Science.gov

Sample records for acid rna synthesis

  1. Mutation of Host Δ9 Fatty Acid Desaturase Inhibits Brome Mosaic Virus RNA Replication between Template Recognition and RNA Synthesis

    PubMed Central

    Lee, Wai-Ming; Ishikawa, Masayuki; Ahlquist, Paul

    2001-01-01

    All positive-strand RNA viruses assemble their RNA replication complexes on intracellular membranes. Brome mosaic virus (BMV) replicates its RNA in endoplasmic reticulum (ER)-associated complexes in plant cells and the yeast Saccharomyces cerevisiae. BMV encodes RNA replication factors 1a, with domains implicated in RNA capping and helicase functions, and 2a, with a central polymerase-like domain. Factor 1a interacts independently with the ER membrane, viral RNA templates, and factor 2a to form RNA replication complexes on the perinuclear ER. We show that BMV RNA replication is severely inhibited by a mutation in OLE1, an essential yeast chromosomal gene encoding Δ9 fatty acid desaturase, an integral ER membrane protein and the first enzyme in unsaturated fatty acid synthesis. OLE1 deletion and medium supplementation show that BMV RNA replication requires unsaturated fatty acids, not the Ole1 protein, and that viral RNA replication is much more sensitive than yeast growth to reduced unsaturated fatty acid levels. In ole1 mutant yeast, 1a still becomes membrane associated, recruits 2a to the membrane, and recognizes and stabilizes viral RNA templates normally. However, RNA replication is blocked prior to initiation of negative-strand RNA synthesis. The results show that viral RNA synthesis is highly sensitive to lipid composition and suggest that proper membrane fluidity or plasticity is essential for an early step in RNA replication. The strong unsaturated fatty acid dependence also demonstrates that modulating fatty acid balance can be an effective antiviral strategy. PMID:11160714

  2. Nonenzymatic synthesis of RNA and DNA oligomers on hexitol nucleic acid templates: the importance of the A structure

    NASA Technical Reports Server (NTRS)

    Kozlov, I. A.; Politis, P. K.; Van Aerschot, A.; Busson, R.; Herdewijn, P.; Orgel, L. E.; Bada, J. L. (Principal Investigator); Dolan, M. (Principal Investigator)

    1999-01-01

    Hexitol nucleic acid (HNA) is an analogue of DNA containing the standard nucleoside bases, but with a phosphorylated 1,5-anhydrohexitol backbone. HNA oligomers form duplexes having the nucleic acid A structure with complementary DNA or RNA oligomers. The HNA decacytidylate oligomer is an efficient template for the oligomerization of the 5'-phosphoroimidazolides of guanosine or deoxyguanosine. Comparison of the oligomerization efficiencies on HNA, RNA, and DNA decacytidylate templates under various conditions suggests strongly that only nucleic acid double helices with the A structure support efficient template-directed synthesis when 5'-phosphoroimidazolides of nucleosides are used as substrates.

  3. The Comparison of Hydrochloric Acid and Phosphoric Acid Treatments in the Preparation of Montmorillonite Catalysts for RNA Synthesis.

    PubMed

    Aldersley, Michael Frank; Joshi, Prakash C; Huang, Yixing

    2017-02-16

    The treatment of clay minerals with a preliminary acid wash and titration to pH 7 has proven to generate catalysts for the most interesting of oligomerization reactions in which activated RNA-nucleotides generate oligomers up to 40-mers. Significantly, not all clay minerals become catalytic following this treatment and none are catalytic in the absence of such treatment. The washing procedure has been modified and explored further using phosphoric acid and the outcomes are compared to those obtained when clay samples are prepared following a hydrochloric acid wash.

  4. The Comparison of Hydrochloric Acid and Phosphoric Acid Treatments in the Preparation of Montmorillonite Catalysts for RNA Synthesis

    NASA Astrophysics Data System (ADS)

    Aldersley, Michael Frank; Joshi, Prakash C.; Huang, Yixing

    2017-02-01

    The treatment of clay minerals with a preliminary acid wash and titration to pH 7 has proven to generate catalysts for the most interesting of oligomerization reactions in which activated RNA-nucleotides generate oligomers up to 40-mers. Significantly, not all clay minerals become catalytic following this treatment and none are catalytic in the absence of such treatment. The washing procedure has been modified and explored further using phosphoric acid and the outcomes are compared to those obtained when clay samples are prepared following a hydrochloric acid wash.

  5. RNA internal standard synthesis by nucleic acid sequence-based amplification for competitive quantitative amplification reactions.

    PubMed

    Lo, Wan-Yu; Baeumner, Antje J

    2007-02-15

    Nucleic acid sequence-based amplification (NASBA) reactions have been demonstrated to successfully synthesize new sequences based on deletion and insertion reactions. Two RNA internal standards were synthesized for use in competitive amplification reactions in which quantitative analysis can be achieved by coamplifying the internal standard with the wild type sample. The sequences were created in two consecutive NASBA reactions using the E. coli clpB mRNA sequence as model analyte. The primer sequences of the wild type sequence were maintained, and a 20-nt-long segment inside the amplicon region was exchanged for a new segment of similar GC content and melting temperature. The new RNA sequence was thus amplifiable using the wild type primers and detectable via a new inserted sequence. In the first reaction, the forwarding primer and an additional 20-nt-long sequence was deleted and replaced by a new 20-nt-long sequence. In the second reaction, a forwarding primer containing as 5' overhang sequence the wild type primer sequence was used. The presence of pure internal standard was verified using electrochemiluminescence and RNA lateral-flow biosensor analysis. Additional sequence deletion in order to shorten the internal standard amplicons and thus generate higher detection signals was found not to be required. Finally, a competitive NASBA reaction between one internal standard and the wild type sequence was carried out proving its functionality. This new rapid construction method via NASBA provides advantages over the traditional techniques since it requires no traditional cloning procedures, no thermocyclers, and can be completed in less than 4 h.

  6. Initiation of RNA synthesis in vitro by vesicular stomatitis virus: single internal initiation in the presence of aurintricarboxylic acid and vanadyl ribonucleoside complexes.

    PubMed Central

    Talib, S; Hearst, J E

    1983-01-01

    In the presence of aurintricarboxylic acid (ATA) and vanadyl ribonucleoside complexes (VRC), we have isolated and characterized a small RNA, product of VSV in vitro transcription. This RNA is capped and lacks poly(A) at its 3'-end. Nucleotide sequence analysis revealed that this RNA corresponds to the 5'-terminal transcription product of the N-gene. The termination of the transcription occurs precisely at the 118th base from the 3'-end of the VSV genome. Analysis of the nucleotide sequence around this region reveals a potential secondary structure. Photoreaction of the VSV with 4'-substituted psoralen fails to inhibit the synthesis of the 68-mer RNA under conditions where full length mRNA synthesis is blocked, indicating that the psoralen binding site is located further into the N-gene. Since this RNA is the only in vitro transcription product synthesized under these conditions, the existence of two types of polymerase activities, one for the synthesis of leader RNA and one for mRNA, is suggested. Images PMID:6314272

  7. Flavivirus RNA Synthesis in vitro

    PubMed Central

    Padmanabhan, Radhakrishnan; Takhampunya, Ratree; Teramoto, Tadahisa; Choi, Kyung H.

    2015-01-01

    Summary Establishment of in vitro systems to study mechanisms of RNA synthesis for positive strand RNA viruses have been very useful in the past and have shed light on the composition of protein and RNA components, optimum conditions, the nature of the products formed, cis-acting RNA elements and trans-acting protein factors required for efficient synthesis. In this review, we summarize our current understanding regarding the requirements for flavivirus RNA synthesis in vitro. We describe details of reaction conditions, the specificity of template used by either the multi-component membrane-bound viral replicase complex or by purified, recombinant RNA-dependent RNA polymerase. We also discuss future perspectives to extend the boundaries of our knowledge. PMID:26272247

  8. Sulfonamide-bridged nucleic acid: synthesis, high RNA selective hybridization, and high nuclease resistance.

    PubMed

    Mitsuoka, Yasunori; Fujimura, Yuko; Waki, Reiko; Kugimiya, Akira; Yamamoto, Tsuyoshi; Hari, Yoshiyuki; Obika, Satoshi

    2014-11-07

    2'-N,4'-C-(N-methylamino)sulfonylmethylene-bridged thymidine (SuNA), which has a six-membered linkage including a sulfonamide moiety, was synthesized and introduced into oligonucleotides. The oligonucleotides containing SuNA exhibited excellent nuclease resistance, a high affinity toward single-stranded RNA, and a low affinity toward single-stranded DNA compared to the natural oligonucleotide.

  9. Effects of S-adenosylmethionine decarboxylase, polyamines, amino acids, and weak bases (amines and ammonia) on development and ribosomal RNA synthesis in Xenopus embryos.

    PubMed

    Shiokawa, Koichiro; Aso, Mai; Kondo, Takeshi; Takai, Jun-Ichi; Yoshida, Junki; Mishina, Takamichi; Fuchimukai, Kota; Ogasawara, Tsukasa; Kariya, Taro; Tashiro, Kosuke; Igarashi, Kazuei

    2010-02-01

    We have been studying control mechanisms of gene expression in early embryogenesis in a South African clawed toad Xenopus laevis, especially during the period of midblastula transition (MBT), or the transition from the phase of active cell division (cleavage stage) to the phase of extensive morphogenesis (post-blastular stages). We first found that ribosomal RNA synthesis is initiated shortly after MBT in Xenopus embryos and those weak bases, such as amines and ammonium ion, selectively inhibit the initiation and subsequent activation of rRNA synthesis. We then found that rapidly labeled heterogeneous mRNA-like RNA is synthesized in embryos at pre-MBT stage. We then performed cloning and expression studies of several genes, such as those for activin receptors, follistatin and aldolases, and then reached the studies of S-adenosylmethionine decarboxylase (SAMDC), a key enzyme in polyamine metabolism. Here, we cloned a Xenopus SAMDC cDNA and performed experiments to overexpress the in vitro-synthesized SAMDC mRNA in Xenopus early embryos, and found that the maternally preset program of apoptosis occurs in cleavage stage embryos, which is executed when embryos reach the stage of MBT. In the present article, we first summarize results on SAMDC and the maternal program of apoptosis, and then describe our studies on small-molecular-weight substances like polyamines, amino acids, and amines in Xenopus embryos. Finally, we summarize our studies on weak bases, especially on ammonium ion, as the specific inhibitor of ribosomal RNA synthesis in Xenopus embryonic cells.

  10. Catalysis and prebiotic RNA synthesis

    NASA Technical Reports Server (NTRS)

    Ferris, James P.

    1993-01-01

    The essential role of catalysis for the origins of life is discussed. The status of the prebiotic synthesis of 2',5'- and 3'5'-linked oligomers of RNA is reviewed. Examples of the role of metal ion and mineral catalysis in RNA oligomer formation are discussed.

  11. Tagetitoxin inhibits chloroplast RNA synthesis

    SciTech Connect

    Mathews, D.E.; Durbin, R.D.

    1987-04-01

    Tagetitoxin is a non-host specific phytotoxin which inhibits chloroplast development. Chloroplast encoded gene products as well as their transcripts are conspicuously depleted in toxin-treated tissue. Intact chloroplasts from 8-9 day old peas were incubated for 60 min. in the presence of tagetitoxin. This treatment reduced RNA synthesis but did not affect protein synthesis as measured by the incorporation of radiolabeled uridine or methionine, respectively. Tagetitoxin also inhibited chloroplast RNA synthesis in vitro. Total UTP incorporation was reduced 50% by 0.5..mu..M tagetitoxin in transcriptionally active chloroplast extracts containing 5mg/ml protein. In vitro transcription with purified E. coli RNA polymerase was also inhibited by tagetitoxin, yet wheat germ RNA polymerase II and several bacteriophage RNA polymerase enzymes were unaffected. Recent evidence suggests that RNA polymerase from chloroplasts and prokaryotes may share extensive homology. In light of this evidence and the authors own data, they propose that tagetitoxin directly inhibits chloroplast RNA polymerase.

  12. An Unconventional Acid-Labile Nucleobase Protection Concept for Guanosine Phosphoramidites in RNA Solid-Phase Synthesis.

    PubMed

    Jud, Lukas; Micura, Ronald

    2017-03-08

    We present an innovative O(6) -tert-butyl/N(2) -tert-butyloxycarbonyl protection concept for guanosine (G) phosphoramidites. This concept is advantageous for 2'-modified G building blocks because of very efficient synthetic access when compared with existing routes that usually employ O(6) -(4-nitrophenyl)ethyl/N(2) -acyl protection or that start from 2-aminoadenosine involving enzymatic transformation into guanosine later on in the synthetic path. The new phosphoramidites are fully compatible with 2'-O-tBDMS or TOM phosphoramidites in standard RNA solid-phase synthesis and deprotection, and provide excellent quality of tailored RNAs for the growing range of applications in RNA biophysics, biochemistry, and biology.

  13. Synthesis of RNA oligomers on heterogeneous templates

    NASA Technical Reports Server (NTRS)

    Ertem, G.; Ferris, J. P.

    1996-01-01

    The concept of an RNA world in the chemical origin of life is appealing, as nucleic acids are capable of both information storage and acting as templates that catalyse the synthesis of complementary molecules. Template-directed synthesis has been demonstrated for homogeneous oligonucleotides that, like natural nucleic acids, have 3',5' linkages between the nucleotide monomers. But it seems likely that prebiotic routes to RNA-like molecules would have produced heterogeneous molecules with various kinds of phosphodiester linkages and both linear and cyclic nucleotide chains. Here we show that such heterogeneity need be no obstacle to the templating of complementary molecules. Specifically, we show that heterogeneous oligocytidylates, formed by the montmorillonite clay-catalysed condensation of actuated monomers, can serve as templates for the synthesis of oligoguanylates. Furthermore, we show that oligocytidylates that are exclusively 2',5'-linked can also direct synthesis of oligoguanylates. Such heterogeneous templating reactions could have increased the diversity of the pool of protonucleic acids from which life ultimately emerged.

  14. Synthesis and Antisense Properties of Fluoro Cyclohexenyl Nucleic Acid (F-CeNA) – A Nuclease Stable Mimic of 2′-Fluoro RNA

    PubMed Central

    Seth, Punit P.; Yu, Jinghua; Jazayeri, Ali; Pallan, Pradeep S.; Allerson, Charles R; Østergaard, Michael E.; Liu, Fengwu; Herdewijn, Piet; Egli, Martin; Swayze, Eric E.

    2013-01-01

    We report the design and synthesis of 2′-fluoro cyclohexenyl nucleic acid (F-CeNA) pyrimidine phosphoramidites and the synthesis and biophysical, structural, and biological evaluation of modified oligonucleotides. The synthesis of the nucleoside phosphoramidites was accomplished in multigram quantities starting from commercially available methyl-D-mannose pyranoside. Installation of the fluorine atom was accomplished using nonafluorobutanesulfonyl fluoride, and the cyclohexenyl ring system was assembled by means of a palladium-catalyzed Ferrier rearrangement. Installation of the nucleobase was carried out under Mitsunobu conditions followed by standard protecting group manipulations to provide the desired pyrimidine phosphoramidites. Biophysical evaluation indicated that F-CeNA shows behavior similar to that of a 2′-modified nucleotide, and duplexes with RNA showed slightly lower duplex thermostability as compared to that of the more rigid 3′-fluoro hexitol nucleic acid (FHNA). However, F-CeNA modified oligonucleotides were significantly more stable against digestion by snake venom phosphodiesterases (SVPD) as compared to unmodified DNA, 2′-fluoro RNA (FRNA), 2′-methoxyethyl RNA (MOE), and FHNA modified oligonucleotides. Examination of crystal structures of a modified DNA heptamer duplex d(GCG)-T*-d(GCG):d(CGCACGC) by X-ray crystallography indicated that the cyclohexenyl ring system exhibits both the 3H2 and 2H3 conformations, similar to the C3′-endo/C2′-endo conformation equilibrium seen in natural furanose nucleosides. In the 2H3 conformation, the equatorial fluorine engages in a relatively close contact with C8 (2.94 Å) of the 3′-adjacent dG nucleotide that may represent a pseudo hydrogen bond. In contrast, the cyclohexenyl ring of F-CeNA was found to exist exclusively in the 3H2 (C3′-endo like) conformation in the crystal structure of the modified A-form DNA decamer duplex [d(GCGTA)-T*-d(ACGC)]2. In an animal experiment, a 16-mer F

  15. Synthesis of amino acids

    DOEpatents

    Davis, J.W. Jr.

    1979-09-21

    A method is described for synthesizing amino acids preceding through novel intermediates of the formulas: R/sub 1/R/sub 2/C(OSOC1)CN, R/sub 1/R/sub 2/C(C1)CN and (R/sub 1/R/sub 2/C(CN)O)/sub 2/SO wherein R/sub 1/ and R/sub 2/ are each selected from hydrogen and monovalent hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  16. SYNTHESIS OF RIBONUCLEIC ACID BY X-IRRADIATED BACTERIA1

    PubMed Central

    Frampton, E. W.

    1964-01-01

    Frampton, E. W. (The University of Texas M. D. Anderson Hospital and Tumor Institute, Houston). Synthesis of ribonucleic acid by X-irradiated bacteria. J. Bacteriol. 87:1369–1376. 1964.—Postirradiation synthesis of total ribonucleic acid (RNA) and of RNA components was measured after exposure of Escherichia coli B/r to X rays. Net synthesis of RNA measured by the orcinol reaction and by the incorporation of uridine-2-C14 was depressed in irradiated cells, but paralleled the period of postirradiation growth (30 to 40 min). Incorporation of uridine-2-C14, added after net synthesis of RNA had ceased, detected an apparent turnover in a portion of the RNA. Irradiated cells retained their ability to adjust RNA synthesis to growth rate. After a shift-down in growth rate, irradiated cells incorporated radioactive uridine, while the net synthesis of RNA ceased—presumptive evidence for a continued synthesis of messenger RNA. Chloramphenicol addition (100 μg/ml) did not influence the total amount of RNA synthesized. Synthesis of ribosomes and transfer RNA preceded by 0, 5, 10, and 15 min of postirradiation incubation was observed by the resolution of cell-free extracts on sucrose density gradients. Little immediate influence of irradiation could be detected on the synthesis of 50S and 30S ribosomes. A decline was observed in the synthesis of 50S ribosomes with continued postirradiation incubation; 30S ribosomes, ribosomal precursors, and 4S RNA continued to be synthesized. PMID:14188715

  17. RNA.

    ERIC Educational Resources Information Center

    Darnell, James E., Jr.

    1985-01-01

    Ribonucleic acid (RNA) converts genetic information into protein and usually must be processed to serve its function. RNA types, chemical structure, protein synthesis, translation, manufacture, and processing are discussed. Concludes that the first genes might have been spliced RNA and that humans might be closer than bacteria to primitive…

  18. Synthesis, Improved Antisense Activity and Structural Rationale for the Divergent RNA Affinities of 3′-Fluoro Hexitol Nucleic Acid (FHNA and Ara-FHNA) Modified Oligonucleotides

    PubMed Central

    Egli, Martin; Pallan, Pradeep S.; Allerson, Charles R.; Prakash, Thazha P.; Berdeja, Andres; Yu, Jinghua; Lee, Sam; Watt, Andrew; Gaus, Hans; Bhat, Balkrishen; Swayze, Eric E.; Seth, Punit P.

    2011-01-01

    The synthesis, biophysical, structural and biological properties of both isomers of 3′-fluoro hexitol nucleic acid (FHNA and Ara-FHNA) modified oligonucleotides are reported. Synthesis of the FHNA and Ara-FHNA thymine phosphoramidites was efficiently accomplished starting from known sugar precursors. Optimal RNA affinities were observed with 3′-fluorine atom and nucleobase in a trans-diaxial orientation. The Ara-FHNA analog with an equatorial fluorine was found to be destabilizing. However, the magnitude of destabilization was sequence-dependent. Thus, the loss of stability is sharply reduced when Ara-FHNA residues were inserted at pyrimidine-purine (Py-Pu) steps compared to placement within a stretch of pyrimidines (Py-Py). Crystal structures of A-type DNA duplexes modified with either monomer, provide a rationalization for the opposing stability effects and point to a steric origin of the destabilization caused by the Ara-FHNA analog. The sequence dependent effect can be explained by the formation of an inter-nucleotide C-F…H-C pseudo hydrogen bond between F3′ of Ara-FHNA and C8-H of the nucleobase from the 3′-adjacent adenosine that is absent at Py-Py steps. In animal experiments, FHNA-modified antisense oligonucleotides formulated in saline showed potent downregulation of gene expression in liver tissue without producing hepatotoxicity. Our data establish FHNA as a useful modification for antisense therapeutics and also confirm the stabilizing influence of F(Py)…H-C(Pu) pseudo hydrogen bonds in nucleic acid structures. PMID:21919455

  19. Synthesis, Improved Antisense Activity and Structural Rationale for the Divergent RNA Affinities of 3;#8242;-Fluoro Hexitol Nucleic Acid (FHNA and Ara-FHNA) Modified Oligonucleotides

    SciTech Connect

    Egli, Martin; Pallan, Pradeep S.; Allerson, Charles R.; Prakash, Thazha P.; Berdeja, Andres; Yu, Jinghua; Lee, Sam; Watt, Andrew; Gaus, Hans; Bhat, Balkrishen; Swayze, Eric E.; Seth, Punit P.

    2012-03-16

    The synthesis, biophysical, structural, and biological properties of both isomers of 3'-fluoro hexitol nucleic acid (FHNA and Ara-FHNA) modified oligonucleotides are reported. Synthesis of the FHNA and Ara-FHNA thymine phosphoramidites was efficiently accomplished starting from known sugar precursors. Optimal RNA affinities were observed with a 3'-fluorine atom and nucleobase in a trans-diaxial orientation. The Ara-FHNA analog with an equatorial fluorine was found to be destabilizing. However, the magnitude of destabilization was sequence-dependent. Thus, the loss of stability is sharply reduced when Ara-FHNA residues were inserted at pyrimidine-purine (Py-Pu) steps compared to placement within a stretch of pyrimidines (Py-Py). Crystal structures of A-type DNA duplexes modified with either monomer provide a rationalization for the opposing stability effects and point to a steric origin of the destabilization caused by the Ara-FHNA analog. The sequence dependent effect can be explained by the formation of an internucleotide C-F {hor_ellipsis} H-C pseudo hydrogen bond between F3' of Ara-FHNA and C8-H of the nucleobase from the 3'-adjacent adenosine that is absent at Py-Py steps. In animal experiments, FHNA-modified antisense oligonucleotides formulated in saline showed a potent downregulation of gene expression in liver tissue without producing hepatotoxicity. Our data establish FHNA as a useful modification for antisense therapeutics and also confirm the stabilizing influence of F(Py) {hor_ellipsis} H-C(Pu) pseudo hydrogen bonds in nucleic acid structures.

  20. De Novo Initiation of RNA Synthesis by the RNA-Dependent RNA Polymerase (NS5B) of Hepatitis C Virus

    PubMed Central

    Luo, Guangxiang; Hamatake, Robert K.; Mathis, Danielle M.; Racela, Jason; Rigat, Karen L.; Lemm, Julie; Colonno, Richard J.

    2000-01-01

    Hepatitis C virus (HCV) NS5B protein possesses an RNA-dependent RNA polymerase (RdRp) activity, a major function responsible for replication of the viral RNA genome. To further characterize the RdRp activity, NS5B proteins were expressed from recombinant baculoviruses, purified to near homogeneity, and examined for their ability to synthesize RNA in vitro. As a result, a highly active NS5B RdRp (1b-42), which contains an 18-amino acid C-terminal truncation resulting from a newly created stop codon, was identified among a number of independent isolates. The RdRp activity of the truncated NS5B is comparable to the activity of the full-length protein and is 20 times higher in the presence of Mn2+ than in the presence of Mg2+. When a 384-nucleotide RNA was used as the template, two major RNA products were synthesized by 1b-42. One is a complementary RNA identical in size to the input RNA template (monomer), while the other is a hairpin dimer RNA synthesized by a “copy-back” mechanism. Substantial evidence derived from several experiments demonstrated that the RNA monomer was synthesized through de novo initiation by NS5B rather than by a terminal transferase activity. Synthesis of the RNA monomer requires all four ribonucleotides. The RNA monomer product was verified to be the result of de novo RNA synthesis, as two expected RNA products were generated from monomer RNA by RNase H digestion. In addition, modification of the RNA template by the addition of the chain terminator cordycepin at the 3′ end did not affect synthesis of the RNA monomer but eliminated synthesis of the self-priming hairpin dimer RNA. Moreover, synthesis of RNA on poly(C) and poly(U) homopolymer templates by 1b-42 NS5B did not require the oligonucleotide primer at high concentrations (≥50 μM) of GTP and ATP, further supporting a de novo initiation mechanism. These findings suggest that HCV NS5B is able to initiate RNA synthesis de novo. PMID:10623748

  1. Continuous and Discontinuous RNA Synthesis in Coronaviruses.

    PubMed

    Sola, Isabel; Almazán, Fernando; Zúñiga, Sonia; Enjuanes, Luis

    2015-11-01

    Replication of the coronavirus genome requires continuous RNA synthesis, whereas transcription is a discontinuous process unique among RNA viruses. Transcription includes a template switch during the synthesis of subgenomic negative-strand RNAs to add a copy of the leader sequence. Coronavirus transcription is regulated by multiple factors, including the extent of base-pairing between transcription-regulating sequences of positive and negative polarity, viral and cell protein-RNA binding, and high-order RNA-RNA interactions. Coronavirus RNA synthesis is performed by a replication-transcription complex that includes viral and cell proteins that recognize cis-acting RNA elements mainly located in the highly structured 5' and 3' untranslated regions. In addition to many viral nonstructural proteins, the presence of cell nuclear proteins and the viral nucleocapsid protein increases virus amplification efficacy. Coronavirus RNA synthesis is connected with the formation of double-membrane vesicles and convoluted membranes. Coronaviruses encode proofreading machinery, unique in the RNA virus world, to ensure the maintenance of their large genome size.

  2. Activity and mRNA Levels of Enzymes Involved in Hepatic Fatty Acid Synthesis in Rats Fed Naringenin.

    PubMed

    Hashimoto, Toru; Ide, Takashi

    2015-11-04

    We investigated the physiological activity of naringenin in affecting hepatic lipogenesis and serum and liver lipid levels in rats. Rats were fed diets containing 0, 1, or 2.5 g/kg naringenin for 15 d. Naringenin at a dietary level of 2.5 g/kg significantly decreased the activities and the mRNA levels of various lipogenic enzymes and sterol regulatory element binding protein-1c (SREBP-1c) mRNA level. The activities and the mRNA levels were also 9-22% and 12-38% lower, respectively, in rats fed a 1 g/kg naringenin diet than in the animals fed a naringenin-free diet, although the differences were not significant in many cases. Naringenin at 2.5 g/kg significantly lowered serum triacylglycerol, cholesterol, and phospholipid and hepatic triacylglycerol and cholesterol. This flavonoid at 1.0 g/kg also significantly lowered these parameters except for serum triacylglycerol. Naringenin levels in serum and liver dose-dependently increased, and hepatic concentrations reached levels that can affect various signaling pathways.

  3. Wheat germ extract decreases glucose uptake and RNA ribose formation but increases fatty acid synthesis in MIA pancreatic adenocarcinoma cells.

    PubMed

    Boros, L G; Lapis, K; Szende, B; Tömösközi-Farkas, R; Balogh, A; Boren, J; Marin, S; Cascante, M; Hidvégi, M

    2001-08-01

    The fermented wheat germ extract with standardized benzoquinone composition has potent tumor propagation inhibitory properties. The authors show that this extract induces profound metabolic changes in cultured MIA pancreatic adenocarcinoma cells when the [1,2-13C2]glucose isotope is used as the single tracer with biologic gas chromatography-mass spectrometry. MIA cells treated with 0.1, 1, and 10 mg/mL wheat germ extract showed a dose-dependent decrease in cell glucose consumption. uptake of isotope into ribosomal RNA (2.4%, 9.4%, and 28.0%), and release of 13CO2. Conversely, direct glucose oxidation and ribose recycling in the pentose cycle showed a dose-dependent increase of 1.2%, 20.7%, and 93.4%. The newly synthesized fraction of cell palmitate and the 13C enrichment of acetyl units were also significantly increased with all doses of wheat germ extract. The fermented wheat germ extract controls tumor propagation primarily by regulating glucose carbon redistribution between cell proliferation-related and cell differentiation-related macromolecules. Wheat germ extract treatment is likely associated with the phosphorylation and transcriptional regulation of metabolic enzymes that are involved in glucose carbon redistribution between cell proliferation-related structural and functional macromolecules (RNA, DNA) and the direct oxidative degradation of glucose, which have devastating consequences for the proliferation and survival of pancreatic adenocarcinoma cells in culture.

  4. Prebiotic RNA Synthesis by Montmorillonite Catalysis

    NASA Astrophysics Data System (ADS)

    Jheeta, Sohan; Joshi, Prakash C.

    2014-08-01

    This review summarizes our recent findings on the role of mineral salts in prebiotic RNA synthesis, which is catalyzed by montmorillonite clay minerals. The clay minerals not only catalyze the synthesis of RNA but also facilitate homochiral selection. Preliminary data of these findings have been presented at the "Horizontal Gene Transfer and the Last Universal Common Ancestor (LUCA)" conference at the Open University, Milton Keynes, UK, 5-6 September 2013. The objective of this meeting was to recognize the significance of RNA in LUCA. We believe that the prebiotic RNA synthesis from its monomers must have been a simple process. As a first step, it may have required activation of the 5'-end of the mononucleotide with a leaving group, e.g., imidazole in our model reaction (Figure 1). Wide ranges of activating groups are produced from HCN under plausible prebiotic Earth conditions. The final step is clay mineral catalysis in the presence of mineral salts to facilitate selective production of functional RNA. Both the clay minerals and mineral salts would have been abundant on early Earth. We have demonstrated that while montmorillonite (pH 7) produced only dimers from its monomers in water, addition of sodium chloride (1 M) enhanced the chain length multifold, as detected by HPLC. The effect of monovalent cations on RNA synthesis was of the following order: Li+ > Na+ > K+. A similar effect was observed with the anions, enhancing catalysis in the following order: Cl- > Br- > I-. The montmorillonite-catalyzed RNA synthesis was not affected by hydrophobic or hydrophilic interactions. We thus show that prebiotic synthesis of RNA from its monomers was a simple process requiring only clay minerals and a small amount of salt.

  5. Prebiotic RNA Synthesis by Montmorillonite Catalysis

    PubMed Central

    Jheeta, Sohan; Joshi, Prakash C.

    2014-01-01

    This review summarizes our recent findings on the role of mineral salts in prebiotic RNA synthesis, which is catalyzed by montmorillonite clay minerals. The clay minerals not only catalyze the synthesis of RNA but also facilitate homochiral selection. Preliminary data of these findings have been presented at the “Horizontal Gene Transfer and the Last Universal Common Ancestor (LUCA)” conference at the Open University, Milton Keynes, UK, 5–6 September 2013. The objective of this meeting was to recognize the significance of RNA in LUCA. We believe that the prebiotic RNA synthesis from its monomers must have been a simple process. As a first step, it may have required activation of the 5'-end of the mononucleotide with a leaving group, e.g., imidazole in our model reaction (Figure 1). Wide ranges of activating groups are produced from HCN under plausible prebiotic Earth conditions. The final step is clay mineral catalysis in the presence of mineral salts to facilitate selective production of functional RNA. Both the clay minerals and mineral salts would have been abundant on early Earth. We have demonstrated that while montmorillonite (pH 7) produced only dimers from its monomers in water, addition of sodium chloride (1 M) enhanced the chain length multifold, as detected by HPLC. The effect of monovalent cations on RNA synthesis was of the following order: Li+ > Na+ > K+. A similar effect was observed with the anions, enhancing catalysis in the following order: Cl− > Br− > I−. The montmorillonite-catalyzed RNA synthesis was not affected by hydrophobic or hydrophilic interactions. We thus show that prebiotic synthesis of RNA from its monomers was a simple process requiring only clay minerals and a small amount of salt. PMID:25370375

  6. Poliovirus RNA synthesis in vitro: structural elements and antibody inhibition

    SciTech Connect

    Semler, B.L.; Hanecak, R.; Dorner, L.F.; Anderson, C.W.; Wimmer, E.

    1983-01-01

    The poliovirus RNA polymerase complex has been analyzed by immunoautoradiography using antibody probes derived from purified replicase (P3) region viral polypeptides. Antibody preparations made against the polio RNA polymerase, P3-4b, detected a previously unreported cellular protein that copurifies with the RNA polymerase. An IgG fraction purified from rabbit antiserum to polypeptide P3-2, a precursor fo the RNA polymerase, specifically inhibits poliovirus RNA synthesis in vitro. The authors have also immunoprecipitated a 60,000-dalton protein (P3-4a) with antiserum to protein P3-4b and have determined the precise genomic map position of this protein by automated Edman degradation. Protein P3-4a originates by cleavage of the RNA polymerase precursor at a glutamine-glucine amino acid pair not previously reported to be a viral cleavage site.

  7. The RNA synthesis machinery of negative-stranded RNA viruses

    SciTech Connect

    Ortín, Juan; Martín-Benito, Jaime

    2015-05-15

    The group of Negative-Stranded RNA Viruses (NSVs) includes many human pathogens, like the influenza, measles, mumps, respiratory syncytial or Ebola viruses, which produce frequent epidemics of disease and occasional, high mortality outbreaks by transmission from animal reservoirs. The genome of NSVs consists of one to several single-stranded, negative-polarity RNA molecules that are always assembled into mega Dalton-sized complexes by association to many nucleoprotein monomers. These RNA-protein complexes or ribonucleoproteins function as templates for transcription and replication by action of the viral RNA polymerase and accessory proteins. Here we review our knowledge on these large RNA-synthesis machines, including the structure of their components, the interactions among them and their enzymatic activities, and we discuss models showing how they perform the virus transcription and replication programmes. - Highlights: • Overall organisation of NSV RNA synthesis machines. • Structure and function of the ribonucleoprotein components: Atomic structure of the RNA polymerase complex. • Commonalities and differences between segmented- and non-segmented NSVs. • Transcription versus replication programmes.

  8. How Amino Acids and Peptides Shaped the RNA World

    PubMed Central

    van der Gulik, Peter T.S.; Speijer, Dave

    2015-01-01

    The “RNA world” hypothesis is seen as one of the main contenders for a viable theory on the origin of life. Relatively small RNAs have catalytic power, RNA is everywhere in present-day life, the ribosome is seen as a ribozyme, and rRNA and tRNA are crucial for modern protein synthesis. However, this view is incomplete at best. The modern protein-RNA ribosome most probably is not a distorted form of a “pure RNA ribosome” evolution started out with. Though the oldest center of the ribosome seems “RNA only”, we cannot conclude from this that it ever functioned in an environment without amino acids and/or peptides. Very small RNAs (versatile and stable due to basepairing) and amino acids, as well as dipeptides, coevolved. Remember, it is the amino group of aminoacylated tRNA that attacks peptidyl-tRNA, destroying the bond between peptide and tRNA. This activity of the amino acid part of aminoacyl-tRNA illustrates the centrality of amino acids in life. With the rise of the “RNA world” view of early life, the pendulum seems to have swung too much towards the ribozymatic part of early biochemistry. The necessary presence and activity of amino acids and peptides is in need of highlighting. In this article, we try to bring the role of the peptide component of early life back into focus. We argue that an RNA world completely independent of amino acids never existed. PMID:25607813

  9. Efficient in vitro synthesis of biologically active RNA and RNA hybridization probes from plasmids containing a bacteriophage SP6 promoter.

    PubMed

    Melton, D A; Krieg, P A; Rebagliati, M R; Maniatis, T; Zinn, K; Green, M R

    1984-09-25

    A simple and efficient method for synthesizing pure single stranded RNAs of virtually any structure is described. This in vitro transcription system is based on the unusually specific RNA synthesis by bacteriophage SP6 RNA polymerase which initiates transcription exclusively at an SP6 promoter. We have constructed convenient cloning vectors that contain an SP6 promoter immediately upstream from a polylinker sequence. Using these SP6 vectors, optimal conditions have been established for in vitro RNA synthesis. The advantages and uses of SP6 derived RNAs as probes for nucleic acid blot and solution hybridizations are demonstrated. We show that single stranded RNA probes of a high specific activity are easy to prepare and can significantly increase the sensitivity of nucleic acid hybridization methods. Furthermore, the SP6 transcription system can be used to prepare RNA substrates for studies on RNA processing (1,5,9) and translation (see accompanying paper).

  10. Borinic acid catalysed peptide synthesis.

    PubMed

    El Dine, Tharwat Mohy; Rouden, Jacques; Blanchet, Jérôme

    2015-11-18

    The catalytic synthesis of peptides is a major challenge in the modern organic chemistry hindered by the well-established use of stoichiometric coupling reagents. Herein, we describe for the first time that borinic acid is able to catalyse this reaction under mild conditions with an improved activity compared to our recently developed thiophene-based boronic acid. This catalyst is particularly efficient for peptide bond synthesis affording dipeptides in good yields without detectable racemization.

  11. Bile acids: regulation of synthesis.

    PubMed

    Chiang, John Y L

    2009-10-01

    Bile acids are physiological detergents that generate bile flow and facilitate intestinal absorption and transport of lipids, nutrients, and vitamins. Bile acids also are signaling molecules and inflammatory agents that rapidly activate nuclear receptors and cell signaling pathways that regulate lipid, glucose, and energy metabolism. The enterohepatic circulation of bile acids exerts important physiological functions not only in feedback inhibition of bile acid synthesis but also in control of whole-body lipid homeostasis. In the liver, bile acids activate a nuclear receptor, farnesoid X receptor (FXR), that induces an atypical nuclear receptor small heterodimer partner, which subsequently inhibits nuclear receptors, liver-related homolog-1, and hepatocyte nuclear factor 4alpha and results in inhibiting transcription of the critical regulatory gene in bile acid synthesis, cholesterol 7alpha-hydroxylase (CYP7A1). In the intestine, FXR induces an intestinal hormone, fibroblast growth factor 15 (FGF15; or FGF19 in human), which activates hepatic FGF receptor 4 (FGFR4) signaling to inhibit bile acid synthesis. However, the mechanism by which FXR/FGF19/FGFR4 signaling inhibits CYP7A1 remains unknown. Bile acids are able to induce FGF19 in human hepatocytes, and the FGF19 autocrine pathway may exist in the human livers. Bile acids and bile acid receptors are therapeutic targets for development of drugs for treatment of cholestatic liver diseases, fatty liver diseases, diabetes, obesity, and metabolic syndrome.

  12. Investigation of the Prebiotic Synthesis of Amino Acids and RNA Bases from CO2 using FeS/H2S as a Reducing Agent

    NASA Technical Reports Server (NTRS)

    Keefe, Anthony D.; Miller, Stanley L.; McDonald, Gene; Bada, Jeffrey

    1995-01-01

    An autotrophic theory of the origin of metabolism and life has been proposed in which carbon dioxide is reduced by ferrous sulfide and hydrogen sulfide by means of a reversed citric acid cycle, leading to the production of amino acids. Similar processes have been proposed for purine synthesis. Ferrous sulfide is a strong reducing agent in the presence of hydrogen sulfide and can produce hydrogen as well as reduce alkenes, alkynes, and thiols to saturated hydrocarbons and reduce ketones to thiols. However, the reduction of carbon dioxide has not been demonstrated. We show here that no amino acids, purines, or pyrimidines are produced from carbon dioxide with the ferrous sulfide and hydrogen sulfide system. Furthermore, this system does not produce amino acids from carboxylic acids by reductive amination and carboxylation. Thus, the proposed autotrophic theory, using carbon dioxide, ferrous sulfide, and hydrogen sulfide, lacks the robustness needed to be a geological process and is, therefore, unlikely to have played a role in the origin of metabolism or the origin of life.

  13. Investigation of the Prebiotic Synthesis of Amino Acids and RNA Bases from CO2 Using FeS/H2S As a Reducing Agent

    NASA Technical Reports Server (NTRS)

    Keefe, Anthony D.; Miller, Stanley L.; McDonald, Gene; Bada, Jeffrey

    1995-01-01

    An autotrophic theory of the origin of metabolism and life has been proposed in which carbon dioxide is reduced by ferrous sulfide and hydrogen sulfide by means of a reversed citric acid cycle, leading to the production of amino acids. Similar processes have been proposed for purine synthesis. Ferrous sulfide is a strong reducing agent in the presence of hydrogen sulfide and can produce hydrogen as well as reduce alkenes, alkynes, and thiols to saturated hydrocarbons and reduce ketones to thiols. However, the reduction of carbon dioxide has not been demonstrated. We show here that no amino acids, purities, or pyrimidines are produced from carbon dioxide with the ferrous sulfide and hydrogen sulfide system. Furthermore, this system does not produce amino acids from carboxylic acids by reductive amination and carboxylation. Thus, the proposed autotrophic theory, using carbon dioxide, ferrous sulfide, and hydrogen sulfide, lacks the robustness needed to be a geological process and is, therefore, unlikely to have played a role In the origin of metabolism or the origin of life.

  14. Induction of collagen synthesis by ascorbic acid. A possible mechanism.

    PubMed

    Pinnel, S R; Murad, S; Darr, D

    1987-12-01

    L-Ascorbic acid stimulates procollagen synthesis in cultured human skin fibroblasts without appreciably altering noncollagen protein synthesis. The effect is unrelated to intracellular degradation of newly synthesized procollagen. Levels of mRNA for pro alpha 1(I), pro alpha 2(I), and pro alpha 1(III), measured by hybridization with the corresponding cDNA probes, are elevated in the presence of ascorbic acid, whereas the level of mRNA for fibronectin is unchanged. Levels of functional mRNA for procollagen, measured in a cell-free translation assay, are specifically increased in the presence of ascorbic acid. Thus, ascorbic acid appears to control the expression of three different procollagen genes, each of which is located on a separate chromosome. It is proposed that intracellularly accumulated procollagen in ascorbate deficiency may lead to a translational repression of procollagen synthesis. Ascorbic acid may relieve this block by promoting hydroxyproline formation and, consequently, secretion of procollagen from the cell. The increased level of procollagen mRNA under the influence of ascorbic acid may be secondary to increased synthesis of procollagen polypeptides; the control point may be gene transcription or mRNA degradation.

  15. Semisynthetic tRNA complement mediates in vitro protein synthesis.

    PubMed

    Cui, Zhenling; Stein, Viktor; Tnimov, Zakir; Mureev, Sergey; Alexandrov, Kirill

    2015-04-08

    Genetic code expansion is a key objective of synthetic biology and protein engineering. Most efforts in this direction are focused on reassigning termination or decoding quadruplet codons. While the redundancy of genetic code provides a large number of potentially reassignable codons, their utility is diminished by the inevitable interaction with cognate aminoacyl-tRNAs. To address this problem, we sought to establish an in vitro protein synthesis system with a simplified synthetic tRNA complement, thereby orthogonalizing some of the sense codons. This quantitative in vitro peptide synthesis assay allowed us to analyze the ability of synthetic tRNAs to decode all of 61 sense codons. We observed that, with the exception of isoacceptors for Asn, Glu, and Ile, the majority of 48 synthetic Escherichia coli tRNAs could support protein translation in the cell-free system. We purified to homogeneity functional Asn, Glu, and Ile tRNAs from the native E. coli tRNA mixture, and by combining them with synthetic tRNAs, we formulated a semisynthetic tRNA complement for all 20 amino acids. We further demonstrated that this tRNA complement could restore the protein translation activity of tRNA-depleted E. coli lysate to a level comparable to that of total native tRNA. To confirm that the developed system could efficiently synthesize long polypeptides, we expressed three different sequences coding for superfolder GFP. This novel semisynthetic translation system is a powerful tool for tRNA engineering and potentially enables the reassignment of at least 9 sense codons coding for Ser, Arg, Leu, Pro, Thr, and Gly.

  16. Ribonucleic acid synthesis in yeast. The effect of cycloheximide on the synthesis of ribonucleic acid in Saccharomyces carlsbergensis

    PubMed Central

    de Kloet, S. R.

    1966-01-01

    1. Cycloheximide causes the release of the control amino acids have over RNA synthesis in Saccharomyces carlsbergensis N.C.T.C. 74. 2. The antibiotic causes a gradual deceleration of RNA formation. After incubation for 60min. at 30° RNA synthesis usually proceeds at a rate only a few per cent of that of the untreated control. 3. In the presence of cycloheximide two types of RNA accumulate in the cell: soluble RNA and a high-molecular-weight RNA. The latter has a base composition intermediate between those of yeast DNA and yeast ribosomal RNA, and sediments in a sucrose gradient at a rate faster than that of the 23s ribosomal RNA component. 4. Yeast ribosomal RNA contains methylated bases. Judged from the incorporation of [Me-14C]methionine, the extent of methylation of ribosomal RNA is about 20% of that of the `soluble' RNA fraction. The high-molecular-weight RNA formed in the presence of cycloheximide is less methylated than normal RNA. In this case the sucrose-density-gradient sedimentation patterns of newly methylated and newly synthesized RNA do not coincide. 5. In the presence of cycloheximide, polysomal material accumulates, indicating that messenger RNA is formed. 6. The effect of the antibiotic on protein and RNA synthesis can be abolished by washing of the cells. The RNA that has accumulated during incubation of the cells with the antibiotic is not stable on removal of cycloheximide. 7. The results presented in this study are discussed in relation to the regulation of RNA formation in yeast. PMID:5964958

  17. Translating Ribosomes Inhibit Poliovirus Negative-Strand RNA Synthesis

    PubMed Central

    Barton, David J.; Morasco, B. Joan; Flanegan, James B.

    1999-01-01

    Poliovirus has a single-stranded RNA genome of positive polarity that serves two essential functions at the start of the viral replication cycle in infected cells. First, it is translated to synthesize viral proteins and, second, it is copied by the viral polymerase to synthesize negative-strand RNA. We investigated these two reactions by using HeLa S10 in vitro translation-RNA replication reactions. Preinitiation RNA replication complexes were isolated from these reactions and then used to measure the sequential synthesis of negative- and positive-strand RNAs in the presence of different protein synthesis inhibitors. Puromycin was found to stimulate RNA replication overall. In contrast, RNA replication was inhibited by diphtheria toxin, cycloheximide, anisomycin, and ricin A chain. Dose-response experiments showed that precisely the same concentration of a specific drug was required to inhibit protein synthesis and to either stimulate or inhibit RNA replication. This suggested that the ability of these drugs to affect RNA replication was linked to their ability to alter the normal clearance of translating ribosomes from the input viral RNA. Consistent with this idea was the finding that the protein synthesis inhibitors had no measurable effect on positive-strand synthesis in normal RNA replication complexes. In marked contrast, negative-strand synthesis was stimulated by puromycin and was inhibited by cycloheximide. Puromycin causes polypeptide chain termination and induces the dissociation of polyribosomes from mRNA. Cycloheximide and other inhibitors of polypeptide chain elongation “freeze” ribosomes on mRNA and prevent the normal clearance of ribosomes from viral RNA templates. Therefore, it appears that the poliovirus polymerase was not able to dislodge translating ribosomes from viral RNA templates and mediate the switch from translation to negative-strand synthesis. Instead, the initiation of negative-strand synthesis appears to be coordinately regulated

  18. Role of RNA and Protein Synthesis in Abscission

    PubMed Central

    Abeles, F. B.

    1968-01-01

    The cell separation aspect of abscission is thought to involve the action of specific cell wall degrading enzymes. Enzymes represent synthesis which in turn is preceded by the synthesis of specific RNA molecules, and it follows that inhibition of either of these processes would also block abscission. Since abscission is a localized phenomenon usually involving 2 or 3 cell layers, RNA and protein synthesis should also be localized. Manipulations of plant material which either accelerate or retard abscission may be due to the regulation of RNA and protein synthesis. This paper is a review of literature concerned with these and related questions. Images PMID:16657020

  19. Pyrophosphate-condensing activity linked to nucleic acid synthesis.

    PubMed Central

    Volloch, V Z; Rits, S; Tumerman, L

    1979-01-01

    In some preparations of DNA dependent RNA polymerase a new enzymatic activity has been found which catalyzes the condensation of two pyrophosphate molecules, liberated in the process of RNA synthesis, to one molecule of orthophosphate and one molecule of Mg (or Mn) - chelate complex with trimetaphosphate. This activity can also cooperate with DNA-polymerase, on condition that both enzymes originate from the same cells. These results point to two general conclusions. First, energy is conserved in the overall process of nucleic acid synthesis and turnover, so that the process does not require an energy influx from the cell's general resources. Second, the synthesis of nucleic acids is catalyzed by a complex enzyme system which contains at least two separate enzymes, one responsible for nucleic acid polymerization and the other for energy conservation via pyrophosphate condensation. Images PMID:88040

  20. Abiotic synthesis of fatty acids

    NASA Technical Reports Server (NTRS)

    Leach, W. W.; Nooner, D. W.; Oro, J.

    1978-01-01

    The formation of fatty acids by Fischer-Tropsch-type synthesis was investigated with ferric oxide, ammonium carbonate, potassium carbonate, powdered Pueblito de Allende carbonaceous chondrite, and filings from the Canyon Diablo meteorite used as catalysts. Products were separated and identified by gas chromatography and mass spectrometry. Iron oxide, Pueblito de Allende chondrite, and Canyon Diablo filings in an oxidized catalyst form yielded no fatty acids. Canyon Diablo filings heated overnight at 500 C while undergoing slow purging by deuterium produced fatty acids only when potassium carbonate was admixed; potassium carbonate alone also produced these compounds. The active catalytic combinations gave relatively high yields of aliphatic and aromatic hydrocarbons; substantial amounts of n-alkenes were almost invariably observed when fatty acids were produced; the latter were in the range C6 to C18, with maximum yield in C9 or 10.

  1. Regulation of the Nucleolar DNA-Dependent RNA Polymerase by Amino Acids in Ehrlich Ascites Tumor Cells

    PubMed Central

    Franze-Fernández, M. T.; Pogo, A. O.

    1971-01-01

    Experiments were performed to ascertain the degree to which the amount of amino acids might be one of the regulatory factors that control the activity of the nucleolar RNA polymerase. Assays of the enzymatic activity were done with isolated nuclei from cells incubated with low and high concentrations of amino acids. Soon after the cells were exposed to a medium enriched in amino acids, a rapid increase of nucleolar RNA polymerase activity occurred. A similar result was obtained in cells incubated with lower concentrations of amino acids. However, the rate of ribosomal RNA synthesized was regularly much higher in cells incubated in a medium enriched with amino acids than in a medium low in amino acids. Apparently, the amino acids only controlled ribosomal RNA synthesis. Thus, neither maturation, processing, and transport of nuclear precursors into cytoplasmic ribosomal RNA, nor the synthesis of rapidly labeled RNA was affected. PMID:4108870

  2. A Model for the Origin of Protein Synthesis as Coreplicational Scanning of Nascent RNA

    NASA Astrophysics Data System (ADS)

    Yakhnin, Alexander V.

    2007-12-01

    The origin of protein synthesis is one of the major riddles of molecular biology. It was proposed a decade ago that the ribosomal RNA evolved from an earlier RNA-replisome (a ribozyme fulfilling RNA replication) while transfer RNA (tRNA) evolved from a genomic replication origin. Applying these hypotheses, I suggest that protein synthesis arose for the purpose of segregating copy and template RNA during replication through the conventional formation of a complementary strand. Nascent RNA was scanned in 5' to 3' direction following the progress of replication. The base pairing of several tRNA-like molecules with nascent RNA released the replication intermediates trapped in duplex. Synthesis of random peptides evolved to fuel the turnover of tRNAs. Then the combination of replication-coupled peptide formation and the independent development of amino acid-specific tRNA aminoacylation resulted in template-based protein synthesis. Therefore, the positioning of tRNAs adjacent to each other developed for the purpose of replication rather than peptide synthesis. This hypothesis does not include either selection for useful peptides or specific recognition of amino acids at the initial evolution of translation. It does, however, explain a number of features of modern translation apparatus, such as the relative flexibility of genetic code, the number of proteins shared by the transcription and translation machines, the universal participation of an RNA subunit in co-translational protein secretion, ‘unscheduled translation’, and factor-independent translocation. Assistance of original ribosomes in keeping apart the nascent transcript from its template is still widely explored by modern bacteria and perhaps by other domains of life.

  3. 2-Selenouridine triphosphate synthesis and Se-RNA transcription.

    PubMed

    Sun, Huiyan; Jiang, Sibo; Caton-Williams, Julianne; Liu, Hehua; Huang, Zhen

    2013-09-01

    2-Selenouridine ((Se)U) is one of the naturally occurring modifications of Se-tRNAs ((Se)U-RNA) at the wobble position of the anticodon loop. Its role in the RNA-RNA interaction, especially during the mRNA decoding, is elusive. To assist the research exploration, herein we report the enzymatic synthesis of the (Se)U-RNA via 2-selenouridine triphosphate ((Se)UTP) synthesis and RNA transcription. Moreover, we have demonstrated that the synthesized (Se)UTP is stable and recognizable by T7 RNA polymerase. Under the optimized conditions, the transcription yield of (Se)U-RNA can reach up to 85% of the corresponding native RNA. Furthermore, the transcribed (Se)U-hammerhead ribozyme has the similar activity as the corresponding native, which suggests usefulness of (Se)U-RNAs in function and structure studies of noncoding RNAs, including the Se-tRNAs.

  4. Synthesis, base pairing and structure studies of geranylated RNA

    PubMed Central

    Wang, Rui; Vangaveti, Sweta; Ranganathan, Srivathsan V.; Basanta-Sanchez, Maria; Haruehanroengra, Phensinee; Chen, Alan; Sheng, Jia

    2016-01-01

    Natural RNAs utilize extensive chemical modifications to diversify their structures and functions. 2-Thiouridine geranylation is a special hydrophobic tRNA modification that has been discovered very recently in several bacteria, such as Escherichia coli, Enterobacter aerogenes, Pseudomonas aeruginosa and Salmonella Typhimurium. The geranylated residues are located in the first anticodon position of tRNAs specific for lysine, glutamine and glutamic acid. This big hydrophobic terpene functional group affects the codon recognition patterns and reduces frameshifting errors during translation. We aimed to systematically study the structure, function and biosynthesis mechanism of this geranylation pathway, as well as answer the question of why nature uses such a hydrophobic modification in hydrophilic RNA systems. Recently, we have synthesized the deoxy-analog of S-geranyluridine and showed the geranylated T-G pair is much stronger than the geranylated T-A pair and other mismatched pairs in the B-form DNA duplex context, which is consistent with the observation that the geranylated tRNAGluUUC recognizes GAG more efficiently than GAA. In this manuscript we report the synthesis and base pairing specificity studies of geranylated RNA oligos. We also report extensive molecular simulation studies to explore the structural features of the geranyl group in the context of A-form RNA and its effect on codon–anticodon interaction during ribosome binding. PMID:27307604

  5. Aminoacyl-RNA synthesis catalyzed by an RNA.

    PubMed

    Illangasekare, M; Sanchez, G; Nickles, T; Yarus, M

    1995-02-03

    An RNA has been selected that rapidly aminoacylates its 2'(3') terminus when provided with phenylalanyl-adenosine monophosphate. That is, the RNA accelerates the same aminoacyl group transfer catalyzed by protein aminoacyl-transfer RNA synthetases. The best characterized RNA reaction requires both Mg2+ and Ca2+. These results confirm a necessary prediction of the RNA world hypothesis and represent efficient RNA reaction (> or = 10(5) times accelerated) at a carbonyl carbon, exemplifying a little explored type of RNA catalysis.

  6. Specific mRNA destabilization in Dictyostelium discoideum requires RNA synthesis.

    PubMed Central

    Amara, J F; Lodish, H F

    1987-01-01

    We tested the effects of inhibitors of protein and RNA synthesis on the disaggregation-mediated destabilization of prespore mRNAs in Dictyostelium discoideum. Incubating disaggregated cells with daunomycin to inhibit RNA synthesis prevented the loss of prespore mRNAs, whereas the inhibitor decreased or did not affect levels of the common mRNAs CZ22 and actin. Protein synthesis inhibitors varied in their effects. Cycloheximide, which inhibited protein synthesis almost completely, prevented the loss of the prespore mRNAs, but puromycin, which inhibited protein synthesis less well, did not. These results indicate that the process of specific mRNA destabilization requires the synthesis of RNA and possibly of protein. Images PMID:3437899

  7. Control of rRNA Synthesis in Escherichia coli: a Systems Biology Approach†

    PubMed Central

    Dennis, Patrick P.; Ehrenberg, Mans; Bremer, Hans

    2004-01-01

    The first part of this review contains an overview of the various contributions and models relating to the control of rRNA synthesis reported over the last 45 years. The second part describes a systems biology approach to identify the factors and effectors that control the interactions between RNA polymerase and rRNA (rrn) promoters of Escherichia coli bacteria during exponential growth in different media. This analysis is based on measurements of absolute rrn promoter activities as transcripts per minute per promoter in bacterial strains either deficient or proficient in the synthesis of the factor Fis and/or the effector ppGpp. These absolute promoter activities are evaluated in terms of rrn promoter strength (Vmax/Km) and free RNA polymerase concentrations. Three major conclusions emerge from this evaluation. First, the rrn promoters are not saturated with RNA polymerase. As a consequence, changes in the concentration of free RNA polymerase contribute to changes in rrn promoter activities. Second, rrn P2 promoter strength is not specifically regulated during exponential growth at different rates; its activity changes only when the concentration of free RNA polymerase changes. Third, the effector ppGpp reduces the strength of the rrn P1 promoter both directly and indirectly by reducing synthesis of the stimulating factor Fis. This control of rrn P1 promoter strength forms part of a larger feedback loop that adjusts the synthesis of ribosomes to the availability of amino acids via amino acid-dependent control of ppGpp accumulation. PMID:15590778

  8. Archaeal aminoacyl-tRNA synthesis: diversity replaces dogma.

    PubMed Central

    Tumbula, D; Vothknecht, U C; Kim, H S; Ibba, M; Min, B; Li, T; Pelaschier, J; Stathopoulos, C; Becker, H; Söll, D

    1999-01-01

    Accurate aminoacyl-tRNA synthesis is essential for faithful translation of the genetic code and consequently has been intensively studied for over three decades. Until recently, the study of aminoacyl-tRNA synthesis in archaea had received little attention. However, as in so many areas of molecular biology, the advent of archaeal genome sequencing has now drawn researchers to this field. Investigations with archaea have already led to the discovery of novel pathways and enzymes for the synthesis of numerous aminoacyl-tRNAs. The most surprising of these findings has been a transamidation pathway for the synthesis of asparaginyl-tRNA and a novel lysyl-tRNA synthetase. In addition, seryl- and phenylalanyl-tRNA synthetases that are only marginally related to known examples outside the archaea have been characterized, and the mechanism of cysteinyl-tRNA formation in Methanococcus jannaschii and Methanobacterium thermoautotrophicum is still unknown. These results have revealed completely unexpected levels of complexity and diversity, questioning the notion that aminoacyl-tRNA synthesis is one of the most conserved functions in gene expression. It has now become clear that the distribution of the various mechanisms of aminoacyl-tRNA synthesis in extant organisms has been determined by numerous gene transfer events, indicating that, while the process of protein biosynthesis is orthologous, its constituents are not. PMID:10430557

  9. RNA synthesis in the thymus of the immunologically mature mouse

    PubMed Central

    Patt, D. J.; Cohen, E. P.

    1974-01-01

    RNA synthesis was investigated in the thymus glands of adult immunized mice. After the intraperitoneal injection of mice with sheep red blood cells (SRBC), the net synthesis of RNA in the gland increased. A small but consistent amount of the RNA synthesized was distinguished by RNA:DNA hybridizations from that found in the glands of mice not injected with antigen. The RNA formed after immunization did not appear by hybridization to be specific for different antigens since the species of RNA formed in the glands of mice injected with SRBC was indistinguishable from RNA formed in the thymuses of mice injected with chicken red blood cells. RNA synthesized in the thymus glands of mice pharmacologically `stressed' by the injections of hydrocortisone, however, was distinguishable from that formed in the glands of mice injected with antigen. PMID:4854183

  10. Synthesis of RNA using 2'-O-DTM protection.

    PubMed

    Semenyuk, Andrey; Földesi, Andras; Johansson, Tommy; Estmer-Nilsson, Camilla; Blomgren, Peter; Brännvall, Mathias; Kirsebom, Leif A; Kwiatkowski, Marek

    2006-09-27

    tert-Butyldithiomethyl (DTM), a novel hydroxyl protecting group, cleavable under reductive conditions, was developed and applied for the protection of 2'-OH during solid-phase RNA synthesis. This function is compatible with all standard protecting groups used in oligonucleotide synthesis, and allows for fast and high-yield synthesis of RNA. Oligonucleotides containing the 2'-O-DTM groups can be easily deprotected under the mildest possible aqueous and homogeneous conditions. The preserved 5'-O-DMTr function can be used for high-throughput cartridge RNA purification.

  11. RNA-catalysed synthesis of complementary-strand RNA

    NASA Astrophysics Data System (ADS)

    Doudna, Jennifer A.; Szostak, Jack W.

    1989-06-01

    The Tetrahymena ribozyme can splice together multiple oligonucleotides aligned on a template strand to yield a fully complementary product strand. This reaction demonstrates the feasibility of RNA-catalysed RNA replications.

  12. The control of ribonucleic acid synthesis in bacteria. The synthesis and stability of ribonucleic acids in relaxed and stringent amino acid auxotrophs of Escherichia coli.

    PubMed

    Gray, W J; Midgley, J E

    1972-08-01

    The biosynthesis and stability of various RNA fractions was studied in RC(str) and RC(rel) multiple amino acid auxotrophs of Escherichia coli. In conditions of amino acid deprivation, RC(str) mutants were labelled with exogenous nucleotide bases at less than 1% of the rate found in cultures growing normally in supplemented media. Studies by DNA-RNA hybridization and by other methods showed that, during a period of amino acid withdrawal, not more than 60-70% of the labelled RNA formed in RC(str) mutants had the characteristics of mRNA. Evidence was obtained for some degradation of newly formed 16S and 23S rRNA species to heterogeneous material of lower molecular weight. This led to overestimations of the mRNA content of rapidly labelled RNA from such methods as simple examination of sucrose-density-gradient profiles. In RC(rel) strains the absolute and relative rates of synthesis of the various RNA fractions were not greatly affected. However, the stability of about half of the mRNA fraction was increased in RC(rel) strains during amino acid starvation, giving kinetics of mRNA labelling and turnover that were identical with those found in either RC(str) or RC(rel) strains inhibited by high concentrations of chloramphenicol. Coincidence hybridization techniques showed that the mRNA content of amino acid-starved RC(str) auxotrophs was unchanged from that found in normally growing cells. In contrast, RC(rel) strains deprived of amino acids increased their mRNA content about threefold. In such cultures the mRNA content of accumulating newly formed RNA was a constant 16% by wt.

  13. Genetics Home Reference: congenital bile acid synthesis defect type 1

    MedlinePlus

    ... bile acid synthesis defect type 1 congenital bile acid synthesis defect type 1 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 1 is a disorder characterized ...

  14. Genetics Home Reference: congenital bile acid synthesis defect type 2

    MedlinePlus

    ... bile acid synthesis defect type 2 congenital bile acid synthesis defect type 2 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 2 is a disorder characterized ...

  15. Hydroxamic Acids in Asymmetric Synthesis

    PubMed Central

    Li, Zhi; Yamamoto, Hisashi

    2012-01-01

    Metal-catalyzed stereoselective reactions are a central theme in organic chemistry research. In these reactions, the stereoselection is achieved predominantly by introducing chiral ligands at the metal catalyst’s center. For decades, researchers have sought better chiral ligands for asymmetric catalysis and have made great progress. Nevertheless, to achieve optimal stereoselectivity and to catalyze new reactions, new chiral ligands are needed. Due to their high metal affinity, hydroxamic acids play major roles across a broad spectrum of fields from biochemistry to metal extraction. Dr. K. Barry Sharpless first revealed their potential as chiral ligands for asymmetric synthesis in 1977: He published the chiral vanadium-hydroxamic-acid-catalyzed, enantioselective epoxidation of allylic alcohols before his discovery of Sharpless Asymmetric Epoxidation, which uses titanium-tartrate complex as the chiral reagent. However, researchers have reported few highly enantioselective reactions using metal-hydroxamic acid as catalysts since then. This Account summarizes our research on metal-catalyzed asymmetric epoxidation using hydroxamic acids as chiral ligands. We designed and synthesized a series of new hydroxamic acids, most notably the C2-symmetric bis-hydroxamic acid (BHA) family. V-BHA-catalyzed epoxidation of allylic and homoallylic alcohols achieved higher activity and stereoselectivity than Sharpless Asymmetric Epoxidation in many cases. Changing the metal species led to a series of unprecedented asymmetric epoxidation reactions, such as (i) single olefins and sulfides with Mo-BHA, (ii) homoallylic and bishomoallylic alcohols with Zr- and Hf-BHA, and (iii) N-alkenyl sulfonamides and N-sulfonyl imines with Hf-BHA. These reactions produce uniquely functionalized chiral epoxides with good yields and enantioselectivities. PMID:23157425

  16. Phosphatidic Acid Synthesis in Bacteria

    PubMed Central

    Yao, Jiangwei; Rock, Charles O.

    2012-01-01

    Membrane phospholipid synthesis is a vital facet of bacterial physiology. Although the spectrum of phospholipid headgroup structures produced by bacteria is large, the key precursor to all of these molecules is phosphatidic acid (PtdOH). Glycerol-3-phosphate derived from the glycolysis via glycerol-phosphate synthase is the universal source for the glycerol backbone of PtdOH. There are two distinct families of enzymes responsible for the acylation of the 1-position of glycerol-3-phosphate. The PlsB acyltransferase was discovered in Escherichia coli, and homologs are present in many eukaryotes. This protein family primarily uses acyl-acyl carrier protein (ACP) endproducts of fatty acid synthesis as acyl donors, but may also use acyl-CoA derived from exogenous fatty acids. The second protein family, PlsY, is more widely distributed in bacteria and utilizes the unique acyl donor, acyl-phosphate, which is produced from acyl-ACP by the enzyme PlsX. The acylation of the 2-position is carried out by members of the PlsC protein family. All PlsCs use acyl-ACP as the acyl donor, although the PlsCs of the γ-proteobacteria also may use acyl-CoA. Phospholipid headgroups are precursors in the biosynthesis of other membrane-associated molecules and the diacylglycerol product of these reactions is converted to PtdOH by one of two distinct families of lipid kinases. The central importance of the de novo and recycling pathways to PtdOH in cell physiology suggest these enzymes are suitable targets for the development of antibacterial therapeutics in Gram-positive pathogens. This article is part of a Special Issue entitled Phospholipids and Phospholipid Metabolism. PMID:22981714

  17. RNA Synthesis by in Vitro Selected Ribozymes for Recreating an RNA World

    PubMed Central

    Martin, Lyssa L.; Unrau, Peter J.; Müller, Ulrich F.

    2015-01-01

    The RNA world hypothesis states that during an early stage of life, RNA molecules functioned as genome and as the only genome-encoded catalyst. This hypothesis is supported by several lines of evidence, one of which is the in vitro selection of catalytic RNAs (ribozymes) in the laboratory for a wide range of reactions that might have been used by RNA world organisms. This review focuses on three types of ribozymes that could have been involved in the synthesis of RNA, the core activity in the self-replication of RNA world organisms. These ribozyme classes catalyze nucleoside synthesis, triphosphorylation, and the polymerization of nucleoside triphosphates. The strengths and weaknesses regarding each ribozyme’s possible function in a self-replicating RNA network are described, together with the obstacles that need to be overcome before an RNA world organism can be generated in the laboratory. PMID:25610978

  18. Transfer RNA is highly unstable during early amino acid starvation in Escherichia coli

    PubMed Central

    Svenningsen, Sine Lo; Kongstad, Mette; Stenum, Thomas Søndergaard; Muñoz-Gómez, Ana J.; Sørensen, Michael A.

    2017-01-01

    Due to its long half-life compared to messenger RNA, bacterial transfer RNA is known as stable RNA. Here, we show that tRNAs become highly unstable as part of Escherichia coli's response to amino acid starvation. Degradation of the majority of cellular tRNA occurs within twenty minutes of the onset of starvation for each of several amino acids. Both the non-cognate and cognate tRNA for the amino acid that the cell is starving for are degraded, and both charged and uncharged tRNA species are affected. The alarmone ppGpp orchestrates the stringent response to amino acid starvation. However, tRNA degradation occurs in a ppGpp-independent manner, as it occurs with similar kinetics in a relaxed mutant. Further, we also observe rapid tRNA degradation in response to rifampicin treatment, which does not induce the stringent response. We propose a unifying model for these observations, in which the surplus tRNA is degraded whenever the demand for protein synthesis is reduced. Thus, the tRNA pool is a highly regulated, dynamic entity. We propose that degradation of surplus tRNA could function to reduce mistranslation in the stressed cell, because it would reduce competition between cognate and near-cognate charged tRNAs at the ribosomal A-site. PMID:27903898

  19. Coupling of double-stranded RNA synthesis and siRNA generation in fission yeast RNAi.

    PubMed

    Colmenares, Serafin U; Buker, Shane M; Buhler, Marc; Dlakić, Mensur; Moazed, Danesh

    2007-08-03

    The fission yeast centromeric repeats are transcribed and ultimately processed into small interfering RNAs (siRNAs) that are required for heterochromatin formation. siRNA generation requires dsRNA synthesis by the RNA-directed RNA polymerase complex (RDRC) and processing by the Dicer ribonuclease. Here we show that Dcr1, the fission yeast Dicer, is physically associated with RDRC. Dcr1 generates siRNAs in an ATP-dependent manner that requires its conserved N-terminal helicase domain. Furthermore, C-terminal truncations of Dcr1 that abolish its interaction with RDRC, but can generate siRNA in vitro, abolish siRNA generation and heterochromatic gene silencing in vivo. Finally, reconstitution experiments show that the association of Dcr1 with RDRC strongly stimulates the dsRNA synthesis activity of RDRC. Our results suggest that heterochromatic dsRNA synthesis and siRNA generation are physically coupled processes. This coupling has implications for cis-restriction of siRNA-mediated heterochromatin assembly and for mechanisms that give rise to siRNA strand polarity.

  20. Abscisic Acid Synthesis and Response

    PubMed Central

    Finkelstein, Ruth

    2013-01-01

    Abscisic acid (ABA) is one of the “classical” plant hormones, i.e. discovered at least 50 years ago, that regulates many aspects of plant growth and development. This chapter reviews our current understanding of ABA synthesis, metabolism, transport, and signal transduction, emphasizing knowledge gained from studies of Arabidopsis. A combination of genetic, molecular and biochemical studies has identified nearly all of the enzymes involved in ABA metabolism, almost 200 loci regulating ABA response, and thousands of genes regulated by ABA in various contexts. Some of these regulators are implicated in cross-talk with other developmental, environmental or hormonal signals. Specific details of the ABA signaling mechanisms vary among tissues or developmental stages; these are discussed in the context of ABA effects on seed maturation, germination, seedling growth, vegetative stress responses, stomatal regulation, pathogen response, flowering, and senescence. PMID:24273463

  1. [The first steps of chlorophyll synthesis: RNA involvement and regulation

    SciTech Connect

    Soell, D.

    1992-01-01

    Glu-tRNA[sup Glu] is synthesized from glutamate and tRNA[sup Glu] by glutamyl-tRNA synthetase (GluRS). Recent work has demonstrated that Glu-tRNA[sup Glu] has dual functions and is a precursor for protein and 5-aminolevulinate (ALA) synthesis. Current data does not provide compelling evidence for the notion that GluRS is regulated by chlorophyll precursors or in concert with the other enzymes of ALA synthesis. We have redefined the C5-pathway as a two-step route to ALA starting with Glu-tRNA[sup Glu]. Only two enzymes, Glu-tRNA reductase (GluTR) and GSA-2,1-amino-mutase (GSA-AM), are specifically involved in ALA synthesis. We have purified these enzymatic activities from Chlamydomonas and demonstrated that the two purified proteins in the presence of their cofactors NADPH and pyridoxal phosphate are sufficient for the in vitro Glu-tRNA [yields] ALA conversion. We have cloned the genes encoding GluTR. The sequences of the GluTR proteins deduced from these genes share highly conserved regions with those of bacterial origin. We havealso cloned and analyzed the gene encoding GSA-AM from Arabidopsis. As in Salmonella typhimurium, there are indications of the existence of an additional pathway for ALA formation in E. coli. To shed light on the recognition of the single tRNA[sup Glu] by the chloroplast enzymes GluTR, GluRS we characterized a chlorophyll-deficient mutant of Euglena having tRNA[sup Glu] with a point mutation in the T[Psi]C-loop. The altered tRNA supports protein but not ALA synthesis.

