Science.gov

Sample records for acid rna synthesis

  1. [Effect of gibberellic acid on RNA synthesis in dwarf peas].

    PubMed

    Kilev, S N; Kholodar', A V; Chekurov, V M; Mertvetsov, N P

    1982-04-01

    The effect of gibberellic acid (GA) on total RNA and polysomal poly-[A]+-RNA synthesis in epicotylia and embryos of dwarf pea of two varieties differing in their physiological sensitivity to GA was studied. It was found that incubation with GA increases the accumulation of total RNA in pea epicotylia, var. "Pioner" and "Polzunok". The maximal stimulation of RNA accumulation makes up to 40% for the low sensitivity variety "Polzunok" and 150% for the highly sensitive variety "Pioner". GA increases the synthesis of polysomal poly (A)+-mRNA in 5-year-old pea sprouts and that of newly synthesized poly (A)+-mRNA in epicotylian polysomes of both varieties 5, 24, 48 and 72 hrs after incubation with GA. GA at concentrations of 10(-6) and 10(-5) stimulates the incorporation of [3H]uridine into polysomal mRNA during the first 1--3 hours after treatment and enhances the accumulation of newly synthesized mRNA in pea embryonic polyribosomes. The stimulating effect is directly proportional to the dose of the hormone. The mechanisms of GA effect on the transcription and translation in pea plant cells are discussed. PMID:6177351

  2. Enhancement of Polyribosome Formation and RNA Synthesis of Gibberellic Acid in Wounded Potato Tuber Tissue 1

    PubMed Central

    Wielgat, Bernard; Kahl, Günter

    1979-01-01

    As part of a more detailed study on plant tumorigenesis, the action of gibberellic acid (GA3) in wounded potato tuber tissues as a model system has been evaluated. GA3 stimulates total RNA synthesis in wounded tissues, the optimal concentration being 0.1 micromolar. The responsiveness of the tissue toward the hormone develops with time after wounding. Whereas freshly wounded tissue does not respond at all to the hormone, it becomes competent after about 6 hours, the competence being maximal after 1 day of wound healing. GA3 enhances the formation of polyribosomes in wounded tissues and stimulates the synthesis of both ribosomal RNAs, transfer RNAs, 5S RNA, and a fraction, which in sucrose density gradients sediments between 18S rRNA and 5S RNA. This fraction contains presumptive mRNA. The hormone, then, is somehow recognized by wounded potato tissue in a time-specific way; the signal is transferred to the genome and triggers the synthesis of various RNA species. PMID:16661070

  3. Intersection of RNA Processing and the Type II Fatty Acid Synthesis Pathway in Yeast Mitochondria▿

    PubMed Central

    Schonauer, Melissa S.; Kastaniotis, Alexander J.; Hiltunen, J. Kalervo; Dieckmann, Carol L.

    2008-01-01

    Distinct metabolic pathways can intersect in ways that allow hierarchical or reciprocal regulation. In a screen of respiration-deficient Saccharomyces cerevisiae gene deletion strains for defects in mitochondrial RNA processing, we found that lack of any enzyme in the mitochondrial fatty acid type II biosynthetic pathway (FAS II) led to inefficient 5′ processing of mitochondrial precursor tRNAs by RNase P. In particular, the precursor containing both RNase P RNA (RPM1) and tRNAPro accumulated dramatically. Subsequent Pet127-driven 5′ processing of RPM1 was blocked. The FAS II pathway defects resulted in the loss of lipoic acid attachment to subunits of three key mitochondrial enzymes, which suggests that the octanoic acid produced by the pathway is the sole precursor for lipoic acid synthesis and attachment. The protein component of yeast mitochondrial RNase P, Rpm2, is not modified by lipoic acid in the wild-type strain, and it is imported in FAS II mutant strains. Thus, a product of the FAS II pathway is required for RNase P RNA maturation, which positively affects RNase P activity. In addition, a product is required for lipoic acid production, which is needed for the activity of pyruvate dehydrogenase, which feeds acetyl-coenzyme A into the FAS II pathway. These two positive feedback cycles may provide switch-like control of mitochondrial gene expression in response to the metabolic state of the cell. PMID:18779316

  4. Source of amino acids for tRNA acylation. Implications for measurement of protein synthesis.

    PubMed Central

    Barnes, D M; Calvert, C C; Klasing, K C

    1992-01-01

    Estimates of protein-synthesis rates using radioisotopes require accurate measurement of the specific radioactivity of the label in protein and in the precursor pool over time. Although the extracellular and intracellular pools of amino acids are easiest to sample, the tRNA pool is the direct precursor and is the appropriate pool for sampling. To test if the intracellular or extracellular pools reflect the tRNA specific radioactivity, a chicken macrophage cell line was incubated in medium containing either 0.23 mM-leucine and 14.5 microCi of [3H]leucine (tracer dose) or 2.3 microM-leucine plus 145.0 microCi of [3H]leucine (flooding dose). At both leucine levels, the tRNA specific radioactivity reached a plateau quickly, but did not equilibrate with either the extracellular or intracellular specific radioactivity within 30 min, and remained closer to that of protein. In a second experiment, proteins in chicken macrophages were labelled with [3H]leucine for 2 days. Labelling medium was removed, and the cells were washed free of residual free [3H]leucine and incubated with medium containing either 0.23 mM- or 2.3 mM-leucine (unlabelled). The specific radioactivity of leucyl-tRNA leucine reached a plateau within 2 min and remained considerably closer to that in the protein than that in intracellular or extracellular pools for at least 60 min. These results suggest that amino acids from protein degradation are a primary source for charging tRNA. When protein-synthesis rates are estimated by label incorporation, use of extracellular or intracellular specific-radioactivity values result in a marked underestimation. PMID:1575701

  5. Antibacterial activity of lichen secondary metabolite usnic acid is primarily caused by inhibition of RNA and DNA synthesis.

    PubMed

    Maciąg-Dorszyńska, Monika; Węgrzyn, Grzegorz; Guzow-Krzemińska, Beata

    2014-04-01

    Usnic acid, a compound produced by various lichen species, has been demonstrated previously to inhibit growth of different bacteria and fungi; however, mechanism of its antimicrobial activity remained unknown. In this report, we demonstrate that usnic acid causes rapid and strong inhibition of RNA and DNA synthesis in Gram-positive bacteria, represented by Bacillus subtilis and Staphylococcus aureus, while it does not inhibit production of macromolecules (DNA, RNA, and proteins) in Escherichia coli, which is resistant to even high doses of this compound. However, we also observed slight inhibition of RNA synthesis in a Gram-negative bacterium, Vibrio harveyi. Inhibition of protein synthesis in B. subtilis and S. aureus was delayed, which suggest indirect action (possibly through impairment of transcription) of usnic acid on translation. Interestingly, DNA synthesis was halted rapidly in B. subtilis and S. aureus, suggesting interference of usnic acid with elongation of DNA replication. We propose that inhibition of RNA synthesis may be a general mechanism of antibacterial action of usnic acid, with additional direct mechanisms, such as impairment of DNA replication in B. subtilis and S. aureus.

  6. Nonenzymatic synthesis of RNA and DNA oligomers on hexitol nucleic acid templates: the importance of the A structure

    NASA Technical Reports Server (NTRS)

    Kozlov, I. A.; Politis, P. K.; Van Aerschot, A.; Busson, R.; Herdewijn, P.; Orgel, L. E.; Bada, J. L. (Principal Investigator); Dolan, M. (Principal Investigator)

    1999-01-01

    Hexitol nucleic acid (HNA) is an analogue of DNA containing the standard nucleoside bases, but with a phosphorylated 1,5-anhydrohexitol backbone. HNA oligomers form duplexes having the nucleic acid A structure with complementary DNA or RNA oligomers. The HNA decacytidylate oligomer is an efficient template for the oligomerization of the 5'-phosphoroimidazolides of guanosine or deoxyguanosine. Comparison of the oligomerization efficiencies on HNA, RNA, and DNA decacytidylate templates under various conditions suggests strongly that only nucleic acid double helices with the A structure support efficient template-directed synthesis when 5'-phosphoroimidazolides of nucleosides are used as substrates.

  7. MicroRNA-24 can control triacylglycerol synthesis in goat mammary epithelial cells by targeting the fatty acid synthase gene.

    PubMed

    Wang, H; Luo, J; Chen, Z; Cao, W T; Xu, H F; Gou, D M; Zhu, J J

    2015-12-01

    In nonruminants it has been demonstrated that microRNA-24 (miR-24) is involved in preadipocyte differentiation, hepatic lipid, and plasma triacylglycerol synthesis. However, its role in ruminant mammary gland remains unclear. In this study we measured miR-24 expression in goat mammary gland tissue at 4 different stages of lactation and observed that it had highest expression at peak lactation when compared with the dry period. Overexpression or downregulation of miR-24 in goat mammary epithelial cells (GMEC) strongly affected fatty acid profiles; in particular, miR-24 enhanced unsaturated fatty acid concentration. Additional effects of miR-24 included changes in triacylglycerol content and the expression of fatty acid synthase, sterol regulatory element binding transcription protein 1, stearoyl-CoA desaturase, glycerol-3-phosphate acyltransferase mitochondrial, and acetyl-CoA carboxylase. Luciferase reporter assay confirmed that fatty acid synthase is a target of miR-24. Taken together, these results not only highlight the physiological importance of miR-24 in fatty acid metabolism in GMEC, but also laid the foundation for further research on regulatory mechanisms among miR-24 and other microRNA expressed in GMEC. PMID:26476938

  8. Flavivirus RNA synthesis in vitro.

    PubMed

    Padmanabhan, Radhakrishnan; Takhampunya, Ratree; Teramoto, Tadahisa; Choi, Kyung H

    2015-12-01

    Establishment of in vitro systems to study mechanisms of RNA synthesis for positive strand RNA viruses have been very useful in the past and have shed light on the composition of protein and RNA components, optimum conditions, the nature of the products formed, cis-acting RNA elements and trans-acting protein factors required for efficient synthesis. In this review, we summarize our current understanding regarding the requirements for flavivirus RNA synthesis in vitro. We describe details of reaction conditions, the specificity of template used by either the multi-component membrane-bound viral replicase complex or by purified, recombinant RNA-dependent RNA polymerase. We also discuss future perspectives to extend the boundaries of our knowledge. PMID:26272247

  9. Catalysis and prebiotic RNA synthesis

    NASA Technical Reports Server (NTRS)

    Ferris, James P.

    1993-01-01

    The essential role of catalysis for the origins of life is discussed. The status of the prebiotic synthesis of 2',5'- and 3'5'-linked oligomers of RNA is reviewed. Examples of the role of metal ion and mineral catalysis in RNA oligomer formation are discussed.

  10. Synthesis of RNA oligomers on heterogeneous templates

    NASA Technical Reports Server (NTRS)

    Ertem, G.; Ferris, J. P.

    1996-01-01

    The concept of an RNA world in the chemical origin of life is appealing, as nucleic acids are capable of both information storage and acting as templates that catalyse the synthesis of complementary molecules. Template-directed synthesis has been demonstrated for homogeneous oligonucleotides that, like natural nucleic acids, have 3',5' linkages between the nucleotide monomers. But it seems likely that prebiotic routes to RNA-like molecules would have produced heterogeneous molecules with various kinds of phosphodiester linkages and both linear and cyclic nucleotide chains. Here we show that such heterogeneity need be no obstacle to the templating of complementary molecules. Specifically, we show that heterogeneous oligocytidylates, formed by the montmorillonite clay-catalysed condensation of actuated monomers, can serve as templates for the synthesis of oligoguanylates. Furthermore, we show that oligocytidylates that are exclusively 2',5'-linked can also direct synthesis of oligoguanylates. Such heterogeneous templating reactions could have increased the diversity of the pool of protonucleic acids from which life ultimately emerged.

  11. Ribonucleic acid (RNA) biosynthesis in human cancer.

    PubMed

    Hajjawi, Omar S

    2015-01-01

    In many respects, the most remarkable chemical substances within the genome of eukaryotic cells are remarkable proteins which are the critical structural and functional units of living cells. The specifications for everything that goes in the cell are natural digital-to-digital decoding process in an archive sequence by deoxyribonucleic acid (DNA) and an articulate construction by ribonucleic acid (RNA). The products of DNA transcription are long polymers of ribonucleotides rather than deoxyribonucleotides and are termed ribonucleic acids. Certain deoxyribonucleotide sequences, or genes, give rise to transfer RNA (tRNA) and other ribosomal RNA (rRNA) when transcribed. The ribonucleotide sequences fold extensively and rRNA is associated with specific proteins to yield the essential cell components, ribosomes. Transcription of other special sequences yields messenger RNAs (mRNAs) that contain ribonucleotide sequences that will be ultimately translated into new types of amino acid sequences of functional cellular protein molecules. This switch to a different variety of cellular molecular sequences is complex, but each sequence of the three ribonucleotides specifies the insertion of one particular amino acid into the polypeptide chain under production. Whilst mRNA is considered the vehicle by which genetic information is transmitted from the genome and allocated in the appropriate cytoplasmic sites for translation into protein via cap-dependent mechanism, the actual translation depends also on the presence of other so-called household and luxury protein molecules. Recent evidence suggests RNA species are required at initiation, because treatment of cells with antibiotics or drugs that inhibit RNA synthesis cause a decrease in protein synthesis. The rRNA is necessary as a structural constituent of the ribosomes upon which translation takes place, whereas tRNA is necessary as an adaptor in amino acid activation and elongation protein chains to ribosomes. In this article

  12. Initiation of minus-strand RNA synthesis by the brome mosaicvirus RNA-dependent RNA polymerase: use of oligoribonucleotide primers.

    PubMed Central

    Kao, C C; Sun, J H

    1996-01-01

    Various DNA- and RNA-dependent RNA polymerases have been reported to use oligoribonucleotide primers to initiate nucleic acid synthesis. For the brome mosaic virus RNA-dependent RNA polymerase (RdRp), we determined that in reactions performed with limited GTP concentrations, minus-strand RNA synthesis can be stimulated by the inclusion of guanosine monophosphate or specific oligoribonucleotides. Furthermore, guanylyl-3',5'-guanosine (GpG) was incorporated into minus-strand RNA and increased the rate of minus-strand RNA synthesis. In the presence of GpG, RdRp's Km for GTP decreased from 50 microM to approximately 3 microM while the Kms for other nucleotides were unaffected. These results have implications for the mechanism of initiation by RdRp. PMID:8794323

  13. Synthesis and Antisense Properties of Fluoro Cyclohexenyl Nucleic Acid (F-CeNA) – A Nuclease Stable Mimic of 2′-Fluoro RNA

    PubMed Central

    Seth, Punit P.; Yu, Jinghua; Jazayeri, Ali; Pallan, Pradeep S.; Allerson, Charles R; Østergaard, Michael E.; Liu, Fengwu; Herdewijn, Piet; Egli, Martin; Swayze, Eric E.

    2013-01-01

    We report the design and synthesis of 2′-fluoro cyclohexenyl nucleic acid (F-CeNA) pyrimidine phosphoramidites and the synthesis and biophysical, structural, and biological evaluation of modified oligonucleotides. The synthesis of the nucleoside phosphoramidites was accomplished in multigram quantities starting from commercially available methyl-D-mannose pyranoside. Installation of the fluorine atom was accomplished using nonafluorobutanesulfonyl fluoride, and the cyclohexenyl ring system was assembled by means of a palladium-catalyzed Ferrier rearrangement. Installation of the nucleobase was carried out under Mitsunobu conditions followed by standard protecting group manipulations to provide the desired pyrimidine phosphoramidites. Biophysical evaluation indicated that F-CeNA shows behavior similar to that of a 2′-modified nucleotide, and duplexes with RNA showed slightly lower duplex thermostability as compared to that of the more rigid 3′-fluoro hexitol nucleic acid (FHNA). However, F-CeNA modified oligonucleotides were significantly more stable against digestion by snake venom phosphodiesterases (SVPD) as compared to unmodified DNA, 2′-fluoro RNA (FRNA), 2′-methoxyethyl RNA (MOE), and FHNA modified oligonucleotides. Examination of crystal structures of a modified DNA heptamer duplex d(GCG)-T*-d(GCG):d(CGCACGC) by X-ray crystallography indicated that the cyclohexenyl ring system exhibits both the 3H2 and 2H3 conformations, similar to the C3′-endo/C2′-endo conformation equilibrium seen in natural furanose nucleosides. In the 2H3 conformation, the equatorial fluorine engages in a relatively close contact with C8 (2.94 Å) of the 3′-adjacent dG nucleotide that may represent a pseudo hydrogen bond. In contrast, the cyclohexenyl ring of F-CeNA was found to exist exclusively in the 3H2 (C3′-endo like) conformation in the crystal structure of the modified A-form DNA decamer duplex [d(GCGTA)-T*-d(ACGC)]2. In an animal experiment, a 16-mer F

  14. Synthesis of amino acids

    DOEpatents

    Davis, J.W. Jr.

    1979-09-21

    A method is described for synthesizing amino acids preceding through novel intermediates of the formulas: R/sub 1/R/sub 2/C(OSOC1)CN, R/sub 1/R/sub 2/C(C1)CN and (R/sub 1/R/sub 2/C(CN)O)/sub 2/SO wherein R/sub 1/ and R/sub 2/ are each selected from hydrogen and monovalent hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  15. RNA.

    ERIC Educational Resources Information Center

    Darnell, James E., Jr.

    1985-01-01

    Ribonucleic acid (RNA) converts genetic information into protein and usually must be processed to serve its function. RNA types, chemical structure, protein synthesis, translation, manufacture, and processing are discussed. Concludes that the first genes might have been spliced RNA and that humans might be closer than bacteria to primitive…

  16. How amino acids and peptides shaped the RNA world.

    PubMed

    van der Gulik, Peter T S; Speijer, Dave

    2015-01-01

    The "RNA world" hypothesis is seen as one of the main contenders for a viable theory on the origin of life. Relatively small RNAs have catalytic power, RNA is everywhere in present-day life, the ribosome is seen as a ribozyme, and rRNA and tRNA are crucial for modern protein synthesis. However, this view is incomplete at best. The modern protein-RNA ribosome most probably is not a distorted form of a "pure RNA ribosome" evolution started out with. Though the oldest center of the ribosome seems "RNA only", we cannot conclude from this that it ever functioned in an environment without amino acids and/or peptides. Very small RNAs (versatile and stable due to basepairing) and amino acids, as well as dipeptides, coevolved. Remember, it is the amino group of aminoacylated tRNA that attacks peptidyl-tRNA, destroying the bond between peptide and tRNA. This activity of the amino acid part of aminoacyl-tRNA illustrates the centrality of amino acids in life. With the rise of the "RNA world" view of early life, the pendulum seems to have swung too much towards the ribozymatic part of early biochemistry. The necessary presence and activity of amino acids and peptides is in need of highlighting. In this article, we try to bring the role of the peptide component of early life back into focus. We argue that an RNA world completely independent of amino acids never existed. PMID:25607813

  17. Regulation of Flavivirus RNA synthesis and replication.

    PubMed

    Selisko, Barbara; Wang, Chunling; Harris, Eva; Canard, Bruno

    2014-12-01

    RNA synthesis and replication of the members of the Flavivirus genus (including dengue, West Nile and Japanese encephalitis viruses) is regulated by a wide variety of mechanisms and actors. These include the sequestration of the RNA-dependent RNA polymerase (RdRp) for functions other than RNA synthesis, regulatory interactions with other viral and host proteins within the replication complex (RC), and regulatory elements within the RNA genome itself. In this review, we discuss our current knowledge of the multiple levels at which Flavivirus RNA synthesis is controlled. We aim to bring together two active research fields: the structural and functional biology of individual proteins of the RC and the impressive wealth of knowledge acquired regarding the viral genomic RNA. PMID:25462437

  18. Regulation of Flavivirus RNA synthesis and replication

    PubMed Central

    Selisko, Barbara; Wang, Chunling; Harris, Eva; Canard, Bruno

    2014-01-01

    RNA synthesis and replication of the members of the Flavivirus genus (including dengue, West Nile and Japanese encephalitis viruses) is regulated by a wide variety of mechanisms and actors. These include the sequestration of the RNA-dependent RNA polymerase (RdRp) for functions other than RNA synthesis, regulatory interactions with other viral and host proteins within the replication complex (RC), and regulatory elements within the RNA genome itself. In this review, we discuss our current knowledge of the multiple levels at which Flavivirus RNA synthesis is controlled. We aim to bring together two active research fields: the structural and functional biology of individual proteins of the RC and the impressive wealth of knowledge acquired regarding the viral genomic RNA. PMID:25462437

  19. Synthesis, Improved Antisense Activity and Structural Rationale for the Divergent RNA Affinities of 3;#8242;-Fluoro Hexitol Nucleic Acid (FHNA and Ara-FHNA) Modified Oligonucleotides

    SciTech Connect

    Egli, Martin; Pallan, Pradeep S.; Allerson, Charles R.; Prakash, Thazha P.; Berdeja, Andres; Yu, Jinghua; Lee, Sam; Watt, Andrew; Gaus, Hans; Bhat, Balkrishen; Swayze, Eric E.; Seth, Punit P.

    2012-03-16

    The synthesis, biophysical, structural, and biological properties of both isomers of 3'-fluoro hexitol nucleic acid (FHNA and Ara-FHNA) modified oligonucleotides are reported. Synthesis of the FHNA and Ara-FHNA thymine phosphoramidites was efficiently accomplished starting from known sugar precursors. Optimal RNA affinities were observed with a 3'-fluorine atom and nucleobase in a trans-diaxial orientation. The Ara-FHNA analog with an equatorial fluorine was found to be destabilizing. However, the magnitude of destabilization was sequence-dependent. Thus, the loss of stability is sharply reduced when Ara-FHNA residues were inserted at pyrimidine-purine (Py-Pu) steps compared to placement within a stretch of pyrimidines (Py-Py). Crystal structures of A-type DNA duplexes modified with either monomer provide a rationalization for the opposing stability effects and point to a steric origin of the destabilization caused by the Ara-FHNA analog. The sequence dependent effect can be explained by the formation of an internucleotide C-F {hor_ellipsis} H-C pseudo hydrogen bond between F3' of Ara-FHNA and C8-H of the nucleobase from the 3'-adjacent adenosine that is absent at Py-Py steps. In animal experiments, FHNA-modified antisense oligonucleotides formulated in saline showed a potent downregulation of gene expression in liver tissue without producing hepatotoxicity. Our data establish FHNA as a useful modification for antisense therapeutics and also confirm the stabilizing influence of F(Py) {hor_ellipsis} H-C(Pu) pseudo hydrogen bonds in nucleic acid structures.

  20. Activity and mRNA Levels of Enzymes Involved in Hepatic Fatty Acid Synthesis in Rats Fed Naringenin.

    PubMed

    Hashimoto, Toru; Ide, Takashi

    2015-11-01

    We investigated the physiological activity of naringenin in affecting hepatic lipogenesis and serum and liver lipid levels in rats. Rats were fed diets containing 0, 1, or 2.5 g/kg naringenin for 15 d. Naringenin at a dietary level of 2.5 g/kg significantly decreased the activities and the mRNA levels of various lipogenic enzymes and sterol regulatory element binding protein-1c (SREBP-1c) mRNA level. The activities and the mRNA levels were also 9-22% and 12-38% lower, respectively, in rats fed a 1 g/kg naringenin diet than in the animals fed a naringenin-free diet, although the differences were not significant in many cases. Naringenin at 2.5 g/kg significantly lowered serum triacylglycerol, cholesterol, and phospholipid and hepatic triacylglycerol and cholesterol. This flavonoid at 1.0 g/kg also significantly lowered these parameters except for serum triacylglycerol. Naringenin levels in serum and liver dose-dependently increased, and hepatic concentrations reached levels that can affect various signaling pathways.

  1. RNA-Primed DNA Synthesis In Vitro

    PubMed Central

    Keller, Walter

    1972-01-01

    In vitro DNA synthesis on single-stranded circular DNA can be initiated by RNA primers. RNA chains are covalently extended by DNA polymerase II from KB cells and DNA polymerase I from Micrococcus luteus, but not by an RNA-dependent DNA polymerase from avian myeloblastosis virus. The reaction product consists of DNA chains with a piece of RNA at their 5′-ends, hydrogen bonded to the template DNA. The primer RNA is linked to the product DNA via a 3′:5′-phosphodiester bond, and can be specifically removed by ribonuclease H. The possible role of ribonuclease H in RNA-primed DNA synthesis in vivo is discussed. Images PMID:4338598

  2. Synthesis and Purification of a Hammerhead Ribozyme and a Fluorescein-Labeled RNA Substrate. A Biochemistry Laboratory: Part 1

    NASA Astrophysics Data System (ADS)

    Chow, Christine S.; Somne, Smita

    1999-05-01

    The applications of in vitro transcription and chemical synthesis of RNA are discussed. This laboratory describes the in vitro synthesis of a 38-nucleotide hammerhead ribozyme and the synthesis of a 17-nucleotide fluorescein-labeled RNA substrate by using standard phosphoramidite methodologies, two widely used methods in modern RNA research. The synthesis and purification procedures outlined allow students to develop an understanding of RNA handling procedures, synthesis of modified nucleic acids, gel electrophoresis, visualization of RNA by nonradioactive techniques, and quantitation of nucleic acids. The RNAs that are synthesized have applications in biotechnology and medicine; thus the students gain access to current problems in chemical and clinical research.

  3. Prebiotic RNA Synthesis by Montmorillonite Catalysis

    NASA Astrophysics Data System (ADS)

    Jheeta, Sohan; Joshi, Prakash C.

    2014-08-01

    This review summarizes our recent findings on the role of mineral salts in prebiotic RNA synthesis, which is catalyzed by montmorillonite clay minerals. The clay minerals not only catalyze the synthesis of RNA but also facilitate homochiral selection. Preliminary data of these findings have been presented at the "Horizontal Gene Transfer and the Last Universal Common Ancestor (LUCA)" conference at the Open University, Milton Keynes, UK, 5-6 September 2013. The objective of this meeting was to recognize the significance of RNA in LUCA. We believe that the prebiotic RNA synthesis from its monomers must have been a simple process. As a first step, it may have required activation of the 5'-end of the mononucleotide with a leaving group, e.g., imidazole in our model reaction (Figure 1). Wide ranges of activating groups are produced from HCN under plausible prebiotic Earth conditions. The final step is clay mineral catalysis in the presence of mineral salts to facilitate selective production of functional RNA. Both the clay minerals and mineral salts would have been abundant on early Earth. We have demonstrated that while montmorillonite (pH 7) produced only dimers from its monomers in water, addition of sodium chloride (1 M) enhanced the chain length multifold, as detected by HPLC. The effect of monovalent cations on RNA synthesis was of the following order: Li+ > Na+ > K+. A similar effect was observed with the anions, enhancing catalysis in the following order: Cl- > Br- > I-. The montmorillonite-catalyzed RNA synthesis was not affected by hydrophobic or hydrophilic interactions. We thus show that prebiotic synthesis of RNA from its monomers was a simple process requiring only clay minerals and a small amount of salt.

  4. Prebiotic RNA Synthesis by Montmorillonite Catalysis

    PubMed Central

    Jheeta, Sohan; Joshi, Prakash C.

    2014-01-01

    This review summarizes our recent findings on the role of mineral salts in prebiotic RNA synthesis, which is catalyzed by montmorillonite clay minerals. The clay minerals not only catalyze the synthesis of RNA but also facilitate homochiral selection. Preliminary data of these findings have been presented at the “Horizontal Gene Transfer and the Last Universal Common Ancestor (LUCA)” conference at the Open University, Milton Keynes, UK, 5–6 September 2013. The objective of this meeting was to recognize the significance of RNA in LUCA. We believe that the prebiotic RNA synthesis from its monomers must have been a simple process. As a first step, it may have required activation of the 5'-end of the mononucleotide with a leaving group, e.g., imidazole in our model reaction (Figure 1). Wide ranges of activating groups are produced from HCN under plausible prebiotic Earth conditions. The final step is clay mineral catalysis in the presence of mineral salts to facilitate selective production of functional RNA. Both the clay minerals and mineral salts would have been abundant on early Earth. We have demonstrated that while montmorillonite (pH 7) produced only dimers from its monomers in water, addition of sodium chloride (1 M) enhanced the chain length multifold, as detected by HPLC. The effect of monovalent cations on RNA synthesis was of the following order: Li+ > Na+ > K+. A similar effect was observed with the anions, enhancing catalysis in the following order: Cl− > Br− > I−. The montmorillonite-catalyzed RNA synthesis was not affected by hydrophobic or hydrophilic interactions. We thus show that prebiotic synthesis of RNA from its monomers was a simple process requiring only clay minerals and a small amount of salt. PMID:25370375

  5. The RNA synthesis machinery of negative-stranded RNA viruses

    SciTech Connect

    Ortín, Juan; Martín-Benito, Jaime

    2015-05-15

    The group of Negative-Stranded RNA Viruses (NSVs) includes many human pathogens, like the influenza, measles, mumps, respiratory syncytial or Ebola viruses, which produce frequent epidemics of disease and occasional, high mortality outbreaks by transmission from animal reservoirs. The genome of NSVs consists of one to several single-stranded, negative-polarity RNA molecules that are always assembled into mega Dalton-sized complexes by association to many nucleoprotein monomers. These RNA-protein complexes or ribonucleoproteins function as templates for transcription and replication by action of the viral RNA polymerase and accessory proteins. Here we review our knowledge on these large RNA-synthesis machines, including the structure of their components, the interactions among them and their enzymatic activities, and we discuss models showing how they perform the virus transcription and replication programmes. - Highlights: • Overall organisation of NSV RNA synthesis machines. • Structure and function of the ribonucleoprotein components: Atomic structure of the RNA polymerase complex. • Commonalities and differences between segmented- and non-segmented NSVs. • Transcription versus replication programmes.

  6. How Amino Acids and Peptides Shaped the RNA World

    PubMed Central

    van der Gulik, Peter T.S.; Speijer, Dave

    2015-01-01

    The “RNA world” hypothesis is seen as one of the main contenders for a viable theory on the origin of life. Relatively small RNAs have catalytic power, RNA is everywhere in present-day life, the ribosome is seen as a ribozyme, and rRNA and tRNA are crucial for modern protein synthesis. However, this view is incomplete at best. The modern protein-RNA ribosome most probably is not a distorted form of a “pure RNA ribosome” evolution started out with. Though the oldest center of the ribosome seems “RNA only”, we cannot conclude from this that it ever functioned in an environment without amino acids and/or peptides. Very small RNAs (versatile and stable due to basepairing) and amino acids, as well as dipeptides, coevolved. Remember, it is the amino group of aminoacylated tRNA that attacks peptidyl-tRNA, destroying the bond between peptide and tRNA. This activity of the amino acid part of aminoacyl-tRNA illustrates the centrality of amino acids in life. With the rise of the “RNA world” view of early life, the pendulum seems to have swung too much towards the ribozymatic part of early biochemistry. The necessary presence and activity of amino acids and peptides is in need of highlighting. In this article, we try to bring the role of the peptide component of early life back into focus. We argue that an RNA world completely independent of amino acids never existed. PMID:25607813

  7. HCV NS5b RNA-dependent RNA polymerase inhibitors: from alpha,gamma-diketoacids to 4,5-dihydroxypyrimidine- or 3-methyl-5-hydroxypyrimidinonecarboxylic acids. Design and synthesis.

    PubMed

    Summa, Vincenzo; Petrocchi, Alessia; Matassa, Victor G; Taliani, Marina; Laufer, Ralph; De Francesco, Raffaele; Altamura, Sergio; Pace, Paola

    2004-10-21

    A new class of the HCV NS5b RNA-dependent RNA polymerase inhibitors, the dihyroxypyrimidinecarboxylic acid derivative, was designed from a diketoacid and meconic acid derivative discovered by screening. Mechanism of action and essential moieties required for activity were identified. The corresponding N-methylpyrimidinone was also prepared; both classes are novel, reversible, and selective inhibitors of the HCV NS5b polymerase with improved druglike characteristics.

  8. Initiation of (-)-strand RNA synthesis catalyzed by the BMV RNA-dependent RNA polymerase: synthesis of oligonucleotides.

    PubMed

    Sun, J H; Adkins, S; Faurote, G; Kao, C C

    1996-12-01

    RNA replication, a process of fundamental importance for pathogenesis by many viruses, remains poorly understood at the mechanistic level because relatively few of the responsible enzymes have been purified and characterized biochemically. Partially purified RNA-dependent RNA polymerase (RdRp) from brome mosaic virus (BMV)-infected barley leaves is able to synthesize (-)-strand RNAs from input (+)-strand templates. In resolving RdRp products generated during (-)-strand BMV RNA synthesis, we found that an RNA of eight nucleotides was generated at approximately 10-fold molar excess to the full-length (-)-strand RNA. Production of the 8-mer was dependent upon and specific to BMV RNA templates. Furthermore, inhibitors of full-length (-)-strand RNA synthesis by RdRp also affected the production of the 8-mer. Analysis of the sequence of the 8-mer suggests that it is initiated at the authentic initiation site on the BMV RNA template, consistent with the possibility that the 8-mer is an abortive initiation product of RNA synthesis by RdRp in vitro. Addition of heparin or Mn2+ differentially affected production of the 8-mer and full-length (-)-strand RNA, as did some nucleotide changes near the site of RNA initiation. These studies further define the initiation process of (-)-strand RNA synthesis.

  9. Synthesis of Glu-tRNA(Gln) by engineered and natural aminoacyl-tRNA synthetases.

    PubMed

    Rodríguez-Hernández, Annia; Bhaskaran, Hari; Hadd, Andrew; Perona, John J

    2010-08-10

    A protein engineering approach to delineating which distinct elements of homologous tRNA synthetase architectures are responsible for divergent RNA-amino acid pairing specificities is described. Previously, we constructed a hybrid enzyme in which 23 amino acids from the catalytic domain of Escherichia coli glutaminyl-tRNA synthetase (GlnRS) were replaced with the corresponding residues of human glutamyl-tRNA synthetase (GluRS). The engineered hybrid (GlnRS S1/L1/L2) synthesizes Glu-tRNA(Gln) more than 10(4)-fold more efficiently than GlnRS. Detailed comparison of kinetic parameters between GlnRS S1/L1/L2 and the naturally occurring Methanothermobacter thermautotrophicus GluRS(ND), which is also capable of Glu-tRNA(Gln) synthesis, now shows that both k(cat) and K(m) for glutamate are recapitulated in the engineered enzyme, but that K(m) for tRNA is 200-fold higher. Thus, the simultaneous optimization of paired amino acid and tRNA binding sites found in a naturally occurring enzyme is not recapitulated in a hybrid that is successfully engineered for amino acid complementarity. We infer that the GlnRS architecture has differentiated to match only cognate amino acid-RNA pairs, and that the substrate selection functions do not operate independently of each other. Design and characterization of four additional hybrids identify further residues involved in improving complementarity for glutamate and in communicating between amino acid and tRNA binding sites. The robust catalytic function demonstrated in this engineered system offers a novel platform for exploring the stereochemical origins of coding as a property of the ancient Rossmann fold.

  10. Coupling mRNA Synthesis and Decay

    PubMed Central

    Braun, Katherine A.

    2014-01-01

    What has been will be again, what has been done will be done again; there is nothing new under the sun.—Ecclesiastes 1:9 (New International Version) Posttranscriptional regulation of gene expression has an important role in defining the phenotypic characteristics of an organism. Well-defined steps in mRNA metabolism that occur in the nucleus—capping, splicing, and polyadenylation—are mechanistically linked to the process of transcription. Recent evidence suggests another link between RNA polymerase II (Pol II) and a posttranscriptional process that occurs in the cytoplasm—mRNA decay. This conclusion appears to represent a conundrum. How could mRNA synthesis in the nucleus and mRNA decay in the cytoplasm be mechanistically linked? After a brief overview of mRNA processing, we will review the recent evidence for transcription-coupled mRNA decay and the possible involvement of Snf1, the Saccharomyces cerevisiae ortholog of AMP-activated protein kinase, in this process. PMID:25154419

  11. Inhibition of Interjacent Ribonucleic Acid (26S) Synthesis in Cells Infected by Sindbis Virus

    PubMed Central

    Scheele, Christina M.; Pfefferkorn, E. R.

    1969-01-01

    The interrelationship of viral ribonucleic acid (RNA) and protein synthesis in cells infected by Sindbis virus was investigated. When cultures were treated with puromycin early in the course of infection, the synthesis of interjacent RNA (26S) was preferentially inhibited. A similar result was obtained by shifting cells infected by one temperature-sensitive mutant defective in RNA synthesis from the permissive (29 C) to the nonpermissive (41.5 C) temperature. Under both conditions, the viral RNA produced appeared to be fully active biologically. Once underway, the synthesis of viral RNA in wild-type Sindbis infections did not require concomitant protein synthesis. PMID:5817400

  12. Single valproic acid treatment inhibits glycogen and RNA ribose turnover while disrupting glucose-derived cholesterol synthesis in liver as revealed by the [U-C(6)]-d-glucose tracer in mice.

    PubMed

    Beger, Richard D; Hansen, Deborah K; Schnackenberg, Laura K; Cross, Brandie M; Fatollahi, Javad J; Lagunero, F Tracy; Sarnyai, Zoltan; Boros, Laszlo G

    2009-09-01

    Previous genetic and proteomic studies identified altered activity of various enzymes such as those of fatty acid metabolism and glycogen synthesis after a single toxic dose of valproic acid (VPA) in rats. In this study, we demonstrate the effect of VPA on metabolite synthesis flux rates and the possible use of abnormal (13)C labeled glucose-derived metabolites in plasma or urine as early markers of toxicity. Female CD-1 mice were injected subcutaneously with saline or 600 mg/kg) VPA. Twelve hours later, the mice were injected with an intraperitoneal load of 1 g/kg [U-(13)C]-d-glucose. (13)C isotopomers of glycogen glucose and RNA ribose in liver, kidney and brain tissue, as well as glucose disposal via cholesterol and glucose in the plasma and urine were determined. The levels of all of the positional (13)C isotopomers of glucose were similar in plasma, suggesting that a single VPA dose does not disturb glucose absorption, uptake or hepatic glucose metabolism. Three-hour urine samples showed an increase in the injected tracer indicating a decreased glucose re-absorption via kidney tubules. (13)C labeled glucose deposited as liver glycogen or as ribose of RNA were decreased by VPA treatment; incorporation of (13)C via acetyl-CoA into plasma cholesterol was significantly lower at 60 min. The severe decreases in glucose-derived carbon flux into plasma and kidney-bound cholesterol, liver glycogen and RNA ribose synthesis, as well as decreased glucose re-absorption and an increased disposal via urine all serve as early flux markers of VPA-induced adverse metabolic effects in the host.

  13. Control of RNA synthesis by chromatin proteins.

    PubMed Central

    Cedar, H; Solage, A; Zurucki, F

    1976-01-01

    The effect of chromatin proteins on template activity has been studied. Using both E. coli RNA polymerase and calf thymmus polymerase B we have measured the number of initiation sites on chromatin and various histone-DNA complexes. Chromatin can be reconstituted with histone proteins alone and this complex is still a restricted template for RNA synthesis. The removal of histone f1 causes a large increase in the template activity. Chromatin is then treated with Micrococcal nuclease and the DNA fragments protected from nuclease attack ("covered DNA") are isolated. Alternatively, the chromatin is titrated with poly-D-lysine, and by successive treatment with Pronase and nuclease, the DNA regions accessible to polylysine are isolated ("open DNA"). Both fractions were tested for template activity. It was found that RNA polymerase initiation sites are distributed equally in open and covered region DNA. PMID:787926

  14. Investigation of the Prebiotic Synthesis of Amino Acids and RNA Bases from CO2 using FeS/H2S as a Reducing Agent

    NASA Technical Reports Server (NTRS)

    Keefe, Anthony D.; Miller, Stanley L.; McDonald, Gene; Bada, Jeffrey

    1995-01-01

    An autotrophic theory of the origin of metabolism and life has been proposed in which carbon dioxide is reduced by ferrous sulfide and hydrogen sulfide by means of a reversed citric acid cycle, leading to the production of amino acids. Similar processes have been proposed for purine synthesis. Ferrous sulfide is a strong reducing agent in the presence of hydrogen sulfide and can produce hydrogen as well as reduce alkenes, alkynes, and thiols to saturated hydrocarbons and reduce ketones to thiols. However, the reduction of carbon dioxide has not been demonstrated. We show here that no amino acids, purines, or pyrimidines are produced from carbon dioxide with the ferrous sulfide and hydrogen sulfide system. Furthermore, this system does not produce amino acids from carboxylic acids by reductive amination and carboxylation. Thus, the proposed autotrophic theory, using carbon dioxide, ferrous sulfide, and hydrogen sulfide, lacks the robustness needed to be a geological process and is, therefore, unlikely to have played a role in the origin of metabolism or the origin of life.

  15. Investigation of the Prebiotic Synthesis of Amino Acids and RNA Bases from CO2 Using FeS/H2S As a Reducing Agent

    NASA Technical Reports Server (NTRS)

    Keefe, Anthony D.; Miller, Stanley L.; McDonald, Gene; Bada, Jeffrey

    1995-01-01

    An autotrophic theory of the origin of metabolism and life has been proposed in which carbon dioxide is reduced by ferrous sulfide and hydrogen sulfide by means of a reversed citric acid cycle, leading to the production of amino acids. Similar processes have been proposed for purine synthesis. Ferrous sulfide is a strong reducing agent in the presence of hydrogen sulfide and can produce hydrogen as well as reduce alkenes, alkynes, and thiols to saturated hydrocarbons and reduce ketones to thiols. However, the reduction of carbon dioxide has not been demonstrated. We show here that no amino acids, purities, or pyrimidines are produced from carbon dioxide with the ferrous sulfide and hydrogen sulfide system. Furthermore, this system does not produce amino acids from carboxylic acids by reductive amination and carboxylation. Thus, the proposed autotrophic theory, using carbon dioxide, ferrous sulfide, and hydrogen sulfide, lacks the robustness needed to be a geological process and is, therefore, unlikely to have played a role In the origin of metabolism or the origin of life.

  16. The action of exogenous gibberellic acid on protein and mRNA in germinating castor bean seeds.

    PubMed

    Martin, C; Northcote, D H

    1982-03-01

    Gibberellic acid (GA3) stimulates water uptake in castor beans and increases the activity of certain enzymes associated with lipid mobilisation.The effect of the GA3 on the enzymes is possibly due to a general effect of the growth substance on protein synthesis. Gibberellic acid advanced the appearance of rRNA and poly (A(+))RNA in castor bean endosperms without specifically stimulating the synthesis of particular mRNA species. Thus these increased levels of mRNA and rRNA may act synergistically to affect the rate of a predetermined pattern of protein synthesis.

  17. Regulation of cardiac myosin synthesis: Studies of RNA content in cultured heart cells

    SciTech Connect

    McDermott, P.; Whitaker-Dowling, P.; Klein, I. Cornell Univ., New York, NY )

    1987-11-01

    Contraction regulates the myosin content and the rate of myosin synthesis in cultured neonatal rat heart cells. To further explore the mechanism for this regulation the authors examined various parameters of RNA content and RNA synthesis in contracting versus noncontracting myocytes. While contraction stimulated myosin heavy chain (MHC) synthesis by 72% compared to that of KCl-arrested cells, simultaneous analyses of polysome profiles were no different under the two culture conditions. Incorporation of ({sup 3}H) uridine monophosphate into cellular RNA revealed no change in the rate of total RNA or ribosomal subunits synthesis. In vitro translation of cellular RNA yielded similar incorporation of ({sup 35}S) methionine not trichloroacetic acid precipitable protein. Specific transcription of the MHC gene was examined by dot-blot analysis and was unaltered by contraction. Northern blot analysis of the MHC sequences detected by a cDNA probe revealed an mRNA sequence corresponding to a molecular weight of approximately 30 S. These data suggest that RNA synthesis and RNA content are unaltered by contraction in cultured heart cells and therefore the changes in myosin synthesis may be mediated at a post-transcriptional control level.

  18. Eucaryotic RNA polymerase conditional mutant that rapidly ceases mRNA synthesis.

    PubMed Central

    Nonet, M; Scafe, C; Sexton, J; Young, R

    1987-01-01

    We have isolated a yeast conditional mutant which rapidly ceases synthesis of mRNA when subjected to the nonpermissive temperature. This mutant (rpb1-1) was constructed by replacing the wild-type chromosomal copy of the gene encoding the largest subunit of RNA polymerase II with one mutagenized in vitro. The rapid cessation of mRNA synthesis in vivo and the lack of RNA polymerase II activity in crude extracts indicate that the mutant possesses a functionally defective, rather than an assembly-defective, RNA polymerase II. The shutdown in mRNA synthesis in the rpb1-1 mutant has pleiotropic effects on the synthesis of other RNAs and on the heat shock response. This mutant provides direct evidence that the RPB1 protein has a functional role in mRNA synthesis. Images PMID:3299050

  19. The genome of RNA tumor viruses contains polyadenylic acid sequences.

    PubMed

    Green, M; Cartas, M

    1972-04-01

    The 70S genome of two RNA tumor viruses, murine sarcoma virus and avian myeloblastosis virus, binds to Millipore filters in buffer with high salt concentration and to glass fiber filters containing poly(U). These observations suggest that 70S RNA contains adenylic acid-rich sequences. When digested by pancreatic RNase, 70S RNA of murine sarcoma virus yielded poly(A) sequences that contain 91% adenylic acid. These poly(A) sequences sedimented as a relatively homogenous peak in sucrose gradients with a sedimentation coefficient of 4-5 S, but had a mobility during polyacrylamide gel electrophoresis that corresponds to molecules that sediment at 6-7 S. If we estimate a molecular weight for each sequence of 30,000-60,000 (100-200 nucleotides) and a molecular weight for viral 70S RNA of 3-12 million, each viral genome could contain 1-8 poly(A) sequences. Possible functions of poly(A) in the infecting viral RNA may include a role in the initiation of viral DNA or RNA synthesis, in protein maturation, or in the assembly of the viral genome.

  20. De Novo RNA Synthesis by RNA-Dependent RNA Polymerase Activity of Telomerase Reverse Transcriptase.

    PubMed

    Maida, Yoshiko; Yasukawa, Mami; Masutomi, Kenkichi

    2016-04-01

    RNA-dependent RNA polymerase (RdRP) plays key roles in RNA silencing to generate double-stranded RNAs. In model organisms, such as Caenorhabditis elegans and Neurospora crassa, two types of small interfering RNAs (siRNAs), primary siRNAs and secondary siRNAs, are expressed; RdRP produces secondary siRNAs de novo, without using either Dicer or primers, while primary siRNAs are processed by Dicer. We reported that human telomerase reverse transcriptase (TERT) has RdRP activity and produces endogenous siRNAs in a Dicer-dependent manner. However, de novo synthesis of siRNAs by human TERT has not been elucidated. Here we show that the TERT RdRP generates short RNAs that are complementary to template RNAs and have 5'-triphosphorylated ends, which indicates de novo synthesis of the RNAs. In addition, we confirmed short RNA synthesis by TERT in several human carcinoma cell lines and found that TERT protein levels are positively correlated with RdRP activity. PMID:26830230

  1. Role of RNA and Protein Synthesis in Abscission

    PubMed Central

    Abeles, F. B.

    1968-01-01

    The cell separation aspect of abscission is thought to involve the action of specific cell wall degrading enzymes. Enzymes represent synthesis which in turn is preceded by the synthesis of specific RNA molecules, and it follows that inhibition of either of these processes would also block abscission. Since abscission is a localized phenomenon usually involving 2 or 3 cell layers, RNA and protein synthesis should also be localized. Manipulations of plant material which either accelerate or retard abscission may be due to the regulation of RNA and protein synthesis. This paper is a review of literature concerned with these and related questions. Images PMID:16657020

  2. Abiotic synthesis of fatty acids

    NASA Technical Reports Server (NTRS)

    Leach, W. W.; Nooner, D. W.; Oro, J.

    1978-01-01

    The formation of fatty acids by Fischer-Tropsch-type synthesis was investigated with ferric oxide, ammonium carbonate, potassium carbonate, powdered Pueblito de Allende carbonaceous chondrite, and filings from the Canyon Diablo meteorite used as catalysts. Products were separated and identified by gas chromatography and mass spectrometry. Iron oxide, Pueblito de Allende chondrite, and Canyon Diablo filings in an oxidized catalyst form yielded no fatty acids. Canyon Diablo filings heated overnight at 500 C while undergoing slow purging by deuterium produced fatty acids only when potassium carbonate was admixed; potassium carbonate alone also produced these compounds. The active catalytic combinations gave relatively high yields of aliphatic and aromatic hydrocarbons; substantial amounts of n-alkenes were almost invariably observed when fatty acids were produced; the latter were in the range C6 to C18, with maximum yield in C9 or 10.

  3. A Model for the Origin of Protein Synthesis as Coreplicational Scanning of Nascent RNA

    NASA Astrophysics Data System (ADS)

    Yakhnin, Alexander V.

    2007-12-01

    The origin of protein synthesis is one of the major riddles of molecular biology. It was proposed a decade ago that the ribosomal RNA evolved from an earlier RNA-replisome (a ribozyme fulfilling RNA replication) while transfer RNA (tRNA) evolved from a genomic replication origin. Applying these hypotheses, I suggest that protein synthesis arose for the purpose of segregating copy and template RNA during replication through the conventional formation of a complementary strand. Nascent RNA was scanned in 5' to 3' direction following the progress of replication. The base pairing of several tRNA-like molecules with nascent RNA released the replication intermediates trapped in duplex. Synthesis of random peptides evolved to fuel the turnover of tRNAs. Then the combination of replication-coupled peptide formation and the independent development of amino acid-specific tRNA aminoacylation resulted in template-based protein synthesis. Therefore, the positioning of tRNAs adjacent to each other developed for the purpose of replication rather than peptide synthesis. This hypothesis does not include either selection for useful peptides or specific recognition of amino acids at the initial evolution of translation. It does, however, explain a number of features of modern translation apparatus, such as the relative flexibility of genetic code, the number of proteins shared by the transcription and translation machines, the universal participation of an RNA subunit in co-translational protein secretion, ‘unscheduled translation’, and factor-independent translocation. Assistance of original ribosomes in keeping apart the nascent transcript from its template is still widely explored by modern bacteria and perhaps by other domains of life.

  4. 2-Selenouridine triphosphate synthesis and Se-RNA transcription.

    PubMed

    Sun, Huiyan; Jiang, Sibo; Caton-Williams, Julianne; Liu, Hehua; Huang, Zhen

    2013-09-01

    2-Selenouridine ((Se)U) is one of the naturally occurring modifications of Se-tRNAs ((Se)U-RNA) at the wobble position of the anticodon loop. Its role in the RNA-RNA interaction, especially during the mRNA decoding, is elusive. To assist the research exploration, herein we report the enzymatic synthesis of the (Se)U-RNA via 2-selenouridine triphosphate ((Se)UTP) synthesis and RNA transcription. Moreover, we have demonstrated that the synthesized (Se)UTP is stable and recognizable by T7 RNA polymerase. Under the optimized conditions, the transcription yield of (Se)U-RNA can reach up to 85% of the corresponding native RNA. Furthermore, the transcribed (Se)U-hammerhead ribozyme has the similar activity as the corresponding native, which suggests usefulness of (Se)U-RNAs in function and structure studies of noncoding RNAs, including the Se-tRNAs.

  5. Regulation of the Nucleolar DNA-Dependent RNA Polymerase by Amino Acids in Ehrlich Ascites Tumor Cells

    PubMed Central

    Franze-Fernández, M. T.; Pogo, A. O.

    1971-01-01

    Experiments were performed to ascertain the degree to which the amount of amino acids might be one of the regulatory factors that control the activity of the nucleolar RNA polymerase. Assays of the enzymatic activity were done with isolated nuclei from cells incubated with low and high concentrations of amino acids. Soon after the cells were exposed to a medium enriched in amino acids, a rapid increase of nucleolar RNA polymerase activity occurred. A similar result was obtained in cells incubated with lower concentrations of amino acids. However, the rate of ribosomal RNA synthesized was regularly much higher in cells incubated in a medium enriched with amino acids than in a medium low in amino acids. Apparently, the amino acids only controlled ribosomal RNA synthesis. Thus, neither maturation, processing, and transport of nuclear precursors into cytoplasmic ribosomal RNA, nor the synthesis of rapidly labeled RNA was affected. PMID:4108870

  6. A 5′ RNA element promotes dengue virus RNA synthesis on a circular genome

    PubMed Central

    Filomatori, Claudia V.; Lodeiro, Maria F.; Alvarez, Diego E.; Samsa, Marcelo M.; Pietrasanta, Lía; Gamarnik, Andrea V.

    2006-01-01

    The mechanisms of RNA replication of plus-strand RNA viruses are still unclear. Here, we identified the first promoter element for RNA synthesis described in a flavivirus. Using dengue virus as a model, we found that the viral RdRp discriminates the viral RNA by specific recognition of a 5′ element named SLA. We demonstrated that RNA–RNA interactions between 5′ and 3′ end sequences of the viral genome enhance dengue virus RNA synthesis only in the presence of an intact SLA. We propose a novel mechanism for minus-strand RNA synthesis in which the viral polymerase binds SLA at the 5′ end of the genome and reaches the site of initiation at the 3′ end via long-range RNA–RNA interactions. These findings provide an explanation for the strict requirement of dengue virus genome cyclization during viral replication. PMID:16882970

  7. Flaviviral Replication Complex: Coordination between RNA Synthesis and 5'-RNA Capping.

    PubMed

    Klema, Valerie J; Padmanabhan, Radhakrishnan; Choi, Kyung H

    2015-08-13

    Genome replication in flavivirus requires (-) strand RNA synthesis, (+) strand RNA synthesis, and 51-RNA capping and methylation. To carry out viral genome replication, flavivirus assembles a replication complex, consisting of both viral and host proteins, on the cytoplasmic side of the endoplasmic reticulum (ER) membrane. Two major components of the replication complex are the viral non-structural (NS) proteins NS3 and NS5. Together they possess all the enzymatic activities required for genome replication, yet how these activities are coordinated during genome replication is not clear. We provide an overview of the flaviviral genome replication process, the membrane-bound replication complex, and recent crystal structures of full-length NS5. We propose a model of how NS3 and NS5 coordinate their activities in the individual steps of (-) RNA synthesis, (+) RNA synthesis, and 51-RNA capping and methylation.

  8. Initiation of protein-primed picornavirus RNA synthesis

    PubMed Central

    Paul, Aniko V.; Wimmer, Eckard

    2015-01-01

    Plus strand RNA viruses use different mechanisms to initiate the synthesis of their RNA chains. The Picornaviridae family constitutes a large group of plus strand RNA viruses that possess a small terminal protein (VPg) covalently linked to the 5’-end of their genomes. The RNA polymerases of these viruses use VPg as primer for both minus and plus strand RNA synthesis. In the first step of the initiation reaction the RNA polymerase links a UMP to the hydroxyl group of a tyrosine in VPg using as template a cis-replicating element (cre) positioned in different regions of the viral genome. In this review we will summarize what is known about the intiation reaction of protein-primed RNA synthesis by the RNA polymerases of the Picornaviridae. As an example we will use the RNA polymerase of poliovirus, the prototype of Picornaviridae. We will also discuss models of how these nucleotidylylated protein primers might be used, together with viral and cellular replication proteins and other cis-replicating RNA elements, during minus and plus strand RNA synthesis. PMID:25592245

  9. RNA synthesis in the thymus of the immunologically mature mouse

    PubMed Central

    Patt, D. J.; Cohen, E. P.

    1974-01-01

    RNA synthesis was investigated in the thymus glands of adult immunized mice. After the intraperitoneal injection of mice with sheep red blood cells (SRBC), the net synthesis of RNA in the gland increased. A small but consistent amount of the RNA synthesized was distinguished by RNA:DNA hybridizations from that found in the glands of mice not injected with antigen. The RNA formed after immunization did not appear by hybridization to be specific for different antigens since the species of RNA formed in the glands of mice injected with SRBC was indistinguishable from RNA formed in the thymuses of mice injected with chicken red blood cells. RNA synthesized in the thymus glands of mice pharmacologically `stressed' by the injections of hydrocortisone, however, was distinguishable from that formed in the glands of mice injected with antigen. PMID:4854183

  10. Metabolic Labeling in the Study of Mammalian Ribosomal RNA Synthesis.

    PubMed

    Stefanovsky, Victor Y; Moss, Tom

    2016-01-01

    RNA metabolic labeling is a method of choice in the study of dynamic changes in the rate of gene transcription and RNA processing. It is particularly applicable to transcription of the ribosomal RNA genes and their processing products due to the very high levels of ribosomal RNA synthesis. Metabolic labeling can detect changes in ribosomal RNA transcription that occur within a few minutes as opposed to the still widely used RT-PCR or Northern blot procedures that measure RNA pool sizes and at best are able to detect changes occurring over several hours or several days. Here, we describe a metabolic labeling technique applicable to the measurement of ribosomal RNA synthesis and processing rates, as well as to the determination of RNA Polymerase I transcription elongation rates. PMID:27576716

  11. RNA-catalysed synthesis of complementary-strand RNA

    NASA Astrophysics Data System (ADS)

    Doudna, Jennifer A.; Szostak, Jack W.

    1989-06-01

    The Tetrahymena ribozyme can splice together multiple oligonucleotides aligned on a template strand to yield a fully complementary product strand. This reaction demonstrates the feasibility of RNA-catalysed RNA replications.

  12. The synthesis of methylated, phosphorylated, and phosphonated 3'-aminoacyl-tRNA(Sec) mimics.

    PubMed

    Rigger, Lukas; Schmidt, Rachel L; Holman, Kaitlyn M; Simonović, Miljan; Micura, Ronald

    2013-11-18

    The twenty first amino acid, selenocysteine (Sec), is the only amino acid that is synthesized on its cognate transfer RNA (tRNA(Sec)) in all domains of life. The multistep pathway involves O-phosphoseryl-tRNA:selenocysteinyl-tRNA synthase (SepSecS), an enzyme that catalyzes the terminal chemical reaction during which the phosphoseryl-tRNA(Sec) intermediate is converted into selenocysteinyl-tRNA(Sec). The SepSecS architecture and the mode of tRNA(Sec) recognition have been recently determined at atomic resolution. The crystal structure provided valuable insights that gave rise to mechanistic proposals that could not be validated because of the lack of appropriate molecular probes. To further improve our understanding of the mechanism of the biosynthesis of selenocysteine in general and the mechanism of SepSecS in particular, stable tRNA(Sec) substrates carrying aminoacyl moieties that mimic particular reaction intermediates are needed. Here, we report on the accurate synthesis of methylated, phosphorylated, and phosphonated serinyl-derived tRNA(Sec) mimics that contain a hydrolysis-resistant ribose 3'-amide linkage instead of the natural ester bond. The procedures introduced allow for efficient site-specific methylation and/or phosphorylation directly on the solid support utilized in the automated RNA synthesis. For the preparation of (S)-2-amino-4-phosphonobutyric acid-oligoribonucleotide conjugates, a separate solid support was generated. Furthermore, we developed a three-strand enzymatic ligation protocol to obtain the corresponding full-length tRNA(Sec) derivatives. Finally, we developed an electrophoretic mobility shift assay (EMSA) for rapid, qualitative characterization of the SepSecS-tRNA interactions. The novel tRNA(Sec) mimics are promising candidates for further elucidation of the biosynthesis of selenocysteine by X-ray crystallography and other biochemical approaches, and could be attractive for similar studies on other tRNA-dependent enzymes.

  13. Measurement of Microbial Activity and Growth in the Ocean by Rates of Stable Ribonucleic Acid Synthesis

    PubMed Central

    Karl, David M.

    1979-01-01

    A relatively simple and extremely sensitive technique for measuring rates of stable ribonucleic acid (RNA) synthesis was devised and applied to bacterial cultures and seawater samples. The procedure is based upon the uptake and incorporation of exogenous radiolabeled adenine into cellular RNA. To calculate absolute rates of synthesis, measurements of the specific radioactivity of the intracellular adenosine 5′-triphosphate pools (precursor to RNA) and of the total amount of radioactivity incorporated into stable cellular RNA per unit time are required. Since the rate of RNA synthesis is positively correlated with growth rate, measurements of RNA synthesis should be extremely useful for estimating and comparing the productivities of microbial assemblages in nature. Adenosine 5′-triphosphate, adenylate energy charge, and rates of stable RNA synthesis have been measured at a station located in the Columbian Basin of the Caribbean Sea. A subsurface peak in RNA synthesis (and therefore growth) was located within the dissolved oxygen minimum zone (450 m), suggesting in situ microbiological utilization of dissolved molecular oxygen. Calculations of the specific rates of RNA synthesis (i.e., RNA synthesis per unit of biomass) revealed that the middepth maximum corresponded to the highest specific rate of growth (420 pmol of adenine incorporated into RNA·day−1) of all depths sampled, including the euphotic zone. The existence of an intermediate depth zone of active microbial growth may be an important site for nutrient regeneration and may serve as a source of reduced carbon for mesopelagic and deep sea environments. PMID:16345461

  14. Genetics Home Reference: congenital bile acid synthesis defect type 1

    MedlinePlus

    ... bile acid synthesis defect type 1 congenital bile acid synthesis defect type 1 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 1 is a disorder characterized ...

  15. Genetics Home Reference: congenital bile acid synthesis defect type 2

    MedlinePlus

    ... bile acid synthesis defect type 2 congenital bile acid synthesis defect type 2 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 2 is a disorder characterized ...

  16. Hydroxamic Acids in Asymmetric Synthesis

    PubMed Central

    Li, Zhi; Yamamoto, Hisashi

    2012-01-01

    Metal-catalyzed stereoselective reactions are a central theme in organic chemistry research. In these reactions, the stereoselection is achieved predominantly by introducing chiral ligands at the metal catalyst’s center. For decades, researchers have sought better chiral ligands for asymmetric catalysis and have made great progress. Nevertheless, to achieve optimal stereoselectivity and to catalyze new reactions, new chiral ligands are needed. Due to their high metal affinity, hydroxamic acids play major roles across a broad spectrum of fields from biochemistry to metal extraction. Dr. K. Barry Sharpless first revealed their potential as chiral ligands for asymmetric synthesis in 1977: He published the chiral vanadium-hydroxamic-acid-catalyzed, enantioselective epoxidation of allylic alcohols before his discovery of Sharpless Asymmetric Epoxidation, which uses titanium-tartrate complex as the chiral reagent. However, researchers have reported few highly enantioselective reactions using metal-hydroxamic acid as catalysts since then. This Account summarizes our research on metal-catalyzed asymmetric epoxidation using hydroxamic acids as chiral ligands. We designed and synthesized a series of new hydroxamic acids, most notably the C2-symmetric bis-hydroxamic acid (BHA) family. V-BHA-catalyzed epoxidation of allylic and homoallylic alcohols achieved higher activity and stereoselectivity than Sharpless Asymmetric Epoxidation in many cases. Changing the metal species led to a series of unprecedented asymmetric epoxidation reactions, such as (i) single olefins and sulfides with Mo-BHA, (ii) homoallylic and bishomoallylic alcohols with Zr- and Hf-BHA, and (iii) N-alkenyl sulfonamides and N-sulfonyl imines with Hf-BHA. These reactions produce uniquely functionalized chiral epoxides with good yields and enantioselectivities. PMID:23157425

  17. Phosphatidic Acid Synthesis in Bacteria

    PubMed Central

    Yao, Jiangwei; Rock, Charles O.

    2012-01-01

    Membrane phospholipid synthesis is a vital facet of bacterial physiology. Although the spectrum of phospholipid headgroup structures produced by bacteria is large, the key precursor to all of these molecules is phosphatidic acid (PtdOH). Glycerol-3-phosphate derived from the glycolysis via glycerol-phosphate synthase is the universal source for the glycerol backbone of PtdOH. There are two distinct families of enzymes responsible for the acylation of the 1-position of glycerol-3-phosphate. The PlsB acyltransferase was discovered in Escherichia coli, and homologs are present in many eukaryotes. This protein family primarily uses acyl-acyl carrier protein (ACP) endproducts of fatty acid synthesis as acyl donors, but may also use acyl-CoA derived from exogenous fatty acids. The second protein family, PlsY, is more widely distributed in bacteria and utilizes the unique acyl donor, acyl-phosphate, which is produced from acyl-ACP by the enzyme PlsX. The acylation of the 2-position is carried out by members of the PlsC protein family. All PlsCs use acyl-ACP as the acyl donor, although the PlsCs of the γ-proteobacteria also may use acyl-CoA. Phospholipid headgroups are precursors in the biosynthesis of other membrane-associated molecules and the diacylglycerol product of these reactions is converted to PtdOH by one of two distinct families of lipid kinases. The central importance of the de novo and recycling pathways to PtdOH in cell physiology suggest these enzymes are suitable targets for the development of antibacterial therapeutics in Gram-positive pathogens. This article is part of a Special Issue entitled Phospholipids and Phospholipid Metabolism. PMID:22981714

  18. RNA Synthesis by in Vitro Selected Ribozymes for Recreating an RNA World

    PubMed Central

    Martin, Lyssa L.; Unrau, Peter J.; Müller, Ulrich F.

    2015-01-01

    The RNA world hypothesis states that during an early stage of life, RNA molecules functioned as genome and as the only genome-encoded catalyst. This hypothesis is supported by several lines of evidence, one of which is the in vitro selection of catalytic RNAs (ribozymes) in the laboratory for a wide range of reactions that might have been used by RNA world organisms. This review focuses on three types of ribozymes that could have been involved in the synthesis of RNA, the core activity in the self-replication of RNA world organisms. These ribozyme classes catalyze nucleoside synthesis, triphosphorylation, and the polymerization of nucleoside triphosphates. The strengths and weaknesses regarding each ribozyme’s possible function in a self-replicating RNA network are described, together with the obstacles that need to be overcome before an RNA world organism can be generated in the laboratory. PMID:25610978

  19. Abscisic Acid Synthesis and Response

    PubMed Central

    Finkelstein, Ruth

    2013-01-01

    Abscisic acid (ABA) is one of the “classical” plant hormones, i.e. discovered at least 50 years ago, that regulates many aspects of plant growth and development. This chapter reviews our current understanding of ABA synthesis, metabolism, transport, and signal transduction, emphasizing knowledge gained from studies of Arabidopsis. A combination of genetic, molecular and biochemical studies has identified nearly all of the enzymes involved in ABA metabolism, almost 200 loci regulating ABA response, and thousands of genes regulated by ABA in various contexts. Some of these regulators are implicated in cross-talk with other developmental, environmental or hormonal signals. Specific details of the ABA signaling mechanisms vary among tissues or developmental stages; these are discussed in the context of ABA effects on seed maturation, germination, seedling growth, vegetative stress responses, stomatal regulation, pathogen response, flowering, and senescence. PMID:24273463

  20. Studies on independent synthesis of cytoplasmic ribonucleic acids in Acetabularia mediterranea.

    PubMed

    NAORA, H; BRACHET, J

    1960-07-01

    1. The RNA content of anucleate and nucleate fragments of Acetabularia has been measured. It was found that there is a net synthesis of RNA in nucleate fragments. On the other hand, the RNA content of anucleate fragments did not change significantly after enucleation. 2. Anucleate fragments, however, can readily incorporate (14)C-labeled adenine, orotic acid, and carbon dioxide into their cytoplasmic RNA. 3. The results of experiments on (14)CO(2) incorporation into the RNA of anucleate and nucleate fragments suggest that there is a mechanism for de novo synthesis of RNA in anucleate cytoplasm. 4. In Acetabularia, 81 per cent of the cytoplasmic RNA is bound to a large granule fraction, consisting mainly of chloroplasts. Even after removal of the nucleus, RNA is synthesized in this "chloroplast" fraction. The chloroplasts are thus a major site of RNA synthesis in the cytoplasm of these algae. Synthesis of "chloroplastic" RNA, in anucleate fragments, possibly occurs at the expense of the RNA present in other fractions (microsomes and supernatant). 5. 8-Azaguanine stimulates regeneration and cap formation in anucleate fragments and does not inhibit RNA synthesis in these fragments.

  1. [The first steps of chlorophyll synthesis: RNA involvement and regulation

    SciTech Connect

    Soell, D.

    1992-01-01

    Glu-tRNA[sup Glu] is synthesized from glutamate and tRNA[sup Glu] by glutamyl-tRNA synthetase (GluRS). Recent work has demonstrated that Glu-tRNA[sup Glu] has dual functions and is a precursor for protein and 5-aminolevulinate (ALA) synthesis. Current data does not provide compelling evidence for the notion that GluRS is regulated by chlorophyll precursors or in concert with the other enzymes of ALA synthesis. We have redefined the C5-pathway as a two-step route to ALA starting with Glu-tRNA[sup Glu]. Only two enzymes, Glu-tRNA reductase (GluTR) and GSA-2,1-amino-mutase (GSA-AM), are specifically involved in ALA synthesis. We have purified these enzymatic activities from Chlamydomonas and demonstrated that the two purified proteins in the presence of their cofactors NADPH and pyridoxal phosphate are sufficient for the in vitro Glu-tRNA [yields] ALA conversion. We have cloned the genes encoding GluTR. The sequences of the GluTR proteins deduced from these genes share highly conserved regions with those of bacterial origin. We havealso cloned and analyzed the gene encoding GSA-AM from Arabidopsis. As in Salmonella typhimurium, there are indications of the existence of an additional pathway for ALA formation in E. coli. To shed light on the recognition of the single tRNA[sup Glu] by the chloroplast enzymes GluTR, GluRS we characterized a chlorophyll-deficient mutant of Euglena having tRNA[sup Glu] with a point mutation in the T[Psi]C-loop. The altered tRNA supports protein but not ALA synthesis.

  2. Ultraviolet light-induced inhibition of small nuclear RNA synthesis.

    PubMed

    Eliceiri, B P; Choudhury, K; Scott, Q O; Eliceiri, G L

    1989-03-01

    Two apparently distinct types of inhibition of the synthesis of U1, U2, U3, U4, and U5 small nuclear RNA, induced by ultraviolet (UV) radiation, have been described before: immediate and delayed. Our present observation can be summarized as follows: a) neither the immediate nor the delayed inhibition appear to be mediated by the formation of cyclobutane pyrimidine dimers, since they were not prevented by photoreactivating light, in ICR 2A frog cells; b) the inhibition of U1 RNA synthesis, monitored in HeLA cells within the first few minutes after irradiation, extrapolated to a substantial suppression at time zero of postirradiation cell incubation, providing further support for the proposal that the immediate inhibition is a reaction separate from the delayed UV light-induced inhibition of U1 RNA synthesis; c) the transition from the pattern of the immediate inhibition to that of the delayed inhibition (disappearance of the UV-resistant fraction of U1 RNA synthesis and increased rate of inhibition) occurred gradually, without an apparent threshold, within the first 2 hr of incubation after irradiation; and d) the incident UV dose that resulted in a 37% level of residual U1 RNA synthesis (D37) during the delayed inhibition was about 7 J/m2, with an apparent UV dose threshold, and was about 60 J/m2 for the immediate inhibition. PMID:2925798

  3. Necessity of transferrin for RNA synthesis in chick myotubes.

    PubMed

    Shoji, A; Ozawa, E

    1986-06-01

    Chick transferrin (Tf) is essential not only for growth and differentiation but also for the maintenance of chick myotubes in culture. Its removal from the culture medium gives rise to degeneration of the myotubes. The analysis of this process revealed that the removal resulted in decrease in total and messenger RNA content in the myotubes; this was mainly due to a decrease in RNA synthesis. Activity of in vitro RNA synthesis in isolated nuclei from myotubes cultured without Tf was lower than the activity in nuclei from myotubes cultured with Tf and increased with the addition of FeCl3. Although RNA degradation in myotubes was also enhanced following Tf removal, the degree was small. The synthesis of most proteins was reduced. In contrast to this, a few new proteins of unknown nature were synthesised in myotubes cultured in Tf-free medium. The role of Fe ion carried into the cells by Tf in promoting myogenic cell growth and differentiation and in preventing the myotubes from degeneration can be explained, at least in part, on the basis of its effect on RNA synthesis. Since we have found that Fe is required for activation of RNA polymerase purified from embryonic muscles (Shoji and Ozawa, 1985b), these effects may be ascribed to this activating effect. PMID:2423539

  4. The mechanism of montmorillonite catalysis in RNA synthesis

    NASA Astrophysics Data System (ADS)

    Joshi, Prakash

    The formation of complex prebiotic molecules on the early Earth is likely to have involved a component of mineral catalysis. Amongst the variety of clay minerals that have been investigated by us for their ability to catalyze the formation of RNA oligomers is montmorillonite. These are 2:1 layer silicates that have a wide range of chemical compositions [(Na,Ca)0.33(Al,Fe,Mg)2(Si,Al)4O10(OH)2.nH2O]. They are commonly produced by the weathering of silicic volcanic ashes to form Bentonite. Once formed, montmorillonites gradually transform to Illites at a modest pressure and temperature. Of the many samples of montmorillonite that we have experimentally examined, a selected subset has been observed to be catalytic for RNA synthesis (Joshi et. al., 2009; Aldersley et al., 2011). Those that have been observed to be excellent catalysts come from a restricted range of elemental compositions. The recent identification of phyllosilicates including montmorillonite on Mars (Bishop et al., 2008) raises the possibility that such processes may have taken place there too. The extent of catalysis depended not only upon the magnitude of the negative charge on the montmorillonite lattice and the number of cations associated with it, but also on the pH at which the reaction is promoted. The isotherm and catalysis studies were extended to provide binding information and catalytic outcomes over a wide pH range. When cations in raw montmorillonite are completely replaced by sodium ions, the resulting Na+-montmorillonite does not catalyze oligomer formation because the ions saturate the interlayer between the platelets of montmorillonite, which blocks the binding of the activated monomers. Acid washed montmorillonite titrated to pH 6-8 with alkali metal ions, serves as the model catalyst for this RNA synthesis (Aldersley et. al., 2011). The optimal binding occurred in the region of maximal oligomer formation. X-ray diffraction studies revealed changes in layer separations of

  5. Synthesis and Isolation of Chelidonic Acid

    ERIC Educational Resources Information Center

    Gagan, J. M. F.; Herbert, R. B.

    1976-01-01

    Described is an undergraduate laboratory experiment involving synthesis of chelidonic acid and its identification in plants. The experiment is offered as an ancillary topic for biology or chemistry classes. (SL)

  6. Cyclic phosphatidic acid and lysophosphatidic acid induce hyaluronic acid synthesis via CREB transcription factor regulation in human skin fibroblasts.

    PubMed

    Maeda-Sano, Katsura; Gotoh, Mari; Morohoshi, Toshiro; Someya, Takao; Murofushi, Hiromu; Murakami-Murofushi, Kimiko

    2014-09-01

    Cyclic phosphatidic acid (cPA) is a naturally occurring phospholipid mediator and an analog of the growth factor-like phospholipid lysophosphatidic acid (LPA). cPA has a unique cyclic phosphate ring at the sn-2 and sn-3 positions of its glycerol backbone. We showed before that a metabolically stabilized cPA derivative, 2-carba-cPA, relieved osteoarthritis pathogenesis in vivo and induced hyaluronic acid synthesis in human osteoarthritis synoviocytes in vitro. This study focused on hyaluronic acid synthesis in human fibroblasts, which retain moisture and maintain health in the dermis. We investigated the effects of cPA and LPA on hyaluronic acid synthesis in human fibroblasts (NB1RGB cells). Using particle exclusion and enzyme-linked immunosorbent assays, we found that both cPA and LPA dose-dependently induced hyaluronic acid synthesis. We revealed that the expression of hyaluronan synthase 2 messenger RNA and protein is up-regulated by cPA and LPA treatment time dependently. We then characterized the signaling pathways up-regulating hyaluronic acid synthesis mediated by cPA and LPA in NB1RGB cells. Pharmacological inhibition and reporter gene assays revealed that the activation of the LPA receptor LPAR1, Gi/o protein, phosphatidylinositol-3 kinase (PI3K), extracellular-signal-regulated kinase (ERK), and cyclic adenosine monophosphate response element-binding protein (CREB) but not nuclear factor κB induced hyaluronic acid synthesis by the treatment with cPA and LPA in NB1RGB cells. These results demonstrate for the first time that cPA and LPA induce hyaluronic acid synthesis in human skin fibroblasts mainly through the activation of LPAR1-Gi/o followed by the PI3K, ERK, and CREB signaling pathway.

