Science.gov

Sample records for acid sequence diversity

  1. Prebiotically plausible mechanisms increase compositional diversity of nucleic acid sequences

    PubMed Central

    Derr, Julien; Manapat, Michael L.; Rajamani, Sudha; Leu, Kevin; Xulvi-Brunet, Ramon; Joseph, Isaac; Nowak, Martin A.; Chen, Irene A.

    2012-01-01

    During the origin of life, the biological information of nucleic acid polymers must have increased to encode functional molecules (the RNA world). Ribozymes tend to be compositionally unbiased, as is the vast majority of possible sequence space. However, ribonucleotides vary greatly in synthetic yield, reactivity and degradation rate, and their non-enzymatic polymerization results in compositionally biased sequences. While natural selection could lead to complex sequences, molecules with some activity are required to begin this process. Was the emergence of compositionally diverse sequences a matter of chance, or could prebiotically plausible reactions counter chemical biases to increase the probability of finding a ribozyme? Our in silico simulations using a two-letter alphabet show that template-directed ligation and high concatenation rates counter compositional bias and shift the pool toward longer sequences, permitting greater exploration of sequence space and stable folding. We verified experimentally that unbiased DNA sequences are more efficient templates for ligation, thus increasing the compositional diversity of the pool. Our work suggests that prebiotically plausible chemical mechanisms of nucleic acid polymerization and ligation could predispose toward a diverse pool of longer, potentially structured molecules. Such mechanisms could have set the stage for the appearance of functional activity very early in the emergence of life. PMID:22319215

  2. tax and rex Sequences of bovine leukaemia virus from globally diverse isolates: rex amino acid sequence more variable than tax.

    PubMed

    McGirr, K M; Buehring, G C

    2005-02-01

    Bovine leukaemia virus (BLV) is an important agricultural problem with high costs to the dairy industry. Here, we examine the variation of the tax and rex genes of BLV. The tax and rex genes share 420 bases and have overlapping reading frames. The tax gene encodes a protein that functions as a transactivator of the BLV promoter, is required for viral replication, acts on cellular promoters, and is responsible for oncogenesis. The rex facilitates the export of viral mRNAs from the nucleus and regulates transcription. We have sequenced five new isolates of the tax/rex gene. We examined the five new and three previously published tax/rex DNA and predicted amino acid sequences of BLV isolates from cattle in representative regions worldwide. The highest variation among nucleic acid sequences for tax and rex was 7% and 5%, respectively; among predicted amino acid sequences for Tax and Rex, 9% and 11%, respectively. Significantly more nucleotide changes resulted in predicted amino acid changes in the rex gene than in the tax gene (P < or = 0.0006). This variability is higher than previously reported for any region of the viral genome. This research may also have implications for the development of Tax-based vaccines. PMID:15702995

  3. Amino acid sequence diversity of the major human papillomavirus capsid protein: implications for current and next generation vaccines.

    PubMed

    Ahmed, Amina I; Bissett, Sara L; Beddows, Simon

    2013-08-01

    Despite the fidelity of host cell polymerases, the human papillomavirus (HPV) displays a degree of genomic polymorphism resulting in distinct genotypes and intra-type variants. The current HPV vaccines target the most prevalent genotypes associated with cervical cancer (HPV16/18) and genital warts (HPV6/11). Although these vaccines confer some measure of cross-protection, a multivalent HPV vaccine is in the pipeline that aims to broaden vaccine protection against other cervical cancer-associated genotypes including HPV31, HPV33, HPV45, HPV52 and HPV58. Both current and next generation vaccines comprise virus-like particles, based upon the major capsid protein, L1, and vaccine-induced, type-specific protection is likely mediated by neutralizing antibodies targeting L1 surface-exposed domains. The aim of this study was to perform an in silico analysis of existing full length L1 sequences representing vaccine-relevant HPV genotypes in order to address the degree of naturally-occurring, intra-type polymorphisms. In total, 1281 sequences from the Americas, Africa, Asia and Europe were assembled. Intra-type entropy was low and/or limited to non-surface-exposed residues for HPV6, HPV11 and HPV52 suggesting a minimal effect on vaccine antibodies for these genotypes. For HPV16, intra-type entropy was high but the present analysis did not reveal any significant polymorphisms not previously identified. For HPV31, HPV33, HPV58, however, intra-type entropy was high, mostly mapped to surface-exposed domains and in some cases within known neutralizing antibody epitopes. For HPV18 and HPV45 there were too few sequences for a definitive analysis, but HPV45 displayed some degree of surface-exposed residue diversity. In most cases, the reference sequence for each genotype represented a minority variant and the consensus L1 sequences for HPV18, HPV31, HPV45 and HPV58 did not reflect the L1 sequence of the currently available HPV pseudoviruses. These data highlight a number of variant

  4. The sequence diversity and expression among genes of the folic acid biosynthesis pathway in industrial Saccharomyces strains.

    PubMed

    Goncerzewicz, Anna; Misiewicz, Anna

    2015-01-01

    Folic acid is an important vitamin in human nutrition and its deficiency in pregnant women's diets results in neural tube defects and other neurological damage to the fetus. Additionally, DNA synthesis, cell division and intestinal absorption are inhibited in case of adults. Since this discovery, governments and health organizations worldwide have made recommendations concerning folic acid supplementation of food for women planning to become pregnant. In many countries this has led to the introduction of fortifications, where synthetic folic acid is added to flour. It is known that Saccharomyces strains (brewing and bakers' yeast) are one of the main producers of folic acid and they can be used as a natural source of this vitamin. Proper selection of the most efficient strains may enhance the folate content in bread, fermented vegetables, dairy products and beer by 100% and may be used in the food industry. The objective of this study was to select the optimal producing yeast strain by determining the differences in nucleotide sequences in the FOL2, FOL3 and DFR1 genes of folic acid biosynthesis pathway. The Multitemperature Single Strand Conformation Polymorphism (MSSCP) method and further nucleotide sequencing for selected strains were applied to indicate SNPs in selected gene fragments. The RT qPCR technique was also applied to examine relative expression of the FOL3 gene. Furthermore, this is the first time ever that industrial yeast strains were analysed regarding genes of the folic acid biosynthesis pathway. It was observed that a correlation exists between the folic acid amount produced by industrial yeast strains and changes in the nucleotide sequence of adequate genes. The most significant changes occur in the DFR1 gene, mostly in the first part, which causes major protein structure modifications in KKP 232, KKP 222 and KKP 277 strains. Our study shows that the large amount of SNP contributes to impairment of the selected enzymes and S. cerevisiae and S

  5. The sequence diversity and expression among genes of the folic acid biosynthesis pathway in industrial Saccharomyces strains.

    PubMed

    Goncerzewicz, Anna; Misiewicz, Anna

    2015-01-01

    Folic acid is an important vitamin in human nutrition and its deficiency in pregnant women's diets results in neural tube defects and other neurological damage to the fetus. Additionally, DNA synthesis, cell division and intestinal absorption are inhibited in case of adults. Since this discovery, governments and health organizations worldwide have made recommendations concerning folic acid supplementation of food for women planning to become pregnant. In many countries this has led to the introduction of fortifications, where synthetic folic acid is added to flour. It is known that Saccharomyces strains (brewing and bakers' yeast) are one of the main producers of folic acid and they can be used as a natural source of this vitamin. Proper selection of the most efficient strains may enhance the folate content in bread, fermented vegetables, dairy products and beer by 100% and may be used in the food industry. The objective of this study was to select the optimal producing yeast strain by determining the differences in nucleotide sequences in the FOL2, FOL3 and DFR1 genes of folic acid biosynthesis pathway. The Multitemperature Single Strand Conformation Polymorphism (MSSCP) method and further nucleotide sequencing for selected strains were applied to indicate SNPs in selected gene fragments. The RT qPCR technique was also applied to examine relative expression of the FOL3 gene. Furthermore, this is the first time ever that industrial yeast strains were analysed regarding genes of the folic acid biosynthesis pathway. It was observed that a correlation exists between the folic acid amount produced by industrial yeast strains and changes in the nucleotide sequence of adequate genes. The most significant changes occur in the DFR1 gene, mostly in the first part, which causes major protein structure modifications in KKP 232, KKP 222 and KKP 277 strains. Our study shows that the large amount of SNP contributes to impairment of the selected enzymes and S. cerevisiae and S

  6. High genetic diversity among strains of the unindustrialized lactic acid bacterium Carnobacterium maltaromaticum in dairy products as revealed by multilocus sequence typing.

    PubMed

    Rahman, Abdur; Cailliez-Grimal, Catherine; Bontemps, Cyril; Payot, Sophie; Chaillou, Stéphane; Revol-Junelles, Anne-Marie; Borges, Frédéric

    2014-07-01

    Dairy products are colonized with three main classes of lactic acid bacteria (LAB): opportunistic bacteria, traditional starters, and industrial starters. Most of the population structure studies were previously performed with LAB species belonging to these three classes and give interesting knowledge about the population structure of LAB at the stage where they are already industrialized. However, these studies give little information about the population structure of LAB prior their use as an industrial starter. Carnobacterium maltaromaticum is a LAB colonizing diverse environments, including dairy products. Since this bacterium was discovered relatively recently, it is not yet commercialized as an industrial starter, which makes C. maltaromaticum an interesting model for the study of unindustrialized LAB population structure in dairy products. A multilocus sequence typing scheme based on an analysis of fragments of the genes dapE, ddlA, glpQ, ilvE, pyc, pyrE, and leuS was applied to a collection of 47 strains, including 28 strains isolated from dairy products. The scheme allowed detecting 36 sequence types with a discriminatory index of 0.98. The whole population was clustered in four deeply branched lineages, in which the dairy strains were spread. Moreover, the dairy strains could exhibit a high diversity within these lineages, leading to an overall dairy population with a diversity level as high as that of the nondairy population. These results are in agreement with the hypothesis according to which the industrialization of LAB leads to a diversity reduction in dairy products.

  7. Genome sequences of eight morphologically diverse Alphaproteobacteria.

    PubMed

    Brown, Pamela J B; Kysela, David T; Buechlein, Aaron; Hemmerich, Chris; Brun, Yves V

    2011-09-01

    The Alphaproteobacteria comprise morphologically diverse bacteria, including many species of stalked bacteria. Here we announce the genome sequences of eight alphaproteobacteria, including the first genome sequences of species belonging to the genera Asticcacaulis, Hirschia, Hyphomicrobium, and Rhodomicrobium. PMID:21705585

  8. Composition for nucleic acid sequencing

    SciTech Connect

    Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu

    2008-08-26

    The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

  9. High speed nucleic acid sequencing

    SciTech Connect

    Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu

    2011-05-17

    The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid. Each type of labeled nucleotide comprises an acceptor fluorophore attached to a phosphate portion of the nucleotide such that the fluorophore is removed upon incorporation into a growing strand. Fluorescent signal is emitted via fluorescent resonance energy transfer between the donor fluorophore and the acceptor fluorophore as each nucleotide is incorporated into the growing strand. The sequence is deduced by identifying which base is being incorporated into the growing strand.

  10. Castor bean organelle genome sequencing and worldwide genetic diversity analysis.

    PubMed

    Rivarola, Maximo; Foster, Jeffrey T; Chan, Agnes P; Williams, Amber L; Rice, Danny W; Liu, Xinyue; Melake-Berhan, Admasu; Huot Creasy, Heather; Puiu, Daniela; Rosovitz, M J; Khouri, Hoda M; Beckstrom-Sternberg, Stephen M; Allan, Gerard J; Keim, Paul; Ravel, Jacques; Rabinowicz, Pablo D

    2011-01-01

    Castor bean is an important oil-producing plant in the Euphorbiaceae family. Its high-quality oil contains up to 90% of the unusual fatty acid ricinoleate, which has many industrial and medical applications. Castor bean seeds also contain ricin, a highly toxic Type 2 ribosome-inactivating protein, which has gained relevance in recent years due to biosafety concerns. In order to gain knowledge on global genetic diversity in castor bean and to ultimately help the development of breeding and forensic tools, we carried out an extensive chloroplast sequence diversity analysis. Taking advantage of the recently published genome sequence of castor bean, we assembled the chloroplast and mitochondrion genomes extracting selected reads from the available whole genome shotgun reads. Using the chloroplast reference genome we used the methylation filtration technique to readily obtain draft genome sequences of 7 geographically and genetically diverse castor bean accessions. These sequence data were used to identify single nucleotide polymorphism markers and phylogenetic analysis resulted in the identification of two major clades that were not apparent in previous population genetic studies using genetic markers derived from nuclear DNA. Two distinct sub-clades could be defined within each major clade and large-scale genotyping of castor bean populations worldwide confirmed previously observed low levels of genetic diversity and showed a broad geographic distribution of each sub-clade.

  11. Castor Bean Organelle Genome Sequencing and Worldwide Genetic Diversity Analysis

    PubMed Central

    Chan, Agnes P.; Williams, Amber L.; Rice, Danny W.; Liu, Xinyue; Melake-Berhan, Admasu; Huot Creasy, Heather; Puiu, Daniela; Rosovitz, M. J.; Khouri, Hoda M.; Beckstrom-Sternberg, Stephen M.; Allan, Gerard J.; Keim, Paul; Ravel, Jacques; Rabinowicz, Pablo D.

    2011-01-01

    Castor bean is an important oil-producing plant in the Euphorbiaceae family. Its high-quality oil contains up to 90% of the unusual fatty acid ricinoleate, which has many industrial and medical applications. Castor bean seeds also contain ricin, a highly toxic Type 2 ribosome-inactivating protein, which has gained relevance in recent years due to biosafety concerns. In order to gain knowledge on global genetic diversity in castor bean and to ultimately help the development of breeding and forensic tools, we carried out an extensive chloroplast sequence diversity analysis. Taking advantage of the recently published genome sequence of castor bean, we assembled the chloroplast and mitochondrion genomes extracting selected reads from the available whole genome shotgun reads. Using the chloroplast reference genome we used the methylation filtration technique to readily obtain draft genome sequences of 7 geographically and genetically diverse castor bean accessions. These sequence data were used to identify single nucleotide polymorphism markers and phylogenetic analysis resulted in the identification of two major clades that were not apparent in previous population genetic studies using genetic markers derived from nuclear DNA. Two distinct sub-clades could be defined within each major clade and large-scale genotyping of castor bean populations worldwide confirmed previously observed low levels of genetic diversity and showed a broad geographic distribution of each sub-clade. PMID:21750729

  12. Capsid protein sequence diversity of avian nephritis virus.

    PubMed

    Todd, D; Trudgett, J; Smyth, V J; Donnelly, B; McBride, N; Welsh, M D

    2011-06-01

    The capsid gene sequences of 25 avian nephritis viruses (ANVs), collected in the UK, Germany and Belgium from the 1980s to 2008, were determined and compared with those of serotype 1 (ANV-1) and serotype 2 (ANV-2) ANV isolates. Amino acid identities as low as 51% were determined. Pairwise comparisons supported by phylogenetic analysis identified six ANVs, including ANV-1 and ANV-2, which shared<80% amino acid identities with one another, and which were selected to be representative of six groups. The ANVs were not distributed according to geographical location or year of sampling, and the detection of ANVs from five different groups in 11 samples sourced from six flocks belonging to the same UK organization within a 4-month period indicated that sequence-diverse ANVs were co-circulating. Amino acid alignments demonstrated the existence of variable regions throughout the capsid protein, nine of which were selected for detailed comparisons. With most ANVs, the variable region sequences were similar to those of one of the six representative ANVs, but some ANV capsids displayed novel variable region profiles, in which variable regions that were characteristic of more than one representative ANV were present. Phylogenetic analysis based on C-terminal sequences of approximately 260 amino acids and SimPlot analysis provided evidence that RNA recombination events located in the 1250 to 1350 nucleotide region resulted in new combinations of the N-terminal and C-terminal capsid regions. The high level of capsid sequence diversity observed in the present study has important implications for both the control and diagnosis of ANV infections.

  13. Sequence diversity and evolution of antimicrobial peptides in invertebrates.

    PubMed

    Tassanakajon, Anchalee; Somboonwiwat, Kunlaya; Amparyup, Piti

    2015-02-01

    Antimicrobial peptides (AMPs) are evolutionarily ancient molecules that act as the key components in the invertebrate innate immunity against invading pathogens. Several AMPs have been identified and characterized in invertebrates, and found to display considerable diversity in their amino acid sequence, structure and biological activity. AMP genes appear to have rapidly evolved, which might have arisen from the co-evolutionary arms race between host and pathogens, and enabled organisms to survive in different microbial environments. Here, the sequence diversity of invertebrate AMPs (defensins, cecropins, crustins and anti-lipopolysaccharide factors) are presented to provide a better understanding of the evolution pattern of these peptides that play a major role in host defense mechanisms.

  14. Menagerie of Viruses: Diverse Chemical Sequences or Simple Electrostatics?

    NASA Astrophysics Data System (ADS)

    Muthukumar, M.

    2008-03-01

    The genome packing in hundreds of viruses is investigated by analyzing the chemical sequences of the genomes and the corresponding capsid proteins, in combination with experimental facts on the structures of the packaged genomes. Based on statistical mechanics arguments and computer simulations, we have derived a universal model, based simply on non-specific electrostatic interactions. Our model is able to predict the essential aspects of genome packing in diversely different viruses, such as the genome size and its density distribution. Our result is in contrast to the long-held view that specific interactions between the sequenced amino acid residues and the nucleotides of the genome control the genome packing. Implications of this finding in the evolution and biotechnology will be discussed.

  15. Chip-based sequencing nucleic acids

    SciTech Connect

    Beer, Neil Reginald

    2014-08-26

    A system for fast DNA sequencing by amplification of genetic material within microreactors, denaturing, demulsifying, and then sequencing the material, while retaining it in a PCR/sequencing zone by a magnetic field. One embodiment includes sequencing nucleic acids on a microchip that includes a microchannel flow channel in the microchip. The nucleic acids are isolated and hybridized to magnetic nanoparticles or to magnetic polystyrene-coated beads. Microreactor droplets are formed in the microchannel flow channel. The microreactor droplets containing the nucleic acids and the magnetic nanoparticles are retained in a magnetic trap in the microchannel flow channel and sequenced.

  16. Diversity of amino acids in a typical chernozem of Moldova

    NASA Astrophysics Data System (ADS)

    Frunze, N. I.

    2014-12-01

    The content and composition of the amino acids in typical chernozems were studied. The objects of the study included a reference soil under an old fallow and three variants under fodder crop rotations: not fertilized, with mineral fertilizers, and with organic fertilizers. The contents of 18 amino acids were determined in these soils. The amino acids were extracted by the method of acid hydrolysis and identified by the method of ion-exchange chromatography. The total content of most of the amino acids was maximal in the reference soil; it was much lower in the cultivated soils and decreased in the following sequence: organic background > mineral background > no fertilization. The diversity of amino acids was evaluated quantitatively using different parameters applied in ecology for estimating various aspects of the species composition of communities (Simpson, Margalef, Menhinick, and Shannon's indices). The diversity and contribution of different amino acids to the total pool of amino acids also varied significantly in the studied variants. The maximum diversity of amino acids and maximum evenness of their relative abundance indices were typical of the reference chernozem; these parameters were lower in the cultivated soils. It was concluded that the changes in the structure of the amino acids under the impact of agricultural loads are similar to those that are usually observed under stress conditions.

  17. Distinguishing proteins from arbitrary amino acid sequences.

    PubMed

    Yau, Stephen S-T; Mao, Wei-Guang; Benson, Max; He, Rong Lucy

    2015-01-01

    What kinds of amino acid sequences could possibly be protein sequences? From all existing databases that we can find, known proteins are only a small fraction of all possible combinations of amino acids. Beginning with Sanger's first detailed determination of a protein sequence in 1952, previous studies have focused on describing the structure of existing protein sequences in order to construct the protein universe. No one, however, has developed a criteria for determining whether an arbitrary amino acid sequence can be a protein. Here we show that when the collection of arbitrary amino acid sequences is viewed in an appropriate geometric context, the protein sequences cluster together. This leads to a new computational test, described here, that has proved to be remarkably accurate at determining whether an arbitrary amino acid sequence can be a protein. Even more, if the results of this test indicate that the sequence can be a protein, and it is indeed a protein sequence, then its identity as a protein sequence is uniquely defined. We anticipate our computational test will be useful for those who are attempting to complete the job of discovering all proteins, or constructing the protein universe. PMID:25609314

  18. Method for sequencing nucleic acid molecules

    DOEpatents

    Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu

    2006-06-06

    The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

  19. Method for sequencing nucleic acid molecules

    DOEpatents

    Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu

    2006-05-30

    The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

  20. Bovine Parathyroid Hormone: Amino Acid Sequence

    PubMed Central

    Brewer, H. Bryan; Ronan, Rosemary

    1970-01-01

    Bovine parathyroid hormone has been isolated in homogeneous form, and its complete amino acid sequence determined. The bovine hormone is a single chain, 84 amino acids long. It contains amino-terminal alanine, and carboxyl-terminal glutamine. The bovine parathyroid hormone is approximately three times the length of the newly discovered hormone, thyrocalcitonin, whose action is reciprocal to parathyroid hormone. Images PMID:5275384

  1. DIVEIN: a web server to analyze phylogenies, sequence divergence, diversity, and informative sites.

    PubMed

    Deng, Wenjie; Maust, Brandon S; Nickle, David C; Learn, Gerald H; Liu, Yi; Heath, Laura; Kosakovsky Pond, Sergei L; Mullins, James I

    2010-05-01

    DIVEIN is a web interface that performs automated phylogenetic and other analyses of nucleotide and amino acid sequences. Starting with a set of aligned sequences, DIVEIN estimates evolutionary parameters and phylogenetic trees while allowing the user to choose from a variety of evolutionary models; it then reconstructs the consensus (CON), most recent common ancestor (MRCA), and center of tree (COT) sequences. DIVEIN also provides tools for further analyses, including condensing sequence alignments to show only informative sites or private mutations; computing phylogenetic or pairwise divergence from any user-specified sequence (CON, MRCA, COT, or existing sequence from the alignment); computing and outputting all genetic distances in column format; calculating summary statistics of diversity and divergence from pairwise distances; and graphically representing the inferred tree and plots of divergence, diversity, and distance distribution histograms. DIVEIN is available at http://indra.mullins.microbiol.washington.edu/DIVEIN.

  2. Estimating the diversity of peptide populations from limited sequence data.

    SciTech Connect

    Makowski, L.; Soares, A.; Biosciences Division; BNL

    2003-03-01

    Combinatorial libraries of peptides such as those displayed on the surface of a bacteriophage particle have become widely used tools for characterizing protein-protein and protein-small molecule interactions. The quality of a library frequently depends on its completeness, or diversity -- the proportion of possible sequences actually present in the library. The diversity of these libraries is frequently quoted on the basis of phage titers that provide little information about their completeness. Here, an analytical expression for diversity is introduced and a method for estimating the diversity of a peptide library from the sequences of a limited number of the members of the library is demonstrated. The diversities of a number of computationally constructed and actual peptide libraries are estimated using this method.

  3. Estimating Protistan Diversity Using High-Throughput Sequencing.

    PubMed

    Hu, Sarah K; Liu, Zhenfeng; Lie, Alle A Y; Countway, Peter D; Kim, Diane Y; Jones, Adriane C; Gast, Rebecca J; Cary, S Craig; Sherr, Evelyn B; Sherr, Barry F; Caron, David A

    2015-01-01

    Sequencing hypervariable regions from the 18S rRNA gene is commonly employed to characterize protistan biodiversity, yet there are concerns that short reads do not provide the same taxonomic resolution as full-length sequences. A total of 7,432 full-length sequences were used to perform an in silico analysis of how sequences of various lengths and target regions impact downstream ecological interpretations. Sequences that were longer than 400 nucleotides and included the V4 hypervariable region generated results similar to those derived from full-length 18S rRNA gene sequences. Present high-throughput sequencing capabilities are approaching protistan diversity estimation comparable to whole gene sequences.

  4. Sequences Of Amino Acids For Human Serum Albumin

    NASA Technical Reports Server (NTRS)

    Carter, Daniel C.

    1992-01-01

    Sequences of amino acids defined for use in making polypeptides one-third to one-sixth as large as parent human serum albumin molecule. Smaller, chemically stable peptides have diverse applications including service as artificial human serum and as active components of biosensors and chromatographic matrices. In applications involving production of artificial sera from new sequences, little or no concern about viral contaminants. Smaller genetically engineered polypeptides more easily expressed and produced in large quantities, making commercial isolation and production more feasible and profitable.

  5. Phenolic acid esterases, coding sequences and methods

    DOEpatents

    Blum, David L.; Kataeva, Irina; Li, Xin-Liang; Ljungdahl, Lars G.

    2002-01-01

    Described herein are four phenolic acid esterases, three of which correspond to domains of previously unknown function within bacterial xylanases, from XynY and XynZ of Clostridium thermocellum and from a xylanase of Ruminococcus. The fourth specifically exemplified xylanase is a protein encoded within the genome of Orpinomyces PC-2. The amino acids of these polypeptides and nucleotide sequences encoding them are provided. Recombinant host cells, expression vectors and methods for the recombinant production of phenolic acid esterases are also provided.

  6. Method for identifying and quantifying nucleic acid sequence aberrations

    DOEpatents

    Lucas, J.N.; Straume, T.; Bogen, K.T.

    1998-07-21

    A method is disclosed for detecting nucleic acid sequence aberrations by detecting nucleic acid sequences having both a first and a second nucleic acid sequence type, the presence of the first and second sequence type on the same nucleic acid sequence indicating the presence of a nucleic acid sequence aberration. The method uses a first hybridization probe which includes a nucleic acid sequence that is complementary to a first sequence type and a first complexing agent capable of attaching to a second complexing agent and a second hybridization probe which includes a nucleic acid sequence that selectively hybridizes to the second nucleic acid sequence type over the first sequence type and includes a detectable marker for detecting the second hybridization probe. 11 figs.

  7. Method for identifying and quantifying nucleic acid sequence aberrations

    DOEpatents

    Lucas, Joe N.; Straume, Tore; Bogen, Kenneth T.

    1998-01-01

    A method for detecting nucleic acid sequence aberrations by detecting nucleic acid sequences having both a first and a second nucleic acid sequence type, the presence of the first and second sequence type on the same nucleic acid sequence indicating the presence of a nucleic acid sequence aberration. The method uses a first hybridization probe which includes a nucleic acid sequence that is complementary to a first sequence type and a first complexing agent capable of attaching to a second complexing agent and a second hybridization probe which includes a nucleic acid sequence that selectively hybridizes to the second nucleic acid sequence type over the first sequence type and includes a detectable marker for detecting the second hybridization probe.

