to complementary RNA template or by elongation of self-primed RNA template. These findings provide new insights into our understanding of the molecular mechanisms of RNA silencing in plants. PMID:25793874

  14. Synthesis of folate-functionalized RAFT polymers for targeted siRNA delivery

    PubMed Central

    Srinivasan, Selvi; Shubin, Andrew D.; Stayton, Patrick S.

    2011-01-01

    Receptor-mediated, cell-specific delivery of siRNA enables silencing of target genes in specific tissues, opening the door to powerful therapeutic options for a multitude of diseases. However, development of delivery systems capable of targeted and effective siRNA delivery typically requires multiple steps and use of sophisticated, orthogonal chemistries. Previously, we developed diblock copolymers consisting of dimethaminoethyl methacrylate-b-dimethylaminoethyl methacrylate-co-butyl methacrylate-copropylacrylic acid as potent siRNA delivery systems that protect siRNA from enzymatic degradation and enable its cytosolic delivery through pH-responsive, endosomolytic behavior.1,2 These architectures were polymerized using a living radical polymerization method, specifically reversible addition-fragmentation chain transfer (RAFT) polymerization, which employs a chain transfer agent (CTA) to modulate the rate of reaction, resulting in polymers with low polydispersity and telechelic chain ends reflecting the chemistry of the CTA. Here, we describe the straightforward, facile synthesis of a folate receptor-targeted diblock copolymer siRNA delivery system, as the folate receptor is an attractive target for tumor-selective therapies due to its overexpression in a number of cancers. Specifically, we detail the de novo synthesis of a folate-functionalized CTA, use the folate-CTA for controlled polymerizations of diblock copolymers, and demonstrate efficient, specific cellular folate receptor interaction and in vitro gene knockdown using the folate-functionalized polymer. PMID:21634800

  15. Fructose utilization for nucleic acid synthesis in the fetal pig.

    PubMed

    White, C E; Piper, E L; Noland, P R; Daniels, L B

    1982-07-01

    Eight fetal pigs, in utero, were injected ip with 20 microCi/fetus [U14C]-fructose between d 55 and 65 pregnancy. The isotope was allowed to equilibrate between blood and tissues within injected fetuses for a period of 240 min. Fetal pigs were then sacrificed and nucleic acids were extracted from cold tissue homogenates of skeletal muscle and liver. Nuclide disintegrations per minute recovered in extracted DNA and RNA were used to calculate incorporation of labeled C from fructose. The recovery of labeled C per mmol of nucleic acids from skeletal muscle was greater (P less than .05) than that from liver. Relative incorporation of labeled C into skeletal muscle RNA (395.9 pmol/mmol) was greater (P less than .05) than for DNA (189.5 pmol/mmol). The same trend was observed for liver RNA (78.0 pmol/mmol) and DNA (55.6 pmol/mmol), but differences were nonsignificant. These data suggest that at least part of the high concentration of endogenous fructose measured in fetal pigs in utero is involved in synthesis of nucleic acids, thereby providing substrate for anabolic functions necessary for fetal growth and development. PMID:6181047

  16. RNA synthesis in isolated rat osteoclasts: inhibitory effect of calcitonin.

    PubMed

    Zheng, M H; Papadimitriou, J M; Nicholson, G C

    1991-01-01

    The metabolism of RNA has not been studied in the osteoclast (OC) because these bone-resorbing cells are only available in small numbers and cultures are always contaminated with other cells. Using two single-cell assay techniques, tritiated uridine (3H-UdR) autoradiography and gallocyanin quantitative cytophotometry, we have examined RNA synthesis in OCs isolated from neonatal rats. Oligo-nuclear OCs showed greater nuclear uptake of 3H-UdR than cells with many nuclei, and the variance of nuclear labeling within polykarya was greater in the latter, possibly because they contain nuclei of various ages. Salmon calcitonin (sCT) was a potent (ED50 approximately 5 x 10(-12) M) and rapid (40% reduction in 2 h, 75% reduction in 6 h) inhibitor of 3H-UdR uptake, and also reduced cytochemical total cellular RNA by 22% within 4 h. Forskolin (10(-5) M) inhibited nuclear uptake of 3H-UdR, suggesting that the sCT response may be mediated by cyclic AMP. Following a short (30 min) exposure to sCT, there was a progressive decline in labeling, followed by complete recovery by 4.5 h, a response possibly related to the phenomenon of calcitonin-induced persistent activation of adenylate cyclase. Inhibition of OC RNA synthesis may be an important component of its anti-resorptive action. PMID:1723609

  17. Alphavirus RNA synthesis and non-structural protein functions

    PubMed Central

    Rupp, Jonathan C.; Sokoloski, Kevin J.; Gebhart, Natasha N.

    2015-01-01

    The members of the genus Alphavirus are positive-sense RNA viruses, which are predominantly transmitted to vertebrates by a mosquito vector. Alphavirus disease in humans can be severely debilitating, and depending on the particular viral species, infection may result in encephalitis and possibly death. In recent years, alphaviruses have received significant attention from public health authorities as a consequence of the dramatic emergence of chikungunya virus in the Indian Ocean islands and the Caribbean. Currently, no safe, approved or effective vaccine or antiviral intervention exists for human alphavirus infection. The molecular biology of alphavirus RNA synthesis has been well studied in a few species of the genus and represents a general target for antiviral drug development. This review describes what is currently understood about the regulation of alphavirus RNA synthesis, the roles of the viral non-structural proteins in this process and the functions of cis-acting RNA elements in replication, and points to open questions within the field. PMID:26219641

  18. pp32 and APRIL are host cell-derived regulators of influenza virus RNA synthesis from cRNA

    PubMed Central

    Sugiyama, Kenji; Kawaguchi, Atsushi; Okuwaki, Mitsuru; Nagata, Kyosuke

    2015-01-01

    Replication of influenza viral genomic RNA (vRNA) is catalyzed by viral RNA-dependent RNA polymerase (vRdRP). Complementary RNA (cRNA) is first copied from vRNA, and progeny vRNAs are then amplified from the cRNA. Although vRdRP and viral RNA are minimal requirements, efficient cell-free replication could not be reproduced using only these viral factors. Using a biochemical complementation assay system, we found a novel activity in the nuclear extracts of uninfected cells, designated IREF-2, that allows robust unprimed vRNA synthesis from a cRNA template. IREF-2 was shown to consist of host-derived proteins, pp32 and APRIL. IREF-2 interacts with a free form of vRdRP and preferentially upregulates vRNA synthesis rather than cRNA synthesis. Knockdown experiments indicated that IREF-2 is involved in in vivo viral replication. On the basis of these results and those of previous studies, a plausible role(s) for IREF-2 during the initiation processes of vRNA replication is discussed. DOI: http://dx.doi.org/10.7554/eLife.08939.001 PMID:26512887

  19. Action of Inhibitors of RNA and Protein Synthesis on Cell Enlargement 1

    PubMed Central

    Noodén, Larry D.; Thimann, Kenneth V.

    1966-01-01

    Further studies with inhibitors of protein synthesis are presented to support the conclusion, drawn from work with chloramphenicol, that protein synthesis is a critical limiting factor in auxin-induced cell expansion. The indoleacetic acid-induced elongation of oat coleoptile sections was strongly inhibited by dl-p-fluorophenylalanine, and the inhibition is antagonized by phenylalanine. Puromycin at 10−4 m very strongly inhibited the indoleacetic acid-induced growth of oat coleoptile and artichoke tuber sections and exerted a less powerful effect on pea stem sections. As found earlier with chloramphenicol, concentrations of puromycin effective in inhibiting the growth of coleoptile sections had quantitatively similar effects on protein synthesis, as measured by the incorporation of C14-leucine into protein of the coleoptile tissue. Several analogues of RNA bases were also tested, but while 8-azaguanine very strongly inhibited growth of artichoke tuber disks, 6-azauracil was the only one of this group clearly inhibitory to growth in coleoptile or pea stem sections. Actinomycin D actively inhibited both elongation and the incorporation of C14-leucine into protein in oat coleoptile sections. Inhibition of the 2 processes went closely parallel. Actinomycin D also powerfully inhibited growth of artichoke tuber disks. All the compounds effective in inhibiting growth generally inhibited the uptake of leucine as well. The possibility that auxin causes cell enlargement in plants by inducing the synthesis of a messenger RNA and of one or more new but unstable enzymes, is discussed. Possible but less favored alternative explanations are: A) that auxin induces synthesis of a wall protein, or B) that the continued synthesis of some other unstable protein (by a process independent of auxin) may be a prerequisite for cell enlargement. PMID:5904588

  20. Improved Incorporation of Noncanonical Amino Acids by an Engineered tRNA(Tyr) Suppressor.

    PubMed

    Rauch, Benjamin J; Porter, Joseph J; Mehl, Ryan A; Perona, John J

    2016-01-26

    The Methanocaldcoccus jannaschii tyrosyl-tRNA synthetase (TyrRS):tRNA(Tyr) cognate pair has been used to incorporate a large number of noncanonical amino acids (ncAAs) into recombinant proteins in Escherichia coli. However, the structural elements of the suppressor tRNA(Tyr) used in these experiments have not been examined for optimal performance. Here, we evaluate the steady-state kinetic parameters of wild-type M. jannaschii TyrRS and an evolved 3-nitrotyrosyl-tRNA synthetase (nitroTyrRS) toward several engineered tRNA(Tyr) suppressors, and we correlate aminoacylation properties with the efficiency and fidelity of superfolder green fluorescent protein (sfGFP) synthesis in vivo. Optimal ncAA-sfGFP synthesis correlates with improved aminoacylation kinetics for a tRNA(Tyr) amber suppressor with two substitutions in the anticodon loop (G34C/G37A), while four additional mutations in the D and variable loops, present in the tRNA(Tyr) used in all directed evolution experiments to date, are deleterious to function both in vivo and in vitro. These findings extend to three of four other evolved TyrRS enzymes that incorporate distinct ncAAs. Suppressor tRNAs elicit decreases in amino acid Km values for both TyrRS and nitroTyrRS, suggesting that direct anticodon recognition by TyrRS need not be an impediment to superior performance of this orthogonal system and offering insight into novel approaches for directed evolution. The G34C/G37A tRNA(Tyr) may enhance future incorporation of many ncAAs by engineered TyrRS enzymes. PMID:26694948

  1. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the snythesis methods of the prior art.

  2. Synthesis of Alkyl Methylphosphonic Acid Esters

    SciTech Connect

    Mong, Gary M.; Harvey, Scott D.; Campbell, James A.

    2005-08-01

    This manuscript describes a simple synthesis and purification of cyclohexyl methylphosphonic and isopropyl methylphosphonic acids that provides high purity (>95% purity) product in gram quantities. Based on needs for improved analytical methods for indirect detection of nerve agent use, there is an increasing demand for these nerve agent hydrolysis products. These products are not commercially available. Synthesis is based on reaction of equimolar amounts of alcohol with methylphosphonic dichloride in toluene followed by the addition of excess water (two mole equivalents). The product was then extracted from the resulting aqueous layer into chloroform. The extraction scheme proved highly effective in removing unreacted starting materials and reaction by-products.

  3. Gene activity during germination of spores of the fern, Onoclea sensibilis: RNA and protein synthesis and the role of stored mRNA

    NASA Technical Reports Server (NTRS)

    Raghavan, V.

    1991-01-01

    Pattern of 3H-uridine incorporation into RNA of spores of Onoclea sensibilis imbibed in complete darkness (non-germinating conditions) and induced to germinate in red light was followed by oligo-dT cellulose chromatography, gel electrophoresis coupled with fluorography and autoradiography. In dark-imbibed spores, RNA synthesis was initiated about 24 h after sowing, with most of the label accumulating in the high mol. wt. poly(A) -RNA fraction. There was no incorporation of the label into poly(A) +RNA until 48 h after sowing. In contrast, photo-induced spores began to synthesize all fractions of RNA within 12 h after sowing and by 24 h, incorporation of 3H-uridine into RNA of irradiated spores was nearly 70-fold higher than that into dark-imbibed spores. Protein synthesis, as monitored by 3H-arginine incorporation into the acid-insoluble fraction and by autoradiography, was initiated in spores within 1-2 h after sowing under both conditions. Autoradiographic experiments also showed that onset of protein synthesis in the cytoplasm of the germinating spore is independent of the transport of newly synthesized nuclear RNA. One-dimensional sodium dodecyl sulphate-polyacrylamide gel electrophoresis of 35S-methionine-labelled proteins revealed a good correspondence between proteins synthesized in a cell-free translation system directed by poly(A) +RNA of dormant spores and those synthesized in vivo by dark-imbibed and photo-induced spores. These results indicate that stored mRNAs of O. sensibilis spores are functionally competent and provide templates for the synthesis of proteins during dark-imbibition and germination.

  4. Synthesis of carbon-13-labeled tetradecanoic acids.

    PubMed

    Sparrow, J T; Patel, K M; Morrisett, J D

    1983-07-01

    The synthesis of tetradecanoic acid enriched with 13C at carbons 1, 3, or 6 is described. The label at the carbonyl carbon was introduced by treating 1-bromotridecane with K13CN (90% enriched) to form the 13C-labeled nitrile, which upon hydrolysis yielded the desired acid. The [3-13C]tetradecanoic acid was synthesized by alkylation of diethyl sodio-malonate with [1-13C]1-bromododecane; the acid was obtained upon saponification and decarboxylation. The label at the 6 position was introduced by coupling the appropriately labeled alkylcadmium chloride with the half acid chloride methyl ester of the appropriate dioic acid, giving the corresponding oxo fatty acid ester. Formation of the tosylhydrazone of the oxo-ester followed by reduction with sodium cyanoborohydride gave the labeled methyl tetradecanoate which, upon hydrolysis, yielded the desired tetradecanoic acid. All tetradecanoic acids were identical to unlabeled analogs as evaluated by gas-liquid chromatography and infrared or NMR spectroscopy. These labeled fatty acids were used subsequently to prepare the correspondingly labeled diacyl phosphatidylcholines. PMID:6631228

  5. Bromovirus RNA replication and transcription require compatibility between the polymerase- and helicase-like viral RNA synthesis proteins.

    PubMed Central

    Dinant, S; Janda, M; Kroner, P A; Ahlquist, P

    1993-01-01

    The positive-strand RNA bromoviruses encode two nonstructural proteins, 1a and 2a, involved in RNA-dependent RNA replication. These proteins have extensive sequence similarities with methyltransferase, helicase, and polymerase proteins of other plant and animal viruses. 1a and 2a can also form a complex in vitro. To explore whether 1a-2a interaction is required for RNA replication in vivo, we reassorted the 1a and 2a genes from two different bromoviruses, brome mosaic virus (BMV) and cowpea chlorotic mottle virus (CCMV). 1a and 2a were expressed independently of viral replication by using RNA- or DNA-based transient expression, and their in vivo RNA replication activities were tested in protoplasts with BMV and CCMV RNA3 templates. RNA-based transient expression confirmed prior indications that bromovirus RNA replication is more sensitive to reductions in 1a expression than to reductions in 2a expression. DNA-based expression of the homologous combinations of 1a and 2a supported high levels of RNA synthesis, but both 1a-2a heterologous combinations exhibited RNA synthesis defects. The combination of CCMV 1a and BMV 2a did not support detectable synthesis of negative-strand, positive-strand, or subgenomic RNA. The converse combination of BMV 1a and CCMV 2a was preferentially defective in positive-strand and subgenomic RNA accumulation, showing that 1a-2a interaction is involved in these processes in ways distinct from negative-strand RNA synthesis, which was only slightly affected. These results indicate that at least some functions of 1a and 2a operate in a mutually dependent manner in vivo and that the mechanisms of positive- and negative-strand RNA synthesis are differentiated in part by features of such interactions. Images PMID:8230440

  6. Guanine nucleotide depletion inhibits pre-ribosomal RNA synthesis and causes nucleolar disruption.

    PubMed

    Huang, Min; Ji, Yanshan; Itahana, Koji; Zhang, Yanping; Mitchell, Beverly

    2008-01-01

    Inosine monophosphate dehydrogenase (IMPDH) is a pivotal enzyme in the de novo pathway of guanine nucleotide biosynthesis. Inhibitors of this enzyme decrease intracellular guanine nucleotide levels by 50-80% and have potential as anti-neoplastic agents. Both mycophenolic acid (MPA) and AVN-944 are highly specific inhibitors of IMPDH that cause cell cycle arrest or apoptosis in lymphocytes and leukemic cell lines. We have examined the mechanisms by which these two agents cause cytotoxicity. Both MPA and AVN-944 inhibit the growth of K562 cells, and induce apoptosis in Raji B and CCRF-CEM T cells. Both compounds strikingly inhibit RNA synthesis within 2 h of exposure. Depletion of guanine nucleotides by MPA and AVN-944 also causes an early and near-complete reduction in levels of the 45S precursor rRNA synthesis and the concomitant translocation of nucleolar proteins including nucleolin, nucleophosmin, and nucleostemin from the nucleolus to the nucleoplasm. This efflux correlates temporally with the sustained induction of p53 in cell lines with wild-type p53. We conclude that inhibition of IMPDH causes a primary reduction in rRNA synthesis and secondary nucleolar disruption and efflux of nucleolar proteins that most likely mediate cell cycle arrest or apoptosis. The ability of AVN-944 to induce apoptosis in a number of leukemic cell lines supports its potential utility in the treatment of hematologic malignancies. PMID:17462731

  7. Synthesis of alpha-amino acids

    DOEpatents

    Davis, J.W. Jr.

    1983-01-25

    A method is described for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R[sub 1]R[sub 2]C(OSOCl)CN, R[sub 1]R[sub 2]C(Cl)CN and [R[sub 1]R[sub 2]C(CN)O][sub 2]SO wherein R[sub 1] and R[sub 2] are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art. No Drawings

  8. Stabilization of tubulin mRNA by inhibition of protein synthesis in sea urchin embryos.

    PubMed Central

    Gong, Z Y; Brandhorst, B P

    1988-01-01

    An increased level of unpolymerized tubulin caused by depolymerization of microtubules in sea urchin larvae resulted in a rapid loss of tubulin mRNA, which was prevented by nearly complete inhibition of protein synthesis. Results of an RNA run-on assay indicated that inhibition of protein synthesis does not alter tubulin gene transcription. Analysis of the decay of tubulin mRNA in embryos in which RNA synthesis was inhibited by actinomycin D indicated that inhibition of protein synthesis prevents the destabilization of tubulin mRNA. The effect was similar whether mRNA was maintained on polysomes in the presence of emetine or anisomycin or displaced from the polysomes in the presence of puromycin or pactamycin; thus, the stabilization of tubulin mRNA is not dependent on the state of the polysomes after inhibition of protein synthesis. Even after tubulin mRNA declined to a low level after depolymerization of microtubules, it could be rescued by treatment of embryos with inhibitors of protein synthesis. Tubulin mRNA could be induced to accumulate prematurely in gastrulae but not in plutei if protein synthesis was inhibited, an observation that is indicative of the importance of the autogenous regulation of tubulin mRNA stability during embryogenesis. Possible explanations for the role of protein synthesis in the control of mRNA stability are discussed. Images PMID:3211150

  9. Peptide nucleic acids rather than RNA may have been the first genetic molecule

    NASA Technical Reports Server (NTRS)

    Nelson, K. E.; Levy, M.; Miller, S. L.

    2000-01-01

    Numerous problems exist with the current thinking of RNA as the first genetic material. No plausible prebiotic processes have yet been demonstrated to produce the nucleosides or nucleotides or for efficient two-way nonenzymatic replication. Peptide nucleic acid (PNA) is a promising precursor to RNA, consisting of N-(2-aminoethyl)glycine (AEG) and the adenine, uracil, guanine, and cytosine-N-acetic acids. However, PNA has not yet been demonstrated to be prebiotic. We show here that AEG is produced directly in electric discharge reactions from CH(4), N(2), NH(3), and H(2)O. Electric discharges also produce ethylenediamine, as do NH(4)CN polymerizations. AEG is produced from the robust Strecker synthesis with ethylenediamine. The NH(4)CN polymerization in the presence of glycine leads to the adenine and guanine-N(9)-acetic acids, and the cytosine and uracil-N(1)-acetic acids are produced in high yield from the reaction of cyanoacetaldehyde with hydantoic acid, rather than urea. Preliminary experiments suggest that AEG may polymerize rapidly at 100 degrees C to give the polypeptide backbone of PNA. The ease of synthesis of the components of PNA and possibility of polymerization of AEG reinforce the possibility that PNA may have been the first genetic material.

  10. An intrinsically disordered peptide from Ebola virus VP35 controls viral RNA synthesis by modulating nucleoprotein-RNA interactions

    SciTech Connect

    Leung, Daisy  W.; Borek, Dominika; Luthra, Priya; Binning, Jennifer  M.; Anantpadma, Manu; Liu, Gai; Harvey, Ian B.; Su, Zhaoming; Endlich-Frazier, Ariel; Pan, Juanli; Shabman, Reed  S.; Chiu, Wah; Davey, Robert  A.; Otwinowski, Zbyszek; Basler, Christopher  F.; Amarasinghe, Gaya  K.

    2015-04-01

    During viral RNA synthesis, Ebola virus (EBOV) nucleoprotein (NP) alternates between an RNA-template-bound form and a template-free form to provide the viral polymerase access to the RNA template. In addition, newly synthesized NP must be prevented from indiscriminately binding to noncognate RNAs. Here, we investigate the molecular bases for these critical processes. We identify an intrinsically disordered peptide derived from EBOV VP35 (NPBP, residues 20–48) that binds NP with high affinity and specificity, inhibits NP oligomerization, and releases RNA from NP-RNA complexes in vitro. The structure of the NPBP/ΔNPNTD complex, solved to 3.7 Å resolution, reveals how NPBP peptide occludes a large surface area that is important for NP-NP and NP-RNA interactions and for viral RNA synthesis. Together, our results identify a highly conserved viral interface that is important for EBOV replication and can be targeted for therapeutic development.

  11. Cystoviral polymerase complex protein P7 uses its acidic C-terminal tail to regulate the RNA-directed RNA polymerase P2.

    PubMed

    Alphonse, Sébastien; Arnold, Jamie J; Bhattacharya, Shibani; Wang, Hsin; Kloss, Brian; Cameron, Craig E; Ghose, Ranajeet

    2014-07-15

    In bacteriophages of the cystovirus family, the polymerase complex (PX) encodes a 75-kDa RNA-directed RNA polymerase (P2) that transcribes the double-stranded RNA genome. Also a constituent of the PX is the essential protein P7 that, in addition to accelerating PX assembly and facilitating genome packaging, plays a regulatory role in transcription. Deletion of P7 from the PX leads to aberrant plus-strand synthesis suggesting its influence on the transcriptase activity of P2. Here, using solution NMR techniques and the P2 and P7 proteins from cystovirus ϕ12, we demonstrate their largely electrostatic interaction in vitro. Chemical shift perturbations on P7 in the presence of P2 suggest that this interaction involves the dynamic C-terminal tail of P7, more specifically an acidic cluster therein. Patterns of chemical shift changes induced on P2 by the P7 C-terminus resemble those seen in the presence of single-stranded RNA suggesting similarities in binding. This association between P2 and P7 reduces the affinity of the former toward template RNA and results in its decreased activity both in de novo RNA synthesis and in extending a short primer. Given the presence of C-terminal acidic tracts on all cystoviral P7 proteins, the electrostatic nature of the P2/P7 interaction is likely conserved within the family and could constitute a mechanism through which P7 regulates transcription in cystoviruses. PMID:24813120

  12. Changes in the patterns of synthesis of ribonucleic acid species in immature rat uterus in response to oestradiol-17β

    PubMed Central

    Billing, R. J.; Barbiroli, B.; Smellie, R. M. S.

    1969-01-01

    1. After treatment of immature rats with diethylstilboestrol, the wet weight and RNA content of uterine tissue increased rapidly, reaching a peak at 40hr. After an initial lag of a few hours, the acid-soluble ribose and protein contents also rose to maxima at 40hr. No increase in DNA content occurred until at least 24hr. after treatment. 2. The RNA from immature rat uterus isolated at various times up to 6hr. after administration of oestradiol-17β was labelled by injecting [3H]uridine and [3H]guanosine intraperitoneally 30min. before the animals were killed. It was fractionated on columns of kieselguhr coated with methylated serum albumin and the radioactivity in fractions corresponding to transfer RNA, 7s RNA, ribosomal RNA, Q1-RNA, Q2-RNA and DNA-like RNA was determined. 3. The radioactivity of the whole RNA increased steadily for 6hr. after hormone treatment. The earliest changes occurred in the Q1-RNA (ribosomal RNA precursor), whereas at longer time-intervals the radioactivity of the ribosomal RNA, 7s RNA and transfer RNA increased by four- to five-fold. The radioactivity of the DNA-like RNA increased by about 50%, but only at the longer time-intervals. 4. It is concluded that one of the earliest changes in response to oestradiol treatment is a major increase in synthesis of ribosomal RNA followed later by a similar increase in synthesis of transfer RNA and by a much smaller increase in synthesis of DNA-like RNA. The change in synthesis of ribosomal RNA in immature rat uterus may represent one of the most important responses to oestradiol treatment. PMID:4309670

  13. Stimulation of delta-Aminolevulinic Acid Formation in Algal Extracts by Heterologous RNA.

    PubMed

    Weinstein, J D; Mayer, S M; Beale, S I

    1986-12-01

    Formation of the chlorophyll and heme precursor delta-aminolevulinic acid (ALA) from glutamate in soluble extracts of Chlorella vulgaris, Euglena gracilis, and Cyanidium caldarium was stimulated by addition of low molecular weight RNA derived from greening algae or plant tissue. Enzyme extracts were prepared for the ALA formation assay by high-speed centrifugation, partial RNA depletion, and gel filtration through Sephadex G-25. RNA was extracted from greening barley epicotyls, greening cucumber cotyledon chloroplasts, and growing cells of Chlorella, Euglena, Chlamydomonas reinhardtii, and Anacystis nidulans, freed of protein, and fractionated on DEAE-cellulose to yield an active component corresponding to the tRNA-containing fraction. RNA from homologous and heterologous species stimulated ALA formation when added to enzyme extracts, and the degree of stimulation was proportional to the amount of RNA added. Algal enzyme extracts were stimulated by algal RNAs interchangeably, with the exception of RNA prepared from aplastidic Euglena, which did not stimulate ALA production. RNA from greening cucumber cotyledon chloroplasts and greening barley epicotyls stimulated ALA formation in algal enzyme incubations. In contrast, tRNA from Escherichia coli, both nonspecific and glutamate-specific, as well as wheat germ, bovine liver, and yeast tRNA, failed to reconstitute ALA formation. Moreover, E. coli tRNA inhibited ALA formation by algal extracts, both in the presence and absence of added algal RNA. Chlorella extracts were capable of catalyzing aminoacyl bond formation between glutamate and both the activity reconstituting and nonreconstituting RNAs, indicating that the inability of some RNAs to stimulate ALA formation was not due to their inability to serve as glutamyl acceptors. The first step in the ALA-forming reaction sequence has been proposed to be activation of glutamate via aminoacyl bond formation with a specific tRNA, analogous to the first step in peptide bond

  14. Stochastic mRNA synthesis in mammalian cells.

    PubMed

    Raj, Arjun; Peskin, Charles S; Tranchina, Daniel; Vargas, Diana Y; Tyagi, Sanjay

    2006-10-01

    Individual cells in genetically homogeneous populations have been found to express different numbers of molecules of specific proteins. We investigated the origins of these variations in mammalian cells by counting individual molecules of mRNA produced from a reporter gene that was stably integrated into the cell's genome. We found that there are massive variations in the number of mRNA molecules present in each cell. These variations occur because mRNAs are synthesized in short but intense bursts of transcription beginning when the gene transitions from an inactive to an active state and ending when they transition back to the inactive state. We show that these transitions are intrinsically random and not due to global, extrinsic factors such as the levels of transcriptional activators. Moreover, the gene activation causes burst-like expression of all genes within a wider genomic locus. We further found that bursts are also exhibited in the synthesis of natural genes. The bursts of mRNA expression can be buffered at the protein level by slow protein degradation rates. A stochastic model of gene activation and inactivation was developed to explain the statistical properties of the bursts. The model showed that increasing the level of transcription factors increases the average size of the bursts rather than their frequency. These results demonstrate that gene expression in mammalian cells is subject to large, intrinsically random fluctuations and raise questions about how cells are able to function in the face of such noise. PMID:17048983

  15. Decreased hepatotoxic bile acid composition and altered synthesis in progressive human nonalcoholic fatty liver disease

    SciTech Connect

    Lake, April D.; Novak, Petr; Shipkova, Petia; Aranibar, Nelly; Robertson, Donald; Reily, Michael D.; Lu, Zhenqiang; Lehman-McKeeman, Lois D.; Cherrington, Nathan J.

    2013-04-15

    Bile acids (BAs) have many physiological roles and exhibit both toxic and protective influences within the liver. Alterations in the BA profile may be the result of disease induced liver injury. Nonalcoholic fatty liver disease (NAFLD) is a prevalent form of chronic liver disease characterized by the pathophysiological progression from simple steatosis to nonalcoholic steatohepatitis (NASH). The hypothesis of this study is that the ‘classical’ (neutral) and ‘alternative’ (acidic) BA synthesis pathways are altered together with hepatic BA composition during progression of human NAFLD. This study employed the use of transcriptomic and metabolomic assays to study the hepatic toxicologic BA profile in progressive human NAFLD. Individual human liver samples diagnosed as normal, steatosis, and NASH were utilized in the assays. The transcriptomic analysis of 70 BA genes revealed an enrichment of downregulated BA metabolism and transcription factor/receptor genes in livers diagnosed as NASH. Increased mRNA expression of BAAT and CYP7B1 was observed in contrast to decreased CYP8B1 expression in NASH samples. The BA metabolomic profile of NASH livers exhibited an increase in taurine together with elevated levels of conjugated BA species, taurocholic acid (TCA) and taurodeoxycholic acid (TDCA). Conversely, cholic acid (CA) and glycodeoxycholic acid (GDCA) were decreased in NASH liver. These findings reveal a potential shift toward the alternative pathway of BA synthesis during NASH, mediated by increased mRNA and protein expression of CYP7B1. Overall, the transcriptomic changes of BA synthesis pathway enzymes together with altered hepatic BA composition signify an attempt by the liver to reduce hepatotoxicity during disease progression to NASH. - Highlights: ► Altered hepatic bile acid composition is observed in progressive NAFLD. ► Bile acid synthesis enzymes are transcriptionally altered in NASH livers. ► Increased levels of taurine and conjugated bile acids

  16. Serine Metabolism Supports the Methionine Cycle and DNA/RNA Methylation through De Novo ATP Synthesis in Cancer Cells.

    PubMed

    Maddocks, Oliver D K; Labuschagne, Christiaan F; Adams, Peter D; Vousden, Karen H

    2016-01-21

    Crosstalk between cellular metabolism and the epigenome regulates epigenetic and metabolic homeostasis and normal cell behavior. Changes in cancer cell metabolism can directly impact epigenetic regulation and promote transformation. Here we analyzed the contribution of methionine and serine metabolism to methylation of DNA and RNA. Serine can contribute to this pathway by providing one-carbon units to regenerate methionine from homocysteine. While we observed this contribution under methionine-depleted conditions, unexpectedly, we found that serine supported the methionine cycle in the presence and absence of methionine through de novo ATP synthesis. Serine starvation increased the methionine/S-adenosyl methionine ratio, decreasing the transfer of methyl groups to DNA and RNA. While serine starvation dramatically decreased ATP levels, this was accompanied by lower AMP and did not activate AMPK. This work highlights the difference between ATP turnover and new ATP synthesis and defines a vital function of nucleotide synthesis beyond making nucleic acids. PMID:26774282

  17. Serine Metabolism Supports the Methionine Cycle and DNA/RNA Methylation through De Novo ATP Synthesis in Cancer Cells

    PubMed Central

    Maddocks, Oliver D.K.; Labuschagne, Christiaan F.; Adams, Peter D.; Vousden, Karen H.

    2016-01-01

    Summary Crosstalk between cellular metabolism and the epigenome regulates epigenetic and metabolic homeostasis and normal cell behavior. Changes in cancer cell metabolism can directly impact epigenetic regulation and promote transformation. Here we analyzed the contribution of methionine and serine metabolism to methylation of DNA and RNA. Serine can contribute to this pathway by providing one-carbon units to regenerate methionine from homocysteine. While we observed this contribution under methionine-depleted conditions, unexpectedly, we found that serine supported the methionine cycle in the presence and absence of methionine through de novo ATP synthesis. Serine starvation increased the methionine/S-adenosyl methionine ratio, decreasing the transfer of methyl groups to DNA and RNA. While serine starvation dramatically decreased ATP levels, this was accompanied by lower AMP and did not activate AMPK. This work highlights the difference between ATP turnover and new ATP synthesis and defines a vital function of nucleotide synthesis beyond making nucleic acids. PMID:26774282

  18. Xylonucleic acid: synthesis, structure, and orthogonal pairing properties

    PubMed Central

    Maiti, Mohitosh; Maiti, Munmun; Knies, Christine; Dumbre, Shrinivas; Lescrinier, Eveline; Rosemeyer, Helmut; Ceulemans, Arnout; Herdewijn, Piet

    2015-01-01

    There is a common interest for studying xeno-nucleic acid systems in the fields of synthetic biology and the origin of life, in particular, those with an engineered backbone and possessing novel properties. Along this line, we have investigated xylonucleic acid (XyloNA) containing a potentially prebiotic xylose sugar (a 3′-epimer of ribose) in its backbone. Herein, we report for the first time the synthesis of four XyloNA nucleotide building blocks and the assembly of XyloNA oligonucleotides containing all the natural nucleobases. A detailed investigation of pairing and structural properties of XyloNAs in comparison to DNA/RNA has been performed by thermal UV-melting, CD, and solution state NMR spectroscopic studies. XyloNA has been shown to be an orthogonal self-pairing system which adopts a slightly right-handed extended helical geometry. Our study on one hand, provides understanding for superior structure-function (-pairing) properties of DNA/RNA over XyloNA for selection as an informational polymer in the prebiotic context, while on the other hand, finds potential of XyloNA as an orthogonal genetic system for application in synthetic biology. PMID:26175047

  19. DNA polymerase-α regulates the activation of type I interferons through cytosolic RNA:DNA synthesis.

    PubMed

    Starokadomskyy, Petro; Gemelli, Terry; Rios, Jonathan J; Xing, Chao; Wang, Richard C; Li, Haiying; Pokatayev, Vladislav; Dozmorov, Igor; Khan, Shaheen; Miyata, Naoteru; Fraile, Guadalupe; Raj, Prithvi; Xu, Zhe; Xu, Zigang; Ma, Lin; Lin, Zhimiao; Wang, Huijun; Yang, Yong; Ben-Amitai, Dan; Orenstein, Naama; Mussaffi, Huda; Baselga, Eulalia; Tadini, Gianluca; Grunebaum, Eyal; Sarajlija, Adrijan; Krzewski, Konrad; Wakeland, Edward K; Yan, Nan; de la Morena, Maria Teresa; Zinn, Andrew R; Burstein, Ezra

    2016-05-01

    Aberrant nucleic acids generated during viral replication are the main trigger for antiviral immunity, and mutations that disrupt nucleic acid metabolism can lead to autoinflammatory disorders. Here we investigated the etiology of X-linked reticulate pigmentary disorder (XLPDR), a primary immunodeficiency with autoinflammatory features. We discovered that XLPDR is caused by an intronic mutation that disrupts the expression of POLA1, which encodes the catalytic subunit of DNA polymerase-α. Unexpectedly, POLA1 deficiency resulted in increased production of type I interferons. This enzyme is necessary for the synthesis of RNA:DNA primers during DNA replication and, strikingly, we found that POLA1 is also required for the synthesis of cytosolic RNA:DNA, which directly modulates interferon activation. Together this work identifies POLA1 as a critical regulator of the type I interferon response. PMID:27019227

  20. Chemical Synthesis of a Hyaluronic Acid Decasaccharide

    PubMed Central

    Lu, Xiaowei; Kamat, Medha N.; Huang, Lijun; Huang, Xuefei

    2009-01-01

    The chemical synthesis of a hyaluronic acid decasaccharide using the pre-activation based chemoselective glycosylation strategy is described. Assembly of large oligosaccharides is generally challenging due to the increased difficulties in both glycosylation and deprotection. Indeed, the same building blocks previously employed for hyaluronic acid hexasaccharide syntheses failed to yield the desired decasaccharide. After extensive experimentation, the decasaccharide backbone was successfully constructed with an overall yield of 37% from disaccharide building blocks. The trichloroacetyl group was used as the nitrogen protective group for the glucosamine units and the addition of TMSOTf was found to be crucial to suppress the formation of trichloromethyl oxazoline side-product and enable high glycosylation yield. For deprotections, the combination of a mild basic condition and the monitoring methodology using 1H-NMR allowed the removal of all base-labile protective groups, which facilitated the generation of the fully deprotected HA decasaccharide. PMID:19764799

  1. Potency of individual bile acids to regulate bile acid synthesis and transport genes in primary human hepatocyte cultures.

    PubMed

    Liu, Jie; Lu, Hong; Lu, Yuan-Fu; Lei, Xiaohong; Cui, Julia Yue; Ellis, Ewa; Strom, Stephen C; Klaassen, Curtis D

    2014-10-01

    Bile acids (BAs) are known to regulate their own homeostasis, but the potency of individual bile acids is not known. This study examined the effects of cholic acid (CA), chenodeoxycholic acid (CDCA), deoxycholic acid (DCA), lithocholic acid (LCA) and ursodeoxycholic acid (UDCA) on expression of BA synthesis and transport genes in human primary hepatocyte cultures. Hepatocytes were treated with the individual BAs at 10, 30, and 100μM for 48 h, and RNA was extracted for real-time PCR analysis. For the classic pathway of BA synthesis, BAs except for UDCA markedly suppressed CYP7A1 (70-95%), the rate-limiting enzyme of bile acid synthesis, but only moderately (35%) down-regulated CYP8B1 at a high concentration of 100μM. BAs had minimal effects on mRNA of two enzymes of the alternative pathway of BA synthesis, namely CYP27A1 and CYP7B1. BAs increased the two major target genes of the farnesoid X receptor (FXR), namely the small heterodimer partner (SHP) by fourfold, and markedly induced fibroblast growth factor 19 (FGF19) over 100-fold. The BA uptake transporter Na(+)-taurocholate co-transporting polypeptide was unaffected, whereas the efflux transporter bile salt export pump was increased 15-fold and OSTα/β were increased 10-100-fold by BAs. The expression of the organic anion transporting polypeptide 1B3 (OATP1B3; sixfold), ATP-binding cassette (ABC) transporter G5 (ABCG5; sixfold), multidrug associated protein-2 (MRP2; twofold), and MRP3 (threefold) were also increased, albeit to lesser degrees. In general, CDCA was the most potent and effective BA in regulating these genes important for BA homeostasis, whereas DCA and CA were intermediate, LCA the least, and UDCA ineffective. PMID:25055961

  2. Conditional expression of RPA190, the gene encoding the largest subunit of yeast RNA polymerase I: effects of decreased rRNA synthesis on ribosomal protein synthesis.

    PubMed Central

    Wittekind, M; Kolb, J M; Dodd, J; Yamagishi, M; Mémet, S; Buhler, J M; Nomura, M

    1990-01-01

    The synthesis of ribosomal proteins (r proteins) under the conditions of greatly reduced RNA synthesis were studied by using a strain of the yeast Saccharomyces cerevisiae in which the production of the largest subunit (RPA190) of RNA polymerase I was controlled by the galactose promoter. Although growth on galactose medium was normal, the strain was unable to sustain growth when shifted to glucose medium. This growth defect was shown to be due to a preferential decrease in RNA synthesis caused by deprivation of RNA polymerase I. Under these conditions, the accumulation of r proteins decreased to match the rRNA synthesis rate. When proteins were pulse-labeled for short periods, no or only a weak decrease was observed in the differential synthesis rate of several r proteins (L5, L39, L29 and/or L28, L27 and/or S21) relative to those of control cells synthesizing RPA190 from the normal promoter. Degradation of these r proteins synthesized in excess was observed during subsequent chase periods. Analysis of the amounts of mRNAs for L3 and L29 and their locations in polysomes also suggested that the synthesis of these proteins relative to other cellular proteins were comparable to those observed in control cells. However, Northern analysis of several r-protein mRNAs revealed that the unspliced precursor mRNA for r-protein L32 accumulated when rRNA synthesis rates were decreased. This result supports the feedback regulation model in which excess L32 protein inhibits the splicing of its own precursor mRNA, as proposed by previous workers (M. D. Dabeva, M. A. Post-Beittenmiller, and J. R. Warner, Proc. Natl. Acad. Sci. USA 83:5854-5857, 1986). Images PMID:2183018

  3. Hyaluronic acid lipoate: synthesis and physicochemical properties.

    PubMed

    Picotti, Fabrizio; Fabbian, Matteo; Gianni, Rita; Sechi, Alessandra; Stucchi, Luca; Bosco, Marco

    2013-03-01

    The synthesis and physicochemical characterisation of mixed lipoic and formic esters of hyaluronan (Lipohyal) are presented in this paper. The synthesis was conducted by activating lipoic acid with 1,1'-carbonyldiimidazole to obtain lipoyl imidazolide, which reacted with hyaluronan (HA) in formamide under basic conditions. This procedure allows researchers to modulate easily the degree of substitution over a range of 0.05-1.8. Radical scavenger properties were analysed by UV-vis spectroscopy, where improved performance was demonstrated for Lipohyal with respect to the HA row material and lipoic acid. The chemical modification also causes HA to show an improved resistance to hyaluronidase digestion. These findings show that Lipohyal is a highly interesting derivative for applications in the tricological and dermo-cosmetic field and as an anti-aging ingredient. Moreover, Lipohyal can be easily crosslinked by UV irradiation, resulting in an innovative hydrogel with distinctive viscoelastic properties that is suitable as both a dermal-filler and as an intra-articular medical device. PMID:23465930

  4. Chemical synthesis of the 5-taurinomethyl(-2-thio)uridine modified anticodon arm of the human mitochondrial tRNA(Leu(UUR)) and tRNA(Lys).

    PubMed

    Leszczynska, Grazyna; Leonczak, Piotr; Wozniak, Karolina; Malkiewicz, Andrzej

    2014-06-01

    5-Taurinomethyluridine (τm(5)U) and 5-taurinomethyl-2-thiouridine (τm(5)s(2)U) are located at the wobble position of human mitochondrial (hmt) tRNA(Leu(UUR)) and tRNA(Lys), respectively. Both hypermodified units restrict decoding of the third codon letter to A and G. Pathogenic mutations in the genes encoding hmt-tRNA(Leu(UUR)) and hmt-tRNA(Lys) are responsible for the loss of the discussed modifications and, as a consequence, for the occurrence of severe mitochondrial dysfunctions (MELAS, MERRF). Synthetic oligoribonucleotides bearing modified nucleosides are a versatile tool for studying mechanisms of genetic message translation and accompanying pathologies at nucleoside resolution. In this paper, we present site-specific chemical incorporation of τm(5)U and τm(5)s(2)U into 17-mers related to the sequence of the anticodon arms hmt-tRNA(Leu(UUR)) and hmt-tRNA(Lys), respectively employing phosphoramidite chemistry on CPG support. Selected protecting groups for the sulfonic acid (4-(tert-butyldiphenylsilanyloxy)-2,2-dimethylbutyl) and the exoamine function (-C(O)CF3) are compatible with the blockage of the canonical monomeric units. The synthesis of τm(5)s(2)U-modified RNA fragment was performed under conditions eliminating the formation of side products of 2-thiocarbonyl group oxidation and/or oxidative desulphurization. The structure of the final oligomers was confirmed by mass spectroscopy and enzymatic cleavage data. PMID:24757169

  5. A MicroRNA precursor surveillance system in quality control of MicroRNA synthesis.

    PubMed

    Liu, Xuhang; Zheng, Qi; Vrettos, Nicholas; Maragkakis, Manolis; Alexiou, Panagiotis; Gregory, Brian D; Mourelatos, Zissimos

    2014-09-18

    MicroRNAs (miRNAs) are essential for regulation of gene expression. Though numerous miRNAs have been identified by high-throughput sequencing, few precursor miRNAs (pre-miRNAs) are experimentally validated. Here we report a strategy for constructing high-throughput sequencing libraries enriched for full-length pre-miRNAs. We find widespread and extensive uridylation of Argonaute (Ago)-bound pre-miRNAs, which is primarily catalyzed by two terminal uridylyltransferases: TUT7 and TUT4. Uridylation by TUT7/4 not only polishes pre-miRNA 3' ends, but also facilitates their degradation by the exosome, preventing clogging of Ago with defective species. We show that the exosome exploits distinct substrate preferences of DIS3 and RRP6, its two catalytic subunits, to distinguish productive from defective pre-miRNAs. Furthermore, we identify a positive feedback loop formed by the exosome and TUT7/4 in triggering uridylation and degradation of Ago-bound pre-miRNAs. Our study reveals a pre-miRNA surveillance system that comprises TUT7, TUT4, and the exosome in quality control of miRNA synthesis. PMID:25175028

  6. Synthesis of novel acid electrolytes for phosphoric acid fuel cells

    NASA Astrophysics Data System (ADS)

    Adcock, James L.

    1988-11-01

    A 40 millimole per hour scale aerosol direct fluorination reactor was constructed. F-Methyl F-4-methoxybutanoate and F-4-methoxybutanoyl fluoride were synthesized by aerosol direct fluorination of methyl 4-methoxybutanoate. Basic hydrolysis of the perfluorinated derivatives produce sodium F-4 methoxybutanoate which was pyrolyzed to F-3-methoxy-1-propene. Purification and shipment of 33 grams of F-3-methoxy-1-propene followed. Syntheses by analogous methods allowed production and shipment of 5 grams of F-3-ethoxy 1-propene, 18 grams of F-3-(2-methoxy.ethoxy) 1-propene, and 37 grams of F-3,3-dimethyl 1-butene. Eighteen grams of F-2,2-dimethyl 1-chloropropane was produced directly and shipped. As suggested by other contractors, 5 grams of F-3-methoxy 1-iodopropane, and 5 grams of F-3-(2-methoxy.ethoxy) 1-iodopropane were produced by converting the respective precursor acid sodium salts produced for olefin synthesis to the silver salts and pyrolyzing them with iodine. Each of these compounds was prepared for the first time by the aerosol fluorination process during the course of the contract. These samples were provided to other Gas Research Institute (GRI) contractors for synthesis of perfluorinated sulfur (VI) and phosphorous (V) acids.

  7. Identification of a human mitochondrial RNA that promotes tropomyosin synthesis and myocardial differentiation.

    PubMed

    Moses-Arms, Ashley; Kochegarov, Andrei; Arms, Jedidiah; Burlbaw, Shane; Lian, Will; Meyer, Jessica; Lemanski, Larry F

    2015-03-01

    Heart disease is the number one killer in the USA, making cardiogenesis and its related pathways a relevant area of study for improving health and life expectancy. The Mexican salamander (axolotl), Ambystoma mexicanum, provides an excellent vertebrate animal model for studying myofibrillogenesis due to its naturally occurring cardiac nonfunction mutation. Homozygous recessive embryos do not develop normal hearts due to a lack of myofibril formation. In previous studies, myofibril-inducing ribonucleic acid (MIR) from the normal wild-type axolotl genome was found to rescue mutant nonfunctioning hearts through restoration of tropomyosin levels followed by normal myofibril formation. Our purpose in this study is to identify and characterize functional homologs for the MIR from human fetal heart ribonucleic acid (RNA). After randomized cloning of human fetal heart RNA, 396 clones were analyzed for rescuing ability by using mutant heart rescue bioassays and confocal microscopy. By these analyses, we discovered a functional homolog of MIR from human fetal heart RNA, which is associated with the mitochondrial cytochrome c oxidase subunit II gene. This RNA came from our clone #30 and induces tropomyosin synthesis and myofibrillogenesis in mutant axolotl hearts which ordinarily do not synthesize tropomyosin or form organized myofibrils. Clone #30, a mitochondrial RNA molecule associated with human cytochrome c oxidase, serves as a functional homolog of MIR, leading to tropomyosin production, organized myofibrils, and beating cardiac tissue in mutant hearts. These findings hold great potential for the treatment and repair of damaged hearts in patients who have suffered from myocardial infarctions and other heart diseases. PMID:25408381

  8. Early gene expression in bacteriophage T7. I. In vivo synthesis, inactivation, and translational utilization of early mRNA's.

    PubMed

    Hercules, K; Jovanovich, S; Sauerbrier, W

    1976-02-01

    In vivo decay rates for the individual T7 early mRNA species were determined. The physical half-lives, measured at 37 C, range from 1.1 min for gene 0.7 RNA to 4.5 min for gene 0.3 RNA. Physical half-lives, as observed after rifampin inhibition of RNA synthesis and polyacylamide electrophoresis of RNAs, are approximately 30% longer than functional half-lives, as observed by 14C-labeled amino acid uptake into individual T7 early proteins. The different RNA species are synthesized at grossly different rates, 0.3 RNA at four times the rate of 1.0 RNA, 0.7 RNA at twice the rate, and 1.1 and 1.3 RNAs at about the same or a slightly lower rate than 1.0 RNA. Rho-factor-mediated termination of transcription behind genes 0.3, 0.7, and perhaps behind 1.0 is inferred from these data. The in vivo translational utilization of the individual T7 early-message species was found to vary by not more than a factor of 2. PMID:1255850

  9. Using Triple Helix Forming Peptide Nucleic Acids for Sequence-selective Recognition of Double-stranded RNA

    PubMed Central

    Hnedzko, Dziyana; Cheruiyot, Samwel K.; Rozners, Eriks

    2014-01-01

    Non-coding RNAs play important roles in regulation of gene expression. Specific recognition and inhibition of these biologically important RNAs that form complex double-helical structures will be highly useful for fundamental studies in biology and practical applications in medicine. This protocol describes a strategy developed in our laboratory for sequence-selective recognition of double-stranded RNA (dsRNA) using triple helix forming peptide nucleic acids (PNAs) that bind in the major grove of RNA helix. The strategy developed uses chemically modified nucleobases, such as 2-aminopyridine (M) that enables strong triple helical binding at physiologically relevant conditions, and 2-pyrimidinone (P) and 3-oxo-2,3-dihydropyridazine (E) that enable recognition of isolated pyrimidines in the purine rich strand of the RNA duplex. Detailed protocols for preparation of modified PNA monomers, solid-phase synthesis and HPLC purification of PNA oligomers, and measuring dsRNA binding affinity using isothermal titration calorimetry are included. PMID:25199637

  10. Myelin basic protein synthesis is regulated by small non-coding RNA 715.

    PubMed

    Bauer, Nina M; Moos, Christina; van Horssen, Jack; Witte, Maarten; van der Valk, Paul; Altenhein, Benjamin; Luhmann, Heiko J; White, Robin

    2012-09-01

    Oligodendroglial Myelin Basic Protein (MBP) synthesis is essential for myelin formation in the central nervous system. During oligodendrocyte differentiation, MBP mRNA is kept in a translationally silenced state while intracellularly transported, until neuron-derived signals initiate localized MBP translation. Here we identify the small non-coding RNA 715 (sncRNA715) as an inhibitor of MBP translation. SncRNA715 localizes to cytoplasmic granular structures and associates with MBP mRNA transport granule components. We also detect increased levels of sncRNA715 in demyelinated chronic human multiple sclerosis lesions, which contain MBP mRNA but lack MBP protein. PMID:22744314

  11. Myelin Basic Protein synthesis is regulated by small non-coding RNA 715

    PubMed Central

    Bauer, Nina M; Moos, Christina; van Horssen, Jack; Witte, Maarten; van der Valk, Paul; Altenhein, Benjamin; Luhmann, Heiko J; White, Robin

    2012-01-01

    Oligodendroglial Myelin Basic Protein (MBP) synthesis is essential for myelin formation in the central nervous system. During oligodendrocyte differentiation, MBP mRNA is kept in a translationally silenced state while intracellularly transported, until neuron-derived signals initiate localized MBP translation. Here we identify the small non-coding RNA 715 (sncRNA715) as an inhibitor of MBP translation. SncRNA715 localizes to cytoplasmic granular structures and associates with MBP mRNA transport granule components. We also detect increased levels of sncRNA715 in demyelinated chronic human multiple sclerosis lesions, which contain MBP mRNA but lack MBP protein. PMID:22744314

  12. Rapid synthesis of the 7-deoxy zaragozic acid core.

    PubMed

    Calter, Michael A; Zhu, Cheng; Lachicotte, Rene J

    2002-01-24

    [reaction: see text] We have developed an efficient synthesis of the 7-deoxy zaragozic acid core. The synthesis begins with a Feist-Bénary reaction that assembles all three carbons of the polycarboxylic acid portion of the core. This reaction is followed by highly diastereoselective aldol and dihydroxylation reactions that set the remaining stereocenters of the core. The synthesis finishes with lactol oxidation and lactone alcoholysis/ketal formation reactions to construct the bicyclic ring system of the core. PMID:11796052

  13. First total synthesis of prasinic acid and its anticancer activity.

    PubMed

    Chakor, Narayan; Patil, Ganesh; Writer, Diana; Periyasamy, Giridharan; Sharma, Rajiv; Roychowdhury, Abhijit; Mishra, Prabhu Dutt

    2012-11-01

    The first total synthesis of prasinic acid is being reported along with its biological evaluation. The ten step synthesis involved readily available and cheap starting materials and can easily be transposed to large scale manufacturing. The crucial steps of the synthesis included the formation of two different aromatic units (7 and 9) and their coupling reaction. The synthetic prasinic acid exhibited moderate antitumor activity (IC(50) 4.3-9.1 μM) in different lines of cancer cells. PMID:23031589

  14. Catalysis of the Carbonylation of Alcohols to Carboxylic Acids Including Acetic Acid Synthesis from Methanol.

    ERIC Educational Resources Information Center

    Forster, Denis; DeKleva, Thomas W.

    1986-01-01

    Monsanto's highly successful synthesis of acetic acid from methanol and carbon monoxide illustrates use of new starting materials to replace pretroleum-derived ethylene. Outlines the fundamental aspects of the acetic acid process and suggests ways of extending the synthesis to higher carboxylic acids. (JN)

  15. Interacting RNA polymerase motors on a DNA track: effects of traffic congestion and intrinsic noise on RNA synthesis.

    PubMed

    Tripathi, Tripti; Chowdhury, Debashish

    2008-01-01

    RNA polymerase (RNAP) is an enzyme that synthesizes a messenger RNA (mRNA) strand which is complementary to a single-stranded DNA template. From the perspective of physicists, an RNAP is a molecular motor that utilizes chemical energy input to move along the track formed by DNA. In many circumstances, which are described in this paper, a large number of RNAPs move simultaneously along the same track; we refer to such collective movements of the RNAPs as RNAP traffic. Here we develop a theoretical model for RNAP traffic by incorporating the steric interactions between RNAPs as well as the mechanochemical cycle of individual RNAPs during the elongation of the mRNA. By a combination of analytical and numerical techniques, we calculate the rates of mRNA synthesis and the average density profile of the RNAPs on the DNA track. We also introduce, and compute, two different measures of fluctuations in the synthesis of RNA. Analyzing these fluctuations, we show how the level of intrinsic noise in mRNA synthesis depends on the concentrations of the RNAPs as well as on those of some of the reactants and the products of the enzymatic reactions catalyzed by RNAP. We suggest appropriate experimental systems and techniques for testing our theoretical predictions. PMID:18351890

  16. Nucleic acid and protein synthesis during lateral root initiation in Marsilea quadrifolia (Marsileaceae)

    NASA Technical Reports Server (NTRS)

    Lin, B. L.; Raghavan, V.

    1991-01-01

    The pattern of DNA, RNA, and protein synthesis during lateral root initiation in Marsilea quadrifolia L. was monitored by autoradiography of incorporated of 3H-thymidine, 3H-uridine, and 3H-leucine, respectively. DNA synthesis was associated with the enlargement of the lateral root initial prior to its division. Consistent with histological studies, derivatives of the lateral root initial as well as the cells of the adjacent inner cortex and pericycle of the parent root also continued to synthesize DNA. RNA and protein synthetic activities were found to be higher in the lateral root initials than in the endodermal initials of the same longitudinal layer. The data suggest a role for nucleic acid and protein synthesis during cytodifferentiation of a potential endodermal cell into a lateral root initial.

  17. Indoleacetic Acid and the Synthesis of Glucanases and Pectic Enzymes

    PubMed Central

    Datko, Anne Harmon; Maclachlan, G. A.

    1968-01-01

    Indoleacetic acid (IAA) and/or inhibitors of DNA, RNA or protein synthesis were added to the apex of decapitated seedlings of Pisum sativum L. var. Alaska. At various times up to 4 days, enzymic protein was extracted from a segment of epicotyl immediately below the apex and assayed for its ability to hydrolyse polysaccharides or their derivatives. With the exception of amylase, the total amounts per segment of all of the tested enzymes increased due to IAA treatment. The development of β-1,4-glucanase (cellulase) activity per unit of protein or fresh weight proceeded according to a typical sigmoid induction curve. Pectinase was formed for about 2 days in control segments and IAA treatment resulted in continued synthesis for at least another 2 days provided cell division took place. β-1,3-glucanase and pectinesterase activities were only enhanced by IAA to the extent that total protein levels increased. Reaction mechanisms for these effects and functions for the enzymes during growth are discussed. PMID:16656834

  18. Channeling of aminoacyl-tRNA for protein synthesis in vivo.

    PubMed Central

    Negrutskii, B S; Deutscher, M P

    1991-01-01

    Channeling, the direct transfer of metabolic intermediates from one enzyme to another in a pathway, has received increased attention as an explanation for the high efficiency of cellular processes. The known structural organization of the protein biosynthetic machinery, and a recent suggestion that aminoacyl-tRNAs may be channeled, has led us to devise a direct test of this possibility. By employing the technique of electroporation, conditions were established for the introduction of aminoacyl-tRNAs into Chinese hamster ovary (CHO) cells. We show, by coelectroporation of various combinations of free [14C]amino acids and [3H]aminoacyl-tRNAs, that whereas the free amino acids serve as effective precursors for protein synthesis, the exogenous aminoacyl-tRNAs are utilized poorly, if at all. The lack of incorporation into protein from added aminoacyl-tRNAs is not due to their leakage from the cell, to their instability, or to their damage during electroporation. Furthermore, in contrast to the findings with intact cells, extracts of CHO cells incorporate both free amino acids and aminoacyl-tRNAs into protein with similar efficiencies. Based on these observations, we conclude that the inability of exogenous aminoacyl-tRNAs to serve as precursors for protein synthesis is due to the structural organization of intact cells that leads to channeling of this substrate in vivo. Thus, we propose that endogenously synthesized aminoacyl-tRNA is directly transferred from aminoacyl-tRNA synthetase to elongation factor to ribosome without dissociation into the cell fluid, and as a consequence, usage of exogenously introduced molecules is precluded. Images PMID:2052582

  19. Akt phosphorylation and regulation of transketolase is a nodal point for amino acid control of purine synthesis.

    PubMed

    Saha, Arindam; Connelly, Stephen; Jiang, Jingjing; Zhuang, Shunhui; Amador, Deron T; Phan, Tony; Pilz, Renate B; Boss, Gerry R

    2014-07-17

    The phosphatidylinositol 3-kinase (PI3K)/Akt pathway integrates environmental clues to regulate cell growth and survival. We showed previously that depriving cells of a single essential amino acid rapidly and reversibly arrests purine synthesis. Here we demonstrate that amino acids via mammalian target of rapamycin 2 and IκB kinase regulate Akt activity and Akt association and phosphorylation of transketolase (TKT), a key enzyme of the nonoxidative pentose phosphate pathway (PPP). Akt phosphorylates TKT on Thr382, markedly enhancing enzyme activity and increasing carbon flow through the nonoxidative PPP, thereby increasing purine synthesis. Mice fed a lysine-deficient diet for 2 days show decreased Akt activity, TKT activity, and purine synthesis in multiple organs. These results provide a mechanism whereby Akt coordinates amino acid availability with glucose utilization, purine synthesis, and RNA and DNA synthesis. PMID:24981175

  20. Rapid Synthesis, RNA Binding, and Antibacterial Screening of a Peptidic-Aminosugar (PA) Library

    PubMed Central

    Jiang, Liuwei; Watkins, Derrick; Jin, Yi; Gong, Changjun; King, Ada; Washington, Arren Z.; Green, Keith D.; Garneau-Tsodikova, Sylvie; Oyelere, Adegboyega K.; Arya, Dev P.

    2016-01-01

    A 215-member mono- and diamino acid peptidic-aminosugar (PA) library, with neomycin as the model aminosugar, was systematically and rapidly synthesized via solid phase synthesis. Antibacterial activities of the PA library, on 13 bacterial strains (seven Gram-positive and six Gram-negative bacterial strains), and binding affinities of the PA library for a 27-base model of the bacterial 16S ribosomal A-site RNA were evaluated using high-throughput screening. The results of the two assays were correlated using Ribosomal Binding-Bacterial Inhibition Plot (RB-BIP) analysis to provide structure–activity relationship (SAR) information. From this work, we have identified PAs that can discriminate the E. coli A-site from the human A-site by up to a 28-fold difference in binding affinity. Aminoglycoside-modifying enzyme activity studies indicate that APH(2″)-Ia showed nearly complete removal of activity with a number of PAs. The synthesis of the compound library and screening can both be performed rapidly, allowing for an iterative process of aminoglycoside synthesis and screening of PA libraries for optimal binding and antibacterial activity for lead identification. PMID:25706406

  1. DNA and RNA Synthesis in Animal Cells in Culture--Methods for Use in Schools

    ERIC Educational Resources Information Center

    Godsell, P. M.; Balls, M.