  2. Total RNA-seq to identify pharmacological effects on specific stages of mRNA synthesis.

    PubMed

    Boswell, Sarah A; Snavely, Andrew; Landry, Heather M; Churchman, L Stirling; Gray, Jesse M; Springer, Michael

    2017-03-06

    Pharmacological perturbation is a powerful tool for understanding mRNA synthesis, but identification of the specific steps of this multi-step process that are targeted by small molecules remains challenging. Here we applied strand-specific total RNA sequencing (RNA-seq) to identify and distinguish specific pharmacological effects on transcription and pre-mRNA processing in human cells. We found unexpectedly that the natural product isoginkgetin, previously described as a splicing inhibitor, inhibits transcription elongation. Compared to well-characterized elongation inhibitors that target CDK9, isoginkgetin caused RNA polymerase accumulation within a broader promoter-proximal band, indicating that elongation inhibition by isoginkgetin occurs after release from promoter-proximal pause. RNA-seq distinguished isoginkgetin and CDK9 inhibitors from topoisomerase I inhibition, which alters elongation across gene bodies. We were able to detect these and other specific defects in mRNA synthesis at low sequencing depth using simple metagene-based metrics. These metrics now enable total-RNA-seq-based screening for high-throughput identification of pharmacological effects on individual stages of mRNA synthesis.

  3. Senescence in isolated carnation petals : effects of indoleacetic Acid and inhibitors of protein synthesis.

    PubMed

    Wulster, G; Sacalis, J; Janes, H W

    1982-10-01

    Indoleacetic acid induces senescence in isolated carnation (Dianthus caryophyllus, cv. White Sim) petals, increasing the duration and amount of ethylene production. This effect is inhibited by Actinomycin D, an inhibitor of RNA synthesis, and cycloheximide, a translational inhibitor of protein synthesis. The ability of petals to respond to indoleacetic acid appears to be a function of physiological age. Indoleacetic acid is capable of enhancing ethylene evolution and senescence only in specific portions of the petal.

  4. The 5' nontranslated region of potato virus X RNA affects both genomic and subgenomic RNA synthesis.

    PubMed Central

    Kim, K H; Hemenway, C

    1996-01-01

    A tobacco protoplast system was developed to analyze cis-acting sequences required for potato virus X (PVX) replication. Protoplasts inoculated with transcripts derived from a PVX cDNA clone or from clones containing mutations in their 5' nontranslated regions (NTRs) were assayed for RNA production by S1 nuclease protection assays. A time course of plus- and minus-strand-RNA accumulation indicated that both minus- and plus-strand PVX RNAs were detectable at 0.5 h postinoculation. Although minus-strand RNAs accumulated more rapidly than plus-strand RNAs, maximum levels of plus-strand RNAs were 40- to 80-fold higher. On the basis of these data, time points were chosen for determination of RNA levels in protoplasts inoculated with PVX clones containing deletions or an insertion in their 5' NTRs. Deletions of more than 12 nucleotides from the 5' end, internal deletions, and one insertion in the 5' NTR resulted in substantially decreased levels of plus-strand-RNA production. In contrast, all modified transcripts were functional for minus-strand-RNA synthesis, suggesting that elements in the 5' NTR were not essential for minus-strand-RNA synthesis. Further analysis of the 5' NTR deletion mutants indicated that all mutations that decreased genomic plus-strand-RNA synthesis also decreased synthesis of the two major subgenomic RNAs. These data indicate that cis-acting elements from different regions of the 5' NTR are required for plus-strand-RNA synthesis and that this process may be linked to synthesis of subgenomic RNAs. PMID:8764066

  5. Stimulation of Ribonucleic Acid Synthesis by Chloramphenicol in a rel+ Aminoacyl-Transfer Ribonucleic Acid Synthetase Mutant of Escherichia coli

    PubMed Central

    Yegian, Charles D.; Vanderslice, Rebecca W.

    1971-01-01

    Escherichia coli strain 9D3 possesses a highly temperature-sensitive valyl-transfer ribonucleic acid (tRNA) synthetase (EC 6.1.1.9). Since 9D3 is a rel+ strain, it cannot carry out net RNA synthesis at high temperature. A 100-μg amount of chloramphenicol (CAP) per ml added in the absence of valine cannot stimulate RNA synthesis. Either 300 μg of CAP or 100 μg of CAP plus 50 μg of valine per ml, however, promotes nearly maximal RNA synthesis. These results can be understood as follows. (i) Valyl-tRNA is required for net RNA synthesis, (ii) the synthetase lesion is incomplete, (iii) the rate of mutant acylation of tRNAval at high temperature is valine-dependent, and (iv) the CAP concentration determines the rate of residual protein synthesis. Data are also presented which demonstrate that the rate of net RNA synthesis can greatly increase long after the addition of CAP, if the amount of valyl-tRNA increases. PMID:4942766

  6. Ribonucleic Acid and Protein Synthesis During Germination of Myxococcus xanthus Myxospores

    PubMed Central

    Juengst, Fredrick W.; Dworkin, Martin

    1973-01-01

    Ribonucleic acid (RNA) and protein synthesis during myxospore germination were examined. When RNA synthesis was inhibited more than 90% by either actinomycin D (Act D) or rifampin, germination was prevented. The data were consistent with the interpretation that rifampin did not interfere with protein synthesis in any way other than by inhibition of messenger RNA formation. Act D concentrations as high as 20 μg/ml did not totally inhibit RNA synthesis. In the presence of 8 μg of Act D/ml, germinating myxospores synthesized transfer RNA, 16S RNA, and 23S RNA. Evidence was presented which indicated that messenger RNA was also synthesized early in the germination period both in the presence and absence of 8 μg of Act D/ml. One explanation for the escape synthesis of RNA in germinating myxospores is that Act D exerts a differential effect on the transcription of larger versus smaller cistrons, the latter having a lower probability of binding Act D. We have found that in the presence of 8 μg of Act D/ml, escape RNA synthesis in myxospores was 25% for 23S RNA, 55% for 16S RNA, and more than 90% for 4S RNA. We have shown that germination of myxospores requires both RNA and protein synthesis during the first 25 to 35 min in germination medium. This finding does not support the earlier suggestion by Ramsey and Dworkin that a stable germination messenger RNA is required for germination of the myxospores of Myxococcus xanthus. PMID:4690965

  7. The mechanism of montmorillonite catalysis in RNA synthesis

    NASA Astrophysics Data System (ADS)

    Joshi, Prakash

    The formation of complex prebiotic molecules on the early Earth is likely to have involved a component of mineral catalysis. Amongst the variety of clay minerals that have been investigated by us for their ability to catalyze the formation of RNA oligomers is montmorillonite. These are 2:1 layer silicates that have a wide range of chemical compositions [(Na,Ca)0.33(Al,Fe,Mg)2(Si,Al)4O10(OH)2.nH2O]. They are commonly produced by the weathering of silicic volcanic ashes to form Bentonite. Once formed, montmorillonites gradually transform to Illites at a modest pressure and temperature. Of the many samples of montmorillonite that we have experimentally examined, a selected subset has been observed to be catalytic for RNA synthesis (Joshi et. al., 2009; Aldersley et al., 2011). Those that have been observed to be excellent catalysts come from a restricted range of elemental compositions. The recent identification of phyllosilicates including montmorillonite on Mars (Bishop et al., 2008) raises the possibility that such processes may have taken place there too. The extent of catalysis depended not only upon the magnitude of the negative charge on the montmorillonite lattice and the number of cations associated with it, but also on the pH at which the reaction is promoted. The isotherm and catalysis studies were extended to provide binding information and catalytic outcomes over a wide pH range. When cations in raw montmorillonite are completely replaced by sodium ions, the resulting Na+-montmorillonite does not catalyze oligomer formation because the ions saturate the interlayer between the platelets of montmorillonite, which blocks the binding of the activated monomers. Acid washed montmorillonite titrated to pH 6-8 with alkali metal ions, serves as the model catalyst for this RNA synthesis (Aldersley et. al., 2011). The optimal binding occurred in the region of maximal oligomer formation. X-ray diffraction studies revealed changes in layer separations of

  8. Cyclic phosphatidic acid and lysophosphatidic acid induce hyaluronic acid synthesis via CREB transcription factor regulation in human skin fibroblasts.

    PubMed

    Maeda-Sano, Katsura; Gotoh, Mari; Morohoshi, Toshiro; Someya, Takao; Murofushi, Hiromu; Murakami-Murofushi, Kimiko

    2014-09-01

    Cyclic phosphatidic acid (cPA) is a naturally occurring phospholipid mediator and an analog of the growth factor-like phospholipid lysophosphatidic acid (LPA). cPA has a unique cyclic phosphate ring at the sn-2 and sn-3 positions of its glycerol backbone. We showed before that a metabolically stabilized cPA derivative, 2-carba-cPA, relieved osteoarthritis pathogenesis in vivo and induced hyaluronic acid synthesis in human osteoarthritis synoviocytes in vitro. This study focused on hyaluronic acid synthesis in human fibroblasts, which retain moisture and maintain health in the dermis. We investigated the effects of cPA and LPA on hyaluronic acid synthesis in human fibroblasts (NB1RGB cells). Using particle exclusion and enzyme-linked immunosorbent assays, we found that both cPA and LPA dose-dependently induced hyaluronic acid synthesis. We revealed that the expression of hyaluronan synthase 2 messenger RNA and protein is up-regulated by cPA and LPA treatment time dependently. We then characterized the signaling pathways up-regulating hyaluronic acid synthesis mediated by cPA and LPA in NB1RGB cells. Pharmacological inhibition and reporter gene assays revealed that the activation of the LPA receptor LPAR1, Gi/o protein, phosphatidylinositol-3 kinase (PI3K), extracellular-signal-regulated kinase (ERK), and cyclic adenosine monophosphate response element-binding protein (CREB) but not nuclear factor κB induced hyaluronic acid synthesis by the treatment with cPA and LPA in NB1RGB cells. These results demonstrate for the first time that cPA and LPA induce hyaluronic acid synthesis in human skin fibroblasts mainly through the activation of LPAR1-Gi/o followed by the PI3K, ERK, and CREB signaling pathway.

  9. Construction of peptides with nucleobase amino acids: design and synthesis of the nucleobase-conjugated peptides derived from HIV-1 Rev and their binding properties to HIV-1 RRE RNA.

    PubMed

    Takahashi, T; Hamasaki, K; Ueno, A; Mihara, H

    2001-04-01

    In order to develop a novel molecule that recognizes a specific structure of RNA, we have attempted to design peptides having L-alpha-amino acids with a nucleobase at the side chain (nucleobase amino acid (NBA)), expecting that the function of a nucleobase which can specifically recognize a base in RNA is regulated in a peptide conformation. In this study, to demonstrate the applicability of the NBA units in the peptide to RNA recognition, we designed and synthesized a variety of NBA-conjugated peptides, derived from HIV-1 Rev. Circular dichroism study revealed that the conjugation of the Rev peptide with an NBA unit did not disturb the peptide conformation. RNA-binding affinities of the designed peptides with RRE IIB RNA were dependent on the structure of the nucleobase moieties in the peptides. The peptide having the cytosine NBA at the position of the Asn40 site in the Rev showed a higher binding ability for RRE IIB RNA, despite the diminishing the Asn40 function. Furthermore, the peptide having the guanine NBA at the position of the Arg44 site, which is the most important residue for the RNA binding in the Rev, bound to RRE IIB RNA in an ability similar to Rev34-50 with native sequence. These results demonstrate that an appropriate NBA unit in the peptide plays an important role in the RNA binding with a specific contact such as hydrogen bonding, and the interaction between the nucleobase in the peptide and the base in the RNA can enhance the RNA-binding affinity and specificity.

  10. Alphavirus RNA synthesis and non-structural protein functions.

    PubMed

    Rupp, Jonathan C; Sokoloski, Kevin J; Gebhart, Natasha N; Hardy, Richard W

    2015-09-01

    The members of the genus Alphavirus are positive-sense RNA viruses, which are predominantly transmitted to vertebrates by a mosquito vector. Alphavirus disease in humans can be severely debilitating, and depending on the particular viral species, infection may result in encephalitis and possibly death. In recent years, alphaviruses have received significant attention from public health authorities as a consequence of the dramatic emergence of chikungunya virus in the Indian Ocean islands and the Caribbean. Currently, no safe, approved or effective vaccine or antiviral intervention exists for human alphavirus infection. The molecular biology of alphavirus RNA synthesis has been well studied in a few species of the genus and represents a general target for antiviral drug development. This review describes what is currently understood about the regulation of alphavirus RNA synthesis, the roles of the viral non-structural proteins in this process and the functions of cis-acting RNA elements in replication, and points to open questions within the field.

  11. Enteral glutamine stimulates protein synthesis and decreases ubiquitin mRNA level in human gut mucosa.

    PubMed

    Coëffier, Moïse; Claeyssens, Sophie; Hecketsweiler, Bernadette; Lavoinne, Alain; Ducrotté, Philippe; Déchelotte, Pierre

    2003-08-01

    Effects of glutamine on whole body and intestinal protein synthesis and on intestinal proteolysis were assessed in humans. Two groups of healthy volunteers received in a random order enteral glutamine (0.8 mmol.kg body wt(-1)x h(-1)) compared either to saline or isonitrogenous amino acids. Intravenous [2H5]phenylalanine and [13C]leucine were simultaneously infused. After gas chromatography-mass spectrometry analysis, whole body protein turnover was estimated from traced plasma amino acid fluxes and the fractional synthesis rate (FSR) of gut mucosal protein was calculated from protein and intracellular phenylalanine and leucine enrichments in duodenal biopsies. mRNA levels for ubiquitin, cathepsin D, and m-calpain were analyzed in biopsies by RT-PCR. Glutamine significantly increased mucosal protein FSR compared with saline. Glutamine and amino acids had similar effects on FSR. The mRNA level for ubiquitin was significantly decreased after glutamine infusion compared with saline and amino acids, whereas cathepsin D and m-calpain mRNA levels were not affected. Enteral glutamine stimulates mucosal protein synthesis and may attenuate ubiquitin-dependent proteolysis and thus improve protein balance in human gut.

  12. RNA synthesis and purification for structural studies.

    PubMed

    Ahmed, Yasar Luqman; Ficner, Ralf

    2014-01-01

    RNAs play pivotal roles in the cell, ranging from catalysis (e.g., RNase P), acting as adaptor molecule (tRNA) to regulation (e.g., riboswitches). Precise understanding of its three-dimensional structures has given unprecedented insight into the molecular basis for all of these processes. Nevertheless, structural studies on RNA are still limited by the very special nature of this polymer. The most common methods for the determination of 3D RNA structures are NMR and X-ray crystallography. Both methods have their own set of requirements and give different amounts of information about the target RNA. For structural studies, the major bottleneck is usually obtaining large amounts of highly pure and homogeneously folded RNA. Especially for X-ray crystallography it can be necessary to screen a large number of variants to obtain well-ordered single crystals. In this mini-review we give an overview about strategies for the design, in vitro production, and purification of RNA for structural studies.

  13. Role of RNA Synthesis in the Estrogen Induction of a Specific Uterine Protein*

    PubMed Central

    DeAngelo, Anthony B.; Gorski, Jack

    1970-01-01

    The rate of amino acid incorporation into a specific uterine protein (induced protein band) isolated by gel electrophoresis has been shown to be markedly stimulated within an hour after estrogen administration. Injection of actinomycin D (8 mg/kg) prior to estrogen blocks the synthesis of induced protein. The accumulation of the product of the actinomycin D-sensitive step (induced protein band RNA) is significant 15 minutes after estrogen, and its synthesis would appear to be initiated as soon as the estrogen-receptor complex reaches the nucleus. Blocking protein synthesis with puromycin or cycloheximide did not affect the accumulation of induced protein band RNA, indicating that this is one of the earliest macromolecular synthetic events to occur after estrogen administration. PMID:5269235

  14. MicroRNA and AU-rich element regulation of prostaglandin synthesis

    PubMed Central

    Moore, Ashleigh E.; Young, Lisa E.

    2012-01-01

    Many liness of evidence demonstrate that prostaglandins play an important role in cancer, and enhanced synthesis of prostaglandin E2 (PGE2) is often observed in various human malignancies often associated with poor prognosis. PGE2 synthesis is initiated with the release of arachidonic acid by phospholipase enzymes, where it is then converted into the intermediate prostaglandin prostaglandin H2 (PGH2) by members of the cyclooxygenase family. The synthesis of PGE2 from PGH2 is facilitated by three different PGE synthases, and functional PGE2 can promote tumor growth by binding to four EP receptors to activate signaling pathways that control cell proliferation, migration, apoptosis, and angiogenesis. An integral method of controlling gene expression is by posttranscriptional mechanisms that regulate mRNA stability and protein translation. Messenger RNA regulatory elements typically reside within the 3′ untranslated region (3′UTR) of the transcript and play a critical role in targeting specific mRNAs for posttranscriptional regulation through micro-RNA (miRNA) binding and adenylate- and uridylate-rich element RNA-binding proteins. In this review, we highlight the current advances in our understanding of the impact these RNA sequence elements have upon regulating PGE2 levels. We also identify various RNA sequence elements consistently observed within the 3′UTRs of the genes involved in the PGE2 pathway, indicating these binding sites for miRNAs and RNA-binding proteins to be central regulators of PGE2 synthesis and function. These findings may provide a rationale for the development of new therapeutic approaches to control tumor growth and metastasis promoted by elevated PGE2 levels. PMID:22005950

  15. Enzymatic synthesis of cinnamic acid derivatives.

    PubMed

    Lee, Gia-Sheu; Widjaja, Arief; Ju, Yi-Hsu

    2006-04-01

    Using Novozym 435 as catalyst, the syntheses of ethyl ferulate (EF) from ferulic acid (4-hydroxy 3-methoxy cinnamic acid) and ethanol, and octyl methoxycinnamate (OMC) from p-methoxycinnamic acid and 2-ethyl hexanol were successfully carried out in this study. A conversion of 87% was obtained within 2 days at 75 degrees C for the synthesis of EF. For the synthesis of OMC at 80 degrees C, 90% conversion can be obtained within 1 day. The use of solvent and high reaction temperature resulted in better conversion for the synthesis of cinnamic acid derivatives. Some cinnamic acid esters could also be obtained with higher conversion and shorter reaction times in comparison to other methods reported in the literature. The enzyme can be reused several times before significant activity loss was observed.

  16. Guanosine tetraphosphate as a global regulator of bacterial RNA synthesis: a model involving RNA polymerase pausing and queuing.

    PubMed

    Bremer, H; Ehrenberg, M

    1995-05-17

    A recently reported comparison of stable RNA (rRNA, tRNA) and mRNA synthesis rates in ppGpp-synthesizing and ppGpp-deficient (delta relA delta spoT) bacteria has suggested that ppGpp inhibits transcription initiation from stable RNA promoters, as well as synthesis of (bulk) mRNA. Inhibition of stable RNA synthesis occurs mainly during slow growth of bacteria when cytoplasmic levels of ppGpp are high. In contrast, inhibition of mRNA occurs mainly during fast growth when ppGpp levels are low, and it is associated with a partial inactivation of RNA polymerase. To explain these observations it has been proposed that ppGpp causes transcriptional pausing and queuing during the synthesis of mRNA. Polymerase queuing requires high rates of transcription initiation in addition to polymerase pausing, and therefore high concentrations of free RNA polymerase. These conditions are found in fast growing bacteria. Furthermore, the RNA polymerase queues lead to a promoter blocking when RNA polymerase molecules stack up from the pause site back to the (mRNA) promoter. This occurs most frequently at pause sites close to the promoter. Blocking of mRNA promoters diverts RNA polymerase to stable RNA promoters. In this manner ppGpp could indirectly stimulate synthesis of stable RNA at high growth rates. In the present work a mathematical analysis, based on the theory of queuing, is presented and applied to the global control of transcription in bacteria. This model predicts the in vivo distribution of RNA polymerase over stable RNA and mRNA genes for both ppGpp-synthesizing and ppGpp-deficient bacteria in response to different environmental conditions. It also shows how small changes in basal ppGpp concentrations can produce large changes in the rate of stable RNA synthesis.

  17. [Lipid synthesis by an acidic acid tolerant Rhodotorula glutinis].

    PubMed

    Lin, Zhangnan; Liu, Hongjuan; Zhang, Jian'an; Wang, Gehua

    2016-03-01

    Acetic acid, as a main by-product generated in the pretreatment process of lignocellulose hydrolysis, significantly affects cell growth and lipid synthesis of oleaginous microorganisms. Therefore, we studied the tolerance of Rhodotorula glutinis to acetic acid and its lipid synthesis from substrate containing acetic acid. In the mixed sugar medium containing 6 g/L glucose and 44 g/L xylose, and supplemented with acetic acid, the cell growth was not:inhibited when the acetic acid concentration was below 10 g/L. Compared with the control, the biomass, lipid concentration and lipid content of R. glutinis increased 21.5%, 171% and 122% respectively when acetic acid concentration was 10 g/L. Furthermore, R. glutinis could accumulate lipid with acetate as the sole carbon source. Lipid concentration and lipid yield reached 3.20 g/L and 13% respectively with the initial acetic acid concentration of 25 g/L. The lipid composition was analyzed by gas chromatograph. The main composition of lipid produced with acetic acid was palmitic acid, stearic acid, oleic acid, linoleic acid and linolenic acid, including 40.9% saturated fatty acids and 59.1% unsaturated fatty acids. The lipid composition was similar to that of plant oil, indicating that lipid from oleaginous yeast R. glutinis had potential as the feedstock of biodiesel production. These results demonstrated that a certain concentration of acetic acid need not to be removed in the detoxification process when using lignocelluloses hydrolysate to produce microbial lipid by R. glutinis.

  18. DNA polymerase-α regulates type I interferon activation through cytosolic RNA:DNA synthesis

    PubMed Central

    Starokadomskyy, Petro; Gemelli, Terry; Rios, Jonathan J.; Xing, Chao; Wang, Richard C.; Li, Haiying; Pokatayev, Vladislav; Dozmorov, Igor; Khan, Shaheen; Miyata, Naoteru; Fraile, Guadalupe; Raj, Prithvi; Xu, Zhe; Xu, Zigang; Ma, Lin; Lin, Zhimiao; Wang, Huijun; Yang, Yong; Ben-Amitai, Dan; Orenstein, Naama; Mussaffi, Huda; Baselga, Eulalia; Tadini, Gianluca; Grunebaum, Eyal; Sarajlija, Adrijan; Krzewski, Konrad; Wakeland, Edward K.; Yan, Nan; de la Morena, Maria Teresa; Zinn, Andrew R.; Burstein, Ezra

    2016-01-01

    Aberrant nucleic acids generated during viral replication are the main trigger for antiviral immunity, and mutations disrupting nucleic acid metabolism can lead to autoinflammatory disorders. Here we investigated the etiology of X-linked reticulate pigmentary disorder (XLPDR), a primary immunodeficiency with autoinflammatory features. We discovered that XLPDR is caused by an intronic mutation that disrupts expression of POLA1, the gene encoding the catalytic subunit of DNA polymerase-α. Unexpectedly, POLA1 deficiency results in increased type I interferon production. This enzyme is necessary for RNA:DNA primer synthesis during DNA replication and strikingly, POLA1 is also required for the synthesis of cytosolic RNA:DNA, which directly modulates interferon activation. Altogether, this work identified POLA1 as a critical regulator of the type I interferon response. PMID:27019227

  19. Effect of the Kinetin-Naphthaleneacetic Acid Interaction Upon Total RNA and Protein in Senescing Detached Leaves 1

    PubMed Central

    Vonabrams, G. J.; Pratt, Harlan K.

    1968-01-01

    The interaction between kinetin and naphthaleneacetic acid in the regulation of senescence of excised tissue of mature broccoli leaves has been used to examine the extent of synchrony between changes in chlorophyll, RNA, and protein. Kinetin increased the net uptake of 14C-labeled orotic acid and leucine. Naphthaleneacetic acid decreased the effect of kinetin on net uptake after long treatment, but in short-time treatments the auxin increased the effect of kinetin on net uptake. Results of long (24 hr) treatments indicated a general synchrony between the loss of RNA, protein, and chlorophyll. Naphthaleneacetic acid reduced the stabilizing effect of kinetin upon chlorophyll content and upon the content and synthesis of RNA. In short-time experiments, however, RNA content and synthesis were transiently increased by kinetin, and further increased by kinetin plus naphthaleneacetic acid, while chlorophyll content decreased in the presence of kinetin and decreased further in the presence of kinetin plus naphthaleneacetic acid. Actinomycin-D accelerated the loss of chlorophyll, RNA and protein and strongly depressed the rate of RNA synthesis. In the presence of actinomycin-D the stabilizing effect of kinetin upon RNA was substantially reduced. In contrast, the chlorophyll and protein contents remained higher than in the control. Actinomycin-D did not nullify the basal incorporation of orotic acid into RNA, nor did it negate the effect of kinetin upon incorporation. The failure of synchrony between changes in chlorophyll and RNA does not substantiate the proposal that kinetin regulates senescence by a direct effect upon DNA-dependent RNA synthesis. Images PMID:5700020

  20. Ribonucleic acid synthesis in chloroplasts

    PubMed Central

    Hartley, M. R.; Ellis, R. J.

    1973-01-01

    Chloroplasts isolated from young spinach leaves incorporate [3H]uridine into RNA. This incorporation shows an absolute requirement for light and does not occur in lysed chloroplasts. Fractionation by polyacrylamide-gel electrophoresis of the RNA synthesized in vitro reveals a major discrete product of molecular weight 2.7×106 and two minor products of molecular weight 1.2×106 and 0.47×106. These discrete products are super-imposed on a background of polydisperse RNA. The incorporation of 32Pi into chloroplast rRNA species (mol.wt. 1.05×106 and 0.56×106) in excised spinach leaves proceeds after a distinct lag period compared with the incorporation into cytoplasmic rRNA species (mol.wt. 1.34×106 and 0.7×106). Incorporation of 32Pi into chloroplast RNA species of molecular weight 2.7×106, 1.2×106, 0.65×106 and 0.47×106 proceeds without such a time-lag. The kinetics of labelling of the individual RNA components is consistent with the rapidly labelled RNA species of molecular weight 1.2×106 and 0.65×106 being precursors to the more slowly labelled rRNA species of molecular weight 1.05×106 and 0.56×106 respectively. PMID:4723226

  1. Switchable Protecting Strategy for Solid Phase Synthesis of DNA and RNA Interacting Nucleopeptides.

    PubMed

    Mercurio, Maria Emilia; Tomassi, Stefano; Gaglione, Maria; Russo, Rosita; Chambery, Angela; Lama, Stefania; Stiuso, Paola; Cosconati, Sandro; Novellino, Ettore; Di Maro, Salvatore; Messere, Anna

    2016-12-02

    Nucleopeptides are promising nucleic acid mimetics in which the peptide backbone bears nucleobases. They can recognize DNA and RNA targets modulating their biological functions. To date, the lack of an effective strategy for the synthesis of nucleopeptides prevents their evaluation for biological and biomedical applications. Herein, we describe an unprecedented approach that enables the synthesis of cationic both homo and heterosequence nucleopeptides wholly on solid support with high yield and purity. Spectroscopic studies indicate advantageous properties of the nucleopeptides in terms of binding, thermodynamic stability and sequence specific recognition. Biostability assay and laser scanning confocal microscopy analyses reveal that the nucleopeptides feature acceptable serum stability and ability to cross the cell membrane.

  2. Synthesis of Geranyl-2-Thiouridine-Modified RNA.

    PubMed

    Wang, Rui; Haruehanroengra, Phensinee; Sheng, Jia

    2017-03-02

    This unit describes the chemical synthesis of the S-geranyl-2-thiouridine (ges(2) U) phosphoramidite and its incorporation into RNA oligonucleotides through solid-phase synthesis. Starting from the 2-thiouracil nucleobase and the protected ribose, the 2-thiouridine is synthesized and the geranyl functionality is introduced into the 2-thio position by using geranyl bromide as the geranylating reagent before the conversion of this modified nucleoside into a phosphoramidite building block. The modified phosphoramidite is used to make the geranyl-RNA oligonucleotides with a solid-phase DNA synthesizer. These RNA strands are then purified by ion-exchange HPLC before further structural and functional studies, such as base pairing and enzyme recognition, can be done. © 2017 by John Wiley & Sons, Inc.

  3. Amino acid metabolism and protein synthesis in malarial parasites*

    PubMed Central

    Sherman, I. W.

    1977-01-01

    amino acid sources for parasite protein synthesis; purification and characterization of plasmodial proteinases; and in vitro translation of parasite messenger RNA. PMID:338183

  4. Synthesis of Pulcherriminic Acid by Bacillus subtilis

    PubMed Central

    Uffen, Robert L.; Canale-Parola, E.

    1972-01-01

    The pathway of pulcherriminic acid synthesis in Bacillus subtilis strains AM and AM-L11 (a leucine-requiring auxotroph) was investigated. Determinations of radioactivity in pulcherriminic acid synthesized by cells growing in media containing 14C-labeled amino acids indicated that B. subtilis produced pulcherriminic acid from l-leucine. The organism utilized the carbon skeletons of two l-leucine molecules to synthesize one molecule of pulcherriminic acid. Similar results were obtained with starved cell suspensions. Growing cells formed significant amounts of pulcherriminic acid only in media including a carbohydrate such as starch. However, carbohydrate carbon was not required for the synthesis of pulcherriminic acid molecules. Data obtained with cell suspensions supported the hypothesis that cyclo-l-leucyl-l-leucyl is an intermediate in pulcherriminic acid biosynthesis and indicated that molecular oxygen is required for the conversion of cyclo-l-leucyl-l-leucyl to pulcherriminic acid. A pathway for the synthesis of pulcherrimin from l-leucine in B. subtilis is proposed. PMID:4204912

  5. Nitrated fatty acids: synthesis and measurement.

    PubMed

    Woodcock, Steven R; Bonacci, Gustavo; Gelhaus, Stacy L; Schopfer, Francisco J

    2013-06-01

    Nitrated fatty acids are the product of nitrogen dioxide reaction with unsaturated fatty acids. The discovery of peroxynitrite and peroxidase-induced nitration of biomolecules led to the initial reports of endogenous nitrated fatty acids. These species increase during ischemia/reperfusion, but concentrations are often at or near the limits of detection. Here, we describe multiple methods for nitrated fatty acid synthesis and sample extraction from complex biological matrices and a rigorous method of qualitative and quantitative detection of nitrated fatty acids by liquid chromatography-mass spectrometry. In addition, optimized instrument conditions and caveats regarding data interpretation are discussed.

  6. Nitrated fatty acids: Synthesis and measurement

    PubMed Central

    Woodcock, Steven R.; Bonacci, Gustavo; Gelhaus, Stacy L.; Schopfer, Francisco J.

    2012-01-01

    Nitrated fatty acids are the product of nitrogen dioxide reaction with unsaturated fatty acids. The discovery of peroxynitrite and peroxidase-induced nitration of biomolecules led to the initial reports of endogenous nitrated fatty acids. These species increase during ischemia reperfusion, but concentrations are often at or near the limits of detection. Here, we describe multiple methods for nitrated fatty acid synthesis, sample extraction from complex biological matrices, and a rigorous method of qualitative and quantitative detection of nitrated fatty acids by LC-MS. In addition, optimized instrument conditions and caveats regarding data interpretation are discussed. PMID:23200809

  7. Rubella virus capsid protein modulation of viral genomic and subgenomic RNA synthesis

    SciTech Connect

    Tzeng, W.-P.; Frey, Teryl K. . E-mail: tfrey@gsu.edu

    2005-07-05

    The ratio of the subgenomic (SG) to genome RNA synthesized by rubella virus (RUB) replicons expressing the green fluorescent protein reporter gene (RUBrep/GFP) is substantially higher than the ratio of these species synthesized by RUB (4.3 for RUBrep/GFP vs. 1.3-1.4 for RUB). It was hypothesized that this modulation of the viral RNA synthesis was by one of the virus structural protein genes and it was found that introduction of the capsid (C) protein gene into the replicons as an in-frame fusion with GFP resulted in an increase of genomic RNA production (reducing the SG/genome RNA ratio), confirming the hypothesis and showing that the C gene was the moiety responsible for the modulation effect. The N-terminal one-third of the C gene was required for the effect of be exhibited. A similar phenomenon was not observed with the replicons of Sindbis virus, a related Alphavirus. Interestingly, modulation was not observed when RUBrep/GFP was co-transfected with either other RUBrep or plasmid constructs expressing the C gene, demonstrating that modulation could occur only when the C gene was provided in cis. Mutations that prevented translation of the C protein failed to modulate RNA synthesis, indicating that the C protein was the moiety responsible for modulation; consistent with this conclusion, modulation of RNA synthesis was maintained when synonymous codon mutations were introduced at the 5' end of the C gene that changed the C gene sequence without altering the amino acid sequence of the C protein. These results indicate that C protein translated in proximity of viral replication complexes, possibly from newly synthesized SG RNA, participate in regulating the replication of viral RNA.

  8. Synthesis of Nucleic Acid and Protein in L Cells Infected with the Agent of Meningopneumonitis

    PubMed Central

    Schechter, Esther M.

    1966-01-01

    Schechter, Esther M. (The University of Chicago, Chicago, Ill.). Synthesis of nucleic acid and protein in L cells infected with the agent of meningopneumonitis. J. Bacteriol. 91:2069–2080. 1966.—Synthesis of deoxyribonucleic acid (DNA), ribonucleic acid (RNA), and protein in uninfected L cells and in L cells infected with the meningopneumonitis agent was compared by measuring rates of incorporation of H3-cytidine and C14-lysine into nuclear, cytoplasmic, and agent fractions in successive 5-hr periods during the meningopneumonitis growth cycle. Synthesis of meningopneumonitis DNA, RNA, and protein was first clearly evident in the labeling period 15 to 20 hr after infection, soon after initiation of agent multiplication. The rates of synthesis of agent DNA, RNA, and protein increased logarithmically for a brief period and then declined. However, rates of isotope incorporation into all three meningopneumonitis macromolecules were sustained at near maximal values throughout the remainder of the meningopneumonitis growth cycle. These data are most readily interpreted in terms of multiplication of the meningopneumonitis agent by binary fission. The L cell response to infection was a decreased rate of DNA and RNA synthesis and an accelerated rate of cell death. Host protein synthesis was unaffected. The inhibition of nucleic acid synthesis in infected L cells probably involved competition between host and parasite for nucleic acid precursors. Different sublines of L cells varied greatly in the degree to which their nucleic acid-synthesizing mechanisms were damaged by infection. The cytoplasm of infected L cells contained newly synthesized DNA and RNA that could not be accounted for as intact meningopneumonitis cells. This nucleic acid probably arose from disintegration of the fragile intracellular forms of the meningopneumonitis agent. Images PMID:5937251

  9. Genetic modulation of RNA metabolism in Drosophilia. I. Increased rate of ribosomal RNA synthesis.

    PubMed

    Clark, S H; Strausbaugh, L D; Kiefer, B I

    1977-08-01

    It has been suggested that a particular Y chromosome which is rDNA-deficient (YbbSuVar-5) may be associated with an increased utilization of rDNA template in adult testes (Shermoen and Kiefer 1975). To extend the observations on this chromosome, experiments were designed to determine if the chromosome has an effect on rRNA synthesis in bobbed adults and on classic bobbed phenotypes (shortened and thinner scutellar bristles and delayed development). Specific activity measurements were made on rRNA extracted from adult males of the genotypes car bb/YbbSuVar-5, which are rDNA-deficient to the same extent, and from Samarkand+ isogenic (Sam+ iso), which is a wild-type stock. The resulting data demonstrated that the presence of the YbbSuVar-5 chromosome increases the rate of ribosomal RNA synthesis in adult flies. In addition, it was found that the presence of this particular Y chromosome restores wild-type bristle phenotype and development time. Appropriate genetic crosses indicate that the observed effects (increased rRNA synthesis, restoration of wild-type phenotype) are a function of this particular Y chromosome, and are not due to autosomal factors. The results of these experiments suggest that the rate of rRNA accumulation is under genetic control.

  10. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  11. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  12. Evolution of Protein Synthesis from an RNA World

    PubMed Central

    Noller, Harry F.

    2012-01-01

    SUMMARY Because of the molecular complexity of the ribosome and protein synthesis, it is a challenge to imagine how translation could have evolved from a primitive RNA World. Two specific suggestions are made here to help to address this, involving separate evolution of the peptidyl transferase and decoding functions. First, it is proposed that translation originally arose not to synthesize functional proteins, but to provide simple (perhaps random) peptides that bound to RNA, increasing its available structure space, and therefore its functional capabilities. Second, it is proposed that the decoding site of the ribosome evolved from a mechanism for duplication of RNA. This process involved homodimeric “duplicator RNAs,” resembling the anticodon arms of tRNAs, which directed ligation of trinucleotides in response to an RNA template. PMID:20610545

  13. Correlation Between the Rate of Ribonucleic Acid Synthesis and the Level of Valyl Transfer Ribonucleic Acid in Mutants of Escherichia coli

    PubMed Central

    Kaplan, Sam

    1969-01-01

    By use of a mutant of Escherichia coli with a partially thermolabile transfer ribonucleic acid (tRNA) synthase, it was possible to regulate the rate of RNA synthesis over a 10-fold range. The addition of chloramphenicol to cultures kept at the nonpermissive temperature stimulated RNA synthesis. The longer the culture was kept at the nonpermissive temperature prior to addition of chloramphenicol, the lower was the resulting rate of RNA synthesis. The decrease in the rate of incorporation of labeled uracil into RNA was correlated with the decrease in the level of valyl tRNA. Additional experiments provided evidence which may be interpreted as indicating that valyl tRNA does not, by itself, react with the RNA-forming system. PMID:4891259

  14. [Total synthesis of nordihydroguaiaretic acid].

    PubMed

    Wu, A X; Zhao, Y R; Chen, N; Pan, X F

    1997-04-01

    beta-Keto ester(5) was obtained from vanilin through etherification, oxidation and condensation with acetoacetic ester, (5) on oxidative coupling reaction by NaOEt/I2 produced dimer (6) in high yield. Acid catalyzed cyclodehydration of (6) gave the furan derivative(7), and by a series of selective hydrogenation nordihydroguaiaretic acid, furoguaiacin dimethyl ether and dihydroguaiaretic acid dimethyl ether were synthesized.

  15. RNA Synthesis in Whole Cells and Protoplasts of Centaurea

    PubMed Central

    Kulikowski, Robert R.; Mascarenhas, Joseph P.

    1978-01-01

    Protoplasts enzymically isolated from suspension cultures of Centaurea cyanus L. incorporate radioactive precursors into RNA with kinetics similar to that of whole cells. There are differences, however, in several other aspects of RNA metabolism. The proportion of total RNA that contains poly(A) sequences (25 to 30%) is similar in both freshly isolated protoplasts and whole cells after a 20-minute pulse with [3H]adenosine. After a 4-hour pulse, however, poly(A)-containing RNA makes up 30% of the total RNA in protoplasts whereas it drops to 8% in whole cells. There appears to be a faulty processing of ribosomal precursor into the mature ribosomal species, as the precursor seems to accumulate to higher levels relative to the mature 18S and 25S rRNAs in protoplasts as compared to whole cells. Additional differences are seen in the size distributions of poly(A)-containing RNA, although the length of the poly(A) segment is similar in both protoplasts and whole cells. Within 24 hours protoplasts appear to have resumed a pattern of RNA synthesis similar to that of whole cells. PMID:16660339

  16. Enzymatic Synthesis of Nucleic Acids with Defined Regioisomeric 2'-5' Linkages.

    PubMed

    Cozens, Christopher; Mutschler, Hannes; Nelson, Geoffrey M; Houlihan, Gillian; Taylor, Alexander I; Holliger, Philipp

    2015-12-14

    Information-bearing nucleic acids display universal 3'-5' linkages, but regioisomeric 2'-5' linkages occur sporadically in non-enzymatic RNA synthesis and may have aided prebiotic RNA replication. Herein we report on the enzymatic synthesis of both DNA and RNA with site-specific 2'-5' linkages by an engineered polymerase using 3'-deoxy- or 3'-O-methyl-NTPs as substrates. We also report the reverse transcription of the resulting modified nucleic acids back to 3'-5' linked DNA with good fidelity. This enables a fast and simple method for "structural mutagenesis" by the position-selective incorporation of 2'-5' linkages, whereby nucleic acid structure and function may be probed through local distortion by regioisomeric linkages while maintaining the wild-type base sequence as we demonstrate for the 10-23 RNA endonuclease DNAzyme.

  17. The Roles of RNA in the Synthesis of Protein

    PubMed Central

    Moore, Peter B.; Steitz, Thomas A.

    2011-01-01

    The crystal structures of ribosomes that have been obtained since 2000 have transformed our understanding of protein synthesis. In addition to proving that RNA is responsible for catalyzing peptide bond formation, these structures have provided important insights into the mechanistic details of how the ribosome functions. This review emphasizes what has been learned about the mechanism of peptide bond formation, the antibiotics that inhibit ribosome function, and the fidelity of decoding. PMID:21068149

  18. Synthesis of pyromellitic acid esters

    NASA Technical Reports Server (NTRS)

    Fedorova, V. A.; Donchak, V. A.; Martynyuk-Lototskaya, A. N.

    1985-01-01

    The ester acids necessary for studyng the thermochemical properties of pyromellitic acid (PMK)-based peroxides were investigated. Obtaining a tetramethyl ester of a PMK was described. The mechanism of an esterification reaction is discussed, as is the complete esterification of PMK with primary alcohol.

  19. Facile synthesis of a 3-deazaadenosine phosphoramidite for RNA solid-phase synthesis

    PubMed Central

    2016-01-01

    Access to 3-deazaadenosine (c3A) building blocks for RNA solid-phase synthesis represents a severe bottleneck in modern RNA research, in particular for atomic mutagenesis experiments to explore mechanistic aspects of ribozyme catalysis. Here, we report the 5-step synthesis of a c3A phosphoramidite from cost-affordable starting materials. The key reaction is a silyl-Hilbert–Johnson nucleosidation using unprotected 6-amino-3-deazapurine and benzoyl-protected 1-O-acetylribose. The novel path is superior to previously described syntheses in terms of efficacy and ease of laboratory handling. PMID:28144324

  20. Catalytic effects of Murchison material: prebiotic synthesis and degradation of RNA precursors.

    PubMed

    Saladino, Raffaele; Crestini, Claudia; Cossetti, Cristina; Di Mauro, Ernesto; Deamer, David

    2011-10-01

    Mineral components of the Murchison meteorite were investigated in terms of potential catalytic effects on synthetic and hydrolytic reactions related to ribonucleic acid. We found that the mineral surfaces catalyzed condensation reactions of formamide to form carboxylic acids, amino acids, nucleobases and sugar precursors. These results suggest that formamide condensation reactions in the parent bodies of carbonaceous meteorites could give rise to multiple organic compounds thought to be required for the emergence of life. Previous studies have demonstrated similar catalytic effects for mineral assemblies likely to have been present in the early Earth environment. The minerals had little or no effect in promoting hydrolysis of RNA (24mer of polyadenylic acid) at 80°C over a pH range from 4.2 to 9.3. RNA was most stable in the neutral pH range, with a half-life ~5 h, but at higher and lower pH ranges the half-life decreased to ~1 h. These results suggest that if RNA was somehow incorporated into a primitive form of RNA-based thermophilic life, either it must be protected from random hydrolytic events, or the rate of synthesis must exceed the rate of hydrolysis.

  1. Synthesis of folate-functionalized RAFT polymers for targeted siRNA delivery.

    PubMed

    Benoit, Danielle S W; Srinivasan, Selvi; Shubin, Andrew D; Stayton, Patrick S

    2011-07-11

    Receptor-mediated, cell-specific delivery of siRNA enables silencing of target genes in specific tissues, opening the door to powerful therapeutic options for a multitude of diseases. However, the development of delivery systems capable of targeted and effective siRNA delivery typically requires multiple steps and the use of sophisticated, orthogonal chemistries. Previously, we developed diblock copolymers consisting of dimethaminoethyl methacrylate-b-dimethylaminoethyl methacrylate-co-butyl methacrylate-co-propylacrylic acid as potent siRNA delivery systems that protect siRNA from enzymatic degradation and enable its cytosolic delivery through pH-responsive, endosomolytic behavior. (1, 2) These architectures were polymerized using a living radical polymerization method, specifically reversible addition-fragmentation chain transfer (RAFT) polymerization, which employs a chain transfer agent (CTA) to modulate the rate of reaction, resulting in polymers with low polydispersity and telechelic chain ends reflecting the chemistry of the CTA. Here we describe the straightforward, facile synthesis of a folate receptor-targeted diblock copolymer siRNA delivery system because the folate receptor is an attractive target for tumor-selective therapies as a result of its overexpression in a number of cancers. Specifically, we detail the de novo synthesis of a folate-functionalized CTA, use the folate-CTA for controlled polymerizations of diblock copolymers, and demonstrate efficient, specific cellular folate receptor interaction and in vitro gene knockdown using the folate-functionalized polymer.

  2. Alphavirus RNA synthesis and non-structural protein functions

    PubMed Central

    Rupp, Jonathan C.; Sokoloski, Kevin J.; Gebhart, Natasha N.

    2015-01-01

    The members of the genus Alphavirus are positive-sense RNA viruses, which are predominantly transmitted to vertebrates by a mosquito vector. Alphavirus disease in humans can be severely debilitating, and depending on the particular viral species, infection may result in encephalitis and possibly death. In recent years, alphaviruses have received significant attention from public health authorities as a consequence of the dramatic emergence of chikungunya virus in the Indian Ocean islands and the Caribbean. Currently, no safe, approved or effective vaccine or antiviral intervention exists for human alphavirus infection. The molecular biology of alphavirus RNA synthesis has been well studied in a few species of the genus and represents a general target for antiviral drug development. This review describes what is currently understood about the regulation of alphavirus RNA synthesis, the roles of the viral non-structural proteins in this process and the functions of cis-acting RNA elements in replication, and points to open questions within the field. PMID:26219641

  3. A plausibly prebiotic synthesis of phosphonic acids.

    PubMed

    de Graaf, R M; Visscher, J; Schwartz, A W

    1995-11-30

    The insolubility of calcium phosphate in water is a significant stumbling block in the chemistry required for the origin of life. The discovery of alkyl phosphonic acids in the Murchison meteorite suggests the possibility of delivery of these water-soluble, phosphorus-containing molecules by meteorites or comets to the early Earth. This could have provided a supply of organic phosphorus for the earliest stages of chemical evolution; although probably not components of early genetic systems, phosphonic acids may have been precursors to the first nucleic acids. Here we report the synthesis of several phosphonic acids, including the most abundant found in the Murchison meteorite, by ultraviolet irradiation of orthophosphorous acid in the presence of formaldehyde, primary alcohols, or acetone. We argue that similar reactions might explain the presence of phosphonic acids in Murchison, and could also have occurred on the prebiotic Earth.

  4. In Vitro Synthesis of Rous Sarcoma Virus-Specific RNA is Catalyzed by a DNA-Dependent RNA Polymerase

    PubMed Central

    Rymo, L.; Parsons, J. T.; Coffin, J. M.; Weissmann, C.

    1974-01-01

    Synthesis of Rous sarcoma virus RNA was examined in vitro with a new assay for radioactive virus-specific RNA. Nuclei from infected and uninfected cells were incubated with ribonucleoside [α-32P]triphosphates, Mn++, Mg++ and (NH4)2SO4. Incorporation into total and viral RNA proceeded with similar kinetics for up to 25 min at 37°. About 0.5% of the RNA synthesized by the infected system was scored as virus-specific, compared to 0.03% of the RNA from the uninfected system and 0.005% of the RNA synthesized by monkey kidney cell nuclei. Preincubation with DNase or actinomycin D completely suppressed total and virus-specific RNA synthesis. α-Amanitin, a specific inhibitor of eukaryotic RNA polymerase II, completely inhibited virus-specific RNA synthesis, while reducing total RNA synthesis by only 50%. We conclude that tumor virus-specific RNA is synthesized on a DNA template, most probably by the host's RNA polymerase II. PMID:4368801

  5. pp32 and APRIL are host cell-derived regulators of influenza virus RNA synthesis from cRNA

    PubMed Central

    Sugiyama, Kenji; Kawaguchi, Atsushi; Okuwaki, Mitsuru; Nagata, Kyosuke

    2015-01-01

    Replication of influenza viral genomic RNA (vRNA) is catalyzed by viral RNA-dependent RNA polymerase (vRdRP). Complementary RNA (cRNA) is first copied from vRNA, and progeny vRNAs are then amplified from the cRNA. Although vRdRP and viral RNA are minimal requirements, efficient cell-free replication could not be reproduced using only these viral factors. Using a biochemical complementation assay system, we found a novel activity in the nuclear extracts of uninfected cells, designated IREF-2, that allows robust unprimed vRNA synthesis from a cRNA template. IREF-2 was shown to consist of host-derived proteins, pp32 and APRIL. IREF-2 interacts with a free form of vRdRP and preferentially upregulates vRNA synthesis rather than cRNA synthesis. Knockdown experiments indicated that IREF-2 is involved in in vivo viral replication. On the basis of these results and those of previous studies, a plausible role(s) for IREF-2 during the initiation processes of vRNA replication is discussed. DOI: http://dx.doi.org/10.7554/eLife.08939.001 PMID:26512887

  6. In vitro synthesis of thymosin beta 4 encoded by rat spleen mRNA.

    PubMed Central

    Filipowicz, A W; Horecker, B L

    1983-01-01

    Thymosin beta 4, containing 43 amino acids and acetylated at the NH2 terminus, is synthesized in vitro in a rabbit reticulocyte lysate or in a yeast protein-synthesis system in the presence of mRNA from rat spleen. The product formed was identified as beta 4 by immunoprecipitation by a specific anti-beta 4 antiserum, comigration with authentic beta 4 in NaDodSO4/polyacrylamide gel electrophoresis and in HPLC, and identity of peptide fragments. The immunoprecipitable product generated in the wheat germ protein-synthesizing system emerged slightly ahead of beta 4 in HPLC and appeared to lack the NH2-terminal acetyl group. There was no evidence for formation of a larger polypeptide precursor of beta 4 in any of the three systems used. In sucrose density gradient centrifugation, the mRNA coding for beta 4 was recovered in the 7-8S mRNA fraction. Images PMID:6572941

  7. Gene activity during germination of spores of the fern, Onoclea sensibilis: RNA and protein synthesis and the role of stored mRNA

    NASA Technical Reports Server (NTRS)

    Raghavan, V.

    1991-01-01

    Pattern of 3H-uridine incorporation into RNA of spores of Onoclea sensibilis imbibed in complete darkness (non-germinating conditions) and induced to germinate in red light was followed by oligo-dT cellulose chromatography, gel electrophoresis coupled with fluorography and autoradiography. In dark-imbibed spores, RNA synthesis was initiated about 24 h after sowing, with most of the label accumulating in the high mol. wt. poly(A) -RNA fraction. There was no incorporation of the label into poly(A) +RNA until 48 h after sowing. In contrast, photo-induced spores began to synthesize all fractions of RNA within 12 h after sowing and by 24 h, incorporation of 3H-uridine into RNA of irradiated spores was nearly 70-fold higher than that into dark-imbibed spores. Protein synthesis, as monitored by 3H-arginine incorporation into the acid-insoluble fraction and by autoradiography, was initiated in spores within 1-2 h after sowing under both conditions. Autoradiographic experiments also showed that onset of protein synthesis in the cytoplasm of the germinating spore is independent of the transport of newly synthesized nuclear RNA. One-dimensional sodium dodecyl sulphate-polyacrylamide gel electrophoresis of 35S-methionine-labelled proteins revealed a good correspondence between proteins synthesized in a cell-free translation system directed by poly(A) +RNA of dormant spores and those synthesized in vivo by dark-imbibed and photo-induced spores. These results indicate that stored mRNAs of O. sensibilis spores are functionally competent and provide templates for the synthesis of proteins during dark-imbibition and germination.

  8. Synthesis of Alkyl Methylphosphonic Acid Esters

    SciTech Connect

    Mong, Gary M.; Harvey, Scott D.; Campbell, James A.

    2005-08-01

    This manuscript describes a simple synthesis and purification of cyclohexyl methylphosphonic and isopropyl methylphosphonic acids that provides high purity (>95% purity) product in gram quantities. Based on needs for improved analytical methods for indirect detection of nerve agent use, there is an increasing demand for these nerve agent hydrolysis products. These products are not commercially available. Synthesis is based on reaction of equimolar amounts of alcohol with methylphosphonic dichloride in toluene followed by the addition of excess water (two mole equivalents). The product was then extracted from the resulting aqueous layer into chloroform. The extraction scheme proved highly effective in removing unreacted starting materials and reaction by-products.

  9. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the snythesis methods of the prior art.

  10. Improved Incorporation of Noncanonical Amino Acids by an Engineered tRNA(Tyr) Suppressor.

    PubMed

    Rauch, Benjamin J; Porter, Joseph J; Mehl, Ryan A; Perona, John J

    2016-01-26

    The Methanocaldcoccus jannaschii tyrosyl-tRNA synthetase (TyrRS):tRNA(Tyr) cognate pair has been used to incorporate a large number of noncanonical amino acids (ncAAs) into recombinant proteins in Escherichia coli. However, the structural elements of the suppressor tRNA(Tyr) used in these experiments have not been examined for optimal performance. Here, we evaluate the steady-state kinetic parameters of wild-type M. jannaschii TyrRS and an evolved 3-nitrotyrosyl-tRNA synthetase (nitroTyrRS) toward several engineered tRNA(Tyr) suppressors, and we correlate aminoacylation properties with the efficiency and fidelity of superfolder green fluorescent protein (sfGFP) synthesis in vivo. Optimal ncAA-sfGFP synthesis correlates with improved aminoacylation kinetics for a tRNA(Tyr) amber suppressor with two substitutions in the anticodon loop (G34C/G37A), while four additional mutations in the D and variable loops, present in the tRNA(Tyr) used in all directed evolution experiments to date, are deleterious to function both in vivo and in vitro. These findings extend to three of four other evolved TyrRS enzymes that incorporate distinct ncAAs. Suppressor tRNAs elicit decreases in amino acid Km values for both TyrRS and nitroTyrRS, suggesting that direct anticodon recognition by TyrRS need not be an impediment to superior performance of this orthogonal system and offering insight into novel approaches for directed evolution. The G34C/G37A tRNA(Tyr) may enhance future incorporation of many ncAAs by engineered TyrRS enzymes.

  11. Total chemical synthesis of a 77-nucleotide-long RNA sequence having methionine-acceptance activity.

    PubMed Central

    Ogilvie, K K; Usman, N; Nicoghosian, K; Cedergren, R J

    1988-01-01

    Chemical synthesis is described of a 77-nucleotide-long RNA molecule that has the sequence of an Escherichia coli Ado-47-containing tRNA(fMet) species in which the modified nucleosides have been substituted by their unmodified parent nucleosides. The sequence was assembled on a solid-phase, controlled-pore glass support in a stepwise manner with an automated DNA synthesizer. The ribonucleotide building blocks used were fully protected 5'-monomethoxytrityl-2'-silyl-3'-N,N-diisopropylaminophosphoram idites. p-Nitro-phenylethyl groups were used to protect the O6 of guanine residues. The fully deprotected tRNA analogue was characterized by polyacrylamide gel electrophoresis (sizing), terminal nucleotide analysis, sequencing, and total enzyme degradation, all of which indicated that the sequence was correct and contained only 3-5 linkages. The 77-mer was then assayed for amino acid acceptor activity by using E. coli methionyl-tRNA synthetase. The results indicated that the synthetic product, lacking modified bases, is a substrate for the enzyme and has an amino acid acceptance 11% of that of the major native species, tRNA(fMet) containing 7-methylguanosine at position 47. Images PMID:3413059

  12. In vitro DNA dependent synthesis of globin RNA sequences from erythroleukemic cell chromatin.

    PubMed

    Reff, M E; Davidson, R L

    1979-01-01

    Murine erythroleukemic cells in culture accumulate cytoplasmic globin mRNA during differentiation induced by dimethyl sulfoxide (DMSO)1. Chromatin was prepared from DMSO induced erythroleukemic cells that were transcribing globin RNA in order to determine whether in vitro synthesis of globin RNA sequences was possible from chromatin. RNA was synthesized in vitro using 5-mercuriuridine triphosphate and exogenous Escheria coli RNA polymerase. Newly synthesized mercurated RNA was purified from endogenous chromatin associated RNA by affinity chromatography on a sepharose sulfhydryl column, and the globin RNA sequence content of the mercurated RNA was assayed by hybridization to cDNA globin. The synthesis of globin RNA sequences was shown to occur and to be sensitive to actinomycin and rifampicin and insensitive to alpha-amanitin. In contrast, synthesis of globin RNA sequence synthesis was not detected in significant amounts from chromatin prepared from uninduced erythroleukemic cells, nor from uninduced cell chromatin to which globin RNA was added prior to transcription. Isolated RNA:cDNA globin hybrids were shown to contain mercurated RNA by affinity chromatography. These results indicated that synthesis of globin RNA sequences from chromatin can be performed by E. coli RNA polymerase.

  13. Benzene-free synthesis of adipic acid.

    PubMed

    Niu, Wei; Draths, K M; Frost, J W

    2002-01-01

    Strains of Escherichia coli were constructed and evaluated that synthesized cis,cis-muconic acid from D-glucose under fed-batch fermentor conditions. Chemical hydrogenation of the cis,cis-muconic acid in the resulting fermentation broth has also been examined. Biocatalytic synthesis of adipic acid from glucose eliminates two environmental concerns characteristic of industrial adipic acid manufacture: use of carcinogenic benzene and benzene-derived chemicals as feedstocks and generation of nitrous oxide as a byproduct of a nitric acid catalyzed oxidation. While alternative catalytic syntheses that eliminate the use of nitric acid have been developed, most continue to rely on petroleum-derived benzene as the ultimate feedstock. In this study, E. coli WN1/pWN2.248 was developed that synthesized 36.8 g/L of cis,cis-muconic acid in 22% (mol/mol) yield from glucose after 48 h of culturing under fed-batch fermentor conditions. Optimization of microbial cis,cis-muconic acid synthesis required expression of three enzymes not typically found in E. coli. Two copies of the Klebsiella pneumoniae aroZ gene encoding DHS dehydratase were inserted into the E. coli chromosome, while the K. pneumoniae aroY gene encoding PCA decarboxylase and the Acinetobacter calcoaceticus catA gene encoding catechol 1,2-dioxygenase were expressed from an extrachromosomal plasmid. After fed-batch culturing of WN1/pWN2.248 was complete, the cells were removed from the broth, which was treated with activated charcoal and subsequently filtered to remove soluble protein. Hydrogenation of the resulting solution with 10% Pt on carbon (5% mol/mol) at 3400 kPa of H2 pressure for 2.5 h at ambient temperature afforded a 97% (mol/mol) conversion of cis,cis-muconic acid into adipic acid.

  14. Synthesis of alpha-amino acids

    DOEpatents

    Davis, J.W. Jr.

    1983-01-25

    A method is described for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R[sub 1]R[sub 2]C(OSOCl)CN, R[sub 1]R[sub 2]C(Cl)CN and [R[sub 1]R[sub 2]C(CN)O][sub 2]SO wherein R[sub 1] and R[sub 2] are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art. No Drawings

  15. Expanding tRNA recognition of a tRNA synthetase by a single amino acid change

    PubMed Central

    Feng, Liang; Tumbula-Hansen, Debra; Toogood, Helen; Söll, Dieter

    2003-01-01

    Aspartyl-tRNA synthetase (AspRS) occurs in two types: the discriminating enzyme (D-AspRS) forms only Asp-tRNAAsp, whereas the nondiscriminating enzyme (ND-AspRS) also synthesizes Asp-tRNAAsn, which is a required intermediate for protein synthesis in many organisms. We attempted to expand the tRNA recognition of the discriminating Thermococcus kodakaraensis AspRS to that of a ND-AspRS by in vitro mutagenesis. An alignment of 26 archaeal AspRS proteins revealed two positions (26 and 85 in the T. kodakaraensis sequence) whose amino acid identity changes according to the enzymes' tRNA specificity. In their anticodon-binding domain, D-AspRS proteins contain W26 (or Q26) and K85, compared with H26 and P85 in the ND-AspRSs. T. kodakaraensis AspRS gained the ability to form Asp-tRNAAsn in vitro when the W26H or K85P changes were introduced independently or in combination. In the aminoacylation of tRNAAsn or tRNAAsp transcripts, the mutant enzymes displayed at least a 100- to 500-fold change in tRNA specificity, as judged by the ratio of the kcat/Km values of Asp-tRNAAsp vs. Asp-tRNAAsn formation. That T. kodakaraensis mutant AspRSs mischarge tRNAAsn was also manifested in the higher level (1.7%) of aspartylation of unfractionated Pyrococcus tRNA compared with that achieved by the wild-type enzyme (0.9%). Northern blot analysis of the Asp-tRNA separated by acid/urea gel electrophoresis confirmed the in vitro synthesis of Asp-tRNAAsn. A structure-based model points to a direct interaction of K85 in T. kodakaraensis AspRS with the anticodon nucleotide C36 of tRNAAsp. Thus, a switch between D-AspRS and ND-AspRS enzymes could have evolved with only limited amino acid changes. PMID:12730374

  16. The synthesis of ribonucleic acid in immature rat uterus responding to oestradiol-17β

    PubMed Central

    Knowler, J. T.; Smellie, R. M. S.

    1971-01-01

    Stimulation of incorporation of labelled precursors into the RNA of immature rat uterus is an early result of oestradiol-17β action. However, the extent of the increased incorporation varies with the mode of administration of the labelled precursors and with the weight of the rat. At the age and weight range normally used response is maximal at ten times control incorporation, 4h after the administration of 0.3μg or more of oestradiol-17β. Under these conditions the stimulation of incorporation into the acid-soluble fraction is only 2–2.5-fold. When the purified RNA is separated on polyacrylamide gels the major increase in incorporation of radioactive precursor is found in rRNA and 4S RNA; the formation of the former has been followed from the 45S precursor. Preceding these events by at least 30min, however, is an increase in the incorporation of precursor into RNA species of very high molecular weight, which remained in the first few slices of the gel. The possible significance of these findings is discussed. The increased synthesis of rRNA in response to oestradiol-17β is more strongly inhibited by actinomycin D than the synthesis of other RNA species. Cycloheximide, depending on time of administration and dosage, inhibits either RNA synthesis or the maturation of rRNA. PMID:5144761

  17. An intrinsically disordered peptide from Ebola virus VP35 controls viral RNA synthesis by modulating nucleoprotein-RNA interactions

    SciTech Connect

    Leung, Daisy  W.; Borek, Dominika; Luthra, Priya; Binning, Jennifer  M.; Anantpadma, Manu; Liu, Gai; Harvey, Ian B.; Su, Zhaoming; Endlich-Frazier, Ariel; Pan, Juanli; Shabman, Reed  S.; Chiu, Wah; Davey, Robert  A.; Otwinowski, Zbyszek; Basler, Christopher  F.; Amarasinghe, Gaya  K.

    2015-04-01

    During viral RNA synthesis, Ebola virus (EBOV) nucleoprotein (NP) alternates between an RNA-template-bound form and a template-free form to provide the viral polymerase access to the RNA template. In addition, newly synthesized NP must be prevented from indiscriminately binding to noncognate RNAs. Here, we investigate the molecular bases for these critical processes. We identify an intrinsically disordered peptide derived from EBOV VP35 (NPBP, residues 20–48) that binds NP with high affinity and specificity, inhibits NP oligomerization, and releases RNA from NP-RNA complexes in vitro. The structure of the NPBP/ΔNPNTD complex, solved to 3.7 Å resolution, reveals how NPBP peptide occludes a large surface area that is important for NP-NP and NP-RNA interactions and for viral RNA synthesis. Together, our results identify a highly conserved viral interface that is important for EBOV replication and can be targeted for therapeutic development.

  18. Peptide nucleic acids rather than RNA may have been the first genetic molecule

    NASA Technical Reports Server (NTRS)

    Nelson, K. E.; Levy, M.; Miller, S. L.

    2000-01-01

    Numerous problems exist with the current thinking of RNA as the first genetic material. No plausible prebiotic processes have yet been demonstrated to produce the nucleosides or nucleotides or for efficient two-way nonenzymatic replication. Peptide nucleic acid (PNA) is a promising precursor to RNA, consisting of N-(2-aminoethyl)glycine (AEG) and the adenine, uracil, guanine, and cytosine-N-acetic acids. However, PNA has not yet been demonstrated to be prebiotic. We show here that AEG is produced directly in electric discharge reactions from CH(4), N(2), NH(3), and H(2)O. Electric discharges also produce ethylenediamine, as do NH(4)CN polymerizations. AEG is produced from the robust Strecker synthesis with ethylenediamine. The NH(4)CN polymerization in the presence of glycine leads to the adenine and guanine-N(9)-acetic acids, and the cytosine and uracil-N(1)-acetic acids are produced in high yield from the reaction of cyanoacetaldehyde with hydantoic acid, rather than urea. Preliminary experiments suggest that AEG may polymerize rapidly at 100 degrees C to give the polypeptide backbone of PNA. The ease of synthesis of the components of PNA and possibility of polymerization of AEG reinforce the possibility that PNA may have been the first genetic material.

  19. Design Considerations for RNA Spherical Nucleic Acids (SNAs)

    PubMed Central

    2016-01-01

    Ribonucleic acids (RNAs) are key components in many cellular processes such as cell division, differentiation, growth, aging, and death. RNA spherical nucleic acids (RNA-SNAs), which consist of dense shells of double-stranded RNA on nanoparticle surfaces, are powerful and promising therapeutic modalities because they confer advantages over linear RNA such as high cellular uptake and enhanced stability. Due to their three-dimensional shell of oligonucleotides, SNAs, in comparison to linear nucleic acids, interact with the biological environment in unique ways. Herein, the modularity of the RNA-SNA is used to systematically study structure–function relationships in order to understand how the oligonucleotide shell affects interactions with a specific type of biological environment, namely, one that contains serum nucleases. We use a combination of experiment and theory to determine the key architectural properties (i.e., sequence, density, spacer moiety, and backfill molecule) that affect how RNA-SNAs interact with serum nucleases. These data establish a set of design parameters for SNA architectures that are optimized in terms of stability. PMID:27523252

  20. Design Considerations for RNA Spherical Nucleic Acids (SNAs).

    PubMed

    Barnaby, Stacey N; Perelman, Grant A; Kohlstedt, Kevin L; Chinen, Alyssa B; Schatz, George C; Mirkin, Chad A

    2016-09-21

    Ribonucleic acids (RNAs) are key components in many cellular processes such as cell division, differentiation, growth, aging, and death. RNA spherical nucleic acids (RNA-SNAs), which consist of dense shells of double-stranded RNA on nanoparticle surfaces, are powerful and promising therapeutic modalities because they confer advantages over linear RNA such as high cellular uptake and enhanced stability. Due to their three-dimensional shell of oligonucleotides, SNAs, in comparison to linear nucleic acids, interact with the biological environment in unique ways. Herein, the modularity of the RNA-SNA is used to systematically study structure-function relationships in order to understand how the oligonucleotide shell affects interactions with a specific type of biological environment, namely, one that contains serum nucleases. We use a combination of experiment and theory to determine the key architectural properties (i.e., sequence, density, spacer moiety, and backfill molecule) that affect how RNA-SNAs interact with serum nucleases. These data establish a set of design parameters for SNA architectures that are optimized in terms of stability.

  1. Virtual High-Throughput Screening Identifies Mycophenolic Acid as a Novel RNA Capping Inhibitor

    PubMed Central

    Tremblay-Létourneau, Maude; Despins, Simon; Bougie, Isabelle; Bisaillon, Martin

    2011-01-01

    The RNA guanylyltransferase (GTase) is involved in the synthesis of the m7Gppp-RNA cap structure found at the 5′ end of eukaryotic mRNAs. GTases are members of the covalent nucleotidyl transferase superfamily, which also includes DNA and RNA ligases. GTases catalyze a two-step reaction in which they initially utilize GTP as a substrate to form a covalent enzyme-GMP intermediate. The GMP moiety is then transferred to the diphosphate end of the RNA transcript in the second step of the reaction to form the Gppp-RNA structure. In the current study, we used a combination of virtual database screening, homology modeling, and biochemical assays to search for novel GTase inhibitors. Using this approach, we demonstrate that mycophenolic acid (MPA) can inhibit the GTase reaction by preventing the catalytic transfer of the GMP moiety onto an acceptor RNA. As such, MPA represents a novel type of inhibitor against RNA guanylyltransferases that inhibits the second step of the catalytic reaction. Moreover, we show that the addition of MPA to S. cerevisiae cells leads to a reduction of capped mRNAs. Finally, biochemical assays also demonstrate that MPA can inhibit DNA ligases through inhibition of the second step of the reaction. The biological implications of these findings for the MPA-mediated inhibition of members of the covalent nucleotidyl superfamily are discussed. PMID:21935470

  2. Physiological effects of γ-linolenic acid and sesamin on hepatic fatty acid synthesis and oxidation.

    PubMed

    Ide, Takashi; Iwase, Haruka; Amano, Saaya; Sunahara, Saki; Tachihara, Ayuka; Yagi, Minako; Watanabe, Tsuyoshi

    2017-03-01

    Interrelated effects of γ-linolenic acid (GLA) and sesamin, a sesame lignan, on hepatic fatty acid synthesis and oxidation were examined. Rats were fed experimental diets supplemented with 0 or 2 g/kg sesamin (1:1 mixture of sesamin and episesamin) and containing 100 g/kg of palm oil (saturated fat), safflower oil rich in linoleic acid, or oil of evening primrose origin containing 43% GLA (GLA oil) for 18 days. In rats fed sesamin-free diets, GLA oil, compared with other oils, increased the activity and mRNA levels of various enzymes involved in fatty acid oxidation, except for some instances. Sesamin greatly increased these parameters, and the enhancing effects of sesamin on peroxisomal fatty acid oxidation rate and acyl-CoA oxidase, enoyl-CoA hydratase and acyl-CoA thioesterase activities were more exaggerated in rats fed GLA oil than in the animals fed other oils. The combination of sesamin and GLA oil also synergistically increased the mRNA levels of some peroxisomal fatty acid oxidation enzymes and of several enzymes involved in fatty acid metabolism located in other cell organelles. In the groups fed sesamin-free diets, GLA oil, compared with other oils, markedly reduced the activity and mRNA levels of various lipogenic enzymes. Sesamin reduced all these parameters, except for malic enzyme, in rats fed palm and safflower oils, but the effects were attenuated in the animals fed GLA oil. These changes by sesamin and fat type accompanied profound alterations in serum lipid levels. This may be ascribable to the changes in apolipoprotein-B-containing lipoproteins.

  3. The RNA accordion model for template positioning by telomerase RNA during telomeric DNA synthesis

    PubMed Central

    Berman, Andrea J.; Akiyama, Benjamin M.; Stone, Michael D.; Cech, Thomas R.

    2011-01-01

    Telomerase is a ribonucleoprotein (RNP) enzyme that maintains the ends of linear eukaryotic chromosomes and whose activation is a hallmark of 90% of all cancers. This RNP minimally contains a reverse transcriptase protein subunit (TERT) that catalyzes telomeric DNA synthesis and an RNA subunit (TER) that has templating, architectural and protein-scaffolding roles. Telomerase is unique among polymerases in that it synthesizes multiple copies of the template on the 3′ end of a primer following a single binding event, a process known as repeat addition processivity (RAP). Using biochemical assays and single-molecule Förster resonance energy transfer (smFRET) experiments on Tetrahymena thermophila telomerase, we now directly demonstrate that TER contributes to template positioning within the active site and to the template translocation required for RAP. We propose that the single-stranded RNA elements flanking the template act as a molecular accordion, undergoing reciprocal extension and compaction during telomerase translocation. PMID:22101935

  4. Membrane synthesis, specific lipid requirements, and localized lipid composition changes associated with a positive-strand RNA virus RNA replication protein.

    PubMed

    Lee, Wai-Ming; Ahlquist, Paul

    2003-12-01

    Multifunctional RNA replication protein 1a of brome mosaic virus (BMV), a positive-strand RNA virus, localizes to the cytoplasmic face of endoplasmic reticulum (ER) membranes and induces ER lumenal spherules in which viral RNA synthesis occurs. We previously showed that BMV RNA replication in yeast is severely inhibited prior to negative-strand RNA synthesis by a single-amino-acid substitution in the ole1w allele of yeast Delta9 fatty acid (FA) desaturase, which converts saturated FAs (SFAs) to unsaturated FAs (UFAs). Here we further define the relationships between 1a, membrane lipid composition, and RNA synthesis. We show that 1a expression increases total membrane lipids in wild-type (wt) yeast by 25 to 33%, consistent with recent results indicating that the numerous 1a-induced spherules are enveloped by invaginations of the outer ER membrane. 1a did not alter total membrane lipid composition in wt or ole1w yeast, but the ole1w mutation selectively depleted 18-carbon, monounsaturated (18:1) FA chains and increased 16:0 SFA chains, reducing the UFA-to-SFA ratio from approximately 2.5 to approximately 1.5. Thus, ole1w inhibition of RNA replication was correlated with decreased levels of UFA, membrane fluidity, and plasticity. The ole1w mutation did not alter 1a-induced membrane synthesis, 1a localization to the perinuclear ER, or colocalization of BMV 2a polymerase, nor did it block spherule formation. Moreover, BMV RNA replication templates were still recovered from cell lysates in a 1a-induced, 1a- and membrane-associated, and nuclease-resistant but detergent-susceptible state consistent with spherules. However, unlike nearby ER membranes, the membranes surrounding spherules in ole1w cells were not distinctively stained with osmium tetroxide, which interacts specifically with UFA double bonds. Thus, in ole1w cells, spherule-associated membranes were locally depleted in UFAs. This localized UFA depletion helps to explain why BMV RNA replication is more sensitive

  5. Meteorites and the RNA World: A Thermodynamic Model of Nucleobase Synthesis within Planetesimals

    NASA Astrophysics Data System (ADS)

    Pearce, Ben K. D.; Pudritz, Ralph E.