  7. Inhibition of DNA-dependent RNA synthesis by 8-methoxypsoralen.

    PubMed

    Gniazdowski, M; Czyz, M; Wilmańska, D; Studzian, K; Frasunek, M; Płucienniczak, A; Szmigiero, L

    1988-09-01

    The effect of the photobinding of 8-methoxypsoralen to phage T7 DNA on different steps of RNA synthesis in vitro was assayed. Total RNA synthesis is reduced to a few percent and the transcript size is decreased, as shown by means of gel filtration on a Sepharose 4B column when DNA of the adduct content of six drug molecules per 10(3) nucleotides is used. The initiation of RNA chains seems to be less affected, as inferred from an abortive initiation assay. Synthesis of pppApU on DNA of the same adduct content is inhibited to 34% of the corresponding controls, while the overall RNA synthesis is inhibited to 6%. The amount of the enzyme needed for maximal retention of DNA, the kinetics of its binding and the decay of the polymerase-DNA complex at high ionic strength (or on decrease of the temperature) are similar with DNA either irradiated in the absence of the drug or DNA bearing six 8-methoxypsoralen molecules per 10(3) nucleotides. It is concluded from this study that 8-methoxypsoralen partially inhibits initiation and blocks movement of RNA polymerase along the template, inducing premature termination. It does not appear to influence the binding of the enzyme to DNA. PMID:3048406

  8. Enzymatic synthesis of cinnamic acid derivatives.

    PubMed

    Lee, Gia-Sheu; Widjaja, Arief; Ju, Yi-Hsu

    2006-04-01

    Using Novozym 435 as catalyst, the syntheses of ethyl ferulate (EF) from ferulic acid (4-hydroxy 3-methoxy cinnamic acid) and ethanol, and octyl methoxycinnamate (OMC) from p-methoxycinnamic acid and 2-ethyl hexanol were successfully carried out in this study. A conversion of 87% was obtained within 2 days at 75 degrees C for the synthesis of EF. For the synthesis of OMC at 80 degrees C, 90% conversion can be obtained within 1 day. The use of solvent and high reaction temperature resulted in better conversion for the synthesis of cinnamic acid derivatives. Some cinnamic acid esters could also be obtained with higher conversion and shorter reaction times in comparison to other methods reported in the literature. The enzyme can be reused several times before significant activity loss was observed.

  9. Montmorillonite Clay-Catalyzed Synthesis of RNA Oligomers

    NASA Astrophysics Data System (ADS)

    Ferris, J. P.; Miyakawa, S.; Huang, W.; Joshi, P.

    2005-12-01

    It is proposed that catalysis had a central role in the origins of life. This will be illustrated using the montmorillonite clay-catalyzed synthesis of oligomers of RNA from activated monomers, (Ferris and Ertem, 1993) a possible step in the origin of the RNA world (Ferris, 2005). Structural analysis of oligomers formed in the reaction of the activated monomer of 5'-AMP with that of 5'-CMP demonstrated that the oligomers formed were not produced by random synthesis but rather the sequences observed were directed by the montmorillonite catalyst (Miyakawa and Ferris, 2003). RNA oligomers containing up to 40 mers have been synthesized in reactions performed in water at 25 oC in the presence of montmorillonite (Huang and Ferris, 2003). Analysis of the structure elements in these oligomers from the 7 to 39 mers showed that they did not vary. Reaction of D, L-mixtures of the activated monomers of A and U resulted in the formation of greater amounts of the homochiral amounts of dimers and trimers of A than would be expected if there was no selectivity in the reaction. A limited number of the dimers and trimers of U were also formed but here the selectivity was for the formation of an excess of heterochiral products (Joshi et al., 2000). A postulate that explains why homochiral trimers of U are not formed and the significance of catalysis in prebiotic synthesis will be discussed. Ferris, J.P. (2005) Origins of life, molecular basis of. In R.A. Meyers, Ed. Encyclopedia of Molecular Cell Biology and Molecular Medicine, 10. Wiley-VCH Verlag, Weinheim, Germany. Ferris, J.P., and Ertem, G. (1993) Montmorillonite catalysis of RNA oligomer formation in aqueous solution. A model for the prebiotic formation of RNA. J. Am. Chem. Soc., 115, 12270-12275. Huang, W., and Ferris, J.P. (2003) Synthesis of 35-40 mers of RNA oligomers from unblocked monomers. A simple approach to the RNA world. Chem. Commun., 1458-1459. Joshi, P.C., Pitsch, S., and Ferris, J.P. (2000) Homochiral selection

  10. Nonenzymatic template-directed RNA synthesis inside model protocells.

    PubMed

    Adamala, Katarzyna; Szostak, Jack W

    2013-11-29

    Efforts to recreate a prebiotically plausible protocell, in which RNA replication occurs within a fatty acid vesicle, have been stalled by the destabilizing effect of Mg(2+) on fatty acid membranes. Here we report that the presence of citrate protects fatty acid membranes from the disruptive effects of high Mg(2+) ion concentrations while allowing RNA copying to proceed, while also protecting single-stranded RNA from Mg(2+)-catalyzed degradation. This combination of properties has allowed us to demonstrate the chemical copying of RNA templates inside fatty acid vesicles, which in turn allows for an increase in copying efficiency by bathing the vesicles in a continuously refreshed solution of activated nucleotides. PMID:24288333

  11. DNA polymerase-α regulates type I interferon activation through cytosolic RNA:DNA synthesis

    PubMed Central

    Starokadomskyy, Petro; Gemelli, Terry; Rios, Jonathan J.; Xing, Chao; Wang, Richard C.; Li, Haiying; Pokatayev, Vladislav; Dozmorov, Igor; Khan, Shaheen; Miyata, Naoteru; Fraile, Guadalupe; Raj, Prithvi; Xu, Zhe; Xu, Zigang; Ma, Lin; Lin, Zhimiao; Wang, Huijun; Yang, Yong; Ben-Amitai, Dan; Orenstein, Naama; Mussaffi, Huda; Baselga, Eulalia; Tadini, Gianluca; Grunebaum, Eyal; Sarajlija, Adrijan; Krzewski, Konrad; Wakeland, Edward K.; Yan, Nan; de la Morena, Maria Teresa; Zinn, Andrew R.; Burstein, Ezra

    2016-01-01

    Aberrant nucleic acids generated during viral replication are the main trigger for antiviral immunity, and mutations disrupting nucleic acid metabolism can lead to autoinflammatory disorders. Here we investigated the etiology of X-linked reticulate pigmentary disorder (XLPDR), a primary immunodeficiency with autoinflammatory features. We discovered that XLPDR is caused by an intronic mutation that disrupts expression of POLA1, the gene encoding the catalytic subunit of DNA polymerase-α. Unexpectedly, POLA1 deficiency results in increased type I interferon production. This enzyme is necessary for RNA:DNA primer synthesis during DNA replication and strikingly, POLA1 is also required for the synthesis of cytosolic RNA:DNA, which directly modulates interferon activation. Altogether, this work identified POLA1 as a critical regulator of the type I interferon response. PMID:27019227

  12. Mutation in human selenocysteine transfer RNA selectively disrupts selenoprotein synthesis.

    PubMed

    Schoenmakers, Erik; Carlson, Bradley; Agostini, Maura; Moran, Carla; Rajanayagam, Odelia; Bochukova, Elena; Tobe, Ryuta; Peat, Rachel; Gevers, Evelien; Muntoni, Francesco; Guicheney, Pascale; Schoenmakers, Nadia; Farooqi, Sadaf; Lyons, Greta; Hatfield, Dolph; Chatterjee, Krishna

    2016-03-01

    Selenium is a trace element that is essential for human health and is incorporated into more than 25 human selenocysteine-containing (Sec-containing) proteins via unique Sec-insertion machinery that includes a specific, nuclear genome-encoded, transfer RNA (tRNA[Ser]Sec). Here, we have identified a human tRNA[Ser]Sec mutation in a proband who presented with a variety of symptoms, including abdominal pain, fatigue, muscle weakness, and low plasma levels of selenium. This mutation resulted in a marked reduction in expression of stress-related, but not housekeeping, selenoproteins. Evaluation of primary cells from the homozygous proband and a heterozygous parent indicated that the observed deficit in stress-related selenoprotein production is likely mediated by reduced expression and diminished 2'-O-methylribosylation at uridine 34 in mutant tRNA[Ser]Sec. Moreover, this methylribosylation defect was restored by cellular complementation with normal tRNA[Ser]Sec. This study identifies a tRNA mutation that selectively impairs synthesis of stress-related selenoproteins and demonstrates the importance of tRNA modification for normal selenoprotein synthesis. PMID:26854926

  13. Gliotoxin: inhibitor of poliovirus RNA synthesis that blocks the viral RNA polymerase 3Dpol.

    PubMed Central

    Rodriguez, P L; Carrasco, L

    1992-01-01

    The mode of action of gliotoxin against poliovirus has been analyzed in detail. This fungal metabolite inhibits the appearance of poliovirus proteins when present from the beginning of infection but has no effect on viral translation when added at late times. In agreement with previous findings, this toxin potently inhibited the incorporation of [3H]uridine into poliovirus RNA soon after its addition to the culture medium. Analysis of the synthesis of poliovirus plus- or minus-stranded RNA in the presence of gliotoxin suggests that this compound effectively hampered both processes. This result contrasts with the mode of action of other inhibitors of poliovirus RNA synthesis, such as guanidine or flavones, that selectively block plus-stranded RNA synthesis and suggests that the target of gliotoxin differs from the target of guanidine, i.e., poliovirus protein 2C. Indeed, gliotoxin was found to be a potent inhibitor of poliovirus RNA synthesis in cell-free systems, using membranous crude replication complexes, a reaction that is not blocked by guanidine or Ro 09-0179. Moreover, in vitro activity of the purified poliovirus polymerase 3Dpol was efficiently inhibited by gliotoxin. These results indicate that this toxin acts on the poliovirus polymerase 3Dpol, providing the first description of an inhibitor of this viral enzyme. Images PMID:1372367

  14. Effect of the Kinetin-Naphthaleneacetic Acid Interaction Upon Total RNA and Protein in Senescing Detached Leaves 1

    PubMed Central

    Vonabrams, G. J.; Pratt, Harlan K.

    1968-01-01

    The interaction between kinetin and naphthaleneacetic acid in the regulation of senescence of excised tissue of mature broccoli leaves has been used to examine the extent of synchrony between changes in chlorophyll, RNA, and protein. Kinetin increased the net uptake of 14C-labeled orotic acid and leucine. Naphthaleneacetic acid decreased the effect of kinetin on net uptake after long treatment, but in short-time treatments the auxin increased the effect of kinetin on net uptake. Results of long (24 hr) treatments indicated a general synchrony between the loss of RNA, protein, and chlorophyll. Naphthaleneacetic acid reduced the stabilizing effect of kinetin upon chlorophyll content and upon the content and synthesis of RNA. In short-time experiments, however, RNA content and synthesis were transiently increased by kinetin, and further increased by kinetin plus naphthaleneacetic acid, while chlorophyll content decreased in the presence of kinetin and decreased further in the presence of kinetin plus naphthaleneacetic acid. Actinomycin-D accelerated the loss of chlorophyll, RNA and protein and strongly depressed the rate of RNA synthesis. In the presence of actinomycin-D the stabilizing effect of kinetin upon RNA was substantially reduced. In contrast, the chlorophyll and protein contents remained higher than in the control. Actinomycin-D did not nullify the basal incorporation of orotic acid into RNA, nor did it negate the effect of kinetin upon incorporation. The failure of synchrony between changes in chlorophyll and RNA does not substantiate the proposal that kinetin regulates senescence by a direct effect upon DNA-dependent RNA synthesis. Images PMID:5700020

  15. Flock house virus RNA polymerase initiates RNA synthesis de novo and possesses a terminal nucleotidyl transferase activity.

    PubMed

    Wu, Wenzhe; Wang, Zhaowei; Xia, Hongjie; Liu, Yongxiang; Qiu, Yang; Liu, Yujie; Hu, Yuanyang; Zhou, Xi

    2014-01-01

    Flock House virus (FHV) is a positive-stranded RNA virus with a bipartite genome of RNAs, RNA1 and RNA2, and belongs to the family Nodaviridae. As the most extensively studied nodavirus, FHV has become a well-recognized model for studying various aspects of RNA virology, particularly viral RNA replication and antiviral innate immunity. FHV RNA1 encodes protein A, which is an RNA-dependent RNA polymerase (RdRP) and functions as the sole viral replicase protein responsible for RNA replication. Although the RNA replication of FHV has been studied in considerable detail, the mechanism employed by FHV protein A to initiate RNA synthesis has not been determined. In this study, we characterized the RdRP activity of FHV protein A in detail and revealed that it can initiate RNA synthesis via a de novo (primer-independent) mechanism. Moreover, we found that FHV protein A also possesses a terminal nucleotidyl transferase (TNTase) activity, which was able to restore the nucleotide loss at the 3'-end initiation site of RNA template to rescue RNA synthesis initiation in vitro, and may function as a rescue and protection mechanism to protect the 3' initiation site, and ensure the efficiency and accuracy of viral RNA synthesis. Altogether, our study establishes the de novo initiation mechanism of RdRP and the terminal rescue mechanism of TNTase for FHV protein A, and represents an important advance toward understanding FHV RNA replication. PMID:24466277

  16. Synthesis of infectious poliovirus RNA by purified T7 RNA polymerase.

    PubMed Central

    van der Werf, S; Bradley, J; Wimmer, E; Studier, F W; Dunn, J J

    1986-01-01

    Plasmids containing the entire cDNA sequence of poliovirus type 1 (Mahoney strain) under control of a promoter for T7 RNA polymerase have been constructed. Purified T7 RNA polymerase efficiently transcribes the entire poliovirus cDNA in either direction to produce full-length poliovirus RNA [(+)RNA] or its complement [(-)RNA]. The (+)RNA produced initially had 60 nucleotides on the 5' side of the poliovirus RNA sequence, including a string of 18 consecutive guanine residues generated in the original cloning and an additional 626 nucleotides of pBR322 sequence beyond the poly(A) tract at the 3' end. Such RNA, while much more infectious than the plasmid DNA, is only about 0.1% as infectious as RNA isolated from the virus. Subsequently, a T7 promoter was placed only 2 base pairs ahead of the poliovirus sequence, so that T7 RNA polymerase synthesizes poliovirus RNA with only 2 additional guanine residues at the 5' end and no more than seven nucleotides past the poly(A) tract at the 3' end. Such RNA has much higher specific infectivity, about 5% that of RNA isolated from the virus. The ability to make infectious poliovirus RNA efficiently from cloned DNA makes it possible to apply techniques of in vitro mutagenesis to the analysis of poliovirus functions and the construction of novel and perhaps useful derivatives of poliovirus. A source of variant RNAs should also allow detailed study of the synthesis and processing of poliovirus proteins in vitro. Images PMID:3010307

  17. Inhibition of vaccinia mRNA methylation by 2',5'-linked oligo(adenylic acid) triphosphate

    SciTech Connect

    Sharma, O.K.; Goswami, B.B.

    1981-04-01

    Extracts of interferon-treated cells synthesize unique 2',5'-linked oligo(adenylic acid) 5'-phosphates in the presence of ATP and double-stranded RNA. 2',5'-linked oligo(adenylic acid) 5'-triphosphate inhibits protein synthesis at nanomolar concentrations by activating RNase. We have observed that oligo(adenylic acid) 5'-monophosphate and 5'-triphosphate are potent inhibitors of vaccinia mRNA methylation in vitro. Both the methylation of the 5'-terminal guanine at the 7 position and the 2'-O-ribose methylation of the penultimate nucleoside are inhibited. Such inhibition of mRNA methylation is not due to degradation of the mRNA. Inhibition of the requisite modification of the 5' terminus of mRNA by 2',5'-linked oligo(adenylic acids) may be a mechanism of interferon action against both DNA and RNA viruses in which mRNAs derived from them are capped.

  18. Aminoacyl-tRNA enrichment after a flood of labeled phenylalanine: insulin effect on muscle protein synthesis.

    PubMed

    Caso, Giuseppe; Ford, G Charles; Nair, K Sreekumaran; Garlick, Peter J; McNurlan, Margaret A

    2002-05-01

    Muscle protein synthesis in dogs measured by flooding with L-[(2)H(5)]phenylalanine (70 mg/kg) was significantly stimulated by infusion of insulin with amino acids. The stimulation of muscle protein synthesis was similar when calculated from the enrichment of phenylalanyl-tRNA (61 +/- 10%, P < 0.001), plasma phenylalanine (61 +/- 10%, P < 0.001), or tissue fluid phenylalanine (54 +/- 10%, P < 0.001). The time course for changes in enrichment of L-[(2)H(5)]phenylalanine throughout the flooding period was determined for plasma, tissue fluid, and phenylalanyl-tRNA in the basal state and during the infusion of insulin with amino acids. Enrichments of plasma free phenylalanine and phenylalanyl-tRNA were equalized between 20 and 45 min, although the enrichment of phenylalanyl-tRNA was lower at early time points. Rates of muscle protein synthesis obtained with the flooding method and calculated from plasma phenylalanine enrichment were comparable to those calculated from phenylalanyl-tRNA and also to those obtained previously with a continuous infusion of phenylalanine with phenylalanyl-tRNA as precursor. This study confirms that, with a bolus injection of labeled phenylalanine, the enrichment of aminoacyl-tRNA, the true precursor pool for protein synthesis, can be assessed from more readily sampled plasma phenylalanine.

  19. RNA synthesis by the brome mosaic virus RNA-dependent RNA polymerase in human cells reveals requirements for de novo initiation and protein-protein interaction.

    PubMed

    Subba-Reddy, Chennareddy V; Tragesser, Brady; Xu, Zhili; Stein, Barry; Ranjith-Kumar, C T; Kao, C Cheng

    2012-04-01

    Brome mosaic virus (BMV) is a model positive-strand RNA virus whose replication has been studied in a number of surrogate hosts. In transiently transfected human cells, the BMV polymerase 2a activated signaling by the innate immune receptor RIG-I, which recognizes de novo-initiated non-self-RNAs. Active-site mutations in 2a abolished RIG-I activation, and coexpression of the BMV 1a protein stimulated 2a activity. Mutations previously shown to abolish 1a and 2a interaction prevented the 1a-dependent enhancement of 2a activity. New insights into 1a-2a interaction include the findings that helicase active site of 1a is required to enhance 2a polymerase activity and that negatively charged amino acid residues between positions 110 and 120 of 2a contribute to interaction with the 1a helicase-like domain but not to the intrinsic polymerase activity. Confocal fluorescence microscopy revealed that the BMV 1a and 2a colocalized to perinuclear region in human cells. However, no perinuclear spherule-like structures were detected in human cells by immunoelectron microscopy. Sequencing of the RNAs coimmunoprecipitated with RIG-I revealed that the 2a-synthesized short RNAs are derived from the message used to translate 2a. That is, 2a exhibits a strong cis preference for BMV RNA2. Strikingly, the 2a RNA products had initiation sequences (5'-GUAAA-3') identical to those from the 5' sequence of the BMV genomic RNA2 and RNA3. These results show that the BMV 2a polymerase does not require other BMV proteins to initiate RNA synthesis but that the 1a helicase domain, and likely helicase activity, can affect RNA synthesis by 2a.

  20. Rubella virus capsid protein modulation of viral genomic and subgenomic RNA synthesis

    SciTech Connect

    Tzeng, W.-P.; Frey, Teryl K. . E-mail: tfrey@gsu.edu

    2005-07-05

    The ratio of the subgenomic (SG) to genome RNA synthesized by rubella virus (RUB) replicons expressing the green fluorescent protein reporter gene (RUBrep/GFP) is substantially higher than the ratio of these species synthesized by RUB (4.3 for RUBrep/GFP vs. 1.3-1.4 for RUB). It was hypothesized that this modulation of the viral RNA synthesis was by one of the virus structural protein genes and it was found that introduction of the capsid (C) protein gene into the replicons as an in-frame fusion with GFP resulted in an increase of genomic RNA production (reducing the SG/genome RNA ratio), confirming the hypothesis and showing that the C gene was the moiety responsible for the modulation effect. The N-terminal one-third of the C gene was required for the effect of be exhibited. A similar phenomenon was not observed with the replicons of Sindbis virus, a related Alphavirus. Interestingly, modulation was not observed when RUBrep/GFP was co-transfected with either other RUBrep or plasmid constructs expressing the C gene, demonstrating that modulation could occur only when the C gene was provided in cis. Mutations that prevented translation of the C protein failed to modulate RNA synthesis, indicating that the C protein was the moiety responsible for modulation; consistent with this conclusion, modulation of RNA synthesis was maintained when synonymous codon mutations were introduced at the 5' end of the C gene that changed the C gene sequence without altering the amino acid sequence of the C protein. These results indicate that C protein translated in proximity of viral replication complexes, possibly from newly synthesized SG RNA, participate in regulating the replication of viral RNA.

  1. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  2. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  3. Evolution of Protein Synthesis from an RNA World

    PubMed Central

    Noller, Harry F.

    2012-01-01

    SUMMARY Because of the molecular complexity of the ribosome and protein synthesis, it is a challenge to imagine how translation could have evolved from a primitive RNA World. Two specific suggestions are made here to help to address this, involving separate evolution of the peptidyl transferase and decoding functions. First, it is proposed that translation originally arose not to synthesize functional proteins, but to provide simple (perhaps random) peptides that bound to RNA, increasing its available structure space, and therefore its functional capabilities. Second, it is proposed that the decoding site of the ribosome evolved from a mechanism for duplication of RNA. This process involved homodimeric “duplicator RNAs,” resembling the anticodon arms of tRNAs, which directed ligation of trinucleotides in response to an RNA template. PMID:20610545

  4. Polyamines in the Synthesis of Bacteriophage Deoxyribonucleic Acid. I. Lack of Dependence of Polyamine Synthesis on Bacteriophage Deoxyribonucleic Acid Synthesis

    PubMed Central

    Dion, Arnold S.; Cohen, Seymour S.

    1972-01-01

    To determine whether polyamine synthesis is dependent on deoxyribonucleic acid (DNA) synthesis, polyamine levels were estimated after infection of bacterial cells with ultraviolet-irradiated T4 or T4 am N 122, a DNA-negative mutant. Although phage DNA accumulation was restricted to various degrees in comparison to cells infected with T4D, nearly commensurate levels of putrescine and spermidine synthesis were observed after infection, regardless of the rate of phage DNA synthesis. We conclude from these data that polyamine synthesis after infection is independent of phage DNA synthesis. PMID:4552549

  5. Nuclear Localization of Flavivirus RNA Synthesis in Infected Cells

    PubMed Central

    Uchil, Pradeep Devappa; Kumar, Anil V. A.; Satchidanandam, Vijaya

    2006-01-01

    Flaviviral replication is believed to be exclusively cytoplasmic, occurring within virus-induced membrane-bound replication complexes in the host cytoplasm. Here we show that a significant proportion (20%) of the total RNA-dependent RNA polymerase (RdRp) activity from cells infected with West Nile virus, Japanese encephalitis virus (JEV), and dengue virus is resident within the nucleus. Consistent with this, the major replicase proteins NS3 and NS5 of JEV also localized within the nucleus. NS5 was found distributed throughout the nucleoplasm, but NS3 was present at sites of active flaviviral RNA synthesis, colocalizing with NS5, and visible as distinct foci along the inner periphery of the nucleus by confocal and immunoelectron microscopy. Both these viral replicase proteins were also present in the nuclear matrix, colocalizing with the peripheral lamina, and revealed a well-entrenched nuclear location for the viral replication complex. In keeping with this observation, antibodies to either NS3 or NS5 coimmunoprecipitated the other protein from isolated nuclei along with newly synthesized viral RNA. Taken together these data suggest an absolute requirement for both of the replicase proteins for nucleus-localized synthesis of flavivirus RNA. Thus, we conclusively demonstrate for the first time that the host cell nucleus functions as an additional site for the presence of functionally active flaviviral replicase complex. PMID:16699025

  6. RNA Synthesis in Whole Cells and Protoplasts of Centaurea

    PubMed Central

    Kulikowski, Robert R.; Mascarenhas, Joseph P.

    1978-01-01

    Protoplasts enzymically isolated from suspension cultures of Centaurea cyanus L. incorporate radioactive precursors into RNA with kinetics similar to that of whole cells. There are differences, however, in several other aspects of RNA metabolism. The proportion of total RNA that contains poly(A) sequences (25 to 30%) is similar in both freshly isolated protoplasts and whole cells after a 20-minute pulse with [3H]adenosine. After a 4-hour pulse, however, poly(A)-containing RNA makes up 30% of the total RNA in protoplasts whereas it drops to 8% in whole cells. There appears to be a faulty processing of ribosomal precursor into the mature ribosomal species, as the precursor seems to accumulate to higher levels relative to the mature 18S and 25S rRNAs in protoplasts as compared to whole cells. Additional differences are seen in the size distributions of poly(A)-containing RNA, although the length of the poly(A) segment is similar in both protoplasts and whole cells. Within 24 hours protoplasts appear to have resumed a pattern of RNA synthesis similar to that of whole cells. PMID:16660339

  7. [Lipid synthesis by an acidic acid tolerant Rhodotorula glutinis].

    PubMed

    Lin, Zhangnan; Liu, Hongjuan; Zhang, Jian'an; Wang, Gehua

    2016-03-01

    Acetic acid, as a main by-product generated in the pretreatment process of lignocellulose hydrolysis, significantly affects cell growth and lipid synthesis of oleaginous microorganisms. Therefore, we studied the tolerance of Rhodotorula glutinis to acetic acid and its lipid synthesis from substrate containing acetic acid. In the mixed sugar medium containing 6 g/L glucose and 44 g/L xylose, and supplemented with acetic acid, the cell growth was not:inhibited when the acetic acid concentration was below 10 g/L. Compared with the control, the biomass, lipid concentration and lipid content of R. glutinis increased 21.5%, 171% and 122% respectively when acetic acid concentration was 10 g/L. Furthermore, R. glutinis could accumulate lipid with acetate as the sole carbon source. Lipid concentration and lipid yield reached 3.20 g/L and 13% respectively with the initial acetic acid concentration of 25 g/L. The lipid composition was analyzed by gas chromatograph. The main composition of lipid produced with acetic acid was palmitic acid, stearic acid, oleic acid, linoleic acid and linolenic acid, including 40.9% saturated fatty acids and 59.1% unsaturated fatty acids. The lipid composition was similar to that of plant oil, indicating that lipid from oleaginous yeast R. glutinis had potential as the feedstock of biodiesel production. These results demonstrated that a certain concentration of acetic acid need not to be removed in the detoxification process when using lignocelluloses hydrolysate to produce microbial lipid by R. glutinis. PMID:27349116

  8. Enzymatic Synthesis of Nucleic Acids with Defined Regioisomeric 2'-5' Linkages.

    PubMed

    Cozens, Christopher; Mutschler, Hannes; Nelson, Geoffrey M; Houlihan, Gillian; Taylor, Alexander I; Holliger, Philipp

    2015-12-14

    Information-bearing nucleic acids display universal 3'-5' linkages, but regioisomeric 2'-5' linkages occur sporadically in non-enzymatic RNA synthesis and may have aided prebiotic RNA replication. Herein we report on the enzymatic synthesis of both DNA and RNA with site-specific 2'-5' linkages by an engineered polymerase using 3'-deoxy- or 3'-O-methyl-NTPs as substrates. We also report the reverse transcription of the resulting modified nucleic acids back to 3'-5' linked DNA with good fidelity. This enables a fast and simple method for "structural mutagenesis" by the position-selective incorporation of 2'-5' linkages, whereby nucleic acid structure and function may be probed through local distortion by regioisomeric linkages while maintaining the wild-type base sequence as we demonstrate for the 10-23 RNA endonuclease DNAzyme.

  9. The Effect of Light and Inhibitors on Chloroplast and Cytoplasmic RNA Synthesis

    PubMed Central

    Ingle, J.

    1968-01-01

    Chloroplast RNA is synthesized in dark-grown radish cotyledons at about one-third the rate of that in the light. The synthesis, however, continues for longer in the dark and the percentage of chloroplast RNA can approach that in light-grown tissue. Light stimulates the synthesis and accumulation of both cytoplasmic and chloroplast RNA, but shows a 4-fold greater stimulation of the chloroplast RNA. Chloramphenicol, streptomycin and cycloheximide inhibit the synthesis of chloroplast RNA with little effect on cytoplasmic RNA. 5-Fluorouracil inhibits the synthesis of cytoplasmic more than chloroplast RNA. Synthesis of the 0.56 × 106 mol wt chloroplast RNA is inhibited much less than the other ribosomal RNA components by actinomycin D. PMID:5699149

  10. Folic acid binds DNA and RNA at different locations.

    PubMed

    Bourassa, P; Tajmir-Riahi, H A

    2015-03-01

    We located multiple binding sites for folic acid on DNA and tRNA at physiological conditions, using FTIR, CD, fluorescence spectroscopic methods and molecular modeling. Structural analysis revealed that folic acid binds DNA and tRNA at multiple sites via hydrophilic, hydrophobic and H-bonding contacts with overall binding constants of Kfolic acid-DNA=1.1 (±0.3)×10(4) M(-1) and Kfolic acid-tRNA=6.4 (±0.5)×10(3) M(-1). Molecular modeling showed the participation of several nucleobases in folic acid complexes with DNA and tRNA, stabilized by H-bonding network. Two types of complexes were located for folic acid-tRNA adducts, one at the major groove and the other with TΨC loop, while acid binding occurs at major and minor grooves of DNA duplex. Folic acid complexation induced more alterations of DNA structure than tRNA.

  11. Ribonucleic acid synthesis during fruiting body formation in Myxococcus xanthus.

    PubMed

    Smith, B A; Dworkin, M

    1981-04-01

    A method has been devised that allowed us, for the first time, to pulse-label M. xanthus cells with precursors for ribonucleic acid biosynthesis while they were undergoing fruiting body formation. Using this method, we examined patterns of ribonucleic acid (RNA) accumulation throughout the process of fruiting body formation. As development proceeded, the rate of RNA accumulation increased at two periods of the developmental cycle: once just before aggregation and once late in the cycle, when sporulation was essentially completed. In contrast to vegetatively growing cells, in which only stable RNA species are labeled during a 30-min pulse, the majority of radioactivity found in RNA from 30-min pulse-labeled developing cells was found in an unstable heterodisperse fraction that migrated to the 5S to 16S region of sucrose density gradients and sodium dodecyl sulfate-polyacrylamide gels. This pattern of incorporation could not be induced (i) by a shift down of vegetatively growing cells to a nutritionally poor medium, in which the generation time was increased to that of developing cells during the growth phase, or (ii) by plating of vegetative cells onto the same solid-surface environment as that of developing cells, but which surface supported vegetative growth rather than fruiting body formation. Thus, the RNA synthesis pattern observed appeared to be related to development per se rather than to nutritional depletion or growth on a solid surface alone. The radioactivity incorporated into the unstable 5S to 16S RNA fraction accumulated as the pulse length was increased from 10 to 30 min; in contrast, an analogous unstable fraction from vegetative cells decreased as pulse length was increased. This suggested that developmental 5S to 16S RNA was more stable than vegetative cell 5S to 16S RNA (presumptive messenger RNA). However, during a 45-min chase period, radioactivity in 30-min-pulse-labeled developmental 5S to 16S RNA decayed to an extent twice that of

  12. Synthesis of pyromellitic acid esters

    NASA Technical Reports Server (NTRS)

    Fedorova, V. A.; Donchak, V. A.; Martynyuk-Lototskaya, A. N.

    1985-01-01

    The ester acids necessary for studyng the thermochemical properties of pyromellitic acid (PMK)-based peroxides were investigated. Obtaining a tetramethyl ester of a PMK was described. The mechanism of an esterification reaction is discussed, as is the complete esterification of PMK with primary alcohol.

  13. Synthesis of higher monocarboxylic acids

    SciTech Connect

    Taikov, B.F.; Novakovskii, E.M.; Zhelkovskaya, V.P.; Shadrova, V.N.; Shcherbik, P.K.

    1981-01-01

    Brown-coal and peat waxes contain higher monocarboxylic acids, alcohols and esters of them as their main components. In view of this, considerable interest is presented by the preparation of individual compounds among those mentioned above, which is particularly important in the study of the composition and development of the optimum variants of the chemical processing of the waxes. In laboratory practice, to obtain higher monocarboxylic acids use is generally made of electrosynthesis according to Kolbe which permits unbranched higher aliphatic acids with given lengths of the hydrocarbon chain to be obtained. The aim of the present work was to synthesize higher monocarboxylic acids: arachidic, behenic, lignoceric, pentacosanoic, erotic, heptacosanoic, montanic, nonacosanoic, melissic, dotriacontanoic and tetratriacontanoic, which are present in waxes. Characteristics of synthesized acids are tabulated. 20 refs.

  14. Primer-Dependent and Primer-Independent Initiation of Double Stranded RNA Synthesis by Purified Arabidopsis RNA-Dependent RNA Polymerases RDR2 and RDR6

    PubMed Central

    Devert, Anthony; Fabre, Nicolas; Floris, Maïna; Canard, Bruno; Robaglia, Christophe; Crété, Patrice

    2015-01-01

    Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA) targeted by RNA silencing. The dsRNA is subsequently cleaved by the ribonuclease DICER-like into secondary small interfering RNAs (siRNAs) that reinforce and/or maintain the silenced state of the target RNA. Models of RNA silencing propose that RDRs could use primer-independent and primer-dependent initiation to generate dsRNA from a transcript targeted by primary siRNA or microRNA (miRNA). However, the biochemical activities of RDR proteins are still partly understood. Here, we obtained active recombinant RDR2 and RDR6 in a purified form. We demonstrate that RDR2 and RDR6 have primer-independent and primer-dependent RNA polymerase activities with different efficiencies. We further show that RDR2 and RDR6 can initiate dsRNA synthesis either by elongation of 21- to 24- nucleotides RNAs hybridized to complementary RNA template or by elongation of self-primed RNA template. These findings provide new insights into our understanding of the molecular mechanisms of RNA silencing in plants. PMID:25793874

  15. Primer-dependent and primer-independent initiation of double stranded RNA synthesis by purified Arabidopsis RNA-dependent RNA polymerases RDR2 and RDR6.

    PubMed

    Devert, Anthony; Fabre, Nicolas; Floris, Maïna; Canard, Bruno; Robaglia, Christophe; Crété, Patrice

    2015-01-01

    Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA) targeted by RNA silencing. The dsRNA is subsequently cleaved by the ribonuclease DICER-like into secondary small interfering RNAs (siRNAs) that reinforce and/or maintain the silenced state of the target RNA. Models of RNA silencing propose that RDRs could use primer-independent and primer-dependent initiation to generate dsRNA from a transcript targeted by primary siRNA or microRNA (miRNA). However, the biochemical activities of RDR proteins are still partly understood. Here, we obtained active recombinant RDR2 and RDR6 in a purified form. We demonstrate that RDR2 and RDR6 have primer-independent and primer-dependent RNA polymerase activities with different efficiencies. We further show that RDR2 and RDR6 can initiate dsRNA synthesis either by elongation of 21- to 24- nucleotides RNAs hybridized to complementary RNA template or by elongation of self-primed RNA template. These findings provide new insights into our understanding of the molecular mechanisms of RNA silencing in plants. PMID:25793874

  16. Ribosomal Synthesis of Peptides with Multiple β-Amino Acids.

    PubMed

    Fujino, Tomoshige; Goto, Yuki; Suga, Hiroaki; Murakami, Hiroshi

    2016-02-17

    The compatibility of β-amino acids with ribosomal translation was studied for decades, but it has been still unclear whether the ribosome can accept various β-amino acids, and whether the ribosome can introduce multiple β-amino acids in a peptide. In the present study, by using the Escherichia coli reconstituted cell-free translation system with a reprogramed genetic code, we screened β-amino acids that give high single incorporation efficiency and used them to synthesize peptides containing multiple β-amino acids. The experiments of single β-amino acid incorporation into a peptide revealed that 13 β-amino acids are compatible with ribosomal translation. Six of the tested β-amino acids (βhGly, l-βhAla, l-βhGln, l-βhPhg, l-βhMet, and d-βhPhg) showed high incorporation efficiencies, and seven (l-βhLeu, l-βhIle, l-βhAsn, l-βhPhe, l-βhLys, d-βhAla, and d-βhLeu) showed moderate incorporation efficiencies; whereas no full-length peptide was produced using other β-amino acids (l-βhPro, l-βhTrp, and l-βhGlu). Subsequent double-incorporation experiments using β-amino acids with high single incorporation efficiency revealed that elongation of peptides with successive β-amino acids is prohibited. Efficiency of the double-incorporation of the β-amino acids was restored by the insertion of Tyr or Ile between the two β-amino acids. On the basis of these experiments, we also designed mRNA sequences of peptides, and demonstrated the ribosomal synthesis of peptides containing different types of β-amino acids at multiple positions.

  17. Alphavirus RNA synthesis and non-structural protein functions

    PubMed Central

    Rupp, Jonathan C.; Sokoloski, Kevin J.; Gebhart, Natasha N.

    2015-01-01

    The members of the genus Alphavirus are positive-sense RNA viruses, which are predominantly transmitted to vertebrates by a mosquito vector. Alphavirus disease in humans can be severely debilitating, and depending on the particular viral species, infection may result in encephalitis and possibly death. In recent years, alphaviruses have received significant attention from public health authorities as a consequence of the dramatic emergence of chikungunya virus in the Indian Ocean islands and the Caribbean. Currently, no safe, approved or effective vaccine or antiviral intervention exists for human alphavirus infection. The molecular biology of alphavirus RNA synthesis has been well studied in a few species of the genus and represents a general target for antiviral drug development. This review describes what is currently understood about the regulation of alphavirus RNA synthesis, the roles of the viral non-structural proteins in this process and the functions of cis-acting RNA elements in replication, and points to open questions within the field. PMID:26219641

  18. A new gene in E. coli RNA synthesis.

    PubMed

    Liebke, H H; Speyer, J F

    1983-01-01

    A novel spontaneous temperature sensitive mutant of Escherichia coli, which stops synthesizing stable RNA and some proteins immediately upon temperature shift from 30 degrees C to 42 degrees C, is described. Stable RNA species are not preferentially degraded in the mutant at the nonpermissive temperature. The guanine polyphosphate compounds, ppGpp (MS1) and pppGpp (MS2), are not produced at 42 degrees C. The mutant strain does not grow at 42 degrees C in either broth or defined minimal medium supplemented with any of a variety of carbon sources. The temperature sensitive mutation in this strain maps between dap A, E and pts I and defines a new locus affecting RNA synthesis in E. coli.

  19. In Vitro Synthesis of Rous Sarcoma Virus-Specific RNA is Catalyzed by a DNA-Dependent RNA Polymerase

    PubMed Central

    Rymo, L.; Parsons, J. T.; Coffin, J. M.; Weissmann, C.

    1974-01-01

    Synthesis of Rous sarcoma virus RNA was examined in vitro with a new assay for radioactive virus-specific RNA. Nuclei from infected and uninfected cells were incubated with ribonucleoside [α-32P]triphosphates, Mn++, Mg++ and (NH4)2SO4. Incorporation into total and viral RNA proceeded with similar kinetics for up to 25 min at 37°. About 0.5% of the RNA synthesized by the infected system was scored as virus-specific, compared to 0.03% of the RNA from the uninfected system and 0.005% of the RNA synthesized by monkey kidney cell nuclei. Preincubation with DNase or actinomycin D completely suppressed total and virus-specific RNA synthesis. α-Amanitin, a specific inhibitor of eukaryotic RNA polymerase II, completely inhibited virus-specific RNA synthesis, while reducing total RNA synthesis by only 50%. We conclude that tumor virus-specific RNA is synthesized on a DNA template, most probably by the host's RNA polymerase II. PMID:4368801

  20. pp32 and APRIL are host cell-derived regulators of influenza virus RNA synthesis from cRNA

    PubMed Central

    Sugiyama, Kenji; Kawaguchi, Atsushi; Okuwaki, Mitsuru; Nagata, Kyosuke

    2015-01-01

    Replication of influenza viral genomic RNA (vRNA) is catalyzed by viral RNA-dependent RNA polymerase (vRdRP). Complementary RNA (cRNA) is first copied from vRNA, and progeny vRNAs are then amplified from the cRNA. Although vRdRP and viral RNA are minimal requirements, efficient cell-free replication could not be reproduced using only these viral factors. Using a biochemical complementation assay system, we found a novel activity in the nuclear extracts of uninfected cells, designated IREF-2, that allows robust unprimed vRNA synthesis from a cRNA template. IREF-2 was shown to consist of host-derived proteins, pp32 and APRIL. IREF-2 interacts with a free form of vRdRP and preferentially upregulates vRNA synthesis rather than cRNA synthesis. Knockdown experiments indicated that IREF-2 is involved in in vivo viral replication. On the basis of these results and those of previous studies, a plausible role(s) for IREF-2 during the initiation processes of vRNA replication is discussed. DOI: http://dx.doi.org/10.7554/eLife.08939.001 PMID:26512887

  1. Nuclear synthesis of cytoplasmic ribonucleic acid in Amoeba proteus.

    PubMed

    PRESCOTT, D M

    1959-10-01

    The enucleation technique has been applied to Amoeba proteus by several laboratories in attempts to determine whether the cytoplasm is capable of nucleus-independent ribonucleic acid synthesis. This cell is very convenient for micrurgy, but its use requires a thorough starvation period to eliminate the possibility of metabolic influence by food vacuoles and frequent washings and medium renewal to maintain asepsis. In the experiments described here, amoebae were starved for periods of 24 to 96 hours, cut into nucleated and enucleated halves, and exposed to either C-14 uracil, C-14 adenine, C-14 orotic acid, or a mixture of all three. When the starvation period was short (less than 72 hours), organisms (especially yeast cells) contained within amoeba food vacuoles frequently showed RNA synthesis in both nucleated and enucleated amoebae. When the preperiod of starvation was longer than 72 hours, food vacuole influence was apparently negligible, and a more meaningful comparison between enucleated and nucleated amoebae was possible. Nucleated cells incorporated all three precursors into RNA; enucleated cells were incapable of such incorporation. The experiments indicate a complete dependence on the nucleus for RNA synthesis. The conflict with the experimental results of others on this problem could possibly stem from differences in culture conditions, starvation treatment, or experimental conditions. For an unequivocal answer in experiments of this design, ideally the cells should be capable of growth on an entirely synthetic medium under aseptic conditions. The use of a synthetic medium (experiments with A. proteus are done under starvation conditions) would permit, moreover, a more realistic comparison of metabolic capacities of nucleated and enucleated cells.

  2. Fructose utilization for nucleic acid synthesis in the fetal pig.

    PubMed

    White, C E; Piper, E L; Noland, P R; Daniels, L B

    1982-07-01

    Eight fetal pigs, in utero, were injected ip with 20 microCi/fetus [U14C]-fructose between d 55 and 65 pregnancy. The isotope was allowed to equilibrate between blood and tissues within injected fetuses for a period of 240 min. Fetal pigs were then sacrificed and nucleic acids were extracted from cold tissue homogenates of skeletal muscle and liver. Nuclide disintegrations per minute recovered in extracted DNA and RNA were used to calculate incorporation of labeled C from fructose. The recovery of labeled C per mmol of nucleic acids from skeletal muscle was greater (P less than .05) than that from liver. Relative incorporation of labeled C into skeletal muscle RNA (395.9 pmol/mmol) was greater (P less than .05) than for DNA (189.5 pmol/mmol). The same trend was observed for liver RNA (78.0 pmol/mmol) and DNA (55.6 pmol/mmol), but differences were nonsignificant. These data suggest that at least part of the high concentration of endogenous fructose measured in fetal pigs in utero is involved in synthesis of nucleic acids, thereby providing substrate for anabolic functions necessary for fetal growth and development. PMID:6181047

  3. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the snythesis methods of the prior art.

  4. Gene activity during germination of spores of the fern, Onoclea sensibilis: RNA and protein synthesis and the role of stored mRNA

    NASA Technical Reports Server (NTRS)

    Raghavan, V.

    1991-01-01

    Pattern of 3H-uridine incorporation into RNA of spores of Onoclea sensibilis imbibed in complete darkness (non-germinating conditions) and induced to germinate in red light was followed by oligo-dT cellulose chromatography, gel electrophoresis coupled with fluorography and autoradiography. In dark-imbibed spores, RNA synthesis was initiated about 24 h after sowing, with most of the label accumulating in the high mol. wt. poly(A) -RNA fraction. There was no incorporation of the label into poly(A) +RNA until 48 h after sowing. In contrast, photo-induced spores began to synthesize all fractions of RNA within 12 h after sowing and by 24 h, incorporation of 3H-uridine into RNA of irradiated spores was nearly 70-fold higher than that into dark-imbibed spores. Protein synthesis, as monitored by 3H-arginine incorporation into the acid-insoluble fraction and by autoradiography, was initiated in spores within 1-2 h after sowing under both conditions. Autoradiographic experiments also showed that onset of protein synthesis in the cytoplasm of the germinating spore is independent of the transport of newly synthesized nuclear RNA. One-dimensional sodium dodecyl sulphate-polyacrylamide gel electrophoresis of 35S-methionine-labelled proteins revealed a good correspondence between proteins synthesized in a cell-free translation system directed by poly(A) +RNA of dormant spores and those synthesized in vivo by dark-imbibed and photo-induced spores. These results indicate that stored mRNAs of O. sensibilis spores are functionally competent and provide templates for the synthesis of proteins during dark-imbibition and germination.

  5. The action of exogenous gibberellic acid on isocitrate lyase -mRNA in germinating castor bean seeds.

    PubMed

    Martin, C; Northcote, D H

    1982-03-01

    Gibberellic acid (GA3) stimulates isocitrate lyase activity of the endosperm during germination of castor bean seeds. Isocitrate lyase from castor bean was purified and an antibody to it was prepared from rabbit serum. This antibody was used to measure the amounts of isocitrate lyase-mRNA using an in vitro translation system. No specific stimulation of isocitrate lyase-mRNA by application of GA3 was detected. The stimulation of isocitrate lyase activity by exogenous GA3 may be accounted for by the action of the growth substance in advancing the overall production of rRNA and mRNA which accelerates the rate of total protein synthesis during germination. The application of Amo 1618 retards the production of isocitrate lyase activity but also retards protein synthesis in general. This suggests that endogenous gibberellins also act non-specifically in the regulation of protein synthesis during castor bean germination.

  6. Synthesis of stable aminoacyl-tRNA analogs.

    PubMed

    Chemama, Maryline; Fonvielle, Matthieu; Lecerf, Maxime; Mellal, Dénia; Fief, Hélène; Arthur, Michel; Etheve-Quelquejeu, Mélanie

    2011-03-01

    Aminoacyl-tRNAs have important roles in a variety of biological processes. Here, we describe the synthesis of stable aminoacyl-tRNA analogs containing 1,4-substituted 1,2,3-triazole rings. The procedure involves (i) copper-catalyzed cycloadditions of 3'-or 2'-azido-adenosine and alkynes, (ii) coupling between the resulting triazole-deoxyadenosine derivatives and a deoxycytidine phosphoramidite, and (iii) the enzymatic ligation of the 2'- or 3'-triazole-dinucleotides with a 22-nt RNA microhelix that mimics the acceptor arm of tRNA. Each nucleoside and nucleotide intermediate was characterized by MS spectrometry and (1)H, (31)P, and (13)C NMR spectroscopy, and the tRNA-analogs were assayed for inhibition of FemXWv, an alanyl-transferase essential for the formation of the peptidoglycan network of Gram-positive bacterial pathogens. The low IC(50) values obtained (2 to 4 µM) indicate that the five-membered triazole rings acted as an isosteres of esters and can be used for the design of stable aminoacyl-tRNA analogs.

  7. Improved Incorporation of Noncanonical Amino Acids by an Engineered tRNA(Tyr) Suppressor.

    PubMed

    Rauch, Benjamin J; Porter, Joseph J; Mehl, Ryan A; Perona, John J

    2016-01-26

    The Methanocaldcoccus jannaschii tyrosyl-tRNA synthetase (TyrRS):tRNA(Tyr) cognate pair has been used to incorporate a large number of noncanonical amino acids (ncAAs) into recombinant proteins in Escherichia coli. However, the structural elements of the suppressor tRNA(Tyr) used in these experiments have not been examined for optimal performance. Here, we evaluate the steady-state kinetic parameters of wild-type M. jannaschii TyrRS and an evolved 3-nitrotyrosyl-tRNA synthetase (nitroTyrRS) toward several engineered tRNA(Tyr) suppressors, and we correlate aminoacylation properties with the efficiency and fidelity of superfolder green fluorescent protein (sfGFP) synthesis in vivo. Optimal ncAA-sfGFP synthesis correlates with improved aminoacylation kinetics for a tRNA(Tyr) amber suppressor with two substitutions in the anticodon loop (G34C/G37A), while four additional mutations in the D and variable loops, present in the tRNA(Tyr) used in all directed evolution experiments to date, are deleterious to function both in vivo and in vitro. These findings extend to three of four other evolved TyrRS enzymes that incorporate distinct ncAAs. Suppressor tRNAs elicit decreases in amino acid Km values for both TyrRS and nitroTyrRS, suggesting that direct anticodon recognition by TyrRS need not be an impediment to superior performance of this orthogonal system and offering insight into novel approaches for directed evolution. The G34C/G37A tRNA(Tyr) may enhance future incorporation of many ncAAs by engineered TyrRS enzymes. PMID:26694948

  8. Synthesis of alpha-amino acids

    DOEpatents

    Davis, J.W. Jr.

    1983-01-25

    A method is described for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R[sub 1]R[sub 2]C(OSOCl)CN, R[sub 1]R[sub 2]C(Cl)CN and [R[sub 1]R[sub 2]C(CN)O][sub 2]SO wherein R[sub 1] and R[sub 2] are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art. No Drawings

  9. Fate of mRNA following disaggregation of brain polysomes after administration of (+)-lysergic acid diethylamide in vivo.

    PubMed

    Mahony, J B; Brown, I R

    1979-11-22

    Intravenous injection of (+)-lysergic acid diethylamide into young rabbits induced a transient brain-specific disaggregation of polysomes to monosomes. Investigation of the fate of mRNA revealed that brain poly(A+)mRNA was conserved. In particular, mRNA coding for brain-specific S100 protein was not degraded, nor was it released into free ribonucleoprotein particles. Following the (+)-lysergic acid diethylamide-induced disaggregation of polysomes, mRNA shifted from polysomes and accumulated on monosomes. Formation of a blocked monosome complex, which contained intact mRNA and 40-S plus 60-S ribosomal subunits but lacked nascent peptide chains, suggested that (+)-lysergic acid diethylamide inhibited brain protein synthesis at a specific stage of late initiation or early elongation.

  10. Regulation of protein synthesis by amino acids in muscle of neonates.

    PubMed

    Suryawan, Agus; Davis, Teresa A

    2011-01-01

    The marked increase in skeletal muscle mass during the neonatal period is largely due to a high rate of postprandial protein synthesis that is modulated by an enhanced sensitivity to insulin and amino acids. The amino acid signaling pathway leading to the stimulation of protein synthesis has not been fully elucidated. Among the amino acids, leucine is considered to be a principal anabolic agent that regulates protein synthesis. mTORC1, which controls protein synthesis, has been implicated as a target for leucine. Until recently, there have been few studies exploring the role of amino acids in enhancing muscle protein synthesis in vivo. In this review, we discuss amino acid-induced protein synthesis in muscle in the neonate, focusing on current knowledge of the role of amino acids in the activation of mTORC1 leading to mRNA translation. The role of the amino acid transporters, SNAT2, LAT1, and PAT, in the modulation of mTORC1 activation and the role of amino acids in the activation of putative regulators of mTORC1, i.e., raptor, Rheb, MAP4K3, Vps34, and Rag GTPases, are discussed.

  11. Fatty acid synthesis: from CO2 to functional genomics.

    PubMed

    Ohlrogge, J; Pollard, M; Bao, X; Focke, M; Girke, T; Ruuska, S; Mekhedov, S; Benning, C

    2000-12-01

    For over 25 years there has been uncertainty over the pathway from CO(2) to acetyl-CoA in chloroplasts. On the one hand, free acetate is the most effective substrate for fatty acid synthesis by isolated chloroplasts, and free acetate concentrations reported in leaf tissue (0.1-1 mM) appear adequate to saturate fatty acid synthase. On the other hand, a clear mechanism to generate sufficient free acetate for fatty acid synthesis is not established and direct production of acetyl-CoA from pyruvate by a plastid pyruvate dehydrogenase seems a more simple and direct path. We have re-examined this question and attempted to distinguish between the alternatives. The kinetics of (13)CO(2) and (14)CO(2) movement into fatty acids and the absolute rate of fatty acid synthesis in leaves was determined in light and dark. Because administered (14)C appears in fatty acids within < 2-3 min our results are inconsistent with a large pool of free acetate as an intermediate in leaf fatty acid synthesis. In addition, these studies provide an estimate of the turnover rate of fatty acid in leaves. Studies similar to the above are more complex in seeds, and some questions about the regulation of plant lipid metabolism seem difficult to solve using conventional biochemical or molecular approaches. For example, we have little understanding of why or how some seeds produce >50% oil whereas other seeds store largely carbohydrate or protein. Major control over complex plant biochemical pathways may only become possible by understanding regulatory networks which provide 'global' control over these pathways. To begin to discover such networks and provide a broad analysis of gene expression in developing oilseeds, we have produced microarrays that display approx. 5000 seed-expressed Arabidopsis genes. Sensitivity of the arrays was 1-2 copies of mRNA/cell. The arrays have been hybridized with probes derived from seeds, leaves and roots, and analysis of expression ratios between the different tissues

  12. Inhibition of RNA synthesis in vitro by 9-aminoacridine carboxamide antitumor agents. Effects on overall RNA synthesis and synthesis of the initiating dinucleotide.

    PubMed

    Piestrzeniewicz, M K; Czyz, M; Denny, W A; Gniazdowski, M

    1990-01-01

    A series of 9-aminoacridine carboxamide derivatives of systematically varied structure was assayed in an RNA synthesis in vitro system. Escherichia coli DNA-dependent RNA polymerase and DNA derived from phage T7 or calf thymus were used to measure the effect of the drugs on overall RNA and the initiating dinucleotide (pppApU) syntheses. By means of multiple linear regression analysis it was shown that the inhibition of these reactions depends both on the drug equilibrium binding constant and kinetic parameters of dissociation of drug-DNA complexes. PMID:1705740

  13. Lanthanide cofactors accelerate DNA-catalyzed synthesis of branched RNA.

    PubMed

    Javadi-Zarnaghi, Fatemeh; Höbartner, Claudia

    2013-08-28

    Most deoxyribozymes (DNA catalysts) require metal ions as cofactors for catalytic activity, with Mg(2+), Mn(2+), and Zn(2+) being the most represented activators. Trivalent transition-metal ions have been less frequently considered. Rare earth ions offer attractive properties for studying metal ion binding by biochemical and spectroscopic methods. Here we report the effect of lanthanide cofactors, in particular terbium (Tb(3+)), for DNA-catalyzed synthesis of 2',5'-branched RNA. We found up to 10(4)-fold increased ligation rates for the 9F7 deoxribozyme using 100 μM Tb(3+) and 7 mM Mg(2+), compared to performing the reaction with 7 mM Mg(2+) alone. Combinatorial mutation interference analysis (CoMA) was used to identify nucleotides in the catalytic region of 9F7 that are essential for ligation activity with different metal ion combinations. A minimized version of the DNA enzyme sustained high levels of Tb(3+)-assisted activity. Sensitized luminescence of Tb(3+) bound to DNA in combination with DMS probing and DNase I footprinting results supported the CoMA data. The accelerating effect of Tb(3+) was confirmed for related RNA-ligating deoxyribozymes, pointing toward favorable activation of internal 2'-OH nucleophiles. The results of this study offer fundamental insights into nucleotide requirements for DNA-catalyzed RNA ligation and will be beneficial for practical applications that utilize 2',5'-branched RNA.

  14. An intrinsically disordered peptide from Ebola virus VP35 controls viral RNA synthesis by modulating nucleoprotein-RNA interactions

    SciTech Connect

    Leung, Daisy  W.; Borek, Dominika; Luthra, Priya; Binning, Jennifer  M.; Anantpadma, Manu; Liu, Gai; Harvey, Ian B.; Su, Zhaoming; Endlich-Frazier, Ariel; Pan, Juanli; Shabman, Reed  S.; Chiu, Wah; Davey, Robert  A.; Otwinowski, Zbyszek; Basler, Christopher  F.; Amarasinghe, Gaya  K.

    2015-04-01

    During viral RNA synthesis, Ebola virus (EBOV) nucleoprotein (NP) alternates between an RNA-template-bound form and a template-free form to provide the viral polymerase access to the RNA template. In addition, newly synthesized NP must be prevented from indiscriminately binding to noncognate RNAs. Here, we investigate the molecular bases for these critical processes. We identify an intrinsically disordered peptide derived from EBOV VP35 (NPBP, residues 20–48) that binds NP with high affinity and specificity, inhibits NP oligomerization, and releases RNA from NP-RNA complexes in vitro. The structure of the NPBP/ΔNPNTD complex, solved to 3.7 Å resolution, reveals how NPBP peptide occludes a large surface area that is important for NP-NP and NP-RNA interactions and for viral RNA synthesis. Together, our results identify a highly conserved viral interface that is important for EBOV replication and can be targeted for therapeutic development.

  15. Internal initiation is responsible for synthesis of Wuhan nodavirus subgenomic RNA.

    PubMed

    Qiu, Yang; Cai, Dawei; Qi, Nan; Wang, Zhaowei; Zhou, Xi; Zhang, Jiamin; Hu, Yuanyang

    2011-05-01

    Nodaviruses are small nonenveloped spherical viruses with a bipartite genome of RNAs. In nodaviruses, subgenomic RNA3 (sgRNA3) plays a critical role in viral replication and survival, as it coordinates the replication of two viral genomic RNAs (RNA1 and RNA2) and encodes protein B2, which is a potent RNA-silencing inhibitor. Despite its importance, the molecular mechanism of nodaviral sgRNA3 synthesis is still poorly understood. Here, we propose that sgRNA3 of Wuhan nodavirus (WhNV) is internally initiated from a promoter on the negative template of genomic RNA1. Serial deletion and mutation analyses further revealed that the core promoter of WhNV sgRNA3 is between nucleotide positions -22 and +6 of its transcription start site. Besides, a stem-loop structure of WhNV sgRNA3 was computationally predicted upstream of sgRNA3's transcription start site. Both the secondary structure and the primary sequence were determined to be required for promoter activity. Furthermore, our results show that the synthesis of WhNV sgRNA3 is counterregulated by the replication of WhNV genomic RNA2, which encodes a viral capsid precursor protein. And this sgRNA3 synthesis is also able to trans-activate the replication of RNA2. Altogether, findings in this study indicate that there is a newly discovered internal initiation model for the synthesis of nodaviral sgRNA. PMID:21325414

  16. Peptide nucleic acids rather than RNA may have been the first genetic molecule

    NASA Technical Reports Server (NTRS)

    Nelson, K. E.; Levy, M.; Miller, S. L.

    2000-01-01

    Numerous problems exist with the current thinking of RNA as the first genetic material. No plausible prebiotic processes have yet been demonstrated to produce the nucleosides or nucleotides or for efficient two-way nonenzymatic replication. Peptide nucleic acid (PNA) is a promising precursor to RNA, consisting of N-(2-aminoethyl)glycine (AEG) and the adenine, uracil, guanine, and cytosine-N-acetic acids. However, PNA has not yet been demonstrated to be prebiotic. We show here that AEG is produced directly in electric discharge reactions from CH(4), N(2), NH(3), and H(2)O. Electric discharges also produce ethylenediamine, as do NH(4)CN polymerizations. AEG is produced from the robust Strecker synthesis with ethylenediamine. The NH(4)CN polymerization in the presence of glycine leads to the adenine and guanine-N(9)-acetic acids, and the cytosine and uracil-N(1)-acetic acids are produced in high yield from the reaction of cyanoacetaldehyde with hydantoic acid, rather than urea. Preliminary experiments suggest that AEG may polymerize rapidly at 100 degrees C to give the polypeptide backbone of PNA. The ease of synthesis of the components of PNA and possibility of polymerization of AEG reinforce the possibility that PNA may have been the first genetic material.

  17. Ribonucleic acid synthesis by Escherichia coli C3000/L after infection by the ribonucleic acid coliphage ZIK/1, and properties of the coliphage-induced double-stranded ribonucleic acid

    PubMed Central

    Bishop, D. H. L.

    1966-01-01

    1. The efficiency of extracting nucleic acids from Escherichia coli after five methods of obtaining cell lysis was determined. 2. The recovery of various nucleic acid species isolated after chromatography on methylated albumin-coated kieselguhr was also examined. 3. Double-stranded coliphage-induced RNA was isolated from infected bacteria and its resistance to ribonuclease digestion under various conditions determined. 4. The involvement of double-stranded RNA during the infection process was demonstrated. 5. The time-course of the syntheses in infected cells of double-stranded RNA, DNA, single-stranded coliphage and 16s ribosomal RNA, transfer RNA and ribosomal 23s RNA was examined. 6. It was demonstrated that the syntheses of DNA, transfer RNA and ribosomal RNA decreased 10–15min. after infection. 7. Synthesis of coliphage RNA commenced 10–15min. after infection and double-stranded RNA was also synthesized from about 10min. after coliphage adsorption. PMID:5338876

  18. Ribonucleic acid synthesis by Escherichia coli C 3000/L after infection by the ribonucleic acid coliphage ZIK/1, and properties of the coliphage-induced double-stranged ribonucleic acid.

    PubMed

    Bishop, D H

    1966-09-01

    1. The efficiency of extracting nucleic acids from Escherichia coli after five methods of obtaining cell lysis was determined. 2. The recovery of various nucleic acid species isolated after chromatography on methylated albumin-coated kieselguhr was also examined. 3. Double-stranded coliphage-induced RNA was isolated from infected bacteria and its resistance to ribonuclease digestion under various conditions determined. 4. The involvement of double-stranded RNA during the infection process was demonstrated. 5. The time-course of the syntheses in infected cells of double-stranded RNA, DNA, single-stranded coliphage and 16s ribosomal RNA, transfer RNA and ribosomal 23s RNA was examined. 6. It was demonstrated that the syntheses of DNA, transfer RNA and ribosomal RNA decreased 10-15min. after infection. 7. Synthesis of coliphage RNA commenced 10-15min. after infection and double-stranded RNA was also synthesized from about 10min. after coliphage adsorption.

  19. Design Considerations for RNA Spherical Nucleic Acids (SNAs).

    PubMed

    Barnaby, Stacey N; Perelman, Grant A; Kohlstedt, Kevin L; Chinen, Alyssa B; Schatz, George C; Mirkin, Chad A

    2016-09-21

    Ribonucleic acids (RNAs) are key components in many cellular processes such as cell division, differentiation, growth, aging, and death. RNA spherical nucleic acids (RNA-SNAs), which consist of dense shells of double-stranded RNA on nanoparticle surfaces, are powerful and promising therapeutic modalities because they confer advantages over linear RNA such as high cellular uptake and enhanced stability. Due to their three-dimensional shell of oligonucleotides, SNAs, in comparison to linear nucleic acids, interact with the biological environment in unique ways. Herein, the modularity of the RNA-SNA is used to systematically study structure-function relationships in order to understand how the oligonucleotide shell affects interactions with a specific type of biological environment, namely, one that contains serum nucleases. We use a combination of experiment and theory to determine the key architectural properties (i.e., sequence, density, spacer moiety, and backfill molecule) that affect how RNA-SNAs interact with serum nucleases. These data establish a set of design parameters for SNA architectures that are optimized in terms of stability. PMID:27523252

  20. Design Considerations for RNA Spherical Nucleic Acids (SNAs)

    PubMed Central

    2016-01-01

    Ribonucleic acids (RNAs) are key components in many cellular processes such as cell division, differentiation, growth, aging, and death. RNA spherical nucleic acids (RNA-SNAs), which consist of dense shells of double-stranded RNA on nanoparticle surfaces, are powerful and promising therapeutic modalities because they confer advantages over linear RNA such as high cellular uptake and enhanced stability. Due to their three-dimensional shell of oligonucleotides, SNAs, in comparison to linear nucleic acids, interact with the biological environment in unique ways. Herein, the modularity of the RNA-SNA is used to systematically study structure–function relationships in order to understand how the oligonucleotide shell affects interactions with a specific type of biological environment, namely, one that contains serum nucleases. We use a combination of experiment and theory to determine the key architectural properties (i.e., sequence, density, spacer moiety, and backfill molecule) that affect how RNA-SNAs interact with serum nucleases. These data establish a set of design parameters for SNA architectures that are optimized in terms of stability. PMID:27523252

  1. Design Considerations for RNA Spherical Nucleic Acids (SNAs).

    PubMed

    Barnaby, Stacey N; Perelman, Grant A; Kohlstedt, Kevin L; Chinen, Alyssa B; Schatz, George C; Mirkin, Chad A

    2016-09-21

    Ribonucleic acids (RNAs) are key components in many cellular processes such as cell division, differentiation, growth, aging, and death. RNA spherical nucleic acids (RNA-SNAs), which consist of dense shells of double-stranded RNA on nanoparticle surfaces, are powerful and promising therapeutic modalities because they confer advantages over linear RNA such as high cellular uptake and enhanced stability. Due to their three-dimensional shell of oligonucleotides, SNAs, in comparison to linear nucleic acids, interact with the biological environment in unique ways. Herein, the modularity of the RNA-SNA is used to systematically study structure-function relationships in order to understand how the oligonucleotide shell affects interactions with a specific type of biological environment, namely, one that contains serum nucleases. We use a combination of experiment and theory to determine the key architectural properties (i.e., sequence, density, spacer moiety, and backfill molecule) that affect how RNA-SNAs interact with serum nucleases. These data establish a set of design parameters for SNA architectures that are optimized in terms of stability.

  2. Translational pauses during the synthesis of proteins and mRNA structure.

    PubMed

    Zama, M

    1997-01-01

    Translational pauses are observed during a spider fibroin synthesis (1,2). The spider major ampullate (dragline) silk of the spider Nephila clavipes is composed of multiple proteins. The amino acid sequences of the partial cDNA clones for the two major dragline silk fibroin components (Spidroin 1 and 2) exhibit repetitive motifs (3,4). Our detailed inspection of the nucleotide sequences of the repetitive motifs revealed highly selective site-specific codon usage patterns within a motif, suggesting that the secondary structure of the spider fibroin mRNA is optimized by the nucleotide sequence of the fibroin gene. The results, combined with our preceding results on silk fibroin from Bombyx mori (5) suggest that translational pauses of spider silk are interpreted in terms of the mRNA secondary structure.

  3. Stochastic mRNA synthesis in mammalian cells.

    PubMed

    Raj, Arjun; Peskin, Charles S; Tranchina, Daniel; Vargas, Diana Y; Tyagi, Sanjay

    2006-10-01

    Individual cells in genetically homogeneous populations have been found to express different numbers of molecules of specific proteins. We investigated the origins of these variations in mammalian cells by counting individual molecules of mRNA produced from a reporter gene that was stably integrated into the cell's genome. We found that there are massive variations in the number of mRNA molecules present in each cell. These variations occur because mRNAs are synthesized in short but intense bursts of transcription beginning when the gene transitions from an inactive to an active state and ending when they transition back to the inactive state. We show that these transitions are intrinsically random and not due to global, extrinsic factors such as the levels of transcriptional activators. Moreover, the gene activation causes burst-like expression of all genes within a wider genomic locus. We further found that bursts are also exhibited in the synthesis of natural genes. The bursts of mRNA expression can be buffered at the protein level by slow protein degradation rates. A stochastic model of gene activation and inactivation was developed to explain the statistical properties of the bursts. The model showed that increasing the level of transcription factors increases the average size of the bursts rather than their frequency. These results demonstrate that gene expression in mammalian cells is subject to large, intrinsically random fluctuations and raise questions about how cells are able to function in the face of such noise. PMID:17048983

  4. Codon usage, amino acid usage, transfer RNA and amino-acyl-tRNA synthetases in Mimiviruses.

    PubMed

    Colson, Philippe; Fournous, Ghislain; Diene, Seydina M; Raoult, Didier

    2013-01-01

    Mimiviruses are giant viruses that infect phagocytic protists, including Acanthamoebae spp., which were discovered during the past decade. They are the current record holder among viruses for their large particle and genome sizes. One group is composed of three lineages, referred to as A, B and C, which include the vast majority of the Mimiviridae members. Cafeteria roenbergensis virus represents a second group, though the Mimiviridae family is still expanding. We analyzed the codon and amino acid usages in mimiviruses, as well as both the transfer RNA (tRNA) and amino acyl-tRNA synthetases. We confirmed that the codon and amino acid usages of these giant viruses are highly dissimilar to those in their amoebal host Acanthamoeba castellanii and are instead correlated with the high adenine and thymine (AT) content of Mimivirus genomes. We further describe that the set of tRNAs and amino acyl-tRNA synthetases in mimiviruses is globally not adapted to the codon and amino acid usages of these viruses. Notwithstanding, Leu(TAA)tRNA, present in several Mimivirus genomes and in multiple copies in some viral genomes, may complement the amoebal tRNA pool and may contribute to accommodate the viral AT-rich codons. In addition, we found that the genes most highly expressed at the beginning of the Mimivirus replicative cycle have a nucleotide content more adapted to the codon usage in A.castellanii.

  5. Origins of tmRNA: the missing link in the birth of protein synthesis?

    PubMed Central

    Macé, Kevin; Gillet, Reynald

    2016-01-01

    The RNA world hypothesis refers to the early period on earth in which RNA was central in assuring both genetic continuity and catalysis. The end of this era coincided with the development of the genetic code and protein synthesis, symbolized by the apparition of the first non-random messenger RNA (mRNA). Modern transfer-messenger RNA (tmRNA) is a unique hybrid molecule which has the properties of both mRNA and transfer RNA (tRNA). It acts as a key molecule during trans-translation, a major quality control pathway of modern bacterial protein synthesis. tmRNA shares many common characteristics with ancestral RNA. Here, we present a model in which proto-tmRNAs were the first molecules on earth to support non-random protein synthesis, explaining the emergence of early genetic code. In this way, proto-tmRNA could be the missing link between the first mRNA and tRNA molecules and modern ribosome-mediated protein synthesis. PMID:27484476

  6. Origins of tmRNA: the missing link in the birth of protein synthesis?

    PubMed

    Macé, Kevin; Gillet, Reynald

    2016-09-30

    The RNA world hypothesis refers to the early period on earth in which RNA was central in assuring both genetic continuity and catalysis. The end of this era coincided with the development of the genetic code and protein synthesis, symbolized by the apparition of the first non-random messenger RNA (mRNA). Modern transfer-messenger RNA (tmRNA) is a unique hybrid molecule which has the properties of both mRNA and transfer RNA (tRNA). It acts as a key molecule during trans-translation, a major quality control pathway of modern bacterial protein synthesis. tmRNA shares many common characteristics with ancestral RNA. Here, we present a model in which proto-tmRNAs were the first molecules on earth to support non-random protein synthesis, explaining the emergence of early genetic code. In this way, proto-tmRNA could be the missing link between the first mRNA and tRNA molecules and modern ribosome-mediated protein synthesis.

  7. Relationship between RNA synthesis and the Ca2+-filled state of the nuclear envelope store.

    PubMed

    Benech, Juan Claudio; Escande, Carlos; Sotelo, José Roberto

    2005-08-01

    RNA synthesis and ATP-dependent (45)Ca(2+) uptake were measured simultaneously in isolated nuclear fraction of rat liver nuclei. Maximal level of RNA synthesis was obtained under ATP-dependent (45)Ca(2+)-uptake conditions (1 microM free [Ca(2+)] and 1 mM ATP in the bathing solution). This experimental condition was defined as "stimulated nuclei" condition. ATP-dependent (45)Ca(2+) uptake was inhibited using different strategies including: (a) eliminating Ca(2+) (1 mM EGTA); (b) lowering the ATP concentration; (c) modifying nuclear envelope membranes Ca(2+) permeability (Ca(2+) ionophores); or (d) inhibiting the nuclear Ca(2+) pump (thapsigargin and 3',3'',5',5''-tetraiodophenolsulfonephthalein). Under all the above conditions, RNA synthesis was lower than in "stimulated nuclei" condition. In the presence of ionomycin, RNA synthesis was significantly higher at 500 nM free [Ca(2+)], as compared with RNA synthesis in a Ca(2+)-free medium or at 1muM free [Ca(2+)]. However, even in such condition (500 nM free [Ca(2+)]), RNA synthesis was lower than RNA synthesis obtained in "stimulated nuclei" condition. We suggest two components for the effect of Ca(2+) on RNA synthesis: (A) a direct effect of nucleoplasmic [Ca(2+)]; and (B) an effect dependent on the accumulation of Ca(2+) in the nuclear envelope store mediated by the SERCA nuclear Ca(2+) pump.

  8. Serine Metabolism Supports the Methionine Cycle and DNA/RNA Methylation through De Novo ATP Synthesis in Cancer Cells

    PubMed Central

    Maddocks, Oliver D.K.; Labuschagne, Christiaan F.; Adams, Peter D.; Vousden, Karen H.

    2016-01-01

    Summary Crosstalk between cellular metabolism and the epigenome regulates epigenetic and metabolic homeostasis and normal cell behavior. Changes in cancer cell metabolism can directly impact epigenetic regulation and promote transformation. Here we analyzed the contribution of methionine and serine metabolism to methylation of DNA and RNA. Serine can contribute to this pathway by providing one-carbon units to regenerate methionine from homocysteine. While we observed this contribution under methionine-depleted conditions, unexpectedly, we found that serine supported the methionine cycle in the presence and absence of methionine through de novo ATP synthesis. Serine starvation increased the methionine/S-adenosyl methionine ratio, decreasing the transfer of methyl groups to DNA and RNA. While serine starvation dramatically decreased ATP levels, this was accompanied by lower AMP and did not activate AMPK. This work highlights the difference between ATP turnover and new ATP synthesis and defines a vital function of nucleotide synthesis beyond making nucleic acids. PMID:26774282

  9. Serine Metabolism Supports the Methionine Cycle and DNA/RNA Methylation through De Novo ATP Synthesis in Cancer Cells.

    PubMed

    Maddocks, Oliver D K; Labuschagne, Christiaan F; Adams, Peter D; Vousden, Karen H

    2016-01-21

    Crosstalk between cellular metabolism and the epigenome regulates epigenetic and metabolic homeostasis and normal cell behavior. Changes in cancer cell metabolism can directly impact epigenetic regulation and promote transformation. Here we analyzed the contribution of methionine and serine metabolism to methylation of DNA and RNA. Serine can contribute to this pathway by providing one-carbon units to regenerate methionine from homocysteine. While we observed this contribution under methionine-depleted conditions, unexpectedly, we found that serine supported the methionine cycle in the presence and absence of methionine through de novo ATP synthesis. Serine starvation increased the methionine/S-adenosyl methionine ratio, decreasing the transfer of methyl groups to DNA and RNA. While serine starvation dramatically decreased ATP levels, this was accompanied by lower AMP and did not activate AMPK. This work highlights the difference between ATP turnover and new ATP synthesis and defines a vital function of nucleotide synthesis beyond making nucleic acids.

  10. Procollagen mRNA metabolism during the fibroblast cell cycle and its synthesis in transformed cells.

    PubMed

    Parker, I; Fitschen, W

    1980-06-25

    Procollagen mRNA was isolated from mouse embryos and used for the synthesis of a highly labelled cDNA probe complementary to collagen mRNA. This probe was used for the investigation of procollagen mRNA metabolism during the cell cycle of 3T6 mouse embryo fibroblasts in culture. Titration hybridization experiments revealed that procollagen mRNA was present throughout the cell cycle following stumulation of confluent monolayers. Procollagen mRNA levels of sparse cultures appeared similar to those of unstimulated monolayers. The fluctuating levels of collagen synthesis during the cell cycle can be ascribed to changes in the amount of collagen mRNA present. In mouse sarcoma virus transformed 3T3 cells only 20--30% of the amount of procollagen mRNA in 3T3 cells is present indicating that the decline in collagen synthesis is due to mRNA availability.

  11. Decreased hepatotoxic bile acid composition and altered synthesis in progressive human nonalcoholic fatty liver disease

    SciTech Connect

    Lake, April D.; Novak, Petr; Shipkova, Petia; Aranibar, Nelly; Robertson, Donald; Reily, Michael D.; Lu, Zhenqiang; Lehman-McKeeman, Lois D.; Cherrington, Nathan J.