    1973-01-01

    Describes the experimental procedures used for detecting DNA and RNA synthesis in xenopus cells by autoradiography. The method described is suitable for senior high school laboratory classes or biology projects, if supervised by a teacher qualified to handle radioisotopes. (JR)

  2. An intrinsically disordered peptide from Ebola virus VP35 controls viral RNA synthesis by modulating nucleoprotein-RNA interactions

    DOE PAGESBeta

    Leung, Daisy  W.; Borek, Dominika; Luthra, Priya; Binning, Jennifer  M.; Anantpadma, Manu; Liu, Gai; Harvey, Ian B.; Su, Zhaoming; Endlich-Frazier, Ariel; Pan, Juanli; et al

    2015-04-01

    During viral RNA synthesis, Ebola virus (EBOV) nucleoprotein (NP) alternates between an RNA-template-bound form and a template-free form to provide the viral polymerase access to the RNA template. In addition, newly synthesized NP must be prevented from indiscriminately binding to noncognate RNAs. Here, we investigate the molecular bases for these critical processes. We identify an intrinsically disordered peptide derived from EBOV VP35 (NPBP, residues 20–48) that binds NP with high affinity and specificity, inhibits NP oligomerization, and releases RNA from NP-RNA complexes in vitro. The structure of the NPBP/ΔNPNTD complex, solved to 3.7 Å resolution, reveals how NPBP peptide occludesmore » a large surface area that is important for NP-NP and NP-RNA interactions and for viral RNA synthesis. Together, our results identify a highly conserved viral interface that is important for EBOV replication and can be targeted for therapeutic development.« less

  3. Structural and mutational analysis of archaeal ATP-dependent RNA ligase identifies amino acids required for RNA binding and catalysis

    PubMed Central

    Gu, Huiqiong; Yoshinari, Shigeo; Ghosh, Raka; Ignatochkina, Anna V.; Gollnick, Paul D.; Murakami, Katsuhiko S.; Ho, C. Kiong

    2016-01-01

    An ATP-dependent RNA ligase from Methanobacterium thermoautotrophicum (MthRnl) catalyzes intramolecular ligation of single-stranded RNA to form a closed circular RNA via covalent ligase-AMP and RNA-adenylylate intermediate. Here, we report the X-ray crystal structures of an MthRnl•ATP complex as well as the covalent MthRnl–AMP intermediate. We also performed structure-guided mutational analysis to survey the functions of 36 residues in three component steps of the ligation pathway including ligase-adenylylation (step 1), RNA adenylylation (step 2) and phosphodiester bond synthesis (step 3). Kinetic analysis underscored the importance of motif 1a loop structure in promoting phosphodiester bond synthesis. Alanine substitutions of Thr117 or Arg118 favor the reverse step 2 reaction to deadenylate the 5′-AMP from the RNA-adenylate, thereby inhibiting step 3 reaction. Tyr159, Phe281 and Glu285, which are conserved among archaeal ATP-dependent RNA ligases and are situated on the surface of the enzyme, are required for RNA binding. We propose an RNA binding interface of the MthRnl based on the mutational studies and two sulfate ions that co-crystallized at the active site cleft in the MthRnl–AMP complex. PMID:26896806

  4. Possible involvement of eEF1A in Tomato spotted wilt virus RNA synthesis.

    PubMed

    Komoda, Keisuke; Ishibashi, Kazuhiro; Kawamura-Nagaya, Kazue; Ishikawa, Masayuki

    2014-11-01

    Tomato spotted wilt virus (TSWV) is a negative-strand RNA virus in the family Bunyaviridae and propagates in both insects and plants. Although TSWV can infect a wide range of plant species, host factors involved in viral RNA synthesis of TSWV in plants have not been characterized. In this report, we demonstrate that the cell-free extract derived from one of the host plants can activate mRNA transcriptional activity of TSWV. Based on activity-guided fractionation of the cell-free extract, we identified eukaryotic elongation factor (eEF) 1A as a possible host factor facilitating TSWV transcription and replication. The RNA synthesis-supporting activity decreased in the presence of an eEF1A inhibitor, suggesting that eEF1A plays an important role in RNA synthesis of TSWV. PMID:25151062

  5. Energetics of amino acid synthesis in hydrothermal ecosystems

    NASA Technical Reports Server (NTRS)

    Amend, J. P.; Shock, E. L.

    1998-01-01

    Thermodynamic calculations showed that the autotrophic synthesis of all 20 protein-forming amino acids was energetically favored in hot (100 degrees C), moderately reduced, submarine hydrothermal solutions relative to the synthesis in cold (18 degrees C), oxidized, surface seawater. The net synthesis reactions of 11 amino acids were exergonic in the hydrothermal solution, but all were endergonic in surface seawater. The synthesis of the requisite amino acids of nine thermophilic and hyperthermophilic proteins in a 100 degreesC hydrothermal solution yielded between 600 and 8000 kilojoules per mole of protein, which is energy that is available to drive the intracellular synthesis of enzymes and other biopolymers in hyperthermophiles thriving in these ecosystems.

  6. Total synthesis and complete stereostructure of gambieric acid A.

    PubMed

    Fuwa, Haruhiko; Ishigai, Kazuya; Hashizume, Keisuke; Sasaki, Makoto

    2012-07-25

    Total synthesis of gambieric acid A, a potent antifungal polycyclic ether metabolite, has been accomplished for the first time, which firmly established the complete stereostructure of this natural product. PMID:22779404

  7. Synthesis of fatty acids in the perused mouse liver.

    PubMed

    Salmon, D M; Bowen, N L; Hems, D A

    1974-09-01

    1. Fatty acid synthesis de novo was measured in the perfused liver of fed mice. 2. The total rate, measured by the incorporation into fatty acid of (3)H from (3)H(2)O (1-7mumol of fatty acid/h per g of fresh liver), resembled the rate found in the liver of intact mice. 3. Perfusions with l-[U-(14)C]lactic acid and [U-(14)C]glucose showed that circulating glucose at concentrations less than about 17mm was not a major carbon source for newly synthesized fatty acid, whereas lactate (10mm) markedly stimulated fatty acid synthesis, and contributed extensive carbon to lipogenesis. 4. The identification of 50% of the carbon converted into newly synthesized fatty acid lends further credibility to the use of (3)H(2)O to measure hepatic fatty acid synthesis. 5. The total rate of fatty acid synthesis, and the contribution of glucose carbon to lipogenesis, were directly proportional to the initial hepatic glycogen concentration. 6. The proportion of total newly synthesized lipid that was released into the perfusion medium was 12-16%. 7. The major products of lipogenesis were saturated fatty acids in triglyceride and phospholipid. 8. The rate of cholesterol synthesis, also measured with (3)H(2)O, expressed as acetyl residues consumed, was about one-fourth of the basal rate of fatty acid synthesis. 9. These results are discussed in terms of the carbon sources of hepatic newly synthesized fatty acids, and the effect of glucose, glycogen and lactate in stimulating lipogenesis, independently of their role as precursors. PMID:4464843

  8. A symmetry-based formal synthesis of zaragozic acid A.

    PubMed

    Freeman-Cook, K D; Halcomb, R L

    2000-09-22

    A symmetry-based strategy for the synthesis of the zaragozic acids is reported. Two enantioselective dihydroxylations were used to establish the absolute configuration of a C(2) symmetric intermediate. Noteworthy transformations include a group-selective lactonization, which accomplished an end-differentiation of a pseudo-C(2) symmetric intermediate. Late stage protecting group adjustments and oxidations accomplished a formal synthesis of zaragozic acid A. PMID:10987953

  9. Photoorganocatalytic One-Pot Synthesis of Hydroxamic Acids from Aldehydes.

    PubMed

    Papadopoulos, Giorgos N; Kokotos, Christoforos G

    2016-05-10

    An efficient one-pot synthesis of hydroxamic acids from aldehydes and hydroxylamine is described. A fast, visible-light-mediated metal-free hydroacylation of dialkyl azodicarboxylates was used to develop the subsequent addition of hydroxylamine hydrochloride. A range of aliphatic and aromatic aldehydes were employed in this reaction to give hydroxamic acids in high to excellent yields. Application of the current methodology was demonstrated in the synthesis of the anticancer medicine vorinostat. PMID:27038037

  10. Formation of supramolecular assemblies and liquid crystals by purine nucleobases and cyanuric acid in water: implications for the possible origins of RNA.

    PubMed

    Li, C; Cafferty, B J; Karunakaran, S C; Schuster, G B; Hud, N V

    2016-07-27

    The free nucleobases and mononucleotides of RNA do not form Watson-Crick base pairs in water, a fact that presents several challenges for the prebiotic synthesis of RNA. 2,6-Diaminopurine and adenosine-5'-monophosphate (AMP) are shown to form supramolecular assemblies with cyanuric acid in water. These assemblies and their propensity to form liquid crystals suggest a possible means by which non-covalent structures might have originally selected the shape of the Watson-Crick base pairs. PMID:27253677

  11. Amino acid residue doublet propensity in the protein-RNA interface and its application to RNA interface prediction.

    PubMed

    Kim, Oanh T P; Yura, Kei; Go, Nobuhiro

    2006-01-01

    Protein-RNA interactions play essential roles in a number of regulatory mechanisms for gene expression such as RNA splicing, transport, translation and post-transcriptional control. As the number of available protein-RNA complex 3D structures has increased, it is now possible to statistically examine protein-RNA interactions based on 3D structures. We performed computational analyses of 86 representative protein-RNA complexes retrieved from the Protein Data Bank. Interface residue propensity, a measure of the relative importance of different amino acid residues in the RNA interface, was calculated for each amino acid residue type (residue singlet interface propensity). In addition to the residue singlet propensity, we introduce a new residue-based propensity, which gives a measure of residue pairing preferences in the RNA interface of a protein (residue doublet interface propensity). The residue doublet interface propensity contains much more information than the sum of two singlet propensities alone. The prediction of the RNA interface using the two types of propensities plus a position-specific multiple sequence profile can achieve a specificity of about 80%. The prediction method was then applied to the 3D structure of two mRNA export factors, TAP (Mex67) and UAP56 (Sub2). The prediction enables us to point out candidate RNA interfaces, part of which are consistent with previous experimental studies and may contribute to elucidation of atomic mechanisms of mRNA export. PMID:17130160

  12. A molecular nanodevice for targeted degradation of mRNA during protein synthesis

    PubMed Central

    Lee, Kyung-Ho; Min, Seung-Eui; Kim, Haseong; Lee, Seung-Goo; Kim, Dong-Myung

    2016-01-01

    RNase H is an endonuclease that catalyzes the cleavage of RNA. Because it only acts on RNA in RNA:DNA hybrids, RNase H can be used for targeted degradation of RNA when used in combination with antisense oligodeoxyribonucleotides (ASODNs) designed against a specific sequence of the target RNA. In this study, ASODN and RNase H were co-conjugated on magnetic nanoparticles. The resulting nanoparticles, having integrated functions of probing and processing target RNA, were able to remove target mRNA sequences more effectively than free ASODNs. The paramagnetic property of the nanoparticles also enabled timed engagement and disengagement of the RNA-degrading components in a given system, and these nanoparticles were able to be used for ON/OFF control of gene expression during cell-free protein synthesis reactions. PMID:26857021

  13. Synthesis of alanyl nucleobase amino acids and their incorporation into proteins.

    PubMed

    Talukder, Poulami; Dedkova, Larisa M; Ellington, Andrew D; Yakovchuk, Petro; Lim, Jaebum; Anslyn, Eric V; Hecht, Sidney M

    2016-09-15

    Proteins which bind to nucleic acids and regulate their structure and functions are numerous and exceptionally important. Such proteins employ a variety of strategies for recognition of the relevant structural elements in their nucleic acid substrates, some of which have been shown to involve rather subtle interactions which might have been difficult to design from first principles. In the present study, we have explored the preparation of proteins containing unnatural amino acids having nucleobase side chains. In principle, the introduction of multiple nucleobase amino acids into the nucleic acid binding domain of a protein should enable these modified proteins to interact with their nucleic acid substrates using Watson-Crick and other base pairing interactions. We describe the synthesis of five alanyl nucleobase amino acids protected in a fashion which enabled their attachment to a suppressor tRNA, and their incorporation into each of two proteins with acceptable efficiencies. The nucleobases studied included cytosine, uracil, thymine, adenine and guanine, i.e. the major nucleobase constituents of DNA and RNA. Dihydrofolate reductase was chosen as one model protein to enable direct comparison of the facility of incorporation of the nucleobase amino acids with numerous other unnatural amino acids studied previously. The Klenow fragment of DNA polymerase I was chosen as a representative DNA binding protein whose mode of action has been studied in detail. PMID:27452282

  14. The role of the priming loop in influenza A virus RNA synthesis.

    PubMed

    Te Velthuis, Aartjan J W; Robb, Nicole C; Kapanidis, Achillefs N; Fodor, Ervin

    2016-01-01

    RNA-dependent RNA polymerases (RdRps) are used by RNA viruses to replicate and transcribe their RNA genomes(1). They adopt a closed, right-handed fold with conserved subdomains called palm, fingers and thumb(1,2). Conserved RdRp motifs A-F coordinate the viral RNA template, NTPs and magnesium ions to facilitate nucleotide condensation(1). For the initiation of RNA synthesis, most RdRps use either a primer-dependent or de novo mechanism(3). The influenza A virus RdRp, in contrast, uses a capped RNA oligonucleotide to initiate transcription, and a combination of terminal and internal de novo initiation for replication(4). To understand how the influenza A virus RdRp coordinates these processes, we analysed the function of a thumb subdomain β-hairpin using initiation, elongation and single-molecule Förster resonance energy transfer (sm-FRET) assays. Our data indicate that this β-hairpin is essential for terminal initiation during replication, but not necessary for internal initiation and transcription. Analysis of individual residues in the tip of the β-hairpin shows that PB1 proline 651 is critical for efficient RNA synthesis in vitro and in cell culture. Overall, this work advances our understanding of influenza A virus RNA synthesis and identifies the initiation platform of viral replication. PMID:27572643

  15. Prebiotic Amino Acid Thioester Synthesis: Thiol-Dependent Amino Acid Synthesis from Formose substrates (Formaldehyde and Glycolaldehyde) and Ammonia

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1998-01-01

    Formaldehyde and glycolaldehyde (substrates of the formose autocatalytic cycle) were shown to react with ammonia yielding alanine and homoserine under mild aqueous conditions in the presence of thiol catalysts. Since similar reactions carried out without ammonia yielded alpha-hydroxy acid thioesters, the thiol-dependent synthesis of alanine and homoserine is presumed to occur via amino acid thioesters-intermediates capable of forming peptides. A pH 5.2 solution of 20 mM formaldehyde, 20 mM glycolaldehyde, 20 mM ammonium chloride, 23 mM 3-mercaptopropionic acid, and 23 mM acetic acid that reacted for 35 days at 40 C yielded (based on initial formaldehyde) 1.8% alanine and 0.08% homoserine. In the absence of thiol catalyst, the synthesis of alanine and homoserine was negligible. Alanine synthesis required both formaldehyde and glycolaldehyde, but homoserine synthesis required only glycolaldehyde. At 25 days the efficiency of alanine synthesis calculated from the ratio of alanine synthesized to formaldehyde reacted was 2.1%, and the yield (based on initial formaldehyde) of triose and tetrose intermediates involved in alanine and homoserine synthesis was 0.3 and 2.1%, respectively. Alanine synthesis was also seen in similar reactions containing only 10 mM each of aldehyde substrates, ammonia, and thiol. The prebiotic significance of these reactions that use the formose reaction to generate sugar intermediates that are converted to reactive amino acid thioesters is discussed.

  16. Docosahexaenoic Acid Conjugation Enhances Distribution and Safety of siRNA upon Local Administration in Mouse Brain.

    PubMed

    Nikan, Mehran; Osborn, Maire F; Coles, Andrew H; Godinho, Bruno Mdc; Hall, Lauren M; Haraszti, Reka A; Hassler, Matthew R; Echeverria, Dimas; Aronin, Neil; Khvorova, Anastasia

    2016-01-01

    The use of siRNA-based therapies for the treatment of neurodegenerative disease requires efficient, nontoxic distribution to the affected brain parenchyma, notably the striatum and cortex. Here, we describe the synthesis and activity of a fully chemically modified siRNA that is directly conjugated to docosahexaenoic acid (DHA), the most abundant polyunsaturated fatty acid in the mammalian brain. DHA conjugation enables enhanced siRNA retention throughout both the ipsilateral striatum and cortex following a single, intrastriatal injection (ranging from 6-60 μg). Within these tissues, DHA conjugation promotes internalization by both neurons and astrocytes. We demonstrate efficient and specific silencing of Huntingtin mRNA expression in both the ipsilateral striatum (up to 73%) and cortex (up to 51%) after 1 week. Moreover, following a bilateral intrastriatal injection (60 μg), we achieve up to 80% silencing of a secondary target, Cyclophilin B, at both the mRNA and protein level. Importantly, DHA-hsiRNAs do not induce neural cell death or measurable innate immune activation following administration of concentrations over 20 times above the efficacious dose. Thus, DHA conjugation is a novel strategy for improving siRNA activity in mouse brain, with potential to act as a new therapeutic platform for the treatment of neurodegenerative disorders. PMID:27504598

  17. Synthesis of ¹⁸O-labeled RNA for application to kinetic studies and imaging.

    PubMed

    Hamasaki, Tomohiro; Matsumoto, Takahiro; Sakamoto, Naoya; Shimahara, Akiko; Kato, Shiori; Yoshitake, Ayumi; Utsunomiya, Ayumi; Yurimoto, Hisayoshi; Gabazza, Esteban C; Ohgi, Tadaaki

    2013-07-01

    Radioisotopes and fluorescent compounds are frequently used for RNA labeling but are unsuitable for clinical studies of RNA drugs because of the risk from radiation exposure or the nonequivalence arising from covalently attached fluorophores. Here, we report a practical phosphoramidite solid-phase synthesis of (18)O-labeled RNA that avoids these disadvantages, and we demonstrate its application to quantification and imaging. The synthesis involves the introduction of a nonbridging (18)O atom into the phosphate group during the oxidation step of the synthetic cycle by using (18)O water as the oxygen donor. The (18)O label in the RNA was stable at pH 3-8.5, while the physicochemical and biological properties of labeled and unlabeled short interfering RNA were indistinguishable by circular dichroism, melting temperature and RNA-interference activity. The (18)O/(16)O ratio as measured by isotope ratio mass spectrometry increased linearly with the concentration of (18)O-labeled RNA, and this technique was used to determine the blood concentration of (18)O-labeled RNA after administration to mice. (18)O-labeled RNA transfected into human A549 cells was visualized by isotope microscopy. The RNA was observed in foci in the cytoplasm around the nucleus, presumably corresponding to endosomes. These methodologies may be useful for kinetic and cellular-localization studies of RNA in basic and pharmaceutical studies. PMID:23632164

  18. PATTERNS OF RNA SYNTHESIS IN T5-INFECTED CELLS I. AS STUDIED BY THE TECHNIQUE OF DNA-RNA HYBRIDIZATION-COMPETITION*

    PubMed Central

    Moyer, Richard W.; Buchanan, John M.

    1969-01-01

    The RNA-labeling patterns obtained after T5 infection of Escherichia coli F agree with the patterns of protein labeling published by McCorquodale and Buchanan.1 Three distinct classes of RNA formed sequentially during the period of viral development can be recognized by the DNA-RNA hybridization-competition technique. Class I RNA is formed within 5 minutes after the beginning of viral metabolism and corresponds to the RNA synthesized in response to infection with the 8 per cent segment of T5 DNA. Protein synthesis directed by this 8 per cent segment is required in some capacity for the cessation of class I synthesis and the beginning of the synthesis of class II at 4 to 5 min after infection. Class III RNA synthesis begins between 9 and 12 minutes. Its appearance is prevented when chloramphenicol is added immediately after complete expression of class I functions. PMID:4916923

  19. Synthesis of coronavirus mRNAs: kinetics of inactivation of infectious bronchitis virus RNA synthesis by UV light. [Chickens

    SciTech Connect

    Stern, D.F.; Sefton, B.M.

    1982-05-01

    Infection of cells with the avian coronavirus infectious bronchitis virus results in the synthesis of five major subgenomic RNAs. These RNAs and the viral genome form a 3' coterminal nested set. We found that the rates of inactivation of synthesis of the RNAs by UV light were different and increased with the length of the transcript. These results show that each RNA is transcribed from a unique promoter and that extensive processing of the primary transcripts probably does not occur.

  20. Regulation of lipid synthesis by the RNA helicase Mov10 controls Wnt5a production

    PubMed Central

    Wang, W; Snyder, N; Worth, A J; Blair, I A; Witze, E S

    2015-01-01

    Expression of the Wnt ligand Wnt5a is frequently elevated in melanoma and is thought to be a critical regulator of cell movement during metastasis. However, the mechanisms regulating its expression are unknown. We find that the level of secreted Wnt5a varies by as much as 10-fold between cell lines and correlates more strongly with invasion than total cellular levels. Our results indicate that the RNA helicase Mov10 plays a role in Wnt5a synthesis and secretion. Inhibition of Mov10 increases secreted Wnt5a levels in melanoma cells by increasing Wnt5a synthesis and acylation. This is achieved by increasing fatty acid synthase (FASN) and stearoyl-CoA desaturase expression, leading to elevated levels of palmitoleoyl-CoA, required for Wnt ligand lipid modification and secretion. Melanoma tumors exhibit reduced expression of Mov10 compared with benign nevi and Mov10 levels inversely correlate with FASN levels in primary tumors. These results reveal a previously unappreciated role for aberrant lipid metabolism in regulating Wnt5a signaling that may be a critical step in melanoma progression. PMID:26029828

  1. Derepression of Synthesis of the Aminoacyl-Transfer Ribonucleic Acid Synthetases for the Branched-Chain Amino Acids of Escherichia coli

    PubMed Central

    McGinnis, Etheleen; Williams, Ann C.; Williams, L. S.

    1974-01-01

    The kinetics of derepression of valyl-, isoleucyl-, and leucyl-transfer ribonucleic acid (tRNA) synthetase formation was examined during valine-, isoleucine-, and leucine-limited growth. When valine was limiting growth, valyl-tRNA synthetase formation was maximally derepressed within 5 min, whereas the rates of synthesis of isoleucyl-, and leucyl-tRNA synthetases were unchanged. Isoleucine-restricted growth caused a maximal derepression of isoleucyl-tRNA synthetase formation in 5 min and derepression of valyl-tRNA synthetase formation in 15 min with no effect on leucyl-tRNA synthetase formation. When leucine was limiting growth, leucyl-tRNA synthetase formation was immediately derepressed, whereas valyl- and isoleucyl-tRNA synthetase formation was unaffected by manipulation of the leucine supply to the cells. These results support our previous findings that valyl-tRNA synthetase formation is subject to multivalent repression control by both isoleucine and valine. In contrast, repression control of iso-leucyl- and leucyl-tRNA synthetase formation is specifically mediated by the supply of the cognate amino acid. PMID:4604302

  2. The Prebiotic Synthesis of Ethylenediamine Monoacetic Acid, The Repeating Unit of Peptide Nucleic Acids

    NASA Technical Reports Server (NTRS)

    Nelson, Kevin E.; Miller, Stanley L.

    1992-01-01

    The polymerization of ribonucleic acids or their precursors constitutes an important event in prebiotic chemistry. The various problems using ribonucleotides to make RNA suggest that there may have been a precursor. An attractive possibility are the peptide nucleic acids (PNA). PNAs are nucleotide analogs that make use of a polymer of ethylenediamine monoacetic acid (EDMA or 2-amninoethyl glycine) with the bases attached by an acetic acid. EDMA is an especially attractive alternative to the ribose phosphate or deoxyribose phosphate backbone because it contains no chiral centers and is potentially prebiotic, but there is no reported prebiotic synthesis. We have synthesized both EDMA and ethylenediamine diacetic acid (EDDA) from the prebiotic compounds ethylenediamine, formaldehyde, and hydrogen cyanide. The yields of EDMA range from 11 to 79% along with some sEDDA and uEDDA. These reactions work with concentrations of 10(exp -1)M and as low as 10(exp -4)M, and the reaction is likely to be effective at even lower concentrations. Ethylenediamine is a likely prebiotic compound, but it has not yet been demonstrated, although compounds such as ethanolamine and cysteamine have been proven to be prebiotic. Under neutral pH and heating at l00 C, EDMA is converted to the lactam, monoketopiperazine (MKP). The cyclization occurs and has an approximate ratio of MKP/EDMA = 3 at equilibrium. We have measured the solubilities of EDMA center dot H20 as 6.4 m, EDMA center dot HCl center dot H20 as 13.7 m, and EDMA center dot 2HCl center dot H20 as 3.4 m. These syntheses together with the high solubility of EDMA suggest that EDMA would concentrate in drying lagoons and might efficiently form polymers. Given the instability of ribose and the poor polymerizability of nucleotides, the prebiotic presence of EDMA and the possibility of its polymerization raises the possibility that PNAs are the progenitors of present day nucleic acids. A pre-RNA world may have existed in which PNAs or

  3. Microinjection of purified ornithine decarboxylase into Xenopus oocytes selectively stimulates ribosomal RNA synthesis.

    PubMed Central

    Russell, D H

    1983-01-01

    This study has utilized stage VI oocytes of Xenopus laevis which have amplified the rDNA gene 1,000-fold to assess whether the microinjection of ornithine decarboxylase (OrnDCase) would stimulate [alpha-32P]guanosine incorporation into 45S and 18S/28S RNA selectively. The injection of purified OrnDCase into individual oocytes resulted in a greater than 2-fold increase in the incorporation of [32P]guanosine into 45S RNA and 18S/28S RNA with no increased incorporation into low molecular weight RNA. Further, an irreversible inhibitor of OrnDCase, alpha-difluoromethylornithine (CHF2-Orn), rapidly inhibited the endogenous activity of OrnDCase when added to the buffered Hepes solution bathing the oocytes and also inhibited the incorporation of [32P]guanosine into rRNA. The inhibitory effect of CHF2-Orn could not be reversed totally by addition of 10 microM putrescine to the oocytes. OrnDCase injected into oocytes in the presence of CHF2-Orn in the media did not stimulate incorporation of [32P]guanosine label into rRNA. However, when CHF2-Orn was removed from the buffered medium at the time of the injection of label and enzyme, a 3-fold increase of 32P incorporation into 18S/28S RNA occurred. Therefore, in an in vivo model in which amplified extrachromosomal rDNA gene copies are present, the microinjection of OrnDCase was capable of specifically stimulating rRNA synthesis. CHF2-Orn, a suicide enzyme inactivator of OrnDCase, was able to inhibit rRNA synthesis and, after washout, there was a more marked stimulation of rRNA synthesis than occurred after only the injection of OrnDCase alone. These data suggest further that OrnDCase is the labile protein that regulates the initiation of RNA synthesis. PMID:6402779

  4. The juxtamembrane sequence of the Hepatitis C virus polymerase can affect RNA synthesis and inhibition by allosteric polymerase inhibitors.

    PubMed

    Wen, Y; Lin, X; Fan, B; Ranjith-Kumar, C T; Kao, C C

    2015-08-01

    The Hepatitis C virus (HCV) RNA-dependent RNA polymerase (RdRp), nonstructural protein 5B (NS5B), is anchored in the membrane through a C-terminal helix. A sequence of ca. 12 residues that connects the catalytically competent portion of the RdRp and the C-terminal helix, the juxtamembrane sequence (JMS), has a poorly defined role in RdRp function in a large part since it is translated from a cis-acting RNA element (CRE) that is essential for HCV replication. Using a HCV replicon that transposed a second copy of CRE to the 3' UTR of the HCV replicon, we demonstrate that amino acid substitutions in the JMS were detrimental for HCV replicon replication. Substitutions in the JMS also resulted in a defect in de novo-initiated RNAs synthesis in vitro and in a cell-based reporter assay. A nonnucleoside inhibitor of the NS5B that binds to the catalytic pocket was less potent in inhibiting NS5B in the presence of JMS mutations. The JMS mutants exhibit reduced stability in thermodenaturation assays, suggesting that the JMS helps confer a more stable conformation to NS5B that could impact RNA synthesis. PMID:25895103

  5. Mechanical stretch of human uterine smooth muscle cells increases IL-8 mRNA expression and peptide synthesis.

    PubMed

    Loudon, J A Z; Sooranna, S R; Bennett, P R; Johnson, M R

    2004-12-01

    Labour is associated with increased synthesis of interleukin-8 (IL-8) by the fetal membranes and myometrium, which leads to an inflammatory infiltrate. Stretch has been shown to increase the expression of contraction-associated proteins in animal models of labour and in human myocytes in vitro. In this study, we tested the hypothesis that mechanical stretch of human myometrial cells increases IL-8 messenger ribonucleic acid (mRNA) expression. We isolated myocytes from non-pregnant women undergoing hysterectomy and pregnant women undergoing Caesarean section before and after the onset of labour. Myocytes in culture were subjected to stretch of varying intensity (6-16%) and duration (1 or 6 h) using the Flexercell system. IL-8 mRNA expression was lowest in myocytes from pregnant women not in labour, intermediate in those from non-pregnant women and greatest in those from pregnant women in labour. Stretch increased IL-8 mRNA expression independent of reproductive state. The stretch-induced increase in IL-8 mRNA expression was associated with higher IL-8 levels in the culture supernatant and enhanced promoter activity. These data suggest that stretch contributes to the increase in myometrial IL-8 synthesis associated with the onset of labour in humans. PMID:15489245

  6. The Murine Norovirus Core Subgenomic RNA Promoter Consists of a Stable Stem-Loop That Can Direct Accurate Initiation of RNA Synthesis

    PubMed Central

    Yunus, Muhammad Amir; Lin, Xiaoyan; Bailey, Dalan; Karakasiliotis, Ioannis; Chaudhry, Yasmin; Vashist, Surender; Zhang, Guo; Thorne, Lucy; Kao, C. Cheng

    2014-01-01

    ABSTRACT All members of the Caliciviridae family of viruses produce a subgenomic RNA during infection. The subgenomic RNA typically encodes only the major and minor capsid proteins, but in murine norovirus (MNV), the subgenomic RNA also encodes the VF1 protein, which functions to suppress host innate immune responses. To date, the mechanism of norovirus subgenomic RNA synthesis has not been characterized. We have previously described the presence of an evolutionarily conserved RNA stem-loop structure on the negative-sense RNA, the complementary sequence of which codes for the viral RNA-dependent RNA polymerase (NS7). The conserved stem-loop is positioned 6 nucleotides 3′ of the start site of the subgenomic RNA in all caliciviruses. We demonstrate that the conserved stem-loop is essential for MNV viability. Mutant MNV RNAs with substitutions in the stem-loop replicated poorly until they accumulated mutations that revert to restore the stem-loop sequence and/or structure. The stem-loop sequence functions in a noncoding context, as it was possible to restore the replication of an MNV mutant by introducing an additional copy of the stem-loop between the NS7- and VP1-coding regions. Finally, in vitro biochemical data suggest that the stem-loop sequence is sufficient for the initiation of viral RNA synthesis by the recombinant MNV RNA-dependent RNA polymerase, confirming that the stem-loop forms the core of the norovirus subgenomic promoter. IMPORTANCE Noroviruses are a significant cause of viral gastroenteritis, and it is important to understand the mechanism of norovirus RNA synthesis. Here we describe the identification of an RNA stem-loop structure that functions as the core of the norovirus subgenomic RNA promoter in cells and in vitro. This work provides new insights into the molecular mechanisms of norovirus RNA synthesis and the sequences that determine the recognition of viral RNA by the RNA-dependent RNA polymerase. PMID:25392209

  7. Lysophosphatidic acid synthesis and phospholipid metabolism in rat mast cells

    SciTech Connect

    Fagan, D.L.

    1986-01-01

    The role of lysophosphatidic acid in mast cell response to antigen was investigated using an isolated rat serosal mast cell model. The cells were incubated with monoclonal murine immunoglobulin E to the dinitrophenyl hapten and prelabeled with /sup 32/P-orthophosphate or /sup 3/H-fatty acids. Lysophosphatidic acid was isolated form cell extracts by 2-dimensional thin-layer chromatography, and the incorporated radioactivity was assessed by liquid scintillation counting. Lysophosphatidic acid labeling with /sup 32/P was increased 2-4 fold within 5 minutes after the addition of antigen or three other mast cell agonists. Functional group analyses unequivocally showed that the labeled compound was lysophosphatidic acid. Lysophosphatidic acid synthesis was dependent on the activity of diacylglycerol lipase, suggesting formation from monoacylglycerol. In addition, the studies of lysophosphatidic acid synthesis suggest that the addition of antigen to mast cells may initiate more than one route of phospholipid degradation and resynthesis. Whatever the origin of lysophosphatidic acid, the results of this study demonstrated that lysophosphatidic acid synthesis is stimulated by a variety of mast cell agonists. Dose-response, kinetic, and pharmacologic studies showed close concordance between histamine release and lysophosphatidic acid labeling responses. These observations provide strong evidence that lysophosphatidic acid plays an important role in mast cell activation.

  8. Sendai virus wild-type and mutant C proteins show a direct correlation between L polymerase binding and inhibition of viral RNA synthesis.

    PubMed

    Grogan, C C; Moyer, S A

    2001-09-15

    The Sendai virus C proteins, C', C, Y1, and Y2, are a nested set of four independently initiated carboxy-coterminal proteins encoded on the P mRNA from an alternate reading frame. Together the C proteins have been shown to inhibit viral transcription and replication in vivo and in vitro and C' binds the Sendai virus L protein, the presumed catalytic subunit of the viral RNA polymerase. To identify amino acids within the C' protein that are important for binding L, site-directed mutagenesis of the gstC' gene was used to change conserved charged amino acids to alanine, generating nine mutants. Additionally, a tenth natural mutant, gstF170S, was also constructed. Six of the gstC' mutants, primarily in the C-terminal half of C', exhibited a defect in the ability to bind L protein. The mutants were assayed for their effect on in vitro transcription and replication from the antigenomic promoter, and the data suggest in all but one case a direct correlation between the ability of C to bind L and to inhibit these steps in RNA synthesis. Further studies with two nonfusion C mutants showed that this correlation was specifically due to the C' portion, and not the gst portion, of the fusion proteins. To study their individual functions, each of the four C proteins was fused downstream of glutathione S-transferase. The gstC', gstC, gstY1, and gstY1 fusion proteins were all able to bind L protein and to inhibit viral mRNA and (+)-leader RNA synthesis, and antigenome replication in vitro. In addition, the nonfusion C, Y1, and Y2 proteins all inhibited transcription. The inhibition of (+)-leader RNA and mRNA synthesis by wt C proteins (nonfusion) showed nearly identical dose-response curves, suggesting that inhibition occurs early in RNA synthesis. PMID:11543662

  9. Oleochemical synthesis of an acid cleavable hydrophobe for surfactant use

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The synthesis of a series of branched hydroxy stearates from commercially available methyl oleate and common organic acids is reported. A variety of different acids, with 3 to 8 carbon atoms, and also varying in their branching and functionality, were used. The kinetics of the ring opening reactio...

  10. The hepatitis C virus core protein can modulate RNA-dependent RNA synthesis by the 2a polymerase

    PubMed Central

    Wen, Y.; Cheng Kao, C.

    2014-01-01

    RNA replication enzymes are multi-subunit protein complexes whose activity can be modulated by other viral and cellular factors. For genotype 1b Hepatitis C virus (HCV), the RNA-dependent RNA polymerase (RdRp) subunit of the replicase, NS5B, has been reported to interact with the HCV Core protein to decrease RNA synthesis (Kang et al., 2009). Here we used a cell-based assay for RNA synthesis to examine the Core–NS5B interaction of genotype 2a HCV. Unlike the 1b NS5B, the activity of the 2a NS5B was stimulated by the Core protein. Using the bimolecular fluorescence complementation assay, the 2a Core co-localized with 2a NS5B when they were transiently expressed in cells. The two proteins can form a coimmunoprecipitable complex. Deletion analysis showed that the N-terminal 75 residues of 2a Core were required to contact 2a NS5B to modulate its activity. The C-terminal transmembrane helix of 2a NS5B also contributes to the interaction with the 2a Core. To determine the basis for the differential effects of the Core–RdRp interaction, we found that the 2a RdRp activity was enhanced by both the 1b Core and 2a Core. However, the 1b NS5B activity was slightly inhibited by either Core protein. The replication of the 2a JFH-1 replicon was increased by co-expressed 2a Core while the genotype 1b Con1 replicon was not significantly affected by the corresponding Core. Mutations in 2a NS5B that affected the closed RdRp structure were found to be less responsive to 2a Core. Finally, we determined that RNA synthesis by the RdRps from genotypes 2a, 3a and 4a HCV were increased by the Core proteins from HCV of genotypes 1–4. These results reveal another difference between RNA syntheses by the different genotype RdRps and add additional examples of a viral structural protein regulating viral RNA synthesis. PMID:24874198

  11. Nucleic acid arrays and methods of synthesis

    DOEpatents

    Sabanayagam, Chandran R.; Sano, Takeshi; Misasi, John; Hatch, Anson; Cantor, Charles

    2001-01-01

    The present invention generally relates to high density nucleic acid arrays and methods of synthesizing nucleic acid sequences on a solid surface. Specifically, the present invention contemplates the use of stabilized nucleic acid primer sequences immobilized on solid surfaces, and circular nucleic acid sequence templates combined with the use of isothermal rolling circle amplification to thereby increase nucleic acid sequence concentrations in a sample or on an array of nucleic acid sequences.

  12. The yin and yang of hepatitis C: synthesis and decay of hepatitis C virus RNA.

    PubMed

    Li, You; Yamane, Daisuke; Masaki, Takahiro; Lemon, Stanley M

    2015-09-01

    Hepatitis C virus (HCV) is an unusual RNA virus that has a striking capacity to persist for the remaining life of the host in the majority of infected individuals. In order to persist, HCV must balance viral RNA synthesis and decay in infected cells. In this Review, we focus on interactions between the positive-sense RNA genome of HCV and the host RNA-binding proteins and microRNAs, and describe how these interactions influence the competing processes of viral RNA synthesis and decay to achieve stable, long-term persistence of the viral genome. Furthermore, we discuss how these processes affect hepatitis C pathogenesis and therapeutic strategies against HCV. PMID:26256788

  13. [The first steps of chlorophyll synthesis: RNA involvement and regulation]. Progress report, January 1990--June 1992

    SciTech Connect

    Soell, D.

    1992-12-31

    Glu-tRNA{sup Glu} is synthesized from glutamate and tRNA{sup Glu} by glutamyl-tRNA synthetase (GluRS). Recent work has demonstrated that Glu-tRNA{sup Glu} has dual functions and is a precursor for protein and 5-aminolevulinate (ALA) synthesis. Current data does not provide compelling evidence for the notion that GluRS is regulated by chlorophyll precursors or in concert with the other enzymes of ALA synthesis. We have redefined the C5-pathway as a two-step route to ALA starting with Glu-tRNA{sup Glu}. Only two enzymes, Glu-tRNA reductase (GluTR) and GSA-2,1-amino-mutase (GSA-AM), are specifically involved in ALA synthesis. We have purified these enzymatic activities from Chlamydomonas and demonstrated that the two purified proteins in the presence of their cofactors NADPH and pyridoxal phosphate are sufficient for the in vitro Glu-tRNA {yields} ALA conversion. We have cloned the genes encoding GluTR. The sequences of the GluTR proteins deduced from these genes share highly conserved regions with those of bacterial origin. We havealso cloned and analyzed the gene encoding GSA-AM from Arabidopsis. As in Salmonella typhimurium, there are indications of the existence of an additional pathway for ALA formation in E. coli. To shed light on the recognition of the single tRNA{sup Glu} by the chloroplast enzymes GluTR, GluRS we characterized a chlorophyll-deficient mutant of Euglena having tRNA{sup Glu} with a point mutation in the T{Psi}C-loop. The altered tRNA supports protein but not ALA synthesis.

  14. Concise total synthesis of (±)-actinophyllic acid

    PubMed Central

    Granger, Brett A.; Jewett, Ivan T.; Butler, Jeffrey D.; Martin, Stephen F.

    2014-01-01

    A concise total synthesis of the complex indole alkaloid (±)-actinophyllic acid was accomplished by a sequence of reactions requiring only 10 steps from readily-available, known starting materials. The approach featured a Lewis acid-catalyzed cascade of reactions involving stabilized carbocations that delivered the tetracyclic core of the natural product in a single chemical operation. Optimal conversion of this key intermediate into (±)-actinophyllic acid required judicious selection of a protecting group strategy. PMID:24882888

  15. Solid Phase Synthesis of C-Terminal Boronic Acid Peptides.

    PubMed

    Behnam, Mira A M; Sundermann, Tom R; Klein, Christian D

    2016-05-01

    Peptides and peptidomimetics with a C-terminal boronic acid group have prolific applications in numerous fields of research, but their synthetic accessibility remains problematic. A convenient, high yield synthesis of peptide-boronic acids on a solid support is described here, using commercially available 1-glycerol polystyrene resin. The method is compatible with Fmoc chemistry and offers a versatile approach to aryl and alkyl aminoboronic acids without additional purification steps. PMID:27104613

  16. Fine-Tuning of the Fatty Acid Pathway by Synthetic Antisense RNA for Enhanced (2S)-Naringenin Production from l-Tyrosine in Escherichia coli

    PubMed Central

    Wu, Junjun; Yu, Oliver; Du, Guocheng

    2014-01-01

    Malonyl coenzyme A (malonyl-CoA) is an important precursor for the synthesis of natural products, such as polyketides and flavonoids. The majority of this cofactor often is consumed for producing fatty acids and phospholipids, leaving only a small amount of cellular malonyl-CoA available for producing the target compound. The tuning of malonyl-CoA into heterologous pathways yields significant phenotypic effects, such as growth retardation and even cell death. In this study, fine-tuning of the fatty acid pathway in Escherichia coli with antisense RNA (asRNA) to balance the demands on malonyl-CoA for target-product synthesis and cell health was proposed. To establish an efficient asRNA system, the relationship between sequence and function for asRNA was explored. It was demonstrated that the gene-silencing effect of asRNA could be tuned by directing asRNA to different positions in the 5′-UTR (untranslated region) of the target gene. Based on this principle, the activity of asRNA was quantitatively tailored to balance the need for malonyl-CoA in cell growth and the production of the main flavonoid precursor, (2S)-naringenin. Appropriate inhibitory efficiency of the anti-fabB/fabF asRNA improved the production titer by 431% (391 mg/liter). Therefore, the strategy presented in this study provided a useful tool for the fine-tuning of endogenous gene expression in bacteria. PMID:25239896

  17. The synthesis and stability of cytoplasmic messenger RNA during myoblast differentiation in culture.

    PubMed

    Buckingham, M E; Caput, D; Cohen, A; Whalen, R G; Gros, F

    1974-04-01

    The synthesis of poly(A)-containing cytoplasmic RNA was examined in primary myoblast cultures prepared from skeletal muscle of fetal calves. After a period of cell division, these cells undergo fusion, with concomitant appearance of acetylcholine receptor and subsequent myosin synthesis. In the dividing myoblast there is a high level of messenger RNA synthesis, including a 26S RNA, the size of a putative messenger for the large subunit of myosin. In the transition period prior to fusion, there are quantitative changes in RNA synthesis. At this time, there is a pronounced production of 26S RNA, which diminishes during fusion. The possibility that 26S RNA is accumulated in the dividing myoblast was investigated by chase experiments. At fusion, there is a marked increase in the half-lives of a number of messenger RNA species, including 26 S, which increases from about 10 hr in the dividing cell to a value of more than 50 hr. The identity of the more rapidly turning over 26 S in the myoblasts, compared to that of the 26 S at fusion, was examined in terms of polysomal distribution, migration on gels, and hybridization with complementary DNA for the myosin message. The results of these analyses suggest that the 26S species are identical. Thus, it would appear that in a predetermined cell like the myoblast, the transition to the differentiated state of myotube that is synthesizing muscle specific proteins is effected by the stabilization of messenger already being actively transcribed: terminal differentiation, with respect to myosin synthesis, is preceded by the stabilization of 26S RNA. PMID:4524649

  18. Synaptic vesicles contain small ribonucleic acids (sRNAs) including transfer RNA fragments (trfRNA) and microRNAs (miRNA)

    PubMed Central

    Li, Huinan; Wu, Cheng; Aramayo, Rodolfo; Sachs, Matthew S.; Harlow, Mark L.

    2015-01-01

    Synaptic vesicles (SVs) are neuronal presynaptic organelles that load and release neurotransmitter at chemical synapses. In addition to classic neurotransmitters, we have found that synaptic vesicles isolated from the electric organ of Torpedo californica, a model cholinergic synapse, contain small ribonucleic acids (sRNAs), primarily the 5′ ends of transfer RNAs (tRNAs) termed tRNA fragments (trfRNAs). To test the evolutionary conservation of SV sRNAs we examined isolated SVs from the mouse central nervous system (CNS). We found abundant levels of sRNAs in mouse SVs, including trfRNAs and micro RNAs (miRNAs) known to be involved in transcriptional and translational regulation. This discovery suggests that, in addition to inducing changes in local dendritic excitability through the release of neurotransmitters, SVs may, through the release of specific trfRNAs and miRNAs, directly regulate local protein synthesis. We believe these findings have broad implications for the study of chemical synaptic transmission. PMID:26446566

  19. Fatty acid synthesis is inhibited by inefficient utilization of unusual fatty acids for glycerolipid assembly

    PubMed Central

    Bates, Philip D.; Johnson, Sean R.; Cao, Xia; Li, Jia; Nam, Jeong-Won; Jaworski, Jan G.; Ohlrogge, John B.; Browse, John

    2014-01-01

    Degradation of unusual fatty acids through β-oxidation within transgenic plants has long been hypothesized as a major factor limiting the production of industrially useful unusual fatty acids in seed oils. Arabidopsis seeds expressing the castor fatty acid hydroxylase accumulate hydroxylated fatty acids up to 17% of total fatty acids in seed triacylglycerols; however, total seed oil is also reduced up to 50%. Investigations into the cause of the reduced oil phenotype through in vivo [14C]acetate and [3H]2O metabolic labeling of developing seeds surprisingly revealed that the rate of de novo fatty acid synthesis within the transgenic seeds was approximately half that of control seeds. RNAseq analysis indicated no changes in expression of fatty acid synthesis genes in hydroxylase-expressing plants. However, differential [14C]acetate and [14C]malonate metabolic labeling of hydroxylase-expressing seeds indicated the in vivo acetyl–CoA carboxylase activity was reduced to approximately half that of control seeds. Therefore, the reduction of oil content in the transgenic seeds is consistent with reduced de novo fatty acid synthesis in the plastid rather than fatty acid degradation. Intriguingly, the coexpression of triacylglycerol synthesis isozymes from castor along with the fatty acid hydroxylase alleviated the reduced acetyl–CoA carboxylase activity, restored the rate of fatty acid synthesis, and the accumulation of seed oil was substantially recovered. Together these results suggest a previously unidentified mechanism that detects inefficient utilization of unusual fatty acids within the endoplasmic reticulum and activates an endogenous pathway for posttranslational reduction of fatty acid synthesis within the plastid. PMID:24398521

  20. Effects of bile acid administration on bile acid synthesis and its circadian rhythm in man

    SciTech Connect

    Pooler, P.A.; Duane, W.C.

    1988-09-01

    In man bile acid synthesis has a distinct circadian rhythm but the relationship of this rhythm to feedback inhibition by bile acid is unknown. We measured bile acid synthesis as release of 14CO2 from (26-14C)cholesterol every 2 hr in three normal volunteers during five separate 24-hr periods. Data were fitted by computer to a cosine curve to estimate amplitude and acrophase of the circadian rhythm. In an additional six volunteers, we measured synthesis every 2 hr from 8:00 a.m. to 4:00 p.m. only. During the control period, amplitude (expressed as percentage of mean synthesis) averaged 52% and acrophase averaged 6:49 a.m. During administration of ursodeoxycholic acid (15 mg per kg per day), synthesis averaged 126% of baseline (p less than 0.1), amplitude averaged 43% and acrophase averaged 6:20 a.m. During administration of chenodeoxycholic acid (15 mg per kg per day), synthesis averaged 43% of baseline (p less than 0.001), amplitude averaged 53% and acrophase averaged 9:04 a.m. Addition of prednisone to this regimen of chenodeoxycholic acid to eliminate release of 14CO2 from corticosteroid hormone synthesis resulted in a mean amplitude of 62% and a mean acrophase of 6:50 a.m., values very similar to those in the baseline period. Administration of prednisone alone also did not significantly alter the baseline amplitude (40%) or acrophase (6:28 a.m.). We conclude that neither chenodeoxycholic acid nor ursodeoxycholic acid significantly alters the circadian rhythm of bile acid synthesis in man.

  1. Decreased hepatotoxic bile acid composition and altered synthesis in progressive human nonalcoholic fatty liver disease.

    PubMed

    Lake, April D; Novak, Petr; Shipkova, Petia; Aranibar, Nelly; Robertson, Donald; Reily, Michael D; Lu, Zhenqiang; Lehman-McKeeman, Lois D; Cherrington, Nathan J

    2013-04-15

    Bile acids (BAs) have many physiological roles and exhibit both toxic and protective influences within the liver. Alterations in the BA profile may be the result of disease induced liver injury. Nonalcoholic fatty liver disease (NAFLD) is a prevalent form of chronic liver disease characterized by the pathophysiological progression from simple steatosis to nonalcoholic steatohepatitis (NASH). The hypothesis of this study is that the 'classical' (neutral) and 'alternative' (acidic) BA synthesis pathways are altered together with hepatic BA composition during progression of human NAFLD. This study employed the use of transcriptomic and metabolomic assays to study the hepatic toxicologic BA profile in progressive human NAFLD. Individual human liver samples diagnosed as normal, steatosis, and NASH were utilized in the assays. The transcriptomic analysis of 70 BA genes revealed an enrichment of downregulated BA metabolism and transcription factor/receptor genes in livers diagnosed as NASH. Increased mRNA expression of BAAT and CYP7B1 was observed in contrast to decreased CYP8B1 expression in NASH samples. The BA metabolomic profile of NASH livers exhibited an increase in taurine together with elevated levels of conjugated BA species, taurocholic acid (TCA) and taurodeoxycholic acid (TDCA). Conversely, cholic acid (CA) and glycodeoxycholic acid (GDCA) were decreased in NASH liver. These findings reveal a potential shift toward the alternative pathway of BA synthesis during NASH, mediated by increased mRNA and protein expression of CYP7B1. Overall, the transcriptomic changes of BA synthesis pathway enzymes together with altered hepatic BA composition signify an attempt by the liver to reduce hepatotoxicity during disease progression to NASH. PMID:23391614

  2. The synthesis of glutamic acid in the absence of enzymes: Implications for biogenesis

    NASA Technical Reports Server (NTRS)

    Morowitz, Harold; Peterson, Eta; Chang, Sherwood

    1995-01-01

    This paper reports on the non-enzymatic aqueous phase synthesis of amino acids from keto acids, ammonia and reducing agents. The facile synthesis of key metabolic intermediates, particularly in the glycolytic pathway, the citric acid cycle, and the first step of amino acid synthesis, lead to new ways of looking at the problem of biogenesis.

  3. Light-regulated protein and poly(A)+ mRNA synthesis in Neurospora crassa.

    PubMed Central

    Chambers, J A; Hinkelammert, K; Russo, V E

    1985-01-01

    We have examined the effect of illumination upon the patterns of protein synthesis in the filamentous ascomycete Neurospora crassa by pulse labelling and two-dimensional gel electrophoresis. Light did not affect overall rates of protein synthesis but did induce the synthesis of six novel polypeptides whose appearance followed a temporally regulated pattern. When translation products of mRNA from illuminated cultures and dark control cultures were compared it was found that the synthesis of five out of six of the polypeptides specific to illuminated cultures could be seen in vitro. We believe that this is consistent with the hypothesis that light regulates the transcription of some genes in N. crassa, although we cannot exclude effects on mRNA stability or the control of precursor splicing. Images Fig. 2. Fig. 3. PMID:2868891

  4. Total synthesis of legionaminic acid as basis for serological studies.

    PubMed

    Matthies, Stefan; Stallforth, Pierre; Seeberger, Peter H

    2015-03-01

    Legionaminic acid is a nine-carbon diamino monosaccharide that is found coating the surface of various bacterial human pathogens. Its unique structure makes it a valuable biological probe, but access via isolation is difficult and no practical synthesis has been reported. We describe a stereoselective synthesis that yields a legionaminic acid building block as well as linker-equipped conjugation-ready legionaminic acid starting from cheap d-threonine. To set the desired amino and hydroxyl group pattern of the target, we designed a concise sequence of stereoselective reactions. The key transformations rely on chelation-controlled organometallic additions and a Petasis multicomponent reaction. The legionaminic acid was synthesized in a form that enables attachment to surfaces. Glycan microarray containing legionaminic acid revealed that human antibodies bind the synthetic glycoside. The synthetic bacterial monosaccharide is a valuable probe to detect an immune response to bacterial pathogens such as Legionella pneumophila, the causative agent of Legionnaire's disease. PMID:25668389

  5. Synthesis of α-aminoboronic acids.

    PubMed

    Andrés, Patricia; Ballano, Gema; Calaza, M Isabel; Cativiela, Carlos

    2016-04-21

    This review describes available methods for the preparation of α-aminoboronic acids in their racemic or in their enantiopure form. Both, highly stereoselective syntheses and asymmetric procedures leading to the stereocontrolled generation of α-aminoboronic acid derivatives are included. The preparation of acyclic, carbocyclic and azacyclic α-aminoboronic acid derivatives is covered. Within each section, the different synthetic approaches have been classified according to the key bond which is formed to complete the α-aminoboronic acid skeleton. PMID:26853637

  6. Influenza virus RNA polymerase: insights into the mechanisms of viral RNA synthesis.

    PubMed

    Te Velthuis, Aartjan J W; Fodor, Ervin

    2016-08-01

    The genomes of influenza viruses consist of multiple segments of single-stranded negative-sense RNA. Each of these segments is bound by the heterotrimeric viral RNA-dependent RNA polymerase and multiple copies of nucleoprotein, which form viral ribonucleoprotein (vRNP) complexes. It is in the context of these vRNPs that the viral RNA polymerase carries out transcription of viral genes and replication of the viral RNA genome. In this Review, we discuss our current knowledge of the structure of the influenza virus RNA polymerase, and insights that have been gained into the molecular mechanisms of viral transcription and replication, and their regulation by viral and host factors. Furthermore, we discuss how advances in our understanding of the structure and function of polymerases could help in identifying new antiviral targets. PMID:27396566

  7. Synthesis of Triamino Acid Building Blocks with Different Lipophilicities

    PubMed Central

    Maity, Jyotirmoy; Honcharenko, Dmytro; Strömberg, Roger

    2015-01-01

    To obtain different amino acids with varying lipophilicity and that can carry up to three positive charges we have developed a number of new triamino acid building blocks. One set of building blocks was achieved by aminoethyl extension, via reductive amination, of the side chain of ortnithine, diaminopropanoic and diaminobutanoic acid. A second set of triamino acids with the aminoethyl extension having hydrocarbon side chains was synthesized from diaminobutanoic acid. The aldehydes needed for the extension by reductive amination were synthesized from the corresponding Fmoc-L-2-amino fatty acids in two steps. Reductive amination of these compounds with Boc-L-Dab-OH gave the C4-C8 alkyl-branched triamino acids. All triamino acids were subsequently Boc-protected at the formed secondary amine to make the monomers appropriate for the N-terminus position when performing Fmoc-based solid-phase peptide synthesis. PMID:25876040

  8. L Protein Requirement for In Vitro RNA Synthesis by Vesicular Stomatitis Virus

    PubMed Central

    Emerson, Suzanne U.; Wagner, Robert R.

    1973-01-01

    The endogenous transcriptase present in purified vesicular stomatitis (VS) virions was solubilized with a Triton X-100 high-salt solution. The polymerase activity was purified on glycerol gradients and by phosphocellulose column chromatography; the viral proteins present in the active enzyme fractions were identified by sodium dodecyl sulfate polyacrylamide gel electrophoresis. It was demonstrated that L protein, but not NS protein, was required for in vitro RNA synthesis on the VS viral nucleocapsid template. Solubilized L protein rebinds to the ribonucleoprotein template when the transcription complex is reconstituted, and the RNA synthesized in vitro by purified L protein hybridizes to virion RNA. Cyanogen bromide peptide fingerprints indicate that the large L protein is a unique polypeptide chain. It is concluded that the L protein functions as the transcriptase, and the nucleocapsid NS protein is not essential for in vitro RNA synthesis. PMID:4357510

  9. Photolithographic Synthesis of High-Density DNA and RNA Arrays on Flexible, Transparent, and Easily Subdivided Plastic Substrates.

    PubMed

    Holden, Matthew T; Carter, Matthew C D; Wu, Cheng-Hsien; Wolfer, Jamison; Codner, Eric; Sussman, Michael R; Lynn, David M; Smith, Lloyd M

    2015-11-17

    The photolithographic fabrication of high-density DNA and RNA arrays on flexible and transparent plastic substrates is reported. The substrates are thin sheets of poly(ethylene terephthalate) (PET) coated with cross-linked polymer multilayers that present hydroxyl groups suitable for conventional phosphoramidite-based nucleic acid synthesis. We demonstrate that by modifying array synthesis procedures to accommodate the physical and chemical properties of these materials, it is possible to synthesize plastic-backed oligonucleotide arrays with feature sizes as small as 14 μm × 14 μm and feature densities in excess of 125 000/cm(2), similar to specifications attainable using rigid substrates such as glass or glassy carbon. These plastic-backed arrays are tolerant to a wide range of hybridization temperatures, and improved synthetic procedures are described that enable the fabrication of arrays with sequences up to 50 nucleotides in length. These arrays hybridize with S/N ratios comparable to those fabricated on otherwise identical arrays prepared on glass or glassy carbon. This platform supports the enzymatic synthesis of RNA arrays and proof-of-concept experiments are presented showing that the arrays can be readily subdivided into smaller arrays (or "millichips") using common laboratory-scale laser cutting tools. These results expand the utility of oligonucleotide arrays fabricated on plastic substrates and open the door to new applications for these important bioanalytical tools. PMID:26494264

  10. Synthesis of Specifically Modified Oligonucleotides for Application in Structural and Functional Analysis of RNA

    PubMed Central

    Rublack, Nico; Nguyen, Hien; Appel, Bettina; Springstubbe, Danilo; Strohbach, Denise; Müller, Sabine

    2011-01-01

    Nowadays, RNA synthesis has become an essential tool not only in the field of molecular biology and medicine, but also in areas like molecular diagnostics and material sciences. Beyond synthetic RNAs for antisense, aptamer, ribozyme, and siRNA technologies, oligoribonucleotides carrying site-specific modifications for structure and function studies are needed. This often requires labeling of the RNA with a suitable spectroscopic reporter group. Herein, we describe the synthesis of functionalized monomer building blocks that upon incorporation in RNA allow for selective reaction with a specific reporter or functional entity. In particular, we report on the synthesis of 5′-O-dimethoxytrityl-2′-O-tert-butyldimethylsilyl protected 3′-O-phosphoramidites of nucleosides that carry amino linkers of different lengths and flexibility at the heterocyclic base, their incorporation in a variety of RNAs, and postsynthetic conjugation with fluorescent dyes and nitroxide spin labels. Further, we show the synthesis of a flavine mononucleotide-N-hydroxy-succinimidyl ester and its conjugation to amino functionalized RNA. PMID:22013508

  11. Enhanced hepatic delivery of siRNA and microRNA using oleic acid based lipid nanoparticle formulations

    PubMed Central

    Wang, Xinmei; Yu, Bo; Ren, Wei; Mo, Xiaokui; Zhou, Chenguang; He, Hongyan; Jia, HuLiang; Wang, Lu; Jacob, Samson T.; Lee, Robert J.; Ghoshal, Kalpana; Lee, L. James

    2015-01-01

    Many cationic lipids have been developed for lipid-based nanoparticles (LNPs) for delivery of siRNA and microRNA (miRNA). However, less attention has been paid to “helper lipids”. Here, we investigated several “helper lipids” and examined their effects on the physicochemical properties such as particle size and zeta potential, as well as cellular uptake and transfection efficiency. We found that inclusion of oleic acid (OA), an unsaturated fatty acid; into the LNP formulation significantly enhanced the delivery efficacy for siRNA and miRNA. For proof-of-concept, miR-122, a liver-specific microRNA associated with many liver diseases, was used as a model agent to demonstrate the hepatic delivery efficacy both in tumor cells and in animals. Compared to Lipofectamine 2000, a commercial transfection agent, OA containing LNPs delivered microRNA-122 in a more efficient manner with a 1.8-fold increase in mature miR-122 expression and a 20% decrease in Bcl-w, a target of microRNA-122. In comparison with Invivofectamine, a commercial transfection agent specifically designed for hepatic delivery, OA containing LNPs showed comparable liver accumulation and in vivo delivery efficiency. These findings demonstrated the importance of “helper lipid” components of the LNP formulation on the cellular uptake and transfection activity of siRNA and miRNA. OA containing LNPs are a promising nanocarrier system for the delivery of RNA-based therapeutics in liver diseases. PMID:24121065

  12. Complestatin exerts antibacterial activity by the inhibition of fatty acid synthesis.

    PubMed

    Kwon, Yun-Ju; Kim, Hyun-Ju; Kim, Won-Gon

    2015-01-01

    Bacterial enoyl-acyl carrier protein (ACP) reductase has been confirmed as a novel target for antibacterial drug development. In the screening of inhibitors of Staphylococcus aureus enoyl-ACP reductase (FabI), complestatin was isolated as a potent inhibitor of S. aureus FabI together with neuroprotectin A and chloropeptin I from Streptomyces chartreusis AN1542. Complestatin and related compounds inhibited S. aureus FabI with IC₅₀ of 0.3-0.6 µM. They also prevented the growth of S. aureus as well as methicillin-resistance S. aureus (MRSA) and quinolone-resistant S. aureus (QRSA), with minimum inhibitory concentrations (MICs) of 2-4 µg/mL. Consistent with its FabI-inhibition, complestatin selectively inhibited the intracellular fatty acid synthesis in S. aureus, whereas it did not affect the macromolecular biosynthesis of other cellular components, such as DNA, RNA, proteins, and the cell wall. Additionally, supplementation with exogenous fatty acids reversed the antibacterial effect of complestatin, demonstrating that it targets fatty acid synthesis. In this study, we reported that complestatin and related compounds showed potent antibacterial activity via inhibiting fatty acid synthesis. PMID:25947917

  13. Synthesis of 5-Hydroxymethylcytidine- and 5-Hydroxymethyl-uridine-Modified RNA

    PubMed Central

    Riml, Christian; Micura, Ronald

    2016-01-01

    We report on the syntheses of 5-hydroxymethyl-uridine [5hm(rU)] and -cytidine [5hm(rC)] phosphoramidites and their incorporation into RNA by solid-phase synthesis. Deprotection of the oligonucleotides is accomplished in a straightforward manner using standard conditions, confirming the appropriateness of the acetyl protection used for the pseudobenzylic alcohol moieties. The approach provides robust access to 5hm(rC/U)-modified RNAs that await applications in pull-down experiments to identify potential modification enzymes. They will also serve as synthetic probes for the development of high-throughput-sequencing methods in native RNAs. 1Introduction2Protection Strategies Reported for the Synthesis of 5hm(dC)-Modified DNA3Synthesis of 5-Hydroxymethylpyrimidine-Modified RNA3.1Synthesis of 5hm(rC) Phosphoramidite3.2Synthesis of 5hm(rU) Phosphoramidite3.3Synthesis of 5hm(rC)- and 5hm(rU)-Modified RNA4Conclusions PMID:27413246

  14. De novo synthesis of minus strand RNA by the rotavirus RNA polymerase in a cell-free system involves a novel mechanism of initiation.