    2016-11-01

    The possible meteorite parent body origin of Earth's pregenetic nucleobases is substantiated by the guanine (G), adenine (A), and uracil (U) measured in various meteorites. Cytosine (C) and thymine (T), however, are absent in meteorites, making the emergence of an RNA and later RNA/DNA/protein world problematic. We investigated the meteorite parent body (planetesimal) origin of all nucleobases by computationally modeling 18 reactions that potentially contribute to nucleobase formation in such environments. Out of this list, we identified the two most important reactions for each nucleobase and found that these involve small molecules such as HCN, CO, NH3, and water that ultimately arise from the protoplanetary disks in which planetesimals are built. The primary result of this study is that cytosine is unlikely to persist within meteorite parent bodies due to aqueous deamination. Thymine has a thermodynamically favorable reaction pathway from uracil, formaldehyde, and formic acid but likely did not persist within planetesimals containing H2O2 due to an oxidation reaction with this molecule. Finally, while Fischer-Tropsch (FT) synthesis is found to be the dominant source of nucleobases within our model planetesimal, non-catalytic (NC) synthesis may still be significant under certain chemical conditions (e.g., within CR2 parent bodies). We discuss several major consequences of our results for the origin of the RNA world.

  6. Serine Metabolism Supports the Methionine Cycle and DNA/RNA Methylation through De Novo ATP Synthesis in Cancer Cells

    PubMed Central

    Maddocks, Oliver D.K.; Labuschagne, Christiaan F.; Adams, Peter D.; Vousden, Karen H.

    2016-01-01

    Summary Crosstalk between cellular metabolism and the epigenome regulates epigenetic and metabolic homeostasis and normal cell behavior. Changes in cancer cell metabolism can directly impact epigenetic regulation and promote transformation. Here we analyzed the contribution of methionine and serine metabolism to methylation of DNA and RNA. Serine can contribute to this pathway by providing one-carbon units to regenerate methionine from homocysteine. While we observed this contribution under methionine-depleted conditions, unexpectedly, we found that serine supported the methionine cycle in the presence and absence of methionine through de novo ATP synthesis. Serine starvation increased the methionine/S-adenosyl methionine ratio, decreasing the transfer of methyl groups to DNA and RNA. While serine starvation dramatically decreased ATP levels, this was accompanied by lower AMP and did not activate AMPK. This work highlights the difference between ATP turnover and new ATP synthesis and defines a vital function of nucleotide synthesis beyond making nucleic acids. PMID:26774282

  7. Origins of tmRNA: the missing link in the birth of protein synthesis?

    PubMed

    Macé, Kevin; Gillet, Reynald

    2016-09-30

    The RNA world hypothesis refers to the early period on earth in which RNA was central in assuring both genetic continuity and catalysis. The end of this era coincided with the development of the genetic code and protein synthesis, symbolized by the apparition of the first non-random messenger RNA (mRNA). Modern transfer-messenger RNA (tmRNA) is a unique hybrid molecule which has the properties of both mRNA and transfer RNA (tRNA). It acts as a key molecule during trans-translation, a major quality control pathway of modern bacterial protein synthesis. tmRNA shares many common characteristics with ancestral RNA. Here, we present a model in which proto-tmRNAs were the first molecules on earth to support non-random protein synthesis, explaining the emergence of early genetic code. In this way, proto-tmRNA could be the missing link between the first mRNA and tRNA molecules and modern ribosome-mediated protein synthesis.

  8. Origins of tmRNA: the missing link in the birth of protein synthesis?

    PubMed Central

    Macé, Kevin; Gillet, Reynald

    2016-01-01

    The RNA world hypothesis refers to the early period on earth in which RNA was central in assuring both genetic continuity and catalysis. The end of this era coincided with the development of the genetic code and protein synthesis, symbolized by the apparition of the first non-random messenger RNA (mRNA). Modern transfer-messenger RNA (tmRNA) is a unique hybrid molecule which has the properties of both mRNA and transfer RNA (tRNA). It acts as a key molecule during trans-translation, a major quality control pathway of modern bacterial protein synthesis. tmRNA shares many common characteristics with ancestral RNA. Here, we present a model in which proto-tmRNAs were the first molecules on earth to support non-random protein synthesis, explaining the emergence of early genetic code. In this way, proto-tmRNA could be the missing link between the first mRNA and tRNA molecules and modern ribosome-mediated protein synthesis. PMID:27484476

  9. Rates of synthesis and degradation of ribosomal ribonucleic acid during differentiation of Dictyostelium discoideum.

    PubMed Central

    Mangiarotti, G; Altruda, F; Lodish, H F

    1981-01-01

    Synthesis of ribosomes and ribosomal ribonucleic acid (RNA) continued during differentiation of Dictyostelium discoideum concurrently with extensive turnover of ribosomes synthesized during both growth and developmental stages. We show here that the rate of synthesis of 26S and 17S ribosomal RNA during differentiation was less than 15% of that in growing cells, and by the time of sorocarp formation only about 25% of the cellular ribosomes had been synthesized during differentiation. Ribosomes synthesized during growth and differentiation were utilized in messenger RNA translation to the same extent; about 50% of each class were on polyribosomes. Ribosome degradation is apparently an all-or-nothing process, since virtually all 80S monosomes present in developing cells could be incorporated into polysomes when growth conditions were restored. By several criteria, ribosomes synthesized during growth and differentiation were functionally indistinguishable. Our data, together with previously published information on changes in the messenger RNA population during differentiation, indicate that synthesis of new ribosomes is not necessary for translation of developmentally regulated messenger RNA. We also establish that the overall rate of messenger RNA synthesis during differentiation is less than 15% of that in growing cells. PMID:6965093

  10. Rates of synthesis and degradation of ribosomal ribonucleic acid during differentiation of Dictyostelium discoideum.

    PubMed

    Mangiarotti, G; Altruda, F; Lodish, H F

    1981-01-01

    Synthesis of ribosomes and ribosomal ribonucleic acid (RNA) continued during differentiation of Dictyostelium discoideum concurrently with extensive turnover of ribosomes synthesized during both growth and developmental stages. We show here that the rate of synthesis of 26S and 17S ribosomal RNA during differentiation was less than 15% of that in growing cells, and by the time of sorocarp formation only about 25% of the cellular ribosomes had been synthesized during differentiation. Ribosomes synthesized during growth and differentiation were utilized in messenger RNA translation to the same extent; about 50% of each class were on polyribosomes. Ribosome degradation is apparently an all-or-nothing process, since virtually all 80S monosomes present in developing cells could be incorporated into polysomes when growth conditions were restored. By several criteria, ribosomes synthesized during growth and differentiation were functionally indistinguishable. Our data, together with previously published information on changes in the messenger RNA population during differentiation, indicate that synthesis of new ribosomes is not necessary for translation of developmentally regulated messenger RNA. We also establish that the overall rate of messenger RNA synthesis during differentiation is less than 15% of that in growing cells.

  11. Phosphatidic Acid Produced by Phospholipase D Promotes RNA Replication of a Plant RNA Virus

    PubMed Central

    Hyodo, Kiwamu; Taniguchi, Takako; Manabe, Yuki; Kaido, Masanori; Mise, Kazuyuki; Sugawara, Tatsuya; Taniguchi, Hisaaki; Okuno, Tetsuro

    2015-01-01

    Eukaryotic positive-strand RNA [(+)RNA] viruses are intracellular obligate parasites replicate using the membrane-bound replicase complexes that contain multiple viral and host components. To replicate, (+)RNA viruses exploit host resources and modify host metabolism and membrane organization. Phospholipase D (PLD) is a phosphatidylcholine- and phosphatidylethanolamine-hydrolyzing enzyme that catalyzes the production of phosphatidic acid (PA), a lipid second messenger that modulates diverse intracellular signaling in various organisms. PA is normally present in small amounts (less than 1% of total phospholipids), but rapidly and transiently accumulates in lipid bilayers in response to different environmental cues such as biotic and abiotic stresses in plants. However, the precise functions of PLD and PA remain unknown. Here, we report the roles of PLD and PA in genomic RNA replication of a plant (+)RNA virus, Red clover necrotic mosaic virus (RCNMV). We found that RCNMV RNA replication complexes formed in Nicotiana benthamiana contained PLDα and PLDβ. Gene-silencing and pharmacological inhibition approaches showed that PLDs and PLDs-derived PA are required for viral RNA replication. Consistent with this, exogenous application of PA enhanced viral RNA replication in plant cells and plant-derived cell-free extracts. We also found that a viral auxiliary replication protein bound to PA in vitro, and that the amount of PA increased in RCNMV-infected plant leaves. Together, our findings suggest that RCNMV hijacks host PA-producing enzymes to replicate. PMID:26020241

  12. Decreased hepatotoxic bile acid composition and altered synthesis in progressive human nonalcoholic fatty liver disease

    SciTech Connect

    Lake, April D.; Novak, Petr; Shipkova, Petia; Aranibar, Nelly; Robertson, Donald; Reily, Michael D.; Lu, Zhenqiang; Lehman-McKeeman, Lois D.; Cherrington, Nathan J.

    2013-04-15

    Bile acids (BAs) have many physiological roles and exhibit both toxic and protective influences within the liver. Alterations in the BA profile may be the result of disease induced liver injury. Nonalcoholic fatty liver disease (NAFLD) is a prevalent form of chronic liver disease characterized by the pathophysiological progression from simple steatosis to nonalcoholic steatohepatitis (NASH). The hypothesis of this study is that the ‘classical’ (neutral) and ‘alternative’ (acidic) BA synthesis pathways are altered together with hepatic BA composition during progression of human NAFLD. This study employed the use of transcriptomic and metabolomic assays to study the hepatic toxicologic BA profile in progressive human NAFLD. Individual human liver samples diagnosed as normal, steatosis, and NASH were utilized in the assays. The transcriptomic analysis of 70 BA genes revealed an enrichment of downregulated BA metabolism and transcription factor/receptor genes in livers diagnosed as NASH. Increased mRNA expression of BAAT and CYP7B1 was observed in contrast to decreased CYP8B1 expression in NASH samples. The BA metabolomic profile of NASH livers exhibited an increase in taurine together with elevated levels of conjugated BA species, taurocholic acid (TCA) and taurodeoxycholic acid (TDCA). Conversely, cholic acid (CA) and glycodeoxycholic acid (GDCA) were decreased in NASH liver. These findings reveal a potential shift toward the alternative pathway of BA synthesis during NASH, mediated by increased mRNA and protein expression of CYP7B1. Overall, the transcriptomic changes of BA synthesis pathway enzymes together with altered hepatic BA composition signify an attempt by the liver to reduce hepatotoxicity during disease progression to NASH. - Highlights: ► Altered hepatic bile acid composition is observed in progressive NAFLD. ► Bile acid synthesis enzymes are transcriptionally altered in NASH livers. ► Increased levels of taurine and conjugated bile acids

  13. Progress in demonstrating homochiral selection in prebiotic RNA synthesis

    NASA Astrophysics Data System (ADS)

    Joshi, Prakash C.; Aldersley, Michael F.; Ferris, James P.

    2013-03-01

    The dual properties of RNA as an enzyme catalyst (ribozyme) and its ability to store genetic information suggest that early life could have been based on RNA. We have synthesized RNA oligomers up to 50-mer chain lengths by Na+-montmorillonite catalyzed reactions of 5‧-activated mononucleotides. For studying chiral selectivity, the reactions of racemic mixtures of D, L-ImpA and D, L-ImpU were carried out on Na+-montmorillonite. The dimer, trimer, tetramer and pentamer fractions (yields 43.3%, 14.5%, 5.8% and 3.0%, respectively) were investigated for homochiral selection. These products were collected via ion exchange HPLC, their terminal 5‧-phosphate was cleaved by alkaline phosphatase and further analyzed by reverse phase HPLC. Twelve linear and three cyclic dimers were isolated and characterized. The homochirality of dimers was 63.5 ± 0.8%. Out of the sixteen trimers isolated, ten were homochiral with an overall homochirality of 74.2 ± 1.6%. The tetramers and pentamers were separated into 24 and 20 isomers, respectively. Their co-elution with those formed in the binary reactions of D-ImpA with D-ImpU on Na+-montmorillonite revealed 92.7 ± 2.0% and 97.2 ± 0.5% homochirality, respectively. These results suggest that Na+-montmorillonite not only catalyzes the prebiotic synthesis of RNA but it also facilitates homochiral selection. Work is in progress to determine chiral selectivity in the reaction mixtures of activated nucleotides of racemic A, U, G and C on Na+-montmorillonite.

  14. RNA and protein synthesis in cultured human fibroblasts derived from donors of various ages.

    PubMed

    Chen, J J; Brot, N; Weissbach, H

    1980-07-01

    RNA synthesis in human fibroblasts from donors of various ages was studied in fibroblasts made permeable to nucleoside triphosphates with the nonionic detergent Nonidet P40. Cells from donors of 11 years and older showed a 30-40% decline in total RNA synthesis. The decrease in RNA synthesis was primarily due to a lowering of RNA polymerase II activity (alpha-amanitin sensitive). Studies on the incorporation of leucine into protein also showed a 30-40% decrease in cells from older donors.

  15. Biochemical and Cytological Analyses of RNA Synthesis in Kinetin-treated Pea Root Parenchyma 1

    PubMed Central

    Shininger, Terry L.

    1980-01-01

    Excised cortical parenchyma from the pea root (cv. Little Marvel) responds to kinetin/auxin treatment with an increased rate of RNA synthesis well before reinitiating DNA synthesis. Few cells synthesize RNA in the 1st hour of culture. In the presence of kinetin/auxin, the nuclear labeling index increases 2.5-fold as compared to control cultures. The RNA synthesis response has an apparent lag period of 2-4 hours as shown by double label ([3H]adenosine/[14C]adenosine) experiments. Qualitatively, the RNA synthesized at 4-6 hours sediments between 18S and 5S. The RNA synthesized at 14-16 hours and 24-26 hours is primarily ribosomal RNA when kinetin is present. In the absence of kinetin, no clear pattern of RNA synthesis emerges. The data are interpreted to mean that kinetin treatment elicits RNA synthesis in a small proportion of the population initially and this may involve messenger-like RNA. Later, more cells synthesize RNA and this is primarily rRNA. Images PMID:16661292

  16. Chemical Synthesis of a Hyaluronic Acid Decasaccharide

    PubMed Central

    Lu, Xiaowei; Kamat, Medha N.; Huang, Lijun; Huang, Xuefei

    2009-01-01

    The chemical synthesis of a hyaluronic acid decasaccharide using the pre-activation based chemoselective glycosylation strategy is described. Assembly of large oligosaccharides is generally challenging due to the increased difficulties in both glycosylation and deprotection. Indeed, the same building blocks previously employed for hyaluronic acid hexasaccharide syntheses failed to yield the desired decasaccharide. After extensive experimentation, the decasaccharide backbone was successfully constructed with an overall yield of 37% from disaccharide building blocks. The trichloroacetyl group was used as the nitrogen protective group for the glucosamine units and the addition of TMSOTf was found to be crucial to suppress the formation of trichloromethyl oxazoline side-product and enable high glycosylation yield. For deprotections, the combination of a mild basic condition and the monitoring methodology using 1H-NMR allowed the removal of all base-labile protective groups, which facilitated the generation of the fully deprotected HA decasaccharide. PMID:19764799

  17. A MicroRNA Precursor Surveillance System in Quality Control of MicroRNA Synthesis

    PubMed Central

    Liu, Xuhang; Zheng, Qi; Vrettos, Nicholas; Maragkakis, Manolis; Alexiou, Panagiotis; Gregory, Brian D.; Mourelatos, Zissimos

    2014-01-01

    Summary MicroRNAs (miRNAs) are essential for regulation of gene expression. Though numerous miRNAs have been identified by high throughput sequencing, few precursor miRNAs (pre-miRNAs) are experimentally validated. Here we report a strategy for constructing high-throughput sequencing libraries enriched for full-length pre-miRNAs. We find widespread and extensive uridylation of Argonaute bound pre-miRNAs, which is primarily catalyzed by two terminal uridylyltransferases: TUT7 and TUT4. Uridylation by TUT7/4 not only polishes pre-miRNA 3′ ends, but also facilitates their degradation by the exosome, preventing clogging of Ago with defective species. We show that the exosome exploits distinct substrate preferences of DIS3 and RRP6, its two catalytic subunits, to distinguish productive from defective pre-miRNAs. Furthermore, we identify a positive feedback loop formed by the exosome and TUT7/4 in triggering uridylation and degradation of Ago-bound pre-miRNAs. Our study reveals a pre-miRNA surveillance system that comprises TUT7, TUT4 and the exosome in quality control of miRNA synthesis. PMID:25175028

  18. [Ubiquitous Ribonucleic Acid:miRNA is the Ubiquitin of RNA].

    PubMed

    Zheng, Xiao-fei

    2015-10-01

    Small RNAs, especially microRNAs (miRNAs),widely exist in eukaryotic cells, with their main functions being regulating gene expression and function of target molecules through the degradation of cellular target RNAs by the ribonuclease-based system. Ubiquitins and ubiquitin-like proteins are polypeptides that exist in most eukaryotic cells, and their main function is almost to regulate protein level through the degradation of cellular proteins by ubiquitin proteasome system. Small RNAs, including miRNAs,and ubiquitins or ubiquitin-like proteins have similarities in many aspects although small RNAs and ubiquitin or ubiquitin-like proteins interact different substrates respectively. Therefore, miRNAs can be defined as ubiquitra (ubiquitous ribonucleic acid, ubiquitra or uRNA), and the other small RNAs can be defined as ubiquitra-like RNA or uRNA-like RNA. The concept of ubiquitra may be applied for explaining the biological essence of small RNAs diversity.

  19. Chemoenzymatic synthesis of surfactants from carbohydrates, amino acids, and fatty acids.

    PubMed

    Bellahouel, S; Rolland, V; Roumestant, M L; Viallefont, P; Martinez, J

    2001-02-01

    The chemoenzymatic synthesis of new surfactants is reported; they were prepared from unprotected carbohydrates, amino acids, and fatty acids. This study pointed out the factors that govern the possibility to enzymatically bind the carbohydrate to the amino acid.

  20. Synthesis of novel acid electrolytes for phosphoric acid fuel cells

    NASA Astrophysics Data System (ADS)

    Adcock, James L.

    1988-11-01

    A 40 millimole per hour scale aerosol direct fluorination reactor was constructed. F-Methyl F-4-methoxybutanoate and F-4-methoxybutanoyl fluoride were synthesized by aerosol direct fluorination of methyl 4-methoxybutanoate. Basic hydrolysis of the perfluorinated derivatives produce sodium F-4 methoxybutanoate which was pyrolyzed to F-3-methoxy-1-propene. Purification and shipment of 33 grams of F-3-methoxy-1-propene followed. Syntheses by analogous methods allowed production and shipment of 5 grams of F-3-ethoxy 1-propene, 18 grams of F-3-(2-methoxy.ethoxy) 1-propene, and 37 grams of F-3,3-dimethyl 1-butene. Eighteen grams of F-2,2-dimethyl 1-chloropropane was produced directly and shipped. As suggested by other contractors, 5 grams of F-3-methoxy 1-iodopropane, and 5 grams of F-3-(2-methoxy.ethoxy) 1-iodopropane were produced by converting the respective precursor acid sodium salts produced for olefin synthesis to the silver salts and pyrolyzing them with iodine. Each of these compounds was prepared for the first time by the aerosol fluorination process during the course of the contract. These samples were provided to other Gas Research Institute (GRI) contractors for synthesis of perfluorinated sulfur (VI) and phosphorous (V) acids.

  1. Early gene expression in bacteriophage T7. I. In vivo synthesis, inactivation, and translational utilization of early mRNA's.

    PubMed Central

    Hercules, K; Jovanovich, S; Sauerbrier, W

    1976-01-01

    In vivo decay rates for the individual T7 early mRNA species were determined. The physical half-lives, measured at 37 C, range from 1.1 min for gene 0.7 RNA to 4.5 min for gene 0.3 RNA. Physical half-lives, as observed after rifampin inhibition of RNA synthesis and polyacylamide electrophoresis of RNAs, are approximately 30% longer than functional half-lives, as observed by 14C-labeled amino acid uptake into individual T7 early proteins. The different RNA species are synthesized at grossly different rates, 0.3 RNA at four times the rate of 1.0 RNA, 0.7 RNA at twice the rate, and 1.1 and 1.3 RNAs at about the same or a slightly lower rate than 1.0 RNA. Rho-factor-mediated termination of transcription behind genes 0.3, 0.7, and perhaps behind 1.0 is inferred from these data. The in vivo translational utilization of the individual T7 early-message species was found to vary by not more than a factor of 2. Images PMID:1255850

  2. Pre-mRNA Processing Factor Prp18 Is a Stimulatory Factor of Influenza Virus RNA Synthesis and Possesses Nucleoprotein Chaperone Activity.

    PubMed

    Minakuchi, M; Sugiyama, K; Kato, Y; Naito, T; Okuwaki, M; Kawaguchi, A; Nagata, K

    2017-02-01

    The genome of influenza virus (viral RNA [vRNA]) is associated with the nucleoprotein (NP) and viral RNA-dependent RNA polymerases and forms helical viral ribonucleoprotein (vRNP) complexes. The NP-vRNA complex is the biologically active template for RNA synthesis by the viral polymerase. Previously, we identified human pre-mRNA processing factor 18 (Prp18) as a stimulatory factor for viral RNA synthesis using a Saccharomyces cerevisiae replicon system and a single-gene deletion library of Saccharomyces cerevisiae (T. Naito, Y. Kiyasu, K. Sugiyama, A. Kimura, R. Nakano, A. Matsukage, and K. Nagata, Proc Natl Acad Sci USA, 104:18235-18240, 2007, https://doi.org/10.1073/pnas.0705856104). In infected Prp18 knockdown (KD) cells, the synthesis of vRNA, cRNA, and viral mRNAs was reduced. Prp18 was found to stimulate in vitro viral RNA synthesis through its interaction with NP. Analyses using in vitro RNA synthesis reactions revealed that Prp18 dissociates newly synthesized RNA from the template after the early elongation step to stimulate the elongation reaction. We found that Prp18 functions as a chaperone for NP to facilitate the formation of NP-RNA complexes. Based on these results, it is suggested that Prp18 accelerates influenza virus RNA synthesis as an NP chaperone for the processive elongation reaction.

  3. Improved nucleic acid descriptors for siRNA efficacy prediction

    PubMed Central

    Sciabola, Simone; Cao, Qing; Orozco, Modesto; Faustino, Ignacio; Stanton, Robert V.

    2013-01-01

    Although considerable progress has been made recently in understanding how gene silencing is mediated by the RNAi pathway, the rational design of effective sequences is still a challenging task. In this article, we demonstrate that including three-dimensional descriptors improved the discrimination between active and inactive small interfering RNAs (siRNAs) in a statistical model. Five descriptor types were used: (i) nucleotide position along the siRNA sequence, (ii) nucleotide composition in terms of presence/absence of specific combinations of di- and trinucleotides, (iii) nucleotide interactions by means of a modified auto- and cross-covariance function, (iv) nucleotide thermodynamic stability derived by the nearest neighbor model representation and (v) nucleic acid structure flexibility. The duplex flexibility descriptors are derived from extended molecular dynamics simulations, which are able to describe the sequence-dependent elastic properties of RNA duplexes, even for non-standard oligonucleotides. The matrix of descriptors was analysed using three statistical packages in R (partial least squares, random forest, and support vector machine), and the most predictive model was implemented in a modeling tool we have made publicly available through SourceForge. Our implementation of new RNA descriptors coupled with appropriate statistical algorithms resulted in improved model performance for the selection of siRNA candidates when compared with publicly available siRNA prediction tools and previously published test sets. Additional validation studies based on in-house RNA interference projects confirmed the robustness of the scoring procedure in prospective studies. PMID:23241392

  4. Escherichia coli Unsaturated Fatty Acid Synthesis

    PubMed Central

    Feng, Youjun; Cronan, John E.

    2009-01-01

    Although the unsaturated fatty acid (UFA) synthetic pathway of Escherichia coli is the prototype of such pathways, several unresolved issues have accumulated over the years. The key players are the fabA and fabB genes. Earlier studies of fabA transcription showed that the gene was transcribed from two promoters, with one being positively regulated by the FadR protein. The other weaker promoter (which could not be mapped with the technology then available) was considered constitutive because its function was independent of FadR. However, the FabR negative regulator was recently shown to represses fabA transcription. We report that the weak promoter overlaps the FadR-dependent promoter and is regulated by FabR. This promoter is strictly conserved in all E. coli and Salmonella enterica genomes sequenced to date and is thought to provide insurance against inappropriate regulation of fabA transcription by exogenous saturated fatty acids. Also, the fabAup promoter, a mutant promoter previously isolated by selection for increased FabA activity, was shown to be a promoter created de novo by a four-base deletion within the gene located immediately upstream of fabA. Demonstration of the key UFA synthetic reaction catalyzed by FabB has been elusive, although it was known to catalyze an elongation reaction. Strains lacking FabB are UFA auxotrophs indicating that the enzyme catalyzes an essential step in UFA synthesis. Using thioesterases specific for hydrolysis of short chain acyl-ACPs, the intermediates of the UFA synthetic pathway have been followed in vivo for the first time. These experiments showed that a fabB mutant strain accumulated less cis-5-dodecenoic acid than the parental wild-type strain. These data indicate that the key reaction in UFA synthesis catalyzed by FabB is elongation of the cis-3-decenoyl-ACP produced by FabA. PMID:19679654

  5. Interacting RNA polymerase motors on a DNA track: Effects of traffic congestion and intrinsic noise on RNA synthesis

    NASA Astrophysics Data System (ADS)

    Tripathi, Tripti; Chowdhury, Debashish

    2008-01-01

    RNA polymerase (RNAP) is an enzyme that synthesizes a messenger RNA (mRNA) strand which is complementary to a single-stranded DNA template. From the perspective of physicists, an RNAP is a molecular motor that utilizes chemical energy input to move along the track formed by DNA. In many circumstances, which are described in this paper, a large number of RNAPs move simultaneously along the same track; we refer to such collective movements of the RNAPs as RNAP traffic. Here we develop a theoretical model for RNAP traffic by incorporating the steric interactions between RNAPs as well as the mechanochemical cycle of individual RNAPs during the elongation of the mRNA. By a combination of analytical and numerical techniques, we calculate the rates of mRNA synthesis and the average density profile of the RNAPs on the DNA track. We also introduce, and compute, two different measures of fluctuations in the synthesis of RNA. Analyzing these fluctuations, we show how the level of intrinsic noise in mRNA synthesis depends on the concentrations of the RNAPs as well as on those of some of the reactants and the products of the enzymatic reactions catalyzed by RNAP. We suggest appropriate experimental systems and techniques for testing our theoretical predictions.

  6. Interacting RNA polymerase motors on a DNA track: effects of traffic congestion and intrinsic noise on RNA synthesis.

    PubMed

    Tripathi, Tripti; Chowdhury, Debashish

    2008-01-01

    RNA polymerase (RNAP) is an enzyme that synthesizes a messenger RNA (mRNA) strand which is complementary to a single-stranded DNA template. From the perspective of physicists, an RNAP is a molecular motor that utilizes chemical energy input to move along the track formed by DNA. In many circumstances, which are described in this paper, a large number of RNAPs move simultaneously along the same track; we refer to such collective movements of the RNAPs as RNAP traffic. Here we develop a theoretical model for RNAP traffic by incorporating the steric interactions between RNAPs as well as the mechanochemical cycle of individual RNAPs during the elongation of the mRNA. By a combination of analytical and numerical techniques, we calculate the rates of mRNA synthesis and the average density profile of the RNAPs on the DNA track. We also introduce, and compute, two different measures of fluctuations in the synthesis of RNA. Analyzing these fluctuations, we show how the level of intrinsic noise in mRNA synthesis depends on the concentrations of the RNAPs as well as on those of some of the reactants and the products of the enzymatic reactions catalyzed by RNAP. We suggest appropriate experimental systems and techniques for testing our theoretical predictions.

  7. Synthesis of new kojic acid based unnatural α-amino acid derivatives.

    PubMed

    Balakrishna, C; Payili, Nagaraju; Yennam, Satyanarayana; Devi, P Uma; Behera, Manoranjan

    2015-11-01

    An efficient method for the preparation of kojic acid based α-amino acid derivatives by alkylation of glycinate schiff base with bromokojic acids have been described. Using this method, mono as well as di alkylated kojic acid-amino acid conjugates have been prepared. This is the first synthesis of C-linked kojic acid-amino acid conjugate where kojic acid is directly linked to amino acid through a C-C bond.

  8. Cell cycle specific distribution of killin: evidence for negative regulation of both DNA and RNA synthesis.

    PubMed

    Qiao, Man; Luo, Dan; Kuang, Yi; Feng, Haiyan; Luo, Guangping; Liang, Peng

    2015-01-01

    p53 tumor-suppressor gene is a master transcription factor which controls cell cycle progression and apoptosis. killin was discovered as one of the p53 target genes implicated in S-phase control coupled to cell death. Due to its extreme proximity to pten tumor-suppressor gene on human chromosome 10, changes in epigenetic modification of killin have also been linked to Cowden syndrome as well as other human cancers. Previous studies revealed that Killin is a high-affinity DNA-binding protein with preference to single-stranded DNA, and it inhibits DNA synthesis in vitro and in vivo. Here, co-localization studies of RFP-Killin with either GFP-PCNA or endogenous single-stranded DNA binding protein RPA during S-phase show that Killin always adopts a mutually exclusive punctuated nuclear expression pattern with the 2 accessory proteins in DNA replication. In contrast, when cells are not in S-phase, RFP-Killin largely congregates in the nucleolus where rRNA transcription normally occurs. Both of these cell cycle specific localization patterns of RFP-Killin are stable under high salt condition, consistent with Killin being tightly associated with nucleic acids within cell nuclei. Together, these cell biological results provide a molecular basis for Killin in competitively inhibiting the formation of DNA replication forks during S-phase, as well as potentially negatively regulate RNA synthesis during other cell cycle phases.

  9. Catalysis of the Carbonylation of Alcohols to Carboxylic Acids Including Acetic Acid Synthesis from Methanol.

    ERIC Educational Resources Information Center

    Forster, Denis; DeKleva, Thomas W.

    1986-01-01

    Monsanto's highly successful synthesis of acetic acid from methanol and carbon monoxide illustrates use of new starting materials to replace pretroleum-derived ethylene. Outlines the fundamental aspects of the acetic acid process and suggests ways of extending the synthesis to higher carboxylic acids. (JN)

  10. Impact of folic acid supplementation on single- and double-stranded RNA degradation in human colostrum and mature milk.

    PubMed

    Kocic, Gordana; Bjelakovic, Ljiljana; Bjelakovic, Bojko; Jevtoci-Stoimenov, Tatjana; Sokolovic, Dusan; Cvetkovic, Tatjana; Kocic, Hristina; Stojanovic, Svetlana; Langerholc, Tomaz; Jonovic, Marina

    2014-07-01

    Sufficient intake of folic acid is necessary for normal embryogenesis, fetal, and neonatal development. Folic acid facilitates nucleic acid internalization, and protects cellular DNA from nuclease degradation. Human milk contains enzymes, antimicrobial proteins, and antibodies, along with macrophages, that protect against infections and allergies. However, little to no information is available on the effects of folic acid supplementation on degradation of nucleic acids in human milk. In the present study, we aimed to determine the RNase activity (free and inhibitor-bound) in colostrum and mature milk, following folic acid supplementation. The study design included a total of 59 women, 27 of whom received 400 μg of folic acid daily periconceptionally and after. Folic acid supplementation increased the free RNase and polyadenylase activity following lactation. However, the increased RNase activity was not due to de novo enzyme synthesis, as the inhibitor-bound (latent) RNase activity was significantly lower and disappeared after one month. Folic acid reduced RNase activity by using double-stranded RNA as substrate. Data suggests that folic acid supplementation may improve viral RNAs degradation and mRNA degradation, but not dsRNA degradation, preserving in this way the antiviral defense.

  11. Nucleic Acid Engineering: RNA Following the Trail of DNA.

    PubMed

    Kim, Hyejin; Park, Yongkuk; Kim, Jieun; Jeong, Jaepil; Han, Sangwoo; Lee, Jae Sung; Lee, Jong Bum

    2016-02-08

    The self-assembly feature of the naturally occurring biopolymer, DNA, has fascinated researchers in the fields of materials science and bioengineering. With the improved understanding of the chemical and structural nature of DNA, DNA-based constructs have been designed and fabricated from two-dimensional arbitrary shapes to reconfigurable three-dimensional nanodevices. Although DNA has been used successfully as a building block in a finely organized and controlled manner, its applications need to be explored. Hence, with the myriad of biological functions, RNA has recently attracted considerable attention to further the application of nucleic acid-based structures. This Review categorizes different approaches of engineering nucleic acid-based structures and introduces the concepts, principles, and applications of each technique, focusing on how DNA engineering is applied as a guide to RNA engineering.

  12. Nucleic acid and protein synthesis during lateral root initiation in Marsilea quadrifolia (Marsileaceae)

    NASA Technical Reports Server (NTRS)

    Lin, B. L.; Raghavan, V.

    1991-01-01

    The pattern of DNA, RNA, and protein synthesis during lateral root initiation in Marsilea quadrifolia L. was monitored by autoradiography of incorporated of 3H-thymidine, 3H-uridine, and 3H-leucine, respectively. DNA synthesis was associated with the enlargement of the lateral root initial prior to its division. Consistent with histological studies, derivatives of the lateral root initial as well as the cells of the adjacent inner cortex and pericycle of the parent root also continued to synthesize DNA. RNA and protein synthetic activities were found to be higher in the lateral root initials than in the endodermal initials of the same longitudinal layer. The data suggest a role for nucleic acid and protein synthesis during cytodifferentiation of a potential endodermal cell into a lateral root initial.

  13. Protein and Ribonucleic Acid Synthesis During the Diploid Life Cycle of Allomyces arbuscula

    PubMed Central

    Burke, Daniel J.; Seale, Thomas W.; McCarthy, Brian J.

    1972-01-01

    The diploid life cycle of Allomyces arbuscula may be divided into four parts: spore induction, germination, vegetative growth, and mitosporangium formation. Spore induction, germination, and mitosporangium formation are insensitive to inhibition of actinomycin D, probably indicating that stable, pre-existing messenger ribonucleic acid (RNA) is responsible for these developmental events. Protein synthesis is necessary during the entire life cycle except for cyst formation. A system for obtaining synchronous germination of mitospores is described. During germination there is a characteristic increase in the rate of synthesis of RNA and protein although none of the other morphogenetic changes occurring during the life cycle are necessarily accompanied by an appreciable change in the rate of macromolecular synthesis. PMID:4113121

  14. RIBONUCLEIC ACID SYNTHESIS DURING MITOSIS AND MEIOSIS IN THE MOUSE TESTIS

    PubMed Central

    Monesi, Valerio

    1964-01-01

    The pattern of ribonucleic acid synthesis during germ cell development, from the stem cell to the mature spermatid, was studied in the mouse testis, by using uridine-H3 or cytidine-H3 labeling and autoradiography. Incorporation of tritiated precursors into the RNA occurs in spermatogonia, resting primary spermatocytes (RPS), throughout the second half of pachytene stage up to early diplotene, and in the Sertoli cells. Cells in leptotene, zygotene, and in the first half of pachytene stage do not synthesize RNA. No RNA synthesis was detected in meiotic stages later than diplotene, with the exception of a very low rate of incorporation in a fraction of secondary spermatocytes and very early spermatids. At long intervals after administration of the tracer, as labeled cells develop to more mature stages, late stages of spermatogenesis also become labeled. The last structures to become labeled are the residual bodies of Regaud. Thus, the RNA synthesized during the active meiotic stages is partially retained within the cell during further development. The rate of RNA synthesis declines gradually with the maturation from type A to intermediate to type B spermatogonia and to resting primary spermatocytes. "Dormant" type A spermatogonia synthesize little or no RNA. The incorporation of RNA precursors occurs exclusively within the nucleus: at later postinjection intervals the cytoplasm also becomes labeled. In spermatogonia all mitotic stages, except metaphase and anaphase, were shown to incorporate uridine-H3. RNA synthesis is then a continuous process throughout the cell division cycle in spermatogonia (generation time about 30 hours), and stops only for a very short interval (1 hour) during metaphase and anaphase. PMID:14206420

  15. Polyadenylic acid at the 3'-terminus of poliovirus RNA.

    PubMed

    Yogo, Y; Wimmer, E

    1972-07-01

    Poliovirus RNA that has been derivatized at the 3'-end with NaIO(4)-NaB(3)H(4) yields, after hydrolysis with alkali or RNase T2, predominantly labeled residues of modified adenosine; no labeled nucleoside derivative is produced by digestion with RNase A or RNase T1. The 3'-terminal bases of the RNA are, therefore,...ApA(OH). Hydrolyzates of poliovirus [(32)P]RNA, after exhaustive digestion with RNase T1 or RNase A, contain, besides internal oligonucleotides, polynucleotides resistant to further action of ribonucleases T1 and A, respectively; these polynucleotides were isolated by membrane-filter binding or ion-exchange chromatography. The sequence of the T1-resistant polynucleotide was determined to be (Ap)(n)A(OH), that of the RNase A-resistant polynucleotide was GpGp(Ap)(n)A(OH). The chain length (n) of the polyadenylic acid, as analyzed by different methods, averages 89 nucleotides. Gel electrophoresis revealed heterogeneity of the size of poly(A). Poliovirus RNA, when labeled in vitro at the 3'-end, contains [3'-(3)H]poly(A); when labeled in vivo with [(3)H]A, it contains [(3)H](Ap)(n)A(OH). The data establish that... YpGpGp(Ap)([unk])A(OH) is the 3'-terminal sequence of poliovirus RNA, Type 1 (Mahoney). Since this mammalian virus reproduces in the cell cytoplasm, these observations may modify prior interpretations of the function of polyadenylate ends on messenger RNAs.

  16. Solid-phase synthesis of branched oligoribonucleotides related to messenger RNA splicing intermediates.

    PubMed Central

    Damha, M J; Ganeshan, K; Hudson, R H; Zabarylo, S V

    1992-01-01

    The chemical synthesis of oligoribonucleotides containing vicinal (2'-5')- and (3'-5')-phosphodiester linkages is described. The solid-phase method, based on silyl-phosphoramidite chemistry, was applied to the synthesis of a series of branched RNA [(Xp)nA2' (pN)n3'(pN)n] related to the splicing intermediates derived from Saccharomyces cerevisiae rp51a pre-messenger RNA. The branched oligonucleotides have been thoroughly characterized by nucleoside and branched nucleotide composition analysis. Branched oligoribonucleotides will be useful in the study of messenger RNA splicing and in determining the biological role of RNA 'lariats' and 'forks' in vivo. Images PMID:1480476

  17. Akt Phosphorylation and Regulation of Transketolase Is a Nodal Point for Amino Acid Control of Purine Synthesis

    PubMed Central

    Saha, Arindam; Connelly, Stephen; Jiang, Jingjing; Zhuang, Shunhui; Amador, Deron T.; Phan, Tony; Pilz, Renate B.; Boss, Gerry R.

    2014-01-01

    SUMMARY The phosphatidylinositol 3-kinase (PI3K)/Akt pathway integrates environmental clues to regulate cell growth and survival. We showed previously that depriving cells of a single essential amino acid rapidly and reversibly arrests purine synthesis. Here we demonstrate that amino acids via mTORC2 and IκB kinase regulate Akt activity, and Akt association and phosphorylation of transketolase (TKT), a key enzyme of the non-oxidative pentose phosphate pathway (PPP). Akt phosphorylates TKT on Thr382, markedly enhancing enzyme activity and increasing carbon flow through the non-oxidative PPP, thereby increasing purine synthesis. Mice fed a lysine-deficient diet for two days show decreased Akt activity, TKT activity, and purine synthesis in multiple organs. These results provide a new mechanism whereby Akt coordinates amino acid availability with glucose utilization, purine synthesis, and RNA and DNA synthesis. PMID:24981175

  18. Origin of amino acid homochirality: relationship with the RNA world and origin of tRNA aminoacylation.

    PubMed

    Tamura, Koji

    2008-04-01

    The origin of homochirality of l-amino acids has long been a mystery. Aminoacylation of tRNA might have provided chiral selectivity, since it is the first process encountered by amino acids and RNA. An RNA minihelix (progenitor of the modern tRNA) was aminoacylated by an aminoacyl phosphate oligonucleotide that exhibited a clear preference for l- as opposed to d-amino acids. A mirror-image RNA system with l-ribose exhibited the opposite selectivity, i.e., it exhibited an apparent preference for the d-amino acid. The selectivity for l-amino acids is based on the stereochemistry of RNA. The side chain of d-amino acids is located much closer to the terminal adenosine of the minihelix, causing them collide and interfere during the amino acid-transfer step. These results suggest that the putative RNA world that preceded the protein theatre determined the homochirality of l-amino acids through tRNA aminoacylation.

  19. DNA and RNA Synthesis in Animal Cells in Culture--Methods for Use in Schools

    ERIC Educational Resources Information Center

    Godsell, P. M.; Balls, M.

    1973-01-01

    Describes the experimental procedures used for detecting DNA and RNA synthesis in xenopus cells by autoradiography. The method described is suitable for senior high school laboratory classes or biology projects, if supervised by a teacher qualified to handle radioisotopes. (JR)

  20. Elimination and utilization of oxidized guanine nucleotides in the synthesis of RNA and its precursors.

    PubMed

    Sekiguchi, Takeshi; Ito, Riyoko; Hayakawa, Hiroshi; Sekiguchi, Mutsuo

    2013-03-22

    Reactive oxygen species are produced as side products of oxygen utilization and can lead to the oxidation of nucleic acids and their precursor nucleotides. Among the various oxidized bases, 8-oxo-7,8-dihydroguanine seems to be the most critical during the transfer of genetic information because it can pair with both cytosine and adenine. During the de novo synthesis of guanine nucleotides, GMP is formed first, and it is converted to GDP by guanylate kinase. This enzyme hardly acts on an oxidized form of GMP (8-oxo-GMP) formed by the oxidation of GMP or by the cleavage of 8-oxo-GDP and 8-oxo-GTP by MutT protein. Although the formation of 8-oxo-GDP from 8-oxo-GMP is thus prevented, 8-oxo-GDP itself may be produced by the oxidation of GDP by reactive oxygen species. The 8-oxo-GDP thus formed can be converted to 8-oxo-GTP because nucleoside-diphosphate kinase and adenylate kinase, both of which catalyze the conversion of GDP to GTP, do not discriminate 8-oxo-GDP from normal GDP. The 8-oxo-GTP produced in this way and by the oxidation of GTP can be used for RNA synthesis. This misincorporation is prevented by MutT protein, which has the potential to cleave 8-oxo-GTP as well as 8-oxo-GDP to 8-oxo-GMP. When (14)C-labeled 8-oxo-GTP was applied to CaCl2-permeabilized cells of a mutT(-) mutant strain, it could be incorporated into RNA at 4% of the rate for GTP. Escherichia coli cells appear to possess mechanisms to prevent misincorporation of 8-oxo-7,8-dihydroguanine into RNA.

  1. An intrinsically disordered peptide from Ebola virus VP35 controls viral RNA synthesis by modulating nucleoprotein-RNA interactions

    DOE PAGES

    Leung, Daisy  W.; Borek, Dominika; Luthra, Priya; ...

    2015-04-01

    During viral RNA synthesis, Ebola virus (EBOV) nucleoprotein (NP) alternates between an RNA-template-bound form and a template-free form to provide the viral polymerase access to the RNA template. In addition, newly synthesized NP must be prevented from indiscriminately binding to noncognate RNAs. Here, we investigate the molecular bases for these critical processes. We identify an intrinsically disordered peptide derived from EBOV VP35 (NPBP, residues 20–48) that binds NP with high affinity and specificity, inhibits NP oligomerization, and releases RNA from NP-RNA complexes in vitro. The structure of the NPBP/ΔNPNTD complex, solved to 3.7 Å resolution, reveals how NPBP peptide occludesmore » a large surface area that is important for NP-NP and NP-RNA interactions and for viral RNA synthesis. Together, our results identify a highly conserved viral interface that is important for EBOV replication and can be targeted for therapeutic development.« less

  2. Motualevic Acids and Analogs: Synthesis and Antimicrobial Structure Activity Relationships

    PubMed Central

    Cheruku, Pradeep; Keffer, Jessica L.; Dogo-Isonagie, Cajetan; Bewley, Carole A.

    2010-01-01

    Synthesis of the marine natural products motualevic acids A, E, and analogs in which modifications have been made to the ω-brominated lipid (E)-14,14-dibromotetra-deca-2,13-dienoic acid or amino acid unit are reported, together with antimicrobial activities against Staphylococcus aureus, methicillin-resistant S. aureus, Enterococcus faecium, and vancomycin-resistant Enterococcus. PMID:20538459

  3. The enhanced rate of transcription of methyl mercury-exposed DNA by RNA polymerase is not sufficient to explain the stimulatory effect of methyl mercury on RNA synthesis in isolated nuclei.

    PubMed

    Frenkel, G D; Ducote, J

    1987-10-01

    Previous work demonstrated two stimulatory effects of methyl mercury on nucleic acid synthesis: (1) in isolated nuclei, methyl mercury stimulates RNA synthesis which is catalyzed by RNA polymerase II [Frenkel and Randles, J. Biol. Chem. 257, 6275-6279 (1982)]. (2) Brief exposure of purified DNA to methyl mercury increases the rate of its transcription by purified RNA polymerase II [Frenkel, Cain, and Chao, Biochem. Biophys. Res. Commun. 127, 849-856 (1985)]. The latter effect was considered as a possible mechanism of the former. Two lines of evidence are presented here which demonstrate that the latter effect is not a sufficient explanation for the former. (1) Mercuric perchlorate has been found to increase the rate of DNA transcription by purified polymerase and the template properties of the mercuric perchlorate-exposed DNA have been found to resemble those of methyl mercury-exposed DNA. Nevertheless, mercuric perchlorate has been shown not to stimulate RNA synthesis in isolated HeLa nuclei. (2) In isolated nuclei of the B50 rat neuroblastoma cell line, RNA synthesis has been found to be stimulated only minimally by methyl mercury. Nevertheless, RNA polymerase II purified from the B50 cells has been found to transcribe methyl mercury-exposed DNA at a higher rate than unexposed control DNA.

  4. Energetics of amino acid synthesis in hydrothermal ecosystems

    NASA Technical Reports Server (NTRS)

    Amend, J. P.; Shock, E. L.

    1998-01-01

    Thermodynamic calculations showed that the autotrophic synthesis of all 20 protein-forming amino acids was energetically favored in hot (100 degrees C), moderately reduced, submarine hydrothermal solutions relative to the synthesis in cold (18 degrees C), oxidized, surface seawater. The net synthesis reactions of 11 amino acids were exergonic in the hydrothermal solution, but all were endergonic in surface seawater. The synthesis of the requisite amino acids of nine thermophilic and hyperthermophilic proteins in a 100 degreesC hydrothermal solution yielded between 600 and 8000 kilojoules per mole of protein, which is energy that is available to drive the intracellular synthesis of enzymes and other biopolymers in hyperthermophiles thriving in these ecosystems.

  5. Gibberellic Acid Activates Chromatin-bound DNA-dependent RNA Polymerase in Wounded Potato Tuber Tissue 1

    PubMed Central

    Wielgat, Bernard; Kahl, Günter

    1979-01-01

    Chromatin-bound DNA-dependent RNA polymerases react upon wounding of white potato tuber tissues with an increase in activity, which is additionally enhanced to 300% in the presence of 0.1 micromolar gibberellic acid (GA3). 2,4-Dichlorophenoxyacetic acid is only weakly effective and indoleacetic acid not at all. Wounding and treatment with GA3 affect template availability of chromatin only slightly. The hormone has no effect on chromatin-bound RNA polymerases, if added in vitro. The enzymes from intact, wounded, and hormone-treated tissues possess similar characteristics: their activity is dependent on the presence of all four ribonucleotides and a divalent cation such as Mg2+ or Mn2+. However, the sensitivity of the enzymes from different preparations toward α-amanitin differs. Total RNA polymerase activity of chromatin was inhibited by α-amanitin to about 44% in intact, to about 22% in wounded, and only 15% in GA3-treated tissues. The relative activities of polymerases I and II were estimated by varying the (NH4)2SO4 and α-amanitin concentrations in the assay system. It is evident that GA3 preferentially stimulates polymerase I and hence ribosomal RNA synthesis. RNA polymerase II is but slightly affected by GA3. Nearest neighbor frequency analysis revealed that the RNA synthesized by the enzymes from the intact tuber is different from that of wounded or GA3-treated tissues. PMID:16661071

  6. On-chip synthesis of RNA aptamer microarrays for multiplexed protein biosensing with SPR imaging measurements.

    PubMed

    Chen, Yulin; Nakamoto, Kohei; Niwa, Osamu; Corn, Robert M

    2012-06-05

    Microarrays of RNA aptamers are fabricated in a one-step, multiplexed enzymatic synthesis on gold thin films in a microfluidic format and then employed in the detection of protein biomarkers with surface plasmon resonance imaging (SPRI) measurements. Single-stranded RNA (ssRNA) oligonucleotides are transcribed on-chip from double-stranded DNA (dsDNA) templates attached to microarray elements (denoted as generator elements) by the surface transcription reaction of T7 RNA polymerase. As they are synthesized, the ssRNA oligonucleotides diffuse in the microfluidic channel and are quickly captured by hybridization adsorption onto adjacent single-stranded DNA (ssDNA) microarray elements (denoted as detector elements) that contain a sequence complementary to 5'-end of the ssRNA. The RNA aptamers attached to these detector elements are subsequently used in SPRI measurements for the bioaffinity detection of protein biomarkers. The microfluidic generator-detector element format permits the simultaneous fabrication of multiple ssRNA oligonucleotides with different capture sequences that can hybridize simultaneously to distinct detector elements and thus create a multiplexed aptamer microarray. In an initial set of demonstration experiments, SPRI measurements are used to monitor the bioaffinity adsorption of human thrombin (hTh) and vascular endothelial growth factor (VEGF) proteins onto RNA aptamer microarrays fabricated in situ with this on-chip RNA polymerase synthesis methodology. Additional SPRI measurements of the hydrolysis and desorption of the surface-bound ssRNA aptamers with a surface RNase H are used to verify the capture of ssRNA with RNA-DNA surface hybridization onto the detector elements. The on-chip RNA synthesis described here is an elegant, one-step multiplexed methodology for the rapid and contamination-free fabrication of RNA aptamer microarrays for protein biosensing with SPRI.

  7. Derivatives of diphosphonic acids: synthesis and biological activity

    NASA Astrophysics Data System (ADS)

    Zolotukhina, M. M.; Krutikov, V. I.; Lavrent'ev, A. N.

    1993-07-01

    The scientific-technical and patent literature on the synthesis of derivatives of diphosphonic acids is surveyed. Various methods of synthesis of diphosphonate, phosphonylphosphinyl, and phosphonophosphate compounds are described. The principal aspects of the use of the above compounds in medicine, biochemistry, and agriculture are examined. The bibliography includes 174 references.

  8. Transaminases for the synthesis of enantiopure beta-amino acids

    PubMed Central

    2012-01-01

    Optically pure β-amino acids constitute interesting building blocks for peptidomimetics and a great variety of pharmaceutically important compounds. Their efficient synthesis still poses a major challenge. Transaminases (also known as aminotransferases) possess a great potential for the synthesis of optically pure β-amino acids. These pyridoxal 5'-dependent enzymes catalyze the transfer of an amino group from a donor substrate to an acceptor, thus enabling the synthesis of a wide variety of chiral amines and amino acids. Transaminases can be applied either for the kinetic resolution of racemic compounds or the asymmetric synthesis starting from a prochiral substrate. This review gives an overview over microbial transaminases with activity towards β-amino acids and their substrate spectra. It also outlines current strategies for the screening of new biocatalysts. Particular emphasis is placed on activity assays which are applicable to high-throughput screening. PMID:22293122

  9. Design, Synthesis, and Properties of Phosphoramidate 2',5'-Linked Branched RNA: Toward the Rational Design of Inhibitors of the RNA Lariat Debranching Enzyme.

    PubMed

    Tago, Nobuhiro; Katolik, Adam; Clark, Nathaniel E; Montemayor, Eric J; Seio, Kohji; Sekine, Mitsuo; Hart, P John; Damha, Masad J

    2015-10-16

    Two RNA fragments linked by means of a 2',5' phosphodiester bridge (2' hydroxyl of one fragment connected to the 5' hydroxyl of the other) constitute a class of nucleic acids known as 2'-5' branched RNAs (bRNAs). In this report we show that bRNA analogues containing 2'-5' phosphoramidate linkages (bN-RNAs) inhibit the lariat debranching enzyme, a 2',5'-phosphodiesterase that has recently been implicated in neurodegenerative diseases associated with aging. bN-RNAs were efficiently generated using automated solid-phase synthesis and suitably protected branchpoint building blocks. Two orthogonally removable groups, namely the 4-monomethoxytrityl (MMTr) group and the fluorenylmethyl-oxycarbonyl (Fmoc) groups, were evaluated as protecting groups of the 2' amino functionality. The 2'-N-Fmoc methodology was found to successfully produce bN-RNAs on solid-phase oligonucleotide synthesis. The synthesized bN-RNAs resisted hydrolysis by the lariat debranching enzyme (Dbr1) and, in addition, were shown to attenuate the Dbr1-mediated hydrolysis of native bRNA.

  10. A Recombinant Collagen-mRNA Platform for Controllable Protein Synthesis.

    PubMed

    Sun, Liping; Xiong, Yunjing; Bashan, Anat; Zimmerman, Ella; Shulman Daube, Shirley; Peleg, Yoav; Albeck, Shira; Unger, Tamar; Yonath, Hagith; Krupkin, Miri; Matzov, Donna; Yonath, Ada

    2015-07-06

    We have developed a collagen-mRNA platform for controllable protein production that is intended to be less prone to the problems associated with commonly used mRNA therapy as well as with collagen skin-healing procedures. A collagen mimic was constructed according to a recombinant method and was used as scaffold for translating mRNA chains into proteins. Cysteines were genetically inserted into the collagen chain at positions allowing efficient ribosome translation activity while minimizing mRNA misfolding and degradation. Enhanced green fluorescence protein (eGFP) mRNA bound to collagen was successfully translated by cell-free Escherichia coli ribosomes. This system enabled an accurate control of specific protein synthesis by monitoring expression time and level. Luciferase-mRNA was also translated on collagen scaffold by eukaryotic cell extracts. Thus we have demonstrated the feasibility of controllable protein synthesis on collagen scaffolds by ribosomal machinery.

  11. The parable of the caveman and the Ferrari: protein synthesis and the RNA world.

    PubMed

    Noller, Harry F

    2017-03-19

    The basic steps of protein synthesis are carried out by the ribosome, a very large and complex ribonucleoprotein particle. In keeping with its proposed emergence from an RNA world, all three of its core mechanisms-aminoacyl-tRNA selection, catalysis of peptide bond formation and coupled translocation of mRNA and tRNA-are embodied in the properties of ribosomal RNA, while its proteins play a supportive role.This article is part of the themed issue 'Perspectives on the ribosome'.

  12. Direct Catalytic Asymmetric Synthesis of β-Hydroxy Acids from Malonic Acid.

    PubMed

    Gao, Hang; Luo, Zhenli; Ge, Pingjin; He, Junqian; Zhou, Feng; Zheng, Peipei; Jiang, Jun

    2015-12-18

    A nickel(II) catalyzed asymmetric synthesis of β-hydroxy acids from malonic acid and ketones was developed, revealing for the first time the synthetic utility of malonic acid in the construction of chiral carboxyl acids; importantly, the synthetic potential of this strategy was further demonstrated by the rapid construction of cephalanthrin A, phaitanthrin B, cruciferane, and rice metabolites.

  13. Effects of Abscisic Acid and Ethylene on the Gibberellic Acid-Induced Synthesis of α-Amylase by Isolated Wheat Aleurone Layers 1

    PubMed Central

    Varty, Keith; Arreguín, Barbarín L.; Gómez, Miguel T.; López, Pablo Jaime T.; Gómez, Miguel Angel L.

    1983-01-01

    Gibberellic acid-induced α-amylase synthesis in wheat aleurone layers (Triticum aestivum L. var Potam S-70) escaped from transcriptional control 30 h after addition of the hormone, as evidenced by the tissue's loss of susceptibility to cordycepin. Abscisic acid inhibited the accumulation of α-amylase activity when added to the tissue during this cordycepin-insensitive phase of enzyme induction. α-Amylase synthesis was not restored by the addition of cordycepin, indicating that the response to abscisic acid was not dependent upon the continuous synthesis of a short lived RNA. When ethylene was added simultaneously or some time after abscisic acid, the accumulation of α-amylase activity was sustained or quickly restored. The loss of susceptibility to cordycepin was completely prevented when aleurone layers were incubated with a combination of gibberellic and abscisic acids from the start of the induction period. This effect of abscisic acid was not reversed by ethylene. On the basis of these observations, it is suggested that abscisic acid inhibits both the transcription and translation of α-amylase mRNA, and that only the latter site of action is susceptible to reversal by ethylene. The rate of incorporation of [methyl-14C]choline into phospholipids was also inhibited by abscisic acid. Ethylene reversed this effect. The effects of abscisic acid and ethylene on phospholipid synthesis were not dependent upon the presence of gibberellic acid. No direct relationship was found between the control of α-amylase synthesis and membrane formation by abscisic acid and ethylene. PMID:16663284

  14. Salicylic acid and gentisic acid induce RNA silencing-related genes and plant resistance to RNA pathogens.

    PubMed

    Campos, Laura; Granell, Pablo; Tárraga, Susana; López-Gresa, Pilar; Conejero, Vicente; Bellés, José María; Rodrigo, Ismael; Lisón, Purificación

    2014-04-01

    We have observed that treatments with salicylic acid (SA) or gentisic acid (GA) induced resistance to RNA pathogens such as ToMV and CEVd in tomato and Gynura auriantiaca, respectively. Accumulation of SA and GA has been found to occur in plants infected by these pathogens, thus pointing out a possible defence role of both molecules. To study the molecular basis of the observed induced resistance to RNA pathogens the induction of silencing-related genes by SA and GA was considered. For that purpose, we searched for tomato genes which were orthologous to those described in Arabidopsis thaliana, such as AtDCL1, AtDCL2, AtDCL4, AtRDR1, AtRDR2 and AtRDR6, and we tracked their induction in tomato along virus and viroid infections. We observed that CEVd significantly induced all these genes in tomato, with the exception of ToRDR6, being the induction of ToDCL4 the most outstanding. Regarding the ToMV asymptomatic infection, with the exception of ToRDR2, we observed a significant induction of all the indicated silencing-related genes, being ToDCL2 the most induced gene. Subsequently, we analyzed their transcriptional activation by SA and at the time when ToMV was inoculated on plants. ToDCL2, ToRDR1 and ToRDR2 were significantly induced by both SA and GA, whereas ToDCL1 was only induced by SA. Such an induction resulted more effective by SA treatment, which is in agreement with the stronger SA-induced resistance observed. Our results suggest that the observed delay in the RNA pathogen accumulation could be due to the pre-induction of RNA silencing-related genes by SA or GA.

  15. Gold-nanobeacons for real-time monitoring of RNA synthesis.

    PubMed

    Rosa, João; Conde, João; de la Fuente, Jesus M; Lima, João C; Baptista, Pedro V

    2012-01-01

    Measuring RNA synthesis and, when required, the level of inhibition, is crucial towards the development of practical strategies to evaluate silencing efficiency of gene silencing approaches. We developed a direct method to follow RNA synthesis in real time based on gold nanoparticles (AuNPs) functionalized with a fluorophore labeled hairpin-DNA, i.e. gold-nanobeacon (Au-nanobeacon). Under hairpin configuration, proximity to gold nanoparticles leads to fluorescence quenching; hybridization to a complementary target restores fluorescence emission due to the Au-nanobeacons' conformational reorganization that causes the fluorophore and the AuNP to part from each other, yielding a quantitative response. With this reporter Au-nanobeacon we were able to measure the rate of in vitro RNA synthesis (~10.3 fmol of RNA per minute). Then, we designed a second Au-nanobeacon targeting the promoter sequence (inhibitor) so as to inhibit transcription whilst simultaneously monitor the number of promoters being silenced. Using the two Au-nanobeacons in the same reaction mixture, we are capable of quantitatively assess in real time the synthesis of RNA and the level of inhibition. The biosensor concept can easily be extended and adapted to situations when real-time quantitative assessment of RNA synthesis and determination of the level of inhibition are required. In fact, this biosensor may assist the in vitro evaluation of silencing potential of a given sequence to be later used for in vivo gene silencing.

  16. The role of the priming loop in Influenza A virus RNA synthesis

    PubMed Central

    te Velthuis, Aartjan J.W.; Robb, Nicole C.; Kapanidis, Achillefs N.; Fodor, Ervin

    2016-01-01

    RNA-dependent RNA polymerases (RdRps) are used by RNA viruses to replicate and transcribe their RNA genomes1. They adopt a closed, right-handed fold with conserved subdomains called palm, fingers, and thumb1,2. Conserved RdRp motifs A-F coordinate the viral RNA template, NTPs, and magnesium ions to facilitate nucleotide condensation1. For the initiation of RNA synthesis, most RdRps use either a primer-dependent or de novo mechanism3. The Influenza A virus RdRp in contrast, uses a capped RNA oligonucleotide to initiate transcription, and a combination of terminal and internal de novo initiation for replication4. To understand how the Influenza A virus RdRp coordinates these processes, we analysed the function of a thumb subdomain β-hairpin using initiation, elongation, and single-molecule FRET assays. Our data shows that this β-hairpin is essential for terminal initiation during replication, but auxiliary for internal initiation and transcription. Analysis of individual residues in the tip of the β-hairpin shows that PB1 proline 651 is critical for efficient RNA synthesis in vitro and in cell culture. Overall, this work advances our understanding of Influenza A virus RNA synthesis and identifies the initiation platform of viral replication. PMID:27274864

  17. An Assay of RNA Synthesis in Hepatic Nuclei from Control and Streptococcus pneumoniae-Infected Rats

    DTIC Science & Technology

    1982-02-22

    Scintisol. The were precipitated in 300 #l ice-cold 10% tri- percentage of total counts in the pellet and chloroacetic acid (TCA) (w/v) contained in...little contamination by other cell organdies. An in vitro system for the incorporation of 2-I14Cluridine- 5-triphosphate into ribonucleic acid (RNA... acid and amino acids (4-6) by the liver, and al- (RNA) production (12) prior to the increased tered carbohydrate (7), lipid (8-10), protein plasma

  18. Inadequacy of prebiotic synthesis as origin of proteinous amino acids.

    PubMed

    Wong, J T; Bronskill, P M

    1979-07-18

    The production of some nonproteinous, and lack of production of other proteinous, amino acids in model prebiotic synthesis, along with the instability of glutamine and asparagine, suggest that not all of the 20 present day proteinous amino acids gained entry into proteins directly from the primordial soup. Instead, a process of active co-evolution of the genetic code and its constituent amino acids would have to precede the final selection of these proteinous amono acids.

  19. Reformation of nucleolus-like bodies in the absence of postmitotic RNA synthesis.

    PubMed

    Stevens, A R; Prescott, D M

    1971-03-01

    The dependence of nucleolar reformation on RNA synthesis that resumes in late anaphase or early telophase has been investigated in synchronously dividing Amoeba proteus. RNA synthesis was completely inhibited throughout all stages of mitosis and the early hours of interphase with high concentrations of actinomycin D. In such cells, nucleolus-like bodies that bind azure B and pyronin were apparent in the reformed nuclei. The bodies appear as dense, fibrous masses with loosely associated, finely fibrillar material. There are no characteristic granular regions in the reformed structures. It is suggested that the bodies probably represent mainly nucleolar protein and residual RNA which can bring about the reorganization of nucleoli in the absence of postmitotic RNA synthesis.

  20. Prebiotic Amino Acid Thioester Synthesis: Thiol-Dependent Amino Acid Synthesis from Formose substrates (Formaldehyde and Glycolaldehyde) and Ammonia

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1998-01-01

    Formaldehyde and glycolaldehyde (substrates of the formose autocatalytic cycle) were shown to react with ammonia yielding alanine and homoserine under mild aqueous conditions in the presence of thiol catalysts. Since similar reactions carried out without ammonia yielded alpha-hydroxy acid thioesters, the thiol-dependent synthesis of alanine and homoserine is presumed to occur via amino acid thioesters-intermediates capable of forming peptides. A pH 5.2 solution of 20 mM formaldehyde, 20 mM glycolaldehyde, 20 mM ammonium chloride, 23 mM 3-mercaptopropionic acid, and 23 mM acetic acid that reacted for 35 days at 40 C yielded (based on initial formaldehyde) 1.8% alanine and 0.08% homoserine. In the absence of thiol catalyst, the synthesis of alanine and homoserine was negligible. Alanine synthesis required both formaldehyde and glycolaldehyde, but homoserine synthesis required only glycolaldehyde. At 25 days the efficiency of alanine synthesis calculated from the ratio of alanine synthesized to formaldehyde reacted was 2.1%, and the yield (based on initial formaldehyde) of triose and tetrose intermediates involved in alanine and homoserine synthesis was 0.3 and 2.1%, respectively. Alanine synthesis was also seen in similar reactions containing only 10 mM each of aldehyde substrates, ammonia, and thiol. The prebiotic significance of these reactions that use the formose reaction to generate sugar intermediates that are converted to reactive amino acid thioesters is discussed.

  1. The inhibitory effect of glycolic acid and lactic acid on melanin synthesis in melanoma cells.

    PubMed

    Usuki, Akiko; Ohashi, Akiko; Sato, Hirofumi; Ochiai, Yasunobu; Ichihashi, Masamitsu; Funasaka, Yoko

    2003-01-01

    Alpha-hydroxy acids (AHAs) such as glycolic acid (GA) and lactic acid (LA) have been reported to be effective in treating pigmentary lesions such as melasma, solar lentigines, and postinflammatory hyperpigmentation. The mechanism of this effect might be due to epidermal remodeling and accelerated desquamation, which would result in quick pigment dispersion. However, the direct effect of AHAs on melanin synthesis has not yet been well studied. To elucidate such a direct effect of AHAs on melanogenesis, we performed melanin assays, growth curve determinations, Northern and Western blotting for melanogenic proteins [tyrosinase, tyrosinase related protein (TRP)-1 and TRP-2], and tyrosinase and, 4-dihydroxyphenylalaninechrome tautomerase enzyme activity assays using mouse B16 and human melanoma cells. GA or LA (at doses of 300 or 500 microg/ml) inhibited melanin formation in similar dose-dependent manner, without affecting cell growth. Although the mRNA and protein expression or molecular size of tyrosinase, TRP-1 and TRP-2 were not affected, tyrosinase activity was inhibited. To see whether GA and/or LA directly inhibit tyrosinase catalytic function, the effect of GA and LA on human tyrosinase purified from the melanosome-rich large granule fraction of human melanoma cells was performed. GA or LA were shown to inhibit tyrosinase enzyme activity directly, but this effect was not due to the acidity of GA or LA, because adjusting the pH to 5.6 (the pH of GA and LA at concentrations of 2500 microg/ml), did not affect tyrosinase activity. Taken together, these results show that GA and LA suppress melanin formation by directly inhibiting tyrosinase activity, an effect independent of their acidic nature. GA and LA might work on pigmentary lesions not only by accelerating the turnover of the epidermis but also by directly inhibiting melanin formation in melanocytes.

  2. Lysophosphatidic acid synthesis and phospholipid metabolism in rat mast cells

    SciTech Connect

    Fagan, D.L.

    1986-01-01

    The role of lysophosphatidic acid in mast cell response to antigen was investigated using an isolated rat serosal mast cell model. The cells were incubated with monoclonal murine immunoglobulin E to the dinitrophenyl hapten and prelabeled with /sup 32/P-orthophosphate or /sup 3/H-fatty acids. Lysophosphatidic acid was isolated form cell extracts by 2-dimensional thin-layer chromatography, and the incorporated radioactivity was assessed by liquid scintillation counting. Lysophosphatidic acid labeling with /sup 32/P was increased 2-4 fold within 5 minutes after the addition of antigen or three other mast cell agonists. Functional group analyses unequivocally showed that the labeled compound was lysophosphatidic acid. Lysophosphatidic acid synthesis was dependent on the activity of diacylglycerol lipase, suggesting formation from monoacylglycerol. In addition, the studies of lysophosphatidic acid synthesis suggest that the addition of antigen to mast cells may initiate more than one route of phospholipid degradation and resynthesis. Whatever the origin of lysophosphatidic acid, the results of this study demonstrated that lysophosphatidic acid synthesis is stimulated by a variety of mast cell agonists. Dose-response, kinetic, and pharmacologic studies showed close concordance between histamine release and lysophosphatidic acid labeling responses. These observations provide strong evidence that lysophosphatidic acid plays an important role in mast cell activation.

  3. Docosahexaenoic Acid Conjugation Enhances Distribution and Safety of siRNA upon Local Administration in Mouse Brain

    PubMed Central

    Nikan, Mehran; Osborn, Maire F; Coles, Andrew H; Godinho, Bruno MDC; Hall, Lauren M; Haraszti, Reka A; Hassler, Matthew R; Echeverria, Dimas; Aronin, Neil; Khvorova, Anastasia

    2016-01-01

    The use of siRNA-based therapies for the treatment of neurodegenerative disease requires efficient, nontoxic distribution to the affected brain parenchyma, notably the striatum and cortex. Here, we describe the synthesis and activity of a fully chemically modified siRNA that is directly conjugated to docosahexaenoic acid (DHA), the most abundant polyunsaturated fatty acid in the mammalian brain. DHA conjugation enables enhanced siRNA retention throughout both the ipsilateral striatum and cortex following a single, intrastriatal injection (ranging from 6–60 μg). Within these tissues, DHA conjugation promotes internalization by both neurons and astrocytes. We demonstrate efficient and specific silencing of Huntingtin mRNA expression in both the ipsilateral striatum (up to 73%) and cortex (up to 51%) after 1 week. Moreover, following a bilateral intrastriatal injection (60 μg), we achieve up to 80% silencing of a secondary target, Cyclophilin B, at both the mRNA and protein level. Importantly, DHA-hsiRNAs do not induce neural cell death or measurable innate immune activation following administration of concentrations over 20 times above the efficacious dose. Thus, DHA conjugation is a novel strategy for improving siRNA activity in mouse brain, with potential to act as a new therapeutic platform for the treatment of neurodegenerative disorders. PMID:27504598

  4. The Prebiotic Synthesis of Ethylenediamine Monoacetic Acid, The Repeating Unit of Peptide Nucleic Acids

    NASA Technical Reports Server (NTRS)

    Nelson, Kevin E.; Miller, Stanley L.

    1992-01-01

    The polymerization of ribonucleic acids or their precursors constitutes an important event in prebiotic chemistry. The various problems using ribonucleotides to make RNA suggest that there may have been a precursor. An attractive possibility are the peptide nucleic acids (PNA). PNAs are nucleotide analogs that make use of a polymer of ethylenediamine monoacetic acid (EDMA or 2-amninoethyl glycine) with the bases attached by an acetic acid. EDMA is an especially attractive alternative to the ribose phosphate or deoxyribose phosphate backbone because it contains no chiral centers and is potentially prebiotic, but there is no reported prebiotic synthesis. We have synthesized both EDMA and ethylenediamine diacetic acid (EDDA) from the prebiotic compounds ethylenediamine, formaldehyde, and hydrogen cyanide. The yields of EDMA range from 11 to 79% along with some sEDDA and uEDDA. These reactions work with concentrations of 10(exp -1)M and as low as 10(exp -4)M, and the reaction is likely to be effective at even lower concentrations. Ethylenediamine is a likely prebiotic compound, but it has not yet been demonstrated, although compounds such as ethanolamine and cysteamine have been proven to be prebiotic. Under neutral pH and heating at l00 C, EDMA is converted to the lactam, monoketopiperazine (MKP). The cyclization occurs and has an approximate ratio of MKP/EDMA = 3 at equilibrium. We have measured the solubilities of EDMA center dot H20 as 6.4 m, EDMA center dot HCl center dot H20 as 13.7 m, and EDMA center dot 2HCl center dot H20 as 3.4 m. These syntheses together with the high solubility of EDMA suggest that EDMA would concentrate in drying lagoons and might efficiently form polymers. Given the instability of ribose and the poor polymerizability of nucleotides, the prebiotic presence of EDMA and the possibility of its polymerization raises the possibility that PNAs are the progenitors of present day nucleic acids. A pre-RNA world may have existed in which PNAs or

  5. Oleochemical synthesis of an acid cleavable hydrophobe for surfactant use

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The synthesis of a series of branched hydroxy stearates from commercially available methyl oleate and common organic acids is reported. A variety of different acids, with 3 to 8 carbon atoms, and also varying in their branching and functionality, were used. The kinetics of the ring opening reactio...

  6. The enxymatic synthesis and characterization of disolketal iminodiacetic acid (DSIDA)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Esterifications between iminodiacetic acid and its methyl and ethyl derivatives with glycerol or solketal have been studied. The synthesis of IDA with solketal was unsuccessful under experimental conditions of 70 degrees C and 200 torr for 24h. However, using dimethyl iminodiacetic acid with solke...