    2013-04-15

    Bile acids (BAs) have many physiological roles and exhibit both toxic and protective influences within the liver. Alterations in the BA profile may be the result of disease induced liver injury. Nonalcoholic fatty liver disease (NAFLD) is a prevalent form of chronic liver disease characterized by the pathophysiological progression from simple steatosis to nonalcoholic steatohepatitis (NASH). The hypothesis of this study is that the ‘classical’ (neutral) and ‘alternative’ (acidic) BA synthesis pathways are altered together with hepatic BA composition during progression of human NAFLD. This study employed the use of transcriptomic and metabolomic assays to study the hepatic toxicologic BA profile in progressive human NAFLD. Individual human liver samples diagnosed as normal, steatosis, and NASH were utilized in the assays. The transcriptomic analysis of 70 BA genes revealed an enrichment of downregulated BA metabolism and transcription factor/receptor genes in livers diagnosed as NASH. Increased mRNA expression of BAAT and CYP7B1 was observed in contrast to decreased CYP8B1 expression in NASH samples. The BA metabolomic profile of NASH livers exhibited an increase in taurine together with elevated levels of conjugated BA species, taurocholic acid (TCA) and taurodeoxycholic acid (TDCA). Conversely, cholic acid (CA) and glycodeoxycholic acid (GDCA) were decreased in NASH liver. These findings reveal a potential shift toward the alternative pathway of BA synthesis during NASH, mediated by increased mRNA and protein expression of CYP7B1. Overall, the transcriptomic changes of BA synthesis pathway enzymes together with altered hepatic BA composition signify an attempt by the liver to reduce hepatotoxicity during disease progression to NASH. - Highlights: ► Altered hepatic bile acid composition is observed in progressive NAFLD. ► Bile acid synthesis enzymes are transcriptionally altered in NASH livers. ► Increased levels of taurine and conjugated bile acids

  12. Phosphatidic Acid Produced by Phospholipase D Promotes RNA Replication of a Plant RNA Virus

    PubMed Central

    Hyodo, Kiwamu; Taniguchi, Takako; Manabe, Yuki; Kaido, Masanori; Mise, Kazuyuki; Sugawara, Tatsuya; Taniguchi, Hisaaki; Okuno, Tetsuro

    2015-01-01

    Eukaryotic positive-strand RNA [(+)RNA] viruses are intracellular obligate parasites replicate using the membrane-bound replicase complexes that contain multiple viral and host components. To replicate, (+)RNA viruses exploit host resources and modify host metabolism and membrane organization. Phospholipase D (PLD) is a phosphatidylcholine- and phosphatidylethanolamine-hydrolyzing enzyme that catalyzes the production of phosphatidic acid (PA), a lipid second messenger that modulates diverse intracellular signaling in various organisms. PA is normally present in small amounts (less than 1% of total phospholipids), but rapidly and transiently accumulates in lipid bilayers in response to different environmental cues such as biotic and abiotic stresses in plants. However, the precise functions of PLD and PA remain unknown. Here, we report the roles of PLD and PA in genomic RNA replication of a plant (+)RNA virus, Red clover necrotic mosaic virus (RCNMV). We found that RCNMV RNA replication complexes formed in Nicotiana benthamiana contained PLDα and PLDβ. Gene-silencing and pharmacological inhibition approaches showed that PLDs and PLDs-derived PA are required for viral RNA replication. Consistent with this, exogenous application of PA enhanced viral RNA replication in plant cells and plant-derived cell-free extracts. We also found that a viral auxiliary replication protein bound to PA in vitro, and that the amount of PA increased in RCNMV-infected plant leaves. Together, our findings suggest that RCNMV hijacks host PA-producing enzymes to replicate. PMID:26020241

  13. [Interrelationships in experiments in vitro between the migration activity of leukocytes and RNA and DNA synthesis].

    PubMed

    Nazarov, P G; Volgarev, A P; Ermakov, S A

    1978-06-01

    The following correlations were revealed in the parallel study of leukocyte migration in vitro in the presence of a specific antigen and of spontaneous RNA and DNA synthesis in the cultured lymphocytes: 1) a direct correlation between the RNA and DNA synthesis in lymphocytes; 2) a close correlation between the antigen-induced migration and the levels of RNA and DNA synthesis. The effect of the antigen was evidenced by the inhibition or stimulation of leukocyte migration. A high ratio of RNA synthesis to DNA synthesis corresponded to the migration inhibition and a low one--to the migration stimulation. The ratio value varied mainly on account of the changes in the level of DNA synthesis. Participation of T and B cells in the regulation of the antigen-induced leukocyte mobility is discussed. PMID:352440

  14. DNA polymerase-α regulates the activation of type I interferons through cytosolic RNA:DNA synthesis.

    PubMed

    Starokadomskyy, Petro; Gemelli, Terry; Rios, Jonathan J; Xing, Chao; Wang, Richard C; Li, Haiying; Pokatayev, Vladislav; Dozmorov, Igor; Khan, Shaheen; Miyata, Naoteru; Fraile, Guadalupe; Raj, Prithvi; Xu, Zhe; Xu, Zigang; Ma, Lin; Lin, Zhimiao; Wang, Huijun; Yang, Yong; Ben-Amitai, Dan; Orenstein, Naama; Mussaffi, Huda; Baselga, Eulalia; Tadini, Gianluca; Grunebaum, Eyal; Sarajlija, Adrijan; Krzewski, Konrad; Wakeland, Edward K; Yan, Nan; de la Morena, Maria Teresa; Zinn, Andrew R; Burstein, Ezra

    2016-05-01

    Aberrant nucleic acids generated during viral replication are the main trigger for antiviral immunity, and mutations that disrupt nucleic acid metabolism can lead to autoinflammatory disorders. Here we investigated the etiology of X-linked reticulate pigmentary disorder (XLPDR), a primary immunodeficiency with autoinflammatory features. We discovered that XLPDR is caused by an intronic mutation that disrupts the expression of POLA1, which encodes the catalytic subunit of DNA polymerase-α. Unexpectedly, POLA1 deficiency resulted in increased production of type I interferons. This enzyme is necessary for the synthesis of RNA:DNA primers during DNA replication and, strikingly, we found that POLA1 is also required for the synthesis of cytosolic RNA:DNA, which directly modulates interferon activation. Together this work identifies POLA1 as a critical regulator of the type I interferon response. PMID:27019227

  15. DNA polymerase-α regulates the activation of type I interferons through cytosolic RNA:DNA synthesis.

    PubMed

    Starokadomskyy, Petro; Gemelli, Terry; Rios, Jonathan J; Xing, Chao; Wang, Richard C; Li, Haiying; Pokatayev, Vladislav; Dozmorov, Igor; Khan, Shaheen; Miyata, Naoteru; Fraile, Guadalupe; Raj, Prithvi; Xu, Zhe; Xu, Zigang; Ma, Lin; Lin, Zhimiao; Wang, Huijun; Yang, Yong; Ben-Amitai, Dan; Orenstein, Naama; Mussaffi, Huda; Baselga, Eulalia; Tadini, Gianluca; Grunebaum, Eyal; Sarajlija, Adrijan; Krzewski, Konrad; Wakeland, Edward K; Yan, Nan; de la Morena, Maria Teresa; Zinn, Andrew R; Burstein, Ezra

    2016-05-01

    Aberrant nucleic acids generated during viral replication are the main trigger for antiviral immunity, and mutations that disrupt nucleic acid metabolism can lead to autoinflammatory disorders. Here we investigated the etiology of X-linked reticulate pigmentary disorder (XLPDR), a primary immunodeficiency with autoinflammatory features. We discovered that XLPDR is caused by an intronic mutation that disrupts the expression of POLA1, which encodes the catalytic subunit of DNA polymerase-α. Unexpectedly, POLA1 deficiency resulted in increased production of type I interferons. This enzyme is necessary for the synthesis of RNA:DNA primers during DNA replication and, strikingly, we found that POLA1 is also required for the synthesis of cytosolic RNA:DNA, which directly modulates interferon activation. Together this work identifies POLA1 as a critical regulator of the type I interferon response.

  16. Xylonucleic acid: synthesis, structure, and orthogonal pairing properties

    PubMed Central

    Maiti, Mohitosh; Maiti, Munmun; Knies, Christine; Dumbre, Shrinivas; Lescrinier, Eveline; Rosemeyer, Helmut; Ceulemans, Arnout; Herdewijn, Piet

    2015-01-01

    There is a common interest for studying xeno-nucleic acid systems in the fields of synthetic biology and the origin of life, in particular, those with an engineered backbone and possessing novel properties. Along this line, we have investigated xylonucleic acid (XyloNA) containing a potentially prebiotic xylose sugar (a 3′-epimer of ribose) in its backbone. Herein, we report for the first time the synthesis of four XyloNA nucleotide building blocks and the assembly of XyloNA oligonucleotides containing all the natural nucleobases. A detailed investigation of pairing and structural properties of XyloNAs in comparison to DNA/RNA has been performed by thermal UV-melting, CD, and solution state NMR spectroscopic studies. XyloNA has been shown to be an orthogonal self-pairing system which adopts a slightly right-handed extended helical geometry. Our study on one hand, provides understanding for superior structure-function (-pairing) properties of DNA/RNA over XyloNA for selection as an informational polymer in the prebiotic context, while on the other hand, finds potential of XyloNA as an orthogonal genetic system for application in synthetic biology. PMID:26175047

  17. Quantitative analysis of RNA cleavage during RNA-directed DNA synthesis by human immunodeficiency and avian myeloblastosis virus reverse transcriptases.

    PubMed Central

    DeStefano, J J; Mallaber, L M; Fay, P J; Bambara, R A

    1994-01-01

    We have determined the extent of RNA cleavage carried out during DNA synthesis by either human immunodeficiency virus (HIV) or avian myeloblastosis virus (AMV) reverse transcriptases (RTs). Conditions were chosen that allowed the analysis of the cleavage and synthesis performed by the RT during one binding event on a given template-primer. The maximum quantity of ribonuclease H (RNase H) sensitive template RNA left after synthesis by the RTs was determined by treatment with Escherichia coli RNase H. RNA cleavage products that were expected to be too short to remain hybridized, less than 13 nucleotides in length, were quantitated. Results showed that HIV- and AMV-RT degraded about 80% and less than 20%, respectively, of the potentially degradable RNA to these short products. Survival of longer, hybridized RNA was not a result of synthesis by a population of RTs that had selectively lost RNase H activity. Using an assay that evaluated the proportion of primers extended versus RNA templates cleaved during primer-extension by the RTs, we determined that essentially each molecule of HIV- and AMV-RT with polymerase also has RNase H activity. The results indicate that although both HIV- and AMV-RTs cleave the RNA template during synthesis, the number of cleavages per nucleotide addition with HIV-RT is much greater. They also suggest that some hybridized RNA segments remain right after the passage of the RT making the first DNA strand. In vivo, these segments would have to be cleaved or displaced in later reactions before second strand DNA synthesis could be completed. Images PMID:7524028

  18. Synthesis of Lipoteichoic Acids in Bacillus anthracis

    PubMed Central

    Garufi, Gabriella; Hendrickx, Antoni P.; Beeri, Karen; Kern, Justin W.; Sharma, Anshika; Richter, Stefan G.; Schneewind, Olaf

    2012-01-01

    Lipoteichoic acid (LTA), a glycerol phosphate polymer, is a component of the envelope of Gram-positive bacteria that has hitherto not been identified in Bacillus anthracis, the causative agent of anthrax. LTA synthesis in Staphylococcus aureus and other microbes is catalyzed by the product of the ltaS gene, a membrane protein that polymerizes polyglycerol phosphate from phosphatidyl glycerol. Here we identified four ltaS homologues, designated ltaS1 to -4, in the genome of Bacillus anthracis. Polyglycerol phosphate-specific monoclonal antibodies were used to detect LTA in the envelope of B. anthracis strain Sterne (pXO1+ pXO2−) vegetative forms. B. anthracis mutants lacking ltaS1, ltaS2, ltaS3, or ltaS4 did not display defects in growth or LTA synthesis. In contrast, B. anthracis strains lacking both ltaS1 and ltaS2 were unable to synthesize LTA and exhibited reduced viability, altered envelope morphology, aberrant separation of vegetative forms, and decreased sporulation efficiency. Expression of ltaS1 or ltaS2 alone in B. anthracis as well as in other microbes was sufficient for polyglycerol phosphate synthesis. Thus, similar to S. aureus, B. anthracis employs LtaS enzymes to synthesize LTA, an envelope component that promotes bacterial growth and cell division. PMID:22685279

  19. Regulation of laminin and entactin mRNA levels by retinoic acid and dibutyryl cyclic AMP

    SciTech Connect

    Durkin, M.E.; Phillips, S.L.; Carlin, B.E.; Merlie, J.P.; Chung, A.E.

    1986-05-01

    Retinoic acid and dibutyryl cAMP induced F9 embryonal carcinoma cells to differentiate to parietal endoderm; the morphological changes were accompanied by the increased synthesis of the basement membrane glycoproteins laminin and entactin. cDNA clones have been isolated for the A (400 kD), B1 (220 kD), and B2 (205 kD) chains of laminin. Northern blot analysis indicated that the A, B1, and B2 chains were encoded by RNA species of 9.8, 6.0, and 8.0 kb, respectively. The kinetics of induction of the laminin mRNAs were studied by dot-blotting dilutions of RNA extracted from F9 cells cultured in retinoic acid and dibutyryl cAMP for increasing amounts of time and hybridizing to /sup 32/P-labeled recombinant plasmids. Very low levels of the A and B chain RNAs were found in uninduced cells, and a large increase occurred between 48 and 72 hr of growth in retinoic acid and dibutyryl cAMP. A cDNA clone was also obtained for entactin, a 150 kD glycoprotein that forms a complex with laminin. Retinoic acid and dibutyryl cAMP treatment also increased the amount of entactin RNA in F9 cells. These results suggested that a common mechanism may exist for the coordinate regulation of the 4 basement membrane protein genes during differentiation.

  20. Regulation of Synthesis of the Branched-Chain Amino Acids and Cognate Aminoacyl-Transfer Ribonucleic Acid Synthetases of Escherichia coli: a Common Regulatory Element

    PubMed Central

    Jackson, Julius; Williams, L. S.; Umbarger, H. E.

    1974-01-01

    Regulation of isoleucine, valine, and leucine biosynthesis and isoleucyl-, valyl-, and leucyl-transfer ribonucleic acid (tRNA) synthetase formation was examined in two mutant strains of Escherichia coli. One mutant was selected for growth resistance to the isoleucine analogue, ketomycin, and the other was selected for growth resistance to both trifluoroleucine and valine. Control of the synthesis of the branched-chain amino acids by repression was altered in both of these mutants. They also exhibited altered control of formation of isoleucyl-tRNA synthetase (EC 6.1.15, isoleucine:sRNA ligase, AMP), valyl-tRNA synthetase (EC 6.1.1.9, valine:sRNA ligase, AMP), and leucyl-tRNA synthetase (EC 6.1.1.4, leucine:sRNA ligase, AMP). These results suggest the existence of a common element for the control of these two classes of enzymes in Escherichia coli. PMID:4612020

  1. Potency of individual bile acids to regulate bile acid synthesis and transport genes in primary human hepatocyte cultures.

    PubMed

    Liu, Jie; Lu, Hong; Lu, Yuan-Fu; Lei, Xiaohong; Cui, Julia Yue; Ellis, Ewa; Strom, Stephen C; Klaassen, Curtis D

    2014-10-01

    Bile acids (BAs) are known to regulate their own homeostasis, but the potency of individual bile acids is not known. This study examined the effects of cholic acid (CA), chenodeoxycholic acid (CDCA), deoxycholic acid (DCA), lithocholic acid (LCA) and ursodeoxycholic acid (UDCA) on expression of BA synthesis and transport genes in human primary hepatocyte cultures. Hepatocytes were treated with the individual BAs at 10, 30, and 100μM for 48 h, and RNA was extracted for real-time PCR analysis. For the classic pathway of BA synthesis, BAs except for UDCA markedly suppressed CYP7A1 (70-95%), the rate-limiting enzyme of bile acid synthesis, but only moderately (35%) down-regulated CYP8B1 at a high concentration of 100μM. BAs had minimal effects on mRNA of two enzymes of the alternative pathway of BA synthesis, namely CYP27A1 and CYP7B1. BAs increased the two major target genes of the farnesoid X receptor (FXR), namely the small heterodimer partner (SHP) by fourfold, and markedly induced fibroblast growth factor 19 (FGF19) over 100-fold. The BA uptake transporter Na(+)-taurocholate co-transporting polypeptide was unaffected, whereas the efflux transporter bile salt export pump was increased 15-fold and OSTα/β were increased 10-100-fold by BAs. The expression of the organic anion transporting polypeptide 1B3 (OATP1B3; sixfold), ATP-binding cassette (ABC) transporter G5 (ABCG5; sixfold), multidrug associated protein-2 (MRP2; twofold), and MRP3 (threefold) were also increased, albeit to lesser degrees. In general, CDCA was the most potent and effective BA in regulating these genes important for BA homeostasis, whereas DCA and CA were intermediate, LCA the least, and UDCA ineffective.

  2. Identification of a human mitochondrial RNA that promotes tropomyosin synthesis and myocardial differentiation.

    PubMed

    Moses-Arms, Ashley; Kochegarov, Andrei; Arms, Jedidiah; Burlbaw, Shane; Lian, Will; Meyer, Jessica; Lemanski, Larry F

    2015-03-01

    Heart disease is the number one killer in the USA, making cardiogenesis and its related pathways a relevant area of study for improving health and life expectancy. The Mexican salamander (axolotl), Ambystoma mexicanum, provides an excellent vertebrate animal model for studying myofibrillogenesis due to its naturally occurring cardiac nonfunction mutation. Homozygous recessive embryos do not develop normal hearts due to a lack of myofibril formation. In previous studies, myofibril-inducing ribonucleic acid (MIR) from the normal wild-type axolotl genome was found to rescue mutant nonfunctioning hearts through restoration of tropomyosin levels followed by normal myofibril formation. Our purpose in this study is to identify and characterize functional homologs for the MIR from human fetal heart ribonucleic acid (RNA). After randomized cloning of human fetal heart RNA, 396 clones were analyzed for rescuing ability by using mutant heart rescue bioassays and confocal microscopy. By these analyses, we discovered a functional homolog of MIR from human fetal heart RNA, which is associated with the mitochondrial cytochrome c oxidase subunit II gene. This RNA came from our clone #30 and induces tropomyosin synthesis and myofibrillogenesis in mutant axolotl hearts which ordinarily do not synthesize tropomyosin or form organized myofibrils. Clone #30, a mitochondrial RNA molecule associated with human cytochrome c oxidase, serves as a functional homolog of MIR, leading to tropomyosin production, organized myofibrils, and beating cardiac tissue in mutant hearts. These findings hold great potential for the treatment and repair of damaged hearts in patients who have suffered from myocardial infarctions and other heart diseases. PMID:25408381

  3. Synthesis of novel acid electrolytes for phosphoric acid fuel cells

    NASA Astrophysics Data System (ADS)

    Adcock, James L.

    1988-11-01

    A 40 millimole per hour scale aerosol direct fluorination reactor was constructed. F-Methyl F-4-methoxybutanoate and F-4-methoxybutanoyl fluoride were synthesized by aerosol direct fluorination of methyl 4-methoxybutanoate. Basic hydrolysis of the perfluorinated derivatives produce sodium F-4 methoxybutanoate which was pyrolyzed to F-3-methoxy-1-propene. Purification and shipment of 33 grams of F-3-methoxy-1-propene followed. Syntheses by analogous methods allowed production and shipment of 5 grams of F-3-ethoxy 1-propene, 18 grams of F-3-(2-methoxy.ethoxy) 1-propene, and 37 grams of F-3,3-dimethyl 1-butene. Eighteen grams of F-2,2-dimethyl 1-chloropropane was produced directly and shipped. As suggested by other contractors, 5 grams of F-3-methoxy 1-iodopropane, and 5 grams of F-3-(2-methoxy.ethoxy) 1-iodopropane were produced by converting the respective precursor acid sodium salts produced for olefin synthesis to the silver salts and pyrolyzing them with iodine. Each of these compounds was prepared for the first time by the aerosol fluorination process during the course of the contract. These samples were provided to other Gas Research Institute (GRI) contractors for synthesis of perfluorinated sulfur (VI) and phosphorous (V) acids.

  4. Evidence for defective transfer ribonucleic acid in polymyopathic hamsters and its inhibitory effect on protein synthesis

    PubMed Central

    Bester, André J.; Gevers, Wieland

    1973-01-01

    1. Different reaction steps involved in protein synthesis were studied in skeletal muscles from control and myopathic hamsters. 2. There was no difference between partially purified aminoacyl-tRNA synthetases from myopathic and control animals in yield or catalytic activity, as tested with exogenous deacylated tRNA. 3. However, isolated deacylated tRNA from myopathic muscle was aminoacylated by these synthetases to a lesser extent than that derived from control muscle. 4. Addition of deacylated tRNA isolated from control muscle improved the performance of pH5 enzymes from myopathic muscle in polypeptide synthesis on homologous polyribosomes; tRNA isolated from myopathic animals did not. 5. Preparation of extracts from both types of animals in the presence of the ribonuclease-absorbent bentonite led to an increased capacity of endogenous tRNA to accept amino acids in pH5 enzymes prepared from normal and abnormal tissue, but the difference between the two systems remained the same. 6. Total tRNA nucleotidyltransferase activity, tested with twice-pyrophosphorolysed rat liver tRNA, was identical in both extracts. 7. Added tRNA nucleotidyltransferase incorporated more AMP and CMP into endogenous tRNA with the pH5 enzyme from myopathic muscle than with that from control muscle. 8. Preincubation of deacylated tRNA from myopathic muscle with ATP, CTP and tRNA nucleotidyltransferase more than doubled its subsequent aminoacyl-acceptor activity, and halved the extent of the defect relative to aminoacylation of control tRNA similarly treated. Endogenous tRNA in pH5 enzyme preparations behaved likewise. 9. It is suggested that a 3′-exonuclease in myopathic muscles attacks tRNA molecules in such a way that some of them remain substrates for tRNA nucleotidyltransferase, which may incorporate into RNA not only AMP and CMP, but also GMP. 10. Cell-free protein synthesis in preparations from myopathic hamster muscles is limited by the supply of intact tRNA molecules. PMID:4725037

  5. Myelin basic protein synthesis is regulated by small non-coding RNA 715.

    PubMed

    Bauer, Nina M; Moos, Christina; van Horssen, Jack; Witte, Maarten; van der Valk, Paul; Altenhein, Benjamin; Luhmann, Heiko J; White, Robin

    2012-09-01

    Oligodendroglial Myelin Basic Protein (MBP) synthesis is essential for myelin formation in the central nervous system. During oligodendrocyte differentiation, MBP mRNA is kept in a translationally silenced state while intracellularly transported, until neuron-derived signals initiate localized MBP translation. Here we identify the small non-coding RNA 715 (sncRNA715) as an inhibitor of MBP translation. SncRNA715 localizes to cytoplasmic granular structures and associates with MBP mRNA transport granule components. We also detect increased levels of sncRNA715 in demyelinated chronic human multiple sclerosis lesions, which contain MBP mRNA but lack MBP protein.

  6. Interacting RNA polymerase motors on a DNA track: effects of traffic congestion and intrinsic noise on RNA synthesis.

    PubMed

    Tripathi, Tripti; Chowdhury, Debashish

    2008-01-01

    RNA polymerase (RNAP) is an enzyme that synthesizes a messenger RNA (mRNA) strand which is complementary to a single-stranded DNA template. From the perspective of physicists, an RNAP is a molecular motor that utilizes chemical energy input to move along the track formed by DNA. In many circumstances, which are described in this paper, a large number of RNAPs move simultaneously along the same track; we refer to such collective movements of the RNAPs as RNAP traffic. Here we develop a theoretical model for RNAP traffic by incorporating the steric interactions between RNAPs as well as the mechanochemical cycle of individual RNAPs during the elongation of the mRNA. By a combination of analytical and numerical techniques, we calculate the rates of mRNA synthesis and the average density profile of the RNAPs on the DNA track. We also introduce, and compute, two different measures of fluctuations in the synthesis of RNA. Analyzing these fluctuations, we show how the level of intrinsic noise in mRNA synthesis depends on the concentrations of the RNAPs as well as on those of some of the reactants and the products of the enzymatic reactions catalyzed by RNAP. We suggest appropriate experimental systems and techniques for testing our theoretical predictions. PMID:18351890

  7. Cell cycle specific distribution of killin: evidence for negative regulation of both DNA and RNA synthesis.

    PubMed

    Qiao, Man; Luo, Dan; Kuang, Yi; Feng, Haiyan; Luo, Guangping; Liang, Peng

    2015-01-01

    p53 tumor-suppressor gene is a master transcription factor which controls cell cycle progression and apoptosis. killin was discovered as one of the p53 target genes implicated in S-phase control coupled to cell death. Due to its extreme proximity to pten tumor-suppressor gene on human chromosome 10, changes in epigenetic modification of killin have also been linked to Cowden syndrome as well as other human cancers. Previous studies revealed that Killin is a high-affinity DNA-binding protein with preference to single-stranded DNA, and it inhibits DNA synthesis in vitro and in vivo. Here, co-localization studies of RFP-Killin with either GFP-PCNA or endogenous single-stranded DNA binding protein RPA during S-phase show that Killin always adopts a mutually exclusive punctuated nuclear expression pattern with the 2 accessory proteins in DNA replication. In contrast, when cells are not in S-phase, RFP-Killin largely congregates in the nucleolus where rRNA transcription normally occurs. Both of these cell cycle specific localization patterns of RFP-Killin are stable under high salt condition, consistent with Killin being tightly associated with nucleic acids within cell nuclei. Together, these cell biological results provide a molecular basis for Killin in competitively inhibiting the formation of DNA replication forks during S-phase, as well as potentially negatively regulate RNA synthesis during other cell cycle phases.

  8. Using Triple Helix Forming Peptide Nucleic Acids for Sequence-selective Recognition of Double-stranded RNA

    PubMed Central

    Hnedzko, Dziyana; Cheruiyot, Samwel K.; Rozners, Eriks

    2014-01-01

    Non-coding RNAs play important roles in regulation of gene expression. Specific recognition and inhibition of these biologically important RNAs that form complex double-helical structures will be highly useful for fundamental studies in biology and practical applications in medicine. This protocol describes a strategy developed in our laboratory for sequence-selective recognition of double-stranded RNA (dsRNA) using triple helix forming peptide nucleic acids (PNAs) that bind in the major grove of RNA helix. The strategy developed uses chemically modified nucleobases, such as 2-aminopyridine (M) that enables strong triple helical binding at physiologically relevant conditions, and 2-pyrimidinone (P) and 3-oxo-2,3-dihydropyridazine (E) that enable recognition of isolated pyrimidines in the purine rich strand of the RNA duplex. Detailed protocols for preparation of modified PNA monomers, solid-phase synthesis and HPLC purification of PNA oligomers, and measuring dsRNA binding affinity using isothermal titration calorimetry are included. PMID:25199637

  9. Catalysis of the Carbonylation of Alcohols to Carboxylic Acids Including Acetic Acid Synthesis from Methanol.

    ERIC Educational Resources Information Center

    Forster, Denis; DeKleva, Thomas W.

    1986-01-01

    Monsanto's highly successful synthesis of acetic acid from methanol and carbon monoxide illustrates use of new starting materials to replace pretroleum-derived ethylene. Outlines the fundamental aspects of the acetic acid process and suggests ways of extending the synthesis to higher carboxylic acids. (JN)

  10. Mengovirus Replication in Novikoff Rat Hepatoma and Mouse L Cells: Effects on Synthesis of Host-Cell Macromolecules and Virus-specific Synthesis of Ribonucleic Acid

    PubMed Central

    Plagemann, Peter G. W.

    1968-01-01

    Novikoff cells (strain N1S1-67) and L-67 cells, a nutritional mutant of the common strain of mouse L cells which grows in the same medium as N1S1-67 cells, were infected with mengovirus under identical experimental conditions. The synthesis of host-cell ribonucleic acid (RNA) by either type of cell was not affected quantitatively or qualitatively until about 2 hr after infection, when viral RNA synthesis rapidly displaced the synthesis of cellular RNA. The rate of synthesis of protein by both types of cells continued at the same rate as in uninfected cells until about 3 hr after infection, and a disintegration of polyribosomes occurred only towards the end of the replicative cycle, between 5 and 6 hr. The time courses and extent of synthesis of single-stranded and double-stranded viral RNA and of the production of virus were very similar in both types of cells, in spite of the fact that the normal rate of RNA synthesis and the growth rate of uninfected N1S1-67 cells are about three times greater than those of L-67 cells. In both cells, the commencement of viral RNA synthesis coincided with the induction of viral RNA polymerase, as measured in cell-free extracts. Viral RNA polymerase activity disappeared from infected L-67 cells during the period of production of mature virus, but there was a secondary increase in activity in both types of cells coincidental with virus-induced disintegration of the host cells. Infected L-67 cells, however, disintegrated and released progeny virus much more slowly than N1S1-67 cells. The two strains of cells also differed in that replication of the same strain of mengovirus was markedly inhibited by treating N1S1-67 cells with actinomycin D prior to infection; the same treatment did not affect replication in L-67 cells. PMID:4176992

  11. Nucleic acid and protein synthesis during lateral root initiation in Marsilea quadrifolia (Marsileaceae)

    NASA Technical Reports Server (NTRS)

    Lin, B. L.; Raghavan, V.

    1991-01-01

    The pattern of DNA, RNA, and protein synthesis during lateral root initiation in Marsilea quadrifolia L. was monitored by autoradiography of incorporated of 3H-thymidine, 3H-uridine, and 3H-leucine, respectively. DNA synthesis was associated with the enlargement of the lateral root initial prior to its division. Consistent with histological studies, derivatives of the lateral root initial as well as the cells of the adjacent inner cortex and pericycle of the parent root also continued to synthesize DNA. RNA and protein synthetic activities were found to be higher in the lateral root initials than in the endodermal initials of the same longitudinal layer. The data suggest a role for nucleic acid and protein synthesis during cytodifferentiation of a potential endodermal cell into a lateral root initial.

  12. Impact of folic acid supplementation on single- and double-stranded RNA degradation in human colostrum and mature milk.

    PubMed

    Kocic, Gordana; Bjelakovic, Ljiljana; Bjelakovic, Bojko; Jevtoci-Stoimenov, Tatjana; Sokolovic, Dusan; Cvetkovic, Tatjana; Kocic, Hristina; Stojanovic, Svetlana; Langerholc, Tomaz; Jonovic, Marina

    2014-07-01

    Sufficient intake of folic acid is necessary for normal embryogenesis, fetal, and neonatal development. Folic acid facilitates nucleic acid internalization, and protects cellular DNA from nuclease degradation. Human milk contains enzymes, antimicrobial proteins, and antibodies, along with macrophages, that protect against infections and allergies. However, little to no information is available on the effects of folic acid supplementation on degradation of nucleic acids in human milk. In the present study, we aimed to determine the RNase activity (free and inhibitor-bound) in colostrum and mature milk, following folic acid supplementation. The study design included a total of 59 women, 27 of whom received 400 μg of folic acid daily periconceptionally and after. Folic acid supplementation increased the free RNase and polyadenylase activity following lactation. However, the increased RNase activity was not due to de novo enzyme synthesis, as the inhibitor-bound (latent) RNase activity was significantly lower and disappeared after one month. Folic acid reduced RNase activity by using double-stranded RNA as substrate. Data suggests that folic acid supplementation may improve viral RNAs degradation and mRNA degradation, but not dsRNA degradation, preserving in this way the antiviral defense.

  13. Indoleacetic Acid and the Synthesis of Glucanases and Pectic Enzymes

    PubMed Central

    Datko, Anne Harmon; Maclachlan, G. A.

    1968-01-01

    Indoleacetic acid (IAA) and/or inhibitors of DNA, RNA or protein synthesis were added to the apex of decapitated seedlings of Pisum sativum L. var. Alaska. At various times up to 4 days, enzymic protein was extracted from a segment of epicotyl immediately below the apex and assayed for its ability to hydrolyse polysaccharides or their derivatives. With the exception of amylase, the total amounts per segment of all of the tested enzymes increased due to IAA treatment. The development of β-1,4-glucanase (cellulase) activity per unit of protein or fresh weight proceeded according to a typical sigmoid induction curve. Pectinase was formed for about 2 days in control segments and IAA treatment resulted in continued synthesis for at least another 2 days provided cell division took place. β-1,3-glucanase and pectinesterase activities were only enhanced by IAA to the extent that total protein levels increased. Reaction mechanisms for these effects and functions for the enzymes during growth are discussed. PMID:16656834

  14. Increase in RNA and protein synthesis by mitochondria irradiated with helium-neon laser

    SciTech Connect

    Greco, M.; Guida, G.; Perlino, E.; Marra, E.; Quagliariello, E. )

    1989-09-29

    To gain further insight into the mechanism of cell photostimulation by laser light, both RNA and protein synthesis were measured in mitochondria irradiated with the low power continuous wave He-Ne laser (Energy dose: 5 Joules/cm{sup 2}). Following mitochondrial irradiation, both the rate and amount of incorporation of alpha-({sup 32}P)UTP and L-({sup 35}S)methionine, used to monitor RNA and protein synthesis respectively, proved to increase. Electrophoretic analysis made of the synthesis products clearly shows that He-Ne laser irradiation stimulates the synthesis of all mitochondrial transcription and translation products.

  15. Nucleic Acid Engineering: RNA Following the Trail of DNA.

    PubMed

    Kim, Hyejin; Park, Yongkuk; Kim, Jieun; Jeong, Jaepil; Han, Sangwoo; Lee, Jae Sung; Lee, Jong Bum

    2016-02-01

    The self-assembly feature of the naturally occurring biopolymer, DNA, has fascinated researchers in the fields of materials science and bioengineering. With the improved understanding of the chemical and structural nature of DNA, DNA-based constructs have been designed and fabricated from two-dimensional arbitrary shapes to reconfigurable three-dimensional nanodevices. Although DNA has been used successfully as a building block in a finely organized and controlled manner, its applications need to be explored. Hence, with the myriad of biological functions, RNA has recently attracted considerable attention to further the application of nucleic acid-based structures. This Review categorizes different approaches of engineering nucleic acid-based structures and introduces the concepts, principles, and applications of each technique, focusing on how DNA engineering is applied as a guide to RNA engineering.

  16. RNA primer used in synthesis of anticomplementary DNA by reverse transcriptase of avian myeloblastosis virus.

    PubMed Central

    Myers, J C; Dobkin, C; Spiegelman, S

    1980-01-01

    When either the homologous RNA (avian myeloblastosis virus RNA) or a heterologous RNA (poliovirus RNA) was used as a template, the anticomplementary DNA synthesized in vitro by avian myeloblastosis virus reverse transcriptase (RNA-directed DNA nucleotidyltransferase, EC 2.7.7.7) was primed by fragments of the original RNA template that usually had adenosine at their 3' ends. When we used phage T/ RNA ligase (EC 6.5.1.3) to label the 3' end of the RNA template fragments contained in the RNA . cDNA hybrid intermediate, adenosine was found to be the principal nucleoside carrying the label. We infer from these results that the ribonuclease H (hybrid nuclease) activity of the reverse transcriptase creates fragments of the original RNA template with adenosine as the principal 3' terminus and that these fragments serve as primers for the synthesis of anticomplementary DNA. Images PMID:6154930

  17. Ribosomal RNA synthesis in imbibing radish (Raphanus sativus) embryo axes : A biochemical and cytological study.

    PubMed

    Aspart, L; Cooke, R; Michaux-Ferriere, N; Delseny, M

    1980-02-01

    The first hours of seed germination are characterized by an increase in the rate of RNA synthesis. Although this change is most easily accounted for by changes in the ribonucleotide pool sizes, we investigated two other aspects of rRNA synthesis which are likely to contribute to the phenomenon. Using isolated radish embryo axes, we demonstrate that processing of rRNA gene transcripts is much slower during early germination than during the growth of the seedling. We also provide evidence that rRNA gene expression is sequentially reactivated in different tissues, starting in the provascular tissue and apex cells and only later in the cortical cells of the rootlet.

  18. NF-kappaB signaling differentially regulates influenza virus RNA synthesis.

    PubMed

    Kumar, Naveen; Xin, Zhong-Tao; Liang, Yuhong; Ly, Hinh; Liang, Yuying

    2008-10-01

    The NF-kappaB signaling pathway has previously been shown to be required for efficient influenza A virus replication, although the molecular mechanism is not well understood. In this study, we identified a specific step of the influenza virus life cycle that is influenced by NF-kappaB signaling by using two known NF-kappaB inhibitors and a variety of influenza virus-specific assays. The results of time course experiments suggest that the NF-kappaB inhibitors Bay11-7082 and ammonium pyrrolidinedithiocarbamate inhibited an early postentry step of viral infection, but they did not appear to affect the nucleocytoplasmic trafficking of the viral ribonucleoprotein complex. Instead, we found that the levels of influenza virus genomic RNA (vRNA), but not the corresponding cRNA or mRNA, were specifically reduced by the inhibitors in virus-infected cells, indicating that NF-kappaB signaling is intimately involved in the vRNA synthesis. Furthermore, we showed that the NF-kappaB inhibitors specifically diminished influenza virus RNA transcription from the cRNA promoter but not from the vRNA promoter in a reporter assay, a result which is consistent with data obtained from virus-infected cells. The overexpression of the p65 NF-kappaB molecule could not only eliminate the inhibition but also activate influenza virus RNA transcription from the cRNA promoter. Finally, using p65-specific small interfering RNA, we have shown that p65 knockdown reduced the levels of influenza virus replication and vRNA synthesis. In summary, we have provided evidence showing, for the first time, that the NF-kappaB host signaling pathway can differentially regulate influenza virus RNA synthesis, which may also offer some new perspectives into understanding the host regulation of RNA synthesis by other RNA viruses.

  19. DNA and RNA Synthesis in Animal Cells in Culture--Methods for Use in Schools

    ERIC Educational Resources Information Center

    Godsell, P. M.; Balls, M.

    1973-01-01

    Describes the experimental procedures used for detecting DNA and RNA synthesis in xenopus cells by autoradiography. The method described is suitable for senior high school laboratory classes or biology projects, if supervised by a teacher qualified to handle radioisotopes. (JR)

  20. Tacaribe virus Z protein interacts with the L polymerase protein to inhibit viral RNA synthesis.

    PubMed

    Jácamo, Rodrigo; López, Nora; Wilda, Maximiliano; Franze-Fernández, María T

    2003-10-01

    Tacaribe virus (TV) is the prototype of the New World group of arenaviruses. The TV genome encodes four proteins, the nucleoprotein (N), the glycoprotein precursor, the polymerase (L), and a small RING finger protein (Z). Using a reverse genetic system, we recently demonstrated that TV N and L are sufficient to drive transcription and full-cycle RNA replication mediated by TV-like RNAs and that Z is a powerful inhibitor of these processes (N. López, R. Jácamo, and M. T. Franze-Fernández, J. Virol. 65:12241-12251, 2001). In the present study we investigated whether Z might interact with either of the proteins, N and L, required for RNA synthesis. To that end, we used coimmunoprecipitation with monospecific antibodies against the viral proteins and coimmunoprecipitation with serum against glutathione S-transferase (GST) and binding to glutathione-Sepharose beads when Z was expressed as a fusion protein with GST. We demonstrated that Z interacted with L but not with N and that Z inhibitory activity was dependent on its ability to bind to L. We also evaluated the contribution of different Z regions to its binding ability and functional activity. We found that integrity of the RING structure is essential for Z binding to L and for Z inhibitory activity. Mutants with deletions at the N and C termini of Z showed that amino acids within the C-terminal region and immediately adjacent to the RING domain N terminus contribute to efficient Z-L interaction and are required for inhibitory activity. The data presented here provide the first evidence of an interaction between Z and L, suggesting that Z interferes with viral RNA synthesis by direct interaction with L. In addition, coimmunoprecipitation studies revealed a previously unreported interaction between N and L.

  1. Analysis of minimal promoter sequences for plus-strand synthesis by the Cucumber necrosis virus RNA-dependent RNA polymerase.

    PubMed

    Panavas, T; Pogany, J; Nagy, P D

    2002-05-10

    Tombusviruses are small, plus-sense, single-stranded RNA viruses of plants. A partially purified RNA-dependent RNA polymerase (RdRp) preparation of Cucumber necrosis virus (CNV), which is capable of de novo initiation of complementary RNA synthesis from either plus-strand or minus-strand templates, was used to dissect minimal promoter sequences for tombusviruses and their defective interfering (DI) RNAs. In vitro RdRp assay revealed that the core plus-strand initiation promoter included only the 3'-terminal 11 nucleotides. A hypothetical promoter-like sequence, which has been termed consensus sequence by Wu and White (1998, J. Virol. 72, 9897-9905), is recognized less efficiently by the CNV RdRp than the core plus-strand initiation promoter. The CNV RdRp can efficiently recognize the core plus-strand initiation promoter for a satellite RNA associated with the distantly related Turnip crinkle virus, while artificial AU- or GC-rich 3'-terminal sequences make poor templates in the in vitro assays. Comparison of the "strength" of minimal plus-strand and minus-strand initiation promoters reveals that the latter is almost twice as efficient in promoting complementary RNA synthesis. Template competition experiments, however, suggest that the minimal plus-strand initiation promoter makes an RNA template more competitive than the minimal minus-strand initiation promoter. Taken together, these results demonstrate that promoter recognition by the tombusvirus RdRp requires only short sequences present at the 3' end of templates.

  2. Definition of the minimal viral components required for the initiation of unprimed RNA synthesis by influenza virus RNA polymerase.

    PubMed

    Lee, M T Michael; Bishop, Konrad; Medcalf, Liz; Elton, Debra; Digard, Paul; Tiley, Laurence

    2002-01-15

    The first 11 nt at the 5' end of influenza virus genomic RNA were shown to be both necessary and sufficient for specific binding by the influenza virus polymerase. A novel in vitro transcription assay, in which the polymerase was bound to paramagnetic beads via a biotinylated 5'-vRNA oligonucleotide, was used to study the activities of different forms of the polymerase. Complexes composed of co-expressed PB1/PB2/PA proteins and a sub-complex composed of PB1/PA bound to the 5'-vRNA oligonucleotide, whereas PB1 expressed alone did not. The enriched 5'-vRNA/PB1/PB2/PA complex was highly active for ApG and globin mRNA primed transcription on a model 3'-vRNA template. RNA synthesis in the absence of added primers produced products with 5'-terminal tri- or diphosphate groups, indicating that genuine unprimed initiation of transcription also occurred. No transcriptase activity was detected for the PB1/PA complex. These results demonstrate a role for PA in the enhancement of 5' end binding activity of PB1, a role for PB2 in the assembly of a polymerase complex able to perform both cap-dependent and -independent synthesis and that NP is not required for the initiation of replicative transcription.

  3. An intrinsically disordered peptide from Ebola virus VP35 controls viral RNA synthesis by modulating nucleoprotein-RNA interactions

    DOE PAGES

    Leung, Daisy  W.; Borek, Dominika; Luthra, Priya; Binning, Jennifer  M.; Anantpadma, Manu; Liu, Gai; Harvey, Ian B.; Su, Zhaoming; Endlich-Frazier, Ariel; Pan, Juanli; et al

    2015-04-01

    During viral RNA synthesis, Ebola virus (EBOV) nucleoprotein (NP) alternates between an RNA-template-bound form and a template-free form to provide the viral polymerase access to the RNA template. In addition, newly synthesized NP must be prevented from indiscriminately binding to noncognate RNAs. Here, we investigate the molecular bases for these critical processes. We identify an intrinsically disordered peptide derived from EBOV VP35 (NPBP, residues 20–48) that binds NP with high affinity and specificity, inhibits NP oligomerization, and releases RNA from NP-RNA complexes in vitro. The structure of the NPBP/ΔNPNTD complex, solved to 3.7 Å resolution, reveals how NPBP peptide occludesmore » a large surface area that is important for NP-NP and NP-RNA interactions and for viral RNA synthesis. Together, our results identify a highly conserved viral interface that is important for EBOV replication and can be targeted for therapeutic development.« less

  4. Possible involvement of eEF1A in Tomato spotted wilt virus RNA synthesis.

    PubMed

    Komoda, Keisuke; Ishibashi, Kazuhiro; Kawamura-Nagaya, Kazue; Ishikawa, Masayuki

    2014-11-01

    Tomato spotted wilt virus (TSWV) is a negative-strand RNA virus in the family Bunyaviridae and propagates in both insects and plants. Although TSWV can infect a wide range of plant species, host factors involved in viral RNA synthesis of TSWV in plants have not been characterized. In this report, we demonstrate that the cell-free extract derived from one of the host plants can activate mRNA transcriptional activity of TSWV. Based on activity-guided fractionation of the cell-free extract, we identified eukaryotic elongation factor (eEF) 1A as a possible host factor facilitating TSWV transcription and replication. The RNA synthesis-supporting activity decreased in the presence of an eEF1A inhibitor, suggesting that eEF1A plays an important role in RNA synthesis of TSWV. PMID:25151062

  5. Studies on the control of ribosomal RNA synthesis in HeLa cells.

    PubMed

    Chesterton, C J; Coupar, B E; Butterworth, P H; Green, M H

    1975-09-01

    In many eucaryotic systems protein synthesis is coupled to ribosomal RNA synthesis such that shut-down of the former causes inhibition of the latter. We have investigated this stringency phenomenon in HeLa cells. The protein synthesis inhibitors cycloheximide and puromycin cause inactivation of both processes but valine starvation totally inhibits only the processing of 45-S RNA. DNA-dependent RNA polymerases from A, B and C (or I, II and III respectively) were extracted, separated partially by DEAE-cellulose chromatography and their activity levels determined. These do not decrease significantly during inhibition of protein synthesis. To find out whether or not form A is bound to its template under these conditions, proteins were removed from chromatin with the detergent sarkosyl. This does not affect bound RNA polymerase. Inhibition of protein synthesis caused up to 50% reduction in endogenous alpha-amanitin-insensitive chromatin-RNA-synthesising activity. This reduced level of activity was not affected by sarkosyl treatment. Levels in normal cells were stimulated. This result indicates that the form A RNA polymerase is not bound to its template when protein synthesis is inhibited.

  6. Energetics of amino acid synthesis in hydrothermal ecosystems

    NASA Technical Reports Server (NTRS)

    Amend, J. P.; Shock, E. L.

    1998-01-01

    Thermodynamic calculations showed that the autotrophic synthesis of all 20 protein-forming amino acids was energetically favored in hot (100 degrees C), moderately reduced, submarine hydrothermal solutions relative to the synthesis in cold (18 degrees C), oxidized, surface seawater. The net synthesis reactions of 11 amino acids were exergonic in the hydrothermal solution, but all were endergonic in surface seawater. The synthesis of the requisite amino acids of nine thermophilic and hyperthermophilic proteins in a 100 degreesC hydrothermal solution yielded between 600 and 8000 kilojoules per mole of protein, which is energy that is available to drive the intracellular synthesis of enzymes and other biopolymers in hyperthermophiles thriving in these ecosystems.

  7. In Organello Transcription in Maize Mitochondria and Its Sensitivity to Inhibitors of RNA Synthesis 1

    PubMed Central

    Finnegan, Patrick M.; Brown, Gregory G.

    1987-01-01

    Purified mitochondrial preparations from etiolated maize shoots support the incorporation of radioactivity from labeled UTP into RNA. The incorporation is linear with time for up to 2 hours, shows Michaelis-Menton kinetics with respect to the concentration of the labeled substrate, UTP, and has salt and pH optima which are different than those previously reported for RNA synthesis by isolated chloroplasts. When a crude mitochondrial preparation is subjected to isopycnic sucrose gradient centrifugation, the bulk of the RNA synthetic activity co-sediments with mitochondrial marker enzymes and with the mitochondrial 26S and 18S rRNAs. Maize mitochondrial RNA synthesis is prevented by actinomycin D and ethidium bromide but unaffected by α-amanitin. It is strongly inhibited by rifampicin at concentrations which have no effect on nuclear and chloroplast RNA synthesis, but only moderately inhibited by rifampicin at concentrations which completely inhibit bacterial RNA synthesis. The optimization, cell fractionation, and inhibitor data all suggest that contaminating organelles and bacteria do not contribute appreciably to the RNA synthesis in purified mitochondrial preparations. Images Fig. 4 PMID:16665676

  8. Arresting initiation of hepatitis C virus RNA synthesis using heterocyclic derivatives.

    PubMed

    Gu, Baohua; Johnston, Victor K; Gutshall, Lester L; Nguyen, Tammy T; Gontarek, Richard R; Darcy, Michael G; Tedesco, Rosanna; Dhanak, Dashyant; Duffy, Kevin J; Kao, C Cheng; Sarisky, Robert T

    2003-05-01

    The hepatitis C virus (HCV) NS5B protein encodes an RNA-dependent RNA polymerase (RdRp), the primary catalytic enzyme of the HCV replicase complex. Recently, two benzo-1,2,4-thiadiazine compounds were shown to be potent, highly specific inhibitors of the genotype 1b HCV RdRp containing a carboxyl-terminal 21 residue truncation (delta21 HCV RdRp) (Dhanak, D., Duffy, K., Johnston, V. K., Lin-Goerke, J., Darcy, M., Shaw, A. N. G. B., Silverman, C., Gates, A. T., Earnshaw, D. L., Casper, D. J., Kaura, A., Baker, A., Greenwood, C., Gutshall, L. L., Maley, D., DelVecchio, A., Macarron, R., Hofmann, G. A., Alnoah, Z., Cheng, H.-Y., Chan, G., Khandekar, S., Keenan, R. M., and Sarisky, R. T. (2002) J. Biol. Chem. 277, 38322-38327). Compound 4 (C(21)H(21)N(3)O(4)S) reduces viral replication by virtue of its direct interaction with the viral polymerase rather than by nonspecific titration of nucleic acid template. In this study, we present several lines of evidence to demonstrate that this inhibitor interferes with the initiation step of RNA synthesis rather than acting as an elongation inhibitor. Inhibition of initial phosphodiester bond formation occurred regardless of whether replication was initiated by primer-dependent or de novo mechanisms. Filter binding studies using increasing concentrations of compound 4 did not interfere with the ability of delta21 HCV RdRp to interact with nucleic acid. Furthermore, varying the order of reagent addition in the primer extension assay showed no distinct differences in inhibition profile. Finally, surface plasmon resonance analyses provided evidence that a ternary complex is capable of forming between the RNA template, RdRp, and compound 4. Together, these data suggest that this heterocyclic agent interacts with the apoenzyme, as well as with the RNA-bound form of delta21 HCV RdRp, and therefore does not directly interfere with the RdRp-RNA interaction to mediate inhibition.

  9. Synthesis of heterogeneous mRNA-like RNA and low-molecular-weight RNA before the midblastula transition in embryos of Xenopus laevis

    SciTech Connect

    Nakakura, N.; Miura, T.; Yamana, K.; Ito, A.; Shiokawa, K.

    1987-10-01

    It has been proposed and is now widely accepted that in Xenopus laevis embryogenesis RNA synthesis starts only at and after 12 rounds of cleavage, at the time of the midblastula transition (MBT). In this report, however, we provide evidence that RNA synthesis takes place prior to the MBT stage in normally developing Xenopus embryos. In the present experiments, we cultured fertilized eggs in 80 mM phosphate buffer and loosened the adhesion between blastomeres, so that (/sup 3/H)uridine could be incorporated into blastomeres from the surrounding medium. By this method and also by microinjection of (/sup 3/H)GTP, we found that embryos synthesize heterogeneous, nonribosomal, high-molecular-weight RNAs and a relatively small amount of low-molecular-weight RNA as early as the sixth cleavage. RNAs synthesized were not of mitochondrial origin, and the synthesis was sensitive to actinomycin D and alpha-amanitin. From these results we conclude that mRNA-like RNA and low-molecular-weight RNA start to be synthesized during the cleavage stage.

  10. Disappearance of stored polyadenylic acid and mRNA during early germination of radish (Raphanus sativus L.) embryo axes.

    PubMed

    Delseny, M; Aspart, L; Guitton, Y

    1977-01-01

    Polyadenylic acid [poly (A)] is detected, characterized and quantitated in dry radish embryo axis RNA using a (3)H poly (U) probe. The amount of poly (A) gradually decreases after the onset of soaking, and, after a few hours, recovers to the initial level. This variation is shown to result from the addition of two opposed phenomena: the decay of stored poly (A) and the accumulation of newly synthesized poly (A). Stored poly (A), as well as the "in vivo" protein synthesis coded for by preformed mRNA, decreases during early germination with a half-life of two hours. As a whole, these results demonstrate that at least a fraction of the stored mRNA is translated as soon as the seed is soaked and that its role is rapidly taken over by newly-made mRNA.

  11. Structural and mutational analysis of archaeal ATP-dependent RNA ligase identifies amino acids required for RNA binding and catalysis

    PubMed Central

    Gu, Huiqiong; Yoshinari, Shigeo; Ghosh, Raka; Ignatochkina, Anna V.; Gollnick, Paul D.; Murakami, Katsuhiko S.; Ho, C. Kiong

    2016-01-01

    An ATP-dependent RNA ligase from Methanobacterium thermoautotrophicum (MthRnl) catalyzes intramolecular ligation of single-stranded RNA to form a closed circular RNA via covalent ligase-AMP and RNA-adenylylate intermediate. Here, we report the X-ray crystal structures of an MthRnl•ATP complex as well as the covalent MthRnl–AMP intermediate. We also performed structure-guided mutational analysis to survey the functions of 36 residues in three component steps of the ligation pathway including ligase-adenylylation (step 1), RNA adenylylation (step 2) and phosphodiester bond synthesis (step 3). Kinetic analysis underscored the importance of motif 1a loop structure in promoting phosphodiester bond synthesis. Alanine substitutions of Thr117 or Arg118 favor the reverse step 2 reaction to deadenylate the 5′-AMP from the RNA-adenylate, thereby inhibiting step 3 reaction. Tyr159, Phe281 and Glu285, which are conserved among archaeal ATP-dependent RNA ligases and are situated on the surface of the enzyme, are required for RNA binding. We propose an RNA binding interface of the MthRnl based on the mutational studies and two sulfate ions that co-crystallized at the active site cleft in the MthRnl–AMP complex. PMID:26896806

  12. Inhibition of plant fatty acid synthesis by nitroimidazoles.

    PubMed Central

    Jones, A V; Harwood, J L; Stratford, M R; Stumpf, P K

    1981-01-01

    1. The effect of the addition of a number of nitroimidazoles was tested on fatty acid synthesis by germinating pea seeds, isolated lettuce chloroplasts and a soluble fraction from pea seeds. 2. All the compounds tested had a marked inhibition on stearate desaturation by lettuce chloroplasts and on the synthesis of very-long-chain fatty acids by pea seeds. 3. In contrast, the effect of the drugs on total fatty acid synthesis from [14C]acetate in chloroplasts was related to the compound's electron reduction potentials. 4. Of the compounds used, only metronidazole had a marked inhibition on palmitate elongation in the systems tested. 5. The mechanism of inhibition of plant fatty acid synthesis by nitroimidazoles is discussed and the possible relevance of these findings to their neurotoxicity is suggested. PMID:7325993

  13. A Recombinant Collagen-mRNA Platform for Controllable Protein Synthesis.

    PubMed

    Sun, Liping; Xiong, Yunjing; Bashan, Anat; Zimmerman, Ella; Shulman Daube, Shirley; Peleg, Yoav; Albeck, Shira; Unger, Tamar; Yonath, Hagith; Krupkin, Miri; Matzov, Donna; Yonath, Ada

    2015-07-01

    We have developed a collagen-mRNA platform for controllable protein production that is intended to be less prone to the problems associated with commonly used mRNA therapy as well as with collagen skin-healing procedures. A collagen mimic was constructed according to a recombinant method and was used as scaffold for translating mRNA chains into proteins. Cysteines were genetically inserted into the collagen chain at positions allowing efficient ribosome translation activity while minimizing mRNA misfolding and degradation. Enhanced green fluorescence protein (eGFP) mRNA bound to collagen was successfully translated by cell-free Escherichia coli ribosomes. This system enabled an accurate control of specific protein synthesis by monitoring expression time and level. Luciferase-mRNA was also translated on collagen scaffold by eukaryotic cell extracts. Thus we have demonstrated the feasibility of controllable protein synthesis on collagen scaffolds by ribosomal machinery.

  14. Direct Catalytic Asymmetric Synthesis of β-Hydroxy Acids from Malonic Acid.

    PubMed

    Gao, Hang; Luo, Zhenli; Ge, Pingjin; He, Junqian; Zhou, Feng; Zheng, Peipei; Jiang, Jun

    2015-12-18

    A nickel(II) catalyzed asymmetric synthesis of β-hydroxy acids from malonic acid and ketones was developed, revealing for the first time the synthetic utility of malonic acid in the construction of chiral carboxyl acids; importantly, the synthetic potential of this strategy was further demonstrated by the rapid construction of cephalanthrin A, phaitanthrin B, cruciferane, and rice metabolites.

  15. Effects of Abscisic Acid and Ethylene on the Gibberellic Acid-Induced Synthesis of α-Amylase by Isolated Wheat Aleurone Layers 1

    PubMed Central

    Varty, Keith; Arreguín, Barbarín L.; Gómez, Miguel T.; López, Pablo Jaime T.; Gómez, Miguel Angel L.

    1983-01-01

    Gibberellic acid-induced α-amylase synthesis in wheat aleurone layers (Triticum aestivum L. var Potam S-70) escaped from transcriptional control 30 h after addition of the hormone, as evidenced by the tissue's loss of susceptibility to cordycepin. Abscisic acid inhibited the accumulation of α-amylase activity when added to the tissue during this cordycepin-insensitive phase of enzyme induction. α-Amylase synthesis was not restored by the addition of cordycepin, indicating that the response to abscisic acid was not dependent upon the continuous synthesis of a short lived RNA. When ethylene was added simultaneously or some time after abscisic acid, the accumulation of α-amylase activity was sustained or quickly restored. The loss of susceptibility to cordycepin was completely prevented when aleurone layers were incubated with a combination of gibberellic and abscisic acids from the start of the induction period. This effect of abscisic acid was not reversed by ethylene. On the basis of these observations, it is suggested that abscisic acid inhibits both the transcription and translation of α-amylase mRNA, and that only the latter site of action is susceptible to reversal by ethylene. The rate of incorporation of [methyl-14C]choline into phospholipids was also inhibited by abscisic acid. Ethylene reversed this effect. The effects of abscisic acid and ethylene on phospholipid synthesis were not dependent upon the presence of gibberellic acid. No direct relationship was found between the control of α-amylase synthesis and membrane formation by abscisic acid and ethylene. PMID:16663284

  16. The role of the priming loop in influenza A virus RNA synthesis.

    PubMed

    Te Velthuis, Aartjan J W; Robb, Nicole C; Kapanidis, Achillefs N; Fodor, Ervin

    2016-01-01

    RNA-dependent RNA polymerases (RdRps) are used by RNA viruses to replicate and transcribe their RNA genomes(1). They adopt a closed, right-handed fold with conserved subdomains called palm, fingers and thumb(1,2). Conserved RdRp motifs A-F coordinate the viral RNA template, NTPs and magnesium ions to facilitate nucleotide condensation(1). For the initiation of RNA synthesis, most RdRps use either a primer-dependent or de novo mechanism(3). The influenza A virus RdRp, in contrast, uses a capped RNA oligonucleotide to initiate transcription, and a combination of terminal and internal de novo initiation for replication(4). To understand how the influenza A virus RdRp coordinates these processes, we analysed the function of a thumb subdomain β-hairpin using initiation, elongation and single-molecule Förster resonance energy transfer (sm-FRET) assays. Our data indicate that this β-hairpin is essential for terminal initiation during replication, but not necessary for internal initiation and transcription. Analysis of individual residues in the tip of the β-hairpin shows that PB1 proline 651 is critical for efficient RNA synthesis in vitro and in cell culture. Overall, this work advances our understanding of influenza A virus RNA synthesis and identifies the initiation platform of viral replication. PMID:27572643

  17. Linoleic acid and its metabolites, hydroperoxyoctadecadienoic acids, stimulate c-Fos, c-Jun, and c-Myc mRNA expression, mitogen-activated protein kinase activation, and growth in rat aortic smooth muscle cells.

    PubMed Central

    Rao, G N; Alexander, R W; Runge, M S

    1995-01-01

    Previous studies from other laboratories suggest that linoleic acid and its metabolites, hydroperoxyoctadecadienoic acids, play an important role in modulating the growth of some cells. A correlation has been demonstrated between hydroperoxyoctadecadienoic acids and conditions characterized by abnormal cell growth such as atherosclerosis and psoriasis. To determine if linoleic acid and its metabolites modulate cell growth in atherosclerosis, we measured DNA synthesis, protooncogene mRNA expression, and mitogen-activated protein kinase (MAPK) activation in vascular smooth muscle cells (VSMC). Linoleic acid induces DNA synthesis, c-fos, c-jun, and c-myc mRNA expression and MAPK activation in VSMC. Furthermore, nordihydroguaiaretic acid, a potent inhibitor of the lipoxygenase system, significantly reduced the growth-response effects of linoleic acid in VSMC, suggesting that conversion of linoleic acid to hydroperoxyoctadecadienoic acids (HPODEs) is required for these effects. HPODEs also caused significant induction of DNA synthesis, protooncogene mRNA expression, and MAPK activation in growth-arrested VSMC, suggesting that linoleic acid and its metabolic products, HPODEs, are potential mitogens in VSMC, and that conditions such as oxidative stress and lipid peroxidation which provoke the production of these substances may alter VSMC growth. Images PMID:7635978

  18. Significance of the C-terminal amino acid residue in mengovirus RNA-dependent RNA polymerase.

    PubMed

    Dmitrieva, Tatiana M; Alexeevski, Andrei V; Shatskaya, Galina S; Tolskaya, Elena A; Gmyl, Anatoly P; Khitrina, Elena V; Agol, Vadim I

    2007-08-15

    Replication of picornavirus genomes is accomplished by the virally encoded RNA-dependent RNA polymerase (RdRP). Although the primary structure of this enzyme exhibits a high level of conservation, there are several significant differences among different picornavirus genera. In particular, a comparative alignment indicates that the C-terminal sequences of cardiovirus RdRP (known also as 3D(pol)), are 1-amino-acid residue (arginine or tryptophan) longer than that of the enterovirus or rhinovirus enzymes. Here, it is shown that alterations of the last codon of the RdRP-encoding sequence of mengovirus RNA leading to deletion of the C-terminal Trp460 or its replacement by Ala or Phe dramatically impaired viral RNA replication and, in the former case, resulted in a quasi-infectious phenotype (i.e., the mutant RNA might generate a low yield of pseudorevertants acquiring a Tyr residue in place of the deleted Trp460). The replacement of Trp460 by His or Tyr did not appreciably alter the viral growth potential. Homology modeling of three-dimensional structure of mengovirus RdRP suggested that Trp460 may be involved in interaction between the thumb and palm domains of the enzyme. Specifically, Trp460 of the thumb may form a hydrogen bond with Thr219 and hydrophobically interact with Val216 of the palm. The proposed interactions were consistent with the results of in vivo SELEX experiment, which demonstrated that infectious virus could contain Ser or Thr at position 219 and hydrophobic Val, Leu, Ile, as well as Arg (whose side chain has a nonpolar part) at position 216. A similar thumb-palm domain interaction may be a general feature of several RdRPs and its possible functional significance is discussed. PMID:17467026

  19. Salicylic acid and gentisic acid induce RNA silencing-related genes and plant resistance to RNA pathogens.

    PubMed

    Campos, Laura; Granell, Pablo; Tárraga, Susana; López-Gresa, Pilar; Conejero, Vicente; Bellés, José María; Rodrigo, Ismael; Lisón, Purificación

    2014-04-01

    We have observed that treatments with salicylic acid (SA) or gentisic acid (GA) induced resistance to RNA pathogens such as ToMV and CEVd in tomato and Gynura auriantiaca, respectively. Accumulation of SA and GA has been found to occur in plants infected by these pathogens, thus pointing out a possible defence role of both molecules. To study the molecular basis of the observed induced resistance to RNA pathogens the induction of silencing-related genes by SA and GA was considered. For that purpose, we searched for tomato genes which were orthologous to those described in Arabidopsis thaliana, such as AtDCL1, AtDCL2, AtDCL4, AtRDR1, AtRDR2 and AtRDR6, and we tracked their induction in tomato along virus and viroid infections. We observed that CEVd significantly induced all these genes in tomato, with the exception of ToRDR6, being the induction of ToDCL4 the most outstanding. Regarding the ToMV asymptomatic infection, with the exception of ToRDR2, we observed a significant induction of all the indicated silencing-related genes, being ToDCL2 the most induced gene. Subsequently, we analyzed their transcriptional activation by SA and at the time when ToMV was inoculated on plants. ToDCL2, ToRDR1 and ToRDR2 were significantly induced by both SA and GA, whereas ToDCL1 was only induced by SA. Such an induction resulted more effective by SA treatment, which is in agreement with the stronger SA-induced resistance observed. Our results suggest that the observed delay in the RNA pathogen accumulation could be due to the pre-induction of RNA silencing-related genes by SA or GA.

  20. A site on the influenza A virus NS1 protein mediates both inhibition of PKR activation and temporal regulation of viral RNA synthesis.

    PubMed

    Min, Ji-Young; Li, Shoudong; Sen, Ganes C; Krug, Robert M

    2007-06-20

    It is not known how influenza A viruses, important human pathogens, counter PKR activation, a crucial host antiviral response. Here we elucidate this mechanism. We show that the direct binding of PKR to the NS1 protein in vitro that results in inhibition of PKR activation requires the NS1 123-127 amino acid sequence. To establish whether such direct binding of PKR to the NS1 protein is responsible for inhibiting PKR activation in infected cells, we generated recombinant influenza A/Udorn/72 viruses expressing NS1 proteins in which amino acids 123/124 or 126/127 are changed to alanines. In cells infected with these mutant viruses, PKR is activated, eIF-2alpha is phosphorylated and viral protein synthesis is inhibited, indicating that direct binding of PKR to the 123-127 sequence of the NS1 protein is necessary and sufficient to block PKR activation in influenza A virus-infected cells. Unexpectedly, the 123/124 mutant virus is not attenuated because reduced viral protein synthesis is offset by enhanced viral RNA synthesis at very early times of infection. These early viral RNAs include those synthesized predominantly at later times during wild-type virus infection, demonstrating that wild-type temporal regulation of viral RNA synthesis is absent in 123/124 virus-infected cells. Enhanced early viral RNA synthesis after 123/124 virus infection also occurs in mouse PKR-/- cells, demonstrating that PKR activation and deregulation of the time course of viral RNA synthesis are not coupled. These results indicate that the 123/124 site of the NS1A protein most likely functionally interacts with the viral polymerase to mediate temporal regulation of viral RNA synthesis. This interaction would occur in the nucleus, whereas PKR would bind to NS1A proteins in the cytoplasm prior to their import into the nucleus.

  1. Prebiotic Amino Acid Thioester Synthesis: Thiol-Dependent Amino Acid Synthesis from Formose substrates (Formaldehyde and Glycolaldehyde) and Ammonia

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1998-01-01

    Formaldehyde and glycolaldehyde (substrates of the formose autocatalytic cycle) were shown to react with ammonia yielding alanine and homoserine under mild aqueous conditions in the presence of thiol catalysts. Since similar reactions carried out without ammonia yielded alpha-hydroxy acid thioesters, the thiol-dependent synthesis of alanine and homoserine is presumed to occur via amino acid thioesters-intermediates capable of forming peptides. A pH 5.2 solution of 20 mM formaldehyde, 20 mM glycolaldehyde, 20 mM ammonium chloride, 23 mM 3-mercaptopropionic acid, and 23 mM acetic acid that reacted for 35 days at 40 C yielded (based on initial formaldehyde) 1.8% alanine and 0.08% homoserine. In the absence of thiol catalyst, the synthesis of alanine and homoserine was negligible. Alanine synthesis required both formaldehyde and glycolaldehyde, but homoserine synthesis required only glycolaldehyde. At 25 days the efficiency of alanine synthesis calculated from the ratio of alanine synthesized to formaldehyde reacted was 2.1%, and the yield (based on initial formaldehyde) of triose and tetrose intermediates involved in alanine and homoserine synthesis was 0.3 and 2.1%, respectively. Alanine synthesis was also seen in similar reactions containing only 10 mM each of aldehyde substrates, ammonia, and thiol. The prebiotic significance of these reactions that use the formose reaction to generate sugar intermediates that are converted to reactive amino acid thioesters is discussed.

  2. Have organic interstellar grains redox-catalyzed RNA and other synthesis from cometary precursors ?

    NASA Astrophysics Data System (ADS)

    Krueger, F. R.; Kissel, J.; Werther, W.; Schmid, E. R.

    The recent in-situ investigations of cosmic dust clearly show, that the only building blocks of life therein are nucleobases. All the other building blocks are just found as precursors in cometary dust. They themselves must be formed from precursors by hydrolysis in liquid water, like phosphates from phosphides, sugars (stabilized at mineralic surfaces) may be from polyines, and amino and lipidic acids from nitriles. Nevertheless, the self-organized synthesis of polymers like RNA's and peptides needs, i.a., additional redox-catalysis. These catalysts act in stabilizing and transmitting single electrons and/or holes in chemical reactions. At mineralic surfaces transition metals like FeII/III may take the task. However, once life has emancipated itself from minerals redox catalysts should be furtheron present yet organically without prior encoding for synthesis - as the code itself must have been evolved already before the encoded enzymes can act. However, there may be another solution for this enigma: Except archeae, all stems of life make use of quinone-type co-enzymes of the PQQ (pyrrolo-quinoline-quinone) type of redox catalysts. Interstellar dust reaching the interior of the solar system consists at least of homologuous polymers which may convert to PQQ types in liquid water, after being decelerated in the upper atmosphere. Due to their enormous radiation stability, these types are the natural end-products after long interstellar trips. They can withstand the collision processes with atmospheric molecules, then being washed out.

  3. Growth and Synthesis of Nucleic Acid and Protein by Excised Radish Cotyledons 1

    PubMed Central

    Nieman, R. H.; Poulsen, L. L.

    1967-01-01

    Nutritional and light requirements for growth and synthesis of RNA, DNA, and protein by cotyledons excised from 5-day-old seedlings of Raphanus sativus L. were investigated, and the course of synthesis was followed through the cell cycle. The minimum requirements for a net increase in nucleic acid and protein were sugar, nitrate, and light. The cotyledons used nitrite at low concentration, but not ammonium ion. Light was required for preliminary steps in synthesis of RNA, DNA, and protein, but the actual polymerization reactions occurred in the dark. The cotyledons contained sufficient endogenous growth factors for about half of the cells to complete 1 cycle on a medium of 1% sucrose, 80 mm KNO3. The increase in DNA was limited to about 50% and was accompanied by a comparable increase in cell number. Fresh weight, RNA, and protein tended to increase in proportion to DNA. Growth of the isolated cotyledons commenced with cell enlargement. RNA began to increase after about 4 hours, DNA after about 12. The major increase in protein also began at about 12 hours. The maximum rate of increase for all 3 occurred between 12 and 16 hours. Cell counts indicated that by 28 hours most of the cells which had replicated DNA had also completed cell division. PMID:16656601

  4. Synthesis of alanyl nucleobase amino acids and their incorporation into proteins.

    PubMed

    Talukder, Poulami; Dedkova, Larisa M; Ellington, Andrew D; Yakovchuk, Petro; Lim, Jaebum; Anslyn, Eric V; Hecht, Sidney M

    2016-09-15

    Proteins which bind to nucleic acids and regulate their structure and functions are numerous and exceptionally important. Such proteins employ a variety of strategies for recognition of the relevant structural elements in their nucleic acid substrates, some of which have been shown to involve rather subtle interactions which might have been difficult to design from first principles. In the present study, we have explored the preparation of proteins containing unnatural amino acids having nucleobase side chains. In principle, the introduction of multiple nucleobase amino acids into the nucleic acid binding domain of a protein should enable these modified proteins to interact with their nucleic acid substrates using Watson-Crick and other base pairing interactions. We describe the synthesis of five alanyl nucleobase amino acids protected in a fashion which enabled their attachment to a suppressor tRNA, and their incorporation into each of two proteins with acceptable efficiencies. The nucleobases studied included cytosine, uracil, thymine, adenine and guanine, i.e. the major nucleobase constituents of DNA and RNA. Dihydrofolate reductase was chosen as one model protein to enable direct comparison of the facility of incorporation of the nucleobase amino acids with numerous other unnatural amino acids studied previously. The Klenow fragment of DNA polymerase I was chosen as a representative DNA binding protein whose mode of action has been studied in detail. PMID:27452282

  5. Synthesis of alanyl nucleobase amino acids and their incorporation into proteins.

    PubMed

    Talukder, Poulami; Dedkova, Larisa M; Ellington, Andrew D; Yakovchuk, Petro; Lim, Jaebum; Anslyn, Eric V; Hecht, Sidney M

    2016-09-15

    Proteins which bind to nucleic acids and regulate their structure and functions are numerous and exceptionally important. Such proteins employ a variety of strategies for recognition of the relevant structural elements in their nucleic acid substrates, some of which have been shown to involve rather subtle interactions which might have been difficult to design from first principles. In the present study, we have explored the preparation of proteins containing unnatural amino acids having nucleobase side chains. In principle, the introduction of multiple nucleobase amino acids into the nucleic acid binding domain of a protein should enable these modified proteins to interact with their nucleic acid substrates using Watson-Crick and other base pairing interactions. We describe the synthesis of five alanyl nucleobase amino acids protected in a fashion which enabled their attachment to a suppressor tRNA, and their incorporation into each of two proteins with acceptable efficiencies. The nucleobases studied included cytosine, uracil, thymine, adenine and guanine, i.e. the major nucleobase constituents of DNA and RNA. Dihydrofolate reductase was chosen as one model protein to enable direct comparison of the facility of incorporation of the nucleobase amino acids with numerous other unnatural amino acids studied previously. The Klenow fragment of DNA polymerase I was chosen as a representative DNA binding protein whose mode of action has been studied in detail.

  6. The juxtamembrane sequence of the Hepatitis C virus polymerase can affect RNA synthesis and inhibition by allosteric polymerase inhibitors.