    PubMed Central

    Chen, D; Patton, J T

    2000-01-01

    The replicase activity of rotavirus open cores has been used to study the synthesis of (-) strand RNA from viral (+) strand RNA in a cell-free replication system. The last 7 nt of the (+) strand RNA, 5'-UGUGACC-3', are highly conserved and are necessary for efficient (-) strand synthesis in vitro. Characterization of the cell-free replication system revealed that the addition of NaCl inhibited (-) strand synthesis. By preincubating open cores with (+) strand RNA and ATP, CTP, and GTP prior to the addition of NaCl and UTP, the salt-sensitive step was overcome. Thus, (-) strand initiation, but not elongation, was a salt-sensitive process in the cell-free system. Further analysis of the requirements for initiation showed that preincubating open cores and the (+) strand RNA with GTP or UTP, but not with ATP or CTP, allowed (-) strand synthesis to occur in the presence of NaCl. Mutagenesis suggested that in the presence of GTP, (-) strand synthesis initiated at the 3'-terminal C residue of the (+) strand template, whereas in the absence of GTP, an aberrant initiation event occurred at the third residue upstream from the 3' end of the (+) strand RNA. During preincubation with GTP, formation of the dinucleotides pGpG and ppGpG was detected; however, no such products were made during preincubation with ATP, CTP, or UTP. Replication assays showed that pGpG, but not GpG, pApG, or ApG, served as a specific primer for (-) strand synthesis and that the synthesis of pGpG may occur by a template-independent process. From these data, we conclude that initiation of rotavirus (-) strand synthesis involves the formation of a ternary complex consisting of the viral RNA-dependent RNA polymerase, viral (+) strand RNA, and possibly a 5'-phosphorylated dinucleotide, that is, pGpG or ppGpG. PMID:11073221

  15. Lipase-catalyzed synthesis of fatty acid amide (erucamide) using fatty acid and urea.

    PubMed

    Awasthi, Neeraj Praphulla; Singh, R P

    2007-01-01

    Ammonolysis of fatty acids to the corresponding fatty acid amides is efficiently catalysed by Candida antartica lipase (Novozym 435). In the present paper lipase-catalysed synthesis of erucamide by ammonolysis of erucic acid and urea in organic solvent medium was studied and optimal conditions for fatty amides synthesis were established. In this process erucic acid gave 88.74 % pure erucamide after 48 hour and 250 rpm at 60 degrees C with 1:4 molar ratio of erucic acid and urea, the organic solvent media is 50 ml tert-butyl alcohol (2-methyl-2-propanol). This process for synthesis is economical as we used urea in place of ammonia or other amidation reactant at atmospheric pressure. The amount of catalyst used is 3 %. PMID:17898456

  16. Mammalian transcription in support of hybrid mRNA and protein synthesis in testis and lung.

    PubMed

    Fitzgerald, Carolyn; Sikora, Curtis; Lawson, Vannice; Dong, Karen; Cheng, Min; Oko, Richard; van der Hoorn, Frans A

    2006-12-15

    Post-transcriptional mechanisms including differential splicing expand the protein repertoire beyond that provided by the one gene-one protein model. Trans-splicing has been observed in mammalian systems but is low level (sometimes referred to as noise), and a contribution to hybrid protein expression is unclear. In the study of rat sperm tail proteins a cDNA, called 1038, was isolated representing a hybrid mRNA derived in part from the ornithine decarboxylase antizyme 3 (Oaz3) gene located on rat chromosome 2 fused to sequences encoded by a novel gene on chromosome 4. Cytoplasmic Oaz3 mRNA is completely testis specific. However, in several tissues Oaz3 is transcribed and contributes to hybrid 1038 mRNA synthesis, without concurrent Oaz3 mRNA synthesis. 1038 mRNA directs synthesis of a hybrid 14-kDa protein, part chromosome 2- and part chromosome 4-derived as shown in vitro and in transfected cells. Antisera that recognize a chromosome 4-encoded C-terminal peptide confirm the hybrid character of endogenous 14-kDa protein and its presence in sperm tail structures and 1038-positive tissue. Our data suggest that the testis-specific OAZ3 gene may be an example of a mammalian gene that in several tissues is transcribed to contribute to a hybrid mRNA and protein. This finding expands the repertoire of known mechanisms available to cells to generate proteome diversity. PMID:17040916

  17. A comparison of RNA with DNA in template-directed synthesis

    NASA Technical Reports Server (NTRS)

    Zielinski, M.; Kozlov, I. A.; Orgel, L. E.; Bada, J. L. (Principal Investigator)

    2000-01-01

    Nonenzymatic template-directed copying of RNA sequences rich in cytidylic acid using nucleoside 5'-(2-methylimidazol-1-yl phosphates) as substrates is substantially more efficient than the copying of corresponding DNA sequences. However, many sequences cannot be copied, and the prospect of replication in this system is remote, even for RNA. Surprisingly, wobble-pairing leads to much more efficient incorporation of G opposite U on RNA templates than of G opposite T on DNA templates.

  18. Reduced secreted mu mRNA synthesis in selective IgM deficiency of Bloom's syndrome.

    PubMed Central

    Kondo, N; Ozawa, T; Kato, Y; Motoyoshi, F; Kasahara, K; Kameyama, T; Orii, T

    1992-01-01

    Serum IgM concentrations were low although serum IgG and IgA concentrations were normal in both our patients with Bloom's syndrome. Although the percentages of surface IgM-bearing cells were not reduced, the numbers of IgM-secreting cells were markedly reduced. The membrane-bound mu (microns) and secreted mu (microseconds) mRNAs are produced from transcripts of a single immunoglobulin mu gene by alternative RNA processing pathways. The control of microseconds mRNA synthesis depends on the addition of poly(A) to microseconds C-terminal segment. In both patients, mu mRNA was well detected but microseconds C-terminal mRNA was scarcely detected, suggesting that microns mRNA was well transcribed but microseconds mRNA was not. There was, at least, no mutation or deletion in the microseconds C-terminal coding sequence, the RNA splice site (GG/TAAAC) at the 5' end of microseconds C-terminal segment and the AATAAA poly(A) signal sequence in both patients. Our results suggest that selective IgM deficiency in Bloom's syndrome is due to an abnormality in the maturation of surface IgM-bearing B cells into IgM-secreting cells and a failure of microseconds mRNA synthesis. Moreover, reduced microseconds mRNA synthesis may be due to the defect on developmental regulation of the site at which poly(A) is added to transcripts of the mu gene. Images Fig. 2 PMID:1563106

  19. Nucleic acid hybridization with RNA immobilized on filter paper.

    NASA Technical Reports Server (NTRS)

    Saxinger, W. C.; Ponnamperuma, C.; Gillespie, D.

    1972-01-01

    RNA has been immobilized in a manner suitable for use in molecular hybridization experiments with dissolved RNA or DNA by a nonaqueous solid-phase reaction with carbonyldiimidazole and RNA 'dry coated' on cellulose or, preferably, on previously activated phosphocellulose filters. Immobilization of RNA does not appear to alter its chemical character or cause it to acquire affinity for unspecific RNA or DNA. The versatility and efficiency of this method make it potentially attractive for use in routine analytical or preparative hybridization experiments, among other applications.

  20. Comparison of bile acid synthesis determined by isotope dilution versus fecal acidic sterol output in human subjects

    SciTech Connect

    Duane, W.C.; Holloway, D.E.; Hutton, S.W.; Corcoran, P.J.; Haas, N.A.

    1982-05-01

    Fecal acidic sterol output has been found to be much lower than bile acid synthesis determined by isotope dilution. Because of this confusing discrepancy, we compared these 2 measurements done simultaneously on 13 occasions in 5 normal volunteers. In contrast to previous findings, bile acid synthesis by the Lindstedt isotope dilution method averaged 16.3% lower than synthesis simultaneously determined by fecal acidic sterol output (95% confidence limit for the difference - 22.2 to -10.4%). When one-sample determinations of bile acid pools were substituted for Lindstedt pools, bile acid synthesis by isotope dilution averaged 5.6% higher than synthesis by fecal acidic sterol output (95% confidence limits -4.9 to 16.1%). These data indicate that the 2 methods yield values in reasonably close agreement with one another. If anything, fecal acidic sterol outputs are slightly higher than synthesis by isotope dilution.

  1. Synthesis of Poly Linear shRNA Expression Cassettes Through Branch-PCR.

    PubMed

    Liu, Jianbing; Xi, Zhen

    2016-01-01

    A facile and universal strategy to construct the poly linear small hairpin RNA (shRNA) expression cassettes with multiple shRNA transcription templates through polymerase chain reaction with flexible branched primers (branch-PCR) is described in this protocol. Double-stranded RNA (dsRNA) is not stable enough for the study of RNA interference (RNAi) delivery in mammalian cells. Therefore, the more stable shRNA transcription template is employed to produce the endogenous transcribed dsRNA. Then, the covalent crosslinked linear shRNA expression cassettes are constructed through the branch-PCR for the long-lasting RNAi effect in this protocol. The branched primer pair is efficiently synthesized through classic click chemistry. In one step of PCR, the much more stable poly linear shRNA expression cassettes can be produced in large scale. This strategy of efficient synthesis of the poly linear gene expression cassettes can also be applied in the field for other target gene delivery. © 2016 by John Wiley & Sons, Inc. PMID:27584702

  2. Non-enzymatic template-directed RNA synthesis inside model protocells

    PubMed Central

    Adamala, Katarzyna; Szostak, Jack W.

    2014-01-01

    Efforts to recreate a prebiotically plausible protocell, in which RNA replication occurs within a fatty acid vesicle, have been stalled by the destabilizing effect of Mg2+ on fatty acid membranes. Here, we report that the presence of citrate protects fatty acid membranes from the disruptive effects of high Mg2+ ion concentrations while allowing RNA copying to proceed, while also protecting single-stranded RNA from Mg2+-catalyzed degradation. This combination of properties has allowed us to demonstrate the chemical copying of RNA templates inside fatty acid vesicles, which in turn allows for an increase in copying efficiency by bathing the vesicles in a continuously refreshed solution of activated nucleotides. PMID:24288333

  3. Synthesis of biobased succinonitrile from glutamic acid and glutamine.

    PubMed

    Lammens, Tijs M; Le Nôtre, Jérôme; Franssen, Maurice C R; Scott, Elinor L; Sanders, Johan P M

    2011-06-20

    Succinonitrile is the precursor of 1,4-diaminobutane, which is used for the industrial production of polyamides. This paper describes the synthesis of biobased succinonitrile from glutamic acid and glutamine, amino acids that are abundantly present in many plant proteins. Synthesis of the intermediate 3-cyanopropanoic amide was achieved from glutamic acid 5-methyl ester in an 86 mol% yield and from glutamine in a 56 mol % yield. 3-Cyanopropanoic acid can be converted into succinonitrile, with a selectivity close to 100% and a 62% conversion, by making use of a palladium(II)-catalyzed equilibrium reaction with acetonitrile. Thus, a new route to produce biobased 1,4-diaminobutane has been discovered. PMID:21557494

  4. Effect of epinephrine and serotonin on hepatic poly(A)/sup +/ RNA synthesis

    SciTech Connect

    Roy, A.K.; Bhadra, R.; Datta, A.G.

    1985-06-17

    In vivo administration of epinephrine or serotonin has been shown to stimulate the incorporation of /sup 14/C-orotic acid into Poly(A)/sup +/ RNA. However, only epinephrine and not serotonin could stimulate DNA dependent RNA polymerase activity of isolated hepatic nuclei in in vitro experiments. 21 references, 1 figure, 3 tables.

  5. Role of the 3′ tRNA-Like Structure in Tobacco Mosaic Virus Minus-Strand RNA Synthesis by the Viral RNA-Dependent RNA Polymerase In Vitro

    PubMed Central

    Osman, T. A. M.; Hemenway, C. L.; Buck, K. W.

    2000-01-01

    A template-dependent RNA polymerase has been used to determine the sequence elements in the 3′ untranslated region of tobacco mosaic virus RNA that are required for promotion of minus-strand RNA synthesis and binding to the RNA polymerase in vitro. Regions which were important for minus-strand synthesis were domain D1, which is equivalent to a tRNA acceptor arm; domain D2, which is similar to a tRNA anticodon arm; an upstream domain, D3; and a central core, C, which connects domains D1, D2, and D3 and determines their relative orientations. Mutational analysis of the 3′-terminal 4 nucleotides of domain D1 indicated the importance of the 3′-terminal CA sequence for minus-strand synthesis, with the sequence CCCA or GGCA giving the highest transcriptional efficiency. Several double-helical regions, but not their sequences, which are essential for forming pseudoknot and/or stem-loop structures in domains D1, D2, and D3 and the central core, C, were shown to be required for high template efficiency. Also important were a bulge sequence in the D2 stem-loop and, to a lesser extent, a loop sequence in a hairpin structure in domain D1. The sequence of the 3′ untranslated region upstream of domain D3 was not required for minus-strand synthesis. Template-RNA polymerase binding competition experiments showed that the highest-affinity RNA polymerase binding element region lay within a region comprising domain D2 and the central core, C, but domains D1 and D3 also bound to the RNA polymerase with lower affinity. PMID:11090166

  6. Site-specific incorporation of probes into RNA polymerase by unnatural-amino-acid mutagenesis and Staudinger-Bertozzi ligation

    PubMed Central

    Chakraborty, Anirban; Mazumder, Abhishek; Lin, Miaoxin; Hasemeyer, Adam; Xu, Qumiao; Wang, Dongye; Ebright, Yon W.; Ebright, Richard H.

    2015-01-01

    Summary A three-step procedure comprising (i) unnatural-amino-acid mutagenesis with 4-azido-phenylalanine, (ii) Staudinger-Bertozzi ligation with a probe-phosphine derivative, and (iii) in vitro reconstitution of RNA polymerase (RNAP) enables the efficient site-specific incorporation of a fluorescent probe, a spin label, a crosslinking agent, a cleaving agent, an affinity tag, or any other biochemical or biophysical probe, at any site of interest in RNAP. Straightforward extensions of the procedure enable the efficient site-specific incorporation of two or more different probes in two or more different subunits of RNAP. We present protocols for synthesis of probe-phosphine derivatives, preparation of RNAP subunits and the transcription initiation factor σ, unnatural amino acid mutagenesis of RNAP subunits and σ, Staudinger ligation with unnatural-amino-acid-containing RNAP subunits and σ, quantitation of labelling efficiency and labelling specificity, and reconstitution of RNAP. PMID:25665560

  7. Rapid Sensitive Assay for Interferons Based on the Inhibition of MM Virus Nucleic Acid Synthesis

    PubMed Central

    Allen, Patton T.; Giron, David J.

    1970-01-01

    A method for assaying mouse interferon based on the inhibition of viral ribonucleic acid (RNA) synthesis was devised. The amount of MM virus and RNA synthesized in interferon-treated L-cell cultures was determined by measuring the amount of 3H-uridine converted into a trichloroacetic acid-insoluble form after treatment of the infected cultures with 2.5 μg of actinomycin D per ml. The amount of RNA synthesized was inversely related to the concentration of interferon used for treatment. A linear dose-response regression curve was obtained by plotting the log of the amount of RNA made, expressed as a percentage of the control, versus the log of the reciprocal of the interferon dilution. A unit of interferon was defined as that concentration which inhibited nucleic acid synthesis by 50% (INAS50). The concentration of mouse interferon could be determined within 24 hr. This assay method, on the average, was approximately half as sensitive as the method which measured the 50% reduction of MM virus plaque number (PDD50-MM method), but was, on the average, almost 1.7 times as sensitive as the PDD50-VSV method. It averaged approximately 20 times the sensitivity of the methods which used as end points the 70% reduction in yield of MM virus or the complete inhibition of cytopathic effect by MM virus. The reproducibility of the INAS50 technique was tested in two ways. (i) Four independent assays of an interferon specimen were performed with replicate cultures. The standard deviation was 11.2% of the mean titer. (ii) On different dates, one interferon specimen was assayed seven times and another was assayed four times. The standard deviations were 21.5 and 26.6% of the respective mean titers. PMID:4320919

  8. By-products of electrochemical synthesis of suberic acid

    SciTech Connect

    Shirobokova, O.I.; Adamov, A.A.; Freidlin, G.N.; Antonenko, N.S.; Grudtsyn, Yu.D.

    1988-05-10

    By-products of the electrochemical synthesis of dimethyl suberate from glutaric anhydride were studied. This is isolated by thermal dehydration of a mixture of lower dicarboxylic acids that are wastes from the production of adipic acid. To isolate the by-products, they used the methods of vacuum rectification and preparative gas-liquid chromatography, and for their identification, PMR, IR spectroscopy, gas-liquid chromatography, and other known physicochemical methods of investigation.

  9. Stereoselective synthesis of unsaturated α-amino acids.

    PubMed

    Fanelli, Roberto; Jeanne-Julien, Louis; René, Adeline; Martinez, Jean; Cavelier, Florine

    2015-06-01

    Stereoselective synthesis of unsaturated α-amino acids was performed by asymmetric alkylation. Two methods were investigated and their enantiomeric excess measured and compared. The first route consisted of an enantioselective approach induced by the Corey-Lygo catalyst under chiral phase transfer conditions while the second one involved the hydroxypinanone chiral auxiliary, both implicating Schiff bases as substrate. In all cases, the use of a prochiral Schiff base gave higher enantiomeric excess and yield in the final desired amino acid. PMID:25715756

  10. The spark discharge synthesis of amino acids from various hydrocarbons

    NASA Technical Reports Server (NTRS)

    Ring, D.; Miller, S. L.

    1984-01-01

    The spark discharge synthesis of amino acids using an atmosphere of CH4+N2+H2O+NH3 has been investigated with variable pNH3. The amino acids produced using higher hydrocarbons (ethane, ethylene, acetylene, propane, butane, and isobutane) instead of CH4 were also investigated. There was considerable range in the absolute yields of amino acids, but the yields relative to glycine (or alpha-amino-n-butyric acid) were more uniform. The relative yields of the C3 to C6 aliphatic alpha-amino acids are nearly the same (with a few exceptions) with all the hydrocarbons. The glycine yields are more variable. The precursors to the C3-C6 aliphatic amino acids seem to be produced in the same process, which is separate from the synthesis of glycine precursors. It may be possible to use these relative yields as a signature for a spark discharge synthesis provided corrections can be made for subsequent decomposition events (e.g. in the Murchison meteorite).

  11. In vitro synthesis of vertebrate U1 snRNA.

    PubMed Central

    Lund, E; Dahlberg, J E

    1989-01-01

    We have developed a DNA-dependent in vitro transcription system for vertebrate snRNA genes. By isolating the nuclei (germinal vesicles, GVs) of Xenopus laevis oocytes under oil to maintain the in vivo composition of their internal milieu, we are able to prepare nuclei that retain their ability to synthesize snRNAs efficiently. Homogenates of these GVs synthesize correctly initiated and terminated U1 snRNA using exogenous X.laevis U1 genes as templates. The templates may be either injected into the nucleus prior to its isolation or added to the nuclear homogenate. Images PMID:2714253

  12. Efficient synthesis of stably adenylated DNA and RNA adapters for microRNA capture using T4 RNA ligase 1.

    PubMed

    Song, Yunke; Liu, Kelvin J; Wang, Tza-Huei

    2015-01-01

    MicroRNA profiling methods have become increasingly important due to the rapid rise of microRNA in both basic and translational sciences. A critical step in many microRNA profiling assays is adapter ligation using pre-adenylated adapters. While pre-adenylated adapters can be chemically or enzymatically prepared, enzymatic adenylation is preferred due to its ease and high yield. However, previously reported enzymatic methods either require tedious purification steps or use thermostable ligases that can generate side products during the subsequent ligation step. We have developed a highly efficient, template- and purification-free, adapter adenylation method using T4 RNA ligase 1. This method is capable of adenylating large amounts of adapter at ~100% efficiency and can efficiently adenylate both DNA and RNA bases. We find that the adenylation reaction speed can differ between DNA and RNA and between terminal nucleotides, leading to bias if reactions are not allowed to run to completion. We further find that the addition of high PEG levels can effectively suppress these differences. PMID:26500066

  13. The Riia Gene of Bacteriophage T4. II. Regulation of Its Messenger RNA Synthesis

    PubMed Central

    Daegelen, P.; Brody, E.

    1990-01-01

    When the rII genes are first introduced into cells which had been previously infected by T4 phage deleted for these genes, the kinetics of synthesis of rIIA and rIIB RNA are rapid and identical. We show that this rapid synthesis depends on a functional motA gene for rIIB, but not for rIIA, RNA synthesis. By primer-extension mapping of T4 messenger RNA, we find three promoters close to the rIIA gene. One of them is an early promoter just before the rIIA.1 gene; it is used under all conditions tested. Another is in the coding portion of the rIIA.1 gene; it is weak, primarily because of a 19-bp spacing between the -10 and -35 elements, and its use is stimulated by T4 functions. The third is a motA-dependent (middle) promoter which has an unusual CCCGCTT box at -33. We present results which suggest that none of these promoters is likely to be the site at which the motB and motC gene products exercise their major influence on rIIA RNA synthesis. PMID:2379818

  14. Synthesis of monomethyl 5,5'-dehydrodiferulic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Synthesis of the internal reference compound, monomethyl 5,5’-dehydrodiferulic acid, is described. The synthetic scheme relies on a selective monomethylation of the known compound 5,5-dehydrodivanillin, followed by elaboration into the dehydrodiferulic framework through a dual Horner-Emmons-Wadswort...

  15. Enantioselective synthesis of isotopically labeled homocitric acid lactone.

    PubMed

    Moore, Jared T; Hanhan, Nadine V; Mahoney, Maximillian E; Cramer, Stephen P; Shaw, Jared T

    2013-11-15

    A concise synthesis of homocitric acid lactone was developed to accommodate systematic placement of carbon isotopes (specifically (13)C) for detailed studies of this cofactor. This new route uses a chiral allylic alcohol, available in multigram quantities from enzymatic resolution, as a starting material, which transposes asymmetry through an Ireland-Claisen rearrangement. PMID:24180620

  16. Fecal bile acid excretion and messenger RNA expression levels of ileal transporters in high risk gallstone patients

    PubMed Central

    2009-01-01

    Background Cholesterol gallstone disease (GS) is highly prevalent among Hispanics and American Indians. In GS, the pool of bile acids (BA) is decreased, suggesting that BA absorption is impaired. In Caucasian GS patients, mRNA levels for ileal BA transporters are decreased. We aimed to determine fecal BA excretion rates, mRNA levels for ileal BA transporter genes and of regulatory genes of BA synthesis in Hispanic GS patients. Results Excretion of fecal BA was measured in seven GS females and in ten GS-free individuals, all with a body mass index < 29. Participants ingested the stool marker Cr2O3 (300 mg/day) for 10 days, and fecal specimens were collected on the last 3 days. Chromium was measured by a colorimetric method, and BA was quantitated by gas chromatography/mass spectroscopy. Intake of calories, nutrients, fiber and cholesterol were similar in the GS and GS-free subjects. Mean BA excretion levels were 520 ± 80 mg/day for the GS-free group, and 461 ± 105 mg/day for the GS group. Messenger RNA expression levels were determined by RT-PCR on biopsy samples obtained from ileum during diagnostic colonoscopy (14 GS-free controls and 16 GS patients) and from liver during surgery performed at 8 and 10 AM (12 GS and 10 GS-free patients operated on for gastrointestinal malignancies), all with a body mass index < 29. Messenger RNA level of the BA transporter genes for ileal lipid binding protein, multidrug resistance-associated protein 3, organic solute transporter alpha, and organic solute transporter beta were similar in GS and GS-free subjects. Messenger RNA level of Cyp27A1, encoding the enzyme 27α-hydroxylase, the short heterodimer partner and farnesoid X receptor remained unchanged, whereas the mRNA level of Cyp7A1, the rate limiting step of BA synthesis, was increased more than 400% (p < 0.01) in the liver of GS compared to GS-free subjects. Conclusion Hispanics with GS have fecal BA excretion rates and mRNA levels of genes for ileal BA transporters that

  17. Coordinated regulation of synthesis and stability of RNA during the acute TNF-induced proinflammatory response

    PubMed Central

    Paulsen, Michelle T.; Veloso, Artur; Prasad, Jayendra; Bedi, Karan; Ljungman, Emily A.; Tsan, Ya-Chun; Chang, Ching-Wei; Tarrier, Brendan; Washburn, Joseph G.; Lyons, Robert; Robinson, Daniel R.; Kumar-Sinha, Chandan; Wilson, Thomas E.; Ljungman, Mats

    2013-01-01

    Steady-state gene expression is a coordination of synthesis and decay of RNA through epigenetic regulation, transcription factors, micro RNAs (miRNAs), and RNA-binding proteins. Here, we present bromouride labeling and sequencing (Bru-Seq) and bromouridine pulse-chase and sequencing (BruChase-Seq) to assess genome-wide changes to RNA synthesis and stability in human fibroblasts at homeostasis and after exposure to the proinflammatory tumor necrosis factor (TNF). The inflammatory response in human cells involves rapid and dramatic changes in gene expression, and the Bru-Seq and BruChase-Seq techniques revealed a coordinated and complex regulation of gene expression both at the transcriptional and posttranscriptional levels. The combinatory analysis of both RNA synthesis and stability using Bru-Seq and BruChase-Seq allows for a much deeper understanding of mechanisms of gene regulation than afforded by the analysis of steady-state total RNA and should be useful in many biological settings. PMID:23345452

  18. Akt activation enhances ribosomal RNA synthesis through casein kinase II and TIF-IA

    PubMed Central

    Nguyen, Le Xuan Truong; Mitchell, Beverly S.

    2013-01-01

    Transcription initiation factor I (TIF-IA) plays an essential role in regulating ribosomal RNA (rRNA) synthesis by tethering RNA polymerase I (Pol I) to the rDNA promoter. We have found that activated Akt enhances rRNA synthesis through the phosphorylation of casein kinase IIα (CK2α) on a threonine residue near its N terminus. CK2 in turn phosphorylates TIF-IA, thereby increasing rDNA transcription. Activated Akt also stabilizes TIF-IA, induces its translocation to the nucleolus, and enhances its interaction with Pol I. Treatment with AZD8055, an inhibitor of both Akt and mammalian target of rapamycin phosphorylation, but not with rapamycin, disrupts Akt-mediated TIF-IA stability, translocation, and activity. These data support a model in which activated Akt enhances rRNA synthesis both by preventing TIF-IA degradation and phosphorylating CK2α, which in turn phosphorylates TIF-IA. This model provides an explanation for the ability of activated Akt to promote cell proliferation and, potentially, transformation. PMID:24297901

  19. Amino acid synthesis in Europa's subsurface environment

    NASA Astrophysics Data System (ADS)

    Abbas, Sam H.; Schulze-Makuch, Dirk

    2008-10-01

    It has been suggested that Europa's subsurface environment may provide a haven for prebiotic evolution and the development of exotic biotic systems. The detection of hydrogen peroxide, sulfuric acid, water, hydrates and related species on the surface, coupled with observed mobility of icebergs, suggests the presence of a substantial subsurface liquid reservoir that actively exchanges materials with the surface environment. The atmospheric, surface and subsurface environments are described with their known chemistry. Three synthetic schemes using hydrogen peroxide, sulfuric acid and hydrocyanic acid leading to the production of larger biologically important molecules such as amino acids are described. Metabolic pathways based on properties of the subsurface ocean environment are detailed. Tidal heating, osmotic gradients, chemical cycling, as well as hydrothermal vents, provide energy and materials that may support a course of prebiotic evolution leading to the development or sustenance of simple biotic systems. Putative organisms may employ metabolic pathways based on chemical oxidation reduction cycles occurring in the putative subsurface ocean environment.

  20. Amino Acid Synthesis in a Supercritical Carbon Dioxide - Water System

    PubMed Central

    Fujioka, Kouki; Futamura, Yasuhiro; Shiohara, Tomoo; Hoshino, Akiyoshi; Kanaya, Fumihide; Manome, Yoshinobu; Yamamoto, Kenji

    2009-01-01

    Mars is a CO2-abundant planet, whereas early Earth is thought to be also CO2-abundant. In addition, water was also discovered on Mars in 2008. From the facts and theory, we assumed that soda fountains were present on both planets, and this affected amino acid synthesis. Here, using a supercritical CO2/liquid H2O (10:1) system which mimicked crust soda fountains, we demonstrate production of amino acids from hydroxylamine (nitrogen source) and keto acids (oxylic acid sources). In this research, several amino acids were detected with an amino acid analyzer. Moreover, alanine polymers were detected with LC-MS. Our research lights up a new pathway in the study of life’s origin. PMID:19582225

  1. Stereoselective synthesis of stable-isotope-labeled amino acids

    SciTech Connect

    Unkefer, C.J.; Martinez, R.A.; Silks, L.A. III; Lodwig, S.N.

    1994-12-01

    For magnetic resonance and vibrational spectroscopies to reach their full potential, they must be used in combination with sophisticated site-specific stable isotope labeling of biological macromolecules. Labeled amino acids are required for the study of the structure and function of enzymes and proteins. Because there are 20 common amino acids, each with its own distinguishing chemistry, they remain a synthetic challenge. The Oppolzer chiral auxiliary provides a general tool with which to approach the synthesis of labeled amino acids. By using the Oppolzer auxiliary, amino acids can be constructed from several small molecules, which is ideal for stable isotope labeling. In addition to directing the stereochemistry at the {alpha}-carbon, the camphorsultam can be used for stereo-specific isotope labeling at prochiral centers in amino acids. By using the camphorsultam auxiliary we have the potential to synthesize virtually any isotopomer of all of the common amino acids.

  2. d-Amino Acids Indirectly Inhibit Biofilm Formation in Bacillus subtilis by Interfering with Protein Synthesis

    PubMed Central

    Leiman, Sara A.; May, Janine M.; Lebar, Matthew D.; Kahne, Daniel; Kolter, Roberto

    2013-01-01

    The soil bacterium Bacillus subtilis forms biofilms on surfaces and at air-liquid interfaces. It was previously reported that these biofilms disassemble late in their life cycle and that conditioned medium from late-stage biofilms inhibits biofilm formation. Such medium contained a mixture of d-leucine, d-methionine, d-tryptophan, and d-tyrosine and was reported to inhibit biofilm formation via the incorporation of these d-amino acids into the cell wall. Here, we show that l-amino acids were able to specifically reverse the inhibitory effects of their cognate d-amino acids. We also show that d-amino acids inhibited growth and the expression of biofilm matrix genes at concentrations that inhibit biofilm formation. Finally, we report that the strain routinely used to study biofilm formation has a mutation in the gene (dtd) encoding d-tyrosyl-tRNA deacylase, an enzyme that prevents the misincorporation of d-amino acids into protein in B. subtilis. When we repaired the dtd gene, B. subtilis became resistant to the biofilm-inhibitory effects of d-amino acids without losing the ability to incorporate at least one noncanonical d-amino acid, d-tryptophan, into the peptidoglycan peptide side chain. We conclude that the susceptibility of B. subtilis to the biofilm-inhibitory effects of d-amino acids is largely, if not entirely, due to their toxic effects on protein synthesis. PMID:24097941

  3. D-amino acids indirectly inhibit biofilm formation in Bacillus subtilis by interfering with protein synthesis.

    PubMed

    Leiman, Sara A; May, Janine M; Lebar, Matthew D; Kahne, Daniel; Kolter, Roberto; Losick, Richard

    2013-12-01

    The soil bacterium Bacillus subtilis forms biofilms on surfaces and at air-liquid interfaces. It was previously reported that these biofilms disassemble late in their life cycle and that conditioned medium from late-stage biofilms inhibits biofilm formation. Such medium contained a mixture of D-leucine, D-methionine, D-tryptophan, and D-tyrosine and was reported to inhibit biofilm formation via the incorporation of these D-amino acids into the cell wall. Here, we show that L-amino acids were able to specifically reverse the inhibitory effects of their cognate D-amino acids. We also show that D-amino acids inhibited growth and the expression of biofilm matrix genes at concentrations that inhibit biofilm formation. Finally, we report that the strain routinely used to study biofilm formation has a mutation in the gene (dtd) encoding D-tyrosyl-tRNA deacylase, an enzyme that prevents the misincorporation of D-amino acids into protein in B. subtilis. When we repaired the dtd gene, B. subtilis became resistant to the biofilm-inhibitory effects of D-amino acids without losing the ability to incorporate at least one noncanonical D-amino acid, D-tryptophan, into the peptidoglycan peptide side chain. We conclude that the susceptibility of B. subtilis to the biofilm-inhibitory effects of D-amino acids is largely, if not entirely, due to their toxic effects on protein synthesis. PMID:24097941

  4. Fidaxomicin Is an Inhibitor of the Initiation of Bacterial RNA Synthesis

    PubMed Central

    Artsimovitch, Irina; Seddon, Jaime; Sears, Pamela

    2012-01-01

    Fidaxomicin was recently approved for the treatment of Clostridium difficile infection. It inhibits transcription by bacterial RNA polymerase. Because transcription is a multistep process, experiments were conducted in which fidaxomicin was added at different stages of transcriptional initiation to identify the blocked step. DNA footprinting experiments were also conducted to further elucidate the stage inhibited. Fidaxomicin blocks initiation only if added before the formation of the “open promoter complex,” in which the template DNA strands have separated but RNA synthesis has not yet begun. Binding of fidaxomicin precludes the initial separation of DNA strands that is prerequisite to RNA synthesis. These studies show that it has a mechanism distinct from that of elongation inhibitors, such as streptolydigin, and from the transcription initiation inhibitors myxopyronin and the rifamycins. PMID:22752861

  5. Benzylidene Acetal Protecting Group as Carboxylic Acid Surrogate: Synthesis of Functionalized Uronic Acids and Sugar Amino Acids.

    PubMed

    Banerjee, Amit; Senthilkumar, Soundararasu; Baskaran, Sundarababu

    2016-01-18

    Direct oxidation of the 4,6-O-benzylidene acetal protecting group to C-6 carboxylic acid has been developed that provides an easy access to a wide range of biologically important and synthetically challenging uronic acid and sugar amino acid derivatives in good yields. The RuCl3 -NaIO4 -mediated oxidative cleavage method eliminates protection and deprotection steps and the reaction takes place under mild conditions. The dual role of the benzylidene acetal, as a protecting group and source of carboxylic acid, was exploited in the efficient synthesis of six-carbon sialic acid analogues and disaccharides bearing uronic acids, including glycosaminoglycan analogues. PMID:26572799

  6. Synthesis and chirality of amino acids under interstellar conditions.

    PubMed

    Giri, Chaitanya; Goesmann, Fred; Meinert, Cornelia; Evans, Amanda C; Meierhenrich, Uwe J

    2013-01-01

    Amino acids are the fundamental building blocks of proteins, the biomolecules that provide cellular structure and function in all living organisms. A majority of amino acids utilized within living systems possess pre-specified orientation geometry (chirality); however the original source for this specific orientation remains uncertain. In order to trace the chemical evolution of life, an appreciation of the synthetic and evolutional origins of the first chiral amino acids must first be gained. Given that the amino acids in our universe are likely to have been synthesized in molecular clouds in interstellar space, it is necessary to understand where and how the first synthesis might have occurred. The asymmetry of the original amino acid synthesis was probably the result of exposure to chiral photons in the form of circularly polarized light (CPL), which has been detected in interstellar molecular clouds. This chirality transfer event, from photons to amino acids, has been successfully recreated experimentally and is likely a combination of both asymmetric synthesis and enantioselective photolysis. A series of innovative studies have reported successful simulation of these environments and afforded production of chiral amino acids under realistic circumstellar and interstellar conditions: irradiation of interstellar ice analogues (CO, CO2, NH3, CH3OH, and H2O) with circularly polarized ultraviolet photons at low temperatures does result in enantiomer enriched amino acid structures (up to 1.3% ee). This topical review summarizes current knowledge and recent discoveries about the simulated interstellar environments within which amino acids were probably formed. A synopsis of the COSAC experiment onboard the ESA cometary mission ROSETTA concludes this review: the ROSETTA mission will soft-land on the nucleus of the comet 67P/Churyumov-Gerasimenko in November 2014, anticipating the first in situ detection of asymmetric organic molecules in cometary ices. PMID:22976459

  7. Glucose and Insulin Induction of Bile Acid Synthesis

    PubMed Central

    Li, Tiangang; Francl, Jessica M.; Boehme, Shannon; Ochoa, Adrian; Zhang, Youcai; Klaassen, Curtis D.; Erickson, Sandra K.; Chiang, John Y. L.

    2012-01-01

    Bile acids facilitate postprandial absorption of nutrients. Bile acids also activate the farnesoid X receptor (FXR) and the G protein-coupled receptor TGR5 and play a major role in regulating lipid, glucose, and energy metabolism. Transgenic expression of cholesterol 7α-hydroxylase (CYP7A1) prevented high fat diet-induced diabetes and obesity in mice. In this study, we investigated the nutrient effects on bile acid synthesis. Refeeding of a chow diet to fasted mice increased CYP7A1 expression, bile acid pool size, and serum bile acids in wild type and humanized CYP7A1-transgenic mice. Chromatin immunoprecipitation assays showed that glucose increased histone acetylation and decreased histone methylation on the CYP7A1 gene promoter. Refeeding also induced CYP7A1 in fxr-deficient mice, indicating that FXR signaling did not play a role in postprandial regulation of bile acid synthesis. In streptozocin-induced type I diabetic mice and genetically obese type II diabetic ob/ob mice, hyperglycemia increased histone acetylation status on the CYP7A1 gene promoter, leading to elevated basal Cyp7a1 expression and an enlarged bile acid pool with altered bile acid composition. However, refeeding did not further increase CYP7A1 expression in diabetic mice. In summary, this study demonstrates that glucose and insulin are major postprandial factors that induce CYP7A1 gene expression and bile acid synthesis. Glucose induces CYP7A1 gene expression mainly by epigenetic mechanisms. In diabetic mice, CYP7A1 chromatin is hyperacetylated, and fasting to refeeding response is impaired and may exacerbate metabolic disorders in diabetes. PMID:22144677

  8. Salicylic Acid Inhibits Synthesis of Proteinase Inhibitors in Tomato Leaves Induced by Systemin and Jasmonic Acid.

    PubMed Central

    Doares, S. H.; Narvaez-Vasquez, J.; Conconi, A.; Ryan, C. A.

    1995-01-01

    Salicylic acid (SA) and acetylsalicylic acid (ASA), previously shown to inhibit proteinase inhibitor synthesis induced by wounding, oligouronides (H.M. Doherty, R.R. Selvendran, D.J. Bowles [1988] Physiol Mol Plant Pathol 33: 377-384), and linolenic acid (H. Pena-Cortes, T. Albrecht, S. Prat, E.W. Weiler, L. Willmitzer [1993] Planta 191: 123-128), are shown here to be potent inhibitors of systemin-induced and jasmonic acid (JA)-induced synthesis of proteinase inhibitor mRNAs and proteins. The inhibition by SA and ASA of proteinase inhibitor synthesis induced by systemin and JA, as well as by wounding and oligosaccharide elicitors, provides further evidence that both oligosaccharide and polypeptide inducer molecules utilize the octadecanoid pathway to signal the activation of proteinase inhibitor genes. Tomato (Lycopersicon esculentum) leaves were pulse labeled with [35S]methionine, followed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and the inhibitory effects of SA are shown to be specific for the synthesis of a small number of JA-inducible proteins that includes the proteinase inhibitors. Previous results have shown that SA inhibits the conversion of 13S-hydroperoxy linolenic acid to 12-oxo-phytodienoic acid, thereby inhibiting the signaling pathway by blocking synthesis of JA. Here we report that the inhibition of synthesis of proteinase inhibitor proteins and mRNAs by SA in both light and darkness also occurs at a step in the signal transduction pathway, after JA synthesis but preceding transcription of the inhibitor genes. PMID:12228577

  9. Amino Acid Synthesis in Photosynthesizing Spinach Cells 1

    PubMed Central

    Larsen, Peder Olesen; Cornwell, Karen L.; Gee, Sherry L.; Bassham, James A.

    1981-01-01

    Isolated cells from leaves of Spinacia oleracea have been maintained in a state capable of high rates of photosynthetic CO2 fixation for more than 60 hours. The incorporation of 14CO2 under saturating CO2 conditions into carbohydrates, carboxylic acids, and amino acids, and the effect of ammonia on this incorporation have been studied. Total incorporation, specific radioactivity, and pool size have been determined as a function of time for most of the protein amino acids and for γ-aminobutyric acid. The measurements of specific radio-activities and of the approaches to 14C “saturation” of some amino acids indicate the presence and relative sizes of metabolically active and passive pools of these amino acids. Added ammonia decreased carbon fixation into carbohydrates and increased fixation into carboxylic acids and amino acids. Different amino acids were, however, affected in different and highly specific ways. Ammonia caused large stimulatory effects in incorporation of 14C into glutamine (a factor of 21), aspartate, asparagine, valine, alanine, arginine, and histidine. No effect or slight decreases were seen in glycine, serine, phenylalanine, and tyrosine labeling. In the case of glutamate, 14C labeling decreased, but specific radioactivity increased. The production of labeled γ-aminobutyric acid was virtually stopped by ammonia. The results indicate that added ammonia stimulates the reactions mediated by pyruvate kinase and phosphoenolpyruvate carboxylase, as seen with other plant systems. The data on the effects of added ammonia on total labeling, pool sizes, and specific radioactivities of several amino acids provides a number of indications about the intracellular sites of principal synthesis from carbon skeletons of these amino acids and the selective nature of effects of increased intracellular ammonia concentration on such synthesis. PMID:16661904

  10. Catalytic RNA and synthesis of the peptide bond

    NASA Technical Reports Server (NTRS)

    Usher, D. A.; Kozlowski, M.; Zou, X.

    1991-01-01

    We are studying whether the L-19 IVS ribozyme from Tetrahymena thermophila can catalyze the formation of the peptide bond when it is supplied with synthetic aminoacyl oligonucleotides. If this reaction works, it could give us some insight into the mechanism of peptide bond formation and the origin of coded protein synthesis. Two short oligoribonucleotides, CCCCC and a protected form of CCCCU were prepared; the former was made by the controlled hydrolysis of Poly(C), and the later by multistep chemical synthesis from the protected monomers. The homopentamer was then aminocylated using C-14 labelled Boc-protected glycine imidazolide. This aminoacylated oligo-nucleotide has now been shown to enter the active site of the L-19 IVS, and aminoacyl transfer, and peptide bond formation reactions are being sought. Our synthesis of CCCCU made us aware of the inadequacy of many of the 2'- hydroxyl protecting groups that are in use today and we therefore designed a new 2'- protecting group that is presently being tested.

  11. Primordial soup or vinaigrette: did the RNA world evolve at acidic pH?

    PubMed Central

    2012-01-01

    Background The RNA world concept has wide, though certainly not unanimous, support within the origin-of-life scientific community. One view is that life may have emerged as early as the Hadean Eon 4.3-3.8 billion years ago with an atmosphere of high CO2 producing an acidic ocean of the order of pH 3.5-6. Compatible with this scenario is the intriguing proposal that life arose within alkaline (pH 9-11) deep-sea hydrothermal vents like those of the 'Lost City', with the interface with the acidic ocean creating a proton gradient sufficient to drive the first metabolism. However, RNA is most stable at pH 4-5 and is unstable at alkaline pH, raising the possibility that RNA may have first arisen in the acidic ocean itself (possibly near an acidic hydrothermal vent), acidic volcanic lake or comet pond. As the Hadean Eon progressed, the ocean pH is inferred to have gradually risen to near neutral as atmospheric CO2 levels decreased. Presentation of the hypothesis We propose that RNA is well suited for a world evolving at acidic pH. This is supported by the enhanced stability at acidic pH of not only the RNA phosphodiester bond but also of the aminoacyl-(t)RNA and peptide bonds. Examples of in vitro-selected ribozymes with activities at acid pH have recently been documented. The subsequent transition to a DNA genome could have been partly driven by the gradual rise in ocean pH, since DNA has greater stability than RNA at alkaline pH, but not at acidic pH. Testing the hypothesis We have proposed mechanisms for two key RNA world activities that are compatible with an acidic milieu: (i) non-enzymatic RNA replication of a hemi-protonated cytosine-rich oligonucleotide, and (ii) specific aminoacylation of tRNA/hairpins through triple helix interactions between the helical aminoacyl stem and a single-stranded aminoacylating ribozyme. Implications of the hypothesis Our hypothesis casts doubt on the hypothesis that RNA evolved in the vicinity of alkaline hydrothermal vents. The

  12. Simple, high-yield synthesis of polyhedral carborane amino acids

    SciTech Connect

    Kahl, S.B.; Kasar, R.A.

    1996-02-07

    Boron neutron capture therapy (BNCT) is a form of binary cancer therapy that offers the potential of delivering spatially selective, high linear energy transfer radiation to the target cells while sparing surrounding normal tissue. We have demonstarted a versatile, general method for the conversion of o- ,m-, and p-carborane to their corresponding Boc-protected amino acids. Heterobifunctional polyhedral carboranes are exceedingly rare in the literature, and the amino acids prepared by this general method may prove to be valuable synthons for use in the synthesis of tumor-seeking compounds for BNCT or PDT. Morever, these conformationally constrained amino acids should be particularly interesting for use in peptide synthesis. The dihedral angle between the carbon atoms of these polyhedra increases in the order 60{degree} (ortho), 110{degree} (meta), and 180{degree} (para), allowing the peptide chemist to select a desired conformation. 11 refs.

  13. Regulation of Viral RNA Synthesis by the V Protein of Parainfluenza Virus 5

    PubMed Central

    Yang, Yang; Zengel, James; Sun, Minghao; Sleeman, Katrina; Timani, Khalid Amine; Aligo, Jason; Rota, Paul

    2015-01-01

    ABSTRACT Paramyxoviruses include many important animal and human pathogens. The genome of parainfluenza virus 5 (PIV5), a prototypical paramyxovirus, encodes a V protein that inhibits viral RNA synthesis. In this work, the mechanism of inhibition was investigated. Using mutational analysis and a minigenome system, we identified regions in the N and C termini of the V protein that inhibit viral RNA synthesis: one at the very N terminus of V and the second at the C terminus of V. Furthermore, we determined that residues L16 and I17 are critical for the inhibitory function of the N-terminal region of the V protein. Both regions interact with the nucleocapsid protein (NP), an essential component of the viral RNA genome complex (RNP). Mutations at L16 and I17 abolished the interaction between NP and the N-terminal domain of V. This suggests that the interaction between NP and the N-terminal domain plays a critical role in V inhibition of viral RNA synthesis by the N-terminal domain. Both the N- and C-terminal regions inhibited viral RNA replication. The C terminus inhibited viral RNA transcription, while the N-terminal domain enhanced viral RNA transcription, suggesting that the two domains affect viral RNA through different mechanisms. Interestingly, V also inhibited the synthesis of the RNA of other paramyxoviruses, such as Nipah virus (NiV), human parainfluenza virus 3 (HPIV3), measles virus (MeV), mumps virus (MuV), and respiratory syncytial virus (RSV). This suggests that a common host factor may be involved in the replication of these paramyxoviruses. IMPORTANCE We identified two regions of the V protein that interact with NP and determined that one of these regions enhances viral RNA transcription via its interaction with NP. Our data suggest that a common host factor may be involved in the regulation of paramyxovirus replication and could be a target for broad antiviral drug development. Understanding the regulation of paramyxovirus replication will enable the

  14. Lactide Synthesis and Chirality Control for Polylactic acid Production.

    PubMed

    Van Wouwe, Pieter; Dusselier, Michiel; Vanleeuw, Evelien; Sels, Bert

    2016-05-10

    Polylactic acid (PLA) is a very promising biodegradable, renewable, and biocompatible polymer. Aside from its production, its application field is also increasing, with use not only in commodity applications but also as durables and in biomedicine. In the current PLA production scheme, the most expensive part is not the polymerization itself but obtaining the building blocks lactic acid (LA) and lactide, the actual cyclic monomer for polymerization. Although the synthesis of LA and the polymerization have been studied systematically, reports of lactide synthesis are scarce. Most lactide synthesis methods are described in patent literature, and current energy-intensive, aselective industrial processes are based on archaic scientific literature. This Review, therefore, highlights new methods with a technical comparison and description of the different approaches. Water-removal methodologies are compared, as this is a crucial factor in PLA production. Apart from the synthesis of lactide, this Review also emphasizes the use of chemically produced racemic lactic acid (esters) as a starting point in the PLA production scheme. Stereochemically tailored PLA can be produced according to such a strategy, giving access to various polymer properties. PMID:27071863

  15. Bile Acid Synthesis in the Isolated, Perfused Rabbit Liver

    PubMed Central

    Mosbach, E. H.; Rothschild, M. A.; Bekersky, I.; Oratz, M.; Mongelli, J.

    1971-01-01

    These experiments were carried out to demonstrate the usefulness of the perfused rabbit liver for studies of bile acid metabolism, and to determine the rate-limiting enzyme of bile acid synthesis. Rabbits were fed a semisynthetic diet, with or without the addition of 1% cholestyramine, under controlled conditions. At the end of 2-5 wk, the livers were removed and perfused for 2.5 hr employing various 14C-labeled precursors to measure de novo cholic acid synthesis. The livers were then analyzed for cholesterol, and the bile collected during the perfusion was analyzed for cholesterol and bile acids. Control bile contained, on the average, 0.34 mg of glycocholate, 7.4 mg of glycodeoxycholate, and 0.06 mg of cholesterol. After cholestyramine treatment of the donor rabbits, the bile contained 3.3 mg of glycocholate, 3.7 mg of glycodeoxycholate, and 0.05 mg of cholesterol. It was assumed that in cholestyramine-treated animals the enterohepatic circulation of the bile acids had been interrupted sufficiently to release the feedback inhibition of the rate-controlling enzyme of bile acid synthesis. Therefore, a given precursor should be incorporated into bile acids at a more rapid rate in livers of cholestyramine-treated animals, provided that the precursor was acted upon by the rate-controlling enzyme. It was found that the incorporation of acetate-14C, mevalonolactone-14C, and cholesterol-14C into cholate was 5-20 times greater in the livers of cholestyramine-treated animals than in the controls. In contrast, there was no difference in the incorporation of 7α-hydroxycholesterol-14C into cholate regardless of dietary pretreatment. It was concluded that given an adequate precursor pool, the 7α-hydroxylation of cholesterol is the rate-limiting step in bile acid formation. PMID:5097576

  16. Guanine nucleotide metabolism in a mutant strain of Escherichia coli with a temperature sensitive lesion in rRNA synthesis.

    PubMed

    Harris, J S; Chaney, S G

    1978-12-21

    We have described a mutant of Escherichia coli (designated 2S142) which shows specific inhibition of rRNA synthesis at 42 degrees C. ppGpp levels increase at the restrictive temperature, as expected. However, when the cells are returned to 30 degrees C, rRNA synthesis resumes before ppGpp levels have returned to normal. Furthermore, when ppGpp levels are decreased by the addition of tetracycline or choramphenicol, rRNA synthesis does not resume at 42 degrees C. Also, a derivative of 2S142 with a temperature-sensitive G factor (which cannot synthesize either protein or ppGpp at 42 degrees C) shows identical kinetics of rRNA shut-off at 42 degrees C as 2S142. Thus, the elevated ppGpp levels in this mutant do not appear to be directly responsible for the cessation of rRNA synthesis at 42 degrees C. PMID:367439

  17. Synthesis of double-stranded RNA in a virus-enriched fraction from Agaricus bisporus

    SciTech Connect

    Sriskantha, A.; Wach, P.; Schlagnhaufer, B.; Romaine, C.P.

    1986-03-01

    Partially purified virus preparations from sporophores of Agaricus bisporus affected with LaFrance disease had up to a 15-fold-higher RNA-dependent RNA polymerase activity than did comparable preparations from health sporophores. Enzyme activity was dependent upon the presence of Mg/sup 2 +/ and the four nucleoside triphosphates and was insensitive to actinomycin D, ..cap alpha..-amanitin, and rifampin. The /sup 3/H-labeled enzyme reaction products were double-stranded RNA (dsRNA) as indicated by CF-11 cellulose column chromatography and by their ionic-strength-dependent sensitivity to hydrolysis by RNase A. The principal dsRNA products had estimated molecular weights of 4.3 /times/ 10/sup 6/ and 1.4 /times/ 10/sup 6/. Cs/sub 2/SO/sub 4/ equilibrium centrifugation of the virus preparation resolved a single peak of RNA polymerase activity that banded with a 35-nm spherical virus particle containing dsRNAs with molecular weights of 4.3 /times/ 10/sup 6/ and 1.4 /times/ 10/sup 6/. The data suggest that the RNA-dependent RNA polymerase associated with the 35-nm spherical virus is a replicase which catalyzes the synthesis of the genomic dsRNAs.

  18. Insights into RNA synthesis, capping, and proofreading mechanisms of SARS-coronavirus.

    PubMed

    Sevajol, Marion; Subissi, Lorenzo; Decroly, Etienne; Canard, Bruno; Imbert, Isabelle

    2014-12-19

    The successive emergence of highly pathogenic coronaviruses (CoVs) such as the Severe Acute Respiratory Syndrome (SARS-CoV) in 2003 and the Middle East Respiratory Syndrome Coronavirus (MERS-CoV) in 2012 has stimulated a number of studies on the molecular biology. This research has provided significant new insight into functions and activities of the replication/transcription multi-protein complex. The latter directs both continuous and discontinuous RNA synthesis to replicate and transcribe the large coronavirus genome made of a single-stranded, positive-sense RNA of ∼30 kb. In this review, we summarize our current understanding of SARS-CoV enzymes involved in RNA biochemistry, such as the in vitro characterization of a highly active and processive RNA polymerase complex which can associate with methyltransferase and 3'-5' exoribonuclease activities involved in RNA capping, and RNA proofreading, respectively. The recent discoveries reveal fascinating RNA-synthesizing machinery, highlighting the unique position of coronaviruses in the RNA virus world. PMID:25451065

  19. Identification of genes and pathways involved in the synthesis of Mead acid (20:3n-9), an indicator of essential fatty acid deficiency.

    PubMed

    Ichi, Ikuyo; Kono, Nozomu; Arita, Yuka; Haga, Shizuka; Arisawa, Kotoko; Yamano, Misato; Nagase, Mana; Fujiwara, Yoko; Arai, Hiroyuki

    2014-01-01

    In mammals, 5,8,11-eicosatrienoic acid (Mead acid, 20:3n-9) is synthesized from oleic acid during a state of essential fatty acid deficiency (EFAD). Mead acid is thought to be produced by the same enzymes that synthesize arachidonic acid and eicosapentaenoic acid, but the genes and the pathways involved in the conversion of oleic acid to Mead acid have not been fully elucidated. The levels of polyunsaturated fatty acids in cultured cells are generally very low compared to those in mammalian tissues. In this study, we found that cultured cells, such as NIH3T3 and Hepa1-6 cells, have significant levels of Mead acid, indicating that cells in culture are in an EFAD state under normal culture conditions. We then examined the effect of siRNA-mediated knockdown of fatty acid desaturases and elongases on the level of Mead acid, and found that knockdown of Elovl5, Fads1, or Fads2 decreased the level of Mead acid. This and the measured levels of possible intermediate products for the synthesis of Mead acid such as 18:2n-9, 20:1n-9 and 20:2n-9 in the knocked down cells indicate two pathways for the synthesis of Mead acid: pathway 1) 18:1n-9→(Fads2)→18:2n-9→(Elovl5)→20:2n-9→(Fads1)→20:3n-9 and pathway 2) 18:1n-9→(Elovl5)→20:1n-9→(Fads2)→20:2n-9→(Fads1)→20:3n-9. PMID:24184513

  20. Incorporation of thio-pseudoisocytosine into triplex-forming peptide nucleic acids for enhanced recognition of RNA duplexes

    PubMed Central

    Devi, Gitali; Yuan, Zhen; Lu, Yunpeng; Zhao, Yanli; Chen, Gang

    2014-01-01

    Peptide nucleic acids (PNAs) have been developed for applications in biotechnology and therapeutics. There is great potential in the development of chemically modified PNAs or other triplex-forming ligands that selectively bind to RNA duplexes, but not single-stranded regions, at near-physiological conditions. Here, we report on a convenient synthesis route to a modified PNA monomer, thio-pseudoisocytosine (L), and binding studies of PNAs incorporating the monomer L. Thermal melting and gel electrophoresis studies reveal that L-incorporated 8-mer PNAs have superior affinity and specificity in recognizing the duplex region of a model RNA hairpin to form a pyrimidine motif major-groove RNA2–PNA triplex, without appreciable binding to single-stranded regions to form an RNA–PNA duplex or, via strand invasion, forming an RNA–PNA2 triplex at near-physiological buffer condition. In addition, an L-incorporated 8-mer PNA shows essentially no binding to single-stranded or double-stranded DNA. Furthermore, an L-modified 6-mer PNA, but not pseudoisocytosine (J) modified or unmodified PNA, binds to the HIV-1 programmed −1 ribosomal frameshift stimulatory RNA hairpin at near-physiological buffer conditions. The stabilization of an RNA2–PNA triplex by L modification is facilitated by enhanced van der Waals contacts, base stacking, hydrogen bonding and reduced dehydration energy. The destabilization of RNA–PNA and DNA–PNA duplexes by L modification is due to the steric clash and loss of two hydrogen bonds in a Watson–Crick-like G–L pair. An RNA2–PNA triplex is significantly more stable than a DNA2–PNA triplex, probably because the RNA duplex major groove provides geometry compatibility and favorable backbone–backbone interactions with PNA. Thus, L-modified triplex-forming PNAs may be utilized for sequence-specifically targeting duplex regions in RNAs for biological and therapeutic applications. PMID:24423869

  1. Scanning of 16S Ribosomal RNA for Peptide Nucleic Acid Targets.

    PubMed

    Górska, Anna; Markowska-Zagrajek, Agnieszka; Równicki, Marcin; Trylska, Joanna

    2016-08-25

    We have designed a protocol and server to aid in the search for putative binding sites in 16S rRNA that could be targeted by peptide nucleic acid oligomers. Various features of 16S rRNA were considered to score its regions as potential targets for sequence-specific binding that could result in inhibition of ribosome function. Specifically, apart from the functional importance of a particular rRNA region, we calculated its accessibility, flexibility, energetics of strand invasion by an oligomer, as well as similarity to human rRNA. To determine 16S rRNA flexibility in the ribosome context, we performed all-atom molecular dynamics simulations of the 30S subunit in explicit solvent. We proposed a few 16S RNA target sites, and one of them was tested experimentally to verify inhibition of bacterial growth by a peptide nucleic acid oligomer. PMID:27105576

  2. A novel in vitro replication system for Dengue virus. Initiation of RNA synthesis at the 3'-end of exogenous viral RNA templates requires 5'- and 3'-terminal complementary sequence motifs of the viral RNA.