  7. RNA Primer Extension Hinders DNA Synthesis by Escherichia coli Mutagenic DNA Polymerase IV

    PubMed Central

    Tashjian, Tommy F.; Lin, Ida; Belt, Verena; Cafarelli, Tiziana M.; Godoy, Veronica G.

    2017-01-01

    In Escherichia coli the highly conserved DNA damage regulated dinB gene encodes DNA Polymerase IV (DinB), an error prone specialized DNA polymerase with a central role in stress-induced mutagenesis. Since DinB is the DNA polymerase with the highest intracellular concentrations upon induction of the SOS response, further regulation must exist to maintain genomic stability. Remarkably, we find that DinB DNA synthesis is inherently poor when using an RNA primer compared to a DNA primer, while high fidelity DNA polymerases are known to have no primer preference. Moreover, we show that the poor DNA synthesis from an RNA primer is conserved in DNA polymerase Kappa, the human DinB homolog. The activity of DinB is modulated by interactions with several other proteins, one of which is the equally evolutionarily conserved recombinase RecA. This interaction is known to positively affect DinB’s fidelity on damaged templates. We find that upon interaction with RecA, DinB shows a significant reduction in DNA synthesis when using an RNA primer. Furthermore, with DinB or DinB:RecA a robust pause, sequence and lesion independent, occurs only when RNA is used as a primer. The robust pause is likely to result in abortive DNA synthesis when RNA is the primer. These data suggest a novel mechanism to prevent DinB synthesis when it is not needed despite its high concentrations, thus protecting genome stability. PMID:28298904

  8. RNA Primer Extension Hinders DNA Synthesis by Escherichia coli Mutagenic DNA Polymerase IV.

    PubMed

    Tashjian, Tommy F; Lin, Ida; Belt, Verena; Cafarelli, Tiziana M; Godoy, Veronica G

    2017-01-01

    In Escherichia coli the highly conserved DNA damage regulated dinB gene encodes DNA Polymerase IV (DinB), an error prone specialized DNA polymerase with a central role in stress-induced mutagenesis. Since DinB is the DNA polymerase with the highest intracellular concentrations upon induction of the SOS response, further regulation must exist to maintain genomic stability. Remarkably, we find that DinB DNA synthesis is inherently poor when using an RNA primer compared to a DNA primer, while high fidelity DNA polymerases are known to have no primer preference. Moreover, we show that the poor DNA synthesis from an RNA primer is conserved in DNA polymerase Kappa, the human DinB homolog. The activity of DinB is modulated by interactions with several other proteins, one of which is the equally evolutionarily conserved recombinase RecA. This interaction is known to positively affect DinB's fidelity on damaged templates. We find that upon interaction with RecA, DinB shows a significant reduction in DNA synthesis when using an RNA primer. Furthermore, with DinB or DinB:RecA a robust pause, sequence and lesion independent, occurs only when RNA is used as a primer. The robust pause is likely to result in abortive DNA synthesis when RNA is the primer. These data suggest a novel mechanism to prevent DinB synthesis when it is not needed despite its high concentrations, thus protecting genome stability.

  9. [The first steps of chlorophyll synthesis: RNA involvement and regulation]. Progress report, January 1990--June 1992

    SciTech Connect

    Soell, D.

    1992-12-31

    Glu-tRNA{sup Glu} is synthesized from glutamate and tRNA{sup Glu} by glutamyl-tRNA synthetase (GluRS). Recent work has demonstrated that Glu-tRNA{sup Glu} has dual functions and is a precursor for protein and 5-aminolevulinate (ALA) synthesis. Current data does not provide compelling evidence for the notion that GluRS is regulated by chlorophyll precursors or in concert with the other enzymes of ALA synthesis. We have redefined the C5-pathway as a two-step route to ALA starting with Glu-tRNA{sup Glu}. Only two enzymes, Glu-tRNA reductase (GluTR) and GSA-2,1-amino-mutase (GSA-AM), are specifically involved in ALA synthesis. We have purified these enzymatic activities from Chlamydomonas and demonstrated that the two purified proteins in the presence of their cofactors NADPH and pyridoxal phosphate are sufficient for the in vitro Glu-tRNA {yields} ALA conversion. We have cloned the genes encoding GluTR. The sequences of the GluTR proteins deduced from these genes share highly conserved regions with those of bacterial origin. We havealso cloned and analyzed the gene encoding GSA-AM from Arabidopsis. As in Salmonella typhimurium, there are indications of the existence of an additional pathway for ALA formation in E. coli. To shed light on the recognition of the single tRNA{sup Glu} by the chloroplast enzymes GluTR, GluRS we characterized a chlorophyll-deficient mutant of Euglena having tRNA{sup Glu} with a point mutation in the T{Psi}C-loop. The altered tRNA supports protein but not ALA synthesis.

  10. Rotavirus Replication: Plus-Sense Templates for Double-Stranded RNA Synthesis Are Made in Viroplasms

    PubMed Central

    Silvestri, Lynn S.; Taraporewala, Zenobia F.; Patton, John T.

    2004-01-01

    Rotavirus plus-strand RNAs not only direct protein synthesis but also serve as templates for the synthesis of the segmented double-stranded RNA (dsRNA) genome. In this study, we identified short-interfering RNAs (siRNAs) for viral genes 5, 8, and 9 that suppressed the expression of NSP1, a nonessential protein; NSP2, a component of viral replication factories (viroplasms); and VP7, an outer capsid protein, respectively. The loss of NSP2 expression inhibited viroplasm formation, genome replication, virion assembly, and synthesis of the other viral proteins. In contrast, the loss of VP7 expression had no effect on genome replication; instead, it inhibited only outer-capsid morphogenesis. Similarly, neither genome replication nor any other event of the viral life cycle was affected by the loss of NSP1. The data indicate that plus-strand RNAs templating dsRNA synthesis within viroplasms are not susceptible to siRNA-induced RNase degradation. In contrast, plus-strand RNAs templating protein synthesis in the cytosol are susceptible to degradation and thus are not the likely source of plus-strand RNAs for dsRNA synthesis in viroplasms. Indeed, immunofluorescence analysis of bromouridine (BrU)-labeled RNA made in infected cells provided evidence that plus-strand RNAs are synthesized within viroplasms. Furthermore, transfection of BrU-labeled viral plus-strand RNA into infected cells suggested that plus-strand RNAs introduced into the cytosol do not localize to viroplasms. From these results, we propose that plus-strand RNAs synthesized within viroplasms are the primary source of templates for genome replication and that trafficking pathways do not exist within the cytosol that transport plus-strand RNAs to viroplasms. The lack of such pathways confounds the development of reverse genetics systems for rotavirus. PMID:15220450

  11. Overview of methods in RNA nanotechnology: synthesis, purification, and characterization of RNA nanoparticles.

    PubMed

    Haque, Farzin; Guo, Peixuan

    2015-01-01

    RNA nanotechnology encompasses the use of RNA as a construction material to build homogeneous nanostructures by bottom-up self-assembly with defined size, structure, and stoichiometry; this pioneering concept demonstrated in 1998 (Guo et al., Molecular Cell 2:149-155, 1998; featured in Cell) has emerged as a new field that also involves materials engineering and synthetic structural biology (Guo, Nature Nanotechnology 5:833-842, 2010). The field of RNA nanotechnology has skyrocketed over the last few years, as evidenced by the burst of publications in prominent journals on RNA nanostructures and their applications in nanomedicine and nanotechnology. Rapid advances in RNA chemistry, RNA biophysics, and RNA biology have created new opportunities for translating basic science into clinical practice. RNA nanotechnology holds considerable promise in this regard. Increased evidence also suggests that substantial part of the 98.5 % of human genome (Lander et al. Nature 409:860-921, 2001) that used to be called "junk DNA" actually codes for noncoding RNA. As we understand more on how RNA structures are related to function, we can fabricate synthetic RNA nanoparticles for the diagnosis and treatment of diseases. This chapter provides a brief overview of the field regarding the design, construction, purification, and characterization of RNA nanoparticles for diverse applications in nanotechnology and nanomedicince.

  12. Nucleic acid arrays and methods of synthesis

    DOEpatents

    Sabanayagam, Chandran R.; Sano, Takeshi; Misasi, John; Hatch, Anson; Cantor, Charles

    2001-01-01

    The present invention generally relates to high density nucleic acid arrays and methods of synthesizing nucleic acid sequences on a solid surface. Specifically, the present invention contemplates the use of stabilized nucleic acid primer sequences immobilized on solid surfaces, and circular nucleic acid sequence templates combined with the use of isothermal rolling circle amplification to thereby increase nucleic acid sequence concentrations in a sample or on an array of nucleic acid sequences.

  13. Synthesis of capped RNA using a DMT group as a purification handle.

    PubMed

    Veliath, Elizabeth; Gaffney, Barbara L; Jones, Roger A

    2014-01-01

    We report a new method for synthesis of capped RNA or 2'-OMe RNA that uses a N(2-)4,4'-dimethoxytrityl (DMT) group as a lipophilic purification handle to allow convenient isolation and purification of the capped RNA. The DMT group is easily removed under mild conditions without degradation of the cap. We have used this approach to prepare capped 10- and 20-mers. This method is compatible with the many condensation reactions that have been reported for preparation of capped RNA or cap analogues.

  14. Phosphoric Acid-Mediated Synthesis of Vinyl Sulfones through Decarboxylative Coupling Reactions of Sodium Sulfinates with Phenylpropiolic Acids.

    PubMed

    Rong, Guangwei; Mao, Jincheng; Yan, Hong; Zheng, Yang; Zhang, Guoqi

    2015-08-07

    A novel phosphoric acid -mediated synthesis of vinyl sulfones through decarboxylative coupling reactions of sodium sulfinates with phenylpropiolic acids is described. This transformation is efficient and environmentally friendly.

  15. Ursolic Acid Inhibits Na+/K+-ATPase Activity and Prevents TNF-α-Induced Gene Expression by Blocking Amino Acid Transport and Cellular Protein Synthesis

    PubMed Central

    Yokomichi, Tomonobu; Morimoto, Kyoko; Oshima, Nana; Yamada, Yuriko; Fu, Liwei; Taketani, Shigeru; Ando, Masayoshi; Kataoka, Takao

    2011-01-01

    Pro-inflammatory cytokines, such as tumor necrosis factor (TNF)-α, induce the expression of a wide variety of genes, including intercellular adhesion molecule-1 (ICAM-1). Ursolic acid (3β-hydroxy-urs-12-en-28-oic acid) was identified to inhibit the cell-surface ICAM-1 expression induced by pro-inflammatory cytokines in human lung carcinoma A549 cells. Ursolic acid was found to inhibit the TNF-α-induced ICAM-1 protein expression almost completely, whereas the TNF-α-induced ICAM-1 mRNA expression and NF-κB signaling pathway were decreased only partially by ursolic acid. In line with these findings, ursolic acid prevented cellular protein synthesis as well as amino acid uptake, but did not obviously affect nucleoside uptake and the subsequent DNA/RNA syntheses. This inhibitory profile of ursolic acid was similar to that of the Na+/K+-ATPase inhibitor, ouabain, but not the translation inhibitor, cycloheximide. Consistent with this notion, ursolic acid was found to inhibit the catalytic activity of Na+/K+-ATPase. Thus, our present study reveals a novel molecular mechanism in which ursolic acid inhibits Na+/K+-ATPase activity and prevents the TNF-α-induced gene expression by blocking amino acid transport and cellular protein synthesis. PMID:24970122

  16. Novel phenotype of RNA synthesis expressed by vesicular stomatitis virus isolated from persistent infection.

    PubMed Central

    Frey, T K; Youngner, J S

    1982-01-01

    Vesicular stomatitis virus (VSV) stocks isolated from two persistently infected mouse L-cell lines (designated VSV-PI stocks) express an altered phenotype of RNA synthesis. This phenotype is different from the RNA synthesis phenotype expressed by the viruses used to initiate the persistently infected lines, wild-type VSV and VSV ts-0-23 (a group III, ts-, RNA+ mutant). At 34 and 37 degrees C in L cells productively infected with VSV-PI stocks derived from the two cell lines, transcription of virus mRNA was significantly reduced, whereas replication of the 40S genomic RNA species was enhanced compared with wild-type VSV or ts-0-23. At 34 and 37 degrees C, both VSV-PI stocks replicated with equal or greater efficiency than wild-type VSV; 37 degrees C was the temperature at which the persistently infected cultures were maintained. At 40 degrees C, both VSV-PI stocks were temperature sensitive, and clonal VSV-PI isolates from both cell lines belong to complementation group I (RNA-). Standard ts- mutants (derived by mutagenesis of wild-type VSV) belonging to RNA- complementation groups I, II, and IV do not express the VSV-PI RNA synthesis phenotype at the permissive temperature, making this phenotype distinctive to persistent infection. Since the two VSV-PI populations from persistently infected cell lines initiated with different viruses both evolved this unique phenotype of RNA synthesis, the expression of this phenotype may play an important role in the maintenance of persistence. Images PMID:6292483

  17. Reliable semi-synthesis of hydrolysis-resistant 3'-peptidyl-tRNA conjugates containing genuine tRNA modifications.

    PubMed

    Graber, Dagmar; Moroder, Holger; Steger, Jessica; Trappl, Krista; Polacek, Norbert; Micura, Ronald

    2010-10-01

    The 3'-peptidyl-tRNA conjugates that possess a hydrolysis-resistant ribose-3'-amide linkage instead of the natural ester linkage would represent valuable substrates for ribosomal studies. Up to date, access to these derivatives is severely limited. Here, we present a novel approach for the reliable synthesis of non-hydrolyzable 3'-peptidyl-tRNAs that contain all the respective genuine nucleoside modifications. In short, the approach is based on tRNAs from natural sources that are site-specifically cleaved within the TΨC loop by using DNA enzymes to obtain defined tRNA 5'-fragments carrying the modifications. After dephosphorylation of the 2',3'-cyclophosphate moieties from these fragments, they are ligated to the respective 3'-peptidylamino-tRNA termini that were prepared following the lines of a recently reported solid-phase synthesis. By this novel concept, non-hydrolyzable 3'-peptidyl-tRNA conjugates possessing all natural nucleoside modifications are accessible in highly efficient manner.

  18. Fatty acid synthesis is inhibited by inefficient utilization of unusual fatty acids for glycerolipid assembly

    PubMed Central

    Bates, Philip D.; Johnson, Sean R.; Cao, Xia; Li, Jia; Nam, Jeong-Won; Jaworski, Jan G.; Ohlrogge, John B.; Browse, John

    2014-01-01

    Degradation of unusual fatty acids through β-oxidation within transgenic plants has long been hypothesized as a major factor limiting the production of industrially useful unusual fatty acids in seed oils. Arabidopsis seeds expressing the castor fatty acid hydroxylase accumulate hydroxylated fatty acids up to 17% of total fatty acids in seed triacylglycerols; however, total seed oil is also reduced up to 50%. Investigations into the cause of the reduced oil phenotype through in vivo [14C]acetate and [3H]2O metabolic labeling of developing seeds surprisingly revealed that the rate of de novo fatty acid synthesis within the transgenic seeds was approximately half that of control seeds. RNAseq analysis indicated no changes in expression of fatty acid synthesis genes in hydroxylase-expressing plants. However, differential [14C]acetate and [14C]malonate metabolic labeling of hydroxylase-expressing seeds indicated the in vivo acetyl–CoA carboxylase activity was reduced to approximately half that of control seeds. Therefore, the reduction of oil content in the transgenic seeds is consistent with reduced de novo fatty acid synthesis in the plastid rather than fatty acid degradation. Intriguingly, the coexpression of triacylglycerol synthesis isozymes from castor along with the fatty acid hydroxylase alleviated the reduced acetyl–CoA carboxylase activity, restored the rate of fatty acid synthesis, and the accumulation of seed oil was substantially recovered. Together these results suggest a previously unidentified mechanism that detects inefficient utilization of unusual fatty acids within the endoplasmic reticulum and activates an endogenous pathway for posttranslational reduction of fatty acid synthesis within the plastid. PMID:24398521

  19. Effects of bile acid administration on bile acid synthesis and its circadian rhythm in man

    SciTech Connect

    Pooler, P.A.; Duane, W.C.

    1988-09-01

    In man bile acid synthesis has a distinct circadian rhythm but the relationship of this rhythm to feedback inhibition by bile acid is unknown. We measured bile acid synthesis as release of 14CO2 from (26-14C)cholesterol every 2 hr in three normal volunteers during five separate 24-hr periods. Data were fitted by computer to a cosine curve to estimate amplitude and acrophase of the circadian rhythm. In an additional six volunteers, we measured synthesis every 2 hr from 8:00 a.m. to 4:00 p.m. only. During the control period, amplitude (expressed as percentage of mean synthesis) averaged 52% and acrophase averaged 6:49 a.m. During administration of ursodeoxycholic acid (15 mg per kg per day), synthesis averaged 126% of baseline (p less than 0.1), amplitude averaged 43% and acrophase averaged 6:20 a.m. During administration of chenodeoxycholic acid (15 mg per kg per day), synthesis averaged 43% of baseline (p less than 0.001), amplitude averaged 53% and acrophase averaged 9:04 a.m. Addition of prednisone to this regimen of chenodeoxycholic acid to eliminate release of 14CO2 from corticosteroid hormone synthesis resulted in a mean amplitude of 62% and a mean acrophase of 6:50 a.m., values very similar to those in the baseline period. Administration of prednisone alone also did not significantly alter the baseline amplitude (40%) or acrophase (6:28 a.m.). We conclude that neither chenodeoxycholic acid nor ursodeoxycholic acid significantly alters the circadian rhythm of bile acid synthesis in man.

  20. Synaptic vesicles contain small ribonucleic acids (sRNAs) including transfer RNA fragments (trfRNA) and microRNAs (miRNA).

    PubMed

    Li, Huinan; Wu, Cheng; Aramayo, Rodolfo; Sachs, Matthew S; Harlow, Mark L

    2015-10-08

    Synaptic vesicles (SVs) are neuronal presynaptic organelles that load and release neurotransmitter at chemical synapses. In addition to classic neurotransmitters, we have found that synaptic vesicles isolated from the electric organ of Torpedo californica, a model cholinergic synapse, contain small ribonucleic acids (sRNAs), primarily the 5' ends of transfer RNAs (tRNAs) termed tRNA fragments (trfRNAs). To test the evolutionary conservation of SV sRNAs we examined isolated SVs from the mouse central nervous system (CNS). We found abundant levels of sRNAs in mouse SVs, including trfRNAs and micro RNAs (miRNAs) known to be involved in transcriptional and translational regulation. This discovery suggests that, in addition to inducing changes in local dendritic excitability through the release of neurotransmitters, SVs may, through the release of specific trfRNAs and miRNAs, directly regulate local protein synthesis. We believe these findings have broad implications for the study of chemical synaptic transmission.

  1. Synaptic vesicles contain small ribonucleic acids (sRNAs) including transfer RNA fragments (trfRNA) and microRNAs (miRNA)

    PubMed Central

    Li, Huinan; Wu, Cheng; Aramayo, Rodolfo; Sachs, Matthew S.; Harlow, Mark L.

    2015-01-01

    Synaptic vesicles (SVs) are neuronal presynaptic organelles that load and release neurotransmitter at chemical synapses. In addition to classic neurotransmitters, we have found that synaptic vesicles isolated from the electric organ of Torpedo californica, a model cholinergic synapse, contain small ribonucleic acids (sRNAs), primarily the 5′ ends of transfer RNAs (tRNAs) termed tRNA fragments (trfRNAs). To test the evolutionary conservation of SV sRNAs we examined isolated SVs from the mouse central nervous system (CNS). We found abundant levels of sRNAs in mouse SVs, including trfRNAs and micro RNAs (miRNAs) known to be involved in transcriptional and translational regulation. This discovery suggests that, in addition to inducing changes in local dendritic excitability through the release of neurotransmitters, SVs may, through the release of specific trfRNAs and miRNAs, directly regulate local protein synthesis. We believe these findings have broad implications for the study of chemical synaptic transmission. PMID:26446566

  2. The synthesis of glutamic acid in the absence of enzymes: Implications for biogenesis

    NASA Technical Reports Server (NTRS)

    Morowitz, Harold; Peterson, Eta; Chang, Sherwood

    1995-01-01

    This paper reports on the non-enzymatic aqueous phase synthesis of amino acids from keto acids, ammonia and reducing agents. The facile synthesis of key metabolic intermediates, particularly in the glycolytic pathway, the citric acid cycle, and the first step of amino acid synthesis, lead to new ways of looking at the problem of biogenesis.

  3. Total Synthesis of (±)- and (−)-Actinophyllic Acid

    PubMed Central

    Martin, Connor L.; Overman, Larry E.; Rohde, Jason M.

    2010-01-01

    Development of efficient sequences for the total syntheses of (±)-actinophyllic acid (rac-1) and (−)-actinophyllic acid (1) are described. The central step in these syntheses is the aza-Cope/Mannich reaction, which constructs the previously unknown hexacyclic ring system of actinophyllic acid in one step from much simpler tetracyclic precursors. The tetracyclic hexahydro-1,5-methano-1H-azocino[4,3-b]indole ketone rac-37 is assembled from o-nitrophenylacetic acid in four steps, with oxidative cyclization of a dienolate derivative of tricyclic precursor rac-35 being the central step. In the first-generation synthesis, this intermediate is transformed in two steps to homoallyl amine rac-43, whose formaldiminium derivative undergoes efficient aza-Cope/Mannich reaction to give pentacyclic ketone rac-44. In four additional steps, this intermediate is advanced to (±)-actinophyllic acid. The synthesis is streamlined by elaborating ketone rac-37 to β-hydroxyester intermediate rac-53, which is directly transformed to (±)-actinophyllic acid upon exposure to HCl and paraformaldehyde. This concise second-generation total synthesis of (±)-actinophyllic acid is realized in 22% overall yield from commercially available di-tert-butylmalonate and o-nitrophenylacetic acid by a sequence that proceeds by way of only six isolated intermediates. The first enantioselective total synthesis of (−)-actinophyllic acid (1) is accomplished by this direct sequence from tricyclic keto malonate (S)-35. Catalytic enantioselective reduction of α,β-unsaturated ketone 66 is the key step in the preparation of intermediate (S)-35 from the commercially available Boc-amino acid 65. Discussed also is the possibility that the aza-Cope/Mannich reaction might be involved in the biosynthesis of (−)-actinophyllic acid. PMID:20218696

  4. A fast click-slow release strategy towards the HPLC-free synthesis of RNA.

    PubMed

    Agustin, E; Asare Okai, P N; Khan, I; Miller, M R; Wang, R; Sheng, J; Royzen, M

    2016-01-25

    A general strategy for purification of oligonucleotides synthesized by solid phase synthesis is described. It is based on a recently developed concept involving a bio-orthogonal inverse electron demand Diels-Alder reaction between trans-cyclooctene and tetrazine, termed 'click-to-release'. The strategy has been applied towards the synthesis and purification of a model hairpin RNA strand, as well as a 34 nt long aptamer.

  5. Influenza virus RNA polymerase: insights into the mechanisms of viral RNA synthesis

    PubMed Central

    te Velthuis, Aartjan J.W.; Fodor, Ervin

    2016-01-01

    The genome of influenza viruses consists of multiple segments of single stranded negative-sense RNA. Each of these segments is bound by the heterotrimeric viral RNA-dependent RNA polymerase and multiple copies of nucleoprotein, forming viral ribonucleoprotein (vRNP) complexes. It is in the context of these vRNPs that the viral RNA polymerase carries out transcription of viral genes and replication of the viral RNA genome. In this Review, we discuss our current knowledge of the structure of the influenza virus RNA polymerase, how it carries out transcription and replication, and how its activities are modulated by viral and host factors. Furthermore, we discuss how advances in our understanding of polymerase function could help identifying new antiviral targets. PMID:27396566

  6. Inhibition of RNA synthesis by bradykinin involves both the B1 and B2 receptor subtypes.

    PubMed

    Yau, L; Pinsk, M; Zahradka, P

    1996-04-01

    The efficacy of angiotensin converting enzyme inhibitors in the treatment of heart disease is due in part to the accumulation of bradykinin (BK). Since BK can exert its effect by influencing cell proliferation, we chose to study the effect of BK on the growth of A10 vascular smooth muscle cells. Ligand binding studies to determine which BK receptor subtypes are present on A10 cells showed that both B1 and B2 receptors were present in approximately equal numbers. Examination of RNA synthesis demonstrated that BK inhibits uridine incorporation in a dose-dependent manner. This decrease in RNA synthesis was blocked by both B1 and B2 receptor antagonists, as well as by addition of indomethacin, a cyclooxygenase inhibitor. The latter result suggested that prostaglandins mediate the biological actions of BK. Consequently, we examined the direct effect of two prostaglandins, PGE2 and PGI2 (prostacyclin), on A10 cells. PGE2 caused a decrease in RNA synthesis, thus mimicking the effect of BK, while PGI2 did not. Therefore, the inhibition of RNA synthesis in A10 vascular smooth muscle cells by BK requires both B1 and B2 receptor subtypes and this action of BK is apparently mediated by de novo synthesis of prostaglandins.

  7. Role of the C terminus of Lassa virus L protein in viral mRNA synthesis.

    PubMed

    Lehmann, Maria; Pahlmann, Meike; Jérôme, Hanna; Busch, Carola; Lelke, Michaela; Günther, Stephan

    2014-08-01

    The N terminus of arenavirus L protein contains an endonuclease presumably involved in "cap snatching." Here, we employed the Lassa virus replicon system to map other L protein sites that might be involved in this mechanism. Residues Phe-1979, Arg-2018, Phe-2071, Asp-2106, Trp-2173, Tyr-2179, Arg-2200, and Arg-2204 were important for viral mRNA synthesis but dispensable for genome replication. Thus, the C terminus of L protein is involved in the mRNA synthesis process, potentially by mediating cap binding.

  8. Reformation of functional liver polyribosomes from ribosome monomers in the absence of RNA synthesis.

    PubMed

    Stewart, G A; Farber, E

    1967-07-07

    The administration to rats of the ethyl analog of methionine, ethionine, results in the rapid decrease in the hepatic concentration of adenosine triphosphate followed by an extensive disaggregation of polysomes to ribosome monomers and a concomitant inhibition of protein synthesis. These effects are readily reversed by the injection of methionine or precursors of adenine nucleotides such as adenine. The reformation of liver polyribosomes in such animals following the administration of adenine plus methionine was found to occur under conditions in which new RNA synthesis was markedly inhibited. Free messenger RNA without attached ribosomes must be capable of remaining functionally active in the liver cytoplasm for many hours.

  9. Dihedral angle preferences of DNA and RNA binding amino acid residues in proteins.

    PubMed

    Ponnuraj, Karthe; Saravanan, Konda Mani

    2017-04-01

    A protein can interact with DNA or RNA molecules to perform various cellular processes. Identifying or analyzing DNA/RNA binding site amino acid residues is important to understand molecular recognition process. It is quite possible to accurately model DNA/RNA binding amino acid residues in experimental protein-DNA/RNA complex by using the electron density map whereas, locating/modeling the binding site amino acid residues in the predicted three dimensional structures of DNA/RNA binding proteins is still a difficult task. Considering the above facts, in the present work, we have carried out a comprehensive analysis of dihedral angle preferences of DNA and RNA binding site amino acid residues by using a classical Ramachandran map. We have computed backbone dihedral angles of non-DNA/RNA binding residues and used as control dataset to make a comparative study. The dihedral angle preference of DNA and RNA binding site residues of twenty amino acid type is presented. Our analysis clearly revealed that the dihedral angles (φ, ψ) of DNA/RNA binding amino acid residues prefer to occupy (-89° to -60°, -59° to -30°) bins. The results presented in this paper will help to model/locate DNA/RNA binding amino acid residues with better accuracy.

  10. Downregulation of de Novo Fatty Acid Synthesis in Subcutaneous Adipose Tissue of Moderately Obese Women.

    PubMed

    Guiu-Jurado, Esther; Auguet, Teresa; Berlanga, Alba; Aragonès, Gemma; Aguilar, Carmen; Sabench, Fàtima; Armengol, Sandra; Porras, José Antonio; Martí, Andreu; Jorba, Rosa; Hernández, Mercè; del Castillo, Daniel; Richart, Cristóbal

    2015-12-16

    The purpose of this work was to evaluate the expression of fatty acid metabolism-related genes in human adipose tissue from moderately obese women. We used qRT-PCR and Western Blot to analyze visceral (VAT) and subcutaneous (SAT) adipose tissue mRNA expression involved in de novo fatty acid synthesis (ACC1, FAS), fatty acid oxidation (PPARα, PPARδ) and inflammation (IL6, TNFα), in normal weight control women (BMI < 25 kg/m², n = 35) and moderately obese women (BMI 30-38 kg/m², n = 55). In SAT, ACC1, FAS and PPARα mRNA expression were significantly decreased in moderately obese women compared to controls. The downregulation reported in SAT was more pronounced when BMI increased. In VAT, lipogenic-related genes and PPARα were similar in both groups. Only PPARδ gene expression was significantly increased in moderately obese women. As far as inflammation is concerned, TNFα and IL6 were significantly increased in moderate obesity in both tissues. Our results indicate that there is a progressive downregulation in lipogenesis in SAT as BMI increases, which suggests that SAT decreases the synthesis of fatty acid de novo during the development of obesity, whereas in VAT lipogenesis remains active regardless of the degree of obesity.

  11. Photolithographic Synthesis of High-Density DNA and RNA Arrays on Flexible, Transparent, and Easily Subdivided Plastic Substrates.

    PubMed

    Holden, Matthew T; Carter, Matthew C D; Wu, Cheng-Hsien; Wolfer, Jamison; Codner, Eric; Sussman, Michael R; Lynn, David M; Smith, Lloyd M

    2015-11-17

    The photolithographic fabrication of high-density DNA and RNA arrays on flexible and transparent plastic substrates is reported. The substrates are thin sheets of poly(ethylene terephthalate) (PET) coated with cross-linked polymer multilayers that present hydroxyl groups suitable for conventional phosphoramidite-based nucleic acid synthesis. We demonstrate that by modifying array synthesis procedures to accommodate the physical and chemical properties of these materials, it is possible to synthesize plastic-backed oligonucleotide arrays with feature sizes as small as 14 μm × 14 μm and feature densities in excess of 125 000/cm(2), similar to specifications attainable using rigid substrates such as glass or glassy carbon. These plastic-backed arrays are tolerant to a wide range of hybridization temperatures, and improved synthetic procedures are described that enable the fabrication of arrays with sequences up to 50 nucleotides in length. These arrays hybridize with S/N ratios comparable to those fabricated on otherwise identical arrays prepared on glass or glassy carbon. This platform supports the enzymatic synthesis of RNA arrays and proof-of-concept experiments are presented showing that the arrays can be readily subdivided into smaller arrays (or "millichips") using common laboratory-scale laser cutting tools. These results expand the utility of oligonucleotide arrays fabricated on plastic substrates and open the door to new applications for these important bioanalytical tools.

  12. Synthesis of 5-Hydroxymethylcytidine- and 5-Hydroxymethyl-uridine-Modified RNA

    PubMed Central

    Riml, Christian; Micura, Ronald

    2016-01-01

    We report on the syntheses of 5-hydroxymethyl-uridine [5hm(rU)] and -cytidine [5hm(rC)] phosphoramidites and their incorporation into RNA by solid-phase synthesis. Deprotection of the oligonucleotides is accomplished in a straightforward manner using standard conditions, confirming the appropriateness of the acetyl protection used for the pseudobenzylic alcohol moieties. The approach provides robust access to 5hm(rC/U)-modified RNAs that await applications in pull-down experiments to identify potential modification enzymes. They will also serve as synthetic probes for the development of high-throughput-sequencing methods in native RNAs. 1Introduction2Protection Strategies Reported for the Synthesis of 5hm(dC)-Modified DNA3Synthesis of 5-Hydroxymethylpyrimidine-Modified RNA3.1Synthesis of 5hm(rC) Phosphoramidite3.2Synthesis of 5hm(rU) Phosphoramidite3.3Synthesis of 5hm(rC)- and 5hm(rU)-Modified RNA4Conclusions PMID:27413246

  13. Synthesis of α-aminoboronic acids.

    PubMed

    Andrés, Patricia; Ballano, Gema; Calaza, M Isabel; Cativiela, Carlos

    2016-04-21

    This review describes available methods for the preparation of α-aminoboronic acids in their racemic or in their enantiopure form. Both, highly stereoselective syntheses and asymmetric procedures leading to the stereocontrolled generation of α-aminoboronic acid derivatives are included. The preparation of acyclic, carbocyclic and azacyclic α-aminoboronic acid derivatives is covered. Within each section, the different synthetic approaches have been classified according to the key bond which is formed to complete the α-aminoboronic acid skeleton.

  14. AlkB homolog 3-mediated tRNA demethylation promotes protein synthesis in cancer cells

    PubMed Central

    Ueda, Yuko; Ooshio, Ikumi; Fusamae, Yasuyuki; Kitae, Kaori; Kawaguchi, Megumi; Jingushi, Kentaro; Hase, Hiroaki; Harada, Kazuo; Hirata, Kazumasa; Tsujikawa, Kazutake

    2017-01-01

    The mammalian AlkB homolog (ALKBH) family of proteins possess a 2-oxoglutarate- and Fe(II)-dependent oxygenase domain. A similar domain in the Escherichia coli AlkB protein catalyzes the oxidative demethylation of 1-methyladenine (1-meA) and 3-methylcytosine (3-meC) in both DNA and RNA. AlkB homolog 3 (ALKBH3) was also shown to demethylate 1-meA and 3-meC (induced in single-stranded DNA and RNA by a methylating agent) to reverse the methylation damage and retain the integrity of the DNA/RNA. We previously reported the high expression of ALKBH3 in clinical tumor specimens and its involvement in tumor progression. In this study, we found that ALKBH3 effectively demethylated 1-meA and 3-meC within endogenously methylated RNA. Moreover, using highly purified recombinant ALKBH3, we identified N6-methyladenine (N6-meA) in mammalian transfer RNA (tRNA) as a novel ALKBH3 substrate. An in vitro translation assay showed that ALKBH3-demethylated tRNA significantly enhanced protein translation efficiency. In addition, ALKBH3 knockdown in human cancer cells impaired cellular proliferation and suppressed the nascent protein synthesis that is usually accompanied by accumulation of the methylated RNAs. Thus, our data highlight a novel role for ALKBH3 in tumor progression via RNA demethylation and subsequent protein synthesis promotion. PMID:28205560

  15. Loss of glycogen debranching enzyme AGL drives bladder tumor growth via induction of hyaluronic acid synthesis

    PubMed Central

    Guin, Sunny; Ru, Yuanbin; Agarwal, Neeraj; Lew, Carolyn R.; Owens, Charles; Comi, Giacomo P.; Theodorescu, Dan

    2015-01-01

    Purpose We demonstrated that Amylo-alpha-1-6-glucosidase-4-alpha-glucanotransferase (AGL) is a tumor growth suppressor and prognostic marker in human bladder cancer. Here we determine how AGL loss enhances tumor growth, hoping to find therapeutically tractable targets/pathways that could be used in patients with low AGL expressing tumors. Experimental Design We transcriptionally profiled bladder cell lines with different AGL expression. By focusing on transcripts overexpressed as a function of low AGL and associated with adverse clinicopathologic variables in human bladder tumors, we sought to increase the chances of discovering novel therapeutic opportunities. Results One such transcript was hyaluronic acid synthase 2 (HAS2), an enzyme responsible for hyaluronic acid (HA) synthesis. HAS2 expression was inversely proportional to that of AGL in bladder cancer cells and immortalized and normal urothelium. HAS2 driven HA synthesis was enhanced in bladder cancer cells with low AGL and this drove anchorage dependent and independent growth. siRNA mediated depletion of HAS2 or inhibition of HA synthesis by 4-Methylumbelliferone (4MU) abrogated in vitro and xenograft growth of bladder cancer cells with low AGL. AGL and HAS2 mRNA expression in human tumors was inversely correlated in patient datasets. Patients with high HAS2 and low AGL tumor mRNA expression had poor survival lending clinical support to xenograft findings that HAS2 drives growth of tumors with low AGL. Conclusion Our study establishes HAS2 mediated HA synthesis as a driver of growth of bladder cancer with low AGL and provides preclinical rationale for personalized targeting of HAS2/HA signaling in patients with low AGL expressing tumors. PMID:26490312

  16. Lipase-catalyzed synthesis of fatty acid amide (erucamide) using fatty acid and urea.

    PubMed

    Awasthi, Neeraj Praphulla; Singh, R P

    2007-01-01

    Ammonolysis of fatty acids to the corresponding fatty acid amides is efficiently catalysed by Candida antartica lipase (Novozym 435). In the present paper lipase-catalysed synthesis of erucamide by ammonolysis of erucic acid and urea in organic solvent medium was studied and optimal conditions for fatty amides synthesis were established. In this process erucic acid gave 88.74 % pure erucamide after 48 hour and 250 rpm at 60 degrees C with 1:4 molar ratio of erucic acid and urea, the organic solvent media is 50 ml tert-butyl alcohol (2-methyl-2-propanol). This process for synthesis is economical as we used urea in place of ammonia or other amidation reactant at atmospheric pressure. The amount of catalyst used is 3 %.

  17. Reduced secreted mu mRNA synthesis in selective IgM deficiency of Bloom's syndrome.

    PubMed Central

    Kondo, N; Ozawa, T; Kato, Y; Motoyoshi, F; Kasahara, K; Kameyama, T; Orii, T

    1992-01-01

    Serum IgM concentrations were low although serum IgG and IgA concentrations were normal in both our patients with Bloom's syndrome. Although the percentages of surface IgM-bearing cells were not reduced, the numbers of IgM-secreting cells were markedly reduced. The membrane-bound mu (microns) and secreted mu (microseconds) mRNAs are produced from transcripts of a single immunoglobulin mu gene by alternative RNA processing pathways. The control of microseconds mRNA synthesis depends on the addition of poly(A) to microseconds C-terminal segment. In both patients, mu mRNA was well detected but microseconds C-terminal mRNA was scarcely detected, suggesting that microns mRNA was well transcribed but microseconds mRNA was not. There was, at least, no mutation or deletion in the microseconds C-terminal coding sequence, the RNA splice site (GG/TAAAC) at the 5' end of microseconds C-terminal segment and the AATAAA poly(A) signal sequence in both patients. Our results suggest that selective IgM deficiency in Bloom's syndrome is due to an abnormality in the maturation of surface IgM-bearing B cells into IgM-secreting cells and a failure of microseconds mRNA synthesis. Moreover, reduced microseconds mRNA synthesis may be due to the defect on developmental regulation of the site at which poly(A) is added to transcripts of the mu gene. Images Fig. 2 PMID:1563106

  18. Synthesis of repressible acid phosphatase in Saccharomyces cerevisiae under conditions of enzyme instability.

    PubMed Central

    Bostian, K A; Lemire, J M; Halvorson, H O

    1982-01-01

    The synthesis of repressible acid phosphatase in Saccharomyces cerevisiae was examined under conditions of blocked derepression as described by Toh-e et al. (Mol. Gen. Genet. 162:139-149, 1978). Based on a genetic and biochemical analysis of the phenomenon these authors proposed a new regulatory model for acid phosphatase expression involving a simultaneous interaction of regulatory factors in the control of structural gene transcription. We demonstrate here that under growth conditions that fail to produce acid phosphatase the enzyme is readily inactivated. Furthermore, we demonstrate under these conditions the production of acid phosphatase mRNA which is active both in vitro and in vivo in the synthesis of enzyme. This eliminates any step prior to translation of acid phosphatase polypeptide as an explanation for the phenomenon. We interpret our results for the block in appearance of acid phosphatase as a result of both deaccelerated growth and cellular biosynthesis during derepression, accompanied by an enhanced instability of the enzyme. Images PMID:7050664

  19. Requirements for Assembly of Poliovirus Replication Complexes and Negative-Strand RNA Synthesis

    PubMed Central

    Teterina, Natalya L.; Egger, Denise; Bienz, Kurt; Brown, David M.; Semler, Bert L.; Ehrenfeld, Ellie

    2001-01-01

    HeLa cells were transfected with several plasmids that encoded all poliovirus (PV) nonstructural proteins. Viral RNAs were transcribed by T7 RNA polymerase expressed from recombinant vaccinia virus. All plasmids produced similar amounts of viral proteins that were processed identically; however, RNAs were designed either to serve as templates for replication or to contain mutations predicted to prevent RNA replication. The mutations included substitution of the entire PV 5′ noncoding region (NCR) with the encephalomyocarditis virus (EMCV) internal ribosomal entry site, thereby deleting the 5′-terminal cloverleaf-like structure, or insertion of three nucleotides in the 3Dpol coding sequence. Production of viral proteins was sufficient to induce the characteristic reorganization of intracellular membranes into heterogeneous-sized vesicles, independent of RNA replication. The vesicles were stably associated with viral RNA only when RNA replication could occur. Nonreplicating RNAs localized to distinct, nonoverlapping regions in the cell, excluded from the viral protein-membrane complexes. The absence of accumulation of positive-strand RNA from both mutated RNAs in transfected cells was documented. In addition, no minus-strand RNA was produced from the EMCV chimeric template RNA in vitro. These data show that the 5′-terminal sequences of PV RNA are essential for initiation of minus-strand RNA synthesis at its 3′ end. PMID:11264373

  20. A comparison of RNA with DNA in template-directed synthesis

    NASA Technical Reports Server (NTRS)

    Zielinski, M.; Kozlov, I. A.; Orgel, L. E.; Bada, J. L. (Principal Investigator)

    2000-01-01

    Nonenzymatic template-directed copying of RNA sequences rich in cytidylic acid using nucleoside 5'-(2-methylimidazol-1-yl phosphates) as substrates is substantially more efficient than the copying of corresponding DNA sequences. However, many sequences cannot be copied, and the prospect of replication in this system is remote, even for RNA. Surprisingly, wobble-pairing leads to much more efficient incorporation of G opposite U on RNA templates than of G opposite T on DNA templates.

  1. Role of the 3′ tRNA-Like Structure in Tobacco Mosaic Virus Minus-Strand RNA Synthesis by the Viral RNA-Dependent RNA Polymerase In Vitro

    PubMed Central

    Osman, T. A. M.; Hemenway, C. L.; Buck, K. W.

    2000-01-01

    A template-dependent RNA polymerase has been used to determine the sequence elements in the 3′ untranslated region of tobacco mosaic virus RNA that are required for promotion of minus-strand RNA synthesis and binding to the RNA polymerase in vitro. Regions which were important for minus-strand synthesis were domain D1, which is equivalent to a tRNA acceptor arm; domain D2, which is similar to a tRNA anticodon arm; an upstream domain, D3; and a central core, C, which connects domains D1, D2, and D3 and determines their relative orientations. Mutational analysis of the 3′-terminal 4 nucleotides of domain D1 indicated the importance of the 3′-terminal CA sequence for minus-strand synthesis, with the sequence CCCA or GGCA giving the highest transcriptional efficiency. Several double-helical regions, but not their sequences, which are essential for forming pseudoknot and/or stem-loop structures in domains D1, D2, and D3 and the central core, C, were shown to be required for high template efficiency. Also important were a bulge sequence in the D2 stem-loop and, to a lesser extent, a loop sequence in a hairpin structure in domain D1. The sequence of the 3′ untranslated region upstream of domain D3 was not required for minus-strand synthesis. Template-RNA polymerase binding competition experiments showed that the highest-affinity RNA polymerase binding element region lay within a region comprising domain D2 and the central core, C, but domains D1 and D3 also bound to the RNA polymerase with lower affinity. PMID:11090166

  2. Targeting pre-miRNA by Peptide Nucleic Acids

    PubMed Central

    Avitabile, Concetta; Saviano, Michele; D'Andrea, Luca; Bianchi, Nicoletta; Fabbri, Enrica; Brognara, Eleonora; Gambari, Roberto; Romanelli, Alessandra

    2012-01-01

    PNAs conjugated to carrier peptides have been employed for the targeting of miRNA precursor, with the aim to develop molecules able to interfere in the pre-miRNA processing. The capability of the molecules to bind pre-miRNA has been tested in vitro by fluorescence assayes on Thiazole Orange labeled molecules and in vivo, in K562 cells, evaluating the amount of miRNA produced after treatment of cells with two amounts of PNAs. PMID:22699795

  3. In vitro synthesis of vertebrate U1 snRNA.

    PubMed Central

    Lund, E; Dahlberg, J E

    1989-01-01

    We have developed a DNA-dependent in vitro transcription system for vertebrate snRNA genes. By isolating the nuclei (germinal vesicles, GVs) of Xenopus laevis oocytes under oil to maintain the in vivo composition of their internal milieu, we are able to prepare nuclei that retain their ability to synthesize snRNAs efficiently. Homogenates of these GVs synthesize correctly initiated and terminated U1 snRNA using exogenous X.laevis U1 genes as templates. The templates may be either injected into the nucleus prior to its isolation or added to the nuclear homogenate. Images PMID:2714253

  4. In situ synthesis of peptide nucleic acids in porous silicon for drug delivery and biosensing.

    PubMed

    Beavers, Kelsey R; Mares, Jeremy W; Swartz, Caleb M; Zhao, Yiliang; Weiss, Sharon M; Duvall, Craig L

    2014-07-16

    Peptide nucleic acids (PNA) are a unique class of synthetic molecules that have a peptide backbone and can hybridize with nucleic acids. Here, a versatile method has been developed for the automated, in situ synthesis of PNA from a porous silicon (PSi) substrate for applications in gene therapy and biosensing. Nondestructive optical measurements were performed to monitor single base additions of PNA initiated from (3-aminopropyl)triethoxysilane attached to the surface of PSi films, and mass spectrometry was conducted to verify synthesis of the desired sequence. Comparison of in situ synthesis to postsynthesis surface conjugation of the full PNA molecules showed that surface mediated, in situ PNA synthesis increased loading 8-fold. For therapeutic proof-of-concept, controlled PNA release from PSi films was characterized in phosphate buffered saline, and PSi nanoparticles fabricated from PSi films containing in situ grown PNA complementary to micro-RNA (miR) 122 generated significant anti-miR activity in a Huh7 psiCHECK-miR122 cell line. The applicability of this platform for biosensing was also demonstrated using optical measurements that indicated selective hybridization of complementary DNA target molecules to PNA synthesized in situ on PSi films. These collective data confirm that we have established a novel PNA-PSi platform with broad utility in drug delivery and biosensing.

  5. By-products of electrochemical synthesis of suberic acid

    SciTech Connect

    Shirobokova, O.I.; Adamov, A.A.; Freidlin, G.N.; Antonenko, N.S.; Grudtsyn, Yu.D.

    1988-05-10

    By-products of the electrochemical synthesis of dimethyl suberate from glutaric anhydride were studied. This is isolated by thermal dehydration of a mixture of lower dicarboxylic acids that are wastes from the production of adipic acid. To isolate the by-products, they used the methods of vacuum rectification and preparative gas-liquid chromatography, and for their identification, PMR, IR spectroscopy, gas-liquid chromatography, and other known physicochemical methods of investigation.

  6. Transfer RNA-mediated regulation of ribosome dynamics during protein synthesis.

    PubMed

    Fei, Jingyi; Richard, Arianne C; Bronson, Jonathan E; Gonzalez, Ruben L

    2011-08-21

    Translocation of tRNAs through the ribosome during protein synthesis involves large-scale structural rearrangement of the ribosome and ribosome-bound tRNAs that is accompanied by extensive and dynamic remodeling of tRNA-ribosome interactions. How the rearrangement of individual tRNA-ribosome interactions influences tRNA movement during translocation, however, remains largely unknown. To address this question, we used single-molecule FRET to characterize the dynamics of ribosomal pretranslocation (PRE) complex analogs carrying either wild-type or systematically mutagenized tRNAs. Our data reveal how specific tRNA-ribosome interactions regulate the rate of PRE complex rearrangement into a critical, on-pathway translocation intermediate and how these interactions control the stability of the resulting configuration. Notably, our results suggest that the conformational flexibility of the tRNA molecule has a crucial role in directing the structural dynamics of the PRE complex during translocation.

  7. Effects of pyrazinamide on fatty acid synthesis by whole mycobacterial cells and purified fatty acid synthase I.

    PubMed

    Boshoff, Helena I; Mizrahi, Valerie; Barry, Clifton E

    2002-04-01

    The effects of low extracellular pH and intracellular accumulation of weak organic acids were compared with respect to fatty acid synthesis by whole cells of Mycobacterium tuberculosis and Mycobacterium smegmatis. The profile of fatty acids synthesized during exposure to benzoic, nicotinic, or pyrazinoic acids, as well as that observed during intracellular hydrolysis of the corresponding amides, was not a direct consequence of modulation of fatty acid synthesis by these compounds but reflected the response to inorganic acid stress. Analysis of fatty acid synthesis in crude mycobacterial cell extracts demonstrated that pyrazinoic acid failed to directly modulate the fatty acid synthase activity catalyzed by fatty acid synthase I (FAS-I). However, fatty acid synthesis was irreversibly inhibited by 5-chloro-pyrazinamide in a time-dependent fashion. Moreover, we demonstrate that pyrazinoic acid does not inhibit purified mycobacterial FAS-I, suggesting that this enzyme is not the immediate target of pyrazinamide.

  8. The “Speedy” Synthesis of Atom-Specific 15N Imino/Amido-Labeled RNA

    PubMed Central

    Kreutz, Christoph; Micura, Ronald

    2016-01-01

    Although numerous reports on the synthesis of atom-specific 15N-labeled nucleosides exist, fast and facile access to the corresponding phosphoramidites for RNA solid-phase synthesis is still lacking. This situation represents a severe bottleneck for NMR spectroscopic investigations on functional RNAs. Here, we present optimized procedures to speed up the synthesis of 15N(1) adenosine and 15N(1) guanosine amidites, which are the much needed counterparts of the more straightforward-to-achieve 15N(3) uridine and 15N(3) cytidine amidites in order to tap full potential of 1H/15N/15N-COSY experiments for directly monitoring individual Watson–Crick base pairs in RNA. Demonstrated for two preQ1 riboswitch systems, we exemplify a versatile concept for individual base-pair labeling in the analysis of conformationally flexible RNAs when competing structures and conformational dynamics are encountered. PMID:26237536

  9. Nucleic acid hybridization with RNA immobilized on filter paper.

    NASA Technical Reports Server (NTRS)

    Saxinger, W. C.; Ponnamperuma, C.; Gillespie, D.

    1972-01-01

    RNA has been immobilized in a manner suitable for use in molecular hybridization experiments with dissolved RNA or DNA by a nonaqueous solid-phase reaction with carbonyldiimidazole and RNA 'dry coated' on cellulose or, preferably, on previously activated phosphocellulose filters. Immobilization of RNA does not appear to alter its chemical character or cause it to acquire affinity for unspecific RNA or DNA. The versatility and efficiency of this method make it potentially attractive for use in routine analytical or preparative hybridization experiments, among other applications.

  10. The spark discharge synthesis of amino acids from various hydrocarbons

    NASA Technical Reports Server (NTRS)

    Ring, D.; Miller, S. L.

    1984-01-01

    The spark discharge synthesis of amino acids using an atmosphere of CH4+N2+H2O+NH3 has been investigated with variable pNH3. The amino acids produced using higher hydrocarbons (ethane, ethylene, acetylene, propane, butane, and isobutane) instead of CH4 were also investigated. There was considerable range in the absolute yields of amino acids, but the yields relative to glycine (or alpha-amino-n-butyric acid) were more uniform. The relative yields of the C3 to C6 aliphatic alpha-amino acids are nearly the same (with a few exceptions) with all the hydrocarbons. The glycine yields are more variable. The precursors to the C3-C6 aliphatic amino acids seem to be produced in the same process, which is separate from the synthesis of glycine precursors. It may be possible to use these relative yields as a signature for a spark discharge synthesis provided corrections can be made for subsequent decomposition events (e.g. in the Murchison meteorite).

  11. Codon-specific and general inhibition of protein synthesis by the tRNA-sequestering minigenes.

    PubMed

    Delgado-Olivares, Luis; Zamora-Romo, Efraín; Guarneros, Gabriel; Hernandez-Sanchez, Javier

    2006-07-01

    The expression of minigenes in bacteria inhibits protein synthesis and cell growth. Presumably, the translating ribosomes, harboring the peptides as peptidyl-tRNAs, pause at the last sense codon of the minigene directed mRNAs. Eventually, the peptidyl-tRNAs drop off and, under limiting activity of peptidyl-tRNA hydrolase, accumulate in the cells reducing the concentration of specific aminoacylable tRNA. Therefore, the extent of inhibition is associated with the rate of starvation for a specific tRNA. Here, we used minigenes harboring various last sense codons that sequester specific tRNAs with different efficiency, to inhibit the translation of reporter genes containing, or not, these codons. A prompt inhibition of the protein synthesis directed by genes containing the codons starved for their cognate tRNA (hungry codons) was observed. However, a non-specific in vitro inhibition of protein synthesis, irrespective of the codon composition of the gene, was also evident. The degree of inhibition correlated directly with the number of hungry codons in the gene. Furthermore, a tRNA(Arg4)-sequestering minigene promoted the production of an incomplete beta-galactosidase polypeptide interrupted, during bacterial polypeptide chain elongation at sites where AGA codons were inserted in the lacZ gene suggesting ribosome pausing at the hungry codons.

  12. Akt activation enhances ribosomal RNA synthesis through casein kinase II and TIF-IA.

    PubMed

    Nguyen, Le Xuan Truong; Mitchell, Beverly S

    2013-12-17

    Transcription initiation factor I (TIF-IA) plays an essential role in regulating ribosomal RNA (rRNA) synthesis by tethering RNA polymerase I (Pol I) to the rDNA promoter. We have found that activated Akt enhances rRNA synthesis through the phosphorylation of casein kinase IIα (CK2α) on a threonine residue near its N terminus. CK2 in turn phosphorylates TIF-IA, thereby increasing rDNA transcription. Activated Akt also stabilizes TIF-IA, induces its translocation to the nucleolus, and enhances its interaction with Pol I. Treatment with AZD8055, an inhibitor of both Akt and mammalian target of rapamycin phosphorylation, but not with rapamycin, disrupts Akt-mediated TIF-IA stability, translocation, and activity. These data support a model in which activated Akt enhances rRNA synthesis both by preventing TIF-IA degradation and phosphorylating CK2α, which in turn phosphorylates TIF-IA. This model provides an explanation for the ability of activated Akt to promote cell proliferation and, potentially, transformation.

  13. Fatty Acid Synthesis Intermediates Represent Novel Noninvasive Biomarkers of Prostate Cancer Chemoprevention by Phenethyl Isothiocyanate.

    PubMed

    Singh, Krishna B; Singh, Shivendra V

    2017-03-14

    Increased de novo synthesis of fatty acids is a distinctive feature of prostate cancer, which continues to be a leading cause of cancer-related deaths among American men. Therefore, inhibition of de novo fatty acid synthesis represents an attractive strategy for chemoprevention of prostate cancer. We have shown previously that dietary feeding of phenethyl isothiocyanate (PEITC), a phytochemical derived from edible cruciferous vegetables such as watercress, inhibits incidence and burden of poorly-differentiated prostate cancer in Transgenic Adenocarcinoma of Mouse Prostate (TRAMP) model. The present study was designed to test the hypothesis of whether fatty acid intermediate(s) can serve as noninvasive biomarker(s) of prostate cancer chemoprevention by PEITC using archived plasma and tumor specimens from the TRAMP study as well as cellular models of prostate cancer. Exposure of prostate cancer cells (LNCaP and 22Rv1) to pharmacological concentrations of PEITC resulted in downregulation of key fatty acid metabolism proteins, including acetyl-CoA carboxylase 1 (ACC1), fatty acid synthase (FASN), and carnitine palmitoyltransferase 1A (CPT1A). The mRNA expression of FASN and CPT1A as well as acetyl-CoA levels were decreased by PEITC treatment in both cell lines. PEITC administration to TRAMP mice also resulted in a significant decrease in tumor expression of FASN protein. Consistent with these findings, the levels of total free fatty acids, total phospholipids, triglyceride, and ATP were significantly lower in the plasma and/or prostate tumors of PEITC-treated TRAMP mice compared with controls. The present study is the first to implicate inhibition of fatty acid synthesis in prostate cancer chemoprevention by PEITC.

  14. Synthesis of monomethyl 5,5'-dehydrodiferulic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Synthesis of the internal reference compound, monomethyl 5,5’-dehydrodiferulic acid, is described. The synthetic scheme relies on a selective monomethylation of the known compound 5,5-dehydrodivanillin, followed by elaboration into the dehydrodiferulic framework through a dual Horner-Emmons-Wadswort...

  15. In Planta Recognition of a Double-Stranded RNA Synthesis Protein Complex by a Potexviral RNA Silencing Suppressor[C][W][OPEN

    PubMed Central

    Okano, Yukari; Senshu, Hiroko; Hashimoto, Masayoshi; Neriya, Yutaro; Netsu, Osamu; Minato, Nami; Yoshida, Tetsuya; Maejima, Kensaku; Oshima, Kenro; Komatsu, Ken; Yamaji, Yasuyuki; Namba, Shigetou

    2014-01-01

    RNA silencing plays an important antiviral role in plants and invertebrates. To counteract antiviral RNA silencing, most plant viruses have evolved viral suppressors of RNA silencing (VSRs). TRIPLE GENE BLOCK PROTEIN1 (TGBp1) of potexviruses is a well-characterized VSR, but the detailed mechanism by which it suppresses RNA silencing remains unclear. We demonstrate that transgenic expression of TGBp1 of plantago asiatica mosaic virus (PlAMV) induced developmental abnormalities in Arabidopsis thaliana similar to those observed in mutants of SUPPRESSOR OF GENE SILENCING3 (SGS3) and RNA-DEPENDENT RNA POLYMERASE6 (RDR6) required for the trans-acting small interfering RNA synthesis pathway. PlAMV-TGBp1 inhibits SGS3/RDR6-dependent double-stranded RNA synthesis in the trans-acting small interfering RNA pathway. TGBp1 interacts with SGS3 and RDR6 and coaggregates with SGS3/RDR6 bodies, which are normally dispersed in the cytoplasm. In addition, TGBp1 forms homooligomers, whose formation coincides with TGBp1 aggregation with SGS3/RDR6 bodies. These results reveal the detailed molecular function of TGBp1 as a VSR and shed new light on the SGS3/RDR6-dependent double-stranded RNA synthesis pathway as another general target of VSRs. PMID:24879427

  16. Synthesis and preliminary investigations of the siRNA delivery potential of novel, single-chain rigid cationic carotenoid lipids.

    PubMed

    Pungente, Michael D; Jubeli, Emile; Øpstad, Christer L; Al-Kawaz, Mais; Barakat, Nour; Ibrahim, Tarek; Abdul Khalique, Nada; Raju, Liji; Jones, Rachel; Leopold, Philip L; Sliwka, Hans-Richard; Partali, Vassilia

    2012-03-16

    The success of nucleic acid delivery requires the development of safe and efficient delivery vectors that overcome cellular barriers for effective transport. Herein we describe the synthesis of a series of novel, single-chain rigid cationic carotenoid lipids and a study of their preliminary in vitro siRNA delivery effectiveness and cellular toxicity. The efficiency of siRNA delivery by the single-chain lipid series was compared with that of known cationic lipid vectors, 3β-[N-(N',N'-dimethylaminoethane)carbamoyl]-cholesterol (DC-Chol) and 1,2-dimyristoyl-sn-glyceryl-3-phosphoethanolamine (EPC) as positive controls. All cationic lipids (controls and single-chain lipids) were co-formulated into liposomes with the neutral co-lipid, 1,2-dioleolyl-sn-glycerol-3-phosphoethanolamine (DOPE). Cationic lipid-siRNA complexes of varying (+/-) molar charge ratios were formulated for delivery into HR5-CL11 cells. Of the five single-chain carotenoid lipids investigated, lipids 1, 2, 3 and 5 displayed significant knockdown efficiency with HR5-CL11 cells. In addition, lipid 1 exhibited the lowest levels of cytotoxicity with cell viability greater than 80% at all (+/-) molar charge ratios studied. This novel, single-chain rigid carotenoid-based cationic lipid represents a new class of transfection vector with excellent cell tolerance, accompanied with encouraging siRNA delivery efficiency.

  17. Catalytic RNA and synthesis of the peptide bond

    NASA Technical Reports Server (NTRS)

    Usher, D. A.; Kozlowski, M.; Zou, X.

    1991-01-01

    We are studying whether the L-19 IVS ribozyme from Tetrahymena thermophila can catalyze the formation of the peptide bond when it is supplied with synthetic aminoacyl oligonucleotides. If this reaction works, it could give us some insight into the mechanism of peptide bond formation and the origin of coded protein synthesis. Two short oligoribonucleotides, CCCCC and a protected form of CCCCU were prepared; the former was made by the controlled hydrolysis of Poly(C), and the later by multistep chemical synthesis from the protected monomers. The homopentamer was then aminocylated using C-14 labelled Boc-protected glycine imidazolide. This aminoacylated oligo-nucleotide has now been shown to enter the active site of the L-19 IVS, and aminoacyl transfer, and peptide bond formation reactions are being sought. Our synthesis of CCCCU made us aware of the inadequacy of many of the 2'- hydroxyl protecting groups that are in use today and we therefore designed a new 2'- protecting group that is presently being tested.

  18. Vitamin B-6 restriction impairs fatty acid synthesis in cultured human hepatoma (HepG2) cells

    PubMed Central

    Zhao, Mei; Ralat, Maria A.; da Silva, Vanessa; Garrett, Timothy J.; Melnyk, Stephan; James, S. Jill

    2013-01-01

    Vitamin B-6 deficiency has been reported to alter n-6 and n-3 fatty acid profiles in plasma and tissue lipids; however, the mechanisms underlying such metabolic changes remain unclear. The objective of this study was to determine the effects of vitamin B-6 restriction on fatty acid profiles and fatty acid synthesis in HepG2 cells. Cells were cultured for 6 wk in media with four different vitamin B-6 concentrations (10, 20, 50, and 2,000 nM added pyridoxal, representing deficient, marginal, adequate, and supraphysiological conditions) that induced a range of steady-state cellular concentrations of pyridoxal phosphate. Total cellular lipid content was greatest in the deficient (10 nM pyridoxal) medium. The percentage of arachidonic acid and the ratio of arachidonic acid to linoleic acid in the total lipid fraction were ∼15% lower in vitamin B-6-restricted cells, which suggests that vitamin B-6 restriction affects n-6 fatty acid interconversions. Metabolic flux studies indicated significantly lower fractional synthesis rate of oleic acid and arachidonic acid at 10, 20, and 50 nM pyridoxal, whereas that of eicosapentaenoic acid was lower in the cells cultured in 10 nM pyridoxal. Additionally, relative mRNA expressions of Δ5 and Δ6 desaturases were 40–50% lower in vitamin B-6-restricted cells. Overall, these findings suggest that vitamin B-6 restriction alters unsaturated fatty acid synthesis, particularly n-6 and n-3 polyunsaturated fatty acid synthesis. These results and observations of changes in human plasma fatty acid profiles caused by vitamin B-6 restriction suggest a mechanism by which vitamin B-6 inadequacy influences the cardiovascular risk. PMID:23211517

  19. Orthogonal Synthesis of Xeno Nucleic Acids.

    PubMed

    Fiers, Guillaume; Chouikhi, Dalila; Oswald, Laurence; Al Ouahabi, Abdelaziz; Chan-Seng, Delphine; Charles, Laurence; Lutz, Jean-François

    2016-12-12

    Sequence-defined peptide triazole nucleic acids (PTzNA) were synthesized by means of a solid-phase orthogonal "AB+CD" iterative strategy. In this approach, AB and CD building blocks containing carboxylic acid (A), azide (B), alkyne (C), and primary amine (D) functions are assembled together by successive copper-catalyzed azide-alkyne cycloaddition (CuAAC) and acid-amine coupling steps. Different PTzNA genetic sequences were prepared using a library of eight building blocks (i.e., four AB and four CD building blocks).

  20. Codon-reading specificity of an unmodified form of Escherichia coli tRNA1Ser in cell-free protein synthesis.

    PubMed Central

    Takai, K; Takaku, H; Yokoyama, S

    1996-01-01

    Unmodified tRNA molecules are useful for many purposes in cell-free protein biosynthesis, but there is little information about how the lack of tRNA post-transcriptional modifications affects the coding specificity for synonymous codons. In the present study, we prepared an unmodified form of Escherichia coli tRNA1Ser, which originally has the cmo5UGA anticodon (cmo5U = uridine 5-oxyacetic acid) and recognizes the UCU, UCA and UCG codons. The codon specificity of the unmodified tRNA was tested in a cell-free protein synthesis directed by designed mRNAs under competition conditions with the parent tRNA1Ser. It was found that the unmodified tRNA with the UGA anti-codon recognizes the UCA codon nearly as efficiently as the modified tRNA. The unmodified tRNA recognized the UCU codon with low, but detectable efficiency, whereas no recognition of the UCC and UCG codons was detected. Therefore, the absence of modifications makes this tRNA more specific to the UCA codon by remarkably reducing the efficiencies of wobble reading of other synonymous codons, without a significant decrease in the UCA reading efficiency. PMID:8760870

  1. Amino acid synthesis in a supercritical carbon dioxide - water system.

    PubMed

    Fujioka, Kouki; Futamura, Yasuhiro; Shiohara, Tomoo; Hoshino, Akiyoshi; Kanaya, Fumihide; Manome, Yoshinobu; Yamamoto, Kenji

    2009-06-15

    Mars is a CO(2)-abundant planet, whereas early Earth is thought to be also CO(2)-abundant. In addition, water was also discovered on Mars in 2008. From the facts and theory, we assumed that soda fountains were present on both planets, and this affected amino acid synthesis. Here, using a supercritical CO(2)/liquid H(2)O (10:1) system which mimicked crust soda fountains, we demonstrate production of amino acids from hydroxylamine (nitrogen source) and keto acids (oxylic acid sources). In this research, several amino acids were detected with an amino acid analyzer. Moreover, alanine polymers were detected with LC-MS. Our research lights up a new pathway in the study of life's origin.

  2. Amino Acid Synthesis in a Supercritical Carbon Dioxide - Water System

    PubMed Central

    Fujioka, Kouki; Futamura, Yasuhiro; Shiohara, Tomoo; Hoshino, Akiyoshi; Kanaya, Fumihide; Manome, Yoshinobu; Yamamoto, Kenji

    2009-01-01

    Mars is a CO2-abundant planet, whereas early Earth is thought to be also CO2-abundant. In addition, water was also discovered on Mars in 2008. From the facts and theory, we assumed that soda fountains were present on both planets, and this affected amino acid synthesis. Here, using a supercritical CO2/liquid H2O (10:1) system which mimicked crust soda fountains, we demonstrate production of amino acids from hydroxylamine (nitrogen source) and keto acids (oxylic acid sources). In this research, several amino acids were detected with an amino acid analyzer. Moreover, alanine polymers were detected with LC-MS. Our research lights up a new pathway in the study of life’s origin. PMID:19582225

  3. [Possible route for thiamine participation in fatty acid synthesis].

    PubMed

    Buko, V U; Larin, F S

    1976-01-01

    The possibility of thiamine partaking in the synthesis of fatty acids through the functions unrelated to the catalytic properties of thiamine-diphosphate was studied. Rats kept on a fat-free ration devoid of thiamine were given thiamine of thiochrome with no vitaminic properties. The total fatty acids content in different tissues and incorporation therein of tagged acetate and pyruvate was determined, while the fatty acids composition of the liver was investigated by using gas chromatography. Thiamine and thiochrome produced a similar effect on a number of the study factors, i.e. they forced down the total acids level in the spleen, intensified incorporation of tagged acetate and pyruvate in fatty acids of the heart and uniformly changed the fatty acids composition in the liver. It is suggested that the unindirectional effects of thiamine and thiochrome is due to the oxidative transformation of thiamine into thiochrome.

  4. Synthesis of gold nanoparticles using various amino acids.

    PubMed

    Maruyama, Tatsuo; Fujimoto, Yuhei; Maekawa, Tetsuya

    2015-06-01

    Gold nanoparticles (4-7nm) were synthesized from tetraauric acid using various amino acids as reducing and capping agents. The gold nanoparticles were produced from the incubation of a AuCl4(-) solution with an amino acid at 80°C for 20min. Among the twenty amino acids tested, several amino acids produced gold nanoparticles. The color of the nanoparticle solutions varied with the amino acids used for the reduction. We adopted l-histidine as a reducing agent and investigated the effects of the synthesis conditions on the gold nanoparticles. The His and AuCl4(-) concentrations affected the size of the gold nanoparticles and their aggregates. The pH of the reaction solution also affected the reaction yields and the shape of the gold nanoparticles.

  5. Stereoselective synthesis of stable-isotope-labeled amino acids

    SciTech Connect

    Unkefer, C.J.; Martinez, R.A.; Silks, L.A. III; Lodwig, S.N.

    1994-12-01

    For magnetic resonance and vibrational spectroscopies to reach their full potential, they must be used in combination with sophisticated site-specific stable isotope labeling of biological macromolecules. Labeled amino acids are required for the study of the structure and function of enzymes and proteins. Because there are 20 common amino acids, each with its own distinguishing chemistry, they remain a synthetic challenge. The Oppolzer chiral auxiliary provides a general tool with which to approach the synthesis of labeled amino acids. By using the Oppolzer auxiliary, amino acids can be constructed from several small molecules, which is ideal for stable isotope labeling. In addition to directing the stereochemistry at the {alpha}-carbon, the camphorsultam can be used for stereo-specific isotope labeling at prochiral centers in amino acids. By using the camphorsultam auxiliary we have the potential to synthesize virtually any isotopomer of all of the common amino acids.

  6. Regulation of Viral RNA Synthesis by the V Protein of Parainfluenza Virus 5

    PubMed Central

    Yang, Yang; Zengel, James; Sun, Minghao; Sleeman, Katrina; Timani, Khalid Amine; Aligo, Jason; Rota, Paul

    2015-01-01

    ABSTRACT Paramyxoviruses include many important animal and human pathogens. The genome of parainfluenza virus 5 (PIV5), a prototypical paramyxovirus, encodes a V protein that inhibits viral RNA synthesis. In this work, the mechanism of inhibition was investigated. Using mutational analysis and a minigenome system, we identified regions in the N and C termini of the V protein that inhibit viral RNA synthesis: one at the very N terminus of V and the second at the C terminus of V. Furthermore, we determined that residues L16 and I17 are critical for the inhibitory function of the N-terminal region of the V protein. Both regions interact with the nucleocapsid protein (NP), an essential component of the viral RNA genome complex (RNP). Mutations at L16 and I17 abolished the interaction between NP and the N-terminal domain of V. This suggests that the interaction between NP and the N-terminal domain plays a critical role in V inhibition of viral RNA synthesis by the N-terminal domain. Both the N- and C-terminal regions inhibited viral RNA replication. The C terminus inhibited viral RNA transcription, while the N-terminal domain enhanced viral RNA transcription, suggesting that the two domains affect viral RNA through different mechanisms. Interestingly, V also inhibited the synthesis of the RNA of other paramyxoviruses, such as Nipah virus (NiV), human parainfluenza virus 3 (HPIV3), measles virus (MeV), mumps virus (MuV), and respiratory syncytial virus (RSV). This suggests that a common host factor may be involved in the replication of these paramyxoviruses. IMPORTANCE We identified two regions of the V protein that interact with NP and determined that one of these regions enhances viral RNA transcription via its interaction with NP. Our data suggest that a common host factor may be involved in the regulation of paramyxovirus replication and could be a target for broad antiviral drug development. Understanding the regulation of paramyxovirus replication will enable the

  7. Using triple-helix-forming Peptide nucleic acids for sequence-selective recognition of double-stranded RNA.

    PubMed

    Hnedzko, Dziyana; Cheruiyot, Samwel K; Rozners, Eriks

    2014-09-08

    Non-coding RNAs play important roles in regulation of gene expression. Specific recognition and inhibition of these biologically important RNAs that form complex double-helical structures will be highly useful for fundamental studies in biology and practical applications in medicine. This protocol describes a strategy developed in our laboratory for sequence-selective recognition of double-stranded RNA (dsRNA) using triple-helix-forming peptide nucleic acids (PNAs) that bind in the major grove of the RNA helix. The strategy developed uses chemically modified nucleobases, such as 2-aminopyridine (M), which enables strong triple-helical binding under physiologically relevant conditions, and 2-pyrimidinone (P) and 3-oxo-2,3-dihydropyridazine (E), which enable recognition of isolated pyrimidines in the purine-rich strand of the RNA duplex. Detailed protocols for preparation of modified PNA monomers, solid-phase synthesis, HPLC purification of PNA oligomers, and measuring dsRNA binding affinity using isothermal titration calorimetry are included.

  8. Control of. cap alpha. -amylase mRNA accumulation by gibberellic acid and calcium in barley aleurone layers

    SciTech Connect

    Deikman, J.; Jones, R.L.