  8. Sequence analysis and genetic diversity of five new Indian isolates of cucumber mosaic virus.

    PubMed

    Kumar, S; Gautam, K K; Raj, S K

    2015-12-01

    Cucumber mosaic virus (CMV) is an important virus since it causes severe losses to many economically important crops worldwide. Five new isolates of CMV were isolated from naturally infected Hippeastrum hybridum, Dahlia pinnata, Hemerocallis fulva, Acorus calamus and Typhonium trilobatum plants, all exhibiting severe leaf mosaic symptoms. For molecular identification and sequence analyses, the complete coat protein (CP) gene of these isolates was amplified by RT-PCR. The resulting amplicons were cloned and sequenced and isolates were designated as HH (KP698590), DP (JF682239), HF (KP698589), AC (KP698588) and TT (JX570732). For study of genetic diversity among these isolates, the sequence data were analysed by BLASTn, multiple alignment and generating phylogenetic trees along with the respective sequences of other CMV isolates available in GenBank Database were done. The isolates under study showed 82-99% sequence diversity among them at nucleotide and amino acid levels; however they showed close relationships with CMV isolates of subgroup IB. In alignment analysis of amino acid sequences of HH and AC isolates, we have found fifteen and twelve unique substitutions, compared to HF, DP and TT isolates, suggesting the cause of high genetic diversity. PMID:26666188

  9. Next Generation Sequencing Reveals the Hidden Diversity of Zooplankton Assemblages

    PubMed Central

    Harmer, Rachel A.; Somerfield, Paul J.; Atkinson, Angus

    2013-01-01

    Background Zooplankton play an important role in our oceans, in biogeochemical cycling and providing a food source for commercially important fish larvae. However, difficulties in correctly identifying zooplankton hinder our understanding of their roles in marine ecosystem functioning, and can prevent detection of long term changes in their community structure. The advent of massively parallel next generation sequencing technology allows DNA sequence data to be recovered directly from whole community samples. Here we assess the ability of such sequencing to quantify richness and diversity of a mixed zooplankton assemblage from a productive time series site in the Western English Channel. Methodology/Principle Findings Plankton net hauls (200 µm) were taken at the Western Channel Observatory station L4 in September 2010 and January 2011. These samples were analysed by microscopy and metagenetic analysis of the 18S nuclear small subunit ribosomal RNA gene using the 454 pyrosequencing platform. Following quality control a total of 419,041 sequences were obtained for all samples. The sequences clustered into 205 operational taxonomic units using a 97% similarity cut-off. Allocation of taxonomy by comparison with the National Centre for Biotechnology Information database identified 135 OTUs to species level, 11 to genus level and 1 to order, <2.5% of sequences were classified as unknowns. By comparison a skilled microscopic analyst was able to routinely enumerate only 58 taxonomic groups. Conclusions Metagenetics reveals a previously hidden taxonomic richness, especially for Copepoda and hard-to-identify meroplankton such as Bivalvia, Gastropoda and Polychaeta. It also reveals rare species and parasites. We conclude that Next Generation Sequencing of 18S amplicons is a powerful tool for elucidating the true diversity and species richness of zooplankton communities. While this approach allows for broad diversity assessments of plankton it may become increasingly

  10. Optimization of short amino acid sequences classifier

    NASA Astrophysics Data System (ADS)

    Barcz, Aleksy; Szymański, Zbigniew

    This article describes processing methods used for short amino acid sequences classification. The data processed are 9-symbols string representations of amino acid sequences, divided into 49 data sets - each one containing samples labeled as reacting or not with given enzyme. The goal of the classification is to determine for a single enzyme, whether an amino acid sequence would react with it or not. Each data set is processed separately. Feature selection is performed to reduce the number of dimensions for each data set. The method used for feature selection consists of two phases. During the first phase, significant positions are selected using Classification and Regression Trees. Afterwards, symbols appearing at the selected positions are substituted with numeric values of amino acid properties taken from the AAindex database. In the second phase the new set of features is reduced using a correlation-based ranking formula and Gram-Schmidt orthogonalization. Finally, the preprocessed data is used for training LS-SVM classifiers. SPDE, an evolutionary algorithm, is used to obtain optimal hyperparameters for the LS-SVM classifier, such as error penalty parameter C and kernel-specific hyperparameters. A simple score penalty is used to adapt the SPDE algorithm to the task of selecting classifiers with best performance measures values.

  11. Methods for analyzing nucleic acid sequences

    DOEpatents

    Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu

    2011-05-17

    The present invention is directed to a method of sequencing a target nucleic acid. The method provides a complex comprising a polymerase enzyme, a target nucleic acid molecule, and a primer, wherein the complex is immobilized on a support Fluorescent label is attached to a terminal phosphate group of the nucleotide or nucleotide analog. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The time duration of the signal from labeled nucleotides or nucleotide analogs that become incorporated is distinguished from freely diffusing labels by a longer retention in the observation volume for the nucleotides or nucleotide analogs that become incorporated than for the freely diffusing labels.

  12. Dynamics of immunoglobulin sequence diversity in HIV-1 infected individuals

    PubMed Central

    Hoehn, Kenneth B.; Gall, Astrid; Bashford-Rogers, Rachael; Fidler, S. J.; Kaye, S.; Weber, J. N.; McClure, M. O.; Kellam, Paul; Pybus, Oliver G.

    2015-01-01

    Advances in immunoglobulin (Ig) sequencing technology are leading to new perspectives on immune system dynamics. Much research in this nascent field has focused on resolving immune responses to viral infection. However, the dynamics of B-cell diversity in early HIV infection, and in response to anti-retroviral therapy, are still poorly understood. Here, we investigate these dynamics through bulk Ig sequencing of samples collected over 2 years from a group of eight HIV-1 infected patients, five of whom received anti-retroviral therapy during the first half of the study period. We applied previously published methods for visualizing and quantifying B-cell sequence diversity, including the Gini index, and compared their efficacy to alternative measures. While we found significantly greater clonal structure in HIV-infected patients versus healthy controls, within HIV patients, we observed no significant relationships between statistics of B-cell clonal expansion and clinical variables such as viral load and CD4+ count. Although there are many potential explanations for this, we suggest that important factors include poor sampling resolution and complex B-cell dynamics that are difficult to summarize using simple summary statistics. Importantly, we find a significant association between observed Gini indices and sequencing read depth, and we conclude that more robust analytical methods and a closer integration of experimental and theoretical work is needed to further our understanding of B-cell repertoire diversity during viral infection. PMID:26194755

  13. An efficient test for comparing sequence diversity between two populations.

    PubMed

    Gilbert, P B; Novitsky, V A; Montano, M A; Essex, M

    2001-01-01

    We address the problem of comparing interindividual genomic sequence diversity between two populations. Although the methods are general, for concreteness we focus on comparing two human immunodeficiency virus (HIV) infected populations. From a viral isolate(s) taken from each individual in a sample of persons from each population, suppose one or multiple measurements are made on the genetic sequence of a coding region of HIV. Given a definition of genetic distance between sequences, the goal is to test if the distribution of interindividual distances differs between populations. If distances between all pairs of sequences within each group are used, then data-dependencies arising from the use of multiple sequences from individuals invalidates the use of a standard two-sample test such as the t-test. Where this problem has been recognized, a typical solution has been to apply a standard test to a reduced dataset comprised of one sequence or a consensus sequence from each patient. Disadvantages of this procedure are that the conclusion of the test depends on the choice of utilized sequences, often an arbitrary decision, and exclusion of replicate sequences from the analysis may needlessly sacrifice statistical power. We present a new test free of these drawbacks, which is based on a statistic that linearly combines all possible standard test statistics calculated from independent sequence subsamples. We describe statistical power advantages of the test and illustrate its use by application to nucleotide sequence distances measured from HIV-1 infected populations in southern Africa (GenBank accession numbers AF110959--AF110981) and North America/Europe. The test makes minimal assumptions, is maximally efficient and objective, and is broadly applicable.

  14. Sequence Programmable Peptoid Polymers for Diverse Materials Applications.

    PubMed

    Knight, Abigail S; Zhou, Effie Y; Francis, Matthew B; Zuckermann, Ronald N

    2015-10-14

    Polymer sequence programmability is required for the diverse structures and complex properties that are achieved by native biological polymers, but efforts towards controlling the sequence of synthetic polymers are, by comparison, still in their infancy. Traditional polymers provide robust and chemically diverse materials, but synthetic control over their monomer sequences is limited. The modular and step-wise synthesis of peptoid polymers, on the other hand, allows for precise control over the monomer sequences, affording opportunities for these chains to fold into well-defined nanostructures. Hundreds of different side chains have been incorporated into peptoid polymers using efficient reaction chemistry, allowing for a seemingly infinite variety of possible synthetically accessible polymer sequences. Combinatorial discovery techniques have allowed the identification of functional polymers within large libraries of peptoids, and newly developed theoretical modeling tools specifically adapted for peptoids enable the future design of polymers with desired functions. Work towards controlling the three-dimensional structure of peptoids, from the conformation of the amide bond to the formation of protein-like tertiary structure, has and will continue to enable the construction of tunable and innovative nanomaterials that bridge the gap between natural and synthetic polymers.

  15. Viral sequence diversity: challenges for AIDS vaccine designs

    PubMed Central

    McBurney, Sean P; Ross, Ted M

    2009-01-01

    Among the greatest challenges facing AIDS vaccine development is the intrinsic diversity among circulating populations of HIV-1 in various geographical locations and the need to develop vaccines that can elicit enduring protective immunity to variant HIV-1 strains. While variation is observed in all of the viral proteins, the greatest diversity is localized to the viral envelope glycoproteins, evidently reflecting the predominant role of these proteins in eliciting host immune recognition and responses that result in progressive evolution of the envelope proteins during persistent infection. Interestingly, while envelope glycoprotein variation is widely assumed to be a major obstacle to AIDS vaccine development, there is very little experimental data in animal or human lentivirus systems addressing this critical issue. In this review, the state of vaccine development to address envelope diversity will be presented, focusing on the use of centralized and polyvalent sequence design as mechanisms to elicit broadly reactive immune responses. PMID:18980542

  16. Next generation sequencing technologies: tool to study avian virus diversity.

    PubMed

    Kapgate, S S; Barbuddhe, S B; Kumanan, K

    2015-03-01

    Increased globalisation, climatic changes and wildlife-livestock interface led to emergence of novel viral pathogens or zoonoses that have become serious concern to avian, animal and human health. High biodiversity and bird migration facilitate spread of the pathogen and provide reservoirs for emerging infectious diseases. Current classical diagnostic methods designed to be virus-specific or aim to be limited to group of viral agents, hinder identifying of novel viruses or viral variants. Recently developed approaches of next-generation sequencing (NGS) provide culture-independent methods that are useful for understanding viral diversity and discovery of novel virus, thereby enabling a better diagnosis and disease control. This review discusses the different possible steps of a NGS study utilizing sequence-independent amplification, high-throughput sequencing and bioinformatics approaches to identify novel avian viruses and their diversity. NGS lead to the identification of a wide range of new viruses such as picobirnavirus, picornavirus, orthoreovirus and avian gamma coronavirus associated with fulminating disease in guinea fowl and is also used in describing viral diversity among avian species. The review also briefly discusses areas of viral-host interaction and disease associated causalities with newly identified avian viruses. PMID:25790045

  17. Next generation sequencing technologies: tool to study avian virus diversity.

    PubMed

    Kapgate, S S; Barbuddhe, S B; Kumanan, K

    2015-03-01

    Increased globalisation, climatic changes and wildlife-livestock interface led to emergence of novel viral pathogens or zoonoses that have become serious concern to avian, animal and human health. High biodiversity and bird migration facilitate spread of the pathogen and provide reservoirs for emerging infectious diseases. Current classical diagnostic methods designed to be virus-specific or aim to be limited to group of viral agents, hinder identifying of novel viruses or viral variants. Recently developed approaches of next-generation sequencing (NGS) provide culture-independent methods that are useful for understanding viral diversity and discovery of novel virus, thereby enabling a better diagnosis and disease control. This review discusses the different possible steps of a NGS study utilizing sequence-independent amplification, high-throughput sequencing and bioinformatics approaches to identify novel avian viruses and their diversity. NGS lead to the identification of a wide range of new viruses such as picobirnavirus, picornavirus, orthoreovirus and avian gamma coronavirus associated with fulminating disease in guinea fowl and is also used in describing viral diversity among avian species. The review also briefly discusses areas of viral-host interaction and disease associated causalities with newly identified avian viruses.

  18. Draft Genome Sequences of Two Novel Acidimicrobiaceae Members from an Acid Mine Drainage Biofilm Metagenome

    PubMed Central

    Pinto, Ameet J.; Sharp, Jonathan O.; Yoder, Michael J.

    2016-01-01

    Bacteria belonging to the family Acidimicrobiaceae are frequently encountered in heavy metal-contaminated acidic environments. However, their phylogenetic and metabolic diversity is poorly resolved. We present draft genome sequences of two novel and phylogenetically distinct Acidimicrobiaceae members assembled from an acid mine drainage biofilm metagenome. PMID:26769942

  19. Code-Time Diversity for Direct Sequence Spread Spectrum Systems

    PubMed Central

    Hassan, A. Y.

    2014-01-01

    Time diversity is achieved in direct sequence spread spectrum by receiving different faded delayed copies of the transmitted symbols from different uncorrelated channel paths when the transmission signal bandwidth is greater than the coherence bandwidth of the channel. In this paper, a new time diversity scheme is proposed for spread spectrum systems. It is called code-time diversity. In this new scheme, N spreading codes are used to transmit one data symbol over N successive symbols interval. The diversity order in the proposed scheme equals to the number of the used spreading codes N multiplied by the number of the uncorrelated paths of the channel L. The paper represents the transmitted signal model. Two demodulators structures will be proposed based on the received signal models from Rayleigh flat and frequency selective fading channels. Probability of error in the proposed diversity scheme is also calculated for the same two fading channels. Finally, simulation results are represented and compared with that of maximal ration combiner (MRC) and multiple-input and multiple-output (MIMO) systems. PMID:24982925

  20. 77 FR 65537 - Requirements for Patent Applications Containing Nucleotide Sequence and/or Amino Acid Sequence...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-10-29

    ... Amino Acid Sequence Disclosures ACTION: Proposed collection; comment request. SUMMARY: The United States....'' SUPPLEMENTARY INFORMATION: I. Abstract Patent applications that contain nucleotide and/or amino acid...

  1. Diverse nucleotide compositions and sequence fluctuation in Rubisco protein genes

    NASA Astrophysics Data System (ADS)

    Holden, Todd; Dehipawala, S.; Cheung, E.; Bienaime, R.; Ye, J.; Tremberger, G., Jr.; Schneider, P.; Lieberman, D.; Cheung, T.

    2011-10-01

    The Rubisco protein-enzyme is arguably the most abundance protein on Earth. The biology dogma of transcription and translation necessitates the study of the Rubisco genes and Rubisco-like genes in various species. Stronger correlation of fractal dimension of the atomic number fluctuation along a DNA sequence with Shannon entropy has been observed in the studied Rubisco-like gene sequences, suggesting a more diverse evolutionary pressure and constraints in the Rubisco sequences. The strategy of using metal for structural stabilization appears to be an ancient mechanism, with data from the porphobilinogen deaminase gene in Capsaspora owczarzaki and Monosiga brevicollis. Using the chi-square distance probability, our analysis supports the conjecture that the more ancient Rubisco-like sequence in Microcystis aeruginosa would have experienced very different evolutionary pressure and bio-chemical constraint as compared to Bordetella bronchiseptica, the two microbes occupying either end of the correlation graph. Our exploratory study would indicate that high fractal dimension Rubisco sequence would support high carbon dioxide rate via the Michaelis- Menten coefficient; with implication for the control of the whooping cough pathogen Bordetella bronchiseptica, a microbe containing a high fractal dimension Rubisco-like sequence (2.07). Using the internal comparison of chi-square distance probability for 16S rRNA (~ E-22) versus radiation repair Rec-A gene (~ E-05) in high GC content Deinococcus radiodurans, our analysis supports the conjecture that high GC content microbes containing Rubisco-like sequence are likely to include an extra-terrestrial origin, relative to Deinococcus radiodurans. Similar photosynthesis process that could utilize host star radiation would not compete with radiation resistant process from the biology dogma perspective in environments such as Mars and exoplanets.

  2. Detection of nucleic acid sequences by invader-directed cleavage

    DOEpatents

    Brow, Mary Ann D.; Hall, Jeff Steven Grotelueschen; Lyamichev, Victor; Olive, David Michael; Prudent, James Robert

    1999-01-01

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The 5' nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof. The present invention further relates to methods and devices for the separation of nucleic acid molecules based by charge.

  3. An intimate link between antimicrobial peptide sequence diversity and binding to essential components of bacterial membranes.

    PubMed

    Schmitt, Paulina; Rosa, Rafael D; Destoumieux-Garzón, Delphine

    2016-05-01

    Antimicrobial peptides and proteins (AMPs) are widespread in the living kingdom. They are key effectors of defense reactions and mediators of competitions between organisms. They are often cationic and amphiphilic, which favors their interactions with the anionic membranes of microorganisms. Several AMP families do not directly alter membrane integrity but rather target conserved components of the bacterial membranes in a process that provides them with potent and specific antimicrobial activities. Thus, lipopolysaccharides (LPS), lipoteichoic acids (LTA) and the peptidoglycan precursor Lipid II are targeted by a broad series of AMPs. Studying the functional diversity of immune effectors tells us about the essential residues involved in AMP mechanism of action. Marine invertebrates have been found to produce a remarkable diversity of AMPs. Molluscan defensins and crustacean anti-LPS factors (ALF) are diverse in terms of amino acid sequence and show contrasted phenotypes in terms of antimicrobial activity. Their activity is directed essentially against Gram-positive or Gram-negative bacteria due to their specific interactions with Lipid II or Lipid A, respectively. Through those interesting examples, we discuss here how sequence diversity generated throughout evolution informs us on residues required for essential molecular interaction at the bacterial membranes and subsequent antibacterial activity. Through the analysis of molecular variants having lost antibacterial activity or shaped novel functions, we also discuss the molecular bases of functional divergence in AMPs. This article is part of a Special Issue entitled: Antimicrobial peptides edited by Karl Lohner and Kai Hilpert. PMID:26498397

  4. Transcriptome Sequencing from Diverse Human Populations Reveals Differentiated Regulatory Architecture

    PubMed Central

    Lappalainen, Tuuli; Henn, Brenna M.; Kidd, Jeffrey M.; Yee, Muh-Ching; Grubert, Fabian; Cann, Howard M.; Snyder, Michael; Montgomery, Stephen B.; Bustamante, Carlos D.

    2014-01-01

    Large-scale sequencing efforts have documented extensive genetic variation within the human genome. However, our understanding of the origins, global distribution, and functional consequences of this variation is far from complete. While regulatory variation influencing gene expression has been studied within a handful of populations, the breadth of transcriptome differences across diverse human populations has not been systematically analyzed. To better understand the spectrum of gene expression variation, alternative splicing, and the population genetics of regulatory variation in humans, we have sequenced the genomes, exomes, and transcriptomes of EBV transformed lymphoblastoid cell lines derived from 45 individuals in the Human Genome Diversity Panel (HGDP). The populations sampled span the geographic breadth of human migration history and include Namibian San, Mbuti Pygmies of the Democratic Republic of Congo, Algerian Mozabites, Pathan of Pakistan, Cambodians of East Asia, Yakut of Siberia, and Mayans of Mexico. We discover that approximately 25.0% of the variation in gene expression found amongst individuals can be attributed to population differences. However, we find few genes that are systematically differentially expressed among populations. Of this population-specific variation, 75.5% is due to expression rather than splicing variability, and we find few genes with strong evidence for differential splicing across populations. Allelic expression analyses indicate that previously mapped common regulatory variants identified in eight populations from the International Haplotype Map Phase 3 project have similar effects in our seven sampled HGDP populations, suggesting that the cellular effects of common variants are shared across diverse populations. Together, these results provide a resource for studies analyzing functional differences across populations by estimating the degree of shared gene expression, alternative splicing, and regulatory genetics

  5. Hybridization and sequencing of nucleic acids using base pair mismatches

    DOEpatents

    Fodor, Stephen P. A.; Lipshutz, Robert J.; Huang, Xiaohua

    2001-01-01

    Devices and techniques for hybridization of nucleic acids and for determining the sequence of nucleic acids. Arrays of nucleic acids are formed by techniques, preferably high resolution, light-directed techniques. Positions of hybridization of a target nucleic acid are determined by, e.g., epifluorescence microscopy. Devices and techniques are proposed to determine the sequence of a target nucleic acid more efficiently and more quickly through such synthesis and detection techniques.

  6. Sequence diversity of O-superfamily conopetides from Conus marmoreus native to Hainan.

    PubMed

    Luo, Sulan; Zhangsun, Dongting; Lin, Qiujin; Xie, Lei; Wu, Yong; Zhu, Xiaopeng

    2006-12-01

    The full-length cDNAs of six new O-superfamily conotoxins (CTX) were cloned and sequenced from Conus marmoreus native to Hainan in China South Sea using RT-PCR and 3'-RACE. Six novel conotoxin precursors encoded by these cDNAs consist of three typical regions of signal, pro-peptide and mature peptide. All the six toxin regions share a common O-superfamily cysteine pattern (C-C-CC-C-C, with three disulfide bridges). The predicted precursors are composed of 73-88 amino acids, and the predicted mature peptides consist of 26-34 amino acids. Phylogenetic analysis of new conotoxins from C. marmoreus from the present study and published homologue T-superfamily sequences from other Conus species was performed systematically. Patterns of sequence divergence for three regions of signal, pro-region and mature peptides, as well as Cys codon usage define the major O-superfamily branches and suggest how these separate branches arose. Percent identities of the amino acid sequences of the signal region exhibited high conservation, whereas the sequences of the mature peptides ranged from almost identical to highly divergent between inter- and intra-species. Notably, the diversity of the pro-region was also high with intermediate divergence between that observed in signal and toxin regions. Amino acid sequences and their mode of action (target) of previously identified conotoxins from molluscivorous C. marmoreus for the known conotoxins classes are discussed in detail. The data presented are new and should pave the way for chemical synthesis of these unique conotoxins for to allow determination of the molecular targets of these peptides, and also to provide clues for a better understanding of the phylogeny of these peptides.

  7. Diverse levels of sequence selectivity and catalytic efficiency of protein-tyrosine phosphatases.

    PubMed

    Selner, Nicholas G; Luechapanichkul, Rinrada; Chen, Xianwen; Neel, Benjamin G; Zhang, Zhong-Yin; Knapp, Stefan; Bell, Charles E; Pei, Dehua

    2014-01-21

    The sequence selectivity of 14 classical protein-tyrosine phosphatases (PTPs) (PTPRA, PTPRB, PTPRC, PTPRD, PTPRO, PTP1B, SHP-1, SHP-2, HePTP, PTP-PEST, TCPTP, PTPH1, PTPD1, and PTPD2) was systematically profiled by screening their catalytic domains against combinatorial peptide libraries. All of the PTPs exhibit similar preference for pY peptides rich in acidic amino acids and disfavor positively charged sequences but differ vastly in their degrees of preference/disfavor. Some PTPs (PTP-PEST, SHP-1, and SHP-2) are highly selective for acidic over basic (or neutral) peptides (by >10(5)-fold), whereas others (PTPRA and PTPRD) show no to little sequence selectivity. PTPs also have diverse intrinsic catalytic efficiencies (kcat/KM values against optimal substrates), which differ by >10(5)-fold due to different kcat and/or KM values. Moreover, PTPs show little positional preference for the acidic residues relative to the pY residue. Mutation of Arg47 of PTP1B, which is located near the pY-1 and pY-2 residues of a bound substrate, decreased the enzymatic activity by 3-18-fold toward all pY substrates containing acidic residues anywhere within the pY-6 to pY+5 region. Similarly, mutation of Arg24, which is situated near the C-terminus of a bound substrate, adversely affected the kinetic activity of all acidic substrates. A cocrystal structure of PTP1B bound with a nephrin pY(1193) peptide suggests that Arg24 engages in electrostatic interactions with acidic residues at the pY+1, pY+2, and likely other positions. These results suggest that long-range electrostatic interactions between positively charged residues near the PTP active site and acidic residues on pY substrates allow a PTP to bind acidic substrates with similar affinities, and the varying levels of preference for acidic sequences by different PTPs are likely caused by the different electrostatic potentials near their active sites. The implications of the varying sequence selectivity and intrinsic catalytic

  8. Predicting intrinsic disorder from amino acid sequence.

    PubMed

    Obradovic, Zoran; Peng, Kang; Vucetic, Slobodan; Radivojac, Predrag; Brown, Celeste J; Dunker, A Keith

    2003-01-01

    Blind predictions of intrinsic order and disorder were made on 42 proteins subsequently revealed to contain 9,044 ordered residues, 284 disordered residues in 26 segments of length 30 residues or less, and 281 disordered residues in 2 disordered segments of length greater than 30 residues. The accuracies of the six predictors used in this experiment ranged from 77% to 91% for the ordered regions and from 56% to 78% for the disordered segments. The average of the order and disorder predictions ranged from 73% to 77%. The prediction of disorder in the shorter segments was poor, from 25% to 66% correct, while the prediction of disorder in the longer segments was better, from 75% to 95% correct. Four of the predictors were composed of ensembles of neural networks. This enabled them to deal more efficiently with the large asymmetry in the training data through diversified sampling from the significantly larger ordered set and achieve better accuracy on ordered and long disordered regions. The exclusive use of long disordered regions for predictor training likely contributed to the disparity of the predictions on long versus short disordered regions, while averaging the output values over 61-residue windows to eliminate short predictions of order or disorder probably contributed to the even greater disparity for three of the predictors. This experiment supports the predictability of intrinsic disorder from amino acid sequence. PMID:14579347

  9. Sequence diversity and gene expression analyses of expansin-related proteins in the white-rot basidiomycete, Phanerochaete carnosa.