    PubMed

    Wen, Y; Lin, X; Fan, B; Ranjith-Kumar, C T; Kao, C C

    2015-08-01

    The Hepatitis C virus (HCV) RNA-dependent RNA polymerase (RdRp), nonstructural protein 5B (NS5B), is anchored in the membrane through a C-terminal helix. A sequence of ca. 12 residues that connects the catalytically competent portion of the RdRp and the C-terminal helix, the juxtamembrane sequence (JMS), has a poorly defined role in RdRp function in a large part since it is translated from a cis-acting RNA element (CRE) that is essential for HCV replication. Using a HCV replicon that transposed a second copy of CRE to the 3' UTR of the HCV replicon, we demonstrate that amino acid substitutions in the JMS were detrimental for HCV replicon replication. Substitutions in the JMS also resulted in a defect in de novo-initiated RNAs synthesis in vitro and in a cell-based reporter assay. A nonnucleoside inhibitor of the NS5B that binds to the catalytic pocket was less potent in inhibiting NS5B in the presence of JMS mutations. The JMS mutants exhibit reduced stability in thermodenaturation assays, suggesting that the JMS helps confer a more stable conformation to NS5B that could impact RNA synthesis. PMID:25895103

  7. The Murine Norovirus Core Subgenomic RNA Promoter Consists of a Stable Stem-Loop That Can Direct Accurate Initiation of RNA Synthesis

    PubMed Central

    Yunus, Muhammad Amir; Lin, Xiaoyan; Bailey, Dalan; Karakasiliotis, Ioannis; Chaudhry, Yasmin; Vashist, Surender; Zhang, Guo; Thorne, Lucy; Kao, C. Cheng

    2014-01-01

    ABSTRACT All members of the Caliciviridae family of viruses produce a subgenomic RNA during infection. The subgenomic RNA typically encodes only the major and minor capsid proteins, but in murine norovirus (MNV), the subgenomic RNA also encodes the VF1 protein, which functions to suppress host innate immune responses. To date, the mechanism of norovirus subgenomic RNA synthesis has not been characterized. We have previously described the presence of an evolutionarily conserved RNA stem-loop structure on the negative-sense RNA, the complementary sequence of which codes for the viral RNA-dependent RNA polymerase (NS7). The conserved stem-loop is positioned 6 nucleotides 3′ of the start site of the subgenomic RNA in all caliciviruses. We demonstrate that the conserved stem-loop is essential for MNV viability. Mutant MNV RNAs with substitutions in the stem-loop replicated poorly until they accumulated mutations that revert to restore the stem-loop sequence and/or structure. The stem-loop sequence functions in a noncoding context, as it was possible to restore the replication of an MNV mutant by introducing an additional copy of the stem-loop between the NS7- and VP1-coding regions. Finally, in vitro biochemical data suggest that the stem-loop sequence is sufficient for the initiation of viral RNA synthesis by the recombinant MNV RNA-dependent RNA polymerase, confirming that the stem-loop forms the core of the norovirus subgenomic promoter. IMPORTANCE Noroviruses are a significant cause of viral gastroenteritis, and it is important to understand the mechanism of norovirus RNA synthesis. Here we describe the identification of an RNA stem-loop structure that functions as the core of the norovirus subgenomic RNA promoter in cells and in vitro. This work provides new insights into the molecular mechanisms of norovirus RNA synthesis and the sequences that determine the recognition of viral RNA by the RNA-dependent RNA polymerase. PMID:25392209

  8. Depletion of ribosomal protein S19 causes a reduction of rRNA synthesis

    PubMed Central

    Juli, Giada; Gismondi, Angelo; Monteleone, Valentina; Caldarola, Sara; Iadevaia, Valentina; Aspesi, Anna; Dianzani, Irma; Proud, Christopher G.; Loreni, Fabrizio

    2016-01-01

    Ribosome biogenesis plays key roles in cell growth by providing increased capacity for protein synthesis. It requires coordinated production of ribosomal proteins (RP) and ribosomal RNA (rRNA), including the processing of the latter. Here, we show that, the depletion of RPS19 causes a reduction of rRNA synthesis in cell lines of both erythroid and non-erythroid origin. A similar effect is observed upon depletion of RPS6 or RPL11. The deficiency of RPS19 does not alter the stability of rRNA, but instead leads to an inhibition of RNA Polymerase I (Pol I) activity. In fact, results of nuclear run-on assays and ChIP experiments show that association of Pol I with the rRNA gene is reduced in RPS19-depleted cells. The phosphorylation of three known regulators of Pol I, CDK2, AKT and AMPK, is altered during ribosomal stress and could be involved in the observed downregulation. Finally, RNA from patients with Diamond Blackfan Anemia (DBA), shows, on average, a lower level of 47S precursor. This indicates that inhibition of rRNA synthesis could be one of the molecular alterations at the basis of DBA. PMID:27734913

  9. The Prebiotic Synthesis of Ethylenediamine Monoacetic Acid, The Repeating Unit of Peptide Nucleic Acids

    NASA Technical Reports Server (NTRS)

    Nelson, Kevin E.; Miller, Stanley L.

    1992-01-01

    The polymerization of ribonucleic acids or their precursors constitutes an important event in prebiotic chemistry. The various problems using ribonucleotides to make RNA suggest that there may have been a precursor. An attractive possibility are the peptide nucleic acids (PNA). PNAs are nucleotide analogs that make use of a polymer of ethylenediamine monoacetic acid (EDMA or 2-amninoethyl glycine) with the bases attached by an acetic acid. EDMA is an especially attractive alternative to the ribose phosphate or deoxyribose phosphate backbone because it contains no chiral centers and is potentially prebiotic, but there is no reported prebiotic synthesis. We have synthesized both EDMA and ethylenediamine diacetic acid (EDDA) from the prebiotic compounds ethylenediamine, formaldehyde, and hydrogen cyanide. The yields of EDMA range from 11 to 79% along with some sEDDA and uEDDA. These reactions work with concentrations of 10(exp -1)M and as low as 10(exp -4)M, and the reaction is likely to be effective at even lower concentrations. Ethylenediamine is a likely prebiotic compound, but it has not yet been demonstrated, although compounds such as ethanolamine and cysteamine have been proven to be prebiotic. Under neutral pH and heating at l00 C, EDMA is converted to the lactam, monoketopiperazine (MKP). The cyclization occurs and has an approximate ratio of MKP/EDMA = 3 at equilibrium. We have measured the solubilities of EDMA center dot H20 as 6.4 m, EDMA center dot HCl center dot H20 as 13.7 m, and EDMA center dot 2HCl center dot H20 as 3.4 m. These syntheses together with the high solubility of EDMA suggest that EDMA would concentrate in drying lagoons and might efficiently form polymers. Given the instability of ribose and the poor polymerizability of nucleotides, the prebiotic presence of EDMA and the possibility of its polymerization raises the possibility that PNAs are the progenitors of present day nucleic acids. A pre-RNA world may have existed in which PNAs or

  10. Docosahexaenoic Acid Conjugation Enhances Distribution and Safety of siRNA upon Local Administration in Mouse Brain

    PubMed Central

    Nikan, Mehran; Osborn, Maire F; Coles, Andrew H; Godinho, Bruno MDC; Hall, Lauren M; Haraszti, Reka A; Hassler, Matthew R; Echeverria, Dimas; Aronin, Neil; Khvorova, Anastasia

    2016-01-01

    The use of siRNA-based therapies for the treatment of neurodegenerative disease requires efficient, nontoxic distribution to the affected brain parenchyma, notably the striatum and cortex. Here, we describe the synthesis and activity of a fully chemically modified siRNA that is directly conjugated to docosahexaenoic acid (DHA), the most abundant polyunsaturated fatty acid in the mammalian brain. DHA conjugation enables enhanced siRNA retention throughout both the ipsilateral striatum and cortex following a single, intrastriatal injection (ranging from 6–60 μg). Within these tissues, DHA conjugation promotes internalization by both neurons and astrocytes. We demonstrate efficient and specific silencing of Huntingtin mRNA expression in both the ipsilateral striatum (up to 73%) and cortex (up to 51%) after 1 week. Moreover, following a bilateral intrastriatal injection (60 μg), we achieve up to 80% silencing of a secondary target, Cyclophilin B, at both the mRNA and protein level. Importantly, DHA-hsiRNAs do not induce neural cell death or measurable innate immune activation following administration of concentrations over 20 times above the efficacious dose. Thus, DHA conjugation is a novel strategy for improving siRNA activity in mouse brain, with potential to act as a new therapeutic platform for the treatment of neurodegenerative disorders. PMID:27504598

  11. Oleochemical synthesis of an acid cleavable hydrophobe for surfactant use

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The synthesis of a series of branched hydroxy stearates from commercially available methyl oleate and common organic acids is reported. A variety of different acids, with 3 to 8 carbon atoms, and also varying in their branching and functionality, were used. The kinetics of the ring opening reactio...

  12. [The first steps of chlorophyll synthesis: RNA involvement and regulation]. Progress report, January 1990--June 1992

    SciTech Connect

    Soell, D.

    1992-12-31

    Glu-tRNA{sup Glu} is synthesized from glutamate and tRNA{sup Glu} by glutamyl-tRNA synthetase (GluRS). Recent work has demonstrated that Glu-tRNA{sup Glu} has dual functions and is a precursor for protein and 5-aminolevulinate (ALA) synthesis. Current data does not provide compelling evidence for the notion that GluRS is regulated by chlorophyll precursors or in concert with the other enzymes of ALA synthesis. We have redefined the C5-pathway as a two-step route to ALA starting with Glu-tRNA{sup Glu}. Only two enzymes, Glu-tRNA reductase (GluTR) and GSA-2,1-amino-mutase (GSA-AM), are specifically involved in ALA synthesis. We have purified these enzymatic activities from Chlamydomonas and demonstrated that the two purified proteins in the presence of their cofactors NADPH and pyridoxal phosphate are sufficient for the in vitro Glu-tRNA {yields} ALA conversion. We have cloned the genes encoding GluTR. The sequences of the GluTR proteins deduced from these genes share highly conserved regions with those of bacterial origin. We havealso cloned and analyzed the gene encoding GSA-AM from Arabidopsis. As in Salmonella typhimurium, there are indications of the existence of an additional pathway for ALA formation in E. coli. To shed light on the recognition of the single tRNA{sup Glu} by the chloroplast enzymes GluTR, GluRS we characterized a chlorophyll-deficient mutant of Euglena having tRNA{sup Glu} with a point mutation in the T{Psi}C-loop. The altered tRNA supports protein but not ALA synthesis.

  13. Nucleic acid arrays and methods of synthesis

    DOEpatents

    Sabanayagam, Chandran R.; Sano, Takeshi; Misasi, John; Hatch, Anson; Cantor, Charles

    2001-01-01

    The present invention generally relates to high density nucleic acid arrays and methods of synthesizing nucleic acid sequences on a solid surface. Specifically, the present invention contemplates the use of stabilized nucleic acid primer sequences immobilized on solid surfaces, and circular nucleic acid sequence templates combined with the use of isothermal rolling circle amplification to thereby increase nucleic acid sequence concentrations in a sample or on an array of nucleic acid sequences.

  14. The In Vitro Synthesis of Avian Myeloblastosis Viral RNA Sequences

    PubMed Central

    Jacquet, Michel; Groner, Yoram; Monroy, Gladys; Hurwitz, Jerard

    1974-01-01

    Isolated nuclei, prepared from myeloblasts of chicks infected with avian myeloblastosis virus, synthesize RNA sequences present in avian myeloblastosis viral RNA. These sequences are also formed during transcription of chromatin, isolated from myeloblasts, by DNA-dependent RNA polymerases purified from Escherichia coli or calfthymus. In the latter case, transcription is α-amanitin sensitive. Formation of hybrids between RNA and avian myeloblastosis virus DNA probes has been monitored by the combined use of ribonucleases A, T1, and H, and ribonucleases specific for single strands. PMID:4370472

  15. Synthesis of capped RNA using a DMT group as a purification handle.

    PubMed

    Veliath, Elizabeth; Gaffney, Barbara L; Jones, Roger A

    2014-01-01

    We report a new method for synthesis of capped RNA or 2'-OMe RNA that uses a N(2-)4,4'-dimethoxytrityl (DMT) group as a lipophilic purification handle to allow convenient isolation and purification of the capped RNA. The DMT group is easily removed under mild conditions without degradation of the cap. We have used this approach to prepare capped 10- and 20-mers. This method is compatible with the many condensation reactions that have been reported for preparation of capped RNA or cap analogues.

  16. Overview of methods in RNA nanotechnology: synthesis, purification, and characterization of RNA nanoparticles.

    PubMed

    Haque, Farzin; Guo, Peixuan

    2015-01-01

    RNA nanotechnology encompasses the use of RNA as a construction material to build homogeneous nanostructures by bottom-up self-assembly with defined size, structure, and stoichiometry; this pioneering concept demonstrated in 1998 (Guo et al., Molecular Cell 2:149-155, 1998; featured in Cell) has emerged as a new field that also involves materials engineering and synthetic structural biology (Guo, Nature Nanotechnology 5:833-842, 2010). The field of RNA nanotechnology has skyrocketed over the last few years, as evidenced by the burst of publications in prominent journals on RNA nanostructures and their applications in nanomedicine and nanotechnology. Rapid advances in RNA chemistry, RNA biophysics, and RNA biology have created new opportunities for translating basic science into clinical practice. RNA nanotechnology holds considerable promise in this regard. Increased evidence also suggests that substantial part of the 98.5 % of human genome (Lander et al. Nature 409:860-921, 2001) that used to be called "junk DNA" actually codes for noncoding RNA. As we understand more on how RNA structures are related to function, we can fabricate synthetic RNA nanoparticles for the diagnosis and treatment of diseases. This chapter provides a brief overview of the field regarding the design, construction, purification, and characterization of RNA nanoparticles for diverse applications in nanotechnology and nanomedicince.

  17. Overview of methods in RNA nanotechnology: synthesis, purification, and characterization of RNA nanoparticles.

    PubMed

    Haque, Farzin; Guo, Peixuan

    2015-01-01

    RNA nanotechnology encompasses the use of RNA as a construction material to build homogeneous nanostructures by bottom-up self-assembly with defined size, structure, and stoichiometry; this pioneering concept demonstrated in 1998 (Guo et al., Molecular Cell 2:149-155, 1998; featured in Cell) has emerged as a new field that also involves materials engineering and synthetic structural biology (Guo, Nature Nanotechnology 5:833-842, 2010). The field of RNA nanotechnology has skyrocketed over the last few years, as evidenced by the burst of publications in prominent journals on RNA nanostructures and their applications in nanomedicine and nanotechnology. Rapid advances in RNA chemistry, RNA biophysics, and RNA biology have created new opportunities for translating basic science into clinical practice. RNA nanotechnology holds considerable promise in this regard. Increased evidence also suggests that substantial part of the 98.5 % of human genome (Lander et al. Nature 409:860-921, 2001) that used to be called "junk DNA" actually codes for noncoding RNA. As we understand more on how RNA structures are related to function, we can fabricate synthetic RNA nanoparticles for the diagnosis and treatment of diseases. This chapter provides a brief overview of the field regarding the design, construction, purification, and characterization of RNA nanoparticles for diverse applications in nanotechnology and nanomedicince. PMID:25895992

  18. The mitochondrial tyrosyl-tRNA synthetase of Podospora anserina is a bifunctional enzyme active in protein synthesis and RNA splicing.

    PubMed Central

    Kämper, U; Kück, U; Cherniack, A D; Lambowitz, A M

    1992-01-01

    The Neurospora crassa mitochondrial tyrosyl-tRNA synthetase (mt tyrRS), which is encoded by the nuclear gene cyt-18, functions not only in aminoacylation but also in the splicing of group I introns. Here, we isolated the cognate Podospora anserina mt tyrRS gene, designated yts1, by using the N. crassa cyt-18 gene as a hybridization probe. DNA sequencing of the P. anserina gene revealed an open reading frame (ORF) of 641 amino acids which has significant similarity to other tyrRSs. The yts1 ORF is interrupted by two introns, one near its N terminus at the same position as the single intron in the cyt-18 gene and the other downstream in a region corresponding to the nucleotide-binding fold. The P. anserina yts1+ gene transformed the N. crassa cyt-18-2 mutant at a high frequency and rescued both the splicing and protein synthesis defects. Furthermore, the YTS1 protein synthesized in Escherichia coli was capable of splicing the N. crassa mt large rRNA intron in vitro. Together, these results indicate that YTS1 is a bifunctional protein active in both splicing and protein synthesis. The P. anserina YTS1 and N. crassa CYT-18 proteins share three blocks of amino acids that are not conserved in bacterial or yeast mt tyrRSs which do not function in splicing. One of these blocks corresponds to the idiosyncratic N-terminal domain shown previously to be required for splicing activity of the CYT-18 protein. The other two are located in the putative tRNA-binding domain toward the C terminus of the protein and also appear to be required for splicing. Since the E. coli and yeast mt tyrRSs do not function in splicing, the adaptation of the Neurospora and Podospora spp. mt tyrRSs to function in splicing most likely occurred after the divergence of their common ancestor from yeast. Images PMID:1531084

  19. High-resolution gene expression profiling for simultaneous kinetic parameter analysis of RNA synthesis and decay.

    PubMed

    Dölken, Lars; Ruzsics, Zsolt; Rädle, Bernd; Friedel, Caroline C; Zimmer, Ralf; Mages, Jörg; Hoffmann, Reinhard; Dickinson, Paul; Forster, Thorsten; Ghazal, Peter; Koszinowski, Ulrich H

    2008-09-01

    RNA levels in a cell are determined by the relative rates of RNA synthesis and decay. State-of-the-art transcriptional analyses only employ total cellular RNA. Therefore, changes in RNA levels cannot be attributed to RNA synthesis or decay, and temporal resolution is poor. Recently, it was reported that newly transcribed RNA can be biosynthetically labeled for 1-2 h using thiolated nucleosides, purified from total cellular RNA and subjected to microarray analysis. However, in order to study signaling events at molecular level, analysis of changes occurring within minutes is required. We developed an improved approach to separate total cellular RNA into newly transcribed and preexisting RNA following 10-15 min of metabolic labeling. Employing new computational tools for array normalization and half-life determination we simultaneously study short-term RNA synthesis and decay as well as their impact on cellular transcript levels. As an example we studied the response of fibroblasts to type I and II interferons (IFN). Analysis of RNA transcribed within 15-30 min at different times during the first three hours of interferon-receptor activation resulted in a >10-fold increase in microarray sensitivity and provided a comprehensive profile of the kinetics of IFN-mediated changes in gene expression. We identify a previously undisclosed highly connected network of short-lived transcripts selectively down-regulated by IFNgamma in between 30 and 60 min after IFN treatment showing strong associations with cell cycle and apoptosis, indicating novel mechanisms by which IFNgamma affects these pathways.

  20. Concise total synthesis of (±)-actinophyllic acid

    PubMed Central

    Granger, Brett A.; Jewett, Ivan T.; Butler, Jeffrey D.; Martin, Stephen F.

    2014-01-01

    A concise total synthesis of the complex indole alkaloid (±)-actinophyllic acid was accomplished by a sequence of reactions requiring only 10 steps from readily-available, known starting materials. The approach featured a Lewis acid-catalyzed cascade of reactions involving stabilized carbocations that delivered the tetracyclic core of the natural product in a single chemical operation. Optimal conversion of this key intermediate into (±)-actinophyllic acid required judicious selection of a protecting group strategy. PMID:24882888

  1. Synthesis and Stability of Chloroplast Ribosomal—RNA's

    PubMed Central

    Ingle, J.

    1968-01-01

    The chloroplast ribosomal-RNAs (1.1 × 106 and 0.56 × 106 mol wt) are synthesized in the normal ratio of 2:1. The non-ribosomal distribution observed after extraction and fractionation results from the lability of the 1.1 × 106 component, and a correction for this breakdown can be applied in certain cases. Newly synthesized 1.1 × 106 RNA is more stable than the older accumulated 1.1 × 106 RNA. Accumulation of the chloroplast RNA during growth of radish cotyledons occurs at a later time than the accumulation of cytoplasmic RNA, and its turnover is much less than that of the cytoplasmic ribosomal-RNA. PMID:16656936

  2. [Effect of blue and red light on the synthesis of ribosomal RNA in Chlorella].

    PubMed

    Steup, M

    1975-10-27

    In autotrophic cultures of Chlorella pyrenoidosa (strain 211-8b) incorporation of tritiated guanosine and uridine into ribosomal RNA is stimulated by light. Blue light of wavelengths around 457 nm is considerably more effective than red light around 679 nm (5-10(-10) Einstein cm-2 sec-1 for both). This effect can be demonstrated for young daughter cells (at the end of the dark period) and for older cells (at the end of the light period). It is shown to depend on a regulation of rRNA-synthesis. The blue light dependent enhancement of incorporation is more pronounced in the cytoplasmic rRNA (25 and 18 s) than in the chloroplast rRNA (23 and 16 s). Blue light of low intensity (1-10(-10) Einstein cm-2 sec-1) has nearly the same effectivity as the fivefold intensity, whereas red light of equal quantum fluxes enhances incorporation only slightly compared with the dark control. The blue light dependent enhancement of rRNA-synthesis continues in the following darkness in contrary to that caused by red light. This enhancement is also found in DCMU-poisened cultures. In contrast to this, is red light in presence of DCMU, incorporation into rRNA is nearly the same as in dark. It is concluded that the regulation of rRNA-synthesis in red light is closely connected to complete photosynthesis, while in blue light an additional regulation takes place independent of photosynthesis.

  3. Protein synthesis in a cell-free system from an extreme thermophile. Effects of preincubation in the cold on polyuridylic acid-dependent polyphenylalanine synthesis at high temperature.

    PubMed

    Ohno-Iwashita, Y; Oshima, T; Imahori, K

    1976-06-01

    1. It was found that preincubation of the reaction mixture in the cold enhanced polyuridylic acid-directed polyphenylalanine synthesis by a cell-free extract of Thermus thermophilus HB8 at high temperature. 2. The effect of preincubation was most marked at 10-25 degrees in the presence of 20 mM Mg2+. Preincubation at 65 degrees failed to stimulate the incorporation. 3. The presence of phenylalanyl-tRNA, polyuridylic acid, and ribosomes was essential for preincubation in the cold to be effective. 4. A ternary complex of amino acyl-tRNA, polyuridylic acid, and a ribosome formed at low temperature was isolated by CPG-10 column chromatography; the isolated complex initiated polyphenylalanine synthesis effectively at high temperature. 5. The amount of the ternary complex formed depends on the preincubation time and the concentration of Mg2+. Since the amount of the complex correlated positively to the rate of polyphenylalanine synthesis at high temperature, the effectiveness of preincubation in the cold is presumably due to the formation of the ternary complex of phenylalanyl-tRNA, polyuridylic acid, and a ribosome.

  4. Efficient Automated Solid-Phase Synthesis of DNA and RNA 5'-Triphosphates.

    PubMed

    Sarac, Ivo; Meier, Chris

    2015-11-01

    A fast, high-yielding and reliable method for the synthesis of DNA- and RNA 5'-triphosphates is reported. After synthesizing DNA or RNA oligonucleotides by automated oligonucleotide synthesis, 5-chloro-saligenyl-N,N-diisopropylphosphoramidite was coupled to the 5'-end. Oxidation of the formed 5'-phosphite using the same oxidizing reagent used in standard oligonucleotide synthesis led to 5'-cycloSal-oligonucleotides. Reaction of the support-bonded 5'-cycloSal-oligonucleotide with pyrophosphate yielded the corresponding 5'-triphosphates. The 5'-triphosphorylated DNA and RNA oligonucleotides were obtained after cleavage from the support in high purity and excellent yields. The whole reaction sequence was adapted to be used on a standard oligonucleotide synthesizer.

  5. Rice yellow stunt rhabdovirus protein 6 suppresses systemic RNA silencing by blocking RDR6-mediated secondary siRNA synthesis.

    PubMed

    Guo, Hongyan; Song, Xiaoguang; Xie, Chuanmiao; Huo, Yan; Zhang, Fujie; Chen, Xiaoying; Geng, Yunfeng; Fang, Rongxiang

    2013-08-01

    The P6 protein of Rice yellow stunt rhabdovirus (RYSV) is a virion structural protein that can be phosphorylated in vitro. However its exact function remains elusive. We found that P6 enhanced the virulence of Potato virus X (PVX) in Nicotiana benthamiana and N. tabacum plants, suggesting that it might function as a suppressor of RNA silencing. We examined the mechanism of P6-mediated silencing suppression by transiently expressing P6 in both N. benthamiana leaves and rice protoplasts. Our results showed that P6 could repress the production of secondary siRNAs and inhibit systemic green fluorescent protein RNA silencing but did not interfere with local RNA silencing in N. benthamiana plants or in rice protoplasts. Intriguingly, P6 and RDR6 had overlapping subcellular localization and P6 bound both rice and Arabidopsis RDR6 in vivo. Furthermore, transgenic rice plants expressing P6 showed enhanced susceptibility to infection by Rice stripe virus. Hence, we propose that P6 is part of the RYSV's counter-defense machinery against the plant RNA silencing system and plays a role mainly in affecting RDR6-mediated secondary siRNA synthesis. Our work provides a new perspective on how a plant-infecting nucleorhabdovirus may counteract host RNA silencing-mediated antiviral defense.

  6. Fatty acid synthesis is inhibited by inefficient utilization of unusual fatty acids for glycerolipid assembly.

    PubMed

    Bates, Philip D; Johnson, Sean R; Cao, Xia; Li, Jia; Nam, Jeong-Won; Jaworski, Jan G; Ohlrogge, John B; Browse, John

    2014-01-21

    Degradation of unusual fatty acids through β-oxidation within transgenic plants has long been hypothesized as a major factor limiting the production of industrially useful unusual fatty acids in seed oils. Arabidopsis seeds expressing the castor fatty acid hydroxylase accumulate hydroxylated fatty acids up to 17% of total fatty acids in seed triacylglycerols; however, total seed oil is also reduced up to 50%. Investigations into the cause of the reduced oil phenotype through in vivo [(14)C]acetate and [(3)H]2O metabolic labeling of developing seeds surprisingly revealed that the rate of de novo fatty acid synthesis within the transgenic seeds was approximately half that of control seeds. RNAseq analysis indicated no changes in expression of fatty acid synthesis genes in hydroxylase-expressing plants. However, differential [(14)C]acetate and [(14)C]malonate metabolic labeling of hydroxylase-expressing seeds indicated the in vivo acetyl-CoA carboxylase activity was reduced to approximately half that of control seeds. Therefore, the reduction of oil content in the transgenic seeds is consistent with reduced de novo fatty acid synthesis in the plastid rather than fatty acid degradation. Intriguingly, the coexpression of triacylglycerol synthesis isozymes from castor along with the fatty acid hydroxylase alleviated the reduced acetyl-CoA carboxylase activity, restored the rate of fatty acid synthesis, and the accumulation of seed oil was substantially recovered. Together these results suggest a previously unidentified mechanism that detects inefficient utilization of unusual fatty acids within the endoplasmic reticulum and activates an endogenous pathway for posttranslational reduction of fatty acid synthesis within the plastid.

  7. Effects of bile acid administration on bile acid synthesis and its circadian rhythm in man

    SciTech Connect

    Pooler, P.A.; Duane, W.C.

    1988-09-01

    In man bile acid synthesis has a distinct circadian rhythm but the relationship of this rhythm to feedback inhibition by bile acid is unknown. We measured bile acid synthesis as release of 14CO2 from (26-14C)cholesterol every 2 hr in three normal volunteers during five separate 24-hr periods. Data were fitted by computer to a cosine curve to estimate amplitude and acrophase of the circadian rhythm. In an additional six volunteers, we measured synthesis every 2 hr from 8:00 a.m. to 4:00 p.m. only. During the control period, amplitude (expressed as percentage of mean synthesis) averaged 52% and acrophase averaged 6:49 a.m. During administration of ursodeoxycholic acid (15 mg per kg per day), synthesis averaged 126% of baseline (p less than 0.1), amplitude averaged 43% and acrophase averaged 6:20 a.m. During administration of chenodeoxycholic acid (15 mg per kg per day), synthesis averaged 43% of baseline (p less than 0.001), amplitude averaged 53% and acrophase averaged 9:04 a.m. Addition of prednisone to this regimen of chenodeoxycholic acid to eliminate release of 14CO2 from corticosteroid hormone synthesis resulted in a mean amplitude of 62% and a mean acrophase of 6:50 a.m., values very similar to those in the baseline period. Administration of prednisone alone also did not significantly alter the baseline amplitude (40%) or acrophase (6:28 a.m.). We conclude that neither chenodeoxycholic acid nor ursodeoxycholic acid significantly alters the circadian rhythm of bile acid synthesis in man.

  8. The synthesis of glutamic acid in the absence of enzymes: Implications for biogenesis

    NASA Technical Reports Server (NTRS)

    Morowitz, Harold; Peterson, Eta; Chang, Sherwood

    1995-01-01

    This paper reports on the non-enzymatic aqueous phase synthesis of amino acids from keto acids, ammonia and reducing agents. The facile synthesis of key metabolic intermediates, particularly in the glycolytic pathway, the citric acid cycle, and the first step of amino acid synthesis, lead to new ways of looking at the problem of biogenesis.

  9. Downregulation of de Novo Fatty Acid Synthesis in Subcutaneous Adipose Tissue of Moderately Obese Women

    PubMed Central

    Guiu-Jurado, Esther; Auguet, Teresa; Berlanga, Alba; Aragonès, Gemma; Aguilar, Carmen; Sabench, Fàtima; Armengol, Sandra; Porras, José Antonio; Martí, Andreu; Jorba, Rosa; Hernández, Mercè; del Castillo, Daniel; Richart, Cristóbal

    2015-01-01

    The purpose of this work was to evaluate the expression of fatty acid metabolism-related genes in human adipose tissue from moderately obese women. We used qRT-PCR and Western Blot to analyze visceral (VAT) and subcutaneous (SAT) adipose tissue mRNA expression involved in de novo fatty acid synthesis (ACC1, FAS), fatty acid oxidation (PPARα, PPARδ) and inflammation (IL6, TNFα), in normal weight control women (BMI < 25 kg/m2, n = 35) and moderately obese women (BMI 30–38 kg/m2, n = 55). In SAT, ACC1, FAS and PPARα mRNA expression were significantly decreased in moderately obese women compared to controls. The downregulation reported in SAT was more pronounced when BMI increased. In VAT, lipogenic-related genes and PPARα were similar in both groups. Only PPARδ gene expression was significantly increased in moderately obese women. As far as inflammation is concerned, TNFα and IL6 were significantly increased in moderate obesity in both tissues. Our results indicate that there is a progressive downregulation in lipogenesis in SAT as BMI increases, which suggests that SAT decreases the synthesis of fatty acid de novo during the development of obesity, whereas in VAT lipogenesis remains active regardless of the degree of obesity. PMID:26694359

  10. Effects of actinomycin D on brain RNA synthesis and discrimination learning in the goldfish (Carassius auratus).

    PubMed

    Ohi, S

    1977-08-01

    Intracranial injection of actinomycin D 2 microgram inhibited about 70% of the brain RNA synthesis from 3 hr to 4 days after injection in the goldfish. Under these conditions, fish were given 4-day-training of visual discrimination between a card with vertical stripes and one with horizontal stripes. Fish injected intracranially with actinomycin D showed deficits in between-day retention (long-term memory) but not interruption of within-day acquisition (short-term memory). It is suggested that brain RNA synthesis is necessary only for the formation of long-term memory but not short-term memory.

  11. Synaptic vesicles contain small ribonucleic acids (sRNAs) including transfer RNA fragments (trfRNA) and microRNAs (miRNA)

    PubMed Central

    Li, Huinan; Wu, Cheng; Aramayo, Rodolfo; Sachs, Matthew S.; Harlow, Mark L.

    2015-01-01

    Synaptic vesicles (SVs) are neuronal presynaptic organelles that load and release neurotransmitter at chemical synapses. In addition to classic neurotransmitters, we have found that synaptic vesicles isolated from the electric organ of Torpedo californica, a model cholinergic synapse, contain small ribonucleic acids (sRNAs), primarily the 5′ ends of transfer RNAs (tRNAs) termed tRNA fragments (trfRNAs). To test the evolutionary conservation of SV sRNAs we examined isolated SVs from the mouse central nervous system (CNS). We found abundant levels of sRNAs in mouse SVs, including trfRNAs and micro RNAs (miRNAs) known to be involved in transcriptional and translational regulation. This discovery suggests that, in addition to inducing changes in local dendritic excitability through the release of neurotransmitters, SVs may, through the release of specific trfRNAs and miRNAs, directly regulate local protein synthesis. We believe these findings have broad implications for the study of chemical synaptic transmission. PMID:26446566

  12. Synaptic vesicles contain small ribonucleic acids (sRNAs) including transfer RNA fragments (trfRNA) and microRNAs (miRNA).

    PubMed

    Li, Huinan; Wu, Cheng; Aramayo, Rodolfo; Sachs, Matthew S; Harlow, Mark L

    2015-01-01

    Synaptic vesicles (SVs) are neuronal presynaptic organelles that load and release neurotransmitter at chemical synapses. In addition to classic neurotransmitters, we have found that synaptic vesicles isolated from the electric organ of Torpedo californica, a model cholinergic synapse, contain small ribonucleic acids (sRNAs), primarily the 5' ends of transfer RNAs (tRNAs) termed tRNA fragments (trfRNAs). To test the evolutionary conservation of SV sRNAs we examined isolated SVs from the mouse central nervous system (CNS). We found abundant levels of sRNAs in mouse SVs, including trfRNAs and micro RNAs (miRNAs) known to be involved in transcriptional and translational regulation. This discovery suggests that, in addition to inducing changes in local dendritic excitability through the release of neurotransmitters, SVs may, through the release of specific trfRNAs and miRNAs, directly regulate local protein synthesis. We believe these findings have broad implications for the study of chemical synaptic transmission.

  13. Synaptic vesicles contain small ribonucleic acids (sRNAs) including transfer RNA fragments (trfRNA) and microRNAs (miRNA).

    PubMed

    Li, Huinan; Wu, Cheng; Aramayo, Rodolfo; Sachs, Matthew S; Harlow, Mark L

    2015-01-01

    Synaptic vesicles (SVs) are neuronal presynaptic organelles that load and release neurotransmitter at chemical synapses. In addition to classic neurotransmitters, we have found that synaptic vesicles isolated from the electric organ of Torpedo californica, a model cholinergic synapse, contain small ribonucleic acids (sRNAs), primarily the 5' ends of transfer RNAs (tRNAs) termed tRNA fragments (trfRNAs). To test the evolutionary conservation of SV sRNAs we examined isolated SVs from the mouse central nervous system (CNS). We found abundant levels of sRNAs in mouse SVs, including trfRNAs and micro RNAs (miRNAs) known to be involved in transcriptional and translational regulation. This discovery suggests that, in addition to inducing changes in local dendritic excitability through the release of neurotransmitters, SVs may, through the release of specific trfRNAs and miRNAs, directly regulate local protein synthesis. We believe these findings have broad implications for the study of chemical synaptic transmission. PMID:26446566

  14. Kinetic investigation of erucamide synthesis using fatty acid and urea.

    PubMed

    Awasthi, Neeraj Praphulla; Upadhayay, Santosh K; Singh, R P

    2008-01-01

    Fatty acid amides like erucamide are mainly used for lubrication and as slip agent to decrease friction in polymer and plastic industry. Erucamide is normally synthesized by ammonolysis of triglycerides or fatty acids at 200 degrees C and at high pressure (345-690 kPa.). However using urea in place of ammonia the economic synthesis of erucamide is possible at atmospheric pressure at approx 190 degrees C. In present investigation, the kinetics of synthesis of erucamide by ammonolysis of erucic acid has been investigated. The optimum conditions for the synthesis of erucamide have also been determined. 1:4 molar ratio of erucic acid to urea, 190 degrees C temperature and catalyst [P2O5 with (NH4)2H PO4, {(1:1) w/w }] concentration 3% (by wt. of erucic acid) were the optimum condition for synthesis of erucamide from erucic acid and can obtain a maximum yield of 92% of pure erucamide. Some other catalysts as titanium-iso -propoxide, phosphorus pent oxide were also tried but these catalysts were not economical. PMID:18685229

  15. Synthesis of Specifically Modified Oligonucleotides for Application in Structural and Functional Analysis of RNA

    PubMed Central

    Rublack, Nico; Nguyen, Hien; Appel, Bettina; Springstubbe, Danilo; Strohbach, Denise; Müller, Sabine

    2011-01-01

    Nowadays, RNA synthesis has become an essential tool not only in the field of molecular biology and medicine, but also in areas like molecular diagnostics and material sciences. Beyond synthetic RNAs for antisense, aptamer, ribozyme, and siRNA technologies, oligoribonucleotides carrying site-specific modifications for structure and function studies are needed. This often requires labeling of the RNA with a suitable spectroscopic reporter group. Herein, we describe the synthesis of functionalized monomer building blocks that upon incorporation in RNA allow for selective reaction with a specific reporter or functional entity. In particular, we report on the synthesis of 5′-O-dimethoxytrityl-2′-O-tert-butyldimethylsilyl protected 3′-O-phosphoramidites of nucleosides that carry amino linkers of different lengths and flexibility at the heterocyclic base, their incorporation in a variety of RNAs, and postsynthetic conjugation with fluorescent dyes and nitroxide spin labels. Further, we show the synthesis of a flavine mononucleotide-N-hydroxy-succinimidyl ester and its conjugation to amino functionalized RNA. PMID:22013508

  16. Synthesis of 5-Hydroxymethylcytidine- and 5-Hydroxymethyl-uridine-Modified RNA

    PubMed Central

    Riml, Christian; Micura, Ronald

    2016-01-01

    We report on the syntheses of 5-hydroxymethyl-uridine [5hm(rU)] and -cytidine [5hm(rC)] phosphoramidites and their incorporation into RNA by solid-phase synthesis. Deprotection of the oligonucleotides is accomplished in a straightforward manner using standard conditions, confirming the appropriateness of the acetyl protection used for the pseudobenzylic alcohol moieties. The approach provides robust access to 5hm(rC/U)-modified RNAs that await applications in pull-down experiments to identify potential modification enzymes. They will also serve as synthetic probes for the development of high-throughput-sequencing methods in native RNAs. 1Introduction2Protection Strategies Reported for the Synthesis of 5hm(dC)-Modified DNA3Synthesis of 5-Hydroxymethylpyrimidine-Modified RNA3.1Synthesis of 5hm(rC) Phosphoramidite3.2Synthesis of 5hm(rU) Phosphoramidite3.3Synthesis of 5hm(rC)- and 5hm(rU)-Modified RNA4Conclusions PMID:27413246

  17. Synthesis of α-aminoboronic acids.

    PubMed

    Andrés, Patricia; Ballano, Gema; Calaza, M Isabel; Cativiela, Carlos

    2016-04-21

    This review describes available methods for the preparation of α-aminoboronic acids in their racemic or in their enantiopure form. Both, highly stereoselective syntheses and asymmetric procedures leading to the stereocontrolled generation of α-aminoboronic acid derivatives are included. The preparation of acyclic, carbocyclic and azacyclic α-aminoboronic acid derivatives is covered. Within each section, the different synthetic approaches have been classified according to the key bond which is formed to complete the α-aminoboronic acid skeleton.

  18. Characterization of a catalytically efficient acidic RNA-cleaving deoxyribozyme.

    PubMed

    Kandadai, Srinivas A; Li, Yingfu

    2005-01-01

    We previously demonstrated--through the isolation of RNA-cleaving deoxyribozymes by in vitro selection that are catalytically active in highly acidic solutions--that DNA, despite its chemical simplicity, could perform catalysis under challenging chemical conditions [Liu,Z., Mei,S.H., Brennan,J.D. and Li,Y. (2003) J. Am. Chem. Soc. 125, 7539-7545]. One remarkable DNA molecule therefrom is pH4DZ1, a self-cleaving deoxyribozyme that exhibits a k(obs) of approximately 1 min(-1) at pH 3.8. In this study, we carried out a series of experiments to examine the sequence and catalytic properties of this acidic deoxyribozyme. Extensive nucleotide truncation experiments indicated that pH4DZ1 was a considerably large deoxyribozyme, requiring approximately 80 out of the original 123 nt for the optimal catalytic activity. A reselection experiment identified ten absolutely conserved nucleotides that are distributed in three catalytically crucial sequence elements. In addition, a trans deoxyribozyme was successfully designed. Comparison of the observed rate constant of pH4DZ1 with experimentally determined rate constant for the uncatalyzed reaction revealed that pH4DZ1 achieved a rate enhancement of approximately 10(6)-fold. This study provides valuable information about this low-pH-functional deoxyribozyme and paves way for further structural and mechanistic characterization of this unique catalytic DNA. PMID:16391005

  19. Regulation of collagen synthesis by ascorbic acid.

    PubMed Central

    Murad, S; Grove, D; Lindberg, K A; Reynolds, G; Sivarajah, A; Pinnell, S R

    1981-01-01

    After prolonged exposure to ascorbate, collagen synthesis in cultured human skin fibroblasts increased approximately 8-fold with no significant change in synthesis of noncollagen protein. This effect of ascorbate appears to be unrelated to its cofactor function in collagen hydroxylation. The collagenous protein secreted in the absence of added ascorbate was normal in hydroxylysine but was mildly deficient in hydroxyproline. In parallel experiments, lysine hydroxylase (peptidyllysine, 2-oxoglutarate:oxygen 5-oxidoreductase, EC 1.14.11.4) activity increased 3-fold in response to ascorbate administration whereas proline hydroxylase (prolyl-glycyl-peptide, 2-oxoglutarate:oxygen oxidoreductase, EC 1.14.11.2) activity decreased considerably. These results suggest that collage polypeptide synthesis, posttranslational hydroxylations, and activities of the two hydroxylases are independently regulated by ascorbate. PMID:6265920

  20. Synthesis of Triamino Acid Building Blocks with Different Lipophilicities

    PubMed Central

    Maity, Jyotirmoy; Honcharenko, Dmytro; Strömberg, Roger

    2015-01-01

    To obtain different amino acids with varying lipophilicity and that can carry up to three positive charges we have developed a number of new triamino acid building blocks. One set of building blocks was achieved by aminoethyl extension, via reductive amination, of the side chain of ortnithine, diaminopropanoic and diaminobutanoic acid. A second set of triamino acids with the aminoethyl extension having hydrocarbon side chains was synthesized from diaminobutanoic acid. The aldehydes needed for the extension by reductive amination were synthesized from the corresponding Fmoc-L-2-amino fatty acids in two steps. Reductive amination of these compounds with Boc-L-Dab-OH gave the C4-C8 alkyl-branched triamino acids. All triamino acids were subsequently Boc-protected at the formed secondary amine to make the monomers appropriate for the N-terminus position when performing Fmoc-based solid-phase peptide synthesis. PMID:25876040

  1. Lipid-assisted Synthesis of RNA-like Polymers from Mononucleotides

    NASA Astrophysics Data System (ADS)

    Rajamani, Sudha; Vlassov, Alexander; Benner, Seico; Coombs, Amy; Olasagasti, Felix; Deamer, David

    2008-02-01

    A fundamental problem in research on the origin of life is the process by which polymers capable of catalysis and replication were produced on the early Earth. Here we show that RNA-like polymers can be synthesized non-enzymatically from mononucleotides in lipid environments. The RNA-like polymers were initially identified by nanopore analysis, a technique with single molecule sensitivity. To our knowledge, this is the first such application of a nanopore instrument to detect RNA synthesis under simulated prebiotic conditions. The synthesis of the RNA-like polymers was confirmed by standard methods of enzymatic end labeling followed by gel electrophoresis. Chemical activation of the mononucleotides is not required. Instead, synthesis of phosphodiester bonds is driven by the chemical potential of fluctuating anhydrous and hydrated conditions, with heat providing activation energy during dehydration. In the final hydration step, the RNA-like polymer is encapsulated within lipid vesicles. This process provides a laboratory model of an early stage of evolution toward an RNA World.

  2. Upregulated mRNA expression of desaturase and elongase, two enzymes involved in highly unsaturated fatty acids biosynthesis pathways during follicle maturation in zebrafish

    PubMed Central

    Ishak, Sairatul D; Tan, Sze-Huey; Khong, Hou-Keat; Jaya-Ram, Annette; Enyu, Yee-Ling; Kuah, Meng-Kiat; Shu-Chien, Alexander Chong

    2008-01-01

    Background Although unsaturated fatty acids such as eicosapentaenoic acid (EPA, C20:5n-3), docosahexaenoic acid (DHA, C22:6n-3) and arachidonic acid (ARA, C20:4n-6), collectively known as the highly unsaturated fatty acids (HUFA), play pivotal roles in vertebrate reproduction, very little is known about their synthesis in the ovary. The zebrafish (Danio rerio) display capability to synthesize all three HUFA via pathways involving desaturation and elongation of two precursors, the linoleic acid (LA, C18:2n-6) and linolenic acid (LNA, C18:3n-3). As a prerequisite to gain full understanding on the importance and regulation of ovarian HUFA synthesis, we described here the mRNA expression pattern of two enzymes; desaturase (fadsd6) and elongase (elovl5), involved in HUFA biosynthesis pathway, in different zebrafish ovarian follicle stages. Concurrently, the fatty acid profile of each follicle stage was also analyzed. Methods mRNA levels of fadsd6 and elovl5 in different ovarian follicle stages were determined by semi-quantitative reverse transcription-polymerase chain reaction (RT-PCR) assays. For analysis of the ovarian follicular fatty acid composition, gas chromatography was used. Results Our results have shown that desaturase displayed significant upregulation in expression during the oocyte maturation stage. Expression of elongase was significantly highest in pre-vitellogenic follicles, followed by maturation stage. Fatty acid composition analysis of different ovarian follicle stages also showed that ARA level was significantly highest in pre-vitellogenic and matured follicles. DHA level was highest in both late vitellogenic and maturation stage. Conclusion Collectively, our findings seem to suggest the existence of a HUFA synthesis system, which could be responsible for the synthesis of HUFA to promote oocyte maturation and possibly ovulation processes. The many advantages of zebrafish as model system to understand folliculogenesis will be useful platform to

  3. [RNA synthesis gradients in the nucleus-free fragments of Acetabularia mediterranea under conditions of local illumination].

    PubMed

    Pikalov, A V; Gorbunova, E E; Naumova, G A; Sandakhchiev, L S; Stefanovich, L E

    1977-01-01

    The intensity of RNA synthesis was studied in different regions of anuclear fragments of the Acetabularia mediterranea stem under their local illumination. The local illumination was shown to activate RNA synthesis and formation of distal-medial gradients of this synthesis in the illuminated regions of the fragments to a much greater extent than in their darkened regions. The formation of the gradient in the illuminated region took place even if the growth in this region was insignificant and was not accompanied by the cap formation. The results obtained suggests the absence of obligatory correspondence between the ability of morphogenesis and the gradient of RNA synthesis.

  4. Reduced secreted mu mRNA synthesis in selective IgM deficiency of Bloom's syndrome.

    PubMed Central

    Kondo, N; Ozawa, T; Kato, Y; Motoyoshi, F; Kasahara, K; Kameyama, T; Orii, T

    1992-01-01

    Serum IgM concentrations were low although serum IgG and IgA concentrations were normal in both our patients with Bloom's syndrome. Although the percentages of surface IgM-bearing cells were not reduced, the numbers of IgM-secreting cells were markedly reduced. The membrane-bound mu (microns) and secreted mu (microseconds) mRNAs are produced from transcripts of a single immunoglobulin mu gene by alternative RNA processing pathways. The control of microseconds mRNA synthesis depends on the addition of poly(A) to microseconds C-terminal segment. In both patients, mu mRNA was well detected but microseconds C-terminal mRNA was scarcely detected, suggesting that microns mRNA was well transcribed but microseconds mRNA was not. There was, at least, no mutation or deletion in the microseconds C-terminal coding sequence, the RNA splice site (GG/TAAAC) at the 5' end of microseconds C-terminal segment and the AATAAA poly(A) signal sequence in both patients. Our results suggest that selective IgM deficiency in Bloom's syndrome is due to an abnormality in the maturation of surface IgM-bearing B cells into IgM-secreting cells and a failure of microseconds mRNA synthesis. Moreover, reduced microseconds mRNA synthesis may be due to the defect on developmental regulation of the site at which poly(A) is added to transcripts of the mu gene. Images Fig. 2 PMID:1563106

  5. Hormonal Control of Enzyme Synthesis: On the Mode of Action of Gibberellic Acid and Abscisin in Aleurone Layers of Barley 1

    PubMed Central

    Chrispeels, Maarten J.; Varner, J. E.

    1967-01-01

    Gibberellic acid (GA) enhances the synthesis of α-amylase and ribonuclease in isolated aleurone layers and this process is inhibited by abscisin. Removal of gibberellic acid in mid-course of α-amylase production results in a slowing down of α-amylase synthesis, suggesting a continued requirement of GA for enzyme synthesis. This is paralleled by a continuous requirement for RNA synthesis. Addition of 6-methylpurine or 8-azaguanine in mid-course results in an inhibition of α-amylase synthesis within 3 to 4 hours. However, actinomycin D added in mid-course is almost without effect. This is not due to its failure to enter the cells, because it does inhibit 14C-uridine incorporation at this stage. Addition of abscisin to aleurone layers which are synthesizing α-amylase results in an inhibition of this synthesis within 2 to 3 hours. Cycloheximide on the other hand inhibits enzyme synthesis immediately upon its addition. These data are consistent with the hypothesis that the expression of the GA effect requires the synthesis of enzyme-specific RNA molecules. The similarity in the kinetics of inhibition between abscisin on the one hand and 8-azaguanine or 6-methylpurine on the other suggests that abscisin may exert its action by inhibiting the synthesis of these enzyme-specific RNA molecules or by preventing their incorporation into an active enzyme-synthesising unit. PMID:16656590

  6. Lipase-catalyzed synthesis of fatty acid amide (erucamide) using fatty acid and urea.

    PubMed

    Awasthi, Neeraj Praphulla; Singh, R P

    2007-01-01

    Ammonolysis of fatty acids to the corresponding fatty acid amides is efficiently catalysed by Candida antartica lipase (Novozym 435). In the present paper lipase-catalysed synthesis of erucamide by ammonolysis of erucic acid and urea in organic solvent medium was studied and optimal conditions for fatty amides synthesis were established. In this process erucic acid gave 88.74 % pure erucamide after 48 hour and 250 rpm at 60 degrees C with 1:4 molar ratio of erucic acid and urea, the organic solvent media is 50 ml tert-butyl alcohol (2-methyl-2-propanol). This process for synthesis is economical as we used urea in place of ammonia or other amidation reactant at atmospheric pressure. The amount of catalyst used is 3 %.

  7. Lipase-catalyzed synthesis of fatty acid amide (erucamide) using fatty acid and urea.

    PubMed

    Awasthi, Neeraj Praphulla; Singh, R P

    2007-01-01

    Ammonolysis of fatty acids to the corresponding fatty acid amides is efficiently catalysed by Candida antartica lipase (Novozym 435). In the present paper lipase-catalysed synthesis of erucamide by ammonolysis of erucic acid and urea in organic solvent medium was studied and optimal conditions for fatty amides synthesis were established. In this process erucic acid gave 88.74 % pure erucamide after 48 hour and 250 rpm at 60 degrees C with 1:4 molar ratio of erucic acid and urea, the organic solvent media is 50 ml tert-butyl alcohol (2-methyl-2-propanol). This process for synthesis is economical as we used urea in place of ammonia or other amidation reactant at atmospheric pressure. The amount of catalyst used is 3 %. PMID:17898456

  8. Synthesis of Poly Linear shRNA Expression Cassettes Through Branch-PCR.

    PubMed

    Liu, Jianbing; Xi, Zhen

    2016-01-01

    A facile and universal strategy to construct the poly linear small hairpin RNA (shRNA) expression cassettes with multiple shRNA transcription templates through polymerase chain reaction with flexible branched primers (branch-PCR) is described in this protocol. Double-stranded RNA (dsRNA) is not stable enough for the study of RNA interference (RNAi) delivery in mammalian cells. Therefore, the more stable shRNA transcription template is employed to produce the endogenous transcribed dsRNA. Then, the covalent crosslinked linear shRNA expression cassettes are constructed through the branch-PCR for the long-lasting RNAi effect in this protocol. The branched primer pair is efficiently synthesized through classic click chemistry. In one step of PCR, the much more stable poly linear shRNA expression cassettes can be produced in large scale. This strategy of efficient synthesis of the poly linear gene expression cassettes can also be applied in the field for other target gene delivery. © 2016 by John Wiley & Sons, Inc. PMID:27584702

  9. Synthesis and antituberculosis activity of new fatty acid amides.

    PubMed

    D'Oca, Caroline Da Ros Montes; Coelho, Tatiane; Marinho, Tamara Germani; Hack, Carolina Rosa Lopes; Duarte, Rodrigo da Costa; da Silva, Pedro Almeida; D'Oca, Marcelo Gonçalves Montes

    2010-09-01

    This work reports the synthesis of new fatty acid amides from C16:0, 18:0, 18:1, 18:1 (OH), and 18:2 fatty acids families with cyclic and acyclic amines and demonstrate for the first time the activity of these compounds as antituberculosis agents against Mycobacterium tuberculosis H(37)Rv, M. tuberculosis rifampicin resistance (ATCC 35338), and M. tuberculosis isoniazid resistance (ATCC 35822). The fatty acid amides derivate from ricinoleic acid were the most potent one among a series of tested compounds, with a MIC 6.25 microg/mL for resistance strains.

  10. A comparison of RNA with DNA in template-directed synthesis

    NASA Technical Reports Server (NTRS)

    Zielinski, M.; Kozlov, I. A.; Orgel, L. E.; Bada, J. L. (Principal Investigator)

    2000-01-01

    Nonenzymatic template-directed copying of RNA sequences rich in cytidylic acid using nucleoside 5'-(2-methylimidazol-1-yl phosphates) as substrates is substantially more efficient than the copying of corresponding DNA sequences. However, many sequences cannot be copied, and the prospect of replication in this system is remote, even for RNA. Surprisingly, wobble-pairing leads to much more efficient incorporation of G opposite U on RNA templates than of G opposite T on DNA templates.

  11. Effect of epinephrine and serotonin on hepatic poly(A)/sup +/ RNA synthesis

    SciTech Connect

    Roy, A.K.; Bhadra, R.; Datta, A.G.

    1985-06-17

    In vivo administration of epinephrine or serotonin has been shown to stimulate the incorporation of /sup 14/C-orotic acid into Poly(A)/sup +/ RNA. However, only epinephrine and not serotonin could stimulate DNA dependent RNA polymerase activity of isolated hepatic nuclei in in vitro experiments. 21 references, 1 figure, 3 tables.

  12. Role of the 3′ tRNA-Like Structure in Tobacco Mosaic Virus Minus-Strand RNA Synthesis by the Viral RNA-Dependent RNA Polymerase In Vitro

    PubMed Central

    Osman, T. A. M.; Hemenway, C. L.; Buck, K. W.

    2000-01-01

    A template-dependent RNA polymerase has been used to determine the sequence elements in the 3′ untranslated region of tobacco mosaic virus RNA that are required for promotion of minus-strand RNA synthesis and binding to the RNA polymerase in vitro. Regions which were important for minus-strand synthesis were domain D1, which is equivalent to a tRNA acceptor arm; domain D2, which is similar to a tRNA anticodon arm; an upstream domain, D3; and a central core, C, which connects domains D1, D2, and D3 and determines their relative orientations. Mutational analysis of the 3′-terminal 4 nucleotides of domain D1 indicated the importance of the 3′-terminal CA sequence for minus-strand synthesis, with the sequence CCCA or GGCA giving the highest transcriptional efficiency. Several double-helical regions, but not their sequences, which are essential for forming pseudoknot and/or stem-loop structures in domains D1, D2, and D3 and the central core, C, were shown to be required for high template efficiency. Also important were a bulge sequence in the D2 stem-loop and, to a lesser extent, a loop sequence in a hairpin structure in domain D1. The sequence of the 3′ untranslated region upstream of domain D3 was not required for minus-strand synthesis. Template-RNA polymerase binding competition experiments showed that the highest-affinity RNA polymerase binding element region lay within a region comprising domain D2 and the central core, C, but domains D1 and D3 also bound to the RNA polymerase with lower affinity. PMID:11090166

  13. Synthesis of biobased succinonitrile from glutamic acid and glutamine.

    PubMed

    Lammens, Tijs M; Le Nôtre, Jérôme; Franssen, Maurice C R; Scott, Elinor L; Sanders, Johan P M

    2011-06-20

    Succinonitrile is the precursor of 1,4-diaminobutane, which is used for the industrial production of polyamides. This paper describes the synthesis of biobased succinonitrile from glutamic acid and glutamine, amino acids that are abundantly present in many plant proteins. Synthesis of the intermediate 3-cyanopropanoic amide was achieved from glutamic acid 5-methyl ester in an 86 mol% yield and from glutamine in a 56 mol % yield. 3-Cyanopropanoic acid can be converted into succinonitrile, with a selectivity close to 100% and a 62% conversion, by making use of a palladium(II)-catalyzed equilibrium reaction with acetonitrile. Thus, a new route to produce biobased 1,4-diaminobutane has been discovered. PMID:21557494

  14. The Riia Gene of Bacteriophage T4. II. Regulation of Its Messenger RNA Synthesis

    PubMed Central

    Daegelen, P.; Brody, E.

    1990-01-01

    When the rII genes are first introduced into cells which had been previously infected by T4 phage deleted for these genes, the kinetics of synthesis of rIIA and rIIB RNA are rapid and identical. We show that this rapid synthesis depends on a functional motA gene for rIIB, but not for rIIA, RNA synthesis. By primer-extension mapping of T4 messenger RNA, we find three promoters close to the rIIA gene. One of them is an early promoter just before the rIIA.1 gene; it is used under all conditions tested. Another is in the coding portion of the rIIA.1 gene; it is weak, primarily because of a 19-bp spacing between the -10 and -35 elements, and its use is stimulated by T4 functions. The third is a motA-dependent (middle) promoter which has an unusual CCCGCTT box at -33. We present results which suggest that none of these promoters is likely to be the site at which the motB and motC gene products exercise their major influence on rIIA RNA synthesis. PMID:2379818

  15. Regulation of RNA Synthesis in Fibroblasts During Transition from Resting to Growing State

    PubMed Central

    Mauck, John C.; Green, Howard

    1973-01-01

    Addition of serum, containing fibroblast growth factors, to a culture of resting 3T6 cells stimulates a transition to the growing state. Studies of ghost monolayers prepared with the aid of detergent at intervals after stimulation showed an increase in the rate of ribosomal RNA synthesis within 10 min. The rate continued to increase for many hours and reached a level 2.5- to 3.5-fold higher by the time DNA synthesis began. The increasing rate of ribosomal RNA synthesis appeared independent of an increase in the number of ribosomal genes, since it was not affected by prevention of DNA synthesis with cytosine arabinoside. In contrast to ribosomal RNA, the overall rate of transscription of heterogeneous nuclear RNA was not directly affected by serum growth factors and does not appear to be regulated during the transition from resting to growing state. It seems, instead, to be fixed in relation to the amount of template, for it increases proportionally to DNA content. PMID:4517934

  16. Inhibition of RNA synthesis in vitro by acridines--relation between structure and activity.

    PubMed

    Piestrzeniewicz, M K; Wilmańska, D; Studzian, K; Szemraj, J; Czyz, M; Denny, W A; Gniazdowski, M

    1998-01-01

    The effects of acridine derivatives (proflavine and 2,7-dialkyl derivatives, diacridines and triacridines, 9-aminoacridine carboxamides, and 9-anilinoacridine, amsacrine and its congeners) on overall RNA synthesis in vitro, on synthesis of initiating oligonucleotides and the binding of the enzyme to DNA were studied. The primary mechanism of action is related to inhibition of the enzyme binding to DNA. The acridines (intercalating or non-intercalating and bis-intercalating ligands) assayed here differ in the properties of their complexes with DNA. Correlation is generally observed between inhibition of RNA synthesis in vitro and cytotoxicity in cell cultures for di- and triacridines and 9-aminoacridine carboxamide derivatives. No relationship was found between the effect on RNA polymerase system and biological effects for amsacrine and its derivatives in contrast to the other series of acridines studied here. The aniline ring seems to decrease the inhibitory potency of a ligand. The discrepancy between the biological effect and RNA synthesis inhibition may be due to a different mechanism of cytotoxicity action of amsacrine which is a potent topoisomerase II poison. PMID:9679327

  17. Stereoselective synthesis of unsaturated α-amino acids.

    PubMed

    Fanelli, Roberto; Jeanne-Julien, Louis; René, Adeline; Martinez, Jean; Cavelier, Florine

    2015-06-01

    Stereoselective synthesis of unsaturated α-amino acids was performed by asymmetric alkylation. Two methods were investigated and their enantiomeric excess measured and compared. The first route consisted of an enantioselective approach induced by the Corey-Lygo catalyst under chiral phase transfer conditions while the second one involved the hydroxypinanone chiral auxiliary, both implicating Schiff bases as substrate. In all cases, the use of a prochiral Schiff base gave higher enantiomeric excess and yield in the final desired amino acid.

  18. In situ synthesis of peptide nucleic acids in porous silicon for drug delivery and biosensing.

    PubMed

    Beavers, Kelsey R; Mares, Jeremy W; Swartz, Caleb M; Zhao, Yiliang; Weiss, Sharon M; Duvall, Craig L

    2014-07-16

    Peptide nucleic acids (PNA) are a unique class of synthetic molecules that have a peptide backbone and can hybridize with nucleic acids. Here, a versatile method has been developed for the automated, in situ synthesis of PNA from a porous silicon (PSi) substrate for applications in gene therapy and biosensing. Nondestructive optical measurements were performed to monitor single base additions of PNA initiated from (3-aminopropyl)triethoxysilane attached to the surface of PSi films, and mass spectrometry was conducted to verify synthesis of the desired sequence. Comparison of in situ synthesis to postsynthesis surface conjugation of the full PNA molecules showed that surface mediated, in situ PNA synthesis increased loading 8-fold. For therapeutic proof-of-concept, controlled PNA release from PSi films was characterized in phosphate buffered saline, and PSi nanoparticles fabricated from PSi films containing in situ grown PNA complementary to micro-RNA (miR) 122 generated significant anti-miR activity in a Huh7 psiCHECK-miR122 cell line. The applicability of this platform for biosensing was also demonstrated using optical measurements that indicated selective hybridization of complementary DNA target molecules to PNA synthesized in situ on PSi films. These collective data confirm that we have established a novel PNA-PSi platform with broad utility in drug delivery and biosensing.

  19. Synthesis and RNA polymerase incorporation of the degenerate ribonucleotide analogue rPTP.

    PubMed Central

    Moriyama, K; Negishi, K; Briggs, M S; Smith, C L; Hill, F; Churcher, M J; Brown, D M; Loakes, D

    1998-01-01

    The synthesis and enzymatic incorporation into RNA of the hydrogen bond degenerate nucleoside analogue 6-(beta-d-ribofuranosyl)-3, 4-dihydro-8H-pyrimido[4,5-c]-[1,2]oxazin-7-one (P) is described. The 5'-triphosphate of this analogue is readily incorporated by T3, T7 and SP6 RNA polymerases into RNA transcripts, being best incorporated in place of UTP, but also in place of CTP. When all the uridine residues in an HIV-1 TAR RNA transcript are replaced by P the transcript has similar characteristics to the wild-type TAR RNA, as demonstrated by similar melting temperatures and CD spectra. The P-substituted TAR transcript binds to the Tat peptide ADP-1 with only 4-fold lowered efficiency compared with wild-type TAR. PMID:9547267

  20. West Nile virus replication requires fatty acid synthesis but is independent on phosphatidylinositol-4-phosphate lipids.

    PubMed

    Martín-Acebes, Miguel A; Blázquez, Ana-Belén; Jiménez de Oya, Nereida; Escribano-Romero, Estela; Saiz, Juan-Carlos

    2011-01-01

    West Nile virus (WNV) is a neurovirulent mosquito-borne flavivirus, which main natural hosts are birds but it also infects equines and humans, among other mammals. As in the case of other plus-stranded RNA viruses, WNV replication is associated to intracellular membrane rearrangements. Based on results obtained with a variety of viruses, different cellular processes have been shown to play important roles on these membrane rearrangements for efficient viral replication. As these processes are related to lipid metabolism, fatty acid synthesis, as well as generation of a specific lipid microenvironment enriched in phosphatidylinositol-4-phosphate (PI4P), has been associated to it in other viral models. In this study, intracellular membrane rearrangements following infection with a highly neurovirulent strain of WNV were addressed by means of electron and confocal microscopy. Infection of WNV, and specifically viral RNA replication, were dependent on fatty acid synthesis, as revealed by the inhibitory effect of cerulenin and C75, two pharmacological inhibitors of fatty acid synthase, a key enzyme of this process. However, WNV infection did not induce redistribution of PI4P lipids, and PI4P did not localize at viral replication complex. Even more, WNV multiplication was not inhibited by the use of the phosphatidylinositol-4-kinase inhibitor PIK93, while infection by the enterovirus Coxsackievirus B5 was reduced. Similar features were found when infection by other flavivirus, the Usutu virus (USUV), was analyzed. These features of WNV replication could help to design specific antiviral approaches against WNV and other related flaviviruses.

  1. Targeting pre-miRNA by Peptide Nucleic Acids

    PubMed Central

    Avitabile, Concetta; Saviano, Michele; D'Andrea, Luca; Bianchi, Nicoletta; Fabbri, Enrica; Brognara, Eleonora; Gambari, Roberto; Romanelli, Alessandra

    2012-01-01

    PNAs conjugated to carrier peptides have been employed for the targeting of miRNA precursor, with the aim to develop molecules able to interfere in the pre-miRNA processing. The capability of the molecules to bind pre-miRNA has been tested in vitro by fluorescence assayes on Thiazole Orange labeled molecules and in vivo, in K562 cells, evaluating the amount of miRNA produced after treatment of cells with two amounts of PNAs. PMID:22699795

  2. Synthesis of sulfonate analogs of bile acids.

    PubMed

    Kihira, K; Mikami, T; Ikawa, S; Okamoto, A; Yoshii, M; Miki, S; Mosbach, E H; Hoshita, T

    1992-04-01

    Sulfonate analogs of C23 and C24 bile acids were synthesized from norcholic, norchenodeoxycholic, norursodeoxycholic, nordeoxycholic, norhyodeoxycholic, cholic, deoxycholic, hyodeoxycholic, and lithocholic acids. The principal reactions used were (1) reduction of the bile acids with NaBH4 to the corresponding bile alcohols, (2) selective tosylation of the terminal hydroxyl group, (3) iodination of the tosyl esters with NaI, and (4) treatment of the iodides with Na2SO3 to form the sulfonate analogs of the bile acids. The sulfonate analogs showed polarity similar to that of taurine-conjugated bile acids on thin-layer chromatography. The carbon 13 nuclear magnetic resonance spectral data for the sulfonate analogs were tabulated.

  3. Efficient synthesis of stably adenylated DNA and RNA adapters for microRNA capture using T4 RNA ligase 1.

    PubMed

    Song, Yunke; Liu, Kelvin J; Wang, Tza-Huei

    2015-01-01

    MicroRNA profiling methods have become increasingly important due to the rapid rise of microRNA in both basic and translational sciences. A critical step in many microRNA profiling assays is adapter ligation using pre-adenylated adapters. While pre-adenylated adapters can be chemically or enzymatically prepared, enzymatic adenylation is preferred due to its ease and high yield. However, previously reported enzymatic methods either require tedious purification steps or use thermostable ligases that can generate side products during the subsequent ligation step. We have developed a highly efficient, template- and purification-free, adapter adenylation method using T4 RNA ligase 1. This method is capable of adenylating large amounts of adapter at ~100% efficiency and can efficiently adenylate both DNA and RNA bases. We find that the adenylation reaction speed can differ between DNA and RNA and between terminal nucleotides, leading to bias if reactions are not allowed to run to completion. We further find that the addition of high PEG levels can effectively suppress these differences.

  4. Synthesis of poly(A)-containing RNA by isolated spinach chloroplasts.

    PubMed

    Bartolf, M; Price, C A

    1979-05-01

    Chloroplasts were isolated from spinach leaves and the intact chloroplasts separated by centrifugation on gradients of silica sol. Chloroplasts prepared in this way were almost completely free of cytoplasmic rRNA. The purified chloroplasts were incubated with 32PO4 in the light. The nucleic acids were then extracted and the RNA was fractionated into poly(A)-lacking RNA and poly(A)-containing RNA (poly(A)-RNA) via oligo(dT)-cellulose chromatography. The poly(A)-RNA had a mean size of approximately 18--20 S as determined by polyacrylamide gel electrophoresis. The poly(A)-RNA was digested with RNase A and RNase T1, and the resulting poly(A) segments were subjected to electrophoresis on a 10% w/v polyacrylamide gel 98% v/v formamide). Radioactivity was incorporated into both poly(A)-RNA and poly(A)-lacking RNA and into the poly(A) segments themselves. The poly(A) segments were between 10 and 45 residues long and alkaline hydrolysis of poly(A) segments followed by descending paper chromatography showed that they were composed primarily of adenine residues. There was no 32PO4 incorporation into acid-insoluble material in the dark. We conclude that isolated chloroplasts are capable of synthesizing poly(A)-RNA. PMID:435477

  5. The spark discharge synthesis of amino acids from various hydrocarbons

    NASA Technical Reports Server (NTRS)

    Ring, D.; Miller, S. L.

    1984-01-01

    The spark discharge synthesis of amino acids using an atmosphere of CH4+N2+H2O+NH3 has been investigated with variable pNH3. The amino acids produced using higher hydrocarbons (ethane, ethylene, acetylene, propane, butane, and isobutane) instead of CH4 were also investigated. There was considerable range in the absolute yields of amino acids, but the yields relative to glycine (or alpha-amino-n-butyric acid) were more uniform. The relative yields of the C3 to C6 aliphatic alpha-amino acids are nearly the same (with a few exceptions) with all the hydrocarbons. The glycine yields are more variable. The precursors to the C3-C6 aliphatic amino acids seem to be produced in the same process, which is separate from the synthesis of glycine precursors. It may be possible to use these relative yields as a signature for a spark discharge synthesis provided corrections can be made for subsequent decomposition events (e.g. in the Murchison meteorite).

  6. Coordinated regulation of synthesis and stability of RNA during the acute TNF-induced proinflammatory response

    PubMed Central

    Paulsen, Michelle T.; Veloso, Artur; Prasad, Jayendra; Bedi, Karan; Ljungman, Emily A.; Tsan, Ya-Chun; Chang, Ching-Wei; Tarrier, Brendan; Washburn, Joseph G.; Lyons, Robert; Robinson, Daniel R.; Kumar-Sinha, Chandan; Wilson, Thomas E.; Ljungman, Mats

    2013-01-01

    Steady-state gene expression is a coordination of synthesis and decay of RNA through epigenetic regulation, transcription factors, micro RNAs (miRNAs), and RNA-binding proteins. Here, we present bromouride labeling and sequencing (Bru-Seq) and bromouridine pulse-chase and sequencing (BruChase-Seq) to assess genome-wide changes to RNA synthesis and stability in human fibroblasts at homeostasis and after exposure to the proinflammatory tumor necrosis factor (TNF). The inflammatory response in human cells involves rapid and dramatic changes in gene expression, and the Bru-Seq and BruChase-Seq techniques revealed a coordinated and complex regulation of gene expression both at the transcriptional and posttranscriptional levels. The combinatory analysis of both RNA synthesis and stability using Bru-Seq and BruChase-Seq allows for a much deeper understanding of mechanisms of gene regulation than afforded by the analysis of steady-state total RNA and should be useful in many biological settings. PMID:23345452

  7. Codon-specific and general inhibition of protein synthesis by the tRNA-sequestering minigenes.

    PubMed

    Delgado-Olivares, Luis; Zamora-Romo, Efraín; Guarneros, Gabriel; Hernandez-Sanchez, Javier

    2006-07-01

    The expression of minigenes in bacteria inhibits protein synthesis and cell growth. Presumably, the translating ribosomes, harboring the peptides as peptidyl-tRNAs, pause at the last sense codon of the minigene directed mRNAs. Eventually, the peptidyl-tRNAs drop off and, under limiting activity of peptidyl-tRNA hydrolase, accumulate in the cells reducing the concentration of specific aminoacylable tRNA. Therefore, the extent of inhibition is associated with the rate of starvation for a specific tRNA. Here, we used minigenes harboring various last sense codons that sequester specific tRNAs with different efficiency, to inhibit the translation of reporter genes containing, or not, these codons. A prompt inhibition of the protein synthesis directed by genes containing the codons starved for their cognate tRNA (hungry codons) was observed. However, a non-specific in vitro inhibition of protein synthesis, irrespective of the codon composition of the gene, was also evident. The degree of inhibition correlated directly with the number of hungry codons in the gene. Furthermore, a tRNA(Arg4)-sequestering minigene promoted the production of an incomplete beta-galactosidase polypeptide interrupted, during bacterial polypeptide chain elongation at sites where AGA codons were inserted in the lacZ gene suggesting ribosome pausing at the hungry codons.

  8. The “Speedy” Synthesis of Atom-Specific 15N Imino/Amido-Labeled RNA

    PubMed Central

    Kreutz, Christoph; Micura, Ronald

    2016-01-01

    Although numerous reports on the synthesis of atom-specific 15N-labeled nucleosides exist, fast and facile access to the corresponding phosphoramidites for RNA solid-phase synthesis is still lacking. This situation represents a severe bottleneck for NMR spectroscopic investigations on functional RNAs. Here, we present optimized procedures to speed up the synthesis of 15N(1) adenosine and 15N(1) guanosine amidites, which are the much needed counterparts of the more straightforward-to-achieve 15N(3) uridine and 15N(3) cytidine amidites in order to tap full potential of 1H/15N/15N-COSY experiments for directly monitoring individual Watson–Crick base pairs in RNA. Demonstrated for two preQ1 riboswitch systems, we exemplify a versatile concept for individual base-pair labeling in the analysis of conformationally flexible RNAs when competing structures and conformational dynamics are encountered. PMID:26237536

  9. Synthesis of monomethyl 5,5'-dehydrodiferulic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Synthesis of the internal reference compound, monomethyl 5,5’-dehydrodiferulic acid, is described. The synthetic scheme relies on a selective monomethylation of the known compound 5,5-dehydrodivanillin, followed by elaboration into the dehydrodiferulic framework through a dual Horner-Emmons-Wadswort...

  10. An RNA synthesis inhibition assay for detecting toxic substances using click chemistry.

    PubMed

    Kametani, Yukiko; Iwai, Shigenori; Kuraoka, Isao

    2014-04-01

    Biological risk assessment studies of chemical substances that induce DNA lesions have been primarily based on the action of DNA polymerases during replication. However, DNA lesions interfere not only with replication, but also with transcription. There is no simple method for the detection of the DNA lesion-induced inhibition of transcription. Here, we report an assay for estimating the toxicity of chemical substances by visualizing transcription in mammalian cells using nucleotide analog 5-ethynyluridine (EU) and its click chemistry reaction. Ultraviolet light and representative chemical substances (camptothecin, 4-nitroquinoline-1-oxide, mitomycin C, and cisplatin, but not etoposide) of DNA- damaging agents show toxicity, as indicated by RNA synthesis inhibition in response to DNA damage in HeLa cells. Using titanium dioxide, we observed RNA synthesis inhibition in response to the rutile form, but not the anatase form, indicating that rutile titanium dioxide is a toxic substance. Because this method is based on the transcriptional response to DNA lesions, we can use terminally differentiated neuron-like PC12 cells, the differentiation of which can be induced by nerve growth factors, for evaluating chemical substances. Ultraviolet light and some chemicals (camptothecin, 4-nitroquinoline-1-oxide, mitomycin C, and cisplatin, but not etoposide) inhibited RNA synthesis in non-differentiated PC12 cells. Conversely, camptothecin and cisplatin did not inhibit RNA synthesis in differentiated PC12 cells, but 4-nitroquinoline-1-oxide, mitomycin C, and etoposide did. And using titanium dioxide, we did not observed any RNA synthesis inhibition. These data suggest that this method might be used to estimate the potential risk of chemical substances in differentiated mammalian cells, which are the most common cell type found in the human body.

  11. Nucleic acid hybridization with RNA immobilized on filter paper.

    NASA Technical Reports Server (NTRS)

    Saxinger, W. C.; Ponnamperuma, C.; Gillespie, D.

    1972-01-01

    RNA has been immobilized in a manner suitable for use in molecular hybridization experiments with dissolved RNA or DNA by a nonaqueous solid-phase reaction with carbonyldiimidazole and RNA 'dry coated' on cellulose or, preferably, on previously activated phosphocellulose filters. Immobilization of RNA does not appear to alter its chemical character or cause it to acquire affinity for unspecific RNA or DNA. The versatility and efficiency of this method make it potentially attractive for use in routine analytical or preparative hybridization experiments, among other applications.

  12. Catalytic RNA and synthesis of the peptide bond

    NASA Technical Reports Server (NTRS)

    Usher, D. A.; Kozlowski, M.; Zou, X.

    1991-01-01

    We are studying whether the L-19 IVS ribozyme from Tetrahymena thermophila can catalyze the formation of the peptide bond when it is supplied with synthetic aminoacyl oligonucleotides. If this reaction works, it could give us some insight into the mechanism of peptide bond formation and the origin of coded protein synthesis. Two short oligoribonucleotides, CCCCC and a protected form of CCCCU were prepared; the former was made by the controlled hydrolysis of Poly(C), and the later by multistep chemical synthesis from the protected monomers. The homopentamer was then aminocylated using C-14 labelled Boc-protected glycine imidazolide. This aminoacylated oligo-nucleotide has now been shown to enter the active site of the L-19 IVS, and aminoacyl transfer, and peptide bond formation reactions are being sought. Our synthesis of CCCCU made us aware of the inadequacy of many of the 2'- hydroxyl protecting groups that are in use today and we therefore designed a new 2'- protecting group that is presently being tested.