    1985-01-01

    Pulse-labeling of barley (Hordeum vulgare L. cv Himalaya) aleurone layers incubated for 13 hours in 2.5 micromolar gibberellic acid (GA/sub 3/) with or without 5 millimolar CaCl/sub 2/ shows that ..cap alpha..-amylase isozymes 3 and 4 are not synthesized in vivo in the absence of Ca/sup 2 +/. No difference was observed in ..cap alpha..-amylase mRNA levels between layers incubated for 12 hours in 2.5 micromolar GA/sub 3/ with 5 millimolar CaCl/sub 2/ and layers incubated in GA/sub 3/ alone. RNA isolated from layers incubated for 12 hours in GA/sub 3/ with and without CA/sup 2 +/. A cDNA clone for ..cap alpha..-amylase was isolated and used to measure ..cap alpha..-amylase mRNA levels in aleurone layers incubated in the presence and absence of Ca/sup 2 +/ was translated in vitro and was found to produce the same complement of translation products regardless of the presence of Ca/sup 2 +/ in the incubation medium. Immunoprecipitation of translation products showed that the RNA for ..cap alpha..-amylase synthesized in Ca/sup 2 +/-deprived aleurone layers was translatable. Ca/sup 2 +/ is required for the synthesis of ..cap alpha..-amylase isozymes 3 and 4 at a step after mRNA accumulation and processing.

  9. Simple, high-yield synthesis of polyhedral carborane amino acids

    SciTech Connect

    Kahl, S.B.; Kasar, R.A.

    1996-02-07

    Boron neutron capture therapy (BNCT) is a form of binary cancer therapy that offers the potential of delivering spatially selective, high linear energy transfer radiation to the target cells while sparing surrounding normal tissue. We have demonstarted a versatile, general method for the conversion of o- ,m-, and p-carborane to their corresponding Boc-protected amino acids. Heterobifunctional polyhedral carboranes are exceedingly rare in the literature, and the amino acids prepared by this general method may prove to be valuable synthons for use in the synthesis of tumor-seeking compounds for BNCT or PDT. Morever, these conformationally constrained amino acids should be particularly interesting for use in peptide synthesis. The dihedral angle between the carbon atoms of these polyhedra increases in the order 60{degree} (ortho), 110{degree} (meta), and 180{degree} (para), allowing the peptide chemist to select a desired conformation. 11 refs.

  10. Benzylidene Acetal Protecting Group as Carboxylic Acid Surrogate: Synthesis of Functionalized Uronic Acids and Sugar Amino Acids.

    PubMed

    Banerjee, Amit; Senthilkumar, Soundararasu; Baskaran, Sundarababu

    2016-01-18

    Direct oxidation of the 4,6-O-benzylidene acetal protecting group to C-6 carboxylic acid has been developed that provides an easy access to a wide range of biologically important and synthetically challenging uronic acid and sugar amino acid derivatives in good yields. The RuCl3 -NaIO4 -mediated oxidative cleavage method eliminates protection and deprotection steps and the reaction takes place under mild conditions. The dual role of the benzylidene acetal, as a protecting group and source of carboxylic acid, was exploited in the efficient synthesis of six-carbon sialic acid analogues and disaccharides bearing uronic acids, including glycosaminoglycan analogues.

  11. Essential Amino Acids of the Hantaan Virus N Protein in Its Interaction with RNA

    PubMed Central

    Severson, William; Xu, Xiaolin; Kuhn, Michaela; Senutovitch, Nina; Thokala, Mercy; Ferron, François; Longhi, Sonia; Canard, Bruno; Jonsson, Colleen B.

    2005-01-01

    The nucleocapsid (N) protein of hantavirus encapsidates viral genomic and antigenomic RNAs. Previously, deletion mapping identified a central, conserved region (amino acids 175 to 217) within the Hantaan virus (HTNV) N protein that interacts with a high affinity with these viral RNAs (vRNAs). To further define the boundaries of the RNA binding domain (RBD), several peptides were synthesized and examined for the ability to bind full-length S-segment vRNA. Peptide 195-217 retained 94% of the vRNA bound by the HTNV N protein, while peptides 175-186 and 205-217 bound only 1% of the vRNA. To further explore which residues were essential for binding vRNA, we performed a comprehensive mutational analysis of the amino acids in the RBD. Single and double Ala substitutions were constructed for 18 amino acids from amino acids 175 to 217 in the full-length N protein. In addition, Ala substitutions were made for the three R residues in peptide 185-217. An analysis of protein-RNA interactions by electrophoretic mobility shift assays implicated E192, Y206, and S217 as important for binding. Chemical modification experiments showed that lysine residues, but not arginine or cysteine residues, contribute to RNA binding, which agreed with bioinformatic predictions. Overall, these data implicate lysine residues dispersed from amino acids 175 to 429 of the protein and three amino acids located in the RBD as essential for RNA binding. PMID:16014963

  12. Stability of free and mineral-protected nucleic acids: Implications for the RNA world

    NASA Astrophysics Data System (ADS)

    Swadling, Jacob B.; Coveney, Peter V.; Christopher Greenwell, H.

    2012-04-01

    Using molecular dynamics simulations we study the structural stability of three different nucleic acids intercalated within a magnesium aluminium layered double hydroxide (LDH) mineral, at varying degrees of hydration, and free in aqueous solution. The nucleotides investigated are ribose nucleic acid (RNA), deoxyribose nucleic acid (DNA) and peptide nucleic acid (PNA), all in duplex form. Our simulations show that DNA has enhanced Watson-Crick hydrogen-bonding when intercalated within the LDH clay interlayers, compared with intercalated RNA and PNA, whilst the reverse trend is found for the nucleic acids in bulk water. The tendency for LDH to alter the stability of the three nucleic acids persists for higher temperature and pressure conditions. The uncharged protein backbone of PNA is found to have a detrimental effect on the overall stability of the duplex, as it experiences a greatly reduced electrostatic interaction with the charged LDH sheets compared to RNA and DNA. Assuming an RNA world, in which RNA preceded the DNA/protein world, at some point in time DNA must have taken over the role as the information storage molecule from RNA. These results suggest that a mineral based origin of life may have favoured DNA as the information-storage biomolecule over potentially competing RNA and PNA, providing a route to modern biology from the RNA world.

  13. Lactide Synthesis and Chirality Control for Polylactic acid Production.

    PubMed

    Van Wouwe, Pieter; Dusselier, Michiel; Vanleeuw, Evelien; Sels, Bert

    2016-05-10

    Polylactic acid (PLA) is a very promising biodegradable, renewable, and biocompatible polymer. Aside from its production, its application field is also increasing, with use not only in commodity applications but also as durables and in biomedicine. In the current PLA production scheme, the most expensive part is not the polymerization itself but obtaining the building blocks lactic acid (LA) and lactide, the actual cyclic monomer for polymerization. Although the synthesis of LA and the polymerization have been studied systematically, reports of lactide synthesis are scarce. Most lactide synthesis methods are described in patent literature, and current energy-intensive, aselective industrial processes are based on archaic scientific literature. This Review, therefore, highlights new methods with a technical comparison and description of the different approaches. Water-removal methodologies are compared, as this is a crucial factor in PLA production. Apart from the synthesis of lactide, this Review also emphasizes the use of chemically produced racemic lactic acid (esters) as a starting point in the PLA production scheme. Stereochemically tailored PLA can be produced according to such a strategy, giving access to various polymer properties.

  14. Insights into RNA synthesis, capping, and proofreading mechanisms of SARS-coronavirus.

    PubMed

    Sevajol, Marion; Subissi, Lorenzo; Decroly, Etienne; Canard, Bruno; Imbert, Isabelle

    2014-12-19

    The successive emergence of highly pathogenic coronaviruses (CoVs) such as the Severe Acute Respiratory Syndrome (SARS-CoV) in 2003 and the Middle East Respiratory Syndrome Coronavirus (MERS-CoV) in 2012 has stimulated a number of studies on the molecular biology. This research has provided significant new insight into functions and activities of the replication/transcription multi-protein complex. The latter directs both continuous and discontinuous RNA synthesis to replicate and transcribe the large coronavirus genome made of a single-stranded, positive-sense RNA of ∼30 kb. In this review, we summarize our current understanding of SARS-CoV enzymes involved in RNA biochemistry, such as the in vitro characterization of a highly active and processive RNA polymerase complex which can associate with methyltransferase and 3'-5' exoribonuclease activities involved in RNA capping, and RNA proofreading, respectively. The recent discoveries reveal fascinating RNA-synthesizing machinery, highlighting the unique position of coronaviruses in the RNA virus world.

  15. RNA synthesis and turnover in the molluscan nervous system studied by Click-iT method.

    PubMed

    Ierusalimsky, Victor N; Balaban, Pavel M

    2016-02-15

    RNA synthesis can be detected by means of the in vivo incorporation of 5-ethynyluridine (EU) in newly-synthesized RNA with the relatively simple Click-iT method. We used this method to study the RNA synthesis in the CNS tissue of adult and juvenile terrestrial snails Helix lucorum L. Temporally, first labeled neurons were detected in the adult CNS after 4-h of isolated CNS incubation in EU solution, while 12-h of incubation led to extensive labeling of most CNS neurons. The EU labeling was present as the nuclear and nucleolar staining. The cytoplasm staining was observed after 2-3 days of CNS washout following the EU exposure for 16 h. In juvenile CNS, the first staining reaction was apparent as the staining of apical region in the procerebral lobe of cerebral ganglia after 1h of CNS incubation in EU, while the maximum pattern of staining was obtained after 4h of CNS incubation. Thus, age-related differences in RNA synthesis are present. Activation of neurons elicited by serotonin and caffeine applications noticeably increased the intensity of staining. EU readily penetrates into the bodies of juvenile snails immersed in the EU solution. When the intact juvenile animals were immersed in the EU solution for 1h, the procerebrum staining, similar to the one detected in the incubated juvenile CNS, was observed.

  16. Primordial soup or vinaigrette: did the RNA world evolve at acidic pH?

    PubMed Central

    2012-01-01

    Background The RNA world concept has wide, though certainly not unanimous, support within the origin-of-life scientific community. One view is that life may have emerged as early as the Hadean Eon 4.3-3.8 billion years ago with an atmosphere of high CO2 producing an acidic ocean of the order of pH 3.5-6. Compatible with this scenario is the intriguing proposal that life arose within alkaline (pH 9-11) deep-sea hydrothermal vents like those of the 'Lost City', with the interface with the acidic ocean creating a proton gradient sufficient to drive the first metabolism. However, RNA is most stable at pH 4-5 and is unstable at alkaline pH, raising the possibility that RNA may have first arisen in the acidic ocean itself (possibly near an acidic hydrothermal vent), acidic volcanic lake or comet pond. As the Hadean Eon progressed, the ocean pH is inferred to have gradually risen to near neutral as atmospheric CO2 levels decreased. Presentation of the hypothesis We propose that RNA is well suited for a world evolving at acidic pH. This is supported by the enhanced stability at acidic pH of not only the RNA phosphodiester bond but also of the aminoacyl-(t)RNA and peptide bonds. Examples of in vitro-selected ribozymes with activities at acid pH have recently been documented. The subsequent transition to a DNA genome could have been partly driven by the gradual rise in ocean pH, since DNA has greater stability than RNA at alkaline pH, but not at acidic pH. Testing the hypothesis We have proposed mechanisms for two key RNA world activities that are compatible with an acidic milieu: (i) non-enzymatic RNA replication of a hemi-protonated cytosine-rich oligonucleotide, and (ii) specific aminoacylation of tRNA/hairpins through triple helix interactions between the helical aminoacyl stem and a single-stranded aminoacylating ribozyme. Implications of the hypothesis Our hypothesis casts doubt on the hypothesis that RNA evolved in the vicinity of alkaline hydrothermal vents. The

  17. AKAP3 synthesis is mediated by RNA binding proteins and PKA signaling during mouse spermiogenesis.

    PubMed

    Xu, Kaibiao; Yang, Lele; Zhao, Danyun; Wu, Yaoyao; Qi, Huayu

    2014-06-01

    Mammalian spermatogenesis is regulated by coordinated gene expression in a spatiotemporal manner. The spatiotemporal regulation of major sperm proteins plays important roles during normal development of the male gamete, of which the underlying molecular mechanisms are poorly understood. A-kinase anchoring protein 3 (AKAP3) is one of the major components of the fibrous sheath of the sperm tail that is formed during spermiogenesis. In the present study, we analyzed the expression of sperm-specific Akap3 and the potential regulatory factors of its protein synthesis during mouse spermiogenesis. Results showed that the transcription of Akap3 precedes its protein synthesis by about 2 wk. Nascent AKAP3 was found to form protein complex with PKA and RNA binding proteins (RBPs), including PIWIL1, PABPC1, and NONO, as revealed by coimmunoprecipitation and protein mass spectrometry. RNA electrophoretic gel mobility shift assay showed that these RBPs bind sperm-specific mRNAs, of which proteins are synthesized during the elongating stage of spermiogenesis. Biochemical and cell biological experiments demonstrated that PIWIL1, PABPC1, and NONO interact with each other and colocalize in spermatids' RNA granule, the chromatoid body. In addition, NONO was found in extracytoplasmic granules in round spermatids, whereas PIWIL1 and PABPC1 were diffusely localized in cytoplasm of elongating spermatids, indicating their participation at different steps of mRNA metabolism during spermatogenesis. Interestingly, type I PKA subunits colocalize with PIWIL1 and PABPC1 in the cytoplasm of elongating spermatids and cosediment with the RBPs in polysomal fractions on sucrose gradients. Further biochemical analyses revealed that activation of PKA positively regulates AKAP3 protein synthesis without changing its mRNA level in elongating spermatids. Taken together, these results indicate that PKA signaling directly participates in the regulation of protein translation in postmeiotic male germ cells

  18. RNA and protein synthesis is required for Ancylostoma caninum larval activation.

    PubMed

    Dryanovski, Dilyan I; Dowling, Camille; Gelmedin, Verena; Hawdon, John M

    2011-06-30

    The developmentally arrested infective larva of hookworms encounters a host-specific signal during invasion that initiates the resumption of suspended developmental pathways. The resumption of development during infection is analogous to recovery from the facultative arrested dauer stage in the free-living nematode Caenorhabditis elegans. Infective larvae of the canine hookworm Ancylostoma caninum resume feeding and secrete molecules important for infection when exposed to a host mimicking signal in vitro. This activation process is a model for the initial steps of the infective process. Dauer recovery requires protein synthesis, but not RNA synthesis in C. elegans. To determine the role of RNA and protein synthesis in hookworm infection, inhibitors of RNA and protein synthesis were tested for their effect on feeding and secretion by A. caninum infective larvae. The RNA synthesis inhibitors α-amanitin and actinomycin D inhibit feeding dose-dependently, with IC(50) values of 30 and 8 μM, respectively. The protein synthesis inhibitors puromycin (IC(50)=110 μM), cycloheximide (IC(50)=50 μM), and anisomycin (IC(50)=200 μM) also displayed dose-dependent inhibition of larval feeding. Significant inhibition of feeding by α-amanitin and anisomycin occurred when the inhibitors were added before 12h of the activation process, but not if the inhibitors were added after 12h. None of the RNA or protein synthesis inhibitors prevented secretion of the activation-associated protein ASP-1, despite nearly complete inhibition of feeding. The results indicate that unlike dauer recovery in C. elegans, de novo gene expression is required for hookworm larval activation, and the critical genes are expressed within 12h of exposure to activating stimuli. However, secretion of infection-associated proteins is independent of gene expression, indicating that the proteins are pre-synthesized and stored for rapid release during the initial stages of infection. The genes that are inhibited

  19. Involvement of a universal amino acid synthesis impediment in cytoplasmic male sterility in pepper

    PubMed Central

    Fang, Xianping; Fu, Hong-Fei; Gong, Zhen-Hui; Chai, Wei-Guo

    2016-01-01

    To explore the mechanisms of pepper (Capsicum annuum L.) cytoplasmic male sterility (CMS), we studied the different maturation processes of sterile and fertile pepper anthers. A paraffin section analysis of the sterile anthers indicated an abnormality of the tapetal layer and an over-vacuolization of the cells. The quantitative proteomics results showed that the expression of histidinol dehydrogenase (HDH), dihydroxy-acid dehydratase (DAD), aspartate aminotransferase (ATAAT), cysteine synthase (CS), delta-1-pyrroline-5-carboxylate synthase (P5CS), and glutamate synthetase (GS) in the amino acid synthesis pathway decreased by more than 1.5-fold. Furthermore, the mRNA and protein expression levels of DAD, ATAAT, CS and P5CS showed a 2- to 16-fold increase in the maintainer line anthers. We also found that most of the amino acid content levels decreased to varying degrees during the anther tapetum period of the sterile line, whereas these levels increased in the maintainer line. The results of our study indicate that during pepper anther development, changes in amino acid synthesis are significant and accompany abnormal tapetum maturity, which is most likely an important cause of male sterility in pepper. PMID:26987793

  20. Identification of genes and pathways involved in the synthesis of Mead acid (20:3n-9), an indicator of essential fatty acid deficiency.

    PubMed

    Ichi, Ikuyo; Kono, Nozomu; Arita, Yuka; Haga, Shizuka; Arisawa, Kotoko; Yamano, Misato; Nagase, Mana; Fujiwara, Yoko; Arai, Hiroyuki

    2014-01-01

    In mammals, 5,8,11-eicosatrienoic acid (Mead acid, 20:3n-9) is synthesized from oleic acid during a state of essential fatty acid deficiency (EFAD). Mead acid is thought to be produced by the same enzymes that synthesize arachidonic acid and eicosapentaenoic acid, but the genes and the pathways involved in the conversion of oleic acid to Mead acid have not been fully elucidated. The levels of polyunsaturated fatty acids in cultured cells are generally very low compared to those in mammalian tissues. In this study, we found that cultured cells, such as NIH3T3 and Hepa1-6 cells, have significant levels of Mead acid, indicating that cells in culture are in an EFAD state under normal culture conditions. We then examined the effect of siRNA-mediated knockdown of fatty acid desaturases and elongases on the level of Mead acid, and found that knockdown of Elovl5, Fads1, or Fads2 decreased the level of Mead acid. This and the measured levels of possible intermediate products for the synthesis of Mead acid such as 18:2n-9, 20:1n-9 and 20:2n-9 in the knocked down cells indicate two pathways for the synthesis of Mead acid: pathway 1) 18:1n-9→(Fads2)→18:2n-9→(Elovl5)→20:2n-9→(Fads1)→20:3n-9 and pathway 2) 18:1n-9→(Elovl5)→20:1n-9→(Fads2)→20:2n-9→(Fads1)→20:3n-9.

  1. Fatty acid phytyl ester synthesis in chloroplasts of Arabidopsis.

    PubMed

    Lippold, Felix; vom Dorp, Katharina; Abraham, Marion; Hölzl, Georg; Wewer, Vera; Yilmaz, Jenny Lindberg; Lager, Ida; Montandon, Cyrille; Besagni, Céline; Kessler, Felix; Stymne, Sten; Dörmann, Peter

    2012-05-01

    During stress or senescence, thylakoid membranes in chloroplasts are disintegrated, and chlorophyll and galactolipid are broken down, resulting in the accumulation of toxic intermediates, i.e., tetrapyrroles, free phytol, and free fatty acids. Chlorophyll degradation has been studied in detail, but the catabolic pathways for phytol and fatty acids remain unclear. A large proportion of phytol and fatty acids is converted into fatty acid phytyl esters and triacylglycerol during stress or senescence in chloroplasts. We isolated two genes (PHYTYL ESTER SYNTHASE1 [PES1] and PES2) of the esterase/lipase/thioesterase family of acyltransferases from Arabidopsis thaliana that are involved in fatty acid phytyl ester synthesis in chloroplasts. The two proteins are highly expressed during senescence and nitrogen deprivation. Heterologous expression in yeast revealed that PES1 and PES2 have phytyl ester synthesis and diacylglycerol acyltransferase activities. The enzymes show broad substrate specificities and can employ acyl-CoAs, acyl carrier proteins, and galactolipids as acyl donors. Double mutant plants (pes1 pes2) grow normally but show reduced phytyl ester and triacylglycerol accumulation. These results demonstrate that PES1 and PES2 are involved in the deposition of free phytol and free fatty acids in the form of phytyl esters in chloroplasts, a process involved in maintaining the integrity of the photosynthetic membrane during abiotic stress and senescence.

  2. Fatty acid effects on fibroblast cholesterol synthesis

    SciTech Connect

    Shireman, R.B.; Muth, J.; Lopez, C.

    1987-05-01

    Two cell lines of normal (CRL 1475, GM5565) and of familial hypercholesterolemia (FH) (CM 486,488) fibroblasts were preincubated with medium containing the growth factor ITS, 2.5 mg/ml fatty acid-free BSA, or 35.2 ..mu..mol/ml of these fatty acids complexed with 2.5 mg BSA/ml: stearic (18:0), caprylic (8:0), oleic (18:1;9), linoleic (18:2;9,12), linolenic (18:3;9,12,15), docosahexaenoic (22:6;4,7,10,13,16,19)(DHA) or eicosapentaenoic (20:5;5,8,11,14,17)(EPA). After 20 h, cells were incubated for 2 h with 0.2 ..mu..Ci (/sup 14/C)acetate/ml. Cells were hydrolyzed; an aliquot was quantitated for radioactivity and protein. After saponification and extraction with hexane, radioactivity in the aqueous and organic phases was determined. The FH cells always incorporated 30-90% more acetate/mg protein than normal cells but the pattern of the fatty acid effects was similar in both types. When the values were normalized to 1 for the BSA-only group, cells with ITS had the greatest (/sup 14/C)acetate incorporation (1.45) followed by the caprylic group (1.14). Cells incubated with 18:3, 20:6 or 22:6 incorporated about the same amount as BSA-only. Those preincubated with 18:2, 18:1, 18:0 showed the least acetate incorporation (0.87, 0.59 and 0.52, respectively). The percentage of total /sup 14/C counts which extracted into hexane was much greater in FH cells; however, these values varied with the fatty acid, e.g., 1.31(18:0) and 0.84(8:0) relative to 1(BSA).

  3. Heat shock represses rRNA synthesis by inactivation of TIF-IA and lncRNA-dependent changes in nucleosome positioning

    PubMed Central

    Zhao, Zhongliang; Dammert, Marcel A.; Hoppe, Sven; Bierhoff, Holger; Grummt, Ingrid

    2016-01-01

    Attenuation of ribosome biogenesis in suboptimal growth environments is crucial for cellular homeostasis and genetic integrity. Here, we show that shutdown of rRNA synthesis in response to elevated temperature is brought about by mechanisms that target both the RNA polymerase I (Pol I) transcription machinery and the epigenetic signature of the rDNA promoter. Upon heat shock, the basal transcription factor TIF-IA is inactivated by inhibition of CK2-dependent phosphorylations at Ser170/172. Attenuation of pre-rRNA synthesis in response to heat stress is accompanied by upregulation of PAPAS, a long non-coding RNA (lncRNA) that is transcribed in antisense orientation to pre-rRNA. PAPAS interacts with CHD4, the adenosine triphosphatase subunit of NuRD, leading to deacetylation of histones and movement of the promoter-bound nucleosome into a position that is refractory to transcription initiation. The results exemplify how stress-induced inactivation of TIF-IA and lncRNA-dependent changes of chromatin structure ensure repression of rRNA synthesis in response to thermo-stress. PMID:27257073

  4. Evaluation of locked nucleic acid-modified small interfering RNA in vitro and in vivo.

    PubMed

    Mook, Olaf R; Baas, Frank; de Wissel, Marit B; Fluiter, Kees

    2007-03-01

    RNA interference has become widely used as an experimental tool to study gene function. In addition, small interfering RNA (siRNA) may have great potential for the treatment of diseases. Recently, it was shown that siRNA can be used to mediate gene silencing in mouse models. Locally administered siRNAs entered the first clinical trials, but strategies for successful systemic delivery of siRNA are still under development. Challenges still exist about the stability, delivery, and therapeutic efficacy of siRNA. In the present study, we compare the efficacy of two methods of systemic siRNA delivery and the effects of siRNA modifications using locked nucleic acids (LNA) in a xenograft cancer model. Low volume tail vein bolus injections and continuous s.c. delivery using osmotic minipumps yielded similar uptake levels of unmodified siRNA by tumor xenografts. Both routes of administration mediated sequence-specific inhibition of two unrelated targets inside tumor xenografts. Previous studies have shown that LNA can be incorporated into the sense strand of siRNA while the efficacy is retained. Modification of siRNA targeting green fluorescent protein with LNA results in a significant increase in serum stability and thus may be beneficial for clinical applications. We show that minimal 3' end LNA modifications of siRNA are effective in stabilization of siRNA. Multiple LNA modifications in the accompanying strand further increase the stability but negate the efficacy in vitro and in vivo. In vivo, LNA-modified siRNA reduced off-target gene regulation compared with nonmodified siRNA. End-modified siRNA targeting green fluorescent protein provides a good trade-off between stability and efficacy in vivo using the two methods of systemic delivery in the nude mouse model. Therefore, LNA-modified siRNA should be preferred over unmodified siRNA.

  5. Protein, RNA, and DNA synthesis in cultures of skin fibroblasts from healthy subjects and patients with rheumatic diseases

    SciTech Connect

    Abakumova, O.Y.; Kutsenko, N.G.; Panasyuk, A.F.

    1985-07-01

    To study the mechanism of the lasting disturbance of fibroblast function, protein, RNA and DNA synthesis was investigated in skin fibroblasts from patients with rheumatoid arthritis (RA) and systemic scleroderma (SS). The labeled precursors used to analyze synthesis of protein, RNA, and DNA were /sup 14/C-protein hydrolysate, (/sup 14/C)uridine, and (/sup 14/C) thymidine. Stimulation was determined by measuring incorporation of (/sup 14/C)proline into fibroblast proteins. During analysis of stability of fast-labeled RNA tests were carried out to discover whether all measurable radioactivity belonged to RNA molecules.

  6. RNA synthesis in whole cells and protoplasts of centaurea: a comparison.

    PubMed

    Kulikowski, R R; Mascarenhas, J P

    1978-04-01

    Protoplasts enzymically isolated from suspension cultures of Centaurea cyanus L. incorporate radioactive precursors into RNA with kinetics similar to that of whole cells. There are differences, however, in several other aspects of RNA metabolism. The proportion of total RNA that contains poly(A) sequences (25 to 30%) is similar in both freshly isolated protoplasts and whole cells after a 20-minute pulse with [(3)H]adenosine. After a 4-hour pulse, however, poly(A)-containing RNA makes up 30% of the total RNA in protoplasts whereas it drops to 8% in whole cells. There appears to be a faulty processing of ribosomal precursor into the mature ribosomal species, as the precursor seems to accumulate to higher levels relative to the mature 18S and 25S rRNAs in protoplasts as compared to whole cells. Additional differences are seen in the size distributions of poly(A)-containing RNA, although the length of the poly(A) segment is similar in both protoplasts and whole cells. Within 24 hours protoplasts appear to have resumed a pattern of RNA synthesis similar to that of whole cells.

  7. Transcriptional profiling of canola developing embryo and identification of the important roles of BnDof5.6 in embryo development and fatty acids synthesis.

    PubMed

    Deng, Wei; Yan, Fang; Zhang, Xiaolan; Tang, Yuwei; Yuan, Yujin

    2015-08-01

    Canola is an important vegetable oil crop globally, and the understanding of the molecular mechanism underlying fatty acids biosynthesis during seed embryo development is an important research goal. Here we report the transcriptional profiling analysis of developing canola embryos using RNA-sequencing (RNA-Seq) method. RNA-Seq analysis generated 58,579,451 sequence reads aligned with 32,243 genes. It was found that a total of 55 differential expression genes (DEGs) encoding 28 enzymes function in carbon flow to fatty acids of storage TAG. Most of the DEGs encoding above enzymes showed similar expression pattern, indicating the DEGs are cooperatively involved in carbon flow into fatty acids. In addition, 41 DEGs associated with signal transductions, transport and metabolic processing of auxin, gibberellin, abscisic acid, cytokinin and salicylic acids were found in the RNA-Seq database, which indicates the important roles of the phytohormones in controlling embryo development and fatty acids synthesis. 122 DEGs encoding transcriptional factor family members were found in developing canola embryos. Furthermore, BnDOF5.6, a zinc finger transcriptional factor gene, found in RNA-Seq database was down-regulated in developing canola embryos. The transgenic plants displayed reduced embryo sizes, decreased fatty acids contents and altered seed fatty acids composition in canola. Down-regulated of BnDof5.6 also changed the expression levels of genes involved in fatty acids synthesis and desaturation. Our results indicate that BnDof5.6 is required for embryo development and fatty acids synthesis in canola. Overall this study presents new information on the global expression patterns of genes during embryo development and will expand our understanding of the complex molecular mechanism of carbon flow into fatty acids and embryo development in canola.

  8. A Concise Synthesis of Berkelic Acid Inspired by Combining the Natural Products Spicifernin and Pulvilloric Acid

    PubMed Central

    Bender, Christopher F.; Yoshimoto, Francis K.; Paradise, Christopher L.; De Brabander, Jef K.

    2009-01-01

    We describe a concise synthesis of the structurally novel fungal extremophile metabolite berkelic acid – an effort leading to an unambiguous assignment of C22 stereochemistry. Our synthetic approach was inspired by the recognition that berkelic acid displays structural characteristics reminiscent of two other fungal metabolites, spicifernin and pulvilloric acid. Based on this notion, we executed a synthesis that features a Ag-catalyzed cascade dearomatization-cycloisomerization-cycloaddition sequence to couple two natural product inspired fragments. Notably, a spicifernin-like synthon was prepared with defined C22 stereochemistry in seven steps and three purifications (24–28% overall yield). A potentially useful anti-selective conjugate propargylation reaction was developed to introduce the vicinal stereodiad. An enantioconvergent synthesis of the other coupling partner, the aromatic precursor to pulvilloric acid methyl ester, was achieved in eight steps and 48% overall yield. The total synthesis of berkelic acid and its C22 epimer was thus completed in 10 steps longest linear sequence and 11–27% overall yield. PMID:19722648

  9. Effect of insulin on human skeletal muscle mitochondrial ATP production, protein synthesis, and mRNA transcripts

    NASA Astrophysics Data System (ADS)

    Stump, Craig S.; Short, Kevin R.; Bigelow, Maureen L.; Schimke, Jill M.; Sreekumaran Nair, K.

    2003-06-01

    Mitochondria are the primary site of skeletal muscle fuel metabolism and ATP production. Although insulin is a major regulator of fuel metabolism, its effect on mitochondrial ATP production is not known. Here we report increases in vastus lateralis muscle mitochondrial ATP production capacity (32-42%) in healthy humans (P < 0.01) i.v. infused with insulin (1.5 milliunits/kg of fat-free mass per min) while clamping glucose, amino acids, glucagon, and growth hormone. Increased ATP production occurred in association with increased mRNA levels from both mitochondrial (NADH dehydrogenase subunit IV) and nuclear [cytochrome c oxidase (COX) subunit IV] genes (164-180%) encoding mitochondrial proteins (P < 0.05). In addition, muscle mitochondrial protein synthesis, and COX and citrate synthase enzyme activities were increased by insulin (P < 0.05). Further studies demonstrated no effect of low to high insulin levels on muscle mitochondrial ATP production for people with type 2 diabetes mellitus, whereas matched nondiabetic controls increased 16-26% (P < 0.02) when four different substrate combinations were used. In conclusion, insulin stimulates mitochondrial oxidative phosphorylation in skeletal muscle along with synthesis of gene transcripts and mitochondrial protein in human subjects. Skeletal muscle of type 2 diabetic patients has a reduced capacity to increase ATP production with high insulin levels. cytochrome c oxidase | NADH dehydrogenase subunit IV | amino acids | citrate synthase

  10. Stimulation of protein synthesis by phosphatidic acid in rat cardiomyocytes.

    PubMed

    Xu, Y J; Yau, L; Yu, L P; Elimban, V; Zahradka, P; Dhalla, N S

    1996-12-13

    Phosphatidic acid (PA) was observed to stimulate protein synthesis in adult cardiomyocytes in a time- and concentration-dependent manner. The maximal stimulation in protein synthesis (142 +/- 12% vs 100% as the control) was achieved at 10 microM PA within 60 min and was inhibited by actinomycin D (107 +/- 4% of the control) or cycloheximide (105 +/- 6% of the control). The increase in protein synthesis due to PA was attenuated or abolished by preincubation of cardiomyocytes with a tyrosine kinase inhibitor, genistein (94 +/- 9% of the control), phospholipase C inhibitors 2-nitro-4-carboxyphenyl N,N-diphenyl carbamate or carbon-odithioic acid O-(octahydro-4,7-methanol-1H-inden-5-yl (101 +/- 6 and 95 +/- 5% of the control, respectively), protein kinase C inhibitors staurosporine or polymyxin B (109 +/- 3 and 93 +/- 3% of the control), and chelators of extracellular and intracellular free Ca2+ EGTA or BAPTA/AM (103 +/- 6 and 95 +/- 6% of the control, respectively). PA at different concentrations (0.1 to 100 microM) also caused phosphorylation of a cell surface protein of approximately 24 kDa. In addition, mitogen-activated protein kinase was stimulated by PA in a concentration-dependent manner; maximal stimulation (217 +/- 6% of the control) was seen at 10 microM PA. These data suggest that PA increases protein synthesis in adult rat cardiomyocytes and thus may play an important role in the development of cardiac hypertrophy.

  11. Inhibition of in vitro cholesterol synthesis by fatty acids.

    PubMed

    Kuroda, M; Endo, A

    1976-01-18

    Inhibitory effect of 44 species of fatty acids on cholesterol synthesis has been examined with a rat liver enzyme system. In the case of saturated fatty acids, the inhibitory activity increased with chain length to a maximum at 11 to 14 carbons, after which activity decreased rapidly. The inhibition increased with the degree of unsaturation of fatty acids. Introduction of a hydroxy group at the alpha-position of fatty acids abolished the inhibition, while the inhibition was enhanced by the presence of a hydroxy group located in an intermediate position of the chain. Branched chain fatty acids having a methyl group at the terminal showed much higher activity than the corresponding saturated straight chain fatty acids with the same number of carbons. With respect to the mechanism for inhibition, tridecanoate was found to inhibit acetoacetyl-CoA thiolase specifically without affecting the other reaction steps in the cholesterol synthetic pathway. The highly unsaturated fatty acids, arachidonate and linoleate, were specific inhibitors of 3-hydroxy-3-methyl-glutaryl-CoA synthase. On the other hand, ricinoleate (hydroxy acid) and phytanate (branched-chain acid) diminished the conversion of mevalonate to sterols by inhibiting a step or steps between squalene and lanosterol.

  12. Cell-free synthesis of mouse mammary tumor virus Pr77 from virion and intracellular mRNA.

    PubMed Central

    Dahl, H H; Dickson, C

    1979-01-01

    Mouse mammary tumor virus (MuMTV) was purified from two cell lines (GR and Mm5MT/c1), and the genomic RNA was isolated and translated in vitro in cell-free systems derived from mouse L cells and rabbit reticulocytes. The major translation product in both systems was a protein with the molecular weight 77,000. Several other products were also detected, among them a 110,000-dalton and in minor amounts a 160,000-dalton protein. All three polypeptides were specifically immunoprecipitated by antiserum raised against the major core protein of MuMTV (p27), but they were not precipitated by antiserum against the virion glycoprotein gp52. Analysis of the in vitro products by tryptic peptide mapping established their relationship to the virion non-glycosylated structural proteins. The 77,000-dalton polypeptide was found to be similar, if not identical, to an analogous precursor isolated from MuMTV-producing cells. Peptide mapping of the 110,000-dalton protein shows that it contains all of the methionine-labeled peptides found in the 77,000-dalton protein plus some additional peptides. We conclude that the products synthesized in vitro from the genomic MuMTV RNA are related to the non-glycosylated virion structural proteins. Polyadenylic acid-containing RNA from MuMTV-producing cells also directed the synthesis of the 77,000-dalton polypeptide in the L-cell system. If this RNA preparation was first fractionated by sucrose gradient centrifugation the 77,000-dalton protein appeared to be synthesized from mRNA with a sedimentation coefficient between 25 and 35S. Images PMID:221668

  13. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, A. L.

    1986-01-01

    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20% for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  14. Microwave-Assisted Rapid Enzymatic Synthesis of Nucleic Acids.

    PubMed

    Hari Das, Rakha; Ahirwar, Rajesh; Kumar, Saroj; Nahar, Pradip

    2016-07-02

    Herein we report microwave-induced enhancement of the reactions catalyzed by Escherichia coli DNA polymerase I and avian myeloblastosis virus-reverse transcriptase. The reactions induced by microwaves result in a highly selective synthesis of nucleic acids in 10-50 seconds. In contrast, same reactions failed to give desired reaction products when carried out in the same time periods, but without microwave irradiation. Each of the reactions was carried out for different duration of microwave exposure time to find the optimum reaction time. The products produced by the respective enzyme upon microwave irradiation of the reaction mixtures were identical to that produced by the conventional procedures. As the microwave-assisted reactions are rapid, microwave could be a useful alternative to the conventional and time consuming procedures of enzymatic synthesis of nucleic acids.

  15. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1987-01-01

    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20 percent for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  16. Tannic acid-mediated green synthesis of antibacterial silver nanoparticles.

    PubMed

    Kim, Tae Yoon; Cha, Song-Hyun; Cho, Seonho; Park, Youmie

    2016-04-01

    The search for novel antibacterial agents is necessary to combat microbial resistance to current antibiotics. Silver nanoparticles (AgNPs) have been reported to be effective antibacterial agents. Tannic acid is a polyphenol compound from plants with antioxidant and antibacterial activities. In this report, AgNPs were prepared from silver ions by tannic acid-mediated green synthesis (TA-AgNPs). The reaction process was facile and involved mixing both silver ions and tannic acid. The absorbance at 423 nm in the UV-Visible spectra demonstrated that tannic acid underwent a reduction reaction to produce TA-AgNPs from silver ions. The synthetic yield of TA-AgNPs was 90.5% based on inductively coupled plasma mass spectrometry analysis. High-resolution transmission electron microscopy and atomic force microscopy images indicated that spherical-shaped TA-AgNPs with a mean particle size of 27.7-46.7 nm were obtained. Powder high-resolution X-ray diffraction analysis indicated that the TA-AgNP structure was face-centered cubic with a zeta potential of -27.56 mV. The hydroxyl functional groups of tannic acid contributed to the synthesis of TA-AgNPs, which was confirmed by Fourier transform infrared spectroscopy. The in vitro antibacterial activity was measured using the minimum inhibitory concentration (MIC) method. The TA-AgNPs were more effective against Gram-negative bacteria than Gram-positive bacteria. The MIC for the TA-AgNPs in all of the tested strains was in a silver concentration range of 6.74-13.48 μg/mL. The tannic acid-mediated synthesis of AgNPs afforded biocompatible nanocomposites for antibacterial applications.

  17. Is acetylcarnitine a substrate for fatty acid synthesis in plants

    SciTech Connect

    Roughan, G. ); Post-Beittenmiller, D.; Ohlrogge, J. ); Browse, J. )

    1993-04-01

    Long-chain fatty acid synthesis from [1-[sup 14]C]acetylcarnitine by chloroplasts isolated from spinach (Spinacia oleracea), pea (Pisum sativum), amaranthus (Amaranthus lividus), or maize (Zea mays) occurred at less than 2% of the rate of fatty acid synthesis from [1-[sup 14]C]acetate irrespective of the maturity of the leaves or whether the plastids were purified using sucrose or Percoll medium. [1-[sup 14]C]Acetylcarnitine was not significantly utilized by highly active chloroplasts rapidly prepared from pea and spinach using methods not involving density gradient centrifugation. [1-[sup 14]C]Acetylcarnitine was recovered quantitatively from chloroplast incubations following 10 min in the light. Unlabeled acetyl-L-carnitine (0.4 mM) did not compete with [1-[sup 14]C]acetate (0.2 mM) as a substrate for fatty acid synthesis by any of the more than 70 chloroplast preparations tested in this study. Carnitine acetyltransferase activity was not detected in any chloroplast preparation and was present in whole leaf homogenates at about 0.1% of the level of acetyl-coenzyme A synthetase activity. When supplied to detached pea shoots and detached spinach, amaranthus, and maize leaves via the transpiration stream, 1 to 4% of the [1-[sup 14]C]acetylcarnitine and 47 to 57% of the [1-[sup 14]C]acetate taken up was incorporated into lipids. Most (78--82%) of the [1-[sup 14]C]acetylcarnitine taken up was recovered intact. It is concluded that acetylcarnitine is not a major precursor for fatty acid synthesis in plants. 29 refs., 5 tabs.

  18. Osteoblast fibronectin mRNA, protein synthesis, and matrix are unchanged after exposure to microgravity

    NASA Technical Reports Server (NTRS)

    Hughes-Fulford, M.; Gilbertson, V.

    1999-01-01

    The well-defined osteoblast line, MC3T3-E1 was used to examine fibronectin (FN) mRNA levels, protein synthesis, and extracellular FN matrix accumulation after growth activation in spaceflight. These osteoblasts produce FN extracellular matrix (ECM) known to regulate adhesion, differentiation, and function in adherent cells. Changes in bone ECM and osteoblast cell shape occur in spaceflight. To determine whether altered FN matrix is a factor in causing these changes in spaceflight, quiescent osteoblasts were launched into microgravity and were then sera activated with and without a 1-gravity field. Synthesis of FN mRNA, protein, and matrix were measured after activation in microgravity. FN mRNA synthesis is significantly reduced in microgravity (0-G) when compared to ground (GR) osteoblasts flown in a centrifuge simulating earth's gravity (1-G) field 2.5 h after activation. However, 27.5 h after activation there were no significant differences in mRNA synthesis. A small but significant reduction of FN protein was found in the 0-G samples 2.5 h after activation. Total FN protein 27.5 h after activation showed no significant difference between any of the gravity conditions, however, there was a fourfold increase in absolute amount of protein synthesized during the incubation. Using immunofluorescence, we found no significant differences in the amount or in the orientation of the FN matrix after 27.5 h in microgravity. These results demonstrate that FN is made by sera-activated osteoblasts even during exposure to microgravity. These data also suggest that after a total period of 43 h of spaceflight FN transcription, translation, or altered matrix assembly is not responsible for the altered cell shape or altered matrix formation of osteoblasts.

  19. The effects of retinoic acid on immunoglobulin synthesis: Role of interleukin 6

    SciTech Connect

    Ballow, M.; Xiang, Shunan; Wang, Weiping; Brodsky, L. |

    1996-05-01

    Retinoic acid (RA) and its parent compound, retinol (ROH, vitamin A), have been recognized as important immunopotentiating agents. Previous studies from our laboratory have demonstrated that PA can augment formalin-treated Staphylococcus aureus (SAC) stimulated immunoglobulin (Ig) synthesis of cord blood mononuclear cells (CBMC). To determine the mechanism(s) by which RA modulates Ig synthesis, we studied the effects of RA on B cells and cytokine production. The addition of RA (10{sup -5} to 10{sup -10} M) to Epstein-Barr virus (EBV)-transformed B-cell clones derived from either adult or cord blood B cells augmented Ig secretion twofold. In contrast, cell proliferation was inhibited as measured by {sup 3}H-thymidine incorporation. We evaluated two cytokines known to be constitutively produced by EBV cell lines, IL-1 and IL-6. While RA had no effect on IL-1 production, IL-6 synthesis was greatly enhanced (20- to 45-fold), which was also reflected by an increase in steady-state mRNA levels for IL-6 but not TNF-{alpha} or TGF-{beta} on Northern blot analysis. Polyclonal rabbit anti-IL-6 antibodies were used to block the augmenting effects of RA on Ig synthesis of adenoidal B cells. RA-induced augmentation in IgG and IgA synthesis was blocked 58 and 29%, respectively, by anti-IL-6 antibodies. These studies suggest that the enhancing effects of RA on Ig synthesis are mediated, at least in part, by the autocrine or paracrine effects of IL-6 on B-cell differentiation. 37 refs., 5 figs.

  20. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  1. A new regulatory mechanism for bacterial lipoic acid synthesis.

    PubMed

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-22

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis.

  2. Identification of antisense nucleic acid hybridization sites in mRNA molecules with self-quenching fluorescent reporter molecules.

    PubMed

    Gifford, Lida K; Opalinska, Joanna B; Jordan, David; Pattanayak, Vikram; Greenham, Paul; Kalota, Anna; Robbins, Michelle; Vernovsky, Kathy; Rodriguez, Lesbeth C; Do, Bao T; Lu, Ponzy; Gewirtz, Alan M

    2005-02-17

    We describe a physical mRNA mapping strategy employing fluorescent self-quenching reporter molecules (SQRMs) that facilitates the identification of mRNA sequence accessible for hybridization with antisense nucleic acids in vitro and in vivo, real time. SQRMs are 20-30 base oligodeoxynucleotides with 5-6 bp complementary ends to which a 5' fluorophore and 3' quenching group are attached. Alone, the SQRM complementary ends form a stem that holds the fluorophore and quencher in contact. When the SQRM forms base pairs with its target, the structure separates the fluorophore from the quencher. This event can be reported by fluorescence emission when the fluorophore is excited. The stem-loop of the SQRM suggests that SQRM be made to target natural stem-loop structures formed during mRNA synthesis. The general utility of this method is demonstrated by SQRM identification of targetable sequence within c-myb and bcl-6 mRNA. Corresponding antisense oligonucleotides reduce these gene products in cells.

  3. Cytochalasin releases mRNA from the cytoskeletal framework and inhibits protein synthesis.

    PubMed Central

    Ornelles, D A; Fey, E G; Penman, S

    1986-01-01

    Cytochalasin D was shown to be a reversible inhibitor of protein synthesis in HeLa cells. The inhibition was detectable at drug levels typically used to perturb cell structure and increased in a dose-dependent manner. The drug also released mRNA from the cytoskeletal framework in direct proportion to the inhibition of protein synthesis. The released mRNA was unaltered in its translatability as measured in vitro but was no longer translated in the cytochalasin-treated HeLa cells. The residual protein synthesis occurred on polyribosomes that were reduced in amount but displayed a normal sedimentation distribution. The results support the hypothesis that mRNA binding to the cytoskeletal framework is necessary although not sufficient for translation. Analysis of the cytoskeletal framework, which binds the polyribosomes, revealed no alterations in composition or amount of protein as a result of treatment with cytochalasin D. Electron microscopy with embedment-free sections shows the framework in great detail. The micrographs revealed the profound reorganization effected by the drug but did not indicate substantial disaggregation of the cytoskeletal elements. Images PMID:3785175

  4. Formation of the chlorophyll precursor. gamma. -aminolevulinic acid in cyanobacteria requires aminoacylation of a tRNA sup Glu species. [Synechocystis

    SciTech Connect

    O'Nell, G.P.; Peterson, D.M.; Schoen, A., Chen, Minwei; Soell, D. )

    1988-09-01

    In the chloroplasts of higher plants and algae, the biosynthesis of the chlorophyll precursor {gamma}-aminolevulinic acid (ALA) involves at least three enzymes and a tRNA species. Here we demonstrate that in cell extracts of the unicellular cyanobacterium Synechocystis sp. strain PCC 6803 ALA was formed from glutamate in a series of reactions in which activation of glutamate by glutamyl-tRNA{sup Glu} formation was the first step. The activated glutamate was reduced by a dehydrogenase which displayed tRNA sequence specificity. Fractionation of strain 6803 tRNA by reverse-phase chromatography and polyacrylamide gel electrophoresis yielded two pure tRNA{sup Glu} species which stimulated ALA synthesis in vitro. These tRNAs had identical primary sequence but differed in the nucleotide modification of their anticodon. The 6803 tRNA{sup Glu} was similar to the sequence of tRNA{sup Glu} species or tRNA genes from Escherichia coli and from chloroplasts of Euglena gracilis and higher plants. Southern blot analysis revealed at least two tRNA{sup Glu} gene copies in the 6803 chromosome. A glutamate-1-semialdehyde aminotransferase, the terminal enzyme in the conversion of glutamate to ALA in chloroplasts, was detected in 6803 cell extracts by the conversion of glutamate-1-semialdehyde to ALA and by the inhibition of this reaction by gabaculin.

  5. Reducible hyaluronic acid-siRNA conjugate for target specific gene silencing.

    PubMed

    Park, Kitae; Yang, Jeong-A; Lee, Min-Young; Lee, Hwiwon; Hahn, Sei Kwang

    2013-07-17

    Despite wide applications of polymer-drug conjugates, there are only a few polymer-siRNA conjugates like poly(ethylene glycol) conjugated siRNA. In this work, reducible hyaluronic acid (HA)-siRNA conjugate was successfully developed for target specific systemic delivery of siRNA to the liver. The conjugation of siRNA to HA made it possible to form a compact nanocomplex of siRNA with relatively nontoxic linear polyethyleneimine (LPEI). After characterization of HA-siRNA conjugate by size exclusion chromatography (SEC) and gel electrophoresis, its complex formation with LPEI was investigated with a particle analyzer. The HA-siRNA/LPEI complex had a mean particle size of ca. 250 nm and a negative or neutral surface charge at physiological condition. The reducible HA-siRNA/LPEI complex showed a higher in vitro gene silencing efficiency than noncleavable HA-siRNA/LPEI complex. Furthermore, after systemic delivery, apolipoprotein B (ApoB) specific HA-siApoB/LPEI complex was target specifically delivered to the liver, which resulted in statistically significant reduction of ApoB mRNA expression in a dose dependent manner. The HA-siRNA conjugate can be effectively applied as a model system to the treatment of liver diseases using various siRNAs and relatively nontoxic polycations.

  6. Poliovirus 5′-Terminal Cloverleaf RNA Is Required in cis for VPg Uridylylation and the Initiation of Negative-Strand RNA Synthesis

    PubMed Central

    Lyons, Traci; Murray, Kenneth E.; Roberts, Allan W.; Barton, David J.

    2001-01-01

    Chimeric poliovirus RNAs, possessing the 5′ nontranslated region (NTR) of hepatitis C virus in place of the 5′ NTR of poliovirus, were used to examine the role of the poliovirus 5′ NTR in viral replication. The chimeric viral RNAs were incubated in cell-free reaction mixtures capable of supporting the sequential translation and replication of poliovirus RNA. Using preinitiation RNA replication complexes formed in these reactions, we demonstrated that the 3′ NTR of poliovirus RNA was insufficient, by itself, to recruit the viral replication proteins required for negative-strand RNA synthesis. The 5′-terminal cloverleaf of poliovirus RNA was required in cis to form functional preinitiation RNA replication complexes capable of uridylylating VPg and initiating the synthesis of negative-strand RNA. These results are consistent with a model in which the 5′-terminal cloverleaf and 3′ NTRs of poliovirus RNA interact via temporally dynamic ribonucleoprotein complexes to coordinately mediate and regulate the sequential translation and replication of poliovirus RNA. PMID:11602711

  7. A Study on Amino Acids: Synthesis of Alpha-Aminophenylacetic Acid (Phenylglycine) and Determination of its Isoelectric Point.

    ERIC Educational Resources Information Center

    Barrelle, M.; And Others

    1983-01-01

    Background information and procedures are provided for an experimental study on aminophenylacetic acid (phenylglycine). These include physical chemistry (determination of isoelectric point by pH measurement) and organic chemistry (synthesis of an amino acid in racemic form) experiments. (JN)

  8. tRNA acceptor-stem and anticodon bases embed separate features of amino acid chemistry

    PubMed Central

    Carter, Charles W.; Wolfenden, Richard

    2016-01-01

    abstract The universal genetic code is a translation table by which nucleic acid sequences can be interpreted as polypeptides with a wide range of biological functions. That information is used by aminoacyl-tRNA synthetases to translate the code. Moreover, amino acid properties dictate protein folding. We recently reported that digital correlation techniques could identify patterns in tRNA identity elements that govern recognition by synthetases. Our analysis, and the functionality of truncated synthetases that cannot recognize the tRNA anticodon, support the conclusion that the tRNA acceptor stem houses an independent code for the same 20 amino acids that likely functioned earlier in the emergence of genetics. The acceptor-stem code, related to amino acid size, is distinct from a code in the anticodon that is related to amino acid polarity. Details of the acceptor-stem code suggest that it was useful in preserving key properties of stereochemically-encoded peptides that had developed the capacity to interact catalytically with RNA. The quantitative embedding of the chemical properties of amino acids into tRNA bases has implications for the origins of molecular biology. PMID:26595350

  9. Biotin and Lipoic Acid: Synthesis, Attachment and Regulation

    PubMed Central

    Cronan, John E.

    2014-01-01

    Summary Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as “swinging arms” that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well-described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like “arm” of biotin were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise and the BioH esterase for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl-ACP of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyl transferase followed by sulfur insertion at carbons C6 and C8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized and thus there is no transcriptional control of the synthetic genes. In contrast transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system, exerted through BirA a dual function protein that both represses

  10. Induction of phytic acid synthesis by abscisic acid in suspension-cultured cells of rice.

    PubMed

    Matsuno, Koya; Fujimura, Tatsuhito

    2014-03-01

    A pathway of phytic acid (PA) synthesis in plants has been revealed via investigations of low phytic acid mutants. However, the regulation of this pathway is not well understood because it is difficult to control the environments of cells in the seeds, where PA is mainly synthesized. We modified a rice suspension culture system in order to study the regulation of PA synthesis. Rice cells cultured with abscisic acid (ABA) accumulate PA at higher levels than cells cultured without ABA, and PA accumulation levels increase with ABA concentration. On the other hand, higher concentrations of sucrose or inorganic phosphorus do not affect PA accumulation. Mutations in the genes RINO1, OsMIK, OsIPK1 and OsLPA1 have each been reported to confer low phytic acid phenotypes in seeds. Each of these genes is upregulated in cells cultured with ABA. OsITPK4 and OsITPK6 are upregulated in cells cultured with ABA and in developing seeds. These results suggest that the regulation of PA synthesis is similar between developing seeds and cells in this suspension culture system. This system will be a powerful tool for elucidating the regulation of PA synthesis.

  11. The Ebola Virus VP30-NP Interaction Is a Regulator of Viral RNA Synthesis

    PubMed Central

    Kirchdoerfer, Robert N.; Moyer, Crystal L.; Abelson, Dafna M.; Saphire, Erica Ollmann

    2016-01-01

    Filoviruses are capable of causing deadly hemorrhagic fevers. All nonsegmented negative-sense RNA-virus nucleocapsids are composed of a nucleoprotein (NP), a phosphoprotein (VP35) and a polymerase (L). However, the VP30 RNA-synthesis co-factor is unique to the filoviruses. The assembly, structure, and function of the filovirus RNA replication complex remain unclear. Here, we have characterized the interactions of Ebola, Sudan and Marburg virus VP30 with NP using in vitro biochemistry, structural biology and cell-based mini-replicon assays. We have found that the VP30 C-terminal domain interacts with a short peptide in the C-terminal region of NP. Further, we have solved crystal structures of the VP30-NP complex for both Ebola and Marburg viruses. These structures reveal that a conserved, proline-rich NP peptide binds a shallow hydrophobic cleft on the VP30 C-terminal domain. Structure-guided Ebola virus VP30 mutants have altered affinities for the NP peptide. Correlation of these VP30-NP affinities with the activity for each of these mutants in a cell-based mini-replicon assay suggests that the VP30-NP interaction plays both essential and inhibitory roles in Ebola virus RNA synthesis. PMID:27755595

  12. Analysis of global RNA synthesis at the single cell level following hypoxia.

    PubMed

    Biddlestone, John; Druker, Jimena; Shmakova, Alena; Ferguson, Gus; Swedlow, Jason R; Rocha, Sonia

    2014-05-13

    Hypoxia or lowering of the oxygen availability is involved in many physiological and pathological processes. At the molecular level, cells initiate a particular transcriptional program in order to mount an appropriate and coordinated cellular response. The cell possesses several oxygen sensor enzymes that require molecular oxygen as cofactor for their activity. These range from prolyl-hydroxylases to histone demethylases. The majority of studies analyzing cellular responses to hypoxia are based on cellular populations and average studies, and as such single cell analysis of hypoxic cells are seldom performed. Here we describe a method of analysis of global RNA synthesis at the single cell level in hypoxia by using Click-iT RNA imaging kits in an oxygen controlled workstation, followed by microscopy analysis and quantification.  Using cancer cells exposed to hypoxia for different lengths of time, RNA is labeled and measured in each cell. This analysis allows the visualization of temporal and cell-to-cell changes in global RNA synthesis following hypoxic stress.

  13. Synthesis and tau RNA binding evaluation of ametantrone-containing ligands.

    PubMed

    Artigas, Gerard; Marchán, Vicente

    2015-02-20

    We describe the synthesis and characterization of ametantrone-containing RNA ligands based on the derivatization of this intercalator with two neamine moieties (Amt-Nea,Nea) or with one azaquinolone heterocycle and one neamine (Amt-Nea,Azq) as well as its combination with guanidinoneamine (Amt-NeaG4). Biophysical studies revealed that guanidinylation of the parent ligand (Amt-Nea) had a positive effect on the binding of the resulting compound for Tau pre-mRNA target as well as on the stabilization upon complexation of some of the mutated RNA sequences associated with the development of tauopathies. Further studies by NMR revealed the existence of a preferred binding site in the stem-loop structure, in which ametantrone intercalates in the characteristic bulged region. Regarding doubly-functionalized ligands, binding affinity and stabilizing ability of Amt-Nea,Nea were similar to those of the guanidinylated ligand, but the two aminoglycoside fragments seem to interfere with its accommodation in a single binding site. However, Amt-Nea,Azq binds at the bulged region in a similar way than Amt-NeaG4. Overall, these results provide new insights on fine-tuning RNA binding properties of ametantrone by single or double derivatization with other RNA recognition motifs, which could help in the future design of new ligands with improved selectivity for disease-causing RNA molecules.

  14. Boron Stress Activates the General Amino Acid Control Mechanism and Inhibits Protein Synthesis

    PubMed Central

    Uluisik, Irem; Kaya, Alaattin; Fomenko, Dmitri E.; Karakaya, Huseyin C.; Carlson, Bradley A.; Gladyshev, Vadim N.; Koc, Ahmet

    2011-01-01

    Boron is an essential micronutrient for plants, and it is beneficial for animals. However, at high concentrations boron is toxic to cells although the mechanism of this toxicity is not known. Atr1 has recently been identified as a boron efflux pump whose expression is upregulated in response to boron treatment. Here, we found that the expression of ATR1 is associated with expression of genes involved in amino acid biosynthesis. These mechanisms are strictly controlled by the transcription factor Gcn4 in response to boron treatment. Further analyses have shown that boron impaired protein synthesis by promoting phosphorylation of eIF2α in a Gcn2 kinase dependent manner. The uncharged tRNA binding domain (HisRS) of Gcn2 is necessary for the phosphorylation of eIF2α in the presence of boron. We postulate that boron exerts its toxic effect through activation of the general amino acid control system and inhibition of protein synthesis. Since the general amino acid control pathway is conserved among eukaryotes, this mechanism of boron toxicity may be of general importance. PMID:22114689

  15. The prebiotic synthesis of modified purines and their potential role in the RNA world

    NASA Technical Reports Server (NTRS)

    Levy, M.; Miller, S. L.; Bada, J. L. (Principal Investigator)

    1999-01-01

    Modified purines are found in all organisms in the tRNA, rRNA, and even DNA, raising the possibility of an early role for these compounds in the evolution of life. These include N6-methyladenine, 1-methyladenine, N6,N6-dimethyladenine, 1-methylhypoxanthine, 1-methylguanine, and N2-methylguanine. We find that these bases as well as a number of nonbiological modified purines can be synthesized from adenine and guanine by the simple reaction of an amine or an amino group with adenine and guanine under the concentrated conditions of the drying-lagoon or drying-beach model of prebiotic synthesis with yields as high as 50%. These compounds are therefore as prebiotic as adenine and guanine and could have played an important role in the RNA world by providing additional functional groups in ribozymes, especially for the construction of hydrophobic binding pockets.

  16. Mechanism of Concerted RNA-DNA Primer Synthesis by the Human Primosome.

    PubMed

    Baranovskiy, Andrey G; Babayeva, Nigar D; Zhang, Yinbo; Gu, Jianyou; Suwa, Yoshiaki; Pavlov, Youri I; Tahirov, Tahir H

    2016-05-06

    The human primosome, a 340-kilodalton complex of primase and DNA polymerase α (Polα), synthesizes chimeric RNA-DNA primers to be extended by replicative DNA polymerases δ and ϵ. The intricate mechanism of concerted primer synthesis by two catalytic centers was an enigma for over three decades. Here we report the crystal structures of two key complexes, the human primosome and the C-terminal domain of the primase large subunit (p58C) with bound DNA/RNA duplex. These structures, along with analysis of primase/polymerase activities, provide a plausible mechanism for all transactions of the primosome including initiation, elongation, accurate counting of RNA primer length, primer transfer to Polα, and concerted autoregulation of alternate activation/inhibition of the catalytic centers. Our findings reveal a central role of p58C in the coordinated actions of two catalytic domains in the primosome and ultimately could impact the design of anticancer drugs.

  17. Differential Effects of Actinomycin D and Cordycepin in Lettuce Seed Germination and RNA Synthesis 1

    PubMed Central

    Tao, Kar-Ling; Khan, Anwar A.

    1976-01-01

    Intact lettuce seed germination was inhibited by cordycepin but not by actinomycin D; however, when seeds were clipped at the cotyledonary end, actinomycin D partially inhibited germination. Uptake studies with intact seeds using 3H-actinomycin D showed that it was unable to reach the embryo prior to radical protrusion. 3H-Cordycepin uptake studies using intact seeds showed that cordycepin was able to reach the embryo during the first 3 hours of incubation and at subsequent times. The pericarp and endosperm offered resistance to penetration of cordycepin into the embryo. In contrast to actinomycin D, cordycepin markedly inhibited 3H-uridine incorporation into RNA of intact seeds during the first 10 and 12 hours of incubation. About 60% of 3H-adenosine incorporation into poly A-RNA was inhibited by cordycepin during 12 hours of incubation, whereas actinomycin D had little effect. RNA synthesis appears to be essential for seed germination. PMID:16659763

  18. Regiospecific solid-phase synthesis of branched oligoribonucleotides that mimic intronic lariat RNA intermediates.

    PubMed

    Katolik, Adam; Johnsson, Richard; Montemayor, Eric; Lackey, Jeremy G; Hart, P John; Damha, Masad J

    2014-02-07

    We have developed new solid phase methods for the synthesis of branched RNAs that mimic intronic lariat RNA intermediates. These methods produce branched oligoribonucleotide sequences of arbitrary length, base composition, and regiochemistry at the branchpoint junction. The methods utilize branching monomers that allow for the growth of each branch regioselectively from any of the hydroxyl positions (5′, 3′, or 2′) at the branch-point junction. The integrity and branchpoint connectivity of the synthetic products have been confirmed by HPLC and MS analysis, and cleavage of the 2′,5′ linkage by recombinant debranching enzyme. Nonhydrolyzable branched RNA analogues containing arabinose instead of ribose at the branchpoint junction were shown to inhibit debranching activity and, hence, represent “decoys” for sequestering RNA binding proteins thought to drive amyotrophic lateral sclerosis (ALS).

  19. Recombinant growth hormone enhances muscle myosin heavy-chain mRNA accumulation and amino acid accrual in humans.

    PubMed

    Fong, Y; Rosenbaum, M; Tracey, K J; Raman, G; Hesse, D G; Matthews, D E; Leibel, R L; Gertner, J M; Fischman, D A; Lowry, S F

    1989-05-01

    A potentially lethal complication of trauma, malignancy, and infection is a progressive erosion of muscle protein mass that is not readily reversed by nutritional support. Growth hormone is capable of improving total body nitrogen balance, but its role in myofibrillar protein synthesis in humans is unknown. The acute, in situ muscle protein response to an infusion of methionyl human growth hormone was investigated in the limbs of nutritionally depleted subjects during a period of intravenous refeeding. A 6-hr methionyl growth hormone infusion achieved steady-state serum levels comparable to normal physiologic peaks and was associated with a significant increase in limb amino acid uptake, without a change in body amino acid oxidation. Myosin heavy-chain mRNA levels, measured by quantitative dot blot hybridization, were also significantly elevated after growth hormone administration. The data indicate that methionyl growth hormone can induce intracellular amino acid accrual and increased levels of myofibrillar protein mRNA during hospitalized nutritional support and suggest growth hormone to be a potential therapy of lean body wasting.

  20. Synthesis and Characterization of Fatty Acid Conjugates of Niacin and Salicylic Acid.

    PubMed

    Vu, Chi B; Bemis, Jean E; Benson, Ericka; Bista, Pradeep; Carney, David; Fahrner, Richard; Lee, Diana; Liu, Feng; Lonkar, Pallavi; Milne, Jill C; Nichols, Andrew J; Picarella, Dominic; Shoelson, Adam; Smith, Jesse; Ting, Amal; Wensley, Allison; Yeager, Maisy; Zimmer, Michael; Jirousek, Michael R

    2016-02-11

    This report describes the synthesis and preliminary biological characterization of novel fatty acid niacin conjugates and fatty acid salicylate conjugates. These molecular entities were created by covalently linking two bioactive molecules, either niacin or salicylic acid, to an omega-3 fatty acid. This methodology allows the simultaneous intracellular delivery of two bioactives in order to elicit a pharmacological response that could not be replicated by administering the bioactives individually or in combination. The fatty acid niacin conjugate 5 has been shown to be an inhibitor of the sterol regulatory element binding protein (SREBP), a key regulator of cholesterol metabolism proteins such as PCSK9, HMG-CoA reductase, ATP citrate lyase, and NPC1L1. On the other hand, the fatty acid salicylate conjugate 11 has been shown to have a unique anti-inflammatory profile based on its ability to modulate the NF-κB pathway through the intracellular release of the two bioactives.

  1. Ribonucleic Acid Regulation in Permeabilized Cells of Escherichia coli Capable of Ribonucleic Acid and Protein Synthesis1

    PubMed Central

    Atherly, Alan G.

    1974-01-01

    A cell permeabilization procedure is described that reduces viability less than 10% and does not significantly reduce the rates of ribonucleic acid and protein synthesis when appropriately supplemented. Permeabilization abolishes the normal stringent coupling of protein and ribonucleic acid synthesis. PMID:4364330

  2. Synthesis and characterization of magnetite nanoparticles coated with lauric acid

    SciTech Connect

    Mamani, J.B.; Costa-Filho, A.J.; Cornejo, D.R.; Vieira, E.D.; Gamarra, L.F.

    2013-07-15

    Understanding the process of synthesis of magnetic nanoparticles is important for its implementation in in vitro and in vivo studies. In this work we report the synthesis of magnetic nanoparticles made from ferrous oxide through coprecipitation chemical process. The nanostructured material was coated with lauric acid and dispersed in aqueous medium containing surfactant that yielded a stable colloidal suspension. The characterization of magnetic nanoparticles with distinct physico-chemical configurations is fundamental for biomedical applications. Therefore magnetic nanoparticles were characterized in terms of their morphology by means of TEM and DLS, which showed a polydispersed set of spherical nanoparticles (average diameter of ca. 9 nm) as a result of the protocol. The structural properties were characterized by using X-ray diffraction (XRD). XRD pattern showed the presence of peaks corresponding to the spinel phase of magnetite (Fe{sub 3}O{sub 4}). The relaxivities r{sub 2} and r{sub 2}* values were determined from the transverse relaxation times T{sub 2} and T{sub 2}* at 3 T. Magnetic characterization was performed using SQUID and FMR, which evidenced the superparamagnetic properties of the nanoparticles. Thermal characterization using DSC showed exothermic events associated with the oxidation of magnetite to maghemite. - Highlights: • Synthesis of magnetic nanoparticles coated with lauric acid • Characterization of magnetic nanoparticles • Morphological, structural, magnetic, calorimetric and relaxometric characterization.

  3. Leucyl-tRNA synthetase: double duty in amino acid sensing.

    PubMed

    Durán, Raúl V; Hall, Michael N

    2012-08-01

    The cellular response to amino acids is controlled at the molecular level by TORC1. While many of the elements that participate in TORC1 signaling are known, we still have no clear idea how cells sense amino acids. Two recent studies found that leucyl-tRNA synthetase (LRS) is a leucine sensor for TORC1, in both yeast and mammalian cells.

  4. Protein Synthesis with Ribosomes Selected for the Incorporation of β-Amino Acids.

    PubMed

    Maini, Rumit; Chowdhury, Sandipan Roy; Dedkova, Larisa M; Roy, Basab; Daskalova, Sasha M; Paul, Rakesh; Chen, Shengxi; Hecht, Sidney M

    2015-06-16

    In an earlier study, β³-puromycin was used for the selection of modified ribosomes, which were utilized for the incorporation of five different β-amino acids into Escherichia coli dihydrofolate reductase (DHFR). The selected ribosomes were able to incorporate structurally disparate β-amino acids into DHFR, in spite of the use of a single puromycin for the selection of the individual clones. In this study, we examine the extent to which the structure of the β³-puromycin employed for ribosome selection influences the regio- and stereochemical preferences of the modified ribosomes during protein synthesis; the mechanistic probe was a single suppressor tRNA(CUA) activated with each of four methyl-β-alanine isomers (1-4). The modified ribosomes were found to incorporate each of the four isomeric methyl-β-alanines into DHFR but exhibited a preference for incorporation of 3(S)-methyl-β-alanine (β-mAla; 4), i.e., the isomer having the same regio- and stereochemistry as the O-methylated β-tyrosine moiety of β³-puromycin. Also conducted were a selection of clones that are responsive to β²-puromycin and a demonstration of reversal of the regio- and stereochemical preferences of these clones during protein synthesis. These results were incorporated into a structural model of the modified regions of 23S rRNA, which included in silico prediction of a H-bonding network. Finally, it was demonstrated that incorporation of 3(S)-methyl-β-alanine (β-mAla; 4) into a short α-helical region of the nucleic acid binding domain of hnRNP LL significantly stabilized the helix without affecting its DNA binding properties.

  5. Synthesis of benzyl cinnamate by enzymatic esterification of cinnamic acid.

    PubMed

    Wang, Yun; Zhang, Dong-Hao; Chen, Na; Zhi, Gao-Ying

    2015-12-01

    In this study, lipase catalysis was successfully applied in synthesis of benzyl cinnamate through esterification of cinnamic acid with benzyl alcohol. Lipozyme TLIM was found to be more efficient for catalyzing this reaction than Novozym 435. In order to increase the yield of benzyl cinnamate, several media, including acetone, trichloromethane, methylbenzene, and isooctane, were used in this reaction. The reaction showed a high yield using isooctane as medium. Furthermore, the effects of several parameters such as water activity, reaction temperature, etc, on this reaction were analyzed. It was pointed out that too much benzyl alcohol would inhibit lipase activity. Under the optimum conditions, lipase-catalyzed synthesis of benzyl cinnamate gave a maximum yield of 97.3%. Besides, reusable experiment of enzyme demonstrated that Lipozyme TLIM retained 63% of its initial activity after three cycles. These results were of general interest for developing industrial processes for the preparation of benzyl cinnamate.

  6. Hydrolysis of tRNA(sup Phe) on Suspensions of Amino Acids

    NASA Technical Reports Server (NTRS)

    Gao, Kui; Orgel, Leslie E.

    2001-01-01

    RNA is adsorbed strongly on suspensions of many moderately soluble organic solids. In some cases, the hydrolysis of tRNA(sup Phe) is greatly accelerated by adsorption, and the major sites of hydrolysis are changed from those that are important in homogeneous solution. Here we show that the hydrolysis is greatly accelerated by suspensions of aspartic acid and beta-glutamic acid but not by suspensions of alpha-glutamic acid, asparagine, or glutamine. The non-enzymatic hydrolysis of RNA has been studied extensively, especially because of its relevance to the mechanisms of action of ribozymes and to biotechnology and therapy. Many ribonucleases, ribozymes, and non-biological catalysts function via acid-base catalysis of an intramolecular transesterification mechanism in which the 2'-OH group attacks the adjacent phosphate group. The pentacoordinated phosphorane intermediate may collapse back to starting material, or yield isomerized or cleaved products.

  7. Xenograft Studies of Fatty Acid Synthesis Inhibition as Novel Therapy for Breast Cancer

    DTIC Science & Technology

    2000-08-01

    Studies of Fatty Acid Synthesis Inhibition as Novel Therapy for Breast Cancer PRINCIPAL INVESTIGATOR: Francis P. Kuhajda, M.D. CONTRACTING ORGANIZATION...SUBTITLE 5. FUNDING NUMBERS Xenograft Studies of Fatty Acid Synthesis DAMD17-96-1-6235 Inhibition as Novel Therapy for Breast Cancer 6. AUTHOR(S...5012. 13. ABSTRACT (Maximum 200 Words) This grant proposed to study the effect of fatty acid synthesis inhibition in human breast cancer xenografts

  8. Synthesis of amino Derivatives of Dithio Acids as Potential Radiation Protective Agents

    DTIC Science & Technology

    1984-08-01

    ation Management S SI ____ K> AD Synthesis of Amino Derivatives of Dithio Acids as Potential Radiation Protective Agents * 0 Annual Report "TIi: o DTIC...Sftcuntiy Clatuftcatio") Synthesis of Amino Derivatives of Dithio Acids as PotentitI- Radiation Protective Agents 12l PERISONAL. Ak.TI4OR(S) * William...methyl- picoline derivatives was accomplished. Use of N-mthyl-2,6-dimethylpyridine also allowed the synthesis of a bis(dithioacetic acid) function not

  9. Existence of two forms of rat liver arginyl-tRNA synthetase suggests channeling of aminoacyl-tRNA for protein synthesis.