    PubMed

    You, S; Padmanabhan, R

    1999-11-19

    Positive strand viral replicases are membrane-bound complexes of viral and host proteins. The mechanism of viral replication and the role of host proteins are not well understood. To understand this mechanism, a viral replicase assay that utilizes extracts from dengue virus-infected mosquito (C6/36) cells and exogenous viral RNA templates is reported in this study. The 5'- and 3'-terminal regions (TR) of the template RNAs contain the conserved elements including the complementary (cyclization) motifs and stem-loop structures. RNA synthesis in vitro requires both 5'- and 3'-TR present in the same template molecule or when the 5'-TR RNA was added in trans to the 3'-untranslated region (UTR) RNA. However, the 3'-UTR RNA alone is not active. RNA synthesis occurs by elongation of the 3'-end of the template RNA to yield predominantly a double-stranded hairpin-like RNA product, twice the size of the template RNA. These results suggest that an interaction between 5'- and 3'-TR of the viral RNA that modulates the 3'-UTR RNA structure is required for RNA synthesis by the viral replicase. The complementary cyclization motifs of the viral genome also seem to play an important role in this interaction. PMID:10559263

  3. Involvement of a universal amino acid synthesis impediment in cytoplasmic male sterility in pepper.

    PubMed

    Fang, Xianping; Fu, Hong-Fei; Gong, Zhen-Hui; Chai, Wei-Guo

    2016-01-01

    To explore the mechanisms of pepper (Capsicum annuum L.) cytoplasmic male sterility (CMS), we studied the different maturation processes of sterile and fertile pepper anthers. A paraffin section analysis of the sterile anthers indicated an abnormality of the tapetal layer and an over-vacuolization of the cells. The quantitative proteomics results showed that the expression of histidinol dehydrogenase (HDH), dihydroxy-acid dehydratase (DAD), aspartate aminotransferase (ATAAT), cysteine synthase (CS), delta-1-pyrroline-5-carboxylate synthase (P5CS), and glutamate synthetase (GS) in the amino acid synthesis pathway decreased by more than 1.5-fold. Furthermore, the mRNA and protein expression levels of DAD, ATAAT, CS and P5CS showed a 2- to 16-fold increase in the maintainer line anthers. We also found that most of the amino acid content levels decreased to varying degrees during the anther tapetum period of the sterile line, whereas these levels increased in the maintainer line. The results of our study indicate that during pepper anther development, changes in amino acid synthesis are significant and accompany abnormal tapetum maturity, which is most likely an important cause of male sterility in pepper. PMID:26987793

  4. Involvement of a universal amino acid synthesis impediment in cytoplasmic male sterility in pepper

    PubMed Central

    Fang, Xianping; Fu, Hong-Fei; Gong, Zhen-Hui; Chai, Wei-Guo

    2016-01-01

    To explore the mechanisms of pepper (Capsicum annuum L.) cytoplasmic male sterility (CMS), we studied the different maturation processes of sterile and fertile pepper anthers. A paraffin section analysis of the sterile anthers indicated an abnormality of the tapetal layer and an over-vacuolization of the cells. The quantitative proteomics results showed that the expression of histidinol dehydrogenase (HDH), dihydroxy-acid dehydratase (DAD), aspartate aminotransferase (ATAAT), cysteine synthase (CS), delta-1-pyrroline-5-carboxylate synthase (P5CS), and glutamate synthetase (GS) in the amino acid synthesis pathway decreased by more than 1.5-fold. Furthermore, the mRNA and protein expression levels of DAD, ATAAT, CS and P5CS showed a 2- to 16-fold increase in the maintainer line anthers. We also found that most of the amino acid content levels decreased to varying degrees during the anther tapetum period of the sterile line, whereas these levels increased in the maintainer line. The results of our study indicate that during pepper anther development, changes in amino acid synthesis are significant and accompany abnormal tapetum maturity, which is most likely an important cause of male sterility in pepper. PMID:26987793

  5. May Cyclic Nucleotides Be a Source for Abiotic RNA Synthesis?

    NASA Astrophysics Data System (ADS)

    Costanzo, Giovanna; Pino, Samanta; Botta, Giorgia; Saladino, Raffaele; di Mauro, Ernesto

    2011-12-01

    Nucleic bases are obtained by heating formamide in the presence of various catalysts. Formamide chemistry also allows the formation of acyclonucleosides and the phosphorylation of nucleosides in every possible position, also affording 2',3' and 3',5' cyclic forms. We have reported that 3',5' cyclic GMP and 3',5' cyclic AMP polymerize in abiotic conditions yielding short oligonucleotides. The characterization of this reaction is being pursued, several of its parameters have been determined and experimental caveats are reported. The yield of non-enzymatic polymerization of cyclic purine nucleotides is very low. Polymerization is strongly enhanced by the presence of base-complementary RNA sequences.

  6. Preferential synthesis of low-molecular-weight RNA in uv-irradiated plasma of Physarum polycephalum

    SciTech Connect

    Kumari, P.A.V.; Nair, V.R.

    1981-10-01

    Mitotically synchronous surface plasmodia of Physarum polycephalum were irradiated during the G2 phase with a Philips 15-W germicidal lamp. At different intervals after irradiation, the plasmodia were pulse-labeled with (/sup 3/H)uridine, and RNA was extracted and analyzed on linear sucrose gradients. The radioactivity profiles of the RNA showed that irradiated plasmodia synthesize preferentially low-molecular-weight RNA types, including 4 SRNA, during the delay period prior to the first postirradiation mitosis and during the following short mitotic cycle. Double-labeling experiments, employing (/sup 14/C)uridine-prelabeled plasmodia which were pulse-labeled with (/sup 3/H)uridine after irradiation, confirmed this finding. It is also seen that there is an overall reduction in the rate of synthesis of rRNA in the irradiated plasmodia.

  7. Synthesis of Branched Methyl Hydroxy Stearates Including an Ester from Bio-Based Levulinic Acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We report the synthesis of 5 useful branched methyl alpha-hydroxy oleate esters from commercially available methyl oleate and common organic acids. Of special interest is the synthesis utilizing the natural byproduct, levulinic acid. The other common organic acids used herein were propionic acid, ...

  8. Transcriptional profiling of canola developing embryo and identification of the important roles of BnDof5.6 in embryo development and fatty acids synthesis.

    PubMed

    Deng, Wei; Yan, Fang; Zhang, Xiaolan; Tang, Yuwei; Yuan, Yujin

    2015-08-01

    Canola is an important vegetable oil crop globally, and the understanding of the molecular mechanism underlying fatty acids biosynthesis during seed embryo development is an important research goal. Here we report the transcriptional profiling analysis of developing canola embryos using RNA-sequencing (RNA-Seq) method. RNA-Seq analysis generated 58,579,451 sequence reads aligned with 32,243 genes. It was found that a total of 55 differential expression genes (DEGs) encoding 28 enzymes function in carbon flow to fatty acids of storage TAG. Most of the DEGs encoding above enzymes showed similar expression pattern, indicating the DEGs are cooperatively involved in carbon flow into fatty acids. In addition, 41 DEGs associated with signal transductions, transport and metabolic processing of auxin, gibberellin, abscisic acid, cytokinin and salicylic acids were found in the RNA-Seq database, which indicates the important roles of the phytohormones in controlling embryo development and fatty acids synthesis. 122 DEGs encoding transcriptional factor family members were found in developing canola embryos. Furthermore, BnDOF5.6, a zinc finger transcriptional factor gene, found in RNA-Seq database was down-regulated in developing canola embryos. The transgenic plants displayed reduced embryo sizes, decreased fatty acids contents and altered seed fatty acids composition in canola. Down-regulated of BnDof5.6 also changed the expression levels of genes involved in fatty acids synthesis and desaturation. Our results indicate that BnDof5.6 is required for embryo development and fatty acids synthesis in canola. Overall this study presents new information on the global expression patterns of genes during embryo development and will expand our understanding of the complex molecular mechanism of carbon flow into fatty acids and embryo development in canola. PMID:26092973

  9. One-pot synthesis of pH-responsive hybrid nanogel particles for the intracellular delivery of small interfering RNA.

    PubMed

    Khaled, Sm Z; Cevenini, Armando; Yazdi, Iman K; Parodi, Alessandro; Evangelopoulos, Michael; Corbo, Claudia; Scaria, Shilpa; Hu, Ye; Haddix, Seth G; Corradetti, Bruna; Salvatore, Francesco; Tasciotti, Ennio

    2016-05-01

    This report describes a novel, one-pot synthesis of hybrid nanoparticles formed by a nanostructured inorganic silica core and an organic pH-responsive hydrogel shell. This easy-to-perform, oil-in-water emulsion process synthesizes fluorescently-doped silica nanoparticles wrapped within a tunable coating of cationic poly(2-diethylaminoethyl methacrylate) hydrogel in one step. Transmission electron microscopy and dynamic light scattering analysis demonstrated that the hydrogel-coated nanoparticles are uniformly dispersed in the aqueous phase. The formation of covalent chemical bonds between the silica and the polymer increases the stability of the organic phase around the inorganic core as demonstrated by thermogravimetric analysis. The cationic nature of the hydrogel is responsible for the pH buffering properties of the nanostructured system and was evaluated by titration experiments. Zeta-potential analysis demonstrated that the charge of the system was reversed when transitioned from acidic to basic pH and vice versa. Consequently, small interfering RNA (siRNA) can be loaded and released in an acidic pH environment thereby enabling the hybrid particles and their payload to avoid endosomal sequestration and enzymatic degradation. These nanoparticles, loaded with specific siRNA molecules directed towards the transcript of the membrane receptor CXCR4, significantly decreased the expression of this protein in a human breast cancer cell line (i.e., MDA-MB-231). Moreover, intravenous administration of siRNA-loaded nanoparticles demonstrated a preferential accumulation at the tumor site that resulted in a reduction of CXCR4 expression. PMID:26901429

  10. Co-ordination between membrane phospholipid synthesis and accelerated biosynthesis of cytoplasmic ribonucleic acid and protein

    PubMed Central

    Tata, J. R.

    1970-01-01

    1. The rate of synthesis of membrane phospholipid was studied in rat liver and seminal vesicles by following the incorporation of [32P]orthophosphate, [14C]choline and [14C]glycerol. Particular emphasis was laid on the endoplasmic reticulum, which was fractionated into smooth microsomal membranes, heavy rough membranes, light rough membranes and free polyribosomes. 2. Phospholipid labelling patterns suggested a heterogeneity in the synthesis and turnover of the different lipid moieties of smooth and rough endoplasmic membranes. The major phospholipids, phosphatidylcholine and phosphatidylethanolamine, were labelled relatively rapidly with 32P over a short period of time whereas incorporation of radioisotope into the minor phospholipids, sphingomyelin, lysolecithin and phosphatidylinositol proceeded slowly but over a longer period of time. 3. The incorporation of orotic acid into RNA and labelled amino acids into protein of the four submicrosomal fractions was also studied. 4. Rapid growth of the liver was induced by the administration of growth hormone and tri-iodothyronine to hypophysectomized and thyroidectomized rats and by partial hepatectomy. Growth of seminal vesicles of castrated rats was stimulated with testosterone propionate. 5. The rate of labelling of membrane phospholipids was enhanced in all major subcellular particulate fractions (nuclear, mitochondrial and microsomal) during induced growth. However, it was in the rough endoplasmic reticulum that the accumulation of phospholipids, RNA and protein was most marked. The effect of hormone administration was also to accelerate preferentially the labelling with 32P of sphingomyelin relative to that of phosphatidylcholine or phosphatidylethanolamine. 6. Time-course analyses showed that, in all four growth systems studied, the enhancement of the rate of membrane phospholipid synthesis coincided with the rather abrupt increase in the synthesis of RNA and protein of the rough endoplasmic reticulum. Growth

  11. An antisense RNA controls synthesis of an SOS-induced toxin evolved from an antitoxin

    PubMed Central

    Kawano, Mitsuoki; Aravind, L; Storz, Gisela

    2007-01-01

    Only few small, regulatory RNAs encoded opposite another gene have been identified in bacteria. Here, we report the characterization of a locus where a small RNA (SymR) is encoded in cis to an SOS-induced gene whose product shows homology to the antitoxin MazE (SymE). Synthesis of the SymE protein is tightly repressed at multiple levels by the LexA repressor, the SymR RNA and the Lon protease. SymE co-purifies with ribosomes and overproduction of the protein leads to cell growth inhibition, decreased protein synthesis and increased RNA degradation. These properties are shared with several RNA endonuclease toxins of the toxin-antitoxin modules, and we show that the SymE protein represents evolution of a toxin from the AbrB fold, whose representatives are typically antitoxins. We suggest that SymE promotion of RNA cleavage may be important for the recycling of RNAs damaged under SOS-inducing conditions. PMID:17462020

  12. Formation of the chlorophyll precursor. gamma. -aminolevulinic acid in cyanobacteria requires aminoacylation of a tRNA sup Glu species. [Synechocystis

    SciTech Connect

    O'Nell, G.P.; Peterson, D.M.; Schoen, A., Chen, Minwei; Soell, D. )

    1988-09-01

    In the chloroplasts of higher plants and algae, the biosynthesis of the chlorophyll precursor {gamma}-aminolevulinic acid (ALA) involves at least three enzymes and a tRNA species. Here we demonstrate that in cell extracts of the unicellular cyanobacterium Synechocystis sp. strain PCC 6803 ALA was formed from glutamate in a series of reactions in which activation of glutamate by glutamyl-tRNA{sup Glu} formation was the first step. The activated glutamate was reduced by a dehydrogenase which displayed tRNA sequence specificity. Fractionation of strain 6803 tRNA by reverse-phase chromatography and polyacrylamide gel electrophoresis yielded two pure tRNA{sup Glu} species which stimulated ALA synthesis in vitro. These tRNAs had identical primary sequence but differed in the nucleotide modification of their anticodon. The 6803 tRNA{sup Glu} was similar to the sequence of tRNA{sup Glu} species or tRNA genes from Escherichia coli and from chloroplasts of Euglena gracilis and higher plants. Southern blot analysis revealed at least two tRNA{sup Glu} gene copies in the 6803 chromosome. A glutamate-1-semialdehyde aminotransferase, the terminal enzyme in the conversion of glutamate to ALA in chloroplasts, was detected in 6803 cell extracts by the conversion of glutamate-1-semialdehyde to ALA and by the inhibition of this reaction by gabaculin.

  13. tRNA acceptor-stem and anticodon bases embed separate features of amino acid chemistry.

    PubMed

    Carter, Charles W; Wolfenden, Richard

    2016-01-01

    The universal genetic code is a translation table by which nucleic acid sequences can be interpreted as polypeptides with a wide range of biological functions. That information is used by aminoacyl-tRNA synthetases to translate the code. Moreover, amino acid properties dictate protein folding. We recently reported that digital correlation techniques could identify patterns in tRNA identity elements that govern recognition by synthetases. Our analysis, and the functionality of truncated synthetases that cannot recognize the tRNA anticodon, support the conclusion that the tRNA acceptor stem houses an independent code for the same 20 amino acids that likely functioned earlier in the emergence of genetics. The acceptor-stem code, related to amino acid size, is distinct from a code in the anticodon that is related to amino acid polarity. Details of the acceptor-stem code suggest that it was useful in preserving key properties of stereochemically-encoded peptides that had developed the capacity to interact catalytically with RNA. The quantitative embedding of the chemical properties of amino acids into tRNA bases has implications for the origins of molecular biology. PMID:26595350

  14. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, A. L.

    1986-01-01

    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20% for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  15. Microwave-Assisted Rapid Enzymatic Synthesis of Nucleic Acids.

    PubMed

    Hari Das, Rakha; Ahirwar, Rajesh; Kumar, Saroj; Nahar, Pradip

    2016-07-01

    Herein we report microwave-induced enhancement of the reactions catalyzed by Escherichia coli DNA polymerase I and avian myeloblastosis virus-reverse transcriptase. The reactions induced by microwaves result in a highly selective synthesis of nucleic acids in 10-50 seconds. In contrast, same reactions failed to give desired reaction products when carried out in the same time periods, but without microwave irradiation. Each of the reactions was carried out for different duration of microwave exposure time to find the optimum reaction time. The products produced by the respective enzyme upon microwave irradiation of the reaction mixtures were identical to that produced by the conventional procedures. As the microwave-assisted reactions are rapid, microwave could be a useful alternative to the conventional and time consuming procedures of enzymatic synthesis of nucleic acids. PMID:27159147

  16. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1987-01-01

    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20 percent for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  17. A New Process for Acrylic Acid Synthesis by Fermentative Process

    NASA Astrophysics Data System (ADS)

    Lunelli, B. H.; Duarte, E. R.; de Toledo, E. C. Vasco; Wolf Maciel, M. R.; Maciel Filho, R.

    With the synthesis of chemical products through biotechnological processes, it is possible to discover and to explore innumerable routes that can be used to obtain products of high addes value. Each route may have particular advantages in obtaining a desired product, compared with others, especially in terms of yield, productivity, easiness to separate the product, economy, and environmental impact. The purpose of this work is the development of a deterministic model for the biochemical synthesis of acrylic acid in order to explore an alternative process. The model is built-up with the tubular reactor equations together with the kinetic representation based on the structured model. The proposed process makes possible to obtain acrylic acid continuously from the sugar cane fermentation.

  18. Protein, RNA, and DNA synthesis in cultures of skin fibroblasts from healthy subjects and patients with rheumatic diseases

    SciTech Connect

    Abakumova, O.Y.; Kutsenko, N.G.; Panasyuk, A.F.

    1985-07-01

    To study the mechanism of the lasting disturbance of fibroblast function, protein, RNA and DNA synthesis was investigated in skin fibroblasts from patients with rheumatoid arthritis (RA) and systemic scleroderma (SS). The labeled precursors used to analyze synthesis of protein, RNA, and DNA were /sup 14/C-protein hydrolysate, (/sup 14/C)uridine, and (/sup 14/C) thymidine. Stimulation was determined by measuring incorporation of (/sup 14/C)proline into fibroblast proteins. During analysis of stability of fast-labeled RNA tests were carried out to discover whether all measurable radioactivity belonged to RNA molecules.

  19. Tannic acid-mediated green synthesis of antibacterial silver nanoparticles.

    PubMed

    Kim, Tae Yoon; Cha, Song-Hyun; Cho, Seonho; Park, Youmie

    2016-04-01

    The search for novel antibacterial agents is necessary to combat microbial resistance to current antibiotics. Silver nanoparticles (AgNPs) have been reported to be effective antibacterial agents. Tannic acid is a polyphenol compound from plants with antioxidant and antibacterial activities. In this report, AgNPs were prepared from silver ions by tannic acid-mediated green synthesis (TA-AgNPs). The reaction process was facile and involved mixing both silver ions and tannic acid. The absorbance at 423 nm in the UV-Visible spectra demonstrated that tannic acid underwent a reduction reaction to produce TA-AgNPs from silver ions. The synthetic yield of TA-AgNPs was 90.5 % based on inductively coupled plasma mass spectrometry analysis. High-resolution transmission electron microscopy and atomic force microscopy images indicated that spherical-shaped TA-AgNPs with a mean particle size of 27.7-46.7 nm were obtained. Powder high-resolution X-ray diffraction analysis indicated that the TA-AgNP structure was face-centered cubic with a zeta potential of -27.56 mV. The hydroxyl functional groups of tannic acid contributed to the synthesis of TA-AgNPs, which was confirmed by Fourier transform infrared spectroscopy. The in vitro antibacterial activity was measured using the minimum inhibitory concentration (MIC) method. The TA-AgNPs were more effective against Gram-negative bacteria than Gram-positive bacteria. The MIC for the TA-AgNPs in all of the tested strains was in a silver concentration range of 6.74-13.48 μg/mL. The tannic acid-mediated synthesis of AgNPs afforded biocompatible nanocomposites for antibacterial applications. PMID:26895244

  20. MicroRNA-26a/b and their host genes synergistically regulate triacylglycerol synthesis by targeting the INSIG1 gene.

    PubMed

    Wang, Hui; Luo, Jun; Zhang, Tianying; Tian, Huibin; Ma, Yue; Xu, Huifen; Yao, Dawei; Loor, Juan J

    2016-05-01

    The microRNA-26 (miR-26) family is known to control adipogenesis in non-ruminants. The genomic loci of miR-26a and miR-26b have been localized in the introns of genes encoding for the proteins of the C-terminal domain RNA polymerase II polypeptide A small phosphatase (CTDSP) family. Insulin-induced gene 1 (INSIG1) encodes a protein with a key role in the regulation of lipogenesis in rodent liver. In the present study, we investigated the synergistic function of the miR-26 family and their host genes in goat mammary epithelial cells (GMEC). Downregulation of miR-26a/b and their host genes in GMEC decreased the expression of genes relate to fatty acid synthesis (PPARG, LXRA, SREBF1, FASN, ACACA, GPAM, LPIN1, DGAT1 and SCD1), triacylglycerol accumulation and unsaturated fatty acid synthesis. Luciferase reporter assays confirmed INSIG1 as a direct target of miR-26a/b. Furthermore, inhibition of the CTDSP family also downregulated the expression of INSIG1. Taken together, our findings highlight a functional association of miR-26a/b, their host genes and INSIG1, and provide new insights into the regulatory network controlling milk fat synthesis in GMEC. The data indicate that targeting this network via nutrition might be important for regulating milk fat synthesis in ruminants. PMID:27002347

  1. Synthesis of bosutinib from 3-methoxy-4-hydroxybenzoic acid.

    PubMed

    Yin, Xiao Jia; Xu, Guan Hong; Sun, Xu; Peng, Yan; Ji, Xing; Jiang, Ke; Li, Fei

    2010-06-01

    This paper reports a novel synthesis of bosutinib starting from 3-methoxy-4-hydroxybenzoic acid. The process starts with esterification of the starting material, followed by alkylation, nitration, reduction, cyclization, chlorination and two successive amination reactions. The intermediates and target molecule were characterized by (1)H-NMR, (13)C-NMR, MS and the purities of all the compounds were determined by HPLC. PMID:20657439

  2. Is acetylcarnitine a substrate for fatty acid synthesis in plants

    SciTech Connect

    Roughan, G. ); Post-Beittenmiller, D.; Ohlrogge, J. ); Browse, J. )

    1993-04-01

    Long-chain fatty acid synthesis from [1-[sup 14]C]acetylcarnitine by chloroplasts isolated from spinach (Spinacia oleracea), pea (Pisum sativum), amaranthus (Amaranthus lividus), or maize (Zea mays) occurred at less than 2% of the rate of fatty acid synthesis from [1-[sup 14]C]acetate irrespective of the maturity of the leaves or whether the plastids were purified using sucrose or Percoll medium. [1-[sup 14]C]Acetylcarnitine was not significantly utilized by highly active chloroplasts rapidly prepared from pea and spinach using methods not involving density gradient centrifugation. [1-[sup 14]C]Acetylcarnitine was recovered quantitatively from chloroplast incubations following 10 min in the light. Unlabeled acetyl-L-carnitine (0.4 mM) did not compete with [1-[sup 14]C]acetate (0.2 mM) as a substrate for fatty acid synthesis by any of the more than 70 chloroplast preparations tested in this study. Carnitine acetyltransferase activity was not detected in any chloroplast preparation and was present in whole leaf homogenates at about 0.1% of the level of acetyl-coenzyme A synthetase activity. When supplied to detached pea shoots and detached spinach, amaranthus, and maize leaves via the transpiration stream, 1 to 4% of the [1-[sup 14]C]acetylcarnitine and 47 to 57% of the [1-[sup 14]C]acetate taken up was incorporated into lipids. Most (78--82%) of the [1-[sup 14]C]acetylcarnitine taken up was recovered intact. It is concluded that acetylcarnitine is not a major precursor for fatty acid synthesis in plants. 29 refs., 5 tabs.

  3. Strategies for the Total Synthesis of Clavicipitic Acid.

    PubMed

    Ito, Mamoru; Tahara, Yu-Ki; Shibata, Takanori

    2016-04-11

    Clavicipitic acid is an ergot alkaloid, which was isolated from Claviceps strain and Claviceps fusiformis. Its unique tricyclic azepinoindole skeleton has attracted synthetic chemists, and various strategies have been developed for its total synthesis. These strategies can be generally categorized into two types based on the synthetic intermediates, namely, 4-substituted gramine derivatives and 4-substituted tryptophan derivatives. This Minireview summarizes the reported total syntheses from the point of these two key intermediates. PMID:26822254

  4. Total Synthesis of (−)-Nodulisporic Acid D

    PubMed Central

    Zou, Yike; Melvin, Jason E.; Gonzales, Stephen S.; Spafford, Matthew J.; Smith, Amos B.

    2015-01-01

    A convergent total synthesis of the architecturally complex indole diterpenoid (−)-nodulisporic acid D has been achieved. Key synthetic transformations include vicinal difunctionalization of an advanced α,β-unsaturated aldehyde to form the E,F-transfused 5,6-ring system of the eastern hemisphere and a cascade cross-coupling/indolization protocol leading to the CDE multisubstituted indole core. PMID:26029849

  5. Retinoic Acid Induces Embryonic Stem Cell Differentiation by Altering Both Encoding RNA and microRNA Expression

    PubMed Central

    Yu, Mengying; Wu, Haibo; Ai, Zhiying; Wu, Yongyan; Liu, Hongliang; Du, Juan; Guo, Zekun; Zhang, Yong

    2015-01-01

    Retinoic acid (RA) is a vitamin A metabolite that is essential for early embryonic development and promotes stem cell neural lineage specification; however, little is known regarding the impact of RA on mRNA transcription and microRNA levels on embryonic stem cell differentiation. Here, we present mRNA microarray and microRNA high-output sequencing to clarify how RA regulates gene expression. Using mRNA microarray analysis, we showed that RA repressed pluripotency-associated genes while activating ectoderm markers in mouse embryonic stem cells (mESCs). Moreover, RA modulated the DNA methylation of mESCs by altering the expression of epigenetic-associated genes such as Dnmt3b and Dnmt3l. Furthermore, H3K4me2, a pluripotent histone modification, was repressed by RA stimulation. From microRNA sequence data, we identified two downregulated microRNAs, namely, miR-200b and miR-200c, which regulated the pluripotency of stem cells. We found that miR-200b or miR-200c deficiency suppressed the expression of pluripotent genes, including Oct4 and Nanog, and activated the expression of the ectodermal marker gene Nestin. These results demonstrate that retinoid induces mESCs to differentiate by regulating miR-200b/200c. Our findings provide the landscapes of mRNA and microRNA gene networks and indicate the crucial role of miR-200b/200c in the RA-induced differentiation of mESCs. PMID:26162091

  6. Effect of insulin on human skeletal muscle mitochondrial ATP production, protein synthesis, and mRNA transcripts

    NASA Astrophysics Data System (ADS)

    Stump, Craig S.; Short, Kevin R.; Bigelow, Maureen L.; Schimke, Jill M.; Sreekumaran Nair, K.

    2003-06-01

    Mitochondria are the primary site of skeletal muscle fuel metabolism and ATP production. Although insulin is a major regulator of fuel metabolism, its effect on mitochondrial ATP production is not known. Here we report increases in vastus lateralis muscle mitochondrial ATP production capacity (32-42%) in healthy humans (P < 0.01) i.v. infused with insulin (1.5 milliunits/kg of fat-free mass per min) while clamping glucose, amino acids, glucagon, and growth hormone. Increased ATP production occurred in association with increased mRNA levels from both mitochondrial (NADH dehydrogenase subunit IV) and nuclear [cytochrome c oxidase (COX) subunit IV] genes (164-180%) encoding mitochondrial proteins (P < 0.05). In addition, muscle mitochondrial protein synthesis, and COX and citrate synthase enzyme activities were increased by insulin (P < 0.05). Further studies demonstrated no effect of low to high insulin levels on muscle mitochondrial ATP production for people with type 2 diabetes mellitus, whereas matched nondiabetic controls increased 16-26% (P < 0.02) when four different substrate combinations were used. In conclusion, insulin stimulates mitochondrial oxidative phosphorylation in skeletal muscle along with synthesis of gene transcripts and mitochondrial protein in human subjects. Skeletal muscle of type 2 diabetic patients has a reduced capacity to increase ATP production with high insulin levels. cytochrome c oxidase | NADH dehydrogenase subunit IV | amino acids | citrate synthase

  7. Synthesis of Rosin Acid Starch Catalyzed by Lipase

    PubMed Central

    Lin, Rihui; Li, He; Long, Han; Su, Jiating; Huang, Wenqin

    2014-01-01

    Rosin, an abundant raw material from pine trees, was used as a starting material directly for the synthesis of rosin acid starch. The esterification reaction was catalyzed by lipase (Novozym 435) under mild conditions. Based on single factor experimentation, the optimal esterification conditions were obtained as follows: rosin acid/anhydrous glucose unit in the molar ratio 2 : 1, reaction time 4 h at 45°C, and 15% of lipase dosage. The degree of substitution (DS) reaches 0.098. Product from esterification of cassava starch with rosin acid was confirmed by FTIR spectroscopy and iodine coloration analysis. Scanning electron microscopy and X-ray diffraction analysis showed that the morphology and crystallinity of the cassava starch were largely destroyed. Thermogravimetric analysis indicated that thermal stability of rosin acid starch decreased compared with native starch. PMID:24977156

  8. Synthesis of oligodiaminomannoses and analysis of their RNA duplex binding properties and their potential application as siRNA-based drugs.

    PubMed

    Iwata, Rintaro; Doi, Akiko; Maeda, Yusuke; Wada, Takeshi

    2015-09-28

    The synthesis of artificial cationic oligodiaminosaccharides, α-(1 → 4)-linked-2,6-diamino-2,6-dideoxy-d-mannopyranose oligomers (ODAMans), and their interactions with RNA duplexes are described. The monomer through the pentamer, all of which bear unnatural 2,6-diaminomannose moieties, were successfully prepared. UV melting and fluorescence anisotropy analyses revealed that the ODAMans bound and thermodynamically stabilized both 12mer RNA duplexes and an siRNA. Furthermore, it was clearly shown that the siRNA acquired substantial RNase A resistance due to its binding to the ODAMan 4mer. PMID:26256756

  9. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  10. The effects of retinoic acid on immunoglobulin synthesis: Role of interleukin 6

    SciTech Connect

    Ballow, M.; Xiang, Shunan; Wang, Weiping; Brodsky, L. |

    1996-05-01

    Retinoic acid (RA) and its parent compound, retinol (ROH, vitamin A), have been recognized as important immunopotentiating agents. Previous studies from our laboratory have demonstrated that PA can augment formalin-treated Staphylococcus aureus (SAC) stimulated immunoglobulin (Ig) synthesis of cord blood mononuclear cells (CBMC). To determine the mechanism(s) by which RA modulates Ig synthesis, we studied the effects of RA on B cells and cytokine production. The addition of RA (10{sup -5} to 10{sup -10} M) to Epstein-Barr virus (EBV)-transformed B-cell clones derived from either adult or cord blood B cells augmented Ig secretion twofold. In contrast, cell proliferation was inhibited as measured by {sup 3}H-thymidine incorporation. We evaluated two cytokines known to be constitutively produced by EBV cell lines, IL-1 and IL-6. While RA had no effect on IL-1 production, IL-6 synthesis was greatly enhanced (20- to 45-fold), which was also reflected by an increase in steady-state mRNA levels for IL-6 but not TNF-{alpha} or TGF-{beta} on Northern blot analysis. Polyclonal rabbit anti-IL-6 antibodies were used to block the augmenting effects of RA on Ig synthesis of adenoidal B cells. RA-induced augmentation in IgG and IgA synthesis was blocked 58 and 29%, respectively, by anti-IL-6 antibodies. These studies suggest that the enhancing effects of RA on Ig synthesis are mediated, at least in part, by the autocrine or paracrine effects of IL-6 on B-cell differentiation. 37 refs., 5 figs.

  11. PlsX deletion impacts fatty acid synthesis and acid adaptation in Streptococcus mutans.

    PubMed

    Cross, Benjamin; Garcia, Ariana; Faustoferri, Roberta; Quivey, Robert G

    2016-04-01

    Streptococcus mutans, one of the primary causative agents of dental caries in humans, ferments dietary sugars in the mouth to produce organic acids. These acids lower local pH values, resulting in demineralization of the tooth enamel, leading to caries. To survive acidic environments, Strep. mutans employs several adaptive mechanisms, including a shift from saturated to unsaturated fatty acids in membrane phospholipids. PlsX is an acyl-ACP : phosphate transacylase that links the fatty acid synthase II (FASII) pathway to the phospholipid synthesis pathway, and is therefore central to the movement of unsaturated fatty acids into the membrane. Recently, we discovered that plsX is not essential in Strep. mutans. A plsX deletion mutant was not a fatty acid or phospholipid auxotroph. Gas chromatography of fatty acid methyl esters indicated that membrane fatty acid chain length in the plsX deletion strain differed from those detected in the parent strain, UA159. The deletion strain displayed a fatty acid shift similar to WT, but had a higher percentage of unsaturated fatty acids at low pH. The deletion strain survived significantly longer than the parent strain when cultures were subjected to an acid challenge of pH 2.5.The ΔplsX strain also exhibited elevated F-ATPase activity at pH 5.2, compared with the parent. These results indicate that the loss of plsX affects both the fatty acid synthesis pathway and the acid-adaptive response of Strep. mutans. PMID:26850107

  12. Genetic dissection of polyunsaturated fatty acid synthesis in Caenorhabditis elegans

    PubMed Central

    Watts, Jennifer L.; Browse, John

    2002-01-01

    Polyunsaturated fatty acids (PUFAs) are important membrane components and precursors of signaling molecules. To investigate the roles of these fatty acids in growth, development, and neurological function in an animal system, we isolated Caenorhabditis elegans mutants deficient in PUFA synthesis by direct analysis of fatty acid composition. C. elegans possesses all the desaturase and elongase activities to synthesize arachidonic acid and eicosapentaenoic acid from saturated fatty acid precursors. In our screen we identified mutants with defects in each fatty acid desaturation and elongation step of the PUFA biosynthetic pathway. The fatty acid compositions of the mutants reveal the substrate preferences of the desaturase and elongase enzymes and clearly demarcate the steps of this pathway. The mutants show that C. elegans does not require n3 or Δ5-unsaturated PUFAs for normal development under laboratory conditions. However, mutants with more severe PUFA deficiencies display growth and neurological defects. The mutants provide tools for investigating the roles of PUFAs in membrane biology and cell function in this animal model. PMID:11972048

  13. A Study on Amino Acids: Synthesis of Alpha-Aminophenylacetic Acid (Phenylglycine) and Determination of its Isoelectric Point.

    ERIC Educational Resources Information Center

    Barrelle, M.; And Others

    1983-01-01

    Background information and procedures are provided for an experimental study on aminophenylacetic acid (phenylglycine). These include physical chemistry (determination of isoelectric point by pH measurement) and organic chemistry (synthesis of an amino acid in racemic form) experiments. (JN)

  14. Delivery of siRNA Using Cationic Liposomes Incorporating Stearic Acid-modified Octa-Arginine.

    PubMed

    Yang, Dongsheng; Li, Yuhuan; Qi, Yuhang; Chen, Yongzhen; Yang, Xuewei; Li, Yujing; Liu, Songcai; Lee, Robert J

    2016-07-01

    Cationic liposomes incorporating stearic acid-modified octa-arginine (StA-R8) were evaluated for survivin small interfering RNA (siRNA) delivery. StA-R8 was synthesized and incorporated into liposomes. The composition of liposomes was optimized. Physicochemical properties, cytotoxicity, cellular uptake and gene silencing activity of the liposomes complexed to survivin siRNA were investigated. The results showed that StA-R8-containing liposomes had reduced cytotoxicity and improved delivery efficiency of siRNA into cancer cells compared with StA-R8 by itself. PMID:27354583

  15. [Electron-microscopic autoradiography of RNA synthesis in the myocardium after damage to it].

    PubMed

    Galankin, V N; Pal'tsyn, A A; Badikova, A K

    1977-06-01

    Thermic burn of the wall of the left cardiac ventricle was inflicted to new born rats. Twenty-four hours after the injury the RNA synthesis of the myocardial cells remote from the site of burn were investigated by electron-microscopic autoradiography. Tissue samples were fixed 2 and 6 hours after the 3H-uridine injections. As compared with the control, experimental animals displayed a reduction of silver grains density over the nucleus and the cytoplasm of cardiomyocytes. PMID:884310

  16. Osteoblast fibronectin mRNA, protein synthesis, and matrix are unchanged after exposure to microgravity

    NASA Technical Reports Server (NTRS)

    Hughes-Fulford, M.; Gilbertson, V.

    1999-01-01

    The well-defined osteoblast line, MC3T3-E1 was used to examine fibronectin (FN) mRNA levels, protein synthesis, and extracellular FN matrix accumulation after growth activation in spaceflight. These osteoblasts produce FN extracellular matrix (ECM) known to regulate adhesion, differentiation, and function in adherent cells. Changes in bone ECM and osteoblast cell shape occur in spaceflight. To determine whether altered FN matrix is a factor in causing these changes in spaceflight, quiescent osteoblasts were launched into microgravity and were then sera activated with and without a 1-gravity field. Synthesis of FN mRNA, protein, and matrix were measured after activation in microgravity. FN mRNA synthesis is significantly reduced in microgravity (0-G) when compared to ground (GR) osteoblasts flown in a centrifuge simulating earth's gravity (1-G) field 2.5 h after activation. However, 27.5 h after activation there were no significant differences in mRNA synthesis. A small but significant reduction of FN protein was found in the 0-G samples 2.5 h after activation. Total FN protein 27.5 h after activation showed no significant difference between any of the gravity conditions, however, there was a fourfold increase in absolute amount of protein synthesized during the incubation. Using immunofluorescence, we found no significant differences in the amount or in the orientation of the FN matrix after 27.5 h in microgravity. These results demonstrate that FN is made by sera-activated osteoblasts even during exposure to microgravity. These data also suggest that after a total period of 43 h of spaceflight FN transcription, translation, or altered matrix assembly is not responsible for the altered cell shape or altered matrix formation of osteoblasts.

  17. In Vitro Fatty Acid Synthesis and Complex Lipid Metabolism in the Cyanobacterium Anabaena variabilis: I. Some Characteristics of Fatty Acid Synthesis.

    PubMed

    Lem, N W; Stumpf, P K

    1984-01-01

    In vitro fatty acid synthesis was examined in crude cell extracts, soluble fractions, and 80% (NH(4))(2)SO(4) fractions from Anabaena variabilis M3. Fatty acid synthesis was absolutely dependent upon acyl carrier protein and required NADPH and NADH. Moreover, fatty acid synthesis and elongation occurred in the cytoplasm of the cell. The major fatty acid products were palmitic acid (16:0) and stearic acid (18:0). Of considerable interest, both stearoyl-acyl carrier protein and stearoyl-coenzyme A desaturases were not detected in any of the fractions from A. variabilis. The similarities and differences in fatty acid synthesis between A. variabilis and higher plant tissues are discussed with respect to the endosymbiotic theory of chloroplast evolution. PMID:16663367

  18. Biotin and Lipoic Acid: Synthesis, Attachment, and Regulation.

    PubMed

    Cronan, John E

    2014-05-01

    Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as "swinging arms" that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like "arm" of biotin were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise, and the BioH esterase is responsible for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl acyl carrier protein of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyltransferase followed by sulfur insertion at carbons C-6 and C-8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized, and, thus, there is no transcriptional control of the synthetic genes. In contrast, transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system, exerted through BirA, a dual-function protein

  19. Biotin and Lipoic Acid: Synthesis, Attachment, and Regulation.

    PubMed

    Cronan, John E

    2008-09-01

    Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as "swinging arms" that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid was discovered 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway, in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like "arm" of biotin, were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise and the BioH esterase for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl-ACP of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyl transferase, followed by sulfur insertion at carbons C6 and C8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized, and thus there is no transcriptional control of the synthetic genes. In contrast, transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system exerted through BirA, a dual-function protein that both represses

  20. Biotin and Lipoic Acid: Synthesis, Attachment and Regulation

    PubMed Central

    Cronan, John E.

    2014-01-01

    Summary Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as “swinging arms” that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well-described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like “arm” of biotin were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise and the BioH esterase for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl-ACP of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyl transferase followed by sulfur insertion at carbons C6 and C8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized and thus there is no transcriptional control of the synthetic genes. In contrast transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system, exerted through BirA a dual function protein that both represses

  1. Impaired rRNA synthesis triggers homeostatic responses in hippocampal neurons

    PubMed Central

    Kiryk, Anna; Sowodniok, Katharina; Kreiner, Grzegorz; Rodriguez-Parkitna, Jan; Sönmez, Aynur; Górkiewicz, Tomasz; Bierhoff, Holger; Wawrzyniak, Marcin; Janusz, Artur K.; Liss, Birgit; Konopka, Witold; Schütz, Günther; Kaczmarek, Leszek; Parlato, Rosanna

    2013-01-01

    Decreased rRNA synthesis and nucleolar disruption, known as nucleolar stress, are primary signs of cellular stress associated with aging and neurodegenerative disorders. Silencing of rDNA occurs during early stages of Alzheimer's disease (AD) and may play a role in dementia. Moreover, aberrant regulation of the protein synthesis machinery is present in the brain of suicide victims and implicates the epigenetic modulation of rRNA. Recently, we developed unique mouse models characterized by nucleolar stress in neurons. We inhibited RNA polymerase I by genetic ablation of the basal transcription factor TIF-IA in adult hippocampal neurons. Nucleolar stress resulted in progressive neurodegeneration, although with a differential vulnerability within the CA1, CA3, and dentate gyrus (DG). Here, we investigate the consequences of nucleolar stress on learning and memory. The mutant mice show normal performance in the Morris water maze and in other behavioral tests, suggesting the activation of adaptive mechanisms. In fact, we observe a significantly enhanced learning and re-learning corresponding to the initial inhibition of rRNA transcription. This phenomenon is accompanied by aberrant synaptic plasticity. By the analysis of nucleolar function and integrity, we find that the synthesis of rRNA is later restored. Gene expression profiling shows that 36 transcripts are differentially expressed in comparison to the control group in absence of neurodegeneration. Additionally, we observe a significant enrichment of the putative serum response factor (SRF) binding sites in the promoters of the genes with changed expression, indicating potential adaptive mechanisms mediated by the mitogen-activated protein kinase pathway. In the DG a neurogenetic response might compensate the initial molecular deficits. These results underscore the role of nucleolar stress in neuronal homeostasis and open a new ground for therapeutic strategies aiming at preserving neuronal function. PMID:24273493

  2. An operational RNA code for amino acids and possible relationship to genetic code.

    PubMed Central

    Schimmel, P; Giegé, R; Moras, D; Yokoyama, S

    1993-01-01

    RNA helical oligonucleotides that recapitulate the acceptor stems of transfer RNAs, and that are devoid of the anticodon trinucleotides of the genetic code, are aminoacylated by aminoacyl tRNA synthetases. The specificity of aminoacylation is sequence dependent, and both specificity and efficiency are generally determined by only a few nucleotides proximal to the amino acid attachment site. This sequence/structure-dependent aminoacylation of RNA oligonucleotides constitutes an operational RNA code for amino acids. To a rough approximation, members of the two different classes of tRNA synthetases are, like tRNAs, organized into two major domains. The class-defining conserved domain containing the active site incorporates determinants for recognition of RNA mini-helix substrates. This domain may reflect the primordial synthetase, which was needed for expression of the operational RNA code. The second synthetase domain, which generally is less or not conserved, provides for interactions with the second domain of tRNA, which incorporates the anticodon. The emergence of the genetic from the operational RNA code could occur when the second domain of synthetases was added with the anticodon-containing domain of tRNAs. Images Fig. 2 Fig. 3 Fig. 4 PMID:7692438

  3. Fatty acid modified octa-arginine for delivery of siRNA.

    PubMed

    Li, Yuhuan; Li, Yujing; Wang, Xinmei; Lee, Robert J; Teng, Lesheng

    2015-11-10

    Therapeutic delivery of small interfering RNA (siRNA) is a major challenge that limits its potential clinical application. Four fatty acids derivatives of octa-arginine (R8) were synthesized and evaluated for the delivery of siRNA into hepatocellular carcinoma Hep G2 and human lung adenocarcinoma A549 cells. The results showed that the long chain acid oleic acid or stearic acid derivatives of R8, OA-R8 and StA-R8, were more efficient in siRNA complexation and form nanoparticles with greater stability compared to the native R8. Cellular uptake of fluorescence-labeled siRNA delivered by OA-R8 and StA-R8 in Hep G2 and A549 cells was substantially 40-50 times higher than unmodified R8. A significant reduction in siRNA cellular uptake was observed in the presence of sucrose and cytochalasin D, indicating endocytosis as a primary mechanism of cellular entry. A survivin siRNA was used to prepare nanoparticles with OA-R8 or StA-R8 and evaluated for silencing of survivin mRNA and protein in A549 cells, and the inhibition efficiencies of survivin protein reached to 50.3% and 54.6%, respectively. The results showed greater effectiveness with the derivatized R8. Taken together, these findings showed that long chain fatty acid derivatives of R8 are efficient delivery agents for siRNA and may facilitate its therapeutic application. PMID:26386137

  4. Ascorbic acid intake and oxalate synthesis.

    PubMed

    Knight, John; Madduma-Liyanage, Kumudu; Mobley, James A; Assimos, Dean G; Holmes, Ross P

    2016-08-01

    In humans, approximately 60 mg of ascorbic acid (AA) breaks down in the body each day and has to be replaced by a dietary intake of 70 mg in women and 90 mg in men to maintain optimal health and AA homeostasis. The breakdown of AA is non-enzymatic and results in oxalate formation. The exact amount of oxalate formed has been difficult to ascertain primarily due to the limited availability of healthy human tissue for such research and the difficulty in measuring AA and its breakdown products. The breakdown of 60 mg of AA to oxalate could potentially result in the formation of up to 30 mg oxalate per day. This exceeds our estimates of the endogenous production of 10-25 mg oxalate per day, indicating that degradative pathways that do not form oxalate exist. In this review, we examine what is known about the pathways of AA metabolism and how oxalate forms. We further identify how gaps in our knowledge may be filled to more precisely determine the contribution of AA breakdown to oxalate production in humans. The use of stable isotopes of AA to directly assess the conversion of vitamin to oxalate should help fill this void. PMID:27002809

  5. Synthesis and Characterization of Fatty Acid Conjugates of Niacin and Salicylic Acid.

    PubMed

    Vu, Chi B; Bemis, Jean E; Benson, Ericka; Bista, Pradeep; Carney, David; Fahrner, Richard; Lee, Diana; Liu, Feng; Lonkar, Pallavi; Milne, Jill C; Nichols, Andrew J; Picarella, Dominic; Shoelson, Adam; Smith, Jesse; Ting, Amal; Wensley, Allison; Yeager, Maisy; Zimmer, Michael; Jirousek, Michael R

    2016-02-11

    This report describes the synthesis and preliminary biological characterization of novel fatty acid niacin conjugates and fatty acid salicylate conjugates. These molecular entities were created by covalently linking two bioactive molecules, either niacin or salicylic acid, to an omega-3 fatty acid. This methodology allows the simultaneous intracellular delivery of two bioactives in order to elicit a pharmacological response that could not be replicated by administering the bioactives individually or in combination. The fatty acid niacin conjugate 5 has been shown to be an inhibitor of the sterol regulatory element binding protein (SREBP), a key regulator of cholesterol metabolism proteins such as PCSK9, HMG-CoA reductase, ATP citrate lyase, and NPC1L1. On the other hand, the fatty acid salicylate conjugate 11 has been shown to have a unique anti-inflammatory profile based on its ability to modulate the NF-κB pathway through the intracellular release of the two bioactives. PMID:26784936

  6. De novo mRNA synthesis is required for both consolidation and reconsolidation of fear memories in the amygdala

    PubMed Central

    Duvarci, Sevil; Nader, Karim; LeDoux, Joseph E.

    2008-01-01

    Memory consolidation is the process by which newly learned information is stabilized into long-term memory (LTM). Considerable evidence indicates that retrieval of a consolidated memory returns it to a labile state that requires it to be restabilized. Consolidation of new fear memories has been shown to require de novo RNA and protein synthesis in the lateral nucleus of the amygdala (LA). We have previously shown that de novo protein synthesis in the LA is required for reconsolidation of auditory fear memories. One key question is whether protein synthesis during reconsolidation depends on already existing mRNAs or on synthesis of new mRNAs in the amygdala. In the present study, we examined the effect of mRNA synthesis inhibition during consolidation and reconsolidation of auditory fear memories. We first show that intra-LA infusion of two different mRNA inhibitors dose-dependently impairs long-term memory but leaves short-term memory (STM) intact. Next, we show that intra-LA infusion of the same inhibitors dose-dependently blocks post-reactivation long-term memory (PR-LTM), whereas post-reactivation short-term memory (PR-STM) is left intact. Furthermore, the same treatment in the absence of memory reactivation has no effect. Together, these results show that both consolidation and reconsolidation of auditory fear memories require de novo mRNA synthesis and are equally sensitive to disruption of de novo mRNA synthesis in the LA. PMID:18832561

  7. Mechanism of Concerted RNA-DNA Primer Synthesis by the Human Primosome.

    PubMed

    Baranovskiy, Andrey G; Babayeva, Nigar D; Zhang, Yinbo; Gu, Jianyou; Suwa, Yoshiaki; Pavlov, Youri I; Tahirov, Tahir H

    2016-05-01

    The human primosome, a 340-kilodalton complex of primase and DNA polymerase α (Polα), synthesizes chimeric RNA-DNA primers to be extended by replicative DNA polymerases δ and ϵ. The intricate mechanism of concerted primer synthesis by two catalytic centers was an enigma for over three decades. Here we report the crystal structures of two key complexes, the human primosome and the C-terminal domain of the primase large subunit (p58C) with bound DNA/RNA duplex. These structures, along with analysis of primase/polymerase activities, provide a plausible mechanism for all transactions of the primosome including initiation, elongation, accurate counting of RNA primer length, primer transfer to Polα, and concerted autoregulation of alternate activation/inhibition of the catalytic centers. Our findings reveal a central role of p58C in the coordinated actions of two catalytic domains in the primosome and ultimately could impact the design of anticancer drugs. PMID:26975377

  8. The prebiotic synthesis of modified purines and their potential role in the RNA world

    NASA Technical Reports Server (NTRS)

    Levy, M.; Miller, S. L.; Bada, J. L. (Principal Investigator)

    1999-01-01

    Modified purines are found in all organisms in the tRNA, rRNA, and even DNA, raising the possibility of an early role for these compounds in the evolution of life. These include N6-methyladenine, 1-methyladenine, N6,N6-dimethyladenine, 1-methylhypoxanthine, 1-methylguanine, and N2-methylguanine. We find that these bases as well as a number of nonbiological modified purines can be synthesized from adenine and guanine by the simple reaction of an amine or an amino group with adenine and guanine under the concentrated conditions of the drying-lagoon or drying-beach model of prebiotic synthesis with yields as high as 50%. These compounds are therefore as prebiotic as adenine and guanine and could have played an important role in the RNA world by providing additional functional groups in ribozymes, especially for the construction of hydrophobic binding pockets.

  9. Ribonucleic Acid Regulation in Permeabilized Cells of Escherichia coli Capable of Ribonucleic Acid and Protein Synthesis1

    PubMed Central

    Atherly, Alan G.

    1974-01-01

    A cell permeabilization procedure is described that reduces viability less than 10% and does not significantly reduce the rates of ribonucleic acid and protein synthesis when appropriately supplemented. Permeabilization abolishes the normal stringent coupling of protein and ribonucleic acid synthesis. PMID:4364330

  10. Hydrolysis of tRNA(sup Phe) on Suspensions of Amino Acids

    NASA Technical Reports Server (NTRS)

    Gao, Kui; Orgel, Leslie E.

    2001-01-01

    RNA is adsorbed strongly on suspensions of many moderately soluble organic solids. In some cases, the hydrolysis of tRNA(sup Phe) is greatly accelerated by adsorption, and the major sites of hydrolysis are changed from those that are important in homogeneous solution. Here we show that the hydrolysis is greatly accelerated by suspensions of aspartic acid and beta-glutamic acid but not by suspensions of alpha-glutamic acid, asparagine, or glutamine. The non-enzymatic hydrolysis of RNA has been studied extensively, especially because of its relevance to the mechanisms of action of ribozymes and to biotechnology and therapy. Many ribonucleases, ribozymes, and non-biological catalysts function via acid-base catalysis of an intramolecular transesterification mechanism in which the 2'-OH group attacks the adjacent phosphate group. The pentacoordinated phosphorane intermediate may collapse back to starting material, or yield isomerized or cleaved products.

  11. The effect of trichloroethylene and acrylonitrile on RNA and ribosome synthesis and ribosome content in Saccharomyces cells.

    PubMed

    Lochmann, E R; Ehrlich, W; Mangir, M

    1984-04-01

    The effects of trichloroethylene (TCE) and acrylonitrile (ACN) on growth, RNA synthesis, ribosome synthesis, and ribosome content were tested in yeast cells. TCE causes a delay of the growth of a cell culture (prolongation of the lag phase), but does not cause inhibition. Cells exposed to increasing concentrations of ACN show increasing damage, so that, at a certain point of the growth curve, cell division stops altogether. Similar results were obtained when RNA synthesis was investigated: After treatment with TCE, the maximum RNA synthesis of the cell culture was retarded, but subsequently reached the same level as the untreated control cells. In the presence of ACN, however, the rate of RNA synthesis was lowered with increasing ACN concentrations. The same effect was observed upon investigation of ribosome synthesis: Whereas TCE produces only a slight effect, treatment with increasing concentrations of ACN leads to a substantial decrease in ribosome synthesis, and finally to total inhibition. Parallel to this, the content of free and membrane-bound ribosomes is diminished. Obviously, the decrease in ribosome content is caused not only by an inhibition of ribosome synthesis, but also by a degradation of existing ribosomes, as well as by induction of a ribosome-associated RNase. PMID:6714140

  12. RNA synthesis in isolated nuclei of lactating mammary cells in presence of unmodified and mercury-labeled CTP.

    PubMed Central

    Ganguly, R; Banerjee, M R

    1978-01-01

    Isolated nuclei of lactating mouse mammary gland were capable of supporting DNA-dependent RNA synthesis in vitro in presence of unmodified and mercurated CTP (Hg-CTP) at high ionic condition at 25 degrees C. In presence of unmodified CTP, [3H]UMP incorporation into RNA increased linearly upto 180 min. The kinetic pattern of the reaction and the rate of RNA synthesis were essentially similar when CTP was replaced by Hg-CTP. Both in unmodified and Hg-CTP containing reactions, 70-80% of RNA synthesis was inhibited by alpha-amanitin. Presence of poly(A) in a small portion of the in vitro synthesized messenger-like RNA was detectable by oligo(dT) cellulose chromatography. Both poly(A)+ and poly(A)- RNAs sedimented with a clear peak around 15S region in a formamide-sucrose denaturing gradient. The Hg-RNA after separation from endogenous nuclear RNA by SH-agarose affinity column chromatography also sedimented around 15S region in a formamide-sucrose gradient. The Hg-RNA synthesized in the isolated mammary cell nuclei in vitro should now permit monitoring hormonal regulation of specific gene (casein) transcription in the mammary cells by molecular hybridization of the Hg-RNA with cDNA to casein mRNA. PMID:724523

  13. Inhibition of Peptidoglycan, Ribonucleic Acid, and Protein Synthesis in Tolerant Strains of Streptococcus mutans

    PubMed Central

    Mychajlonka, Myron; McDowell, Thomas D.; Shockman, Gerald D.

    1980-01-01

    Exposure of exponentially growing cultures of Streptococcus mutans strains FA-1 and GS-5 to various concentrations of benzylpenicillin (Pen G) resulted in inhibition of turbidity increases at low concentrations (0.02 to 0.04 μg/ml). However, in contrast to some other streptococcal species, growth inhibition was not accompanied by cellular lysis or by a rapid loss of viability. In both strains, synthesis of insoluble cell wall peptidoglycan was very sensitive to Pen G inhibition and responded in a dose-dependent manner to concentrations of about 0.2 and 0.5 μg/ml for strains GS-5 and FA-1, respectively. Higher Pen G concentrations failed to inhibit further either growth or insoluble peptidoglycan assembly. Somewhat surprisingly, Pen G also inhibited both ribonucleic acid (RNA) and protein syntheses, each in a dose-dependent manner. Compared with inhibition of peptidoglycan synthesis, inhibition of RNA and protein syntheses by Pen G was less rapid and less extensive. Maximum amounts of radiolabeled Pen G were specifically bound to intact cells upon exposure to about 0.2 and 0.5 μg/ml of Pen G for strains GS-5 and FA-1, respectively, concentrations consistent with those that resulted in maximum or near-maximum inhibitions of the synthesis of cellular peptidoglycan, RNA, and protein. Five polypeptide bands that had a very high affinity for [14C]Pen G were detected in a crude cell envelope preparation of strain FA-1. After exposure of cultures of strain FA-1 to the effects of saturating concentrations of the drug for up to 3 h, addition of penicillinase was followed by recovery of growth after a lag. The length of the lag before regrowth depended on both Pen G concentration and time of exposure. On the basis of these and other observations, it is proposed that the secondary inhibitions of cellular RNA or protein synthesis, or both, are involved in the tolerance of these organisms to lysis and killing by Pen G and other inhibitors of insoluble peptidoglycan assembly

  14. Synthesis and characterization of magnetite nanoparticles coated with lauric acid

    SciTech Connect

    Mamani, J.B.; Costa-Filho, A.J.; Cornejo, D.R.; Vieira, E.D.; Gamarra, L.F.

    2013-07-15

    Understanding the process of synthesis of magnetic nanoparticles is important for its implementation in in vitro and in vivo studies. In this work we report the synthesis of magnetic nanoparticles made from ferrous oxide through coprecipitation chemical process. The nanostructured material was coated with lauric acid and dispersed in aqueous medium containing surfactant that yielded a stable colloidal suspension. The characterization of magnetic nanoparticles with distinct physico-chemical configurations is fundamental for biomedical applications. Therefore magnetic nanoparticles were characterized in terms of their morphology by means of TEM and DLS, which showed a polydispersed set of spherical nanoparticles (average diameter of ca. 9 nm) as a result of the protocol. The structural properties were characterized by using X-ray diffraction (XRD). XRD pattern showed the presence of peaks corresponding to the spinel phase of magnetite (Fe{sub 3}O{sub 4}). The relaxivities r{sub 2} and r{sub 2}* values were determined from the transverse relaxation times T{sub 2} and T{sub 2}* at 3 T. Magnetic characterization was performed using SQUID and FMR, which evidenced the superparamagnetic properties of the nanoparticles. Thermal characterization using DSC showed exothermic events associated with the oxidation of magnetite to maghemite. - Highlights: • Synthesis of magnetic nanoparticles coated with lauric acid • Characterization of magnetic nanoparticles • Morphological, structural, magnetic, calorimetric and relaxometric characterization.

  15. Increased Bile Acid Synthesis and Deconjugation After Biliopancreatic Diversion.

    PubMed

    Ferrannini, Ele; Camastra, Stefania; Astiarraga, Brenno; Nannipieri, Monica; Castro-Perez, Jose; Xie, Dan; Wang, Liangsu; Chakravarthy, Manu; Haeusler, Rebecca A

    2015-10-01

    Biliopancreatic diversion (BPD) improves insulin sensitivity and decreases serum cholesterol out of proportion with weight loss. Mechanisms of these effects are unknown. One set of proposed contributors to metabolic improvements after bariatric surgeries is bile acids (BAs). We investigated the early and late effects of BPD on plasma BA levels, composition, and markers of BA synthesis in 15 patients with type 2 diabetes (T2D). We compared these to the early and late effects of Roux-en-Y gastric bypass (RYGB) in 22 patients with T2D and 16 with normal glucose tolerance. Seven weeks after BPD, insulin sensitivity had doubled and serum cholesterol had halved. At this time, BA synthesis markers and total plasma BAs, particularly unconjugated BAs, had markedly risen; this effect could not be entirely explained by low FGF19. In contrast, after RYGB, insulin sensitivity improved gradually with weight loss and cholesterol levels declined marginally; BA synthesis markers were decreased at an early time point (2 weeks) after surgery and returned to the normal range 1 year later. These findings indicate that BA synthesis contributes to the decreased serum cholesterol after BPD. Moreover, they suggest a potential role for altered enterohepatic circulation of BAs in improving insulin sensitivity and cholesterol metabolism after BPD. PMID:26015549

  16. Upregulation of capacity for glutathione synthesis in response to amino acid deprivation: regulation of glutamate-cysteine ligase subunits.

    PubMed

    Sikalidis, Angelos K; Mazor, Kevin M; Lee, Jeong-In; Roman, Heather B; Hirschberger, Lawrence L; Stipanuk, Martha H

    2014-05-01

    Using HepG2/C3A cells and MEFs, we investigated whether induction of GSH synthesis in response to sulfur amino acid deficiency is mediated by the decrease in cysteine levels or whether it requires a decrease in GSH levels per se. Both the glutamate-cysteine ligase catalytic (GCLC) and modifier (GCLM) subunit mRNA levels were upregulated in response to a lack of cysteine or other essential amino acids, independent of GSH levels. This upregulation did not occur in MEFs lacking GCN2 (general control non-derepressible 2, also known as eIF2α kinase 4) or in cells expressing mutant eIF2α lacking the eIF2α kinase Ser(51) phosphorylation site, indicating that expression of both GCLC and GCLM was mediated by the GCN2/ATF4 stress response pathway. Only the increase in GCLM mRNA level, however, was accompanied by a parallel increase in protein expression, suggesting that the enhanced capacity for GSH synthesis depended largely on increased association of GCLC with its regulatory subunit. Upregulation of both GCLC and GLCM mRNA levels in response to cysteine deprivation was dependent on new protein synthesis, which is consistent with expression of GCLC and GCLM being mediated by proteins whose synthesis depends on activation of the GCN2/ATF4 pathway. Our data suggest that the regulation of GCLC expression may be mediated by changes in the abundance of transcriptional regulators, whereas the regulation of GCLM expression may be mediated by changes in the abundance of mRNA stabilizing or destabilizing proteins. Upregulation of GCLM levels in response to low cysteine levels may serve to protect the cell in the face of a future stress requiring GSH as an antioxidant or conjugating/detoxifying agent. PMID:24557597

  17. Upregulation of capacity for glutathione synthesis in response to amino acid deprivation: regulation of glutamate-cysteine ligase subunits

    PubMed Central

    Sikalidis, Angelos K.; Mazor, Kevin M.; Lee, Jeong-In; Roman, Heather B.; Hirschberger, Lawrence L.; Stipanuk, Martha H.