  13. Effect of Infection with Ribonucleic Acid Bacteriophage R23 on the Inducible Synthesis of β-Galactosidase in Escherichia coli

    PubMed Central

    Watanabe, Hiroko; Watanabe, Mamoru

    1968-01-01

    Infection by ribonucleic acid (RNA) bacteriophage R23 inhibited the synthesis of β-galactosidase in Escherichia coli. The inhibition, although not complete, was apparent shortly after infection and was maximal after the first 20 min of infection. R23 diminished the β-galactosidase-synthesizing capacity when inducer was added after phage infection, but not when infection followed inducer removal. These findings suggested that the primary effect of R23 on enzyme-forming capacity was limitation of synthesis of enzyme-specific messenger RNA. Studies with ultraviolet irradiated phage and amber mutants of R23 indicated that the inhibitory process could be separated into two phases. Early inhibition did not require the expression of the viral genome, whereas late inhibition required the expression of the viral RNA synthetase cistron. PMID:4910818

  14. Metabolic switch during adipogenesis: From branched chain amino acid catabolism to lipid synthesis.

    PubMed

    Halama, Anna; Horsch, Marion; Kastenmüller, Gabriele; Möller, Gabriele; Kumar, Pankaj; Prehn, Cornelia; Laumen, Helmut; Hauner, Hans; Hrabĕ de Angelis, Martin; Beckers, Johannes; Suhre, Karsten; Adamski, Jerzy

    2016-01-01

    Fat cell metabolism has an impact on body homeostasis and its proper function. Nevertheless, the knowledge about simultaneous metabolic processes, which occur during adipogenesis and in mature adipocytes, is limited. Identification of key metabolic events associated with fat cell metabolism could be beneficial in the field of novel drug development, drug repurposing, as well as for the discovery of patterns predicting obesity risk. The main objective of our work was to provide comprehensive characterization of metabolic processes occurring during adipogenesis and in mature adipocytes. In order to globally determine crucial metabolic pathways involved in fat cell metabolism, metabolomics and transcriptomics approaches were applied. We observed significantly regulated metabolites correlating with significantly regulated genes at different stages of adipogenesis. We identified the synthesis of phosphatidylcholines, the metabolism of even and odd chain fatty acids, as well as the catabolism of branched chain amino acids (BCAA; leucine, isoleucine and valine) as key regulated pathways. Our further analysis led to identification of an enzymatic switch comprising the enzymes Hmgcs2 (3-hydroxy-3-methylglutaryl-CoA synthase) and Auh (AU RNA binding protein/enoyl-CoA hydratase) which connects leucine degradation with cholesterol synthesis. In addition, propionyl-CoA, a product of isoleucine degradation, was identified as a putative substrate for odd chain fatty acid synthesis. The uncovered crosstalks between BCAA and lipid metabolism during adipogenesis might contribute to the understanding of molecular mechanisms of obesity and have potential implications in obesity prediction. PMID:26408941

  15. Role of procollagen mRNA levels in controlling the rate of procollagen synthesis.

    PubMed Central

    Rowe, L B; Schwarz, R I

    1983-01-01

    Two factors must be present for primary avian tendon cells to commit 50% of their total protein production to procollagen: ascorbate and high cell density. Scorbutic primary avian tendon cells at high cell density (greater than 4 X 10(4) cells per cm2) responded to the addition of ascorbate by a sixfold increase in the rate of procollagen synthesis. The kinetics were biphasic, showing a slow increase during the first 12 h followed by a more rapid rise to a maximum after 36 to 48 h. In contrast, after ascorbate addition, the level of accumulated cytoplasmic procollagen mRNA (alpha 2) showed a 12-h lag followed by a slow linear increase requiring 60 to 72 h to reach full induction. At all stages of the induction process, the relative increase in the rate of procollagen synthesis over the uninduced state exceeded the relative increase in the accumulation of procollagen mRNA. A similar delay in mRNA induction was observed when the cells were grown in an ascorbate-containing medium but the cell density was allowed to increase. In all cases, the rate of procollagen synthesis peaked approximately 24 h before the maximum accumulation of procollagen mRNA. The kinetics for the increase in procollagen synthesis are not, therefore, in agreement with the simple model that mRNA levels are the rate-limiting factor in the collagen pathway. We propose that the primary control point is at a later step. Further support for this idea comes from inhibitor studies, using alpha, alpha'-dipyridyl to block ascorbate action. In the presence of 0.3 mM alpha, alpha'-dipyridyl there was a specific two- to threefold decrease in procollagen production after 4 h, but this was unaccompanied by a drop in procollagen mRNA levels. Therefore, inhibitor studies give further support to the idea that primary action of ascorbate is to release a post-translational block. Images PMID:6835211

  16. Vitamin B-6 restriction impairs fatty acid synthesis in cultured human hepatoma (HepG2) cells.

    PubMed

    Zhao, Mei; Ralat, Maria A; da Silva, Vanessa; Garrett, Timothy J; Melnyk, Stephan; James, S Jill; Gregory, Jesse F

    2013-02-15

    Vitamin B-6 deficiency has been reported to alter n-6 and n-3 fatty acid profiles in plasma and tissue lipids; however, the mechanisms underlying such metabolic changes remain unclear. The objective of this study was to determine the effects of vitamin B-6 restriction on fatty acid profiles and fatty acid synthesis in HepG2 cells. Cells were cultured for 6 wk in media with four different vitamin B-6 concentrations (10, 20, 50, and 2,000 nM added pyridoxal, representing deficient, marginal, adequate, and supraphysiological conditions) that induced a range of steady-state cellular concentrations of pyridoxal phosphate. Total cellular lipid content was greatest in the deficient (10 nM pyridoxal) medium. The percentage of arachidonic acid and the ratio of arachidonic acid to linoleic acid in the total lipid fraction were ~15% lower in vitamin B-6-restricted cells, which suggests that vitamin B-6 restriction affects n-6 fatty acid interconversions. Metabolic flux studies indicated significantly lower fractional synthesis rate of oleic acid and arachidonic acid at 10, 20, and 50 nM pyridoxal, whereas that of eicosapentaenoic acid was lower in the cells cultured in 10 nM pyridoxal. Additionally, relative mRNA expressions of Δ5 and Δ6 desaturases were 40-50% lower in vitamin B-6-restricted cells. Overall, these findings suggest that vitamin B-6 restriction alters unsaturated fatty acid synthesis, particularly n-6 and n-3 polyunsaturated fatty acid synthesis. These results and observations of changes in human plasma fatty acid profiles caused by vitamin B-6 restriction suggest a mechanism by which vitamin B-6 inadequacy influences the cardiovascular risk.

  17. Amino Acid Synthesis in a Supercritical Carbon Dioxide - Water System

    PubMed Central

    Fujioka, Kouki; Futamura, Yasuhiro; Shiohara, Tomoo; Hoshino, Akiyoshi; Kanaya, Fumihide; Manome, Yoshinobu; Yamamoto, Kenji

    2009-01-01

    Mars is a CO2-abundant planet, whereas early Earth is thought to be also CO2-abundant. In addition, water was also discovered on Mars in 2008. From the facts and theory, we assumed that soda fountains were present on both planets, and this affected amino acid synthesis. Here, using a supercritical CO2/liquid H2O (10:1) system which mimicked crust soda fountains, we demonstrate production of amino acids from hydroxylamine (nitrogen source) and keto acids (oxylic acid sources). In this research, several amino acids were detected with an amino acid analyzer. Moreover, alanine polymers were detected with LC-MS. Our research lights up a new pathway in the study of life’s origin. PMID:19582225

  18. Stereoselective synthesis of stable-isotope-labeled amino acids

    SciTech Connect

    Unkefer, C.J.; Martinez, R.A.; Silks, L.A. III; Lodwig, S.N.

    1994-12-01

    For magnetic resonance and vibrational spectroscopies to reach their full potential, they must be used in combination with sophisticated site-specific stable isotope labeling of biological macromolecules. Labeled amino acids are required for the study of the structure and function of enzymes and proteins. Because there are 20 common amino acids, each with its own distinguishing chemistry, they remain a synthetic challenge. The Oppolzer chiral auxiliary provides a general tool with which to approach the synthesis of labeled amino acids. By using the Oppolzer auxiliary, amino acids can be constructed from several small molecules, which is ideal for stable isotope labeling. In addition to directing the stereochemistry at the {alpha}-carbon, the camphorsultam can be used for stereo-specific isotope labeling at prochiral centers in amino acids. By using the camphorsultam auxiliary we have the potential to synthesize virtually any isotopomer of all of the common amino acids.

  19. Synthesis of gold nanoparticles using various amino acids.

    PubMed

    Maruyama, Tatsuo; Fujimoto, Yuhei; Maekawa, Tetsuya

    2015-06-01

    Gold nanoparticles (4-7nm) were synthesized from tetraauric acid using various amino acids as reducing and capping agents. The gold nanoparticles were produced from the incubation of a AuCl4(-) solution with an amino acid at 80°C for 20min. Among the twenty amino acids tested, several amino acids produced gold nanoparticles. The color of the nanoparticle solutions varied with the amino acids used for the reduction. We adopted l-histidine as a reducing agent and investigated the effects of the synthesis conditions on the gold nanoparticles. The His and AuCl4(-) concentrations affected the size of the gold nanoparticles and their aggregates. The pH of the reaction solution also affected the reaction yields and the shape of the gold nanoparticles.

  20. Em polypeptide and its messenger RNA levels are modulated by abscisic acid during embryogenesis in wheat.

    PubMed

    Williamson, J D; Quatrano, R S; Cuming, A C

    1985-10-15

    The effect of abscisic acid (ABA) on the expression of the 'early-methionine-labeled' (Em) polypeptide was examined in cultured, immature wheat (Triticum aestivum, L.) embryos and in developing embryos in planta. A complementary DNA (cDNA) library was constructed from poly(A)-rich RNA from immature embryos cultured in the presence of ABA. ABA-enhanced sequences were first identified by differential colony-blot hybridization, and then verified using RNA slot-blot analysis. Dot-blot hybridization showed that one clone, p1015, was homologous to the previously isolated Em cDNA, pWG432. Electrophoretic analysis of the hybrid-select translation product of p1015 confirmed its identity as an Em sequence. Comparison of the p1015 cDNA insert size and the Em message size, from northern blot analysis, showed that p1015 contained about 87% of the Em sequence. RNA slot-blot analysis and protein electrophoresis showed that Em message, but not Em protein, accumulated at a low, basal level in immature embryos in the absence of ABA. Neither Em message nor Em protein was seen in three-day germinated seedlings. Steady-state levels of Em message and protein increased in immature embryos in the presence of ABA, both in culture and in planta. Regulation appeared to be primarily at the level of transcription or specific message stability. Regulation may also involve specific protein stability, since synthesis of Em protein continued in immature embryos in the absence of ABA, but Em protein did not accumulate in detectable amounts. We conclude that ABA specifically modulates Em message and protein levels in immature embryos, but is probably not responsible for the embryogenic specificity of Em expression.

  1. Synthesis and chirality of amino acids under interstellar conditions.

    PubMed

    Giri, Chaitanya; Goesmann, Fred; Meinert, Cornelia; Evans, Amanda C; Meierhenrich, Uwe J

    2013-01-01

    Amino acids are the fundamental building blocks of proteins, the biomolecules that provide cellular structure and function in all living organisms. A majority of amino acids utilized within living systems possess pre-specified orientation geometry (chirality); however the original source for this specific orientation remains uncertain. In order to trace the chemical evolution of life, an appreciation of the synthetic and evolutional origins of the first chiral amino acids must first be gained. Given that the amino acids in our universe are likely to have been synthesized in molecular clouds in interstellar space, it is necessary to understand where and how the first synthesis might have occurred. The asymmetry of the original amino acid synthesis was probably the result of exposure to chiral photons in the form of circularly polarized light (CPL), which has been detected in interstellar molecular clouds. This chirality transfer event, from photons to amino acids, has been successfully recreated experimentally and is likely a combination of both asymmetric synthesis and enantioselective photolysis. A series of innovative studies have reported successful simulation of these environments and afforded production of chiral amino acids under realistic circumstellar and interstellar conditions: irradiation of interstellar ice analogues (CO, CO2, NH3, CH3OH, and H2O) with circularly polarized ultraviolet photons at low temperatures does result in enantiomer enriched amino acid structures (up to 1.3% ee). This topical review summarizes current knowledge and recent discoveries about the simulated interstellar environments within which amino acids were probably formed. A synopsis of the COSAC experiment onboard the ESA cometary mission ROSETTA concludes this review: the ROSETTA mission will soft-land on the nucleus of the comet 67P/Churyumov-Gerasimenko in November 2014, anticipating the first in situ detection of asymmetric organic molecules in cometary ices.

  2. Synthesis and chirality of amino acids under interstellar conditions.

    PubMed

    Giri, Chaitanya; Goesmann, Fred; Meinert, Cornelia; Evans, Amanda C; Meierhenrich, Uwe J

    2013-01-01

    Amino acids are the fundamental building blocks of proteins, the biomolecules that provide cellular structure and function in all living organisms. A majority of amino acids utilized within living systems possess pre-specified orientation geometry (chirality); however the original source for this specific orientation remains uncertain. In order to trace the chemical evolution of life, an appreciation of the synthetic and evolutional origins of the first chiral amino acids must first be gained. Given that the amino acids in our universe are likely to have been synthesized in molecular clouds in interstellar space, it is necessary to understand where and how the first synthesis might have occurred. The asymmetry of the original amino acid synthesis was probably the result of exposure to chiral photons in the form of circularly polarized light (CPL), which has been detected in interstellar molecular clouds. This chirality transfer event, from photons to amino acids, has been successfully recreated experimentally and is likely a combination of both asymmetric synthesis and enantioselective photolysis. A series of innovative studies have reported successful simulation of these environments and afforded production of chiral amino acids under realistic circumstellar and interstellar conditions: irradiation of interstellar ice analogues (CO, CO2, NH3, CH3OH, and H2O) with circularly polarized ultraviolet photons at low temperatures does result in enantiomer enriched amino acid structures (up to 1.3% ee). This topical review summarizes current knowledge and recent discoveries about the simulated interstellar environments within which amino acids were probably formed. A synopsis of the COSAC experiment onboard the ESA cometary mission ROSETTA concludes this review: the ROSETTA mission will soft-land on the nucleus of the comet 67P/Churyumov-Gerasimenko in November 2014, anticipating the first in situ detection of asymmetric organic molecules in cometary ices. PMID:22976459

  3. Fecal bile acid excretion and messenger RNA expression levels of ileal transporters in high risk gallstone patients

    PubMed Central

    2009-01-01

    Background Cholesterol gallstone disease (GS) is highly prevalent among Hispanics and American Indians. In GS, the pool of bile acids (BA) is decreased, suggesting that BA absorption is impaired. In Caucasian GS patients, mRNA levels for ileal BA transporters are decreased. We aimed to determine fecal BA excretion rates, mRNA levels for ileal BA transporter genes and of regulatory genes of BA synthesis in Hispanic GS patients. Results Excretion of fecal BA was measured in seven GS females and in ten GS-free individuals, all with a body mass index < 29. Participants ingested the stool marker Cr2O3 (300 mg/day) for 10 days, and fecal specimens were collected on the last 3 days. Chromium was measured by a colorimetric method, and BA was quantitated by gas chromatography/mass spectroscopy. Intake of calories, nutrients, fiber and cholesterol were similar in the GS and GS-free subjects. Mean BA excretion levels were 520 ± 80 mg/day for the GS-free group, and 461 ± 105 mg/day for the GS group. Messenger RNA expression levels were determined by RT-PCR on biopsy samples obtained from ileum during diagnostic colonoscopy (14 GS-free controls and 16 GS patients) and from liver during surgery performed at 8 and 10 AM (12 GS and 10 GS-free patients operated on for gastrointestinal malignancies), all with a body mass index < 29. Messenger RNA level of the BA transporter genes for ileal lipid binding protein, multidrug resistance-associated protein 3, organic solute transporter alpha, and organic solute transporter beta were similar in GS and GS-free subjects. Messenger RNA level of Cyp27A1, encoding the enzyme 27α-hydroxylase, the short heterodimer partner and farnesoid X receptor remained unchanged, whereas the mRNA level of Cyp7A1, the rate limiting step of BA synthesis, was increased more than 400% (p < 0.01) in the liver of GS compared to GS-free subjects. Conclusion Hispanics with GS have fecal BA excretion rates and mRNA levels of genes for ileal BA transporters that

  4. PHF6 regulates cell cycle progression by suppressing ribosomal RNA synthesis.

    PubMed

    Wang, Jiadong; Leung, Justin Wai-chung; Gong, Zihua; Feng, Lin; Shi, Xiaobing; Chen, Junjie

    2013-02-01

    Mutation of PHF6, which results in the X-linked mental retardation disorder Börjeson-Forssman-Lehmann syndrome, is also present in about 38% of adult T-cell acute lymphoblastic leukemias and 3% of adult acute myeloid leukemias. However, it remains to be determined exactly how PHF6 acts in vivo and what functions of PHF6 may be associated with its putative tumor suppressor function. Here, we demonstrate that PHF6 is a nucleolus, ribosomal RNA promoter-associated protein. PHF6 directly interacts with upstream binding factor (UBF) through its PHD1 domain and suppresses ribosomal RNA (rRNA) transcription by affecting the protein level of UBF. Knockdown of PHF6 impairs cell proliferation and arrests cells at G(2)/M phase, which is accompanied by an increased level of phosphorylated H2AX, indicating that PHF6 deficiency leads to the accumulation of DNA damage in the cell. We found that increased DNA damage occurs at the ribosomal DNA (rDNA) locus in PHF6-deficient cells. This effect could be reversed by knocking down UBF or overexpressing RNASE1, which removes RNA-DNA hybrids, suggesting that there is a functional link between rRNA synthesis and genomic stability at the rDNA locus. Together, these results reveal that the key function of PHF6 is involved in regulating rRNA synthesis, which may contribute to its roles in cell cycle control, genomic maintenance, and tumor suppression.

  5. Salicylic Acid Inhibits Synthesis of Proteinase Inhibitors in Tomato Leaves Induced by Systemin and Jasmonic Acid.

    PubMed Central

    Doares, S. H.; Narvaez-Vasquez, J.; Conconi, A.; Ryan, C. A.

    1995-01-01

    Salicylic acid (SA) and acetylsalicylic acid (ASA), previously shown to inhibit proteinase inhibitor synthesis induced by wounding, oligouronides (H.M. Doherty, R.R. Selvendran, D.J. Bowles [1988] Physiol Mol Plant Pathol 33: 377-384), and linolenic acid (H. Pena-Cortes, T. Albrecht, S. Prat, E.W. Weiler, L. Willmitzer [1993] Planta 191: 123-128), are shown here to be potent inhibitors of systemin-induced and jasmonic acid (JA)-induced synthesis of proteinase inhibitor mRNAs and proteins. The inhibition by SA and ASA of proteinase inhibitor synthesis induced by systemin and JA, as well as by wounding and oligosaccharide elicitors, provides further evidence that both oligosaccharide and polypeptide inducer molecules utilize the octadecanoid pathway to signal the activation of proteinase inhibitor genes. Tomato (Lycopersicon esculentum) leaves were pulse labeled with [35S]methionine, followed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and the inhibitory effects of SA are shown to be specific for the synthesis of a small number of JA-inducible proteins that includes the proteinase inhibitors. Previous results have shown that SA inhibits the conversion of 13S-hydroperoxy linolenic acid to 12-oxo-phytodienoic acid, thereby inhibiting the signaling pathway by blocking synthesis of JA. Here we report that the inhibition of synthesis of proteinase inhibitor proteins and mRNAs by SA in both light and darkness also occurs at a step in the signal transduction pathway, after JA synthesis but preceding transcription of the inhibitor genes. PMID:12228577

  6. Enzymatic activity of poliovirus RNA polymerase mutants with single amino acid changes in the conserved YGDD amino acid motif.

    PubMed

    Jablonski, S A; Luo, M; Morrow, C D

    1991-09-01

    RNA-dependent RNA polymerases contain a highly conserved region of amino acids with a core segment composed of the amino acids YGDD which have been hypothesized to be at or near the catalytic active site of the molecule. Six mutations in this conserved YGDD region of the poliovirus RNA-dependent RNA polymerase were made by using oligonucleotide site-directed DNA mutagenesis of the poliovirus cDNA to substitute A, C, M, P, S, or V for the amino acid G. The mutant polymerase genes were expressed in Escherichia coli, and the purified RNA polymerases were tested for in vitro enzyme activity. Two of the mutant RNA polymerases (those in which the glycine residue was replaced with alanine or serine) exhibited in vitro enzymatic activity ranging from 5 to 20% of wild-type activity, while the remaining mutant RNA polymerases were inactive. Alterations in the in vitro reaction conditions by modification of temperature, metal ion concentration, or pH resulted in no significant differences in the activities of the mutant RNA polymerases relative to that of the wild-type enzyme. An antipeptide antibody directed against the wild-type core amino acid segment containing the YGDD region of the poliovirus polymerase reacted with the wild-type recombinant RNA polymerase and to a limited extent with the two enzymatically active mutant polymerases; the antipeptide antibody did not react with the mutant RNA polymerases which did not have in vitro enzyme activity. These results are discussed in the context of secondary-structure predictions for the core segment containing the conserved YGDD amino acids in the poliovirus RNA polymerase. PMID:1651402

  7. Benzylidene Acetal Protecting Group as Carboxylic Acid Surrogate: Synthesis of Functionalized Uronic Acids and Sugar Amino Acids.

    PubMed

    Banerjee, Amit; Senthilkumar, Soundararasu; Baskaran, Sundarababu

    2016-01-18

    Direct oxidation of the 4,6-O-benzylidene acetal protecting group to C-6 carboxylic acid has been developed that provides an easy access to a wide range of biologically important and synthetically challenging uronic acid and sugar amino acid derivatives in good yields. The RuCl3 -NaIO4 -mediated oxidative cleavage method eliminates protection and deprotection steps and the reaction takes place under mild conditions. The dual role of the benzylidene acetal, as a protecting group and source of carboxylic acid, was exploited in the efficient synthesis of six-carbon sialic acid analogues and disaccharides bearing uronic acids, including glycosaminoglycan analogues.

  8. Using triple-helix-forming Peptide nucleic acids for sequence-selective recognition of double-stranded RNA.

    PubMed

    Hnedzko, Dziyana; Cheruiyot, Samwel K; Rozners, Eriks

    2014-09-08

    Non-coding RNAs play important roles in regulation of gene expression. Specific recognition and inhibition of these biologically important RNAs that form complex double-helical structures will be highly useful for fundamental studies in biology and practical applications in medicine. This protocol describes a strategy developed in our laboratory for sequence-selective recognition of double-stranded RNA (dsRNA) using triple-helix-forming peptide nucleic acids (PNAs) that bind in the major grove of the RNA helix. The strategy developed uses chemically modified nucleobases, such as 2-aminopyridine (M), which enables strong triple-helical binding under physiologically relevant conditions, and 2-pyrimidinone (P) and 3-oxo-2,3-dihydropyridazine (E), which enable recognition of isolated pyrimidines in the purine-rich strand of the RNA duplex. Detailed protocols for preparation of modified PNA monomers, solid-phase synthesis, HPLC purification of PNA oligomers, and measuring dsRNA binding affinity using isothermal titration calorimetry are included.

  9. Control of. cap alpha. -amylase mRNA accumulation by gibberellic acid and calcium in barley aleurone layers

    SciTech Connect

    Deikman, J.; Jones, R.L.

    1985-01-01

    Pulse-labeling of barley (Hordeum vulgare L. cv Himalaya) aleurone layers incubated for 13 hours in 2.5 micromolar gibberellic acid (GA/sub 3/) with or without 5 millimolar CaCl/sub 2/ shows that ..cap alpha..-amylase isozymes 3 and 4 are not synthesized in vivo in the absence of Ca/sup 2 +/. No difference was observed in ..cap alpha..-amylase mRNA levels between layers incubated for 12 hours in 2.5 micromolar GA/sub 3/ with 5 millimolar CaCl/sub 2/ and layers incubated in GA/sub 3/ alone. RNA isolated from layers incubated for 12 hours in GA/sub 3/ with and without CA/sup 2 +/. A cDNA clone for ..cap alpha..-amylase was isolated and used to measure ..cap alpha..-amylase mRNA levels in aleurone layers incubated in the presence and absence of Ca/sup 2 +/ was translated in vitro and was found to produce the same complement of translation products regardless of the presence of Ca/sup 2 +/ in the incubation medium. Immunoprecipitation of translation products showed that the RNA for ..cap alpha..-amylase synthesized in Ca/sup 2 +/-deprived aleurone layers was translatable. Ca/sup 2 +/ is required for the synthesis of ..cap alpha..-amylase isozymes 3 and 4 at a step after mRNA accumulation and processing.

  10. Interaction of TIF-90 and filamin A in the regulation of rRNA synthesis in leukemic cells.

    PubMed

    Nguyen, Le Xuan Truong; Chan, Steven M; Ngo, Tri Duc; Raval, Aparna; Kim, Kyeong Kyu; Majeti, Ravindra; Mitchell, Beverly S

    2014-07-24

    The transcription initiation factor I (TIF-IA) is an important regulator of the synthesis of ribosomal RNA (rRNA) through its facilitation of the recruitment of RNA polymerase I (Pol I) to the ribosomal DNA promoter. Activation of the phosphoinositide 3-kinase (PI3K)/protein kinase B (Akt) pathway, which occurs commonly in acute myelogenous leukemia, enhances rRNA synthesis through TIF-IA stabilization and phosphorylation. We have discovered that TIF-IA coexists with a splicing isoform, TIF-90, which is expressed preferentially in the nucleolus and at higher levels in proliferating and transformed hematopoietic cells. TIF-90 interacts directly with Pol I to increase rRNA synthesis as a consequence of Akt activation. Furthermore, TIF-90 binds preferentially to a 90-kDa cleavage product of the actin binding protein filamin A (FLNA) that inhibits rRNA synthesis. Increased expression of TIF-90 overcomes the inhibitory effect of this cleavage product and stimulates rRNA synthesis. Because activated Akt also reduces FLNA cleavage, these results indicate that activated Akt and TIF-90 function in parallel to increase rRNA synthesis and, as a consequence, cell proliferation in leukemic cells. These results provide evidence that the direct targeting of Akt would be an effective therapy in acute leukemias in which Akt is activated.

  11. Stability of free and mineral-protected nucleic acids: Implications for the RNA world

    NASA Astrophysics Data System (ADS)

    Swadling, Jacob B.; Coveney, Peter V.; Christopher Greenwell, H.

    2012-04-01

    Using molecular dynamics simulations we study the structural stability of three different nucleic acids intercalated within a magnesium aluminium layered double hydroxide (LDH) mineral, at varying degrees of hydration, and free in aqueous solution. The nucleotides investigated are ribose nucleic acid (RNA), deoxyribose nucleic acid (DNA) and peptide nucleic acid (PNA), all in duplex form. Our simulations show that DNA has enhanced Watson-Crick hydrogen-bonding when intercalated within the LDH clay interlayers, compared with intercalated RNA and PNA, whilst the reverse trend is found for the nucleic acids in bulk water. The tendency for LDH to alter the stability of the three nucleic acids persists for higher temperature and pressure conditions. The uncharged protein backbone of PNA is found to have a detrimental effect on the overall stability of the duplex, as it experiences a greatly reduced electrostatic interaction with the charged LDH sheets compared to RNA and DNA. Assuming an RNA world, in which RNA preceded the DNA/protein world, at some point in time DNA must have taken over the role as the information storage molecule from RNA. These results suggest that a mineral based origin of life may have favoured DNA as the information-storage biomolecule over potentially competing RNA and PNA, providing a route to modern biology from the RNA world.

  12. Lactide Synthesis and Chirality Control for Polylactic acid Production.

    PubMed

    Van Wouwe, Pieter; Dusselier, Michiel; Vanleeuw, Evelien; Sels, Bert

    2016-05-10

    Polylactic acid (PLA) is a very promising biodegradable, renewable, and biocompatible polymer. Aside from its production, its application field is also increasing, with use not only in commodity applications but also as durables and in biomedicine. In the current PLA production scheme, the most expensive part is not the polymerization itself but obtaining the building blocks lactic acid (LA) and lactide, the actual cyclic monomer for polymerization. Although the synthesis of LA and the polymerization have been studied systematically, reports of lactide synthesis are scarce. Most lactide synthesis methods are described in patent literature, and current energy-intensive, aselective industrial processes are based on archaic scientific literature. This Review, therefore, highlights new methods with a technical comparison and description of the different approaches. Water-removal methodologies are compared, as this is a crucial factor in PLA production. Apart from the synthesis of lactide, this Review also emphasizes the use of chemically produced racemic lactic acid (esters) as a starting point in the PLA production scheme. Stereochemically tailored PLA can be produced according to such a strategy, giving access to various polymer properties.

  13. Synthesis of double-stranded RNA in a virus-enriched fraction from Agaricus bisporus

    SciTech Connect

    Sriskantha, A.; Wach, P.; Schlagnhaufer, B.; Romaine, C.P.

    1986-03-01

    Partially purified virus preparations from sporophores of Agaricus bisporus affected with LaFrance disease had up to a 15-fold-higher RNA-dependent RNA polymerase activity than did comparable preparations from health sporophores. Enzyme activity was dependent upon the presence of Mg/sup 2 +/ and the four nucleoside triphosphates and was insensitive to actinomycin D, ..cap alpha..-amanitin, and rifampin. The /sup 3/H-labeled enzyme reaction products were double-stranded RNA (dsRNA) as indicated by CF-11 cellulose column chromatography and by their ionic-strength-dependent sensitivity to hydrolysis by RNase A. The principal dsRNA products had estimated molecular weights of 4.3 /times/ 10/sup 6/ and 1.4 /times/ 10/sup 6/. Cs/sub 2/SO/sub 4/ equilibrium centrifugation of the virus preparation resolved a single peak of RNA polymerase activity that banded with a 35-nm spherical virus particle containing dsRNAs with molecular weights of 4.3 /times/ 10/sup 6/ and 1.4 /times/ 10/sup 6/. The data suggest that the RNA-dependent RNA polymerase associated with the 35-nm spherical virus is a replicase which catalyzes the synthesis of the genomic dsRNAs.

  14. Insights into RNA synthesis, capping, and proofreading mechanisms of SARS-coronavirus.

    PubMed

    Sevajol, Marion; Subissi, Lorenzo; Decroly, Etienne; Canard, Bruno; Imbert, Isabelle

    2014-12-19

    The successive emergence of highly pathogenic coronaviruses (CoVs) such as the Severe Acute Respiratory Syndrome (SARS-CoV) in 2003 and the Middle East Respiratory Syndrome Coronavirus (MERS-CoV) in 2012 has stimulated a number of studies on the molecular biology. This research has provided significant new insight into functions and activities of the replication/transcription multi-protein complex. The latter directs both continuous and discontinuous RNA synthesis to replicate and transcribe the large coronavirus genome made of a single-stranded, positive-sense RNA of ∼30 kb. In this review, we summarize our current understanding of SARS-CoV enzymes involved in RNA biochemistry, such as the in vitro characterization of a highly active and processive RNA polymerase complex which can associate with methyltransferase and 3'-5' exoribonuclease activities involved in RNA capping, and RNA proofreading, respectively. The recent discoveries reveal fascinating RNA-synthesizing machinery, highlighting the unique position of coronaviruses in the RNA virus world. PMID:25451065

  15. The SBP2 and 15.5 kD/Snu13p proteins share the same RNA binding domain: identification of SBP2 amino acids important to SECIS RNA binding.

    PubMed Central

    Allmang, Christine; Carbon, Philippe; Krol, Alain

    2002-01-01

    Selenoprotein synthesis in eukaryotes requires the selenocysteine insertion sequence (SECIS) RNA, a hairpin in the 3' untranslated region of selenoprotein mRNAs. The SECIS RNA is recognized by the SECIS-binding protein 2 (SBP2), which is a key player in this specialized translation machinery. The objective of this work was to obtain structural insight into the SBP2-SECIS RNA complex. Multiple sequence alignment revealed that SBP2 and the U4 snRNA-binding protein 15.5 kD/Snu13p share the same RNA binding domain of the L7A/L30 family, also found in the box H/ACA snoRNP protein Nhp2p and several ribosomal proteins. In corollary, we have detected a similar secondary structure motif in the SECIS and U4 RNAs. Combining the data of the crystal structure of the 15.5 kD-U4 snRNA complex, and the SBP2/15.5 kD sequence similarities, we designed a structure-guided strategy predicting 12 SBP2 amino acids that should be critical for SECIS RNA binding. Alanine substitution of these amino acids followed by gel shift assays of the SBP2 mutant proteins identified four residues whose mutation severely diminished or abolished SECIS RNA binding, the other eight provoking intermediate down effects. In addition to identifying key amino acids for SECIS recognition by SBP2, our findings led to the proposal that some of the recognition principles governing the 15.5 kD-U4 snRNA interaction must be similar in the SBP2-SECIS RNA complex. PMID:12403468

  16. RNA synthesis and turnover in the molluscan nervous system studied by Click-iT method.

    PubMed

    Ierusalimsky, Victor N; Balaban, Pavel M

    2016-02-15

    RNA synthesis can be detected by means of the in vivo incorporation of 5-ethynyluridine (EU) in newly-synthesized RNA with the relatively simple Click-iT method. We used this method to study the RNA synthesis in the CNS tissue of adult and juvenile terrestrial snails Helix lucorum L. Temporally, first labeled neurons were detected in the adult CNS after 4-h of isolated CNS incubation in EU solution, while 12-h of incubation led to extensive labeling of most CNS neurons. The EU labeling was present as the nuclear and nucleolar staining. The cytoplasm staining was observed after 2-3 days of CNS washout following the EU exposure for 16 h. In juvenile CNS, the first staining reaction was apparent as the staining of apical region in the procerebral lobe of cerebral ganglia after 1h of CNS incubation in EU, while the maximum pattern of staining was obtained after 4h of CNS incubation. Thus, age-related differences in RNA synthesis are present. Activation of neurons elicited by serotonin and caffeine applications noticeably increased the intensity of staining. EU readily penetrates into the bodies of juvenile snails immersed in the EU solution. When the intact juvenile animals were immersed in the EU solution for 1h, the procerebrum staining, similar to the one detected in the incubated juvenile CNS, was observed. PMID:26749075

  17. May Cyclic Nucleotides Be a Source for Abiotic RNA Synthesis?

    NASA Astrophysics Data System (ADS)

    Costanzo, Giovanna; Pino, Samanta; Botta, Giorgia; Saladino, Raffaele; di Mauro, Ernesto

    2011-12-01

    Nucleic bases are obtained by heating formamide in the presence of various catalysts. Formamide chemistry also allows the formation of acyclonucleosides and the phosphorylation of nucleosides in every possible position, also affording 2',3' and 3',5' cyclic forms. We have reported that 3',5' cyclic GMP and 3',5' cyclic AMP polymerize in abiotic conditions yielding short oligonucleotides. The characterization of this reaction is being pursued, several of its parameters have been determined and experimental caveats are reported. The yield of non-enzymatic polymerization of cyclic purine nucleotides is very low. Polymerization is strongly enhanced by the presence of base-complementary RNA sequences.

  18. A novel approach in cinnamic acid synthesis: direct synthesis of cinnamic acids from aromatic aldehydes and aliphatic carboxylic acids in the presence of boron tribromide.

    PubMed

    Chiriac, Constantin I; Tanasa, Fulga; Onciu, Marioara

    2005-02-28

    Cinnamic acids have been prepared in moderate to high yields by a new direct synthesis using aromatic aldehydes and aliphatic carboxylic acids, in the presence of boron tribromide as reagent, 4-dimethylaminopyridine (4-DMAP) and pyridine (Py) as bases and N-methyl-2-pyrolidinone (NMP) as solvent, at reflux (180-190 degrees C) for 8-12 hours.

  19. Rapamycin Inhibits Expression of Elongation of Very-long-chain Fatty Acids 1 and Synthesis of Docosahexaenoic Acid in Bovine Mammary Epithelial Cells

    PubMed Central

    Guo, Zhixin; Wang, Yanfeng; Feng, Xue; Bao, Chaogetu; He, Qiburi; Bao, Lili; Hao, Huifang; Wang, Zhigang

    2016-01-01

    Mammalian target of rapamycin complex 1 (mTORC1) is a central regulator of cell growth and metabolism and is sufficient to induce specific metabolic processes, including de novo lipid biosynthesis. Elongation of very-long-chain fatty acids 1 (ELOVL1) is a ubiquitously expressed gene and the product of which was thought to be associated with elongation of carbon (C) chain in fatty acids. In the present study, we examined the effects of rapamycin, a specific inhibitor of mTORC1, on ELOVL1 expression and docosahexaenoic acid (DHA, C22:6 n-3) synthesis in bovine mammary epithelial cells (BMECs). We found that rapamycin decreased the relative abundance of ELOVL1 mRNA, ELOVL1 expression and the level of DHA in a time-dependent manner. These data indicate that ELOVL1 expression and DHA synthesis are regulated by mTORC1 in BMECs. PMID:26954224

  20. Is docosahexaenoic acid synthesis from α-linolenic acid sufficient to supply the adult brain?

    PubMed

    Domenichiello, Anthony F; Kitson, Alex P; Bazinet, Richard P

    2015-07-01

    Docosahexaenoic acid (DHA) is important for brain function, and can be obtained directly from the diet or synthesized in the body from α-linolenic acid (ALA). Debate exists as to whether DHA synthesized from ALA can provide sufficient DHA for the adult brain, as measures of DHA synthesis from ingested ALA are typically <1% of the oral ALA dose. However, the primary fate of orally administered ALA is β-oxidation and long-term storage in adipose tissue, suggesting that DHA synthesis measures involving oral ALA tracer ingestion may underestimate total DHA synthesis. There is also evidence that DHA synthesized from ALA can meet brain DHA requirements, as animals fed ALA-only diets have brain DHA concentrations similar to DHA-fed animals, and the brain DHA requirement is estimated to be only 2.4-3.8 mg/day in humans. This review summarizes evidence that DHA synthesis from ALA can provide sufficient DHA for the adult brain by examining work in humans and animals involving estimates of DHA synthesis and brain DHA requirements. Also, an update on methods to measure DHA synthesis in humans is presented highlighting a novel approach involving steady-state infusion of stable isotope-labeled ALA that bypasses several limitations of oral tracer ingestion. It is shown that this method produces estimates of DHA synthesis that are at least 3-fold higher than brain uptake rates in rats.

  1. Primordial soup or vinaigrette: did the RNA world evolve at acidic pH?

    PubMed Central

    2012-01-01

    Background The RNA world concept has wide, though certainly not unanimous, support within the origin-of-life scientific community. One view is that life may have emerged as early as the Hadean Eon 4.3-3.8 billion years ago with an atmosphere of high CO2 producing an acidic ocean of the order of pH 3.5-6. Compatible with this scenario is the intriguing proposal that life arose within alkaline (pH 9-11) deep-sea hydrothermal vents like those of the 'Lost City', with the interface with the acidic ocean creating a proton gradient sufficient to drive the first metabolism. However, RNA is most stable at pH 4-5 and is unstable at alkaline pH, raising the possibility that RNA may have first arisen in the acidic ocean itself (possibly near an acidic hydrothermal vent), acidic volcanic lake or comet pond. As the Hadean Eon progressed, the ocean pH is inferred to have gradually risen to near neutral as atmospheric CO2 levels decreased. Presentation of the hypothesis We propose that RNA is well suited for a world evolving at acidic pH. This is supported by the enhanced stability at acidic pH of not only the RNA phosphodiester bond but also of the aminoacyl-(t)RNA and peptide bonds. Examples of in vitro-selected ribozymes with activities at acid pH have recently been documented. The subsequent transition to a DNA genome could have been partly driven by the gradual rise in ocean pH, since DNA has greater stability than RNA at alkaline pH, but not at acidic pH. Testing the hypothesis We have proposed mechanisms for two key RNA world activities that are compatible with an acidic milieu: (i) non-enzymatic RNA replication of a hemi-protonated cytosine-rich oligonucleotide, and (ii) specific aminoacylation of tRNA/hairpins through triple helix interactions between the helical aminoacyl stem and a single-stranded aminoacylating ribozyme. Implications of the hypothesis Our hypothesis casts doubt on the hypothesis that RNA evolved in the vicinity of alkaline hydrothermal vents. The

  2. Involvement of a universal amino acid synthesis impediment in cytoplasmic male sterility in pepper

    PubMed Central

    Fang, Xianping; Fu, Hong-Fei; Gong, Zhen-Hui; Chai, Wei-Guo

    2016-01-01

    To explore the mechanisms of pepper (Capsicum annuum L.) cytoplasmic male sterility (CMS), we studied the different maturation processes of sterile and fertile pepper anthers. A paraffin section analysis of the sterile anthers indicated an abnormality of the tapetal layer and an over-vacuolization of the cells. The quantitative proteomics results showed that the expression of histidinol dehydrogenase (HDH), dihydroxy-acid dehydratase (DAD), aspartate aminotransferase (ATAAT), cysteine synthase (CS), delta-1-pyrroline-5-carboxylate synthase (P5CS), and glutamate synthetase (GS) in the amino acid synthesis pathway decreased by more than 1.5-fold. Furthermore, the mRNA and protein expression levels of DAD, ATAAT, CS and P5CS showed a 2- to 16-fold increase in the maintainer line anthers. We also found that most of the amino acid content levels decreased to varying degrees during the anther tapetum period of the sterile line, whereas these levels increased in the maintainer line. The results of our study indicate that during pepper anther development, changes in amino acid synthesis are significant and accompany abnormal tapetum maturity, which is most likely an important cause of male sterility in pepper. PMID:26987793

  3. Identification of genes and pathways involved in the synthesis of Mead acid (20:3n-9), an indicator of essential fatty acid deficiency.

    PubMed

    Ichi, Ikuyo; Kono, Nozomu; Arita, Yuka; Haga, Shizuka; Arisawa, Kotoko; Yamano, Misato; Nagase, Mana; Fujiwara, Yoko; Arai, Hiroyuki

    2014-01-01

    In mammals, 5,8,11-eicosatrienoic acid (Mead acid, 20:3n-9) is synthesized from oleic acid during a state of essential fatty acid deficiency (EFAD). Mead acid is thought to be produced by the same enzymes that synthesize arachidonic acid and eicosapentaenoic acid, but the genes and the pathways involved in the conversion of oleic acid to Mead acid have not been fully elucidated. The levels of polyunsaturated fatty acids in cultured cells are generally very low compared to those in mammalian tissues. In this study, we found that cultured cells, such as NIH3T3 and Hepa1-6 cells, have significant levels of Mead acid, indicating that cells in culture are in an EFAD state under normal culture conditions. We then examined the effect of siRNA-mediated knockdown of fatty acid desaturases and elongases on the level of Mead acid, and found that knockdown of Elovl5, Fads1, or Fads2 decreased the level of Mead acid. This and the measured levels of possible intermediate products for the synthesis of Mead acid such as 18:2n-9, 20:1n-9 and 20:2n-9 in the knocked down cells indicate two pathways for the synthesis of Mead acid: pathway 1) 18:1n-9→(Fads2)→18:2n-9→(Elovl5)→20:2n-9→(Fads1)→20:3n-9 and pathway 2) 18:1n-9→(Elovl5)→20:1n-9→(Fads2)→20:2n-9→(Fads1)→20:3n-9.

  4. Fatty acid effects on fibroblast cholesterol synthesis

    SciTech Connect

    Shireman, R.B.; Muth, J.; Lopez, C.

    1987-05-01

    Two cell lines of normal (CRL 1475, GM5565) and of familial hypercholesterolemia (FH) (CM 486,488) fibroblasts were preincubated with medium containing the growth factor ITS, 2.5 mg/ml fatty acid-free BSA, or 35.2 ..mu..mol/ml of these fatty acids complexed with 2.5 mg BSA/ml: stearic (18:0), caprylic (8:0), oleic (18:1;9), linoleic (18:2;9,12), linolenic (18:3;9,12,15), docosahexaenoic (22:6;4,7,10,13,16,19)(DHA) or eicosapentaenoic (20:5;5,8,11,14,17)(EPA). After 20 h, cells were incubated for 2 h with 0.2 ..mu..Ci (/sup 14/C)acetate/ml. Cells were hydrolyzed; an aliquot was quantitated for radioactivity and protein. After saponification and extraction with hexane, radioactivity in the aqueous and organic phases was determined. The FH cells always incorporated 30-90% more acetate/mg protein than normal cells but the pattern of the fatty acid effects was similar in both types. When the values were normalized to 1 for the BSA-only group, cells with ITS had the greatest (/sup 14/C)acetate incorporation (1.45) followed by the caprylic group (1.14). Cells incubated with 18:3, 20:6 or 22:6 incorporated about the same amount as BSA-only. Those preincubated with 18:2, 18:1, 18:0 showed the least acetate incorporation (0.87, 0.59 and 0.52, respectively). The percentage of total /sup 14/C counts which extracted into hexane was much greater in FH cells; however, these values varied with the fatty acid, e.g., 1.31(18:0) and 0.84(8:0) relative to 1(BSA).

  5. Fat Metabolism in Higher Plants. XXXIV. Development of Fatty Acid Synthetase as a Function of Protein Synthesis in Aging Potato Tuber Slices

    PubMed Central

    Willemot, Claude; Stumpf, P. K.

    1967-01-01

    Experiments with inhibitors of protein synthesis (actinomycin D, puromycin, actidione) showed that the increase and the change in fatty acid synthetase activity, observed during the aging of potato disks, were accompanied by and related to a temporary rise in the rate of protein and RNA synthesis. These results concur with the earlier suggestion by Click and Hackett that the aging process involves a type of derepression. A possible course of events during aging, and possible derepression mechanisms are suggested and discussed. PMID:6045298

  6. Novel synthesis of steryl esters from phytosterols and amino Acid.

    PubMed

    Pang, Min; Jiang, Shaotong; Cao, Lili; Pan, Lijun

    2011-10-12

    The feasibility of esterification of phytosterol with the amino acid l-glutamic acid was established. The influence of various organic solvents was investigated, and n-butanol was selected as an ideal solvent for phytosteryl esters synthesis with l-glutamic acid. The reaction conditions were further optimized by orthogonal experiments, and a 92.3% degree of esterification was obtained when optimum conditions were used. FT-IR spectral, GC-MS, and NMR analyses were adopted to determine the steryl esters of l-glutamic acid. The FT-IR spectrum indicated the presence of ester bonds in the phytosteryl esters with l-glutamic acid, and on the basis of the detailed mass spectrography analysis, GC-MS and NMR offered an efficient and reliable way to confirm the steryl esters. This novel synthesis approach of phytosteryl esters with amino acid supplied a promising alternative to the substrate on esterification of phytosterols and thus can be readily applied to further studies of functional food ingredients of phytosteryl esters.

  7. Fatty acid phytyl ester synthesis in chloroplasts of Arabidopsis.

    PubMed

    Lippold, Felix; vom Dorp, Katharina; Abraham, Marion; Hölzl, Georg; Wewer, Vera; Yilmaz, Jenny Lindberg; Lager, Ida; Montandon, Cyrille; Besagni, Céline; Kessler, Felix; Stymne, Sten; Dörmann, Peter

    2012-05-01

    During stress or senescence, thylakoid membranes in chloroplasts are disintegrated, and chlorophyll and galactolipid are broken down, resulting in the accumulation of toxic intermediates, i.e., tetrapyrroles, free phytol, and free fatty acids. Chlorophyll degradation has been studied in detail, but the catabolic pathways for phytol and fatty acids remain unclear. A large proportion of phytol and fatty acids is converted into fatty acid phytyl esters and triacylglycerol during stress or senescence in chloroplasts. We isolated two genes (PHYTYL ESTER SYNTHASE1 [PES1] and PES2) of the esterase/lipase/thioesterase family of acyltransferases from Arabidopsis thaliana that are involved in fatty acid phytyl ester synthesis in chloroplasts. The two proteins are highly expressed during senescence and nitrogen deprivation. Heterologous expression in yeast revealed that PES1 and PES2 have phytyl ester synthesis and diacylglycerol acyltransferase activities. The enzymes show broad substrate specificities and can employ acyl-CoAs, acyl carrier proteins, and galactolipids as acyl donors. Double mutant plants (pes1 pes2) grow normally but show reduced phytyl ester and triacylglycerol accumulation. These results demonstrate that PES1 and PES2 are involved in the deposition of free phytol and free fatty acids in the form of phytyl esters in chloroplasts, a process involved in maintaining the integrity of the photosynthetic membrane during abiotic stress and senescence.

  8. Heat shock represses rRNA synthesis by inactivation of TIF-IA and lncRNA-dependent changes in nucleosome positioning.

    PubMed

    Zhao, Zhongliang; Dammert, Marcel A; Hoppe, Sven; Bierhoff, Holger; Grummt, Ingrid

    2016-09-30

    Attenuation of ribosome biogenesis in suboptimal growth environments is crucial for cellular homeostasis and genetic integrity. Here, we show that shutdown of rRNA synthesis in response to elevated temperature is brought about by mechanisms that target both the RNA polymerase I (Pol I) transcription machinery and the epigenetic signature of the rDNA promoter. Upon heat shock, the basal transcription factor TIF-IA is inactivated by inhibition of CK2-dependent phosphorylations at Ser170/172. Attenuation of pre-rRNA synthesis in response to heat stress is accompanied by upregulation of PAPAS, a long non-coding RNA (lncRNA) that is transcribed in antisense orientation to pre-rRNA. PAPAS interacts with CHD4, the adenosine triphosphatase subunit of NuRD, leading to deacetylation of histones and movement of the promoter-bound nucleosome into a position that is refractory to transcription initiation. The results exemplify how stress-induced inactivation of TIF-IA and lncRNA-dependent changes of chromatin structure ensure repression of rRNA synthesis in response to thermo-stress.

  9. Protein, RNA, and DNA synthesis in cultures of skin fibroblasts from healthy subjects and patients with rheumatic diseases

    SciTech Connect

    Abakumova, O.Y.; Kutsenko, N.G.; Panasyuk, A.F.

    1985-07-01

    To study the mechanism of the lasting disturbance of fibroblast function, protein, RNA and DNA synthesis was investigated in skin fibroblasts from patients with rheumatoid arthritis (RA) and systemic scleroderma (SS). The labeled precursors used to analyze synthesis of protein, RNA, and DNA were /sup 14/C-protein hydrolysate, (/sup 14/C)uridine, and (/sup 14/C) thymidine. Stimulation was determined by measuring incorporation of (/sup 14/C)proline into fibroblast proteins. During analysis of stability of fast-labeled RNA tests were carried out to discover whether all measurable radioactivity belonged to RNA molecules.

  10. A yeast acetyl coenzyme A carboxylase mutant links very-long-chain fatty acid synthesis to the structure and function of the nuclear membrane-pore complex.

    PubMed Central

    Schneiter, R; Hitomi, M; Ivessa, A S; Fasch, E V; Kohlwein, S D; Tartakoff, A M

    1996-01-01

    The conditional mRNA transport mutant of Saccharomyces cerevisiae, acc1-7-1 (mtr7-1), displays a unique alteration of the nuclear envelope. Unlike nucleoporin mutants and other RNA transport mutants, the intermembrane space expands, protuberances extend from the inner membrane into the intermembrane space, and vesicles accumulate in the intermembrane space. MTR7 is the same gene as ACC1, encoding acetyl coenzyme A (CoA) carboxylase (Acc1p), the rate-limiting enzyme of de novo fatty acid synthesis. Genetic and biochemical analyses of fatty acid synthesis mutants and acc1-7-1 indicate that the continued synthesis of malonyl-CoA, the enzymatic product of acetyl-CoA carboxylase, is required for an essential pathway which is independent from de novo synthesis of fatty acids. We provide evidence that synthesis of very-long-chain fatty acids (C26 atoms) is inhibited in acc1-7-1, suggesting that very-long-chain fatty acid synthesis is required to maintain a functional nuclear envelope. PMID:8943372

  11. Taurine homeostasis requires de novo synthesis via cysteine sulfinic acid decarboxylase during zebrafish early embryogenesis.

    PubMed

    Chang, Yen-Chia; Ding, Shih-Torng; Lee, Yen-Hua; Wang, Ya-Ching; Huang, Ming-Feng; Liu, I-Hsuan

    2013-02-01

    Cysteine sulfinic acid decarboxylase (Csad) is the rate-limiting enzyme in the de novo biosynthesis of taurine. There are a number of physiological roles of taurine, such as bile salt synthesis, osmoregulation, lipid metabolism, and oxidative stress inhibition. To investigate the role of de novo synthesis of taurine during embryonic development, zebrafish csad was cloned and functionally analyzed. Semi-quantitative RT-PCR showed that csad transcripts are maternally deposited, while whole-mount in situ hybridization demonstrated that csad is expressed in yolk syncytial layer and various embryonic tissues such as notochord, brain, retina, pronephric duct, liver, and pancreas. Knockdown of csad significantly reduced the embryonic taurine level, and the affected embryos had increased early mortality and cardiac anomalies. mRNA coinjection and taurine supplementation rescued the cardiac phenotypes suggesting that taurine originating from the de novo synthesis pathway plays a role in cardiac development. Our findings indicated that the de novo synthesis pathway via Csad plays a critical role in taurine homeostasis and cardiac development in zebrafish early embryos. PMID:22907836

  12. Transcriptional profiling of canola developing embryo and identification of the important roles of BnDof5.6 in embryo development and fatty acids synthesis.

    PubMed

    Deng, Wei; Yan, Fang; Zhang, Xiaolan; Tang, Yuwei; Yuan, Yujin

    2015-08-01

    Canola is an important vegetable oil crop globally, and the understanding of the molecular mechanism underlying fatty acids biosynthesis during seed embryo development is an important research goal. Here we report the transcriptional profiling analysis of developing canola embryos using RNA-sequencing (RNA-Seq) method. RNA-Seq analysis generated 58,579,451 sequence reads aligned with 32,243 genes. It was found that a total of 55 differential expression genes (DEGs) encoding 28 enzymes function in carbon flow to fatty acids of storage TAG. Most of the DEGs encoding above enzymes showed similar expression pattern, indicating the DEGs are cooperatively involved in carbon flow into fatty acids. In addition, 41 DEGs associated with signal transductions, transport and metabolic processing of auxin, gibberellin, abscisic acid, cytokinin and salicylic acids were found in the RNA-Seq database, which indicates the important roles of the phytohormones in controlling embryo development and fatty acids synthesis. 122 DEGs encoding transcriptional factor family members were found in developing canola embryos. Furthermore, BnDOF5.6, a zinc finger transcriptional factor gene, found in RNA-Seq database was down-regulated in developing canola embryos. The transgenic plants displayed reduced embryo sizes, decreased fatty acids contents and altered seed fatty acids composition in canola. Down-regulated of BnDof5.6 also changed the expression levels of genes involved in fatty acids synthesis and desaturation. Our results indicate that BnDof5.6 is required for embryo development and fatty acids synthesis in canola. Overall this study presents new information on the global expression patterns of genes during embryo development and will expand our understanding of the complex molecular mechanism of carbon flow into fatty acids and embryo development in canola. PMID:26092973

  13. Characterization of a nodavirus replicase revealed a de novo initiation mechanism of RNA synthesis and terminal nucleotidyltransferase activity.

    PubMed

    Wang, Zhaowei; Qiu, Yang; Liu, Yongxiang; Qi, Nan; Si, Jie; Xia, Xiaoling; Wu, Di; Hu, Yuanyang; Zhou, Xi

    2013-10-25

    Nodaviruses are a family of positive-stranded RNA viruses with a bipartite genome of RNAs. In nodaviruses, genomic RNA1 encodes protein A, which is recognized as an RNA-dependent RNA polymerase (RdRP) and functions as the sole viral replicase protein responsible for its RNA replication. Although nodaviral RNA replication has been studied in considerable detail, and nodaviruses are well recognized models for investigating viral RNA replication, the mechanism(s) governing the initiation of nodaviral RNA synthesis have not been determined. In this study, we characterized the RdRP activity of Wuhan nodavirus (WhNV) protein A in detail and determined that this nodaviral protein A initiates RNA synthesis via a de novo mechanism, and this RNA synthesis initiation could be independent of other viral or cellular factors. Moreover, we uncovered that WhNV protein A contains a terminal nucleotidyltransferase (TNTase) activity, which is the first time such an activity has been identified in nodaviruses. We subsequently found that the TNTase activity could function in vitro to repair the 3' initiation site, which may be digested by cellular exonucleases, to ensure the efficiency and accuracy of viral RNA synthesis initiation. Furthermore, we determined the cis-acting elements for RdRP or TNTase activity at the 3'-end of positive or negative strand RNA1. Taken together, our data establish the de novo synthesis initiation mechanism and the TNTase activity of WhNV protein A, and this work represents an important advance toward understanding the mechanism(s) of nodaviral RNA replication. PMID:24019510

  14. Stimulation of protein synthesis by phosphatidic acid in rat cardiomyocytes.

    PubMed

    Xu, Y J; Yau, L; Yu, L P; Elimban, V; Zahradka, P; Dhalla, N S

    1996-12-13

    Phosphatidic acid (PA) was observed to stimulate protein synthesis in adult cardiomyocytes in a time- and concentration-dependent manner. The maximal stimulation in protein synthesis (142 +/- 12% vs 100% as the control) was achieved at 10 microM PA within 60 min and was inhibited by actinomycin D (107 +/- 4% of the control) or cycloheximide (105 +/- 6% of the control). The increase in protein synthesis due to PA was attenuated or abolished by preincubation of cardiomyocytes with a tyrosine kinase inhibitor, genistein (94 +/- 9% of the control), phospholipase C inhibitors 2-nitro-4-carboxyphenyl N,N-diphenyl carbamate or carbon-odithioic acid O-(octahydro-4,7-methanol-1H-inden-5-yl (101 +/- 6 and 95 +/- 5% of the control, respectively), protein kinase C inhibitors staurosporine or polymyxin B (109 +/- 3 and 93 +/- 3% of the control), and chelators of extracellular and intracellular free Ca2+ EGTA or BAPTA/AM (103 +/- 6 and 95 +/- 6% of the control, respectively). PA at different concentrations (0.1 to 100 microM) also caused phosphorylation of a cell surface protein of approximately 24 kDa. In addition, mitogen-activated protein kinase was stimulated by PA in a concentration-dependent manner; maximal stimulation (217 +/- 6% of the control) was seen at 10 microM PA. These data suggest that PA increases protein synthesis in adult rat cardiomyocytes and thus may play an important role in the development of cardiac hypertrophy.

  15. MicroRNA-26a/b and their host genes synergistically regulate triacylglycerol synthesis by targeting the INSIG1 gene.

    PubMed

    Wang, Hui; Luo, Jun; Zhang, Tianying; Tian, Huibin; Ma, Yue; Xu, Huifen; Yao, Dawei; Loor, Juan J

    2016-05-01

    The microRNA-26 (miR-26) family is known to control adipogenesis in non-ruminants. The genomic loci of miR-26a and miR-26b have been localized in the introns of genes encoding for the proteins of the C-terminal domain RNA polymerase II polypeptide A small phosphatase (CTDSP) family. Insulin-induced gene 1 (INSIG1) encodes a protein with a key role in the regulation of lipogenesis in rodent liver. In the present study, we investigated the synergistic function of the miR-26 family and their host genes in goat mammary epithelial cells (GMEC). Downregulation of miR-26a/b and their host genes in GMEC decreased the expression of genes relate to fatty acid synthesis (PPARG, LXRA, SREBF1, FASN, ACACA, GPAM, LPIN1, DGAT1 and SCD1), triacylglycerol accumulation and unsaturated fatty acid synthesis. Luciferase reporter assays confirmed INSIG1 as a direct target of miR-26a/b. Furthermore, inhibition of the CTDSP family also downregulated the expression of INSIG1. Taken together, our findings highlight a functional association of miR-26a/b, their host genes and INSIG1, and provide new insights into the regulatory network controlling milk fat synthesis in GMEC. The data indicate that targeting this network via nutrition might be important for regulating milk fat synthesis in ruminants. PMID:27002347

  16. Cell-free synthesis of mouse mammary tumor virus Pr77 from virion and intracellular mRNA.

    PubMed Central

    Dahl, H H; Dickson, C

    1979-01-01

    Mouse mammary tumor virus (MuMTV) was purified from two cell lines (GR and Mm5MT/c1), and the genomic RNA was isolated and translated in vitro in cell-free systems derived from mouse L cells and rabbit reticulocytes. The major translation product in both systems was a protein with the molecular weight 77,000. Several other products were also detected, among them a 110,000-dalton and in minor amounts a 160,000-dalton protein. All three polypeptides were specifically immunoprecipitated by antiserum raised against the major core protein of MuMTV (p27), but they were not precipitated by antiserum against the virion glycoprotein gp52. Analysis of the in vitro products by tryptic peptide mapping established their relationship to the virion non-glycosylated structural proteins. The 77,000-dalton polypeptide was found to be similar, if not identical, to an analogous precursor isolated from MuMTV-producing cells. Peptide mapping of the 110,000-dalton protein shows that it contains all of the methionine-labeled peptides found in the 77,000-dalton protein plus some additional peptides. We conclude that the products synthesized in vitro from the genomic MuMTV RNA are related to the non-glycosylated virion structural proteins. Polyadenylic acid-containing RNA from MuMTV-producing cells also directed the synthesis of the 77,000-dalton polypeptide in the L-cell system. If this RNA preparation was first fractionated by sucrose gradient centrifugation the 77,000-dalton protein appeared to be synthesized from mRNA with a sedimentation coefficient between 25 and 35S. Images PMID:221668

  17. Microwave-Assisted Rapid Enzymatic Synthesis of Nucleic Acids.

    PubMed

    Hari Das, Rakha; Ahirwar, Rajesh; Kumar, Saroj; Nahar, Pradip

    2016-07-01

    Herein we report microwave-induced enhancement of the reactions catalyzed by Escherichia coli DNA polymerase I and avian myeloblastosis virus-reverse transcriptase. The reactions induced by microwaves result in a highly selective synthesis of nucleic acids in 10-50 seconds. In contrast, same reactions failed to give desired reaction products when carried out in the same time periods, but without microwave irradiation. Each of the reactions was carried out for different duration of microwave exposure time to find the optimum reaction time. The products produced by the respective enzyme upon microwave irradiation of the reaction mixtures were identical to that produced by the conventional procedures. As the microwave-assisted reactions are rapid, microwave could be a useful alternative to the conventional and time consuming procedures of enzymatic synthesis of nucleic acids. PMID:27159147

  18. A New Process for Acrylic Acid Synthesis by Fermentative Process

    NASA Astrophysics Data System (ADS)

    Lunelli, B. H.; Duarte, E. R.; de Toledo, E. C. Vasco; Wolf Maciel, M. R.; Maciel Filho, R.

    With the synthesis of chemical products through biotechnological processes, it is possible to discover and to explore innumerable routes that can be used to obtain products of high addes value. Each route may have particular advantages in obtaining a desired product, compared with others, especially in terms of yield, productivity, easiness to separate the product, economy, and environmental impact. The purpose of this work is the development of a deterministic model for the biochemical synthesis of acrylic acid in order to explore an alternative process. The model is built-up with the tubular reactor equations together with the kinetic representation based on the structured model. The proposed process makes possible to obtain acrylic acid continuously from the sugar cane fermentation.

  19. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1987-01-01

    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20 percent for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  20. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, A. L.

    1986-01-01

    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20% for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  1. Effect of insulin on human skeletal muscle mitochondrial ATP production, protein synthesis, and mRNA transcripts

    NASA Astrophysics Data System (ADS)

    Stump, Craig S.; Short, Kevin R.; Bigelow, Maureen L.; Schimke, Jill M.; Sreekumaran Nair, K.

    2003-06-01

    Mitochondria are the primary site of skeletal muscle fuel metabolism and ATP production. Although insulin is a major regulator of fuel metabolism, its effect on mitochondrial ATP production is not known. Here we report increases in vastus lateralis muscle mitochondrial ATP production capacity (32-42%) in healthy humans (P < 0.01) i.v. infused with insulin (1.5 milliunits/kg of fat-free mass per min) while clamping glucose, amino acids, glucagon, and growth hormone. Increased ATP production occurred in association with increased mRNA levels from both mitochondrial (NADH dehydrogenase subunit IV) and nuclear [cytochrome c oxidase (COX) subunit IV] genes (164-180%) encoding mitochondrial proteins (P < 0.05). In addition, muscle mitochondrial protein synthesis, and COX and citrate synthase enzyme activities were increased by insulin (P < 0.05). Further studies demonstrated no effect of low to high insulin levels on muscle mitochondrial ATP production for people with type 2 diabetes mellitus, whereas matched nondiabetic controls increased 16-26% (P < 0.02) when four different substrate combinations were used. In conclusion, insulin stimulates mitochondrial oxidative phosphorylation in skeletal muscle along with synthesis of gene transcripts and mitochondrial protein in human subjects. Skeletal muscle of type 2 diabetic patients has a reduced capacity to increase ATP production with high insulin levels. cytochrome c oxidase | NADH dehydrogenase subunit IV | amino acids | citrate synthase

  2. Structure of acridines and their effect on RNA synthesis in vitro.

    PubMed

    Szmigiero, L; Slaska, K; Ciesielska, E; Jaros-Kamińska, B; Gniazdowski, M

    1977-01-01

    1. Ledakrin (C-283), a 1-nitro-9-aminopropylacridine derivative, inhibits RNA synthesis in vitro if the complex with DNA is formed in the presence of thiol. 2. Using several analogues of Ledakrin, it has been found that the 1-nitro group is essential for enhancement of the inhibition by thiol; the length of 9-aminoalkyl side chain also plays a role in the reaction between DNA and the dye. 3. It is suggested that the low inhibitory effect of Ledakrin in the absence of thiol compounds is due to a steric hindrance between neighbouring 1-nitro and 9-aminoalkyl groups. This hypothesis has been confirmed by assaying inhibition of RNA synthesis by several analogues of Ledakrin. PMID:868436

  3. Synthesis of oligodiaminomannoses and analysis of their RNA duplex binding properties and their potential application as siRNA-based drugs.

    PubMed

    Iwata, Rintaro; Doi, Akiko; Maeda, Yusuke; Wada, Takeshi

    2015-09-28

    The synthesis of artificial cationic oligodiaminosaccharides, α-(1 → 4)-linked-2,6-diamino-2,6-dideoxy-d-mannopyranose oligomers (ODAMans), and their interactions with RNA duplexes are described. The monomer through the pentamer, all of which bear unnatural 2,6-diaminomannose moieties, were successfully prepared. UV melting and fluorescence anisotropy analyses revealed that the ODAMans bound and thermodynamically stabilized both 12mer RNA duplexes and an siRNA. Furthermore, it was clearly shown that the siRNA acquired substantial RNase A resistance due to its binding to the ODAMan 4mer. PMID:26256756

  4. Is Acetylcarnitine a Substrate for Fatty Acid Synthesis in Plants?

    PubMed

    Roughan, G.; Post-Beittenmiller, D.; Ohlrogge, J.; Browse, J.

    1993-04-01

    Long-chain fatty acid synthesis from [1-14C]acetylcarnitine by chloroplasts isolated from spinach (Spinacia oleracea), pea (Pisum sativum), amaranthus (Amaranthus lividus), or maize (Zea mays) occurred at less than 2% of the rate of fatty acid synthesis from [1-14C]acetate irrespective of the maturity of the leaves or whether the plastids were purified using sucrose or Percoll medium. [1-14C]-Acetylcarnitine was not significantly utilized by highly active chloroplasts rapidly prepared from pea and spinach using methods not involving density gradient centrifugation. [1-14C]Acetylcarnitine was recovered quantitatively from chloroplast incubations following 10 min in the light. Unlabeled acetyl-L-carnitine (0.4 mM) did not compete with [1-14C]acetate (0.2 mM) as a substrate for fatty acid synthesis by any of the more than 70 chloroplast preparations tested in this study. Carnitine acetyltransferase activity was not detected in any chloroplast preparation and was present in whole leaf homogenates at about 0.1% of the level of acetyl-coenzyme A synthetase activity. When supplied to detached pea shoots and detached spinach, amaranthus, and maize leaves via the transpiration stream, 1 to 4% of the [1-14C]acetylcarnitine and 47 to 57% of the [1-14C]acetate taken up was incorporated into lipids. Most (78-82%) of the [1-14C]acetylcarnitine taken up was recovered intact. It is concluded that acetylcarnitine is not a major precursor for fatty acid synthesis in plants.

  5. Is acetylcarnitine a substrate for fatty acid synthesis in plants

    SciTech Connect

    Roughan, G. ); Post-Beittenmiller, D.; Ohlrogge, J. ); Browse, J. )

    1993-04-01

    Long-chain fatty acid synthesis from [1-[sup 14]C]acetylcarnitine by chloroplasts isolated from spinach (Spinacia oleracea), pea (Pisum sativum), amaranthus (Amaranthus lividus), or maize (Zea mays) occurred at less than 2% of the rate of fatty acid synthesis from [1-[sup 14]C]acetate irrespective of the maturity of the leaves or whether the plastids were purified using sucrose or Percoll medium. [1-[sup 14]C]Acetylcarnitine was not significantly utilized by highly active chloroplasts rapidly prepared from pea and spinach using methods not involving density gradient centrifugation. [1-[sup 14]C]Acetylcarnitine was recovered quantitatively from chloroplast incubations following 10 min in the light. Unlabeled acetyl-L-carnitine (0.4 mM) did not compete with [1-[sup 14]C]acetate (0.2 mM) as a substrate for fatty acid synthesis by any of the more than 70 chloroplast preparations tested in this study. Carnitine acetyltransferase activity was not detected in any chloroplast preparation and was present in whole leaf homogenates at about 0.1% of the level of acetyl-coenzyme A synthetase activity. When supplied to detached pea shoots and detached spinach, amaranthus, and maize leaves via the transpiration stream, 1 to 4% of the [1-[sup 14]C]acetylcarnitine and 47 to 57% of the [1-[sup 14]C]acetate taken up was incorporated into lipids. Most (78--82%) of the [1-[sup 14]C]acetylcarnitine taken up was recovered intact. It is concluded that acetylcarnitine is not a major precursor for fatty acid synthesis in plants. 29 refs., 5 tabs.

  6. Design and synthesis of caged fluorescent nucleotides and application to live-cell RNA imaging.

    PubMed

    Ikeda, Shuji; Kubota, Takeshi; Wang, Dan Ohtan; Yanagisawa, Hiroyuki; Umemoto, Tadashi; Okamoto, Akimitsu

    2011-12-16

    A binary photocontrolled nucleic acid probe that contains a nucleotide modified with one photolabile nitrobenzyl unit and two hybridization-sensitive thiazole orange units has been designed for area-specific fluorescence imaging of RNA in a cell. The synthesized probe emitted very weak fluorescence regardless of the presence of the complementary RNA, whereas it showed hybridization-sensitive fluorescence emission at 532 nm after photoirradiation at 360 or 405 nm for uncaging. Fluorescence suppression of the caged probe was attributed to a decrease in the duplex-formation ability. Caged fluorescent nucleotides with other emission wavelengths (622 and 724 nm) were also synthesized in this study; they were uncaged by 360 nm irradiation, and emitted fluorescence in the presence of the complementary RNA. Such probes were applied to area-specific RNA imaging in a cell. Only probes in the defined irradiation area were activated by uncaging irradiation, and subnuclear mRNA diffusion in a living cell was monitored.

  7. Osteoblast fibronectin mRNA, protein synthesis, and matrix are unchanged after exposure to microgravity

    NASA Technical Reports Server (NTRS)

    Hughes-Fulford, M.; Gilbertson, V.

    1999-01-01

    The well-defined osteoblast line, MC3T3-E1 was used to examine fibronectin (FN) mRNA levels, protein synthesis, and extracellular FN matrix accumulation after growth activation in spaceflight. These osteoblasts produce FN extracellular matrix (ECM) known to regulate adhesion, differentiation, and function in adherent cells. Changes in bone ECM and osteoblast cell shape occur in spaceflight. To determine whether altered FN matrix is a factor in causing these changes in spaceflight, quiescent osteoblasts were launched into microgravity and were then sera activated with and without a 1-gravity field. Synthesis of FN mRNA, protein, and matrix were measured after activation in microgravity. FN mRNA synthesis is significantly reduced in microgravity (0-G) when compared to ground (GR) osteoblasts flown in a centrifuge simulating earth's gravity (1-G) field 2.5 h after activation. However, 27.5 h after activation there were no significant differences in mRNA synthesis. A small but significant reduction of FN protein was found in the 0-G samples 2.5 h after activation. Total FN protein 27.5 h after activation showed no significant difference between any of the gravity conditions, however, there was a fourfold increase in absolute amount of protein synthesized during the incubation. Using immunofluorescence, we found no significant differences in the amount or in the orientation of the FN matrix after 27.5 h in microgravity. These results demonstrate that FN is made by sera-activated osteoblasts even during exposure to microgravity. These data also suggest that after a total period of 43 h of spaceflight FN transcription, translation, or altered matrix assembly is not responsible for the altered cell shape or altered matrix formation of osteoblasts.

  8. Synthesis and degradation of the mRNA of the Tn21 mer operon.

    PubMed

    Gambill, B D; Summers, A O

    1992-05-20

    The mercury resistance locus encoded by Tn21 on the monocopy IncFII plasmid R100 (merTn21) consists of a metal-responsive activator/repressor, merR, which controls initiation of a polycistronic message that includes genes for the uptake (merTPC) and reduction (merA) of Hg2+ and merD, which may also play a minor regulatory role. Comparison of the relative abundance of the 5' and 3' ends of the merTPCAD transcript revealed a strong transcriptional gradient in the operon, consistent with previous observations of lower relative abundance of the more promoter-distal gene products. In vivo mRNA degradation rates varied only slightly for the different genes: however, the rates of mRNA synthesis varied considerably from the beginning to the end of the operon. Specifically, mRNA corresponding to the promoter-proximal genes, merTPC, achieved a maximum in vivo synthesis rate between 60 and 120 seconds after induction; this rate was maintained for approximately ten minutes. In contrast, the synthesis rates of mRNA corresponding to the promoter-distal genes merA and merD, were initially fivefold lower than the rates of the promoter-proximal genes for the first five minutes after induction, and then rose gradually to approximately 50% of the merTPC synthesis rates. These data suggested that early after induction only 20% of the transcripts initiating at merT proceed beyond merC. At later times after induction approximately 50% of the transcripts proceed beyond merC. Nuclease end mapping did not reveal any discrete termination events in the merPCA region, thus, premature termination may occur at many sites.

  9. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  10. A direct method for the synthesis of orthogonally protected furyl- and thienyl- amino acids.

    PubMed

    Hudson, Alex S; Caron, Laurent; Colgin, Neil; Cobb, Steven L

    2015-04-01

    The synthesis of unnatural amino acids plays a key part in expanding the potential application of peptide-based drugs and in the total synthesis of peptide natural products. Herein, we report a direct method for the synthesis of orthogonally protected 5-membered heteroaromatic amino acids.

  11. Synthesis of rosin acid starch catalyzed by lipase.

    PubMed

    Lin, Rihui; Li, He; Long, Han; Su, Jiating; Huang, Wenqin

    2014-01-01

    Rosin, an abundant raw material from pine trees, was used as a starting material directly for the synthesis of rosin acid starch. The esterification reaction was catalyzed by lipase (Novozym 435) under mild conditions. Based on single factor experimentation, the optimal esterification conditions were obtained as follows: rosin acid/anhydrous glucose unit in the molar ratio 2:1, reaction time 4 h at 45°C, and 15% of lipase dosage. The degree of substitution (DS) reaches 0.098. Product from esterification of cassava starch with rosin acid was confirmed by FTIR spectroscopy and iodine coloration analysis. Scanning electron microscopy and X-ray diffraction analysis showed that the morphology and crystallinity of the cassava starch were largely destroyed. Thermogravimetric analysis indicated that thermal stability of rosin acid starch decreased compared with native starch.

  12. Pterandric acid--its isolation, synthesis and stereochemistry.

    PubMed

    Haleem, Muhammad A; Capellari, Simone C; Sympson, Beryl B; Marsaioli, Anita J

    2015-01-01

    Some plant families have a specialized type of pollination system, with floral lipid rewards for pollinators, which is common. In neotropical Malpighiaceae species like Pterandra pyroidea, this specialized type of pollination system is apparently shifting from floral oils/lipids to pollen reward. Mass spectrometric analysis (GC/MS-EI) indicated that P. pyroidea floral oil has a unique chemical composition, i.e., few fatty acid constituents possessing acetoxy groups at positions 5 and 7, which is distinct from the other floral oils of sympatric Malpighiaceae species. The structure of the major floral oil constituent, a novel fatty acid, anti-5,7-diacetoxydocosanoic acid, was confirmed based on synthesis, mass fragmentation, and 1H and 13C NMR analyses; the compound is herein named pterandric acid.