    PubMed Central

    Sivaram, P; Deutscher, M P

    1990-01-01

    Arginyl-tRNA synthetase (arginine-tRNA ligase, EC 6.1.1.19) is found in extracts of mammalian cells both as a free protein (Mr = 60,000) and as a component (Mr approximately 72,000) of the high molecular weight aminoacyl-tRNA synthetase complex (Mr greater than 10(6). Several pieces of evidence indicate that the low molecular weight free form is not a proteolytic degradation product of the complex-bound enzyme but that it preexists in vivo: (i) the endogenous free form differs in size from the active proteolytic fragment generated in vitro, (ii) conditions expected to increase or decrease the amount of proteolysis do not alter the ratio of the two forms of the enzyme, and (iii) the free form contains an NH2-terminal methionine residue. A model is presented that provides a rationale for the existence of two forms of arginyl-tRNA synthetase in cells. In this model the complexed enzyme supplies arginyl-tRNA for protein synthesis, whereas the free enzyme provides arginyl-tRNA for the NH2-terminal arginine modification of proteins by arginyl-tRNA:protein arginyltransferase. This latter process targets certain proteins for removal by the ubiquitin-dependent protein degradation pathway. The necessity for an additional pool of arginyl-tRNA for the modification reaction leads to the conclusion that the arginyl-tRNA destined for protein synthesis (and/or protein modification) is channeled and unavailable for other processes. Other evidence supporting channeling in protein synthesis is discussed. Images PMID:2187187

  10. RNA synthesis in the ultrastructural and biochemical components of the nucleolus of Chinese hamster ovary cells

    PubMed Central

    1975-01-01

    A correlated autoradiographic and biochemical study of RNA synthesis in the nucleoli of chinese hamster ovary cells has been made. Quantitative analysis of the labeling indicates that the fibrillar ribonucleoprotein (RNP) component is labeled faster than 80S RNP and 45S RNA molecules, but approaches simultaneously a steady-state 3H to 14C ratio or grains/mum2 after 30 min of [3H]uridine incorporation. On the other hand, the 55S RNP, the 36S + 32S RNA, and the granular RNP components have the same kinetic of labeling with [3H]uridine. These results suggest that the fibrillar and granular RNP components of the nucleolus are the ultrastructural substratum of, respectively, the 80S RNP (45S RNA) and 55S RNP (36S + 32S RNA). The possibility that precursors to 80S RNP exist also in the fibrillar region of the nucleolus is strongly suggested by the rapid labeling of the fibrils on the autoradiographs. PMID:1171872

  11. Transfer RNA-mediated regulation of ribosome dynamics during protein synthesis

    PubMed Central

    Fei, Jingyi; Richard, Arianne C.; Bronson, Jonathan E.; Gonzalez, & Ruben L.

    2011-01-01

    Translocation of transfer RNAs (tRNAs) through the ribosome during protein synthesis involves large-scale structural rearrangements of the ribosome and the ribosome-bound tRNAs that are accompanied by extensive and dynamic remodeling of tRNA-ribosome interactions. The contributions that rearranging individual tRNA-ribosome interactions make to directing tRNA movements during translocation, however, remain largely unknown. To address this question, we have used single-molecule fluorescence resonance energy transfer to characterize the dynamics of ribosomal pre-translocation (PRE) complex analogs carrying either wild-type or systematically mutagenized tRNAs. Our data reveal how specific tRNA-ribosome interactions regulate the rate with which the PRE complex rearranges into a critical, on-pathway translocation intermediate and how these interactions control the stability of the resulting configuration. More interestingly, our results suggest that the conformational flexibility of the tRNA molecule itself plays a crucial role in directing the structural dynamics of the PRE complex during translocation. PMID:21857664

  12. Flexibility of nucleic acids: From DNA to RNA

    NASA Astrophysics Data System (ADS)

    Lei, Bao; Xi, Zhang; Lei, Jin; Zhi-Jie, Tan

    2016-01-01

    The structural flexibility of nucleic acids plays a key role in many fundamental life processes, such as gene replication and expression, DNA-protein recognition, and gene regulation. To obtain a thorough understanding of nucleic acid flexibility, extensive studies have been performed using various experimental methods and theoretical models. In this review, we will introduce the progress that has been made in understanding the flexibility of nucleic acids including DNAs and RNAs, and will emphasize the experimental findings and the effects of salt, temperature, and sequence. Finally, we will discuss the major unanswered questions in understanding the flexibility of nucleic acids. Project supported by the National Basic Research Program of China (Grant No. 2011CB933600), the National Natural Science Foundation of China (Grant Nos. 11175132, 11575128, and 11374234), and the Program for New Century Excellent Talents, China (Grant No. NCET 08-0408).

  13. Positive-strand RNA viruses stimulate host phosphatidylcholine synthesis at viral replication sites

    PubMed Central

    Zhang, Jiantao; Zhang, Zhenlu; Chukkapalli, Vineela; Nchoutmboube, Jules A.; Li, Jianhui; Randall, Glenn; Belov, George A.; Wang, Xiaofeng

    2016-01-01

    All positive-strand RNA viruses reorganize host intracellular membranes to assemble their viral replication complexes (VRCs); however, how these viruses modulate host lipid metabolism to accommodate such membrane proliferation and rearrangements is not well defined. We show that a significantly increased phosphatidylcholine (PC) content is associated with brome mosaic virus (BMV) replication in both natural host barley and alternate host yeast based on a lipidomic analysis. Enhanced PC levels are primarily associated with the perinuclear ER membrane, where BMV replication takes place. More specifically, BMV replication protein 1a interacts with and recruits Cho2p (choline requiring 2), a host enzyme involved in PC synthesis, to the site of viral replication. These results suggest that PC synthesized at the site of VRC assembly, not the transport of existing PC, is responsible for the enhanced accumulation. Blocking PC synthesis by deleting the CHO2 gene resulted in VRCs with wider diameters than those in wild-type cells; however, BMV replication was significantly inhibited, highlighting the critical role of PC in VRC formation and viral replication. We further show that enhanced PC levels also accumulate at the replication sites of hepatitis C virus and poliovirus, revealing a conserved feature among a group of positive-strand RNA viruses. Our work also highlights a potential broad-spectrum antiviral strategy that would disrupt PC synthesis at the sites of viral replication but would not alter cellular processes. PMID:26858414

  14. In low protein diets, microRNA-19b regulates urea synthesis by targeting SIRT5

    PubMed Central

    Sun, Rui-Ping; Xi, Qian-Yun; Sun, Jia-Jie; Cheng, Xiao; Zhu, Yan-Ling; Ye, Ding-Ze; Chen, Ting; Wei, Li-Min; Ye, Rui-Song; Jiang, Qing-Yan; Zhang, Yong-Liang

    2016-01-01

    Ammonia detoxification, which takes place via the hepatic urea cycle, is essential for nitrogen homeostasis and physiological well-being. It has been reported that a reduction in dietary protein reduces urea nitrogen. MicroRNAs (miRNAs) are major regulatory non-coding RNAs that have significant effects on several metabolic pathways; however, little is known on whether miRNAs regulate hepatic urea synthesis. The objective of this study was to assess the miRNA expression profile in a low protein diet and identify miRNAs involved in the regulation of the hepatic urea cycle using a porcine model. Weaned 28-days old piglets were fed a corn-soybean normal protein diet (NP) or a corn-soybean low protein diet (LP) for 30 d. Hepatic and blood samples were collected, and the miRNA expression profile was assessed by sequencing and qRT-PCR. Furthermore, we evaluated the possible role of miR-19b in urea synthesis regulation. There were 25 differentially expressed miRNAs between the NP and LP groups. Six of these miRNAs were predicted to be involved in urea cycle metabolism. MiR-19b negatively regulated urea synthesis by targeting SIRT5, which is a positive regulator of CPS1, the rate limiting enzyme in the urea cycle. Our study presented a novel explanation of ureagenesis regulation by miRNAs. PMID:27686746

  15. Cationic derivatives of biocompatible hyaluronic acids for delivery of siRNA and antisense oligonucleotides.

    PubMed

    Han, Su-Eun; Kang, Hyungu; Shim, Ga Yong; Kim, Sun Jae; Choi, Han-Gon; Kim, Jiseok; Hahn, Sei Kwang; Oh, Yu-Kyoung

    2009-02-01

    In this study, we tested the use of cationic polymer derivatives of biocompatible hyaluronic acid (HA) as a delivery system of siRNA and antisense oligonucleotides. HA was modified with cationic polymer polyethylenimine (PEI). When compared with PEI alone, cationic PEI derivatives of HA (HA-PEI) provided increased cellular delivery of Small interfering RNA (siRNA) in B16F1, A549, HeLa, and Hep3B tumor cells. Indeed, more than 95% of the cells were positive for siRNA following its delivery with HA-PEI. A survivin-specific siRNA that was delivered using HA-PEI potently reduced the mRNA expression levels of the target gene in all of the cell lines. By contrast, survivin-specific siRNA delivered by PEI alone did not induce a significant reduction in mRNA levels. In green fluorescent protein (GFP)-expressing 293 T cells, a loss of GFP expression was evident in the cells that had been treated with GFP-specific siRNA and HA-PEI complex. The inhibition of target gene expression by antisense oligonucleotide G3139 was also enhanced after delivery with HA-PEI. Moreover, HA-PEI displayed lower cytotoxicity than PEI alone. These results suggest that HA-PEI could be further developed as biocompatible delivery systems of siRNA and antisense oligonucleotides for enhanced cellular uptake and inhibition of target gene expression.

  16. The synthesis of mycosporine-like amino acids (MAAs) by cultured, symbiotic dinoflagellates.

    PubMed

    T Banaszak1 A; LaJeunesse; Trench

    2000-06-28

    We tested the hypothesis that there is a relation between phylotypes (phylogenetic types, as determined by restriction fragment length polymorphism (RFLP) and partial sequence analysis of the small subunit ribosomal RNA gene (SSUrDNA)) and the synthesis of mycosporine-like amino acids (MAAs) by symbiotic dinoflagellates under the influence of ultraviolet radiation (UV-B/A) and photosynthetically active radiation (PAR). We exposed 27 isolates of symbiotic dinoflagellates simultaneously to UV-B/A and PAR, and subsequently determined the MAAs present in cell extracts and in the media. The algae used included 24 isolates of Symbiodinium spp. originating from jellyfishes, sea anemones, zoanthids, scleractinians, octocorals, and bivalves, and three others in the genera Gymnodinium, Gloeodinium and Amphidinium from a jellyfish, an hydrocoral and a flatworm, respectively. In this study, all of the phylotype A Symbiodinium spp. synthesized up to three identified MAAs. None of the 11 cultured phylotypes B and C Symbiodinium spp. synthesized MAAs. The three non-Symbiodinium symbionts also synthesized up to three MAAs. The results support a conclusion that phylotype A Symbiodinium spp. have a high predilection for the synthesis of MAAs, while phylotypes B and C do not. Synthesis of MAAs by symbiotic dinoflagellates in culture does not appear to relate directly to depths or to the UV exposure regimes from which the consortia were collected.

  17. A 3′-end structure in RNA2 of a crinivirus is essential for viral RNA synthesis and contributes to replication-associated translation activity

    PubMed Central

    Mongkolsiriwattana, Chawin; Zhou, Jaclyn S.; Ng, James C. K.

    2016-01-01

    The terminal ends in the genome of RNA viruses contain features that regulate viral replication and/or translation. We have identified a Y-shaped structure (YSS) in the 3′ terminal regions of the bipartite genome of Lettuce chlorosis virus (LCV), a member in the genus Crinivirus (family Closteroviridae). The YSS is the first in this family of viruses to be determined using Selective 2′-Hydroxyl Acylation Analyzed by Primer Extension (SHAPE). Using luciferase constructs/replicons, in vivo and in vitro assays showed that the 5′ and YSS-containing 3′ terminal regions of LCV RNA1 supported translation activity. In contrast, similar regions from LCV RNA2, including those upstream of the YSS, did not. LCV RNA2 mutants with nucleotide deletions or replacements that affected the YSS were replication deficient. In addition, the YSS of LCV RNA1 and RNA2 were interchangeable without affecting viral RNA synthesis. Translation and significant replication were observed for specific LCV RNA2 replicons only in the presence of LCV RNA1, but both processes were impaired when the YSS and/or its upstream region were incomplete or altered. These results are evidence that the YSS is essential to the viral replication machinery, and contributes to replication enhancement and replication-associated translation activity in the RNA2 replicons. PMID:27694962

  18. Calcineurin mediates homeostatic synaptic plasticity by regulating retinoic acid synthesis

    PubMed Central

    Arendt, Kristin L.; Zhang, Zhenjie; Ganesan, Subhashree; Hintze, Maik; Shin, Maggie M.; Tang, Yitai; Cho, Ahryon; Graef, Isabella A.; Chen, Lu

    2015-01-01

    Homeostatic synaptic plasticity is a form of non-Hebbian plasticity that maintains stability of the network and fidelity for information processing in response to prolonged perturbation of network and synaptic activity. Prolonged blockade of synaptic activity decreases resting Ca2+ levels in neurons, thereby inducing retinoic acid (RA) synthesis and RA-dependent homeostatic synaptic plasticity; however, the signal transduction pathway that links reduced Ca2+-levels to RA synthesis remains unknown. Here we identify the Ca2+-dependent protein phosphatase calcineurin (CaN) as a key regulator for RA synthesis and homeostatic synaptic plasticity. Prolonged inhibition of CaN activity promotes RA synthesis in neurons, and leads to increased excitatory and decreased inhibitory synaptic transmission. These effects of CaN inhibitors on synaptic transmission are blocked by pharmacological inhibitors of RA synthesis or acute genetic deletion of the RA receptor RARα. Thus, CaN, acting upstream of RA, plays a critical role in gating RA signaling pathway in response to synaptic activity. Moreover, activity blockade-induced homeostatic synaptic plasticity is absent in CaN knockout neurons, demonstrating the essential role of CaN in RA-dependent homeostatic synaptic plasticity. Interestingly, in GluA1 S831A and S845A knockin mice, CaN inhibitor- and RA-induced regulation of synaptic transmission is intact, suggesting that phosphorylation of GluA1 C-terminal serine residues S831 and S845 is not required for CaN inhibitor- or RA-induced homeostatic synaptic plasticity. Thus, our study uncovers an unforeseen role of CaN in postsynaptic signaling, and defines CaN as the Ca2+-sensing signaling molecule that mediates RA-dependent homeostatic synaptic plasticity. PMID:26443861

  19. Effect of insulin on human skeletal muscle mitochondrial ATP production, protein synthesis, and mRNA transcripts

    PubMed Central

    Stump, Craig S.; Short, Kevin R.; Bigelow, Maureen L.; Schimke, Jill M.; Nair, K. Sreekumaran

    2003-01-01

    Mitochondria are the primary site of skeletal muscle fuel metabolism and ATP production. Although insulin is a major regulator of fuel metabolism, its effect on mitochondrial ATP production is not known. Here we report increases in vastus lateralis muscle mitochondrial ATP production capacity (32–42%) in healthy humans (P < 0.01) i.v. infused with insulin (1.5 milliunits/kg of fat-free mass per min) while clamping glucose, amino acids, glucagon, and growth hormone. Increased ATP production occurred in association with increased mRNA levels from both mitochondrial (NADH dehydrogenase subunit IV) and nuclear [cytochrome c oxidase (COX) subunit IV] genes (164–180%) encoding mitochondrial proteins (P < 0.05). In addition, muscle mitochondrial protein synthesis, and COX and citrate synthase enzyme activities were increased by insulin (P < 0.05). Further studies demonstrated no effect of low to high insulin levels on muscle mitochondrial ATP production for people with type 2 diabetes mellitus, whereas matched nondiabetic controls increased 16–26% (P < 0.02) when four different substrate combinations were used. In conclusion, insulin stimulates mitochondrial oxidative phosphorylation in skeletal muscle along with synthesis of gene transcripts and mitochondrial protein in human subjects. Skeletal muscle of type 2 diabetic patients has a reduced capacity to increase ATP production with high insulin levels. PMID:12808136

  20. Skeletal muscle plasticity induced by seasonal acclimatization in carp involves differential expression of rRNA and molecules that epigenetically regulate its synthesis.

    PubMed

    Fuentes, Eduardo N; Zuloaga, Rodrigo; Nardocci, Gino; Fernandez de la Reguera, Catalina; Simonet, Nicolas; Fumeron, Robinson; Valdes, Juan Antonio; Molina, Alfredo; Alvarez, Marco

    2014-01-01

    Ribosomal biogenesis controls cellular growth in living organisms, with the rate-limiting step of this process being the transcription of ribosomal DNA (rDNA). Considering that epigenetic mechanisms allow an organism to respond to environmental changes, the expression in muscle of several molecules that regulate epigenetic rRNA synthesis, as well as rDNA transcription, were evaluated during the seasonal acclimatization of the carp. First, the nucleotide sequences encoding the components forming the NoRC (ttf-I, tip5) and eNoSC (sirt1, nml, suv39h1), two chromatin remodeling complexes that silence rRNA synthesis, as well as the sequence of ubf1, a key regulator of rDNA transcription, were obtained. Subsequently the transcriptional regulation of the aforementioned molecules, and other key molecules involved in rRNA synthesis (mh2a1, mh2a2, h2a.z, h2a.z.7, nuc, p80), was assessed. The carp sequences for TTF-I, TIP5, SIRT1, NML, SUV39H1, and UBF1 showed a high conservation of domains and key amino acids in comparison with other fish and higher vertebrates. The mRNA contents in muscle for ttf-I, tip5, sirt1, nml, suv39h1, mh2a1, mh2a.z, and nuc were up-regulated during winter in comparison with summer, whereas the mRNA levels of mh2a2, ubf1, and p80 were down-regulated. Also, the contents of molecules involved in processing the rRNA (snoRNAs) and pRNA, a stabilizer of NoRC complex, were analyzed, finding that these non-coding RNAs were not affected by seasonal acclimatization. These results suggest that variations in the expression of rRNA and the molecules that epigenetically regulate its synthesis are contributing to the muscle plasticity induced by seasonal acclimatization in carp.

  1. LKB1 promotes cell survival by modulating TIF-IA-mediated pre-ribosomal RNA synthesis under uridine downregulated conditions.

    PubMed

    Liu, Fakeng; Jin, Rui; Liu, Xiuju; Huang, Henry; Wilkinson, Scott C; Zhong, Diansheng; Khuri, Fadlo R; Fu, Haian; Marcus, Adam; He, Yulong; Zhou, Wei

    2016-01-19

    We analyzed the mechanism underlying 5-aminoimidazole-4-carboxamide riboside (AICAR) mediated apoptosis in LKB1-null non-small cell lung cancer (NSCLC) cells. Metabolic profile analysis revealed depletion of the intracellular pyrimidine pool after AICAR treatment, but uridine was the only nucleotide precursor capable of rescuing this apoptosis, suggesting the involvement of RNA metabolism. Because half of RNA transcription in cancer is for pre-ribosomal RNA (rRNA) synthesis, which is suppressed by over 90% after AICAR treatment, we evaluated the role of TIF-IA-mediated rRNA synthesis. While the depletion of TIF-IA by RNAi alone promoted apoptosis in LKB1-null cells, the overexpression of a wild-type or a S636A TIF-IA mutant, but not a S636D mutant, attenuated AICAR-induced apoptosis. In LKB1-null H157 cells, pre-rRNA synthesis was not suppressed by AICAR when wild-type LKB1 was present, and cellular fractionation analysis indicated that TIF-IA quickly accumulated in the nucleus in the presence of a wild-type LKB1 but not a kinase-dead mutant. Furthermore, ectopic expression of LKB1 was capable of attenuating AICAR-induced death in AMPK-null cells. Because LKB1 promotes cell survival by modulating TIF-IA-mediated pre-rRNA synthesis, this discovery suggested that targeted depletion of uridine related metabolites may be exploited in the clinic to eliminate LKB1-null cancer cells.

  2. Synthesis and characterization of copolyanhydrides of carbohydrate-based galactaric acid and adipic acid.

    PubMed

    Mehtiö, Tuomas; Nurmi, Leena; Rämö, Virpi; Mikkonen, Hannu; Harlin, Ali

    2015-01-30

    A series of copolyanhydrides, consisting of 2,3,4,5-tetra-O-acetylgalactaric acid (AGA) and adipic acid (AA) as monomer units, was polymerized. Synthesis of AGA monomer consisted of two steps. First, O-acetylation of galactaric acid secondary hydroxyl groups was performed using acetic anhydride as a reagent. Acetic anhydride was then further used as a reagent in the synthesis of diacetyl mixed anhydride of AGA. Polymerizations were conducted as bulk condensation polymerization at 150 °C. Thermal properties of the copolymers varied depending on monomer composition. Increase in the AGA content had a clear increasing effect on the Tg. A similar increasing effect was observed in Tm. The degree of crystallinity decreased as AGA content increased. There was a slightly lowering tendency in the molecular weights of the obtained polymers when the AGA content in the polymerization mixtures increased. The described synthesis route shows that bio-based aldaric acid monomers are potential candidates for the adjustment of thermal properties of polyanhydrides.

  3. Inhibition of Protein Synthesis and Malaria Parasite Development by Drug Targeting of Methionyl-tRNA Synthetases

    PubMed Central

    Hussain, Tahir; Yogavel, Manickam

    2015-01-01

    Aminoacyl-tRNA synthetases (aaRSs) are housekeeping enzymes that couple cognate tRNAs with amino acids to transmit genomic information for protein translation. The Plasmodium falciparum nuclear genome encodes two P. falciparum methionyl-tRNA synthetases (PfMRS), termed PfMRScyt and PfMRSapi. Phylogenetic analyses revealed that the two proteins are of primitive origin and are related to heterokonts (PfMRScyt) or proteobacteria/primitive bacteria (PfMRSapi). We show that PfMRScyt localizes in parasite cytoplasm, while PfMRSapi localizes to apicoplasts in asexual stages of malaria parasites. Two known bacterial MRS inhibitors, REP3123 and REP8839, hampered Plasmodium growth very effectively in the early and late stages of parasite development. Small-molecule drug-like libraries were screened against modeled PfMRS structures, and several “hit” compounds showed significant effects on parasite growth. We then tested the effects of the hit compounds on protein translation by labeling nascent proteins with 35S-labeled cysteine and methionine. Three of the tested compounds reduced protein synthesis and also blocked parasite growth progression from the ring stage to the trophozoite stage. Drug docking studies suggested distinct modes of binding for the three compounds, compared with the enzyme product methionyl adenylate. Therefore, this study provides new targets (PfMRSs) and hit compounds that can be explored for development as antimalarial drugs. PMID:25583729

  4. Synthesis and biological activity of novel deoxycholic acid derivatives.

    PubMed

    Popadyuk, Irina I; Markov, Andrey V; Salomatina, Oksana V; Logashenko, Evgeniya B; Shernyukov, Andrey V; Zenkova, Marina A; Salakhutdinov, Nariman F

    2015-08-01

    We report the synthesis and biological activity of new semi-synthetic derivatives of naturally occurring deoxycholic acid (DCA) bearing 2-cyano-3-oxo-1-ene, 3-oxo-1(2)-ene or 3-oxo-4(5)-ene moieties in ring A and 12-oxo or 12-oxo-9(11)-ene moieties in ring C. Bioassays using murine macrophage-like cells and tumour cells show that the presence of the 9(11)-double bond associated with the increased polarity of ring A or with isoxazole ring joined to ring A, improves the ability of the compounds to inhibit cancer cell growth.

  5. Antimicrobial polyurethane thermosets based on undecylenic acid: synthesis and evaluation.

    PubMed

    Lluch, Cristina; Esteve-Zarzoso, Braulio; Bordons, Albert; Lligadas, Gerard; Ronda, Juan C; Galià, Marina; Cádiz, Virginia

    2014-08-01

    In the present study, plant oil-derived surface-modifiable polyurethane thermosets are presented. Polyol synthesis is carried out taking advantage of thiol-yne photopolymerization of undecylenic acid derivatives containing methyl ester or hydroxyl moieties. The prepared methyl ester-containing polyurethanes allow surface modification treatment to enhance their hydrophilicity and impart antimicrobial activity through the following two steps: i) grafting poly(propylene glycol) monoamine (Jeffamine M-600) via aminolysis and ii) Jeffamine M-600 layer complexation with iodine. The antimicrobial activity of the iodine-containing polyurethanes is demonstrated by its capacity to inhibit the growth of Staphylococcus aureus, and Candida albicans in agar media.

  6. The relation of RNA synthesis to chondroitin sulphate biosynthesis in cultured bovine cartilage.

    PubMed Central

    McQuillan, D J; Handley, C J; Robinson, H C; Ng, K; Tzaicos, C

    1986-01-01

    Addition of actinomycin D (or cordycepin, an alternative inhibitor of RNA synthesis) to cartilage cultures resulted in a first-order decrease in the rate of incorporation of [35S]sulphate into proteoglycan (half-life = 7.5 +/- 1.1 h). Addition of 1.0 mM-benzyl beta-D-xyloside relieved the initial inhibition of glycosaminoglycan synthesis induced by actinomycin D; however, after a lag of about 10 h the rate of xyloside-initiated glycosaminoglycan synthesis also decreased with apparent first-order kinetics (half-life = 7.1 +/- 1.8 h), which paralleled the decrease in the rate of core-protein-initiated glycosaminoglycan synthesis. The hydrodynamic size of the proteoglycans formed in the presence of actinomycin D remained essentially constant (Kav. 0.21-0.23), whereas the constituent glycosaminoglycan chains were larger than those formed by control cultures, which suggested that the core protein was substituted with fewer but larger glycosaminoglycan chains. Proteoglycans formed in the presence of beta-D-xyloside were significantly smaller (Kav. approximately 0.33) than those synthesized by control cultures, and were further diminished in size after exposure of cultures to actinomycin D. Glycosaminoglycan chains synthesized by these same cultures on to both core-protein and xyloside acceptors were also smaller than those of control cultures. The decrease in synthesis observed after exposure to actinomycin D was not reflected by any significant decrease in the activities of several glycosyltransferases involved in chondroitin sulphate synthesis (galactosyltransferase-I, galactosyltransferase-II, N-acetylgalactosaminyltransferase and glucuronosyltransferase-II). PMID:2427073

  7. Differences in acid tolerance between Bifidobacterium breve BB8 and its acid-resistant derivative B. breve BB8dpH, revealed by RNA-sequencing and physiological analysis.

    PubMed

    Yang, Xu; Hang, Xiaomin; Tan, Jing; Yang, Hong

    2015-06-01

    Bifidobacteria are common inhabitants of the human gastrointestinal tract, and their application has increased dramatically in recent years due to their health-promoting effects. The ability of bifidobacteria to tolerate acidic environments is particularly important for their function as probiotics because they encounter such environments in food products and during passage through the gastrointestinal tract. In this study, we generated a derivative, Bifidobacterium breve BB8dpH, which displayed a stable, acid-resistant phenotype. To investigate the possible reasons for the higher acid tolerance of B. breve BB8dpH, as compared with its parental strain B. breve BB8, a combined transcriptome and physiological approach was used to characterize differences between the two strains. An analysis of the transcriptome by RNA-sequencing indicated that the expression of 121 genes was increased by more than 2-fold, while the expression of 146 genes was reduced more than 2-fold, in B. breve BB8dpH. Validation of the RNA-sequencing data using real-time quantitative PCR analysis demonstrated that the RNA-sequencing results were highly reliable. The comparison analysis, based on differentially expressed genes, suggested that the acid tolerance of B. breve BB8dpH was enhanced by regulating the expression of genes involved in carbohydrate transport and metabolism, energy production, synthesis of cell envelope components (peptidoglycan and exopolysaccharide), synthesis and transport of glutamate and glutamine, and histidine synthesis. Furthermore, an analysis of physiological data showed that B. breve BB8dpH displayed higher production of exopolysaccharide and lower H(+)-ATPase activity than B. breve BB8. The results presented here will improve our understanding of acid tolerance in bifidobacteria, and they will lead to the development of new strategies to enhance the acid tolerance of bifidobacterial strains.

  8. Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments.

    PubMed

    Kitadai, Norio

    2015-12-01

    Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids.

  9. Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments

    NASA Astrophysics Data System (ADS)

    Kitadai, Norio

    2015-12-01

    Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids.

  10. Effect of mevalonic acid on cholesterol synthesis in bovine intramuscular and subcutaneous adipocytes.

    PubMed

    Liu, Xiaomu; You, Wei; Cheng, Haijian; Zhang, Qingfeng; Song, Enliang; Wan, Fachun; Han, Hong; Liu, Guifen

    2016-02-01

    Mevalonic acid (MVA) is a key material in the synthesis of cholesterol; indeed, intracellular cholesterol synthesis is also called the mevalonic acid pathway. 3-Hydroxy-3-methylglutaryl-CoA reductase (HMGR) is an essential enzyme in cholesterol biosynthesis. This study suggests that MVA may play an important role in the differentiation of bovine adipose tissue in vivo. We investigated differential mRNA expression in bovine intramuscular preadipocytes (BIPs) and bovine subcutaneous preadipocytes (BSPs) by culturing cells from the longissimus dorsi muscle and subcutaneous fat tissues of Luxi yellow cattle. The morphology of lipid accumulation of bovine preadipocytes was detected by Oil Red O staining, and total cholesterol (TC), low-density lipoprotein cholesterol (LDLC), and high-density lipoprotein cholesterol (HDLC) levels were measured. Temporospatial expression of HMGR was investigated by real-time quantitative polymerase chain reaction (PCR). The TC, LDLC, and HDLC content did not significantly differ over time but increased slowly with increasing MVA concentration. HMGR expression increased over time and with increasing concentrations of MVA. MVA increased adipose cell proliferation in a dose-dependent and time-dependent manner. MVA stimulated HMGR expression in two cell types and its influence on adipocyte differentiation.

  11. Consequences of PPARα Invalidation on Glutathione Synthesis: Interactions with Dietary Fatty Acids

    PubMed Central

    Guelzim, Najoua; Huneau, Jean-François; Mathé, Véronique; Quignard-Boulangé, Annie; Martin, Pascal G.; Tomé, Daniel; Hermier, Dominique

    2011-01-01

    Glutathione (GSH) derives from cysteine and plays a key role in redox status. GSH synthesis is determined mainly by cysteine availability and γ-glutamate cysteine ligase (γGCL) activity. Because PPARα activation is known to control the metabolism of certain amino acids, GSH synthesis from cysteine and related metabolisms were explored in wild-type (WT) and PPARα-null (KO) mice, fed diets containing either saturated (COCO diet) or 18 : 3 n-3, LIN diet. In mice fed the COCO diet, but not in those fed the LIN diet, PPARα deficiency enhanced hepatic GSH content and γGCL activity, superoxide dismutase 2 mRNA levels, and plasma uric acid concentration, suggesting an oxidative stress. In addition, in WT mice, the LIN diet increased the hepatic GSH pool, without effect on γGCL activity, or change in target gene expression, which rules out a direct effect of PPARα. This suggests that dietary 18 : 3 n-3 may regulate GSH metabolism and thus mitigate the deleterious effects of PPARα deficiency on redox status, without direct PPARα activation. PMID:21915176

  12. The small noncoding DsrA RNA is an acid resistance regulator in Escherichia coli.

    PubMed

    Lease, Richard A; Smith, Dorie; McDonough, Kathleen; Belfort, Marlene

    2004-09-01

    DsrA RNA is a small (87-nucleotide) regulatory RNA of Escherichia coli that acts by RNA-RNA interactions to control translation and turnover of specific mRNAs. Two targets of DsrA regulation are RpoS, the stationary-phase and stress response sigma factor (sigmas), and H-NS, a histone-like nucleoid protein and global transcription repressor. Genes regulated globally by RpoS and H-NS include stress response proteins and virulence factors for pathogenic E. coli. Here, by using transcription profiling via DNA arrays, we have identified genes induced by DsrA. Steady-state levels of mRNAs from many genes increased with DsrA overproduction, including multiple acid resistance genes of E. coli. Quantitative primer extension analysis verified the induction of individual acid resistance genes in the hdeAB, gadAX, and gadBC operons. E. coli K-12 strains, as well as pathogenic E. coli O157:H7, exhibited compromised acid resistance in dsrA mutants. Conversely, overproduction of DsrA from a plasmid rendered the acid-sensitive dsrA mutant extremely acid resistant. Thus, DsrA RNA plays a regulatory role in acid resistance. Whether DsrA targets acid resistance genes directly by base pairing or indirectly via perturbation of RpoS and/or H-NS is not known, but in either event, our results suggest that DsrA RNA may enhance the virulence of pathogenic E. coli.

  13. Functional specificity of amino acid at position 246 in the tRNA mimicry domain of bacterial release factor 2.

    PubMed

    Uno, M; Ito, K; Nakamura, Y

    1996-01-01

    The termination of protein synthesis in bacteria requires codon-specific polypeptide release factors RF-1 (UAG/UAA specific) and RF-2 (UGA/UAA specific). We have proposed that release factors mimic tRNA and recognize the stop codon for polypeptide release (Nakamura et al (1996) Cell 87, 147-150). In contrast to the textbook view, genetic experiments have indicated that Escherichia coli RF-2 terminates translation very weakly at UAA while Salmonella RF-2 decodes this signal efficiently. Moreover, an excess of E coli RF-2 was toxic to cells while an excess of Salmonella RF-2 was not. These two RF-2 proteins are identical except for 16 out of 365 amino acids. Fragment swap experiments and site-directed mutagenesis revealed that a residue at position 246 is solely responsible for these two phenotypes. Upon substituting Ala (equivalent to Salmonella RF-2) for Thr-246 of E coli RF-2, the protein acquired increased release activity for UAA as well as for UGA. These results led us to conclude that E coli RF-2 activity is potentially weak and that the amino acid at position 246 plays a crucial role, not for codon discrimination, but for stop codon recognition or polypeptide release, presumably constituting an essential moiety of tRNA mimicry or interacting with peptidyltransferase centers of the ribosome.

  14. A synthetic snRNA m3G-CAP enhances nuclear delivery of exogenous proteins and nucleic acids.

    PubMed

    Moreno, Pedro M D; Wenska, Malgorzata; Lundin, Karin E; Wrange, Orjan; Strömberg, Roger; Smith, C I Edvard

    2009-04-01

    Accessing the nucleus through the surrounding membrane poses one of the major obstacles for therapeutic molecules large enough to be excluded due to nuclear pore size limits. In some therapeutic applications the large size of some nucleic acids, like plasmid DNA, hampers their access to the nuclear compartment. However, also for small oligonucleotides, achieving higher nuclear concentrations could be of great benefit. We report on the synthesis and possible applications of a natural RNA 5'-end nuclear localization signal composed of a 2,2,7-trimethylguanosine cap (m(3)G-CAP). The cap is found in the small nuclear RNAs that are constitutive part of the small nuclear ribonucleoprotein complexes involved in nuclear splicing. We demonstrate the use of the m(3)G signal as an adaptor that can be attached to different oligonucleotides, thereby conferring nuclear targeting capabilities with capacity to transport large-size cargo molecules. The synthetic capping of oligos interfering with splicing may have immediate clinical applications.

  15. Protein synthesis factors (RF1, RF2, RF3, RRF, and tmRNA) and peptidyl-tRNA hydrolase rescue stalled ribosomes at sense codons.

    PubMed

    Vivanco-Domínguez, Serafín; Bueno-Martínez, José; León-Avila, Gloria; Iwakura, Nobuhiro; Kaji, Akira; Kaji, Hideko; Guarneros, Gabriel

    2012-04-13

    During translation, ribosomes stall on mRNA when the aminoacyl-tRNA to be read is not readily available. The stalled ribosomes are deleterious to the cell and should be rescued to maintain its viability. To investigate the contribution of some of the cellular translation factors on ribosome rescuing, we provoked stalling at AGA codons in mutants that affected the factors and then analyzed the accumulation of oligopeptidyl (peptides of up to 6 amino acid residues, oligopep-)-tRNA or polypeptidyl (peptides of more than 300 amino acids in length, polypep-)-tRNA associated with ribosomes. Stalling was achieved by starvation for aminoacyl-tRNA(Arg4) upon induced expression of engineered lacZ (β-galactosidase) reporter gene harboring contiguous AGA codons close to the initiation codon or at internal codon positions together with minigene ATGAGATAA accompanied by reduced peptidyl-tRNA hydrolase (Pth). Our results showed accumulations of peptidyl-tRNA associated with ribosomes in mutants for release factors (RF1, RF2, and RF3), ribosome recycling factor (RRF), Pth, and transfer-messenger RNA (tmRNA), implying that each of these factors cooperate in rescuing stalled ribosomes. The role of these factors in ribosome releasing from the stalled complex may vary depending on the length of the peptide in the peptidyl-tRNA. RF3 and RRF rescue stalled ribosomes by "drop-off" of peptidyl-tRNA, while RF1, RF2 (in the absence of termination codon), or Pth may rescue by hydrolyzing the associated peptidyl-tRNA. This is followed by the disassembly of the ribosomal complex of tRNA and mRNA by RRF and elongation factor G.

  16. Synthesis and characterization of carboxylic acid functionalized silicon nanoparticles

    NASA Astrophysics Data System (ADS)

    Shaner, Ted V.

    Silicon nanoparticles are of great interest in a great number of fields. Silicon nanoparticles show great promise particularly in the field of bioimaging. Carboxylic acid functionalized silicon nanoparticles have the ability to covalently bond to biomolecules through the conjugation of the carboxylic acid to an amine functionalized biomolecule. This thesis explores the synthesis of silicon nanoparticles functionalized by both carboxylic acids and alkenes and their carboxylic acid functionality. Also discussed is the characterization of the silicon nanoparticles by the use of x-ray spectroscopy. Finally, the nature of the Si-H bond that is observed on the surface of the silicon nanoparticles will be investigated using photoassisted exciton mediated hydrosilation reactions. The silicon nanoparticles are synthesized from both carboxylic acids and alkenes. However, the lack of solubility of diacids is a significant barrier to carboxylic acid functionalization by a mixture of monoacids and diacids. A synthesis route to overcome this obstacle is to synthesize silicon nanoparticles with terminal vinyl group. This terminal vinyl group is distal to the surface of the silicon nanoparticle. The conversion of the vinyl group to a carboxylic acid is accomplished by oxidative cleavage using ozonolysis. The carboxylic acid functionalized silicon nanoparticles were then successfully conjugated to amine functionalized DNA strand through an n-hydroxy succinimide ester activation step, which promotes the formation of the amide bond. Conjugation was characterized by TEM and polyacrylamide gel electrophoresis (PAGE). The PAGE results show that the silicon nanoparticle conjugates move slower through the polyacrylamide gel, resulting in a significant separation from the nonconjugated DNA. The silicon nanoparticles were then characterized by the use of x-ray absorption near edge spectroscopy (Xanes) and x-ray photoelectron spectroscopy (XPS) to investigate the bonding and chemical

  17. Temporal aspects of DNA and RNA synthesis during human immunodeficiency virus infection: evidence for differential gene expression.

    PubMed Central

    Kim, S Y; Byrn, R; Groopman, J; Baltimore, D

    1989-01-01

    The kinetics of retroviral DNA and RNA synthesis are parameters vital to understanding viral growth, especially for human immunodeficiency virus (HIV), which encodes several of its own regulatory genes. We have established a single-cycle growth condition for HIV in H9 cells, a human CD4+ lymphocyte line. The full-length viral linear DNA is first detectable by 4 h postinfection. During a one-step growth of HIV, amounts of viral DNA gradually increase until 8 to 12 h postinfection and then decrease. The copy number of unintegrated viral DNA is not extraordinarily high even at its peak. Most strikingly, there is a temporal program of RNA accumulation: the earliest RNA is greatly enriched in the 2-kilobase subgenomic mRNA species, while the level of 9.2-kilobase RNA which is both genomic RNA and mRNA remains low until after 24 h of infection. Virus production begins at about 24 h postinfection. Thus, viral DNA synthesis is as rapid as for other retroviruses, but viral RNA synthesis involves temporal alteration in the species that accumulate, presumably as a consequence of viral regulatory genes. Images PMID:2760980

  18. Treatment with the hyaluronic Acid synthesis inhibitor 4-methylumbelliferone suppresses LPS-induced lung inflammation.

    PubMed

    McKallip, Robert J; Ban, Hao; Uchakina, Olga N

    2015-01-01

    Exposure to bacterial endotoxins, such as lipopolysaccharide (LPS), can lead to the induction of acute lung injury/acute respiratory distress syndrome (ALI/ARDS). To date, there are no known effective treatments for LPS-induced inflammation. In the current study, we investigated the potential use of the hyaluronic acid (HA) synthesis inhibitor 4-methylumbelliferone (4-MU) on LPS-induced acute lung inflammation. Culturing LPS-activated immune cells with 4-MU led to reduced proliferation, reduced cytokine production, and an increase in apoptosis when compared to untreated cells. Treatment of mice with 4-MU led to protection from LPS-induced lung injury. Specifically, 4-MU treatment led to a reduction in LPS-induced hyaluronic acid synthase (HAS) messenger RNA (mRNA) levels, reduction in lung permeability, and reduction in proinflammatory cytokine production. Taken together, these results suggest that use of 4-MU to target HA production may be an effective treatment for the inflammatory response following exposure to LPS.

  19. Viability of Poliovirus/Rhinovirus VPg Chimeric Viruses and Identification of an Amino Acid Residue in the VPg Gene Critical for Viral RNA Replication

    PubMed Central

    Cheney, I. Wayne; Naim, Suhaila; Shim, Jae Hoon; Reinhardt, Meghan; Pai, Bharati; Wu, Jim Z.; Hong, Zhi; Zhong, Weidong

    2003-01-01

    Picornaviral RNA replication utilizes a small virus-encoded protein, termed 3B or VPg, as a primer to initiate RNA synthesis. This priming step requires uridylylation of the VPg peptide by the viral polymerase protein 3Dpol, in conjunction with other viral or host cofactors. In this study, we compared the viral specificity in 3Dpol-catalyzed uridylylation reactions between poliovirus (PV) and human rhinovirus 16 (HRV16). It was found that HRV16 3Dpol was able to uridylylate PV VPg as efficiently as its own VPg, but PV 3Dpol could not uridylylate HRV16 VPg. Two chimeric viruses, PV containing HRV16 VPg (PV/R16-VPg) and HRV16 containing PV VPg (R16/PV-VPg), were constructed and tested for replication capability in H1-HeLa cells. Interestingly, only PV/R16-VPg chimeric RNA produced infectious virus particles upon transfection. No viral RNA replication or cytopathic effect was observed in cells transfected with R16/PV-VPg chimeric RNA, despite the ability of HRV16 3Dpol to uridylylate PV VPg in vitro. Sequencing analysis of virion RNA isolated from the virus particles generated by PV/R16-VPg chimeric RNA identified a single residue mutation in the VPg peptide (Glu6 to Val). Reverse genetics confirmed that this mutation was highly compensatory in enhancing replication of the chimeric viral RNA. PV/R16-VPg RNA carrying this mutation replicated with similar kinetics and magnitude to wild-type PV RNA. This cell culture-induced mutation in HRV16 VPg moderately increased its uridylylation by PV 3Dpol in vitro, suggesting that it might be involved in other function(s) in addition to the direct uridylylation reaction. This study demonstrated the use of chimeric viruses to characterize viral specificity and compatibility in vivo between PV and HRV16 and to identify critical amino acid residue(s) for viral RNA replication. PMID:12805442

  20. Sequences more than 500 base pairs upstream of the human U3 small nuclear RNA gene stimulate the synthesis of U3 RNA in frog oocytes

    SciTech Connect

    Suh, D.; Reddy, R. ); Wright, D. )

    1991-06-04

    Small nuclear RNA (snRNA) genes contain strong promoters capable of initiating transcription once every 4 s. Studies on the human U1 snRNA gene, carried out in other laboratories, showed that sequences within 400 bp of the 5' flanking region are sufficient for maximal levels of transcription both in vivo and in frog oocytes (reviewed in Dahlberg and Lund (1988)). The authors studied the expression of a human U3 snRNA gene by injecting 5' deletion mutants into frog oocytes. The results show that sequences more than 500 bp upstream of the U3 snRNA gene have a 2-3-fold stimulatory effect on the U3 snRNA synthesis. These results indicate that the human U3 snRNA gene is different from human U1 snRNA gene in containing regulatory elements more than 500 bp upstream. The U3 snRNA gene upstream sequences contain an AluI homologous sequence in the {minus}1,200 region; these AluI sequences were transcribed in vitro and in frog oocytes but were not detectable in Hela cells.

  1. Effect of mitochondrial ascorbic acid synthesis on photosynthesis.

    PubMed

    Senn, M E; Gergoff Grozeff, G E; Alegre, M L; Barrile, F; De Tullio, M C; Bartoli, C G

    2016-07-01

    Ascorbic acid (AA) is synthesized in plant mitochondria through the oxidation of l-galactono-1,4-lactone (l-GalL) and then distributed to different cell compartments. AA-deficient Arabidopsis thaliana mutants (vtc2) and exogenous applications of l-GalL were used to generate plants with different AA content in their leaves. This experimental approach allows determining specific AA-dependent effects on carbon metabolism. No differences in O2 uptake, malic and citric acid and NADH content suggest that AA synthesis or accumulation did not affect mitochondrial activity; however, l-GalL treatment increased CO2 assimilation and photosynthetic electron transport rate in vtc2 (but not wt) leaves demonstrating a stimulation of photosynthesis after l-GalL treatment. Increased CO2 assimilation correlated with increased leaf stomatal conductance observed in l-GalL-treated vtc2 plants.

  2. Electrocarboxylation: towards sustainable and efficient synthesis of valuable carboxylic acids

    PubMed Central

    Matthessen, Roman; Fransaer, Jan; Binnemans, Koen

    2014-01-01

    Summary The near-unlimited availability of CO2 has stimulated a growing research effort in creating value-added products from this greenhouse gas. This paper presents the trends on the most important methods used in the electrochemical synthesis of carboxylic acids from carbon dioxide. An overview is given of different substrate groups which form carboxylic acids upon CO2 fixation, including mechanistic considerations. While most work focuses on the electrocarboxylation of substrates with sacrificial anodes, this review considers the possibilities and challenges of implementing other synthetic methodologies. In view of potential industrial application, the choice of reactor setup, electrode type and reaction pathway has a large influence on the sustainability and efficiency of the process. PMID:25383120

  3. Synthesis of acetylene-substituted probes with benzene-phosphate backbones for RNA labeling.

    PubMed

    Kitamura, Yoshiaki; Ueno, Yoshihito; Kitade, Yukio

    2014-06-24

    Conversion of dimethyl 5-aminoisophthalate into the iodoarene via the corresponding diazonium intermediate, followed by Sonogashira coupling with trimethylsilylacetylene afford the alkynylarene, which is reduced with LiAlH4 to give 5-ethynyl-1,3-benzenedimethanol (B(E)). One hydroxyl group is protected with a 4,4'-dimethoxytrityl (DMTr) group and subsequently another hydroxyl group is phosphitylated to produce the phosphoramidite. The mono-DMTr compound is also modified to afford the corresponding succinate, which is then reacted with controlled pore glass (CPG) to provide the solid support. Either the phosphoramidite or the solid support is employed in solid-phase synthesis of RNA containing B(E). RNA oligomers bearing B(E) rapidly react with 4-fluorobenzylazide to produce the cycloaddition products in good to excellent yield.

  4. Synthesis and applications of selectively {sup 13}C-labeled RNA

    SciTech Connect

    SantaLucia, J. Jr.; Shen, L.X.; Lewis, H.; Cai, Z.; Tinoci, I. Jr.

    1994-12-01

    Spectral overlap is a substantial problem in NMR studies of RNA molecules >30 nucleotides. To overcome this difficulty, we synthesized selectively {sup 13}C-labeled RNAs and adapted several isotope-edited two- and three-dimensional NMR experiments originally developed for protein studies. We optimized protocols for synthesis of multi-gram quantities of CTP, UTp, ATP, and GTP using a combination of synthetic organic and enzymatic methods. Uracil is prepared in 40 to 50% yield from {sup 13}C-cyanide in two steps. Using acetyl- tribenzoyl-ribose and standard chemistry uracil is then attached to the sugar (90% yield). The tribenzoyl-uridine intermediate is converted into uridine or cytidine quantitatively, depending on the deblocking protocol. Labeled purines are synthesized using simple pyrimidine precursors and reacting with {sup 13}C-formic acid (80% yield). Purine nucleosides are then synthesized using uridine phosphorylase and purine nucleoside phosphorylase. The nucleosides were converted to NMPs by treatment with POC1{sub 3} in triethylphosphate. We converted NMPs to NTPs by standard enzymatic methods. Selectively labeled RNAs were synthesized by run-off transcription using {sup 13}C-labeled NTPs. Several different strategies help solve over-lap problems in larger RNAs. Isotope-edited two-dimensional NMR experiments such as {omega}1-1/2 X-filtered NOESY simplify NMR spectra by dividing the normal NOESY spectrum into two subspectra-one involving NOEs from protons bound to {sup 12}C and one from protons bound to {sup 13}C. For example, we labeled A and U residues of a 34-nucleotide pseudoknot, and the {sup 12}C subspectrum of the 1/2 X-filtered NOESY contained NOEs only from G and C residues (along with adenine 2H); the {sup 13}C subspectrum contained NOEs only from A and U residues. Each subspectrum has less overlap than the NOESY of an unlabeled sample; the editing strategy allows each resonance to be identified by residue type (A, C, G, or U).

  5. Alternative pathways for editing non-cognate amino acids by aminoacyl-tRNA synthetases.

    PubMed Central

    Jakubowski, H; Fersht, A R

    1981-01-01

    Evidence is presented that the editing mechanisms of aminoacyl-tRNA synthetase operate by two alternative pathways: pre-transfer, by hydrolysis of the non-cognate aminoacyl adenylate; post-transfer, by hydrolysis of the mischarged tRNA. The methionyl-tRNA synthetases from Escherichia coli and Bacillus stearothermophilus and isoleucyl-tRNA synthetase from E. coli, for example, are shown to reject misactivated homocysteine rapidly by the pre-transfer route. A novel feature of this reaction is that homocysteine thiolactone is formed by the facile cyclisation of the homocysteinyl adenylate. Valyl-tRNA synthetases, on the other hand, reject the more readily activated non-cognate amino acids by primarily the post-transfer route. The features governing the choice of pathway are discussed. PMID:7024910

  6. Significance of mineral salts in prebiotic RNA synthesis catalyzed by montmorillonite.

    PubMed

    Joshi, Prakash C; Aldersley, Michael F

    2013-06-01

    The montmorillonite-catalyzed reactions of the 5'-phosphorimidazolide of adenosine used as a model generated RNA type oligomers. These reactions were found to be dependent on the presence of mineral salts. Whereas montmorillonite (pH 7) produced only dimers and traces of trimer in water, addition of sodium chloride (0.1-2.0 M) enhanced the chain length of oligomers to 10-mers as detected by HPLC. Maximum catalytic activity was observed with sodium chloride at a concentration between 0.8 and 1.2 M. This concentration of sodium chloride resembled its abundance in the ancient oceans (0.9-1.2 M). Magnesium chloride produced a similar effect but its joint action with sodium chloride did not produce any difference in the oligomer chain length. Therefore, Mg(2+) was not deemed necessary for generating longer oligomers. The effect of monovalent cations upon RNA chain length was: Li(+) > Na(+) > K(+). A similar effect was observed with the anions with enhanced oligomer length in the following order: Cl(-) > Br(-) > I(-). Thus, the smaller ions facilitated the formation of the longest oligomers. Inorganic salts that tend to salt out organic compounds from water and salts which show salt-in effects had no influence on the oligomerization process indicating that the montmorillonite-catalyzed RNA synthesis is not affected by either of these hydrophobic or hydrophilic interactions. A 2.3-fold decrease in the yield of cyclic dimer was observed upon increasing the sodium chloride concentration from 0.2 to 2.0 M. Inhibition of cyclic dimer formation is vital for increasing the yield of linear dimers and longer oligomers. In summary, sodium chloride is likely to have played an essential role in any clay mineral-catalyzed prebiotic RNA synthesis.

  7. Synthesis of 6-phosphofructose aspartic acid and some related Amadori compounds.

    PubMed

    Hansen, Alexandar L; Behrman, Edward J

    2016-08-05

    We describe the synthesis and characterization of 6-phosphofructose-aspartic acid, an intermediate in the metabolism of fructose-asparagine by Salmonella. We also report improved syntheses of fructose-asparagine itself and of fructose-aspartic acid.

  8. Synthesis and characterization of acetic acid and ethanoic acid (based)-maleimide

    NASA Astrophysics Data System (ADS)

    Poad, Siti Nashwa Mohd; Hassan, Nurul Izzaty; Hassan, Nur Hasyareeda

    2016-11-01

    A new route to the synthesis of maleimide is described. 2-(2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)acetic acid maleimide (1) and 2-(4-(2,5-Dioxo-2,5-dihydro- 1H-pyrrol-1-yl)phenyl)ethanoic acid maleimide (2) have been synthesized by the reaction of maleic anhydride with glycine and 4-aminophenyl acetic aicd. Maleimide (1) was synthesized by conventional technique while maleimide (2) was synthesized by microwave method. The compounds were characterized using FT-Infrared (FT-IR), 1H and 13C Nuclear Magnetic Resonance (NMR) spectroscopies and Mass Spectrometry.

  9. Sequence selective recognition of double-stranded RNA using triple helix-forming peptide nucleic acids.

    PubMed

    Zengeya, Thomas; Gupta, Pankaj; Rozners, Eriks

    2014-01-01

    Noncoding RNAs are attractive targets for molecular recognition because of the central role they play in gene expression. Since most noncoding RNAs are in a double-helical conformation, recognition of such structures is a formidable problem. Herein, we describe a method for sequence-selective recognition of biologically relevant double-helical RNA (illustrated on ribosomal A-site RNA) using peptide nucleic acids (PNA) that form a triple helix in the major grove of RNA under physiologically relevant conditions. Protocols for PNA preparation and binding studies using isothermal titration calorimetry are described in detail.

  10. Alternative kynurenic acid synthesis routes studied in the rat cerebellum

    PubMed Central

    Blanco Ayala, Tonali; Lugo Huitrón, Rafael; Carmona Aparicio, Liliana; Ramírez Ortega, Daniela; González Esquivel, Dinora; Pedraza Chaverrí, José; Pérez de la Cruz, Gonzalo; Ríos, Camilo; Schwarcz, Robert; Pérez de la Cruz, Verónica

    2015-01-01

    Kynurenic acid (KYNA), an astrocyte-derived, endogenous antagonist of α7 nicotinic acetylcholine and excitatory amino acid receptors, regulates glutamatergic, GABAergic, cholinergic and dopaminergic neurotransmission in several regions of the rodent brain. Synthesis of KYNA in the brain and elsewhere is generally attributed to the enzymatic conversion of L-kynurenine (L-KYN) by kynurenine aminotransferases (KATs). However, alternative routes, including KYNA formation from D-kynurenine (D-KYN) by D-amino acid oxidase (DAAO) and the direct transformation of kynurenine to KYNA by reactive oxygen species (ROS), have been demonstrated in the rat brain. Using the rat cerebellum, a region of low KAT activity and high DAAO activity, the present experiments were designed to examine KYNA production from L-KYN or D-KYN by KAT and DAAO, respectively, and to investigate the effect of ROS on KYNA synthesis. In chemical combinatorial systems, both L-KYN and D-KYN interacted directly with peroxynitrite (ONOO−) and hydroxyl radicals (OH•), resulting in the formation of KYNA. In tissue homogenates, the non-specific KAT inhibitor aminooxyacetic acid (AOAA; 1 mM) reduced KYNA production from L-KYN and D-KYN by 85.1 ± 1.7% and 27.1 ± 4.5%, respectively. Addition of DAAO inhibitors (benzoic acid, kojic acid or 3-methylpyrazole-5-carboxylic acid; 5 μM each) attenuated KYNA formation from L-KYN and D-KYN by ~35% and ~66%, respectively. ONOO− (25 μM) potentiated KYNA production from both L-KYN and D-KYN, and these effects were reduced by DAAO inhibition. AOAA attenuated KYNA production from L-KYN + ONOO− but not from D-KYN + ONOO−. In vivo, extracellular KYNA levels increased rapidly after perfusion of ONOO− and, more prominently, after subsequent perfusion with L-KYN or D-KYN (100 μM). Taken together, these results suggest that different mechanisms are involved in KYNA production in the rat cerebellum, and that, specifically, DAAO and ROS can function as alternative

  11. A functional heat shock protein 90 chaperone is essential for efficient flock house virus RNA polymerase synthesis in Drosophila cells.

    PubMed

    Castorena, Kathryn M; Weeks, Spencer A; Stapleford, Kenneth A; Cadwallader, Amy M; Miller, David J

    2007-08-01

    The molecular chaperone heat shock protein 90 (Hsp90) is involved in multiple cellular processes including protein maturation, complex assembly and disassembly, and intracellular transport. We have recently shown that a disruption of Hsp90 activity in cultured Drosophila melanogaster cells suppresses Flock House virus (FHV) replication and the accumulation of protein A, the FHV RNA-dependent RNA polymerase. In the present study, we investigated whether the defect in FHV RNA polymerase accumulation induced by Hsp90 suppression was secondary to an effect on protein A synthesis, degradation, or intracellular membrane association. Treatment with the Hsp90-specific inhibitor geldanamycin selectively reduced FHV RNA polymerase synthesis by 80% in Drosophila S2 cells stably transfected with an inducible protein A expression plasmid. The suppressive effect of geldanamycin on protein A synthesis was not attenuated by proteasome inhibition, nor was it sensitive to changes in either the mRNA untranslated regions or protein A intracellular membrane localization. Furthermore, geldanamycin did not promote premature protein A degradation, nor did it alter the extremely rapid kinetics of protein A membrane association. These results identify a novel role for Hsp90 in facilitating viral RNA polymerase synthesis in Drosophila cells and suggest that FHV subverts normal cellular pathways to assemble functional replication complexes.

  12. Methyldeficient mammalian 4S RNA: evidence for L-ethionine-induced inhibition of N6-dimethyladenosine synthesis in rat liver tRNA

    PubMed Central

    Wildenauer, Dieter; Gross, Hans J.

    1974-01-01

    The nucleotide composition of 4s RNA from livers of rats fed with a diet containing 0.3% D-ethionine was found to be identical with that from untreated animals. In contrast, one single modified nucleotide was absent in 4s RNA from livers of rats fed with a 0.3% L-ethionine diet. The minor nucleo=tide was also absent in liver 4s RNA from rats fed with a 0.3% L-ethionine diet followed by ten days of normal food. It was identified after dephosphorylation by ultraviolet absorption spectra, cochromatography with authentic material and mass spectra as N6-dimethyladenosine. It is concluded that S-adenosylethionine, the primary product of L-ethionine in the liver, causes strong and selective inhibition of the specific RNA-methylase responsible for adenosine to N6-dimethyl=adenosine methylation in rat liver 4s RNA. Compared to the strong inhibition of N6-dimethyladenosine formation described here, L-ethionine-dependent ethylation of liver 4s RNA is far less efficient. The quantitation of l-methyladenosine, ribothymidine and 3′-terminal adenosine in this 4s RNA as well as its aminoacid acceptor activity is typical for tRNA; hence it may be concluded that N6-dimethyladenosine is a component of rat liver tRNA. This may demonstrate the first evidence for the existence of specifically methyl-deficient mammalian tRNA. A possible correlation between the activity of L-ethionine as a liver carcinogen and its ability to induce the formation of methyl-deficient tRNA by selectively inhibiting the synthesis of N6-dimethyladenosine on the tRNA level in the same organ is discussed. PMID:4414662

  13. Efficient transfer of information from hexitol nucleic acids to RNA during nonenzymatic oligomerization

    NASA Technical Reports Server (NTRS)

    Kozlov, I. A.; De Bouvere, B.; Van Aerschot, A.; Herdewijn, P.; Orgel, L. E.

    1999-01-01

    Hexitol nucleic acids (HNAs) are DNA analogues that contain the standard nucleoside bases attached to a phosphorylated 1,5-anhydrohexitol backbone. We find that HNAs support efficient information transfer in nonensymatic template-directed reactions. HNA heterosequences appeared to be superior to the corresponding DNA heterosequences in facilitating synthesis of complementary oligonucleotides from nucleoside-5'-phosphoro-2-methyl imidazolides.

  14. Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway

    PubMed Central

    Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z.; Yazdani, Syed Shams

    2016-01-01

    Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817

  15. recA gene product is responsible for inhibition of deoxyribonucleic acid synthesis after ultraviolet irradiation.

    PubMed Central

    Trgovcević, Z; Petranović, D; Petranović, M; Salaj-Smic, E

    1980-01-01

    Deoxyribonucleic acid synthesis after ultraviolet irradiation was studied in wild-type, uvrA, recB, recA recB, and recA Escherichia coli strains. Inhibition of deoxyribonucleic acid synthesis, which occurs almost immediately after exposing the cells to ultraviolet radiation, depends on the functional gene recA. PMID:6997276

  16. Quantitative rRNA-targeted solution-based hybridization assay using peptide nucleic acid molecular beacons.

    PubMed

    Li, Xu; Morgenroth, Eberhard; Raskin, Lutgarde

    2008-12-01

    The potential of a solution-based hybridization assay using peptide nucleic acid (PNA) molecular beacon (MB) probes to quantify 16S rRNA of specific populations in RNA extracts of environmental samples was evaluated by designing PNA MB probes for the genera Dechloromonas and Dechlorosoma. In a kinetic study with 16S rRNA from pure cultures, the hybridization of PNA MB to target 16S rRNA exhibited a higher final hybridization signal and a lower apparent rate constant than the hybridizations to nontarget 16S rRNAs. A concentration of 10 mM NaCl in the hybridization buffer was found to be optimal for maximizing the difference between final hybridization signals from target and nontarget 16S rRNAs. Hybridization temperatures and formamide concentrations in hybridization buffers were optimized to minimize signals from hybridizations of PNA MB to nontarget 16S rRNAs. The detection limit of the PNA MB hybridization assay was determined to be 1.6 nM of 16S rRNA. To establish proof for the application of PNA MB hybridization assays in complex systems, target 16S rRNA from Dechlorosoma suillum was spiked at different levels to RNA isolated from an environmental (bioreactor) sample, and the PNA MB assay enabled effective quantification of the D. suillum RNA in this complex mixture. For another environmental sample, the quantitative results from the PNA MB hybridization assay were compared with those from clone libraries.

  17. NUCLEOLAR AND NUCLEAR RNA SYNTHESIS DURING THE CELL LIFE CYCLE IN MONKEY AND PIG KIDNEY CELLS IN VITRO

    PubMed Central

    Showacre, Jane L.; Cooper, W. G.; Prescott, D. M.

    1967-01-01

    The incorporation of 5-3H-uridine and 5-3H-cytidine into nucleolar and nonnucleolar RNA in the nucleus of monkey and pig kidney cells was measured in vitro during the cell life cycle. Time-lapse cinematographic records were made of cells during asynchronous exponential proliferation, in order to identify the temporal position of individual cells in relation to the preceding mitosis. Immediately following cinematography, cells were labeled with uridine-3H and cytidine-3H for a short period, fixed, and analyzed by radioautography. Since the data permit correlation of the rate of RNA labeling with the position of a cell within the cycle, curves could be constructed describing the rate of RNA synthesis over the average cell cycle. RNA synthesis was absent in early telophase, and rose very abruptly in rate in late telophase and in very early G1 in both the nucleus and the reconstituting nucleolus. Thereafter, through the G1 and S periods the rate of nuclear RNA synthesis rose gradually. When we used a 10-min pulse, there was no detectable change in the rate for nucleolar RNA labeling in monkey kidney cells during G1 or S. When we used a 30-min labeling time, the rate of nucleolar RNA labeling rose gradually in pig kidney cells. With increasing time after mitosis, the data became more variable, which may, in part, be related to the variation in generation times for individual cells. PMID:6039371

  18. Targeting of arenavirus RNA synthesis by a carboxamide-derivatized aromatic disulfide with virucidal activity.

    PubMed

    Sepúlveda, Claudia S; García, Cybele C; Levingston Macleod, Jesica M; López, Nora; Damonte, Elsa B

    2013-01-01

    Several arenaviruses can cause severe hemorrhagic fever (HF) in humans, representing a public health threat in endemic areas of Africa and South America. The present study characterizes the potent virucidal activity of the carboxamide-derivatized aromatic disulfide NSC4492, an antiretroviral zinc finger-reactive compound, against Junín virus (JUNV), the causative agent of Argentine HF. The compound was able to inactivate JUNV in a time and temperature-dependent manner, producing more than 99 % reduction in virus titer upon incubation with virions at 37 °C for 90 min. The ability of NSC4492-treated JUNV to go through different steps of the multiplication cycle was then evaluated. Inactivated virions were able to bind and enter into the host cell with similar efficiency as control infectious particles. In contrast, treatment with NSC4492 impaired the capacity of JUNV to drive viral RNA synthesis, as measured by quantitative RT-PCR, and blocked viral protein expression, as determined by indirect immunofluorescence. These results suggest that the disulfide NSC4492 targets on the arenavirus replication complex leading to impairment in viral RNA synthesis. Additionally, analysis of VLP produced in NSC4492-treated cells expressing JUNV matrix Z protein revealed that the compound may interact with Z resulting in an altered aggregation behavior of this protein, but without affecting its intrinsic self-budding properties. The potential perspectives of NSC4492 as an inactivating vaccinal compound for pathogenic arenaviruses are discussed.

  19. Targeting of Arenavirus RNA Synthesis by a Carboxamide-Derivatized Aromatic Disulfide with Virucidal Activity

    PubMed Central

    Sepúlveda, Claudia S.; García, Cybele C.; Levingston Macleod, Jesica M.

    2013-01-01

    Several arenaviruses can cause severe hemorrhagic fever (HF) in humans, representing a public health threat in endemic areas of Africa and South America. The present study characterizes the potent virucidal activity of the carboxamide-derivatized aromatic disulfide NSC4492, an antiretroviral zinc finger-reactive compound, against Junín virus (JUNV), the causative agent of Argentine HF. The compound was able to inactivate JUNV in a time and temperature-dependent manner, producing more than 99 % reduction in virus titer upon incubation with virions at 37°C for 90 min. The ability of NSC4492-treated JUNV to go through different steps of the multiplication cycle was then evaluated. Inactivated virions were able to bind and enter into the host cell with similar efficiency as control infectious particles. In contrast, treatment with NSC4492 impaired the capacity of JUNV to drive viral RNA synthesis, as measured by quantitative RT-PCR, and blocked viral protein expression, as determined by indirect immunofluorescence. These results suggest that the disulfide NSC4492 targets on the arenavirus replication complex leading to impairment in viral RNA synthesis. Additionally, analysis of VLP produced in NSC4492-treated cells expressing JUNV matrix Z protein revealed that the compound may interact with Z resulting in an altered aggregation behavior of this protein, but without affecting its intrinsic self-budding properties. The potential perspectives of NSC4492 as an inactivating vaccinal compound for pathogenic arenaviruses are discussed. PMID:24278404

  20. Cdk7 mediates RPB1-driven mRNA synthesis in Toxoplasma gondii

    PubMed Central

    Deshmukh, Abhijit S.; Mitra, Pallabi; Maruthi, Mulaka

    2016-01-01

    Cyclin-dependent kinase 7 in conjunction with CyclinH and Mat1 activates cell cycle CDKs and is a part of the general transcription factor TFIIH. Role of Cdk7 is well characterized in model eukaryotes however its relevance in protozoan parasites has not been investigated. This important regulator of key processes warrants closer examination particularly in this parasite given its unique cell cycle progression and flexible mode of replication. We report functional characterization of TgCdk7 and its partners TgCyclinH and TgMat1. Recombinant Cdk7 displays kinase activity upon binding its cyclin partner and this activity is further enhanced in presence of Mat1. The activated kinase phosphorylates C-terminal domain of TgRPB1 suggesting its role in parasite transcription. Therefore, the function of Cdk7 in CTD phosphorylation and RPB1 mediated transcription was investigated using Cdk7 inhibitor. Unphosphorylated CTD binds promoter DNA while phosphorylation by Cdk7 triggers its dissociation from DNA with implications for transcription initiation. Inhibition of Cdk7 in the parasite led to strong reduction in Serine 5 phosphorylation of TgRPB1-CTD at the promoters of constitutively expressed actin1 and sag1 genes with concomitant reduction of both nascent RNA synthesis and 5′-capped transcripts. Therefore, we provide compelling evidence for crucial role of TgCdk7 kinase activity in mRNA synthesis. PMID:27759017

  1. The Predicted Metal-Binding Region of the Arterivirus Helicase Protein Is Involved in Subgenomic mRNA Synthesis, Genome Replication, and Virion Biogenesis

    PubMed Central

    van Dinten, Leonie C.; van Tol, Hans; Gorbalenya, Alexander E.; Snijder, Eric J.

    2000-01-01

    Equine arteritis virus (EAV), the prototype Arterivirus, is a positive-stranded RNA virus that expresses its replicase in the form of two large polyproteins of 1,727 and 3,175 amino acids. The functional replicase subunits (nonstructural proteins), which drive EAV genome replication and subgenomic mRNA transcription, are generated by extensive proteolytic processing. Subgenomic mRNA transcription involves an unusual discontinuous step and generates the mRNAs for structural protein expression. Previously, the phenotype of mutant EAV030F, which carries a single replicase point mutation (Ser-2429→Pro), had implicated the nsp10 replicase subunit (51 kDa) in viral RNA synthesis, and in particular in subgenomic mRNA transcription. nsp10 contains an N-terminal (putative) metal-binding domain (MBD), located just upstream of the Ser-2429→Pro mutation, and a helicase activity in its C-terminal part. We have now analyzed the N-terminal domain of nsp10 in considerable detail. A total of 38 mutants, most of them carrying specific single point mutations, were tested in the context of an EAV infectious cDNA clone. Variable effects on viral genome replication and subgenomic mRNA transcription were observed. In general, our results indicated that the MBD region, and in particular a set of 13 conserved Cys and His residues that are assumed to be involved in zinc binding, is essential for viral RNA synthesis. On the basis of these data and comparative sequence analyses, we postulate that the MBD may employ a rather unusual mode of zinc binding that could result in the association of up to four zinc cations with this domain. The region containing residue Ser-2429 may play the role of “hinge spacer,” which connects the MBD to the rest of nsp10. Several mutations in this region specifically affected subgenomic mRNA synthesis. Furthermore, one of the MBD mutants was replication and transcription competent but did not produce infectious progeny virus. This suggests that nsp10 is

  2. Induction of fatty acid synthesis by pravastatin sodium in rat liver and primary hepatocytes.

    PubMed

    Fujioka, T; Tsujita, Y; Shimotsu, H

    1997-06-11

    We examined the effect of pravastatin sodium (pravastatin), a 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase inhibitor, on fatty acid synthesis in rat liver. The repeated administration of pravastatin to rats at 250 mg/kg for 7 days led to a 2.8-fold increase in fatty acid synthesis in the liver. The diurnal change of fatty acid synthesis was not affected by the treatment. Hepatic fatty acid synthase activity was increased 3.2-fold, while acetyl-CoA carboxylase activity was not changed by the repeated administration of pravastatin. In rat hepatocytes, the incubation with 2 microg/ml pravastatin for 24 h increased fatty acid synthase activity 1.5-fold, as well as HMG-CoA reductase activity 2.8-fold. These results suggest that HMG-CoA reductase inhibitors might increase fatty acid synthesis in vivo through the induction of hepatic fatty acid synthase.

  3. Retinoic acid-related orphan receptor α regulates diurnal rhythm and fasting induction of sterol 12α-hydroxylase in bile acid synthesis.

    PubMed

    Pathak, Preeti; Li, Tiangang; Chiang, John Y L

    2013-12-27

    Sterol 12α-hydroxylase (CYP8B1) is required for cholic acid synthesis and plays a critical role in intestinal cholesterol absorption and pathogenesis of cholesterol gallstone, dyslipidemia, and diabetes. In this study we investigated the underlying mechanism of fasting induction and circadian rhythm of CYP8B1 by a cholesterol-activated nuclear receptor and core clock gene retinoic acid-related orphan receptor α (RORα). Fasting stimulated, whereas restricted-feeding reduced expression of CYP8B1 mRNA and protein. However, fasting and feeding had little effect on the diurnal rhythm of RORα mRNA expression, but fasting increased RORα protein levels by cAMP-activated protein kinase A-mediated phosphorylation and stabilization of the protein. Adenovirus-mediated gene transduction of RORα to mice strongly induced CYP8B1 expression, and increased liver cholesterol and 12α-hydroxylated bile acids in the bile acid pool and serum. A reporter assay identified a functional RORα response element in the CYP8B1 promoter. RORα recruited cAMP response element-binding protein-binding protein (CBP) to stimulate histone acetylation on the CYP8B1 gene promoter. In conclusion, RORα is a key regulator of diurnal rhythm and fasting induction of CYP8B1, which regulates bile acid composition and serum and liver cholesterol levels. Antagonizing RORα activity may be a therapeutic strategy for treating inflammatory diseases such as non-alcoholic fatty liver disease and type 2 diabetes.

  4. Effects of Saturated Long-chain Fatty Acid on mRNA Expression of Genes Associated with Milk Fat and Protein Biosynthesis in Bovine Mammary Epithelial Cells.