    2014-01-01

    Using HepG2/C3A cells and MEFs, we investigated whether induction of GSH synthesis in response to sulfur amino acid deficiency is mediated by the decrease in cysteine levels or whether it requires a decrease in GSH levels per se. Both the glutamate-cysteine ligase catalytic (GCLC) and modifier (GCLM) subunit mRNA levels were upregulated in response to a lack of cysteine or other essential amino acids, independent of GSH levels. This upregulation did not occur in MEFs lacking GCN2 (general control non-derepressible 2, also known as eIF2α kinase 4) or in cells expressing mutant eIF2α lacking the eIF2α kinase Ser51 phosphorylation site, indicating that expression of both GCLC and GCLM was mediated by the GCN2/ATF4 stress response pathway. Only the increase in GCLM mRNA level, however, was accompanied by a parallel increase in protein expression, suggesting that the enhanced capacity for GSH synthesis depended largely on increased association of GCLC with its regulatory subunit. Upregulation of both GCLC and GLCM mRNA levels in response to cysteine deprivation was dependent on new protein synthesis, which is consistent with expression of GCLC and GCLM being mediated by proteins whose synthesis depends on activation of the GCN2/ATF4 pathway. Our data suggest that the regulation of GCLC expression may be mediated by changes in the abundance of transcriptional regulators, whereas the regulation of GCLM expression may be mediated by changes in the abundance of mRNA stabilizing or destabilizing proteins. Upregulation of GCLM levels in response to low cysteine levels may serve to protect the cell in the face of a future stress requiring GSH as an antioxidant or conjugating/detoxifying agent. PMID:24557597

  18. Flexibility of nucleic acids: From DNA to RNA

    NASA Astrophysics Data System (ADS)

    Lei, Bao; Xi, Zhang; Lei, Jin; Zhi-Jie, Tan

    2016-01-01

    The structural flexibility of nucleic acids plays a key role in many fundamental life processes, such as gene replication and expression, DNA-protein recognition, and gene regulation. To obtain a thorough understanding of nucleic acid flexibility, extensive studies have been performed using various experimental methods and theoretical models. In this review, we will introduce the progress that has been made in understanding the flexibility of nucleic acids including DNAs and RNAs, and will emphasize the experimental findings and the effects of salt, temperature, and sequence. Finally, we will discuss the major unanswered questions in understanding the flexibility of nucleic acids. Project supported by the National Basic Research Program of China (Grant No. 2011CB933600), the National Natural Science Foundation of China (Grant Nos. 11175132, 11575128, and 11374234), and the Program for New Century Excellent Talents, China (Grant No. NCET 08-0408).

  19. The acid tolerance response of Salmonella typhimurium involves transient synthesis of key acid shock proteins.

    PubMed Central

    Foster, J W

    1993-01-01

    Although Salmonella typhimurium prefers neutral-pH environments, it can adapt to survive conditions of severe low-pH stress (pH 3.3). The process, termed the acid tolerance response (ATR), includes two distinct stages. The first stage, called pre-acid shock, is induced at pH 5.8 and involves the production of an inducible pH homeostasis system functional at external pH values below 4.0. The second stage occurs following an acid shock shift to pH 4.5 or below and is called the post-acid shock stage. During this stage of the ATR, 43 acid shock proteins (ASPs) are synthesized. The present data reveal that several ASPs important for pH 3.3 acid tolerance are only transiently produced. Their disappearance after 30 to 40 min of pH 4.4 acid shock coincides with an inability to survive subsequent pH 3.3 acid challenge. Clearly, an essential feature of inducible acid tolerance is an ability to synthesize these key ASPs. The pre-acid shock stage, with its inducible pH homeostasis system, offers the cell an enhanced ability to synthesize ASPs following rapid shifts to conditions below pH 4.0, an external pH that normally prevents ASP synthesis. The data also address possible signals for ASP synthesis. The inducing signal for 22 ASPs appears to be internal acidification, while external pH serves to induce 13 others. Of the 14 transient ASPs, 10 are induced in response to changes in internal pH. Mutations in the fur (ferric uptake regulator) locus that produce an Atr- acid-sensitive phenotype also eliminate induction of six transiently induced ASPs. Images PMID:8458840

  20. Effect of protein synthesis inhibitors on viral mRNA's synthesized early in adenovirus type 2 infection.

    PubMed Central

    Eggerding, F; Raskas, H J

    1978-01-01

    Viral mRNA species synthesized early in adenovirus type 2 infection in the presence of cycloheximide were compared with those synthesized in the absence of drug or in the presence of the DNA synthesis inhibitor 1-beta-D-arabinofuranosylcytosine. Cycloheximide caused approximately a 10-fold stimulation in the accumulation of [3H]uridine into early viral mRNA species. The only exception was a 24s mRNA transcribed from the transforming end of the genome; in the presence of cycloheximide, accumulation of this mRNA species was stimulated no more than 2-fold. Treatment with cycloheximide also resulted in the accumulation of polyadenylated RNAs transcribed from EcoRI-C that are heterogeneous and smaller than the 20S mRNA. Other translation inhibitors were shown to have similar effects, suggesting that inhibition of protein synthesis early after infection induces alterations in the metabolism of specific RNA sequences. PMID:621786

  1. Synthesis of human adenovirus early RNA species is similar in productive and abortive infections of monkey and human cells.

    PubMed Central

    Anderson, K P; Klessig, D F

    1982-01-01

    Northern (RNA) blot analysis has been used to show that synthesis of early mRNA species is similar in monkey cells productively or abortively infected with human adenovirus. mRNA species from all five major early regions (1A, 1B, 2, 3, 4) are identical in size and comparable in abundance whether isolated from monkey cells infected with adenovirus type 2 or with the host range mutant Ad2hr400 or coinfected with adenovirus type 2 plus simian virus 40. The mRNA species isolated from monkey cells are identical in size to those isolated from human cells. Production of virus-associated RNA is also identical in productive and abortive infections of monkey cells. Synthesis of virus-associated RNA is, however, significantly greater in HeLa cells than in CV1 cells at late times after infection regardless of which virus is used in the infection. Images PMID:6283181

  2. Essential amino acids increase microRNA-499, -208b, and -23a and downregulate myostatin and myocyte enhancer factor 2C mRNA expression in human skeletal muscle.

    PubMed

    Drummond, Micah J; Glynn, Erin L; Fry, Christopher S; Dhanani, Shaheen; Volpi, Elena; Rasmussen, Blake B

    2009-12-01

    Essential amino acids (EAA) stimulate muscle protein synthesis in humans. However, little is known about whether microRNAs (miRNA) and genes associated with muscle growth are expressed differently following EAA ingestion. Our purpose in this experiment was to determine whether miRNA and growth-related mRNA expressed in skeletal muscle are up- or downregulated in humans following the ingestion of EAA. We hypothesized that EAA would alter miRNA expression in skeletal muscle as well as select growth-related genes. Muscle biopsies were obtained from the vastus lateralis of 7 young adult participants (3 male, 4 female) before and 3 h after ingesting 10 g of EAA. Muscle samples were analyzed for muscle miRNA (miR-499, -208b, -23a, -1, -133a, and -206) and muscle-growth related genes [MyoD1, myogenin, myostatin, myocyte enhancer factor C (MEF2C), follistatin-like-1 (FSTL1), histone deacytylase 4, and serum response factor mRNA] before and after EAA ingestion using real-time PCR. Following EAA ingestion, miR-499, -208b, -23a, -1, and pri-miR-206 expression increased (P < 0.05). The muscle-growth genes MyoD1 and FSTL1 mRNA expression increased (P < 0.05), and myostatin and MEF2C mRNA were downregulated following EAA ingestion (P < 0.05). We conclude that miRNA and growth-related genes expressed in skeletal muscle are rapidly altered within hours following EAA ingestion. Further work is needed to determine whether these miRNA are post-transcriptional regulators of growth-related genes following an anabolic stimulus. PMID:19828686

  3. Enzymatic synthesis of oligo- and polysaccharide fatty acid esters.

    PubMed

    van den Broek, Lambertus A M; Boeriu, Carmen G

    2013-03-01

    Amphiphilic oligo- and polysaccharides (e.g. polysaccharide alkyl or alkyl-aryl esters) form a new class of polymers with exceptional properties. They function as polymeric surfactants, whilst maintaining most of the properties of the starting polymeric material such as emulsifying, gelling, and film forming properties combined with partial water solubility or permeability. At present carbohydrate fatty acid esters are generally obtained by chemical methods using toxic solvents and organic and inorganic catalysts that leave residual traces in the final products. Enzymatic reactions offer an attractive alternative route for the synthesis of polysaccharide esters. In this review the state of the art of enzymatic synthesis of oligo- and polysaccharides fatty esters has been described. PMID:23465902

  4. Simian Virus 40 Deoxyribonucleic Acid Synthesis: Analysis by Gel Electrophoresis

    PubMed Central

    Tegtmeyer, Peter; Macasaet, Francisco

    1972-01-01

    An agarose-gel electrophoresis technique has been developed to study simian virus 40 deoxyribonucleic acid (DNA) synthesis. Superhelical DNA I, relaxed DNA II, and replicative intermediate (RI) molecules were clearly resolved from one another for analytical purposes. Moreover, the RI molecules could be identified as early or late forms on the basis of their electrophoretic migration in relation to that of DNA II. The technique has been utilized to study the kinetics of simian virus 40 DNA synthesis in pulse and in pulse-chase experiments. The average time required to complete the replication of prelabeled RI molecules and to convert them into DNA I was approximately 10 min under the experimental conditions employed. PMID:4343542

  5. (-)-Hydroxycitric Acid Nourishes Protein Synthesis via Altering Metabolic Directions of Amino Acids in Male Rats.

    PubMed

    Han, Ningning; Li, Longlong; Peng, Mengling; Ma, Haitian

    2016-08-01

    (-)-Hydroxycitric acid (HCA), a major active ingredient of Garcinia Cambogia extracts, had shown to suppress body weight gain and fat accumulation in animals and humans. While, the underlying mechanism of (-)-HCA has not fully understood. Thus, this study was aimed to investigate the effects of long-term supplement with (-)-HCA on body weight gain and variances of amino acid content in rats. Results showed that (-)-HCA treatment reduced body weight gain and increased feed conversion ratio in rats. The content of hepatic glycogen, muscle glycogen, and serum T4 , T3 , insulin, and Leptin were increased in (-)-HCA treatment groups. Protein content in liver and muscle were significantly increased in (-)-HCA treatment groups. Amino acid profile analysis indicated that most of amino acid contents in serum and liver, especially aromatic amino acid and branched amino acid, were higher in (-)-HCA treatment groups. However, most of the amino acid contents in muscle, especially aromatic amino acid and branched amino acid, were reduced in (-)-HCA treatment groups. These results indicated that (-)-HCA treatment could reduce body weight gain through promoting energy expenditure via regulation of thyroid hormone levels. In addition, (-)-HCA treatment could promote protein synthesis by altering the metabolic directions of amino acids. Copyright © 2016 John Wiley & Sons, Ltd. PMID:27145492

  6. The synthesis of mycosporine-like amino acids (MAAs) by cultured, symbiotic dinoflagellates.

    PubMed

    T Banaszak1 A; LaJeunesse; Trench

    2000-06-28

    We tested the hypothesis that there is a relation between phylotypes (phylogenetic types, as determined by restriction fragment length polymorphism (RFLP) and partial sequence analysis of the small subunit ribosomal RNA gene (SSUrDNA)) and the synthesis of mycosporine-like amino acids (MAAs) by symbiotic dinoflagellates under the influence of ultraviolet radiation (UV-B/A) and photosynthetically active radiation (PAR). We exposed 27 isolates of symbiotic dinoflagellates simultaneously to UV-B/A and PAR, and subsequently determined the MAAs present in cell extracts and in the media. The algae used included 24 isolates of Symbiodinium spp. originating from jellyfishes, sea anemones, zoanthids, scleractinians, octocorals, and bivalves, and three others in the genera Gymnodinium, Gloeodinium and Amphidinium from a jellyfish, an hydrocoral and a flatworm, respectively. In this study, all of the phylotype A Symbiodinium spp. synthesized up to three identified MAAs. None of the 11 cultured phylotypes B and C Symbiodinium spp. synthesized MAAs. The three non-Symbiodinium symbionts also synthesized up to three MAAs. The results support a conclusion that phylotype A Symbiodinium spp. have a high predilection for the synthesis of MAAs, while phylotypes B and C do not. Synthesis of MAAs by symbiotic dinoflagellates in culture does not appear to relate directly to depths or to the UV exposure regimes from which the consortia were collected. PMID:10841936

  7. Synthesis and evaluation of colletoic acid core derivatives.

    PubMed

    Ling, Taotao; Gautam, Lekh Nath; Griffith, Elizabeth; Das, Sourav; Lang, Walter; Shadrick, William R; Shelat, Anang; Lee, Richard; Rivas, Fatima

    2016-03-01

    Cortisol homeostasis has been linked to the pathogenesis of metabolic syndrome (MetS), since it stimulates hepatic gluconeogenesis and adipogenesis. MetS is classified as a constellation of health conditions that increase the risk of type 2 diabetes and cardiovascular disease. Intracellular cortisol levels are regulated by 11β-hydroxysteroid dehydrogenase (type 1 and type 2) in a tissue dependent manner. The type 1 enzyme (11β-HSD1) is widely expressed in glucocorticoid targeted tissues and is responsible for the conversion of cortisone to the active cortisol. Local reduction of cortisol regeneration presents a potential strategy for MetS treatment. Recently we disclosed the total synthesis of (+)-colletoic acid as a potent 11β-HSD1 inhibitor. Herein, we describe our improved processing chemistry for the synthesis of the colletoic acid core to access a diverse number of derivatives for evaluation against 11β-HSD1. The Evan's chiral auxiliary was utilized to construct the acyclic precursor 12 to afford the acorane core 9 using a modified Heck reaction in excellent chemical yields. The colletoic acid core derivatives showed modest activity against 11β-HSD1 and will serve for further biological evaluation. PMID:26820555

  8. Rabies RNA synthesis, detected with cDNA probes, as a marker for virus transport in the rat nervous system.

    PubMed

    Ermine, A; Ceccaldi, P E; Masson, G; Tsiang, H

    1993-02-01

    The kinetics of viral RNA synthesis in different parts of the rat brain, infected with fixed or street rabies virus strains, is correlated with their anatomical neuronal connections with the masseter muscles, using hybridization with rabies cDNA probes. Viral RNA synthesis is first detected in the brain-stem and in the pons where the direct anatomical projection of the masseter muscle nervous arborization into the sensory and motor nuclei is located, through the trigeminus nerve. Rabies RNA detection is delayed in the other regions of the rat brain depending on the time course of virus transport from the trigeminal nuclei through multiple nervous connections. PMID:7681151

  9. Effects of induction of rRNA overproduction on ribosomal protein synthesis and ribosome subunit assembly in Escherichia coli.

    PubMed Central

    Yamagishi, M; Nomura, M

    1988-01-01

    Overproduction of rRNA was artificially induced in Escherichia coli cells to test whether the synthesis of ribosomal protein (r-protein) is normally repressed by feedback regulation. When rRNA was overproduced more than twofold from a hybrid plasmid carrying the rrnB operon fused to the lambda pL promoter (pL-rrnB), synthesis of individual r-proteins increased by an average of about 60%. This demonstrates that the synthesis of r-proteins is repressed under normal conditions. The increase of r-protein production, however, for unknown reasons, was not as great as the increase in rRNA synthesis and resulted in an imbalance between the amounts of rRNA and r-protein synthesis. Therefore, only a small (less than 20%) increase in the synthesis of complete 30S and 50S ribosome subunits was detected, and a considerable fraction of the excess rRNA was degraded. Lack of complete cooperativity in the assembly of ribosome subunits in vivo is discussed as a possible explanation for the absence of a large stimulation of ribosome synthesis observed under these conditions. In addition to the induction of intact rRNA overproduction from the pL-rrnB operon, the effects of unbalanced overproduction of each of the two large rRNAs, 16S rRNA and 23S rRNA, on r-protein synthesis were examined using pL-rrnB derivatives carrying a large deletion in either the 23S rRNA gene or the 16S rRNA gene. Operon-specific derepression after 23S or 16S rRNA overproduction correlated with the overproduction of rRNA containing the target site for the operon-specific repressor r-protein. These results are discussed to explain the apparent coupling of the assembly of one ribosomal subunit with that of the other which was observed in earlier studies on conditionally lethal mutants with defects in ribosome assembly. PMID:3053641

  10. Calcineurin mediates homeostatic synaptic plasticity by regulating retinoic acid synthesis

    PubMed Central

    Arendt, Kristin L.; Zhang, Zhenjie; Ganesan, Subhashree; Hintze, Maik; Shin, Maggie M.; Tang, Yitai; Cho, Ahryon; Graef, Isabella A.; Chen, Lu

    2015-01-01

    Homeostatic synaptic plasticity is a form of non-Hebbian plasticity that maintains stability of the network and fidelity for information processing in response to prolonged perturbation of network and synaptic activity. Prolonged blockade of synaptic activity decreases resting Ca2+ levels in neurons, thereby inducing retinoic acid (RA) synthesis and RA-dependent homeostatic synaptic plasticity; however, the signal transduction pathway that links reduced Ca2+-levels to RA synthesis remains unknown. Here we identify the Ca2+-dependent protein phosphatase calcineurin (CaN) as a key regulator for RA synthesis and homeostatic synaptic plasticity. Prolonged inhibition of CaN activity promotes RA synthesis in neurons, and leads to increased excitatory and decreased inhibitory synaptic transmission. These effects of CaN inhibitors on synaptic transmission are blocked by pharmacological inhibitors of RA synthesis or acute genetic deletion of the RA receptor RARα. Thus, CaN, acting upstream of RA, plays a critical role in gating RA signaling pathway in response to synaptic activity. Moreover, activity blockade-induced homeostatic synaptic plasticity is absent in CaN knockout neurons, demonstrating the essential role of CaN in RA-dependent homeostatic synaptic plasticity. Interestingly, in GluA1 S831A and S845A knockin mice, CaN inhibitor- and RA-induced regulation of synaptic transmission is intact, suggesting that phosphorylation of GluA1 C-terminal serine residues S831 and S845 is not required for CaN inhibitor- or RA-induced homeostatic synaptic plasticity. Thus, our study uncovers an unforeseen role of CaN in postsynaptic signaling, and defines CaN as the Ca2+-sensing signaling molecule that mediates RA-dependent homeostatic synaptic plasticity. PMID:26443861

  11. Calcineurin mediates homeostatic synaptic plasticity by regulating retinoic acid synthesis.

    PubMed

    Arendt, Kristin L; Zhang, Zhenjie; Ganesan, Subhashree; Hintze, Maik; Shin, Maggie M; Tang, Yitai; Cho, Ahryon; Graef, Isabella A; Chen, Lu

    2015-10-20

    Homeostatic synaptic plasticity is a form of non-Hebbian plasticity that maintains stability of the network and fidelity for information processing in response to prolonged perturbation of network and synaptic activity. Prolonged blockade of synaptic activity decreases resting Ca(2+) levels in neurons, thereby inducing retinoic acid (RA) synthesis and RA-dependent homeostatic synaptic plasticity; however, the signal transduction pathway that links reduced Ca(2+)-levels to RA synthesis remains unknown. Here we identify the Ca(2+)-dependent protein phosphatase calcineurin (CaN) as a key regulator for RA synthesis and homeostatic synaptic plasticity. Prolonged inhibition of CaN activity promotes RA synthesis in neurons, and leads to increased excitatory and decreased inhibitory synaptic transmission. These effects of CaN inhibitors on synaptic transmission are blocked by pharmacological inhibitors of RA synthesis or acute genetic deletion of the RA receptor RARα. Thus, CaN, acting upstream of RA, plays a critical role in gating RA signaling pathway in response to synaptic activity. Moreover, activity blockade-induced homeostatic synaptic plasticity is absent in CaN knockout neurons, demonstrating the essential role of CaN in RA-dependent homeostatic synaptic plasticity. Interestingly, in GluA1 S831A and S845A knockin mice, CaN inhibitor- and RA-induced regulation of synaptic transmission is intact, suggesting that phosphorylation of GluA1 C-terminal serine residues S831 and S845 is not required for CaN inhibitor- or RA-induced homeostatic synaptic plasticity. Thus, our study uncovers an unforeseen role of CaN in postsynaptic signaling, and defines CaN as the Ca(2+)-sensing signaling molecule that mediates RA-dependent homeostatic synaptic plasticity. PMID:26443861

  12. Development of nucleic acid vaccines: use of self-amplifying RNA in lipid nanoparticles.

    PubMed

    Rodríguez-Gascón, Alicia; del Pozo-Rodríguez, Ana; Solinís, María Ángeles

    2014-01-01

    Self-amplifying RNA or RNA replicon is a form of nucleic acid-based vaccine derived from either positive-strand or negative-strand RNA viruses. The gene sequences encoding structural proteins in these RNA viruses are replaced by mRNA encoding antigens of interest as well as by RNA polymerase for replication and transcription. This kind of vaccine has been successfully assayed with many different antigens as vaccines candidates, and has been shown to be potent in several animal species, including mice, nonhuman primates, and humans. A key challenge to realizing the broad potential of self-amplifying vaccines is the need for safe and effective delivery methods. Ideally, an RNA nanocarrier should provide protection from blood nucleases and extended blood circulation, which ultimately would increase the possibility of reaching the target tissue. The delivery system must then be internalized by the target cell and, upon receptor-mediated endocytosis, must be able to escape from the endosomal compartment into the cell cytoplasm, where the RNA machinery is located, while avoiding degradation by lysosomal enzymes. Further, delivery systems for systemic administration ought to be well tolerated upon administration. They should be safe, enabling the multiadministration treatment modalities required for improved clinical outcomes and, from a developmental point of view, production of large batches with reproducible specifications is also desirable. In this review, the concept of self-amplifying RNA vaccines and the most promising lipid-based delivery systems are discussed. PMID:24748793

  13. N-3 fatty acid intake altered fat content and fatty acid distribution in chicken breast muscle, but did not influence mRNA expression of lipid-related enzymes

    PubMed Central

    2014-01-01

    Background The conversions of the n-3 and n-6 fatty acid of plant origin to the C20 and C22 very long chain fatty acids (LCPUFAs) is regulated by several cellular enzymes such as elongases and desaturases. Methods Sixty-five male one-day old chickens (Ross 308) were randomly divided into four groups and given one of four diets; with or without linseed oil (LO), (the diets contained equal amounts of fat) and with low or high selenium (Se). Final body weight, amount of Se and fat in breast muscle, fatty acid profile, and gene expression for fatty acid desaturases (Fads1, Fads2, Fads9), HMG-CoA reductase, Acyl-CoA oxidase (Acox), carnitine palmitoyl transferase1 (Cpt1), superoxide dismutase (Sod) and glutathione peroxidase4 (Gpx4) were analyzed in all animals, and Gpx activity in whole blood was determined. Results mRNA expression of elongases and desaturases in chicken breast muscle was not affected by feed rich in C18:3n-3. The highly positive correlation between amount of fat in breast muscle and the product/precursor indices of monounsaturated fatty acid synthesis, and the negative correlation between muscle fat and indices of LCPUFA synthesis should be further studied. Conclusion mRNA expression in chicken breast muscle of elongases and desaturases was not affected by feed rich in C18:3n-3. The highly positive correlation between amount of fat in breast muscle and the product/precursor indices of monounsaturated fatty acid synthesis, and the negative correlation between muscle fat and indices of LCPUFA synthesis should be further studied. PMID:24894510

  14. Positive-strand RNA viruses stimulate host phosphatidylcholine synthesis at viral replication sites.

    PubMed

    Zhang, Jiantao; Zhang, Zhenlu; Chukkapalli, Vineela; Nchoutmboube, Jules A; Li, Jianhui; Randall, Glenn; Belov, George A; Wang, Xiaofeng

    2016-02-23

    All positive-strand RNA viruses reorganize host intracellular membranes to assemble their viral replication complexes (VRCs); however, how these viruses modulate host lipid metabolism to accommodate such membrane proliferation and rearrangements is not well defined. We show that a significantly increased phosphatidylcholine (PC) content is associated with brome mosaic virus (BMV) replication in both natural host barley and alternate host yeast based on a lipidomic analysis. Enhanced PC levels are primarily associated with the perinuclear ER membrane, where BMV replication takes place. More specifically, BMV replication protein 1a interacts with and recruits Cho2p (choline requiring 2), a host enzyme involved in PC synthesis, to the site of viral replication. These results suggest that PC synthesized at the site of VRC assembly, not the transport of existing PC, is responsible for the enhanced accumulation. Blocking PC synthesis by deleting the CHO2 gene resulted in VRCs with wider diameters than those in wild-type cells; however, BMV replication was significantly inhibited, highlighting the critical role of PC in VRC formation and viral replication. We further show that enhanced PC levels also accumulate at the replication sites of hepatitis C virus and poliovirus, revealing a conserved feature among a group of positive-strand RNA viruses. Our work also highlights a potential broad-spectrum antiviral strategy that would disrupt PC synthesis at the sites of viral replication but would not alter cellular processes. PMID:26858414

  15. Positive-strand RNA viruses stimulate host phosphatidylcholine synthesis at viral replication sites

    PubMed Central

    Zhang, Jiantao; Zhang, Zhenlu; Chukkapalli, Vineela; Nchoutmboube, Jules A.; Li, Jianhui; Randall, Glenn; Belov, George A.; Wang, Xiaofeng

    2016-01-01

    All positive-strand RNA viruses reorganize host intracellular membranes to assemble their viral replication complexes (VRCs); however, how these viruses modulate host lipid metabolism to accommodate such membrane proliferation and rearrangements is not well defined. We show that a significantly increased phosphatidylcholine (PC) content is associated with brome mosaic virus (BMV) replication in both natural host barley and alternate host yeast based on a lipidomic analysis. Enhanced PC levels are primarily associated with the perinuclear ER membrane, where BMV replication takes place. More specifically, BMV replication protein 1a interacts with and recruits Cho2p (choline requiring 2), a host enzyme involved in PC synthesis, to the site of viral replication. These results suggest that PC synthesized at the site of VRC assembly, not the transport of existing PC, is responsible for the enhanced accumulation. Blocking PC synthesis by deleting the CHO2 gene resulted in VRCs with wider diameters than those in wild-type cells; however, BMV replication was significantly inhibited, highlighting the critical role of PC in VRC formation and viral replication. We further show that enhanced PC levels also accumulate at the replication sites of hepatitis C virus and poliovirus, revealing a conserved feature among a group of positive-strand RNA viruses. Our work also highlights a potential broad-spectrum antiviral strategy that would disrupt PC synthesis at the sites of viral replication but would not alter cellular processes. PMID:26858414

  16. Effect of Trifluralin on Growth, Morphology, and Nucleic Acid Synthesis 1

    PubMed Central

    Schultz, Donald P.; Funderburk, H. H.; Negi, N. S.

    1968-01-01

    Roots and shoots of corn seedlings (Zea mays L. var. Dixie 18) germinated in trifluralin (α,α,α-trifluoro-2,6-dinitro-N,N-dipropyl-p-toluidine) solutions are characterized by radial enlargement of the cortical cells and by multinucleate cells in the meristematic regions. Trifluralin inhibits elongation of Avena coleoptile sections at concentrations of 0.1 μm to 10 μm. Synthesis of DNA, RNA, and protein is suppressed in the root tips while no significant effect is noticeable in the shoots of corn germinated in trifluralin. A 32P time-course study of 48, 72, and 96 hours utilizing phenol extraction and MAK column separation of corn root and shoot nucleic acids showed suppression of 32P incorporation in the treated roots; however, the 72 and 96 hour treated shoots incorporated a much greater amount than the control with most of the increased incorporation found in the sRNA and DNA fractions. The increased activity in the DNA may be due to a high G-C type DNA. No selective suppression or enhancement of any particular RNA species was noticed in the treated plants. Images PMID:16656762

  17. Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments

    NASA Astrophysics Data System (ADS)

    Kitadai, Norio

    2015-12-01

    Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids.

  18. Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments.

    PubMed

    Kitadai, Norio

    2015-12-01

    Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids. PMID:25796392

  19. Effect of mevalonic acid on cholesterol synthesis in bovine intramuscular and subcutaneous adipocytes.

    PubMed

    Liu, Xiaomu; You, Wei; Cheng, Haijian; Zhang, Qingfeng; Song, Enliang; Wan, Fachun; Han, Hong; Liu, Guifen

    2016-02-01

    Mevalonic acid (MVA) is a key material in the synthesis of cholesterol; indeed, intracellular cholesterol synthesis is also called the mevalonic acid pathway. 3-Hydroxy-3-methylglutaryl-CoA reductase (HMGR) is an essential enzyme in cholesterol biosynthesis. This study suggests that MVA may play an important role in the differentiation of bovine adipose tissue in vivo. We investigated differential mRNA expression in bovine intramuscular preadipocytes (BIPs) and bovine subcutaneous preadipocytes (BSPs) by culturing cells from the longissimus dorsi muscle and subcutaneous fat tissues of Luxi yellow cattle. The morphology of lipid accumulation of bovine preadipocytes was detected by Oil Red O staining, and total cholesterol (TC), low-density lipoprotein cholesterol (LDLC), and high-density lipoprotein cholesterol (HDLC) levels were measured. Temporospatial expression of HMGR was investigated by real-time quantitative polymerase chain reaction (PCR). The TC, LDLC, and HDLC content did not significantly differ over time but increased slowly with increasing MVA concentration. HMGR expression increased over time and with increasing concentrations of MVA. MVA increased adipose cell proliferation in a dose-dependent and time-dependent manner. MVA stimulated HMGR expression in two cell types and its influence on adipocyte differentiation. PMID:26122311

  20. Retinoid resistance and multifaceted impairment of retinoic acid synthesis in glioblastoma.

    PubMed

    Campos, Benito; Weisang, Sarah; Osswald, Florian; Ali, Ramadan; Sedlmeier, Georg; Bageritz, Josephine; Mallm, Jan-Philipp; Hartmann, Christian; von Deimling, Andreas; Popanda, Odillia; Goidts, Violaine; Plass, Christoph; Unterberg, Andreas; Schmezer, Peter; Burhenne, Jürgen; Herold-Mende, Christel

    2015-10-01

    Measuring concentrations of the differentiation-promoting hormone retinoic acid (RA) in glioblastoma tissues would help to understand the reason why RA treatment has been inefficient in clinical trials involving brain tumor patients. Here, we apply a recently established extraction and measurement protocol to screen glioblastoma tissues for the levels of the RA precursor retinol and biologically active RA. Combining this approach with mRNA analyses of 26 tumors and 8 normal brains, we identify a multifaceted disturbance of RA synthesis in glioblastoma, involving multiple aldehyde dehydrogenase 1 family and retinol dehydrogenase enzymes. Through database studies and methylation analyses, we narrow down chromosomal deletions and aberrant promoter hypermethylation as potential mechanisms accounting for these alterations. Employing chromatin immunoprecipitation analyses and cell-culture studies, we further show that chromatin at RA target genes is poised to RA substitution, but most glioblastoma cell cultures are completely resistant to RA treatment. This paradoxical RA response is unrelated to alternative RA signaling through the fatty acid-binding protein 5/peroxisome proliferator-activated receptor delta axis. Our data suggest a multifaceted disturbance of RA synthesis in glioblastoma and contribute to reconsider current RA treatment strategies. PMID:25944104

  1. Design and synthesis of boronic acid inhibitors of endothelial lipase.

    PubMed

    O'Connell, Daniel P; LeBlanc, Daniel F; Cromley, Debra; Billheimer, Jeffrey; Rader, Daniel J; Bachovchin, William W

    2012-02-01

    Endothelial lipase (EL) and lipoprotein lipase (LPL) are homologous lipases that act on plasma lipoproteins. EL is predominantly a phospholipase and appears to be a key regulator of plasma HDL-C. LPL is mainly a triglyceride lipase regulating (V)LDL levels. The existing biological data indicate that inhibitors selective for EL over LPL should have anti-atherogenic activity, mainly through increasing plasma HDL-C levels. We report here the synthesis of alkyl, aryl, or acyl-substituted phenylboronic acids that inhibit EL. Many of the inhibitors evaluated proved to be nearly equally potent against both EL and LPL, but several exhibited moderate to good selectivity for EL. PMID:22225633

  2. Synthesis of Nanoporous Iminodiacetic Acid Sorbents for Binding Transition Metals

    PubMed Central

    Busche, Brad; Wiacek, Robert; Davidson, Joseph; Koonsiripaiboon, View; Yantasee, Wassana; Addleman, R. Shane; Fryxell, Glen E.

    2009-01-01

    Iminodiacetic acid (IDAA) forms strong complexes with a wide variety of metal ions. Using self-assembled monolayers in mesoporous supports (SAMMS) to present the IDAA ligand potentially allows for multiple metal-ligand interactions to enhance the metal binding affinity relative to that of randomly oriented polymer-based supports. This manuscript describes the synthesis of a novel nanostructured sorbent material built using self-assembly of a IDAA ligand inside a nanoporous silica, and demonstrates its use for capturing transition metal cations, and anionic metal complexes, such as PdCl4−2. PMID:22068901

  3. Synthesis and biological activity of novel deoxycholic acid derivatives.

    PubMed

    Popadyuk, Irina I; Markov, Andrey V; Salomatina, Oksana V; Logashenko, Evgeniya B; Shernyukov, Andrey V; Zenkova, Marina A; Salakhutdinov, Nariman F

    2015-08-01

    We report the synthesis and biological activity of new semi-synthetic derivatives of naturally occurring deoxycholic acid (DCA) bearing 2-cyano-3-oxo-1-ene, 3-oxo-1(2)-ene or 3-oxo-4(5)-ene moieties in ring A and 12-oxo or 12-oxo-9(11)-ene moieties in ring C. Bioassays using murine macrophage-like cells and tumour cells show that the presence of the 9(11)-double bond associated with the increased polarity of ring A or with isoxazole ring joined to ring A, improves the ability of the compounds to inhibit cancer cell growth. PMID:26037611

  4. Amino Acid-Functionalized Dendritic Polyglycerol for Safe and Effective siRNA Delivery.

    PubMed

    Zeng, Hanxiang; Schlesener, Cathleen; Cromwell, Olivia; Hellmund, Markus; Haag, Rainer; Guan, Zhibin

    2015-12-14

    The development of safe and effective delivery vectors is a great challenge for the medicinal application of RNA interference (RNAi). In this study, we aimed to develop new synthetic transfection agents based on dendritic polyglycercol (dPG), which has shown great biocompatibility in several biomaterial applications. Histidine and aromatic amino acids were conjugated to the amine-terminated dPGs through amide bonds. We systematically tuned the amino acid combination, functionalization ratio, ligand density, and dPG core size to find optimal vectors. It was found that histidine-tryptophan-functionalized dPGs exhibited improved delivery efficiency and greatly reduced toxicity over simple amine-terminated dPGs. Furthermore, the optimized vectors exhibited strong siRNA binding and high transfection efficiency in serum containing media. The results indicate that the current amino acid-functionalized dPG system is a promising candidate for in vivo siRNA delivery applications. PMID:26569043

  5. Recovery of total microbial RNA from lactic acid fermented foods with a high starch content.

    PubMed

    Ampe, F; ben Omar, N; Guyot, J P

    1998-11-01

    An optimized procedure for the recovery of RNA from micro-organisms involved in the fermentation of starchy foods (mainly hard-to-lyse lactic acid bacteria) is reported. Critical steps for the extraction were: cell recovery by differential centrifugation; cell wall digestion with both mutanolysin and lysozyme; and CTAB treatment for the elimination of starch. Digestion of starch with alpha-amylase did not improve extraction yields. The method yielded high amounts of RNA from pozol, a Mexican maize-based fermented food, and was found to extract total RNA efficiently from all the micro-organisms potentially present in these ecosystems. Both rRNA and mRNA recovered were of high quality and suitable for hybridization studies. PMID:9830143

  6. Knockout of mouse Cyp3a gene enhances synthesis of cholesterol and bile acid in the liver[S

    PubMed Central

    Hashimoto, Mari; Kobayashi, Kaoru; Watanabe, Mio; Kazuki, Yasuhiro; Takehara, Shoko; Inaba, Asumi; Nitta, Shin-ichiro; Senda, Naoto; Oshimura, Mitsuo; Chiba, Kan

    2013-01-01

    Here, we studied the effects of cytochrome P450 (CYP)3A deficiency on the mRNA expression of genes encoding regulators of hepatic cholesterol levels using Cyp3a-knockout (Cyp3a−/−) mice. The mRNA expression levels of genes encoding enzymes involved in cholesterol biosynthesis in the livers of Cyp3a−/− mice were higher than those of wild-type (WT) mice. Nuclear levels of sterol regulatory element-binding protein-2 (SREBP-2), which enhances cholesterol biosynthesis, were also higher in the livers of Cyp3a−/− mice. Binding of SREBP-2 to the Hmgcs1 gene promoter was more abundant in the livers of Cyp3a−/− mice. These results suggest that deficiency of CYP3A enzymes enhances transcription of genes encoding enzymes involved in cholesterol biosynthesis via activation of SREBP-2. On the other hand, hepatic cholesterol levels in Cyp3a−/− mice were 20% lower than those in WT mice. The mRNA expression levels of genes encoding enzymes involved in bile acid synthesis, plasma levels of 7α-hydroxy-4-cholesten-3-one and hepatic levels of total bile acid were significantly higher in Cyp3a−/− mice than in WT mice. These findings suggest that reduction of hepatic total cholesterol in Cyp3a−/− mice would be the consequence of enhanced bile acid synthesis. Therefore, CYP3A enzymes appear to play roles in the synthesis of cholesterol and bile acid in vivo. PMID:23709690

  7. Synthesis of all nineteen appropriately protected chiral alpha-hydroxy acid equivalents of the alpha-amino acids for Boc solid-phase depsi-peptide synthesis.

    PubMed

    Deechongkit, Songpon; You, Shu-Li; Kelly, Jeffery W

    2004-02-19

    [reaction: see text] The preparation of depsi-peptides, amide-to-ester-substituted peptides used to probe the role of hydrogen bonding in protein folding energetics, is accomplished by replacing specific l-alpha-amino acid residues by their alpha-hydroxy acid counterparts in a solid-phase synthesis employing a t-Boc strategy. Herein we describe the efficient stereoselective synthesis of all 19 appropriately protected alpha-hydroxy acid equivalents of the l-alpha-amino acids, employing commercially available materials, expanding the number of available alpha-hydroxy acids from 9 to 19. PMID:14961607

  8. Acidic Residues in the Hfq Chaperone Increase the Selectivity of sRNA Binding and Annealing.

    PubMed

    Panja, Subrata; Santiago-Frangos, Andrew; Schu, Daniel J; Gottesman, Susan; Woodson, Sarah A

    2015-11-01

    Hfq facilitates gene regulation by small non-coding RNAs (sRNAs), thereby affecting bacterial attributes such as biofilm formation and virulence. Escherichia coli Hfq recognizes specific U-rich and AAN motifs in sRNAs and target mRNAs, after which an arginine patch on the rim promotes base pairing between their complementary sequences. In the cell, Hfq must discriminate between many similar RNAs. Here, we report that acidic amino acids lining the sRNA binding channel between the inner pore and rim of the Hfq hexamer contribute to the selectivity of Hfq's chaperone activity. RNase footprinting, in vitro binding and stopped-flow fluorescence annealing assays showed that alanine substitution of D9, E18 or E37 strengthened RNA interactions with the rim of Hfq and increased annealing of non-specific or U-tailed RNA oligomers. Although the mutants were less able than wild-type Hfq to anneal sRNAs with wild-type rpoS mRNA, the D9A mutation bypassed recruitment of Hfq to an (AAN)4 motif in rpoS, both in vitro and in vivo. These results suggest that acidic residues normally modulate access of RNAs to the arginine patch. We propose that this selectivity limits indiscriminate target selection by E. coli Hfq and enforces binding modes that favor genuine sRNA and mRNA pairs. PMID:26196441

  9. Cationic Mucic Acid Polymer-Based siRNA Delivery Systems.

    PubMed

    Pan, Dorothy W; Davis, Mark E

    2015-08-19

    Nanoparticle (NP) delivery systems for small interfering RNA (siRNA) that have good systemic circulation and high nucleic acid content are highly desired for translation into clinical use. Here, a family of cationic mucic acid-containing polymers is synthesized and shown to assemble with siRNA to form NPs. A cationic mucic acid polymer (cMAP) containing alternating mucic acid and charged monomers is synthesized. When combined with siRNA, cMAP forms NPs that require steric stabilization by poly(ethylene glycol) (PEG) that is attached to the NP surface via a 5-nitrophenylboronic acid linkage (5-nitrophenylboronic acid-PEGm (5-nPBA-PEGm)) to diols on mucic acid in the cMAP in order to inhibit aggregation in biological fluids. As an alternative, cMAP is covalently conjugated with PEG via two methods. First, a copolymer is prepared with alternating cMAP-PEG units that can form loops of PEG on the surface of the formulated siRNA-containing NPs. Second, an mPEG-cMAP-PEGm triblock polymer is synthesized that could lead to a PEG brush configuration on the surface of the formulated siRNA-containing NPs. The copolymer and triblock polymer are able to form stable siRNA-containing NPs without and with the addition of 5-nPBA-PEGm. Five formulations, (i) cMAP with 5-nPBA-PEGm, (ii) cMAP-PEG copolymer both (a) with and (b) without 5-nPBA-PEGm, and (iii) mPEG-cMAP-PEGm triblock polymer both (a) with and (b) without 5-nPBA-PEGm, are used to produce NPs in the 30-40 nm size range, and their circulation times are evaluated in mice using tail vein injections. The mPEG-cMAP-PEGm triblock polymer provides the siRNA-containing NP with the longest circulation time (5-10% of the formulation remains in circulation at 60 min postdosing), even when a portion of the excess cationic components used in the formulation is filtered away prior to injection. A NP formulation using the mPEG-cMAP-PEGm triblock polymer that is free of excess components could contain as much as ca. 30 wt % siRNA. PMID

  10. Effects of starvation for potassium and other inorganic ions on protein degradation and ribonucleic acid synthesis in Escherichia coli.

    PubMed

    St John, A C; Goldberg, A L

    1980-09-01

    Starvation of Escherichia coli for potassium, phosphate, or magnesium ions leads to a reversible increase in the rate of protein degradation and an inhibition of ribonucleic acid (RNA) synthesis. In cells deprived of potassium, the breakdown of the more stable cell proteins increased two- to threefold, whereas the hydrolysis of short-lived proteins, both normal ones and analog-containing polypeptides, did not change. The mechanisms initiating the enhancement of proteolysis during starvation for these ions were examined. Upon starvation for amino acids or amino acyl-transfer RNA (tRNA), protein breakdown increases in relA+ (but not relA) cells as a result of the rapid synthesis of guanosine-5'-diphosphate-3'-diphosphate (ppGpp). However, a lack of amino acyl-tRNA does not appear to be responsible for the increased protein breakdown in cells starved for inorganic ions, since protein breakdown increased in the absence of these ions in both relA+ and relA cultures, and since a large excess of amino acids did not affect this response. In bacteria in which energy production is restricted, ppGpp levels also rise, and protein breakdown increases. The ion-deprived cultures did show a 40 to 75% reduction in adenosine-5'-triphosphate levels,l similar to that seen upon glucose starvation. However, this decrease in ATP content does not appear to cause the increase in protein breakdown or lead to an accumulation of ppGpp. No consistent change in intracellular ppGpp levels was found in relA+ or relA cells starved for these ions. In addition, in relX mutants, removal of these ions led to accelerated protein degradation even though relX cells are unable to increase ppGpp levels or proteolysis when deprived of a carbon source. In the potassium-, phosphate-, and magnesium-deprived cultures, the addition of choramphenicol or tetracycline caused a reduction in protein breakdown toward basal levels. Such findings, however, do not indicate that protein synthesis is essential for the

  11. Synthesis of nucleic acid methylphosphonates via the 1-hydroxybenzotriazole phosphotriester approach.

    PubMed Central

    Marugg, J E; de Vroom, E; Dreef, C E; Tromp, M; van der Marel, G A; van Boom, J H

    1986-01-01

    Dinucleoside methylphosphonates can easily be prepared starting from properly protected d-nucleosides and the bifunctional phosphorylating reagent methyl-O,O-bis(1-benzotriazolyl)phosphate. Separation of the diastereoisomers of 5'-DMTR-d-Ap(Me)T-3'-lev affords optically pure dinucleoside methylphosphonates which, after removal of the 3'-levulinoyl group, have been used for the synthesis of the two optically pure diastereoisomers of the hexamer d-CpGpAp(Me)TpCpG. Further, a one-pot procedure for the preparation of uridine-3',5'-cyclic methylphosphonate will be described. We also found that 3',5'-methylphosphonate linkages in RNA are not stable towards mild acid treatment. PMID:3457366

  12. Synthesis and characterization of acidic mesoporous borosilicate thin films.

    PubMed

    Xiu, Tongping; Liu, Qian; Wang, Jiacheng

    2009-02-01

    Work on the synthesis and characterization of acidic wormhole-like ordered mesoporous borosilicate thin films (MBSTFs) on silicon wafers is described in this paper. The MBSTFs coated by the dip-coating method were prepared through an evaporation-induced self-assembly (EISA) process using nonionic block copolymers as structure-directing agents. Fourier transform infrared (FT-IR) spectroscopy confirmed the formation of borosiloxane bonds (Si-O-B). High-resolution transmission electron microscopy (HRTEM) and N2 sorption evidenced a wormhole-like mesoporous structure in the MBSTFs obtained. Scanning electron microscopy (SEM) images of the cross sections and surfaces of the samples showed that MBSTFs on silicon wafers were continuous, homogeneous and did not crack. The acidic properties of the MBSTFs were characterized by FT-IR spectra of chemisorbed pyridine. The MBSTFs thus prepared may find their future applications in many fields including chemical sensors, catalysis, optical coating, molecule separation, etc. PMID:19441565

  13. Effect of mitochondrial ascorbic acid synthesis on photosynthesis.

    PubMed

    Senn, M E; Gergoff Grozeff, G E; Alegre, M L; Barrile, F; De Tullio, M C; Bartoli, C G

    2016-07-01

    Ascorbic acid (AA) is synthesized in plant mitochondria through the oxidation of l-galactono-1,4-lactone (l-GalL) and then distributed to different cell compartments. AA-deficient Arabidopsis thaliana mutants (vtc2) and exogenous applications of l-GalL were used to generate plants with different AA content in their leaves. This experimental approach allows determining specific AA-dependent effects on carbon metabolism. No differences in O2 uptake, malic and citric acid and NADH content suggest that AA synthesis or accumulation did not affect mitochondrial activity; however, l-GalL treatment increased CO2 assimilation and photosynthetic electron transport rate in vtc2 (but not wt) leaves demonstrating a stimulation of photosynthesis after l-GalL treatment. Increased CO2 assimilation correlated with increased leaf stomatal conductance observed in l-GalL-treated vtc2 plants. PMID:27010742

  14. Electrocarboxylation: towards sustainable and efficient synthesis of valuable carboxylic acids

    PubMed Central

    Matthessen, Roman; Fransaer, Jan; Binnemans, Koen

    2014-01-01

    Summary The near-unlimited availability of CO2 has stimulated a growing research effort in creating value-added products from this greenhouse gas. This paper presents the trends on the most important methods used in the electrochemical synthesis of carboxylic acids from carbon dioxide. An overview is given of different substrate groups which form carboxylic acids upon CO2 fixation, including mechanistic considerations. While most work focuses on the electrocarboxylation of substrates with sacrificial anodes, this review considers the possibilities and challenges of implementing other synthetic methodologies. In view of potential industrial application, the choice of reactor setup, electrode type and reaction pathway has a large influence on the sustainability and efficiency of the process. PMID:25383120

  15. Ribonucleic acid synthesis in the renal cortex at the initiation of compensatory growth.

    PubMed Central

    Cortes, P; Levin, N W; Martin, P R

    1976-01-01

    The mechanisms responsible for the increase in RNA per cell during the first 48h of renal compensatory growth were studied in the renal cortex. Unilaterally nephrectomized, sham-operated or non-operated rats were used. Incorporation into RNA of labelled precursors was studied in vivo and in vitro. Sham-operation produced significant changes in precursor incorporation, absolute amounts of UTP and RNA, and the rate of RNA synthesis. At 6h after surgery, the amount of RNA decreased in sham-operated controls, whereas that in growing cortex remained unchanged. Incorporation into RNA in vivo was greater in the growing cortex, although the rate of RNA synthesis was not increased. At 24h, precursor incorporation into RNA and UTP and RNA synthesis were all increased in the growing cortex. In contrast with results obtained in vivo, slices of growing cortex incorporated less labelled precursor into RNA than did cortex slices from sham-operated controls, from 3 to 48h. Maximal differences were found from 6 to 24h. An attempt was made to equalize endogenous precursor pool sizes by increasing the concentration of unlabelled uridine in the media; incorporation differences were narrowed significantly. Serum from nephrectomized animals did not increase precursor incorporation into RNA in vitro. An increase in RNA synthesis is an important factor in RNA accretion in the renal cortex beyond 12h of compensatory growth. This is accompanied by increased UTP content and preceded by expansion of other pools. The amount of labelled precursor incorporated into RNA is greatly influenced by its delivery rate to the growing kidney in vivo and by intracellular dilution of expanded precursor pools in vitro. PMID:985437

  16. miR-122, a mammalian liver-specific microRNA, is processed from hcr mRNA and may downregulate the high affinity cationic amino acid transporter CAT-1.

    PubMed

    Chang, Jinhong; Nicolas, Emmanuelle; Marks, Debora; Sander, Chris; Lerro, Anthony; Buendia, Marie Annick; Xu, Chunxiao; Mason, William S; Moloshok, Thomas; Bort, Roque; Zaret, Kenneth S; Taylor, John M

    2004-07-01

    These studies show that miR-122, a 22-nucleotide microRNA, is derived from a liver-specific noncoding polyadenylated RNA transcribed from the gene hcr. The exact sequence of miR-122 as well as the adjacent secondary structure within the hcr mRNA are conserved from mammalian species back to fish. Levels of miR-122 in the mouse liver increase to half maximal values around day 17 of embryogenesis, and reach near maximal levels of 50,000 copies per average cell before birth. Lewis et al. (2003) predicted the cationic amino acid transporter (CAT-1 or SLC7A1) as a miR-122 target. CAT-1 protein and its mRNA are expressed in all mammalian tissues but with lower levels in adult liver. Furthermore, during mouse liver development CAT-1 mRNA decreases in an almost inverse correlation with miR-122. Eight potential miR-122 target sites were predicted within the human CAT-1 mRNA, with six in the 3'-untranslated region. Using a reporter construct it was found that just three of the predicted sites, linked in a 400-nucleotide sequence from human CAT-1, acted with synergy and were sufficient to strongly inhibit protein synthesis and reduce mRNA levels. In summary, these studies followed the accumulation during development of miR-122 from its mRNA precursor, hcr, through to identification of what may be a specific mRNA target, CAT-1. PMID:17179747

  17. Synthesis of 14C-labeled perfluorooctanoic and perfluorodecanoic acids; Purification of perfluorodecanoic acid

    SciTech Connect

    Reich, I.L.; Reich, H.J.; Menahan, L.A.; Peterson, R.E.

    1987-01-01

    Perfluorooctanoic and -decanoic acids are representative of a series of perfluorinated acids that have been used for a variety of industrial purposes primarily due to their surfactant properties. The toxicity of these compounds is being investigated in a number of laboratories. 14C-labeled materials would be useful in these studies but are not commercially available. Johncock prepared unlabeled PFOA in low yield by carbonation of the unstable perfluoroheptyllithium at -90 degrees Centigrade. We anticipated several problems in applying this procedure to the synthesis of the 14C-labeled material. Johncock's procedure was run on a fairly large scale (10 mmol) with excess CO2.

  18. Sequences more than 500 base pairs upstream of the human U3 small nuclear RNA gene stimulate the synthesis of U3 RNA in frog oocytes

    SciTech Connect

    Suh, D.; Reddy, R. ); Wright, D. )

    1991-06-04

    Small nuclear RNA (snRNA) genes contain strong promoters capable of initiating transcription once every 4 s. Studies on the human U1 snRNA gene, carried out in other laboratories, showed that sequences within 400 bp of the 5' flanking region are sufficient for maximal levels of transcription both in vivo and in frog oocytes (reviewed in Dahlberg and Lund (1988)). The authors studied the expression of a human U3 snRNA gene by injecting 5' deletion mutants into frog oocytes. The results show that sequences more than 500 bp upstream of the U3 snRNA gene have a 2-3-fold stimulatory effect on the U3 snRNA synthesis. These results indicate that the human U3 snRNA gene is different from human U1 snRNA gene in containing regulatory elements more than 500 bp upstream. The U3 snRNA gene upstream sequences contain an AluI homologous sequence in the {minus}1,200 region; these AluI sequences were transcribed in vitro and in frog oocytes but were not detectable in Hela cells.

  19. Function of DNA polymerase I in RNA-primed synthesis of bacteriophage M-13 duplex DNA.

    PubMed Central

    Schneck, P K; Staudenbauer, W L; Hofschneider, P H

    1976-01-01

    Cell-free extracts from Escherichia coli contain a DNA polymerase activity resistant to SH-blocking agents, which is capable of synthesizing complementary strand DNA on a circular M-13 DNA template by extension of RNA primers. This activity is considered to be identical with DNA polymerase I (or some altered form of this enzyme) since it is missing in extracts from po1A- cells. DNA synthesis in the presence of SH-blocking agents occurs at a reduced rate as compared to untreated controls and leads to the formation of DNA chains of defined size (0.4-0.5 genome's length). It is concluded that efficient M-13 duplex DNA synthesis requires the cooperation of both DNA polymerase I and III. PMID:1272793

  20. Temporal aspects of DNA and RNA synthesis during human immunodeficiency virus infection: Evidence for differential gene expression

    SciTech Connect

    Kim, Sunyoung; Baltimore, D. Massachusetts Institute of Technology, Cambridge ); Byrn, R.; Groopman, J. )

    1989-09-01

    The kinetics of retroviral DNA and RNA synthesis are parameters vital to understanding viral growth, especially for human immunodeficiency virus (HIV), which encodes several of its own regulatory genes. The authors have established a single-cycle growth condition for HIV in H9 cells, a human CD4{sup +} lymphocyte line. The full-length viral linear DNA is first detectable by 4 h postinfection. During a one-step growth of HIV, amounts of viral DNA gradually increase until 8 to 12 h postinfection and then decrease. The copy number of unintegrated viral DNA is not extraordinarily high even at its peak. Most strikingly, there is a temporal program of RNA accumulation: the earliest RNA is greatly enriched in the 2-kilobase subgenomic mRNA species, while the level of 9.2-kilobase RNA which is both genomic RNA and mRNA remains low until after 24 h of infection. Virus production begins at about 24 h postinfection. Thus, viral DNA synthesis is as rapid as for other retroviruses, but viral RNA synthesis involves temporal alteration in the species that accumulate, presumably as a consequence of viral regulatory genes.

  1. Alternative kynurenic acid synthesis routes studied in the rat cerebellum

    PubMed Central

    Blanco Ayala, Tonali; Lugo Huitrón, Rafael; Carmona Aparicio, Liliana; Ramírez Ortega, Daniela; González Esquivel, Dinora; Pedraza Chaverrí, José; Pérez de la Cruz, Gonzalo; Ríos, Camilo; Schwarcz, Robert; Pérez de la Cruz, Verónica

    2015-01-01

    Kynurenic acid (KYNA), an astrocyte-derived, endogenous antagonist of α7 nicotinic acetylcholine and excitatory amino acid receptors, regulates glutamatergic, GABAergic, cholinergic and dopaminergic neurotransmission in several regions of the rodent brain. Synthesis of KYNA in the brain and elsewhere is generally attributed to the enzymatic conversion of L-kynurenine (L-KYN) by kynurenine aminotransferases (KATs). However, alternative routes, including KYNA formation from D-kynurenine (D-KYN) by D-amino acid oxidase (DAAO) and the direct transformation of kynurenine to KYNA by reactive oxygen species (ROS), have been demonstrated in the rat brain. Using the rat cerebellum, a region of low KAT activity and high DAAO activity, the present experiments were designed to examine KYNA production from L-KYN or D-KYN by KAT and DAAO, respectively, and to investigate the effect of ROS on KYNA synthesis. In chemical combinatorial systems, both L-KYN and D-KYN interacted directly with peroxynitrite (ONOO−) and hydroxyl radicals (OH•), resulting in the formation of KYNA. In tissue homogenates, the non-specific KAT inhibitor aminooxyacetic acid (AOAA; 1 mM) reduced KYNA production from L-KYN and D-KYN by 85.1 ± 1.7% and 27.1 ± 4.5%, respectively. Addition of DAAO inhibitors (benzoic acid, kojic acid or 3-methylpyrazole-5-carboxylic acid; 5 μM each) attenuated KYNA formation from L-KYN and D-KYN by ~35% and ~66%, respectively. ONOO− (25 μM) potentiated KYNA production from both L-KYN and D-KYN, and these effects were reduced by DAAO inhibition. AOAA attenuated KYNA production from L-KYN + ONOO− but not from D-KYN + ONOO−. In vivo, extracellular KYNA levels increased rapidly after perfusion of ONOO− and, more prominently, after subsequent perfusion with L-KYN or D-KYN (100 μM). Taken together, these results suggest that different mechanisms are involved in KYNA production in the rat cerebellum, and that, specifically, DAAO and ROS can function as alternative

  2. Synthesis and applications of selectively {sup 13}C-labeled RNA

    SciTech Connect

    SantaLucia, J. Jr.; Shen, L.X.; Lewis, H.; Cai, Z.; Tinoci, I. Jr.

    1994-12-01

    Spectral overlap is a substantial problem in NMR studies of RNA molecules >30 nucleotides. To overcome this difficulty, we synthesized selectively {sup 13}C-labeled RNAs and adapted several isotope-edited two- and three-dimensional NMR experiments originally developed for protein studies. We optimized protocols for synthesis of multi-gram quantities of CTP, UTp, ATP, and GTP using a combination of synthetic organic and enzymatic methods. Uracil is prepared in 40 to 50% yield from {sup 13}C-cyanide in two steps. Using acetyl- tribenzoyl-ribose and standard chemistry uracil is then attached to the sugar (90% yield). The tribenzoyl-uridine intermediate is converted into uridine or cytidine quantitatively, depending on the deblocking protocol. Labeled purines are synthesized using simple pyrimidine precursors and reacting with {sup 13}C-formic acid (80% yield). Purine nucleosides are then synthesized using uridine phosphorylase and purine nucleoside phosphorylase. The nucleosides were converted to NMPs by treatment with POC1{sub 3} in triethylphosphate. We converted NMPs to NTPs by standard enzymatic methods. Selectively labeled RNAs were synthesized by run-off transcription using {sup 13}C-labeled NTPs. Several different strategies help solve over-lap problems in larger RNAs. Isotope-edited two-dimensional NMR experiments such as {omega}1-1/2 X-filtered NOESY simplify NMR spectra by dividing the normal NOESY spectrum into two subspectra-one involving NOEs from protons bound to {sup 12}C and one from protons bound to {sup 13}C. For example, we labeled A and U residues of a 34-nucleotide pseudoknot, and the {sup 12}C subspectrum of the 1/2 X-filtered NOESY contained NOEs only from G and C residues (along with adenine 2H); the {sup 13}C subspectrum contained NOEs only from A and U residues. Each subspectrum has less overlap than the NOESY of an unlabeled sample; the editing strategy allows each resonance to be identified by residue type (A, C, G, or U).

  3. Design, synthesis and biological evaluation of dinucleotide mRNA cap analog containing propargyl moiety.

    PubMed

    Shanmugasundaram, Muthian; Charles, Irudaya; Kore, Anilkumar R

    2016-03-15

    The first example of the synthesis of new dinucleotide cap analog containing propargyl group such as m(7,3'-)(O)(-propargyl)G[5']ppp[5']G is reported. The effect of propargyl cap analog with standard cap was evaluated with respect to their capping efficiency, in vitro T7 RNA polymerase transcription efficiency, and translation activity using cultured HeLa cells. It is noteworthy that propargyl cap analog outperforms standard cap by 3.1 fold in terms of translational properties. The propargyl cap analog forms a more stable complex with translation initiation factor eIF4E based on the molecular modeling studies. PMID:26899596

  4. AMINO ACIDS AUGMENT MUSCLE PROTEIN SYNTHESIS IN NEONATAL PIGS DURING ENDOTOXEMIA BY MODULATING TRANSLATION INITIATION

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In adults, sepsis reduces protein synthesis in skeletal muscle by restraining translation. The effect of sepsis on amino acid-stimulated muscle protein synthesis has not been determined in neonates, a population who is highly anabolic and whose muscle protein synthesis rates are uniquely sensitive ...

  5. Efficient transfer of information from hexitol nucleic acids to RNA during nonenzymatic oligomerization

    NASA Technical Reports Server (NTRS)

    Kozlov, I. A.; De Bouvere, B.; Van Aerschot, A.; Herdewijn, P.; Orgel, L. E.

    1999-01-01

    Hexitol nucleic acids (HNAs) are DNA analogues that contain the standard nucleoside bases attached to a phosphorylated 1,5-anhydrohexitol backbone. We find that HNAs support efficient information transfer in nonensymatic template-directed reactions. HNA heterosequences appeared to be superior to the corresponding DNA heterosequences in facilitating synthesis of complementary oligonucleotides from nucleoside-5'-phosphoro-2-methyl imidazolides.

  6. Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway

    PubMed Central

    Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z.; Yazdani, Syed Shams

    2016-01-01

    Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817

  7. Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway.