  13. Very long chain fatty acid synthesis in sunflower kernels.

    PubMed

    Salas, Joaquín J; Martínez-Force, Enrique; Garcés, Rafael

    2005-04-01

    Most common seed oils contain small amounts of very long chain fatty acids (VLCFAs), the main components of oils from species such as Brassica napus or Lunnaria annua. These fatty acids are synthesized from acyl-CoA precursors in the endoplasmic reticulum through the activity of a dissociated enzyme complex known as fatty acid elongase. We studied the synthesis of the arachidic, behenic, and lignoceric VLCFAs in sunflower kernels, in which they account for 1-3% of the saturated fatty acids. These VLCFAs are synthesized from 18:0-CoA by membrane-bound fatty acid elongases, and their biosynthesis is mainly dependent on NADPH equivalents. Two condensing enzymes appear to be responsible for the synthesis of VLCFAs in sunflower kernels, beta-ketoacyl-CoA synthase-I (KCS-I) and beta-ketoacyl-CoA synthase-II (KCS-II). Both of these enzymes were resolved by ion exchange chromatography and display different substrate specificities. While KCS-I displays a preference for 20:0-CoA, 18:0-CoA was more efficiently elongated by KCS-II. Both enzymes have different sensitivities to pH and Triton X-100, and their kinetic properties indicate that both are strongly inhibited by the presence of their substrates. In light of these results, the VLCFA composition of sunflower oil is considered in relation to that in other commercially exploited oils.

  14. Predicted class-I aminoacyl tRNA synthetase-like proteins in non-ribosomal peptide synthesis

    PubMed Central

    2010-01-01

    Background Recent studies point to a great diversity of non-ribosomal peptide synthesis systems with major roles in amino acid and co-factor biosynthesis, secondary metabolism, and post-translational modifications of proteins by peptide tags. The least studied of these systems are those utilizing tRNAs or aminoacyl-tRNA synthetases (AAtRS) in non-ribosomal peptide ligation. Results Here we describe novel examples of AAtRS related proteins that are likely to be involved in the synthesis of widely distributed peptide-derived metabolites. Using sensitive sequence profile methods we show that the cyclodipeptide synthases (CDPSs) are members of the HUP class of Rossmannoid domains and are likely to be highly derived versions of the class-I AAtRS catalytic domains. We also identify the first eukaryotic CDPSs in fungi and in animals; they might be involved in immune response in the latter organisms. We also identify a paralogous version of the methionyl-tRNA synthetase, which is widespread in bacteria, and present evidence using contextual information that it might function independently of protein synthesis as a peptide ligase in the formation of a peptide- derived secondary metabolite. This metabolite is likely to be heavily modified through multiple reactions catalyzed by a metal-binding cupin domain and a lysine N6 monooxygenase that are strictly associated with this paralogous methionyl-tRNA synthetase (MtRS). We further identify an analogous system wherein the MtRS has been replaced by more typical peptide ligases with the ATP-grasp or modular condensation-domains. Conclusions The prevalence of these predicted biosynthetic pathways in phylogenetically distant, pathogenic or symbiotic bacteria suggests that metabolites synthesized by them might participate in interactions with the host. More generally, these findings point to a complete spectrum of recruitment of AAtRS to various non-ribosomal biosynthetic pathways, ranging from the conventional AAtRS, through

  15. PlsX deletion impacts fatty acid synthesis and acid adaptation in Streptococcus mutans.

    PubMed

    Cross, Benjamin; Garcia, Ariana; Faustoferri, Roberta; Quivey, Robert G

    2016-04-01

    Streptococcus mutans, one of the primary causative agents of dental caries in humans, ferments dietary sugars in the mouth to produce organic acids. These acids lower local pH values, resulting in demineralization of the tooth enamel, leading to caries. To survive acidic environments, Strep. mutans employs several adaptive mechanisms, including a shift from saturated to unsaturated fatty acids in membrane phospholipids. PlsX is an acyl-ACP : phosphate transacylase that links the fatty acid synthase II (FASII) pathway to the phospholipid synthesis pathway, and is therefore central to the movement of unsaturated fatty acids into the membrane. Recently, we discovered that plsX is not essential in Strep. mutans. A plsX deletion mutant was not a fatty acid or phospholipid auxotroph. Gas chromatography of fatty acid methyl esters indicated that membrane fatty acid chain length in the plsX deletion strain differed from those detected in the parent strain, UA159. The deletion strain displayed a fatty acid shift similar to WT, but had a higher percentage of unsaturated fatty acids at low pH. The deletion strain survived significantly longer than the parent strain when cultures were subjected to an acid challenge of pH 2.5.The ΔplsX strain also exhibited elevated F-ATPase activity at pH 5.2, compared with the parent. These results indicate that the loss of plsX affects both the fatty acid synthesis pathway and the acid-adaptive response of Strep. mutans. PMID:26850107

  16. A Study on Amino Acids: Synthesis of Alpha-Aminophenylacetic Acid (Phenylglycine) and Determination of its Isoelectric Point.

    ERIC Educational Resources Information Center

    Barrelle, M.; And Others

    1983-01-01

    Background information and procedures are provided for an experimental study on aminophenylacetic acid (phenylglycine). These include physical chemistry (determination of isoelectric point by pH measurement) and organic chemistry (synthesis of an amino acid in racemic form) experiments. (JN)

  17. tRNA acceptor-stem and anticodon bases embed separate features of amino acid chemistry.

    PubMed

    Carter, Charles W; Wolfenden, Richard

    2016-01-01

    The universal genetic code is a translation table by which nucleic acid sequences can be interpreted as polypeptides with a wide range of biological functions. That information is used by aminoacyl-tRNA synthetases to translate the code. Moreover, amino acid properties dictate protein folding. We recently reported that digital correlation techniques could identify patterns in tRNA identity elements that govern recognition by synthetases. Our analysis, and the functionality of truncated synthetases that cannot recognize the tRNA anticodon, support the conclusion that the tRNA acceptor stem houses an independent code for the same 20 amino acids that likely functioned earlier in the emergence of genetics. The acceptor-stem code, related to amino acid size, is distinct from a code in the anticodon that is related to amino acid polarity. Details of the acceptor-stem code suggest that it was useful in preserving key properties of stereochemically-encoded peptides that had developed the capacity to interact catalytically with RNA. The quantitative embedding of the chemical properties of amino acids into tRNA bases has implications for the origins of molecular biology.

  18. tRNA acceptor-stem and anticodon bases embed separate features of amino acid chemistry.

    PubMed

    Carter, Charles W; Wolfenden, Richard

    2016-01-01

    The universal genetic code is a translation table by which nucleic acid sequences can be interpreted as polypeptides with a wide range of biological functions. That information is used by aminoacyl-tRNA synthetases to translate the code. Moreover, amino acid properties dictate protein folding. We recently reported that digital correlation techniques could identify patterns in tRNA identity elements that govern recognition by synthetases. Our analysis, and the functionality of truncated synthetases that cannot recognize the tRNA anticodon, support the conclusion that the tRNA acceptor stem houses an independent code for the same 20 amino acids that likely functioned earlier in the emergence of genetics. The acceptor-stem code, related to amino acid size, is distinct from a code in the anticodon that is related to amino acid polarity. Details of the acceptor-stem code suggest that it was useful in preserving key properties of stereochemically-encoded peptides that had developed the capacity to interact catalytically with RNA. The quantitative embedding of the chemical properties of amino acids into tRNA bases has implications for the origins of molecular biology. PMID:26595350

  19. The Ebola Virus VP30-NP Interaction Is a Regulator of Viral RNA Synthesis

    PubMed Central

    Kirchdoerfer, Robert N.; Moyer, Crystal L.; Abelson, Dafna M.; Saphire, Erica Ollmann

    2016-01-01

    Filoviruses are capable of causing deadly hemorrhagic fevers. All nonsegmented negative-sense RNA-virus nucleocapsids are composed of a nucleoprotein (NP), a phosphoprotein (VP35) and a polymerase (L). However, the VP30 RNA-synthesis co-factor is unique to the filoviruses. The assembly, structure, and function of the filovirus RNA replication complex remain unclear. Here, we have characterized the interactions of Ebola, Sudan and Marburg virus VP30 with NP using in vitro biochemistry, structural biology and cell-based mini-replicon assays. We have found that the VP30 C-terminal domain interacts with a short peptide in the C-terminal region of NP. Further, we have solved crystal structures of the VP30-NP complex for both Ebola and Marburg viruses. These structures reveal that a conserved, proline-rich NP peptide binds a shallow hydrophobic cleft on the VP30 C-terminal domain. Structure-guided Ebola virus VP30 mutants have altered affinities for the NP peptide. Correlation of these VP30-NP affinities with the activity for each of these mutants in a cell-based mini-replicon assay suggests that the VP30-NP interaction plays both essential and inhibitory roles in Ebola virus RNA synthesis. PMID:27755595

  20. Analysis of Global RNA Synthesis at the Single Cell Level following Hypoxia

    PubMed Central

    Biddlestone, John; Druker, Jimena; Shmakova, Alena; Ferguson, Gus; Swedlow, Jason R.; Rocha, Sonia

    2014-01-01

    Hypoxia or lowering of the oxygen availability is involved in many physiological and pathological processes. At the molecular level, cells initiate a particular transcriptional program in order to mount an appropriate and coordinated cellular response. The cell possesses several oxygen sensor enzymes that require molecular oxygen as cofactor for their activity. These range from prolyl-hydroxylases to histone demethylases. The majority of studies analyzing cellular responses to hypoxia are based on cellular populations and average studies, and as such single cell analysis of hypoxic cells are seldom performed. Here we describe a method of analysis of global RNA synthesis at the single cell level in hypoxia by using Click-iT RNA imaging kits in an oxygen controlled workstation, followed by microscopy analysis and quantification.  Using cancer cells exposed to hypoxia for different lengths of time, RNA is labeled and measured in each cell. This analysis allows the visualization of temporal and cell-to-cell changes in global RNA synthesis following hypoxic stress. PMID:24895009

  1. Retinoic Acid Induces Embryonic Stem Cell Differentiation by Altering Both Encoding RNA and microRNA Expression.

    PubMed

    Zhang, Jingcheng; Gao, Yang; Yu, Mengying; Wu, Haibo; Ai, Zhiying; Wu, Yongyan; Liu, Hongliang; Du, Juan; Guo, Zekun; Zhang, Yong

    2015-01-01

    Retinoic acid (RA) is a vitamin A metabolite that is essential for early embryonic development and promotes stem cell neural lineage specification; however, little is known regarding the impact of RA on mRNA transcription and microRNA levels on embryonic stem cell differentiation. Here, we present mRNA microarray and microRNA high-output sequencing to clarify how RA regulates gene expression. Using mRNA microarray analysis, we showed that RA repressed pluripotency-associated genes while activating ectoderm markers in mouse embryonic stem cells (mESCs). Moreover, RA modulated the DNA methylation of mESCs by altering the expression of epigenetic-associated genes such as Dnmt3b and Dnmt3l. Furthermore, H3K4me2, a pluripotent histone modification, was repressed by RA stimulation. From microRNA sequence data, we identified two downregulated microRNAs, namely, miR-200b and miR-200c, which regulated the pluripotency of stem cells. We found that miR-200b or miR-200c deficiency suppressed the expression of pluripotent genes, including Oct4 and Nanog, and activated the expression of the ectodermal marker gene Nestin. These results demonstrate that retinoid induces mESCs to differentiate by regulating miR-200b/200c. Our findings provide the landscapes of mRNA and microRNA gene networks and indicate the crucial role of miR-200b/200c in the RA-induced differentiation of mESCs.

  2. Boron Stress Activates the General Amino Acid Control Mechanism and Inhibits Protein Synthesis

    PubMed Central

    Uluisik, Irem; Kaya, Alaattin; Fomenko, Dmitri E.; Karakaya, Huseyin C.; Carlson, Bradley A.; Gladyshev, Vadim N.; Koc, Ahmet

    2011-01-01

    Boron is an essential micronutrient for plants, and it is beneficial for animals. However, at high concentrations boron is toxic to cells although the mechanism of this toxicity is not known. Atr1 has recently been identified as a boron efflux pump whose expression is upregulated in response to boron treatment. Here, we found that the expression of ATR1 is associated with expression of genes involved in amino acid biosynthesis. These mechanisms are strictly controlled by the transcription factor Gcn4 in response to boron treatment. Further analyses have shown that boron impaired protein synthesis by promoting phosphorylation of eIF2α in a Gcn2 kinase dependent manner. The uncharged tRNA binding domain (HisRS) of Gcn2 is necessary for the phosphorylation of eIF2α in the presence of boron. We postulate that boron exerts its toxic effect through activation of the general amino acid control system and inhibition of protein synthesis. Since the general amino acid control pathway is conserved among eukaryotes, this mechanism of boron toxicity may be of general importance. PMID:22114689

  3. The prebiotic synthesis of modified purines and their potential role in the RNA world

    NASA Technical Reports Server (NTRS)

    Levy, M.; Miller, S. L.; Bada, J. L. (Principal Investigator)

    1999-01-01

    Modified purines are found in all organisms in the tRNA, rRNA, and even DNA, raising the possibility of an early role for these compounds in the evolution of life. These include N6-methyladenine, 1-methyladenine, N6,N6-dimethyladenine, 1-methylhypoxanthine, 1-methylguanine, and N2-methylguanine. We find that these bases as well as a number of nonbiological modified purines can be synthesized from adenine and guanine by the simple reaction of an amine or an amino group with adenine and guanine under the concentrated conditions of the drying-lagoon or drying-beach model of prebiotic synthesis with yields as high as 50%. These compounds are therefore as prebiotic as adenine and guanine and could have played an important role in the RNA world by providing additional functional groups in ribozymes, especially for the construction of hydrophobic binding pockets.

  4. Chemical synthesis of a biologically active natural tRNA with its minor bases.

    PubMed Central

    Gasparutto, D; Livache, T; Bazin, H; Duplaa, A M; Guy, A; Khorlin, A; Molko, D; Roget, A; Téoule, R

    1992-01-01

    The complete chemical synthesis of an E. coli tRNA(Ala) with its specific minor nucleosides, dihydrouridine, ribothymidine and pseudouridine, is reported. The method makes use of protected 2'-O-tertiobutyldimethylsilyl-ribonucleoside-3'-O-(2-cyanoethyl-N- ethyl-N- methyl)phosphoramidites. The exocyclic amino functions of the bases were protected by the phenoxyacetyl group for purines and acetyl for cytosine. The assembling has been performed on a silica support with coupling yield better than 98% within 2 min of condensation. Triethylamine tris-hydrofluoride allowed a clean and complete deprotection of the tBDMS groups. The synthetic tRNA(Ala) has been transcribed into cDNA by reverse transcriptase and sequenced. With E. coli alanyl-tRNA synthetase the alanyl acceptance activity and kcat/Km were 672 pmol/A260 and 6 x 10(4)M-1s-1, respectively. Images PMID:1383941

  5. RNA synthesis in isolated nuclei of lactating mammary cells in presence of unmodified and mercury-labeled CTP.

    PubMed Central

    Ganguly, R; Banerjee, M R

    1978-01-01

    Isolated nuclei of lactating mouse mammary gland were capable of supporting DNA-dependent RNA synthesis in vitro in presence of unmodified and mercurated CTP (Hg-CTP) at high ionic condition at 25 degrees C. In presence of unmodified CTP, [3H]UMP incorporation into RNA increased linearly upto 180 min. The kinetic pattern of the reaction and the rate of RNA synthesis were essentially similar when CTP was replaced by Hg-CTP. Both in unmodified and Hg-CTP containing reactions, 70-80% of RNA synthesis was inhibited by alpha-amanitin. Presence of poly(A) in a small portion of the in vitro synthesized messenger-like RNA was detectable by oligo(dT) cellulose chromatography. Both poly(A)+ and poly(A)- RNAs sedimented with a clear peak around 15S region in a formamide-sucrose denaturing gradient. The Hg-RNA after separation from endogenous nuclear RNA by SH-agarose affinity column chromatography also sedimented around 15S region in a formamide-sucrose gradient. The Hg-RNA synthesized in the isolated mammary cell nuclei in vitro should now permit monitoring hormonal regulation of specific gene (casein) transcription in the mammary cells by molecular hybridization of the Hg-RNA with cDNA to casein mRNA. PMID:724523

  6. Visible sensing of nucleic acid sequences using a genetically encodable unmodified mRNA probe.

    PubMed

    Narita, Atsushi; Ogawa, Kazumasa; Sando, Shinsuke; Aoyama, Yasuhiro

    2006-01-01

    We previously reported a molecular beacon-mRNA (MB-mRNA) strategy for nucleic acid detection/sensing in a cell-free translation system using unmodified RNA as a probe. Here in this presentation, we report that a combination with RNase H activity, which induces an additional process of irreversible cleavage of MB-domain, achieves an improved sequence selectivity (one nucleotide selectivity) and an enhanced sensitivity. This improved system finally enabled visible sensing of target nucleic acid sequence at a single nucleotide resolution under isothermal conditions.

  7. Synthesis and Characterization of Fatty Acid Conjugates of Niacin and Salicylic Acid.

    PubMed

    Vu, Chi B; Bemis, Jean E; Benson, Ericka; Bista, Pradeep; Carney, David; Fahrner, Richard; Lee, Diana; Liu, Feng; Lonkar, Pallavi; Milne, Jill C; Nichols, Andrew J; Picarella, Dominic; Shoelson, Adam; Smith, Jesse; Ting, Amal; Wensley, Allison; Yeager, Maisy; Zimmer, Michael; Jirousek, Michael R

    2016-02-11

    This report describes the synthesis and preliminary biological characterization of novel fatty acid niacin conjugates and fatty acid salicylate conjugates. These molecular entities were created by covalently linking two bioactive molecules, either niacin or salicylic acid, to an omega-3 fatty acid. This methodology allows the simultaneous intracellular delivery of two bioactives in order to elicit a pharmacological response that could not be replicated by administering the bioactives individually or in combination. The fatty acid niacin conjugate 5 has been shown to be an inhibitor of the sterol regulatory element binding protein (SREBP), a key regulator of cholesterol metabolism proteins such as PCSK9, HMG-CoA reductase, ATP citrate lyase, and NPC1L1. On the other hand, the fatty acid salicylate conjugate 11 has been shown to have a unique anti-inflammatory profile based on its ability to modulate the NF-κB pathway through the intracellular release of the two bioactives.

  8. Delivery of siRNA Using Cationic Liposomes Incorporating Stearic Acid-modified Octa-Arginine.

    PubMed

    Yang, Dongsheng; Li, Yuhuan; Qi, Yuhang; Chen, Yongzhen; Yang, Xuewei; Li, Yujing; Liu, Songcai; Lee, Robert J

    2016-07-01

    Cationic liposomes incorporating stearic acid-modified octa-arginine (StA-R8) were evaluated for survivin small interfering RNA (siRNA) delivery. StA-R8 was synthesized and incorporated into liposomes. The composition of liposomes was optimized. Physicochemical properties, cytotoxicity, cellular uptake and gene silencing activity of the liposomes complexed to survivin siRNA were investigated. The results showed that StA-R8-containing liposomes had reduced cytotoxicity and improved delivery efficiency of siRNA into cancer cells compared with StA-R8 by itself.

  9. Delivery of siRNA Using Cationic Liposomes Incorporating Stearic Acid-modified Octa-Arginine.

    PubMed

    Yang, Dongsheng; Li, Yuhuan; Qi, Yuhang; Chen, Yongzhen; Yang, Xuewei; Li, Yujing; Liu, Songcai; Lee, Robert J

    2016-07-01

    Cationic liposomes incorporating stearic acid-modified octa-arginine (StA-R8) were evaluated for survivin small interfering RNA (siRNA) delivery. StA-R8 was synthesized and incorporated into liposomes. The composition of liposomes was optimized. Physicochemical properties, cytotoxicity, cellular uptake and gene silencing activity of the liposomes complexed to survivin siRNA were investigated. The results showed that StA-R8-containing liposomes had reduced cytotoxicity and improved delivery efficiency of siRNA into cancer cells compared with StA-R8 by itself. PMID:27354583

  10. Ribonucleic Acid Regulation in Permeabilized Cells of Escherichia coli Capable of Ribonucleic Acid and Protein Synthesis1

    PubMed Central

    Atherly, Alan G.

    1974-01-01

    A cell permeabilization procedure is described that reduces viability less than 10% and does not significantly reduce the rates of ribonucleic acid and protein synthesis when appropriately supplemented. Permeabilization abolishes the normal stringent coupling of protein and ribonucleic acid synthesis. PMID:4364330

  11. Synthesis of human adenovirus early RNA species is similar in productive and abortive infections of monkey and human cells.

    PubMed Central

    Anderson, K P; Klessig, D F

    1982-01-01

    Northern (RNA) blot analysis has been used to show that synthesis of early mRNA species is similar in monkey cells productively or abortively infected with human adenovirus. mRNA species from all five major early regions (1A, 1B, 2, 3, 4) are identical in size and comparable in abundance whether isolated from monkey cells infected with adenovirus type 2 or with the host range mutant Ad2hr400 or coinfected with adenovirus type 2 plus simian virus 40. The mRNA species isolated from monkey cells are identical in size to those isolated from human cells. Production of virus-associated RNA is also identical in productive and abortive infections of monkey cells. Synthesis of virus-associated RNA is, however, significantly greater in HeLa cells than in CV1 cells at late times after infection regardless of which virus is used in the infection. Images PMID:6283181

  12. Synthesis and characterization of magnetite nanoparticles coated with lauric acid

    SciTech Connect

    Mamani, J.B.; Costa-Filho, A.J.; Cornejo, D.R.; Vieira, E.D.; Gamarra, L.F.

    2013-07-15

    Understanding the process of synthesis of magnetic nanoparticles is important for its implementation in in vitro and in vivo studies. In this work we report the synthesis of magnetic nanoparticles made from ferrous oxide through coprecipitation chemical process. The nanostructured material was coated with lauric acid and dispersed in aqueous medium containing surfactant that yielded a stable colloidal suspension. The characterization of magnetic nanoparticles with distinct physico-chemical configurations is fundamental for biomedical applications. Therefore magnetic nanoparticles were characterized in terms of their morphology by means of TEM and DLS, which showed a polydispersed set of spherical nanoparticles (average diameter of ca. 9 nm) as a result of the protocol. The structural properties were characterized by using X-ray diffraction (XRD). XRD pattern showed the presence of peaks corresponding to the spinel phase of magnetite (Fe{sub 3}O{sub 4}). The relaxivities r{sub 2} and r{sub 2}* values were determined from the transverse relaxation times T{sub 2} and T{sub 2}* at 3 T. Magnetic characterization was performed using SQUID and FMR, which evidenced the superparamagnetic properties of the nanoparticles. Thermal characterization using DSC showed exothermic events associated with the oxidation of magnetite to maghemite. - Highlights: • Synthesis of magnetic nanoparticles coated with lauric acid • Characterization of magnetic nanoparticles • Morphological, structural, magnetic, calorimetric and relaxometric characterization.

  13. Ravynic acid, an antibiotic polyeneyne tetramic acid from Penicillium sp. elucidated through synthesis.

    PubMed

    Myrtle, J D; Beekman, A M; Barrow, R A

    2016-09-21

    A new antibiotic natural product, ravynic acid, has been isolated from a Penicillium sp. of fungus, collected from Ravensbourne National Park. The 3-acylpolyenyne tetramic acid structure was definitively elucidated via synthesis. Highlights of the synthetic method include the heat induced formation of the 3-acylphosphorane tetramic acid and a selective Wittig cross-coupling to efficiently prepare the natural compounds carbon skeleton. The natural compound was shown to inhibit the growth of Staphylococcus aureus down to concentrations of 2.5 µg mL(-1). PMID:27519121

  14. An assay for ribonuclease activity, based on ultraviolet absorption of RNA hydrolysate, using phosphotungstic acid.

    PubMed

    Isobe, K; Uchiyama, S

    1986-06-01

    In the method for the determination of ribonuclease activity that depends on the ultraviolet absorption of the RNA hydrolysate, the uranium reagent (25% perchloric acid solution containing 0.75% uranyl acetate) is commonly used for the efficient precipitation of the unhydrolyzed RNA. However, this reagent is always contaminated by the presence of radioactive isotopes. Radioactive uranium is one of the substances used for atomic nuclear fuel and therefore, at least in Japan, the use of uranium compounds requires permission from the government. We tried to find another efficient and non-radioactive precipitant of RNA to replace the uranium reagent, and have developed a phosphotungsten reagent (25% perchloric acid solution containing 0.75% phosphotungstic acid plus 0.6% bovine serum albumin solution) which functions as efficiently as the uranium reagent in the precipitation of RNA. A cell-free crude extract of Dictyostelium discoideum was used as the source of ribonuclease.

  15. Eutectic Phases in Ice Facilitate Nonenzymatic Nucleic Acid Synthesis

    NASA Astrophysics Data System (ADS)

    Kanavarioti, Anastassia; Monnard, Pierre-Alain; Deamer, David W.

    2001-09-01

    Polymeric compounds similar to oligonucleotides are relevant to the origin of life and particularly to the concept of an RNA world. Although short oligomers of RNA can be synthesized nonenzymatically under laboratory conditions by second-order reactions in concentrated solutions, there is no consensus on how these polymers could have been synthesized de novo on the early Earth from dilute solutions of monomers. To address this question in the context of an RNA world, we have explored ice eutectic phases as a reaction medium. When an aqueous solution freezes, the solutes become concentrated in the spaces between the ice crystals. The increased concentration offsets the effect of the lower temperature and accelerates the reaction. Here we show that in the presence of metal ions in dilute solutions, frozen samples of phosphoimidazolide-activated uridine react within days at -18°C to form oligouridylates up to 11 bases long. Product yields typically exceed 90%, and ~30% of the oligomers include one or more 3‧-5‧ linkages. These conditions facilitate not only the notoriously difficult oligouridylate synthesis, but also the oligomerization of activated cytidylate, adenylate, and guanylate. To our knowledge, this represents the first report to indicate that ice matrices on the early Earth may have accelerated certain prebiotic polymerization reactions.

  16. Fatty acid modified octa-arginine for delivery of siRNA.

    PubMed

    Li, Yuhuan; Li, Yujing; Wang, Xinmei; Lee, Robert J; Teng, Lesheng

    2015-11-10

    Therapeutic delivery of small interfering RNA (siRNA) is a major challenge that limits its potential clinical application. Four fatty acids derivatives of octa-arginine (R8) were synthesized and evaluated for the delivery of siRNA into hepatocellular carcinoma Hep G2 and human lung adenocarcinoma A549 cells. The results showed that the long chain acid oleic acid or stearic acid derivatives of R8, OA-R8 and StA-R8, were more efficient in siRNA complexation and form nanoparticles with greater stability compared to the native R8. Cellular uptake of fluorescence-labeled siRNA delivered by OA-R8 and StA-R8 in Hep G2 and A549 cells was substantially 40-50 times higher than unmodified R8. A significant reduction in siRNA cellular uptake was observed in the presence of sucrose and cytochalasin D, indicating endocytosis as a primary mechanism of cellular entry. A survivin siRNA was used to prepare nanoparticles with OA-R8 or StA-R8 and evaluated for silencing of survivin mRNA and protein in A549 cells, and the inhibition efficiencies of survivin protein reached to 50.3% and 54.6%, respectively. The results showed greater effectiveness with the derivatized R8. Taken together, these findings showed that long chain fatty acid derivatives of R8 are efficient delivery agents for siRNA and may facilitate its therapeutic application. PMID:26386137

  17. Protein Synthesis with Ribosomes Selected for the Incorporation of β-Amino Acids.

    PubMed

    Maini, Rumit; Chowdhury, Sandipan Roy; Dedkova, Larisa M; Roy, Basab; Daskalova, Sasha M; Paul, Rakesh; Chen, Shengxi; Hecht, Sidney M

    2015-06-16

    In an earlier study, β³-puromycin was used for the selection of modified ribosomes, which were utilized for the incorporation of five different β-amino acids into Escherichia coli dihydrofolate reductase (DHFR). The selected ribosomes were able to incorporate structurally disparate β-amino acids into DHFR, in spite of the use of a single puromycin for the selection of the individual clones. In this study, we examine the extent to which the structure of the β³-puromycin employed for ribosome selection influences the regio- and stereochemical preferences of the modified ribosomes during protein synthesis; the mechanistic probe was a single suppressor tRNA(CUA) activated with each of four methyl-β-alanine isomers (1-4). The modified ribosomes were found to incorporate each of the four isomeric methyl-β-alanines into DHFR but exhibited a preference for incorporation of 3(S)-methyl-β-alanine (β-mAla; 4), i.e., the isomer having the same regio- and stereochemistry as the O-methylated β-tyrosine moiety of β³-puromycin. Also conducted were a selection of clones that are responsive to β²-puromycin and a demonstration of reversal of the regio- and stereochemical preferences of these clones during protein synthesis. These results were incorporated into a structural model of the modified regions of 23S rRNA, which included in silico prediction of a H-bonding network. Finally, it was demonstrated that incorporation of 3(S)-methyl-β-alanine (β-mAla; 4) into a short α-helical region of the nucleic acid binding domain of hnRNP LL significantly stabilized the helix without affecting its DNA binding properties.

  18. West Nile Virus Replication Requires Fatty Acid Synthesis but Is Independent on Phosphatidylinositol-4-Phosphate Lipids

    PubMed Central

    Martín-Acebes, Miguel A.; Blázquez, Ana-Belén; Jiménez de Oya, Nereida; Escribano-Romero, Estela; Saiz, Juan-Carlos

    2011-01-01

    West Nile virus (WNV) is a neurovirulent mosquito-borne flavivirus, which main natural hosts are birds but it also infects equines and humans, among other mammals. As in the case of other plus-stranded RNA viruses, WNV replication is associated to intracellular membrane rearrangements. Based on results obtained with a variety of viruses, different cellular processes have been shown to play important roles on these membrane rearrangements for efficient viral replication. As these processes are related to lipid metabolism, fatty acid synthesis, as well as generation of a specific lipid microenvironment enriched in phosphatidylinositol-4-phosphate (PI4P), has been associated to it in other viral models. In this study, intracellular membrane rearrangements following infection with a highly neurovirulent strain of WNV were addressed by means of electron and confocal microscopy. Infection of WNV, and specifically viral RNA replication, were dependent on fatty acid synthesis, as revealed by the inhibitory effect of cerulenin and C75, two pharmacological inhibitors of fatty acid synthase, a key enzyme of this process. However, WNV infection did not induce redistribution of PI4P lipids, and PI4P did not localize at viral replication complex. Even more, WNV multiplication was not inhibited by the use of the phosphatidylinositol-4-kinase inhibitor PIK93, while infection by the enterovirus Coxsackievirus B5 was reduced. Similar features were found when infection by other flavivirus, the Usutu virus (USUV), was analyzed. These features of WNV replication could help to design specific antiviral approaches against WNV and other related flaviviruses. PMID:21949814

  19. Virus-specific RNA synthesis in interferon-treated mouse cells productively infected with Moloney murine leukemia virus.

    PubMed Central

    Fan, H; MacIsaac, P

    1978-01-01

    Mouse cells productively infected with Moloney murine leukemia virus were treated with interferon, and intracellular virus-specific RNA was studied by hybridization with complementary DNA. The steady-state concentration of virus-specific RNA in interferon-treated cells was somewhat greater than that in untreated cells, and the rates of virus-specific RNA synthesis were approximately equal in treated and untreated cells. PMID:691118

  20. Leucyl-tRNA synthetase: double duty in amino acid sensing.

    PubMed

    Durán, Raúl V; Hall, Michael N

    2012-08-01

    The cellular response to amino acids is controlled at the molecular level by TORC1. While many of the elements that participate in TORC1 signaling are known, we still have no clear idea how cells sense amino acids. Two recent studies found that leucyl-tRNA synthetase (LRS) is a leucine sensor for TORC1, in both yeast and mammalian cells.

  1. Enzymatic synthesis of oligo- and polysaccharide fatty acid esters.

    PubMed

    van den Broek, Lambertus A M; Boeriu, Carmen G

    2013-03-01

    Amphiphilic oligo- and polysaccharides (e.g. polysaccharide alkyl or alkyl-aryl esters) form a new class of polymers with exceptional properties. They function as polymeric surfactants, whilst maintaining most of the properties of the starting polymeric material such as emulsifying, gelling, and film forming properties combined with partial water solubility or permeability. At present carbohydrate fatty acid esters are generally obtained by chemical methods using toxic solvents and organic and inorganic catalysts that leave residual traces in the final products. Enzymatic reactions offer an attractive alternative route for the synthesis of polysaccharide esters. In this review the state of the art of enzymatic synthesis of oligo- and polysaccharides fatty esters has been described.

  2. Transfer ribonucleic acid synthesis during sporulation and spore outgrowth in Bacillus subtilis studied by two-dimensional polyacrylamide gel electrophoresis.

    PubMed Central

    Henner, D J; Steinberg, W

    1979-01-01

    The synthesis of transfer ribonucleic acid (tRNA) was examined during spore formation and spore outgrowth in Bacillus subtilis by two-dimensional polyacrylamide gel electrophoresis of in vivo 32P-labeled RNA. The two-dimensional gel system separated the B. subtilis tRNA's into 32 well-resolved spots, with the relative abundances ranging from 0.9 to 17% of the total. There were several spots (five to six) resolved which were not quantitated due to their low abundance. All of the tRNA species resolved by this gel system were synthesized at every stage examined, including vegetative growth, different stages of sporulation, and different stages of outgrowth. Quantitation of the separated tRNA's showed that in general the tRNA species were present in approximately the same relative abundances at the different developmental periods. tRNA turnover and compartmentation occurring during sporulation were examined by labeling during vegetative growth followed by the addition of excess phosphate to block further 32P incorporation. The two-dimensional gels of these samples showed the same tRNA's seen during vegetative growth, and they were in approximately the same relative abundances, indicating minimal differences in the rates of turnover of individual tRNA's. Vegetatively labeled samples, chased with excess phosphate into mature spores, also showed all of the tRNA species seen during vegetative growth, but an additional five to six minor spots were also observed. These are hypothesized to arise from the loss of 3'-terminal residues from preexisting tRNA's. Images PMID:115846

  3. Activation of PPARα by Fatty Acid Accumulation Enhances Fatty Acid Degradation and Sulfatide Synthesis.

    PubMed

    Yang, Yang; Feng, Yuyao; Zhang, Xiaowei; Nakajima, Takero; Tanaka, Naoki; Sugiyama, Eiko; Kamijo, Yuji; Aoyama, Toshifumi

    2016-01-01

    Very-long-chain acyl-CoA dehydrogenase (VLCAD) catalyzes the first reaction in the mitochondrial fatty acid β-oxidation pathway. VLCAD deficiency is associated with the accumulation of fat in multiple organs and tissues, which results in specific clinical features including cardiomyopathy, cardiomegaly, muscle weakness, and hepatic dysfunction in infants. We speculated that the abnormal fatty acid metabolism in VLCAD-deficient individuals might cause cell necrosis by fatty acid toxicity. The accumulation of fatty acids may activate peroxisome proliferator-activated receptor (PPAR), a master regulator of fatty acid metabolism and a potent nuclear receptor for free fatty acids. We examined six skin fibroblast lines, derived from VLCAD-deficient patients and identified fatty acid accumulation and PPARα activation in these cell lines. We then found that the expression levels of three enzymes involved in fatty acid degradation, including long-chain acyl-CoA synthetase (LACS), were increased in a PPARα-dependent manner. This increased expression of LACS might enhance the fatty acyl-CoA supply to fatty acid degradation and sulfatide synthesis pathways. In fact, the first and last reactions in the sulfatide synthesis pathway are regulated by PPARα. Therefore, we also measured the expression levels of enzymes involved in sulfatide metabolism and the regulation of cellular sulfatide content. The levels of these enzymes and cellular sulfatide content both increased in a PPARα-dependent manner. These results indicate that PPARα activation plays defensive and compensative roles by reducing cellular toxicity associated with fatty acids and sulfuric acid. PMID:27644403

  4. Single-gene dual-color reporter cell line to analyze RNA synthesis in vivo.

    PubMed

    Palangat, Murali; Larson, Daniel R

    2016-07-01

    RNA synthesis occurs through the multi-step process of transcription which consists of initiation, elongation, termination, and cleavage of the nascent RNA. In recent years, post-initiation events have attracted considerable attention as regulatory steps in gene expression. In particular, changes in elongation rate have been proposed to alter RNA fate either through changes in RNA secondary structure or recruitment of trans-acting factors, but systematic approaches for perturbing and measuring elongation rate are currently lacking. Here, we describe a system for precisely measuring elongation dynamics for single nascent transcripts at a single gene locus in human cell lines. The system is based on observing the production of fluorescently labeled RNA stem loops which flank a region of interest. The region of interest can be altered using flp recombinases, thus allowing one to study the effects of cis-acting sequences on transcription rate. The dual-color RNAs which are made during this process are exported and translated, thus enabling visualization of each step in gene expression.

  5. Detection of reduced RNA synthesis in UV-irradiated Cockayne syndrome group B cells using an isolated nuclear system.

    PubMed

    Yamada, Ayumi; Masutani, Chikahide; Hanaoka, Fumio

    2002-10-21

    Cockayne syndrome (CS) is a human hereditary disorder characterized by UV sensitivity, developmental abnormalities and premature aging. CS cells display a selective deficiency in transcription-coupled repair (TCR), a subpathway of nucleotide excision repair (NER) that preferentially removes lesions from transcribed strands. Following UV irradiation, the recovery of RNA synthesis is abnormally delayed in CS cells in conjunction with TCR deficiency. To date, TCR has been detected in cultured cells, but not in cell-free systems. In this study, we constructed an assay system using isolated nuclei. RNA synthesis catalyzed by RNA polymerases (pol I and II) was measured in nuclei prepared from UV-irradiated cells. In nuclei isolated from HeLa and xeroderma pigmentosum (XP) group C cells, RNA synthesis was relatively resistant to UV irradiation. In contrast, RNA synthesis by pol I and, in particular, pol II in CS-B nuclei was significantly inhibited upon UV irradiation. Our data support the utility of this assay system for the in vitro detection of the recovery of RNA synthesis in cultured cells. PMID:12379475

  6. [Synthesis of new mandelic acid derivatives with preservative action. Synthesis and acute toxicity study].

    PubMed

    Stan, Cătălina; Năstase, V; Pavelescu, M; Vasile, Cornelia; Dumitrache, M; Gherase, Florenţa; Năstasă, Veronica

    2004-01-01

    Starting from the antiseptic action of DL mandelic acid, there were synthesized a series of esters of the mandelic acid, esters which could have preservative action. This study present the synthesis, structure validation and the acute toxicity study, for the new synthesized compounds. The esters were obtained by acylating 4-hydroxybenzoic acid propyl, ethyl, methyl esters and salicylic acid with the DL mandelic chloride (that was protected initially by the hydroxylic group). The structure of the synthesized compounds was confirmed by quantitative elemental analysis and RMN 1H spectral measurements. The acute toxicity was determined for two of the esters, who proved to had a preservative action (previously studied) and indicated that these esters have a small toxicity.

  7. The synthesis of mycosporine-like amino acids (MAAs) by cultured, symbiotic dinoflagellates.

    PubMed

    T Banaszak1 A; LaJeunesse; Trench

    2000-06-28

    We tested the hypothesis that there is a relation between phylotypes (phylogenetic types, as determined by restriction fragment length polymorphism (RFLP) and partial sequence analysis of the small subunit ribosomal RNA gene (SSUrDNA)) and the synthesis of mycosporine-like amino acids (MAAs) by symbiotic dinoflagellates under the influence of ultraviolet radiation (UV-B/A) and photosynthetically active radiation (PAR). We exposed 27 isolates of symbiotic dinoflagellates simultaneously to UV-B/A and PAR, and subsequently determined the MAAs present in cell extracts and in the media. The algae used included 24 isolates of Symbiodinium spp. originating from jellyfishes, sea anemones, zoanthids, scleractinians, octocorals, and bivalves, and three others in the genera Gymnodinium, Gloeodinium and Amphidinium from a jellyfish, an hydrocoral and a flatworm, respectively. In this study, all of the phylotype A Symbiodinium spp. synthesized up to three identified MAAs. None of the 11 cultured phylotypes B and C Symbiodinium spp. synthesized MAAs. The three non-Symbiodinium symbionts also synthesized up to three MAAs. The results support a conclusion that phylotype A Symbiodinium spp. have a high predilection for the synthesis of MAAs, while phylotypes B and C do not. Synthesis of MAAs by symbiotic dinoflagellates in culture does not appear to relate directly to depths or to the UV exposure regimes from which the consortia were collected.

  8. The synthesis of mycosporine-like amino acids (MAAs) by cultured, symbiotic dinoflagellates.

    PubMed

    T Banaszak1 A; LaJeunesse; Trench

    2000-06-28

    We tested the hypothesis that there is a relation between phylotypes (phylogenetic types, as determined by restriction fragment length polymorphism (RFLP) and partial sequence analysis of the small subunit ribosomal RNA gene (SSUrDNA)) and the synthesis of mycosporine-like amino acids (MAAs) by symbiotic dinoflagellates under the influence of ultraviolet radiation (UV-B/A) and photosynthetically active radiation (PAR). We exposed 27 isolates of symbiotic dinoflagellates simultaneously to UV-B/A and PAR, and subsequently determined the MAAs present in cell extracts and in the media. The algae used included 24 isolates of Symbiodinium spp. originating from jellyfishes, sea anemones, zoanthids, scleractinians, octocorals, and bivalves, and three others in the genera Gymnodinium, Gloeodinium and Amphidinium from a jellyfish, an hydrocoral and a flatworm, respectively. In this study, all of the phylotype A Symbiodinium spp. synthesized up to three identified MAAs. None of the 11 cultured phylotypes B and C Symbiodinium spp. synthesized MAAs. The three non-Symbiodinium symbionts also synthesized up to three MAAs. The results support a conclusion that phylotype A Symbiodinium spp. have a high predilection for the synthesis of MAAs, while phylotypes B and C do not. Synthesis of MAAs by symbiotic dinoflagellates in culture does not appear to relate directly to depths or to the UV exposure regimes from which the consortia were collected. PMID:10841936

  9. A 3′-end structure in RNA2 of a crinivirus is essential for viral RNA synthesis and contributes to replication-associated translation activity

    PubMed Central

    Mongkolsiriwattana, Chawin; Zhou, Jaclyn S.; Ng, James C. K.

    2016-01-01

    The terminal ends in the genome of RNA viruses contain features that regulate viral replication and/or translation. We have identified a Y-shaped structure (YSS) in the 3′ terminal regions of the bipartite genome of Lettuce chlorosis virus (LCV), a member in the genus Crinivirus (family Closteroviridae). The YSS is the first in this family of viruses to be determined using Selective 2′-Hydroxyl Acylation Analyzed by Primer Extension (SHAPE). Using luciferase constructs/replicons, in vivo and in vitro assays showed that the 5′ and YSS-containing 3′ terminal regions of LCV RNA1 supported translation activity. In contrast, similar regions from LCV RNA2, including those upstream of the YSS, did not. LCV RNA2 mutants with nucleotide deletions or replacements that affected the YSS were replication deficient. In addition, the YSS of LCV RNA1 and RNA2 were interchangeable without affecting viral RNA synthesis. Translation and significant replication were observed for specific LCV RNA2 replicons only in the presence of LCV RNA1, but both processes were impaired when the YSS and/or its upstream region were incomplete or altered. These results are evidence that the YSS is essential to the viral replication machinery, and contributes to replication enhancement and replication-associated translation activity in the RNA2 replicons. PMID:27694962

  10. Positive-strand RNA viruses stimulate host phosphatidylcholine synthesis at viral replication sites

    PubMed Central

    Zhang, Jiantao; Zhang, Zhenlu; Chukkapalli, Vineela; Nchoutmboube, Jules A.; Li, Jianhui; Randall, Glenn; Belov, George A.; Wang, Xiaofeng

    2016-01-01

    All positive-strand RNA viruses reorganize host intracellular membranes to assemble their viral replication complexes (VRCs); however, how these viruses modulate host lipid metabolism to accommodate such membrane proliferation and rearrangements is not well defined. We show that a significantly increased phosphatidylcholine (PC) content is associated with brome mosaic virus (BMV) replication in both natural host barley and alternate host yeast based on a lipidomic analysis. Enhanced PC levels are primarily associated with the perinuclear ER membrane, where BMV replication takes place. More specifically, BMV replication protein 1a interacts with and recruits Cho2p (choline requiring 2), a host enzyme involved in PC synthesis, to the site of viral replication. These results suggest that PC synthesized at the site of VRC assembly, not the transport of existing PC, is responsible for the enhanced accumulation. Blocking PC synthesis by deleting the CHO2 gene resulted in VRCs with wider diameters than those in wild-type cells; however, BMV replication was significantly inhibited, highlighting the critical role of PC in VRC formation and viral replication. We further show that enhanced PC levels also accumulate at the replication sites of hepatitis C virus and poliovirus, revealing a conserved feature among a group of positive-strand RNA viruses. Our work also highlights a potential broad-spectrum antiviral strategy that would disrupt PC synthesis at the sites of viral replication but would not alter cellular processes. PMID:26858414

  11. In low protein diets, microRNA-19b regulates urea synthesis by targeting SIRT5

    PubMed Central

    Sun, Rui-Ping; Xi, Qian-Yun; Sun, Jia-Jie; Cheng, Xiao; Zhu, Yan-Ling; Ye, Ding-Ze; Chen, Ting; Wei, Li-Min; Ye, Rui-Song; Jiang, Qing-Yan; Zhang, Yong-Liang

    2016-01-01

    Ammonia detoxification, which takes place via the hepatic urea cycle, is essential for nitrogen homeostasis and physiological well-being. It has been reported that a reduction in dietary protein reduces urea nitrogen. MicroRNAs (miRNAs) are major regulatory non-coding RNAs that have significant effects on several metabolic pathways; however, little is known on whether miRNAs regulate hepatic urea synthesis. The objective of this study was to assess the miRNA expression profile in a low protein diet and identify miRNAs involved in the regulation of the hepatic urea cycle using a porcine model. Weaned 28-days old piglets were fed a corn-soybean normal protein diet (NP) or a corn-soybean low protein diet (LP) for 30 d. Hepatic and blood samples were collected, and the miRNA expression profile was assessed by sequencing and qRT-PCR. Furthermore, we evaluated the possible role of miR-19b in urea synthesis regulation. There were 25 differentially expressed miRNAs between the NP and LP groups. Six of these miRNAs were predicted to be involved in urea cycle metabolism. MiR-19b negatively regulated urea synthesis by targeting SIRT5, which is a positive regulator of CPS1, the rate limiting enzyme in the urea cycle. Our study presented a novel explanation of ureagenesis regulation by miRNAs. PMID:27686746

  12. Hydrolysis of tRNA(sup Phe) on Suspensions of Amino Acids

    NASA Technical Reports Server (NTRS)

    Gao, Kui; Orgel, Leslie E.

    2001-01-01

    RNA is adsorbed strongly on suspensions of many moderately soluble organic solids. In some cases, the hydrolysis of tRNA(sup Phe) is greatly accelerated by adsorption, and the major sites of hydrolysis are changed from those that are important in homogeneous solution. Here we show that the hydrolysis is greatly accelerated by suspensions of aspartic acid and beta-glutamic acid but not by suspensions of alpha-glutamic acid, asparagine, or glutamine. The non-enzymatic hydrolysis of RNA has been studied extensively, especially because of its relevance to the mechanisms of action of ribozymes and to biotechnology and therapy. Many ribonucleases, ribozymes, and non-biological catalysts function via acid-base catalysis of an intramolecular transesterification mechanism in which the 2'-OH group attacks the adjacent phosphate group. The pentacoordinated phosphorane intermediate may collapse back to starting material, or yield isomerized or cleaved products.

  13. Calcineurin mediates homeostatic synaptic plasticity by regulating retinoic acid synthesis

    PubMed Central

    Arendt, Kristin L.; Zhang, Zhenjie; Ganesan, Subhashree; Hintze, Maik; Shin, Maggie M.; Tang, Yitai; Cho, Ahryon; Graef, Isabella A.; Chen, Lu

    2015-01-01

    Homeostatic synaptic plasticity is a form of non-Hebbian plasticity that maintains stability of the network and fidelity for information processing in response to prolonged perturbation of network and synaptic activity. Prolonged blockade of synaptic activity decreases resting Ca2+ levels in neurons, thereby inducing retinoic acid (RA) synthesis and RA-dependent homeostatic synaptic plasticity; however, the signal transduction pathway that links reduced Ca2+-levels to RA synthesis remains unknown. Here we identify the Ca2+-dependent protein phosphatase calcineurin (CaN) as a key regulator for RA synthesis and homeostatic synaptic plasticity. Prolonged inhibition of CaN activity promotes RA synthesis in neurons, and leads to increased excitatory and decreased inhibitory synaptic transmission. These effects of CaN inhibitors on synaptic transmission are blocked by pharmacological inhibitors of RA synthesis or acute genetic deletion of the RA receptor RARα. Thus, CaN, acting upstream of RA, plays a critical role in gating RA signaling pathway in response to synaptic activity. Moreover, activity blockade-induced homeostatic synaptic plasticity is absent in CaN knockout neurons, demonstrating the essential role of CaN in RA-dependent homeostatic synaptic plasticity. Interestingly, in GluA1 S831A and S845A knockin mice, CaN inhibitor- and RA-induced regulation of synaptic transmission is intact, suggesting that phosphorylation of GluA1 C-terminal serine residues S831 and S845 is not required for CaN inhibitor- or RA-induced homeostatic synaptic plasticity. Thus, our study uncovers an unforeseen role of CaN in postsynaptic signaling, and defines CaN as the Ca2+-sensing signaling molecule that mediates RA-dependent homeostatic synaptic plasticity. PMID:26443861

  14. Recovery from ultraviolet tight-induced depression of ribosomal RNA synthesis in normal human, xeroderma pigmentosum and Cockayne syndrome cells.

    PubMed

    Ayaki, H; Hara, R; Ikenaga, M

    1996-06-01

    The rate of ribosomal RNA (rRNA) synthesis was analyzed at different times after ultraviolet light (UV) irradiation in normal human, xeroderma pigmentosum (XP) and Cockayne syndrome (CS) cells. In normal cells, the rate of rRNA synthesis, as measured by the incorporation of 3H-uridine into 18S and 28S rRNAs, decreased immediately after UV irradiation to about half of that of unirradiated cells, and then recovered significantly at 24 h after UV. However, the rate of synthesis continued to decrease during post-UV incubation in XP cells belonging to groups A, D, E, F and G, as well as in CS cells of groups A and B. In contrast, group C XP cells showed a slight recovery at 24 h after UV, suggesting that they have the capacity to repair UV lesions in rRNA genes. PMID:8840721

  15. Limiting amino acid for protein synthesis with mammary cells in tissue culture.

    PubMed

    Park, C S; Chandler, P T; Norman, A W

    1976-05-01

    To identify the limiting amino acid in the minimal essential medium as published by Eagle (Science 130:432, 1959) for milk protein synthesis in rat mammary cells in tissue culture, two different experimental approaches were used. The first study involved the reduction of amino acids singly from the total amino acid complement of the medium for milk protein synthesis. The second study was to investigate the effect on milk protein synthesis of single amino acid addition to the basic complement of amino acids. Order of limiting amino acids was lysine (first) and possible methionine, valine, or arginine (second).

  16. Abscisic acid is involved in the iron-induced synthesis of maize ferritin.

    PubMed

    Lobréaux, S; Hardy, T; Briat, J F

    1993-02-01

    The ubiquitous iron storage protein ferritin has a highly conserved structure in plants and animals, but a distinct cytological location and a different level of control in response to iron excess. Plant ferritins are plastid-localized and transcriptionally regulated in response to iron, while animal ferritins are found in the cytoplasm and have their expression mainly controlled at the translational level. In order to understand the basis of these differences, we developed hydroponic cultures of maize plantlets which allowed an increase in the intracellular iron concentration, leading to a transient accumulation of ferritin mRNA and protein (Lobréaux,S., Massenet,O. and Briat,J.F., 1992, Plant Mol. Biol., 19, 563-575). Here, it is shown that iron induces ferritin and RAB (Responsive to Abscisic Acid) mRNA accumulation relatively with abscisic acid (ABA) accumulation. Ferritin mRNA also accumulates in response to exogenous ABA. Synergistic experiments demonstrate that the ABA and iron responses are linked, although full expression of the ferritin genes cannot be entirely explained by an increase in ABA concentration. Inducibility of ferritin mRNA accumulation by iron is dramatically decreased in the maize ABA-deficient mutant vp2 and can be rescued by addition of exogenous ABA, confirming the involvement of ABA in the iron response in plants. Therefore, it is concluded that a major part of the iron-induced biosynthesis of ferritin is achieved through a pathway involving an increase in the level of the plant hormone ABA. The general conclusion of this work is that the synthesis of the same protein in response to the same environmental signal can be controlled by separate and distinct mechanisms in plants and animals.

  17. Skeletal muscle plasticity induced by seasonal acclimatization in carp involves differential expression of rRNA and molecules that epigenetically regulate its synthesis.

    PubMed

    Fuentes, Eduardo N; Zuloaga, Rodrigo; Nardocci, Gino; Fernandez de la Reguera, Catalina; Simonet, Nicolas; Fumeron, Robinson; Valdes, Juan Antonio; Molina, Alfredo; Alvarez, Marco

    2014-01-01

    Ribosomal biogenesis controls cellular growth in living organisms, with the rate-limiting step of this process being the transcription of ribosomal DNA (rDNA). Considering that epigenetic mechanisms allow an organism to respond to environmental changes, the expression in muscle of several molecules that regulate epigenetic rRNA synthesis, as well as rDNA transcription, were evaluated during the seasonal acclimatization of the carp. First, the nucleotide sequences encoding the components forming the NoRC (ttf-I, tip5) and eNoSC (sirt1, nml, suv39h1), two chromatin remodeling complexes that silence rRNA synthesis, as well as the sequence of ubf1, a key regulator of rDNA transcription, were obtained. Subsequently the transcriptional regulation of the aforementioned molecules, and other key molecules involved in rRNA synthesis (mh2a1, mh2a2, h2a.z, h2a.z.7, nuc, p80), was assessed. The carp sequences for TTF-I, TIP5, SIRT1, NML, SUV39H1, and UBF1 showed a high conservation of domains and key amino acids in comparison with other fish and higher vertebrates. The mRNA contents in muscle for ttf-I, tip5, sirt1, nml, suv39h1, mh2a1, mh2a.z, and nuc were up-regulated during winter in comparison with summer, whereas the mRNA levels of mh2a2, ubf1, and p80 were down-regulated. Also, the contents of molecules involved in processing the rRNA (snoRNAs) and pRNA, a stabilizer of NoRC complex, were analyzed, finding that these non-coding RNAs were not affected by seasonal acclimatization. These results suggest that variations in the expression of rRNA and the molecules that epigenetically regulate its synthesis are contributing to the muscle plasticity induced by seasonal acclimatization in carp.

  18. Skeletal muscle plasticity induced by seasonal acclimatization in carp involves differential expression of rRNA and molecules that epigenetically regulate its synthesis.

    PubMed

    Fuentes, Eduardo N; Zuloaga, Rodrigo; Nardocci, Gino; Fernandez de la Reguera, Catalina; Simonet, Nicolas; Fumeron, Robinson; Valdes, Juan Antonio; Molina, Alfredo; Alvarez, Marco

    2014-01-01

    Ribosomal biogenesis controls cellular growth in living organisms, with the rate-limiting step of this process being the transcription of ribosomal DNA (rDNA). Considering that epigenetic mechanisms allow an organism to respond to environmental changes, the expression in muscle of several molecules that regulate epigenetic rRNA synthesis, as well as rDNA transcription, were evaluated during the seasonal acclimatization of the carp. First, the nucleotide sequences encoding the components forming the NoRC (ttf-I, tip5) and eNoSC (sirt1, nml, suv39h1), two chromatin remodeling complexes that silence rRNA synthesis, as well as the sequence of ubf1, a key regulator of rDNA transcription, were obtained. Subsequently the transcriptional regulation of the aforementioned molecules, and other key molecules involved in rRNA synthesis (mh2a1, mh2a2, h2a.z, h2a.z.7, nuc, p80), was assessed. The carp sequences for TTF-I, TIP5, SIRT1, NML, SUV39H1, and UBF1 showed a high conservation of domains and key amino acids in comparison with other fish and higher vertebrates. The mRNA contents in muscle for ttf-I, tip5, sirt1, nml, suv39h1, mh2a1, mh2a.z, and nuc were up-regulated during winter in comparison with summer, whereas the mRNA levels of mh2a2, ubf1, and p80 were down-regulated. Also, the contents of molecules involved in processing the rRNA (snoRNAs) and pRNA, a stabilizer of NoRC complex, were analyzed, finding that these non-coding RNAs were not affected by seasonal acclimatization. These results suggest that variations in the expression of rRNA and the molecules that epigenetically regulate its synthesis are contributing to the muscle plasticity induced by seasonal acclimatization in carp. PMID:24769445

  19. LKB1 promotes cell survival by modulating TIF-IA-mediated pre-ribosomal RNA synthesis under uridine downregulated conditions.

    PubMed

    Liu, Fakeng; Jin, Rui; Liu, Xiuju; Huang, Henry; Wilkinson, Scott C; Zhong, Diansheng; Khuri, Fadlo R; Fu, Haian; Marcus, Adam; He, Yulong; Zhou, Wei

    2016-01-19

    We analyzed the mechanism underlying 5-aminoimidazole-4-carboxamide riboside (AICAR) mediated apoptosis in LKB1-null non-small cell lung cancer (NSCLC) cells. Metabolic profile analysis revealed depletion of the intracellular pyrimidine pool after AICAR treatment, but uridine was the only nucleotide precursor capable of rescuing this apoptosis, suggesting the involvement of RNA metabolism. Because half of RNA transcription in cancer is for pre-ribosomal RNA (rRNA) synthesis, which is suppressed by over 90% after AICAR treatment, we evaluated the role of TIF-IA-mediated rRNA synthesis. While the depletion of TIF-IA by RNAi alone promoted apoptosis in LKB1-null cells, the overexpression of a wild-type or a S636A TIF-IA mutant, but not a S636D mutant, attenuated AICAR-induced apoptosis. In LKB1-null H157 cells, pre-rRNA synthesis was not suppressed by AICAR when wild-type LKB1 was present, and cellular fractionation analysis indicated that TIF-IA quickly accumulated in the nucleus in the presence of a wild-type LKB1 but not a kinase-dead mutant. Furthermore, ectopic expression of LKB1 was capable of attenuating AICAR-induced death in AMPK-null cells. Because LKB1 promotes cell survival by modulating TIF-IA-mediated pre-rRNA synthesis, this discovery suggested that targeted depletion of uridine related metabolites may be exploited in the clinic to eliminate LKB1-null cancer cells.

  20. Highly conserved base A55 of 16S ribosomal RNA is important for the elongation cycle of protein synthesis.

    PubMed

    Sahu, Bhubanananda; Khade, Prashant K; Joseph, Simpson

    2013-09-24

    Accurate decoding of mRNA requires the precise interaction of protein factors and tRNAs with the ribosome. X-ray crystallography and cryo-electron microscopy have provided detailed structural information about the 70S ribosome with protein factors and tRNAs trapped during translation. Crystal structures showed that one of the universally conserved 16S rRNA bases, A55, in the shoulder domain of the 30S subunit interacts with elongation factors Tu and G (EF-Tu and EF-G, respectively). The exact functional role of A55 in protein synthesis is not clear. We changed A55 to U and analyzed the effect of the mutation on the elongation cycle of protein synthesis using functional assays. Expression of 16S rRNA with the A55U mutation in cells confers a dominant lethal phenotype. Additionally, ribosomes with the A55U mutation in 16S rRNA show substantially reduced in vitro protein synthesis activity. Equilibrium binding studies showed that the A55U mutation considerably inhibited the binding of the EF-Tu·GTP·tRNA ternary complex to the ribosome. Furthermore, the A55U mutation slightly inhibited the peptidyl transferase reaction, the binding of EF-G·GTP to the ribosome, and mRNA-tRNA translocation. These results indicate that A55 is important for fine-tuning the activity of the ribosome during the elongation cycle of protein synthesis.

  1. Flexibility of nucleic acids: From DNA to RNA

    NASA Astrophysics Data System (ADS)

    Lei, Bao; Xi, Zhang; Lei, Jin; Zhi-Jie, Tan

    2016-01-01

    The structural flexibility of nucleic acids plays a key role in many fundamental life processes, such as gene replication and expression, DNA-protein recognition, and gene regulation. To obtain a thorough understanding of nucleic acid flexibility, extensive studies have been performed using various experimental methods and theoretical models. In this review, we will introduce the progress that has been made in understanding the flexibility of nucleic acids including DNAs and RNAs, and will emphasize the experimental findings and the effects of salt, temperature, and sequence. Finally, we will discuss the major unanswered questions in understanding the flexibility of nucleic acids. Project supported by the National Basic Research Program of China (Grant No. 2011CB933600), the National Natural Science Foundation of China (Grant Nos. 11175132, 11575128, and 11374234), and the Program for New Century Excellent Talents, China (Grant No. NCET 08-0408).

  2. (-)-Hydroxycitric Acid Nourishes Protein Synthesis via Altering Metabolic Directions of Amino Acids in Male Rats.

    PubMed

    Han, Ningning; Li, Longlong; Peng, Mengling; Ma, Haitian

    2016-08-01

    (-)-Hydroxycitric acid (HCA), a major active ingredient of Garcinia Cambogia extracts, had shown to suppress body weight gain and fat accumulation in animals and humans. While, the underlying mechanism of (-)-HCA has not fully understood. Thus, this study was aimed to investigate the effects of long-term supplement with (-)-HCA on body weight gain and variances of amino acid content in rats. Results showed that (-)-HCA treatment reduced body weight gain and increased feed conversion ratio in rats. The content of hepatic glycogen, muscle glycogen, and serum T4 , T3 , insulin, and Leptin were increased in (-)-HCA treatment groups. Protein content in liver and muscle were significantly increased in (-)-HCA treatment groups. Amino acid profile analysis indicated that most of amino acid contents in serum and liver, especially aromatic amino acid and branched amino acid, were higher in (-)-HCA treatment groups. However, most of the amino acid contents in muscle, especially aromatic amino acid and branched amino acid, were reduced in (-)-HCA treatment groups. These results indicated that (-)-HCA treatment could reduce body weight gain through promoting energy expenditure via regulation of thyroid hormone levels. In addition, (-)-HCA treatment could promote protein synthesis by altering the metabolic directions of amino acids. Copyright © 2016 John Wiley & Sons, Ltd. PMID:27145492

  3. Acid-cleavable ketal containing poly(β-amino ester) for enhanced siRNA delivery.

    PubMed

    Guk, Kyeonghye; Lim, Hyungsuk; Kim, Byungkuk; Hong, Minsung; Khang, Gilson; Lee, Dongwon

    2013-09-10

    The safe and effective intracellular delivery of nucleic acids remains the most challenging obstacle to the broad application of gene therapy in clinic. Endosomal escape of nucleic acids is also a major barrier for efficient gene delivery. Ketal linkage is known to readily cleave at the acidic pH of endosomal compartments. Here, we report ketal containing poly(β-amino ester) (KPAE) as an acid-cleavable non-viral siRNA delivery system. KPAE efficiently condensed siRNA into nanocomplexes with a diameter of ≈ 150 nm, which are stable under neutral conditions but rapidly dissociate to release siRNA at acidic pH. KPAE had a buffering capacity due to the presence of secondary amines in its backbone, confirmed by acid-base titration. Moreover, the studies of confocal fluorescence imaging using calcein and LysoTracker Red revealed that KPAE disrupted endosomes by colloid osmotic mechanism and "proton sponge" effects. Cell culture studies demonstrated that KPAE can deliver tumor necrosis factor-α (TNF-α) siRNA to lipopolysaccharide (LPS)-stimulated macrophages and significantly inhibit the expression of TNF-α. The results demonstrate that acid-cleavable KPAE has great potential as gene delivery systems based on its excellent biocompatibility, pH sensitivity and high gene delivery efficiency.

  4. Synthesis and biological activity of novel deoxycholic acid derivatives.

    PubMed

    Popadyuk, Irina I; Markov, Andrey V; Salomatina, Oksana V; Logashenko, Evgeniya B; Shernyukov, Andrey V; Zenkova, Marina A; Salakhutdinov, Nariman F

    2015-08-01

    We report the synthesis and biological activity of new semi-synthetic derivatives of naturally occurring deoxycholic acid (DCA) bearing 2-cyano-3-oxo-1-ene, 3-oxo-1(2)-ene or 3-oxo-4(5)-ene moieties in ring A and 12-oxo or 12-oxo-9(11)-ene moieties in ring C. Bioassays using murine macrophage-like cells and tumour cells show that the presence of the 9(11)-double bond associated with the increased polarity of ring A or with isoxazole ring joined to ring A, improves the ability of the compounds to inhibit cancer cell growth. PMID:26037611

  5. Synthesis and biological activity of novel deoxycholic acid derivatives.

    PubMed

    Popadyuk, Irina I; Markov, Andrey V; Salomatina, Oksana V; Logashenko, Evgeniya B; Shernyukov, Andrey V; Zenkova, Marina A; Salakhutdinov, Nariman F

    2015-08-01

    We report the synthesis and biological activity of new semi-synthetic derivatives of naturally occurring deoxycholic acid (DCA) bearing 2-cyano-3-oxo-1-ene, 3-oxo-1(2)-ene or 3-oxo-4(5)-ene moieties in ring A and 12-oxo or 12-oxo-9(11)-ene moieties in ring C. Bioassays using murine macrophage-like cells and tumour cells show that the presence of the 9(11)-double bond associated with the increased polarity of ring A or with isoxazole ring joined to ring A, improves the ability of the compounds to inhibit cancer cell growth.

  6. Antimicrobial polyurethane thermosets based on undecylenic acid: synthesis and evaluation.

    PubMed

    Lluch, Cristina; Esteve-Zarzoso, Braulio; Bordons, Albert; Lligadas, Gerard; Ronda, Juan C; Galià, Marina; Cádiz, Virginia

    2014-08-01

    In the present study, plant oil-derived surface-modifiable polyurethane thermosets are presented. Polyol synthesis is carried out taking advantage of thiol-yne photopolymerization of undecylenic acid derivatives containing methyl ester or hydroxyl moieties. The prepared methyl ester-containing polyurethanes allow surface modification treatment to enhance their hydrophilicity and impart antimicrobial activity through the following two steps: i) grafting poly(propylene glycol) monoamine (Jeffamine M-600) via aminolysis and ii) Jeffamine M-600 layer complexation with iodine. The antimicrobial activity of the iodine-containing polyurethanes is demonstrated by its capacity to inhibit the growth of Staphylococcus aureus, and Candida albicans in agar media.

  7. Design and synthesis of boronic acid inhibitors of endothelial lipase.

    PubMed

    O'Connell, Daniel P; LeBlanc, Daniel F; Cromley, Debra; Billheimer, Jeffrey; Rader, Daniel J; Bachovchin, William W

    2012-02-01

    Endothelial lipase (EL) and lipoprotein lipase (LPL) are homologous lipases that act on plasma lipoproteins. EL is predominantly a phospholipase and appears to be a key regulator of plasma HDL-C. LPL is mainly a triglyceride lipase regulating (V)LDL levels. The existing biological data indicate that inhibitors selective for EL over LPL should have anti-atherogenic activity, mainly through increasing plasma HDL-C levels. We report here the synthesis of alkyl, aryl, or acyl-substituted phenylboronic acids that inhibit EL. Many of the inhibitors evaluated proved to be nearly equally potent against both EL and LPL, but several exhibited moderate to good selectivity for EL. PMID:22225633

  8. Synthesis of Nanoporous Iminodiacetic Acid Sorbents for Binding Transition Metals

    PubMed Central

    Busche, Brad; Wiacek, Robert; Davidson, Joseph; Koonsiripaiboon, View; Yantasee, Wassana; Addleman, R. Shane; Fryxell, Glen E.

    2009-01-01

    Iminodiacetic acid (IDAA) forms strong complexes with a wide variety of metal ions. Using self-assembled monolayers in mesoporous supports (SAMMS) to present the IDAA ligand potentially allows for multiple metal-ligand interactions to enhance the metal binding affinity relative to that of randomly oriented polymer-based supports. This manuscript describes the synthesis of a novel nanostructured sorbent material built using self-assembly of a IDAA ligand inside a nanoporous silica, and demonstrates its use for capturing transition metal cations, and anionic metal complexes, such as PdCl4−2. PMID:22068901

  9. Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments

    NASA Astrophysics Data System (ADS)

    Kitadai, Norio

    2015-12-01

    Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids.

  10. Effect of mevalonic acid on cholesterol synthesis in bovine intramuscular and subcutaneous adipocytes.

    PubMed

    Liu, Xiaomu; You, Wei; Cheng, Haijian; Zhang, Qingfeng; Song, Enliang; Wan, Fachun; Han, Hong; Liu, Guifen

    2016-02-01

    Mevalonic acid (MVA) is a key material in the synthesis of cholesterol; indeed, intracellular cholesterol synthesis is also called the mevalonic acid pathway. 3-Hydroxy-3-methylglutaryl-CoA reductase (HMGR) is an essential enzyme in cholesterol biosynthesis. This study suggests that MVA may play an important role in the differentiation of bovine adipose tissue in vivo. We investigated differential mRNA expression in bovine intramuscular preadipocytes (BIPs) and bovine subcutaneous preadipocytes (BSPs) by culturing cells from the longissimus dorsi muscle and subcutaneous fat tissues of Luxi yellow cattle. The morphology of lipid accumulation of bovine preadipocytes was detected by Oil Red O staining, and total cholesterol (TC), low-density lipoprotein cholesterol (LDLC), and high-density lipoprotein cholesterol (HDLC) levels were measured. Temporospatial expression of HMGR was investigated by real-time quantitative polymerase chain reaction (PCR). The TC, LDLC, and HDLC content did not significantly differ over time but increased slowly with increasing MVA concentration. HMGR expression increased over time and with increasing concentrations of MVA. MVA increased adipose cell proliferation in a dose-dependent and time-dependent manner. MVA stimulated HMGR expression in two cell types and its influence on adipocyte differentiation.

  11. Consequences of PPARα Invalidation on Glutathione Synthesis: Interactions with Dietary Fatty Acids

    PubMed Central

    Guelzim, Najoua; Huneau, Jean-François; Mathé, Véronique; Quignard-Boulangé, Annie; Martin, Pascal G.; Tomé, Daniel; Hermier, Dominique

    2011-01-01

    Glutathione (GSH) derives from cysteine and plays a key role in redox status. GSH synthesis is determined mainly by cysteine availability and γ-glutamate cysteine ligase (γGCL) activity. Because PPARα activation is known to control the metabolism of certain amino acids, GSH synthesis from cysteine and related metabolisms were explored in wild-type (WT) and PPARα-null (KO) mice, fed diets containing either saturated (COCO diet) or 18 : 3 n-3, LIN diet. In mice fed the COCO diet, but not in those fed the LIN diet, PPARα deficiency enhanced hepatic GSH content and γGCL activity, superoxide dismutase 2 mRNA levels, and plasma uric acid concentration, suggesting an oxidative stress. In addition, in WT mice, the LIN diet increased the hepatic GSH pool, without effect on γGCL activity, or change in target gene expression, which rules out a direct effect of PPARα. This suggests that dietary 18 : 3 n-3 may regulate GSH metabolism and thus mitigate the deleterious effects of PPARα deficiency on redox status, without direct PPARα activation. PMID:21915176

  12. The action of exogenous gibberellic acid on polysome formation and translation of mRNA in germinating castor-bean seeds.

    PubMed

    Martin, C; Northcote, D H

    1983-06-01

    The amount of protein synthesis in germinating castor-bean seeds has been estimated by the quantitative and qualitative exmainatin of polysomes from the seeds in the presence and absence of gibberellic acid (GA3). Careful optimisation of polysome extraction procedures was required to minimise the ribonuclease activity in the extracts. Ribonuclease activity in seed extracts increased fourfold over the first 5 d of germination. Gibberellic acid stimulated polysome formation about twofold during the first 4 d of germination. It also stimulated the amount of mRNA associated with polysomes by about twofold during the first 3 d of germination. Between days 1 and 5 of germination, polysome formation was primarily limited by mRNA availability. During the period 0-24 h, polysome formation was independent of mRNA levles. The increase in enzyme activities stimulated by GA3 was probably the result of an increase in the amount of cellular mRNA. No evidence was obtained for an action of GA3 on translation other than on the increased production of RNA. Examination of the recruitment of isocitrate-lyase mRNA into polysomes showed that GA3 did not specifically stimulate production of this enzyme.

  13. Escherichia coli methionyl-tRNA formyltransferase: role of amino acids conserved in the linker region and in the C-terminal domain on the specific recognition of the initiator tRNA.

    PubMed

    Gite, S; Li, Y; Ramesh, V; RajBhandary, U L

    2000-03-01

    The formylation of initiator methionyl-tRNA by methionyl-tRNA formyltransferase (MTF) is important for the initiation of protein synthesis in eubacteria. We are studying the molecular mechanisms of recognition of the initiator tRNA by Escherichia coli MTF. MTF from eubacteria contains an approximately 100-amino acid C-terminal extension that is not found in the E. coli glycinamide ribonucleotide formyltransferase, which, like MTF, use N(10)-formyltetrahydrofolate as a formyl group donor. This C-terminal extension, which forms a distinct structural domain, is attached to the N-terminal domain through a linker region. Here, we describe the effect of (i) substitution mutations on some nineteen basic, aromatic and other conserved amino acids in the linker region and in the C-terminal domain of MTF and (ii) deletion mutations from the C-terminus on enzyme activity. We show that the positive charge on two of the lysine residues in the linker region leading to the C-terminal domain are important for enzyme activity. Mutation of some of the basic amino acids in the C-terminal domain to alanine has mostly small effects on the kinetic parameters, whereas mutation to glutamic acid has large effects. However, the deletion of 18, 20, or 80 amino acids from the C-terminus has very large effects on enzyme activity. Overall, our results support the notion that the basic amino acid residues in the C-terminal domain provide a positively charged channel that is used for the nonspecific binding of tRNA, whereas some of the amino acids in the linker region play an important role in activity of MTF.

  14. Multistrand Structure Prediction of Nucleic Acid Assemblies and Design of RNA Switches.

    PubMed

    Bindewald, Eckart; Afonin, Kirill A; Viard, Mathias; Zakrevsky, Paul; Kim, Taejin; Shapiro, Bruce A

    2016-03-01

    RNA is an attractive material for the creation of molecular logic gates that release programmed functionalities only in the presence of specific molecular interaction partners. Here we present HyperFold, a multistrand RNA/DNA structure prediction approach for predicting nucleic acid complexes that can contain pseudoknots. We show that HyperFold also performs competitively compared to other published folding algorithms. We performed a large variety of RNA/DNA hybrid reassociation experiments for different concentrations, DNA toehold lengths, and G+C content and find that the observed tendencies for reassociation correspond well to computational predictions. Importantly, we apply this method to the design and experimental verification of a two-stranded RNA molecular switch that upon binding to a single-stranded RNA toehold disease-marker trigger mRNA changes its conformation releasing an shRNA-like Dicer substrate structure. To demonstrate the concept, connective tissue growth factor (CTGF) mRNA and enhanced green fluorescent protein (eGFP) mRNA were chosen as trigger and target sequences, respectively. In vitro experiments confirm the formation of an RNA switch and demonstrate that the functional unit is being released when the trigger RNA interacts with the switch toehold. The designed RNA switch is shown to be functional in MDA-MB-231 breast cancer cells. Several other switches were also designed and tested. We conclude that this approach has considerable potential because, in principle, it allows the release of an siRNA designed against a gene that differs from the gene that is utilized as a biomarker for a disease state. PMID:26926528

  15. Treatment with the hyaluronic Acid synthesis inhibitor 4-methylumbelliferone suppresses LPS-induced lung inflammation.

    PubMed

    McKallip, Robert J; Ban, Hao; Uchakina, Olga N

    2015-01-01

    Exposure to bacterial endotoxins, such as lipopolysaccharide (LPS), can lead to the induction of acute lung injury/acute respiratory distress syndrome (ALI/ARDS). To date, there are no known effective treatments for LPS-induced inflammation. In the current study, we investigated the potential use of the hyaluronic acid (HA) synthesis inhibitor 4-methylumbelliferone (4-MU) on LPS-induced acute lung inflammation. Culturing LPS-activated immune cells with 4-MU led to reduced proliferation, reduced cytokine production, and an increase in apoptosis when compared to untreated cells. Treatment of mice with 4-MU led to protection from LPS-induced lung injury. Specifically, 4-MU treatment led to a reduction in LPS-induced hyaluronic acid synthase (HAS) messenger RNA (mRNA) levels, reduction in lung permeability, and reduction in proinflammatory cytokine production. Taken together, these results suggest that use of 4-MU to target HA production may be an effective treatment for the inflammatory response following exposure to LPS.