    PubMed

    Suzuki, Hitoshi; Vuong, Thu V; Gong, Yunchen; Chan, Kin; Ho, Chi-Yip; Master, Emma R; Kondo, Akihiko

    2014-11-01

    Expansin and expansin-related proteins loosen plant cell wall architectures and are widely distributed in several types of organisms, including plants, fungi and bacteria. Here we describe sequence diversity and unique gene expression profiles of multiple expansin-related proteins identified in the basidiomycete, Phanerochaete carnosa. The protein sequences were homologous to loosenin, an expansin-related protein reported in the basidiomycete, Bjerkandera adusta. We identified homologous sequences of each of those P. carnosa proteins in many basidiomycete species. Twelve P. carnosa loosenin-like proteins (LOOLs) were classified into two subgroups according to sequence homology. Conservation of polysaccharide-binding amino acid residues was stricter in subgroup A. Subgroup A sequences included a conserved 8-9 amino acid insertion in a polysaccharide-binding groove whereas subgroup B contained a 12-18 amino acid insertion next to the binding groove. The P. carnosa genome also encodes the expansin-related protein, DREX1, which adopts a loosenin-like structure but has lower sequence homology to other LOOLs. The gene expression analysis of those proteins showed distinct patterns that were not significantly related to subgroupings. The variation in the protein sequences and gene expression patterns, and wide distribution among the basidiomycota, suggest that the diverse cell wall loosening proteins contribute to effective plant cell wall association and utilization by basidiomycetes.

  10. Methods and compositions for efficient nucleic acid sequencing

    DOEpatents

    Drmanac, Radoje

    2002-01-01

    Disclosed are novel methods and compositions for rapid and highly efficient nucleic acid sequencing based upon hybridization with two sets of small oligonucleotide probes of known sequences. Extremely large nucleic acid molecules, including chromosomes and non-amplified RNA, may be sequenced without prior cloning or subcloning steps. The methods of the invention also solve various current problems associated with sequencing technology such as, for example, high noise to signal ratios and difficult discrimination, attaching many nucleic acid fragments to a surface, preparing many, longer or more complex probes and labelling more species.

  11. Methods and compositions for efficient nucleic acid sequencing

    DOEpatents

    Drmanac, Radoje

    2006-07-04

    Disclosed are novel methods and compositions for rapid and highly efficient nucleic acid sequencing based upon hybridization with two sets of small oligonucleotide probes of known sequences. Extremely large nucleic acid molecules, including chromosomes and non-amplified RNA, may be sequenced without prior cloning or subcloning steps. The methods of the invention also solve various current problems associated with sequencing technology such as, for example, high noise to signal ratios and difficult discrimination, attaching many nucleic acid fragments to a surface, preparing many, longer or more complex probes and labelling more species.

  12. Kit for detecting nucleic acid sequences using competitive hybridization probes

    DOEpatents

    Lucas, Joe N.; Straume, Tore; Bogen, Kenneth T.

    2001-01-01

    A kit is provided for detecting a target nucleic acid sequence in a sample, the kit comprising: a first hybridization probe which includes a nucleic acid sequence that is sufficiently complementary to selectively hybridize to a first portion of the target sequence, the first hybridization probe including a first complexing agent for forming a binding pair with a second complexing agent; and a second hybridization probe which includes a nucleic acid sequence that is sufficiently complementary to selectively hybridize to a second portion of the target sequence to which the first hybridization probe does not selectively hybridize, the second hybridization probe including a detectable marker; a third hybridization probe which includes a nucleic acid sequence that is sufficiently complementary to selectively hybridize to a first portion of the target sequence, the third hybridization probe including the same detectable marker as the second hybridization probe; and a fourth hybridization probe which includes a nucleic acid sequence that is sufficiently complementary to selectively hybridize to a second portion of the target sequence to which the third hybridization probe does not selectively hybridize, the fourth hybridization probe including the first complexing agent for forming a binding pair with the second complexing agent; wherein the first and second hybridization probes are capable of simultaneously hybridizing to the target sequence and the third and fourth hybridization probes are capable of simultaneously hybridizing to the target sequence, the detectable marker is not present on the first or fourth hybridization probes and the first, second, third, and fourth hybridization probes each include a competitive nucleic acid sequence which is sufficiently complementary to a third portion of the target sequence that the competitive sequences of the first, second, third, and fourth hybridization probes compete with each other to hybridize to the third portion of the

  13. Analysis and Annotation of Nucleic Acid Sequence

    SciTech Connect

    States, David J.

    2004-07-28

    The aims of this project were to develop improved methods for computational genome annotation and to apply these methods to improve the annotation of genomic sequence data with a specific focus on human genome sequencing. The project resulted in a substantial body of published work. Notable contributions of this project were the identification of basecalling and lane tracking as error processes in genome sequencing and contributions to improved methods for these steps in genome sequencing. This technology improved the accuracy and throughput of genome sequence analysis. Probabilistic methods for physical map construction were developed. Improved methods for sequence alignment, alternative splicing analysis, promoter identification and NF kappa B response gene prediction were also developed.

  14. Analysis of sequence diversity through internal transcribed spacers and simple sequence repeats to identify Dendrobium species.

    PubMed

    Liu, Y T; Chen, R K; Lin, S J; Chen, Y C; Chin, S W; Chen, F C; Lee, C Y

    2014-04-08

    The Orchidaceae is one of the largest and most diverse families of flowering plants. The Dendrobium genus has high economic potential as ornamental plants and for medicinal purposes. In addition, the species of this genus are able to produce large crops. However, many Dendrobium varieties are very similar in outward appearance, making it difficult to distinguish one species from another. This study demonstrated that the 12 Dendrobium species used in this study may be divided into 2 groups by internal transcribed spacer (ITS) sequence analysis. Red and yellow flowers may also be used to separate these species into 2 main groups. In particular, the deciduous characteristic is associated with the ITS genetic diversity of the A group. Of 53 designed simple sequence repeat (SSR) primer pairs, 7 pairs were polymorphic for polymerase chain reaction products that were amplified from a specific band. The results of this study demonstrate that these 7 SSR primer pairs may potentially be used to identify Dendrobium species and their progeny in future studies.

  15. Solid phase sequencing of double-stranded nucleic acids

    DOEpatents

    Fu, Dong-Jing; Cantor, Charles R.; Koster, Hubert; Smith, Cassandra L.

    2002-01-01

    This invention relates to methods for detecting and sequencing of target double-stranded nucleic acid sequences, to nucleic acid probes and arrays of probes useful in these methods, and to kits and systems which contain these probes. Useful methods involve hybridizing the nucleic acids or nucleic acids which represent complementary or homologous sequences of the target to an array of nucleic acid probes. These probe comprise a single-stranded portion, an optional double-stranded portion and a variable sequence within the single-stranded portion. The molecular weights of the hybridized nucleic acids of the set can be determined by mass spectroscopy, and the sequence of the target determined from the molecular weights of the fragments. Nucleic acids whose sequences can be determined include nucleic acids in biological samples such as patient biopsies and environmental samples. Probes may be fixed to a solid support such as a hybridization chip to facilitate automated determination of molecular weights and identification of the target sequence.

  16. Protist genetic diversity in the acidic hydrothermal environments of Lassen Volcanic National Park, USA.

    PubMed

    Brown, Patricia B; Wolfe, Gordon V

    2006-01-01

    We examined eukaryote genetic diversity in the hydrothermal environments of Lassen Volcanic National Park (LVNP), Northern California. We sampled hydrothermal areas of the Bumpass Hell, Sulfur Works, Devil's Kitchen, and Boiling Springs Lake sites, all of which included diverse acidic pools, mud pots, and streams with visible algal mats and biofilms. Temperatures varied from 15 to 85 degrees C and pH from 1.7 to 5.8. DNA extraction methods compared by denaturing gradient gel electrophoresis fingerprinting exhibited similar patterns, and showed limited diversity of eukaryotic small subunit (SSU) rRNA genes compared with prokaryotes. We successfully amplified eukaryotic SSU rRNA genes from most environments up to 68 degrees C. Cloned rDNA sequences reveal acidophilic protists dominate eukaryotes in LVNP hydrothermal environments. Most sites showed phototrophic assemblages dominated by chlorophytes and stramenopiles (diatoms and chrysophytes). Heterotrophic taxa, though less abundant, included diverse alveolates (ciliates), amoebae, and flagellates. Fungi were also found at most sites, and metazoans (hexapods, nematodes, platyhelminths) were sometimes detected in less acidic environments, especially in algal mats. While many cloned rDNA sequences showed 95%-99% identity to known acidophilic isolates or environmental clones from other acidic sites (Rio Tinto), sequence diversity generally declined both with decreasing pH and increasing temperature, and both were controlling physical variables on the abundance and distribution of organisms at our sites. However, a pool at 68 degrees C with pH 1.7 yielded the greatest number of distinct sequences. While some were likely contaminants from nearby cooler sites, we suggest that Lassen's acidic hydrothermal features may harbor novel protists.

  17. Marine protist diversity in European coastal waters and sediments as revealed by high-throughput sequencing.

    PubMed

    Massana, Ramon; Gobet, Angélique; Audic, Stéphane; Bass, David; Bittner, Lucie; Boutte, Christophe; Chambouvet, Aurélie; Christen, Richard; Claverie, Jean-Michel; Decelle, Johan; Dolan, John R; Dunthorn, Micah; Edvardsen, Bente; Forn, Irene; Forster, Dominik; Guillou, Laure; Jaillon, Olivier; Kooistra, Wiebe H C F; Logares, Ramiro; Mahé, Frédéric; Not, Fabrice; Ogata, Hiroyuki; Pawlowski, Jan; Pernice, Massimo C; Probert, Ian; Romac, Sarah; Richards, Thomas; Santini, Sébastien; Shalchian-Tabrizi, Kamran; Siano, Raffaele; Simon, Nathalie; Stoeck, Thorsten; Vaulot, Daniel; Zingone, Adriana; de Vargas, Colomban

    2015-10-01

    Although protists are critical components of marine ecosystems, they are still poorly characterized. Here we analysed the taxonomic diversity of planktonic and benthic protist communities collected in six distant European coastal sites. Environmental deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) from three size fractions (pico-, nano- and micro/mesoplankton), as well as from dissolved DNA and surface sediments were used as templates for tag pyrosequencing of the V4 region of the 18S ribosomal DNA. Beta-diversity analyses split the protist community structure into three main clusters: picoplankton-nanoplankton-dissolved DNA, micro/mesoplankton and sediments. Within each cluster, protist communities from the same site and time clustered together, while communities from the same site but different seasons were unrelated. Both DNA and RNA-based surveys provided similar relative abundances for most class-level taxonomic groups. Yet, particular groups were overrepresented in one of the two templates, such as marine alveolates (MALV)-I and MALV-II that were much more abundant in DNA surveys. Overall, the groups displaying the highest relative contribution were Dinophyceae, Diatomea, Ciliophora and Acantharia. Also, well represented were Mamiellophyceae, Cryptomonadales, marine alveolates and marine stramenopiles in the picoplankton, and Monadofilosa and basal Fungi in sediments. Our extensive and systematic sequencing of geographically separated sites provides the most comprehensive molecular description of coastal marine protist diversity to date.

  18. Diversity of HIV type 1 envelope (V3-V5) sequence in HIV type 1-infected Indian children.

    PubMed

    Prakash, Somi Sankaran; Kalra, Rajesh; Lodha, Rakesh; Kabra, Sushil K; Luthra, Kalpana

    2012-05-01

    Abstract We assessed the viral envelope (V3-V5 region) sequence diversity from 13 HIV-1-infected Indian children from north India. All of the 13 children were found to be infected with subtype C viruses. One of the viral sequences exhibited usage of the CXCR4 coreceptor predicted by Web PSSM and Geno2pheno tools. This virus also had a longer V3 sequence with 37 amino acids, a GRGQ motif, and a methionine residue before it (AIIMS_307). A unique finding was the complete deletion of the V4 region of another virus (AIIMS_363). High sequence diversity was observed in the envelope of the HIV-1-infected Indian children.

  19. Combination of high throughput cultivation and dsrA sequencing for assessment of sulfate-reducing bacteria diversity in sediments.

    PubMed

    Colin, Yannick; Goñi-Urriza, Marisol; Caumette, Pierre; Guyoneaud, Rémy

    2013-01-01

    Improving the knowledge on sulfate-reducing bacteria (SRB) diversity and ecophysiology will permit a better understanding on their key roles in aquatic ecosystems. Therefore, their diversity was evaluated in estuarine sediments by a polyphasic approach including dsrA gene cloning and sequencing (156 clones) and high-throughput isolations in 384-well microplates (177 strains). Using the related thresholds of 95% (DsrA amino acid sequences) and 97% (16S rRNA gene sequences) for sequence similarity, SRB were grouped into 60 and 22 operational taxonomic units, respectively. Both approaches poorly overlapped and rather complemented each other. The clone library was dominated by sequences related to the Desulfobacteraceae, while only one isolate belonged to this family. Most of the strains were affiliated to the genera Desulfopila and Desulfotalea within the Desulfobulbaceae. Desulfopila-related strains exhibited a high phylogenetic microdiversity and represented numerically significant populations. In contrast, Desulfovibrio isolates were less abundant but displayed a high phylogenetic diversity. Three hundred and eighty-four-well microplate isolations enhanced significantly the number of isolates handled. As a consequence, 15 new taxa sharing less than 98% sequence similarity (16S rRNA gene) with their closest relatives were obtained. This polyphasic approach allowed to obtain a high phylogenetic diversity and thus a better view of sulfate-reducing communities in intertidal sediments.

  20. Complete Genome Sequences of 12 Species of Stable Defined Moderately Diverse Mouse Microbiota 2.

    PubMed

    Uchimura, Yasuhiro; Wyss, Madeleine; Brugiroux, Sandrine; Limenitakis, Julien P; Stecher, Bärbel; McCoy, Kathy D; Macpherson, Andrew J

    2016-01-01

    We report here the complete genome sequences of 12 bacterial species of stable defined moderately diverse mouse microbiota 2 (sDMDMm2) used to colonize germ-free mice with defined microbes. Whole-genome sequencing of these species was performed using the PacBio sequencing platform yielding circularized genome sequences of all 12 species. PMID:27634994

  1. Complete Genome Sequences of 12 Species of Stable Defined Moderately Diverse Mouse Microbiota 2

    PubMed Central

    Uchimura, Yasuhiro; Wyss, Madeleine; Brugiroux, Sandrine; Limenitakis, Julien P.; Stecher, Bärbel; McCoy, Kathy D.

    2016-01-01

    We report here the complete genome sequences of 12 bacterial species of stable defined moderately diverse mouse microbiota 2 (sDMDMm2) used to colonize germ-free mice with defined microbes. Whole-genome sequencing of these species was performed using the PacBio sequencing platform yielding circularized genome sequences of all 12 species. PMID:27634994

  2. Survey of duckweed diversity in Lake Chao and total fatty acid, triacylglycerol, profiles of representative strains.

    PubMed

    Tang, J; Li, Y; Ma, J; Cheng, J J

    2015-09-01

    Lemnaceae (duckweeds) are widely distributed aquatic flowering plants. Their high growth rate, starch content and suitability for bioremediation make them potential feedstock for biofuels. However, few natural duckweed resources have been investigated in China, and there is no information about total fatty acid (TFA) and triacylglycerol (TAG) composition of duckweeds from China. Here, the genetic diversity of a natural duckweed population collected from Lake Chao, China, was investigated using multilocus sequence typing (MLST). The 54 strains were categorised into four species in four genera, representing 12 distinct sequence types. Strains representing Lemna aequinoctialis and Spirodela polyrhiza were predominant. Interestingly, a surprisingly high degree of genetic diversification within L. aequinoctialis was observed. The four duckweed species revealed a uniform fatty acid composition, with three fatty acids, palmitic acid, linoleic acid and linolenic acid, accounting for more than 80% of the TFA. The TFA in biomass varied among species, ranging from 1.05% (of dry weight, DW) for L. punctata and S. polyrhiza to 1.62% for Wolffia globosa. The four duckweed species contained similar TAG contents, 0.02% mg · DW(-1). The fatty acid profiles of TAG were different from those of TFA, and also varied among the four species. The survey investigated the genetic diversity of duckweeds from Lake Chao, and provides an initial insight into TFA and TAG of four duckweed species, indicating that intraspecific and interspecific variations exist in the content and composition of both TFA and TAG in comparison with other studies.

  3. From Artificial Amino Acids to Sequence-Defined Targeted Oligoaminoamides.

    PubMed

    Morys, Stephan; Wagner, Ernst; Lächelt, Ulrich

    2016-01-01

    Artificial oligoamino acids with appropriate protecting groups can be used for the sequential assembly of oligoaminoamides on solid-phase. With the help of these oligoamino acids multifunctional nucleic acid (NA) carriers can be designed and produced in highly defined topologies. Here we describe the synthesis of the artificial oligoamino acid Fmoc-Stp(Boc3)-OH, the subsequent assembly into sequence-defined oligomers and the formulation of tumor-targeted plasmid DNA (pDNA) polyplexes. PMID:27436323

  4. Segments of amino acid sequence similarity in beta-amylases.

    PubMed

    Friedberg, F; Rhodes, C

    1988-01-01

    In alpha-amylases from animals, plants and bacteria and in beta-amylases from plants and bacteria a number of segments exhibit amino acid sequence similarity specific to the alpha or to the beta type, respectively. In the case of the beta-amylases the similar sequence regions are extensive and they are disrupted only by short interspersed dissimilar regions. Close to the C terminus, however, no such sequence similarity exist. PMID:2464171

  5. Design, construction, and validation of a modular library of sequence diversity standards for polymerase chain reaction.

    PubMed

    Baum, Paul D; Young, Jennifer J; Zhang, Qianjun; Kasakow, Zeljka; McCune, Joseph M

    2011-04-01

    Methods to measure the sequence diversity of polymerase chain reaction (PCR)-amplified DNA lack standards for use as assay calibrators and controls. Here we present a general and economical method for developing customizable DNA standards of known sequence diversity. Standards ranging from 1 to 25,000 sequences were generated by directional ligation of oligonucleotide "words" of standard length and GC content and then amplified by PCR. The sequence accuracy and diversity of the library were validated using AmpliCot analysis (DNA hybridization kinetics) and Illumina sequencing. The library has the following features: (i) pools containing tens of thousands of sequences can be generated from the ligation of relatively few commercially synthesized short oligonucleotides; (ii) each sequence differs from all others in the library at a minimum of three nucleotide positions, permitting discrimination between different sequences by either sequencing or hybridization; (iii) all sequences have identical length, GC content, and melting temperature; (iv) the identity of each standard can be verified by restriction digestion; and (v) once made, the ends of the library may be cleaved and replaced with sequences to match any PCR primer pair. These standards should greatly improve the accuracy and reproducibility of sequence diversity measurements.

  6. Penicillium arizonense, a new, genome sequenced fungal species, reveals a high chemical diversity in secreted metabolites

    PubMed Central

    Grijseels, Sietske; Nielsen, Jens Christian; Randelovic, Milica; Nielsen, Jens; Nielsen, Kristian Fog; Workman, Mhairi; Frisvad, Jens Christian

    2016-01-01

    A new soil-borne species belonging to the Penicillium section Canescentia is described, Penicillium arizonense sp. nov. (type strain CBS 141311T = IBT 12289T). The genome was sequenced and assembled into 33.7 Mb containing 12,502 predicted genes. A phylogenetic assessment based on marker genes confirmed the grouping of P. arizonense within section Canescentia. Compared to related species, P. arizonense proved to encode a high number of proteins involved in carbohydrate metabolism, in particular hemicellulases. Mining the genome for genes involved in secondary metabolite biosynthesis resulted in the identification of 62 putative biosynthetic gene clusters. Extracts of P. arizonense were analysed for secondary metabolites and austalides, pyripyropenes, tryptoquivalines, fumagillin, pseurotin A, curvulinic acid and xanthoepocin were detected. A comparative analysis against known pathways enabled the proposal of biosynthetic gene clusters in P. arizonense responsible for the synthesis of all detected compounds except curvulinic acid. The capacity to produce biomass degrading enzymes and the identification of a high chemical diversity in secreted bioactive secondary metabolites, offers a broad range of potential industrial applications for the new species P. arizonense. The description and availability of the genome sequence of P. arizonense, further provides the basis for biotechnological exploitation of this species. PMID:27739446

  7. Sequence Diversity in MIC6 Gene among Toxoplasma gondii Isolates from Different Hosts and Geographical Locations.

    PubMed

    Li, Zhong-Yuan; Song, Hui-Qun; Chen, Jia; Zhu, Xing-Quan

    2015-06-01

    Toxoplasma gondii is an opportunistic protozoan parasite that can infect almost all warm-blooded animals including humans with a worldwide distribution. Micronemes play an important role in invasion process of T. gondii, associated with the attachment, motility, and host cell recognition. In this research, sequence diversity in microneme protein 6 (MIC6) gene among 16 T. gondii isolates from different hosts and geographical regions and 1 reference strain was examined. The results showed that the sequence of all the examined T. gondii strains was 1,050 bp in length, and their A + T content was between 45.7% and 46.1%. Sequence analysis presented 33 nucleotide mutation positions (0-1.1%), resulting in 23 amino acid substitutions (0-2.3%) aligned with T. gondii RH strain. Moreover, T. gondii strains representing the 3 classical genotypes (Type I, II, and III) were separated into different clusters based on the locus of MIC6 using phylogenetic analyses by Bayesian inference (BI), maximum parsimony (MP), and maximum likelihood (ML), but T. gondii strains belonging to ToxoDB #9 were separated into different clusters. Our results suggested that MIC6 gene is not a suitable marker for T. gondii population genetic studies. PMID:26174829

  8. Self-sequencing of amino acids and origins of polyfunctional protocells

    NASA Technical Reports Server (NTRS)

    Fox, S. W.

    1984-01-01

    The role of proteins in the origin of living things is discussed. It has been experimentally established that amino acids can sequence themselves under simulated geological conditions with highly nonrandom products which accordingly contain diverse information. Multiple copies of each type of macromolecule are formed, resulting in greater power for any protoenzymic molecule than would accrue from a single copy of each type. Thermal proteins are readily incorporated into laboratory protocells. The experimental evidence for original polyfunctional protocells is discussed.

  9. Global Genomic Diversity of Human Papillomavirus 6 Based on 724 Isolates and 190 Complete Genome Sequences

    PubMed Central

    Jelen, Mateja M.; Chen, Zigui; Kocjan, Boštjan J.; Burt, Felicity J.; Chan, Paul K. S.; Chouhy, Diego; Combrinck, Catharina E.; Coutlée, François; Estrade, Christine; Ferenczy, Alex; Fiander, Alison; Franco, Eduardo L.; Garland, Suzanne M.; Giri, Adriana A.; González, Joaquín Víctor; Gröning, Arndt; Heidrich, Kerstin; Hibbitts, Sam; Hošnjak, Lea; Luk, Tommy N. M.; Marinic, Karina; Matsukura, Toshihiko; Neumann, Anna; Oštrbenk, Anja; Picconi, Maria Alejandra; Richardson, Harriet; Sagadin, Martin; Sahli, Roland; Seedat, Riaz Y.; Seme, Katja; Severini, Alberto; Sinchi, Jessica L.; Smahelova, Jana; Tabrizi, Sepehr N.; Tachezy, Ruth; Tohme, Sarah; Uloza, Virgilijus; Vitkauskiene, Astra; Wong, Yong Wee; Židovec Lepej, Snježana; Burk, Robert D.

    2014-01-01

    ABSTRACT Human papillomavirus type 6 (HPV6) is the major etiological agent of anogenital warts and laryngeal papillomas and has been included in both the quadrivalent and nonavalent prophylactic HPV vaccines. This study investigated the global genomic diversity of HPV6, using 724 isolates and 190 complete genomes from six continents, and the association of HPV6 genomic variants with geographical location, anatomical site of infection/disease, and gender. Initially, a 2,800-bp E5a-E5b-L1-LCR fragment was sequenced from 492/530 (92.8%) HPV6-positive samples collected for this study. Among them, 130 exhibited at least one single nucleotide polymorphism (SNP), indel, or amino acid change in the E5a-E5b-L1-LCR fragment and were sequenced in full. A global alignment and maximum likelihood tree of 190 complete HPV6 genomes (130 fully sequenced in this study and 60 obtained from sequence repositories) revealed two variant lineages, A and B, and five B sublineages: B1, B2, B3, B4, and B5. HPV6 (sub)lineage-specific SNPs and a 960-bp representative region for whole-genome-based phylogenetic clustering within the L2 open reading frame were identified. Multivariate logistic regression analysis revealed that lineage B predominated globally. Sublineage B3 was more common in Africa and North and South America, and lineage A was more common in Asia. Sublineages B1 and B3 were associated with anogenital infections, indicating a potential lesion-specific predilection of some HPV6 sublineages. Females had higher odds for infection with sublineage B3 than males. In conclusion, a global HPV6 phylogenetic analysis revealed the existence of two variant lineages and five sublineages, showing some degree of ethnogeographic, gender, and/or disease predilection in their distribution. IMPORTANCE This study established the largest database of globally circulating HPV6 genomic variants and contributed a total of 130 new, complete HPV6 genome sequences to available sequence repositories. Two HPV

  10. Insights into the diversity of eukaryotes in acid mine drainage biofilm communities.

    PubMed

    Baker, Brett J; Tyson, Gene W; Goosherst, Lindsey; Banfield, Jillian F

    2009-04-01

    Microscopic eukaryotes are known to have important ecosystem functions, but their diversity in most environments remains vastly unexplored. Here we analyzed an 18S rRNA gene library from a subsurface iron- and sulfur-oxidizing microbial community growing in highly acidic (pH < 0.9) runoff within the Richmond Mine at Iron Mountain (northern California). Phylogenetic analysis revealed that the majority (68%) of the sequences belonged to fungi. Protists falling into the deeply branching lineage named the acidophilic protist clade (APC) and the class Heterolobosea were also present. The APC group represents kingdom-level novelty, with <76% sequence similarity to 18S rRNA gene sequences of organisms from other environments. Fluorescently labeled oligonucleotide rRNA probes were designed to target each of these groups in biofilm samples, enabling abundance and morphological characterization. Results revealed that the populations vary significantly with the habitat and no group is ubiquitous. Surprisingly, many of the eukaryotic lineages (with the exception of the APC) are closely related to neutrophiles, suggesting that they recently adapted to this extreme environment. Molecular analyses presented here confirm that the number of eukaryotic species associated with the acid mine drainage (AMD) communities is low. This finding is consistent with previous results showing a limited diversity of archaea, bacteria, and viruses in AMD environments and suggests that the environmental pressures and interplay between the members of these communities limit species diversity at all trophic levels.