    PubMed

    Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z; Yazdani, Syed Shams

    2016-01-01

    Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817

  8. CNP2 mRNA directs synthesis of both CNP1 and CNP2 polypeptides.

    PubMed

    O'Neill, R C; Minuk, J; Cox, M E; Braun, P E; Gravel, M

    1997-10-15

    The ribosome scanning model for translational initiation predicts that eukaryotic mRNAs should, as a rule, be monocistronic. However, cases have recently been described of eukaryotic mRNAs producing more than one protein through alternative translational initiation at several different AUG codons. The present work reports the occurrence of two translational start sites on the mRNA encoding isoform 2 of the myelin marker enzyme 2',3'-cyclic nucleotide 3'-phosphodiesterase (CNP) in rat and mouse. We show that the CNP2 mRNA is able to direct synthesis of not only CNP2, but also CNP1 polypeptide. Immunoprecipitation experiments using a polyclonal antibody directed against CNP detect both CNP isoforms in tissues or cell lines expressing only the CNP2 transcript. Thus, the synthesis of CNP1 and CNP2 polypeptides must be encoded by the CNP2 transcript. In vitro translation of synthetic CNP2 mRNA demonstrates that both CNP isoforms are synthesized by initiation at different AUG codons. Furthermore, by introducing mutations to "switch off" translation from the second in-frame AUG codon in the CNP2 cDNA, and transfecting 293T cells with those constructs, we are able to correlate the production of CNP1 and CNP2 with different translational start sites. These results lead us to conclude that the CNP2 mRNA is able to produce both CNP1 and CNP2 polypeptides. This investigation has altered our understanding of the temporal expression of the CNP protein isoforms during development of the central nervous system (CNS). PMID:9373034

  9. Total synthesis of the squalene synthase inhibitor zaragozic acid C.

    PubMed

    Nakamura, Seiichi

    2005-01-01

    Zaragozic acids and squalestatins were documented by Merck, Glaxo, and Tokyo Noko University/Mitsubishi Kasei Corporation as part of a program aimed at identifying novel inhibitors of squalene synthase, as well as farnesyl transferase. These natural products have attracted considerable attention from numerous synthetic chemists because of their therapeutic potential and novel architecture. This review highlights our total syntheses of zaragozic acid C by two convergent strategies. The key steps in our first-generation synthesis involve 1) simultaneous creation of the C4 and C5 quaternary stereocenters through the Sn(OTf)2-promoted aldol coupling reaction between the alpha-keto ester and silyl ketene thioacetal derived from L- and D-tartaric acids, respectively; and 2) construction of the bicyclic core structure via acid-catalyzed internal ketalization under kinetically controlled conditions. The second-generation strategy relies on a tandem carbonyl ylide formation/1,3-dipolar cycloaddition approach and features elongation of the C1 alkyl side chain through an olefin cross-metathesis as well as high convergency and flexibility. PMID:15635219

  10. Synthesis and scavenging role of furan fatty acids

    PubMed Central

    Lemke, Rachelle A. S.; Peterson, Amelia C.; Ziegelhoffer, Eva C.; Westphall, Michael S.; Tjellström, Henrik; Coon, Joshua J.; Donohue, Timothy J.

    2014-01-01

    Fatty acids play important functional and protective roles in living systems. This paper reports on the synthesis of a previously unidentified 19 carbon furan-containing fatty acid, 10,13-epoxy-11-methyl-octadecadienoate (9-(3-methyl-5-pentylfuran-2-yl)nonanoic acid) (19Fu-FA), in phospholipids from Rhodobacter sphaeroides. We show that 19Fu-FA accumulation is increased in cells containing mutations that increase the transcriptional response of this bacterium to singlet oxygen (1O2), a reactive oxygen species generated by energy transfer from one or more light-excited donors to molecular oxygen. We identify a previously undescribed class of S-adenosylmethionine-dependent methylases that convert a phospholipid 18 carbon cis unsaturated fatty acyl chain to a 19 carbon methylated trans unsaturated fatty acyl chain (19M-UFA). We also identify genes required for the O2-dependent conversion of this 19M-UFA to 19Fu-FA. Finally, we show that the presence of 1O2 leads to turnover of 19Fu-Fa in vivo. We propose that furan-containing fatty acids like 19Fu-FA can act as a membrane-bound scavenger of 1O2, which is naturally produced by integral membrane enzymes of the R. sphaeroides photosynthetic apparatus. PMID:25092314

  11. The effect of linoleic acid on the whole body synthesis rates of polyunsaturated fatty acids from α-linolenic acid and linoleic acid in free-living rats.

    PubMed

    Domenichiello, Anthony F; Kitson, Alex P; Chen, Chuck T; Trépanier, Marc-Olivier; Stavro, P Mark; Bazinet, Richard P

    2016-04-01

    Docosahexaenoic acid (DHA) is thought to be important for brain function. The main dietary source of DHA is fish, however, DHA can also be synthesized from precursor omega-3 polyunsaturated fatty acids (n-3 PUFA), the most abundantly consumed being α-linolenic acid (ALA). The enzymes required to synthesize DHA from ALA are also used to synthesize longer chain omega-6 (n-6) PUFA from linoleic acid (LNA). The large increase in LNA consumption that has occurred over the last century has led to concern that LNA and other n-6 PUFA outcompete n-3 PUFA for enzymes involved in DHA synthesis, and therefore, decrease overall DHA synthesis. To assess this, rats were fed diets containing LNA at 53 (high LNA diet), 11 (medium LNA diet) or 1.5% (low LNA diet) of the fatty acids with ALA being constant across all diets (approximately 4% of the fatty acids). Rats were maintained on these diets from weaning for 8 weeks, at which point they were subjected to a steady-state infusion of labeled ALA and LNA to measure DHA and arachidonic acid (ARA) synthesis rates. DHA and ARA synthesis rates were generally highest in rats fed the medium and high LNA diets, while the plasma half-life of DHA was longer in rats fed the low LNA diet. Therefore, increasing dietary LNA, in rats, did not impair DHA synthesis; however, low dietary LNA led to a decrease in DHA synthesis with tissue concentrations of DHA possibly being maintained by a longer DHA half-life. PMID:27012633

  12. In Vivo RNAi Efficacy of Palmitic Acid-Conjugated Dicer-Substrate siRNA in a Subcutaneous Tumor Mouse Model.

    PubMed

    Kubo, Takanori; Yanagihara, Kazuyoshi; Seyama, Toshio

    2016-06-01

    Short interfering RNAs are used in RNA interference technology and are powerful tools for target gene silencing in a sequence-specific manner. In this study, we synthesized Dicer-substrate siRNAs consisting of 27-nt double-stranded RNAs conjugated with palmitic acid at the 5'-end of the sense strand and investigated their RNA interference efficacies in vitro and in vivo. The palmitic acid-conjugated 27-nt DsiRNAs (C16-Dsi27RNAs) were prepared by our simple synthesis strategy and achieved a good yield. C16-Dsi27RNAs showed enhanced in vitro RNA interference potency compared with not only non-modified Dsi27RNAs but also cholesterol-conjugated Dsi27RNAs against both an exogenous enhanced green fluorescent protein and the endogenous vascular endothelial growth factor gene in a human scirrhous-type gastric cancer cell line that stably expressed the enhanced green fluorescent protein gene (GCIY-eGFP). Additionally, C16-Dsi27RNAs had potent gene silencing activity against both enhanced green fluorescent protein and vascular endothelial growth factor as target genes in a subcutaneous tumor mouse model generated from GCIY-eGFP cells administered by intratumoral injection. These results suggest that the C16-Dsi27RNAs will be useful next-generation RNA interference molecules that can overcome the problems associated with RNA interference technology. PMID:26800111

  13. Synthesis of acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters

    DOEpatents

    Moens, Luc

    2003-06-24

    A process of preparing an acid addition salt of delta-aminolevulinc acid comprising: a) dissolving a lower alkyl 5-bromolevulinate and hexamethylenetetramine in a solvent selected from the group consisting of water, ethyl acetate, chloroform, acetone, ethanol, tetrahydrofuran and acetonitrile, to form a quaternary ammonium salt of the lower alkyl 5-bromolevulinate; and b) hydrolyzing the quaternary ammonium salt with an inorganic acid to form an acid addition salt of delta-aminolevulinic acid.

  14. Diversity of putative archaeal RNA viruses in metagenomic datasets of a yellowstone acidic hot spring.

    PubMed

    Wang, Hongming; Yu, Yongxin; Liu, Taigang; Pan, Yingjie; Yan, Shuling; Wang, Yongjie

    2015-01-01

    Two genomic fragments (5,662 and 1,269 nt in size, GenBank accession no. JQ756122 and JQ756123, respectively) of novel, positive-strand RNA viruses that infect archaea were first discovered in an acidic hot spring in Yellowstone National Park (Bolduc et al., 2012). To investigate the diversity of these newly identified putative archaeal RNA viruses, global metagenomic datasets were searched for sequences that were significantly similar to those of the viruses. A total of 3,757 associated reads were retrieved solely from the Yellowstone datasets and were used to assemble the genomes of the putative archaeal RNA viruses. Nine contigs with lengths ranging from 417 to 5,866 nt were obtained, 4 of which were longer than 2,200 nt; one contig was 204 nt longer than JQ756122, representing the longest genomic sequence of the putative archaeal RNA viruses. These contigs revealed more than 50% sequence similarity to JQ756122 or JQ756123 and may be partial or nearly complete genomes of novel genogroups or genotypes of the putative archaeal RNA viruses. Sequence and phylogenetic analyses indicated that the archaeal RNA viruses are genetically diverse, with at least 3 related viral lineages in the Yellowstone acidic hot spring environment. PMID:25918685

  15. Acid Sensitive Polymeric Micelles Combining Folate and Bioreducible Conjugate for Specific Intracellular siRNA Delivery.

    PubMed

    Yang, Yanfang; Xia, Xuejun; Dong, Wujun; Wang, Hongliang; Li, Lin; Ma, Panpan; Sheng, Wei; Xu, Xueqing; Liu, Yuling

    2016-05-01

    An efficiently siRNA transporting nanocarrier still remains to be developed. In this study, utilizing the dual stimulus of acid tumor extracellular environment and redox effect of glutathione in the cytosol, a new siRNA transporting system combining triple effects of folate targeting, acid sensitive polymer micelles, and bio-reducible disulfide bond linked siRNA-cell penetrating peptides (CPPs) conjugate is developed to suppress c-myc gene expression of breast cancer (MCF-7 cells) both in vitro and in vivo. Subsequent research demonstrates that the vesicle has particle size of about 100 nm and siRNA entrapment efficiency of approximately 80%. In vitro studies verified over 90% of encapsulated siRNA-CPPs can be released and the vesicle shows higher cellular uptake in response to the tumorous zone. Determination of gene expression at both mRNA and protein levels indicates the constructed vesicle exhibited enhanced cancer cell apoptosis and improved therapeutic efficacy in vitro and in vivo. PMID:26822264

  16. Natural and artificial binders of polyriboadenylic acid and their effect on RNA structure

    PubMed Central

    Musumeci, Domenica; Roviello, Valentina; Pirtskhalava, Marina; Egoyan, Alexander; Mirtskhulava, Merab

    2015-01-01

    Summary The employment of molecular tools with nucleic acid binding ability to specifically control crucial cellular functions represents an important scientific area at the border between biochemistry and pharmaceutical chemistry. In this review we describe several molecular systems of natural or artificial origin, which are able to bind polyriboadenylic acid (poly(rA)) both in its single-stranded or structured forms. Due to the fundamental role played by the poly(rA) tail in the maturation and stability of mRNA, as well as in the initiation of the translation process, compounds able to bind this RNA tract, influencing the mRNA fate, are of special interest for developing innovative biomedical strategies mainly in the field of anticancer therapy. PMID:26199837

  17. Interactions between tRNA identity nucleotides and their recognition sites in glutaminyl-tRNA synthetase determine the cognate amino acid affinity of the enzyme.

    PubMed

    Ibba, M; Hong, K W; Sherman, J M; Sever, S; Söll, D

    1996-07-01

    Sequence-specific interactions between aminoacyl-tRNA synthetases and their cognate tRNAs both ensure accurate RNA recognition and prevent the binding of noncognate substrates. Here we show for Escherichia coli glutaminyl-tRNA synthetase (GlnRS; EC 6.1.1.18) that the accuracy of tRNA recognition also determines the efficiency of cognate amino acid recognition. Steady-state kinetics revealed that interactions between tRNA identity nucleotides and their recognition sites in the enzyme modulate the amino acid affinity of GlnRS. Perturbation of any of the protein-RNA interactions through mutation of either component led to considerable changes in glutamine affinity with the most marked effects seen at the discriminator base, the 10:25 base pair, and the anticodon. Reexamination of the identity set of tRNA(Gln) in the light of these results indicates that its constituents can be differentiated based upon biochemical function and their contribution to the apparent Gibbs' free energy of tRNA binding. Interactions with the acceptor stem act as strong determinants of tRNA specificity, with the discriminator base positioning the 3' end. The 10:25 base pair and U35 are apparently the major binding sites to GlnRS, with G36 contributing both to binding and recognition. Furthermore, we show that E. coli tryptophanyl-tRNA synthetase also displays tRNA-dependent changes in tryptophan affinity when charging a noncognate tRNA. The ability of tRNA to optimize amino acid recognition reveals a novel mechanism for maintaining translational fidelity and also provides a strong basis for the coevolution of tRNAs and their cognate synthetases. PMID:8692925

  18. Indole diterpene synthetic studies. Total synthesis of (+)-nodulisporic acid F and construction of the heptacyclic cores of (+)-nodulisporic acids A and B and (-)-nodulisporic acid D.

    PubMed

    Smith, Amos B; Davulcu, Akin H; Cho, Young Shin; Ohmoto, Kazuyuki; Kürti, László; Ishiyama, Haruaki

    2007-06-22

    A first-generation strategy for construction of (+)-nodulisporic acids A (1) and B (2) is described. The strategy entails union of the eastern and western hemisphere subtargets via the indole synthesis protocol developed in our laboratory. Subsequent elaboration of rings E and F, however, revealed the considerable acid instability of the C(24) hydroxyl, thereby preventing further advancement. Nonetheless, preparation of the heptacyclic core of (+)-nodulisporic acids A and B, the total synthesis of (+)-nodulisporic acid F, the simplest member of the nodulisporic acid family, and elaboration of the heptacyclic core of (-)-nodulisporic acid D were achieved. PMID:17511507

  19. Lipoprotein Lipase, Tissue Expression and Effects on Genes Related to Fatty Acid Synthesis in Goat Mammary Epithelial Cells

    PubMed Central

    Zhao, Wang-Sheng; Hu, Shi-Liang; Yu, Kang; Wang, Hui; Wang, Wei; Loor, Juan; Luo, Jun

    2014-01-01

    Lipoprotein lipase (LPL) serves as a central factor in hydrolysis of triacylglycerol and uptake of free fatty acids from the plasma. However, there are limited data concerning the action of LPL on the regulation of milk fat synthesis in goat mammary gland. In this investigation, we describe the cloning and sequencing of the LPL gene from Xinong Saanen dairy goat mammary gland, along with a study of its phylogenetic relationships. Sequence analysis showed that goat LPL shares similarities with other species including sheep, bovine, human and mouse. LPL mRNA expression in various tissues determined by RT-qPCR revealed the highest expression in white adipose tissue, with lower expression in heart, lung, spleen, rumen, small intestine, mammary gland, and kidney. Expression was almost undetectable in liver and muscle. The expression profiles of LPL gene in mammary gland at early, peak, mid, late lactation, and the dry period were also measured. Compared with the dry period, LPL mRNA expression was markedly greater at early lactation. However, compared with early lactation, the expression was lower at peak lactation and mid lactation. Despite those differences, LPL mRNA expression was still greater at peak, mid, and late lactation compared with the dry period. Using goat mammary epithelial cells (GMEC), the in vitro knockdown of LPL via shRNA or with Orlistat resulted in a similar degree of down-regulation of LPL (respectively). Furthermore, knockdown of LPL was associated with reduced mRNA expression of SREBF1, FASN, LIPE and PPARG but greater expression of FFAR3. There was no effect on ACACA expression. Orlistat decreased expression of LIPE, FASN, ACACA, and PPARG, and increased FFAR3 and SREBF1 expression. The pattern of LPL expression was similar to the changes in milk fat percentage in lactating goats. Taken together, results suggest that LPL may play a crucial role in fatty acid synthesis. PMID:25501331

  20. Targeting of Arenavirus RNA Synthesis by a Carboxamide-Derivatized Aromatic Disulfide with Virucidal Activity

    PubMed Central

    Sepúlveda, Claudia S.; García, Cybele C.; Levingston Macleod, Jesica M.

    2013-01-01

    Several arenaviruses can cause severe hemorrhagic fever (HF) in humans, representing a public health threat in endemic areas of Africa and South America. The present study characterizes the potent virucidal activity of the carboxamide-derivatized aromatic disulfide NSC4492, an antiretroviral zinc finger-reactive compound, against Junín virus (JUNV), the causative agent of Argentine HF. The compound was able to inactivate JUNV in a time and temperature-dependent manner, producing more than 99 % reduction in virus titer upon incubation with virions at 37°C for 90 min. The ability of NSC4492-treated JUNV to go through different steps of the multiplication cycle was then evaluated. Inactivated virions were able to bind and enter into the host cell with similar efficiency as control infectious particles. In contrast, treatment with NSC4492 impaired the capacity of JUNV to drive viral RNA synthesis, as measured by quantitative RT-PCR, and blocked viral protein expression, as determined by indirect immunofluorescence. These results suggest that the disulfide NSC4492 targets on the arenavirus replication complex leading to impairment in viral RNA synthesis. Additionally, analysis of VLP produced in NSC4492-treated cells expressing JUNV matrix Z protein revealed that the compound may interact with Z resulting in an altered aggregation behavior of this protein, but without affecting its intrinsic self-budding properties. The potential perspectives of NSC4492 as an inactivating vaccinal compound for pathogenic arenaviruses are discussed. PMID:24278404

  1. Target-specific intracellular delivery of siRNA using degradable hyaluronic acid nanogels.

    PubMed

    Lee, Hyukjin; Mok, Hyejung; Lee, Soohyeon; Oh, Yu-Kyoung; Park, Tae Gwan

    2007-06-01

    Novel hyaluronic acid (HA) nanogels physically encapsulating small interfering RNA (siRNA) were fabricated by an inverse water-in-oil emulsion method. Thiol-conjugated HA dissolved in aqueous emulsion droplets was ultrasonically crosslinked via the formation of disulfide linkages to produce HA nanogels with a size distribution from 200 to 500 nm. Green fluorescence protein (GFP) siRNA was physically entrapped within the HA nanogels during the emulsion/crosslinking process. The HA/siRNA nanogels were readily taken up by HA receptor positive cells (HCT-116 cells) having HA-specific CD44 receptors on the surface. Release rates of siRNA from the HA nanogels could be modulated by changing the concentration of glutathione (GSH) in the buffer solution, indicating that the degradation/erosion of disulfide crosslinked HA nanogels, triggered by an intracellular reductive agent, controlled the release pattern of siRNA. When HA nanogels containing GFP siRNA were co-transfected with GFP plasmid/Lipofectamine to HCT-116 cells, a significant extent of GFP gene silencing was observed in both serum and non-serum conditions. The gene silencing effect was reduced in the presence of free HA in the transfection medium, revealing that HA nanogels were selectively taken up by HCT-116 cells via receptor mediated endocytosis. PMID:17408798

  2. Purification of a soluble template-dependent rhinovirus RNA polymerase and its dependence on a host cell protein for viral RNA synthesis.

    PubMed Central

    Morrow, C D; Lubinski, J; Hocko, J; Gibbons, G F; Dasgupta, A

    1985-01-01

    The soluble phase of the cytoplasm of human rhinovirus type 2-infected cells contains an enzymatic activity able to copy rhinovirion RNA without an added primer. This RNA-dependent RNA polymerase (replicase) makes a specific copy of the added rhinovirion RNA, as shown by hybridization of the product to its template RNA but not to other RNAs. The same replicase preparation also contains a virus-specific polyuridylic acid [poly(U)] polymerase activity which is dependent on added polyadenylic acid-oligouridylic acid template-primer. Both activities purify together until a step at which poly(U) polymerase but no replicase activity is recovered. Addition of a purified HeLa cell protein (host factor) to this poly(U) polymerase completely reconstitutes rhinovirus replicase activity. Host factor activity can be supplied by adding oligouridylic acid, suggesting that the host cell protein acts at the initiation step of rhinovirus RNA replication. A virus-specific 64,000-dalton protein purifies with both poly(U) polymerase and replicase activities. Images PMID:2981346

  3. Interactions between the Influenza A Virus RNA Polymerase Components and Retinoic Acid-Inducible Gene I

    PubMed Central

    Li, Weizhong; Chen, Hongjun; Sutton, Troy; Obadan, Adebimpe

    2014-01-01

    ABSTRACT The influenza A virus genome possesses eight negative-strand RNA segments in the form of viral ribonucleoprotein particles (vRNPs) in association with the three viral RNA polymerase subunits (PB2, PB1, and PA) and the nucleoprotein (NP). Through interactions with multiple host factors, the RNP subunits play vital roles in replication, host adaptation, interspecies transmission, and pathogenicity. In order to gain insight into the potential roles of RNP subunits in the modulation of the host's innate immune response, the interactions of each RNP subunit with retinoic acid-inducible gene I protein (RIG-I) from mammalian and avian species were investigated. Studies using coimmunoprecipitation (co-IP), bimolecular fluorescence complementation (BiFc), and colocalization using confocal microscopy provided direct evidence for the RNA-independent binding of PB2, PB1, and PA with RIG-I from various hosts (human, swine, mouse, and duck). In contrast, the binding of NP with RIG-I was found to be RNA dependent. Expression of the viral NS1 protein, which interacts with RIG-I, did not interfere with the association of RNA polymerase subunits with RIG-I. The association of each individual virus polymerase component with RIG-I failed to significantly affect the interferon (IFN) induction elicited by RIG-I and 5′ triphosphate (5′ppp) RNA in reporter assays, quantitative reverse transcription-PCR (RT-PCR), and IRF3 phosphorylation tests. Taken together, these findings indicate that viral RNA polymerase components PB2, PB1, and PA directly target RIG-I, but the exact biological significance of these interactions in the replication and pathogenicity of influenza A virus needs to be further clarified. IMPORTANCE RIG-I is an important RNA sensor to elicit the innate immune response in mammals and some bird species (such as duck) upon influenza A virus infection. Although the 5′-triphosphate double-stranded RNA (dsRNA) panhandle structure at the end of viral genome RNA is

  4. Expression of fatty acid synthesis genes and fatty acid accumulation in haematococcus pluvialis under different stressors

    PubMed Central

    2012-01-01

    Background Biofuel has been the focus of intensive global research over the past few years. The development of 4th generation biofuel production (algae-to-biofuels) based on metabolic engineering of algae is still in its infancy, one of the main barriers is our lacking of understanding of microalgal growth, metabolism and biofuel production. Although fatty acid (FA) biosynthesis pathway genes have been all cloned and biosynthesis pathway was built up in some higher plants, the molecular mechanism for its regulation in microalgae is far away from elucidation. Results We cloned main key genes for FA biosynthesis in Haematococcus pluvialis, a green microalga as a potential biodiesel feedstock, and investigated the correlations between their expression alternation and FA composition and content detected by GC-MS under different stress treatments, such as nitrogen depletion, salinity, high or low temperature. Our results showed that high temperature, high salinity, and nitrogen depletion treatments played significant roles in promoting microalgal FA synthesis, while FA qualities were not changed much. Correlation analysis showed that acyl carrier protein (ACP), 3-ketoacyl-ACP-synthase (KAS), and acyl-ACP thioesterase (FATA) gene expression had significant correlations with monounsaturated FA (MUFA) synthesis and polyunsaturated FA (PUFA) synthesis. Conclusions We proposed that ACP, KAS, and FATA in H. pluvialis may play an important role in FA synthesis and may be rate limiting genes, which probably could be modified for the further study of metabolic engineering to improve microalgal biofuel quality and production. PMID:22448811

  5. Protein Synthesis with Ribosomes Selected for the Incorporation of β-Amino Acids

    PubMed Central

    2016-01-01

    In an earlier study, β3-puromycin was used for the selection of modified ribosomes, which were utilized for the incorporation of five different β-amino acids into Escherichia coli dihydrofolate reductase (DHFR). The selected ribosomes were able to incorporate structurally disparate β-amino acids into DHFR, in spite of the use of a single puromycin for the selection of the individual clones. In this study, we examine the extent to which the structure of the β3-puromycin employed for ribosome selection influences the regio- and stereochemical preferences of the modified ribosomes during protein synthesis; the mechanistic probe was a single suppressor tRNACUA activated with each of four methyl-β-alanine isomers (1–4). The modified ribosomes were found to incorporate each of the four isomeric methyl-β-alanines into DHFR but exhibited a preference for incorporation of 3(S)-methyl-β-alanine (β-mAla; 4), i.e., the isomer having the same regio- and stereochemistry as the O-methylated β-tyrosine moiety of β3-puromycin. Also conducted were a selection of clones that are responsive to β2-puromycin and a demonstration of reversal of the regio- and stereochemical preferences of these clones during protein synthesis. These results were incorporated into a structural model of the modified regions of 23S rRNA, which included in silico prediction of a H-bonding network. Finally, it was demonstrated that incorporation of 3(S)-methyl-β-alanine (β-mAla; 4) into a short α-helical region of the nucleic acid binding domain of hnRNP LL significantly stabilized the helix without affecting its DNA binding properties. PMID:25982410

  6. Evidence for RNA synthesis-dependent and -independent pathways in stimulation of neurite outgrowth by nerve growth factor

    PubMed Central

    Burstein, David E.; Greene, Lloyd A.

    1978-01-01

    Studies on the mechanism of action of nerve growth factor (NGF) were carried out with PC12 rat pheochromocytoma cells. PC12 cells are uniquely useful for such studies because they respond to, but (unlike normal neurons) do not require, NGF and may undergo either generation or regeneration of neurites in response to NGF. Regeneration is defined here as NGF-dependent regrowth of neurites within 24 hr after subculture of NGF-treated PC12 cells. As in cultures of normal NGF-responsive neurons, neurite regeneration by PC12 cells occurs even in the presence of high concentrations of RNA synthesis inhibitors. Generation of neurites is defined as the de novo initiation of outgrowth when PC12 cells are exposed to NGF for the first time. In contrast to regeneration, neurite generation takes place with a lag of at least 24 hr and is blocked by low concentrations of RNA synthesis inhibitors. Such findings suggest that there are both RNA synthesis-dependent and -independent pathways in the mechanism whereby NGF stimulates neurite outgrowth. In addition, NGF-treated PC12 cells undergo a time-dependent loss of the capacity for neurite regeneration after pretreatment with RNA synthesis inhibitors or withdrawal of NGF. Such findings suggest that (i) initiation of neurite outgrowth requires NGF-stimulated, RNA synthesis-dependent accumulation of intracellular material(s), (ii) once such accumulation occurs, RNA synthesis-independent regeneration can occur (but only in the presence of NGF), and (iii) the turnover of such material(s) in the absence of their replacement leads to loss of the capacity for regeneration. A tentative sequence is presented for the events whereby NGF may stimulate neurite outgrowth. PMID:310552

  7. Nucleic acid chaperons: a theory of an RNA-assisted protein folding

    PubMed Central

    Biro, Jan C

    2005-01-01

    Background Proteins are assumed to contain all the information necessary for unambiguous folding (Anfinsen's principle). However, ab initio structure prediction is often not successful because the amino acid sequence itself is not sufficient to guide between endless folding possibilities. It seems to be a logical to try to find the "missing" information in nucleic acids, in the redundant codon base. Results mRNA energy dot plots and protein residue contact maps were found to be rather similar. The structure of mRNA is also conserved if the protein structure is conserved, even if the sequence similarity is low. These observations led me to suppose that some similarity might exist between nucleic acid and protein folding. I found that amino acid pairs, which are co-located in the protein structure, are preferentially coded by complementary codons. This codon complementarity is not perfect; it is suboptimal where the 1st and 3rd codon residues are complementary to each other in reverse orientation, while the 2nd codon letters may be, but are not necessarily, complementary. Conclusion Partial complementary coding of co-locating amino acids in protein structures suggests that mRNA assists in protein folding and functions not only as a template but even as a chaperon during translation. This function explains the role of wobble bases and answers the mystery of why we have a redundant codon base. PMID:16137324

  8. Mutation at position 791 in Escherichia coli 16S ribosomal RNA affects processes involved in the initiation of protein synthesis.

    PubMed Central

    Tapprich, W E; Goss, D J; Dahlberg, A E

    1989-01-01

    A single base was mutated from guanine to adenine at position 791 in 16S rRNA in the Escherichia coli rrnB operon on the multicopy plasmid pKK3535. The plasmid-coded rRNA was processed and assembled into 30S ribosomal subunits in E. coli and caused a retardation of cell growth. The mutation affected crucial functional roles of the 30S subunit in the initiation of protein synthesis. The affinity of the mutant 30S subunits for 50S subunits was reduced and the association equilibrium constant for initiation factor 3 was decreased by a factor of 10 compared to wild-type 30S subunits. The interrelationship among the region of residue 790 in 16S rRNA, subunit association, and initiation factor 3 binding during initiation complex formation, as revealed by this study, offers insights into the functional role of rRNA in protein synthesis. PMID:2662189

  9. Synthesis of E. faecium wall teichoic acid fragments.

    PubMed

    van der Es, Daan; Groenia, Nadia A; Laverde, Diana; Overkleeft, Herman S; Huebner, Johannes; van der Marel, Gijsbert A; Codée, Jeroen D C

    2016-09-01

    The first synthesis of different Enterococcus faecium wall teichoic acid (WTA) fragments is presented. The structure of these major cell wall components was elucidated recently and it was shown that these glycerolphosphate (GroP) based polymers are built up from -6-(GalNAc-α(1-3)-GalNAc-β(1-2)-GroP)- repeating units. We assembled WTA fragments up to three repeating units in length, in two series that differ in the stereochemistry of the glycerolphosphate moiety. The key GalNAc-GalNAc-GroP synthons, required for the synthesis, were generated from galactosazide building blocks that were employed in highly stereoselective glycosylation reactions to furnish both the α- and β-configured linkages. By comparing the NMR spectra of the synthesized fragments with the isolated material it appears that the hereto undefined stereochemistry of the glycerol phosphate moiety is sn-glycerol-3-phosphate. The generated fragments will be valuable tools to study their immunological activity at the molecular level. PMID:26993744

  10. Intermediates in the Synthesis of Type 2 Adenovirus Deoxyribonucleic Acid

    PubMed Central

    Horwitz, Marshall S.

    1971-01-01

    Intermediates in the synthesis of adenovirus type 2 deoxyribonucleic acid (DNA) were studied in HeLa cells. Pieces of DNA smaller than the viral genome were demonstrated after labeling with 3H-thymidine for 10 to 240 sec. Intermediates as small as the Okazaki fragments (8 to 10S) do not predominate at any of the above times. No detectable addition of nucleotides to parental genome could be shown, nor was there any breakdown of recently synthesized viral DNA. The DNA intermediates were of viral origin for they hybridized to viral DNA and were made at a stage of the cell cycle (G2) when host DNA is not synthesized. PMID:5132696

  11. Visualising single molecules of HIV-1 and miRNA nucleic acids

    PubMed Central

    2013-01-01

    Background The scarcity of certain nucleic acid species and the small size of target sequences such as miRNA, impose a significant barrier to subcellular visualization and present a major challenge to cell biologists. Here, we offer a generic and highly sensitive visualization approach (oligo fluorescent in situ hybridization, O-FISH) that can be used to detect such nucleic acids using a single-oligonucleotide probe of 19–26 nucleotides in length. Results We used O-FISH to visualize miR146a in human and avian cells. Furthermore, we reveal the sensitivity of O-FISH detection by using a HIV-1 model system to show that as little as 1–2 copies of nucleic acids can be detected in a single cell. We were able to discern newly synthesized viral cDNA and, moreover, observed that certain HIV RNA sequences are only transiently available for O-FISH detection. Conclusions Taken together, these results suggest that the O-FISH method can potentially be used for in situ probing of, as few as, 1–2 copies of nucleic acid and, additionally, to visualize small RNA such as miRNA. We further propose that the O-FISH method could be extended to understand viral function by probing newly transcribed viral intermediates; and discern the localisation of nucleic acids of interest. Additionally, interrogating the conformation and structure of a particular nucleic acid in situ might also be possible, based on the accessibility of a target sequence. PMID:23590669

  12. Synthesis of reinitiated transcripts by mammalian RNA polymerase II is controlled by elongation factor SII.

    PubMed Central

    Szentirmay, M N; Sawadogo, M

    1993-01-01

    Previous studies have revealed that the in vitro synthesis of reinitiated transcripts by RNA polymerase II requires an additional activity, designated reinitiation transcription factor (RTF), which is distinct from all of the general class II initiation factors. While further characterizing this activity, it was found that RTF displays properties indistinguishable from those of the RNA polymerase II elongation factor SII. In addition, Western blot analysis using SII-specific antibodies revealed that human SII is a major component in purified RTF preparations. The functional equivalence of the two proteins was established using recombinant SII, which proved fully capable of substituting for RTF in the reinitiation assay. In these reconstituted reactions, transcription complexes resulting from reinitiation events required SII to proceed through a 400 bp G-free cassette, while complexes resulting from the first round of initiations were SII-independent. Reinitiations can take place in the absence of SII; however, addition of the elongation factor is essential for full extension of the reinitiated transcripts. These results suggest that events taking place at the promoter (e.g. first-round initiations versus reinitiations) can create marked differences in the properties of RNA polymerase II elongation complexes. Images PMID:8223477

  13. The methyltransferase domain of dengue virus protein NS5 ensures efficient RNA synthesis initiation and elongation by the polymerase domain.

    PubMed

    Potisopon, Supanee; Priet, Stéphane; Collet, Axelle; Decroly, Etienne; Canard, Bruno; Selisko, Barbara

    2014-10-01

    Viral RNA-dependent RNA polymerases (RdRps) responsible for the replication of single-strand RNA virus genomes exert their function in the context of complex replication machineries. Within these replication complexes the polymerase activity is often highly regulated by RNA elements, proteins or other domains of multi-domain polymerases. Here, we present data of the influence of the methyltransferase domain (NS5-MTase) of dengue virus (DENV) protein NS5 on the RdRp activity of the polymerase domain (NS5-Pol). The steady-state polymerase activities of DENV-2 recombinant NS5 and NS5-Pol are compared using different biochemical assays allowing the dissection of the de novo initiation, transition and elongation steps of RNA synthesis. We show that NS5-MTase ensures efficient RdRp activity by stimulating the de novo initiation and the elongation phase. This stimulation is related to a higher affinity of NS5 toward the single-strand RNA template indicating NS5-MTase either completes a high-affinity RNA binding site and/or promotes the correct formation of the template tunnel. Furthermore, the NS5-MTase increases the affinity of the priming nucleotide ATP upon de novo initiation and causes a higher catalytic efficiency of the polymerase upon elongation. The complex stimulation pattern is discussed under the perspective that NS5 adopts several conformations during RNA synthesis. PMID:25209234

  14. The methyltransferase domain of dengue virus protein NS5 ensures efficient RNA synthesis initiation and elongation by the polymerase domain

    PubMed Central

    Potisopon, Supanee; Priet, Stéphane; Collet, Axelle; Decroly, Etienne; Canard, Bruno; Selisko, Barbara

    2014-01-01

    Viral RNA-dependent RNA polymerases (RdRps) responsible for the replication of single-strand RNA virus genomes exert their function in the context of complex replication machineries. Within these replication complexes the polymerase activity is often highly regulated by RNA elements, proteins or other domains of multi-domain polymerases. Here, we present data of the influence of the methyltransferase domain (NS5-MTase) of dengue virus (DENV) protein NS5 on the RdRp activity of the polymerase domain (NS5-Pol). The steady-state polymerase activities of DENV-2 recombinant NS5 and NS5-Pol are compared using different biochemical assays allowing the dissection of the de novo initiation, transition and elongation steps of RNA synthesis. We show that NS5-MTase ensures efficient RdRp activity by stimulating the de novo initiation and the elongation phase. This stimulation is related to a higher affinity of NS5 toward the single-strand RNA template indicating NS5-MTase either completes a high-affinity RNA binding site and/or promotes the correct formation of the template tunnel. Furthermore, the NS5-MTase increases the affinity of the priming nucleotide ATP upon de novo initiation and causes a higher catalytic efficiency of the polymerase upon elongation. The complex stimulation pattern is discussed under the perspective that NS5 adopts several conformations during RNA synthesis. PMID:25209234

  15. Metabolic Labeling of Newly Transcribed RNA for High Resolution Gene Expression Profiling of RNA Synthesis, Processing and Decay in Cell Culture

    PubMed Central

    Ruzsics, Zsolt; Friedel, Caroline C.; Koszinowski, Ulrich H.; Dölken, Lars

    2013-01-01

    The development of whole-transcriptome microarrays and next-generation sequencing has revolutionized our understanding of the complexity of cellular gene expression. Along with a better understanding of the involved molecular mechanisms, precise measurements of the underlying kinetics have become increasingly important. Here, these powerful methodologies face major limitations due to intrinsic properties of the template samples they study, i.e. total cellular RNA. In many cases changes in total cellular RNA occur either too slowly or too quickly to represent the underlying molecular events and their kinetics with sufficient resolution. In addition, the contribution of alterations in RNA synthesis, processing, and decay are not readily differentiated. We recently developed high-resolution gene expression profiling to overcome these limitations. Our approach is based on metabolic labeling of newly transcribed RNA with 4-thiouridine (thus also referred to as 4sU-tagging) followed by rigorous purification of newly transcribed RNA using thiol-specific biotinylation and streptavidin-coated magnetic beads. It is applicable to a broad range of organisms including vertebrates, Drosophila, and yeast. We successfully applied 4sU-tagging to study real-time kinetics of transcription factor activities, provide precise measurements of RNA half-lives, and obtain novel insights into the kinetics of RNA processing. Finally, computational modeling can be employed to generate an integrated, comprehensive analysis of the underlying molecular mechanisms. PMID:23963265

  16. PREECLAMPSIA IS ASSOCIATED WITH COMPROMISED MATERNAL SYNTHESIS OF LONG CHAIN POLYUNSATURATED FATTY ACIDS LEADING TO OFFSPRING DEFICIENCY

    PubMed Central

    Mackay, Vanessa A; Huda, Shahzya S; Stewart, Frances M; Tham, Kahmeng; McKenna, Louise A; Martin, Iain; Jordan, Fiona; Brown, E Ann; Hodson, Leanne; Greer, Ian A; Meyer, Barbara J; Freeman, Dilys J

    2013-01-01

    Obesity and excessive lipolysis are implicated in preeclampsia. Intrauterine growth restriction is associated with low maternal body mass index and decreased lipolysis. Our aim was to assess how maternal and offspring fatty acid metabolism is altered in mothers in the third trimester of pregnancy with preeclampsia (n=62) or intrauterine growth restriction (n=23) compared to healthy pregnancies (n=164). Markers of lipid metabolism and erythrocyte fatty acid concentrations were measured. Maternal adipose tissue fatty acid composition and mRNA expression of adipose tissue fatty acid metabolizing enzymes and placental fatty acid transporters were compared. Mothers with preeclampsia had higher plasma triglyceride (21%, p<0.001) and non-esterified fatty acid (50%, p<0.001) concentrations than Controls. Concentrations of major n-6 and n-3 long chain polyunsaturated fatty acids in erythrocytes were 23-60% lower (all p<0.005) in preeclampsia and intrauterine growth restriction mothers and offspring compared to Controls. Subcutaneous adipose tissue Δ-5 and Δ-6 desaturase and very long chain fatty acid elongase mRNA expression was lower in preeclampsia than Controls [Control 3.38(2.96) vs preeclampsia 1.83(1.91), p=0.030; 3.33(2.25) vs 1.03(0.96), p<0.001; 0.40 (0.81) vs 0.00 (0.00), p=0.038 (square root) expression relative to control gene respectively]. Low maternal and fetal long chain polyunsaturated fatty acid concentrations in preeclampsia may be the result of decreased maternal synthesis. PMID:22949531

  17. Radioautographic visualization of differences in the pattern of (/sup 3/H)uridine and (/sup 3/H)orotic acid incorporation into the RNA of migrating columnar cells in the rat small intestine

    SciTech Connect

    Uddin, M.; Altmann, G.G.; Leblond, C.P.

    1984-05-01

    The epithelium of rat small intestine was radioautographed to examine whether RNA is synthesized by the salvage pathway as shown after (/sup 3/H)uridine injection or by the de novo pathway as shown after (/sup 3/H)orotic acid injection. The two modes of RNA synthesis were thus investigated during the migration of columnar cells from crypt base to villus top, and the rate of synthesis was assessed by counting silver grains over the nucleolus and nucleoplasm at six levels along the duodenal epithelium - that is, in the base, mid, and top regions of the crypts and in the base, mid, and top regions of the villi. Concomitant biochemical analyses established that, after injection of either (5-/sup 3/H)uridine or (5-/sup 3/H)orotic acid: (a) buffered glutaraldehyde fixative was as effective as perchloric acid or trichloroacetic acid in insolubilizing the nucleic acids of rat small intestine; (b) a major fraction of the nucleic acid label was in RNA, that is, 91% after (/sup 3/H)uridine and 72% after (/sup 3/H)orotic acid, with the rest in DNA; and (c) a substantial fraction of the RNA label was in poly A/sup +/ RNA (presumed to be messenger RNA). In radioautographs of duodenum prepared after (/sup 3/H)uridine injection, the count of silver grains was high over nucleolus and nucleoplasm in crypt base cells and gradually decreased at the upper levels up to the villus base. In the rest of the villus, the grain count over the nucleolus was negligible, while over the nucleoplasm it was low but significant.

  18. RNA:DNA Ratio and Other Nucleic Acid Derived Indices in Marine Ecology

    PubMed Central

    Chícharo, Maria Alexandra; Chícharo, Luis

    2008-01-01

    Some of most used indicators in marine ecology are nucleic acid-derived indices. They can be divided by target levels in three groups: 1) at the organism level as ecophysiologic indicators, indicators such as RNA:DNA ratios, DNA:dry weight and RNA:protein, 2) at the population level, indicators such as growth rate, starvation incidence or fisheries impact indicators, and 3) at the community level, indicators such as trophic interactions, exergy indices and prey identification. The nucleic acids derived indices, especially RNA:DNA ratio, have been applied with success as indicators of nutritional condition, well been and growth in marine organisms. They are also useful as indicators of natural or anthropogenic impacts in marine population and communities, such as upwelling or dredge fisheries, respectively. They can help in understanding important issues of marine ecology such as trophic interactions in marine environment, fish and invertebrate recruitment failure and biodiversity changes, without laborious work of counting, measuring and identification of small marine organisms. Besides the objective of integrate nucleic acid derived indices across levels of organization, the paper will also include a general characterization of most used nucleic acid derived indices in marine ecology and also advantages and limitations of them. We can conclude that using indicators, such RNA:DNA ratios and other nucleic acids derived indices concomitantly with organism and ecosystems measures of responses to climate change (distribution, abundance, activity, metabolic rate, survival) will allow for the development of more rigorous and realistic predictions of the effects of anthropogenic climate change on marine systems. PMID:19325815

  19. Inhibition of Mammalian Target of Rapamycin Complex 1 (mTORC1) Downregulates ELOVL1 Gene Expression and Fatty Acid Synthesis in Goat Fetal Fibroblasts

    PubMed Central

    Wang, Weipeng; He, Qiburi; Guo, Zhixin; Yang, Limin; Bao, Lili; Bao, Wenlei; Zheng, Xu; Wang, Yanfeng; Wang, Zhigang

    2015-01-01

    Elongation of very-long-chain fatty acids 1 (ELOVL1) is a ubiquitously expressed gene that belongs to the ELOVL family and regulates the synthesis of very-long-chain fatty acids (VLCFAs) and sphingolipids, from yeast to mammals. Mammalian target of rapamycin complex 1 (mTORC1) is a central regulator of cell metabolism and is associated with fatty acids synthesis. In this study, we cloned the cDNA that encodes Cashmere goat (Capra hircus) ELOVL1 (GenBank Accession number KF549985) and investigated its expression in 10 tissues. ELOVL1 cDNA was 840 bp, encoding a deduced protein of 279 amino acids, and ELOVL1 mRNA was expressed in a wide range of tissues. Inhibition of mTORC1 by rapamycin decreased ELOVL1 expression and fatty acids synthesis in Cashmere goat fetal fibroblasts. These data show that ELOVL1 expression is regulated by mTORC1 and that mTORC1 has significant function in fatty acids synthesis in Cashmere goat. PMID:26204830

  20. Decreased bile-acid synthesis in livers of hepatocyte-conditional NADPH-cytochrome P450 reductase-null mice results in increased bile acids in serum.

    PubMed

    Cheng, Xingguo; Zhang, Youcai; Klaassen, Curtis D

    2014-10-01

    NADPH-cytochrome P450 reductase (Cpr) is essential for the function of microsomal cytochrome P450 monooxygenases (P450), including those P450s involved in bile acid (BA) synthesis. Mice with hepatocyte-specific deletion of NADPH-cytochrome P450 reductase (H-Cpr-null) have been engineered to understand the in vivo function of hepatic P450s in the metabolism of xenobiotics and endogenous compounds. However, the impact of hepatic Cpr on BA homeostasis is not clear. The present study revealed that H-Cpr-null mice had a 60% decrease in total BA concentration in liver, whereas the total BA concentration in serum was almost doubled. The decreased level of cholic acid (CA) in both serum and livers of H-Cpr-null mice is likely due to diminished enzyme activity of Cyp8b1 that is essential for CA biosynthesis. Feedback mechanisms responsible for the reduced liver BA concentrations and/or increased serum BA concentrations in H-Cpr-null mice included the following: 1) enhanced alternative BA synthesis pathway, as evidenced by the fact that classic BA synthesis is diminished but chenodeoxycholic acid still increases in both serum and livers of H-Cpr-null mice; 2) inhibition of farnesoid X receptor activation, which increased the mRNA of Cyp7a1 and 8b1; 3) induction of intestinal BA transporters to facilitate BA absorption from the intestine to the circulation; 4) induction of hepatic multidrug resistance-associated protein transporters to increase BA efflux from the liver to blood; and 5) increased generation of secondary BAs. In summary, the present study reveals an important contribution of the alternative BA synthesis pathway and BA transporters in regulating BA concentrations in H-Cpr-null mice. PMID:25034404

  1. Monitoring mRNA Translation in Neuronal Processes Using Fluorescent Non-Canonical Amino Acid Tagging.

    PubMed

    Kos, Aron; Wanke, Kai A; Gioio, Anthony; Martens, Gerard J; Kaplan, Barry B; Aschrafi, Armaz

    2016-05-01

    A steady accumulation of experimental data argues that protein synthesis in neurons is not merely restricted to the somatic compartment, but also occurs in several discrete cellular micro-domains. Local protein synthesis is critical for the establishment of synaptic plasticity in mature dendrites and in directing the growth cones of immature axons, and has been associated with cognitive impairment in mice and humans. Although in recent years a number of important mechanisms governing this process have been described, it remains technically challenging to precisely monitor local protein synthesis in individual neuronal cell parts independent from the soma. This report presents the utility of employing microfluidic chambers for the isolation and treatment of single neuronal cellular compartments. Furthermore, it is demonstrated that a protein synthesis assay, based on fluorescent non-canonical amino acid tagging (FUNCAT), can be combined with this cell culture system to label nascent proteins within a discrete structural and functional domain of the neuron. Together, these techniques could be employed for the detection of protein synthesis within developing and mature neurites, offering an effective approach to elucidate novel mechanisms controlling synaptic maintenance and plasticity. PMID:27026294

  2. 4-Methylumbelliferone inhibits hyaluronan synthesis by depletion of cellular UDP-glucuronic acid and downregulation of hyaluronan synthase 2 and 3

    SciTech Connect

    Kultti, Anne; Pasonen-Seppaenen, Sanna; Jauhiainen, Marjo; Rilla, Kirsi J.; Kaernae, Riikka; Pyoeriae, Emma; Tammi, Raija H.; Tammi, Markku I.

    2009-07-01

    Hyaluronan accumulation on cancer cells and their surrounding stroma predicts an unfavourable disease outcome, suggesting that hyaluronan enhances tumor growth and spreading. 4-Methylumbelliferone (4-MU) inhibits hyaluronan synthesis and retards cancer spreading in experimental animals through mechanisms not fully understood. These mechanisms were studied in A2058 melanoma cells, MCF-7 and MDA-MB-361 breast, SKOV-3 ovarian and UT-SCC118 squamous carcinoma cells by analysing hyaluronan synthesis, UDP-glucuronic acid (UDP-GlcUA) content, and hyaluronan synthase (HAS) mRNA levels. The maximal inhibition in hyaluronan synthesis ranged 22-80% in the cell lines tested. Active glucuronidation of 4-MU produced large quantities of 4-MU-glucuronide, depleting the cellular UDP-GlcUA pool. The maximal reduction varied between 38 and 95%. 4-MU also downregulated HAS mRNA levels: HAS3 was 84-60% lower in MDA-MB-361, A2058 and SKOV-3 cells. HAS2 was the major isoenzyme in MCF-7 cells and lowered by 81%, similar to 88% in A2058 cells. These data indicate that both HAS substrate and HAS2 and/or HAS3 mRNA are targeted by 4-MU. Despite different target point sensitivities, the reduction of hyaluronan caused by 4-MU was associated with a significant inhibition of cell migration, proliferation and invasion, supporting the importance of hyaluronan synthesis in cancer, and the therapeutic potential of hyaluronan synthesis inhibition.

  3. Ascorbic acid inhibits replication and infectivity of avian RNA tumor virus

    SciTech Connect

    BISSELL, MINA J; HATIE, CARROLL; FARSON, DEBORAH A.; SCHWARZ, RICHARD I.; SOO, WHAI-JEN

    1980-04-01

    Ascorbic acid, at nontoxic concentrations, causes a substantial reduction in the ability of avian tumor viruses to replicate in both primary avian tendon cells and chicken embryo fibroblasts. The virus-infected cultures appear to be less transformed in the presence of ascorbic acid by the criteria of morphology, reduced glucose uptake, and increased collagen synthesis. The vitamin does not act by altering the susceptibility of the cells to initial infection and transformation, but instead appears to interfere with the spread of infection through a reduction in virus replication and virus infectivity. The effect is reversible and requires the continuous presence of the vitamin in the culture medium.

  4. Ascorbic acid inhibits replication and infectivity of avian RNA tumor virus

    SciTech Connect

    Bissell, M.J.; Hatie, C.; Farson, D.A.; Schwarz, R.I.; Soo, W.J.

    1980-05-01

    Ascrobic acid, at nontoxic concentrations, causes a substantial reduction in the ability of avian tumor viruses to replicate in both primary avian tendon cells and chicken embryo fibroblasts. The virus-infected cultures appear to be less transformed in the presence of ascorbic acid by the criteria of morphology, reduced glucose uptake, and increased collagen synthesis. The vitamin does not act by altering the susceptibility of the cells to initial infection and transformation, but instead appears to interfere with the spread of infection through a reduction in virus replication and virus infectivity. The effect is reversible and requires the continuous presence of the vitamin in the culture medium.

  5. Alternative mRNA Splicing from the Glial Fibrillary Acidic Protein (GFAP) Gene Generates Isoforms with Distinct Subcellular mRNA Localization Patterns in Astrocytes

    PubMed Central

    Thomsen, Rune; Daugaard, Tina F.; Holm, Ida E.; Nielsen, Anders Lade

    2013-01-01

    The intermediate filament network of astrocytes includes Glial fibrillary acidic protein (Gfap) as a major component. Gfap mRNA is alternatively spliced resulting in generation of different protein isoforms where Gfapα is the most predominant isoform. The Gfapδ isoform is expressed in proliferating neurogenic astrocytes of the developing human brain and in the adult human and mouse brain. Here we provide a characterization of mouse Gfapδ mRNA and Gfapδ protein. RT-qPCR analysis showed that Gfapδ mRNA and Gfapα mRNA expression is coordinately increased in the post-natal period. Immunohistochemical staining of developing mouse brain samples showed that Gfapδ is expressed in the sub-ventricular zones in accordance with the described localization in the developing and adult human brain. Immunofluorescence analysis verified incorporation of Gfapδ into the Gfap intermediate filament network and overlap in Gfapδ and Gfapα subcellular localization. Subcellular mRNA localization studies identified different localization patterns of Gfapδ and Gfapα mRNA in mouse primary astrocytes. A larger fraction of Gfapα mRNA showed mRNA localization to astrocyte protrusions compared to Gfapδ mRNA. The differential mRNA localization patterns were dependent on the different 3′-exon sequences included in Gfapδ and Gfapα mRNA. The presented results show that alternative Gfap mRNA splicing results in isoform-specific mRNA localization patterns with resulting different local mRNA concentration ratios which have potential to participate in subcellular region-specific intermediate filament dynamics during brain development, maintenance and in disease. PMID:23991052

  6. LKB1 promotes cell survival by modulating TIF-IA-mediated pre-ribosomal RNA synthesis under uridine downregulated conditions

    PubMed Central

    Liu, Xiuju; Huang, Henry; Wilkinson, Scott C.; Zhong, Diansheng; Khuri, Fadlo R.; Fu, Haian; Marcus, Adam; He, Yulong; Zhou, Wei

    2016-01-01

    We analyzed the mechanism underlying 5-aminoimidazole-4-carboxamide riboside (AICAR) mediated apoptosis in LKB1-null non-small cell lung cancer (NSCLC) cells. Metabolic profile analysis revealed depletion of the intracellular pyrimidine pool after AICAR treatment, but uridine was the only nucleotide precursor capable of rescuing this apoptosis, suggesting the involvement of RNA metabolism. Because half of RNA transcription in cancer is for pre-ribosomal RNA (rRNA) synthesis, which is suppressed by over 90% after AICAR treatment, we evaluated the role of TIF-IA-mediated rRNA synthesis. While the depletion of TIF-IA by RNAi alone promoted apoptosis in LKB1-null cells, the overexpression of a wild-type or a S636A TIF-IA mutant, but not a S636D mutant, attenuated AICAR-induced apoptosis. In LKB1-null H157 cells, pre-rRNA synthesis was not suppressed by AICAR when wild-type LKB1 was present, and cellular fractionation analysis indicated that TIF-IA quickly accumulated in the nucleus in the presence of a wild-type LKB1 but not a kinase-dead mutant. Furthermore, ectopic expression of LKB1 was capable of attenuating AICAR-induced death in AMPK-null cells. Because LKB1 promotes cell survival by modulating TIF-IA-mediated pre-rRNA synthesis, this discovery suggested that targeted depletion of uridine related metabolites may be exploited in the clinic to eliminate LKB1-null cancer cells. PMID:26506235

  7. Interrelated effects of dihomo-γ-linolenic and arachidonic acids, and sesamin on hepatic fatty acid synthesis and oxidation in rats.

    PubMed

    Ide, Takashi; Ono, Yoshiko; Kawashima, Hiroshi; Kiso, Yoshinobu

    2012-12-14

    Interrelated effects of dihomo-γ-linolenic acid (DGLA) and arachidonic acid (ARA), and sesamin, a sesame lignan, on hepatic fatty acid synthesis and oxidation were examined in rats. Rats were fed experimental diets supplemented with 0 or 2 g/kg sesamin (1:1 mixture of sesamin and episesamin), containing 100 g/kg of maize oil or fungal oil rich in DGLA or ARA for 16 d. Among the groups fed sesamin-free diets, oils rich in DGLA or ARA, especially the latter, compared with maize oil strongly reduced the activity and mRNA levels of various lipogenic enzymes. Sesamin, irrespective of the type of fat, reduced the parameters of lipogenic enzymes except for malic enzyme. The type of dietary fat was rather irrelevant in affecting hepatic fatty acid oxidation among rats fed the sesamin-free diets. Sesamin increased the activities of enzymes involved in fatty acid oxidation in all groups of rats given different fats. The extent of the increase depended on the dietary fat type, and the values became much higher with a diet containing sesamin and oil rich in ARA in combination than with a diet containing lignan and maize oil. Analyses of mRNA levels revealed that the combination of sesamin and oil rich in ARA compared with the combination of lignan and maize oil markedly increased the gene expression of various peroxisomal fatty acid oxidation enzymes but not mitochondrial enzymes. The enhancement of sesamin action on hepatic fatty acid oxidation was also confirmed with oil rich in DGLA but to a lesser extent. PMID:22370182

  8. An improved synthesis for the (Z)-14-methyl-9-pentadecenoic acid and its topoisomerase I inhibitory activity

    PubMed Central

    Carballeira, Néstor M.; Sanabria, David; Oyola, Delise

    2006-01-01

    An improved synthesis for the (Z)-14-methyl-9-pentadecenoic acid was developed based on the appropriate use of (trimethylsilyl)acetylene as the key reagent in the synthesis. The reported synthesis started with commercially available 8-bromo-1-octanol and furnished the desired acid in seven steps and in a 16% overall yield, a significant improvement over the previous reported synthesis for this fatty acid. The synthesis reported herein afforded sufficient amounts to study the acid topoisomerase I inhibitory potential and it was found that the title acid inhibits the human placenta DNA topoisomerase I enzyme at concentrations of 500 μM. PMID:17680032

  9. The Yeast Mitochondrial RNA Polymerase and Transcription Factor Complex Catalyzes Efficient Priming of DNA Synthesis on Single-stranded DNA.

    PubMed

    Ramachandran, Aparna; Nandakumar, Divya; Deshpande, Aishwarya P; Lucas, Thomas P; R-Bhojappa, Ramanagouda; Tang, Guo-Qing; Raney, Kevin; Yin, Y Whitney; Patel, Smita S

    2016-08-01

    Primases use single-stranded (ss) DNAs as templates to synthesize short oligoribonucleotide primers that initiate lagging strand DNA synthesis or reprime DNA synthesis after replication fork collapse, but the origin of this activity in the mitochondria remains unclear. Herein, we show that the Saccharomyces cerevisiae mitochondrial RNA polymerase (Rpo41) and its transcription factor (Mtf1) is an efficient primase that initiates DNA synthesis on ssDNA coated with the yeast mitochondrial ssDNA-binding protein, Rim1. Both Rpo41 and Rpo41-Mtf1 can synthesize short and long RNAs on ssDNA template and prime DNA synthesis by the yeast mitochondrial DNA polymerase Mip1. However, the ssDNA-binding protein Rim1 severely inhibits the RNA synthesis activity of Rpo41, but not the Rpo41-Mtf1 complex, which continues to prime DNA synthesis efficiently in the presence of Rim1. We show that RNAs as short as 10-12 nt serve as primers for DNA synthesis. Characterization of the RNA-DNA products shows that Rpo41 and Rpo41-Mtf1 have slightly different priming specificity. However, both prefer to initiate with ATP from short priming sequences such as 3'-TCC, TTC, and TTT, and the consensus sequence is 3'-Pu(Py)2-3 Based on our studies, we propose that Rpo41-Mtf1 is an attractive candidate for serving as the primase to initiate lagging strand DNA synthesis during normal replication and/or to restart stalled replication from downstream ssDNA. PMID:27311715

  10. The Hypothesis that the Genetic Code Originated in Coupled Synthesis of Proteins and the Evolutionary Predecessors of Nucleic Acids in Primitive Cells

    PubMed Central

    Francis, Brian R.

    2015-01-01

    Although analysis of the genetic code has allowed explanations for its evolution to be proposed, little evidence exists in biochemistry and molecular biology to offer an explanation for the origin of the genetic code. In particular, two features of biology make the origin of the genetic code difficult to understand. First, nucleic acids are highly complicated polymers requiring numerous enzymes for biosynthesis. Secondly, proteins have a simple backbone with a set of 20 different amino acid side chains synthesized by a highly complicated ribosomal process in which mRNA sequences are read in triplets. Apparently, both nucleic acid and protein syntheses have extensive evolutionary histories. Supporting these processes is a complex metabolism and at the hub of metabolism are the carboxylic acid cycles. This paper advances the hypothesis that the earliest predecessor of the nucleic acids was a β-linked polyester made from malic acid, a highly conserved metabolite in the carboxylic acid cycles. In the β-linked polyester, the side chains are carboxylic acid groups capable of forming interstrand double hydrogen bonds. Evolution of the nucleic acids involved changes to the backbone and side chain of poly(β-d-malic acid). Conversion of the side chain carboxylic acid into a carboxamide or a longer side chain bearing a carboxamide group, allowed information polymers to form amide pairs between polyester chains. Aminoacylation of the hydroxyl groups of malic acid and its derivatives with simple amino acids such as glycine and alanine allowed coupling of polyester synthesis and protein synthesis. Use of polypeptides containing glycine and l-alanine for activation of two different monomers with either glycine or l-alanine allowed simple coded autocatalytic synthesis of polyesters and polypeptides and established the first genetic code. A primitive cell capable of supporting electron transport, thioester synthesis, reduction reactions, and synthesis of polyesters and

  11. The Hypothesis that the Genetic Code Originated in Coupled Synthesis of Proteins and the Evolutionary Predecessors of Nucleic Acids in Primitive Cells.