  16. Synthesis and radiolabeling of chelator-RNA aptamer bioconjugates with copper-64 for targeted molecular imaging.

    PubMed

    Rockey, William M; Huang, Ling; Kloepping, Kyle C; Baumhover, Nicholas J; Giangrande, Paloma H; Schultz, Michael K

    2011-07-01

    Ribonucleic acid (RNA) aptamers with high affinity and specificity for cancer-specific cell-surface antigens are promising reagents for targeted molecular imaging of cancer using positron emission tomography (PET). For this application, aptamers must be conjugated to chelators capable of coordinating PET-radionuclides (e.g., copper-64, (64)Cu) to enable radiolabeling for in vivo imaging of tumors. This study investigates the choice of chelator and radiolabeling parameters such as pH and temperature for the development of (64)Cu-labeled RNA-based targeted agents for PET imaging. The characterization and optimization of labeling conditions are described for four chelator-aptamer complexes. Three commercially available bifunctional macrocyclic chelators (1,4,7,10-tetraazacyclododecane-1,4,7-triacetic acid mono N-hydroxysuccinimide [DOTA-NHS]; S-2-(4-isothiocyanatobenzyl)-1,4,7-triazacyclononane-1,4,7-triacetic acid [p-SCN-Bn-NOTA]; and p-SCN-Bn-3,6,9,15-tetraazabicyclo [9.3.1]pentadeca-1(15),11,13-triene-3,6,9-triacetic acid [p-SCN-Bn-PCTA]), as well as the polyamino-macrocyclic diAmSar (3,6,10,13,16,19-hexaazabicyclo[6.6.6] icosane-1,8-diamine) were conjugated to A10-3.2, a RNA aptamer which has been shown to bind specifically to a prostate cancer-specific cell-surface antigen (PSMA). Although a commercial bifunctional version of diAmSar was not available, RNA conjugation with this chelator was achieved in a two-step reaction by the addition of a disuccinimidyl suberate linker. Radiolabeling parameters (e.g., pH, temperature, and time) for each chelator-RNA conjugate were assessed in order to optimize specific activity and RNA stability. Furthermore, the radiolabeled chelator-coupled RNA aptamers were evaluated for binding specificity to their target antigen. In summary, key parameters were established for optimal radiolabeling of RNA aptamers for eventual PET imaging with (64)Cu.

  17. Identification of a broad-spectrum inhibitor of virus RNA synthesis: validation of a prototype virus-based approach

    PubMed Central

    Filone, Claire Marie; Hodges, Erin N.; Honeyman, Brian; Bushkin, G. Guy; Boyd, Karla; Platt, Andrew; Ni, Feng; Strom, Kyle; Hensley, Lisa; Snyder, John K.; Connor, John H.

    2013-01-01

    There are no approved therapeutics for the most deadly nonsegmented negative-strand (NNS) RNA viruses, including Ebola (EBOV). To identify new chemical scaffolds for development of broad-spectrum antivirals, we undertook a prototype-based lead identification screen. Using the prototype NNS virus, vesicular stomatitis virus (VSV), multiple inhibitory compounds were identified. Three compounds were investigated for broad-spectrum activity, and inhibited EBOV infection. The most potent, CMLDBU3402, was selected for further study. CMLDBU3402 did not show significant activity against segmented negative-strand RNA viruses suggesting proscribed broad-spectrum activity. Mechanistic analysis indicated that CMLDBU3402 blocked VSV viral RNA synthesis and inhibited EBOV RNA transcription, demonstrating a consistent mechanism of action against genetically distinct viruses. The identification of this chemical backbone as a broad-spectrum inhibitor of viral RNA synthesis offers significant potential for the development of new therapies for highly pathogenic viruses. PMID:23521799

  18. Temporal aspects of DNA and RNA synthesis during human immunodeficiency virus infection: Evidence for differential gene expression

    SciTech Connect

    Kim, Sunyoung; Baltimore, D. Massachusetts Institute of Technology, Cambridge ); Byrn, R.; Groopman, J. )

    1989-09-01

    The kinetics of retroviral DNA and RNA synthesis are parameters vital to understanding viral growth, especially for human immunodeficiency virus (HIV), which encodes several of its own regulatory genes. The authors have established a single-cycle growth condition for HIV in H9 cells, a human CD4{sup +} lymphocyte line. The full-length viral linear DNA is first detectable by 4 h postinfection. During a one-step growth of HIV, amounts of viral DNA gradually increase until 8 to 12 h postinfection and then decrease. The copy number of unintegrated viral DNA is not extraordinarily high even at its peak. Most strikingly, there is a temporal program of RNA accumulation: the earliest RNA is greatly enriched in the 2-kilobase subgenomic mRNA species, while the level of 9.2-kilobase RNA which is both genomic RNA and mRNA remains low until after 24 h of infection. Virus production begins at about 24 h postinfection. Thus, viral DNA synthesis is as rapid as for other retroviruses, but viral RNA synthesis involves temporal alteration in the species that accumulate, presumably as a consequence of viral regulatory genes.

  19. Electrocarboxylation: towards sustainable and efficient synthesis of valuable carboxylic acids

    PubMed Central

    Matthessen, Roman; Fransaer, Jan; Binnemans, Koen

    2014-01-01

    Summary The near-unlimited availability of CO2 has stimulated a growing research effort in creating value-added products from this greenhouse gas. This paper presents the trends on the most important methods used in the electrochemical synthesis of carboxylic acids from carbon dioxide. An overview is given of different substrate groups which form carboxylic acids upon CO2 fixation, including mechanistic considerations. While most work focuses on the electrocarboxylation of substrates with sacrificial anodes, this review considers the possibilities and challenges of implementing other synthetic methodologies. In view of potential industrial application, the choice of reactor setup, electrode type and reaction pathway has a large influence on the sustainability and efficiency of the process. PMID:25383120

  20. Effect of mitochondrial ascorbic acid synthesis on photosynthesis.

    PubMed

    Senn, M E; Gergoff Grozeff, G E; Alegre, M L; Barrile, F; De Tullio, M C; Bartoli, C G

    2016-07-01

    Ascorbic acid (AA) is synthesized in plant mitochondria through the oxidation of l-galactono-1,4-lactone (l-GalL) and then distributed to different cell compartments. AA-deficient Arabidopsis thaliana mutants (vtc2) and exogenous applications of l-GalL were used to generate plants with different AA content in their leaves. This experimental approach allows determining specific AA-dependent effects on carbon metabolism. No differences in O2 uptake, malic and citric acid and NADH content suggest that AA synthesis or accumulation did not affect mitochondrial activity; however, l-GalL treatment increased CO2 assimilation and photosynthetic electron transport rate in vtc2 (but not wt) leaves demonstrating a stimulation of photosynthesis after l-GalL treatment. Increased CO2 assimilation correlated with increased leaf stomatal conductance observed in l-GalL-treated vtc2 plants.

  1. Synthesis and characterization of acidic mesoporous borosilicate thin films.

    PubMed

    Xiu, Tongping; Liu, Qian; Wang, Jiacheng

    2009-02-01

    Work on the synthesis and characterization of acidic wormhole-like ordered mesoporous borosilicate thin films (MBSTFs) on silicon wafers is described in this paper. The MBSTFs coated by the dip-coating method were prepared through an evaporation-induced self-assembly (EISA) process using nonionic block copolymers as structure-directing agents. Fourier transform infrared (FT-IR) spectroscopy confirmed the formation of borosiloxane bonds (Si-O-B). High-resolution transmission electron microscopy (HRTEM) and N2 sorption evidenced a wormhole-like mesoporous structure in the MBSTFs obtained. Scanning electron microscopy (SEM) images of the cross sections and surfaces of the samples showed that MBSTFs on silicon wafers were continuous, homogeneous and did not crack. The acidic properties of the MBSTFs were characterized by FT-IR spectra of chemisorbed pyridine. The MBSTFs thus prepared may find their future applications in many fields including chemical sensors, catalysis, optical coating, molecule separation, etc.

  2. Effect of mitochondrial ascorbic acid synthesis on photosynthesis.

    PubMed

    Senn, M E; Gergoff Grozeff, G E; Alegre, M L; Barrile, F; De Tullio, M C; Bartoli, C G

    2016-07-01

    Ascorbic acid (AA) is synthesized in plant mitochondria through the oxidation of l-galactono-1,4-lactone (l-GalL) and then distributed to different cell compartments. AA-deficient Arabidopsis thaliana mutants (vtc2) and exogenous applications of l-GalL were used to generate plants with different AA content in their leaves. This experimental approach allows determining specific AA-dependent effects on carbon metabolism. No differences in O2 uptake, malic and citric acid and NADH content suggest that AA synthesis or accumulation did not affect mitochondrial activity; however, l-GalL treatment increased CO2 assimilation and photosynthetic electron transport rate in vtc2 (but not wt) leaves demonstrating a stimulation of photosynthesis after l-GalL treatment. Increased CO2 assimilation correlated with increased leaf stomatal conductance observed in l-GalL-treated vtc2 plants. PMID:27010742

  3. Sequences more than 500 base pairs upstream of the human U3 small nuclear RNA gene stimulate the synthesis of U3 RNA in frog oocytes

    SciTech Connect

    Suh, D.; Reddy, R. ); Wright, D. )

    1991-06-04

    Small nuclear RNA (snRNA) genes contain strong promoters capable of initiating transcription once every 4 s. Studies on the human U1 snRNA gene, carried out in other laboratories, showed that sequences within 400 bp of the 5' flanking region are sufficient for maximal levels of transcription both in vivo and in frog oocytes (reviewed in Dahlberg and Lund (1988)). The authors studied the expression of a human U3 snRNA gene by injecting 5' deletion mutants into frog oocytes. The results show that sequences more than 500 bp upstream of the U3 snRNA gene have a 2-3-fold stimulatory effect on the U3 snRNA synthesis. These results indicate that the human U3 snRNA gene is different from human U1 snRNA gene in containing regulatory elements more than 500 bp upstream. The U3 snRNA gene upstream sequences contain an AluI homologous sequence in the {minus}1,200 region; these AluI sequences were transcribed in vitro and in frog oocytes but were not detectable in Hela cells.

  4. Thiol-dependent inhibition of RNA synthesis in vitro by acridines: structure-inhibition relationships.

    PubMed

    Gniazdowski, M; Szmigiero, L; Wilmańska, D

    1982-01-01

    In the presence of sulfhydryl compounds an anticancer drug, 1-nitro-9-aminoalkylacridine derivative, forms with DNA irreversible, probably covalent, complexes of decreased template properties. Five 9-substituted 1-nitro-9-aminoacridine derivatives of cytostatic activity show irreversible thiol-dependent inhibitory effects on the RNA synthesis in vitro system while equal inhibition is observed both in the presence and in the absence of dithiothreitol with biologically inactive analogues of nitrocrine. In the absence of sulfhydryl compounds the inhibition depends on the planarity of the acridine ring. Hence, both 1-nitro-9-aminoalkylacridine and tetrahydroacridine derivatives show low inhibitory effect. PMID:6174208

  5. Inhibition of mRNA synthesis in the hippocampus impairs consolidation and reconsolidation of spatial memory.

    PubMed

    Da Silva, Weber C; Bonini, Juliana S; Bevilaqua, Lia R M; Medina, Jorge H; Izquierdo, Iván; Cammarota, Martín

    2008-01-01

    Using two different mRNA synthesis inhibitors, we show that blockade of hippocampal gene expression during restricted posttraining or postretrieval time windows hinders retention of long-term spatial memory for the Morris water maze task, without affecting short-term memory, nonspatial learning, or the functionality of the hippocampus. Our results indicate that spatial memory consolidation induces the activation of the hippocampal transcriptional machinery and suggest the existence of a gene expression-dependent reconsolidation process that operates in the dorsal hippocampus at the moment of retrieval to stabilize the reactivated mnemonic trace.

  6. Synthesis and applications of selectively {sup 13}C-labeled RNA

    SciTech Connect

    SantaLucia, J. Jr.; Shen, L.X.; Lewis, H.; Cai, Z.; Tinoci, I. Jr.

    1994-12-01

    Spectral overlap is a substantial problem in NMR studies of RNA molecules >30 nucleotides. To overcome this difficulty, we synthesized selectively {sup 13}C-labeled RNAs and adapted several isotope-edited two- and three-dimensional NMR experiments originally developed for protein studies. We optimized protocols for synthesis of multi-gram quantities of CTP, UTp, ATP, and GTP using a combination of synthetic organic and enzymatic methods. Uracil is prepared in 40 to 50% yield from {sup 13}C-cyanide in two steps. Using acetyl- tribenzoyl-ribose and standard chemistry uracil is then attached to the sugar (90% yield). The tribenzoyl-uridine intermediate is converted into uridine or cytidine quantitatively, depending on the deblocking protocol. Labeled purines are synthesized using simple pyrimidine precursors and reacting with {sup 13}C-formic acid (80% yield). Purine nucleosides are then synthesized using uridine phosphorylase and purine nucleoside phosphorylase. The nucleosides were converted to NMPs by treatment with POC1{sub 3} in triethylphosphate. We converted NMPs to NTPs by standard enzymatic methods. Selectively labeled RNAs were synthesized by run-off transcription using {sup 13}C-labeled NTPs. Several different strategies help solve over-lap problems in larger RNAs. Isotope-edited two-dimensional NMR experiments such as {omega}1-1/2 X-filtered NOESY simplify NMR spectra by dividing the normal NOESY spectrum into two subspectra-one involving NOEs from protons bound to {sup 12}C and one from protons bound to {sup 13}C. For example, we labeled A and U residues of a 34-nucleotide pseudoknot, and the {sup 12}C subspectrum of the 1/2 X-filtered NOESY contained NOEs only from G and C residues (along with adenine 2H); the {sup 13}C subspectrum contained NOEs only from A and U residues. Each subspectrum has less overlap than the NOESY of an unlabeled sample; the editing strategy allows each resonance to be identified by residue type (A, C, G, or U).

  7. A synthetic snRNA m3G-CAP enhances nuclear delivery of exogenous proteins and nucleic acids.

    PubMed

    Moreno, Pedro M D; Wenska, Malgorzata; Lundin, Karin E; Wrange, Orjan; Strömberg, Roger; Smith, C I Edvard

    2009-04-01

    Accessing the nucleus through the surrounding membrane poses one of the major obstacles for therapeutic molecules large enough to be excluded due to nuclear pore size limits. In some therapeutic applications the large size of some nucleic acids, like plasmid DNA, hampers their access to the nuclear compartment. However, also for small oligonucleotides, achieving higher nuclear concentrations could be of great benefit. We report on the synthesis and possible applications of a natural RNA 5'-end nuclear localization signal composed of a 2,2,7-trimethylguanosine cap (m(3)G-CAP). The cap is found in the small nuclear RNAs that are constitutive part of the small nuclear ribonucleoprotein complexes involved in nuclear splicing. We demonstrate the use of the m(3)G signal as an adaptor that can be attached to different oligonucleotides, thereby conferring nuclear targeting capabilities with capacity to transport large-size cargo molecules. The synthetic capping of oligos interfering with splicing may have immediate clinical applications.

  8. Genomic plus-strand RNA synthesis by the brome mosaic virus (BMV) RNA replicase requires a sequence that is complementary to the binding site of the BMV helicase-like protein.

    PubMed

    Sivakumaran, K; Kao, C C

    2000-11-01

    Summary Initiation of genomic plus-strand RNA synthesis by the brome mosaic virus (BMV) replicase in vitro requires a 26-nucleotide (nt) RNA sequence at the 3' end of the minus-strand RNA and a nontemplated nucleotide 3' of the initiation cytidylate [Sivakumaran, K. and Kao, C.C. (1999)J. Virol.64, 6415-6423]. At the 5' end of this RNA is a 9-nt sequence called the cB box, the complement of the previously defined B box. The cB box can not be functionally replaced by the B box and has specific positional and sequence requirements. The portion of the cB box that is required for RNA synthesis in vitro is well-conserved in species in the Bromoviridae family. An equivalent RNA from Cucumber mosaic virus was unable to direct efficient RNA synthesis by the BMV replicase until the cB box was positioned at the same site relative to the BMV RNA and guanylates were present at positions +6 and +7 from the initiation cytidylate. These results further define the elements required for the recognition and initiation of viral genomic plus-strand RNA synthesis and suggest that a sequence important for minus-strand RNA synthesis is also required for plus-strand RNA synthesis.

  9. Alternative kynurenic acid synthesis routes studied in the rat cerebellum

    PubMed Central

    Blanco Ayala, Tonali; Lugo Huitrón, Rafael; Carmona Aparicio, Liliana; Ramírez Ortega, Daniela; González Esquivel, Dinora; Pedraza Chaverrí, José; Pérez de la Cruz, Gonzalo; Ríos, Camilo; Schwarcz, Robert; Pérez de la Cruz, Verónica

    2015-01-01

    Kynurenic acid (KYNA), an astrocyte-derived, endogenous antagonist of α7 nicotinic acetylcholine and excitatory amino acid receptors, regulates glutamatergic, GABAergic, cholinergic and dopaminergic neurotransmission in several regions of the rodent brain. Synthesis of KYNA in the brain and elsewhere is generally attributed to the enzymatic conversion of L-kynurenine (L-KYN) by kynurenine aminotransferases (KATs). However, alternative routes, including KYNA formation from D-kynurenine (D-KYN) by D-amino acid oxidase (DAAO) and the direct transformation of kynurenine to KYNA by reactive oxygen species (ROS), have been demonstrated in the rat brain. Using the rat cerebellum, a region of low KAT activity and high DAAO activity, the present experiments were designed to examine KYNA production from L-KYN or D-KYN by KAT and DAAO, respectively, and to investigate the effect of ROS on KYNA synthesis. In chemical combinatorial systems, both L-KYN and D-KYN interacted directly with peroxynitrite (ONOO−) and hydroxyl radicals (OH•), resulting in the formation of KYNA. In tissue homogenates, the non-specific KAT inhibitor aminooxyacetic acid (AOAA; 1 mM) reduced KYNA production from L-KYN and D-KYN by 85.1 ± 1.7% and 27.1 ± 4.5%, respectively. Addition of DAAO inhibitors (benzoic acid, kojic acid or 3-methylpyrazole-5-carboxylic acid; 5 μM each) attenuated KYNA formation from L-KYN and D-KYN by ~35% and ~66%, respectively. ONOO− (25 μM) potentiated KYNA production from both L-KYN and D-KYN, and these effects were reduced by DAAO inhibition. AOAA attenuated KYNA production from L-KYN + ONOO− but not from D-KYN + ONOO−. In vivo, extracellular KYNA levels increased rapidly after perfusion of ONOO− and, more prominently, after subsequent perfusion with L-KYN or D-KYN (100 μM). Taken together, these results suggest that different mechanisms are involved in KYNA production in the rat cerebellum, and that, specifically, DAAO and ROS can function as alternative

  10. Alternative kynurenic acid synthesis routes studied in the rat cerebellum.

    PubMed

    Blanco Ayala, Tonali; Lugo Huitrón, Rafael; Carmona Aparicio, Liliana; Ramírez Ortega, Daniela; González Esquivel, Dinora; Pedraza Chaverrí, José; Pérez de la Cruz, Gonzalo; Ríos, Camilo; Schwarcz, Robert; Pérez de la Cruz, Verónica

    2015-01-01

    Kynurenic acid (KYNA), an astrocyte-derived, endogenous antagonist of α7 nicotinic acetylcholine and excitatory amino acid receptors, regulates glutamatergic, GABAergic, cholinergic and dopaminergic neurotransmission in several regions of the rodent brain. Synthesis of KYNA in the brain and elsewhere is generally attributed to the enzymatic conversion of L-kynurenine (L-KYN) by kynurenine aminotransferases (KATs). However, alternative routes, including KYNA formation from D-kynurenine (D-KYN) by D-amino acid oxidase (DAAO) and the direct transformation of kynurenine to KYNA by reactive oxygen species (ROS), have been demonstrated in the rat brain. Using the rat cerebellum, a region of low KAT activity and high DAAO activity, the present experiments were designed to examine KYNA production from L-KYN or D-KYN by KAT and DAAO, respectively, and to investigate the effect of ROS on KYNA synthesis. In chemical combinatorial systems, both L-KYN and D-KYN interacted directly with peroxynitrite (ONOO(-)) and hydroxyl radicals (OH•), resulting in the formation of KYNA. In tissue homogenates, the non-specific KAT inhibitor aminooxyacetic acid (AOAA; 1 mM) reduced KYNA production from L-KYN and D-KYN by 85.1 ± 1.7% and 27.1 ± 4.5%, respectively. Addition of DAAO inhibitors (benzoic acid, kojic acid or 3-methylpyrazole-5-carboxylic acid; 5 μM each) attenuated KYNA formation from L-KYN and D-KYN by ~35% and ~66%, respectively. ONOO(-) (25 μM) potentiated KYNA production from both L-KYN and D-KYN, and these effects were reduced by DAAO inhibition. AOAA attenuated KYNA production from L-KYN + ONOO(-) but not from D-KYN + ONOO(-). In vivo, extracellular KYNA levels increased rapidly after perfusion of ONOO(-) and, more prominently, after subsequent perfusion with L-KYN or D-KYN (100 μM). Taken together, these results suggest that different mechanisms are involved in KYNA production in the rat cerebellum, and that, specifically, DAAO and ROS can function as alternative

  11. On the Light Dependence of Fatty Acid Synthesis in Spinach Chloroplasts

    PubMed Central

    Sauer, Andreas; Heise, Klaus-Peter

    1983-01-01

    The capacity of intact chloroplasts to synthesize long chain fatty acids from acetate depends on the stroma pH in Spinacia oleracea, U. S. hybrid 424. The pH optimum is close to 8.5. Lowering of the stroma pH leads to a reduction of acetate incorporation but does not suffice to eliminate fatty acid synthesis completely. Chain elongation from palmitic to oleic acid shows the same pH dependence. Fatty acid synthesis is activated in the dark upon the simultaneous addition of dihydroxyacetone phosphate and orthophosphate supplying ATP and oxaloacetate for reoxidation of NADPH in the stroma. Under these conditions both dark fatty acid synthesis and synthesis of oleate from palmitate show the same pH dependence as in the light. Dark fatty acid synthesis is further stimulated by increasing the stromal Mg2+ concentration with the ionophore A 23187. In contrast to CO2 fixation, dark fatty acid synthesis is considerably reduced by dithiothreitol (DTT). This observation may be due to an acetyl-CoA deficiency, caused by a nonenzymic acylation of DTT, and a competition for ATP between DTT-activated CO2 fixation and fatty acid synthesis. Because d,l-glyceraldehyde as inhibitor of CO2 fixation compensates the DTT effect on dark fatty acid synthesis, reducing equivalents may be involved in the light dependence of acetate activation. PMID:16663156

  12. Cyclic diguanylic acid and cellulose synthesis in Agrobacterium tumefaciens

    SciTech Connect

    Amikam, D.; Benziman, M. )

    1989-12-01

    The occurrence of the novel regulatory nucleotide bis(3',5')-cyclic diguanylic acid (c-di-GMP) and its relation to cellulose biogenesis in the plant pathogen Agrobacterium tumefaciens was studied. c-di-GMP was detected in acid extracts of {sup 32}P-labeled cells grown in various media, and an enzyme responsible for its formation from GTP was found to be present in cell-free preparations. Cellulose synthesis in vivo was quantitatively assessed with ({sup 14}C)glucose as a tracer. The organism produced cellulose during growth in the absence of plant cells, and this capacity was retained in resting cells. Synthesis of a cellulosic product from UDP-glucose in vitro with membrane preparations was markedly stimulated by c-di-GMP and its precursor GTP and was further enhanced by Ca2+. The calcium effect was attributed to inhibition of a c-di-GMP-degrading enzyme shown to be present in the cellulose synthase-containing membranes.

  13. miR-122 Stimulates Hepatitis C Virus RNA Synthesis by Altering the Balance of Viral RNAs Engaged in Replication Versus Translation

    PubMed Central

    Masaki, Takahiro; Arend, Kyle C.; Li, You; Yamane, Daisuke; McGivern, David R.; Kato, Takanobu; Wakita, Takaji; Moorman, Nathaniel J.; Lemon, Stanley M.

    2015-01-01

    SUMMARY The liver-specific microRNA, miR-122, stabilizes hepatitis C virus (HCV) RNA genomes by recruiting host argonaute 2 (AGO2) to the 5′ end and preventing decay mediated by exonuclease Xrn1. However, HCV replication requires miR-122 in Xrn1-depleted cells, indicating additional function s. We show that miR-122 enhances HCV RNA levels by altering the fraction of HCV genomes available for RNA synthesis. Exogenous miR-122 increases viral RNA and protein levels in Xrn1-depleted cells, with enhanced RNA synthesis occurring before heightened protein synthesis. Inhibiting protein translation blocks miR-122-mediated increases in RNA synthesis, but independently enhances RNA synthesis by releasing ribosomes from viral genomes. Additionally, miR-122 reduces the fraction of viral genomes engaged in protein translation. Depleting AGO2 or PCBP2, which binds HCV RNA in competition with miR-122 and promotes translation, eliminates miR-122 stimulation of RNA synthesis. Thus, by displacing PCBP2, miR-122 reduces HCV genomes engaged in translation while increasing the fraction available for RNA synthesis. PMID:25662750

  14. Acidic Residues in the Hfq Chaperone Increase the Selectivity of sRNA Binding and Annealing.

    PubMed

    Panja, Subrata; Santiago-Frangos, Andrew; Schu, Daniel J; Gottesman, Susan; Woodson, Sarah A

    2015-11-01

    Hfq facilitates gene regulation by small non-coding RNAs (sRNAs), thereby affecting bacterial attributes such as biofilm formation and virulence. Escherichia coli Hfq recognizes specific U-rich and AAN motifs in sRNAs and target mRNAs, after which an arginine patch on the rim promotes base pairing between their complementary sequences. In the cell, Hfq must discriminate between many similar RNAs. Here, we report that acidic amino acids lining the sRNA binding channel between the inner pore and rim of the Hfq hexamer contribute to the selectivity of Hfq's chaperone activity. RNase footprinting, in vitro binding and stopped-flow fluorescence annealing assays showed that alanine substitution of D9, E18 or E37 strengthened RNA interactions with the rim of Hfq and increased annealing of non-specific or U-tailed RNA oligomers. Although the mutants were less able than wild-type Hfq to anneal sRNAs with wild-type rpoS mRNA, the D9A mutation bypassed recruitment of Hfq to an (AAN)4 motif in rpoS, both in vitro and in vivo. These results suggest that acidic residues normally modulate access of RNAs to the arginine patch. We propose that this selectivity limits indiscriminate target selection by E. coli Hfq and enforces binding modes that favor genuine sRNA and mRNA pairs.

  15. Sequence selective recognition of double-stranded RNA using triple helix-forming peptide nucleic acids.

    PubMed

    Zengeya, Thomas; Gupta, Pankaj; Rozners, Eriks

    2014-01-01

    Noncoding RNAs are attractive targets for molecular recognition because of the central role they play in gene expression. Since most noncoding RNAs are in a double-helical conformation, recognition of such structures is a formidable problem. Herein, we describe a method for sequence-selective recognition of biologically relevant double-helical RNA (illustrated on ribosomal A-site RNA) using peptide nucleic acids (PNA) that form a triple helix in the major grove of RNA under physiologically relevant conditions. Protocols for PNA preparation and binding studies using isothermal titration calorimetry are described in detail.

  16. Characterization of the RNA Required for Biosynthesis of δ-Aminolevulinic Acid from Glutamate 1

    PubMed Central

    Schneegurt, Mark A.; Beale, Samuel I.

    1988-01-01

    The heme and chlorophyll precursor δ-aminolevulinic acid acid (ALA) is formed in plants and algae from glutamate in a process that requires at least three enzyme components plus a low molecular weight RNA which co-purifies with the tRNA fraction during DEAE-cellulose column chromatography. RNA that is effective in the in vitro ALA biosynthetic system was extracted from several plant and algal species that form ALA via this route. In all cases, the effective RNA contained the UUC glutamate anticodon, as determined by its specific retention on an affinity resin containing an affine ligand directed against this anticodon. Construction of the affinity resin was based on the fact that the UUC glutamate anticodon is complementary to the GAA phenylalanine anticodon. By covalently linking the 3′ terminus of yeast tRNAPhe(GAA) to hydrazine-activated polyacrylamide gel beads, a resin carrying an affine ligand specific for the anticodon of tRNAGlu(UUC) was obtained. Column chromatography of plant and algal RNA extracts over this resin yielded a fraction that was highly enriched in the ability to stimulate ALA formation from glutamate when added to enzyme extracts of the unicellular green alga Chlorella vulgaris. Enhancement of ALA formation per A260 unit added was as much as 50 times greater with the affinity-purified RNA than with the RNA before affinity purification. The affinity column selectively retained RNA which supported ALA formation upon chromatography of RNA extracts from species of the diverse algal groups Chlorophyta (Chlorella Vulgaris), Euglenophyta (Euglena gracilis), Rhodophyta (Cyanidium caldarium), and Cyanophyta (Synechocystis sp. PCC 6803), and a higher plant (spinach). Other glutamate-accepting tRNAs that were not retained by the affinity column were ineffective in supporting ALA formation. These results indicate that possession of the UUC glutamate anticodon is a general requirement for RNA to participate in the conversion of glutamate to ALA in

  17. Replicative RNA synthesis and nucleocapsid assembly in vesicular stomatitis virus-infected permeable cells.

    PubMed Central

    Condra, J H; Lazzarini, R A

    1980-01-01

    A permeable-cell system has been developed to study the replication of vesicular stomatitis virus. When vesicular stomatitis virus-infected BHK cells were permeabilized by lysolecithin treatment, they incorporated nucleoside triphosphates into RNA and amino acids into proteins at nearly normal rates. The viral mRNA's synthesized appeared normal in polarity, size distribution, and polyadenylation, and all five viral proteins were synthesized. Replication of the viral genome proceeded, and full-length RNA strands were synthesized in amounts and polarities resembling those found in intact cells. These full-length RNAs associated with viral N proteins to form RNase-resistant nucleocapsids of normal buoyant density. Permeable cells appear to represent ideal hosts for studying vesicular stomatitis virus replication since they closely mimic in vivo conditions while retaining much of the experimental flexibility of current in vitro systems. Images PMID:6257927

  18. Cationic Mucic Acid Polymer-Based siRNA Delivery Systems.

    PubMed

    Pan, Dorothy W; Davis, Mark E

    2015-08-19

    Nanoparticle (NP) delivery systems for small interfering RNA (siRNA) that have good systemic circulation and high nucleic acid content are highly desired for translation into clinical use. Here, a family of cationic mucic acid-containing polymers is synthesized and shown to assemble with siRNA to form NPs. A cationic mucic acid polymer (cMAP) containing alternating mucic acid and charged monomers is synthesized. When combined with siRNA, cMAP forms NPs that require steric stabilization by poly(ethylene glycol) (PEG) that is attached to the NP surface via a 5-nitrophenylboronic acid linkage (5-nitrophenylboronic acid-PEGm (5-nPBA-PEGm)) to diols on mucic acid in the cMAP in order to inhibit aggregation in biological fluids. As an alternative, cMAP is covalently conjugated with PEG via two methods. First, a copolymer is prepared with alternating cMAP-PEG units that can form loops of PEG on the surface of the formulated siRNA-containing NPs. Second, an mPEG-cMAP-PEGm triblock polymer is synthesized that could lead to a PEG brush configuration on the surface of the formulated siRNA-containing NPs. The copolymer and triblock polymer are able to form stable siRNA-containing NPs without and with the addition of 5-nPBA-PEGm. Five formulations, (i) cMAP with 5-nPBA-PEGm, (ii) cMAP-PEG copolymer both (a) with and (b) without 5-nPBA-PEGm, and (iii) mPEG-cMAP-PEGm triblock polymer both (a) with and (b) without 5-nPBA-PEGm, are used to produce NPs in the 30-40 nm size range, and their circulation times are evaluated in mice using tail vein injections. The mPEG-cMAP-PEGm triblock polymer provides the siRNA-containing NP with the longest circulation time (5-10% of the formulation remains in circulation at 60 min postdosing), even when a portion of the excess cationic components used in the formulation is filtered away prior to injection. A NP formulation using the mPEG-cMAP-PEGm triblock polymer that is free of excess components could contain as much as ca. 30 wt % siRNA. PMID

  19. miR-122, a mammalian liver-specific microRNA, is processed from hcr mRNA and may downregulate the high affinity cationic amino acid transporter CAT-1.

    PubMed

    Chang, Jinhong; Nicolas, Emmanuelle; Marks, Debora; Sander, Chris; Lerro, Anthony; Buendia, Marie Annick; Xu, Chunxiao; Mason, William S; Moloshok, Thomas; Bort, Roque; Zaret, Kenneth S; Taylor, John M

    2004-07-01

    These studies show that miR-122, a 22-nucleotide microRNA, is derived from a liver-specific noncoding polyadenylated RNA transcribed from the gene hcr. The exact sequence of miR-122 as well as the adjacent secondary structure within the hcr mRNA are conserved from mammalian species back to fish. Levels of miR-122 in the mouse liver increase to half maximal values around day 17 of embryogenesis, and reach near maximal levels of 50,000 copies per average cell before birth. Lewis et al. (2003) predicted the cationic amino acid transporter (CAT-1 or SLC7A1) as a miR-122 target. CAT-1 protein and its mRNA are expressed in all mammalian tissues but with lower levels in adult liver. Furthermore, during mouse liver development CAT-1 mRNA decreases in an almost inverse correlation with miR-122. Eight potential miR-122 target sites were predicted within the human CAT-1 mRNA, with six in the 3'-untranslated region. Using a reporter construct it was found that just three of the predicted sites, linked in a 400-nucleotide sequence from human CAT-1, acted with synergy and were sufficient to strongly inhibit protein synthesis and reduce mRNA levels. In summary, these studies followed the accumulation during development of miR-122 from its mRNA precursor, hcr, through to identification of what may be a specific mRNA target, CAT-1. PMID:17179747

  20. Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway

    PubMed Central

    Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z.; Yazdani, Syed Shams

    2016-01-01

    Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817

  1. Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway.

    PubMed

    Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z; Yazdani, Syed Shams

    2016-01-01

    Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817

  2. Regulation of bile acid synthesis in rat hepatocyte monolayer cultures

    SciTech Connect

    Kubaska, W.M.

    1986-01-01

    Primary hepatocyte monolayer cultures (PHC) were prepared and incubated in serum free media. Cells from a cholestyramine fed rat converted exogenous (/sup 14/C)-cholesterol into (/sup 14/C)-bile acids at a 3-fold greater rate than rats fed a normal diet. PHC synthesize bile acids (BA) at a rate of approximately 0.06 ..mu..g/mg protein/h. The major bile acid composition, as determined by GLC, was ..beta..-muricholic acid (BMC) and cholic acid (CA) in a 3:1 ratio, respectively. PHC rapidly converted free BA and BA intermediates into taurine conjugated trihydroxy-BA up to 87h after plating. 3-Hydroxy-3-methylglutaryl-coenzyme A-reductase activity assayed in microsomes prepared from PHC, decreased during the initial 48h, then remained constant. Cholesterol 7..cap alpha..-hydroxylase activity decreased during the initial 48h, then increased during the next 48h. This occurred while whole cells produced BA at a linear rate. The effect of individual BA on bile acid synthesis (BAS) was also studied. Relative rates of BAS were measured as the conversion of (/sup 14/C)-cholesterol into (/sup 14/C)-BA. BA combinations were tested in order to simulate the composition of the enterohepatic circulation. The addition of TCA (525 ..mu..M) plus TCDCA (80..mu..M), in concentrations which greatly exceed the concentration of BA (60..mu..M) in rate portal blood, failed to inhibit BAS. BA plus phospholipid and/or cholesterol also did not inhibit BAS. Surprisingly, crude rat bile with a final concentration comparable to those in the synthetic mix inhibited (/sup 14/C)-cholesterol conversion into (/sup 14/C)-BA.

  3. Cdk7 mediates RPB1-driven mRNA synthesis in Toxoplasma gondii

    PubMed Central

    Deshmukh, Abhijit S.; Mitra, Pallabi; Maruthi, Mulaka

    2016-01-01

    Cyclin-dependent kinase 7 in conjunction with CyclinH and Mat1 activates cell cycle CDKs and is a part of the general transcription factor TFIIH. Role of Cdk7 is well characterized in model eukaryotes however its relevance in protozoan parasites has not been investigated. This important regulator of key processes warrants closer examination particularly in this parasite given its unique cell cycle progression and flexible mode of replication. We report functional characterization of TgCdk7 and its partners TgCyclinH and TgMat1. Recombinant Cdk7 displays kinase activity upon binding its cyclin partner and this activity is further enhanced in presence of Mat1. The activated kinase phosphorylates C-terminal domain of TgRPB1 suggesting its role in parasite transcription. Therefore, the function of Cdk7 in CTD phosphorylation and RPB1 mediated transcription was investigated using Cdk7 inhibitor. Unphosphorylated CTD binds promoter DNA while phosphorylation by Cdk7 triggers its dissociation from DNA with implications for transcription initiation. Inhibition of Cdk7 in the parasite led to strong reduction in Serine 5 phosphorylation of TgRPB1-CTD at the promoters of constitutively expressed actin1 and sag1 genes with concomitant reduction of both nascent RNA synthesis and 5′-capped transcripts. Therefore, we provide compelling evidence for crucial role of TgCdk7 kinase activity in mRNA synthesis. PMID:27759017

  4. Targeting of Arenavirus RNA Synthesis by a Carboxamide-Derivatized Aromatic Disulfide with Virucidal Activity

    PubMed Central

    Sepúlveda, Claudia S.; García, Cybele C.; Levingston Macleod, Jesica M.

    2013-01-01

    Several arenaviruses can cause severe hemorrhagic fever (HF) in humans, representing a public health threat in endemic areas of Africa and South America. The present study characterizes the potent virucidal activity of the carboxamide-derivatized aromatic disulfide NSC4492, an antiretroviral zinc finger-reactive compound, against Junín virus (JUNV), the causative agent of Argentine HF. The compound was able to inactivate JUNV in a time and temperature-dependent manner, producing more than 99 % reduction in virus titer upon incubation with virions at 37°C for 90 min. The ability of NSC4492-treated JUNV to go through different steps of the multiplication cycle was then evaluated. Inactivated virions were able to bind and enter into the host cell with similar efficiency as control infectious particles. In contrast, treatment with NSC4492 impaired the capacity of JUNV to drive viral RNA synthesis, as measured by quantitative RT-PCR, and blocked viral protein expression, as determined by indirect immunofluorescence. These results suggest that the disulfide NSC4492 targets on the arenavirus replication complex leading to impairment in viral RNA synthesis. Additionally, analysis of VLP produced in NSC4492-treated cells expressing JUNV matrix Z protein revealed that the compound may interact with Z resulting in an altered aggregation behavior of this protein, but without affecting its intrinsic self-budding properties. The potential perspectives of NSC4492 as an inactivating vaccinal compound for pathogenic arenaviruses are discussed. PMID:24278404

  5. Baker's Yeast Deficient in Storage Lipid Synthesis Uses cis-Vaccenic Acid to Reduce Unsaturated Fatty Acid Toxicity.

    PubMed

    Sec, Peter; Garaiova, Martina; Gajdos, Peter; Certik, Milan; Griac, Peter; Hapala, Ivan; Holic, Roman

    2015-07-01

    The role of cis-vaccenic acid (18:1n-7) in the reduction of unsaturated fatty acids toxicity was investigated in baker's yeast Saccharomyces cerevisiae. The quadruple mutant (QM, dga1Δ lro1Δ are1Δ are2Δ) deficient in enzymes responsible for triacylglycerol and steryl ester synthesis has been previously shown to be highly sensitive to exogenous unsaturated fatty acids. We have found that cis-vaccenic acid accumulated during cultivation in the QM cells but not in the corresponding wild type strain. This accumulation was accompanied by a reduction in palmitoleic acid (16:1n-7) content in the QM cells that is consistent with the proposed formation of cis-vaccenic acid by elongation of palmitoleic acid. Fatty acid analysis of individual lipid classes from the QM strain revealed that cis-vaccenic acid was highly enriched in the free fatty acid pool. Furthermore, production of cis-vaccenic acid was arrested if the mechanism of fatty acids release to the medium was activated. We also showed that exogenous cis-vaccenic acid did not affect viability of the QM strain at concentrations toxic for palmitoleic or oleic acids. Moreover, addition of cis-vaccenic acid to the growth medium provided partial protection against the lipotoxic effects of exogenous oleic acid. Transformation of palmitoleic acid to cis-vaccenic acid is thus a rescue mechanism enabling S. cerevisiae cells to survive in the absence of triacylglycerol synthesis as the major mechanism for unsaturated fatty acid detoxification.

  6. Efficient transfer of information from hexitol nucleic acids to RNA during nonenzymatic oligomerization

    NASA Technical Reports Server (NTRS)

    Kozlov, I. A.; De Bouvere, B.; Van Aerschot, A.; Herdewijn, P.; Orgel, L. E.

    1999-01-01

    Hexitol nucleic acids (HNAs) are DNA analogues that contain the standard nucleoside bases attached to a phosphorylated 1,5-anhydrohexitol backbone. We find that HNAs support efficient information transfer in nonensymatic template-directed reactions. HNA heterosequences appeared to be superior to the corresponding DNA heterosequences in facilitating synthesis of complementary oligonucleotides from nucleoside-5'-phosphoro-2-methyl imidazolides.

  7. The effect of linoleic acid on the whole body synthesis rates of polyunsaturated fatty acids from α-linolenic acid and linoleic acid in free-living rats.

    PubMed

    Domenichiello, Anthony F; Kitson, Alex P; Chen, Chuck T; Trépanier, Marc-Olivier; Stavro, P Mark; Bazinet, Richard P

    2016-04-01

    Docosahexaenoic acid (DHA) is thought to be important for brain function. The main dietary source of DHA is fish, however, DHA can also be synthesized from precursor omega-3 polyunsaturated fatty acids (n-3 PUFA), the most abundantly consumed being α-linolenic acid (ALA). The enzymes required to synthesize DHA from ALA are also used to synthesize longer chain omega-6 (n-6) PUFA from linoleic acid (LNA). The large increase in LNA consumption that has occurred over the last century has led to concern that LNA and other n-6 PUFA outcompete n-3 PUFA for enzymes involved in DHA synthesis, and therefore, decrease overall DHA synthesis. To assess this, rats were fed diets containing LNA at 53 (high LNA diet), 11 (medium LNA diet) or 1.5% (low LNA diet) of the fatty acids with ALA being constant across all diets (approximately 4% of the fatty acids). Rats were maintained on these diets from weaning for 8 weeks, at which point they were subjected to a steady-state infusion of labeled ALA and LNA to measure DHA and arachidonic acid (ARA) synthesis rates. DHA and ARA synthesis rates were generally highest in rats fed the medium and high LNA diets, while the plasma half-life of DHA was longer in rats fed the low LNA diet. Therefore, increasing dietary LNA, in rats, did not impair DHA synthesis; however, low dietary LNA led to a decrease in DHA synthesis with tissue concentrations of DHA possibly being maintained by a longer DHA half-life.

  8. Quantitative rRNA-targeted solution-based hybridization assay using peptide nucleic acid molecular beacons.

    PubMed

    Li, Xu; Morgenroth, Eberhard; Raskin, Lutgarde

    2008-12-01

    The potential of a solution-based hybridization assay using peptide nucleic acid (PNA) molecular beacon (MB) probes to quantify 16S rRNA of specific populations in RNA extracts of environmental samples was evaluated by designing PNA MB probes for the genera Dechloromonas and Dechlorosoma. In a kinetic study with 16S rRNA from pure cultures, the hybridization of PNA MB to target 16S rRNA exhibited a higher final hybridization signal and a lower apparent rate constant than the hybridizations to nontarget 16S rRNAs. A concentration of 10 mM NaCl in the hybridization buffer was found to be optimal for maximizing the difference between final hybridization signals from target and nontarget 16S rRNAs. Hybridization temperatures and formamide concentrations in hybridization buffers were optimized to minimize signals from hybridizations of PNA MB to nontarget 16S rRNAs. The detection limit of the PNA MB hybridization assay was determined to be 1.6 nM of 16S rRNA. To establish proof for the application of PNA MB hybridization assays in complex systems, target 16S rRNA from Dechlorosoma suillum was spiked at different levels to RNA isolated from an environmental (bioreactor) sample, and the PNA MB assay enabled effective quantification of the D. suillum RNA in this complex mixture. For another environmental sample, the quantitative results from the PNA MB hybridization assay were compared with those from clone libraries.

  9. Synthesis of acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters

    DOEpatents

    Moens, Luc

    2003-06-24

    A process of preparing an acid addition salt of delta-aminolevulinc acid comprising: a) dissolving a lower alkyl 5-bromolevulinate and hexamethylenetetramine in a solvent selected from the group consisting of water, ethyl acetate, chloroform, acetone, ethanol, tetrahydrofuran and acetonitrile, to form a quaternary ammonium salt of the lower alkyl 5-bromolevulinate; and b) hydrolyzing the quaternary ammonium salt with an inorganic acid to form an acid addition salt of delta-aminolevulinic acid.

  10. Uptake, efficacy, and systemic distribution of naked, inhaled short interfering RNA (siRNA) and locked nucleic acid (LNA) antisense.

    PubMed

    Moschos, Sterghios A; Frick, Manfred; Taylor, Bruce; Turnpenny, Paul; Graves, Helen; Spink, Karen G; Brady, Kevin; Lamb, David; Collins, David; Rockel, Thomas D; Weber, Markus; Lazari, Ovadia; Perez-Tosar, Luis; Fancy, Sally A; Lapthorn, Chris; Green, Martin X; Evans, Steve; Selby, Matthew; Jones, Gareth; Jones, Lyn; Kearney, Sarah; Mechiche, Houria; Gikunju, Diana; Subramanian, Romesh; Uhlmann, Eugen; Jurk, Marion; Vollmer, Jörg; Ciaramella, Giuseppe; Yeadon, Michael

    2011-12-01

    Antisense oligonucleotides (ASOs) and small interfering RNA (siRNA) promise specific correction of disease-causing gene expression. Therapeutic implementation, however, has been forestalled by poor delivery to the appropriate tissue, cell type, and subcellular compartment. Topical administration is considered to circumvent these issues. The availability of inhalation devices and unmet medical need in lung disease has focused efforts in this tissue. We report the development of a novel cell sorting method for quantitative, cell type-specific analysis of siRNA, and locked nucleic acid (LNA) ASO uptake and efficacy after intratracheal (i.t.) administration in mice. Through fluorescent dye labeling, we compare the utility of this approach to whole animal and whole tissue analysis, and examine the extent of tissue distribution. We detail rapid systemic access and renal clearance for both therapeutic classes and lack of efficacy at the protein level in lung macrophages, epithelia, or other cell types. We nevertheless observe efficient redirection of i.t. administered phosphorothioate (PS) LNA ASO to the liver and kidney leading to targeted gene knockdown. These data suggest delivery remains a key obstacle to topically administered, naked oligonucleotide efficacy in the lung and introduce inhalation as a potentially viable alternative to injection for antisense administration to the liver and kidneys.

  11. In Vivo RNAi Efficacy of Palmitic Acid-Conjugated Dicer-Substrate siRNA in a Subcutaneous Tumor Mouse Model.

    PubMed

    Kubo, Takanori; Yanagihara, Kazuyoshi; Seyama, Toshio

    2016-06-01

    Short interfering RNAs are used in RNA interference technology and are powerful tools for target gene silencing in a sequence-specific manner. In this study, we synthesized Dicer-substrate siRNAs consisting of 27-nt double-stranded RNAs conjugated with palmitic acid at the 5'-end of the sense strand and investigated their RNA interference efficacies in vitro and in vivo. The palmitic acid-conjugated 27-nt DsiRNAs (C16-Dsi27RNAs) were prepared by our simple synthesis strategy and achieved a good yield. C16-Dsi27RNAs showed enhanced in vitro RNA interference potency compared with not only non-modified Dsi27RNAs but also cholesterol-conjugated Dsi27RNAs against both an exogenous enhanced green fluorescent protein and the endogenous vascular endothelial growth factor gene in a human scirrhous-type gastric cancer cell line that stably expressed the enhanced green fluorescent protein gene (GCIY-eGFP). Additionally, C16-Dsi27RNAs had potent gene silencing activity against both enhanced green fluorescent protein and vascular endothelial growth factor as target genes in a subcutaneous tumor mouse model generated from GCIY-eGFP cells administered by intratumoral injection. These results suggest that the C16-Dsi27RNAs will be useful next-generation RNA interference molecules that can overcome the problems associated with RNA interference technology. PMID:26800111

  12. Effects of Saturated Long-chain Fatty Acid on mRNA Expression of Genes Associated with Milk Fat and Protein Biosynthesis in Bovine Mammary Epithelial Cells

    PubMed Central

    Qi, Lizhi; Yan, Sumei; Sheng, Ran; Zhao, Yanli; Guo, Xiaoyu

    2014-01-01

    This study was conducted to determine the effects of saturated long-chain fatty acids (LCFA) on cell proliferation and triacylglycerol (TAG) content, as well as mRNA expression of αs1-casein (CSN1S1) and genes associated with lipid and protein synthesis in bovine mammary epithelial cells (BMECs). Primary cells were isolated from the mammary glands of Holstein dairy cows, and were passaged twice. Then cells were cultured with different levels of palmitate or stearate (0, 200, 300, 400, 500, and 600 μM) for 48 h and fetal bovine serum in the culture solution was replaced with fatty acid-free BSA (1 g/L). The results showed that cell proliferation tended to be increased quadratically with increasing addition of stearate. Treatments with palmitate or stearate induced an increase in TAG contents at 0 to 600 μM in a concentration-dependent manner, and the addition of 600 μM was less effective in improving TAG accumulation. The expression of acetyl-coenzyme A carboxylase alpha, fatty acid synthase and fatty acid-binding protein 3 was inhibited when palmitate or stearate were added in culture medium, whereas cluster of differentiation 36 and CSN1S1 mRNA abundance was increased in a concentration-dependent manner. The mRNA expressions of peroxisome proliferator-activated receptor gamma, mammalian target of rapamycin and signal transducer and activator of transcription 5 with palmitate or stearate had no significant differences relative to the control. These results implied that certain concentrations of saturated LCFA could stimulate cell proliferation and the accumulation of TAG, whereas a reduction may occur with the addition of an overdose of saturated LCFA. Saturated LCFA could up-regulate CSN1S1 mRNA abundance, but further studies are necessary to elucidate the mechanism for regulating milk fat and protein synthesis. PMID:25049969

  13. Lipoprotein Lipase, Tissue Expression and Effects on Genes Related to Fatty Acid Synthesis in Goat Mammary Epithelial Cells

    PubMed Central

    Zhao, Wang-Sheng; Hu, Shi-Liang; Yu, Kang; Wang, Hui; Wang, Wei; Loor, Juan; Luo, Jun

    2014-01-01

    Lipoprotein lipase (LPL) serves as a central factor in hydrolysis of triacylglycerol and uptake of free fatty acids from the plasma. However, there are limited data concerning the action of LPL on the regulation of milk fat synthesis in goat mammary gland. In this investigation, we describe the cloning and sequencing of the LPL gene from Xinong Saanen dairy goat mammary gland, along with a study of its phylogenetic relationships. Sequence analysis showed that goat LPL shares similarities with other species including sheep, bovine, human and mouse. LPL mRNA expression in various tissues determined by RT-qPCR revealed the highest expression in white adipose tissue, with lower expression in heart, lung, spleen, rumen, small intestine, mammary gland, and kidney. Expression was almost undetectable in liver and muscle. The expression profiles of LPL gene in mammary gland at early, peak, mid, late lactation, and the dry period were also measured. Compared with the dry period, LPL mRNA expression was markedly greater at early lactation. However, compared with early lactation, the expression was lower at peak lactation and mid lactation. Despite those differences, LPL mRNA expression was still greater at peak, mid, and late lactation compared with the dry period. Using goat mammary epithelial cells (GMEC), the in vitro knockdown of LPL via shRNA or with Orlistat resulted in a similar degree of down-regulation of LPL (respectively). Furthermore, knockdown of LPL was associated with reduced mRNA expression of SREBF1, FASN, LIPE and PPARG but greater expression of FFAR3. There was no effect on ACACA expression. Orlistat decreased expression of LIPE, FASN, ACACA, and PPARG, and increased FFAR3 and SREBF1 expression. The pattern of LPL expression was similar to the changes in milk fat percentage in lactating goats. Taken together, results suggest that LPL may play a crucial role in fatty acid synthesis. PMID:25501331

  14. Effect of retinoic acid and ethanol on retinoic acid receptor beta and glial fibrillary acidic protein mRNA expression in human astrocytoma cells.

    PubMed

    Grummer, M A; Salih, Z N; Zachman, R D

    2000-11-17

    This work explores the hypothesis that perturbations caused by ethanol on the regulatory role of retinoids in brain development may be a mechanism involved in the neuropathology of fetal alcohol syndrome. The interaction of ethanol and retinoic acid (RA) on RA receptor (RAR) beta and glial fibrillary acidic protein (GFAP) mRNA expression is evaluated. In the U-373 MG astrocytoma, mRNA expression of RAR beta was increased and GFAP was decreased by RA. Ethanol decreased the expression of RAR beta mRNA, but increased that of GFAP. The RA-stimulated increase in RAR beta was not affected by the presence of ethanol. RA prevented the ethanol-induced increase in GFAP mRNA. Cycloheximide abolished only the GFAP response to ethanol. This work shows that an interrelationship between ethanol and RA exists in the astrocyte. PMID:11058790

  15. The predictive power of synthetic nucleic acid technologies in RNA biology.

    PubMed

    Chakraborty, Saikat; Mehtab, Shabana; Krishnan, Yamuna

    2014-06-17

    CONSPECTUS: The impact of nucleic acid nanotechnology in terms of transforming motifs from biology in synthetic and translational ways is widely appreciated. But it is also emerging that the thinking and vision behind nucleic acids as construction material has broader implications, not just in nanotechnology or even synthetic biology, but can feed back into our understanding of biology itself. Physicists have treated nucleic acids as polymers and connected physical principles to biology by abstracting out the molecular interactions. In contrast, biologists delineate molecular players and pathways related to nucleic acids and how they may be networked. But in vitro nucleic acid nanotechnology has provided a valuable framework for nucleic acids by connecting its biomolecular interactions with its materials properties and thereby superarchitecture ultramanipulation that on multiple occasions has pre-empted the elucidation of how living cells themselves are exploiting these same structural concepts. This Account seeks to showcase the larger implications of certain architectural principles that have arisen from the field of structural DNA/RNA nanotechnology in biology. Here we draw connections between these principles and particular molecular phenomena within living systems that have fed in to our understanding of how the cell uses nucleic acids as construction material to achieve different functions. We illustrate this by considering a few exciting and emerging examples in biology in the context of both switchable systems and scaffolding type systems. Due to the scope of this Account, we will focus our discussion on examples of the RNA scaffold as summarized. In the context of switchable RNA architectures, the synthetic demonstration of small molecules blocking RNA translation preceded the discovery of riboswitches. In another example, it was after the description of aptazymes that the first allosteric ribozyme, glmS, was discovered. In the context of RNA architectures

  16. Expression of fatty acid synthesis genes and fatty acid accumulation in haematococcus pluvialis under different stressors

    PubMed Central

    2012-01-01

    Background Biofuel has been the focus of intensive global research over the past few years. The development of 4th generation biofuel production (algae-to-biofuels) based on metabolic engineering of algae is still in its infancy, one of the main barriers is our lacking of understanding of microalgal growth, metabolism and biofuel production. Although fatty acid (FA) biosynthesis pathway genes have been all cloned and biosynthesis pathway was built up in some higher plants, the molecular mechanism for its regulation in microalgae is far away from elucidation. Results We cloned main key genes for FA biosynthesis in Haematococcus pluvialis, a green microalga as a potential biodiesel feedstock, and investigated the correlations between their expression alternation and FA composition and content detected by GC-MS under different stress treatments, such as nitrogen depletion, salinity, high or low temperature. Our results showed that high temperature, high salinity, and nitrogen depletion treatments played significant roles in promoting microalgal FA synthesis, while FA qualities were not changed much. Correlation analysis showed that acyl carrier protein (ACP), 3-ketoacyl-ACP-synthase (KAS), and acyl-ACP thioesterase (FATA) gene expression had significant correlations with monounsaturated FA (MUFA) synthesis and polyunsaturated FA (PUFA) synthesis. Conclusions We proposed that ACP, KAS, and FATA in H. pluvialis may play an important role in FA synthesis and may be rate limiting genes, which probably could be modified for the further study of metabolic engineering to improve microalgal biofuel quality and production. PMID:22448811

  17. DNA repair and recovery of RNA synthesis following exposure to ultraviolet light are delayed in long genes.

    PubMed

    Andrade-Lima, Leonardo C; Veloso, Artur; Paulsen, Michelle T; Menck, Carlos F M; Ljungman, Mats

    2015-03-11

    The kinetics of DNA repair and RNA synthesis recovery in human cells following UV-irradiation were assessed using nascent RNA Bru-seq and quantitative long PCR. It was found that UV light inhibited transcription elongation and that recovery of RNA synthesis occurred as a wave in the 5'-3' direction with slow recovery and TC-NER at the 3' end of long genes. RNA synthesis resumed fully at the 3'-end of genes after a 24 h recovery in wild-type fibroblasts, but not in cells deficient in transcription-coupled nucleotide excision repair (TC-NER) or global genomic NER (GG-NER). Different transcription recovery profiles were found for individual genes but these differences did not fully correlate to differences in DNA repair of these genes. Our study gives the first genome-wide view of how UV-induced lesions affect transcription and how the recovery of RNA synthesis of large genes are particularly delayed by the apparent lack of resumption of transcription by arrested polymerases.

  18. New stabilized FastPrep-CLEAs for sialic acid synthesis.

    PubMed

    García-García, María Inmaculada; Sola-Carvajal, Agustín; Sánchez-Carrón, Guiomar; García-Carmona, Francisco; Sánchez-Ferrer, Alvaro

    2011-05-01

    N-acetyl-D-neuraminic acid aldolase, a key enzyme in the biotechnological production of N-acetyl-D-neuraminic acid (sialic acid) from N-acetyl-D-mannosamine and pyruvate, was immobilized as cross-linked enzyme aggregates (CLEAs) by precipitation with 90% ammonium sulfate and crosslinking with 1% glutaraldehyde. Because dispersion in a reciprocating disruptor (FastPrep) was only able to recover 40% of the activity, improved CLEAs were then prepared by co-aggregation of the enzyme with 10mg/mL bovine serum albumin followed by a sodium borohydride treatment and final disruption by FastPrep (FastPrep-CLEAs). This produced a twofold increase in activity up to 86%, which is a 30% more than that reported for this aldolase in cross-linked inclusion bodies (CLIBs). In addition, these FastPrep-CLEAs presented remarkable biotechnological features for Neu5Ac synthesis, including, good activity and stability at alkaline pHs, a high K(M) for ManNAc (lower for pyruvate) and good operational stability. These results reinforce the practicability of using FastPrep-CLEAs in biocatalysis, thus reducing production costs and favoring reusability.

  19. RNA-Binding Efficacy of N-Phenylbenzohydroxamic Acid: An Invitro and Insilico Approach.

    PubMed

    Khilari, Rubi; Thakur, Yamini; Pardhi, Manish; Pande, Rama

    2015-01-01

    RNA has attracted recent attention for its key role in gene expression and hence targeting by small molecules for therapeutic intervention. This study is aimed to elucidate the specificity of RNA binding affinity of parent compound of N-arylhydroxamic acids series, N-phenylbenzohydroxamic acid trivially named as PBHA,C6H5NOH.C6H5C˭O. The binding behavior was examined by various biophysical methods such as absorption, fluorescence, and viscosity measurements. Molecular docking was also done. The value of affinity constant and overall binding constant was calculated 5.79±0.03×10(4) M(-1) and K'=1.09±0.03×10(5) M(-1), respectively. The Stern-Volmer constant Ksv obtained was 2.28±0.04×10(4) M(-1). The compound (PBHA) shows a concentration-based enhancement of fluorescence intensity with increasing RNA concentration. Fluorescence quenching of PBHA-RNA complex in presence of K4 [Fe(CN)6] was also observed. Viscometric studies complimented the UV results where a continuous increase in relative viscosity of the RNA solution was observed with added optimal PBHA concentration. All the experimental evidences indicate that PBHA can strongly bind to RNA through an intercalative mode. PMID:25874942

  20. Diversity of putative archaeal RNA viruses in metagenomic datasets of a yellowstone acidic hot spring.

    PubMed

    Wang, Hongming; Yu, Yongxin; Liu, Taigang; Pan, Yingjie; Yan, Shuling; Wang, Yongjie

    2015-01-01

    Two genomic fragments (5,662 and 1,269 nt in size, GenBank accession no. JQ756122 and JQ756123, respectively) of novel, positive-strand RNA viruses that infect archaea were first discovered in an acidic hot spring in Yellowstone National Park (Bolduc et al., 2012). To investigate the diversity of these newly identified putative archaeal RNA viruses, global metagenomic datasets were searched for sequences that were significantly similar to those of the viruses. A total of 3,757 associated reads were retrieved solely from the Yellowstone datasets and were used to assemble the genomes of the putative archaeal RNA viruses. Nine contigs with lengths ranging from 417 to 5,866 nt were obtained, 4 of which were longer than 2,200 nt; one contig was 204 nt longer than JQ756122, representing the longest genomic sequence of the putative archaeal RNA viruses. These contigs revealed more than 50% sequence similarity to JQ756122 or JQ756123 and may be partial or nearly complete genomes of novel genogroups or genotypes of the putative archaeal RNA viruses. Sequence and phylogenetic analyses indicated that the archaeal RNA viruses are genetically diverse, with at least 3 related viral lineages in the Yellowstone acidic hot spring environment.

  1. Synthesis of reinitiated transcripts by mammalian RNA polymerase II is controlled by elongation factor SII.

    PubMed Central

    Szentirmay, M N; Sawadogo, M

    1993-01-01

    Previous studies have revealed that the in vitro synthesis of reinitiated transcripts by RNA polymerase II requires an additional activity, designated reinitiation transcription factor (RTF), which is distinct from all of the general class II initiation factors. While further characterizing this activity, it was found that RTF displays properties indistinguishable from those of the RNA polymerase II elongation factor SII. In addition, Western blot analysis using SII-specific antibodies revealed that human SII is a major component in purified RTF preparations. The functional equivalence of the two proteins was established using recombinant SII, which proved fully capable of substituting for RTF in the reinitiation assay. In these reconstituted reactions, transcription complexes resulting from reinitiation events required SII to proceed through a 400 bp G-free cassette, while complexes resulting from the first round of initiations were SII-independent. Reinitiations can take place in the absence of SII; however, addition of the elongation factor is essential for full extension of the reinitiated transcripts. These results suggest that events taking place at the promoter (e.g. first-round initiations versus reinitiations) can create marked differences in the properties of RNA polymerase II elongation complexes. Images PMID:8223477

  2. The methyltransferase domain of dengue virus protein NS5 ensures efficient RNA synthesis initiation and elongation by the polymerase domain.

    PubMed

    Potisopon, Supanee; Priet, Stéphane; Collet, Axelle; Decroly, Etienne; Canard, Bruno; Selisko, Barbara

    2014-10-01

    Viral RNA-dependent RNA polymerases (RdRps) responsible for the replication of single-strand RNA virus genomes exert their function in the context of complex replication machineries. Within these replication complexes the polymerase activity is often highly regulated by RNA elements, proteins or other domains of multi-domain polymerases. Here, we present data of the influence of the methyltransferase domain (NS5-MTase) of dengue virus (DENV) protein NS5 on the RdRp activity of the polymerase domain (NS5-Pol). The steady-state polymerase activities of DENV-2 recombinant NS5 and NS5-Pol are compared using different biochemical assays allowing the dissection of the de novo initiation, transition and elongation steps of RNA synthesis. We show that NS5-MTase ensures efficient RdRp activity by stimulating the de novo initiation and the elongation phase. This stimulation is related to a higher affinity of NS5 toward the single-strand RNA template indicating NS5-MTase either completes a high-affinity RNA binding site and/or promotes the correct formation of the template tunnel. Furthermore, the NS5-MTase increases the affinity of the priming nucleotide ATP upon de novo initiation and causes a higher catalytic efficiency of the polymerase upon elongation. The complex stimulation pattern is discussed under the perspective that NS5 adopts several conformations during RNA synthesis. PMID:25209234

  3. The methyltransferase domain of dengue virus protein NS5 ensures efficient RNA synthesis initiation and elongation by the polymerase domain

    PubMed Central

    Potisopon, Supanee; Priet, Stéphane; Collet, Axelle; Decroly, Etienne; Canard, Bruno; Selisko, Barbara

    2014-01-01

    Viral RNA-dependent RNA polymerases (RdRps) responsible for the replication of single-strand RNA virus genomes exert their function in the context of complex replication machineries. Within these replication complexes the polymerase activity is often highly regulated by RNA elements, proteins or other domains of multi-domain polymerases. Here, we present data of the influence of the methyltransferase domain (NS5-MTase) of dengue virus (DENV) protein NS5 on the RdRp activity of the polymerase domain (NS5-Pol). The steady-state polymerase activities of DENV-2 recombinant NS5 and NS5-Pol are compared using different biochemical assays allowing the dissection of the de novo initiation, transition and elongation steps of RNA synthesis. We show that NS5-MTase ensures efficient RdRp activity by stimulating the de novo initiation and the elongation phase. This stimulation is related to a higher affinity of NS5 toward the single-strand RNA template indicating NS5-MTase either completes a high-affinity RNA binding site and/or promotes the correct formation of the template tunnel. Furthermore, the NS5-MTase increases the affinity of the priming nucleotide ATP upon de novo initiation and causes a higher catalytic efficiency of the polymerase upon elongation. The complex stimulation pattern is discussed under the perspective that NS5 adopts several conformations during RNA synthesis. PMID:25209234

  4. Discovery of alpha,gamma-diketo acids as potent selective and reversible inhibitors of hepatitis C virus NS5b RNA-dependent RNA polymerase.

    PubMed

    Summa, Vincenzo; Petrocchi, Alessia; Pace, Paola; Matassa, Victor G; De Francesco, Raffaele; Altamura, Sergio; Tomei, Licia; Koch, Uwe; Neuner, Philippe

    2004-01-01

    alpha,gamma-Diketo acids (DKA) were discovered from screening as selective and reversible inhibitors of hepatitis C virus NS5b RNA-dependent RNA polymerase. The diketo acid moiety proved essential for activity, while substitution on the gamma position was necessary for selectivity and potency. Optimization led to the identification of a DKA inhibitor of NS5b polymerase with IC(50) = 45 nM, one of the most potent HCV NS5b polymerase inhibitors reported.

  5. Inhibition of acidic mammalian chitinase by RNA interference suppresses ovalbumin-sensitized allergic asthma.

    PubMed

    Yang, Ching-Jen; Liu, Yu-Kuo; Liu, Chao-Lin; Shen, Chia-Ning; Kuo, Ming-Ling; Su, Chien-Chang; Tseng, Ching-Ping; Yen, Tzu-Chen; Shen, Chia-Rui

    2009-12-01

    Asthma, a chronic helper T cell type 2-mediated inflammatory disease, is characterized by airway hyperresponsiveness and inflammation. Growing evidence suggests that increased expression of acidic mammalian chitinase (AMCase) may play a role in the pathogenesis of asthma. In the present study, we sought to develop an RNA interference approach to suppress allergic asthma in mice through silencing of AMCase expression. Mice sensitized with ovalbumin (OVA) were intratracheally administered a recombinant adeno-associated virus expressing short hairpin RNA (rAAV-shRNA) against AMCase. In OVA-sensitized mice, the development of allergic symptoms was significantly associated with elevated AMCase expression. After administration of rAAV-shRNA, there was a significant reduction of AMCase expression in the lung and in bronchoalveolar lavage fluid (BALF) cells of sensitized mice. Sensitized mice receiving rAAV-shRNA showed a significant improvement in allergic symptoms, including airway hyperresponsiveness (AHR), eosinophil infiltration, eotaxin, interleukin-13 secretion in BALF, and serum OVA-specific IgE level. Our data suggest the hyperexpression of AMCase in asthma can be suppressed by rAAV-mediated shRNA. Silencing AMCase expression by shRNA may be a promising therapeutic strategy in asthma.

  6. Recovery of RNA synthesis from the DHFR gene following UV-irradiation precedes the removal of photolesions from the transcribed strand.

    PubMed

    Ljungman, M

    1999-03-01

    It is thought that recovery of RNA synthesis following UV-irradiation is closely related to the removal of UV-induced lesions from the transcribed strand of active genes. To test this hypothesis, nascent RNA synthesis from three different locations within the DHFR gene in CHO cells was assessed following exposure to UV light (254 nm). Using both in vivo RNA labeling as well as the nuclear run-on technique, it was found that RNA synthesis from the middle and the 3'-end of the gene was inhibited within 20 min by approximately 30 and 70%, respectively, while RNA synthesis from the 5'-end of the DHFR gene was enhanced. RNA synthesis from the middle portion of the gene fully recovered within 30-45 min of post-UV incubation, while recovery was slower from the 3'-end of the gene. Compared with previously published data for the kinetics of removal of UV-induced DNA lesions from the 5'-half of the DHFR gene in these cells, it is concluded that RNA synthesis resumed significantly faster in this region than could be accounted for by the removal of photolesions from the transcribed strand. Thus, although RNA synthesis was initially inhibited by UV-induced photolesions, the results suggest that RNA polymerase II was able to bypass these lesions prior to their removal.

  7. Interactions between the Influenza A Virus RNA Polymerase Components and Retinoic Acid-Inducible Gene I

    PubMed Central

    Li, Weizhong; Chen, Hongjun; Sutton, Troy; Obadan, Adebimpe

    2014-01-01

    ABSTRACT The influenza A virus genome possesses eight negative-strand RNA segments in the form of viral ribonucleoprotein particles (vRNPs) in association with the three viral RNA polymerase subunits (PB2, PB1, and PA) and the nucleoprotein (NP). Through interactions with multiple host factors, the RNP subunits play vital roles in replication, host adaptation, interspecies transmission, and pathogenicity. In order to gain insight into the potential roles of RNP subunits in the modulation of the host's innate immune response, the interactions of each RNP subunit with retinoic acid-inducible gene I protein (RIG-I) from mammalian and avian species were investigated. Studies using coimmunoprecipitation (co-IP), bimolecular fluorescence complementation (BiFc), and colocalization using confocal microscopy provided direct evidence for the RNA-independent binding of PB2, PB1, and PA with RIG-I from various hosts (human, swine, mouse, and duck). In contrast, the binding of NP with RIG-I was found to be RNA dependent. Expression of the viral NS1 protein, which interacts with RIG-I, did not interfere with the association of RNA polymerase subunits with RIG-I. The association of each individual virus polymerase component with RIG-I failed to significantly affect the interferon (IFN) induction elicited by RIG-I and 5′ triphosphate (5′ppp) RNA in reporter assays, quantitative reverse transcription-PCR (RT-PCR), and IRF3 phosphorylation tests. Taken together, these findings indicate that viral RNA polymerase components PB2, PB1, and PA directly target RIG-I, but the exact biological significance of these interactions in the replication and pathogenicity of influenza A virus needs to be further clarified. IMPORTANCE RIG-I is an important RNA sensor to elicit the innate immune response in mammals and some bird species (such as duck) upon influenza A virus infection. Although the 5′-triphosphate double-stranded RNA (dsRNA) panhandle structure at the end of viral genome RNA is

  8. Efficient ytterbium triflate catalyzed microwave-assisted synthesis of 3-acylacrylic acid building blocks.

    PubMed

    Tolstoluzhsky, Nikita V; Gorobets, Nikolay Yu; Kolos, Nadezhda N; Desenko, Sergey M

    2008-01-01

    The derivatives of 4-(hetero)aryl-4-oxobut-2-enoic acid are useful as building blocks in the synthesis of biologically active compounds. An efficient general protocol for the synthesis of these building blocks was developed. This method combines microwave assistance and ytterbium triflate catalyst and allows the fast preparation of the target acids starting from different (hetero)aromatic ketones and glyoxylic acid monohydrate giving pure products in 52-75% isolated yields.

  9. Inhibition of RNA synthesis in vitro and cell growth by anthracycline antibiotics.

    PubMed

    Studzian, K; Wasowska, M; Piestrzeniewicz, M K; Wilmańska, D; Szmigiero, L; Oszczapowicz, I; Gniazdowski, M

    2001-01-01

    New derivatives of doxorubicin and daunorubicin with amidine group bonded to daunosamine at C-3' atom and bearing the morpholine ring attached to the amidine group have been recently synthesized. Their cytotoxic activities and effects on RNA synthesis in vitro were assayed. The drug concentrations inhibiting mouse leukaemia L1210 cell growth to 50% were about two- and three fold higher for the derivatives compared to doxorubicin and daunorubicin respectively. Inhibition of phage T7 RNA polymerase by the non-covalently interacting derivatives was also slightly lower than that by the parent compounds. As doxorubicin and daunorubicin, their amidine derivatives in the presence of dithiothreitol and Fe(III) ions are activated and covalently bind to DNA. The adducts formed affect RNA polymerase activity. Several bands corresponding to prematurely terminated RNA chains are observed by means of polyacrylamide gel electrophoresis. The patterns of bands are virtually identical for all the anthracyclines studied here and are similar to the terminations induced by actinomycin D. This observation is consistent with a notion that the adducts are formed at guanine in GpC sequences which are also binding sites of actinomycin D. A substantial difference between daunorubicin and its amidine derivative is shown by means of high performance liquid chromatography. The derivative undergoes rapid rearrangements in the presence of dithiothreitol and Fe(III) ions, while daunorubicin is stable for several hours under these conditions. The results presented here indicate that the amidine derivatives despite bulky morpholine substitution exhibit biological activity in the systems used here. PMID:11845988

  10. Nucleic acid chaperons: a theory of an RNA-assisted protein folding

    PubMed Central

    Biro, Jan C

    2005-01-01

    Background Proteins are assumed to contain all the information necessary for unambiguous folding (Anfinsen's principle). However, ab initio structure prediction is often not successful because the amino acid sequence itself is not sufficient to guide between endless folding possibilities. It seems to be a logical to try to find the "missing" information in nucleic acids, in the redundant codon base. Results mRNA energy dot plots and protein residue contact maps were found to be rather similar. The structure of mRNA is also conserved if the protein structure is conserved, even if the sequence similarity is low. These observations led me to suppose that some similarity might exist between nucleic acid and protein folding. I found that amino acid pairs, which are co-located in the protein structure, are preferentially coded by complementary codons. This codon complementarity is not perfect; it is suboptimal where the 1st and 3rd codon residues are complementary to each other in reverse orientation, while the 2nd codon letters may be, but are not necessarily, complementary. Conclusion Partial complementary coding of co-locating amino acids in protein structures suggests that mRNA assists in protein folding and functions not only as a template but even as a chaperon during translation. This function explains the role of wobble bases and answers the mystery of why we have a redundant codon base. PMID:16137324

  11. LKB1 promotes cell survival by modulating TIF-IA-mediated pre-ribosomal RNA synthesis under uridine downregulated conditions

    PubMed Central

    Liu, Xiuju; Huang, Henry; Wilkinson, Scott C.; Zhong, Diansheng; Khuri, Fadlo R.; Fu, Haian; Marcus, Adam; He, Yulong; Zhou, Wei

    2016-01-01

    We analyzed the mechanism underlying 5-aminoimidazole-4-carboxamide riboside (AICAR) mediated apoptosis in LKB1-null non-small cell lung cancer (NSCLC) cells. Metabolic profile analysis revealed depletion of the intracellular pyrimidine pool after AICAR treatment, but uridine was the only nucleotide precursor capable of rescuing this apoptosis, suggesting the involvement of RNA metabolism. Because half of RNA transcription in cancer is for pre-ribosomal RNA (rRNA) synthesis, which is suppressed by over 90% after AICAR treatment, we evaluated the role of TIF-IA-mediated rRNA synthesis. While the depletion of TIF-IA by RNAi alone promoted apoptosis in LKB1-null cells, the overexpression of a wild-type or a S636A TIF-IA mutant, but not a S636D mutant, attenuated AICAR-induced apoptosis. In LKB1-null H157 cells, pre-rRNA synthesis was not suppressed by AICAR when wild-type LKB1 was present, and cellular fractionation analysis indicated that TIF-IA quickly accumulated in the nucleus in the presence of a wild-type LKB1 but not a kinase-dead mutant. Furthermore, ectopic expression of LKB1 was capable of attenuating AICAR-induced death in AMPK-null cells. Because LKB1 promotes cell survival by modulating TIF-IA-mediated pre-rRNA synthesis, this discovery suggested that targeted depletion of uridine related metabolites may be exploited in the clinic to eliminate LKB1-null cancer cells. PMID:26506235

  12. Amino acids inhibit kynurenic acid formation via suppression of kynurenine uptake or kynurenic acid synthesis in rat brain in vitro.