  11. Meteoritic Amino Acids: Diversity in Compositions Reflects Parent Body Histories

    PubMed Central

    2016-01-01

    The analysis of amino acids in meteorites dates back over 50 years; however, it is only in recent years that research has expanded beyond investigations of a narrow set of meteorite groups (exemplified by the Murchison meteorite) into meteorites of other types and classes. These new studies have shown a wide diversity in the abundance and distribution of amino acids across carbonaceous chondrite groups, highlighting the role of parent body processes and composition in the creation, preservation, or alteration of amino acids. Although most chiral amino acids are racemic in meteorites, the enantiomeric distribution of some amino acids, particularly of the nonprotein amino acid isovaline, has also been shown to vary both within certain meteorites and across carbonaceous meteorite groups. Large l-enantiomeric excesses of some extraterrestrial protein amino acids (up to ∼60%) have also been observed in rare cases and point to nonbiological enantiomeric enrichment processes prior to the emergence of life. In this Outlook, we review these recent meteoritic analyses, focusing on variations in abundance, structural distributions, and enantiomeric distributions of amino acids and discussing possible explanations for these observations and the potential for future work. PMID:27413780

  12. Meteoritic Amino Acids: Diversity in Compositions Reflects Parent Body Histories.

    PubMed

    Elsila, Jamie E; Aponte, José C; Blackmond, Donna G; Burton, Aaron S; Dworkin, Jason P; Glavin, Daniel P

    2016-06-22

    The analysis of amino acids in meteorites dates back over 50 years; however, it is only in recent years that research has expanded beyond investigations of a narrow set of meteorite groups (exemplified by the Murchison meteorite) into meteorites of other types and classes. These new studies have shown a wide diversity in the abundance and distribution of amino acids across carbonaceous chondrite groups, highlighting the role of parent body processes and composition in the creation, preservation, or alteration of amino acids. Although most chiral amino acids are racemic in meteorites, the enantiomeric distribution of some amino acids, particularly of the nonprotein amino acid isovaline, has also been shown to vary both within certain meteorites and across carbonaceous meteorite groups. Large l-enantiomeric excesses of some extraterrestrial protein amino acids (up to ∼60%) have also been observed in rare cases and point to nonbiological enantiomeric enrichment processes prior to the emergence of life. In this Outlook, we review these recent meteoritic analyses, focusing on variations in abundance, structural distributions, and enantiomeric distributions of amino acids and discussing possible explanations for these observations and the potential for future work. PMID:27413780

  13. Meteoritic Amino Acids: Diversity in Compositions Reflects Parent Body Histories.

    PubMed

    Elsila, Jamie E; Aponte, José C; Blackmond, Donna G; Burton, Aaron S; Dworkin, Jason P; Glavin, Daniel P

    2016-06-22

    The analysis of amino acids in meteorites dates back over 50 years; however, it is only in recent years that research has expanded beyond investigations of a narrow set of meteorite groups (exemplified by the Murchison meteorite) into meteorites of other types and classes. These new studies have shown a wide diversity in the abundance and distribution of amino acids across carbonaceous chondrite groups, highlighting the role of parent body processes and composition in the creation, preservation, or alteration of amino acids. Although most chiral amino acids are racemic in meteorites, the enantiomeric distribution of some amino acids, particularly of the nonprotein amino acid isovaline, has also been shown to vary both within certain meteorites and across carbonaceous meteorite groups. Large l-enantiomeric excesses of some extraterrestrial protein amino acids (up to ∼60%) have also been observed in rare cases and point to nonbiological enantiomeric enrichment processes prior to the emergence of life. In this Outlook, we review these recent meteoritic analyses, focusing on variations in abundance, structural distributions, and enantiomeric distributions of amino acids and discussing possible explanations for these observations and the potential for future work.

  14. Patterns of diversity of citric acid cycle enzymes.

    PubMed

    Weitzman, P D

    1987-01-01

    The citric acid cycle performs a dual role in cell metabolism, acting as a source of both 'energy' and biosynthetic starting materials. The widespread occurrence of the cycle throughout Nature is an excellent example of the unity of biochemistry, but closer examination reveals that there is considerable diversity in the citric acid cycle of different organisms with respect to metabolic role, molecular enzymology and mode of regulation. Two enzymes of the cycle--citrate synthase and succinate thiokinase--have been found to exhibit particularly striking patterns of diversity in structure and catalytic and regulatory function. Some of these patterns show a correlation with the taxonomic groupings of the organisms and with their physiological characteristics. Comparative enzyme studies have a contribution to make to an ultimate understanding of the cycle and its cellular operation, and there are substantial benefits to be gained from interactive studies on both prokaryotic and eukaryotic systems.

  15. Diversity of putative archaeal RNA viruses in metagenomic datasets of a yellowstone acidic hot spring.

    PubMed

    Wang, Hongming; Yu, Yongxin; Liu, Taigang; Pan, Yingjie; Yan, Shuling; Wang, Yongjie

    2015-01-01

    Two genomic fragments (5,662 and 1,269 nt in size, GenBank accession no. JQ756122 and JQ756123, respectively) of novel, positive-strand RNA viruses that infect archaea were first discovered in an acidic hot spring in Yellowstone National Park (Bolduc et al., 2012). To investigate the diversity of these newly identified putative archaeal RNA viruses, global metagenomic datasets were searched for sequences that were significantly similar to those of the viruses. A total of 3,757 associated reads were retrieved solely from the Yellowstone datasets and were used to assemble the genomes of the putative archaeal RNA viruses. Nine contigs with lengths ranging from 417 to 5,866 nt were obtained, 4 of which were longer than 2,200 nt; one contig was 204 nt longer than JQ756122, representing the longest genomic sequence of the putative archaeal RNA viruses. These contigs revealed more than 50% sequence similarity to JQ756122 or JQ756123 and may be partial or nearly complete genomes of novel genogroups or genotypes of the putative archaeal RNA viruses. Sequence and phylogenetic analyses indicated that the archaeal RNA viruses are genetically diverse, with at least 3 related viral lineages in the Yellowstone acidic hot spring environment.

  16. Bovine Genetic Diversity Revealed By mtDNA Sequence Variation

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Mitochondrial DNA single nucleotide polymorphism (SNP) data were used to determine genetic distance, nucleotide diversity, construction of haplotypes, estimation of information contents, and phylogenic relationships in bovine HapMap breeds. The Bovine International HapMap panel consists of 720 anima...

  17. Amino acid sequences of proteins from Leptospira serovar pomona.

    PubMed

    Alves, S F; Lefebvre, R B; Probert, W

    2000-01-01

    This report describes a partial amino acid sequences from three putative outer envelope proteins from Leptospira serovar pomona. In order to obtain internal fragments for protein sequencing, enzymatic and chemical digestion was performed. The enzyme clostripain was used to digest the proteins 32 and 45 kDa. In situ digestion of 40 kDa molecular weight protein was accomplished using cyanogen bromide. The 32 kDa protein generated two fragments, one of 21 kDa and another of 10 kDa that yielded five residues. A fragment of 24 kDa that yielded nineteen residues of amino acids was obtained from 45 kDa protein. A fragment with a molecular weight of 20 kDa, yielding a twenty amino acids sequence from the 40 kDa protein.

  18. The amino acid sequence of Staphylococcus aureus penicillinase.

    PubMed Central

    Ambler, R P

    1975-01-01

    The amino acid sequence of the penicillinase (penicillin amido-beta-lactamhydrolase, EC 3.5.2.6) from Staphylococcus aureus strain PC1 was determined. The protein consists of a single polypeptide chain of 257 residues, and the sequence was determined by characterization of tryptic, chymotryptic, peptic and CNBr peptides, with some additional evidence from thermolysin and S. aureus proteinase peptides. A mistake in the preliminary report of the sequence is corrected; residues 113-116 are now thought to be -Lys-Lys-Val-Lys- rather than -Lys-Val-Lys-Lys-. Detailed evidence for the amino acid sequence has been deposited as Supplementary Publication SUP 50056 (91 pages) at the British Library (Lending Division), Boston Spa, Wetherby, West Yorkshire LS23 7BQ, U.K., from whom copies may be obtained on the terms given in Biochem. J. (1975) 145, 5. PMID:1218078

  19. Demographic history of India and mtDNA-sequence diversity.

    PubMed Central

    Mountain, J L; Hebert, J M; Bhattacharyya, S; Underhill, P A; Ottolenghi, C; Gadgil, M; Cavalli-Sforza, L L

    1995-01-01

    The demographic history of India was examined by comparing mtDNA sequences obtained from members of three culturally divergent Indian subpopulations (endogamous caste groups). While an inferred tree revealed some clustering according to caste affiliation, there was no clear separation into three genetically distinct groups along caste lines. Comparison of pairwise nucleotide difference distributions, however, did indicate a difference in growth patterns between two of the castes. The Brahmin population appears to have undergone either a rapid expansion or steady growth. The low-ranking Mukri caste, however, may have either maintained a roughly constant population size or undergone multiple bottlenecks during that period. Comparison of the Indian sequences to those obtained from other populations, using a tree, revealed that the Indian sequences, along with all other non-African samples, form a starlike cluster. This cluster may represent a major expansion, possibly originating in southern Asia, taking place at some point after modern humans initially left Africa. PMID:7717409

  20. Multilocus sequence analysis of Streptomyces griseus isolates delineating intraspecific diversity in terms of both taxonomy and biosynthetic potential.

    PubMed

    Rong, Xiaoying; Liu, Ning; Ruan, Jisheng; Huang, Ying

    2010-08-01

    Systematics can provide a fundamental framework for understanding the relationships and diversification of organisms. Multilocus sequence analysis (MLSA) has shown great promise for an elaborate taxonomic grouping of streptomycete diversity. To evaluate the practical significance of MLSA as a valuable systematic tool for streptomycetes, we examined six endophytic Streptomyces griseus isolates and two S. griseus reference strains possessing obvious antagonistic activities and identical 16S rRNA gene sequences, using both housekeeping genes and secondary metabolic genes. All the eight strains contained PKS-I and NRPS genes, but not PKS-II genes, and showed similar diversity in both the MLSA phylogeny based on five housekeeping genes (atpD, gyrB, recA, rpoB and trpB) and fingerprinting of KS-AT genes. We also inferred a phylogeny based on concatenated amino acid sequences of representative KS-AT genes from the strains, which displayed a topology correlated well with those of housekeeping-gene MLSA and KS-AT fingerprinting. The good congruence observed between phylogenies based on the different datasets verified that the MLSA scheme provided robust resolution at intraspecific level and could predict the overall diversity of secondary metabolic potential within a Streptomyces species, despite somewhat of a discrepancy with antimicrobial data. It is therefore feasible to apply MLSA to dissecting natural diversity of streptomycetes for a better understanding of their evolution and ecology, as well as for facilitating their bioprospecting. PMID:20461465

  1. Sequence diversity of NanA manifests in distinct enzyme kinetics and inhibitor susceptibility

    NASA Astrophysics Data System (ADS)

    Xu, Zhongli; von Grafenstein, Susanne; Walther, Elisabeth; Fuchs, Julian E.; Liedl, Klaus R.; Sauerbrei, Andreas; Schmidtke, Michaela

    2016-04-01

    Streptococcus pneumoniae is the leading pathogen causing bacterial pneumonia and meningitis. Its surface-associated virulence factor neuraminidase A (NanA) promotes the bacterial colonization by removing the terminal sialyl residues from glycoconjugates on eukaryotic cell surface. The predominant role of NanA in the pathogenesis of pneumococci renders it an attractive target for therapeutic intervention. Despite the highly conserved activity of NanA, our alignment of the 11 NanAs revealed the evolutionary diversity of this enzyme. The amino acid substitutions we identified, particularly those in the lectin domain and in the insertion domain next to the catalytic centre triggered our special interest. We synthesised the representative NanAs and the mutagenized derivatives from E. coli for enzyme kinetics study and neuraminidase inhibitor susceptibility test. Via molecular docking we got a deeper insight into the differences between the two major variants of NanA and their influence on the ligand-target interactions. In addition, our molecular dynamics simulations revealed a prominent intrinsic flexibility of the linker between the active site and the insertion domain, which influences the inhibitor binding. Our findings for the first time associated the primary sequence diversity of NanA with the biochemical properties of the enzyme and with the inhibitory efficiency of neuraminidase inhibitors.

  2. Sequence diversity of NanA manifests in distinct enzyme kinetics and inhibitor susceptibility

    PubMed Central

    Xu, Zhongli; von Grafenstein, Susanne; Walther, Elisabeth; Fuchs, Julian E.; Liedl, Klaus R.; Sauerbrei, Andreas; Schmidtke, Michaela

    2016-01-01

    Streptococcus pneumoniae is the leading pathogen causing bacterial pneumonia and meningitis. Its surface-associated virulence factor neuraminidase A (NanA) promotes the bacterial colonization by removing the terminal sialyl residues from glycoconjugates on eukaryotic cell surface. The predominant role of NanA in the pathogenesis of pneumococci renders it an attractive target for therapeutic intervention. Despite the highly conserved activity of NanA, our alignment of the 11 NanAs revealed the evolutionary diversity of this enzyme. The amino acid substitutions we identified, particularly those in the lectin domain and in the insertion domain next to the catalytic centre triggered our special interest. We synthesised the representative NanAs and the mutagenized derivatives from E. coli for enzyme kinetics study and neuraminidase inhibitor susceptibility test. Via molecular docking we got a deeper insight into the differences between the two major variants of NanA and their influence on the ligand-target interactions. In addition, our molecular dynamics simulations revealed a prominent intrinsic flexibility of the linker between the active site and the insertion domain, which influences the inhibitor binding. Our findings for the first time associated the primary sequence diversity of NanA with the biochemical properties of the enzyme and with the inhibitory efficiency of neuraminidase inhibitors. PMID:27125351

  3. Nucleotide sequence of Crithidia fasciculata cytosol 5S ribosomal ribonucleic acid.

    PubMed

    MacKay, R M; Gray, M W; Doolittle, W F

    1980-11-11

    The complete nucleotide sequence of the cytosol 5S ribosomal ribonucleic acid of the trypanosomatid protozoan Crithidia fasciculata has been determined by a combination of T1-oligonucleotide catalog and gel sequencing techniques. The sequence is: GAGUACGACCAUACUUGAGUGAAAACACCAUAUCCCGUCCGAUUUGUGAAGUUAAGCACC CACAGGCUUAGUUAGUACUGAGGUCAGUGAUGACUCGGGAACCCUGAGUGCCGUACUCCCOH. This 5S ribosomal RNA is unique in having GAUU in place of the GAAC or GAUC found in all other prokaryotic and eukaryotic 5S RNAs, and thought to be involved in interactions with tRNAs. Comparisons to other eukaryotic cytosol 5S ribosomal RNA sequences indicate that the four major eukaryotic kingdoms (animals, plants, fungi, and protists) are about equally remote from each other, and that the latter kingdom may be the most internally diverse.

  4. Diverse Sequence of Courses Focuses on Problem Solving.

    ERIC Educational Resources Information Center

    Bennett, John

    1984-01-01

    Describes a program at the University of Iowa called the Mass Communication Laboratory Sequence that offers students the opportunity to develop their abilities as professional communicators who can identify, research, and analyze problems that need communication strategies and media products for solutions. (HOD)

  5. The amino-acid sequence of kangaroo pancreatic ribonuclease.

    PubMed

    Gaastra, W; Welling, G W; Beintema, J J

    1978-05-01

    Red kangaroo (Macropus rufus) ribonuclease was isolated from pancreatic tissue by affinity chromatography. The amino acid sequence was determined by automatic sequencing of overlapping large fragments and by analysis of shorter peptides obtained by digestion with a number of proteolytic enzymes. The polypeptide chain consists of 122 amino acid residues. Compared to other ribonucleases, the N-terminal residue and residue 114 are deleted. In other pancreatic ribonucleases position 114 is occupied by a cis proline residue in an external loop at the surface of the molecule. Other remarkable substitutions are the presence of a tyrosine residue at position 123 instead of a serine which forms a hydrogen bond with the pyrimidine ring of a nucleotide substrate, and a number of hydrophobichydrophilic interchanges in the sequence 51-55, which forms part of an alpha-helix in bovine ribonuclease and exhibits few substitutions in the placental mammals. Kangaroo ribonuclease contains no carbohydrate, although the enzyme possesses a recognition site for carbohydrate attachment in the sequence Asn-Val-Thr (62-64). The enzyme differs at about 35-40% of the positions from all other mammalian pancreatic ribonucleases sequenced to date, which is in agreement with the early divergence between the marsupials and the placental mammals. From fragmentary data a tentative sequence of red-necked wallaby (Macropus rufogriseus) pancreatic ribonuclease has been derived. Eight differences with the kangaroo sequence were found.

  6. The amino-acid sequence of kangaroo pancreatic ribonuclease.

    PubMed

    Gaastra, W; Welling, G W; Beintema, J J

    1978-05-01

    Red kangaroo (Macropus rufus) ribonuclease was isolated from pancreatic tissue by affinity chromatography. The amino acid sequence was determined by automatic sequencing of overlapping large fragments and by analysis of shorter peptides obtained by digestion with a number of proteolytic enzymes. The polypeptide chain consists of 122 amino acid residues. Compared to other ribonucleases, the N-terminal residue and residue 114 are deleted. In other pancreatic ribonucleases position 114 is occupied by a cis proline residue in an external loop at the surface of the molecule. Other remarkable substitutions are the presence of a tyrosine residue at position 123 instead of a serine which forms a hydrogen bond with the pyrimidine ring of a nucleotide substrate, and a number of hydrophobichydrophilic interchanges in the sequence 51-55, which forms part of an alpha-helix in bovine ribonuclease and exhibits few substitutions in the placental mammals. Kangaroo ribonuclease contains no carbohydrate, although the enzyme possesses a recognition site for carbohydrate attachment in the sequence Asn-Val-Thr (62-64). The enzyme differs at about 35-40% of the positions from all other mammalian pancreatic ribonucleases sequenced to date, which is in agreement with the early divergence between the marsupials and the placental mammals. From fragmentary data a tentative sequence of red-necked wallaby (Macropus rufogriseus) pancreatic ribonuclease has been derived. Eight differences with the kangaroo sequence were found. PMID:658039

  7. Sequence diversity under the multispecies coalescent with Yule process and constant population size.

    PubMed

    Heled, Joseph

    2012-03-01

    The study of sequence diversity under phylogenetic models is now classic. Theoretical studies of diversity under the Kingman coalescent appeared shortly after the introduction of the coalescent. In this paper we revisit this topic under the multispecies coalescent, an extension of the single population model to multiple populations. We derive exact formulas for the sequence dissimilarity of two sequences drawn at random under a basic multispecies setup. The multispecies model uses three parameters--the species tree birth rate under the pure birth process (Yule), the species effective population size and the mutation rate. We also discuss the effects of relaxing some of the model assumptions.

  8. Exploring Genetic Diversity in Plants Using High-Throughput Sequencing Techniques.

    PubMed

    Onda, Yoshihiko; Mochida, Keiichi

    2016-08-01

    Food security has emerged as an urgent concern because of the rising world population. To meet the food demands of the near future, it is required to improve the productivity of various crops, not just of staple food crops. The genetic diversity among plant populations in a given species allows the plants to adapt to various environmental conditions. Such diversity could therefore yield valuable traits that could overcome the food-security challenges. To explore genetic diversity comprehensively and to rapidly identify useful genes and/or allele, advanced high-throughput sequencing techniques, also called next-generation sequencing (NGS) technologies, have been developed. These provide practical solutions to the challenges in crop genomics. Here, we review various sources of genetic diversity in plants, newly developed genetic diversity-mining tools synergized with NGS techniques, and related genetic approaches such as quantitative trait locus analysis and genome-wide association study. PMID:27499684

  9. Development of an expert system for amino acid sequence identification.

    PubMed

    Hu, L; Saulinskas, E F; Johnson, P; Harrington, P B

    1996-08-01

    An expert system for amino acid sequence identification has been developed. The algorithm uses heuristic rules developed by human experts in protein sequencing. The system is applied to the chromatographic data of phenylthiohydantoin-amino acids acquired from an automated sequencer. The peak intensities in the current cycle are compared with those in the previous cycle, while the calibration and succeeding cycles are used as ancillary identification criteria when necessary. The retention time for each chromatographic peak in each cycle is corrected by the corresponding peak in the calibration cycle at the same run. The main improvement of our system compared with the onboard software used by the Applied Biosystems 477A Protein/Peptide Sequencer is that each peak in each cycle is assigned an identification name according to the corrected retention time to be used for the comparison with different cycles. The system was developed from analyses of ribonuclease A and evaluated by runs of four other protein samples that were not used in rule development. This paper demonstrates that rules developed by human experts can be automatically applied to sequence assignment. The expert system performed more accurately than the onboard software of the protein sequencer, in that the misidentification rates for the expert system were around 7%, whereas those for the onboard software were between 13 and 21%.

  10. Microbial diversity of active layer and permafrost in an acidic wetland from the Canadian High Arctic.

    PubMed

    Wilhelm, Roland C; Niederberger, Thomas D; Greer, Charles; Whyte, Lyle G

    2011-04-01

    The abundance and structure of archaeal and bacterial communities from the active layer and the associated permafrost of a moderately acidic (pH < 5.0) High Arctic wetland (Axel Heiberg Island, Nunavut, Canada) were investigated using culture- and molecular-based methods. Aerobic viable cell counts from the active layer were ∼100-fold greater than those from the permafrost (2.5 × 10(5) CFU·(g soil dry mass)(-1)); however, a greater diversity of isolates were cultured from permafrost, as determined by 16S rRNA gene sequencing. Isolates from both layers demonstrated growth characteristics of a psychrotolerant, halotolerant, and acidotolerant community. Archaea constituted 0.1% of the total 16S rRNA gene copy number and, in the 16S rRNA gene clone library, predominantly (71% and 95%) consisted of Crenarchaeota related to Group I. 1b. In contrast, bacterial communities were diverse (Shannon's diversity index, H = ∼4), with Acidobacteria constituting the largest division of active layer clones (30%) and Actinobacteria most abundant in permafrost (28%). Direct comparisons of 16S rRNA gene sequence data highlighted significant differences between the bacterial communities of each layer, with the greatest differences occurring within Actinobacteria. Comparisons of 16S rRNA gene sequences with those from other Arctic permafrost and cold-temperature wetlands revealed commonly occurring taxa within the phyla Chloroflexi, Acidobacteria, and Actinobacteria (families Intrasporangiaceae and Rubrobacteraceae). PMID:21491982

  11. RNA editing generates cellular subsets with diverse sequence within populations

    PubMed Central

    Harjanto, Dewi; Papamarkou, Theodore; Oates, Chris J.; Rayon-Estrada, Violeta; Papavasiliou, F. Nina; Papavasiliou, Anastasia

    2016-01-01

    RNA editing is a mutational mechanism that specifically alters the nucleotide content in transcribed RNA. However, editing rates vary widely, and could result from equivalent editing amongst individual cells, or represent an average of variable editing within a population. Here we present a hierarchical Bayesian model that quantifies the variance of editing rates at specific sites using RNA-seq data from both single cells, and a cognate bulk sample to distinguish between these two possibilities. The model predicts high variance for specific edited sites in murine macrophages and dendritic cells, findings that we validated experimentally by using targeted amplification of specific editable transcripts from single cells. The model also predicts changes in variance in editing rates for specific sites in dendritic cells during the course of LPS stimulation. Our data demonstrate substantial variance in editing signatures amongst single cells, supporting the notion that RNA editing generates diversity within cellular populations. PMID:27418407

  12. Low diversity in the mitogenome of sperm whales revealed by next-generation sequencing.

    PubMed

    Alexander, Alana; Steel, Debbie; Slikas, Beth; Hoekzema, Kendra; Carraher, Colm; Parks, Matthew; Cronn, Richard; Baker, C Scott

    2013-01-01

    Large population sizes and global distributions generally associate with high mitochondrial DNA control region (CR) diversity. The sperm whale (Physeter macrocephalus) is an exception, showing low CR diversity relative to other cetaceans; however, diversity levels throughout the remainder of the sperm whale mitogenome are unknown. We sequenced 20 mitogenomes from 17 sperm whales representative of worldwide diversity using Next Generation Sequencing (NGS) technologies (Illumina GAIIx, Roche 454 GS Junior). Resequencing of three individuals with both NGS platforms and partial Sanger sequencing showed low discrepancy rates (454-Illumina: 0.0071%; Sanger-Illumina: 0.0034%; and Sanger-454: 0.0023%) confirming suitability of both NGS platforms for investigating low mitogenomic diversity. Using the 17 sperm whale mitogenomes in a phylogenetic reconstruction with 41 other species, including 11 new dolphin mitogenomes, we tested two hypotheses for the low CR diversity. First, the hypothesis that CR-specific constraints have reduced diversity solely in the CR was rejected as diversity was low throughout the mitogenome, not just in the CR (overall diversity π = 0.096%; protein-coding 3rd codon = 0.22%; CR = 0.35%), and CR phylogenetic signal was congruent with protein-coding regions. Second, the hypothesis that slow substitution rates reduced diversity throughout the sperm whale mitogenome was rejected as sperm whales had significantly higher rates of CR evolution and no evidence of slow coding region evolution relative to other cetaceans. The estimated time to most recent common ancestor for sperm whale mitogenomes was 72,800 to 137,400 years ago (95% highest probability density interval), consistent with previous hypotheses of a bottleneck or selective sweep as likely causes of low mitogenome diversity.

  13. Low Diversity in the Mitogenome of Sperm Whales Revealed by Next-Generation Sequencing

    PubMed Central

    Alexander, Alana; Steel, Debbie; Slikas, Beth; Hoekzema, Kendra; Carraher, Colm; Parks, Matthew; Cronn, Richard; Baker, C. Scott

    2013-01-01

    Large population sizes and global distributions generally associate with high mitochondrial DNA control region (CR) diversity. The sperm whale (Physeter macrocephalus) is an exception, showing low CR diversity relative to other cetaceans; however, diversity levels throughout the remainder of the sperm whale mitogenome are unknown. We sequenced 20 mitogenomes from 17 sperm whales representative of worldwide diversity using Next Generation Sequencing (NGS) technologies (Illumina GAIIx, Roche 454 GS Junior). Resequencing of three individuals with both NGS platforms and partial Sanger sequencing showed low discrepancy rates (454-Illumina: 0.0071%; Sanger-Illumina: 0.0034%; and Sanger-454: 0.0023%) confirming suitability of both NGS platforms for investigating low mitogenomic diversity. Using the 17 sperm whale mitogenomes in a phylogenetic reconstruction with 41 other species, including 11 new dolphin mitogenomes, we tested two hypotheses for the low CR diversity. First, the hypothesis that CR-specific constraints have reduced diversity solely in the CR was rejected as diversity was low throughout the mitogenome, not just in the CR (overall diversity π = 0.096%; protein-coding 3rd codon = 0.22%; CR = 0.35%), and CR phylogenetic signal was congruent with protein-coding regions. Second, the hypothesis that slow substitution rates reduced diversity throughout the sperm whale mitogenome was rejected as sperm whales had significantly higher rates of CR evolution and no evidence of slow coding region evolution relative to other cetaceans. The estimated time to most recent common ancestor for sperm whale mitogenomes was 72,800 to 137,400 years ago (95% highest probability density interval), consistent with previous hypotheses of a bottleneck or selective sweep as likely causes of low mitogenome diversity. PMID:23254394

  14. High mitochondrial sequence diversity in linguistic isolates of the Alps.

    PubMed Central

    Stenico, M.; Nigro, L.; Bertorelle, G.; Calafell, F.; Capitanio, M.; Corrain, C.; Barbujani, G.