    PubMed

    Qi, Lizhi; Yan, Sumei; Sheng, Ran; Zhao, Yanli; Guo, Xiaoyu

    2014-03-01

    This study was conducted to determine the effects of saturated long-chain fatty acids (LCFA) on cell proliferation and triacylglycerol (TAG) content, as well as mRNA expression of αs1-casein (CSN1S1) and genes associated with lipid and protein synthesis in bovine mammary epithelial cells (BMECs). Primary cells were isolated from the mammary glands of Holstein dairy cows, and were passaged twice. Then cells were cultured with different levels of palmitate or stearate (0, 200, 300, 400, 500, and 600 μM) for 48 h and fetal bovine serum in the culture solution was replaced with fatty acid-free BSA (1 g/L). The results showed that cell proliferation tended to be increased quadratically with increasing addition of stearate. Treatments with palmitate or stearate induced an increase in TAG contents at 0 to 600 μM in a concentration-dependent manner, and the addition of 600 μM was less effective in improving TAG accumulation. The expression of acetyl-coenzyme A carboxylase alpha, fatty acid synthase and fatty acid-binding protein 3 was inhibited when palmitate or stearate were added in culture medium, whereas cluster of differentiation 36 and CSN1S1 mRNA abundance was increased in a concentration-dependent manner. The mRNA expressions of peroxisome proliferator-activated receptor gamma, mammalian target of rapamycin and signal transducer and activator of transcription 5 with palmitate or stearate had no significant differences relative to the control. These results implied that certain concentrations of saturated LCFA could stimulate cell proliferation and the accumulation of TAG, whereas a reduction may occur with the addition of an overdose of saturated LCFA. Saturated LCFA could up-regulate CSN1S1 mRNA abundance, but further studies are necessary to elucidate the mechanism for regulating milk fat and protein synthesis.

  5. Synthesis of acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters

    DOEpatents

    Moens, Luc

    2003-06-24

    A process of preparing an acid addition salt of delta-aminolevulinc acid comprising: a) dissolving a lower alkyl 5-bromolevulinate and hexamethylenetetramine in a solvent selected from the group consisting of water, ethyl acetate, chloroform, acetone, ethanol, tetrahydrofuran and acetonitrile, to form a quaternary ammonium salt of the lower alkyl 5-bromolevulinate; and b) hydrolyzing the quaternary ammonium salt with an inorganic acid to form an acid addition salt of delta-aminolevulinic acid.

  6. The predictive power of synthetic nucleic acid technologies in RNA biology.

    PubMed

    Chakraborty, Saikat; Mehtab, Shabana; Krishnan, Yamuna

    2014-06-17

    CONSPECTUS: The impact of nucleic acid nanotechnology in terms of transforming motifs from biology in synthetic and translational ways is widely appreciated. But it is also emerging that the thinking and vision behind nucleic acids as construction material has broader implications, not just in nanotechnology or even synthetic biology, but can feed back into our understanding of biology itself. Physicists have treated nucleic acids as polymers and connected physical principles to biology by abstracting out the molecular interactions. In contrast, biologists delineate molecular players and pathways related to nucleic acids and how they may be networked. But in vitro nucleic acid nanotechnology has provided a valuable framework for nucleic acids by connecting its biomolecular interactions with its materials properties and thereby superarchitecture ultramanipulation that on multiple occasions has pre-empted the elucidation of how living cells themselves are exploiting these same structural concepts. This Account seeks to showcase the larger implications of certain architectural principles that have arisen from the field of structural DNA/RNA nanotechnology in biology. Here we draw connections between these principles and particular molecular phenomena within living systems that have fed in to our understanding of how the cell uses nucleic acids as construction material to achieve different functions. We illustrate this by considering a few exciting and emerging examples in biology in the context of both switchable systems and scaffolding type systems. Due to the scope of this Account, we will focus our discussion on examples of the RNA scaffold as summarized. In the context of switchable RNA architectures, the synthetic demonstration of small molecules blocking RNA translation preceded the discovery of riboswitches. In another example, it was after the description of aptazymes that the first allosteric ribozyme, glmS, was discovered. In the context of RNA architectures

  7. Indole diterpene synthetic studies. Total synthesis of (+)-nodulisporic acid F and construction of the heptacyclic cores of (+)-nodulisporic acids A and B and (-)-nodulisporic acid D.

    PubMed

    Smith, Amos B; Davulcu, Akin H; Cho, Young Shin; Ohmoto, Kazuyuki; Kürti, László; Ishiyama, Haruaki

    2007-06-22

    A first-generation strategy for construction of (+)-nodulisporic acids A (1) and B (2) is described. The strategy entails union of the eastern and western hemisphere subtargets via the indole synthesis protocol developed in our laboratory. Subsequent elaboration of rings E and F, however, revealed the considerable acid instability of the C(24) hydroxyl, thereby preventing further advancement. Nonetheless, preparation of the heptacyclic core of (+)-nodulisporic acids A and B, the total synthesis of (+)-nodulisporic acid F, the simplest member of the nodulisporic acid family, and elaboration of the heptacyclic core of (-)-nodulisporic acid D were achieved.

  8. Diversity of putative archaeal RNA viruses in metagenomic datasets of a yellowstone acidic hot spring.

    PubMed

    Wang, Hongming; Yu, Yongxin; Liu, Taigang; Pan, Yingjie; Yan, Shuling; Wang, Yongjie

    2015-01-01

    Two genomic fragments (5,662 and 1,269 nt in size, GenBank accession no. JQ756122 and JQ756123, respectively) of novel, positive-strand RNA viruses that infect archaea were first discovered in an acidic hot spring in Yellowstone National Park (Bolduc et al., 2012). To investigate the diversity of these newly identified putative archaeal RNA viruses, global metagenomic datasets were searched for sequences that were significantly similar to those of the viruses. A total of 3,757 associated reads were retrieved solely from the Yellowstone datasets and were used to assemble the genomes of the putative archaeal RNA viruses. Nine contigs with lengths ranging from 417 to 5,866 nt were obtained, 4 of which were longer than 2,200 nt; one contig was 204 nt longer than JQ756122, representing the longest genomic sequence of the putative archaeal RNA viruses. These contigs revealed more than 50% sequence similarity to JQ756122 or JQ756123 and may be partial or nearly complete genomes of novel genogroups or genotypes of the putative archaeal RNA viruses. Sequence and phylogenetic analyses indicated that the archaeal RNA viruses are genetically diverse, with at least 3 related viral lineages in the Yellowstone acidic hot spring environment.

  9. Iodide-catalyzed reductions: development of a synthesis of phenylacetic acids.

    PubMed

    Milne, Jacqueline E; Storz, Thomas; Colyer, John T; Thiel, Oliver R; Dilmeghani Seran, Mina; Larsen, Robert D; Murry, Jerry A

    2011-11-18

    A new convenient and scalable synthesis of phenylacetic acids has been developed via the iodide catalyzed reduction of mandelic acids. The procedure relies on in situ generation of hydroiodic acid from catalytic sodium iodide, employing phosphorus acid as the stoichiometric reductant.

  10. [Protein and RNA synthesis in larvae of the yellow mealworm beetle (Tenebrio molitor) during cooling and cold acclimatization].

    PubMed

    Gulevskiĭ, A K; Riazantsev, V V; Grishchenkova, E A; Relina, L I

    1996-01-01

    Functioning of protein-synthesis system freeze-avoiding larvae of Tenebrio molitor. (Tenebrinidae family) has been investigated at temperature lowering to 6-8 degrees. It has been shown that mealworms maintain the protein and RNA biosynthesis under cold acclimation (6-8 degrees C). Judging by the angle of inclination of Arrenius of plot reorganization of protein synthesis system takes place in the temperature range 0-10 degrees C. Biosynthesis of proteins at the room and low temperatures is inhibited by cycloheximide while biosynthesis of RNA--by alpha-amanitine.

  11. Natural and artificial binders of polyriboadenylic acid and their effect on RNA structure

    PubMed Central

    Musumeci, Domenica; Roviello, Valentina; Pirtskhalava, Marina; Egoyan, Alexander; Mirtskhulava, Merab

    2015-01-01

    Summary The employment of molecular tools with nucleic acid binding ability to specifically control crucial cellular functions represents an important scientific area at the border between biochemistry and pharmaceutical chemistry. In this review we describe several molecular systems of natural or artificial origin, which are able to bind polyriboadenylic acid (poly(rA)) both in its single-stranded or structured forms. Due to the fundamental role played by the poly(rA) tail in the maturation and stability of mRNA, as well as in the initiation of the translation process, compounds able to bind this RNA tract, influencing the mRNA fate, are of special interest for developing innovative biomedical strategies mainly in the field of anticancer therapy. PMID:26199837

  12. Hyaluronic acid synthesis is required for zebrafish tail fin regeneration

    PubMed Central

    Ouyang, Xiaohu; Panetta, Nicholas J.; Talbott, Maya D.; Payumo, Alexander Y.; Halluin, Caroline; Longaker, Michael T.

    2017-01-01

    Using genome-wide transcriptional profiling and whole-mount expression analyses of zebrafish larvae, we have identified hyaluronan synthase 3 (has3) as an upregulated gene during caudal fin regeneration. has3 expression is induced in the wound epithelium within hours after tail amputation, and its onset and maintenance requires fibroblast growth factor, phosphoinositide 3-kinase, and transforming growth factor-ß signaling. Inhibition of hyaluronic acid (HA) synthesis by the small molecule 4-methylumbelliferone (4-MU) impairs tail regeneration in zebrafish larvae by preventing injury-induced cell proliferation. In addition, 4-MU reduces the expression of genes associated with wound epithelium and blastema function. Treatment with glycogen synthase kinase 3 inhibitors rescues 4-MU-induced defects in cell proliferation and tail regeneration, while restoring a subset of wound epithelium and blastema markers. Our findings demonstrate a role for HA biosynthesis in zebrafish tail regeneration and delineate its epistatic relationships with other regenerative processes. PMID:28207787

  13. Total Synthesis of Five Lipoteichoic acids of Clostridium difficile.

    PubMed

    Hogendorf, Wouter F J; Gisch, Nicolas; Schwudke, Dominik; Heine, Holger; Bols, Mikael; Pedersen, Christian Marcus

    2014-10-13

    The emergence of hypervirulent resistant strains have made Clostridium difficile a notorious nosocomial pathogen and has resulted in a renewed interest in preventive strategies, such as vaccines based on (synthetic) cell wall antigens. Recently, the structure of the lipoteichoic acid (LTA) of this species has been elucidated. Additionally, this LTA was found to induce the formation of protective antibodies against C. difficile in rabbits and mice. The LTA from C. difficile is isolated as a microheterogenous mixture, differing in size and composition, impeding any structure-activity relationship studies. To ensure reliable biological results, pure and well-defined synthetic samples are required. In this work the total synthesis of LTAs from C. difficile with defined chain length is described and the initial biological results are presented.

  14. Synthesis and characterization of 2-mercaptoethanesulfonic acid albumin.

    PubMed

    Bauer, H H; Ehmig, S; Engels, J W; Voelcker, G

    1998-06-01

    Autoimmune patients treated with ifosfamide (CAS 3778-73-2) and mesna (2-mercaptoethanesulfonic acid, CAS 3375-50-6) in some cases suffered from severe allergic reactions that were proposed to be due to mesna linked to serum albumin by a disulfide bond. To prove the existence of the hypothetic mesna albumin adduct in vivo it was synthesized: The free thiol group of albumin (molecular mass determined by MALDI spectroscopy: 67009 Da) was converted to S-phenylsulfonyl albumin and reacted with mesna to albumin mesna (molecular mass: 67159 Da). In an alternative synthesis albumin was incubated with mesna at pH 8, 40 degrees C (molecular mass of the adduct: 67166 Da).

  15. Comparison of nucleic acid targets prepared from total RNA or poly(A) RNA for DNA oligonucleotide microarray hybridization.

    PubMed

    Petersen, Kjell; Oyan, Anne Margrete; Rostad, Kari; Olsen, Sue; Bø, Trond Hellem; Salvesen, Helga B; Gjertsen, Bjørn Tore; Bruserud, Oystein; Halvorsen, Ole Johan; Akslen, Lars Andreas; Steen, Vidar M; Jonassen, Inge; Kalland, Karl-Henning

    2007-07-01

    The aim of this work was to compare DNA microarray results using either total RNA or affinity-purified poly(A) RNA from the same biological sample for target preparation. The high-density oligonucleotide microarrays of both Agilent Technologies (based on two-color detection) and Applied Biosystems (based on single-color detection) were evaluated. Real-time quantitative PCR was used to quantify messenger RNA (mRNA) and ribosomal RNA (rRNA) at different stages of target preparations. Poly(A) RNA versus total RNA target hybridizations exhibited slightly lower correlation coefficients than did self versus self hybridizations (i.e., poly(A) RNA targets vs. poly(A) RNA targets or total RNA targets vs. total RNA targets). Only a small fraction of all transcripts appeared to be significantly over- or underrepresented when total RNA targets or poly(A) RNA targets from the same biological sample were compared. Therefore, the conclusion is that poly(A) affinity purification from total RNA can be omitted during target preparation for routine mRNA expression analysis using high-density oligonucleotide microarrays. Among consistently overrepresented transcripts in total RNA targets were histone mRNAs known to lack poly(A) tails. Therefore, structurally exceptional RNA species can be identified by comparing targets derived from either poly(A) RNA or total RNA using microarray hybridization.

  16. Nucleic acid chaperons: a theory of an RNA-assisted protein folding

    PubMed Central

    Biro, Jan C

    2005-01-01

    Background Proteins are assumed to contain all the information necessary for unambiguous folding (Anfinsen's principle). However, ab initio structure prediction is often not successful because the amino acid sequence itself is not sufficient to guide between endless folding possibilities. It seems to be a logical to try to find the "missing" information in nucleic acids, in the redundant codon base. Results mRNA energy dot plots and protein residue contact maps were found to be rather similar. The structure of mRNA is also conserved if the protein structure is conserved, even if the sequence similarity is low. These observations led me to suppose that some similarity might exist between nucleic acid and protein folding. I found that amino acid pairs, which are co-located in the protein structure, are preferentially coded by complementary codons. This codon complementarity is not perfect; it is suboptimal where the 1st and 3rd codon residues are complementary to each other in reverse orientation, while the 2nd codon letters may be, but are not necessarily, complementary. Conclusion Partial complementary coding of co-locating amino acids in protein structures suggests that mRNA assists in protein folding and functions not only as a template but even as a chaperon during translation. This function explains the role of wobble bases and answers the mystery of why we have a redundant codon base. PMID:16137324

  17. Efficient ytterbium triflate catalyzed microwave-assisted synthesis of 3-acylacrylic acid building blocks.

    PubMed

    Tolstoluzhsky, Nikita V; Gorobets, Nikolay Yu; Kolos, Nadezhda N; Desenko, Sergey M

    2008-01-01

    The derivatives of 4-(hetero)aryl-4-oxobut-2-enoic acid are useful as building blocks in the synthesis of biologically active compounds. An efficient general protocol for the synthesis of these building blocks was developed. This method combines microwave assistance and ytterbium triflate catalyst and allows the fast preparation of the target acids starting from different (hetero)aromatic ketones and glyoxylic acid monohydrate giving pure products in 52-75% isolated yields.

  18. Enantiospecific Synthesis of a Genetically Encodable Fluorescent Unnatural Amino Acid L-3-(6-Acetylnaphthalen-2-ylamino)-2-aminopropanoic Acid

    PubMed Central

    Xiang, Zheng; Wang, Lei

    2011-01-01

    Fluorescent unnatural amino acids (Uaas), when genetically incorporated into proteins, can provide unique advantages for imaging biological processes in vivo. Synthesis of optically pure L-enantiomer of fluorescent Uaas is crucial for their effective application in live cells. An efficient six-step synthesis of L-3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (L-Anap), a genetically encodable and polarity-sensitive fluorescent Uaa, has been developed. The synthesis takes advantage of a high-yield and enantiospecific Fukuyama-Mitsunobu reaction as the key transformation. PMID:21732687

  19. Regulation of alpha-1 acid glycoprotein synthesis by porcine hepatocytes in monolayer culture.

    PubMed

    Caperna, T J; Shannon, A E; Stoll, M; Blomberg, L A; Ramsay, T G

    2015-07-01

    Alpha-1 acid glycoprotein (AGP, orosomucoid, ORM-1) is a highly glycosylated mammalian acute-phase protein, which is synthesized primarily in the liver and represents the major serum protein in newborn pigs. Recent data have suggested that the pig is unique in that AGP is a negative acute-phase protein in this species, and its circulating concentration appears to be associated with growth rate. The purpose of the present study was to investigate the regulation of AGP synthesis in hepatocytes prepared from suckling piglets and to provide a framework to compare its regulation with that of haptoglobin (HP), a positive acute-phase protein. Hepatocytes were isolated from preweaned piglets and maintained in serum-free monolayer culture for up to 72 h. The influences of hormones, cytokines, and redox modifiers on the expression and secretion of AGP and HP were determined by relative polymerase chain reaction and by measuring the concentration of each protein secreted into culture medium. The messenger RNA abundance and/or secretion of AGP protein was enhanced by interleukin (IL)-17a, IL-1, and resveratrol and inhibited by tumor necrosis factor-α (TNF), oncostatin M, and thyroid hormone (P < 0.05). HP expression and synthesis were upregulated by oncostatin M, IL-6, and dexamethasone and downregulated by TNF (P < 0.01). The overall messenger RNA expression at 24 h was in agreement with the secreted protein patterns confirming that control of these proteins in hepatocytes is largely transcriptional. Moreover, these data support the consideration that AGP is a negative acute-phase reactant and appears to be regulated by cytokines (with the exception of TNF) and hormones primarily in a manner opposite to that of the positive acute-phase protein, HP.

  20. Synthesis and photochromic property of nanosized amino acid polyoxometalate compounds

    NASA Astrophysics Data System (ADS)

    Sun, Dehui; Zhang, Jilin; Ren, Huijuan; Cui, Zhenfeng

    2009-07-01

    A series of novel nanosized amino acid-polyoxometalate compounds were successfully synthesized using a low temperature solid-state chemical reaction method. Their compositions, structures, morphologies, photochromic properties were characterized by ICP-AES/MS, TG/DTA, FTIR, XRD, SEM and UV-Vis diffuse reflectance spectra (DRS), respectively. The elemental analysis results showed that the compounds ((HThr)7PMo12O42•4H2O, (HTyr)7PMo12O42Â.5H2O, (HSer)7PMo12O42•5H2O and (HGlu)7PMo12O42•4H2O) were obtained. The analyses of the TG/DTA, XRD and FTIR confirmed that the four compounds are new phases different from the corresponding reactants and they are composed of the polyoxometalate anions and the corresponding protonated amino acids, respectively. Observation of the SEM revealed that the particle shape (e.g. (HThr)7PMo12O42Â.4H2O nanoplates, (HTyr)7PMo12O42•5H2O nanorods, (HSer)7PMo12O42•5H2O and (HGlu)7PMo12O42•4H2O nanoparticles) depended strongly on the structures of amino acids. This implied that the amino acids can play a structural template agent role in synthesis of the Silverton-type polyoxometalate compounds. After irradiated with ultraviolet light, these samples all exhibited photochromism. Their photochromic mechanism may be explained based on Yamase's photochromic model. These photochromic compounds could be applied to the field of photosensitive materials.

  1. Characterization of tRNA-dependent peptide bond formation by MurM in the synthesis of Streptococcus pneumoniae peptidoglycan.

    PubMed

    Lloyd, Adrian J; Gilbey, Andrea M; Blewett, Anne M; De Pascale, Gianfranco; El Zoeiby, Ahmed; Levesque, Roger C; Catherwood, Anita C; Tomasz, Alexander; Bugg, Timothy D H; Roper, David I; Dowson, Christopher G

    2008-03-07

    MurM is an aminoacyl ligase that adds l-serine or l-alanine as the first amino acid of a dipeptide branch to the stem peptide lysine of the pneumococcal peptidoglycan. MurM activity is essential for clinical pneumococcal penicillin resistance. Analysis of peptidoglycan from the highly penicillin-resistant Streptococcus pneumoniae strain 159 revealed that in vivo and in vitro, in the presence of the appropriate acyl-tRNA, MurM(159) alanylated the peptidoglycan epsilon-amino group of the stem peptide lysine in preference to its serylation. However, in contrast, identical analyses of the penicillin-susceptible strain Pn16 revealed that MurM(Pn16) activity supported serylation more than alanylation both in vivo and in vitro. Interestingly, both MurM(Pn16) acylation activities were far lower than the alanylation activity of MurM(159). The resulting differing stem peptide structures of 159 and Pn16 were caused by the profoundly greater catalytic efficiency of MurM(159) compared with MurM(Pn16) bought about by sequence variation between these enzymes and, to a lesser extent, differences in the in vivo tRNA(Ala):tRNA(Ser) ratio in 159 and Pn16. Kinetic analysis revealed that MurM(159) acted during the lipid-linked stages of peptidoglycan synthesis, that the d-alanyl-d-alanine of the stem peptide and the lipid II N-acetylglucosaminyl group were not essential for substrate recognition, that epsilon-carboxylation of the lysine of the stem peptide was not tolerated, and that lipid II-alanine was a substrate, suggesting an evolutionary link to staphylococcal homologues of MurM such as FemA. Kinetic analysis also revealed that MurM recognized the acceptor stem and/or the TPsiC loop stem of the tRNA(Ala). It is anticipated that definition of the minimal structural features of MurM substrates will allow development of novel resistance inhibitors that will restore the efficacy of beta-lactams for treatment of pneumococcal infection.

  2. Amino acids inhibit kynurenic acid formation via suppression of kynurenine uptake or kynurenic acid synthesis in rat brain in vitro.

    PubMed

    Sekine, Airi; Okamoto, Misaki; Kanatani, Yuka; Sano, Mitsue; Shibata, Katsumi; Fukuwatari, Tsutomu

    2015-01-01

    The tryptophan metabolite, kynurenic acid (KYNA), is a preferential antagonist of the α7 nicotinic acetylcholine receptor at endogenous brain concentrations. Recent studies have suggested that increase of brain KYNA levels is involved in psychiatric disorders such as schizophrenia and depression. KYNA-producing enzymes have broad substrate specificity for amino acids, and brain uptake of kynurenine (KYN), the immediate precursor of KYNA, is via large neutral amino acid transporters (LAT). In the present study, to find out amino acids with the potential to suppress KYNA production, we comprehensively investigated the effects of proteinogenic amino acids on KYNA formation and KYN uptake in rat brain in vitro. Cortical slices of rat brain were incubated for 2 h in Krebs-Ringer buffer containing a physiological concentration of KYN with individual amino acids. Ten out of 19 amino acids (specifically, leucine, isoleucine, phenylalanine, methionine, tyrosine, alanine, cysteine, glutamine, glutamate, and aspartate) significantly reduced KYNA formation at 1 mmol/L. These amino acids showed inhibitory effects in a dose-dependent manner, and partially inhibited KYNA production at physiological concentrations. Leucine, isoleucine, methionine, phenylalanine, and tyrosine, all LAT substrates, also reduced tissue KYN concentrations in a dose-dependent manner, with their inhibitory rates for KYN uptake significantly correlated with KYNA formation. These results suggest that five LAT substrates inhibit KYNA formation via blockade of KYN transport, while the other amino acids act via blockade of the KYNA synthesis reaction in brain. Amino acids can be a good tool to modulate brain function by manipulation of KYNA formation in the brain. This approach may be useful in the treatment and prevention of neurological and psychiatric diseases associated with increased KYNA levels.

  3. An RNA sequence of hundreds of nucleotides at the 5' end of poliovirus RNA is involved in allowing viral protein synthesis.

    PubMed Central

    Trono, D; Andino, R; Baltimore, D

    1988-01-01

    Twenty-one mutations were engineered in the 5' noncoding region of poliovirus type 1 RNA, using an infectious cDNA copy of the viral genome. RNA was made from these constructs and used to transfect HeLa cells. Viable virus was recovered from 12 of these transfection experiments, including six strains with a recognizable phenotype, mapping in four different regions. One mutant of each site was studied in more detail. Mutant 5NC-11, having a 4-base insertion at nucleotide 70, was dramatically deficient in RNA synthesis, suggesting that the far 5' end of the genome is primarily involved in one or more steps of RNA replication. Mutants 5NC-13, 5NC-114, and 5NC-116, mapping at nucleotides 224, 270, and 392, respectively, showed a similar behavior; they made very little viral protein, they did not inhibit host cell translation, and they synthesized a significant amount of viral RNA, although with some delay compared with wild type. These three mutants were efficiently complemented by all other poliovirus mutants tested, except those with lesions in protein 2A. Our results imply that these three mutants map in a region (region P) primarily involved in viral protein synthesis and that their inability to shut off host cell translation is secondary to a quantitative defect in protein 2A. The exact function of region P is still to be determined, but our data supports the hypothesis of a single functional module allowing viral protein synthesis and extending over several hundred nucleotides. Images PMID:2836612

  4. LKB1 promotes cell survival by modulating TIF-IA-mediated pre-ribosomal RNA synthesis under uridine downregulated conditions

    PubMed Central

    Liu, Xiuju; Huang, Henry; Wilkinson, Scott C.; Zhong, Diansheng; Khuri, Fadlo R.; Fu, Haian; Marcus, Adam; He, Yulong; Zhou, Wei

    2016-01-01

    We analyzed the mechanism underlying 5-aminoimidazole-4-carboxamide riboside (AICAR) mediated apoptosis in LKB1-null non-small cell lung cancer (NSCLC) cells. Metabolic profile analysis revealed depletion of the intracellular pyrimidine pool after AICAR treatment, but uridine was the only nucleotide precursor capable of rescuing this apoptosis, suggesting the involvement of RNA metabolism. Because half of RNA transcription in cancer is for pre-ribosomal RNA (rRNA) synthesis, which is suppressed by over 90% after AICAR treatment, we evaluated the role of TIF-IA-mediated rRNA synthesis. While the depletion of TIF-IA by RNAi alone promoted apoptosis in LKB1-null cells, the overexpression of a wild-type or a S636A TIF-IA mutant, but not a S636D mutant, attenuated AICAR-induced apoptosis. In LKB1-null H157 cells, pre-rRNA synthesis was not suppressed by AICAR when wild-type LKB1 was present, and cellular fractionation analysis indicated that TIF-IA quickly accumulated in the nucleus in the presence of a wild-type LKB1 but not a kinase-dead mutant. Furthermore, ectopic expression of LKB1 was capable of attenuating AICAR-induced death in AMPK-null cells. Because LKB1 promotes cell survival by modulating TIF-IA-mediated pre-rRNA synthesis, this discovery suggested that targeted depletion of uridine related metabolites may be exploited in the clinic to eliminate LKB1-null cancer cells. PMID:26506235

  5. The Yeast Mitochondrial RNA Polymerase and Transcription Factor Complex Catalyzes Efficient Priming of DNA Synthesis on Single-stranded DNA.

    PubMed

    Ramachandran, Aparna; Nandakumar, Divya; Deshpande, Aishwarya P; Lucas, Thomas P; R-Bhojappa, Ramanagouda; Tang, Guo-Qing; Raney, Kevin; Yin, Y Whitney; Patel, Smita S

    2016-08-05

    Primases use single-stranded (ss) DNAs as templates to synthesize short oligoribonucleotide primers that initiate lagging strand DNA synthesis or reprime DNA synthesis after replication fork collapse, but the origin of this activity in the mitochondria remains unclear. Herein, we show that the Saccharomyces cerevisiae mitochondrial RNA polymerase (Rpo41) and its transcription factor (Mtf1) is an efficient primase that initiates DNA synthesis on ssDNA coated with the yeast mitochondrial ssDNA-binding protein, Rim1. Both Rpo41 and Rpo41-Mtf1 can synthesize short and long RNAs on ssDNA template and prime DNA synthesis by the yeast mitochondrial DNA polymerase Mip1. However, the ssDNA-binding protein Rim1 severely inhibits the RNA synthesis activity of Rpo41, but not the Rpo41-Mtf1 complex, which continues to prime DNA synthesis efficiently in the presence of Rim1. We show that RNAs as short as 10-12 nt serve as primers for DNA synthesis. Characterization of the RNA-DNA products shows that Rpo41 and Rpo41-Mtf1 have slightly different priming specificity. However, both prefer to initiate with ATP from short priming sequences such as 3'-TCC, TTC, and TTT, and the consensus sequence is 3'-Pu(Py)2-3 Based on our studies, we propose that Rpo41-Mtf1 is an attractive candidate for serving as the primase to initiate lagging strand DNA synthesis during normal replication and/or to restart stalled replication from downstream ssDNA.

  6. Comparison of commercial systems for extraction of nucleic acids from DNA/RNA respiratory pathogens.

    PubMed

    Yang, Genyan; Erdman, Dean E; Kodani, Maja; Kools, John; Bowen, Michael D; Fields, Barry S

    2011-01-01

    This study compared six automated nucleic acid extraction systems and one manual kit for their ability to recover nucleic acids from human nasal wash specimens spiked with five respiratory pathogens, representing Gram-positive bacteria (Streptococcus pyogenes), Gram-negative bacteria (Legionella pneumophila), DNA viruses (adenovirus), segmented RNA viruses (human influenza virus A), and non-segmented RNA viruses (respiratory syncytial virus). The robots and kit evaluated represent major commercially available methods that are capable of simultaneous extraction of DNA and RNA from respiratory specimens, and included platforms based on magnetic-bead technology (KingFisher mL, Biorobot EZ1, easyMAG, KingFisher Flex, and MagNA Pure Compact) or glass fiber filter technology (Biorobot MDX and the manual kit Allprep). All methods yielded extracts free of cross-contamination and RT-PCR inhibition. All automated systems recovered L. pneumophila and adenovirus DNA equivalently. However, the MagNA Pure protocol demonstrated more than 4-fold higher DNA recovery from the S. pyogenes than other methods. The KingFisher mL and easyMAG protocols provided 1- to 3-log wider linearity and extracted 3- to 4-fold more RNA from the human influenza virus and respiratory syncytial virus. These findings suggest that systems differed in nucleic acid recovery, reproducibility, and linearity in a pathogen specific manner.

  7. Proline Coordination with Fatty Acid Synthesis and Redox Metabolism of Chloroplast and Mitochondria1[OPEN

    PubMed Central

    Shinde, Suhas; Villamor, Joji Grace; Lin, Wendar; Verslues, Paul E.

    2016-01-01

    Proline (Pro) accumulation is one of the most prominent changes in plant metabolism during drought and low water potential; however, the regulation and function of Pro metabolism remain unclear. We used a combination of forward genetic screening based on a Proline Dehydrogenase1 (PDH1) promoter-luciferase reporter (PDH1pro:LUC2) and RNA sequencing of the Pro synthesis mutant p5cs1-4 to identify multiple loci affecting Pro accumulation in Arabidopsis (Arabidopsis thaliana). Two mutants having high PDH1pro:LUC2 expression and increased Pro accumulation at low water potential were found to be alleles of Cytochrome P450, Family 86, Subfamily A, Polypeptide2 (CYP86A2) and Long Chain Acyl Synthetase2 (LACS2), which catalyze two successive steps in very-long-chain fatty acid (VLCFA) synthesis. Reverse genetic experiments found additional VLCFA and lipid metabolism-related mutants with increased Pro accumulation. Altered cellular redox status is a key factor in the coordination of Pro and VLCFA metabolism. The NADPH oxidase inhibitor diphenyleneiodonium (DPI) induced high levels of Pro accumulation and strongly repressed PDH1pro:LUC2 expression. cyp86a2 and lacs2 mutants were hypersensitive to diphenyleneiodonium but could be reverted to wild-type Pro and PDH1pro:LUC2 expression by reactive oxygen species scavengers. The coordination of Pro and redox metabolism also was indicated by the altered expression of chloroplast and mitochondria electron transport genes in p5cs1-4. These results show that Pro metabolism is both influenced by and influences cellular redox status via previously unknown coordination with several metabolic pathways. In particular, Pro and VLCFA synthesis share dual roles to help buffer cellular redox status while producing products useful for stress resistance, namely the compatible solute Pro and cuticle lipids. PMID:27512016

  8. Erythromycin, carbomycin, and spiramycin inhibit protein synthesis by stimulating the dissociation of peptidyl-tRNA from ribosomes.

    PubMed

    Menninger, J R; Otto, D P

    1982-05-01

    In mutant Escherichia coli with temperature-sensitive peptidyl-tRNA hydrolase (aminoacyl-tRNA hydrolase; EC 3.1.1.29), peptidyl-tRNA accumulates at the nonpermissive temperature (40 degrees C), and the cells die. These consequences of high temperature were enhanced if the cells were first treated with erythromycin, carbomycin, or spiramycin at doses sufficient to inhibit protein synthesis in wild-type cells but not sufficient to kill either mutant or wild-type cells at the permissive temperature (30 degrees C). Since peptidyl-tRNA hydrolase in he mutant cells is inactivated rapidly and irreversibly at 40 degrees C, the enhanced accumulation of peptidyl-tRNA and killing were the result of enhanced dissociation, stimulated by the antibiotics, of peptidyl-tRNA from ribosomes. The implications of these findings for inhibition of cell growth and protein synthesis are discussed. Certain alternative interpretations are shown to be inconsistent with the relevant data. Previous conflicting observations on the effects of macrolide antibiotics are explained in terms of our observations. We conclude that erythromycin, carbomycin, and spiramycin (and probably all macrolides) have as a primary mechanism of action the stimulation of dissociation of peptidyl-tRNA from ribosomes, probably during translocation.

  9. Serum concentration and increased temperature alter Mayaro virus RNA and protein synthesis in Aedes albopictus (mosquito)-infected cells.

    PubMed

    Motta, M C; Fournier, M V; Carvalho, M G

    1995-01-01

    We have previously shown the inhibition of Mayaro virus multiplication in Aedes albopictus-infected cells maintained at a supraoptimal temperature for growth (37 degrees C) and a stimulation of virus production in response to high serum concentrations in the incubation medium. In the present study, we addressed the question of how the effect of continuous heat stress and high serum concentration soon after infection interfere with virus macromolecule synthesis. Cells maintained at 28 degrees C in the presence of 2% serum synthesized a viral genomic RNA of 12 kb and a subgenomic RNA of 5.2 kb 6 h postinfection. Analysis of the protein profile showed the presence of the viral nucleocapsid protein of 34 kDa (P34). However, if infected cells were maintained at 37 degrees C, a smear starting immediately below the 5.2-kb RNA was noticed and the viral P34 was not detected by SDS-PAGE. Addition of 10% serum to the growth medium of infected cells maintained at 37 degrees C results in a viral RNA profile and protein synthesis similar to those observed in cultures kept at 28 degrees C, i.e., the smear was not observed and the P34 protein was detected. The results suggest that the inhibition of virus multiplication by temperature may be related to the inhibition of viral nonstructural protein synthesis early during infection. The presence of high serum levels in the incubation medium protects macromolecule synthesis against heat stress.

  10. De Novo mRNA Synthesis Is Required for Both Consolidation and Reconsolidation of Fear Memories in the Amygdala

    ERIC Educational Resources Information Center

    Duvarci, Sevil; Nader, Karim; LeDoux, Joseph E.

    2008-01-01

    Memory consolidation is the process by which newly learned information is stabilized into long-term memory (LTM). Considerable evidence indicates that retrieval of a consolidated memory returns it to a labile state that requires it to be restabilized. Consolidation of new fear memories has been shown to require de novo RNA and protein synthesis in…

  11. Role of fatty-acid synthesis in dendritic cell generation and function.

    PubMed

    Rehman, Adeel; Hemmert, Keith C; Ochi, Atsuo; Jamal, Mohsin; Henning, Justin R; Barilla, Rocky; Quesada, Juan P; Zambirinis, Constantinos P; Tang, Kerry; Ego-Osuala, Melvin; Rao, Raghavendra S; Greco, Stephanie; Deutsch, Michael; Narayan, Suchithra; Pachter, H Leon; Graffeo, Christopher S; Acehan, Devrim; Miller, George

    2013-05-01

    Dendritic cells (DC) are professional APCs that regulate innate and adaptive immunity. The role of fatty-acid synthesis in DC development and function is uncertain. We found that blockade of fatty-acid synthesis markedly decreases dendropoiesis in the liver and in primary and secondary lymphoid organs in mice. Human DC development from PBMC precursors was also diminished by blockade of fatty-acid synthesis. This was associated with higher rates of apoptosis in precursor cells and increased expression of cleaved caspase-3 and BCL-xL and downregulation of cyclin B1. Further, blockade of fatty-acid synthesis decreased DC expression of MHC class II, ICAM-1, B7-1, and B7-2 but increased their production of selected proinflammatory cytokines including IL-12 and MCP-1. Accordingly, inhibition of fatty-acid synthesis enhanced DC capacity to activate allogeneic as well as Ag-restricted CD4(+) and CD8(+) T cells and induce CTL responses. Further, blockade of fatty-acid synthesis increased DC expression of Notch ligands and enhanced their ability to activate NK cell immune phenotype and IFN-γ production. Because endoplasmic reticulum (ER) stress can augment the immunogenic function of APC, we postulated that this may account for the higher DC immunogenicity. We found that inhibition of fatty-acid synthesis resulted in elevated expression of numerous markers of ER stress in humans and mice and was associated with increased MAPK and Akt signaling. Further, lowering ER stress by 4-phenylbutyrate mitigated the enhanced immune stimulation associated with fatty-acid synthesis blockade. Our findings elucidate the role of fatty-acid synthesis in DC development and function and have implications to the design of DC vaccines for immunotherapy.

  12. Role of Fatty-acid Synthesis in Dendritic Cell Generation and Function

    PubMed Central

    Rehman, Adeel; Hemmert, Keith C.; Ochi, Atsuo; Jamal, Mohsin; Henning, Justin R.; Barilla, Rocky; Quesada, Juan P.; Zambirinis, Constantinos P.; Tang, Kerry; Ego-Osuala, Melvin; Rao, Raghavendra S.; Greco, Stephanie; Deutsch, Michael; Narayan, Suchithra; Pachter, H. Leon; Graffeo, Christopher S.; Acehan, Devrim; Miller, George

    2013-01-01

    Dendritic cells (DC) are professional antigen presenting cells that regulate innate and adaptive immunity. The role of fatty-acid synthesis in DC development and function is uncertain. We found that blockade of fatty-acid synthesis markedly decreases dendropoiesis in the liver and in primary and secondary lymphoid organs in mice. Human DC development from PBMC precursors was also diminished by blockade of fatty-acid synthesis. This was associated with higher rates of apoptosis in precursor cells and increased expression of Cleaved Caspase 3 and BCL-xL, and down-regulation of Cyclin B1. Further, blockade of fatty-acid synthesis decreased DC expression of MHCII, ICAM-1, B7-1, B7-2 but increased their production of selected pro-inflammatory cytokines including IL-12 and MCP-1. Accordingly, inhibition of fatty-acid synthesis enhanced DC capacityto activate allogeneic as well as antigen-restricted CD4+ and CD8+ T cells and induce CTL responses. Further, blockade of fatty-acid synthesis increased DC expression of Notch ligands and enhanced their ability to activate NK cell immune-phenotype and IFN-γ production. Since endoplasmic reticular (ER)-stress can augment the immunogenic function of APC, we postulated that this may account for the higher DC immunogenicity. We found that inhibition of fatty-acid synthesis resulted in elevated expression of numerous markers of ER stress in humans and mice and was associated with increased MAP kinase and Akt signaling. Further, lowering ER-stress by 4-phenylbutyrate mitigated the enhanced immune-stimulation associated with fatty-acid synthesis blockade. Our findings elucidate the role of fatty-acid synthesis in DC development and function and have implications to the design of DC vaccines for immunotherapy. PMID:23536633

  13. 4-Methylumbelliferone inhibits hyaluronan synthesis by depletion of cellular UDP-glucuronic acid and downregulation of hyaluronan synthase 2 and 3

    SciTech Connect

    Kultti, Anne; Pasonen-Seppaenen, Sanna; Jauhiainen, Marjo; Rilla, Kirsi J.; Kaernae, Riikka; Pyoeriae, Emma; Tammi, Raija H.; Tammi, Markku I.

    2009-07-01

    Hyaluronan accumulation on cancer cells and their surrounding stroma predicts an unfavourable disease outcome, suggesting that hyaluronan enhances tumor growth and spreading. 4-Methylumbelliferone (4-MU) inhibits hyaluronan synthesis and retards cancer spreading in experimental animals through mechanisms not fully understood. These mechanisms were studied in A2058 melanoma cells, MCF-7 and MDA-MB-361 breast, SKOV-3 ovarian and UT-SCC118 squamous carcinoma cells by analysing hyaluronan synthesis, UDP-glucuronic acid (UDP-GlcUA) content, and hyaluronan synthase (HAS) mRNA levels. The maximal inhibition in hyaluronan synthesis ranged 22-80% in the cell lines tested. Active glucuronidation of 4-MU produced large quantities of 4-MU-glucuronide, depleting the cellular UDP-GlcUA pool. The maximal reduction varied between 38 and 95%. 4-MU also downregulated HAS mRNA levels: HAS3 was 84-60% lower in MDA-MB-361, A2058 and SKOV-3 cells. HAS2 was the major isoenzyme in MCF-7 cells and lowered by 81%, similar to 88% in A2058 cells. These data indicate that both HAS substrate and HAS2 and/or HAS3 mRNA are targeted by 4-MU. Despite different target point sensitivities, the reduction of hyaluronan caused by 4-MU was associated with a significant inhibition of cell migration, proliferation and invasion, supporting the importance of hyaluronan synthesis in cancer, and the therapeutic potential of hyaluronan synthesis inhibition.

  14. Decreased bile-acid synthesis in livers of hepatocyte-conditional NADPH-cytochrome P450 reductase-null mice results in increased bile acids in serum.

    PubMed

    Cheng, Xingguo; Zhang, Youcai; Klaassen, Curtis D

    2014-10-01

    NADPH-cytochrome P450 reductase (Cpr) is essential for the function of microsomal cytochrome P450 monooxygenases (P450), including those P450s involved in bile acid (BA) synthesis. Mice with hepatocyte-specific deletion of NADPH-cytochrome P450 reductase (H-Cpr-null) have been engineered to understand the in vivo function of hepatic P450s in the metabolism of xenobiotics and endogenous compounds. However, the impact of hepatic Cpr on BA homeostasis is not clear. The present study revealed that H-Cpr-null mice had a 60% decrease in total BA concentration in liver, whereas the total BA concentration in serum was almost doubled. The decreased level of cholic acid (CA) in both serum and livers of H-Cpr-null mice is likely due to diminished enzyme activity of Cyp8b1 that is essential for CA biosynthesis. Feedback mechanisms responsible for the reduced liver BA concentrations and/or increased serum BA concentrations in H-Cpr-null mice included the following: 1) enhanced alternative BA synthesis pathway, as evidenced by the fact that classic BA synthesis is diminished but chenodeoxycholic acid still increases in both serum and livers of H-Cpr-null mice; 2) inhibition of farnesoid X receptor activation, which increased the mRNA of Cyp7a1 and 8b1; 3) induction of intestinal BA transporters to facilitate BA absorption from the intestine to the circulation; 4) induction of hepatic multidrug resistance-associated protein transporters to increase BA efflux from the liver to blood; and 5) increased generation of secondary BAs. In summary, the present study reveals an important contribution of the alternative BA synthesis pathway and BA transporters in regulating BA concentrations in H-Cpr-null mice.

  15. Reliable semi-synthesis of hydrolysis-resistant 3′-peptidyl-tRNA conjugates containing genuine tRNA modifications

    PubMed Central

    Graber, Dagmar; Moroder, Holger; Steger, Jessica; Trappl, Krista; Polacek, Norbert; Micura, Ronald

    2010-01-01

    The 3′-peptidyl-tRNA conjugates that possess a hydrolysis-resistant ribose-3′-amide linkage instead of the natural ester linkage would represent valuable substrates for ribosomal studies. Up to date, access to these derivatives is severely limited. Here, we present a novel approach for the reliable synthesis of non-hydrolyzable 3′-peptidyl-tRNAs that contain all the respective genuine nucleoside modifications. In short, the approach is based on tRNAs from natural sources that are site-specifically cleaved within the TΨC loop by using DNA enzymes to obtain defined tRNA 5′-fragments carrying the modifications. After dephosphorylation of the 2′,3′-cyclophosphate moieties from these fragments, they are ligated to the respective 3′-peptidylamino-tRNA termini that were prepared following the lines of a recently reported solid-phase synthesis. By this novel concept, non-hydrolyzable 3′-peptidyl-tRNA conjugates possessing all natural nucleoside modifications are accessible in highly efficient manner. PMID:20525967

  16. Editing of the Sendai virus P/C mRNA by G insertion occurs during mRNA synthesis via a virus-encoded activity.

    PubMed Central

    Vidal, S; Curran, J; Kolakofsky, D

    1990-01-01

    Two forms of the Sendai virus P/C mRNA have been predicted: one an exact copy of the viral genome, and the other with a single G insertion within a run of three G's. We directly cloned the mRNA or portions of it containing the insertion site and screened the resulting colonies with oligonucleotides that could distinguish the presence of three or four G's at this position. We found that 31% of the mRNAs did in fact contain the predicted insertion, whereas the viral genomes contained no heterogeneity at this position. A smaller fraction (7%) of the mRNA contained two to eight G's inserted at this position. The insertions also took place during RNA synthesis in vitro with purified virions but were not detected when the mRNA was expressed in vivo via a vaccinia virus recombinant. When the Sendai virus- and vaccinia virus-derived P/C mRNAs were coexpressed in the same cells under conditions in which each could be distinguished, those from the Sendai genome were altered as before, but those from the vaccinia virus genome remained unaltered. The activity that alters the mRNA is therefore likely to be coded for by the virus and cannot function in trans. Images PMID:1688384

  17. Selective charging of tRNA isoacceptors induced by amino-acid starvation

    PubMed Central

    Dittmar, Kimberly A; Sørensen, Michael A; Elf, Johan; Ehrenberg, Måns; Pan, Tao

    2005-01-01

    Aminoacylated (charged) transfer RNA isoacceptors read different messenger RNA codons for the same amino acid. The concentration of an isoacceptor and its charged fraction are principal determinants of the translation rate of its codons. A recent theoretical model predicts that amino-acid starvation results in ‘selective charging' where the charging levels of some tRNA isoacceptors will be low and those of others will remain high. Here, we developed a microarray for the analysis of charged fractions of tRNAs and measured charging for all Escherichia coli tRNAs before and during leucine, threonine or arginine starvation. Before starvation, most tRNAs were fully charged. During starvation, the isoacceptors in the leucine, threonine or arginine families showed selective charging when cells were starved for their cognate amino acid, directly confirming the theoretical prediction. Codons read by isoacceptors that retain high charging can be used for efficient translation of genes that are essential during amino-acid starvation. Selective charging can explain anomalous patterns of codon usage in the genes for different families of proteins. PMID:15678157

  18. Ascorbic acid inhibits replication and infectivity of avian RNA tumor virus

    SciTech Connect

    BISSELL, MINA J; HATIE, CARROLL; FARSON, DEBORAH A.; SCHWARZ, RICHARD I.; SOO, WHAI-JEN

    1980-04-01

    Ascorbic acid, at nontoxic concentrations, causes a substantial reduction in the ability of avian tumor viruses to replicate in both primary avian tendon cells and chicken embryo fibroblasts. The virus-infected cultures appear to be less transformed in the presence of ascorbic acid by the criteria of morphology, reduced glucose uptake, and increased collagen synthesis. The vitamin does not act by altering the susceptibility of the cells to initial infection and transformation, but instead appears to interfere with the spread of infection through a reduction in virus replication and virus infectivity. The effect is reversible and requires the continuous presence of the vitamin in the culture medium.

  19. Synthesis of hybrid hydrazino peptides: protected vs unprotected chiral α-hydrazino acids.

    PubMed

    Suć, Josipa; Jerić, Ivanka

    2015-01-01

    Peptidomimetics based on hydrazino derivatives of α-amino acids represent an important class of peptidic foldamers with promising biological activities, like protease inhibition and antimicrobial activity. However, the lack of straightforward method for the synthesis of optically pure hydrazino acids and efficient incorporation of hydrazino building blocks into peptide sequence hamper wider exploitation of hydrazino peptidomimetics. Here we described the utility of N (α)-benzyl protected and unprotected hydrazino derivatives of natural α-amino acids in synthesis of peptidomimetics. While incorporation of N (α)-benzyl-hydrazino acids into peptide chain and deprotection of benzyl moiety proceeded with difficulties, unprotected hydrazino acids allowed fast and simple construction of hybrid peptidomimetics.

  20. A convenient synthesis of anthranilic acids by Pd-catalyzed direct intermolecular ortho-C-H amidation of benzoic acids.

    PubMed

    Ng, Ka-Ho; Ng, Fo-Ning; Yu, Wing-Yiu

    2012-12-11

    An efficient method for synthesis of anthranilic acids by Pd-catalyzed ortho-C-H amidation of benzoic acids is disclosed. The amidation is proposed to proceed by carboxylate-assisted ortho-C-H palladation to form an arylpalladium(II) complex, followed by nitrene insertion to the Pd-C bond.

  1. ORAL AND INTRAVENOUSLY ADMINISTERED AMINO ACIDS PRODUCE SIMILAR EFFECTS ON MUSCLE PROTEIN SYNTHESIS IN THE ELDERLY

    PubMed Central

    Rasmussen, B.B.; Wolfe, R.R.; Volpi, E.

    2011-01-01

    BACKGROUND Muscle protein synthesis is stimulated in the elderly when amino acid availability is increased. OBJECTIVE To determine which mode of delivery of amino acids (intravenous vs. oral ingestion) is more effective in stimulating the rate of muscle protein synthesis in elderly subjects. DESIGN Fourteen elderly subjects were assigned to one of two groups. Following insertion of femoral arterial and venous catheters, subjects were infused with a primed, continuous infusion of L-[ring-2H5] phenylalanine. Blood samples and muscle biopsies were obtained to measure muscle protein fractional synthesis rate (FSR) with the precursor-product model, phenylalanine kinetics across the leg with the three-pool model, and whole body phenylalanine kinetics. Protein metabolism parameters were measured in the basal period, and during the administration of oral amino acids (n=8) or a similar amount of intravenous amino acids (n=6). RESULTS Enteral and parenteral amino acid administration increased amino acid arterial concentrations and delivery to the leg to a similar extent in both groups. Muscle protein synthesis as measured by both FSR, and the three-pool model, increased during amino acid administration (P < 0.05 vs. basal) in both groups with no differences between groups. Whole body proteolysis did not change with the oral amino acids whereas it increased slightly during parenteral amino acid administration. CONCLUSIONS Increased amino acid availability stimulates the rate of muscle protein synthesis independent of the route of administration (enteral vs. parenteral). PMID:12459885

  2. Amino Acid Synthesis in Seafloor Environments on Icy Worlds

    NASA Astrophysics Data System (ADS)

    Flores, Erika; Barge, Laura; VanderVelde, David; Kallas, Kayo; Baum, Marc M.; Russell, Michael J.; Kanik, Isik

    2016-10-01

    In 2005, the Cassini mission detected plumes erupting from Enceladus' surface, containing carbon dioxide, methane, silica, and possibly ammonia. Subsequent laboratory experiments indicated that the silica particles in the plumes were generated under alkaline conditions and at moderate temperatures of ~90°C (Hsu et al., 2015); one scenario for such conditions would be the existence of alkaline (serpentinization-driven) hydrothermal activity within Enceladus. Alkaline vents are significant since they have been proposed as a likely environment for the emergence of metabolism on the early Earth (Russell et al. 2014) and thus could also provide a mechanism for origin of life on ocean worlds with a water-rock interface. Alkaline vents in an acidic, iron-containing ocean could produce mineral precipitates that could act as primitive enzymes or catalysts mediating organic reactions; for example, metal sulfides can catalyze the reductive amination of pyruvate to alanine (Novikov and Copley 2013). We have conducted experiments testing the synthesis of amino acids catalyzed by other iron minerals that might be expected to precipitate on the seafloor of early Earth or Enceladus. Preliminary results indicate that amino acids as well as other organic products can be synthesized in 1-3 days under alkaline hydrothermal conditions. We also find that the yield and type of organic products is highly dependent on pH and temperature, implying that understanding the specifics of the geochemical hydrothermal gradients on Enceladus (or other ocean worlds) will be significant in determining their potential for synthesizing building blocks for life.Hsu, H.-W. et al. (2015), Nature 519, 207-210.Russell, M. J. et al. (2014), Astrobiology, 14, 308-43.Novikov Y. and Copley S. D. (2013) PNAS 110, 33, 13283-13288.

  3. The Hypothesis that the Genetic Code Originated in Coupled Synthesis of Proteins and the Evolutionary Predecessors of Nucleic Acids in Primitive Cells.

    PubMed

    Francis, Brian R

    2015-02-11

    Although analysis of the genetic code has allowed explanations for its evolution to be proposed, little evidence exists in biochemistry and molecular biology to offer an explanation for the origin of the genetic code. In particular, two features of biology make the origin of the genetic code difficult to understand. First, nucleic acids are highly complicated polymers requiring numerous enzymes for biosynthesis. Secondly, proteins have a simple backbone with a set of 20 different amino acid side chains synthesized by a highly complicated ribosomal process in which mRNA sequences are read in triplets. Apparently, both nucleic acid and protein syntheses have extensive evolutionary histories. Supporting these processes is a complex metabolism and at the hub of metabolism are the carboxylic acid cycles. This paper advances the hypothesis that the earliest predecessor of the nucleic acids was a β-linked polyester made from malic acid, a highly conserved metabolite in the carboxylic acid cycles. In the β-linked polyester, the side chains are carboxylic acid groups capable of forming interstrand double hydrogen bonds. Evolution of the nucleic acids involved changes to the backbone and side chain of poly(β-d-malic acid). Conversion of the side chain carboxylic acid into a carboxamide or a longer side chain bearing a carboxamide group, allowed information polymers to form amide pairs between polyester chains. Aminoacylation of the hydroxyl groups of malic acid and its derivatives with simple amino acids such as glycine and alanine allowed coupling of polyester synthesis and protein synthesis. Use of polypeptides containing glycine and l-alanine for activation of two different monomers with either glycine or l-alanine allowed simple coded autocatalytic synthesis of polyesters and polypeptides and established the first genetic code. A primitive cell capable of supporting electron transport, thioester synthesis, reduction reactions, and synthesis of polyesters and

  4. The Hypothesis that the Genetic Code Originated in Coupled Synthesis of Proteins and the Evolutionary Predecessors of Nucleic Acids in Primitive Cells

    PubMed Central

    Francis, Brian R.

    2015-01-01

    Although analysis of the genetic code has allowed explanations for its evolution to be proposed, little evidence exists in biochemistry and molecular biology to offer an explanation for the origin of the genetic code. In particular, two features of biology make the origin of the genetic code difficult to understand. First, nucleic acids are highly complicated polymers requiring numerous enzymes for biosynthesis. Secondly, proteins have a simple backbone with a set of 20 different amino acid side chains synthesized by a highly complicated ribosomal process in which mRNA sequences are read in triplets. Apparently, both nucleic acid and protein syntheses have extensive evolutionary histories. Supporting these processes is a complex metabolism and at the hub of metabolism are the carboxylic acid cycles. This paper advances the hypothesis that the earliest predecessor of the nucleic acids was a β-linked polyester made from malic acid, a highly conserved metabolite in the carboxylic acid cycles. In the β-linked polyester, the side chains are carboxylic acid groups capable of forming interstrand double hydrogen bonds. Evolution of the nucleic acids involved changes to the backbone and side chain of poly(β-d-malic acid). Conversion of the side chain carboxylic acid into a carboxamide or a longer side chain bearing a carboxamide group, allowed information polymers to form amide pairs between polyester chains. Aminoacylation of the hydroxyl groups of malic acid and its derivatives with simple amino acids such as glycine and alanine allowed coupling of polyester synthesis and protein synthesis. Use of polypeptides containing glycine and l-alanine for activation of two different monomers with either glycine or l-alanine allowed simple coded autocatalytic synthesis of polyesters and polypeptides and established the first genetic code. A primitive cell capable of supporting electron transport, thioester synthesis, reduction reactions, and synthesis of polyesters and

  5. DFT study of the Lewis acid mediated synthesis of 3-acyltetramic acids.

    PubMed

    Mikula, Hannes; Svatunek, Dennis; Skrinjar, Philipp; Horkel, Ernst; Hametner, Christian; Fröhlich, Johannes

    2014-05-01

    The synthesis of 3-acyltetramic acids by C-acylation of pyrrolidine-2,4-diones was studied by density functional theory (DFT). DFT was applied to the mycotoxin tenuazonic acid (TeA), an important representative of these bioactive natural compounds. Lewis acid mediated C-acylation in combination with previous pH-neutral domino N-acylation-Wittig cyclization can be used for the efficient preparation of 3-acyltetramic acids. Nevertheless, quite harsh conditions are still required to carry out this synthetic step, leading to unwanted isomerization of stereogenic centers in some cases. In the presented study, the reaction pathway for the C-acetylation of (5S,6S-5-s-butylpyrrolidine-2,4-dione was studied in terms of mechanism, solvent effects, and Lewis acid activation, in order to obtain an appropriate theoretical model for further investigations. Crucial steps were identified that showed rather high activation barriers and rationalized previously reported experimental discoveries. After in silico optimization, aluminum chlorides were found to be promising Lewis acids that promote the C-acylation of pyrrolidine-2,4-diones, whereas calculations performed in various organic solvents showed that the solvent had only a minor effect on the energy profiles of the considered mechanisms. This clearly indicates that further synthetic studies should focus on the Lewis-acidic mediator rather than other reaction parameters. Additionally, given the results obtained for different reaction routes, the stereochemistry of this C-acylation is discussed. It is assumed that the formation of Z-configured TeA is favored, in good agreement with our previous studies.

  6. Interrelated effects of dihomo-γ-linolenic and arachidonic acids, and sesamin on hepatic fatty acid synthesis and oxidation in rats.

    PubMed

    Ide, Takashi; Ono, Yoshiko; Kawashima, Hiroshi; Kiso, Yoshinobu

    2012-12-14

    Interrelated effects of dihomo-γ-linolenic acid (DGLA) and arachidonic acid (ARA), and sesamin, a sesame lignan, on hepatic fatty acid synthesis and oxidation were examined in rats. Rats were fed experimental diets supplemented with 0 or 2 g/kg sesamin (1:1 mixture of sesamin and episesamin), containing 100 g/kg of maize oil or fungal oil rich in DGLA or ARA for 16 d. Among the groups fed sesamin-free diets, oils rich in DGLA or ARA, especially the latter, compared with maize oil strongly reduced the activity and mRNA levels of various lipogenic enzymes. Sesamin, irrespective of the type of fat, reduced the parameters of lipogenic enzymes except for malic enzyme. The type of dietary fat was rather irrelevant in affecting hepatic fatty acid oxidation among rats fed the sesamin-free diets. Sesamin increased the activities of enzymes involved in fatty acid oxidation in all groups of rats given different fats. The extent of the increase depended on the dietary fat type, and the values became much higher with a diet containing sesamin and oil rich in ARA in combination than with a diet containing lignan and maize oil. Analyses of mRNA levels revealed that the combination of sesamin and oil rich in ARA compared with the combination of lignan and maize oil markedly increased the gene expression of various peroxisomal fatty acid oxidation enzymes but not mitochondrial enzymes. The enhancement of sesamin action on hepatic fatty acid oxidation was also confirmed with oil rich in DGLA but to a lesser extent.

  7. Primary and secondary siRNA synthesis triggered by RNAs from food bacteria in the ciliate Paramecium tetraurelia

    PubMed Central

    Carradec, Quentin; Götz, Ulrike; Arnaiz, Olivier; Pouch, Juliette; Simon, Martin; Meyer, Eric; Marker, Simone

    2015-01-01

    In various organisms, an efficient RNAi response can be triggered by feeding cells with bacteria producing double-stranded RNA (dsRNA) against an endogenous gene. However, the detailed mechanisms and natural functions of this pathway are not well understood in most cases. Here, we studied siRNA biogenesis from exogenous RNA and its genetic overlap with endogenous RNAi in the ciliate Paramecium tetraurelia by high-throughput sequencing. Using wild-type and mutant strains deficient for dsRNA feeding we found that high levels of primary siRNAs of both strands are processed from the ingested dsRNA trigger by the Dicer Dcr1, the RNA-dependent RNA polymerases Rdr1 and Rdr2 and other factors. We further show that this induces the synthesis of secondary siRNAs spreading along the entire endogenous mRNA, demonstrating the occurrence of both 3′-to-5′ and 5′-to-3′ transitivity for the first time in the SAR clade of eukaryotes (Stramenopiles, Alveolates, Rhizaria). Secondary siRNAs depend on Rdr2 and show a strong antisense bias; they are produced at much lower levels than primary siRNAs and hardly contribute to RNAi efficiency. We further provide evidence that the Paramecium RNAi machinery also processes single-stranded RNAs from its bacterial food, broadening the possible natural functions of exogenously induced RNAi in this organism. PMID:25593325

  8. Primary and secondary siRNA synthesis triggered by RNAs from food bacteria in the ciliate Paramecium tetraurelia.

    PubMed

    Carradec, Quentin; Götz, Ulrike; Arnaiz, Olivier; Pouch, Juliette; Simon, Martin; Meyer, Eric; Marker, Simone

    2015-02-18

    In various organisms, an efficient RNAi response can be triggered by feeding cells with bacteria producing double-stranded RNA (dsRNA) against an endogenous gene. However, the detailed mechanisms and natural functions of this pathway are not well understood in most cases. Here, we studied siRNA biogenesis from exogenous RNA and its genetic overlap with endogenous RNAi in the ciliate Paramecium tetraurelia by high-throughput sequencing. Using wild-type and mutant strains deficient for dsRNA feeding we found that high levels of primary siRNAs of both strands are processed from the ingested dsRNA trigger by the Dicer Dcr1, the RNA-dependent RNA polymerases Rdr1 and Rdr2 and other factors. We further show that this induces the synthesis of secondary siRNAs spreading along the entire endogenous mRNA, demonstrating the occurrence of both 3'-to-5' and 5'-to-3' transitivity for the first time in the SAR clade of eukaryotes (Stramenopiles, Alveolates, Rhizaria). Secondary siRNAs depend on Rdr2 and show a strong antisense bias; they are produced at much lower levels than primary siRNAs and hardly contribute to RNAi efficiency. We further provide evidence that the Paramecium RNAi machinery also processes single-stranded RNAs from its bacterial food, broadening the possible natural functions of exogenously induced RNAi in this organism.

  9. Effect of microwaves (2450-MHz) on the immune system in mice: studies of nucleic acid and protein synthesis

    SciTech Connect

    Wiktor-Jedrzejczak, W.; Ahmed, A.; Czerski, P.; Leach, W.M.; Sell, K.W.

    1980-01-01

    CBA/J adult male mice were given single or triple exposures to 2450-mHz microwaves in an environmentally controlled wave guide facility. The average absorbed dose rate for a single exposure varied from 12 to 15 mW/g. Sham-exposed mice served as controls. Lymphoid cells were collected and tested for metabolic activity on days 3, 6, and 9 following a single exposure, and on days 9, 12, and 16 following triple exposures on days 0, 3, and 6. Cells were cultured in vitro for four hours to seven days before their metabolic rates were assayed. Under these conditions, microwaves failed to produce any detectable change in deoxyribonucleic acid (DNA), ribonucleic acid (RNA), and protein synthesis, as measured by the incorporation of methyl(3H)-thymidine (3H-TDR) (DNA substrate), 3H-uridine (3H-UR) (RNA substrate), and 3H-leucine (protein substrate) by spleen, bone marrow, and peripheral blood lymphocytes (PBL) in vitro. These data suggest that microwave-induced increases in the frequency of complement-receptor (CR)- or surface-immunoglobulin (sIg)-bearing cells were not associated with a concomitant increase in cell proliferation and/or protein synthesis, and favor the concept that microwaves under these conditions stimulate already existing B-cell precursors for maturation.

  10. Tailored fatty acid synthesis via dynamic control of fatty acid elongation

    SciTech Connect

    Torella, JP; Ford, TJ; Kim, SN; Chen, AM; Way, JC; Silver, PA

    2013-07-09

    Medium-chain fatty acids (MCFAs, 4-12 carbons) are valuable as precursors to industrial chemicals and biofuels, but are not canonical products of microbial fatty acid synthesis. We engineered microbial production of the full range of even-and odd-chain-length MCFAs and found that MCFA production is limited by rapid, irreversible elongation of their acyl-ACP precursors. To address this limitation, we programmed an essential ketoacyl synthase to degrade in response to a chemical inducer, thereby slowing acyl-ACP elongation and redirecting flux from phospholipid synthesis to MCFA production. Our results show that induced protein degradation can be used to dynamically alter metabolic flux, and thereby increase the yield of a desired compound. The strategy reported herein should be widely useful in a range of metabolic engineering applications in which essential enzymes divert flux away from a desired product, as well as in the production of polyketides, bioplastics, and other recursively synthesized hydrocarbons for which chain-length control is desired.

  11. Alternative bases in the RNA world: the prebiotic synthesis of urazole and its ribosides

    NASA Technical Reports Server (NTRS)

    Kolb, V. M.; Dworkin, J. P.; Miller, S. L.

    1994-01-01

    Urazole is a five-membered heterocyclic compound which is isosteric with uracil's hydrogen-bonding segment. Urazole reacts spontaneoulsy with ribose (and other aldoses) to give a mixture of four ribosides: alpha and beta pyranosides and furanosides. This reaction occurs in aqueous solution at mild temperatures. Thermodynamic and kinetic parameters for the reaction of urazole with ribose were determined. In contrast, uracil is completely unreactive with ribose under these conditions. Urazole's unusual reactivity is ascribed to the hydrazine portion of the molecule. Urazole can be synthesized from biuret and hydrazine under prebiotic conditions. The prebiotic synthesis of guanazole, which is isosteric in part to diaminopyrimidine and cytosine, is accomplished from dicyandiamide and hydrazine. Kinetic parameters for both prebiotic reactions were measured. Urazole and guanazole are transparent in the UV, which would be a favorable property in the absence of an ozone layer on the early Earth. Urazole makes hydrogen bonds with adenine in DMSO similar to those of uracil, as established by H NMR. All of these properties make urazole an attractive potential precursor to uracil and guanazole a potential precursor to cytosine in the RNA or pre-RNA world.

  12. Clay catalyzed RNA synthesis under Martian conditions: Application for Mars return samples.

    PubMed

    Joshi, Prakash C; Dubey, Krishna; Aldersley, Michael F; Sausville, Meaghen

    2015-06-26

    Catalysis by montmorillonites clay minerals is regarded as a feasible mechanism for the abiotic production and polymerization of key biomolecules on early Earth. We have investigated a montmorillonite-catalyzed reaction of the 5'-phosphorimidazolide of nucleosides as a model to probe prebiotic synthesis of RNA-type oligomers. Here we show that this model is specific for the generation of RNA oligomers despite deoxy-mononucleotides adsorbing equally well onto the montmorillonite catalytic surfaces. Optimum catalytic activity was observed over a range of pH (6-9) and salinity (1 ± 0.2 M NaCl). When the weathering steps of early Earth that generated catalytic montmorillonite were modified to meet Martian soil conditions, the catalytic activity remained intact without altering the surface layer charge. Additionally, the formation of oligomers up to tetramer was detected using as little as 0.1 mg of Na⁺-montmorillonite, suggesting that the catalytic activity of a Martian clay return sample can be investigated with sub-milligram scale samples.

  13. Progress in demonstrating total homochiral selection in montmorillonite-catalyzed RNA synthesis.

    PubMed

    Joshi, Prakash C; Aldersley, Michael F; Ferris, James P

    2011-10-07

    The Na(+)-montmorillonite-catalyzed reactions of 5'-phosphorimidazolides of nucleosides generates RNA oligomers. The question arises as to how chiral selectivity was introduced into this biopolymer from a simple chemical system. We have demonstrated homochiral selection in quaternary reactions of a racemic mixture of D,L-ImpA and D,L-ImpU on Na(+)-montmorillonite. The dimer, trimer, tetramer and pentamer fractions were investigated for homochiral selection. The products were collected via ion exchange HPLC and their terminal 5'-phosphate was cleaved by alkaline phosphatase. These fractions were analyzed by reverse phase HPLC for the identification of homochiral and heterochiral isomers. Encouraged by favorable homochiral excesses of dimer (63.5 ± 0.8%) and trimer (74.3 ± 1.7%), the study was extended to the analysis of higher oligomers. The tetramer and pentamer of the quaternary reaction were separated into 26 and 22 isomers, respectively, on a reverse phase column. Their co-elution with those formed in the binary reactions of d-ImpA and D-ImpU on Na(+)-montmorillonite revealed 92.7 ± 2.0% and 97.2 ± 0.5% homochirality of the tetramer and pentamer, respectively. These results suggest that Na(+)-montmorillonite not only catalyzes the prebiotic synthesis of RNA but it also facilitates homochiral selection.

  14. Synthesis and evaluation of fluorescent cap analogues for mRNA labelling

    PubMed Central

    Ziemniak, Marcin; Szabelski, Mariusz; Lukaszewicz, Maciej; Nowicka, Anna; Darzynkiewicz, Edward; Rhoads, Robert E.; Wieczorek, Zbigniew; Jemielity, Jacek

    2013-01-01

    We describe the synthesis and properties of five dinucleotide fluorescent cap analogues labelled at the ribose of the 7-methylguanosine moiety with either anthraniloyl (Ant) or N-methylanthraniloyl (Mant), which have been designed for the preparation of fluorescent mRNAs via transcription in vitro. Two of the analogues bear a methylene modification in the triphosphate bridge, providing resistance against either the Dcp2 or DcpS decapping enzymes. All these compounds were prepared by ZnCl2-mediated coupling of a nucleotide P-imidazolide with a fluorescently labelled mononucleotide. To evaluate the utility of these compounds for studying interactions with cap-binding proteins and cap-related cellular processes, both biological and spectroscopic features of those compounds were determined. The results indicate acceptable quantum yields of fluorescence, pH independence, environmental sensitivity, and photostability. The cap analogues are incorporated by RNA polymerase into mRNA transcripts that are efficiently translated in vitro. Transcripts containing fluorescent caps but unmodified in the triphosphate chain are hydrolysed by Dcp2 whereas those containing a α-β methylene modification are resistant. Model studies exploiting sensitivity of Mant to changes of local environment demonstrated utility of the synthesized compounds for studying cap-related proteins. PMID:24273643

  15. Identification and sequence of the initiation site for rat 45S ribosomal RNA synthesis.

    PubMed Central

    Harrington, C A; Chikaraishi, D M

    1983-01-01

    The transcription initiation site for rat 45S precursor ribosomal RNA synthesis was determined by nuclease protection mapping with two single-strand endonucleases. S1 and mung bean, and one single-strand exonuclease, ExoVII. These experiments were performed with end-labeled ribosomal DNA from double-stranded pBR322 recombinants and from single-stranded M13 recombinants. Results from experiments using both kinds of DNA and all three enzymes showed that the 5' end of 45S RNA mapped to a unique site 125 bases upstream from the Hind III site in the ribosomal DNA gene. The DNA surrounding this site (designated +1) was sequenced from -281 to +641. The entire sequence of this region shows extensive homology to the comparable region of mouse. This includes three stretches of T residues in the non-coding strand between +300 and +630. Two sets of direct repeats adjacent to these T-rich regions are observed. Comparison of the mouse and human ribosomal DNA transcription initiation sites with the rat sequence reported in this paper demonstrates a conserved sequence at +2 to +16, CTGACACGCTGTCCT. This suggests that this region may be important for the initiation of transcription on mammalian ribosomal DNAs. Images PMID:6304628

  16. Open reading frames 1a and 1b of the porcine reproductive and respiratory syndrome virus (PRRSV) collaboratively initiate viral minus-strand RNA synthesis.

    PubMed

    Tang, Yan-Dong; Fang, Qiong-Qiong; Liu, Ji-Ting; Wang, Tong-Yun; Wang, Yu; Tao, Ye; Liu, Yong-Gang; Cai, Xue-Hui

    2016-09-02

    The porcine reproductive and respiratory syndrome virus (PRRSV) causes a persistent threat to the swine industry, especially when highly pathogenic PRRSV (HP-PRRSV) emerges. Previous studies have indicated that PRRSV RNA synthesis was correlated with HP-PRRSV virulence. PRRSV RNA synthesis includes genomic RNA and sub-genomic mRNA, and these processes require minus-strand RNA as a template. However, the mechanisms involved in PRRSV minus-strand RNA synthesis are not fully understood. A mini-genome system can be used to assess viral replication mechanisms and to evaluate the effects of potential antiviral drugs on viral replicase activities. In this study, we developed a mini-genome system that uses firefly luciferase as a reporter. Based on this system, we found that PRRSV RNA-dependent RNA polymerase nsp9 alone failed to activate virus minus-strand RNA synthesis. We also demonstrated that combinations of open reading frames 1a (ORF1a) and ORF1b are necessary for viral minus-strand RNA synthesis.

  17. Synthesis and cytotoxic activity of new betulin and betulinic acid esters with conjugated linoleic acid (CLA).

    PubMed

    Tubek, Barbara; Mituła, Paweł; Niezgoda, Natalia; Kempińska, Katarzyna; Wietrzyk, Joanna; Wawrzeńczyk, Czesław

    2013-04-01

    The synthesis of new ester derivatives of betulin (3a-c) and betulinic acid (4) with conjugated linoleic acid isomers (CLA; in a mixture of 43.4% 9c, 11t; 49.5% 10t, 12c; 7.1% other isomers) is presented. Esterification was carried out with N,N'-dicyclohexylcarbodiimide (DCC) as the coupling agent in the presence of 4-dimethylamino-pyridine (DMAP) in dichloromethane (or pyridine). The in vitro cytotoxic effect of betulin (1), betulinic acid (2), a mixture of CLA isomers and their derivatives (3a-c, 4) was examined using the MTT assay against four cancer cell lines (P388, CEM/C2, CCRF/CEM and HL-60) and the SRB assay on the HT-29 cell line. Ester 4 was the most active among the esters synthesized against the CEM/C2 cell line with an ID50 value 16.9 +/- 6.5 microg/mL. Betulin (1), betulinic acid (2) and CLA were the most active agents against the cancer cell lines studied.