    PubMed

    Francis, Brian R

    2015-01-01

    Although analysis of the genetic code has allowed explanations for its evolution to be proposed, little evidence exists in biochemistry and molecular biology to offer an explanation for the origin of the genetic code. In particular, two features of biology make the origin of the genetic code difficult to understand. First, nucleic acids are highly complicated polymers requiring numerous enzymes for biosynthesis. Secondly, proteins have a simple backbone with a set of 20 different amino acid side chains synthesized by a highly complicated ribosomal process in which mRNA sequences are read in triplets. Apparently, both nucleic acid and protein syntheses have extensive evolutionary histories. Supporting these processes is a complex metabolism and at the hub of metabolism are the carboxylic acid cycles. This paper advances the hypothesis that the earliest predecessor of the nucleic acids was a β-linked polyester made from malic acid, a highly conserved metabolite in the carboxylic acid cycles. In the β-linked polyester, the side chains are carboxylic acid groups capable of forming interstrand double hydrogen bonds. Evolution of the nucleic acids involved changes to the backbone and side chain of poly(β-d-malic acid). Conversion of the side chain carboxylic acid into a carboxamide or a longer side chain bearing a carboxamide group, allowed information polymers to form amide pairs between polyester chains. Aminoacylation of the hydroxyl groups of malic acid and its derivatives with simple amino acids such as glycine and alanine allowed coupling of polyester synthesis and protein synthesis. Use of polypeptides containing glycine and l-alanine for activation of two different monomers with either glycine or l-alanine allowed simple coded autocatalytic synthesis of polyesters and polypeptides and established the first genetic code. A primitive cell capable of supporting electron transport, thioester synthesis, reduction reactions, and synthesis of polyesters and

  12. Alteration of mitochondrial DNA and RNA level in human fibroblasts with impaired vitamin B12 coenzyme synthesis.

    PubMed

    Cantatore, P; Petruzzella, V; Nicoletti, C; Papadia, F; Fracasso, F; Rustin, P; Gadaleta, M N

    1998-08-01

    Alterations of mitochondrial (mt) nucleic acid metabolism in methylmalonic aciduria (MMA) were studied in two cell lines from skin fibroblasts of patients with mitochondrial (GM00595) or cytosolic (GM10011) defects in the biosynthesis pathways of cobalamin coenzymes. The mtDNA level increased two-fold in GM00595 cells, which carry a mt defect in the adenosylcobalamin synthesis, whereas no appreciable change was found in GM10011 cells. The content of the two rRNAs 16S and 12S mtRNAs, normalized for the mtDNA copy number, decreased by 70% and 50% in GM00595 and GM10011, respectively. The normalized content of ND1, ND2 and CO I mRNAs decreased in GM00595, but was unchanged in GM10011. Respiratory chain complex activities measured in these two cell lines were not different from control activities. These data suggest that the maintenance of the mt function is due to doubling of mtDNA and that this compensatory response takes place only in those cells in which the greater reduction of the level of rRNA might have brought the content of these transcripts below the threshold value for optimal expression of the mt genome. PMID:9720919

  13. De Novo mRNA Synthesis Is Required for Both Consolidation and Reconsolidation of Fear Memories in the Amygdala

    ERIC Educational Resources Information Center

    Duvarci, Sevil; Nader, Karim; LeDoux, Joseph E.

    2008-01-01

    Memory consolidation is the process by which newly learned information is stabilized into long-term memory (LTM). Considerable evidence indicates that retrieval of a consolidated memory returns it to a labile state that requires it to be restabilized. Consolidation of new fear memories has been shown to require de novo RNA and protein synthesis in…

  14. Nucleic acid determinants for selective deamination of DNA over RNA by activation-induced deaminase.

    PubMed

    Nabel, Christopher S; Lee, Jae W; Wang, Laura C; Kohli, Rahul M

    2013-08-27

    Activation-induced deaminase (AID), a member of the larger AID/APOBEC family, is the key catalyst in initiating antibody somatic hypermutation and class-switch recombination. The DNA deamination model accounting for AID's functional role posits that AID deaminates genomic deoxycytosine bases within the immunoglobulin locus, activating downstream repair pathways that result in antibody maturation. Although this model is well supported, the molecular basis for AID's selectivity for DNA over RNA remains an open and pressing question, reflecting a broader need to elucidate how AID/APOBEC enzymes engage their substrates. To address these questions, we have synthesized a series of chimeric nucleic acid substrates and characterized their reactivity with AID. These chimeric substrates feature targeted variations at the 2'-position of nucleotide sugars, allowing us to interrogate the steric and conformational basis for nucleic acid selectivity. We demonstrate that modifications to the target nucleotide can significantly alter AID's reactivity. Strikingly, within a substrate that is otherwise DNA, a single RNA-like 2'-hydroxyl substitution at the target cytosine is sufficient to compromise deamination. Alternatively, modifications that favor a DNA-like conformation (or sugar pucker) are compatible with deamination. AID's closely related homolog APOBEC1 is similarly sensitive to RNA-like substitutions at the target cytosine. Inversely, with unreactive 2'-fluoro-RNA substrates, AID's deaminase activity was rescued by introducing a trinucleotide DNA patch spanning the target cytosine and two nucleotides upstream. These data suggest a role for nucleotide sugar pucker in explaining the molecular basis for AID's DNA selectivity and, more generally, suggest how other nucleic acid-modifying enzymes may distinguish DNA from RNA. PMID:23942124

  15. Application of Escherichia coli phage K1E DNA-dependent RNA polymerase for in vitro RNA synthesis and in vivo protein production in Bacillus megaterium.

    PubMed

    Stammen, Simon; Schuller, Franziska; Dietrich, Sylvia; Gamer, Martin; Biedendieck, Rebekka; Jahn, Dieter

    2010-09-01

    Gene "7" of Escherichia coli phage K1E was proposed to encode a novel DNA-dependent RNA polymerase (RNAP). The corresponding protein was produced recombinantly, purified to apparent homogeneity via affinity chromatography, and successfully employed for in vitro RNA synthesis. Optimal assay conditions (pH 8, 37 degrees C, 10 mM magnesium chloride and 1.3 mM spermidine) were established. The corresponding promoter regions were identified on the phage genome and summarized in a sequence logo. Surprisingly, next to K1E promoters, the SP6 promoter was also recognized efficiently in vitro by K1E RNAP, while the T7 RNAP promoter was not recognized at all. Based on these results, a system for high-yield in vitro RNA synthesis using K1E RNAP was established. The template plasmid is a pUC18 derivative, which enables blue/white screening for positive cloning of the target DNA. Production of more than 5 microg of purified RNA per microgram plasmid DNA was achieved. Finally, in vivo protein production systems for Bacillus megaterium were established based on K1E and SP6 phage RNAP transcription. Up to 61.4 mg g (CDW) (-1) (K1E RNAP) of the reporter protein Gfp was produced in shaking flask cultures of B. megaterium. PMID:20596705

  16. Non-standard amino acid recognition by Escherichia coli leucyl-tRNA synthetase

    NASA Technical Reports Server (NTRS)

    Martinis, S. A.; Fox, G. E.

    1997-01-01

    Recombinant E. coli leucyl-tRNA synthetase was screened for amino acid-dependent pyrophosphate exchange activity using noncognate aliphatic amino acids including norvaline, homocysteine, norleucine, methionine, and homoserine. [32P]-labeled reaction products were separated by thin layer chromatography using a novel solvent system and then quantified by phosphorimaging. Norvaline which differs from leucine by only one methyl group stimulated pyrophosphate exchange activity as did both homocysteine and norleucine to a lesser extent. The KM parameters for leucine and norvaline were measured to be 10 micromoles and 1.5 mM, respectively. Experiments are in progress to determine if norvaline is transferred to tRNA(Leu) and/or edited by a pre- or post-transfer mechanism.

  17. Information transfer from peptide nucleic acids to RNA by template-directed syntheses

    NASA Technical Reports Server (NTRS)

    Schmidt, J. G.; Nielsen, P. E.; Orgel, L. E.; Bada, J. L. (Principal Investigator)

    1997-01-01

    Peptide nucleic acids (PNAs) are uncharged analogs of DNA and RNA in which the ribose-phosphate backbone is substituted by a backbone held together by amide bonds. PNAs are interesting as models of alternative genetic systems because they form potentially informational base paired helical structures. A PNA C10 oligomer has been shown to act as template for efficient formation of oligoguanylates from activated guanosine ribonucleotides. In a previous paper we used heterosequences of DNA as templates in sequence-dependent polymerization of PNA dimers. In this paper we show that information can be transferred from PNA to RNA. We describe the reactions of activated mononucleotides on heterosequences of PNA. Adenylic, cytidylic and guanylic acids were incorporated into the products opposite their complement on PNA, although less efficiently than on DNA templates.

  18. Synthesis of novel acid electrolytes for phosphoric acid fuel cells. Final report, May 1985-October 1988

    SciTech Connect

    Adcock, J.L.

    1988-11-01

    Construction of a 40-millimole-per-hour-scale aerosol direct-fluorination reactor was completed June 26, 1986. F-Methyl F-4-methoxybutanoate and F-4-methoxybutanoyl fluoride were synthesized by aerosol direct fluorination of methyl 4-methoxybutanoate. Basic hydrolysis of the perfluorinated derivatives produce sodium F-4-methoxybutanoate which was pyrolyzed to F-3-methoxy-1-propene. Purification and shipment of 33 grams of F-3-methoxy-1-propene followed. Syntheses by analogous methods allowed production and shipment of 5 grams of F-3-ethoxy-1-propene, 18 grams of F-3-(2-methoxy.ethoxy)-1-propene, and 37 grams of F-3,3-dimethyl-1-butene. Eighteen grams of F-2,2-dimethyl-1-chloropropane was produced directly and shipped. As suggested by other contractors, 5 grams of F-3-methoxy-1-iodopropane, and 5 grams of F-3-(2-methoxy.ethoxy)-1-iodopropane were produced by converting the respective precursor acid sodium salts produced for olefin synthesis to the silver salts and pyrolyzing them with iodine. Each of these compounds was prepared for the first time by the aerosol fluorination process during the course of the contract. These samples were provided to other GRI contractors for synthesis of perfluorinated sulfur(VI) and phosphorous(V) acids.

  19. Tailored fatty acid synthesis via dynamic control of fatty acid elongation

    SciTech Connect

    Torella, JP; Ford, TJ; Kim, SN; Chen, AM; Way, JC; Silver, PA

    2013-07-09

    Medium-chain fatty acids (MCFAs, 4-12 carbons) are valuable as precursors to industrial chemicals and biofuels, but are not canonical products of microbial fatty acid synthesis. We engineered microbial production of the full range of even-and odd-chain-length MCFAs and found that MCFA production is limited by rapid, irreversible elongation of their acyl-ACP precursors. To address this limitation, we programmed an essential ketoacyl synthase to degrade in response to a chemical inducer, thereby slowing acyl-ACP elongation and redirecting flux from phospholipid synthesis to MCFA production. Our results show that induced protein degradation can be used to dynamically alter metabolic flux, and thereby increase the yield of a desired compound. The strategy reported herein should be widely useful in a range of metabolic engineering applications in which essential enzymes divert flux away from a desired product, as well as in the production of polyketides, bioplastics, and other recursively synthesized hydrocarbons for which chain-length control is desired.

  20. Synthesis of hyaluronic acid oligosaccharides and exploration of a fluorous-assisted approach.

    PubMed

    Macchione, Giuseppe; de Paz, José L; Nieto, Pedro M

    2014-07-23

    The synthesis of hyaluronic acid oligomers (tri- and tetrasaccharide) is described. We have followed a pre-glycosylation oxidation strategy. Glucuronic acid units were directly employed in coupling reactions with suitably protected glucosamine derivatives. In order to simplify the purification of synthetic intermediates, a fluorous-assisted strategy has been also explored. Using this approach, a hyaluronic acid trisaccharide was prepared. PMID:24930061

  1. Pore-expanded SBA-15 sulfonic acid silicas for biodiesel synthesis.

    PubMed

    Dacquin, J P; Lee, A F; Pirez, C; Wilson, K

    2012-01-01

    Here we present the first application of pore-expanded SBA-15 in heterogeneous catalysis. Pore expansion over the range 6-14 nm confers a striking activity enhancement towards fatty acid methyl ester (FAME) synthesis from triglycerides (TAG), and free fatty acid (FFA), attributed to improved mass transport and acid site accessibility. PMID:22089025

  2. Acid-Degradable Cationic Dextran Particles for the Delivery of siRNA Therapeutics

    PubMed Central

    Cohen, Jessica L.; Schubert, Stephanie; Wich, Peter R.; Cui, Lina; Cohen, Joel A.; Mynar, Justin L.; Fréchet, Jean M. J.

    2011-01-01

    We report a new acid-sensitive, biocompatible and biodegradable microparticulate delivery system, spermine modified acetalated-dextran (Spermine-Ac-DEX), which can be used to efficiently encapsulate siRNA. These particles demonstrated efficient gene knockdown in HeLa-luc cells with minimal toxicity. This knockdown was comparable to that obtained using Lipofectamine, a commercially available transfection reagent generally limited to in vitro use due to its high toxicity. PMID:21539393

  3. Developmental changes in translatable RNA species and protein synthesis during sporulation in the aquatic fungus Blastocladiella emersonii.

    PubMed

    da Silva, A M; da Costa Maia, J C; Juliani, M H

    1986-06-01

    Protein synthesis during sporulation in Blastocladiella emersonii is developmentally regulated as revealed using [35S]methionine pulse labeling and two-dimensional gel electrophoresis. A large increase in the synthesis of several proteins is associated with particular stages. A large number of basic proteins are synthesized exclusively during late sporulation. Changes in translatable mRNA species were also detected by two-dimensional gel electrophoresis of the polypeptides produced in a cell-free rabbit reticulocyte lysate primed with RNA prepared at different stages of sporulation. The synthesis of several proteins during sporulation seems to be transcriptionally controlled. Most of the sporulation-specific messages are not present in the mature zoospores. PMID:3719699

  4. Selective synthesis of 3-hydroxy acids from Meldrum's acids using SmI2-H2O.

    PubMed

    Szostak, Michal; Spain, Malcolm; Procter, David J

    2012-05-01

    The single-step synthesis of 3-hydroxy carboxylic acids from readily available Meldrum's acids involves a selective monoreduction using a SmI(2)-H(2)O complex to give products in high crude purity, and it represents a considerable advancement over other methods for the synthesis of 3-hydroxy acids. The protocol includes a detailed guide to the preparation of a single electron-reducing SmI(2)-H(2)O complex and describes two representative examples of the methodology: monoreduction of a fully saturated Meldrum's acid (5-(4-bromobenzyl)-2,2-dimethyl-1,3-dioxane-4,6-dione) and tandem conjugate reduction-selective monoreduction of α,β-unsaturated Meldrum's acid (5-(4-methoxybenzylidene)-2,2-dimethyl-1,3-dioxane-4,6-dione). The protocol for selective monoreduction of Meldrum's acids takes ∼6 h to complete. PMID:22538848

  5. Primary and secondary siRNA synthesis triggered by RNAs from food bacteria in the ciliate Paramecium tetraurelia.

    PubMed

    Carradec, Quentin; Götz, Ulrike; Arnaiz, Olivier; Pouch, Juliette; Simon, Martin; Meyer, Eric; Marker, Simone

    2015-02-18

    In various organisms, an efficient RNAi response can be triggered by feeding cells with bacteria producing double-stranded RNA (dsRNA) against an endogenous gene. However, the detailed mechanisms and natural functions of this pathway are not well understood in most cases. Here, we studied siRNA biogenesis from exogenous RNA and its genetic overlap with endogenous RNAi in the ciliate Paramecium tetraurelia by high-throughput sequencing. Using wild-type and mutant strains deficient for dsRNA feeding we found that high levels of primary siRNAs of both strands are processed from the ingested dsRNA trigger by the Dicer Dcr1, the RNA-dependent RNA polymerases Rdr1 and Rdr2 and other factors. We further show that this induces the synthesis of secondary siRNAs spreading along the entire endogenous mRNA, demonstrating the occurrence of both 3'-to-5' and 5'-to-3' transitivity for the first time in the SAR clade of eukaryotes (Stramenopiles, Alveolates, Rhizaria). Secondary siRNAs depend on Rdr2 and show a strong antisense bias; they are produced at much lower levels than primary siRNAs and hardly contribute to RNAi efficiency. We further provide evidence that the Paramecium RNAi machinery also processes single-stranded RNAs from its bacterial food, broadening the possible natural functions of exogenously induced RNAi in this organism. PMID:25593325

  6. p53-Regulated Networks of Protein, mRNA, miRNA, and lncRNA Expression Revealed by Integrated Pulsed Stable Isotope Labeling With Amino Acids in Cell Culture (pSILAC) and Next Generation Sequencing (NGS) Analyses.

    PubMed

    Hünten, Sabine; Kaller, Markus; Drepper, Friedel; Oeljeklaus, Silke; Bonfert, Thomas; Erhard, Florian; Dueck, Anne; Eichner, Norbert; Friedel, Caroline C; Meister, Gunter; Zimmer, Ralf; Warscheid, Bettina; Hermeking, Heiko

    2015-10-01

    We determined the effect of p53 activation on de novo protein synthesis using quantitative proteomics (pulsed stable isotope labeling with amino acids in cell culture/pSILAC) in the colorectal cancer cell line SW480. This was combined with mRNA and noncoding RNA expression analyses by next generation sequencing (RNA-, miR-Seq). Furthermore, genome-wide DNA binding of p53 was analyzed by chromatin-immunoprecipitation (ChIP-Seq). Thereby, we identified differentially regulated proteins (542 up, 569 down), mRNAs (1258 up, 415 down), miRNAs (111 up, 95 down) and lncRNAs (270 up, 123 down). Changes in protein and mRNA expression levels showed a positive correlation (r = 0.50, p < 0.0001). In total, we detected 133 direct p53 target genes that were differentially expressed and displayed p53 occupancy in the vicinity of their promoter. More transcriptionally induced genes displayed occupied p53 binding sites (4.3% mRNAs, 7.2% miRNAs, 6.3% lncRNAs, 5.9% proteins) than repressed genes (2.4% mRNAs, 3.2% miRNAs, 0.8% lncRNAs, 1.9% proteins), suggesting indirect mechanisms of repression. Around 50% of the down-regulated proteins displayed seed-matching sequences of p53-induced miRNAs in the corresponding 3'-UTRs. Moreover, proteins repressed by p53 significantly overlapped with those previously shown to be repressed by miR-34a. We confirmed up-regulation of the novel direct p53 target genes LINC01021, MDFI, ST14 and miR-486 and showed that ectopic LINC01021 expression inhibits proliferation in SW480 cells. Furthermore, KLF12, HMGB1 and CIT mRNAs were confirmed as direct targets of the p53-induced miR-34a, miR-205 and miR-486-5p, respectively. In line with the loss of p53 function during tumor progression, elevated expression of KLF12, HMGB1 and CIT was detected in advanced stages of cancer. In conclusion, the integration of multiple omics methods allowed the comprehensive identification of direct and indirect effectors of p53 that provide new insights and leads into the

  7. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization.

    PubMed

    Anahtar, Melis N; Bowman, Brittany A; Kwon, Douglas S

    2016-01-01

    There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information. PMID:27168460

  8. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization

    PubMed Central

    Anahtar, Melis N.; Bowman, Brittany A.; Kwon, Douglas S.

    2016-01-01

    There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information. PMID:27168460

  9. Poly(U) RNA-templated synthesis of AppA

    PubMed Central

    Puthenvedu, Deepa; Janas, Teresa; Majerfeld, Irene; Illangasekare, Mali; Yarus, Michael

    2015-01-01

    Simple nucleotide templating activities are of interest as potential primordial reactions. Here we describe the acceleration of 5′-5′ AppA synthesis by 3′-5′ poly(U) under normal solution conditions. This reaction is apparently templated via complementary U:A base-pairing, despite the involvement of two different RNA backbones, because poly(U), unlike other polymers, significantly stimulates AppA synthesis. These interactions occur in moderate (K+) and (Mg2+) and are temperature sensitive, being more efficient at 10°C than at 4°C, but absent at 20°C. The reaction is only slightly pH sensitive, despite potentially relevant substrate pKa’s. Kinetic data explicitly support production of AppA by interaction of stacked 2MeImpA and pA nucleotides paired with a single molecule of U template. At a lower rate, AppA can also be produced by a chemical reaction between 2MeImpA and pA, without participation of poly(U). Molecular modeling suggests that 5′-5′ joining between stacked or concurrently paired A's can occur without major departures from normal U-A helical coordinates. So, coenzyme-like 5′-5′ purine dinucleotides might be readily synthesized from 3′-5′ RNAs with complementary sequences. PMID:26272215

  10. Detection of Sialic Acid-Utilising Bacteria in a Caecal Community Batch Culture Using RNA-Based Stable Isotope Probing

    PubMed Central

    Young, Wayne; Egert, Markus; Bassett, Shalome A.; Bibiloni, Rodrigo

    2015-01-01

    Sialic acids are monosaccharides typically found on cell surfaces and attached to soluble proteins, or as essential components of ganglioside structures that play a critical role in brain development and neural transmission. Human milk also contains sialic acid conjugated to oligosaccharides, glycolipids, and glycoproteins. These nutrients can reach the large bowel where they may be metabolised by the microbiota. However, little is known about the members of the microbiota involved in this function. To identify intestinal bacteria that utilise sialic acid within a complex intestinal community, we cultured the caecal microbiota from piglets in the presence of 13C-labelled sialic acid. Using RNA-based stable isotope probing, we identified bacteria that consumed 13C-sialic acid by fractionating total RNA in isopycnic buoyant density gradients followed by 16S rRNA gene analysis. Addition of sialic acid caused significant microbial community changes. A relative rise in Prevotella and Lactobacillus species was accompanied by a corresponding reduction in the genera Escherichia/Shigella, Ruminococcus and Eubacterium. Inspection of isotopically labelled RNA sequences suggests that the labelled sialic acid was consumed by a wide range of bacteria. However, species affiliated with the genus Prevotella were clearly identified as the most prolific users, as solely their RNA showed significantly higher relative shares among the most labelled RNA species. Given the relevance of sialic acid in nutrition, this study contributes to a better understanding of their microbial transformation in the intestinal tract with potential implications for human health. PMID:25816158

  11. Crystallographic analysis of a subcomplex of the transsulfursome with tRNA for Cys-tRNA(Cys) synthesis.

    PubMed

    Chen, Meirong; Nakazawa, Yuto; Kubo, Yume; Asano, Nozomi; Kato, Koji; Tanaka, Isao; Yao, Min

    2016-07-01

    In most organisms, Cys-tRNA(Cys) is directly synthesized by cysteinyl-tRNA synthetase (CysRS). Many methanogenic archaea, however, use a two-step, indirect pathway to synthesize Cys-tRNA(Cys) owing to a lack of CysRS and cysteine-biosynthesis systems. This reaction is catalyzed by O-phosphoseryl-tRNA synthetase (SepRS), Sep-tRNA:Cys-tRNA synthase (SepCysS) and SepRS/SepCysS pathway enhancer (SepCysE) as the transsulfursome, in which SepCysE connects both SepRS and SepCysS. On the transsulfursome, SepRS first ligates an O-phosphoserine to tRNA(Cys), and the mischarged intermediate Sep-tRNA(Cys) is then transferred to SepCysS, where it is further modified to Cys-tRNA(Cys). In this study, a subcomplex of the transsulfursome with tRNA(Cys) (SepCysS-SepCysE-tRNA(Cys)), which is involved in the second reaction step of the indirect pathway, was constructed and then crystallized. The crystals diffracted X-rays to a resolution of 2.6 Å and belonged to space group P6522, with unit-cell parameters a = b = 107.2, c = 551.1 Å. The structure determined by molecular replacement showed that the complex consists of a SepCysS dimer, a SepCysE dimer and one tRNA(Cys) in the asymmetric unit. PMID:27380375

  12. Pyrazinamide Induced Rat Cholestatic Liver Injury through Inhibition of FXR Regulatory Effect on Bile Acid Synthesis and Transport.

    PubMed

    Guo, Hong-Li; Hassan, Hozeifa M; Zhang, Yun; Dong, Si-Zhe; Ding, Ping-Ping; Wang, Tao; Sun, Li-Xin; Zhang, Lu-Yong; Jiang, Zhen-Zhou

    2016-08-01

    Pyrazinamide (PZA) is an indispensable first-line drug used for the treatment of tuberculosis which may cause serious hepatotoxicity; however, the mechanisms underlying these toxicities are poorly understood. Cholestasis plays an important role in drug-induced liver injury. Since there were no previous published works reported cholestasis and PZA hepatotoxicity relationship, this study aimed to identify whether PZA can induce liver injury with characterized evidences of cholestasis and to clarify expression changes of proteins related to both bile acid synthesis and transport in PZA-induced liver injury. PZA (2 g/kg) was administered for 7 consecutive days by oral gavage. Results showed there were 2-fold elevation in both ALT and AST serum levels in PZA-treated rats. In addition, a 10-fold increment in serum total bile acid was observed after PZA administration. The mRNA and protein expressions of bile acid synthesis and transport parameters were markedly altered, in which FXR, Bsep, Mrp2, Mdr2, Ostα/β, Oatp1a1, Oatp1b2, and Cyp8b1 were decreased (P < .05), while Mrp3, Ntcp, Oatp1a4, and Cyp7a1 were increased (P < .05). Moreover, treatment with the FXR agonist obeticholic acid (OCA) generated obvious reductions in serum ALT, AST, and TBA levels in PZA-treated rats. Those effects were due to transcriptional regulation of pre-mentioned target genes by OCA. Taken together, these results suggested that PZA-induced cholestatic liver injury was related to FXR inhibition, leading to the dysfunction in bile acid synthesis and transport. PMID:27255380

  13. Alternative bases in the RNA world: the prebiotic synthesis of urazole and its ribosides

    NASA Technical Reports Server (NTRS)

    Kolb, V. M.; Dworkin, J. P.; Miller, S. L.

    1994-01-01

    Urazole is a five-membered heterocyclic compound which is isosteric with uracil's hydrogen-bonding segment. Urazole reacts spontaneoulsy with ribose (and other aldoses) to give a mixture of four ribosides: alpha and beta pyranosides and furanosides. This reaction occurs in aqueous solution at mild temperatures. Thermodynamic and kinetic parameters for the reaction of urazole with ribose were determined. In contrast, uracil is completely unreactive with ribose under these conditions. Urazole's unusual reactivity is ascribed to the hydrazine portion of the molecule. Urazole can be synthesized from biuret and hydrazine under prebiotic conditions. The prebiotic synthesis of guanazole, which is isosteric in part to diaminopyrimidine and cytosine, is accomplished from dicyandiamide and hydrazine. Kinetic parameters for both prebiotic reactions were measured. Urazole and guanazole are transparent in the UV, which would be a favorable property in the absence of an ozone layer on the early Earth. Urazole makes hydrogen bonds with adenine in DMSO similar to those of uracil, as established by H NMR. All of these properties make urazole an attractive potential precursor to uracil and guanazole a potential precursor to cytosine in the RNA or pre-RNA world.

  14. Clay catalyzed RNA synthesis under Martian conditions: Application for Mars return samples.

    PubMed

    Joshi, Prakash C; Dubey, Krishna; Aldersley, Michael F; Sausville, Meaghen

    2015-06-26

    Catalysis by montmorillonites clay minerals is regarded as a feasible mechanism for the abiotic production and polymerization of key biomolecules on early Earth. We have investigated a montmorillonite-catalyzed reaction of the 5'-phosphorimidazolide of nucleosides as a model to probe prebiotic synthesis of RNA-type oligomers. Here we show that this model is specific for the generation of RNA oligomers despite deoxy-mononucleotides adsorbing equally well onto the montmorillonite catalytic surfaces. Optimum catalytic activity was observed over a range of pH (6-9) and salinity (1 ± 0.2 M NaCl). When the weathering steps of early Earth that generated catalytic montmorillonite were modified to meet Martian soil conditions, the catalytic activity remained intact without altering the surface layer charge. Additionally, the formation of oligomers up to tetramer was detected using as little as 0.1 mg of Na⁺-montmorillonite, suggesting that the catalytic activity of a Martian clay return sample can be investigated with sub-milligram scale samples. PMID:25888789

  15. Regulation by nitrate of protein synthesis and translation of RNA in maize roots

    SciTech Connect

    McClure, P.R.; Bouthyette, P.Y.

    1986-04-01

    Roots of maize seedlings were exposed to /sup 35/S-methionine in the presence or absence of nitrate. Using SDS-PAGE, nitrate-induced changes in labeled polypeptides were noted in the soluble (at 92, 63 and 21kD) and organellar(at 14kD) fractions, as well as in a membrane fraction of putative tonoplast origin (at 31kD). No nitrate-induced changes were noted in a plasmamembrane-enriched fraction or in a membrane fraction of mixed origin. Total RNA from nitrate-treated and control roots was translated in a rabbit reticulocyte system. Five translation products (94, 63, 41, 39 and 21kD) were identified as nitrate-inducible by comparative gel electrophoresis. Changes in protein synthesis and translation of mRNA were apparent within 2-3 h after introduction of nitrate. Within 4-6 h after removal of nitrate, the level of nitrate-inducible translation products diminished to that of control roots. In contrast, the 31kD tonoplast polypeptide was still labeled 26 h after removal of external nitrate and /sup 35/S-methionine. The results will be discussed in relation to the nitrate induction of nitrate reductase, nitrite reductase, and the nitrate uptake system.

  16. Control of adenovirus E1B mRNA synthesis by a shift in the activities of RNA splice sites.

    PubMed Central

    Montell, C; Fisher, E F; Caruthers, M H; Berk, A J

    1984-01-01

    The primary transcript from adenovirus 2 early region 1B (E1B) is processed by differential RNA splicing into two overlapping mRNAs, 13S and 22S. The 22S mRNA is the major E1B mRNA during the early phase of infection, whereas the 13S mRNA predominates during the late phase. In previous work, it has been shown that this shift in proportions of the E1B mRNAs is influenced by increased cytoplasmic stability of the 13S mRNA at late times in infection. Two observations presented here demonstrate that the increase in proportion of the 13S mRNA at late times is also regulated by a change in the specificity of RNA splicing. First, the relative concentrations of the 13S to 22S nuclear RNAs were not constant throughout infection but increased at late times. Secondly, studies with the mutant, adenovirus 2 pm2250 , provided evidence that there was an increased propensity to utilize a 5' splice in the region of the 13S 5' splice site at late times in infection. Adenovirus 2 pm2250 has a G----C transversion in the first base of E1B 13S mRNA intron preventing splicing of the 13S mRNA but not of the 22S mRNA. During the early phase of a pm2250 infection, the E1B primary transcripts were processed into the 22S mRNA only. However, during the late phase, when the 13S mRNA normally predominates, E1B primary transcripts were also processed by RNA splicing at two formerly unused or cryptic 5' splice sites. Both cryptic splice sites were located much closer to the disrupted 13S 5' splice site than to the 22S 5' splice site. Thus, the temporal increase in proportion of the 13S mRNA to the 22S mRNA is regulated by two processes, an increase in cytoplasmic stability of the 13S mRNA and an increased propensity to utilize the 13S 5' splice site during the late phase of infection. Adenovirus 2 pm2250 was not defective for productive infection of HeLa cells or for transformation of rat cells. Images PMID:6727875

  17. Open reading frames 1a and 1b of the porcine reproductive and respiratory syndrome virus (PRRSV) collaboratively initiate viral minus-strand RNA synthesis.

    PubMed

    Tang, Yan-Dong; Fang, Qiong-Qiong; Liu, Ji-Ting; Wang, Tong-Yun; Wang, Yu; Tao, Ye; Liu, Yong-Gang; Cai, Xue-Hui

    2016-09-01

    The porcine reproductive and respiratory syndrome virus (PRRSV) causes a persistent threat to the swine industry, especially when highly pathogenic PRRSV (HP-PRRSV) emerges. Previous studies have indicated that PRRSV RNA synthesis was correlated with HP-PRRSV virulence. PRRSV RNA synthesis includes genomic RNA and sub-genomic mRNA, and these processes require minus-strand RNA as a template. However, the mechanisms involved in PRRSV minus-strand RNA synthesis are not fully understood. A mini-genome system can be used to assess viral replication mechanisms and to evaluate the effects of potential antiviral drugs on viral replicase activities. In this study, we developed a mini-genome system that uses firefly luciferase as a reporter. Based on this system, we found that PRRSV RNA-dependent RNA polymerase nsp9 alone failed to activate virus minus-strand RNA synthesis. We also demonstrated that combinations of open reading frames 1a (ORF1a) and ORF1b are necessary for viral minus-strand RNA synthesis. PMID:27378424

  18. S-(−)-10,11-Dihydroxyfarnesoic Acid Methyl Ester Inhibits Melanin Synthesis in Murine Melanocyte Cells

    PubMed Central

    Baek, Seung-Hwa; Ahn, Jun-Won; Nam, Sung-Hee; Yoon, Cheol-Sik; Shin, Jae-Cheon; Lee, Sang-Han

    2014-01-01

    The development of antimelanogenic agents is important for the prevention of serious aesthetic problems such as melasmas, freckles, age spots, and chloasmas. In the course of screening for melanin synthesis inhibitors, we found that the culture broth from an insect morphopathogenic fungus, Beauveria bassiana CS1029, exhibits potent antimelanogenic activity. We isolated and purified an active metabolite and identified it as S-(−)-10,11-dihydroxyfarnesoic acid methyl ester (dhFAME), an insect juvenile hormone. To address whether dhFAME inhibits melanin synthesis, we first measured the size of the melanin biosynthesis inhibition zone caused by dhFAME. dhFAME also showed inhibitory activity against mushroom tyrosinase in Melan-a cells. Intracellular, dose-dependent tyrosinase inhibition activity was also confirmed by zymography. In addition, we showed that dhFAME strongly inhibits melanin synthesis in Melan-a cells. Furthermore, we compared levels of TYR, TRP-1, TRP-2, MITF, and MC1R mRNA expression by reverse-transcription polymerase chain reaction and showed that treatment of Melan-a cells with 35 μM dhFAME led to an 11-fold decrease in TYR expression, a 6-fold decrease in TRP-2 expression, and a 5-fold decrease in MITF expression. Together, these results indicate that dhFAME is a potent inhibitor of melanin synthesis that can potentially be used for cosmetic biomaterial(s). PMID:25046747

  19. Three-Dimensional Algebraic Models of the tRNA Code and 12 Graphs for Representing the Amino Acids.

    PubMed

    José, Marco V; Morgado, Eberto R; Guimarães, Romeu Cardoso; Zamudio, Gabriel S; de Farías, Sávio Torres; Bobadilla, Juan R; Sosa, Daniela

    2014-01-01

    Three-dimensional algebraic models, also called Genetic Hotels, are developed to represent the Standard Genetic Code, the Standard tRNA Code (S-tRNA-C), and the Human tRNA code (H-tRNA-C). New algebraic concepts are introduced to be able to describe these models, to wit, the generalization of the 2n-Klein Group and the concept of a subgroup coset with a tail. We found that the H-tRNA-C displayed broken symmetries in regard to the S-tRNA-C, which is highly symmetric. We also show that there are only 12 ways to represent each of the corresponding phenotypic graphs of amino acids. The averages of statistical centrality measures of the 12 graphs for each of the three codes are carried out and they are statistically compared. The phenotypic graphs of the S-tRNA-C display a common triangular prism of amino acids in 10 out of the 12 graphs, whilst the corresponding graphs for the H-tRNA-C display only two triangular prisms. The graphs exhibit disjoint clusters of amino acids when their polar requirement values are used. We contend that the S-tRNA-C is in a frozen-like state, whereas the H-tRNA-C may be in an evolving state. PMID:25370377

  20. Three-Dimensional Algebraic Models of the tRNA Code and 12 Graphs for Representing the Amino Acids

    PubMed Central

    José, Marco V.; Morgado, Eberto R.; Guimarães, Romeu Cardoso; Zamudio, Gabriel S.; de Farías, Sávio Torres; Bobadilla, Juan R.; Sosa, Daniela

    2014-01-01

    Three-dimensional algebraic models, also called Genetic Hotels, are developed to represent the Standard Genetic Code, the Standard tRNA Code (S-tRNA-C), and the Human tRNA code (H-tRNA-C). New algebraic concepts are introduced to be able to describe these models, to wit, the generalization of the 2n-Klein Group and the concept of a subgroup coset with a tail. We found that the H-tRNA-C displayed broken symmetries in regard to the S-tRNA-C, which is highly symmetric. We also show that there are only 12 ways to represent each of the corresponding phenotypic graphs of amino acids. The averages of statistical centrality measures of the 12 graphs for each of the three codes are carried out and they are statistically compared. The phenotypic graphs of the S-tRNA-C display a common triangular prism of amino acids in 10 out of the 12 graphs, whilst the corresponding graphs for the H-tRNA-C display only two triangular prisms. The graphs exhibit disjoint clusters of amino acids when their polar requirement values are used. We contend that the S-tRNA-C is in a frozen-like state, whereas the H-tRNA-C may be in an evolving state. PMID:25370377

  1. ELECTRON MICROSCOPIC EXAMINATION OF THE SITES OF NUCLEAR RNA SYNTHESIS DURING AMPHIBIAN EMBRYOGENESIS

    PubMed Central

    Karasaki, Shuichi

    1965-01-01

    The site of H3-uridine incorporation and the fate of labeled RNA during early embryo-genesis of the newt Triturus pyrrhogaster were studied with electron microscopic autoradiography. Isolated ectodermal and mesodermal tissues from the embryos were treated in H3-uridine for 3 hours and cultured in cold solution for various periods before fixation with OsO4 and embedding in Epon. At the blastula stage, the only structural component of the nucleus seen in electron micrographs is a mass of chromatin fibrils. At the early gastrula stage, the primary nucleoli originate as small dense fibrous bodies within the chromatin material. These dense fibrous nucleoli enlarge during successive developmental stages by the acquisition of granular components 150 A in diameter, which form a layer around them. Simultaneously larger granules (300 to 500 A) appear in the chromatin, and they fill the interchromatin spaces by the tail bud stage. Autoradiographic examination has demonstrated that nuclear RNA synthesis takes place in both the nucleolus and the chromatin, with the former consistently showing more label per unit area than the latter. When changes in the distribution pattern of radioactivity were studied 3 to 24 hours after immersion in isotope at each developmental stage, the following results were obtained. Labeled RNA is first localized in the fibrous region of the nucleolus and in the peripheral region of chromatin material. After longer culture in non-radioactive medium, labeled materials also appear in the granular region of the nucleolus and in the interchromatin areas. Further incubation gives labeling in cytoplasm. PMID:19866688

  2. Dihydrolipoic acid activates oligomycin-sensitive thiol groups and increases ATP synthesis in mitochondria.

    PubMed

    Zimmer, G; Mainka, L; Krüger, E

    1991-08-01

    Investigations with dihydrolipoic acid in rat heart mitochondria and mitoplasts reveal an activation of ATP-synthase up to 45%, whereas ATPase activities decrease by 36%. In parallel with an increase in ATP synthesis oligomycin-sensitive mitochondrial -SH groups are activated at 2-4 nmol dihydrolipoic acid/mg protein. ATPase activation by the uncouplers carbonylcyanide-p-trifluoromethoxyphenylhydrazone and oleate is diminished by dihydrolipoic acid, and ATP synthesis depressed by oleate is partially restored. No such efficiency of dihydrolipoic acid is seen with palmitate-induced ATPase activation or decrease of ATP synthesis. This indicates different interference of oleate and palmitate with mitochondria. In addition to its known coenzymatic properties dihydrolipoic acid may act as a substitute for coenzyme A, thereby diminishing the uncoupling efficiency of oleate. Furthermore, dihydrolipoic acid is a very potent antioxidant, shifting the -SH-S-S- equilibrium in mitochondria to the reduced state and improving the energetic state of cells. PMID:1832845

  3. Synthesis of functionalized fluorescent gold nanoclusters for acid phosphatase sensing

    NASA Astrophysics Data System (ADS)

    Sun, Jian; Yang, Fan; Yang, Xiurong

    2015-10-01

    A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au+ complexes, and then a class of ~2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ~1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by introducing an alkaline aqueous solution of MUA into the GSH-Au+ complexes or AuNC@GSH solution. Subsequently, a reliable AuNC@GSH/MUA-based real-time assay of acid phosphatase (ACP) is established for the first time, inspired by the selective coordination of Fe3+ with surface ligands of AuNCs, the higher binding affinity between the pyrophosphate ion (PPi) and Fe3+, and the hydrolysis of PPi into orthophosphate by ACP. Our fluorescent chemosensor can also be applied to assay ACP in a real biological sample and, furthermore, to screen the inhibitor of ACP. This report paves a new avenue for synthesizing AuNCs based on either the bottom-up reduction or top-down etching method, establishing real-time fluorescence assays for ACP by means of PPi as the substrate, and further exploring the sensing applications of fluorescent AuNCs.A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au+ complexes, and then a class of ~2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ~1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by

  4. In Vitro Synthesis of Poliovirus Ribonucleic Acid: Role of the Replicative Intermediate

    PubMed Central

    Girard, Marc

    1969-01-01

    Poliovirus ribonucleic acid (RNA) polymerase crude extracts could be stored frozen in liquid nitrogen without loss of activity or specificity. The major in vitro product of these extracts was viral single-stranded RNA. However, after short periods of incubation with radioactive nucleoside triphosphates, most of the incorporated label was found in replicative intermediate. When excess unlabeled nucleoside triphosphate was added, the label was displaced from the replicative intermediate and accumulated as viral RNA. It is concluded from this experiment that the replicative intermediate is the precursor to viral RNA. In addition, some of the label was chased into double-stranded RNA. The implications of this finding are discussed. PMID:4306193

  5. Long-term leucine induced stimulation of muscle protein synthesis is amino acid dependent

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Infusing leucine for 1 h increases skeletal muscle protein synthesis in the neonate, but this is not sustained for 2 h unless the corresponding fall in amino acids is prevented. This study aimed to determine whether a continuous leucine infusion can stimulate protein synthesis for a prolonged period...

  6. Allosteric vs. spontaneous exit-site (E-site) tRNA dissociation early in protein synthesis

    PubMed Central

    Chen, Chunlai; Stevens, Benjamin; Kaur, Jaskiran; Smilansky, Zeev; Cooperman, Barry S.; Goldman, Yale E.

    2011-01-01

    During protein synthesis, deacylated transfer RNAs leave the ribosome via an exit (E) site after mRNA translocation. How the ribosome regulates tRNA dissociation and whether functional linkages between the aminoacyl (A) and E sites modulate the dynamics of protein synthesis have long been debated. Using single molecule fluorescence resonance energy transfer experiments, we find that, during early cycles of protein elongation, tRNAs are often held in the E site until being allosterically released when the next aminoacyl tRNA binds to the A site. This process is regulated by the length and sequence of the nascent peptide and by the conformational state, detected by tRNA proximity, prior to translocation. In later cycles, E-site tRNA dissociates spontaneously. Our results suggest that the distribution of pretranslocation tRNA states and posttranslocation pathways are correlated within each elongation cycle via communication between distant subdomains in the ribosome, but that this correlation between elongation cycle intermediates does not persist into succeeding cycles. PMID:21969541

  7. An Alkyne Diboration/6π-Electrocyclization Strategy for the Synthesis of Pyridine Boronic Acid Derivatives.

    PubMed

    Mora-Radó, Helena; Bialy, Laurent; Czechtizky, Werngard; Méndez, María; Harrity, Joseph P A

    2016-05-01

    A new and efficient synthesis of pyridine-based heteroaromatic boronic acid derivatives is reported through a novel diboration/6π-electrocyclization strategy. This method delivers a range of functionalized heterocycles from readily available starting materials. PMID:27059895

  8. The Synthesis of an Amino Acid Derivative and Spectroscopic Monitoring of Dipeptide Formation.

    ERIC Educational Resources Information Center

    Simmonds, Richard J.

    1987-01-01

    Described are experiments to give students experience in the synthesis of peptides from amino acids and to use visible spectroscopy to measure a rate of reaction. The activities were designed for undergraduate courses. (RH)

  9. Synthesis and self-assembly of poly(3-hexylthiophene)-block-poly(acrylic acid)

    SciTech Connect

    Li, Zicheng; Ono, Robert J.; Wu, Zong-Quan; Bielawski, Christopher W.

    2011-01-01

    A modular and convenient synthesis of ethynyl end functionalized poly(3-hexylthiophene) in high purity is reported; this material facilitated access to poly(3-hexylthiophene)-block-poly(acrylic acid) which self-assembled into hierarchical structures.

  10. The synthesis of ribonucleic acid during inhibition of Escherichia coli by chlortetracycline

    PubMed Central

    Holmes, Isobel A.; Wild, D. G.

    1965-01-01

    1. During inhibition of Escherichia coli by chlortetracycline, protein synthesis was sharply reduced whereas synthesis of RNA was much less affected. 2. Most of the RNA made during inhibition was contained in particles that sedimented more slowly than ribosomes. 3. The particles were more sensitive than ribosomes to degradation by ultrasonic vibrations and ribonuclease and differed from ribosomes in their behaviour during chromatography on DEAE-cellulose. 4. The particles contained two species of RNA that differed slightly in their sedimentation properties from the two RNA components found in ribosomes. 5. The nature of the events taking place during inhibition by chlortetracycline is discussed with particular reference to the status of the particles that accumulate and to the mode of action of this and other antibiotics. ImagesFig. 2. PMID:16749115

  11. Changes in Oleic Acid Content of Transgenic Soybeans by Antisense RNA Mediated Posttranscriptional Gene Silencing

    PubMed Central

    Zhang, Ling; Yang, Xiang-dong; Zhang, Yuan-yu; Yang, Jing; Qi, Guang-xun; Guo, Dong-quan; Xing, Guo-jie; Yao, Yao; Xu, Wen-jing; Li, Hai-yun; Li, Qi-yun; Dong, Ying-shan

    2014-01-01

    The Delta-12 oleate desaturase gene (FAD2-1), which converts oleic acid into linoleic acid, is the key enzyme determining the fatty acid composition of seed oil. In this study, we inhibited the expression of endogenous Delta-12 oleate desaturase GmFad2-1b gene by using antisense RNA in soybean Williams 82. By employing the soybean cotyledonary-node method, a part of the cDNA of soybean GmFad2-1b 801 bp was cloned for the construction of a pCAMBIA3300 vector under the soybean seed promoter BCSP. Leaf painting, LibertyLink strip, PCR, Southern blot, qRT-PCR, and fatty acid analysis were used to detect the insertion and expression of GmFad2-1b in the transgenic soybean lines. The results indicate that the metabolically engineered plants exhibited a significant increase in oleic acid (up to 51.71%) and a reduction in palmitic acid (to <3%) in their seed oil content. No structural differences were observed between the fatty acids of the transgenic and the nontransgenic oil extracts. PMID:25197629

  12. Cluster of Differentiation 44 Targeted Hyaluronic Acid Based Nanoparticles for MDR1 siRNA Delivery to Overcome Drug Resistance in Ovarian Cancer

    PubMed Central

    Yang, Xiaoqian; Iyer, Arun K.; Singh, Amit; Milane, Lara; Choy, Edwin; Hornicek, Francis J.; Amiji, Mansoor M.; Duan, Zhenfeng

    2014-01-01

    Purpose Approaches for the synthesis of biomaterials to facilitate the delivery of “biologics” is a major area of research in cancer therapy. Here we designed and characterized a hyaluronic acid (HA) based self-assembling nanoparticles that can target CD44 receptors overexpressed on multidrug resistance (MDR) ovarian cancer. The nanoparticle system is composed of HA-poly(ethyleneimine)/HA-poly(ethylene glycol) (HA-PEI/HA-PEG) designed to deliver MDR1 siRNA for the treatment of MDR in an ovarian cancer model. Methods HA-PEI/HA-PEG nanoparticles were synthesized and characterized, then the cellular uptake and knockdown efficiency of HA-PEI/HA-PEG/MDR1 siRNA nanoparticles was further determined. A human xenograft MDR ovarian cancer model was established to evaluate the effects of the combination of HA-PEI/HA-PEG/MDR1 siRNA nanoparticles and paclitaxel on MDR tumor growth. Results Our results demonstrated that HA-PEI/HA-PEG nanoparticles successfully targeted CD44 and delivered MDR1 siRNA into OVCAR8TR (established paclitaxel resistant) tumors. Additionally, HA-PEI/HA-PEG nanoparticles loaded with MDR1 siRNA efficiently down-regulated the expression of MDR1 and P-glycoprotein (Pgp), inhibited the functional activity of Pgp, and subsequently increased cell sensitivity to paclitaxel. HA-PEI/HA-PEG/MDR1 siRNA nanoparticle therapy followed by paclitaxel treatment inhibited tumor growth in MDR ovarian cancer mouse models. Conclusions These findings suggest that this CD44 targeted HA-PEI/HA-PEG nanoparticle platform may be a clinicaly relevant gene delivery system for systemic siRNA-based anticancer therapeutics for the treatment of MDR cancers. PMID:25515492

  13. Smart functional nucleic acid chimeras: Enabling tissue specific RNA targeting therapy

    PubMed Central

    Aaldering, Lukas J; Tayeb, Hossam; Krishnan, Shilpa; Fletcher, Susan; Wilton, Stephen D; Veedu, Rakesh N

    2015-01-01

    A major obstacle for effective utilization of therapeutic oligonucleotides such as siRNA, antisense, antimiRs etc. is to deliver them specifically to the target tissues. Toward this goal, nucleic acid aptamers are re-emerging as a prominent class of biomolecules capable of delivering target specific therapy and therapeutic monitoring by various molecular imaging modalities. This class of short oligonucleotide ligands with high affinity and specificity are selected from a large nucleic acid pool against a molecular target of choice. Poor cellular uptake of therapeutic oligonucleotides impedes gene-targeting efficacy in vitro and in vivo. In contrast, aptamer-oligonucleotide chimeras have shown the capacity to deliver siRNA, antimiRs, small molecule drugs etc. toward various targets and showed very promising results in various studies on different diseases models. However, to further improve the bio-stability of such chimeric conjugates, it is important to introduce chemically-modified nucleic acid analogs. In this review, we highlight the applications of nucleic acid aptamers for target specific delivery of therapeutic oligonucleotides. PMID:25849197

  14. Evolution of Abscisic Acid Synthesis and Signaling Mechanisms

    PubMed Central

    Hauser, Felix; Waadt, Rainer; Schroeder, Julian I.

    2011-01-01

    The plant hormone abscisic acid (ABA) mediates seed dormancy, controls seedling development and triggers tolerance to abiotic stresses, including drought. Core ABA signaling components consist of a recently identified group of ABA receptor proteins of the PYRABACTIN RESISTANCE (PYR)/REGULATORY COMPONENT OF ABA RECEPTOR (RCAR) family that act as negative regulators of members of the PROTEIN PHOSPHATASE 2C (PP2C) family. Inhibition of PP2C activity enables activation of SNF1-RELATED KINASE 2 (SnRK2) protein kinases, which target downstream components, including transcription factors, ion channels and NADPH oxidases. These and other components form a complex ABA signaling network. Here, an in depth analysis of the evolution of components in this ABA signaling network shows that (i) PYR/RCAR ABA receptor and ABF-type transcription factor families arose during land colonization of plants and are not found in algae and other species, (ii) ABA biosynthesis enzymes have evolved to plant- and fungal-specific forms, leading to different ABA synthesis pathways, (iii) existing stress signaling components, including PP2C phosphatases and SnRK kinases, were adapted for novel roles in this plant-specific network to respond to water limitation. In addition, evolutionarily conserved secondary structures in the PYR/RCAR ABA receptor family are visualized. PMID:21549957

  15. Cetalox and analogues: synthesis via acid-mediated polyene cyclizations.

    PubMed

    Snowden, Roger L

    2008-06-01

    Using a novel, acid-mediated cyclization methodology, a direct access to Cetalox ((+/-)-1; a commercially important ambergris-type odorant) and various structurally related didehydro (i.e., 19, 26, and 30) and tetradehydro (i.e., 28 and 37/38) analogues is described. Treatment of either (E,E)-14 or (E)-15 with an excess of FSO(3)H in 2-nitropropane at -90 degrees stereospecifically afforded (+/-)-1 in 40 and 42% yield, respectively. Under similar conditions, cyclization of (E)-18 or 20 furnished 19 in 60 and 64% yield, respectively. Analogously, using an excess of ClSO(3)H in CH(2)Cl(2) at -80 degrees, 26 is formed with high stereoselectivity by cyclization of either (E)-24 or (Z)-25 (52 and 31% yield, resp.); in the same manner, 28 was prepared from 27 (22% yield). The same principle was applied to the synthesis of racemic Superambrox (30), via cyclization of 35, but only with poor selectivity (22%) and low yield (7%). Another approach via cyclization of (E)-40 under solvolysis conditions (excess TFA in CH(2)Cl(2) at -10 degrees) gave a higher yield (15%) with improved selectivity (43%). Finally, cyclization of 34 (1:1 diastereoisomer mixture) afforded 37/38 (10:1) in 27% yield. The qualitative organoleptic properties of 19, 26, 28, 30, and 37/38 (10:1) are briefly discussed. PMID:18618391

  16. Synthesis of carboranyl amino acids, hydantoins, and barbiturates

    SciTech Connect

    Wyzlic, I.M.; Tjarks, W.; Soloway, A.H.

    1996-07-31

    The syntheses of three novel boronated hydantoins, 5-(o-carboran-1-ylmethyl)hydantoin, 14, the tetraphenylphosphonium salt of 7-(hydantoin-5-ylmethyl)dodecahydro-7,8-dicarba-nido-undecaborate, 15, 5-(o-carboran-1-ylmethyl)-2-thiohydantoin, 16, and two new barbiturates, 5,5-bis(but-2-ynyl)barbiturate, 18, and 5,5-bis[(2-methyl-0-carboran-1-yl)methyl]barbiturate, 20, are described. Hydantoins 14-16 were synthesized from o-carboranylalanine (Car, 13). The detailed synthesis of Car and two other carborane-containing amino acids, O-(o-carboran-1-ylmethyl)tyrosine (CBT, 5a) and p-(o-carboran-1-yl)phenylalanine (CBPA, 5b), presented earlier as a communication, {sup 16} are also described. Hydantoin 14 and barbiturates 18 and 20 were tested for their potential anticonvulsant activity. Initial qualitative screening showed moderate activities for hydantoin 14 and barbiturate 18. Barbiturate 20 had no activity. Compound 14 appeared to be nontoxic at doses of 300 mg/kg (mice, ip) and 50 mg/kg (rats, oral). However, 18 was very toxic under similar conditions.

  17. Evolution of DNA and RNA as catalysts for chemical reactions.

    PubMed

    Jäschke, A; Seelig, B

    2000-06-01

    In vitro selection from combinatorial nucleic acid libraries has provided new RNA and DNA molecules that have catalytic properties. Catalyzed reactions now go far beyond self-modifying reactions of nucleic acid molecules. The future application of in vitro selected RNA and DNA catalysts in bioorganic synthesis appears promising. PMID:10826969

  18. Synthesis of 1-O-methylchlorogenic acid: reassignment of structure for MCGA3 isolated from bamboo (Phyllostachys edulis) leaves

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The first synthesis of 1-O-methylchlorogenic acid is described. The short and efficient synthesis of this compound provides laboratory-scale quantities of the material to investigate its biological properties. The synthesis involved C-1 alkylation of the known (-)-4,5-cyclohexylidenequinic acid lact...

  19. WRINKLED1 Rescues Feedback Inhibition of Fatty Acid Synthesis in Hydroxylase-Expressing Seeds.

    PubMed

    Adhikari, Neil D; Bates, Philip D; Browse, John

    2016-05-01

    Previous attempts at engineering Arabidopsis (Arabidopsis thaliana) to produce seed oils containing hydroxy fatty acids (HFA) have resulted in low yields of HFA compared with the native castor (Ricinus communis) plant and caused undesirable effects, including reduced total oil content. Recent studies have led to an understanding of problems involved in the accumulation of HFA in oils of transgenic plants, which include metabolic bottlenecks and a decrease in the rate of fatty acid synthesis. Focusing on engineering the triacylglycerol assembly mechanisms led to modest increases in the HFA content of seed oil, but much room for improvement still remains. We hypothesized that engineering fatty acid synthesis in the plastids to increase flux would facilitate enhanced total incorporation of fatty acids, including HFA, into seed oil. The transcription factor WRINKLED1 (WRI1) positively regulates the expression of genes involved in fatty acid synthesis and controls seed oil levels. We overexpressed Arabidopsis WRI1 in seeds of a transgenic line expressing the castor fatty acid hydroxylase. The proportion of HFA in the oil, the total HFA per seed, and the total oil content of seeds increased to an average of 20.9%, 1.26 µg, and 32.2%, respectively, across five independent lines, compared with 17.6%, 0.83 µg, and 27.9%, respectively, for isogenic segregants. WRI1 and WRI1-regulated genes involved in fatty acid synthesis were up-regulated, providing for a corresponding increase in the rate of fatty acid synthesis. PMID:27208047

  20. WRINKLED1 Rescues Feedback Inhibition of Fatty Acid Synthesis in Hydroxylase-Expressing Seeds1[OPEN

    PubMed Central

    Browse, John

    2016-01-01

    Previous attempts at engineering Arabidopsis (Arabidopsis thaliana) to produce seed oils containing hydroxy fatty acids (HFA) have resulted in low yields of HFA compared with the native castor (Ricinus communis) plant and caused undesirable effects, including reduced total oil content. Recent studies have led to an understanding of problems involved in the accumulation of HFA in oils of transgenic plants, which include metabolic bottlenecks and a decrease in the rate of fatty acid synthesis. Focusing on engineering the triacylglycerol assembly mechanisms led to modest increases in the HFA content of seed oil, but much room for improvement still remains. We hypothesized that engineering fatty acid synthesis in the plastids to increase flux would facilitate enhanced total incorporation of fatty acids, including HFA, into seed oil. The transcription factor WRINKLED1 (WRI1) positively regulates the expression of genes involved in fatty acid synthesis and controls seed oil levels. We overexpressed Arabidopsis WRI1 in seeds of a transgenic line expressing the castor fatty acid hydroxylase. The proportion of HFA in the oil, the total HFA per seed, and the total oil content of seeds increased to an average of 20.9%, 1.26 µg, and 32.2%, respectively, across five independent lines, compared with 17.6%, 0.83 µg, and 27.9%, respectively, for isogenic segregants. WRI1 and WRI1-regulated genes involved in fatty acid synthesis were up-regulated, providing for a corresponding increase in the rate of fatty acid synthesis. PMID:27208047

  1. Lactic acid as an invaluable green solvent for ultrasound-assisted scalable synthesis of pyrrole derivatives.

    PubMed

    Wang, Shi-Fan; Guo, Chao-Lun; Cui, Ke-ke; Zhu, Yan-Ting; Ding, Jun-Xiong; Zou, Xin-Yue; Li, Yi-Hang

    2015-09-01

    Lactic acid has been used as a bio-based green solvent to study the ultrasound-assisted scale-up synthesis. We report here, for the first time, on the novel and scalable process for synthesis of pyrrole derivatives in lactic acid solvent under ultrasonic radiation. Eighteen pyrrole derivatives have been synthesized in lactic acid solvent under ultrasonic radiation and characterized by (1)H NMR, IR, ESI MS. The results show, under ultrasonic radiation, lactic acid solvent can overcome the scale-up challenges and exhibited many advantages, such as bio-based origin, shorter reaction time, lower volatility, higher yields, and ease of isolating the products. PMID:25605585

  2. Synthesis and Characterization of Fatty Acid/Amino Acid Self-Assemblies

    PubMed Central

    Gajowy, Joanna; Bolikal, Durgadas; Kohn, Joachim; El Fray, Miroslawa

    2014-01-01

    In this paper, we discuss the synthesis and self-assembling behavior of new copolymers derived from fatty acid/amino acid components, namely dimers of linoleic acid (DLA) and tyrosine derived diphenols containing alkyl ester pendent chains, designated as “R” (DTR). Specific pendent chains were ethyl (E) and hexyl (H). These poly(aliphatic/aromatic-ester-amide)s were further reacted with poly(ethylene glycol) (PEG) and poly(ethylene glycol methyl ether) of different molecular masses, thus resulting in ABA type (hydrophilic-hydrophobic-hydrophilic) triblock copolymers. We used Fourier transform infrared (FTIR) and nuclear magnetic resonance (NMR) spectroscopies to evaluate the chemical structure of the final materials. The molecular masses were estimated by gel permeation chromatography (GPC) measurements. The self-organization of these new polymeric systems into micellar/nanospheric structures in aqueous environment was evaluated using ultraviolet/visible (UV-VIS) spectroscopy, dynamic light scattering (DLS) and transmission electron microscopy (TEM). The polymers were found to spontaneously self-assemble into nanoparticles with sizes in the range 196–239 nm and critical micelle concentration (CMC) of 0.125–0.250 mg/mL. The results are quite promising and these materials are capable of self-organizing into well-defined micelles/nanospheres encapsulating bioactive molecules, e.g., vitamins or antibacterial peptides for antibacterial coatings on medical devices. PMID:25347356

  3. Abc Amino Acids: Design, Synthesis, and Properties of New Photoelastic Amino Acids

    SciTech Connect

    Standaert, Robert F; Park, Dr Seung Bum

    2006-01-01

    Photoisomerizable amino acids provide a direct avenue to the experimental manipulation of bioactive polypeptides, potentially allowing real-time, remote control of biological systems and enabling useful applications in nanobiotechnology. Herein, we report a new class of photoisomerizable amino acids intended to cause pronounced expansion and contraction in the polypeptide backbone, i.e., to be photoelastic. These compounds, termed Abc amino acids, employ a photoisomerizable azobiphenyl chromophore to control the relative disposition of aminomethyl and carboxyl substituents. Molecular modeling of nine Abc isomers led to the identification of one with particularly attractive properties, including the ability to induce contractions up to 13A in the backbone upon transa?cis photoisomerization. This isomer, designated mpAbc, has substituents at meta and para positions on the inner (azo-linked) and outer rings, respectively. An efficient synthesis of Fmoc-protected mpAbc was executed in which the biaryl components were formed via Suzuki couplings and the azo linkage was formed via amine/nitroso condensation; protected forms of three other Abc isomers were prepared similarly. A decapeptide incorporating mpAbc was synthesized by conventional solid-phase methods and displayed characteristic azobenzene photochemical behavior with optimal conversion to the cis isomer at 360 nm and a thermal cisa?trans half life of 100 min. at 80 AoC.

  4. Preparation, characterization and catalytic properties of MCM-48 supported tungstophosphoric acid mesoporous materials for green synthesis of benzoic acid

    SciTech Connect

    Wu, Hai-Yan; Zhang, Xiao-Li; Chen, Xi; Chen, Ya; Zheng, Xiu-Cheng

    2014-03-15

    MCM-48 and tungstophosphoric acid (HPW) were prepared and applied for the synthesis of HPW/MCM-48 mesoporous materials. The characterization results showed that HPW/MCM-48 obtained retained the typical mesopore structure of MCM-48, and the textural parameters decreased with the increase loading of HPW. The catalytic oxidation results of benzyl alcohol and benzaldehyde with 30% H{sub 2}O{sub 2} indicated that HPW/MCM-48 was an efficient catalyst for the green synthesis of benzoic acid. Furthermore, 35 wt% HPW/MCM-48 sample showed the highest activity under the reaction conditions. Highlights: • 5–45 wt% HPW/MCM-48 mesoporous catalysts were prepared and characterized. • Their catalytic activities for the green synthesis of benzoic acid were investigated. • HPW/MCM-48 was approved to be an efficient catalyst. • 5 wt% HPW/MCM-48 exhibited the highest catalytic activity.