    1996-01-01

    Segment I of the control region of mtDNA (360 bases) was sequenced in seven samples, each of 10 individuals inhabiting villages in the eastern Italian Alps (South Tyrol and Trentino). Three linguistic groups, German, Italian, and Ladin, were represented by two samples each; the seventh sample comes from an isolated group of German origin, the Mocheni, who are linguistically distinct and geographically separated from the bulk of the German speakers. Seventy-four polymorphic sites were identified, defining 63 different haplotypes. Mocheni and Ladin speakers tend to form two clusters in the evolutionary trees inferred from sequences. Analysis of molecular variance shows significant differentiation within samples, among them, and among linguistic groups. Genetic differences between the Ladins and the other groups are not much smaller than between Europeans and some Africans; variation is large within groups, as well, with the exception of only the Mocheni. In the evolutionary trees where the four alpine groups are compared with other European populations, Mocheni and especially Ladins appear as clear outliers. Romansch-speaking Swiss, who are linguistically related to Ladins, are not genetically similar to them, for this segment of DNA. Because the time elapsed since colonization of the Alps (< or = 12,000 years) is short in mutational terms, the only model accounting for the observed relationships between mtDNA variation and linguistic identity seems one in which a population ancestral to Ladin speakers was already differentiated long before the Alps were settled and the current linguistic affiliations were established. For the Mocheni, the results are consistent with a simpler episode of allele loss, from an original genetic pool common to the ancestors of the current German speakers. PMID:8940282

  15. The genome of RNA tumor viruses contains polyadenylic acid sequences.

    PubMed

    Green, M; Cartas, M

    1972-04-01

    The 70S genome of two RNA tumor viruses, murine sarcoma virus and avian myeloblastosis virus, binds to Millipore filters in buffer with high salt concentration and to glass fiber filters containing poly(U). These observations suggest that 70S RNA contains adenylic acid-rich sequences. When digested by pancreatic RNase, 70S RNA of murine sarcoma virus yielded poly(A) sequences that contain 91% adenylic acid. These poly(A) sequences sedimented as a relatively homogenous peak in sucrose gradients with a sedimentation coefficient of 4-5 S, but had a mobility during polyacrylamide gel electrophoresis that corresponds to molecules that sediment at 6-7 S. If we estimate a molecular weight for each sequence of 30,000-60,000 (100-200 nucleotides) and a molecular weight for viral 70S RNA of 3-12 million, each viral genome could contain 1-8 poly(A) sequences. Possible functions of poly(A) in the infecting viral RNA may include a role in the initiation of viral DNA or RNA synthesis, in protein maturation, or in the assembly of the viral genome.

  16. Genome diversity in Brachypodium distachyon: deep sequencing of highly diverse inbred lines

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Natural variation provides a powerful opportunity to study the genetic basis of biological traits. Brachypodium distachyon is a broadly distributed diploid model grass with a small genome and a large collection of diverse inbred lines. As a step towards understanding the genetic basis of the natura...

  17. Genotyping by sequencing reveals the genetic diversity of the USDA pisum diversity collection

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The USDA expanded Pisum Single Plant (PSP) core collection is a unique resource that represents the breadth of the genetic diversity of the genus in an inbred format that facilitates genetic study. The collection includes inbred accessions from the refined pea core collection, parent lines of USDA r...

  18. Sequence diversity of the merozoite surface protein 1 of Plasmodium falciparum in clinical isolates from the Kilombero District, Tanzania.

    PubMed

    Jiang, G; Daubenberger, C; Huber, W; Matile, H; Tanner, M; Pluschke, G

    2000-01-01

    Merozoite surface protein 1 of Plasmodium falciparum (PfMSP-1) is regarded as a key candidate antigen for malaria vaccine development. It exhibits significant antigenic polymorphism and has been divided into 17 building blocks based on the analysis of sequence diversity. Differences in the antigenic composition of PfMSP-1 in local P. falciparum populations may result in differences in the efficacy of vaccines, which contain sequences of particular allelic variant(s) of PfMSP-1. To contribute to the required knowledge of genetic diversity of malaria parasites in geographically diverse regions, we have used the polymerase chain reaction (PCR) to analyze the sequence diversity of blocks 1-4 of PfMSP-1 in disease isolates from the Kilombero District in Tanzania. In the semi-conserved block 1, in which dimorphic amino acid variances have been described at three positions, we found three of the five previously described combinations of these three pairs of amino acids. In addition one combination was found, which has not been reported before in parasite isolates from different locations worldwide. Of the two sequence variants, which were dominating, one (S44-Q47-V52) corresponded to the 83.1 sequence incorporated into the SPf66 malaria peptide vaccine, while the other one (G44-H47-I52) differed from the previous in all three dimorphic amino acids. The partial protection observed in a phase III SPf66 trial conducted in the Kilombero District in children aged 1-5, thus does not seem to be associated with a clear dominance of favourable variants of block 1 of PfMSP-1 in this area. All three different principle types of block 2, the major polymorphic region of PfMSP-1, were found in the Tanzanian isolates. Most of the sequences contained K1-type tripeptide repeats, but clones with MAD20-type repeats or no repetitive sequence (RO33-type block 2) were also present. K1- and MAD20-type tripeptide repeat motifs were never mixed within one parasite clone. In one sequence a

  19. Nucleic acid sequence design via efficient ensemble defect optimization.

    PubMed

    Zadeh, Joseph N; Wolfe, Brian R; Pierce, Niles A

    2011-02-01

    We describe an algorithm for designing the sequence of one or more interacting nucleic acid strands intended to adopt a target secondary structure at equilibrium. Sequence design is formulated as an optimization problem with the goal of reducing the ensemble defect below a user-specified stop condition. For a candidate sequence and a given target secondary structure, the ensemble defect is the average number of incorrectly paired nucleotides at equilibrium evaluated over the ensemble of unpseudoknotted secondary structures. To reduce the computational cost of accepting or rejecting mutations to a random initial sequence, candidate mutations are evaluated on the leaf nodes of a tree-decomposition of the target structure. During leaf optimization, defect-weighted mutation sampling is used to select each candidate mutation position with probability proportional to its contribution to the ensemble defect of the leaf. As subsequences are merged moving up the tree, emergent structural defects resulting from crosstalk between sibling sequences are eliminated via reoptimization within the defective subtree starting from new random subsequences. Using a Θ(N(3) ) dynamic program to evaluate the ensemble defect of a target structure with N nucleotides, this hierarchical approach implies an asymptotic optimality bound on design time: for sufficiently large N, the cost of sequence design is bounded below by 4/3 the cost of a single evaluation of the ensemble defect for the full sequence. Hence, the design algorithm has time complexity Ω(N(3) ). For target structures containing N ∈{100,200,400,800,1600,3200} nucleotides and duplex stems ranging from 1 to 30 base pairs, RNA sequence designs at 37°C typically succeed in satisfying a stop condition with ensemble defect less than N/100. Empirically, the sequence design algorithm exhibits asymptotic optimality and the exponent in the time complexity bound is sharp.

  20. Diversity of lactic acid bacteria of the bioethanol process

    PubMed Central

    2010-01-01

    Background Bacteria may compete with yeast for nutrients during bioethanol production process, potentially causing economic losses. This is the first study aiming at the quantification and identification of Lactic Acid Bacteria (LAB) present in the bioethanol industrial processes in different distilleries of Brazil. Results A total of 489 LAB isolates were obtained from four distilleries in 2007 and 2008. The abundance of LAB in the fermentation tanks varied between 6.0 × 105 and 8.9 × 108 CFUs/mL. Crude sugar cane juice contained 7.4 × 107 to 6.0 × 108 LAB CFUs. Most of the LAB isolates belonged to the genus Lactobacillus according to rRNA operon enzyme restriction profiles. A variety of Lactobacillus species occurred throughout the bioethanol process, but the most frequently found species towards the end of the harvest season were L. fermentum and L. vini. The different rep-PCR patterns indicate the co-occurrence of distinct populations of the species L. fermentum and L. vini, suggesting a great intraspecific diversity. Representative isolates of both species had the ability to grow in medium containing up to 10% ethanol, suggesting selection of ethanol tolerant bacteria throughout the process. Conclusions This study served as a first survey of the LAB diversity in the bioethanol process in Brazil. The abundance and diversity of LAB suggest that they have a significant impact in the bioethanol process. PMID:21092306

  1. Microbial diversity and metabolic networks in acid mine drainage habitats

    PubMed Central

    Méndez-García, Celia; Peláez, Ana I.; Mesa, Victoria; Sánchez, Jesús; Golyshina, Olga V.; Ferrer, Manuel

    2015-01-01

    Acid mine drainage (AMD) emplacements are low-complexity natural systems. Low-pH conditions appear to be the main factor underlying the limited diversity of the microbial populations thriving in these environments, although temperature, ionic composition, total organic carbon, and dissolved oxygen are also considered to significantly influence their microbial life. This natural reduction in diversity driven by extreme conditions was reflected in several studies on the microbial populations inhabiting the various micro-environments present in such ecosystems. Early studies based on the physiology of the autochthonous microbiota and the growing success of omics-based methodologies have enabled a better understanding of microbial ecology and function in low-pH mine outflows; however, complementary omics-derived data should be included to completely describe their microbial ecology. Furthermore, recent updates on the distribution of eukaryotes and archaea recovered through sterile filtering (herein referred to as filterable fraction) in these environments demand their inclusion in the microbial characterization of AMD systems. In this review, we present a complete overview of the bacterial, archaeal (including filterable fraction), and eukaryotic diversity in these ecosystems, and include a thorough depiction of the metabolism and element cycling in AMD habitats. We also review different metabolic network structures at the organismal level, which is necessary to disentangle the role of each member of the AMD communities described thus far. PMID:26074887

  2. On combining protein sequences and nucleic acid sequences in phylogenetic analysis: the homeobox protein case.

    PubMed

    Agosti, D; Jacobs, D; DeSalle, R

    1996-01-01

    Amino acid encoding genes contain character state information that may be useful for phylogenetic analysis on at least two levels. The nucleotide sequence and the translated amino acid sequences have both been employed separately as character states for cladistic studies of various taxa, including studies of the genealogy of genes in multigene families. In essence, amino acid sequences and nucleic acid sequences are two different ways of character coding the information in a gene. Silent positions in the nucleotide sequence (first or third positions in codons that can accrue change without changing the identity of the amino acid that the triplet codes for) may accrue change relatively rapidly and become saturated, losing the pattern of historical divergence. On the other hand, non-silent nucleotide alterations and their accompanying amino acid changes may evolve too slowly to reveal relationships among closely related taxa. In general, the dynamics of sequence change in silent and non-silent positions in protein coding genes result in homoplasy and lack of resolution, respectively. We suggest that the combination of nucleic acid and the translated amino acid coded character states into the same data matrix for phylogenetic analysis addresses some of the problems caused by the rapid change of silent nucleotide positions and overall slow rate of change of non-silent nucleotide positions and slowly changing amino acid positions. One major theoretical problem with this approach is the apparent non-independence of the two sources of characters. However, there are at least three possible outcomes when comparing protein coding nucleic acid sequences with their translated amino acids in a phylogenetic context on a codon by codon basis. First, the two character sets for a codon may be entirely congruent with respect to the information they convey about the relationships of a certain set of taxa. Second, one character set may display no information concerning a phylogenetic

  3. Nanopores and nucleic acids: prospects for ultrarapid sequencing

    NASA Technical Reports Server (NTRS)

    Deamer, D. W.; Akeson, M.

    2000-01-01

    DNA and RNA molecules can be detected as they are driven through a nanopore by an applied electric field at rates ranging from several hundred microseconds to a few milliseconds per molecule. The nanopore can rapidly discriminate between pyrimidine and purine segments along a single-stranded nucleic acid molecule. Nanopore detection and characterization of single molecules represents a new method for directly reading information encoded in linear polymers. If single-nucleotide resolution can be achieved, it is possible that nucleic acid sequences can be determined at rates exceeding a thousand bases per second.

  4. Diversity of Frankia in soil assessed by Illumina sequencing of nifH gene fragments.

    PubMed

    Rodriguez, David; Guerra, Trina M; Forstner, Michael R J; Hahn, Dittmar

    2016-09-01

    Targeted Illumina sequencing of nitrogenase reductase (nifH) gene fragments and analyses of pair-end reads through a modified QIIME pipeline were used to assess the diversity of the actinomyceteous genus Frankia in three soils. Soils were vegetated with host or non-host plants, and included locations in Illinois (ABA, host), Colorado (CoMt, non-host), and Wisconsin (FMWI, non-host). After filtering, seven unique sequences were recovered for soil ABA, six for CoMt, and four sequences for FMWI. These sequences were included in a Bayesian topology anchored by published sequence data from pure cultures of Frankia. Sequences from all three soils showed affinities to Frankia strains from both the Alnus and Elaeagnus host infection groups. Reads representing Casuarina-infective strains were not detected. Four sequences from soil CoMt and five sequences from soil ABA did not cluster, at 97% similarity, into a shared OTU that contained a cultured relative. These results demonstrate that targeted Illumina sequencing provides an efficient and economical method for assessing haplotype diversity of ecofunctional genes (e.g. nifH) at the genus level in microorganisms that perform important ecosystem functions. PMID:27485903

  5. Sequence diversity and novelty of natural assemblages of picoeukaryotes from the Indian Ocean.

    PubMed

    Massana, Ramon; Pernice, Massimo; Bunge, John A; del Campo, Javier

    2011-02-01

    Despite the ecological importance of marine pico-size eukaryotes, the study of their in situ diversity using molecular tools started just a few years ago. These studies have revealed that marine picoeukaryotes are very diverse and include many novel taxa. However, the amount and structure of their phylogenetic diversity and the extent of their sequence novelty still remains poorly known, as a systematic analysis has been seldom attempted. In this study, we use a coherent and carefully curated data set of 500 published 18S ribosomal DNA sequences to quantify the diversity and novelty patterns of picoeukaryotes in the Indian Ocean. Our phylogenetic tree showed many distant lineages. We grouped sequences in OTUs (operational taxonomic units) at discrete values delineated by pair-wise Jukes-Cantor (JC) distances and tree patristic distances. At a distance of 0.01, the number of OTUs observed (237/242; using JC or patristic distances, respectively) was half the number of sequences analyzed, indicating the existence of microdiverse clusters of highly related sequences. At this distance level, we estimated 600-800 OTUs using several statistical methods. The number of OTUs observed was still substantial at higher distances (39/82 at 0.20 distance) suggesting a large diversity at high-taxonomic ranks. Most sequences were related to marine clones from other sites and many were distant to cultured organisms, highlighting the huge culturing gap within protists. The novelty analysis indicated the putative presence of pseudogenes and of truly novel high-rank phylogenetic lineages. The identified diversity and novelty patterns among marine picoeukaryotes are of great importance for understanding and interpreting their ecology and evolution.

  6. Diversity of 1,213 hepatitis C virus NS3 protease sequences from a clinical virology laboratory database in Marseille university hospitals, southeastern France.

    PubMed

    Hajji, Hind; Aherfi, Sarah; Motte, Anne; Ravaux, Isabelle; Mokhtari, Saadia; Ruiz, Jean-Marie; Poizot-Martin, Isabelle; Tourres, Christian; Tivoli, Natacha; Gérolami, René; Tamalet, Catherine; Colson, Philippe

    2015-11-01

    Infection with hepatitis C virus (HCV) represents a major public health concern worldwide. Recent therapeutic advances have been considerable, HCV genotype continuing to guide therapeutic management. Since 2008, HCV genotyping in our clinical microbiology laboratory at university hospitals of Marseille, Southeastern France, has been based on NS3 protease gene population sequencing, to allow concurrent HCV genotype and protease inhibitor (PI) genotypic resistance determinations. We aimed, first, to analyze the genetic diversity of HCV NS3 protease obtained from blood samples collected between 2003 and 2013 from patients monitored at university hospitals of Marseille and detect possible atypical sequences; and, second, to identify NS3 protease amino acid patterns associated with decreased susceptibility to HCV PIs. A total of 1,213 HCV NS3 protease sequences were available in our laboratory sequence database. We implemented a strategy based on bioinformatic tools to determine whether HCV sequences are representative of our local HCV genetic diversity, or divergent. In our 2003-2012 HCV NS3 protease sequence database, we delineated 32 clusters representative of the majority HCV genetic diversity, and 61 divergent sequences. Five of these divergent sequences showed less than 85% nucleotide identity with their top GenBank hit. In addition, among the 294 sequences obtained in 2013, three were divergent relative to these 32 previously delineated clusters. Finally, we detected both natural and on-treatment genotypic resistance to HCV NS3 PIs, including a substantial prevalence of Q80K substitutions associated with decreased susceptibility to simeprevir, a second generation PI.

  7. Exploring the environmental diversity of kinetoplastid flagellates in the high-throughput DNA sequencing era.

    PubMed

    d'Avila-Levy, Claudia Masini; Boucinha, Carolina; Kostygov, Alexei; Santos, Helena Lúcia Carneiro; Morelli, Karina Alessandra; Grybchuk-Ieremenko, Anastasiia; Duval, Linda; Votýpka, Jan; Yurchenko, Vyacheslav; Grellier, Philippe; Lukeš, Julius

    2015-12-01

    The class Kinetoplastea encompasses both free-living and parasitic species from a wide range of hosts. Several representatives of this group are responsible for severe human diseases and for economic losses in agriculture and livestock. While this group encompasses over 30 genera, most of the available information has been derived from the vertebrate pathogenic genera Leishmaniaand Trypanosoma. Recent studies of the previously neglected groups of Kinetoplastea indicated that the actual diversity is much higher than previously thought. This article discusses the known segment of kinetoplastid diversity and how gene-directed Sanger sequencing and next-generation sequencing methods can help to deepen our knowledge of these interesting protists.

  8. Exploring the environmental diversity of kinetoplastid flagellates in the high-throughput DNA sequencing era

    PubMed Central

    d’Avila-Levy, Claudia Masini; Boucinha, Carolina; Kostygov, Alexei; Santos, Helena Lúcia Carneiro; Morelli, Karina Alessandra; Grybchuk-Ieremenko, Anastasiia; Duval, Linda; Votýpka, Jan; Yurchenko, Vyacheslav; Grellier, Philippe; Lukeš, Julius

    2015-01-01

    The class Kinetoplastea encompasses both free-living and parasitic species from a wide range of hosts. Several representatives of this group are responsible for severe human diseases and for economic losses in agriculture and livestock. While this group encompasses over 30 genera, most of the available information has been derived from the vertebrate pathogenic genera Leishmaniaand Trypanosoma. Recent studies of the previously neglected groups of Kinetoplastea indicated that the actual diversity is much higher than previously thought. This article discusses the known segment of kinetoplastid diversity and how gene-directed Sanger sequencing and next-generation sequencing methods can help to deepen our knowledge of these interesting protists. PMID:26602872

  9. Challenges and opportunities in estimating viral genetic diversity from next-generation sequencing data

    PubMed Central

    Beerenwinkel, Niko; Günthard, Huldrych F.; Roth, Volker; Metzner, Karin J.

    2012-01-01

    Many viruses, including the clinically relevant RNA viruses HIV (human immunodeficiency virus) and HCV (hepatitis C virus), exist in large populations and display high genetic heterogeneity within and between infected hosts. Assessing intra-patient viral genetic diversity is essential for understanding the evolutionary dynamics of viruses, for designing effective vaccines, and for the success of antiviral therapy. Next-generation sequencing (NGS) technologies allow the rapid and cost-effective acquisition of thousands to millions of short DNA sequences from a single sample. However, this approach entails several challenges in experimental design and computational data analysis. Here, we review the entire process of inferring viral diversity from sample collection to computing measures of genetic diversity. We discuss sample preparation, including reverse transcription and amplification, and the effect of experimental conditions on diversity estimates due to in vitro base substitutions, insertions, deletions, and recombination. The use of different NGS platforms and their sequencing error profiles are compared in the context of various applications of diversity estimation, ranging from the detection of single nucleotide variants (SNVs) to the reconstruction of whole-genome haplotypes. We describe the statistical and computational challenges arising from these technical artifacts, and we review existing approaches, including available software, for their solution. Finally, we discuss open problems, and highlight successful biomedical applications and potential future clinical use of NGS to estimate viral diversity. PMID:22973268

  10. Challenges and opportunities in estimating viral genetic diversity from next-generation sequencing data.

    PubMed

    Beerenwinkel, Niko; Günthard, Huldrych F; Roth, Volker; Metzner, Karin J

    2012-01-01

    Many viruses, including the clinically relevant RNA viruses HIV (human immunodeficiency virus) and HCV (hepatitis C virus), exist in large populations and display high genetic heterogeneity within and between infected hosts. Assessing intra-patient viral genetic diversity is essential for understanding the evolutionary dynamics of viruses, for designing effective vaccines, and for the success of antiviral therapy. Next-generation sequencing (NGS) technologies allow the rapid and cost-effective acquisition of thousands to millions of short DNA sequences from a single sample. However, this approach entails several challenges in experimental design and computational data analysis. Here, we review the entire process of inferring viral diversity from sample collection to computing measures of genetic diversity. We discuss sample preparation, including reverse transcription and amplification, and the effect of experimental conditions on diversity estimates due to in vitro base substitutions, insertions, deletions, and recombination. The use of different NGS platforms and their sequencing error profiles are compared in the context of various applications of diversity estimation, ranging from the detection of single nucleotide variants (SNVs) to the reconstruction of whole-genome haplotypes. We describe the statistical and computational challenges arising from these technical artifacts, and we review existing approaches, including available software, for their solution. Finally, we discuss open problems, and highlight successful biomedical applications and potential future clinical use of NGS to estimate viral diversity.

  11. Expanding the diversity of oenococcal bacteriophages: insights into a novel group based on the integrase sequence.

    PubMed

    Jaomanjaka, Fety; Ballestra, Patricia; Dols-lafargue, Marguerite; Le Marrec, Claire

    2013-09-01

    Temperate bacteriophages are a contributor of the genetic diversity in the lactic acid bacterium Oenococcus oeni. We used a classification scheme for oenococcal prophages based on integrase gene polymorphism, to analyze a collection of Oenococcus strains mostly isolated in the area of Bordeaux, which represented the major lineages identified through MLST schemes in the species. Genome sequences of oenococcal prophages were clustered into four integrase groups (A to D) which were related to the chromosomal integration site. The prevalence of each group was determined and we could show that members of the intB- and intC-prophage groups were rare in our panel of strains. Our study focused on the so far uncharacterized members of the intD-group. Various intD viruses could be easily isolated from wine samples, while intD lysogens could be induced to produce phages active against two permissive O. oeni isolates. These data support the role of this prophage group in the biology of O. oeni. Global alignment of three relevant intD-prophages revealed significant conservation and highlighted a number of unique ORFs that may contribute to phage and lysogen fitness.

  12. The amino acid sequence of Escherichia coli cyanase.

    PubMed

    Chin, C C; Anderson, P M; Wold, F

    1983-01-10

    The amino acid sequence of the enzyme cyanase (cyanate hydrolase) from Escherichia coli has been determined by automatic Edman degradation of the intact protein and of its component peptides. The primary peptides used in the sequencing were produced by cyanogen bromide cleavage at the methionine residues, yielding 4 peptides plus free homoserine from the NH2-terminal methionine, and by trypsin cleavage at the 7 arginine residues after acetylation of the lysines. Secondary peptides required for overlaps and COOH-terminal sequences were produced by chymotrypsin or clostripain cleavage of some of the larger peptides. The complete sequence of the cyanase subunit consists of 156 amino acid residues (Mr 16,350). Based on the observation that the cysteine-containing peptide is obtained as a disulfide-linked dimer, it is proposed that the covalent structure of cyanase is made up of two subunits linked by a disulfide bond between the single cystine residue in each subunit. The native enzyme (Mr 150,000) then appears to be a complex of four or five such subunit dimers.

  13. Archaeal and bacterial diversity in acidic to circumneutral hot springs in the Philippines.

    PubMed

    Huang, Qiuyuan; Jiang, Hongchen; Briggs, Brandon R; Wang, Shang; Hou, Weiguo; Li, Gaoyuan; Wu, Geng; Solis, Ramonito; Arcilla, Carlo A; Abrajano, Teofilo; Dong, Hailiang

    2013-09-01

    The microbial diversity was investigated in sediments of six acidic to circumneutral hot springs (Temperature: 60-92 °C, pH 3.72-6.58) in the Philippines using an integrated approach that included geochemistry and 16S rRNA gene pyrosequencing. Both bacterial and archaeal abundances were lower in high-temperature springs than in moderate-temperature ones. Overall, the archaeal community consisted of sequence reads that exhibited a high similarity (nucleotide identity > 92%) to phyla Crenarchaeota, Euryarchaeota, and unclassified Archaea. The bacterial community was composed of sequence reads moderately related (nucleotide identity > 90%) to 17 phyla, with Aquificae and Firmicutes being dominant. These phylogenetic groups were correlated with environmental conditions such as temperature, dissolved sulfate and calcium concentrations in spring water, and sediment properties including total nitrogen, pyrite, and elemental sulfur. Based on the phylogenetic inference, sulfur metabolisms appear to be key physiological functions in these hot springs. Sulfobacillus (within phylum Firmicutes) along with members within Sulfolobales were abundant in two high-temperature springs (> 76 °C), and they were hypothesized to play an important role in regulating the sulfur cycling under high-temperature conditions. The results of this study improve our understanding of microbial diversity and community composition in acidic to circumneutral terrestrial hot springs and their relationships with geochemical conditions.