  18. Nucleic acid determinants for selective deamination of DNA over RNA by activation-induced deaminase.

    PubMed

    Nabel, Christopher S; Lee, Jae W; Wang, Laura C; Kohli, Rahul M

    2013-08-27

    Activation-induced deaminase (AID), a member of the larger AID/APOBEC family, is the key catalyst in initiating antibody somatic hypermutation and class-switch recombination. The DNA deamination model accounting for AID's functional role posits that AID deaminates genomic deoxycytosine bases within the immunoglobulin locus, activating downstream repair pathways that result in antibody maturation. Although this model is well supported, the molecular basis for AID's selectivity for DNA over RNA remains an open and pressing question, reflecting a broader need to elucidate how AID/APOBEC enzymes engage their substrates. To address these questions, we have synthesized a series of chimeric nucleic acid substrates and characterized their reactivity with AID. These chimeric substrates feature targeted variations at the 2'-position of nucleotide sugars, allowing us to interrogate the steric and conformational basis for nucleic acid selectivity. We demonstrate that modifications to the target nucleotide can significantly alter AID's reactivity. Strikingly, within a substrate that is otherwise DNA, a single RNA-like 2'-hydroxyl substitution at the target cytosine is sufficient to compromise deamination. Alternatively, modifications that favor a DNA-like conformation (or sugar pucker) are compatible with deamination. AID's closely related homolog APOBEC1 is similarly sensitive to RNA-like substitutions at the target cytosine. Inversely, with unreactive 2'-fluoro-RNA substrates, AID's deaminase activity was rescued by introducing a trinucleotide DNA patch spanning the target cytosine and two nucleotides upstream. These data suggest a role for nucleotide sugar pucker in explaining the molecular basis for AID's DNA selectivity and, more generally, suggest how other nucleic acid-modifying enzymes may distinguish DNA from RNA.

  19. Altered expression of hyaluronan synthase and hyaluronidase mRNA may affect hyaluronic acid distribution in keloid disease compared with normal skin.

    PubMed

    Sidgwick, Gary P; Iqbal, Syed A; Bayat, Ardeshir

    2013-05-01

    Keloid disease (KD) is a fibroproliferative disorder characterised partly by an altered extracellular matrix (ECM) profile. In fetal scarring, hyaluronic acid (HA) expression is increased, but is reduced in KD tissue compared with normal skin (NS). The expression of Hyaluronan Synthase (HAS) and hyaluronidase (HYAL) in KD and NS tissue were investigated for the first time using a range of techniques. Hyaluronan synthase and HYAL mRNA expression were significantly increased in NS tissue compared with KD tissue (P < 0.05). Immunohistological analysis of tissue indicated an accumulation of HAS and HYAL protein expression in KD compared with NS due to the thicker epidermis. No differences were observed in mRNA or protein expression in KD and NS fibroblasts. Reduced expression of HAS and HYAL may alter HA synthesis, degradation and accumulation in KD. Better understanding of the role of HA in KD may lead to novel therapeutic approaches to address the resulting ECM imbalance.

  20. Information transfer from peptide nucleic acids to RNA by template-directed syntheses

    NASA Technical Reports Server (NTRS)

    Schmidt, J. G.; Nielsen, P. E.; Orgel, L. E.; Bada, J. L. (Principal Investigator)

    1997-01-01

    Peptide nucleic acids (PNAs) are uncharged analogs of DNA and RNA in which the ribose-phosphate backbone is substituted by a backbone held together by amide bonds. PNAs are interesting as models of alternative genetic systems because they form potentially informational base paired helical structures. A PNA C10 oligomer has been shown to act as template for efficient formation of oligoguanylates from activated guanosine ribonucleotides. In a previous paper we used heterosequences of DNA as templates in sequence-dependent polymerization of PNA dimers. In this paper we show that information can be transferred from PNA to RNA. We describe the reactions of activated mononucleotides on heterosequences of PNA. Adenylic, cytidylic and guanylic acids were incorporated into the products opposite their complement on PNA, although less efficiently than on DNA templates.

  1. Non-standard amino acid recognition by Escherichia coli leucyl-tRNA synthetase

    NASA Technical Reports Server (NTRS)

    Martinis, S. A.; Fox, G. E.

    1997-01-01

    Recombinant E. coli leucyl-tRNA synthetase was screened for amino acid-dependent pyrophosphate exchange activity using noncognate aliphatic amino acids including norvaline, homocysteine, norleucine, methionine, and homoserine. [32P]-labeled reaction products were separated by thin layer chromatography using a novel solvent system and then quantified by phosphorimaging. Norvaline which differs from leucine by only one methyl group stimulated pyrophosphate exchange activity as did both homocysteine and norleucine to a lesser extent. The KM parameters for leucine and norvaline were measured to be 10 micromoles and 1.5 mM, respectively. Experiments are in progress to determine if norvaline is transferred to tRNA(Leu) and/or edited by a pre- or post-transfer mechanism.

  2. p53-Regulated Networks of Protein, mRNA, miRNA, and lncRNA Expression Revealed by Integrated Pulsed Stable Isotope Labeling With Amino Acids in Cell Culture (pSILAC) and Next Generation Sequencing (NGS) Analyses*

    PubMed Central

    Hünten, Sabine; Kaller, Markus; Drepper, Friedel; Oeljeklaus, Silke; Bonfert, Thomas; Erhard, Florian; Dueck, Anne; Eichner, Norbert; Friedel, Caroline C.; Meister, Gunter; Zimmer, Ralf; Warscheid, Bettina; Hermeking, Heiko

    2015-01-01

    We determined the effect of p53 activation on de novo protein synthesis using quantitative proteomics (pulsed stable isotope labeling with amino acids in cell culture/pSILAC) in the colorectal cancer cell line SW480. This was combined with mRNA and noncoding RNA expression analyses by next generation sequencing (RNA-, miR-Seq). Furthermore, genome-wide DNA binding of p53 was analyzed by chromatin-immunoprecipitation (ChIP-Seq). Thereby, we identified differentially regulated proteins (542 up, 569 down), mRNAs (1258 up, 415 down), miRNAs (111 up, 95 down) and lncRNAs (270 up, 123 down). Changes in protein and mRNA expression levels showed a positive correlation (r = 0.50, p < 0.0001). In total, we detected 133 direct p53 target genes that were differentially expressed and displayed p53 occupancy in the vicinity of their promoter. More transcriptionally induced genes displayed occupied p53 binding sites (4.3% mRNAs, 7.2% miRNAs, 6.3% lncRNAs, 5.9% proteins) than repressed genes (2.4% mRNAs, 3.2% miRNAs, 0.8% lncRNAs, 1.9% proteins), suggesting indirect mechanisms of repression. Around 50% of the down-regulated proteins displayed seed-matching sequences of p53-induced miRNAs in the corresponding 3′-UTRs. Moreover, proteins repressed by p53 significantly overlapped with those previously shown to be repressed by miR-34a. We confirmed up-regulation of the novel direct p53 target genes LINC01021, MDFI, ST14 and miR-486 and showed that ectopic LINC01021 expression inhibits proliferation in SW480 cells. Furthermore, KLF12, HMGB1 and CIT mRNAs were confirmed as direct targets of the p53-induced miR-34a, miR-205 and miR-486–5p, respectively. In line with the loss of p53 function during tumor progression, elevated expression of KLF12, HMGB1 and CIT was detected in advanced stages of cancer. In conclusion, the integration of multiple omics methods allowed the comprehensive identification of direct and indirect effectors of p53 that provide new insights and leads into the

  3. Initiation of poliovirus plus-strand RNA synthesis in a membrane complex of infected HeLa cells

    SciTech Connect

    Takeda, N.; Kuhn, R.J.; Yang, C.F.; Takegami, T.; Wimmer, E.

    1986-10-01

    An in vitro poliovirus RNA-synthesizing system derived from a crude membrance fraction of infected HeLa cells was used to analyze the mechanism of initiation of poliovirus plus-strand RNA synthesis. This system contains an activity that synthesizes the nucleotidyl proteins VPg-pU and VPg-pUpU. These molecules represent the 5'-terminal structure of nascent RNA molecules and of virion RNA. The membranous replication complex is also capable of synthesizing mucleotidyl proteins containing nine or more of the poliovirus 5'-proximal nucleotides as assayed by the formation of the RNase T/sub 1/-resistant oligonucleotide VPg-pUUAAAACAGp or by fingerprint analysis of the in vitro-synthesized /sup 32/P-RNA. Incubation of preformed VPg-pUpU with unlabeled nucleoside triphosphates resulted in the formation of VPg-pUUAAAACAGp. This reaction, which appeared to be an elongation of VPg-pUpU, was stimulated by the addition of a soluble fraction (S-10) obtained from uninfected HeLa cells. Preformed VPg-pU could be chased into VPg-pUpU in the presence of UTP. The data are consistent with a model that VPg-pU can function as a primer for poliovirus plus-strand RNA synthesis in the membranous replication complex and that the elongation reaction may be stimulated by a host cellular factor.

  4. Acid-Degradable Cationic Dextran Particles for the Delivery of siRNA Therapeutics

    PubMed Central

    Cohen, Jessica L.; Schubert, Stephanie; Wich, Peter R.; Cui, Lina; Cohen, Joel A.; Mynar, Justin L.; Fréchet, Jean M. J.

    2011-01-01

    We report a new acid-sensitive, biocompatible and biodegradable microparticulate delivery system, spermine modified acetalated-dextran (Spermine-Ac-DEX), which can be used to efficiently encapsulate siRNA. These particles demonstrated efficient gene knockdown in HeLa-luc cells with minimal toxicity. This knockdown was comparable to that obtained using Lipofectamine, a commercially available transfection reagent generally limited to in vitro use due to its high toxicity. PMID:21539393

  5. Long-term leucine induced stimulation of muscle protein synthesis is amino acid dependent

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Infusing leucine for 1 h increases skeletal muscle protein synthesis in the neonate, but this is not sustained for 2 h unless the corresponding fall in amino acids is prevented. This study aimed to determine whether a continuous leucine infusion can stimulate protein synthesis for a prolonged period...

  6. Amino Acid Specific Effects on RNA Tertiary Interactions: Single-Molecule Kinetic and Thermodynamic Studies.

    PubMed

    Sengupta, Abhigyan; Sung, Hsuan-Lei; Nesbitt, David J

    2016-10-10

    In light of the current models for an early RNA-based universe, the potential influence of simple amino acids on tertiary folding of ribozymal RNA into biochemically competent structures is speculated to be of significant evolutionary importance. In the present work, the folding-unfolding kinetics of a ubiquitous tertiary interaction motif, the GAAA tetraloop-tetraloop receptor (TL-TLR), is investigated by single-molecule fluorescence resonance energy transfer spectroscopy in the presence of natural amino acids both with (e.g., lysine, arginine) and without (e.g., glycine) protonated side chain residues. By way of control, we also investigate the effects of a special amino acid (e.g., proline) and amino acid mimetic (e.g., betaine) that contain secondary or quaternary amine groups rather than a primary amine group. This combination permits systematic study of amino acid induced (or amino acid like) RNA folding dynamics as a function of side chain complexity, pKa, charge state, and amine group content. Most importantly, each of the naturally occurring amino acids is found to destabilize the TL-TLR tertiary folding equilibrium, the kinetic origin of which is dominated by a decrease in the folding rate constant (kdock), also affected by a strongly amino acid selective increase in the unfolding rate constant (kundock). To further elucidate the underlying thermodynamics, single-molecule equilibrium constants (Keq) for TL-TLR folding have been probed as a function of temperature, which reveal an amino acid dependent decrease in both overall exothermicity (ΔΔH° > 0) and entropic cost (-TΔΔS° < 0) for the overall folding process. Temperature-dependent studies on the folding/unfolding kinetic rate constants reveal analogous amino acid specific changes in both enthalpy (ΔΔH(⧧)) and entropy (ΔΔS(⧧)) for accessing the transition state barrier. The maximum destabilization of the TL-TLR tertiary interaction is observed for arginine, which is consistent with early

  7. Conjugation of Palmitic Acid Improves Potency and Longevity of siRNA Delivered via Endosomolytic Polymer Nanoparticles

    PubMed Central

    Sarett, Samantha M.; Kilchrist, Kameron V.; Miteva, Martina; Duvall, Craig L.

    2015-01-01

    Clinical translation of siRNA therapeutics has been limited by the inability to effectively overcome the rigorous delivery barriers associated with intracellular-acting biologics. Here, in order to address both potency and longevity of siRNA gene silencing, pH-responsive micellar nanoparticle (NP) carriers loaded with siRNA conjugated to palmitic acid (siRNA-PA) were investigated as a combined approach to improve siRNA endosomal escape and stability. Conjugation to hydrophobic PA improved NP loading efficiency relative to unmodified siRNA, enabling complete packaging of siRNA-PA at a lower polymer:siRNA ratio. PA conjugation also increased intracellular uptake of the nucleic acid cargo by 35-fold and produced a 3.1-fold increase in intracellular half-life. The higher uptake and improved retention of siRNA-PA NPs correlated to a 2- and 11-fold decrease in gene silencing IC50 in comparison to siRNA NPs in fibroblasts and mesenchymal stem cells, respectively, for both the model gene luciferase and the therapeutically relevant gene PHD2. PA conjugation also significantly increased longevity of silencing activity following a single treatment, as observed in fibroblasts. Thus, conjugation of PA to siRNA paired with endosomolytic NPs is a promising approach to enhance the functional efficacy of siRNA in tissue regenerative and other applications. PMID:25641816

  8. The Synthesis of an Amino Acid Derivative and Spectroscopic Monitoring of Dipeptide Formation.

    ERIC Educational Resources Information Center

    Simmonds, Richard J.

    1987-01-01

    Described are experiments to give students experience in the synthesis of peptides from amino acids and to use visible spectroscopy to measure a rate of reaction. The activities were designed for undergraduate courses. (RH)

  9. Synthesis of functionalized fluorescent gold nanoclusters for acid phosphatase sensing

    NASA Astrophysics Data System (ADS)

    Sun, Jian; Yang, Fan; Yang, Xiurong

    2015-10-01

    A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au+ complexes, and then a class of ~2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ~1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by introducing an alkaline aqueous solution of MUA into the GSH-Au+ complexes or AuNC@GSH solution. Subsequently, a reliable AuNC@GSH/MUA-based real-time assay of acid phosphatase (ACP) is established for the first time, inspired by the selective coordination of Fe3+ with surface ligands of AuNCs, the higher binding affinity between the pyrophosphate ion (PPi) and Fe3+, and the hydrolysis of PPi into orthophosphate by ACP. Our fluorescent chemosensor can also be applied to assay ACP in a real biological sample and, furthermore, to screen the inhibitor of ACP. This report paves a new avenue for synthesizing AuNCs based on either the bottom-up reduction or top-down etching method, establishing real-time fluorescence assays for ACP by means of PPi as the substrate, and further exploring the sensing applications of fluorescent AuNCs.A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au+ complexes, and then a class of ~2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ~1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by

  10. Synthesis of 1-O-methylchlorogenic acid: reassignment of structure for MCGA3 isolated from bamboo (Phyllostachys edulis) leaves

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The first synthesis of 1-O-methylchlorogenic acid is described. The short and efficient synthesis of this compound provides laboratory-scale quantities of the material to investigate its biological properties. The synthesis involved C-1 alkylation of the known (-)-4,5-cyclohexylidenequinic acid lact...

  11. Detection of Sialic Acid-Utilising Bacteria in a Caecal Community Batch Culture Using RNA-Based Stable Isotope Probing

    PubMed Central

    Young, Wayne; Egert, Markus; Bassett, Shalome A.; Bibiloni, Rodrigo

    2015-01-01

    Sialic acids are monosaccharides typically found on cell surfaces and attached to soluble proteins, or as essential components of ganglioside structures that play a critical role in brain development and neural transmission. Human milk also contains sialic acid conjugated to oligosaccharides, glycolipids, and glycoproteins. These nutrients can reach the large bowel where they may be metabolised by the microbiota. However, little is known about the members of the microbiota involved in this function. To identify intestinal bacteria that utilise sialic acid within a complex intestinal community, we cultured the caecal microbiota from piglets in the presence of 13C-labelled sialic acid. Using RNA-based stable isotope probing, we identified bacteria that consumed 13C-sialic acid by fractionating total RNA in isopycnic buoyant density gradients followed by 16S rRNA gene analysis. Addition of sialic acid caused significant microbial community changes. A relative rise in Prevotella and Lactobacillus species was accompanied by a corresponding reduction in the genera Escherichia/Shigella, Ruminococcus and Eubacterium. Inspection of isotopically labelled RNA sequences suggests that the labelled sialic acid was consumed by a wide range of bacteria. However, species affiliated with the genus Prevotella were clearly identified as the most prolific users, as solely their RNA showed significantly higher relative shares among the most labelled RNA species. Given the relevance of sialic acid in nutrition, this study contributes to a better understanding of their microbial transformation in the intestinal tract with potential implications for human health. PMID:25816158

  12. Synthesis of unnatural amino acids from serine derivatives by beta-fragmentation of primary alkoxyl radicals.

    PubMed

    Boto, Alicia; Gallardo, Juan A; Hernández, Dacil; Hernández, Rosendo

    2007-09-14

    The fragmentation of primary alkoxyl radicals has been scarcely used in synthesis since other competing processes (such as oxidation or hydrogen abstraction) usually predominate. However, when serine derivatives were used as substrates, the scission took place in excellent yields. Tandem scission-allylation, -alkylation, or -arylation reactions were subsequently developed. This one-pot methodology was applied to the synthesis of unnatural amino acids, which are useful synthetic blocks or amino acid surrogates in peptidomimetics.

  13. Copper-catalyzed formic acid synthesis from CO2 with hydrosilanes and H2O.

    PubMed

    Motokura, Ken; Kashiwame, Daiki; Miyaji, Akimitsu; Baba, Toshihide

    2012-05-18

    A copper-catalyzed formic acid synthesis from CO2 with hydrosilanes has been accomplished. The Cu(OAc)2·H2O-1,2-bis(diphenylphosphino)benzene system is highly effective for the formic acid synthesis under 1 atm of CO2. The TON value approached 8100 in 6 h. The reaction pathway was revealed by in situ NMR analysis and isotopic experiments.

  14. Synthesis of stable C-linked ferrocenyl amino acids and their use in solution-phase peptide synthesis.

    PubMed

    Philip, Anijamol T; Chacko, Shibin; Ramapanicker, Ramesh

    2015-12-01

    Incorporation of ferrocenyl group to peptides is an efficient method to alter their hydrophobicity. Ferrocenyl group can also act as an electrochemical probe when incorporated onto functional peptides. Most often, ferrocene is incorporated onto peptides post-synthesis via amide, ester or triazole linkages. Stable amino acids containing ferrocene as a C-linked side chain are potentially useful building units for the synthesis of ferrocene-containing peptides. We report here an efficient route to synthesize ferrocene-containing amino acids that are stable and can be used in peptide synthesis. Coupling of 2-ferrocenyl-1,3-dithiane and iodides derived from aspartic acid or glutamic acid using n-butyllithium leads to the incorporation of a ferrocenyl unit to the δ-position or ε-position of an α-amino acid. The reduction or hydrolysis of the dithiane group yields an alkyl or an oxo derivative. The usability of the synthesized amino acids is demonstrated by incorporating one of the amino acids in both C-terminus and N-terminus of tripeptides in solution phase.

  15. M-phase-specific protein kinase from mitotic sea urchin eggs: cyclic activation depends on protein synthesis and phosphorylation but does not require DNA or RNA synthesis.

    PubMed

    Arion, D; Meijer, L

    1989-08-01

    Histone H1 kinase (H1K) undergoes a transient activation at each early M phase of both meiotic and mitotic cell cycles. The mechanisms underlying the transient activation of this protein kinase were investigated in mitotic sea urchin eggs. Translocation of active H1K from particulate to soluble fraction does not seem to be responsible for this activation. H1K activation cannot be accounted for by the transient disappearance of a putative H1K inhibitor present in soluble fractions of homogenates. Aphidicolin, an inhibitor of DNA synthesis, and actinomycin D, an inhibitor of RNA synthesis, do not impede the transient appearance of H1K activity. H1K activation therefore does not require DNA or RNA synthesis. Fertilization triggers a rise in intracellular pH responsible for the increase of protein synthesis. H1K activation is highly dependent on the intracellular pH. Ammonia triggers an increase of intracellular pH and stimulates protein synthesis and H1K activation. Acetate lowers the intracellular pH, decreases protein synthesis, and blocks H1K activation. Protein synthesis is an absolute requirement for H1K activation as demonstrated by their identical sensitivities to emetine concentration and to time of emetine addition. About 60 min after fertilization, H1K activation and cleavage become independent of protein synthesis. The concentration of p34, a homolog of the yeast cdc2 gene product which has been recently shown to be a subunit of H1K, does not vary during the cell cycle and remains constant in emetine-treated cells. H1K activation thus requires the synthesis of either a p34 postranslational modifying enzyme or another subunit. Finally, phosphatase inhibitors and ATP slow down in the in vitro inactivation rate of H1K. These results suggest that a subunit or an activator of H1K is stored as an mRNA in the egg before mitosis and that full activation of H1K requires a phosphorylation.

  16. Distribution, synthesis, and absorption of kynurenic acid in plants.

    PubMed

    Turski, Michal P; Turska, Monika; Zgrajka, Wojciech; Bartnik, Magdalena; Kocki, Tomasz; Turski, Waldemar A

    2011-05-01

    Kynurenic acid (KYNA) is an endogenous antagonist of the ionotropic glutamate receptors and the α7 nicotinic acetylcholine receptor as well as an agonist of the G-protein-coupled receptor GPR35. In this study, KYNA distribution and synthesis in plants as well as its absorption was researched. KYNA level was determined by means of the high-performance liquid chromatography with fluorescence detection. KYNA was found in leaves, flowers, and roots of tested medicinal herbs: dandelion (Taraxacum officinale), common nettle (Urtica dioica), and greater celandine (Chelidoniummajus). The highest concentration of this compound was detected in leaves of dandelion--a mean value of 0.49 µg/g wet weight. It was shown that KYNA can be synthesized enzymatically in plants from its precursor, L-kynurenine, or absorbed by plants from the soil. Finally, the content of KYNA was investigated in 21 herbal tablets, herbal tea, herbs in sachets, and single herbs in bags. The highest content of KYNA in a maximum daily dose of herbal medicines appeared in St. John's wort--33.75 µg (tablets) or 32.60 µg (sachets). The pharmacological properties of KYNA and its presence in high concentrations in medicinal herbs may suggest that it possesses therapeutic potential, especially in the digestive system and should be considered a new valuable dietary supplement.

  17. Evolution of Abscisic Acid Synthesis and Signaling Mechanisms

    PubMed Central

    Hauser, Felix; Waadt, Rainer; Schroeder, Julian I.

    2011-01-01

    The plant hormone abscisic acid (ABA) mediates seed dormancy, controls seedling development and triggers tolerance to abiotic stresses, including drought. Core ABA signaling components consist of a recently identified group of ABA receptor proteins of the PYRABACTIN RESISTANCE (PYR)/REGULATORY COMPONENT OF ABA RECEPTOR (RCAR) family that act as negative regulators of members of the PROTEIN PHOSPHATASE 2C (PP2C) family. Inhibition of PP2C activity enables activation of SNF1-RELATED KINASE 2 (SnRK2) protein kinases, which target downstream components, including transcription factors, ion channels and NADPH oxidases. These and other components form a complex ABA signaling network. Here, an in depth analysis of the evolution of components in this ABA signaling network shows that (i) PYR/RCAR ABA receptor and ABF-type transcription factor families arose during land colonization of plants and are not found in algae and other species, (ii) ABA biosynthesis enzymes have evolved to plant- and fungal-specific forms, leading to different ABA synthesis pathways, (iii) existing stress signaling components, including PP2C phosphatases and SnRK kinases, were adapted for novel roles in this plant-specific network to respond to water limitation. In addition, evolutionarily conserved secondary structures in the PYR/RCAR ABA receptor family are visualized. PMID:21549957

  18. Evolution of abscisic acid synthesis and signaling mechanisms.

    PubMed

    Hauser, Felix; Waadt, Rainer; Schroeder, Julian I

    2011-05-10

    The plant hormone abscisic acid (ABA) mediates seed dormancy, controls seedling development and triggers tolerance to abiotic stresses, including drought. Core ABA signaling components consist of a recently identified group of ABA receptor proteins of the PYRABACTIN RESISTANCE (PYR)/REGULATORY COMPONENT OF ABA RECEPTOR (RCAR) family that act as negative regulators of members of the PROTEIN PHOSPHATASE 2C (PP2C) family. Inhibition of PP2C activity enables activation of SNF1-RELATED KINASE 2 (SnRK2) protein kinases, which target downstream components, including transcription factors, ion channels and NADPH oxidases. These and other components form a complex ABA signaling network. Here, an in depth analysis of the evolution of components in this ABA signaling network shows that (i) PYR/RCAR ABA receptor and ABF-type transcription factor families arose during land colonization of plants and are not found in algae and other species, (ii) ABA biosynthesis enzymes have evolved to plant- and fungal-specific forms, leading to different ABA synthesis pathways, (iii) existing stress signaling components, including PP2C phosphatases and SnRK kinases, were adapted for novel roles in this plant-specific network to respond to water limitation. In addition, evolutionarily conserved secondary structures in the PYR/RCAR ABA receptor family are visualized.

  19. WRINKLED1 Rescues Feedback Inhibition of Fatty Acid Synthesis in Hydroxylase-Expressing Seeds1[OPEN

    PubMed Central

    Browse, John

    2016-01-01

    Previous attempts at engineering Arabidopsis (Arabidopsis thaliana) to produce seed oils containing hydroxy fatty acids (HFA) have resulted in low yields of HFA compared with the native castor (Ricinus communis) plant and caused undesirable effects, including reduced total oil content. Recent studies have led to an understanding of problems involved in the accumulation of HFA in oils of transgenic plants, which include metabolic bottlenecks and a decrease in the rate of fatty acid synthesis. Focusing on engineering the triacylglycerol assembly mechanisms led to modest increases in the HFA content of seed oil, but much room for improvement still remains. We hypothesized that engineering fatty acid synthesis in the plastids to increase flux would facilitate enhanced total incorporation of fatty acids, including HFA, into seed oil. The transcription factor WRINKLED1 (WRI1) positively regulates the expression of genes involved in fatty acid synthesis and controls seed oil levels. We overexpressed Arabidopsis WRI1 in seeds of a transgenic line expressing the castor fatty acid hydroxylase. The proportion of HFA in the oil, the total HFA per seed, and the total oil content of seeds increased to an average of 20.9%, 1.26 µg, and 32.2%, respectively, across five independent lines, compared with 17.6%, 0.83 µg, and 27.9%, respectively, for isogenic segregants. WRI1 and WRI1-regulated genes involved in fatty acid synthesis were up-regulated, providing for a corresponding increase in the rate of fatty acid synthesis. PMID:27208047

  20. Is bacterial fatty acid synthesis a valid target for antibacterial drug discovery?

    PubMed

    Parsons, Joshua B; Rock, Charles O

    2011-10-01

    The emergence of resistance against most current drugs emphasizes the need to develop new approaches to control bacterial pathogens, particularly Staphylococcus aureus. Bacterial fatty acid synthesis is one such target that is being actively pursued by several research groups to develop anti-Staphylococcal agents. Recently, the wisdom of this approach has been challenged based on the ability of a Gram-positive bacterium to incorporate extracellular fatty acids and thus circumvent the inhibition of de novo fatty acid synthesis. The generality of this conclusion has been challenged, and there is enough diversity in the enzymes and regulation of fatty acid synthesis in bacteria to conclude that there is not a single organism that can be considered typical and representative of bacteria as a whole. We are left without a clear resolution to this ongoing debate and await new basic research to define the pathways for fatty acid uptake and that determine the biochemical and genetic mechanisms for the regulation of fatty acid synthesis in Gram-positive bacteria. These crucial experiments will determine whether diversity in the control of this important pathway accounts for the apparently different responses of Gram-positive bacteria to the inhibition of de novo fatty acid synthesis in presence of extracellular fatty acid supplements.

  1. Dual Mechanisms of Translation Initiation of the Full-Length HIV-1 mRNA Contribute to Gag Synthesis

    PubMed Central

    Rivero, Matias; Cohen, Éric A.; Lopez-Lastra, Marcelo; Mouland, Andrew J.

    2013-01-01

    The precursor group-specific antigen (pr55Gag) is central to HIV-1 assembly. Its expression alone is sufficient to assemble into virus-like particles. It also selects the genomic RNA for encapsidation and is involved in several important virus-host interactions for viral assembly and restriction, making its synthesis essential for aspects of viral replication. Here, we show that the initiation of translation of the HIV-1 genomic RNA is mediated through both a cap-dependent and an internal ribosome entry site (IRES)-mediated mechanisms. In support of this notion, pr55Gag synthesis was maintained at 70% when cap-dependent translation initiation was blocked by the expression of eIF4G- and PABP targeting viral proteases in two in vitro systems and in HIV-1-expressing cells directly infected with poliovirus. While our data reveal that IRES-dependent translation of the viral genomic RNA ensures pr55Gag expression, the synthesis of other HIV-1 proteins, including that of pr160Gag/Pol, Vpr and Tat is suppressed early during progressive poliovirus infection. The data presented herein implies that the unspliced HIV-1 genomic RNA utilizes both cap-dependent and IRES-dependent translation initiation to supply pr55Gag for virus assembly and production. PMID:23861855

  2. Site-Specific Cleavage of Ribosomal RNA in Escherichia coli-Based Cell-Free Protein Synthesis Systems

    PubMed Central

    Failmezger, Jurek; Nitschel, Robert; Sánchez-Kopper, Andrés; Kraml, Michael; Siemann-Herzberg, Martin

    2016-01-01

    Cell-free protein synthesis, which mimics the biological protein production system, allows rapid expression of proteins without the need to maintain a viable cell. Nevertheless, cell-free protein expression relies on active in vivo translation machinery including ribosomes and translation factors. Here, we examined the integrity of the protein synthesis machinery, namely the functionality of ribosomes, during (i) the cell-free extract preparation and (ii) the performance of in vitro protein synthesis by analyzing crucial components involved in translation. Monitoring the 16S rRNA, 23S rRNA, elongation factors and ribosomal protein S1, we show that processing of a cell-free extract results in no substantial alteration of the translation machinery. Moreover, we reveal that the 16S rRNA is specifically cleaved at helix 44 during in vitro translation reactions, resulting in the removal of the anti-Shine-Dalgarno sequence. These defective ribosomes accumulate in the cell-free system. We demonstrate that the specific cleavage of the 16S rRNA is triggered by the decreased concentrations of Mg2+. In addition, we provide evidence that helix 44 of the 30S ribosomal subunit serves as a point-of-entry for ribosome degradation in Escherichia coli. Our results suggest that Mg2+ homeostasis is fundamental to preserving functional ribosomes in cell-free protein synthesis systems, which is of major importance for cell-free protein synthesis at preparative scale, in order to create highly efficient technical in vitro systems. PMID:27992588

  3. Induction of human spermine oxidase SMO(PAOh1) is regulated at the levels of new mRNA synthesis, mRNA stabilization and newly synthesized protein.

    PubMed

    Wang, Yanlin; Hacker, Amy; Murray-Stewart, Tracy; Fleischer, Jennifer G; Woster, Patrick M; Casero, Robert A

    2005-03-15

    The oxidation of polyamines induced by antitumour polyamine analogues has been associated with tumour response to specific agents. The human spermine oxidase, SMO(PAOh1), is one enzyme that may play a direct role in the cellular response to the antitumour polyamine analogues. In the present study, the induction of SMO(PAOh1) enzyme activity by CPENSpm [N1-ethyl-N11-(cyclopropyl)methyl-4,8,diazaundecane] is demonstrated to be a result of newly synthesized mRNA and protein. Inhibition of new RNA synthesis by actinomycin D inhibits both the appearance of SMO(PAOh1) mRNA and enzyme activity. Similarly, inhibition of newly synthesized protein with cycloheximide prevents analogue-induced enzyme activity. Half-life determinations indicate that stabilization of SMO(PAOh1) protein does not play a significant role in analogue-induced activity. However, half-life experiments using actinomycin D indicate that CPENSpm treatment not only increases mRNA expression, but also leads to a significant increase in mRNA half-life (17.1 and 8.8 h for CPENSpm-treated cells and control respectively). Using reporter constructs encompassing the SMO(PAOh1) promoter region, a 30-90% increase in transcription is observed after exposure to CPENSpm. The present results are consistent with the hypothesis that analogue-induced expression of SMO(PAOh1) is a result of increased transcription and stabilization of SMO(PAOh1) mRNA, leading to increased protein production and enzyme activity. These data indicate that the major level of control of SMO(PAOh1) expression in response to polyamine analogues exposure is at the level of mRNA.

  4. Cooperative Brønsted Acid-Type Organocatalysis for the Stereoselective Synthesis of Deoxyglycosides

    PubMed Central

    2016-01-01

    A practical approach for the α-stereoselective synthesis of deoxyglycosides using cooperative Brønsted acid-type organocatalysis has been developed. The method is tolerant of a wide range of glycoside donors and acceptors, and its versatility is exemplified in the one-pot synthesis of a trisaccharide. Mechanistic studies suggest that thiourea-induced acid amplification of the chiral acid via H-bonding is key for the enhancement in reaction rate and yield, while stereocontrol is dependent on the chirality of the acid. PMID:28004941

  5. Exogenous amino acids stimulate net muscle protein synthesis in the elderly.

    PubMed Central

    Volpi, E; Ferrando, A A; Yeckel, C W; Tipton, K D; Wolfe, R R

    1998-01-01

    We have investigated the response of amino acid transport and protein synthesis in healthy elderly individuals (age 71+/-2 yr) to the stimulatory effect of increased amino acid availability. Muscle protein synthesis and breakdown, and amino acid transport were measured in the postabsorptive state and during the intravenous infusion of an amino acid mixture. Muscle-free amino acid kinetics were calculated by means of a three compartment model using data obtained by femoral arterio-venous catheterization and muscle biopsies from the vastus lateralis during the infusion of stable isotope tracers of amino acids. In addition, muscle protein fractional synthetic rate (FSR) was measured. Peripheral amino acid infusion significantly increased amino acid delivery to the leg, amino acid transport, and muscle protein synthesis when measured either with the three compartment model (P < 0.05) or with the traditional precursor-product approach (FSR increased from 0. 0474+/-0.0054 to 0.0940+/-0.0143%/h, P < 0.05). Because protein breakdown did not change during amino acid infusion, a positive net balance of amino acids across the muscle was achieved. We conclude that, although muscle mass is decreased in the elderly, muscle protein anabolism can nonetheless be stimulated by increased amino acid availability. We thus hypothesize that muscle mass could be better maintained with an increased intake of protein or amino acids. PMID:9576765

  6. Three-Dimensional Algebraic Models of the tRNA Code and 12 Graphs for Representing the Amino Acids

    PubMed Central

    José, Marco V.; Morgado, Eberto R.; Guimarães, Romeu Cardoso; Zamudio, Gabriel S.; de Farías, Sávio Torres; Bobadilla, Juan R.; Sosa, Daniela

    2014-01-01

    Three-dimensional algebraic models, also called Genetic Hotels, are developed to represent the Standard Genetic Code, the Standard tRNA Code (S-tRNA-C), and the Human tRNA code (H-tRNA-C). New algebraic concepts are introduced to be able to describe these models, to wit, the generalization of the 2n-Klein Group and the concept of a subgroup coset with a tail. We found that the H-tRNA-C displayed broken symmetries in regard to the S-tRNA-C, which is highly symmetric. We also show that there are only 12 ways to represent each of the corresponding phenotypic graphs of amino acids. The averages of statistical centrality measures of the 12 graphs for each of the three codes are carried out and they are statistically compared. The phenotypic graphs of the S-tRNA-C display a common triangular prism of amino acids in 10 out of the 12 graphs, whilst the corresponding graphs for the H-tRNA-C display only two triangular prisms. The graphs exhibit disjoint clusters of amino acids when their polar requirement values are used. We contend that the S-tRNA-C is in a frozen-like state, whereas the H-tRNA-C may be in an evolving state. PMID:25370377

  7. Targeting membrane-bound viral RNA synthesis reveals potent inhibition of diverse coronaviruses including the middle East respiratory syndrome virus.

    PubMed

    Lundin, Anna; Dijkman, Ronald; Bergström, Tomas; Kann, Nina; Adamiak, Beata; Hannoun, Charles; Kindler, Eveline; Jónsdóttir, Hulda R; Muth, Doreen; Kint, Joeri; Forlenza, Maria; Müller, Marcel A; Drosten, Christian; Thiel, Volker; Trybala, Edward

    2014-05-01

    Coronaviruses raise serious concerns as emerging zoonotic viruses without specific antiviral drugs available. Here we screened a collection of 16671 diverse compounds for anti-human coronavirus 229E activity and identified an inhibitor, designated K22, that specifically targets membrane-bound coronaviral RNA synthesis. K22 exerts most potent antiviral activity after virus entry during an early step of the viral life cycle. Specifically, the formation of double membrane vesicles (DMVs), a hallmark of coronavirus replication, was greatly impaired upon K22 treatment accompanied by near-complete inhibition of viral RNA synthesis. K22-resistant viruses contained substitutions in non-structural protein 6 (nsp6), a membrane-spanning integral component of the viral replication complex implicated in DMV formation, corroborating that K22 targets membrane bound viral RNA synthesis. Besides K22 resistance, the nsp6 mutants induced a reduced number of DMVs, displayed decreased specific infectivity, while RNA synthesis was not affected. Importantly, K22 inhibits a broad range of coronaviruses, including Middle East respiratory syndrome coronavirus (MERS-CoV), and efficient inhibition was achieved in primary human epithelia cultures representing the entry port of human coronavirus infection. Collectively, this study proposes an evolutionary conserved step in the life cycle of positive-stranded RNA viruses, the recruitment of cellular membranes for viral replication, as vulnerable and, most importantly, druggable target for antiviral intervention. We expect this mode of action to serve as a paradigm for the development of potent antiviral drugs to combat many animal and human virus infections.

  8. Hyaluronan tetrasaccharides stimulate ceramide production through upregulated mRNA expression of ceramide synthesis-associated enzymes.

    PubMed

    Kage, Madoka; Tokudome, Yoshihiro

    2016-03-01

    It has been reported that hyaluronan has different physiological functions as suggested by variation in molecular weight. In addition, it has also been reported that CD44, the major hyaluronan receptor, was demonstrated to induce keratinocyte differentiation and lipid synthesis of cholesterol. We focus attention on the hyaluronan tetrasaccharides (HA4) which is the smallest unit of hyaluronan. We previously reported that HA4 induced keratinocyte differentiation and that CD44 may be involved. For the purpose of clarifying the influence of HA4 on ceramide synthesis, we evaluated both of these factors in keratinocytes in vitro and in vivo. The mRNA expression of ceramide synthesis-associated enzymes and intracellular ceramide content were evaluated after HA4 treatment in normal human epidermal keratinocytes. In addition, the ceramide increasing effect of HA4 on skin in UVA-irradiated hairless mice was assessed by water content of stratum corneum (SC) and transepidermal water loss (TEWL) methods. The mRNA expression of ceramide synthesis-associated enzymes and intracellular ceramide content after HA4 treatment were increased compared with the control. Furthermore, HA4 treatment increased water content of SC and decreased TEWL. These findings suggest that HA4 affected ceramide synthesis and is involved in the improvement of UV-induced skin damage.

  9. Effect of heat shock on the synthesis of low molecular weight RNAs in drosophilia: accumulation of a novel form of 5S RNA.

    PubMed

    Rubin, G M; Hogness, D S

    1975-10-01

    The synthesis and stability of low molecular weight RNAs following heat shock in Drosophilia melanogaster cell cultures have been examined. When cultures are raised from 25 degrees C to 37 degrees C, the synthesis of tRNA and at least two other low molecular weight RNAs continues at the 25 degree C rate. 5.8S ribosomal RNA and most of the low molecular weight nuclear RNAs are not synthesized. The synthesis of 5S ribosomal RNA is greatly reduced. A large amount of an RNA of about 135 nucleotides in length accumulates at 37 degrees C. Nucleotide sequence analysis reveals that this RNA is a novel form of 5S RNA with approximately 15 additional nucleotides at its 3' end.

  10. Synthesis and Properties of 2′-Deoxy-2′,4′-difluoroarabinose-Modified Nucleic Acids

    PubMed Central

    Martínez-Montero, Saúl; Deleavey, Glen F.; Dierker-Viik, Arden; Lindovska, Petra; Ilina, Tatiana; Portella, Guillem; Orozco, Modesto; Parniak, Michael A.; González, Carlos; Damha, Masad J.

    2015-01-01

    We report the synthesis, thermal stability, and RNase H substrate activity of 2′-deoxy-2′,4′-difluoroarabino-modified nucleic acids. 2′-Deoxy-2′,4′-difluoroarabinouridine (2,′4′-diF-araU) was prepared in a stereoselective way in six steps from 2′-deoxy-2′-fluoroarabinouridine (2′-F-araU). NMR analysis and quantum mechanical calculations at the nucleoside level reveal that introduction of 4′-fluorine introduces a strong bias toward the North conformation, despite the presence of the 2′-βF, which generally steers the sugar pucker toward the South/East conformation. Incorporation of the novel monomer into DNA results on a neutral to slightly stabilizing thermal effect on DNA–RNA hybrids. Insertion of 2′,4′-diF-araU nucleotides in the DNA strand of a DNA–RNA hybrid decreases the rate of both human and HIV reverse transcriptase-associated RNase H-mediated cleavage of the complement RNA strand compared to that for an all-DNA strand or a DNA strand containing the corresponding 2′-F-araU nucleotide units, consistent with the notion that a 4′-fluorine in 2′-F-araU switches the preferred sugar conformation from DNA-like (South/East) to RNA-like (North). PMID:25723361

  11. Preparation, characterization and catalytic properties of MCM-48 supported tungstophosphoric acid mesoporous materials for green synthesis of benzoic acid

    SciTech Connect

    Wu, Hai-Yan; Zhang, Xiao-Li; Chen, Xi; Chen, Ya; Zheng, Xiu-Cheng

    2014-03-15

    MCM-48 and tungstophosphoric acid (HPW) were prepared and applied for the synthesis of HPW/MCM-48 mesoporous materials. The characterization results showed that HPW/MCM-48 obtained retained the typical mesopore structure of MCM-48, and the textural parameters decreased with the increase loading of HPW. The catalytic oxidation results of benzyl alcohol and benzaldehyde with 30% H{sub 2}O{sub 2} indicated that HPW/MCM-48 was an efficient catalyst for the green synthesis of benzoic acid. Furthermore, 35 wt% HPW/MCM-48 sample showed the highest activity under the reaction conditions. Highlights: • 5–45 wt% HPW/MCM-48 mesoporous catalysts were prepared and characterized. • Their catalytic activities for the green synthesis of benzoic acid were investigated. • HPW/MCM-48 was approved to be an efficient catalyst. • 5 wt% HPW/MCM-48 exhibited the highest catalytic activity.

  12. Suppression of glycosaminoglycan synthesis by articular cartilage, but not of hyaluronic acid synthesis by synovium, after exposure to radiation

    SciTech Connect

    Hugenberg, S.T.; Myers, S.L.; Brandt, K.D.

    1989-04-01

    We recently found that injection of 2 mCi of yttrium 90 (90Y; approximately 23,000 rads) into normal canine knees stimulated glycosaminoglycan (GAG) synthesis by femoral condylar cartilage. The present investigation was conducted to determine whether radiation affects cartilage metabolism directly. Rates of GAG synthesis and degradation in normal canine articular cartilage were studied following irradiation. Cultured synovium from the same knees was treated similarly, to determine the effects of irradiation on hyaluronic acid synthesis. Twenty-four hours after exposure to 1,000 rads, 10,000 rads, or 50,000 rads, 35S-GAG synthesis by the cartilage was 93%, 69%, and 37%, respectively, of that in control, nonirradiated cartilage. The effect was not rapidly reversible: 120 hours after exposure to 50,000 rads, GAG synthesis remained at only 28% of the control level. Autoradiography showed marked suppression of 35S uptake by chondrocytes after irradiation. Cartilage GAG degradation was also increased following irradiation: 4 hours and 8 hours after exposure to 50,000 rads, the cartilage GAG concentration was only 66% and 54%, respectively, of that at time 0, while corresponding values for control, nonirradiated cartilage were 90% and 87%. In contrast to its effects on cartilage GAG metabolism, radiation at these levels had no effect on synovial hyaluronic acid synthesis.

  13. Increased long chain acyl-Coa synthetase activity and fatty acid import is linked to membrane synthesis for development of picornavirus replication organelles.

    PubMed

    Nchoutmboube, Jules A; Viktorova, Ekaterina G; Scott, Alison J; Ford, Lauren A; Pei, Zhengtong; Watkins, Paul A; Ernst, Robert K; Belov, George A

    2013-01-01

    All positive strand (+RNA) viruses of eukaryotes replicate their genomes in association with membranes. The mechanisms of membrane remodeling in infected cells represent attractive targets for designing future therapeutics, but our understanding of this process is very limited. Elements of autophagy and/or the secretory pathway were proposed to be hijacked for building of picornavirus replication organelles. However, even closely related viruses differ significantly in their requirements for components of these pathways. We demonstrate here that infection with diverse picornaviruses rapidly activates import of long chain fatty acids. While in non-infected cells the imported fatty acids are channeled to lipid droplets, in infected cells the synthesis of neutral lipids is shut down and the fatty acids are utilized in highly up-regulated phosphatidylcholine synthesis. Thus the replication organelles are likely built from de novo synthesized membrane material, rather than from the remodeled pre-existing membranes. We show that activation of fatty acid import is linked to the up-regulation of cellular long chain acyl-CoA synthetase activity and identify the long chain acyl-CoA syntheatse3 (Acsl3) as a novel host factor required for polio replication. Poliovirus protein 2A is required to trigger the activation of import of fatty acids independent of its protease activity. Shift in fatty acid import preferences by infected cells results in synthesis of phosphatidylcholines different from those in uninfected cells, arguing that the viral replication organelles possess unique properties compared to the pre-existing membranes. Our data show how poliovirus can change the overall cellular membrane homeostasis by targeting one critical process. They explain earlier observations of increased phospholipid synthesis in infected cells and suggest a simple model of the structural development of the membranous scaffold of replication complexes of picorna-like viruses, that may be

  14. Newly identified phosphorylation site in the vesicular stomatitis virus P protein is required for viral RNA synthesis.

    PubMed

    Mondal, Arindam; Victor, Ken G; Pudupakam, R S; Lyons, Charles E; Wertz, Gail W

    2014-02-01

    The vesicular stomatitis virus (VSV) RNA-dependent RNA polymerase consists of two viral proteins; the large (L) protein is the main catalytic subunit, and the phosphoprotein (P) is an essential cofactor for polymerase function. The P protein interacts with the L protein and the N-RNA template, thus connecting the polymerase to the template. P protein also binds to free N protein to maintain it in a soluble, encapsidation-competent form. Previously, five sites of phosphorylation were identified on the P protein and these sites were reported to be differentially important for mRNA synthesis or genomic replication. The previous studies were carried out by biochemical analysis of portions of the authentic viral P protein or by analysis of bacterium-expressed, exogenously phosphorylated P protein by mutagenesis. However, there has been no systematic biochemical search for phosphorylation sites on authentic, virus-expressed P protein. In this study, we analyzed the P protein isolated from VSV-infected cells for sites of phosphorylation by mass spectrometry. We report the identification of Tyr14 as a previously unidentified phosphorylation site of VSV P and show that it is essential for viral transcription and replication. However, our mass spectral analysis failed to observe the phosphorylation of previously reported C-terminal residues Ser226 and Ser227 and mutagenic analyses did not demonstrate a role for these sites in RNA synthesis.

  15. Influence of virgin coconut oil-enriched diet on the transcriptional regulation of fatty acid synthesis and oxidation in rats - a comparative study.

    PubMed

    Arunima, Sakunthala; Rajamohan, Thankappan

    2014-05-28

    The present study was carried out to evaluate the effects of virgin coconut oil (VCO) compared with copra oil, olive oil and sunflower-seed oil on the synthesis and oxidation of fatty acids and the molecular regulation of fatty acid metabolism in normal rats. Male Sprague-Dawley rats were fed the test oils at 8 % for 45 d along with a synthetic diet. Dietary supplementation of VCO decreased tissue lipid levels and reduced the activity of the enzymes involved in lipogenesis, namely acyl CoA carboxylase and fatty acid synthase (FAS) (P< 0·05). Moreover, VCO significantly (P< 0·05) reduced the de novo synthesis of fatty acids by down-regulating the mRNA expression of FAS and its transcription factor, sterol regulatory element-binding protein-1c, compared with the other oils. VCO significantly (P< 0·05) increased the mitochondrial and peroxisomal β-oxidation of fatty acids, which was evident from the increased activities of carnitine palmitoyl transferase I, acyl CoA oxidase and the enzymes involved in mitochondrial β-oxidation; this was accomplished by up-regulating the mRNA expression of PPARα and its target genes involved in fatty acid oxidation. In conclusion, the present results confirmed that supplementation of VCO has beneficial effects on lipid parameters by reducing lipogenesis and enhancing the rate of fatty acid catabolism; this effect was mediated at least in part via PPARα-dependent pathways. Thus, dietary VCO reduces the risk for CHD by beneficially modulating the synthesis and degradation of fatty acids.

  16. Eicosanoid synthesis in cardiomyocytes: influence of hypoxia, reoxygenation, and polyunsaturated fatty acids.

    PubMed

    Oudot, F; Grynberg, A; Sergiel, J P

    1995-01-01

    The synthesis of eicosanoids was investigated in cultured rat ventricular myocytes. Under normoxia, the cardiomyocytes released 6-ketoprostaglandin F1 alpha (6-keto-PGF1 alpha) and prostaglandin (PG) E2 and smaller amounts of PGF2 alpha and thromboxane B2. Hypoxia enhanced the production of PGE2 and PGF2 alpha, whereas the synthesis of 6-keto-PGF1 alpha was not affected. Conversely, posthypoxic reoxygenation greatly increased the synthesis of 6-keto-PGF1 alpha, whereas the synthesis of PGF2 alpha, was not affected and that of PGE2 was reduced. The cardiomyocyte polyunsaturated fatty acid (PUFA) profile was altered by arachidonic acid or eicosapentaenoic acid and docosahexaenoic acid. Under normoxia, the eicosanoid production appeared to be roughly related to the cell phospholipid arachidonic acid content. Conversely, during posthypoxic reoxygenation, the production of eicosanoids was related to the cell phospholipid n-3 PUFA content, with the n-3-rich cells displaying a marked inhibition of the synthesis. This inhibition was mainly attributed to eicosapentaenoic acid and/or docosapentaenoic acid. Whether this inhibition occurs in vivo during postischemic reperfusion, it may contribute to the beneficial effect of n-3 PUFA on the heart.

  17. Diagnosis and treatment of sideroblastic anemias: from defective heme synthesis to abnormal RNA splicing.

    PubMed

    Cazzola, Mario; Malcovati, Luca

    2015-01-01

    The sideroblastic anemias are a heterogeneous group of inherited and acquired disorders characterized by the presence of ring sideroblasts in the bone marrow. X-linked sideroblastic anemia (XLSA) is caused by germline mutations in ALAS2. Hemizygous males have a hypochromic microcytic anemia, which is generally mild to moderate and is caused by defective heme synthesis and ineffective erythropoiesis. XLSA is a typical iron-loading anemia; although most patients are responsive to pyridoxine, treatment of iron overload is also important in the management of these patients. Autosomal recessive sideroblastic anemia attributable to mutations in SLC25A38, a member of the mitochondrial carrier family, is a severe disease: patients present in infancy with microcytic anemia, which soon becomes transfusion dependent. Conservative therapy includes regular red cell transfusion and iron chelation, whereas allogenic stem cell transplantation represents the only curative treatment. Refractory anemia with ring sideroblasts (RARS) is a myelodysplastic syndrome characterized mainly by anemia attributable to ineffective erythropoiesis. The clinical course of RARS is generally indolent, but there is a tendency to worsening of anemia over time, so that most patients become transfusion dependent in the long run. More than 90% of these patients carry somatic mutations in SF3B1, a gene encoding a core component of the RNA splicing machinery. These mutations cause misrecognition of 3' splice sites in downstream genes, resulting in truncated gene products and/or decreased expression attributable to nonsense-mediated RNA decay; this explains the multifactorial pathogenesis of RARS. Variants of RARS include refractory cytopenia with multilineage dysplasia and ring sideroblasts, and RARS associated with marked thrombocytosis; these variants involve additional genetic lesions. Inhibitors of molecules of the transforming growth factor-β superfamily have been shown recently to target ineffective

  18. Characterization of a novel N-acetylneuraminic acid lyase favoring N-acetylneuraminic acid synthesis

    PubMed Central

    Ji, Wenyan; Sun, Wujin; Feng, Jinmei; Song, Tianshun; Zhang, Dalu; Ouyang, Pingkai; Gu, Zhen; Xie, Jingjing

    2015-01-01

    N-Acetylneuraminic acid lyase (NAL, E.C. number 4.1.3.3) is a Class I aldolase that catalyzes the reversible aldol cleavage of N-acetylneuraminic acid (Neu5Ac) from pyruvate and N-acetyl-D-mannosamine (ManNAc). Due to the equilibrium favoring Neu5Ac cleavage, the enzyme catalyzes the rate-limiting step of two biocatalytic reactions producing Neu5Ac in industry. We report the biochemical characterization of a novel NAL from a “GRAS” (General recognized as safe) strain C. glutamicum ATCC 13032 (CgNal). Compared to all previously reported NALs, CgNal exhibited the lowest kcat/Km value for Neu5Ac and highest kcat/Km values for ManNAc and pyruvate, which makes CgNal favor Neu5Ac synthesis the most. The recombinant CgNal reached the highest expression level (480 mg/L culture), and the highest reported yield of Neu5Ac was achieved (194 g/L, 0.63 M). All these unique properties make CgNal a promising biocatalyst for industrial Neu5Ac biosynthesis. Additionally, although showing the best Neu5Ac synthesis activity among the NAL family, CgNal is more related to dihydrodipicolinate synthase (DHDPS) by phylogenetic analysis. The activities of CgNal towards both NAL's and DHDPS' substrates are fairly high, which indicates CgNal a bi-functional enzyme. The sequence analysis suggests that CgNal might have adopted a unique set of residues for substrates recognition. PMID:25799411

  19. Identification of bacteriophage N4 virion RNA polymerase-nucleic acid interactions in transcription complexes.

    PubMed

    Davydova, Elena K; Kaganman, Irene; Kazmierczak, Krystyna M; Rothman-Denes, Lucia B

    2009-01-23

    Bacteriophage N4 mini-virion RNA polymerase (mini-vRNAP), the 1106-amino acid transcriptionally active domain of vRNAP, recognizes single-stranded DNA template-containing promoters composed of conserved sequences and a 3-base loop-5-base pair stem hairpin structure. The major promoter recognition determinants are a purine located at the center of the hairpin loop (-11G) and a base at the hairpin stem (-8G). Mini-vRNAP is an evolutionarily highly diverged member of the T7 family of RNAPs. A two-plasmid system was developed to measure the in vivo activity of mutant mini-vRNAP enzymes. Five mini-vRNAP derivatives, each containing a pair of cysteine residues separated by approximately 100 amino acids and single cysteine-containing enzymes, were generated. These reagents were used to determine the smallest catalytically active polypeptide and to map promoter, substrate, and RNA-DNA hybrid contact sites to single amino acid residues in the enzyme by using end-labeled 5-iododeoxyuridine- and azidophenacyl-substituted oligonucleotides, cross-linkable derivatives of the initiating nucleotide, and RNA products with 5-iodouridine incorporated at specific positions. Localization of functionally important amino acid residues in the recently determined crystal structures of apomini-vRNAP and the mini-vRNAP-promoter complex and comparison with the crystal structures of the T7 RNAP initiation and elongation complexes allowed us to predict major rearrangements in mini-vRNAP in the transition from transcription initiation to elongation similar to those observed in T7 RNAP, a task otherwise precluded by the lack of sequence homology between N4 mini-vRNAP and T7 RNAP.

  20. ANTITUMOR ACTIVITY OF HYALURONIC ACID SYNTHESIS INHIBITOR 4-METHYLUMBELLIFERONE IN PROSTATE CANCER CELLS

    PubMed Central

    Lokeshwar, Vinata B.; Lopez, Luis E.; Munoz, Daniel; Chi, Andrew; Shirodkar, Samir P.; Lokeshwar, Soum D.; Escudero, Diogo O.; Dhir, Neetika; Altman, Norman

    2010-01-01

    4-methylumbelliferone (4-MU) is a hyaluronic acid (HA) synthesis inhibitor with anticancer properties; the mechanism of its anticancer effects is unknown. We evaluated the effects of 4-MU on prostate cancer cells. 4-MU inhibited proliferation, motility and invasion of DU145, PC3-ML, LNCaP, C4-2B and/or LAPC-4 cells. At IC50 for HA synthesis (0.4 mM), 4-MU induced > 3-fold apoptosis in prostate cancer cells, which could be prevented by HA addition. 4-MU induced caspase-8, -9 and -3 activation, PARP cleavage, up-regulation of Fas-L, Fas, FADD and DR4 and down regulation of bcl-2, phospho-bad, bcl-XL, phospho-Akt, phospho-IKB, phospho-ErbB2 and phospho-EGFR. At IC50, 4-MU also caused > 90% inhibition of NFkB reporter activity which was prevented partially by HA addition. With the exception of caveolin-1, HA prevented the 4-MU induced down regulation of HA receptors (CD44, RHAMM), matrix-degrading enzymes (MMP-2, MMP-9), IL-8, and chemokine receptors (CXCR1, CXCR4, CXCR7) at protein and mRNA levels. Expression of myristoylated-Akt rescued 4-MU induced apoptosis and inhibition of cell growth and IL-8, RHAMM, HAS2, CD44 and MMP-9 expression. Oral administration of 4-MU significantly decreased PC3-ML tumor growth (> 3-fold), when treatment was started either on the day of tumor cell injection or after the tumors became palpable, without organ toxicity, changes in serum chemistry or body weight. Tumors from 4-MU treated animals showed reduced microvessel density (~ 3-fold) and HA expression but increased TUNEL positive cells and expression of apoptosis-related molecules. Therefore, anticancer effects of 4-MU, an orally bioavailable and relatively non-toxic agent, are primarily mediated by inhibition of HA signaling. PMID:20332231

  1. Leucine-Enriched Essential Amino Acids Augment Mixed Protein Synthesis, But Not Collagen Protein Synthesis, in Rat Skeletal Muscle after Downhill Running

    PubMed Central

    Kato, Hiroyuki; Suzuki, Hiromi; Inoue, Yoshiko; Suzuki, Katsuya; Kobayashi, Hisamine

    2016-01-01

    Mixed and collagen protein synthesis is elevated for as many as 3 days following exercise. Immediately after exercise, enhanced amino acid availability increases synthesis of mixed muscle protein, but not muscle collagen protein. However, the potential for synergic effects of amino acid ingestion with exercise on both mixed and collagen protein synthesis remains unclear. We investigated muscle collagen protein synthesis in rats following post-exercise ingestion of leucine-enriched essential amino acids. We determined fractional protein synthesis rates (FSR) at different time points following exercise. Mixed protein and collagen protein FSRs in skeletal muscle were determined by measuring protein-bound enrichments of hydroxyproline and proline, and by measuring the intracellular enrichment of proline, using injections of flooding d3-proline doses. A leucine-enriched mixture of essential amino acids (or distilled water as a control) was administrated 30 min or 1 day post-exercise. The collagen protein synthesis in the vastus lateralis was elevated for 2 days after exercise. Although amino acid administration did not increase muscle collagen protein synthesis, it did lead to augmented mixed muscle protein synthesis 1 day following exercise. Thus, contrary to the regulation of mixed muscle protein synthesis, muscle collagen protein synthesis is not affected by amino acid availability after damage-inducing exercise. PMID:27367725

  2. Leucine-Enriched Essential Amino Acids Augment Mixed Protein Synthesis, But Not Collagen Protein Synthesis, in Rat Skeletal Muscle after Downhill Running.

    PubMed

    Kato, Hiroyuki; Suzuki, Hiromi; Inoue, Yoshiko; Suzuki, Katsuya; Kobayashi, Hisamine

    2016-06-28

    Mixed and collagen protein synthesis is elevated for as many as 3 days following exercise. Immediately after exercise, enhanced amino acid availability increases synthesis of mixed muscle protein, but not muscle collagen protein. However, the potential for synergic effects of amino acid ingestion with exercise on both mixed and collagen protein synthesis remains unclear. We investigated muscle collagen protein synthesis in rats following post-exercise ingestion of leucine-enriched essential amino acids. We determined fractional protein synthesis rates (FSR) at different time points following exercise. Mixed protein and collagen protein FSRs in skeletal muscle were determined by measuring protein-bound enrichments of hydroxyproline and proline, and by measuring the intracellular enrichment of proline, using injections of flooding d₃-proline doses. A leucine-enriched mixture of essential amino acids (or distilled water as a control) was administrated 30 min or 1 day post-exercise. The collagen protein synthesis in the vastus lateralis was elevated for 2 days after exercise. Although amino acid administration did not increase muscle collagen protein synthesis, it did lead to augmented mixed muscle protein synthesis 1 day following exercise. Thus, contrary to the regulation of mixed muscle protein synthesis, muscle collagen protein synthesis is not affected by amino acid availability after damage-inducing exercise.

  3. Synthesis of native-like crosslinked duplex RNA and study of its properties.

    PubMed

    Onizuka, Kazumitsu; Hazemi, Madoka E; Thomas, Justin M; Monteleone, Leanna R; Yamada, Ken; Imoto, Shuhei; Beal, Peter A; Nagatsugi, Fumi

    2017-04-01

    A variety of enzymes have been found to interact with double-stranded RNA (dsRNA) in order to carry out its functions. We have endeavored to prepare the covalently crosslinked native-like duplex RNA, which could be useful for biochemical studies and RNA nanotechnology. In this study, the interstrand covalently linked duplex RNA was formed by a crosslinking reaction between vinylpurine (VP) and the target cytosine or uracil in RNA. We measured melting temperatures and CD spectra to identify the properties of the VP crosslinked duplex RNA. The crosslinking formation increased the thermodynamic stability without disturbing the natural conformation of dsRNA. In addition, a competitive binding experiment with the duplex RNA binding enzyme, ADAR2, showed the crosslinked dsRNA bound the protein with nearly the same binding affinity as the natural dsRNA, confirming that it has finely preserved the natural traits of duplex RNA.

  4. Crystal structure of Spot 14, a modulator of fatty acid synthesis

    SciTech Connect

    Colbert, Christopher L.; Kim, Chai-Wan; Moon, Young-Ah; Henry, Lisa; Palnitkar, Maya; McKean, William B.; Fitzgerald, Kevin; Deisenhofer, Johann; Horton, Jay D.; Kwon, Hyock Joo

    2011-09-06

    Spot 14 (S14) is a protein that is abundantly expressed in lipogenic tissues and is regulated in a manner similar to other enzymes involved in fatty acid synthesis. Deletion of S14 in mice decreased lipid synthesis in lactating mammary tissue, but the mechanism of S14's action is unknown. Here we present the crystal structure of S14 to 2.65 {angstrom} and biochemical data showing that S14 can form heterodimers with MIG12. MIG12 modulates fatty acid synthesis by inducing the polymerization and activity of acetyl-CoA carboxylase, the first committed enzymatic reaction in the fatty acid synthesis pathway. Coexpression of S14 and MIG12 leads to heterodimers and reduced acetyl-CoA carboxylase polymerization and activity. The structure of S14 suggests a mechanism whereby heterodimer formation with MIG12 attenuates the ability of MIG12 to activate ACC.

  5. Thermal synthesis and hydrolysis of polyglyceric acid. [in orgin of life studying

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1989-01-01

    Polyglyceric acid was synthesized by thermal condensation of glyceric acid at 80 C in the presence and absence of two mole percent of sulfuric acid catalyst. The acid catalyst accelerated the polymerization over 100-fold and made possible the synthesis of insoluble polymers of both L- and DL-glyceric acid by heating for less than 1 day. Racemization of L-glyceric acid yielded less than 1 percent D-glyceric acid in condensations carried out at 80 C with catalyst for 1 day and without catalyst for 12 days. The condensation of L-glyceric acid yielded an insoluble polymer much more readily than condensation of DL-glyceric acid. Studies of the hydrolysis of poly-DL-glyceric acid revealed that it was considerably more stable under mild acidic conditions compared to neutral pH. The relationship of this study to the origin of life is discussed.

  6. Extracellular vesicles for nucleic acid delivery: progress and prospects for safe RNA-based gene therapy.

    PubMed

    Jiang, L; Vader, P; Schiffelers, R M

    2017-03-01

    Nucleic acid-based drugs offer a potentially effective tool for treatment of a variety of diseases, including cancer, cardiovascular diseases, neurological disorders and infectious diseases. However, clinical applications are hindered by instability of RNA molecules in the circulation and lack of efficient vectors that can deliver RNAs to target tissues and into diseased target cells. Synthetic polymer and lipids as well as virus-based vectors are among the most widely explored vehicles for RNA delivery, but clinical progress has been limited as a result of issues related to toxicity, immunogenicity and low efficiency. Most recently, the discovery that extracellular vesicles (EVs) are endogenous RNA carriers, which may display better biocompatibility and higher delivery efficiency as compared with the synthetic systems, has provided a ray of hope in coping with the delivery dilemma, and EV-based gene therapy has already sparked general interest both in academia and industry. In this review, the current knowledge on EV biology and their role in cell-cell communication will be summarized. Promises of EVs as drug carriers and recent technologies on tailoring EVs' biological attributes will be included, and preclinical studies in which EVs have shown promise for therapeutic RNA delivery will be discussed.

  7. Regulation of mRNA abundance in activated T lymphocytes: identification of mRNA species affected by the inhibition of protein synthesis.

    PubMed Central

    Coleclough, C; Kuhn, L; Lefkovits, I

    1990-01-01

    Inhibition of protein synthesis has often been observed to increase the concentration of mRNAs that encode proteins associated with the regulation of cell division. As two-dimensional gel electrophoresis permits the simultaneous monitoring of individual elements in large populations of gene products, we have used this technique to assess the effect of cycloheximide treatment on the mRNA complement of activated mouse T cells in an objective fashion. Two-dimensional gels of proteins generated by cell-free translation of mRNA from T-cell blasts display about 400 spots; only 5 of these are reproducibly enhanced by cycloheximide treatment and about 4 are diminished. The cDNA cloning vector lambda jac allows analysis of large arrays of molecular clones by cell-free expression, and we have used it in a sibling selection scheme to isolate a clone of one of the prominently induced mRNA species, which we refer to as chx1. chx1 mRNA concentration is increased by cycloheximide treatment of activated B cells, as well as T cells, and it is rapidly and transiently induced, in a cycloheximide-enhanced manner, upon serum stimulation of resting 3T3 fibroblastoid cells. The chx1 protein is hydrophilic, is slightly basic, and has patches of homology with the Jun-D gene product. The chx1 gene is remarkable in its lack of detectable introns and of strong bias against CpG dinucleotides. Images PMID:2308934

  8. On-Electrode Synthesis of Shape-Controlled Hierarchical Flower-Like Gold Nanostructures for Efficient Interfacial DNA Assembly and Sensitive Electrochemical Sensing of MicroRNA.

    PubMed

    Su, Shao; Wu, Yan; Zhu, Dan; Chao, Jie; Liu, Xingfen; Wan, Ying; Su, Yan; Zuo, Xiaolei; Fan, Chunhai; Wang, Lianhui

    2016-07-01

    The performance for biomolecular detection is closely associated with the interfacial structure of a biosensor, which profoundly affects both thermodynamics and kinetics of the assembly, binding and signal transduction of biomolecules. Herein, it is reported on a one-step and template-free on-electrode synthesis method for making shape-controlled gold nanostructures on indium tin oxide substrates, which provide an electrochemical sensing platform for ultrasensitive detection of nucleic acids. Thus-prepared hierarchical flower-like gold nanostructures (HFGNs) possess large surface area that can readily accommodate the assembly of DNA probes for subsequent hybridization detection. It is found that the sensitivity for electrochemical DNA sensing is critically dependent on the morphology of HFGNs. By using this new strategy, a highly sensitive electrochemical biosensor is developed for label-free detection of microRNA-21 (miRNA-21), a biomarker for lung cancers. Importantly, it is demonstrated that this biosensor can be employed to measure the miRNA-21 expression level from human lung cancer cell (A549) lysates and worked well in 100% serum, suggesting its potential for applications in clinical diagnosis and a wide range of bioanalysis.

  9. The role of 23S ribosomal RNA residue A2451 in peptide bond synthesis revealed by atomic mutagenesis.

    PubMed

    Lang, Kathrin; Erlacher, Matthias; Wilson, Daniel N; Micura, Ronald; Polacek, Norbert

    2008-05-01

    Peptide bond formation is a fundamental reaction in biology, catalyzed by the ribosomal peptidyl-transferase ribozyme. Although all active-site 23S ribosomal RNA nucleotides are universally conserved, atomic mutagenesis suggests that these nucleobases do not carry functional groups directly involved in peptide bond formation. Instead, a single ribose 2'-hydroxyl group at A2451 was identified to be of pivotal importance. Here, we altered the chemical characteristics by replacing its 2'-hydroxyl with selected functional groups and demonstrate that hydrogen donor capability is essential for transpeptidation. We propose that the A2451-2'-hydroxyl directly hydrogen bonds to the P-site tRNA-A76 ribose. This promotes an effective A76 ribose C2'-endo conformation to support amide synthesis via a proton shuttle mechanism. Simultaneously, the direct interaction of A2451 with A76 renders the intramolecular transesterification of the peptide from the 3'- to 2'-oxygen unfeasible, thus promoting effective peptide bond synthesis.

  10. RNA Crystallization

    NASA Technical Reports Server (NTRS)

    Golden, Barbara L.; Kundrot, Craig E.

    2003-01-01

    RNA molecules may be crystallized using variations of the methods developed for protein crystallography. As the technology has become available to syntheisize and purify RNA molecules in the quantities and with the quality that is required for crystallography, the field of RNA structure has exploded. The first consideration when crystallizing an RNA is the sequence, which may be varied in a rational way to enhance crystallizability or prevent formation of alternate structures. Once a sequence has been designed, the RNA may be synthesized chemically by solid-state synthesis, or it may be produced enzymatically using RNA polymerase and an appropriate DNA template. Purification of milligram quantities of RNA can be accomplished by HPLC or gel electrophoresis. As with proteins, crystallization of RNA is usually accomplished by vapor diffusion techniques. There are several considerations that are either unique to RNA crystallization or more important for RNA crystallization. Techniques for design, synthesis, purification, and crystallization of RNAs will be reviewed here.

  11. Noninvasive molecular imaging of MYC mRNA expression in human breast cancer xenografts with a [99mTc]peptide-peptide nucleic acid-peptide chimera.

    PubMed

    Tian, Xiaobing; Aruva, Mohan R; Qin, Wenyi; Zhu, Weizhu; Sauter, Edward R; Thakur, Mathew L; Wickstrom, Eric

    2005-01-01

    Human estrogen receptor-positive breast cancer cells typically display elevated levels of Myc protein due to overexpression of MYC mRNA, and elevated insulin-like growth factor 1 receptor (IGF1R) due to overexpression of IGF1R mRNA. We hypothesized that scintigraphic detection of MYC peptide nucleic acid (PNA) probes with an IGF1 peptide loop on the C-terminus, and a [99mTc]chelator peptide on the N-terminus, could measure levels of MYC mRNA noninvasively in human IGF1R-overexpressing MCF7 breast cancer xenografts in nude mice. We prepared the chelator-MYC PNA-IGF1 peptide, as well as a 4-nt mismatch PNA control, by solid-phase synthesis. We imaged MCF7 xenografts scintigraphically and measured the distribution of [99mTc]probes by scintillation counting of dissected tissues. MCF7 xenografts in nude mice were visualized at 4 and 24 h after tail vein administration of the [99mTc]PNA probe specific for MYC mRNA, but not with the mismatch control. The [99mTc]probes distributed normally to the kidneys, livers, tumors, and other tissues. Molecular imaging of oncogene mRNAs in solid tumors with radiolabel-PNA-peptide chimeras might provide additional genetic characterization of preinvasive and invasive breast cancers.

  12. tRNA synthase suppression activates de novo cysteine synthesis to compensate for cystine and glutathione deprivation during ferroptosis.

    PubMed

    Shimada, Kenichi; Stockwell, Brent R

    2016-03-01

    Glutathione is a major endogenous reducing agent in cells, and cysteine is a limiting factor in glutathione synthesis. Cysteine is obtained by uptake or biosynthesis, and mammalian cells often rely on either one or the other pathway. Because of the scarcity of glutathione, blockade of cysteine uptake causes oxidative cell death known as ferroptosis. A new study suggests that tRNA synt