  5. Respiratory CO(2) as Carbon Source for Nocturnal Acid Synthesis at High Temperatures in Three Species Exhibiting Crassulacean Acid Metabolism.

    PubMed

    Winter, K; Schröppel-Meier, G; Caldwell, M M

    1986-06-01

    TEMPERATURE EFFECTS ON NOCTURNAL CARBON GAIN AND NOCTURNAL ACID ACCUMULATION WERE STUDIED IN THREE SPECIES OF PLANTS EXHIBITING CRASSULACEAN ACID METABOLISM: Mamillaria woodsii, Opuntia vulgaris, and Kalanchoë daigremontiana. Under conditions of high soil moisture, nocturnal CO(2) gain and acid accumulation had temperature optima at 15 to 20 degrees C. Between 5 and 15 degrees C, uptake of atmospheric CO(2) largely accounted for acid accumulation. At higher tissue temperatures, acid accumulation exceeded net carbon gain indicating that acid synthesis was partly due to recycling of respiratory CO(2). When plants were kept in CO(2)-free air, acid accumulation based on respiratory CO(2) was highest at 25 to 35 degrees C. Net acid synthesis occurred up to 45 degrees C, although the nocturnal carbon balance became largely negative above 25 to 35 degrees C. Under conditions of water stress, net CO(2) exchange and nocturnal acid accumulation were reduced. Acid accumulation was proportionally more decreased at low than at high temperatures. Acid accumulation was either similar over the whole temperature range (5-45 degrees C) or showed an optimum at high temperatures, although net carbon balance became very negative with increasing tissue temperatures. Conservation of carbon by recycling respiratory CO(2) was temperature dependent. At 30 degrees C, about 80% of the dark respiratory CO(2) was conserved by dark CO(2) fixation, in both well irrigated and water stressed plants. PMID:16664827

  6. Automated parallel synthesis of 5'-triphosphate oligonucleotides and preparation of chemically modified 5'-triphosphate small interfering RNA.

    PubMed

    Zlatev, Ivan; Lackey, Jeremy G; Zhang, Ligang; Dell, Amy; McRae, Kathy; Shaikh, Sarfraz; Duncan, Richard G; Rajeev, Kallanthottathil G; Manoharan, Muthiah

    2013-02-01

    A fully automated chemical method for the parallel and high-throughput solid-phase synthesis of 5'-triphosphate and 5'-diphosphate oligonucleotides is described. The desired full-length oligonucleotides were first constructed using standard automated DNA/RNA solid-phase synthesis procedures. Then, on the same column and instrument, efficient implementation of an uninterrupted sequential cycle afforded the corresponding unmodified or chemically modified 5'-triphosphates and 5'-diphosphates. The method was readily translated into a scalable and high-throughput synthesis protocol compatible with the current DNA/RNA synthesizers yielding a large variety of unique 5'-polyphosphorylated oligonucleotides. Using this approach, we accomplished the synthesis of chemically modified 5'-triphosphate oligonucleotides that were annealed to form small-interfering RNAs (ppp-siRNAs), a potentially interesting class of novel RNAi therapeutic tools. The attachment of the 5'-triphosphate group to the passenger strand of a siRNA construct did not induce a significant improvement in the in vitro RNAi-mediated gene silencing activity nor a strong specific in vitro RIG-I activation. The reported method will enable the screening of many chemically modified ppp-siRNAs, resulting in a novel bi-functional RNAi therapeutic platform. PMID:23260577

  7. Increased Long Chain acyl-Coa Synthetase Activity and Fatty Acid Import Is Linked to Membrane Synthesis for Development of Picornavirus Replication Organelles

    PubMed Central

    Scott, Alison J.; Ford, Lauren A.; Pei, Zhengtong; Watkins, Paul A.; Ernst, Robert K.; Belov, George A.

    2013-01-01

    All positive strand (+RNA) viruses of eukaryotes replicate their genomes in association with membranes. The mechanisms of membrane remodeling in infected cells represent attractive targets for designing future therapeutics, but our understanding of this process is very limited. Elements of autophagy and/or the secretory pathway were proposed to be hijacked for building of picornavirus replication organelles. However, even closely related viruses differ significantly in their requirements for components of these pathways. We demonstrate here that infection with diverse picornaviruses rapidly activates import of long chain fatty acids. While in non-infected cells the imported fatty acids are channeled to lipid droplets, in infected cells the synthesis of neutral lipids is shut down and the fatty acids are utilized in highly up-regulated phosphatidylcholine synthesis. Thus the replication organelles are likely built from de novo synthesized membrane material, rather than from the remodeled pre-existing membranes. We show that activation of fatty acid import is linked to the up-regulation of cellular long chain acyl-CoA synthetase activity and identify the long chain acyl-CoA syntheatse3 (Acsl3) as a novel host factor required for polio replication. Poliovirus protein 2A is required to trigger the activation of import of fatty acids independent of its protease activity. Shift in fatty acid import preferences by infected cells results in synthesis of phosphatidylcholines different from those in uninfected cells, arguing that the viral replication organelles possess unique properties compared to the pre-existing membranes. Our data show how poliovirus can change the overall cellular membrane homeostasis by targeting one critical process. They explain earlier observations of increased phospholipid synthesis in infected cells and suggest a simple model of the structural development of the membranous scaffold of replication complexes of picorna-like viruses, that may be

  8. Dual mechanisms of translation initiation of the full-length HIV-1 mRNA contribute to gag synthesis.

    PubMed

    Monette, Anne; Valiente-Echeverría, Fernando; Rivero, Matias; Cohen, Éric A; Lopez-Lastra, Marcelo; Mouland, Andrew J

    2013-01-01

    The precursor group-specific antigen (pr55(Gag)) is central to HIV-1 assembly. Its expression alone is sufficient to assemble into virus-like particles. It also selects the genomic RNA for encapsidation and is involved in several important virus-host interactions for viral assembly and restriction, making its synthesis essential for aspects of viral replication. Here, we show that the initiation of translation of the HIV-1 genomic RNA is mediated through both a cap-dependent and an internal ribosome entry site (IRES)-mediated mechanisms. In support of this notion, pr55(Gag) synthesis was maintained at 70% when cap-dependent translation initiation was blocked by the expression of eIF4G- and PABP targeting viral proteases in two in vitro systems and in HIV-1-expressing cells directly infected with poliovirus. While our data reveal that IRES-dependent translation of the viral genomic RNA ensures pr55(Gag) expression, the synthesis of other HIV-1 proteins, including that of pr160(Gag/Pol), Vpr and Tat is suppressed early during progressive poliovirus infection. The data presented herein implies that the unspliced HIV-1 genomic RNA utilizes both cap-dependent and IRES-dependent translation initiation to supply pr55(Gag) for virus assembly and production. PMID:23861855

  9. Inhibition of pyrimidine synthesis reverses viral virulence factor-mediated block of mRNA nuclear export

    PubMed Central

    Zhang, Liang; Das, Priyabrata; Schmolke, Mirco; Manicassamy, Balaji; Wang, Yaming; Deng, Xiaoyi; Cai, Ling; Tu, Benjamin P.; Forst, Christian V.; Roth, Michael G.; Levy, David E.; García-Sastre, Adolfo; de Brabander, Jef; Phillips, Margaret A.

    2012-01-01

    The NS1 protein of influenza virus is a major virulence factor essential for virus replication, as it redirects the host cell to promote viral protein expression. NS1 inhibits cellular messenger ribonucleic acid (mRNA) processing and export, down-regulating host gene expression and enhancing viral gene expression. We report in this paper the identification of a nontoxic quinoline carboxylic acid that reverts the inhibition of mRNA nuclear export by NS1, in the absence or presence of the virus. This quinoline carboxylic acid directly inhibited dihydroorotate dehydrogenase (DHODH), a host enzyme required for de novo pyrimidine biosynthesis, and partially reduced pyrimidine levels. This effect induced NXF1 expression, which promoted mRNA nuclear export in the presence of NS1. The release of NS1-mediated mRNA export block by DHODH inhibition also occurred in the presence of vesicular stomatitis virus M (matrix) protein, another viral inhibitor of mRNA export. This reversal of mRNA export block allowed expression of antiviral factors. Thus, pyrimidines play a necessary role in the inhibition of mRNA nuclear export by virulence factors. PMID:22312003

  10. Suppression of glycosaminoglycan synthesis by articular cartilage, but not of hyaluronic acid synthesis by synovium, after exposure to radiation

    SciTech Connect

    Hugenberg, S.T.; Myers, S.L.; Brandt, K.D.

    1989-04-01

    We recently found that injection of 2 mCi of yttrium 90 (90Y; approximately 23,000 rads) into normal canine knees stimulated glycosaminoglycan (GAG) synthesis by femoral condylar cartilage. The present investigation was conducted to determine whether radiation affects cartilage metabolism directly. Rates of GAG synthesis and degradation in normal canine articular cartilage were studied following irradiation. Cultured synovium from the same knees was treated similarly, to determine the effects of irradiation on hyaluronic acid synthesis. Twenty-four hours after exposure to 1,000 rads, 10,000 rads, or 50,000 rads, 35S-GAG synthesis by the cartilage was 93%, 69%, and 37%, respectively, of that in control, nonirradiated cartilage. The effect was not rapidly reversible: 120 hours after exposure to 50,000 rads, GAG synthesis remained at only 28% of the control level. Autoradiography showed marked suppression of 35S uptake by chondrocytes after irradiation. Cartilage GAG degradation was also increased following irradiation: 4 hours and 8 hours after exposure to 50,000 rads, the cartilage GAG concentration was only 66% and 54%, respectively, of that at time 0, while corresponding values for control, nonirradiated cartilage were 90% and 87%. In contrast to its effects on cartilage GAG metabolism, radiation at these levels had no effect on synovial hyaluronic acid synthesis.

  11. Characterization of a novel N-acetylneuraminic acid lyase favoring N-acetylneuraminic acid synthesis.

    PubMed

    Ji, Wenyan; Sun, Wujin; Feng, Jinmei; Song, Tianshun; Zhang, Dalu; Ouyang, Pingkai; Gu, Zhen; Xie, Jingjing

    2015-01-01

    N-Acetylneuraminic acid lyase (NAL, E.C. number 4.1.3.3) is a Class I aldolase that catalyzes the reversible aldol cleavage of N-acetylneuraminic acid (Neu5Ac) from pyruvate and N-acetyl-D-mannosamine (ManNAc). Due to the equilibrium favoring Neu5Ac cleavage, the enzyme catalyzes the rate-limiting step of two biocatalytic reactions producing Neu5Ac in industry. We report the biochemical characterization of a novel NAL from a "GRAS" (General recognized as safe) strain C. glutamicum ATCC 13032 (CgNal). Compared to all previously reported NALs, CgNal exhibited the lowest kcat/Km value for Neu5Ac and highest kcat/Km values for ManNAc and pyruvate, which makes CgNal favor Neu5Ac synthesis the most. The recombinant CgNal reached the highest expression level (480 mg/L culture), and the highest reported yield of Neu5Ac was achieved (194 g/L, 0.63 M). All these unique properties make CgNal a promising biocatalyst for industrial Neu5Ac biosynthesis. Additionally, although showing the best Neu5Ac synthesis activity among the NAL family, CgNal is more related to dihydrodipicolinate synthase (DHDPS) by phylogenetic analysis. The activities of CgNal towards both NAL's and DHDPS' substrates are fairly high, which indicates CgNal a bi-functional enzyme. The sequence analysis suggests that CgNal might have adopted a unique set of residues for substrates recognition. PMID:25799411

  12. Screening and Characterization of a Novel RNA Aptamer That Specifically Binds to Human Prostatic Acid Phosphatase and Human Prostate Cancer Cells

    PubMed Central

    Kong, Hoon Young; Byun, Jonghoe

    2015-01-01

    Prostatic acid phosphatase (PAP) expression increases proportionally with prostate cancer progression, making it useful in prognosticating intermediate to high-risk prostate cancers. A novel ligand that can specifically bind to PAP would be very helpful for guiding prostate cancer therapy. RNA aptamers bind to target molecules with high specificity and have key advantages such as low immunogenicity and easy synthesis. Here, human PAP-specific aptamers were screened from a 2′-fluoropyrimidine (FY)-modified RNA library by SELEX. The candidate aptamer families were identified within six rounds followed by analysis of their sequences and PAP-specific binding. A gel shift assay was used to identify PAP binding aptamers and the 6N aptamer specifically bound to PAP with a Kd value of 118 nM. RT-PCR and fluorescence labeling analyses revealed that the 6N aptamer bound to PAP-positive mammalian cells, such as PC-3 and LNCaP. IMR-90 negative control cells did not bind the 6N aptamer. Systematic minimization analyses revealed that 50 nucleotide sequences and their two hairpin structures in the 6N 2′-FY RNA aptamer were equally important for PAP binding. Renewed interest in PAP combined with the versatility of RNA aptamers, including conjugation of anti-cancer drugs and nano-imaging probes, could open up a new route for early theragnosis of prostate cancer. PMID:25591398

  13. Thermal synthesis and hydrolysis of polyglyceric acid. [in orgin of life studying

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1989-01-01

    Polyglyceric acid was synthesized by thermal condensation of glyceric acid at 80 C in the presence and absence of two mole percent of sulfuric acid catalyst. The acid catalyst accelerated the polymerization over 100-fold and made possible the synthesis of insoluble polymers of both L- and DL-glyceric acid by heating for less than 1 day. Racemization of L-glyceric acid yielded less than 1 percent D-glyceric acid in condensations carried out at 80 C with catalyst for 1 day and without catalyst for 12 days. The condensation of L-glyceric acid yielded an insoluble polymer much more readily than condensation of DL-glyceric acid. Studies of the hydrolysis of poly-DL-glyceric acid revealed that it was considerably more stable under mild acidic conditions compared to neutral pH. The relationship of this study to the origin of life is discussed.

  14. NANS-mediated synthesis of sialic acid is required for brain and skeletal development.

    PubMed

    van Karnebeek, Clara D M; Bonafé, Luisa; Wen, Xiao-Yan; Tarailo-Graovac, Maja; Balzano, Sara; Royer-Bertrand, Beryl; Ashikov, Angel; Garavelli, Livia; Mammi, Isabella; Turolla, Licia; Breen, Catherine; Donnai, Dian; Cormier, Valerie; Heron, Delphine; Nishimura, Gen; Uchikawa, Shinichi; Campos-Xavier, Belinda; Rossi, Antonio; Hennet, Thierry; Brand-Arzamendi, Koroboshka; Rozmus, Jacob; Harshman, Keith; Stevenson, Brian J; Girardi, Enrico; Superti-Furga, Giulio; Dewan, Tammie; Collingridge, Alissa; Halparin, Jessie; Ross, Colin J; Van Allen, Margot I; Rossi, Andrea; Engelke, Udo F; Kluijtmans, Leo A J; van der Heeft, Ed; Renkema, Herma; de Brouwer, Arjan; Huijben, Karin; Zijlstra, Fokje; Heisse, Thorben; Boltje, Thomas; Wasserman, Wyeth W; Rivolta, Carlo; Unger, Sheila; Lefeber, Dirk J; Wevers, Ron A; Superti-Furga, Andrea

    2016-07-01

    We identified biallelic mutations in NANS, the gene encoding the synthase for N-acetylneuraminic acid (NeuNAc; sialic acid), in nine individuals with infantile-onset severe developmental delay and skeletal dysplasia. Patient body fluids showed an elevation in N-acetyl-D-mannosamine levels, and patient-derived fibroblasts had reduced NANS activity and were unable to incorporate sialic acid precursors into sialylated glycoproteins. Knockdown of nansa in zebrafish embryos resulted in abnormal skeletal development, and exogenously added sialic acid partially rescued the skeletal phenotype. Thus, NANS-mediated synthesis of sialic acid is required for early brain development and skeletal growth. Normal sialylation of plasma proteins was observed in spite of NANS deficiency. Exploration of endogenous synthesis, nutritional absorption, and rescue pathways for sialic acid in different tissues and developmental phases is warranted to design therapeutic strategies to counteract NANS deficiency and to shed light on sialic acid metabolism and its implications for human nutrition. PMID:27213289

  15. Amino Acid Signature Enables Proteins to Recognize Modified tRNA

    PubMed Central

    2015-01-01

    Human tRNALys3UUU is the primer for HIV replication. The HIV-1 nucleocapsid protein, NCp7, facilitates htRNALys3UUU recruitment from the host cell by binding to and remodeling the tRNA structure. Human tRNALys3UUU is post-transcriptionally modified, but until recently, the importance of those modifications in tRNA recognition by NCp7 was unknown. Modifications such as the 5-methoxycarbonylmethyl-2-thiouridine at anticodon wobble position-34 and 2-methylthio-N6-threonylcarbamoyladenosine, adjacent to the anticodon at position-37, are important to the recognition of htRNALys3UUU by NCp7. Several short peptides selected from phage display libraries were found to also preferentially recognize these modifications. Evolutionary algorithms (Monte Carlo and self-consistent mean field) and assisted model building with energy refinement were used to optimize the peptide sequence in silico, while fluorescence assays were developed and conducted to verify the in silico results and elucidate a 15-amino acid signature sequence (R-W-Q/N-H-X2-F-Pho-X-G/A-W-R-X2-G, where X can be most amino acids, and Pho is hydrophobic) that recognized the tRNA’s fully modified anticodon stem and loop domain, hASLLys3UUU. Peptides of this sequence specifically recognized and bound modified htRNALys3UUU with an affinity 10-fold higher than that of the starting sequence. Thus, this approach provides an effective means of predicting sequences of RNA binding peptides that have better binding properties. Such peptides can be used in cell and molecular biology as well as biochemistry to explore RNA binding proteins and to inhibit those protein functions. PMID:24483944

  16. Inhibition of sterol but not fatty acid synthesis by valproate in developing rat brain in vivo.

    PubMed Central

    Bolaños, J P; Medina, J M; Williamson, D H

    1990-01-01

    The effect of administration of valproate on lipogenesis in the developing rat brain in vivo was studied. Valproate inhibited by 21-38% the rate of 3H2O incorporation into brain sterols, without significantly affecting fatty acid synthesis. Similarly, R-[2-14C]mevalonate incorporation into sterols was inhibited by 33-54%; the low rate of fatty acid synthesis under these conditions was not affected by valproate. Plasma ketone bodies decreased after treatment with valproate. Valproate inhibited (about 50%) both sterol and fatty acid synthesis in livers of weanling rats. It is concluded that valproate can specifically inhibit sterol synthesis in the brain during development, in part at a stage after mevalonate formation, and also by decreased exogenous precursor supply. PMID:2264830

  17. RNA Crystallization

    NASA Technical Reports Server (NTRS)

    Golden, Barbara L.; Kundrot, Craig E.

    2003-01-01

    RNA molecules may be crystallized using variations of the methods developed for protein crystallography. As the technology has become available to syntheisize and purify RNA molecules in the quantities and with the quality that is required for crystallography, the field of RNA structure has exploded. The first consideration when crystallizing an RNA is the sequence, which may be varied in a rational way to enhance crystallizability or prevent formation of alternate structures. Once a sequence has been designed, the RNA may be synthesized chemically by solid-state synthesis, or it may be produced enzymatically using RNA polymerase and an appropriate DNA template. Purification of milligram quantities of RNA can be accomplished by HPLC or gel electrophoresis. As with proteins, crystallization of RNA is usually accomplished by vapor diffusion techniques. There are several considerations that are either unique to RNA crystallization or more important for RNA crystallization. Techniques for design, synthesis, purification, and crystallization of RNAs will be reviewed here.

  18. MicroRNA-133 Inhibits Behavioral Aggregation by Controlling Dopamine Synthesis in Locusts

    PubMed Central

    Wang, Yanli; Guo, Xiaojiao; He, Jing; Kang, Le

    2014-01-01

    Phenotypic plasticity is ubiquitous and primarily controlled by interactions between environmental and genetic factors. The migratory locust, a worldwide pest, exhibits pronounced phenotypic plasticity, which is a population density-dependent transition that occurs between the gregarious and solitary phases. Genes involved in dopamine synthesis have been shown to regulate the phase transition of locusts. However, the function of microRNAs in this process remains unknown. In this study, we report the participation of miR-133 in dopamine production and the behavioral transition by negatively regulating two critical genes, henna and pale, in the dopamine pathway. miR-133 participated in the post-transcriptional regulation of henna and pale by binding to their coding region and 3′ untranslated region, respectively. miR-133 displayed cellular co-localization with henna/pale in the protocerebrum, and its expression in the protocerebrum was negatively correlated with henna and pale expression. Moreover, miR-133 agomir delivery suppressed henna and pale expression, which consequently decreased dopamine production, thus resulting in the behavioral shift of the locusts from the gregarious phase to the solitary phase. Increasing the dopamine content could rescue the solitary phenotype, which was induced by miR-133 agomir delivery. Conversely, miR-133 inhibition increased the expression of henna and pale, resulting in the gregarious-like behavior of solitary locusts; this gregarious phenotype could be rescued by RNA interference of henna and pale. This study shows the novel function and modulation pattern of a miRNA in phenotypic plasticity and provides insight into the underlying molecular mechanisms of the phase transition of locusts. PMID:24586212

  19. Leucine-Enriched Essential Amino Acids Augment Mixed Protein Synthesis, But Not Collagen Protein Synthesis, in Rat Skeletal Muscle after Downhill Running.

    PubMed

    Kato, Hiroyuki; Suzuki, Hiromi; Inoue, Yoshiko; Suzuki, Katsuya; Kobayashi, Hisamine

    2016-01-01

    Mixed and collagen protein synthesis is elevated for as many as 3 days following exercise. Immediately after exercise, enhanced amino acid availability increases synthesis of mixed muscle protein, but not muscle collagen protein. However, the potential for synergic effects of amino acid ingestion with exercise on both mixed and collagen protein synthesis remains unclear. We investigated muscle collagen protein synthesis in rats following post-exercise ingestion of leucine-enriched essential amino acids. We determined fractional protein synthesis rates (FSR) at different time points following exercise. Mixed protein and collagen protein FSRs in skeletal muscle were determined by measuring protein-bound enrichments of hydroxyproline and proline, and by measuring the intracellular enrichment of proline, using injections of flooding d₃-proline doses. A leucine-enriched mixture of essential amino acids (or distilled water as a control) was administrated 30 min or 1 day post-exercise. The collagen protein synthesis in the vastus lateralis was elevated for 2 days after exercise. Although amino acid administration did not increase muscle collagen protein synthesis, it did lead to augmented mixed muscle protein synthesis 1 day following exercise. Thus, contrary to the regulation of mixed muscle protein synthesis, muscle collagen protein synthesis is not affected by amino acid availability after damage-inducing exercise. PMID:27367725

  20. Leucine-Enriched Essential Amino Acids Augment Mixed Protein Synthesis, But Not Collagen Protein Synthesis, in Rat Skeletal Muscle after Downhill Running

    PubMed Central

    Kato, Hiroyuki; Suzuki, Hiromi; Inoue, Yoshiko; Suzuki, Katsuya; Kobayashi, Hisamine

    2016-01-01

    Mixed and collagen protein synthesis is elevated for as many as 3 days following exercise. Immediately after exercise, enhanced amino acid availability increases synthesis of mixed muscle protein, but not muscle collagen protein. However, the potential for synergic effects of amino acid ingestion with exercise on both mixed and collagen protein synthesis remains unclear. We investigated muscle collagen protein synthesis in rats following post-exercise ingestion of leucine-enriched essential amino acids. We determined fractional protein synthesis rates (FSR) at different time points following exercise. Mixed protein and collagen protein FSRs in skeletal muscle were determined by measuring protein-bound enrichments of hydroxyproline and proline, and by measuring the intracellular enrichment of proline, using injections of flooding d3-proline doses. A leucine-enriched mixture of essential amino acids (or distilled water as a control) was administrated 30 min or 1 day post-exercise. The collagen protein synthesis in the vastus lateralis was elevated for 2 days after exercise. Although amino acid administration did not increase muscle collagen protein synthesis, it did lead to augmented mixed muscle protein synthesis 1 day following exercise. Thus, contrary to the regulation of mixed muscle protein synthesis, muscle collagen protein synthesis is not affected by amino acid availability after damage-inducing exercise. PMID:27367725

  1. α-Lipoic Acids Promote the Protein Synthesis of C2C12 Myotubes by the TLR2/PI3K Signaling Pathway.

    PubMed

    Jing, Yuanyuan; Cai, Xingcai; Xu, Yaqiong; Zhu, Canjun; Wang, Lina; Wang, Songbo; Zhu, Xiaotong; Gao, Ping; Zhang, Yongliang; Jiang, Qingyan; Shu, Gang

    2016-03-01

    Skeletal muscle protein turnover is regulated by endocrine hormones, nutrients, and inflammation. α-Lipoic acid (ALA) plays an important role in energy homeostasis. Therefore, the aim of this study was to investigate the effects of ALA on protein synthesis in skeletal muscles and reveal the underlying mechanism. ALA (25 μM) significantly increased the protein synthesis and phosphorylation of Akt, mTOR, and S6 in C2C12 myotubes with attenuated phosphorylation of AMPK, Ikkα/β, and eIF2α. Intraperitoneal injection of 50 mg/kg ALA also produced the same results in mouse gastrocnemius. Both the PI3K (LY294002) and mTOR (rapamycin) inhibitors abolished the effects of ALA on protein synthesis in the C2C12 myotubes. However, AICAR (AMPK agonist) failed to block the activation of mTOR and S6 by ALA. ALA increased TLR2 and MyD88 mRNA expression in the C2C12 myotubes. TLR2 knockdown by siRNA almost eliminated the effects of ALA on protein synthesis and the Akt/mTOR pathway in the C2C12 myotubes. Immunoprecipitation data showed that ALA enhanced the p85 subunit of PI3K binding to MyD88. These findings indicate that ALA induces protein synthesis and the PI3K/Akt signaling pathway by TLR2. PMID:26855124

  2. Chemical synthesis of the hexanucleotide d(A-C-C-A-G-C) required to isolate fibroin mRNA on an affinity column.

    PubMed Central

    Cashion, P; Notman, H; Sathe, G; Cadger, T; Porter, K; Jay, E

    1977-01-01

    The synthesis of the hexanucleotide d)A-C-C-A-G-C), complementary to the 2 major triplets of fibroin mRNA, using the phosphotriester methodology is described. The protected dinucleotides ((MeO)2Tr)dbzA.anC, ((MeO)2Tr)danC.bzA and ((meO)2Tr)dacG.anC were synthesized; the latter two were detritylated and joined in stepwize fashion to the 1st to form the protected hexanucleotide ((MeO)2Tr)dbzA.anC.anC.bzA.acG.anC. The latter was deblocked with NH3 and acid to form the hexanucleotide d(A-C-C-A-G-C). In view of the ability of a prototype affinity column, oligo dC-cellulose, to isolate fibroin mRNA, prospects appear excellent for the d(A-C-C-A-G-C)-cellulose affinity column isolation of fibroin mRNA. PMID:909785

  3. On-Electrode Synthesis of Shape-Controlled Hierarchical Flower-Like Gold Nanostructures for Efficient Interfacial DNA Assembly and Sensitive Electrochemical Sensing of MicroRNA.

    PubMed

    Su, Shao; Wu, Yan; Zhu, Dan; Chao, Jie; Liu, Xingfen; Wan, Ying; Su, Yan; Zuo, Xiaolei; Fan, Chunhai; Wang, Lianhui

    2016-07-01

    The performance for biomolecular detection is closely associated with the interfacial structure of a biosensor, which profoundly affects both thermodynamics and kinetics of the assembly, binding and signal transduction of biomolecules. Herein, it is reported on a one-step and template-free on-electrode synthesis method for making shape-controlled gold nanostructures on indium tin oxide substrates, which provide an electrochemical sensing platform for ultrasensitive detection of nucleic acids. Thus-prepared hierarchical flower-like gold nanostructures (HFGNs) possess large surface area that can readily accommodate the assembly of DNA probes for subsequent hybridization detection. It is found that the sensitivity for electrochemical DNA sensing is critically dependent on the morphology of HFGNs. By using this new strategy, a highly sensitive electrochemical biosensor is developed for label-free detection of microRNA-21 (miRNA-21), a biomarker for lung cancers. Importantly, it is demonstrated that this biosensor can be employed to measure the miRNA-21 expression level from human lung cancer cell (A549) lysates and worked well in 100% serum, suggesting its potential for applications in clinical diagnosis and a wide range of bioanalysis. PMID:27305644

  4. Synthesis of 6-phosphofructose aspartic acid and some related Amadori compounds.

    PubMed

    Hansen, Alexandar L; Behrman, Edward J

    2016-08-01

    We describe the synthesis and characterization of 6-phosphofructose-aspartic acid, an intermediate in the metabolism of fructose-asparagine by Salmonella. We also report improved syntheses of fructose-asparagine itself and of fructose-aspartic acid. PMID:27258673

  5. 4-Dimenthylaminopyridine or Acid-Catalyzed Synthesis of Esters: A Comparison

    ERIC Educational Resources Information Center

    van den Berg, Annemieke W. C.; Hanefeld, Ulf

    2006-01-01

    A set of highly atom-economic experiments was developed to highlight the differences between acid- and base-catalyzed ester syntheses and to introduce the principles of atom economy. The hydrochloric acid-catalyzed formation of an ester was compared with the 4-dimethylaminopyradine-catalyzed ester synthesis.

  6. Exogenous fatty acids affect CDP-choline pathway to increase phosphatidylcholine synthesis in granular pneumocytes

    SciTech Connect

    Chander, A.; Gullo, J.; Reicherter, J.; Fisher, A.

    1987-05-01

    Regulation of phosphatidylcholine (PC) synthesis in rat granular pneumocytes isolated by tryptic digestion of lungs and maintained in primary culture for 24 h was investigated by following effects of exogenous fatty acids on (/sup 3/H-methyl)choline incorporation into PC and disaturated PC (DSPC). At 0.1 mM choline, the rate of choline incorporation into PC and DSPC was 440 +/- and 380 +/- 50 pmol/h/ug Pi (mean +/- SE, n=3-5), respectively, and was linear for up to 3 h. PC synthesis was significantly increased by 0.1 mM each of palmitic, oleic, linoleic, or linolenic acid. However, synthesis of DSPC was increased only by palmitic acid and this increase was prevented by addition of oleic acid suggesting lack of effect on the remodeling pathway. Pulse-chase experiments with choline in absence or presence of palmitic or oleic acid showed that the label declined in choline phosphate and increased in PC more rapidly in presence of either of the fatty acids, suggesting rapid conversion of choline phosphate to PC. Microsomal choline phosphate cytidyltransferase activity in cells preincubated without or with palmitic acid for 3 h was 0.81 +/- 0.07 and 1.81 +/- 0.09 nmol choline phosphate converted/min/mg protein (n=4). These results suggest that in granular pneumocytes, exogenous fatty acids modulate PC synthesis by increasing choline phosphate cytidyltransferase activity.

  7. Synthesis of novel trivalent amino acid glycoconjugates based on the cyclotriveratrylene ('CTV') scaffold.

    PubMed

    van Ameijde, Jeroen; Liskamp, Rob M J

    2003-08-01

    The convenient synthesis of novel trivalent amino acid glycoconjugates based on cyclotriveratrylene ('CTV') is described. These constructs consist of the CTV scaffold, three oligoethylene glycol spacers of variable length connected to a glyco amino acid residue which can also be varied. The resulting library of trivalent glycoconjugates can be used for studying multivalent interactions. PMID:12948190

  8. Diesters from Oleic Acid: Synthesis, Low Temperature Properties, and Oxidation Stability

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Several diesters were prepared from commercially available oleic acid and common organic acids. The key step in the three step synthesis of oleochemical diesters entails a ring opening esterification of alkyl 9,10-epoxyoctadecanoates (alkyl: propyl, iso-propyl, octyl, 2-ethylhexyl) using propionic a...

  9. [The clinical evaluation of the hypocholesterolemic effects of an inhibitor of cholesterol synthesis: mevalonic acid].

    PubMed

    Del Nero, E; Aloe, N; Augeri, C; Avola, F; Carta, G; Cavagnaro, A; De Grandi, R; Gianfreda, M; Magro, G P; Mazzarello, G P

    1992-07-01

    Twenty eight patients with heterozygous familial hypercholesterolemia were treated with mevalonic acid (an inhibitor of cholesterol synthesis) for 45 days. Patients received a daily dose of 750 to 1500 mg mevalonic acid depending on plasma cholesterol levels. Results showed a significant reduction in cholesterol values whereas no significant difference was observed in HDL cholesterol and triglyceride levels. PMID:1505176

  10. The effect of gestational age on expression of genes involved in uptake, trafficking and synthesis of fatty acids in the rat placenta.

    PubMed

    Rodríguez-Cruz, Maricela; González, Raúl Sánchez; Maldonado, Jorge; López-Alarcón, Mardia; Bernabe-García, Mariela

    2016-10-15

    Gestation triggers a tight coordination among maternal tissues to provide fatty acids (FA) to the fetus through placental transport; however, there is insufficient evidence regarding regulation of proteins involved in placental transport of FA according to gestational age. The aim of this study was to determine the role of gestational age on the expression of genes involved in FA uptake, trafficking and synthesis in the rat placenta to support fetal demands. Gene expression of encoding proteins for placental transport and synthesis of FA was measured in placenta. Also, FA composition was measured in placenta, fetuses and newborns. mRNA expression of lipoprotein lipase (lpl) and fatp-1 (for uptake) was 4.4- and 1.43-fold higher, respectively, during late gestation than at P14, but expression of p-fabp-pm decreased 0.37-fold at late pregnancy in comparison with P14. Only mRNA fabp-4 member for trafficking of FA was 2.95-fold higher at late gestation than at P14. mRNA of fasn and elovl-6 participating in saturated FA and enzymes for the polyunsaturated FA synthesis were downregulated during late gestation and their regulator srebf-1c increased at P16. This study suggests that gestational age has an effect on expression of some genes involved in uptake, trafficking and synthesis of FA in the rat placenta; mRNA expression of lpl and, fatp-1 for uptake and fabp-4 implicated in trafficking was expressed at high levels at late gestation. In addition, placenta expresses the mRNAs involved in FA synthesis; these genes were expressed at low levels at late gestation. Additionally, mRNAs of Srebf-1c transcriptional regulator of desaturases and elongases was highly expressed during late gestation. Finally, these changes in the rat placenta allowed the placenta to partially supply saturated and monounsaturated FA to the fetus. PMID:27317891

  11. Effects of chitin synthesis inhibitors on incorporation of nucleosides into DNA and RNA in a cell line from Manduca sexta (L).

    PubMed

    Klitschka, G E; Mayer, R T; Droleskey, R E; Norman, J O; Chen, A C

    1986-06-01

    Five putative chitin synthesis inhibitors (CSI) were tested to determine if they inhibited nucleoside incorporation into acid precipitable material in a cell line from Manduca sexta (L.). The results varied. Diflubenzuron (DFB) (100 micron) inhibited cytidine incorporation by 38%; EL-494 (100 micron) inhibited adenosine incorporation by 43%; Bay Sir 8514 (100 micron) inhibited uridine incorporation by 24%. Superdiflubenzuron (100 micron) was the worst inhibitor overall (18-22%) for the benzoylphenyl urea CSI. The triazine CSI, CGA 19255, was the best inhibitor tested with 60% inhibition for cytidine and 49% for adenosine incorporation into DNA and RNA. Examination of cells incubated with diflubenzuron by scanning electron microscopy revealed distinct external morphological changes. Transmission electron microscopy showed that crystalline structures accumulated in the cytoplasm of cells treated with DFB. The crystalline structures were assumed to be diflubenzuron and they persisted even after diflubenzuron was removed from the medium. PMID:2422789

  12. Prebiotic Synthesis of Hydrophobic and Protein Amino Acids

    PubMed Central

    Ring, David; Wolman, Yecheskel; Friedmann, Nadav; Miller, Stanley L.

    1972-01-01

    The formation of amino acids by the action of electric discharges on a mixture of methane, nitrogen, and water with traces of ammonia was studied in detail. The presence of glycine, alanine, α-amino-n-butyric acid, α-aminoisobutyric acid, valine, norvaline, isovaline, leucine, isoleucine, alloisoleucine, norleucine, proline, aspartic acid, glutamic acid, serine, threonine, allothreonine, α-hydroxy-γ-aminobutyric acid, and α,γ-diaminobutyric acid was confirmed by ion-exchange chromatography and gas chromatography-mass spectrometry. All of the primary α-amino acids found in the Murchison Meteorite have been synthesized by this electric discharge experiment. PMID:4501592

  13. Selective inhibition of leukotriene C/sub 4/ synthesis in human neutrophils by ethacrynic acid

    SciTech Connect

    Leung, K.H.

    1986-05-29

    Addition of glutathione S-transferase inhibitors, ethyacrynic acid (ET), caffeic acid (CA), and ferulic acid (FA) to human neutrophils led to inhibition of leukotriene C/sub 4/ (LTC/sub 4/) synthesis induced by calcium ionophore A23187. ET is the most specific of these inhibitors for it had little effect on LTB/sub 4/, PGE/sub 2/, and 5-HETE synthesis. The inhibition of LTC/sub 4/ was irreversible and time dependent. ET also had little effect on /sup 3/H-AA release from A23187-stimulated neutrophils.

  14. Synthesis of zirconium carbide nanosized powders by pursed wire discharge in oleic acid

    NASA Astrophysics Data System (ADS)

    Sugashima, Kenta; Suzuki, Kazuma; Suzuki, Tsuneo; Nakayama, Tadachika; Suematsu, Hisayuki; Niihara, Koichi

    2016-01-01

    In this study, we propose novel PWD methods in inert gas mixed organic vapor and organic liquid which work as harmless carbon sources. Metal zirconium wire evaporation by PWD in organic vapor or liquid media was investigated. It was confirmed that in the PWD process using oleic acid liquid, single phase zirconium carbide nanopowders were synthesized by a reaction between Zr vapor and oleic acid. A new method for synthesis of carbide nanopowders was developed using the PWD in organic liquid. Therefore, the present result suggested that PWD method in oleic acid liquids is effective for the synthesis of carbide nanopowders.

  15. Computer-assisted automated synthesis. III. Synthesis of substituted N-(carboxyalkyl) amino-acid tert-butyl ester derivatives.

    PubMed

    Hayashi, N; Sugawara, T; Kato, S

    1991-01-01

    A versatile automated synthesis apparatus, equipped with a chemical artificial intelligence, was developed to prepare and isolate a wide variety of compounds. The apparatus was to the synthesis of substituted N-(carboxyalkyl)amino-acids. The apparatus [1,2] is composed of units for performing various tasks,for example reagent supply, reaction, purification and separation, each linked to a control system. All synthetic processes, including washing and drying of the apparatus after each synthetic run, were automatically performed from the mixing of the reactants to the isolation of the products as powders or crystals. The reaction of an amino-acid tertbutyl ester acetic acid salt with a 2-keto acid sodium salt produces an unstable intermediate, Schiff base, which is reduced with sodum cyanoborohydride to give a substituted N-(carboxyalkyl)aminoacid tert-butyl ester sodium salt. The equilibrium and the consecutive reactions were controlled by adding sodium cyanoborohydride using the artificial intelligence software, which contained novel kinetic equations [3] and substituent effects [4].Substitued N-(carboxyalkyl)amino-acid tert-butyl esters, 90 derivatives, were automatically synthesized using the computerassisted automated synthesis apparatus. The syntheses were performed unattended 24 hours a day, except for supplying the raw materials, reagents and solvents. The apparatus is extremely valuable for synthesizing many derivatives of a particular compound. The configurations of the products were determined by circular dichroism measurements. PMID:18924904

  16. Computer-assisted automated synthesis. III. Synthesis of substituted N-(carboxyalkyl) amino-acid tert-butyl ester derivatives

    PubMed Central

    Hayashi, Nobuyoshi; Sugawara, Tohru; Kato, Shinji

    1991-01-01

    A versatile automated synthesis apparatus, equipped with a chemical artificial intelligence, was developed to prepare and isolate a wide variety of compounds. The apparatus was to the synthesis of substituted N-(carboxyalkyl)amino-acids. The apparatus [1,2] is composed of units for performing various tasks,for example reagent supply, reaction, purification and separation, each linked to a control system. All synthetic processes, including washing and drying of the apparatus after each synthetic run, were automatically performed from the mixing of the reactants to the isolation of the products as powders or crystals. The reaction of an amino-acid tertbutyl ester acetic acid salt with a 2-keto acid sodium salt produces an unstable intermediate, Schiff base, which is reduced with sodum cyanoborohydride to give a substituted N-(carboxyalkyl)aminoacid tert-butyl ester sodium salt. The equilibrium and the consecutive reactions were controlled by adding sodium cyanoborohydride using the artificial intelligence software, which contained novel kinetic equations [3] and substituent effects [4]. Substitued N-(carboxyalkyl)amino-acid tert-butyl esters, 90 derivatives, were automatically synthesized using the computerassisted automated synthesis apparatus. The syntheses were performed unattended 24 hours a day, except for supplying the raw materials, reagents and solvents. The apparatus is extremely valuable for synthesizing many derivatives of a particular compound. The configurations of the products were determined by circular dichroism measurements. PMID:18924904

  17. Inhibition of viral RNA synthesis in canine distemper virus infection by proanthocyanidin A2.

    PubMed

    Gallina, Laura; Dal Pozzo, Fabiana; Galligioni, Viola; Bombardelli, Ezio; Scagliarini, Alessandra

    2011-12-01

    Canine distemper virus (CDV) is a contagious and multisystemic viral disease that affects domestic and wild canines as well as other terrestrial and aquatic carnivores. The disease in dogs is often fatal and no specific antiviral therapy is currently available. In this study, we evaluated the in vitro antiviral activity against CDV of proanthocyanidin A2 (PA2), a phenolic dimer belonging to the class of condensed tannins present in plants. Our results showed that PA2 exerted in vitro antiviral activity against CDV with a higher selectivity index compared to ribavirin, included in our study for the previously tested anti-CDV activity. The time of addition assay led us to observe that PA2 was able to decrease the viral RNA synthesis and to reduce progeny virus liberation, at different times post infection suggesting multiple mechanisms of action including inhibition of viral replicative complex and modulation of the redox milieu. These data suggest that PA2, isolated from the bark of Aesculus hippocastanum, has potential usefulness as an anti-CDV compound inhibiting viral replication. PMID:22020306

  18. Role of Malic Enzyme during Fatty Acid Synthesis in the Oleaginous Fungus Mortierella alpina

    PubMed Central

    Hao, Guangfei; Chen, Haiqin; Wang, Lei; Gu, Zhennan; Song, Yuanda; Zhang, Hao

    2014-01-01

    The generation of NADPH by malic enzyme (ME) was postulated to be a rate-limiting step during fatty acid synthesis in oleaginous fungi, based primarily on the results from research focusing on ME in Mucor circinelloides. This hypothesis is challenged by a recent study showing that leucine metabolism, rather than ME, is critical for fatty acid synthesis in M. circinelloides. To clarify this, the gene encoding ME isoform E from Mortierella alpina was homologously expressed. ME overexpression increased the fatty acid content by 30% compared to that for a control. Our results suggest that ME may not be the sole rate-limiting enzyme, but does play a role, during fatty acid synthesis in oleaginous fungi. PMID:24532075

  19. Chemical Synthesis of Uncommon Natural Bile Acids: The 9α-Hydroxy Derivatives of Chenodeoxycholic and Lithocholic Acids.

    PubMed

    Iida, Takashi; Namegawa, Kazunari; Nakane, Naoya; Iida, Kyoko; Hofmann, Alan Frederick; Omura, Kaoru

    2016-09-01

    The chemical synthesis of the 9α-hydroxy derivatives of chenodeoxycholic and lithocholic acids is reported. For initiating the synthesis of the 9α-hydroxy derivative of chenodeoxycholic acid, cholic acid was used; for the synthesis of the 9α-hydroxy derivative of lithocholic acid, deoxycholic acid was used. The principal reactions involved were (1) decarbonylation of conjugated 12-oxo-Δ(9(11))-derivatives using in situ generated monochloroalane (AlH2Cl) prepared from LiAlH4 and AlCl3, (2) epoxidation of the deoxygenated Δ(9(11))-enes using m-chloroperbenzoic acid catalyzed by 4,4'-thiobis-(6-tert-butyl-3-methylphenol), (3) subsequent Markovnikov 9α-hydroxylation of the Δ(9(11))-enes with AlH2Cl, and (4) selective oxidation of the primary hydroxyl group at C-24 in the resulting 3α,9α,24-triol and 3α,7α,9α,24-tetrol to the corresponding C-24 carboxylic acids using sodium chlorite (NaClO2) in the presence of a catalytic amount of 2,2,6,6-tetramethylpiperidine 1-oxyl free radical (TEMPO) and sodium hypochlorite (NaOCl). The (1)H- and (13)C-NMR spectra are reported. The 3α,7α,9α-trihydroxy-5β-cholan-24-oic acid has been reported to be present in the bile of the Asian bear, and its 7-deoxy derivative is likely to be a bacterial metabolite. These bile acids are now available as authentic reference standards, permitting their identification in vertebrate bile acids. PMID:27319285

  20. Latency, duration and dose response relationships of amino acid effects on human muscle protein synthesis.

    PubMed

    Rennie, Michael J; Bohé, Julien; Wolfe, Robert R

    2002-10-01

    The components of the stimulatory effect of food on net deposition of protein are beginning to be identified and separated. One of the most important of these appears to be the effect of amino acids per se in stimulating muscle anabolism. Amino acids appear to have a linear stimulatory effect within the range of normal diurnal plasma concentrations from postabsorptive to postprandial. Within this range, muscle protein synthesis (measured by incorporation of stable isotope tracers of amino acids into biopsied muscle protein) appears to be stimulated approximately twofold; however, little further increase occurs when very high concentrations of amino acids (>2.5 times the normal postabsorptive plasma concentration) are made available. Amino acids provided in surfeit of the ability of the system to synthesize protein are disposed of by oxidation, ureagenesis and gluconeogenesis. The stimulatory effect of amino acids appears to be time dependent; a square wave increase in the availability of amino acids causes muscle protein synthesis to be stimulated and to fall back to basal values, despite continued amino acid availability. The relationship between muscle protein synthesis and insulin availability suggests that most of the stimulatory effects occur at low insulin concentrations, with large increases having no effect. These findings may have implications for our understanding of the body's requirements for protein. The maximal capacity for storage of amino acids as muscle protein probably sets an upper value on the extent to which amino acids can be stored after a single meal. PMID:12368422

  1. Effect of 2,3,7,8-tetrachlorodibenzo-P-dioxin (TCDD) in vitro on RNA synthesis in rat thymocytes

    SciTech Connect

    Olnes, M.; Abraham, M.; Kurl, R.N. )

    1991-03-11

    TCDD, a potent inducer of cytochrome P-450, augments synthesis of specific liver constituents while simultaneously causing marked involution of the thymus. To elucidate the mechanism by which TCDD induces thymic atrophy, initial experiments were performed to establish the kinetics of uptake of TCDD in vitro by thymocytes. The latter were incubated with either {sup 3}H-TCDD or TCDD for various time intervals. Measurement of radio-activity and gel mobility shift assays using nuclear extracts and a dioxin-responsive element (DRE-3) of the cytochrome P-450 (Cyplal) gene revealed maximum uptake of TCDD by thymocyte nuclei at 30-60 min post incubation. RNA synthesis was increased as early as 30 min. The increase in RNA synthesis could be inhibited by actinomycin D. At these time points degradation of DNA was visible. Whether newly formed RNA is translated into a protein(s) which in turn is (are) responsible for degradation of DNA leading to cell death needs to be established.

  2. De novo Synthesis and Assembly of rRNA into Ribosomal Subunits during Cold Acclimation in Escherichia coli.

    PubMed

    Piersimoni, Lolita; Giangrossi, Mara; Marchi, Paolo; Brandi, Anna; Gualerzi, Claudio O; Pon, Cynthia L

    2016-04-24

    During the cold adaptation that follows a cold stress, bacterial cells undergo many physiological changes and extensive reprogramming of their gene expression pattern. Bulk gene expression is drastically reduced, while a set of cold shock genes is selectively and transiently expressed. The initial stage of cold acclimation is characterized by the establishment of a stoichiometric imbalance of the translation initiation factors (IFs)/ribosomes ratio that contributes to the preferential translation of cold shock transcripts. Whereas de novo synthesis of the IFs following cold stress has been documented, nothing was known concerning the activity of the rrn operons during the cold acclimation period. In this work, we focus on the expression of the rrn operons and the fate of rRNA after temperature downshift. We demonstrate that in Escherichia coli, rRNA synthesis does not stop during the cold acclimation phase, but continues with greater contribution of the P2 compared to the P1 promoter and all seven rrn operons are active, although their expression levels change with respect to pre-stress conditions. Eight hours after the 37°→10°C temperature downshift, the newly transcribed rRNA represents up to 20% of total rRNA and is preferentially found in the polysomes. However, with respect to the de novo synthesis of the IFs, both rRNA transcription and maturation are slowed down drastically by cold stress, thereby accounting in part for the stoichiometric imbalance of the IFs/ribosomes. Overall, our data indicate that new ribosomes, which are possibly suitable to function at low temperature, are slowly assembled during cold acclimation. PMID:26953262

  3. Transforming growth factor-β1 induces cholesterol synthesis by increasing HMG-CoA reductase mRNA expression in keratinocytes.

    PubMed

    Yamane, Takumi; Muramatsu, Aimi; Shimura, Mari; Kobayashi-Hattori, Kazuo; Oishi, Yuichi

    2016-07-01

    In this study, we investigated the effect of TGF-β1 on cholesterol synthesis in human keratinocytes. TGF-β1 increased the level of cholesterol and the mRNA level of 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase in human keratinocytes. These results show that TGF-β1 induces cholesterol synthesis by increasing HMG-CoA reductase mRNA expression in human keratinocytes. PMID:26932266

  4. A review on synthesis and characterization of solid acid materials for fuel cell applications

    NASA Astrophysics Data System (ADS)

    Mohammad, Norsyahida; Mohamad, Abu Bakar; Kadhum, Abdul Amir H.; Loh, Kee Shyuan

    2016-08-01

    Solid acids emerged as an electrolyte material for application in fuel cells due to their high protonic conductivity and stability at high temperatures between 100 °C and 250 °C. This paper gives an overview of the different solid acid materials and their properties, such as high protonic conductivity and thermal stability, in relation to phase transitions and mechanisms of proton transport. Various solid acid synthesis methods including aqueous and dry mixing, electrospinning, sol-gel, impregnation and thin-film casting will be discussed, and the impact of synthesis methods on the properties of solid acids will be highlighted. The properties of solid acids synthesized as either single crystals and or polycrystalline powders were identified via X-ray diffraction, nuclear magnetic resonance, thermal analyses, optical microscopy and infrared spectroscopy. A selection of electrolyte-electrode assembly methods and the performance of solid acid fuel cell prototypes are also reviewed.

  5. Identification of a nucleic acid-binding region within the largest subunit of Drosophila melanogaster RNA polymerase II.

    PubMed Central

    Kontermann, R. E.; Kobor, M.; Bautz, E. K.

    1993-01-01

    The largest and the second-largest subunit of the multisubunit eukaryotic RNA polymerases are involved in interaction with the DNA template and the nascent RNA chain. Using Southwestern DNA-binding techniques and nitrocellulose filter binding assays of bacterially expressed fusion proteins, we have identified a region of the largest, 215-kDa, subunit of Drosophila RNA polymerase II that has the potential to bind nucleic acids nonspecifically. This nucleic acid-binding region is located between amino acid residues 309-384 and is highly conserved within the largest subunits of eukaryotic and bacterial RNA polymerases. A homology to a region of the DNA-binding cleft of Escherichia coli DNA polymerase I involved in binding of the newly synthesized DNA duplex provides indirect evidence that the nucleic acid-binding region of the largest subunit participates in interaction with double-stranded nucleic acids during transcription. The nonspecific DNA-binding behavior of the region is similar to that observed for the native enzyme in nitrocellulose filter binding assays and that of the separated largest subunit in Southwestern assays. A high content of basic amino acid residues is consistent with the electrostatic nature of nonspecific DNA binding by RNA polymerases. PMID:8443600

  6. Resistance training suppresses intra-abdominal fatty acid synthesis in ovariectomized rats.

    PubMed

    Stotzer, U S; Rodrigues, M F C; Domingos, M M; Silva, G H G; Duarte, F O; Gatto, C V G; Duarte, A C G O; Shiguemoto, G E; Perez, S E A; Selistre-de-Araujo, H S

    2015-03-01

    Ovarian hormone loss is associated with a shift in fat distribution to intra-abdomin al adipose tissue (intra-AAT) depots and with lipid metabolism disorders, which predisposes individuals to developing insulin resistance. Resistance training (RT) prevents increases in intra-AAT after ovarian hormone loss. However, the molecular mechanisms underlying these changes remain unclear. We investigated the effects of ovariectomy and RT on gene expression related to lipogenesis and fat oxidation in the intra-AAT of ovariectomized rats. Sprague-Dawley rats (n=6/group) were divided into the groups: sham-sedentary, ovariectomized-sedentary, sham-RT and ovariectomized-RT. RT groups performed a 10-week climbing program on a ladder with progressive overload. Intra-AAT was subjected to morphometric and mRNA analysis. Ovariectomized-sedentary group had larger adipocytes and higher expression of peroxisome proliferator-activated receptor-γ (PPAR-γ), sterol regulatory element-binding protein-1c (SREBP-1c), stearoyl-CoA desaturase-1 (SCD-1), acetyl-CoA carboxylase (ACC), hormone-sensitive lipase (HSL) and lower expression of the oxidative carnitinepalmitoyltransferase-I (CPT-1). RT counteracted OVX-induced increases in PPAR-γ and SCD-1 and decreased SREBP-1c. ACC and HSL were downregulated in ovariectomized-RT compared with the ovariectomized-sedentary group. Ovariectomized-RT group had the highest CPT-1 gene expression. Adipocyte size decreased in ovariectomized-RT group. Results suggest that RT reduces intra-AAT adipocyte size in ovariectomized rats by suppressing intra-AAT fatty acid synthesis and enhancing fatty acid β-oxidation. PMID:25415388

  7. Effect of Poliovirus on Deoxyribonucleic Acid Synthesis in HeLa Cells

    PubMed Central

    Ackermann, W. W.; Cox, D. C.; Kurtz, H.; Powers, C. D.; Davies, S. J.

    1966-01-01

    Ackermann, W. W. (University of Michigan, Ann Arbor), D. C. Cox, H. Kurtz, C. D. Powers, and S. J. Davies. Effect of poliovirus on deoxyribonucleic acid synthesis in HeLa cells. J. Bacteriol. 91:1943–1952. 1966.—Both poliovirus and arginine stimulated deoxyribonucleic acid (DNA) synthesis in cultures of HeLa cells which were preconditioned by incubation in a medium deficient in arginine. However, the number of cells producing DNA was unaffected. DNA synthesis in such preconditioned cells was 10 to 20% of the maximal value obtained with a full complement of amino acids. Inhibition of DNA synthesis was produced in these cultures either by increasing the multiplicity of exposure above 40 plaque-forming units of virus per cell or by increasing the concentration of the deficient amino acid at the time of virus addition. Inhibition of DNA synthesis resulted from a reduction in the fraction of cells producing DNA. The concentration of arginine required for viral inhibition of DNA synthesis is greater than that for viral multiplication. PMID:4287076

  8. Prostate-specific RNA aptamer: promising nucleic acid antibody-like cancer detection

    PubMed Central

    Marangoni, Karina; Neves, Adriana F.; Rocha, Rafael M.; Faria, Paulo R.; Alves, Patrícia T.; Souza, Aline G.; Fujimura, Patrícia T.; Santos, Fabiana A. A.; Araújo, Thaise G.; Ward, Laura S.; Goulart, Luiz R.

    2015-01-01

    We described the selection of a novel nucleic acid antibody-like prostate cancer (PCa) that specifically binds to the single-stranded DNA molecule from a 277-nt fragment that may have been partially paired and bound to the PCA3 RNA conformational structure. PCA3-277 aptamer ligands were obtained, and the best binding molecule, named CG3, was synthesized for validation. Aiming to prove its diagnostic utility, we used an apta-qPCR assay with CG3-aptamer conjugated to magnetic beads to capture PCA3 transcripts, which were amplified 97-fold and 7-fold higher than conventional qPCR in blood and tissue, respectively. Histopathologic analysis of 161 prostate biopsies arranged in a TMA and marked with biotin-labeled CG3-aptamer showed moderate staining in both cytoplasm and nucleus of PCa samples; in contrast, benign prostatic hyperplasia (BPH) samples presented strong nuclear staining (78% of the cases). No staining was observed in stromal cells. In addition, using an apta-qPCR, we demonstrated that CG3-aptamer specifically recognizes the conformational PCA3-277 molecule and at least three other transcript variants, indicating that long non-coding RNA (lncRNA) is processed after transcription. We suggest that CG3-aptamer may be a useful PCa diagnostic tool. In addition, this molecule may be used in drug design and drug delivery for PCa therapy. PMID:26174796

  9. The isolation of an RNA aptamer targeting to p53 protein with single amino acid mutation

    PubMed Central

    Chen, Liang; Rashid, Farooq; Shah, Abdullah; Awan, Hassaan M.; Wu, Mingming; Liu, An; Wang, Jun; Zhu, Tao; Luo, Zhaofeng; Shan, Ge

    2015-01-01

    p53, known as a tumor suppressor, is a DNA binding protein that regulates cell cycle, activates DNA repair proteins, and triggers apoptosis in multicellular animals. More than 50% of human cancers contain a mutation or deletion of the p53 gene, and p53R175 is one of the hot spots of p53 mutation. Nucleic acid aptamers are short single-stranded oligonucleotides that are able to bind various targets, and they are typically isolated from an experimental procedure called systematic evolution of ligand exponential enrichment (SELEX). Using a previously unidentified strategy of contrast screening with SELEX, we have isolated an RNA aptamer targeting p53R175H. This RNA aptamer (p53R175H-APT) has a significantly stronger affinity to p53R175H than to the wild-type p53 in both in vitro and in vivo assays. p53R175H-APT decreased the growth rate, weakened the migration capability, and triggered apoptosis in human lung cancer cells harboring p53R175H. Further analysis actually indicated that p53R175H-APT might partially rescue or correct the p53R175H to function more like the wild-type p53. In situ injections of p53R175H-APT to the tumor xenografts confirmed the effects of this RNA aptamer on p53R175H mutation in mice. PMID:26216949

  10. The isolation of an RNA aptamer targeting to p53 protein with single amino acid mutation.

    PubMed

    Chen, Liang; Rashid, Farooq; Shah, Abdullah; Awan, Hassaan M; Wu, Mingming; Liu, An; Wang, Jun; Zhu, Tao; Luo, Zhaofeng; Shan, Ge

    2015-08-11

    p53, known as a tumor suppressor, is a DNA binding protein that regulates cell cycle, activates DNA repair proteins, and triggers apoptosis in multicellular animals. More than 50% of human cancers contain a mutation or deletion of the p53 gene, and p53R175 is one of the hot spots of p53 mutation. Nucleic acid aptamers are short single-stranded oligonucleotides that are able to bind various targets, and they are typically isolated from an experimental procedure called systematic evolution of ligand exponential enrichment (SELEX). Using a previously unidentified strategy of contrast screening with SELEX, we have isolated an RNA aptamer targeting p53R175H. This RNA aptamer (p53R175H-APT) has a significantly stronger affinity to p53R175H than to the wild-type p53 in both in vitro and in vivo assays. p53R175H-APT decreased the growth rate, weakened the migration capability, and triggered apoptosis in human lung cancer cells harboring p53R175H. Further analysis actually indicated that p53R175H-APT might partially rescue or correct the p53R175H to function more like the wild-type p53. In situ injections of p53R175H-APT to the tumor xenografts confirmed the effects of this RNA aptamer on p53R175H mutation in mice. PMID:26216949

  11. Liquid-Phase Synthesis of 2′-Methyl-RNA on a Homostar Support through Organic-Solvent Nanofiltration

    PubMed Central

    Gaffney, Piers R J; Kim, Jeong F; Valtcheva, Irina B; Williams, Glynn D; Anson, Mike S; Buswell, Andrew M; Livingston, Andrew G

    2015-01-01

    Due to the discovery of RNAi, oligonucleotides (oligos) have re-emerged as a major pharmaceutical target that may soon be required in ton quantities. However, it is questionable whether solid-phase oligo synthesis (SPOS) methods can provide a scalable synthesis. Liquid-phase oligo synthesis (LPOS) is intrinsically scalable and amenable to standard industrial batch synthesis techniques. However, most reported LPOS strategies rely upon at least one precipitation per chain extension cycle to separate the growing oligonucleotide from reaction debris. Precipitation can be difficult to develop and control on an industrial scale and, because many precipitations would be required to prepare a therapeutic oligonucleotide, we contend that this approach is not viable for large-scale industrial preparation. We are developing an LPOS synthetic strategy for 2′-methyl RNA phosphorothioate that is more amenable to standard batch production techniques, using organic solvent nanofiltration (OSN) as the critical scalable separation technology. We report the first LPOS-OSN preparation of a 2′-Me RNA phosphorothioate 9-mer, using commercial phosphoramidite monomers, and monitoring all reactions by HPLC, 31P NMR spectroscopy and MS. PMID:26012874

  12. Oleochemical synthesis