  14. Multilocus Sequence Typing of Genital Chlamydia trachomatis in Norway Reveals Multiple New Sequence Types and a Large Genetic Diversity

    PubMed Central

    Gravningen, Kirsten; Christerson, Linus; Furberg, Anne-Sofie; Simonsen, Gunnar Skov; Ödman, Kristina; Ståhlsten, Anna; Herrmann, Björn

    2012-01-01

    Background The Chlamydia trachomatis incidence rate in Finnmark, the most northern and sparsely populated county in Norway, has been twice the national average. This population based cross-sectional study among Finnmark high school students had the following aims: i) to examine distribution of multilocus sequence types (STs) of C. trachomatis in a previously unmapped area, ii) to compare chlamydia genetic diversity in Finnmark with that of two urban regions, and iii) to compare discriminatory capacity of multilocus sequence typing (MLST) with conventional ompA sequencing in a large number of chlamydia specimens. Methodology ompA sequencing and a high-resolution MLST system based on PCR amplification and DNA sequencing of five highly variable genetic regions were used. Eighty chlamydia specimens from adolescents aged 15–20 years in Finnmark were collected in five high schools (n = 60) and from routine clinical samples in the laboratory (n = 20). These were compared to routine clinical samples from adolescents in Tromsø (n = 80) and Trondheim (n = 88), capitals of North and Central Norway, respectively. Principal Findings ompA sequencing detected 11 genotypes in 248 specimens from all three areas. MLST displayed 50 STs providing a five-fold higher resolution. Two-thirds of all STs were novel. The common ompA E/Bour genotype comprised 46% and resolved into 24 different STs. MLST identified the Swedish new variant of C. trachomatis not discriminated by ompA sequencing. Simpson's discriminatory index (D) was 0.93 for MLST, while a corrected Dc was 0.97. There were no statistically significant differences in ST genetic diversity between geographic areas. Finnmark had an atypical genovar distribution with G being predominant. This was mainly due to expansion of specific STs of which the novel ST161 was unique for Finnmark. Conclusions/Significance MLST revealed multiple new STs and a larger genetic diversity in comparison to ompA sequencing and proved

  15. Estimating and comparing microbial diversity in the presence of sequencing errors

    PubMed Central

    Chiu, Chun-Huo

    2016-01-01

    Estimating and comparing microbial diversity are statistically challenging due to limited sampling and possible sequencing errors for low-frequency counts, producing spurious singletons. The inflated singleton count seriously affects statistical analysis and inferences about microbial diversity. Previous statistical approaches to tackle the sequencing errors generally require different parametric assumptions about the sampling model or about the functional form of frequency counts. Different parametric assumptions may lead to drastically different diversity estimates. We focus on nonparametric methods which are universally valid for all parametric assumptions and can be used to compare diversity across communities. We develop here a nonparametric estimator of the true singleton count to replace the spurious singleton count in all methods/approaches. Our estimator of the true singleton count is in terms of the frequency counts of doubletons, tripletons and quadrupletons, provided these three frequency counts are reliable. To quantify microbial alpha diversity for an individual community, we adopt the measure of Hill numbers (effective number of taxa) under a nonparametric framework. Hill numbers, parameterized by an order q that determines the measures’ emphasis on rare or common species, include taxa richness (q = 0), Shannon diversity (q = 1, the exponential of Shannon entropy), and Simpson diversity (q = 2, the inverse of Simpson index). A diversity profile which depicts the Hill number as a function of order q conveys all information contained in a taxa abundance distribution. Based on the estimated singleton count and the original non-singleton frequency counts, two statistical approaches (non-asymptotic and asymptotic) are developed to compare microbial diversity for multiple communities. (1) A non-asymptotic approach refers to the comparison of estimated diversities of standardized samples with a common finite sample size or sample completeness. This

  16. Estimating and comparing microbial diversity in the presence of sequencing errors.

    PubMed

    Chiu, Chun-Huo; Chao, Anne

    2016-01-01

    Estimating and comparing microbial diversity are statistically challenging due to limited sampling and possible sequencing errors for low-frequency counts, producing spurious singletons. The inflated singleton count seriously affects statistical analysis and inferences about microbial diversity. Previous statistical approaches to tackle the sequencing errors generally require different parametric assumptions about the sampling model or about the functional form of frequency counts. Different parametric assumptions may lead to drastically different diversity estimates. We focus on nonparametric methods which are universally valid for all parametric assumptions and can be used to compare diversity across communities. We develop here a nonparametric estimator of the true singleton count to replace the spurious singleton count in all methods/approaches. Our estimator of the true singleton count is in terms of the frequency counts of doubletons, tripletons and quadrupletons, provided these three frequency counts are reliable. To quantify microbial alpha diversity for an individual community, we adopt the measure of Hill numbers (effective number of taxa) under a nonparametric framework. Hill numbers, parameterized by an order q that determines the measures' emphasis on rare or common species, include taxa richness (q = 0), Shannon diversity (q = 1, the exponential of Shannon entropy), and Simpson diversity (q = 2, the inverse of Simpson index). A diversity profile which depicts the Hill number as a function of order q conveys all information contained in a taxa abundance distribution. Based on the estimated singleton count and the original non-singleton frequency counts, two statistical approaches (non-asymptotic and asymptotic) are developed to compare microbial diversity for multiple communities. (1) A non-asymptotic approach refers to the comparison of estimated diversities of standardized samples with a common finite sample size or sample completeness. This approach

  17. Estimating and comparing microbial diversity in the presence of sequencing errors.

    PubMed

    Chiu, Chun-Huo; Chao, Anne

    2016-01-01

    Estimating and comparing microbial diversity are statistically challenging due to limited sampling and possible sequencing errors for low-frequency counts, producing spurious singletons. The inflated singleton count seriously affects statistical analysis and inferences about microbial diversity. Previous statistical approaches to tackle the sequencing errors generally require different parametric assumptions about the sampling model or about the functional form of frequency counts. Different parametric assumptions may lead to drastically different diversity estimates. We focus on nonparametric methods which are universally valid for all parametric assumptions and can be used to compare diversity across communities. We develop here a nonparametric estimator of the true singleton count to replace the spurious singleton count in all methods/approaches. Our estimator of the true singleton count is in terms of the frequency counts of doubletons, tripletons and quadrupletons, provided these three frequency counts are reliable. To quantify microbial alpha diversity for an individual community, we adopt the measure of Hill numbers (effective number of taxa) under a nonparametric framework. Hill numbers, parameterized by an order q that determines the measures' emphasis on rare or common species, include taxa richness (q = 0), Shannon diversity (q = 1, the exponential of Shannon entropy), and Simpson diversity (q = 2, the inverse of Simpson index). A diversity profile which depicts the Hill number as a function of order q conveys all information contained in a taxa abundance distribution. Based on the estimated singleton count and the original non-singleton frequency counts, two statistical approaches (non-asymptotic and asymptotic) are developed to compare microbial diversity for multiple communities. (1) A non-asymptotic approach refers to the comparison of estimated diversities of standardized samples with a common finite sample size or sample completeness. This approach

  18. Quantum-Sequencing: Biophysics of quantum tunneling through nucleic acids

    NASA Astrophysics Data System (ADS)

    Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant

    2014-03-01

    Tunneling microscopy and spectroscopy has extensively been used in physical surface sciences to study quantum tunneling to measure electronic local density of states of nanomaterials and to characterize adsorbed species. Quantum-Sequencing (Q-Seq) is a new method based on tunneling microscopy for electronic sequencing of single molecule of nucleic acids. A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free single-molecule sequencing method. Here, we present the unique ``electronic fingerprints'' for all nucleotides on DNA and RNA using Q-Seq along their intrinsic biophysical parameters. We have analyzed tunneling spectra for the nucleotides at different pH conditions and analyzed the HOMO, LUMO and energy gap for all of them. In addition we show a number of biophysical parameters to further characterize all nucleobases (electron and hole transition voltage and energy barriers). These results highlight the robustness of Q-Seq as a technique for next-generation sequencing.

  19. Next generation sequencing to define prokaryotic and fungal diversity in the bovine rumen

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A combination of Sanger and 454 sequences of small subunit rRNA loci were used to interrogate the microbial diversity in the bovine rumen of 14 pasture-fed animals. The observed bacterial species richness, based on the V1-V3 region of the 15S rRNA gene, was between 1902 to 2596 species-level operati...

  20. Propionibacterium acnes: Disease-Causing Agent or Common Contaminant? Detection in Diverse Patient Samples by Next-Generation Sequencing

    PubMed Central

    Friis-Nielsen, Jens; Vinner, Lasse; Hansen, Thomas Arn; Richter, Stine Raith; Fridholm, Helena; Herrera, Jose Alejandro Romero; Lund, Ole; Brunak, Søren; Izarzugaza, Jose M. G.; Mourier, Tobias; Nielsen, Lars Peter

    2016-01-01

    Propionibacterium acnes is the most abundant bacterium on human skin, particularly in sebaceous areas. P. acnes is suggested to be an opportunistic pathogen involved in the development of diverse medical conditions but is also a proven contaminant of human clinical samples and surgical wounds. Its significance as a pathogen is consequently a matter of debate. In the present study, we investigated the presence of P. acnes DNA in 250 next-generation sequencing data sets generated from 180 samples of 20 different sample types, mostly of cancerous origin. The samples were subjected to either microbial enrichment, involving nuclease treatment to reduce the amount of host nucleic acids, or shotgun sequencing. We detected high proportions of P. acnes DNA in enriched samples, particularly skin tissue-derived and other tissue samples, with the levels being higher in enriched samples than in shotgun-sequenced samples. P. acnes reads were detected in most samples analyzed, though the proportions in most shotgun-sequenced samples were low. Our results show that P. acnes can be detected in practically all sample types when molecular methods, such as next-generation sequencing, are employed. The possibility of contamination from the patient or other sources, including laboratory reagents or environment, should therefore always be considered carefully when P. acnes is detected in clinical samples. We advocate that detection of P. acnes always be accompanied by experiments validating the association between this bacterium and any clinical condition. PMID:26818667

  1. Diversity of preferred nucleotide sequences around the translation initiation codon in eukaryote genomes.

    PubMed

    Nakagawa, So; Niimura, Yoshihito; Gojobori, Takashi; Tanaka, Hiroshi; Miura, Kin-ichiro

    2008-02-01

    Understanding regulatory mechanisms of protein synthesis in eukaryotes is essential for the accurate annotation of genome sequences. Kozak reported that the nucleotide sequence GCCGCC(A/G)CCAUGG (AUG is the initiation codon) was frequently observed in vertebrate genes and that this 'consensus' sequence enhanced translation initiation. However, later studies using invertebrate, fungal and plant genes reported different 'consensus' sequences. In this study, we conducted extensive comparative analyses of nucleotide sequences around the initiation codon by using genomic data from 47 eukaryote species including animals, fungi, plants and protists. The analyses revealed that preferred nucleotide sequences are quite diverse among different species, but differences between patterns of nucleotide bias roughly reflect the evolutionary relationships of the species. We also found strong biases of A/G at position -3, A/C at position -2 and C at position +5 that were commonly observed in all species examined. Genes with higher expression levels showed stronger signals, suggesting that these nucleotides are responsible for the regulation of translation initiation. The diversity of preferred nucleotide sequences around the initiation codon might be explained by differences in relative contributions from two distinct patterns, GCCGCCAUG and AAAAAAAUG, which implies the presence of multiple molecular mechanisms for controlling translation initiation.

  2. Nucleic acid sequence detection using multiplexed oligonucleotide PCR

    SciTech Connect

    Nolan, John P.; White, P. Scott

    2006-12-26

    Methods for rapidly detecting single or multiple sequence alleles in a sample nucleic acid are described. Provided are all of the oligonucleotide pairs capable of annealing specifically to a target allele and discriminating among possible sequences thereof, and ligating to each other to form an oligonucleotide complex when a particular sequence feature is present (or, alternatively, absent) in the sample nucleic acid. The design of each oligonucleotide pair permits the subsequent high-level PCR amplification of a specific amplicon when the oligonucleotide complex is formed, but not when the oligonucleotide complex is not formed. The presence or absence of the specific amplicon is used to detect the allele. Detection of the specific amplicon may be achieved using a variety of methods well known in the art, including without limitation, oligonucleotide capture onto DNA chips or microarrays, oligonucleotide capture onto beads or microspheres, electrophoresis, and mass spectrometry. Various labels and address-capture tags may be employed in the amplicon detection step of multiplexed assays, as further described herein.

  3. Molecular cloning and amino acid sequence of human 5-lipoxygenase

    SciTech Connect

    Matsumoto, T.; Funk, C.D.; Radmark, O.; Hoeoeg, J.O.; Joernvall, H.; Samuelsson, B.

    1988-01-01

    5-Lipoxygenase (EC 1.13.11.34), a Ca/sup 2 +/- and ATP-requiring enzyme, catalyzes the first two steps in the biosynthesis of the peptidoleukotrienes and the chemotactic factor leukotriene B/sub 4/. A cDNA clone corresponding to 5-lipoxygenase was isolated from a human lung lambda gt11 expression library by immunoscreening with a polyclonal antibody. Additional clones from a human placenta lambda gt11 cDNA library were obtained by plaque hybridization with the /sup 32/P-labeled lung cDNA clone. Sequence data obtained from several overlapping clones indicate that the composite DNAs contain the complete coding region for the enzyme. From the deduced primary structure, 5-lipoxygenase encodes a 673 amino acid protein with a calculated molecular weight of 77,839. Direct analysis of the native protein and its proteolytic fragments confirmed the deduced composition, the amino-terminal amino acid sequence, and the structure of many internal segments. 5-Lipoxygenase has no apparent sequence homology with leukotriene A/sub 4/ hydrolase or Ca/sup 2 +/-binding proteins. RNA blot analysis indicated substantial amounts of an mRNA species of approx. = 2700 nucleotides in leukocytes, lung, and placenta.

  4. Characterization and amino acid sequence of a fatty acid-binding protein from human heart.

    PubMed Central

    Offner, G D; Brecher, P; Sawlivich, W B; Costello, C E; Troxler, R F

    1988-01-01

    The complete amino acid sequence of a fatty acid-binding protein from human heart was determined by automated Edman degradation of CNBr, BNPS-skatole [3'-bromo-3-methyl-2-(2-nitrobenzenesulphenyl)indolenine], hydroxylamine, Staphylococcus aureus V8 proteinase, tryptic and chymotryptic peptides, and by digestion of the protein with carboxypeptidase A. The sequence of the blocked N-terminal tryptic peptide from citraconylated protein was determined by collisionally induced decomposition mass spectrometry. The protein contains 132 amino acid residues, is enriched with respect to threonine and lysine, lacks cysteine, has an acetylated valine residue at the N-terminus, and has an Mr of 14768 and an isoelectric point of 5.25. This protein contains two short internal repeated sequences from residues 48-54 and from residues 114-119 located within regions of predicted beta-structure and decreasing hydrophobicity. These short repeats are contained within two longer repeated regions from residues 48-60 and residues 114-125, which display 62% sequence similarity. These regions could accommodate the charged and uncharged moieties of long-chain fatty acids and may represent fatty acid-binding domains consistent with the finding that human heart fatty acid-binding protein binds 2 mol of oleate or palmitate/mol of protein. Detailed evidence for the amino acid sequences of the peptides has been deposited as Supplementary Publication SUP 50143 (23 pages) at the British Library Lending Division, Boston Spa, Yorkshire LS23 7BQ, U.K., from whom copies may be obtained as indicated in Biochem. J. (1988) 249, 5. PMID:3421901

  5. Local diversity of heathland Cercozoa explored by in-depth sequencing

    PubMed Central

    Harder, Christoffer Bugge; Rønn, Regin; Brejnrod, Asker; Bass, David; Al-Soud, Waleed Abu; Ekelund, Flemming

    2016-01-01

    Cercozoa are abundant free-living soil protozoa and quantitatively important in soil food webs; yet, targeted high-throughput sequencing (HTS) has not yet been applied to this group. Here we describe the development of a targeted assay to explore Cercozoa using HTS, and we apply this assay to measure Cercozoan community response to drought in a Danish climate manipulation experiment (two sites exposed to artificial drought, two unexposed). Based on a comparison of the hypervariable regions of the 18S ribosomal DNA of 193 named Cercozoa, we concluded that the V4 region is the most suitable for group-specific diversity analysis. We then designed a set of highly specific primers (encompassing ~270 bp) for 454 sequencing. The primers captured all major cercozoan groups; and >95% of the obtained sequences were from Cercozoa. From 443 350 high-quality short reads (>300 bp), we recovered 1585 operational taxonomic units defined by >95% V4 sequence similarity. Taxonomic annotation by phylogeny enabled us to assign >95% of our reads to order level and ~85% to genus level despite the presence of a large, hitherto unknown diversity. Over 40% of the annotated sequences were assigned to Glissomonad genera, whereas the most common individually named genus was the euglyphid Trinema. Cercozoan diversity was largely resilient to drought, although we observed a community composition shift towards fewer testate amoebae. PMID:26953604

  6. Archaeon and archaeal virus diversity classification via sequence entropy and fractal dimension

    NASA Astrophysics Data System (ADS)

    Tremberger, George, Jr.; Gallardo, Victor; Espinoza, Carola; Holden, Todd; Gadura, N.; Cheung, E.; Schneider, P.; Lieberman, D.; Cheung, T.

    2010-09-01

    Archaea are important potential candidates in astrobiology as their metabolism includes solar, inorganic and organic energy sources. Archaeal viruses would also be expected to be present in a sustainable archaeal exobiological community. Genetic sequence Shannon entropy and fractal dimension can be used to establish a two-dimensional measure for classification and phylogenetic study of these organisms. A sequence fractal dimension can be calculated from a numerical series consisting of the atomic numbers of each nucleotide. Archaeal 16S and 23S ribosomal RNA sequences were studied. Outliers in the 16S rRNA fractal dimension and entropy plot were found to be halophilic archaea. Positive correlation (R-square ~ 0.75, N = 18) was observed between fractal dimension and entropy across the studied species. The 16S ribosomal RNA sequence entropy correlates with the 23S ribosomal RNA sequence entropy across species with R-square 0.93, N = 18. Entropy values correspond positively with branch lengths of a published phylogeny. The studied archaeal virus sequences have high fractal dimensions of 2.02 or more. A comparison of selected extremophile sequences with archaeal sequences from the Humboldt Marine Ecosystem database (Wood-Hull Oceanography Institute, MIT) suggests the presence of continuous sequence expression as inferred from distributions of entropy and fractal dimension, consistent with the diversity expected in an exobiological archaeal community.

  7. Soil Parameters Drive the Structure, Diversity and Metabolic Potentials of the Bacterial Communities Across Temperate Beech Forest Soil Sequences.

    PubMed

    Jeanbille, M; Buée, M; Bach, C; Cébron, A; Frey-Klett, P; Turpault, M P; Uroz, S

    2016-02-01

    Soil and climatic conditions as well as land cover and land management have been shown to strongly impact the structure and diversity of the soil bacterial communities. Here, we addressed under a same land cover the potential effect of the edaphic parameters on the soil bacterial communities, excluding potential confounding factors as climate. To do this, we characterized two natural soil sequences occurring in the Montiers experimental site. Spatially distant soil samples were collected below Fagus sylvatica tree stands to assess the effect of soil sequences on the edaphic parameters, as well as the structure and diversity of the bacterial communities. Soil analyses revealed that the two soil sequences were characterized by higher pH and calcium and magnesium contents in the lower plots. Metabolic assays based on Biolog Ecoplates highlighted higher intensity and richness in usable carbon substrates in the lower plots than in the middle and upper plots, although no significant differences occurred in the abundance of bacterial and fungal communities along the soil sequences as assessed using quantitative PCR. Pyrosequencing analysis of 16S ribosomal RNA (rRNA) gene amplicons revealed that Proteobacteria, Acidobacteria and Bacteroidetes were the most abundantly represented phyla. Acidobacteria, Proteobacteria and Chlamydiae were significantly enriched in the most acidic and nutrient-poor soils compared to the Bacteroidetes, which were significantly enriched in the soils presenting the higher pH and nutrient contents. Interestingly, aluminium, nitrogen, calcium, nutrient availability and pH appeared to be the best predictors of the bacterial community structures along the soil sequences.

  8. HuCAL PLATINUM, a synthetic Fab library optimized for sequence diversity and superior performance in mammalian expression systems.

    PubMed

    Prassler, Josef; Thiel, Stefanie; Pracht, Catrin; Polzer, Andrea; Peters, Solveig; Bauer, Marion; Nörenberg, Stephanie; Stark, Yvonne; Kölln, Johanna; Popp, Andreas; Urlinger, Stefanie; Enzelberger, Markus

    2011-10-14

    This article describes the design of HuCAL (human combinatorial antibody library) PLATINUM, an optimized, second-generation, synthetic human Fab antibody library with six trinucleotide-randomized complementarity-determining regions (CDRs). Major improvements regarding the optimized antibody library sequence space were implemented. Sequence space optimization is considered a multistep process that includes the analysis of unproductive antibody sequences in order to, for example, avoid motifs such as potential N-glycosylation sites, which are undesirable in antibody production. Gene optimization has been used to improve expression of the antibody master genes in the library context. As a result, full-length IgGs derived from the library show both significant improvements in expression levels and less undesirable glycosylation sites when compared to the previous HuCAL GOLD library. Additionally, in-depth analysis of sequences from public databases revealed that diversity of CDR-H3 is a function of loop length. Based upon this analysis, the relatively uniform diversification strategy used in the CDR-H3s of the previous HuCAL libraries was changed to a length-dependent design, which replicates the natural amino acid distribution of CDR-H3 in the human repertoire. In a side-by-side comparison of HuCAL GOLD and HuCAL PLATINUM, the new library concept led to isolation of about fourfold more unique sequences and to a higher number of high-affinity antibodies. In the majority of HuCAL PLATINUM projects, 100-300 antibodies each having different CDR-H3s are obtained against each antigen. This increased diversity pool has been shown to significantly benefit functional antibody profiling and screening for superior biophysical properties.

  9. New approaches for computer analysis of nucleic acid sequences.

    PubMed

    Karlin, S; Ghandour, G; Ost, F; Tavare, S; Korn, L J

    1983-09-01

    A new high-speed computer algorithm is outlined that ascertains within and between nucleic acid and protein sequences all direct repeats, dyad symmetries, and other structural relationships. Large repeats, repeats of high frequency, dyad symmetries of specified stem length and loop distance, and their distributions are determined. Significance of homologies is assessed by a hierarchy of permutation procedures. Applications are made to papovaviruses, the human papillomavirus HPV, lambda phage, the human and mouse mitochondrial genomes, and the human and mouse immunoglobulin kappa-chain genes. PMID:6577449

  10. Fatty Acid Profile and Unigene-Derived Simple Sequence Repeat Markers in Tung Tree (Vernicia fordii)

    PubMed Central

    Zhang, Lin; Jia, Baoguang; Tan, Xiaofeng; Thammina, Chandra S.; Long, Hongxu; Liu, Min; Wen, Shanna; Song, Xianliang; Cao, Heping

    2014-01-01

    Tung tree (Vernicia fordii) provides the sole source of tung oil widely used in industry. Lack of fatty acid composition and molecular markers hinders biochemical, genetic and breeding research. The objectives of this study were to determine fatty acid profiles and develop unigene-derived simple sequence repeat (SSR) markers in tung tree. Fatty acid profiles of 41 accessions showed that the ratio of α-eleostearic acid was increasing continuously with a parallel trend to the amount of tung oil accumulation while the ratios of other fatty acids were decreasing in different stages of the seeds and that α-eleostearic acid (18∶3) consisted of 77% of the total fatty acids in tung oil. Transcriptome sequencing identified 81,805 unigenes from tung cDNA library constructed using seed mRNA and discovered 6,366 SSRs in 5,404 unigenes. The di- and tri-nucleotide microsatellites accounted for 92% of the SSRs with AG/CT and AAG/CTT being the most abundant SSR motifs. Fifteen polymorphic genic-SSR markers were developed from 98 unigene loci tested in 41 cultivated tung accessions by agarose gel and capillary electrophoresis. Genbank database search identified 10 of them putatively coding for functional proteins. Quantitative PCR demonstrated that all 15 polymorphic SSR-associated unigenes were expressed in tung seeds and some of them were highly correlated with oil composition in the seeds. Dendrogram revealed that most of the 41 accessions were clustered according to the geographic region. These new polymorphic genic-SSR markers will facilitate future studies on genetic diversity, molecular fingerprinting, comparative genomics and genetic mapping in tung tree. The lipid profiles in the seeds of 41 tung accessions will be valuable for biochemical and breeding studies. PMID:25167054

  11. Evaluating methods for isolating total RNA and predicting the success of sequencing phylogenetically diverse plant transcriptomes.

    PubMed

    Johnson, Marc T J; Carpenter, Eric J; Tian, Zhijian; Bruskiewich, Richard; Burris, Jason N; Carrigan, Charlotte T; Chase, Mark W; Clarke, Neil D; Covshoff, Sarah; Depamphilis, Claude W; Edger, Patrick P; Goh, Falicia; Graham, Sean; Greiner, Stephan; Hibberd, Julian M; Jordon-Thaden, Ingrid; Kutchan, Toni M; Leebens-Mack, James; Melkonian, Michael; Miles, Nicholas; Myburg, Henrietta; Patterson, Jordan; Pires, J Chris; Ralph, Paula; Rolf, Megan; Sage, Rowan F; Soltis, Douglas; Soltis, Pamela; Stevenson, Dennis; Stewart, C Neal; Surek, Barbara; Thomsen, Christina J M; Villarreal, Juan Carlos; Wu, Xiaolei; Zhang, Yong; Deyholos, Michael K; Wong, Gane Ka-Shu

    2012-01-01

    Next-generation sequencing plays a central role in the characterization and quantification of transcriptomes. Although numerous metrics are purported to quantify the quality of RNA, there have been no large-scale empirical evaluations of the major determinants of sequencing success. We used a combination of existing and newly developed methods to isolate total RNA from 1115 samples from 695 plant species in 324 families, which represents >900 million years of phylogenetic diversity from green algae through flowering plants, including many plants of economic importance. We then sequenced 629 of these samples on Illumina GAIIx and HiSeq platforms and performed a large comparative analysis to identify predictors of RNA quality and the diversity of putative genes (scaffolds) expressed within samples. Tissue types (e.g., leaf vs. flower) varied in RNA quality, sequencing depth and the number of scaffolds. Tissue age also influenced RNA quality but not the number of scaffolds ≥ 1000 bp. Overall, 36% of the variation in the number of scaffolds was explained by metrics of RNA integrity (RIN score), RNA purity (OD 260/230), sequencing platform (GAIIx vs HiSeq) and the amount of total RNA used for sequencing. However, our results show that the most commonly used measures of RNA quality (e.g., RIN) are weak predictors of the number of scaffolds because Illumina sequencing is robust to variation in RNA quality. These results provide novel insight into the methods that are most important in isolating high quality RNA for sequencing and assembling plant transcriptomes. The methods and recommendations provided here could increase the efficiency and decrease the cost of RNA sequencing for individual labs and genome centers.