    PubMed

    Sekine, Airi; Okamoto, Misaki; Kanatani, Yuka; Sano, Mitsue; Shibata, Katsumi; Fukuwatari, Tsutomu

    2015-01-01

    The tryptophan metabolite, kynurenic acid (KYNA), is a preferential antagonist of the α7 nicotinic acetylcholine receptor at endogenous brain concentrations. Recent studies have suggested that increase of brain KYNA levels is involved in psychiatric disorders such as schizophrenia and depression. KYNA-producing enzymes have broad substrate specificity for amino acids, and brain uptake of kynurenine (KYN), the immediate precursor of KYNA, is via large neutral amino acid transporters (LAT). In the present study, to find out amino acids with the potential to suppress KYNA production, we comprehensively investigated the effects of proteinogenic amino acids on KYNA formation and KYN uptake in rat brain in vitro. Cortical slices of rat brain were incubated for 2 h in Krebs-Ringer buffer containing a physiological concentration of KYN with individual amino acids. Ten out of 19 amino acids (specifically, leucine, isoleucine, phenylalanine, methionine, tyrosine, alanine, cysteine, glutamine, glutamate, and aspartate) significantly reduced KYNA formation at 1 mmol/L. These amino acids showed inhibitory effects in a dose-dependent manner, and partially inhibited KYNA production at physiological concentrations. Leucine, isoleucine, methionine, phenylalanine, and tyrosine, all LAT substrates, also reduced tissue KYN concentrations in a dose-dependent manner, with their inhibitory rates for KYN uptake significantly correlated with KYNA formation. These results suggest that five LAT substrates inhibit KYNA formation via blockade of KYN transport, while the other amino acids act via blockade of the KYNA synthesis reaction in brain. Amino acids can be a good tool to modulate brain function by manipulation of KYNA formation in the brain. This approach may be useful in the treatment and prevention of neurological and psychiatric diseases associated with increased KYNA levels.

  13. The Yeast Mitochondrial RNA Polymerase and Transcription Factor Complex Catalyzes Efficient Priming of DNA Synthesis on Single-stranded DNA.

    PubMed

    Ramachandran, Aparna; Nandakumar, Divya; Deshpande, Aishwarya P; Lucas, Thomas P; R-Bhojappa, Ramanagouda; Tang, Guo-Qing; Raney, Kevin; Yin, Y Whitney; Patel, Smita S

    2016-08-01

    Primases use single-stranded (ss) DNAs as templates to synthesize short oligoribonucleotide primers that initiate lagging strand DNA synthesis or reprime DNA synthesis after replication fork collapse, but the origin of this activity in the mitochondria remains unclear. Herein, we show that the Saccharomyces cerevisiae mitochondrial RNA polymerase (Rpo41) and its transcription factor (Mtf1) is an efficient primase that initiates DNA synthesis on ssDNA coated with the yeast mitochondrial ssDNA-binding protein, Rim1. Both Rpo41 and Rpo41-Mtf1 can synthesize short and long RNAs on ssDNA template and prime DNA synthesis by the yeast mitochondrial DNA polymerase Mip1. However, the ssDNA-binding protein Rim1 severely inhibits the RNA synthesis activity of Rpo41, but not the Rpo41-Mtf1 complex, which continues to prime DNA synthesis efficiently in the presence of Rim1. We show that RNAs as short as 10-12 nt serve as primers for DNA synthesis. Characterization of the RNA-DNA products shows that Rpo41 and Rpo41-Mtf1 have slightly different priming specificity. However, both prefer to initiate with ATP from short priming sequences such as 3'-TCC, TTC, and TTT, and the consensus sequence is 3'-Pu(Py)2-3 Based on our studies, we propose that Rpo41-Mtf1 is an attractive candidate for serving as the primase to initiate lagging strand DNA synthesis during normal replication and/or to restart stalled replication from downstream ssDNA.

  14. The Yeast Mitochondrial RNA Polymerase and Transcription Factor Complex Catalyzes Efficient Priming of DNA Synthesis on Single-stranded DNA.

    PubMed

    Ramachandran, Aparna; Nandakumar, Divya; Deshpande, Aishwarya P; Lucas, Thomas P; R-Bhojappa, Ramanagouda; Tang, Guo-Qing; Raney, Kevin; Yin, Y Whitney; Patel, Smita S

    2016-08-01

    Primases use single-stranded (ss) DNAs as templates to synthesize short oligoribonucleotide primers that initiate lagging strand DNA synthesis or reprime DNA synthesis after replication fork collapse, but the origin of this activity in the mitochondria remains unclear. Herein, we show that the Saccharomyces cerevisiae mitochondrial RNA polymerase (Rpo41) and its transcription factor (Mtf1) is an efficient primase that initiates DNA synthesis on ssDNA coated with the yeast mitochondrial ssDNA-binding protein, Rim1. Both Rpo41 and Rpo41-Mtf1 can synthesize short and long RNAs on ssDNA template and prime DNA synthesis by the yeast mitochondrial DNA polymerase Mip1. However, the ssDNA-binding protein Rim1 severely inhibits the RNA synthesis activity of Rpo41, but not the Rpo41-Mtf1 complex, which continues to prime DNA synthesis efficiently in the presence of Rim1. We show that RNAs as short as 10-12 nt serve as primers for DNA synthesis. Characterization of the RNA-DNA products shows that Rpo41 and Rpo41-Mtf1 have slightly different priming specificity. However, both prefer to initiate with ATP from short priming sequences such as 3'-TCC, TTC, and TTT, and the consensus sequence is 3'-Pu(Py)2-3 Based on our studies, we propose that Rpo41-Mtf1 is an attractive candidate for serving as the primase to initiate lagging strand DNA synthesis during normal replication and/or to restart stalled replication from downstream ssDNA. PMID:27311715

  15. Visualising single molecules of HIV-1 and miRNA nucleic acids

    PubMed Central

    2013-01-01

    Background The scarcity of certain nucleic acid species and the small size of target sequences such as miRNA, impose a significant barrier to subcellular visualization and present a major challenge to cell biologists. Here, we offer a generic and highly sensitive visualization approach (oligo fluorescent in situ hybridization, O-FISH) that can be used to detect such nucleic acids using a single-oligonucleotide probe of 19–26 nucleotides in length. Results We used O-FISH to visualize miR146a in human and avian cells. Furthermore, we reveal the sensitivity of O-FISH detection by using a HIV-1 model system to show that as little as 1–2 copies of nucleic acids can be detected in a single cell. We were able to discern newly synthesized viral cDNA and, moreover, observed that certain HIV RNA sequences are only transiently available for O-FISH detection. Conclusions Taken together, these results suggest that the O-FISH method can potentially be used for in situ probing of, as few as, 1–2 copies of nucleic acid and, additionally, to visualize small RNA such as miRNA. We further propose that the O-FISH method could be extended to understand viral function by probing newly transcribed viral intermediates; and discern the localisation of nucleic acids of interest. Additionally, interrogating the conformation and structure of a particular nucleic acid in situ might also be possible, based on the accessibility of a target sequence. PMID:23590669

  16. Proline Coordination with Fatty Acid Synthesis and Redox Metabolism of Chloroplast and Mitochondria1[OPEN

    PubMed Central

    Shinde, Suhas; Villamor, Joji Grace; Lin, Wendar; Verslues, Paul E.

    2016-01-01

    Proline (Pro) accumulation is one of the most prominent changes in plant metabolism during drought and low water potential; however, the regulation and function of Pro metabolism remain unclear. We used a combination of forward genetic screening based on a Proline Dehydrogenase1 (PDH1) promoter-luciferase reporter (PDH1pro:LUC2) and RNA sequencing of the Pro synthesis mutant p5cs1-4 to identify multiple loci affecting Pro accumulation in Arabidopsis (Arabidopsis thaliana). Two mutants having high PDH1pro:LUC2 expression and increased Pro accumulation at low water potential were found to be alleles of Cytochrome P450, Family 86, Subfamily A, Polypeptide2 (CYP86A2) and Long Chain Acyl Synthetase2 (LACS2), which catalyze two successive steps in very-long-chain fatty acid (VLCFA) synthesis. Reverse genetic experiments found additional VLCFA and lipid metabolism-related mutants with increased Pro accumulation. Altered cellular redox status is a key factor in the coordination of Pro and VLCFA metabolism. The NADPH oxidase inhibitor diphenyleneiodonium (DPI) induced high levels of Pro accumulation and strongly repressed PDH1pro:LUC2 expression. cyp86a2 and lacs2 mutants were hypersensitive to diphenyleneiodonium but could be reverted to wild-type Pro and PDH1pro:LUC2 expression by reactive oxygen species scavengers. The coordination of Pro and redox metabolism also was indicated by the altered expression of chloroplast and mitochondria electron transport genes in p5cs1-4. These results show that Pro metabolism is both influenced by and influences cellular redox status via previously unknown coordination with several metabolic pathways. In particular, Pro and VLCFA synthesis share dual roles to help buffer cellular redox status while producing products useful for stress resistance, namely the compatible solute Pro and cuticle lipids. PMID:27512016

  17. De Novo mRNA Synthesis Is Required for Both Consolidation and Reconsolidation of Fear Memories in the Amygdala

    ERIC Educational Resources Information Center

    Duvarci, Sevil; Nader, Karim; LeDoux, Joseph E.

    2008-01-01

    Memory consolidation is the process by which newly learned information is stabilized into long-term memory (LTM). Considerable evidence indicates that retrieval of a consolidated memory returns it to a labile state that requires it to be restabilized. Consolidation of new fear memories has been shown to require de novo RNA and protein synthesis in…

  18. Inhibition of Mammalian Target of Rapamycin Complex 1 (mTORC1) Downregulates ELOVL1 Gene Expression and Fatty Acid Synthesis in Goat Fetal Fibroblasts

    PubMed Central

    Wang, Weipeng; He, Qiburi; Guo, Zhixin; Yang, Limin; Bao, Lili; Bao, Wenlei; Zheng, Xu; Wang, Yanfeng; Wang, Zhigang

    2015-01-01

    Elongation of very-long-chain fatty acids 1 (ELOVL1) is a ubiquitously expressed gene that belongs to the ELOVL family and regulates the synthesis of very-long-chain fatty acids (VLCFAs) and sphingolipids, from yeast to mammals. Mammalian target of rapamycin complex 1 (mTORC1) is a central regulator of cell metabolism and is associated with fatty acids synthesis. In this study, we cloned the cDNA that encodes Cashmere goat (Capra hircus) ELOVL1 (GenBank Accession number KF549985) and investigated its expression in 10 tissues. ELOVL1 cDNA was 840 bp, encoding a deduced protein of 279 amino acids, and ELOVL1 mRNA was expressed in a wide range of tissues. Inhibition of mTORC1 by rapamycin decreased ELOVL1 expression and fatty acids synthesis in Cashmere goat fetal fibroblasts. These data show that ELOVL1 expression is regulated by mTORC1 and that mTORC1 has significant function in fatty acids synthesis in Cashmere goat. PMID:26204830

  19. Comparison of commercial systems for extraction of nucleic acids from DNA/RNA respiratory pathogens.

    PubMed

    Yang, Genyan; Erdman, Dean E; Kodani, Maja; Kools, John; Bowen, Michael D; Fields, Barry S

    2011-01-01

    This study compared six automated nucleic acid extraction systems and one manual kit for their ability to recover nucleic acids from human nasal wash specimens spiked with five respiratory pathogens, representing Gram-positive bacteria (Streptococcus pyogenes), Gram-negative bacteria (Legionella pneumophila), DNA viruses (adenovirus), segmented RNA viruses (human influenza virus A), and non-segmented RNA viruses (respiratory syncytial virus). The robots and kit evaluated represent major commercially available methods that are capable of simultaneous extraction of DNA and RNA from respiratory specimens, and included platforms based on magnetic-bead technology (KingFisher mL, Biorobot EZ1, easyMAG, KingFisher Flex, and MagNA Pure Compact) or glass fiber filter technology (Biorobot MDX and the manual kit Allprep). All methods yielded extracts free of cross-contamination and RT-PCR inhibition. All automated systems recovered L. pneumophila and adenovirus DNA equivalently. However, the MagNA Pure protocol demonstrated more than 4-fold higher DNA recovery from the S. pyogenes than other methods. The KingFisher mL and easyMAG protocols provided 1- to 3-log wider linearity and extracted 3- to 4-fold more RNA from the human influenza virus and respiratory syncytial virus. These findings suggest that systems differed in nucleic acid recovery, reproducibility, and linearity in a pathogen specific manner.

  20. 4-Methylumbelliferone inhibits hyaluronan synthesis by depletion of cellular UDP-glucuronic acid and downregulation of hyaluronan synthase 2 and 3

    SciTech Connect

    Kultti, Anne; Pasonen-Seppaenen, Sanna; Jauhiainen, Marjo; Rilla, Kirsi J.; Kaernae, Riikka; Pyoeriae, Emma; Tammi, Raija H.; Tammi, Markku I.

    2009-07-01

    Hyaluronan accumulation on cancer cells and their surrounding stroma predicts an unfavourable disease outcome, suggesting that hyaluronan enhances tumor growth and spreading. 4-Methylumbelliferone (4-MU) inhibits hyaluronan synthesis and retards cancer spreading in experimental animals through mechanisms not fully understood. These mechanisms were studied in A2058 melanoma cells, MCF-7 and MDA-MB-361 breast, SKOV-3 ovarian and UT-SCC118 squamous carcinoma cells by analysing hyaluronan synthesis, UDP-glucuronic acid (UDP-GlcUA) content, and hyaluronan synthase (HAS) mRNA levels. The maximal inhibition in hyaluronan synthesis ranged 22-80% in the cell lines tested. Active glucuronidation of 4-MU produced large quantities of 4-MU-glucuronide, depleting the cellular UDP-GlcUA pool. The maximal reduction varied between 38 and 95%. 4-MU also downregulated HAS mRNA levels: HAS3 was 84-60% lower in MDA-MB-361, A2058 and SKOV-3 cells. HAS2 was the major isoenzyme in MCF-7 cells and lowered by 81%, similar to 88% in A2058 cells. These data indicate that both HAS substrate and HAS2 and/or HAS3 mRNA are targeted by 4-MU. Despite different target point sensitivities, the reduction of hyaluronan caused by 4-MU was associated with a significant inhibition of cell migration, proliferation and invasion, supporting the importance of hyaluronan synthesis in cancer, and the therapeutic potential of hyaluronan synthesis inhibition.

  1. Residues in human respiratory syncytial virus P protein that are essential for its activity on RNA viral synthesis.

    PubMed

    Asenjo, Ana; Mendieta, Jesús; Gómez-Puertas, Paulino; Villanueva, Nieves

    2008-03-01

    Human respiratory syncytial virus (HRSV) P protein, 241 amino acid long, is a structural homotetrameric phosphoprotein. Viral transcription and replication processes are dependent on functional P protein interactions inside viral ribonucleoprotein complexes (RNPs). Binding capacity to RNPs proteins and transcription and replication complementation analyses, using inactive P protein variants, have identified residues essential for functional interactions with itself, L, N and M2-1 proteins. P protein may establish some of these interactions as monomer, but efficient viral transcription and replication requires P protein oligomerization through the central region of the molecule. A structurally stable three-dimensional model has been generated in silico for this region (residues 98-158). Our analysis has indicated that P protein residues L135, D139, E140 and L142 are involved in homotetramerization. Additionally, the residues D136, S156, T160 and E179 appear to be essential for P protein activity on viral RNA synthesis and very high turnover phosphorylation at S143, T160 and T210 could regulate it. Thus, compounds targeted to those of these residues, located in the modeled three-dimensional structure, could have specific anti-HRSV effect.

  2. Effects of postprandial starvation on mRNA expression of endocrine-, amino acid and peptide transporter-, and metabolic enzyme-related genes in zebrafish (Danio rerio).

    PubMed

    Tian, Juan; He, Gen; Mai, Kangsen; Liu, Chengdong

    2015-06-01

    The goal of this study was to systematically evaluate the molecular activities of endocrine-, amino acid and peptide transporters-, and metabolic enzyme-related genes in 35-day-old mixed-sex zebrafish (Danio rerio) after feeding . Zebrafish with initial body weights ranging from 9 to 11 mg were fasted for 384 h in a controlled indoor environment. Fish were sampled at 0, 3, 6, 12, 24, 48, 96, 192, and 384 h after fed. Overall, the present study results show that the regulatory mechanism that insulin-like growth factor I negative feedback regulated growth hormone is conserved in zebrafish, as it is in mammals, but that regulation of growth hormone receptors is highly intricate. Leptin and cholecystokinin are time-dependent negative feedback signals, and neuropeptide Y may be an important positive neuropeptide for food intake in zebrafish. The amino acid/carnitine transporters B(0,+) (ATB(0,+)) and broad neutral (0) amino acid transporter 1(B(0)AT1) mRNA levels measured in our study suggest that protein may be utilized during 24-96 h of fasting in zebrafish. Glutamine synthetase mRNA levels were downregulated, and glutamate dehydrogenase, alanine aminotransferase, aspartate transaminase, and trypsin mRNA levels were upregulated after longtime fasting in this study. The mRNA expression levels of fatty acid synthetase decreased significantly (P < 0.05), whereas those of lipoprotein lipase rapidly increased after 96 h of fasting. Fasting activated the expression of glucose synthesis genes when fasting for short periods of time; when fasting is prolonged, the mRNA levels of glucose breakdown enzymes and pentose phosphate shunt genes decreased. PMID:25805459

  3. Decreased bile-acid synthesis in livers of hepatocyte-conditional NADPH-cytochrome P450 reductase-null mice results in increased bile acids in serum.

    PubMed

    Cheng, Xingguo; Zhang, Youcai; Klaassen, Curtis D

    2014-10-01

    NADPH-cytochrome P450 reductase (Cpr) is essential for the function of microsomal cytochrome P450 monooxygenases (P450), including those P450s involved in bile acid (BA) synthesis. Mice with hepatocyte-specific deletion of NADPH-cytochrome P450 reductase (H-Cpr-null) have been engineered to understand the in vivo function of hepatic P450s in the metabolism of xenobiotics and endogenous compounds. However, the impact of hepatic Cpr on BA homeostasis is not clear. The present study revealed that H-Cpr-null mice had a 60% decrease in total BA concentration in liver, whereas the total BA concentration in serum was almost doubled. The decreased level of cholic acid (CA) in both serum and livers of H-Cpr-null mice is likely due to diminished enzyme activity of Cyp8b1 that is essential for CA biosynthesis. Feedback mechanisms responsible for the reduced liver BA concentrations and/or increased serum BA concentrations in H-Cpr-null mice included the following: 1) enhanced alternative BA synthesis pathway, as evidenced by the fact that classic BA synthesis is diminished but chenodeoxycholic acid still increases in both serum and livers of H-Cpr-null mice; 2) inhibition of farnesoid X receptor activation, which increased the mRNA of Cyp7a1 and 8b1; 3) induction of intestinal BA transporters to facilitate BA absorption from the intestine to the circulation; 4) induction of hepatic multidrug resistance-associated protein transporters to increase BA efflux from the liver to blood; and 5) increased generation of secondary BAs. In summary, the present study reveals an important contribution of the alternative BA synthesis pathway and BA transporters in regulating BA concentrations in H-Cpr-null mice.

  4. Distribution, industrial applications, and enzymatic synthesis of D-amino acids.

    PubMed

    Gao, Xiuzhen; Ma, Qinyuan; Zhu, Hailiang

    2015-04-01

    D-Amino acids exist widely in microbes, plants, animals, and food and can be applied in pharmaceutical, food, and cosmetics. Because of their widespread applications in industry, D-amino acids have recently received more and more attention. Enzymes including D-hydantoinase, N-acyl-D-amino acid amidohydrolase, D-amino acid amidase, D-aminopeptidase, D-peptidase, L-amino acid oxidase, D-amino acid aminotransferase, and D-amino acid dehydrogenase can be used for D-amino acids synthesis by kinetic resolution or asymmetric amination. In this review, the distribution, industrial applications, and enzymatic synthesis methods are summarized. And, among all the current enzymatic methods, D-amino acid dehydrogenase method not only produces D-amino acid by a one-step reaction but also takes environment and atom economics into consideration; therefore, it is deserved to be paid more attention.

  5. Viral RNA modulates the acid sensitivity of foot-and-mouth disease virus capsids.

    PubMed Central

    Curry, S; Abrams, C C; Fry, E; Crowther, J C; Belsham, G J; Stuart, D I; King, A M

    1995-01-01

    Foot-and-mouth disease virus (FMDV) manifests an extreme sensitivity to acid, which is thought to be important for entry of the RNA genome into the cell. We have compared the low-pH-induced disassembly in vitro of virions and natural empty capsids of three subtypes of serotype A FMDV by enzyme-linked immunosorbent assay and sucrose gradient sedimentation analysis. For all three subtypes (A22 Iraq 24/64, A10(61), and A24 Cruzeiro), the empty capsid was more stable by 0.5 pH unit on average than the corresponding virion. Unexpectedly, in the natural empty capsids used in this study, the precursor capsid protein VP0 was found largely to be cleaved into VP2 and VP4. For picornaviruses the processing of VP0 is closely associated with encapsidation of viral RNA, which is considered likely to play a catalytic role in the cleavage. Investigation of the cleavage of VP0 in natural empty capsids failed to implicate the viral RNA. However, it remains possible that these particles arise from abortive attempts to encapsidate RNA. Empty capsids expressed from a vaccinia virus recombinant showed essentially the same acid lability as natural empty capsids, despite differing considerably in the extent of VP0 processing, with the synthetic particles containing almost exclusively uncleaved VP0. These results indicate that it is the viral RNA that modulates acid lability in FMDV. In all cases the capsids dissociate at low pH directly into pentameric subunits. Comparison of the three viruses indicates that FMDV A22 Iraq is about 0.5 pH unit more sensitive to low pH than types A10(61) and A24 Cruzeiro. Sequence analysis of the three subtypes identified several differences at the interface between pentamers and highlighted a His-alpha-helix dipole interaction which spans the pentamer interface and appears likely to influence the acid lability of the virus. PMID:7983739

  6. Synthesis and application of acid labile anchor groups for the synthesis of peptide amides by Fmoc-solid-phase peptide synthesis.

    PubMed

    Breipohl, G; Knolle, J; Stüber, W

    1989-10-01

    The preparation and application of a new linker for the synthesis of peptide amides using a modified Fmoc-method is described. The new anchor group was developed based on our experience with 4,4'-dimethoxybenzhydryl (Mbh)-protecting group for amides. Lability towards acid treatment was increased dramatically and results in an easy cleavage procedure for the preparation of peptide amides. The synthesis of N-9-fluorenylmethoxycarbonyl- ([5-carboxylatoethyl-2.4-dimethoxyphenyl)- 4'-methoxyphenyl]-methylamin is reported in detail. This linker was coupled to a commercially available aminomethyl polystyrene resin. Peptide synthesis proceeded smoothly using HOOBt esters of Fmoc-amino acids. Release of the peptide amide and final cleavage of the side chain protecting groups was accomplished by treatment with trifluoroacetic acid-dichloromethane mixtures in the presence of scavengers. The synthesis of peptide amides such as LHRH and C-terminal hexapeptide of secretin are given as examples.

  7. Amino Acid Synthesis in Seafloor Environments on Icy Worlds

    NASA Astrophysics Data System (ADS)

    Flores, Erika; Barge, Laura; VanderVelde, David; Kallas, Kayo; Baum, Marc M.; Russell, Michael J.; Kanik, Isik

    2016-10-01

    In 2005, the Cassini mission detected plumes erupting from Enceladus' surface, containing carbon dioxide, methane, silica, and possibly ammonia. Subsequent laboratory experiments indicated that the silica particles in the plumes were generated under alkaline conditions and at moderate temperatures of ~90°C (Hsu et al., 2015); one scenario for such conditions would be the existence of alkaline (serpentinization-driven) hydrothermal activity within Enceladus. Alkaline vents are significant since they have been proposed as a likely environment for the emergence of metabolism on the early Earth (Russell et al. 2014) and thus could also provide a mechanism for origin of life on ocean worlds with a water-rock interface. Alkaline vents in an acidic, iron-containing ocean could produce mineral precipitates that could act as primitive enzymes or catalysts mediating organic reactions; for example, metal sulfides can catalyze the reductive amination of pyruvate to alanine (Novikov and Copley 2013). We have conducted experiments testing the synthesis of amino acids catalyzed by other iron minerals that might be expected to precipitate on the seafloor of early Earth or Enceladus. Preliminary results indicate that amino acids as well as other organic products can be synthesized in 1-3 days under alkaline hydrothermal conditions. We also find that the yield and type of organic products is highly dependent on pH and temperature, implying that understanding the specifics of the geochemical hydrothermal gradients on Enceladus (or other ocean worlds) will be significant in determining their potential for synthesizing building blocks for life.Hsu, H.-W. et al. (2015), Nature 519, 207-210.Russell, M. J. et al. (2014), Astrobiology, 14, 308-43.Novikov Y. and Copley S. D. (2013) PNAS 110, 33, 13283-13288.

  8. Radioautographic visualization of differences in the pattern of (/sup 3/H)uridine and (/sup 3/H)orotic acid incorporation into the RNA of migrating columnar cells in the rat small intestine

    SciTech Connect

    Uddin, M.; Altmann, G.G.; Leblond, C.P.

    1984-05-01

    The epithelium of rat small intestine was radioautographed to examine whether RNA is synthesized by the salvage pathway as shown after (/sup 3/H)uridine injection or by the de novo pathway as shown after (/sup 3/H)orotic acid injection. The two modes of RNA synthesis were thus investigated during the migration of columnar cells from crypt base to villus top, and the rate of synthesis was assessed by counting silver grains over the nucleolus and nucleoplasm at six levels along the duodenal epithelium - that is, in the base, mid, and top regions of the crypts and in the base, mid, and top regions of the villi. Concomitant biochemical analyses established that, after injection of either (5-/sup 3/H)uridine or (5-/sup 3/H)orotic acid: (a) buffered glutaraldehyde fixative was as effective as perchloric acid or trichloroacetic acid in insolubilizing the nucleic acids of rat small intestine; (b) a major fraction of the nucleic acid label was in RNA, that is, 91% after (/sup 3/H)uridine and 72% after (/sup 3/H)orotic acid, with the rest in DNA; and (c) a substantial fraction of the RNA label was in poly A/sup +/ RNA (presumed to be messenger RNA). In radioautographs of duodenum prepared after (/sup 3/H)uridine injection, the count of silver grains was high over nucleolus and nucleoplasm in crypt base cells and gradually decreased at the upper levels up to the villus base. In the rest of the villus, the grain count over the nucleolus was negligible, while over the nucleoplasm it was low but significant.

  9. Poly(U) RNA-templated synthesis of AppA.

    PubMed

    Puthenvedu, Deepa; Janas, Teresa; Majerfeld, Irene; Illangasekare, Mali; Yarus, Michael

    2015-10-01

    Simple nucleotide templating activities are of interest as potential primordial reactions. Here we describe the acceleration of 5'-5' AppA synthesis by 3'-5' poly(U) under normal solution conditions. This reaction is apparently templated via complementary U:A base-pairing, despite the involvement of two different RNA backbones, because poly(U), unlike other polymers, significantly stimulates AppA synthesis. These interactions occur in moderate (K(+)) and (Mg(2+)) and are temperature sensitive, being more efficient at 10°C than at 4°C, but absent at 20°C. The reaction is only slightly pH sensitive, despite potentially relevant substrate pKa's. Kinetic data explicitly support production of AppA by interaction of stacked 2MeImpA and pA nucleotides paired with a single molecule of U template. At a lower rate, AppA can also be produced by a chemical reaction between 2MeImpA and pA, without participation of poly(U). Molecular modeling suggests that 5'-5' joining between stacked or concurrently paired A's can occur without major departures from normal U-A helical coordinates. So, coenzyme-like 5'-5' purine dinucleotides might be readily synthesized from 3'-5' RNAs with complementary sequences.

  10. The Hypothesis that the Genetic Code Originated in Coupled Synthesis of Proteins and the Evolutionary Predecessors of Nucleic Acids in Primitive Cells

    PubMed Central

    Francis, Brian R.

    2015-01-01

    Although analysis of the genetic code has allowed explanations for its evolution to be proposed, little evidence exists in biochemistry and molecular biology to offer an explanation for the origin of the genetic code. In particular, two features of biology make the origin of the genetic code difficult to understand. First, nucleic acids are highly complicated polymers requiring numerous enzymes for biosynthesis. Secondly, proteins have a simple backbone with a set of 20 different amino acid side chains synthesized by a highly complicated ribosomal process in which mRNA sequences are read in triplets. Apparently, both nucleic acid and protein syntheses have extensive evolutionary histories. Supporting these processes is a complex metabolism and at the hub of metabolism are the carboxylic acid cycles. This paper advances the hypothesis that the earliest predecessor of the nucleic acids was a β-linked polyester made from malic acid, a highly conserved metabolite in the carboxylic acid cycles. In the β-linked polyester, the side chains are carboxylic acid groups capable of forming interstrand double hydrogen bonds. Evolution of the nucleic acids involved changes to the backbone and side chain of poly(β-d-malic acid). Conversion of the side chain carboxylic acid into a carboxamide or a longer side chain bearing a carboxamide group, allowed information polymers to form amide pairs between polyester chains. Aminoacylation of the hydroxyl groups of malic acid and its derivatives with simple amino acids such as glycine and alanine allowed coupling of polyester synthesis and protein synthesis. Use of polypeptides containing glycine and l-alanine for activation of two different monomers with either glycine or l-alanine allowed simple coded autocatalytic synthesis of polyesters and polypeptides and established the first genetic code. A primitive cell capable of supporting electron transport, thioester synthesis, reduction reactions, and synthesis of polyesters and

  11. Primary and secondary siRNA synthesis triggered by RNAs from food bacteria in the ciliate Paramecium tetraurelia.

    PubMed

    Carradec, Quentin; Götz, Ulrike; Arnaiz, Olivier; Pouch, Juliette; Simon, Martin; Meyer, Eric; Marker, Simone

    2015-02-18

    In various organisms, an efficient RNAi response can be triggered by feeding cells with bacteria producing double-stranded RNA (dsRNA) against an endogenous gene. However, the detailed mechanisms and natural functions of this pathway are not well understood in most cases. Here, we studied siRNA biogenesis from exogenous RNA and its genetic overlap with endogenous RNAi in the ciliate Paramecium tetraurelia by high-throughput sequencing. Using wild-type and mutant strains deficient for dsRNA feeding we found that high levels of primary siRNAs of both strands are processed from the ingested dsRNA trigger by the Dicer Dcr1, the RNA-dependent RNA polymerases Rdr1 and Rdr2 and other factors. We further show that this induces the synthesis of secondary siRNAs spreading along the entire endogenous mRNA, demonstrating the occurrence of both 3'-to-5' and 5'-to-3' transitivity for the first time in the SAR clade of eukaryotes (Stramenopiles, Alveolates, Rhizaria). Secondary siRNAs depend on Rdr2 and show a strong antisense bias; they are produced at much lower levels than primary siRNAs and hardly contribute to RNAi efficiency. We further provide evidence that the Paramecium RNAi machinery also processes single-stranded RNAs from its bacterial food, broadening the possible natural functions of exogenously induced RNAi in this organism. PMID:25593325

  12. Primary and secondary siRNA synthesis triggered by RNAs from food bacteria in the ciliate Paramecium tetraurelia

    PubMed Central

    Carradec, Quentin; Götz, Ulrike; Arnaiz, Olivier; Pouch, Juliette; Simon, Martin; Meyer, Eric; Marker, Simone

    2015-01-01

    In various organisms, an efficient RNAi response can be triggered by feeding cells with bacteria producing double-stranded RNA (dsRNA) against an endogenous gene. However, the detailed mechanisms and natural functions of this pathway are not well understood in most cases. Here, we studied siRNA biogenesis from exogenous RNA and its genetic overlap with endogenous RNAi in the ciliate Paramecium tetraurelia by high-throughput sequencing. Using wild-type and mutant strains deficient for dsRNA feeding we found that high levels of primary siRNAs of both strands are processed from the ingested dsRNA trigger by the Dicer Dcr1, the RNA-dependent RNA polymerases Rdr1 and Rdr2 and other factors. We further show that this induces the synthesis of secondary siRNAs spreading along the entire endogenous mRNA, demonstrating the occurrence of both 3′-to-5′ and 5′-to-3′ transitivity for the first time in the SAR clade of eukaryotes (Stramenopiles, Alveolates, Rhizaria). Secondary siRNAs depend on Rdr2 and show a strong antisense bias; they are produced at much lower levels than primary siRNAs and hardly contribute to RNAi efficiency. We further provide evidence that the Paramecium RNAi machinery also processes single-stranded RNAs from its bacterial food, broadening the possible natural functions of exogenously induced RNAi in this organism. PMID:25593325

  13. Synthesis of L-ascorbic acid in the phloem

    PubMed Central

    Hancock, Robert D; McRae, Diane; Haupt, Sophie; Viola, Roberto

    2003-01-01

    Background Although plants are the main source of vitamin C in the human diet, we still have a limited understanding of how plants synthesise L-ascorbic acid (AsA) and what regulates its concentration in different plant tissues. In particular, the enormous variability in the vitamin C content of storage organs from different plants remains unexplained. Possible sources of AsA in plant storage organs include in situ synthesis and long-distance transport of AsA synthesised in other tissues via the phloem. In this paper we examine a third possibility, that of synthesis within the phloem. Results We provide evidence for the presence of AsA in the phloem sap of a wide range of crop species using aphid stylectomy and histochemical approaches. The activity of almost all the enzymes of the primary AsA biosynthetic pathway were detected in phloem-rich vascular exudates from Cucurbita pepo fruits and AsA biosynthesis was demonstrated in isolated phloem strands from Apium graveolens petioles incubated with a range of precursors (D-glucose, D-mannose, L-galactose and L-galactono-1,4-lactone). Phloem uptake of D-[U-14C]mannose and L-[1-14C]galactose (intermediates of the AsA biosynthetic pathway) as well as L-[1-14C]AsA and L-[1-14C]DHA, was observed in Nicotiana benthamiana leaf discs. Conclusions We present the novel finding that active AsA biosynthesis occurs in the phloem. This process must now be considered in the context of mechanisms implicated in whole plant AsA distribution. This work should provoke studies aimed at elucidation of the in vivo substrates for phloem AsA biosynthesis and its contribution to AsA accumulation in plant storage organs. PMID:14633288

  14. RNA:DNA Ratio and Other Nucleic Acid Derived Indices in Marine Ecology

    PubMed Central

    Chícharo, Maria Alexandra; Chícharo, Luis

    2008-01-01

    Some of most used indicators in marine ecology are nucleic acid-derived indices. They can be divided by target levels in three groups: 1) at the organism level as ecophysiologic indicators, indicators such as RNA:DNA ratios, DNA:dry weight and RNA:protein, 2) at the population level, indicators such as growth rate, starvation incidence or fisheries impact indicators, and 3) at the community level, indicators such as trophic interactions, exergy indices and prey identification. The nucleic acids derived indices, especially RNA:DNA ratio, have been applied with success as indicators of nutritional condition, well been and growth in marine organisms. They are also useful as indicators of natural or anthropogenic impacts in marine population and communities, such as upwelling or dredge fisheries, respectively. They can help in understanding important issues of marine ecology such as trophic interactions in marine environment, fish and invertebrate recruitment failure and biodiversity changes, without laborious work of counting, measuring and identification of small marine organisms. Besides the objective of integrate nucleic acid derived indices across levels of organization, the paper will also include a general characterization of most used nucleic acid derived indices in marine ecology and also advantages and limitations of them. We can conclude that using indicators, such RNA:DNA ratios and other nucleic acids derived indices concomitantly with organism and ecosystems measures of responses to climate change (distribution, abundance, activity, metabolic rate, survival) will allow for the development of more rigorous and realistic predictions of the effects of anthropogenic climate change on marine systems. PMID:19325815

  15. Clay catalyzed RNA synthesis under Martian conditions: Application for Mars return samples.

    PubMed

    Joshi, Prakash C; Dubey, Krishna; Aldersley, Michael F; Sausville, Meaghen

    2015-06-26

    Catalysis by montmorillonites clay minerals is regarded as a feasible mechanism for the abiotic production and polymerization of key biomolecules on early Earth. We have investigated a montmorillonite-catalyzed reaction of the 5'-phosphorimidazolide of nucleosides as a model to probe prebiotic synthesis of RNA-type oligomers. Here we show that this model is specific for the generation of RNA oligomers despite deoxy-mononucleotides adsorbing equally well onto the montmorillonite catalytic surfaces. Optimum catalytic activity was observed over a range of pH (6-9) and salinity (1 ± 0.2 M NaCl). When the weathering steps of early Earth that generated catalytic montmorillonite were modified to meet Martian soil conditions, the catalytic activity remained intact without altering the surface layer charge. Additionally, the formation of oligomers up to tetramer was detected using as little as 0.1 mg of Na⁺-montmorillonite, suggesting that the catalytic activity of a Martian clay return sample can be investigated with sub-milligram scale samples.

  16. Synthesis and evaluation of fluorescent cap analogues for mRNA labelling

    PubMed Central

    Ziemniak, Marcin; Szabelski, Mariusz; Lukaszewicz, Maciej; Nowicka, Anna; Darzynkiewicz, Edward; Rhoads, Robert E.; Wieczorek, Zbigniew; Jemielity, Jacek

    2013-01-01

    We describe the synthesis and properties of five dinucleotide fluorescent cap analogues labelled at the ribose of the 7-methylguanosine moiety with either anthraniloyl (Ant) or N-methylanthraniloyl (Mant), which have been designed for the preparation of fluorescent mRNAs via transcription in vitro. Two of the analogues bear a methylene modification in the triphosphate bridge, providing resistance against either the Dcp2 or DcpS decapping enzymes. All these compounds were prepared by ZnCl2-mediated coupling of a nucleotide P-imidazolide with a fluorescently labelled mononucleotide. To evaluate the utility of these compounds for studying interactions with cap-binding proteins and cap-related cellular processes, both biological and spectroscopic features of those compounds were determined. The results indicate acceptable quantum yields of fluorescence, pH independence, environmental sensitivity, and photostability. The cap analogues are incorporated by RNA polymerase into mRNA transcripts that are efficiently translated in vitro. Transcripts containing fluorescent caps but unmodified in the triphosphate chain are hydrolysed by Dcp2 whereas those containing a α-β methylene modification are resistant. Model studies exploiting sensitivity of Mant to changes of local environment demonstrated utility of the synthesized compounds for studying cap-related proteins. PMID:24273643

  17. Alternative bases in the RNA world: the prebiotic synthesis of urazole and its ribosides

    NASA Technical Reports Server (NTRS)

    Kolb, V. M.; Dworkin, J. P.; Miller, S. L.

    1994-01-01

    Urazole is a five-membered heterocyclic compound which is isosteric with uracil's hydrogen-bonding segment. Urazole reacts spontaneoulsy with ribose (and other aldoses) to give a mixture of four ribosides: alpha and beta pyranosides and furanosides. This reaction occurs in aqueous solution at mild temperatures. Thermodynamic and kinetic parameters for the reaction of urazole with ribose were determined. In contrast, uracil is completely unreactive with ribose under these conditions. Urazole's unusual reactivity is ascribed to the hydrazine portion of the molecule. Urazole can be synthesized from biuret and hydrazine under prebiotic conditions. The prebiotic synthesis of guanazole, which is isosteric in part to diaminopyrimidine and cytosine, is accomplished from dicyandiamide and hydrazine. Kinetic parameters for both prebiotic reactions were measured. Urazole and guanazole are transparent in the UV, which would be a favorable property in the absence of an ozone layer on the early Earth. Urazole makes hydrogen bonds with adenine in DMSO similar to those of uracil, as established by H NMR. All of these properties make urazole an attractive potential precursor to uracil and guanazole a potential precursor to cytosine in the RNA or pre-RNA world.

  18. Alternative bases in the RNA world: the prebiotic synthesis of urazole and its ribosides.

    PubMed

    Kolb, V M; Dworkin, J P; Miller, S L

    1994-01-01

    Urazole is a five-membered heterocyclic compound which is isosteric with uracil's hydrogen-bonding segment. Urazole reacts spontaneoulsy with ribose (and other aldoses) to give a mixture of four ribosides: alpha and beta pyranosides and furanosides. This reaction occurs in aqueous solution at mild temperatures. Thermodynamic and kinetic parameters for the reaction of urazole with ribose were determined. In contrast, uracil is completely unreactive with ribose under these conditions. Urazole's unusual reactivity is ascribed to the hydrazine portion of the molecule. Urazole can be synthesized from biuret and hydrazine under prebiotic conditions. The prebiotic synthesis of guanazole, which is isosteric in part to diaminopyrimidine and cytosine, is accomplished from dicyandiamide and hydrazine. Kinetic parameters for both prebiotic reactions were measured. Urazole and guanazole are transparent in the UV, which would be a favorable property in the absence of an ozone layer on the early Earth. Urazole makes hydrogen bonds with adenine in DMSO similar to those of uracil, as established by H NMR. All of these properties make urazole an attractive potential precursor to uracil and guanazole a potential precursor to cytosine in the RNA or pre-RNA world.

  19. Clay catalyzed RNA synthesis under Martian conditions: Application for Mars return samples.

    PubMed

    Joshi, Prakash C; Dubey, Krishna; Aldersley, Michael F; Sausville, Meaghen

    2015-06-26

    Catalysis by montmorillonites clay minerals is regarded as a feasible mechanism for the abiotic production and polymerization of key biomolecules on early Earth. We have investigated a montmorillonite-catalyzed reaction of the 5'-phosphorimidazolide of nucleosides as a model to probe prebiotic synthesis of RNA-type oligomers. Here we show that this model is specific for the generation of RNA oligomers despite deoxy-mononucleotides adsorbing equally well onto the montmorillonite catalytic surfaces. Optimum catalytic activity was observed over a range of pH (6-9) and salinity (1 ± 0.2 M NaCl). When the weathering steps of early Earth that generated catalytic montmorillonite were modified to meet Martian soil conditions, the catalytic activity remained intact without altering the surface layer charge. Additionally, the formation of oligomers up to tetramer was detected using as little as 0.1 mg of Na⁺-montmorillonite, suggesting that the catalytic activity of a Martian clay return sample can be investigated with sub-milligram scale samples. PMID:25888789

  20. Tailored fatty acid synthesis via dynamic control of fatty acid elongation

    SciTech Connect

    Torella, JP; Ford, TJ; Kim, SN; Chen, AM; Way, JC; Silver, PA

    2013-07-09

    Medium-chain fatty acids (MCFAs, 4-12 carbons) are valuable as precursors to industrial chemicals and biofuels, but are not canonical products of microbial fatty acid synthesis. We engineered microbial production of the full range of even-and odd-chain-length MCFAs and found that MCFA production is limited by rapid, irreversible elongation of their acyl-ACP precursors. To address this limitation, we programmed an essential ketoacyl synthase to degrade in response to a chemical inducer, thereby slowing acyl-ACP elongation and redirecting flux from phospholipid synthesis to MCFA production. Our results show that induced protein degradation can be used to dynamically alter metabolic flux, and thereby increase the yield of a desired compound. The strategy reported herein should be widely useful in a range of metabolic engineering applications in which essential enzymes divert flux away from a desired product, as well as in the production of polyketides, bioplastics, and other recursively synthesized hydrocarbons for which chain-length control is desired.

  1. Tailored fatty acid synthesis via dynamic control of fatty acid elongation.

    PubMed

    Torella, Joseph P; Ford, Tyler J; Kim, Scott N; Chen, Amanda M; Way, Jeffrey C; Silver, Pamela A

    2013-07-01

    Medium-chain fatty acids (MCFAs, 4-12 carbons) are valuable as precursors to industrial chemicals and biofuels, but are not canonical products of microbial fatty acid synthesis. We engineered microbial production of the full range of even- and odd-chain-length MCFAs and found that MCFA production is limited by rapid, irreversible elongation of their acyl-ACP precursors. To address this limitation, we programmed an essential ketoacyl synthase to degrade in response to a chemical inducer, thereby slowing acyl-ACP elongation and redirecting flux from phospholipid synthesis to MCFA production. Our results show that induced protein degradation can be used to dynamically alter metabolic flux, and thereby increase the yield of a desired compound. The strategy reported herein should be widely useful in a range of metabolic engineering applications in which essential enzymes divert flux away from a desired product, as well as in the production of polyketides, bioplastics, and other recursively synthesized hydrocarbons for which chain-length control is desired. PMID:23798438

  2. Chimeric RNA-DNA molecular beacons for quantification of nucleic acids, single nucleotide polymophisms, and nucleic acid damage.

    PubMed

    El-Yazbi, Amira F; Loppnow, Glen R

    2013-05-01

    Single nucleotide polymorphisms (SNPs) are the main cause for variations in the human genome. DNA lesions, such as cyclobutane pyrimidine dimers (CPDs), [6-4] pyrimidine-pyrimidinones, dewar pyrimidinones, and photohydrates, can subsequently lead to mutagenesis, carcinogenesis, and cell death. Much effort has focused on methods for detecting DNA, SNPs, or damaged nucleic acids. However, almost all of the proposed methods consist of multistep procedures, are limited to specific types of damage, some of these methods require expensive instruments, and some suffer from a high level of interferences. In this paper, we present a novel, simple, mix-and-read assay for the detection of nucleic acids that is general for all types of SNPs and nucleic acid damage. This method uses a chimeric RNA-DNA molecular beacon (chMB). The calibration curve of the chMB for detecting single base mismatch and ultraviolet (UV)-induced DNA damage shows good linearity (R(2) = 0.981 and 0.996, respectively) and limits of detection of 10.4 ± 2.2 and 8.64 ± 1.2 nM, respectively. The chimeric RNA-DNA MB proves to be a more sensitive and selective tool for the quantification of nucleic acids, DNA mismatches, and UV-induced DNA damage than DNA MBs.

  3. Ascorbic acid inhibits replication and infectivity of avian RNA tumor virus.

    PubMed Central

    Bissell, M J; Hatie, C; Farson, D A; Schwarz, R I; Soo, W J

    1980-01-01

    Ascorbic acid, at nontoxic concentrations, causes a substantial reduction in the ability of avian tumor viruses to replicate in both primary avian tendon cells and chicken embryo fibroblasts. The virus-infected cultures appear to be less transformed in the presence of ascorbic acid by the criteria of morphology, reduced glucose uptake, and increased collagen synthesis. The vitamin does not act by altering the susceptibility of the cells to initial infection and transformation, but instead appears to interfere with the spread of infection through a reduction in virus replication and virus infectivity. The effect is reversible and requires the continuous presence of the vitamin in the culture medium. Images PMID:6248860

  4. Ascorbic acid inhibits replication and infectivity of avian RNA tumor virus

    SciTech Connect

    BISSELL, MINA J; HATIE, CARROLL; FARSON, DEBORAH A.; SCHWARZ, RICHARD I.; SOO, WHAI-JEN

    1980-04-01

    Ascorbic acid, at nontoxic concentrations, causes a substantial reduction in the ability of avian tumor viruses to replicate in both primary avian tendon cells and chicken embryo fibroblasts. The virus-infected cultures appear to be less transformed in the presence of ascorbic acid by the criteria of morphology, reduced glucose uptake, and increased collagen synthesis. The vitamin does not act by altering the susceptibility of the cells to initial infection and transformation, but instead appears to interfere with the spread of infection through a reduction in virus replication and virus infectivity. The effect is reversible and requires the continuous presence of the vitamin in the culture medium.

  5. Crystallographic analysis of a subcomplex of the transsulfursome with tRNA for Cys-tRNA(Cys) synthesis.

    PubMed

    Chen, Meirong; Nakazawa, Yuto; Kubo, Yume; Asano, Nozomi; Kato, Koji; Tanaka, Isao; Yao, Min

    2016-07-01

    In most organisms, Cys-tRNA(Cys) is directly synthesized by cysteinyl-tRNA synthetase (CysRS). Many methanogenic archaea, however, use a two-step, indirect pathway to synthesize Cys-tRNA(Cys) owing to a lack of CysRS and cysteine-biosynthesis systems. This reaction is catalyzed by O-phosphoseryl-tRNA synthetase (SepRS), Sep-tRNA:Cys-tRNA synthase (SepCysS) and SepRS/SepCysS pathway enhancer (SepCysE) as the transsulfursome, in which SepCysE connects both SepRS and SepCysS. On the transsulfursome, SepRS first ligates an O-phosphoserine to tRNA(Cys), and the mischarged intermediate Sep-tRNA(Cys) is then transferred to SepCysS, where it is further modified to Cys-tRNA(Cys). In this study, a subcomplex of the transsulfursome with tRNA(Cys) (SepCysS-SepCysE-tRNA(Cys)), which is involved in the second reaction step of the indirect pathway, was constructed and then crystallized. The crystals diffracted X-rays to a resolution of 2.6 Å and belonged to space group P6522, with unit-cell parameters a = b = 107.2, c = 551.1 Å. The structure determined by molecular replacement showed that the complex consists of a SepCysS dimer, a SepCysE dimer and one tRNA(Cys) in the asymmetric unit. PMID:27380375

  6. Thioacetic acid/NaSH-mediated synthesis of N-protected amino thioacids and their utility in peptide synthesis.

    PubMed

    Mali, Sachitanand M; Gopi, Hosahudya N

    2014-03-21

    Thioacids are recently gaining momentum due to their versatile reactivity. The reactivity of thioacids has been widely explored in the selective amide/peptide bond formation. Thioacids are generally synthesized from the reaction between activated carboxylic acids such as acid chlorides, active esters, etc., and Na2S, H2S, or NaSH. We sought to investigate whether the versatile reactivity of the thioacids can be tuned for the conversion of carboxylic acids into corresponding thioacids in the presence of NaSH. Herein, we report that thioacetic acid- and NaSH-mediated synthesis of N-protected amino thioacids from the corresponding N-protected amino acids, oxidative dimerization of thioacids, crystal conformations of thioacid oxidative dimers, and the utility of thioacids and oxidative dimers in peptide synthesis. Our results suggest that peptides can be synthesized without using standard coupling agents.

  7. Control of adenovirus E1B mRNA synthesis by a shift in the activities of RNA splice sites.

    PubMed Central

    Montell, C; Fisher, E F; Caruthers, M H; Berk, A J

    1984-01-01

    The primary transcript from adenovirus 2 early region 1B (E1B) is processed by differential RNA splicing into two overlapping mRNAs, 13S and 22S. The 22S mRNA is the major E1B mRNA during the early phase of infection, whereas the 13S mRNA predominates during the late phase. In previous work, it has been shown that this shift in proportions of the E1B mRNAs is influenced by increased cytoplasmic stability of the 13S mRNA at late times in infection. Two observations presented here demonstrate that the increase in proportion of the 13S mRNA at late times is also regulated by a change in the specificity of RNA splicing. First, the relative concentrations of the 13S to 22S nuclear RNAs were not constant throughout infection but increased at late times. Secondly, studies with the mutant, adenovirus 2 pm2250 , provided evidence that there was an increased propensity to utilize a 5' splice in the region of the 13S 5' splice site at late times in infection. Adenovirus 2 pm2250 has a G----C transversion in the first base of E1B 13S mRNA intron preventing splicing of the 13S mRNA but not of the 22S mRNA. During the early phase of a pm2250 infection, the E1B primary transcripts were processed into the 22S mRNA only. However, during the late phase, when the 13S mRNA normally predominates, E1B primary transcripts were also processed by RNA splicing at two formerly unused or cryptic 5' splice sites. Both cryptic splice sites were located much closer to the disrupted 13S 5' splice site than to the 22S 5' splice site. Thus, the temporal increase in proportion of the 13S mRNA to the 22S mRNA is regulated by two processes, an increase in cytoplasmic stability of the 13S mRNA and an increased propensity to utilize the 13S 5' splice site during the late phase of infection. Adenovirus 2 pm2250 was not defective for productive infection of HeLa cells or for transformation of rat cells. Images PMID:6727875

  8. Ribonucleic acid synthesis by Escherichia coli C3000/L after infection by the ribonucleic acid coliphage ZIK/1, and properties of coliphage-ZIK/1 ribonucleic acid.

    PubMed

    Bishop, D H

    1965-10-01

    1. A method is described for the preparation and purification of the RNA from the RNA coliphage ZIK/1. 2. Some of the physical characteristics and infective properties of coliphage-ZIK/1 RNA were examined. 3. A method is also described for examining the type and quantity of RNA synthesized after bacteriophage infection. 4. Ribosome synthesis was decreased 15min. after bacteriophage adsorption, bacteriophage RNA was synthesized from 15min. to 120min. after adsorption and intracellular bacteriophages appeared 40min. after adsorption. Cell lysis commenced 60min. after adsorption, and was half complete 20min. later and 90-95% complete 120min. after adsorption. 5. Cell division continued until 40min. after bacteriophage adsorption. 6. Bacterial ribosomes were conserved during the infective process. 7. Intracellular bacteriophage RNA has sedimentation coefficient 28s but after cell lysis it has sedimentation coefficient 10-5s.

  9. Open reading frames 1a and 1b of the porcine reproductive and respiratory syndrome virus (PRRSV) collaboratively initiate viral minus-strand RNA synthesis.

    PubMed

    Tang, Yan-Dong; Fang, Qiong-Qiong; Liu, Ji-Ting; Wang, Tong-Yun; Wang, Yu; Tao, Ye; Liu, Yong-Gang; Cai, Xue-Hui

    2016-09-01

    The porcine reproductive and respiratory syndrome virus (PRRSV) causes a persistent threat to the swine industry, especially when highly pathogenic PRRSV (HP-PRRSV) emerges. Previous studies have indicated that PRRSV RNA synthesis was correlated with HP-PRRSV virulence. PRRSV RNA synthesis includes genomic RNA and sub-genomic mRNA, and these processes require minus-strand RNA as a template. However, the mechanisms involved in PRRSV minus-strand RNA synthesis are not fully understood. A mini-genome system can be used to assess viral replication mechanisms and to evaluate the effects of potential antiviral drugs on viral replicase activities. In this study, we developed a mini-genome system that uses firefly luciferase as a reporter. Based on this system, we found that PRRSV RNA-dependent RNA polymerase nsp9 alone failed to activate virus minus-strand RNA synthesis. We also demonstrated that combinations of open reading frames 1a (ORF1a) and ORF1b are necessary for viral minus-strand RNA synthesis. PMID:27378424

  10. Selective synthesis of 3-hydroxy acids from Meldrum's acids using SmI2-H2O.

    PubMed

    Szostak, Michal; Spain, Malcolm; Procter, David J

    2012-05-01

    The single-step synthesis of 3-hydroxy carboxylic acids from readily available Meldrum's acids involves a selective monoreduction using a SmI(2)-H(2)O complex to give products in high crude purity, and it represents a considerable advancement over other methods for the synthesis of 3-hydroxy acids. The protocol includes a detailed guide to the preparation of a single electron-reducing SmI(2)-H(2)O complex and describes two representative examples of the methodology: monoreduction of a fully saturated Meldrum's acid (5-(4-bromobenzyl)-2,2-dimethyl-1,3-dioxane-4,6-dione) and tandem conjugate reduction-selective monoreduction of α,β-unsaturated Meldrum's acid (5-(4-methoxybenzylidene)-2,2-dimethyl-1,3-dioxane-4,6-dione). The protocol for selective monoreduction of Meldrum's acids takes ∼6 h to complete. PMID:22538848

  11. Importance of amino acid composition to improve skin collagen protein synthesis rates in UV-irradiated mice.

    PubMed

    Murakami, Hitoshi; Shimbo, Kazutaka; Inoue, Yoshiko; Takino, Yoshinobu; Kobayashi, Hisamine

    2012-06-01

    Skin collagen metabolism abnormalities induced by ultraviolet (UV) radiation are the major causes of skin photoaging. It has been shown that the one-time exposure of UV irradiation decreases procollagen mRNA expression in dermis and that chronic UV irradiation decreases collagen amounts and induces wrinkle formation. Amino acids are generally known to regulate protein metabolism. Therefore, we investigated the effects of UV irradiation and various orally administered amino acids on skin collagen synthesis rates. Groups of 4-5 male, 8-week-old HR-1 hairless mice were irradiated with UVB (66 mJ/cm2) twice every other day, then fasted for 16 h. The fractional synthesis rate (FSR; %/h) of skin tropocollagen was evaluated by incorporating L-[ring-2H5]-phenylalanine. We confirmed that the FSR of dermal tropocollagen decreased after UVB irradiation. The FSR of dermal tropocollagen was measured 30 min after a single oral administration of amino acids (1 g/kg) to groups of 5-16 UVB-irradiated mice. Branched-chain amino acids (BCAA, 1.34±0.32), arginine (Arg, 1.66±0.39), glutamine (Gln, 1.75±0.60), and proline (Pro, 1.48±0.26) did not increase the FSR of skin tropocollagen compared with distilled water, which was used as a control (1.56±0.30). However, essential amino acids mixtures (BCAA+Arg+Gln, BCAA+Gln, and BCAA+Pro) significantly increased the FSR (2.07±0.58, 2.04±0.54, 2.01±0.50 and 2.07±0.59, respectively). This result suggests that combinations of BCAA and glutamine or proline are important for restoring dermal collagen protein synthesis impaired by UV irradiation.

  12. Pyrazinamide Induced Rat Cholestatic Liver Injury through Inhibition of FXR Regulatory Effect on Bile Acid Synthesis and Transport.

    PubMed

    Guo, Hong-Li; Hassan, Hozeifa M; Zhang, Yun; Dong, Si-Zhe; Ding, Ping-Ping; Wang, Tao; Sun, Li-Xin; Zhang, Lu-Yong; Jiang, Zhen-Zhou

    2016-08-01

    Pyrazinamide (PZA) is an indispensable first-line drug used for the treatment of tuberculosis which may cause serious hepatotoxicity; however, the mechanisms underlying these toxicities are poorly understood. Cholestasis plays an important role in drug-induced liver injury. Since there were no previous published works reported cholestasis and PZA hepatotoxicity relationship, this study aimed to identify whether PZA can induce liver injury with characterized evidences of cholestasis and to clarify expression changes of proteins related to both bile acid synthesis and transport in PZA-induced liver injury. PZA (2 g/kg) was administered for 7 consecutive days by oral gavage. Results showed there were 2-fold elevation in both ALT and AST serum levels in PZA-treated rats. In addition, a 10-fold increment in serum total bile acid was observed after PZA administration. The mRNA and protein expressions of bile acid synthesis and transport parameters were markedly altered, in which FXR, Bsep, Mrp2, Mdr2, Ostα/β, Oatp1a1, Oatp1b2, and Cyp8b1 were decreased (P < .05), while Mrp3, Ntcp, Oatp1a4, and Cyp7a1 were increased (P < .05). Moreover, treatment with the FXR agonist obeticholic acid (OCA) generated obvious reductions in serum ALT, AST, and TBA levels in PZA-treated rats. Those effects were due to transcriptional regulation of pre-mentioned target genes by OCA. Taken together, these results suggested that PZA-induced cholestatic liver injury was related to FXR inhibition, leading to the dysfunction in bile acid synthesis and transport. PMID:27255380

  13. Induction of Gnrh mRNA expression by the ω-3 polyunsaturated fatty acid docosahexaenoic acid and the saturated fatty acid palmitate in a GnRH-synthesizing neuronal cell model, mHypoA-GnRH/GFP.

    PubMed

    Tran, Dean Q; Ramos, Ernesto H; Belsham, Denise D

    2016-05-01

    Gonadotropin-releasing hormone (GnRH) neurons coordinate reproduction. However, whether GnRH neurons directly sense free fatty acids (FFAs) is unknown. We investigated the individual effects of the FFAs docosahexaenoic acid (DHA), palmitate, palmitoleate, and oleate (100 μM each) on Gnrh mRNA expression in the mHypoA-GnRH/GFP neuronal cell model. We report that 2 h exposure to palmitate or DHA increases Gnrh transcription. Using the inhibitors AH7614, K252c, U0126, wortmannin, and LY294002, we demonstrate that the effect of DHA is mediated through GPR120 to downstream PKC/MAPK and PI3K signaling. Our results indicate that the effect of palmitate may depend on palmitoyl-coA synthesis and PI3K signaling. Finally, we demonstrate that both DHA and palmitate increase Gnrh enhancer-derived RNA levels. Overall, these studies provide evidence that GnRH neurons directly sense FFAs. This will advance our understanding of the mechanisms underlying FFA sensing in the brain and provides insight into the links between nutrition and reproductive function. PMID:26923440

  14. Non-standard amino acid recognition by Escherichia coli leucyl-tRNA synthetase

    NASA Technical Reports Server (NTRS)

    Martinis, S. A.; Fox, G. E.

    1997-01-01

    Recombinant E. coli leucyl-tRNA synthetase was screened for amino acid-dependent pyrophosphate exchange activity using noncognate aliphatic amino acids including norvaline, homocysteine, norleucine, methionine, and homoserine. [32P]-labeled reaction products were separated by thin layer chromatography using a novel solvent system and then quantified by phosphorimaging. Norvaline which differs from leucine by only one methyl group stimulated pyrophosphate exchange activity as did both homocysteine and norleucine to a lesser extent. The KM parameters for leucine and norvaline were measured to be 10 micromoles and 1.5 mM, respectively. Experiments are in progress to determine if norvaline is transferred to tRNA(Leu) and/or edited by a pre- or post-transfer mechanism.

  15. Information transfer from peptide nucleic acids to RNA by template-directed syntheses

    NASA Technical Reports Server (NTRS)

    Schmidt, J. G.; Nielsen, P. E.; Orgel, L. E.; Bada, J. L. (Principal Investigator)

    1997-01-01

    Peptide nucleic acids (PNAs) are uncharged analogs of DNA and RNA in which the ribose-phosphate backbone is substituted by a backbone held together by amide bonds. PNAs are interesting as models of alternative genetic systems because they form potentially informational base paired helical structures. A PNA C10 oligomer has been shown to act as template for efficient formation of oligoguanylates from activated guanosine ribonucleotides. In a previous paper we used heterosequences of DNA as templates in sequence-dependent polymerization of PNA dimers. In this paper we show that information can be transferred from PNA to RNA. We describe the reactions of activated mononucleotides on heterosequences of PNA. Adenylic, cytidylic and guanylic acids were incorporated into the products opposite their complement on PNA, although less efficiently than on DNA templates.

  16. Synthesis of functionalized fluorescent gold nanoclusters for acid phosphatase sensing

    NASA Astrophysics Data System (ADS)

    Sun, Jian; Yang, Fan; Yang, Xiurong

    2015-10-01

    A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au+ complexes, and then a class of ~2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ~1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by introducing an alkaline aqueous solution of MUA into the GSH-Au+ complexes or AuNC@GSH solution. Subsequently, a reliable AuNC@GSH/MUA-based real-time assay of acid phosphatase (ACP) is established for the first time, inspired by the selective coordination of Fe3+ with surface ligands of AuNCs, the higher binding affinity between the pyrophosphate ion (PPi) and Fe3+, and the hydrolysis of PPi into orthophosphate by ACP. Our fluorescent chemosensor can also be applied to assay ACP in a real biological sample and, furthermore, to screen the inhibitor of ACP. This report paves a new avenue for synthesizing AuNCs based on either the bottom-up reduction or top-down etching method, establishing real-time fluorescence assays for ACP by means of PPi as the substrate, and further exploring the sensing applications of fluorescent AuNCs.A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au+ complexes, and then a class of ~2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ~1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by

  17. p53-Regulated Networks of Protein, mRNA, miRNA, and lncRNA Expression Revealed by Integrated Pulsed Stable Isotope Labeling With Amino Acids in Cell Culture (pSILAC) and Next Generation Sequencing (NGS) Analyses*

    PubMed Central

    Hünten, Sabine; Kaller, Markus; Drepper, Friedel; Oeljeklaus, Silke; Bonfert, Thomas; Erhard, Florian; Dueck, Anne; Eichner, Norbert; Friedel, Caroline C.; Meister, Gunter; Zimmer, Ralf; Warscheid, Bettina; Hermeking, Heiko

    2015-01-01

    We determined the effect of p53 activation on de novo protein synthesis using quantitative proteomics (pulsed stable isotope labeling with amino acids in cell culture/pSILAC) in the colorectal cancer cell line SW480. This was combined with mRNA and noncoding RNA expression analyses by next generation sequencing (RNA-, miR-Seq). Furthermore, genome-wide DNA binding of p53 was analyzed by chromatin-immunoprecipitation (ChIP-Seq). Thereby, we identified differentially regulated proteins (542 up, 569 down), mRNAs (1258 up, 415 down), miRNAs (111 up, 95 down) and lncRNAs (270 up, 123 down). Changes in protein and mRNA expression levels showed a positive correlation (r = 0.50, p < 0.0001). In total, we detected 133 direct p53 target genes that were differentially expressed and displayed p53 occupancy in the vicinity of their promoter. More transcriptionally induced genes displayed occupied p53 binding sites (4.3% mRNAs, 7.2% miRNAs, 6.3% lncRNAs, 5.9% proteins) than repressed genes (2.4% mRNAs, 3.2% miRNAs, 0.8% lncRNAs, 1.9% proteins), suggesting indirect mechanisms of repression. Around 50% of the down-regulated proteins displayed seed-matching sequences of p53-induced miRNAs in the corresponding 3′-UTRs. Moreover, proteins repressed by p53 significantly overlapped with those previously shown to be repressed by miR-34a. We confirmed up-regulation of the novel direct p53 target genes LINC01021, MDFI, ST14 and miR-486 and showed that ectopic LINC01021 expression inhibits proliferation in SW480 cells. Furthermore, KLF12, HMGB1 and CIT mRNAs were confirmed as direct targets of the p53-induced miR-34a, miR-205 and miR-486–5p, respectively. In line with the loss of p53 function during tumor progression, elevated expression of KLF12, HMGB1 and CIT was detected in advanced stages of cancer. In conclusion, the integration of multiple omics methods allowed the comprehensive identification of direct and indirect effectors of p53 that provide new insights and leads into the

  18. p53-Regulated Networks of Protein, mRNA, miRNA, and lncRNA Expression Revealed by Integrated Pulsed Stable Isotope Labeling With Amino Acids in Cell Culture (pSILAC) and Next Generation Sequencing (NGS) Analyses.

    PubMed

    Hünten, Sabine; Kaller, Markus; Drepper, Friedel; Oeljeklaus, Silke; Bonfert, Thomas; Erhard, Florian; Dueck, Anne; Eichner, Norbert; Friedel, Caroline C; Meister, Gunter; Zimmer, Ralf; Warscheid, Bettina; Hermeking, Heiko

    2015-10-01

    We determined the effect of p53 activation on de novo protein synthesis using quantitative proteomics (pulsed stable isotope labeling with amino acids in cell culture/pSILAC) in the colorectal cancer cell line SW480. This was combined with mRNA and noncoding RNA expression analyses by next generation sequencing (RNA-, miR-Seq). Furthermore, genome-wide DNA binding of p53 was analyzed by chromatin-immunoprecipitation (ChIP-Seq). Thereby, we identified differentially regulated proteins (542 up, 569 down), mRNAs (1258 up, 415 down), miRNAs (111 up, 95 down) and lncRNAs (270 up, 123 down). Changes in protein and mRNA expression levels showed a positive correlation (r = 0.50, p < 0.0001). In total, we detected 133 direct p53 target genes that were differentially expressed and displayed p53 occupancy in the vicinity of their promoter. More transcriptionally induced genes displayed occupied p53 binding sites (4.3% mRNAs, 7.2% miRNAs, 6.3% lncRNAs, 5.9% proteins) than repressed genes (2.4% mRNAs, 3.2% miRNAs, 0.8% lncRNAs, 1.9% proteins), suggesting indirect mechanisms of repression. Around 50% of the down-regulated proteins displayed seed-matching sequences of p53-induced miRNAs in the corresponding 3'-UTRs. Moreover, proteins repressed by p53 significantly overlapped with those previously shown to be repressed by miR-34a. We confirmed up-regulation of the novel direct p53 target genes LINC01021, MDFI, ST14 and miR-486 and showed that ectopic LINC01021 expression inhibits proliferation in SW480 cells. Furthermore, KLF12, HMGB1 and CIT mRNAs were confirmed as direct targets of the p53-induced miR-34a, miR-205 and miR-486-5p, respectively. In line with the loss of p53 function during tumor progression, elevated expression of KLF12, HMGB1 and CIT was detected in advanced stages of cancer. In conclusion, the integration of multiple omics methods allowed the comprehensive identification of direct and indirect effectors of p53 that provide new insights and leads into the

  19. Versatile Multicomponent Reaction Macrocycle Synthesis Using α-Isocyano-ω-carboxylic Acids.

    PubMed

    Liao, George P; Abdelraheem, Eman M M; Neochoritis, Constantinos G; Kurpiewska, Katarzyna; Kalinowska-Tłuścik, Justyna; McGowan, David C; Dömling, Alexander

    2015-10-16

    The direct macrocycle synthesis of α-isocyano-ω-carboxylic acids via an Ugi multicomponent reaction is introduced. This multicomponent reaction (MCR) protocol differs by being especially short, convergent, and versatile, giving access to 12-22 membered rings.

  20. Synthesis and self-assembly of poly(3-hexylthiophene)-block-poly(acrylic acid)

    SciTech Connect

    Li, Zicheng; Ono, Robert J.; Wu, Zong-Quan; Bielawski, Christopher W.

    2011-01-01

    A modular and convenient synthesis of ethynyl end functionalized poly(3-hexylthiophene) in high purity is reported; this material facilitated access to poly(3-hexylthiophene)-block-poly(acrylic acid) which self-assembled into hierarchical structures.

  1. The Synthesis of an Amino Acid Derivative and Spectroscopic Monitoring of Dipeptide Formation.

    ERIC Educational Resources Information Center

    Simmonds, Richard J.

    1987-01-01

    Described are experiments to give students experience in the synthesis of peptides from amino acids and to use visible spectroscopy to measure a rate of reaction. The activities were designed for undergraduate courses. (RH)

  2. Acid-Degradable Cationic Dextran Particles for the Delivery of siRNA Therapeutics

    PubMed Central

    Cohen, Jessica L.; Schubert, Stephanie; Wich, Peter R.; Cui, Lina; Cohen, Joel A.; Mynar, Justin L.; Fréchet, Jean M. J.

    2011-01-01

    We report a new acid-sensitive, biocompatible and biodegradable microparticulate delivery system, spermine modified acetalated-dextran (Spermine-Ac-DEX), which can be used to efficiently encapsulate siRNA. These particles demonstrated efficient gene knockdown in HeLa-luc cells with minimal toxicity. This knockdown was comparable to that obtained using Lipofectamine, a commercially available transfection reagent generally limited to in vitro use due to its high toxicity. PMID:21539393

  3. Synthesis of functionalized fluorescent gold nanoclusters for acid phosphatase sensing.

    PubMed

    Sun, Jian; Yang, Fan; Yang, Xiurong

    2015-10-21

    A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au(+) complexes, and then a class of ∼2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ∼1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by introducing an alkaline aqueous solution of MUA into the GSH-Au(+) complexes or AuNC@GSH solution. Subsequently, a reliable AuNC@GSH/MUA-based real-time assay of acid phosphatase (ACP) is established for the first time, inspired by the selective coordination of Fe(3+) with surface ligands of AuNCs, the higher binding affinity between the pyrophosphate ion (PPi) and Fe(3+), and the hydrolysis of PPi into orthophosphate by ACP. Our fluorescent chemosensor can also be applied to assay ACP in a real biological sample and, furthermore, to screen the inhibitor of ACP. This report paves a new avenue for synthesizing AuNCs based on either the bottom-up reduction or top-down etching method, establishing real-time fluorescence assays for ACP by means of PPi as the substrate, and further exploring the sensing applications of fluorescent AuNCs. PMID:26391420

  4. Conjugation of Palmitic Acid Improves Potency and Longevity of siRNA Delivered via Endosomolytic Polymer Nanoparticles

    PubMed Central

    Sarett, Samantha M.; Kilchrist, Kameron V.; Miteva, Martina; Duvall, Craig L.

    2015-01-01

    Clinical translation of siRNA therapeutics has been limited by the inability to effectively overcome the rigorous delivery barriers associated with intracellular-acting biologics. Here, in order to address both potency and longevity of siRNA gene silencing, pH-responsive micellar nanoparticle (NP) carriers loaded with siRNA conjugated to palmitic acid (siRNA-PA) were investigated as a combined approach to improve siRNA endosomal escape and stability. Conjugation to hydrophobic PA improved NP loading efficiency relative to unmodified siRNA, enabling complete packaging of siRNA-PA at a lower polymer:siRNA ratio. PA conjugation also increased intracellular uptake of the nucleic acid cargo by 35-fold and produced a 3.1-fold increase in intracellular half-life. The higher uptake and improved retention of siRNA-PA NPs correlated to a 2- and 11-fold decrease in gene silencing IC50 in comparison to siRNA NPs in fibroblasts and mesenchymal stem cells, respectively, for both the model gene luciferase and the therapeutically relevant gene PHD2. PA conjugation also significantly increased longevity of silencing activity following a single treatment, as observed in fibroblasts. Thus, conjugation of PA to siRNA paired with endosomolytic NPs is a promising approach to enhance the functional efficacy of siRNA in tissue regenerative and other applications. PMID:25641816

  5. In Vitro Synthesis of Poliovirus Ribonucleic Acid: Role of the Replicative Intermediate

    PubMed Central

    Girard, Marc

    1969-01-01

    Poliovirus ribonucleic acid (RNA) polymerase crude extracts could be stored frozen in liquid nitrogen without loss of activity or specificity. The major in vitro product of these extracts was viral single-stranded RNA. However, after short periods of incubation with radioactive nucleoside triphosphates, most of the incorporated label was found in replicative intermediate. When excess unlabeled nucleoside triphosphate was added, the label was displaced from the replicative intermediate and accumulated as viral RNA. It is concluded from this experiment that the replicative intermediate is the precursor to viral RNA. In addition, some of the label was chased into double-stranded RNA. The implications of this finding are discussed. PMID:4306193

  6. Automated parallel synthesis of 5'-triphosphate oligonucleotides and preparation of chemically modified 5'-triphosphate small interfering RNA.

    PubMed

    Zlatev, Ivan; Lackey, Jeremy G; Zhang, Ligang; Dell, Amy; McRae, Kathy; Shaikh, Sarfraz; Duncan, Richard G; Rajeev, Kallanthottathil G; Manoharan, Muthiah

    2013-02-01

    A fully automated chemical method for the parallel and high-throughput solid-phase synthesis of 5'-triphosphate and 5'-diphosphate oligonucleotides is described. The desired full-length oligonucleotides were first constructed using standard automated DNA/RNA solid-phase synthesis procedures. Then, on the same column and instrument, efficient implementation of an uninterrupted sequential cycle afforded the corresponding unmodified or chemically modified 5'-triphosphates and 5'-diphosphates. The method was readily translated into a scalable and high-throughput synthesis protocol compatible with the current DNA/RNA synthesizers yielding a large variety of unique 5'-polyphosphorylated oligonucleotides. Using this approach, we accomplished the synthesis of chemically modified 5'-triphosphate oligonucleotides that were annealed to form small-interfering RNAs (ppp-siRNAs), a potentially interesting class of novel RNAi therapeutic tools. The attachment of the 5'-triphosphate group to the passenger strand of a siRNA construct did not induce a significant improvement in the in vitro RNAi-mediated gene silencing activity nor a strong specific in vitro RIG-I activation. The reported method will enable the screening of many chemically modified ppp-siRNAs, resulting in a novel bi-functional RNAi therapeutic platform. PMID:23260577

  7. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization.

    PubMed

    Anahtar, Melis N; Bowman, Brittany A; Kwon, Douglas S

    2016-01-01

    There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information. PMID:27168460

  8. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization

    PubMed Central

    Anahtar, Melis N.; Bowman, Brittany A.; Kwon, Douglas S.

    2016-01-01

    There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, includ