  12. Characterization of the microbial acid mine drainage microbial community using culturing and direct sequencing techniques.

    PubMed

    Auld, Ryan R; Myre, Maxine; Mykytczuk, Nadia C S; Leduc, Leo G; Merritt, Thomas J S

    2013-05-01

    We characterized the bacterial community from an AMD tailings pond using both classical culturing and modern direct sequencing techniques and compared the two methods. Acid mine drainage (AMD) is produced by the environmental and microbial oxidation of minerals dissolved from mining waste. Surprisingly, we know little about the microbial communities associated with AMD, despite the fundamental ecological roles of these organisms and large-scale economic impact of these waste sites. AMD microbial communities have classically been characterized by laboratory culturing-based techniques and more recently by direct sequencing of marker gene sequences, primarily the 16S rRNA gene. In our comparison of the techniques, we find that their results are complementary, overall indicating very similar community structure with similar dominant species, but with each method identifying some species that were missed by the other. We were able to culture the majority of species that our direct sequencing results indicated were present, primarily species within the Acidithiobacillus and Acidiphilium genera, although estimates of relative species abundance were only obtained from direct sequencing. Interestingly, our culture-based methods recovered four species that had been overlooked from our sequencing results because of the rarity of the marker gene sequences, likely members of the rare biosphere. Further, direct sequencing indicated that a single genus, completely missed in our culture-based study, Legionella, was a dominant member of the microbial community. Our results suggest that while either method does a reasonable job of identifying the dominant members of the AMD microbial community, together the methods combine to give a more complete picture of the true diversity of this environment. PMID:23485423

  13. Genetic diversity of Eritrean sorghum landraces assessed with simple sequence repeat (SSR) markers.

    PubMed

    Ghebru, B.; Schmidt, J.; Bennetzen, L.

    2002-08-01

    A precise high-throughput approach was used to characterize diversity in 28 Eritrean sorghum landraces, and to compare this diversity to representative samples of the world sorghum collection. Pools of simple sequence repeat (SSR) markers were sized and scored on automated DNA-sizing gels. An exceptionally high level of diversity was observed among the 28 Eritrean landraces, compared to other sorghum germplasms, in both the number and size range of SSR alleles. Individual landraces were found to carry a high level of within-population diversity and heterozygosity, and between-population diversity was equally high. Eritrean sorghums could be clustered into 7-10 major subgroups, with most (but not all) classifications agreeing with descriptions by farmers. Clustering did not concur particularly well with the major classification system applied in Eritrea, highland versus lowland. Eight of the Eritrean landraces grouped with other sorghums in the world collection, particularly those from Ethiopia/Sudan and India or of the durra and caudatum races, but most Eritrean sorghums clustered in a separate subgroup. These results indicate that a great deal of germplasm diversity and genetic novelty are available in Eritrean sorghums, and that SSR markers can contribute to the wise use of this diversity for sorghum study and improvement. PMID:12582524

  14. Deep sequencing uncovers protistan plankton diversity in the Portuguese Ria Formosa solar saltern ponds.

    PubMed

    Filker, Sabine; Gimmler, Anna; Dunthorn, Micah; Mahé, Frédéric; Stoeck, Thorsten

    2015-03-01

    We used high-throughput sequencing to unravel the genetic diversity of protistan (including fungal) plankton in hypersaline ponds of the Ria Formosa solar saltern works in Portugal. From three ponds of different salinity (4, 12 and 38 %), we obtained ca. 105,000 amplicons (V4 region of the SSU rDNA). The genetic diversity we found was higher than what has been described from solar saltern ponds thus far by microscopy or molecular studies. The obtained operational taxonomic units (OTUs) could be assigned to 14 high-rank taxonomic groups and blasted to 120 eukaryotic families. The novelty of this genetic diversity was extremely high, with 27 % of all OTUs having a sequence divergence of more than 10 % to deposited sequences of described taxa. The highest degree of novelty was found at intermediate salinity of 12 % within the ciliates, which traditionally are considered as the best known and described taxon group within the kingdom Protista. Further substantial novelty was detected within the stramenopiles and the chlorophytes. Analyses of community structures suggest a transition boundary for protistan plankton between 4 and 12 % salinity, suggesting different haloadaptation strategies in individual evolutionary lineages as a result of environmental filtering. Our study makes evident the gaps in our knowledge not only of protistan and fungal plankton diversity in hypersaline environments, but also in their ecology and their strategies to cope with these environmental conditions. It substantiates that specific future research needs to fill these gaps.

  15. Detection of novel sequence heterogeneity and haplotypic diversity of HLA class II genes.

    PubMed

    Santamaria, P; Boyce-Jacino, M T; Lindstrom, A L; Barbosa, J J; Faras, A J; Rich, S S

    1991-01-01

    Nucleic acid sequences of the second exons of HLA-DRB1, -DRB3/4/5, -DQB1, and -DQA1 genes were determined from 43 homozygous cell lines, representing each of the known class II haplotypes, and from 30 unrelated Caucasian subjects, comprising 60 haplotypes. This systematic sequence analysis was undertaken in order to a) determine the existence of sequence microheterogeneity among cell lines which type as identical by methods other than sequencing; b) determine whether direct sequencing of class II genes will identify the presence of more extensive sequence polymorphism at the population level than that identified with other typing methods; c) accurately determine the molecular composition of the known class II haplotypes; and d) study their evolutionary relatedness by maximum parsimony analysis. The identification of seven previously unidentified haplotypes carrying five new allelic amino acid sequences suggests that sequence microheterogeneity at the population level may be more frequent than previously thought. Maximum parsimony analysis of these haplotypes allowed their evolutionary classification and indicates that the higher mutation rate at DRB1 compared to DQB1 loci in most haplotypic groups is inversed in specific haplotype lineages. Furthermore, the extent and localization of gene conversions and point mutations at class II loci in the evolution of these haplotypes is significantly different at each locus. Identification of additional HLA class II molecular microheterogeneity suggests that direct sequence analysis of class II HLA genes can uncover new allelic sequences in the population and may represent a useful alternative to current typing methodologies to study the effects of sequence allelism in organ transplantation.

  16. Rapid quantification of mutant fitness in diverse bacteria by sequencing randomly bar-coded transposons

    SciTech Connect

    Wetmore, Kelly M.; Price, Morgan N.; Waters, Robert J.; Lamson, Jacob S.; He, Jennifer; Hoover, Cindi A.; Blow, Matthew J.; Bristow, James; Butland, Gareth; Arkin, Adam P.; Deutschbauer, Adam

    2015-05-12

    Transposon mutagenesis with next-generation sequencing (TnSeq) is a powerful approach to annotate gene function in bacteria, but existing protocols for TnSeq require laborious preparation of every sample before sequencing. Thus, the existing protocols are not amenable to the throughput necessary to identify phenotypes and functions for the majority of genes in diverse bacteria. Here, we present a method, random bar code transposon-site sequencing (RB-TnSeq), which increases the throughput of mutant fitness profiling by incorporating random DNA bar codes into Tn5 and mariner transposons and by using bar code sequencing (BarSeq) to assay mutant fitness. RB-TnSeq can be used with any transposon, and TnSeq is performed once per organism instead of once per sample. Each BarSeq assay requires only a simple PCR, and 48 to 96 samples can be sequenced on one lane of an Illumina HiSeq system. We demonstrate the reproducibility and biological significance of RB-TnSeq with Escherichia coli, Phaeobacter inhibens, Pseudomonas stutzeri, Shewanella amazonensis, and Shewanella oneidensis. To demonstrate the increased throughput of RB-TnSeq, we performed 387 successful genome-wide mutant fitness assays representing 130 different bacterium-carbon source combinations and identified 5,196 genes with significant phenotypes across the five bacteria. In P. inhibens, we used our mutant fitness data to identify genes important for the utilization of diverse carbon substrates, including a putative D-mannose isomerase that is required for mannitol catabolism. RB-TnSeq will enable the cost-effective functional annotation of diverse bacteria using mutant fitness profiling. A large challenge in microbiology is the functional assessment of the millions of uncharacterized genes identified by genome sequencing. Transposon mutagenesis coupled to next-generation sequencing (TnSeq) is a powerful approach to assign phenotypes and functions to genes

  17. Rapid quantification of mutant fitness in diverse bacteria by sequencing randomly bar-coded transposons

    DOE PAGES

    Wetmore, Kelly M.; Price, Morgan N.; Waters, Robert J.; Lamson, Jacob S.; He, Jennifer; Hoover, Cindi A.; Blow, Matthew J.; Bristow, James; Butland, Gareth; Arkin, Adam P.; et al

    2015-05-12

    Transposon mutagenesis with next-generation sequencing (TnSeq) is a powerful approach to annotate gene function in bacteria, but existing protocols for TnSeq require laborious preparation of every sample before sequencing. Thus, the existing protocols are not amenable to the throughput necessary to identify phenotypes and functions for the majority of genes in diverse bacteria. Here, we present a method, random bar code transposon-site sequencing (RB-TnSeq), which increases the throughput of mutant fitness profiling by incorporating random DNA bar codes into Tn5 and mariner transposons and by using bar code sequencing (BarSeq) to assay mutant fitness. RB-TnSeq can be used with anymore » transposon, and TnSeq is performed once per organism instead of once per sample. Each BarSeq assay requires only a simple PCR, and 48 to 96 samples can be sequenced on one lane of an Illumina HiSeq system. We demonstrate the reproducibility and biological significance of RB-TnSeq with Escherichia coli, Phaeobacter inhibens, Pseudomonas stutzeri, Shewanella amazonensis, and Shewanella oneidensis. To demonstrate the increased throughput of RB-TnSeq, we performed 387 successful genome-wide mutant fitness assays representing 130 different bacterium-carbon source combinations and identified 5,196 genes with significant phenotypes across the five bacteria. In P. inhibens, we used our mutant fitness data to identify genes important for the utilization of diverse carbon substrates, including a putative D-mannose isomerase that is required for mannitol catabolism. RB-TnSeq will enable the cost-effective functional annotation of diverse bacteria using mutant fitness profiling. A large challenge in microbiology is the functional assessment of the millions of uncharacterized genes identified by genome sequencing. Transposon mutagenesis coupled to next-generation sequencing (TnSeq) is a powerful approach to assign phenotypes and functions to genes. However, the current strategies for TnSeq are

  18. High sequence variability, diverse subcellular localizations, and ecological implications of alkaline phosphatase in dinoflagellates and other eukaryotic phytoplankton.

    PubMed

    Lin, Xin; Zhang, Huan; Cui, Yudong; Lin, Senjie

    2012-01-01

    Alkaline phosphatase (AP) is a key enzyme for phytoplankton to utilize dissolved organic phosphorus (DOP) when dissolved inorganic phosphorus is limited. While three major types of AP and their correspondingly diverse subcellular localization have been recognized in bacteria, little is known about AP in eukaryotic phytoplankton such as dinoflagellates. Here, we isolated a full-length AP cDNA from a latest-diverging dinoflagellate genus Alexandrium, and conducted comparative analyses with homologs from a relatively basal (Amphidinium carterae) and late-diverging (Karenia brevis) lineage of dinoflagellates as well as other eukaryotic algae. New data and previous studies indicate that AP is common in dinoflagellates and most other major eukaryotic groups of phytoplankton. AP sequences are more variable than many other genes studied in dinoflagellates, and are divergent among different eukaryotic phytoplankton lineages. Sequence comparison to the other characterized APs suggests that dinoflagellates and some other eukaryotic phytoplankton possess the putative AP as phoA type, but some other eukaryotic phytoplankton seem to have other types. Phylogenetic analyses based on AP amino acid sequences indicated that the "red-type" eukaryotic lineages formed a monophyletic group, suggesting a common origin of their APs. As different amino acid sequences have been found to predictably determine different spatial distribution in the cells, which may facilitate access to different pools of DOP, existing computational models were adopted to predict the subcellular localizations of putative AP in the three dinoflagellates and other eukaryotic phytoplankton. Results showed different subcellular localizations of APs in different dinoflagellates and other lineages. The linkage between AP sequence divergence, subcellular localization, and ecological niche differentiation requires rigorous experimental verification, and this study now provides a framework for such a future effort.

  19. High Sequence Variability, Diverse Subcellular Localizations, and Ecological Implications of Alkaline Phosphatase in Dinoflagellates and Other Eukaryotic Phytoplankton

    PubMed Central

    Lin, Xin; Zhang, Huan; Cui, Yudong; Lin, Senjie

    2012-01-01

    Alkaline phosphatase (AP) is a key enzyme for phytoplankton to utilize dissolved organic phosphorus (DOP) when dissolved inorganic phosphorus is limited. While three major types of AP and their correspondingly diverse subcellular localization have been recognized in bacteria, little is known about AP in eukaryotic phytoplankton such as dinoflagellates. Here, we isolated a full-length AP cDNA from a latest-diverging dinoflagellate genus Alexandrium, and conducted comparative analyses with homologs from a relatively basal (Amphidinium carterae) and late-diverging (Karenia brevis) lineage of dinoflagellates as well as other eukaryotic algae. New data and previous studies indicate that AP is common in dinoflagellates and most other major eukaryotic groups of phytoplankton. AP sequences are more variable than many other genes studied in dinoflagellates, and are divergent among different eukaryotic phytoplankton lineages. Sequence comparison to the other characterized APs suggests that dinoflagellates and some other eukaryotic phytoplankton possess the putative AP as phoA type, but some other eukaryotic phytoplankton seem to have other types. Phylogenetic analyses based on AP amino acid sequences indicated that the “red-type” eukaryotic lineages formed a monophyletic group, suggesting a common origin of their APs. As different amino acid sequences have been found to predictably determine different spatial distribution in the cells, which may facilitate access to different pools of DOP, existing computational models were adopted to predict the subcellular localizations of putative AP in the three dinoflagellates and other eukaryotic phytoplankton. Results showed different subcellular localizations of APs in different dinoflagellates and other lineages. The linkage between AP sequence divergence, subcellular localization, and ecological niche differentiation requires rigorous experimental verification, and this study now provides a framework for such a future effort

  20. New Tools For Understanding Microbial Diversity Using High-throughput Sequence Data

    NASA Astrophysics Data System (ADS)

    Knight, R.; Hamady, M.; Liu, Z.; Lozupone, C.

    2007-12-01

    High-throughput sequencing techniques such as 454 are straining the limits of tools traditionally used to build trees, choose OTUs, and perform other essential sequencing tasks. We have developed a workflow for phylogenetic analysis of large-scale sequence data sets that combines existing tools, such as the Arb phylogeny package and the NAST multiple sequence alignment tool, with new methods for choosing and clustering OTUs and for performing phylogenetic community analysis with UniFrac. This talk discusses the cyberinfrastructure we are developing to support the human microbiome project, and the application of these workflows to analyze very large data sets that contrast the gut microbiota with a range of physical environments. These tools will ultimately help to define core and peripheral microbiomes in a range of environments, and will allow us to understand the physical and biotic factors that contribute most to differences in microbial diversity.

  1. Increasing Sequence Diversity with Flexible Backbone Protein Design: The Complete Redesign of a Protein Hydrophobic Core

    SciTech Connect

    Murphy, Grant S.; Mills, Jeffrey L.; Miley, Michael J.; Machius, Mischa; Szyperski, Thomas; Kuhlman, Brian

    2015-10-15

    Protein design tests our understanding of protein stability and structure. Successful design methods should allow the exploration of sequence space not found in nature. However, when redesigning naturally occurring protein structures, most fixed backbone design algorithms return amino acid sequences that share strong sequence identity with wild-type sequences, especially in the protein core. This behavior places a restriction on functional space that can be explored and is not consistent with observations from nature, where sequences of low identity have similar structures. Here, we allow backbone flexibility during design to mutate every position in the core (38 residues) of a four-helix bundle protein. Only small perturbations to the backbone, 12 {angstrom}, were needed to entirely mutate the core. The redesigned protein, DRNN, is exceptionally stable (melting point >140C). An NMR and X-ray crystal structure show that the side chains and backbone were accurately modeled (all-atom RMSD = 1.3 {angstrom}).

  2. Microbial Diversity and Population Structure of Extremely Acidic Sulfur-Oxidizing Biofilms From Sulfidic Caves

    NASA Astrophysics Data System (ADS)

    Jones, D.; Stoffer, T.; Lyon, E. H.; Macalady, J. L.

    2005-12-01

    Extremely acidic (pH 0-1) microbial biofilms called snottites form on the walls of sulfidic caves where gypsum replacement crusts isolate sulfur-oxidizing microorganisms from the buffering action of limestone host rock. We investigated the phylogeny and population structure of snottites from sulfidic caves in central Italy using full cycle rRNA methods. A small subunit rRNA bacterial clone library from a Frasassi cave complex snottite sample contained a single sequence group (>60 clones) similar to Acidithiobacillus thiooxidans. Bacterial and universal rRNA clone libraries from other Frasassi snottites were only slightly more diverse, containing a maximum of 4 bacterial species and probably 2 archaeal species. Fluorescence in situ hybridization (FISH) of snottites from Frasassi and from the much warmer Rio Garrafo cave complex revealed that all of the communities are simple (low-diversity) and dominated by Acidithiobacillus and/or Ferroplasma species, with smaller populations of an Acidimicrobium species, filamentous fungi, and protists. Our results suggest that sulfidic cave snottites will be excellent model microbial ecosystems suited for ecological and metagenomic studies aimed at elucidating geochemical and ecological controls on microbial diversity, and at mapping the spatial history of microbial evolutionary events such as adaptations, recombinations and gene transfers.

  3. Diversity of lactic acid bacteria in two Flemish artisan raw milk Gouda-type cheeses.

    PubMed

    Van Hoorde, Koenraad; Verstraete, Tine; Vandamme, Peter; Huys, Geert

    2008-10-01

    PCR-denaturing gradient gel electrophoresis (PCR-DGGE) was used to study the diversity of lactic acid bacteria (LAB) in two Flemish artisan raw milk Gouda-type cheeses. In parallel, conventional culturing was performed. Isolates were identified using (GTG)(5)-PCR and sequence analysis of 16S rRNA and pheS genes. Discriminant analysis revealed some differences in overall LAB diversity between the two batches and between the two cheeses. Within each batch, the diversity of 8- and 12-week-old cheeses was relatively similar. Conventional isolation mainly revealed the presence of Lactobacillus paracasei, Lactobacillus plantarum, Lactobacillus brevis, Lactobacillus rhamnosus and Pediococcus pentosaceus. PCR-DGGE revealed the presence of three species of which no isolates were recovered, i.e. Enterococcus faecalis, Lactobacillus parabuchneri and Lactobacillus gallinarum. Conversely, not all isolated bacteria were detected by PCR-DGGE. We recommend the integrated use of culture-dependent and -independent approaches to maximally encompass the taxonomic spectrum of LAB occurring in Gouda-type and other cheeses.

  4. Analysis of environmental 18S ribosomal RNA sequences reveals unknown diversity of the cosmopolitan phylum Telonemia.

    PubMed

    Shalchian-Tabrizi, Kamran; Kauserud, Håvard; Massana, Ramon; Klaveness, Dag; Jakobsen, Kjetill S

    2007-04-01

    Telonemia has recently been described as a new eukaryotic phylum with uncertain evolutionary origin. So far, only two Telonemia species, Telonema subtilis and Telonema antarcticum, have been described, but there are substantial variations in size and morphology among Telonema isolates and field observations, indicating a hidden diversity of Telonemia-like species and populations. In this study, we investigated the diversity and the global distribution of this group by analyzing 18S rDNA sequences from marine environmental clone libraries published in GenBank as well as several unpublished sequences from the Indian Ocean. Phylogenetic analyses of the identified sequences suggest that the Telonemia phylum includes several undescribed 18S rDNA phylotypes, probably corresponding to a number of different species and/or populations. The Telonemia phylotypes form two main groups, here referred to as Telonemia Groups 1 and 2. Some of the closely related sequences originate from separate oceans, indicating worldwide distributions of various Telonemia phylotypes, while other phylotypes seem to have limited geographical distribution. Further investigations of the evolutionary relationships within Telonemia should be conducted on isolated cultures of Telonema-like strains using multi-locus sequencing and morphological data. PMID:17196879

  5. Novel chytrid lineages dominate fungal sequences in diverse marine and freshwater habitats

    PubMed Central

    Comeau, André M.; Vincent, Warwick F.; Bernier, Louis; Lovejoy, Connie

    2016-01-01

    In aquatic environments, fungal communities remain little studied despite their taxonomic and functional diversity. To extend the ecological coverage of this group, we conducted an in-depth analysis of fungal sequences within our collection of 3.6 million V4 18S rRNA pyrosequences originating from 319 individual marine (including sea-ice) and freshwater samples from libraries generated within diverse projects studying Arctic and temperate biomes in the past decade. Among the ~1.7 million post-filtered reads of highest taxonomic and phylogenetic quality, 23,263 fungal sequences were identified. The overall mean proportion was 1.35%, but with large variability; for example, from 0.01 to 59% of total sequences for Arctic seawater samples. Almost all sample types were dominated by Chytridiomycota-like sequences, followed by moderate-to-minor contributions of Ascomycota, Cryptomycota and Basidiomycota. Species and/or strain richness was high, with many novel sequences and high niche separation. The affinity of the most common reads to phytoplankton parasites suggests that aquatic fungi deserve renewed attention for their role in algal succession and carbon cycling. PMID:27444055

  6. Novel chytrid lineages dominate fungal sequences in diverse marine and freshwater habitats

    NASA Astrophysics Data System (ADS)

    Comeau, André M.; Vincent, Warwick F.; Bernier, Louis; Lovejoy, Connie

    2016-07-01

    In aquatic environments, fungal communities remain little studied despite their taxonomic and functional diversity. To extend the ecological coverage of this group, we conducted an in-depth analysis of fungal sequences within our collection of 3.6 million V4 18S rRNA pyrosequences originating from 319 individual marine (including sea-ice) and freshwater samples from libraries generated within diverse projects studying Arctic and temperate biomes in the past decade. Among the ~1.7 million post-filtered reads of highest taxonomic and phylogenetic quality, 23,263 fungal sequences were identified. The overall mean proportion was 1.35%, but with large variability; for example, from 0.01 to 59% of total sequences for Arctic seawater samples. Almost all sample types were dominated by Chytridiomycota-like sequences, followed by moderate-to-minor contributions of Ascomycota, Cryptomycota and Basidiomycota. Species and/or strain richness was high, with many novel sequences and high niche separation. The affinity of the most common reads to phytoplankton parasites suggests that aquatic fungi deserve renewed attention for their role in algal succession and carbon cycling.

  7. Novel chytrid lineages dominate fungal sequences in diverse marine and freshwater habitats.

    PubMed

    Comeau, André M; Vincent, Warwick F; Bernier, Louis; Lovejoy, Connie

    2016-01-01

    In aquatic environments, fungal communities remain little studied despite their taxonomic and functional diversity. To extend the ecological coverage of this group, we conducted an in-depth analysis of fungal sequences within our collection of 3.6 million V4 18S rRNA pyrosequences originating from 319 individual marine (including sea-ice) and freshwater samples from libraries generated within diverse projects studying Arctic and temperate biomes in the past decade. Among the ~1.7 million post-filtered reads of highest taxonomic and phylogenetic quality, 23,263 fungal sequences were identified. The overall mean proportion was 1.35%, but with large variability; for example, from 0.01 to 59% of total sequences for Arctic seawater samples. Almost all sample types were dominated by Chytridiomycota-like sequences, followed by moderate-to-minor contributions of Ascomycota, Cryptomycota and Basidiomycota. Species and/or strain richness was high, with many novel sequences and high niche separation. The affinity of the most common reads to phytoplankton parasites suggests that aquatic fungi deserve renewed attention for their role in algal succession and carbon cycling. PMID:27444055

  8. Genome sequence diversity and clues to the evolution of variola (smallpox) virus.

    PubMed

    Esposito, Joseph J; Sammons, Scott A; Frace, A Michael; Osborne, John D; Olsen-Rasmussen, Melissa; Zhang, Ming; Govil, Dhwani; Damon, Inger K; Kline, Richard; Laker, Miriam; Li, Yu; Smith, Geoffrey L; Meyer, Hermann; Leduc, James W; Wohlhueter, Robert M

    2006-08-11

    Comparative genomics of 45 epidemiologically varied variola virus isolates from the past 30 years of the smallpox era indicate low sequence diversity, suggesting that there is probably little difference in the isolates' functional gene content. Phylogenetic clustering inferred three clades coincident with their geographical origin and case-fatality rate; the latter implicated putative proteins that mediate viral virulence differences. Analysis of the viral linear DNA genome suggests that its evolution involved direct descent and DNA end-region recombination events. Knowing the sequences will help understand the viral proteome and improve diagnostic test precision, therapeutics, and systems for their assessment.

  9. Quality-filtering vastly improves diversity estimates from Illumina amplicon sequencing.

    PubMed

    Bokulich, Nicholas A; Subramanian, Sathish; Faith, Jeremiah J; Gevers, Dirk; Gordon, Jeffrey I; Knight, Rob; Mills, David A; Caporaso, J Gregory

    2013-01-01

    High-throughput sequencing has revolutionized microbial ecology, but read quality remains a considerable barrier to accurate taxonomy assignment and α-diversity assessment for microbial communities. We demonstrate that high-quality read length and abundance are the primary factors differentiating correct from erroneous reads produced by Illumina GAIIx, HiSeq and MiSeq instruments. We present guidelines for user-defined quality-filtering strategies, enabling efficient extraction of high-quality data and facilitating interpretation of Illumina sequencing results.

  10. Phylogenetic diversity in the genus Bacillus as seen by 16S rRNA sequencing studies

    NASA Technical Reports Server (NTRS)

    Rossler, D.; Ludwig, W.; Schleifer, K. H.; Lin, C.; McGill, T. J.; Wisotzkey, J. D.; Jurtshuk, P. Jr; Fox, G. E.

    1991-01-01

    Comparative sequence analysis of 16S ribosomal (r)RNAs or DNAs of Bacillus alvei, B. laterosporus, B. macerans, B. macquariensis, B. polymyxa and B. stearothermophilus revealed the phylogenetic diversity of the genus Bacillus. Based on the presently available data set of 16S rRNA sequences from bacilli and relatives at least four major "Bacillus clusters" can be defined: a "Bacillus subtilis cluster" including B. stearothermophilus, a "B. brevis cluster" including B. laterosporus, a "B. alvei cluster" including B. macerans, B. maquariensis and B. polymyxa and a "B. cycloheptanicus branch".

  11. Using mitochondrial nucleotide sequences to investigate diversity and genealogical relationships within common carp (Cyprinus carpio L.).

    PubMed

    Thai, B T; Burridge, C P; Pham, T A; Austin, C M

    2005-02-01

    Direct sequencing of mitochondrial DNA (mtDNA) D-loop (745 bp) and MTATPase6/MTATPase8 (857 bp) regions was used to investigate genetic variation within common carp and develop a global genealogy of common carp strains. The D-loop region was more variable than the MTATPase6/MTATPase8 region, but given the wide distribution of carp the overall levels of sequence divergence were low. Levels of haplotype diversity varied widely among countries with Chinese, Indonesian and Vietnamese carp showing the greatest diversity whereas Japanese Koi and European carp had undetectable nucleotide variation. A genealogical analysis supports a close relationship between Vietnamese, Koi and Chinese Color carp strains and to a lesser extent, European carp. Chinese and Indonesian carp strains were the most divergent, and their relationships do not support the evolution of independent Asian and European lineages and current taxonomic treatments.

  12. Genome Sequencing of Multiple Isolates Highlights Subtelomeric Genomic Diversity within Fusarium fujikuroi.

    PubMed

    Chiara, Matteo; Fanelli, Francesca; Mulè, Giuseppina; Logrieco, Antonio F; Pesole, Graziano; Leslie, John F; Horner, David S; Toomajian, Christopher

    2015-11-01

    Comparisons of draft genome sequences of three geographically distinct isolates of Fusarium fujikuroi with two recently published genome sequences from the same species suggest diverse profiles of secondary metabolite production within F. fujikuroi. Species- and lineage-specific genes, many of which appear to exhibit expression profiles that are consistent with roles in host-pathogen interactions and adaptation to environmental changes, are concentrated in subtelomeric regions. These genomic compartments also exhibit distinct gene densities and compositional characteristics with respect to other genomic partitions, and likely play a role in the generation of molecular diversity. Our data provide additional evidence that gene duplication, divergence, and differential loss play important roles in F. fujikuroi genome evolution and suggest that hundreds of lineage-specific genes might have been acquired through horizontal gene transfer.

  13. Myeloma Ig heavy chain V region sequences reveal prior antigenic selection and marked somatic mutation but no intraclonal diversity

    SciTech Connect

    Vescio, R.A.; Cao, J.; Hong, C.H.

    1995-09-01

    The IgV{sub H} region sequence in 48 patients with multiple myeloma (MM) was analyzed to characterize the malignant cell of origin. The sequences were obtained after amplification of bone marrow cDNA by using V{sub H} family-specific and C{sub H} primers, then compared with either directly sequenced patient germ-line or published V{sub H} gene sequences to assay for somatic mutation. Because somatic hypermutation of the V{sub H} gene occurs late in B cell development, its presence has been helpful in determining the cell of origin in other B cell malignancies. Overall, a median of 8.2% of the nucleotides had evidence of substitution within each V{sub H} gene sequence (range = 2.7% to 16.5%), which is more prevalent than in any other reported tumor type. Strong evidence of prior antigenic selection pressure was also evident. The ratio of nucleotide substitutions that resulted in amino acid replacement was significantly higher in the complementarity-determining region than in the framework region (3.25 vs. 1.56, respectively; p < 0.00005). No V{sub H} gene intraclonal diversity was noted, despite sequencing multiple clones (3-16) from each patient, nor was there evidence of further V{sub H} gene somatic mutation over the course of three patients` disease. These findings strongly imply that the malignant clone in MM evolves from a cell late in B cell development. 63 refs., 4 figs., 2 tabs.

  14. Diversity of full-length subtype E HIV type 1 env sequences in early seroconvertors from northern Thailand.

    PubMed

    Yu, X F; Wang, Z; Beyrer, C; Celentano, D D; Khamboonruang, C; Nelson, K

    1997-11-01

    Although both HIV-1 subtypes B and E have been identified from infected individuals in Thailand, subtype E is the main form of HIV currently circulating in the country. Full-length gp160 sequences were obtained from 2 early seroconverters from northern Thailand in a study to learn more about the HIV-1 sequences currently being transmitted among recently infected individuals. Subject A01021 was a female prostitute who tested negative for antibodies to HIV-1 in April 1993, then positive in July 1993. Subject E11429 was a male military conscript who tested negative for antibodies to HIV-1 in May 1993, then positive in November 1993. Uncultured peripheral blood mononuclear cells (PBMCs) were collected from these two individuals in January 1994 and about 2500-bp segments containing the full-length gp160 gene were amplified by nested polymerase chain reaction (PCR) using the Expand high-fidelity PCR system. The nucleotide sequences of full-length gp120 from the subjects were subtype E based upon phylogenetic analysis. The gp120 sequences from the 2 seroconverters appeared more diverse than previously published subtype E HIV-1 sequences from Thailand. Overall, however, the subtype E HIV-1 gp120 sequences from Thailand were less diversified compared to the subtype E HIV-1 isolated from people with AIDS in the Central African Republic. Most of the observed amino acid variations were limited to the 5 variable regions in gp120. Therefore, vaccine strategies which elicit immune responses to the conserved regions of HIV-1 env protein will have a greater possibility of success.

  15. Genomic Diversity between Strains of the Same Serotype and Multilocus Sequence Type among Pneumococcal Clinical Isolates

    PubMed Central

    Silva, Nuno A.; McCluskey, Jackie; Jefferies, Johanna M. C.; Hinds, Jason; Smith, Andrew; Clarke, Stuart C.; Mitchell, Tim J.; Paterson, Gavin K.

    2006-01-01

    The important human pathogen Streptococcus pneumoniae is known to be a genetically diverse species. We have used comparative genome hybridization (CGH) microarray analysis to investigate this diversity in a collection of clinical isolates including several capsule serotype 14 pneumococci, a dominant serotype among disease isolates. We have identified three new regions of diversity among pneumococcal isolates and, importantly, clearly demonstrate genetic differences between strains of the same multilocus sequence type (ST) and capsule serotype. CGH may therefore, under certain circumstances, prove to be a valuable tool to supplement current typing methods. Finally, we show that these clonal strains with the same serotype and ST behave differently in an animal model. Strains of the same ST and serotype therefore have important genetic and phenotypic differences. PMID:16714583

  16. Multilocus sequence analysis reveals high genetic diversity in clinical isolates of Burkholderia cepacia complex from India

    PubMed Central

    Gautam, Vikas; Patil, Prashant P.; Kumar, Sunil; Midha, Samriti; Kaur, Mandeep; Kaur, Satinder; Singh, Meenu; Mali, Swapna; Shastri, Jayanthi; Arora, Anita; Ray, Pallab; Patil, Prabhu B.

    2016-01-01

    Burkholderia cepacia complex (Bcc) is a complex group of bacteria causing opportunistic infections in immunocompromised and cystic fibrosis (CF) patients. Herein, we report multilocus sequence typing and analysis of the 57 clinical isolates of Bcc collected over the period of seven years (2005–2012) from several hospitals across India. A total of 21 sequence types (ST) including two STs from cystic fibrosis patient’s isolates and twelve novel STs were identified in the population reflecting the extent of genetic diversity. Multilocus sequence analysis revealed two lineages in population, a major lineage belonging to B. cenocepacia and a minor lineage belonging to B. cepacia. Split-decomposition analysis suggests absence of interspecies recombination and intraspecies recombination contributed in generating genotypic diversity amongst isolates. Further linkage disequilibrium analysis indicates that recombination takes place at a low frequency, which is not sufficient to break down the clonal relationship. This knowledge of the genetic structure of Bcc population from a rapidly developing country will be invaluable in the epidemiology, surveillance and understanding global diversity of this group of a pathogen. PMID:27767197

  17. Sequence-defined bioactive macrocycles via an acid-catalysed cascade reaction

    NASA Astrophysics Data System (ADS)

    Porel, Mintu; Thornlow, Dana N.; Phan, Ngoc N.; Alabi, Christopher A.

    2016-06-01

    Synthetic macrocycles derived from sequence-defined oligomers are a unique structural class whose ring size, sequence and structure can be tuned via precise organization of the primary sequence. Similar to peptides and other peptidomimetics, these well-defined synthetic macromolecules become pharmacologically relevant when bioactive side chains are incorporated into their primary sequence. In this article, we report the synthesis of oligothioetheramide (oligoTEA) macrocycles via a one-pot acid-catalysed cascade reaction. The versatility of the cyclization chemistry and modularity of the assembly process was demonstrated via the synthesis of >20 diverse oligoTEA macrocycles. Structural characterization via NMR spectroscopy revealed the presence of conformational isomers, which enabled the determination of local chain dynamics within the macromolecular structure. Finally, we demonstrate the biological activity of oligoTEA macrocycles designed to mimic facially amphiphilic antimicrobial peptides. The preliminary results indicate that macrocyclic oligoTEAs with just two-to-three cationic charge centres can elicit potent antibacterial activity against Gram-positive and Gram-negative bacteria.

  18. Rapid Quantification of Mutant Fitness in Diverse Bacteria by Sequencing Randomly Bar-Coded Transposons

    PubMed Central

    Wetmore, Kelly M.; Price, Morgan N.; Waters, Robert J.; Lamson, Jacob S.; He, Jennifer; Hoover, Cindi A.; Blow, Matthew J.; Bristow, James; Butland, Gareth

    2015-01-01

    ABSTRACT Transposon mutagenesis with next-generation sequencing (TnSeq) is a powerful approach to annotate gene function in bacteria, but existing protocols for TnSeq require laborious preparation of every sample before sequencing. Thus, the existing protocols are not amenable to the throughput necessary to identify phenotypes and functions for the majority of genes in diverse bacteria. Here, we present a method, random bar code transposon-site sequencing (RB-TnSeq), which increases the throughput of mutant fitness profiling by incorporating random DNA bar codes into Tn5 and mariner transposons and by using bar code sequencing (BarSeq) to assay mutant fitness. RB-TnSeq can be used with any transposon, and TnSeq is performed once per organism instead of once per sample. Each BarSeq assay requires only a simple PCR, and 48 to 96 samples can be sequenced on one lane of an Illumina HiSeq system. We demonstrate the reproducibility and biological significance of RB-TnSeq with Escherichia coli, Phaeobacter inhibens, Pseudomonas stutzeri, Shewanella amazonensis, and Shewanella oneidensis. To demonstrate the increased throughput of RB-TnSeq, we performed 387 successful genome-wide mutant fitness assays representing 130 different bacterium-carbon source combinations and identified 5,196 genes with significant phenotypes across the five bacteria. In P. inhibens, we used our mutant fitness data to identify genes important for the utilization of diverse carbon substrates, including a putative d-mannose isomerase that is required for mannitol catabolism. RB-TnSeq will enable the cost-effective functional annotation of diverse bacteria using mutant fitness profiling. PMID:25968644

  19. The pig gut microbial diversity: Understanding the pig gut microbial ecology through the next generation high throughput sequencing.

    PubMed

    Kim, Hyeun Bum; Isaacson, Richard E

    2015-06-12

    The importance of the gut microbiota of animals is widely acknowledged because of its pivotal roles in the health and well being of animals. The genetic diversity of the gut microbiota contributes to the overall development and metabolic needs of the animal, and provides the host with many beneficial functions including production of volatile fatty acids, re-cycling of bile salts, production of vitamin K, cellulose digestion, and development of immune system. Thus the intestinal microbiota of animals has been the subject of study for many decades. Although most of the older studies have used culture dependent methods, the recent advent of high throughput sequencing of 16S rRNA genes has facilitated in depth studies exploring microbial populations and their dynamics in the animal gut. These culture independent DNA based studies generate large amounts of data and as a result contribute to a more detailed understanding of the microbiota dynamics in the gut and the ecology of the microbial populations. Of equal importance, is being able to identify and quantify microbes that are difficult to grow or that have not been grown in the laboratory. Interpreting the data obtained from this type of study requires using basic principles of microbial diversity to understand importance of the composition of microbial populations. In this review, we summarize the literature on culture independent studies of the pig gut microbiota with an emphasis on its succession and alterations caused by diverse factors.

  20. Sequence of the core antenna domain from the anoxygenic phototroph Heliophilum fasciatum: implications for diversity of reaction center type I.

    PubMed

    Mix, Lucas J; Harmer, Tara L; Cavanaugh, Colleen M

    2004-06-01

    Broad variation among anoxygenic reaction centers makes it essential to consider a wide variety when considering the origins of photosynthesis. The photosynthetic core antenna domain in the gene pshA from Heliophilum fasciatum was sequenced doubling the number of core sequences available from heliobacteria. The sequence shares a pattern of hydrophobicity and histidine residues with the core antenna domain of pshA from Heliobacillus mobilis. Sequence identity between the two pshA sequences was 68%, indicating heliobacterial reaction centers show similar diversity to photosystem I throughout cyanobacteria and plastids. Thus, the diversity of anoxygenic phototrophic reaction centers may be greater than previously thought. PMID:15170240

  1. Sequence of the core antenna domain from the anoxygenic phototroph Heliophilum fasciatum: implications for diversity of reaction center type I.

    PubMed

    Mix, Lucas J; Harmer, Tara L; Cavanaugh, Colleen M

    2004-06-01

    Broad variation among anoxygenic reaction centers makes it essential to consider a wide variety when considering the origins of photosynthesis. The photosynthetic core antenna domain in the gene pshA from Heliophilum fasciatum was sequenced doubling the number of core sequences available from heliobacteria. The sequence shares a pattern of hydrophobicity and histidine residues with the core antenna domain of pshA from Heliobacillus mobilis. Sequence identity between the two pshA sequences was 68%, indicating heliobacterial reaction centers show similar diversity to photosystem I throughout cyanobacteria and plastids. Thus, the diversity of anoxygenic phototrophic reaction centers may be greater than previously thought.

  2. Strategies for Achieving High Sequencing Accuracy for Low Diversity Samples and Avoiding Sample Bleeding Using Illumina Platform

    PubMed Central

    Mitra, Abhishek; Skrzypczak, Magdalena; Ginalski, Krzysztof; Rowicka, Maga

    2015-01-01

    Sequencing microRNA, reduced representation sequencing, Hi-C technology and any method requiring the use of in-house barcodes result in sequencing libraries with low initial sequence diversity. Sequencing such data on the Illumina platform typically produces low quality data due to the limitations of the Illumina cluster calling algorithm. Moreover, even in the case of diverse samples, these limitations are causing substantial inaccuracies in multiplexed sample assignment (sample bleeding). Such inaccuracies are unacceptable in clinical applications, and in some other fields (e.g. detection of rare variants). Here, we discuss how both problems with quality of low-diversity samples and sample bleeding are caused by incorrect detection of clusters on the flowcell during initial sequencing cycles. We propose simple software modifications (Long Template Protocol) that overcome this problem. We present experimental results showing that our Long Template Protocol remarkably increases data quality for low diversity samples, as compared with the standard analysis protocol; it also substantially reduces sample bleeding for all samples. For comprehensiveness, we also discuss and compare experimental results from alternative approaches to sequencing low diversity samples. First, we discuss how the low diversity problem, if caused by barcodes, can be avoided altogether at the barcode design stage. Second and third, we present modified guidelines, which are more stringent than the manufacturer’s, for mixing low diversity samples with diverse samples and lowering cluster density, which in our experience consistently produces high quality data from low diversity samples. Fourth and fifth, we present rescue strategies that can be applied when sequencing results in low quality data and when there is no more biological material available. In such cases, we propose that the flowcell be re-hybridized and sequenced again using our Long Template Protocol. Alternatively, we discuss how

  3. Comparison of a high-resolution melting assay to next-generation sequencing for analysis of HIV diversity.

    PubMed

    Cousins, Matthew M; Ou, San-San; Wawer, Maria J; Munshaw, Supriya; Swan, David; Magaret, Craig A; Mullis, Caroline E; Serwadda, David; Porcella, Stephen F; Gray, Ronald H; Quinn, Thomas C; Donnell, Deborah; Eshleman, Susan H; Redd, Andrew D

    2012-09-01

    Next-generation sequencing (NGS) has recently been used for analysis of HIV diversity, but this method is labor-intensive, costly, and requires complex protocols for data analysis. We compared diversity measures obtained using NGS data to those obtained using a diversity assay based on high-resolution melting (HRM) of DNA duplexes. The HRM diversity assay provides a single numeric score that reflects the level of diversity in the region analyzed. HIV gag and env from individuals in Rakai, Uganda, were analyzed in a previous study using NGS (n = 220 samples from 110 individuals). Three sequence-based diversity measures were calculated from the NGS sequence data (percent diversity, percent complexity, and Shannon entropy). The amplicon pools used for NGS were analyzed with the HRM diversity assay. HRM scores were significantly associated with sequence-based measures of HIV diversity for both gag and env (P < 0.001 for all measures). The level of diversity measured by the HRM diversity assay and NGS increased over time in both regions analyzed (P < 0.001 for all measures except for percent complexity in gag), and similar amounts of diversification were observed with both methods (P < 0.001 for all measures except for percent complexity in gag). Diversity measures obtained using the HRM diversity assay were significantly associated with those from NGS, and similar increases in diversity over time were detected by both methods. The HRM diversity assay is faster and less expensive than NGS, facilitating rapid analysis of large studies of HIV diversity and evolution.

  4. Microbial diversity at the moderate acidic stage in three different sulfidic mine tailings dumps generating acid mine drainage.

    PubMed

    Korehi, Hananeh; Blöthe, Marco; Schippers, Axel

    2014-11-01

    In freshly deposited sulfidic mine tailings the pH is alkaline or circumneutral. Due to pyrite or pyrrhotite oxidation the pH is dropping over time to pH values <3 at which acidophilic iron- and sulfur-oxidizing prokaryotes prevail and accelerate the oxidation processes, well described for several mine waste sites. The microbial communities at the moderate acidic stage in mine tailings are only scarcely studied. Here we investigated the microbial diversity via 16S rRNA gene sequence analysis in eight samples (pH range 3.2-6.5) from three different sulfidic mine tailings dumps in Botswana, Germany and Sweden. In total 701 partial 16S rRNA gene sequences revealed a divergent microbial community between the three sites and at different tailings depths. Proteobacteria and Firmicutes were overall the most abundant phyla in the clone libraries. Acidobacteria, Actinobacteria, Bacteroidetes, and Nitrospira occurred less frequently. The found microbial communities were completely different to microbial communities in tailings at

  5. Predicting protein disorder by analyzing amino acid sequence

    PubMed Central

    Yang, Jack Y; Yang, Mary Qu

    2008-01-01

    Background Many protein regions and some entire proteins have no definite tertiary structure, presenting instead as dynamic, disorder ensembles under different physiochemical circumstances. These proteins and regions are known as Intrinsically Unstructured Proteins (IUP). IUP have been associated with a wide range of protein functions, along with roles in diseases characterized by protein misfolding and aggregation. Results Identifying IUP is important task in structural and functional genomics. We exact useful features from sequences and develop machine learning algorithms for the above task. We compare our IUP predictor with PONDRs (mainly neural-network-based predictors), disEMBL (also based on neural networks) and Globplot (based on disorder propensity). Conclusion We find that augmenting features derived from physiochemical properties of amino acids (such as hydrophobicity, complexity etc.) and using ensemble method proved beneficial. The IUP predictor is a viable alternative software tool for identifying IUP protein regions and proteins. PMID:18831799

  6. Fungal diversity in grape must and wine fermentation assessed by massive sequencing, quantitative PCR and DGGE.

    PubMed

    Wang, Chunxiao; García-Fernández, David; Mas, Albert; Esteve-Zarzoso, Braulio

    2015-01-01

    The diversity of fungi in grape must and during wine fermentation was investigated in this study by culture-dependent and culture-independent techniques. Carignan and Grenache grapes were harvested from three vineyards in the Priorat region (Spain) in 2012, and nine samples were selected from the grape must after crushing and during wine fermentation. From culture-dependent techniques, 362 isolates were randomly selected and identified by 5.8S-ITS-RFLP and 26S-D1/D2 sequencing. Meanwhile, genomic DNA was extracted directly from the nine samples and analyzed by qPCR, DGGE and massive sequencing. The results indicated that grape must after crushing harbored a high species richness of fungi with Aspergillus tubingensis, Aureobasidium pullulans, or Starmerella bacillaris as the dominant species. As fermentation proceeded, the species richness decreased, and yeasts such as Hanseniaspora uvarum, Starmerella bacillaris and Saccharomyces cerevisiae successively occupied the must samples. The "terroir" characteristics of the fungus population are more related to the location of the vineyard than to grape variety. Sulfur dioxide treatment caused a low effect on yeast diversity by similarity analysis. Because of the existence of large population of fungi on grape berries, massive sequencing was more appropriate to understand the fungal community in grape must after crushing than the other techniques used in this study. Suitable target sequences and databases were necessary for accurate evaluation of the community and the identification of species by the 454 pyrosequencing of amplicons. PMID:26557110

  7. Cytogenetic Diversity of Simple Sequences Repeats in Morphotypes of Brassica rapa ssp. chinensis

    PubMed Central

    Zheng, Jin-shuang; Sun, Cheng-zhen; Zhang, Shu-ning; Hou, Xi-lin; Bonnema, Guusje

    2016-01-01

    A significant fraction of the nuclear DNA of all eukaryotes is comprised of simple sequence repeats (SSRs). Although these sequences are widely used for studying genetic variation, linkage mapping and evolution, little attention had been paid to the chromosomal distribution and cytogenetic diversity of these sequences. In this paper, we report the distribution characterization of mono-, di-, and tri-nucleotide SSRs in Brassica rapa ssp. chinensis. Fluorescence in situ hybridization was used to characterize the cytogenetic diversity of SSRs among morphotypes of B. rapa ssp. chinensis. The proportion of different SSR motifs varied among morphotypes of B. rapa ssp. chinensis, with tri-nucleotide SSRs being more prevalent in the genome of B. rapa ssp. chinensis. We determined the chromosomal locations of mono-, di-, and tri-nucleotide repeat loci. The results showed that the chromosomal distribution of SSRs in the different morphotypes is non-random and motif-dependent, and allowed us to characterize the relative variability in terms of SSR numbers and similar chromosomal distributions in centromeric/peri-centromeric heterochromatin. The differences between SSR repeats with respect to abundance and distribution indicate that SSRs are a driving force in the genomic evolution of B. rapa species. Our results provide a comprehensive view of the SSR sequence distribution and evolution for comparison among morphotypes B. rapa ssp. chinensis. PMID:27507974

  8. Cytogenetic Diversity of Simple Sequences Repeats in Morphotypes of Brassica rapa ssp. chinensis.

    PubMed

    Zheng, Jin-Shuang; Sun, Cheng-Zhen; Zhang, Shu-Ning; Hou, Xi-Lin; Bonnema, Guusje

    2016-01-01

    A significant fraction of the nuclear DNA of all eukaryotes is comprised of simple sequence repeats (SSRs). Although these sequences are widely used for studying genetic variation, linkage mapping and evolution, little attention had been paid to the chromosomal distribution and cytogenetic diversity of these sequences. In this paper, we report the distribution characterization of mono-, di-, and tri-nucleotide SSRs in Brassica rapa ssp. chinensis. Fluorescence in situ hybridization was used to characterize the cytogenetic diversity of SSRs among morphotypes of B. rapa ssp. chinensis. The proportion of different SSR motifs varied among morphotypes of B. rapa ssp. chinensis, with tri-nucleotide SSRs being more prevalent in the genome of B. rapa ssp. chinensis. We determined the chromosomal locations of mono-, di-, and tri-nucleotide repeat loci. The results showed that the chromosomal distribution of SSRs in the different morphotypes is non-random and motif-dependent, and allowed us to characterize the relative variability in terms of SSR numbers and similar chromosomal distributions in centromeric/peri-centromeric heterochromatin. The differences between SSR repeats with respect to abundance and distribution indicate that SSRs are a driving force in the genomic evolution of B. rapa species. Our results provide a comprehensive view of the SSR sequence distribution and evolution for comparison among morphotypes B. rapa ssp. chinensis.

  9. Fungal diversity in grape must and wine fermentation assessed by massive sequencing, quantitative PCR and DGGE

    PubMed Central

    Wang, Chunxiao; García-Fernández, David; Mas, Albert; Esteve-Zarzoso, Braulio

    2015-01-01

    The diversity of fungi in grape must and during wine fermentation was investigated in this study by culture-dependent and culture-independent techniques. Carignan and Grenache grapes were harvested from three vineyards in the Priorat region (Spain) in 2012, and nine samples were selected from the grape must after crushing and during wine fermentation. From culture-dependent techniques, 362 isolates were randomly selected and identified by 5.8S-ITS-RFLP and 26S-D1/D2 sequencing. Meanwhile, genomic DNA was extracted directly from the nine samples and analyzed by qPCR, DGGE and massive sequencing. The results indicated that grape must after crushing harbored a high species richness of fungi with Aspergillus tubingensis, Aureobasidium pullulans, or Starmerella bacillaris as the dominant species. As fermentation proceeded, the species richness decreased, and yeasts such as Hanseniaspora uvarum, Starmerella bacillaris and Saccharomyces cerevisiae successively occupied the must samples. The “terroir” characteristics of the fungus population are more related to the location of the vineyard than to grape variety. Sulfur dioxide treatment caused a low effect on yeast diversity by similarity analysis. Because of the existence of large population of fungi on grape berries, massive sequencing was more appropriate to understand the fungal community in grape must after crushing than the other techniques used in this study. Suitable target sequences and databases were necessary for accurate evaluation of the community and the identification of species by the 454 pyrosequencing of amplicons. PMID:26557110

  10. Cytogenetic Diversity of Simple Sequences Repeats in Morphotypes of Brassica rapa ssp. chinensis.

    PubMed

    Zheng, Jin-Shuang; Sun, Cheng-Zhen; Zhang, Shu-Ning; Hou, Xi-Lin; Bonnema, Guusje

    2016-01-01

    A significant fraction of the nuclear DNA of all eukaryotes is comprised of simple sequence repeats (SSRs). Although these sequences are widely used for studying genetic variation, linkage mapping and evolution, little attention had been paid to the chromosomal distribution and cytogenetic diversity of these sequences. In this paper, we report the distribution characterization of mono-, di-, and tri-nucleotide SSRs in Brassica rapa ssp. chinensis. Fluorescence in situ hybridization was used to characterize the cytogenetic diversity of SSRs among morphotypes of B. rapa ssp. chinensis. The proportion of different SSR motifs varied among morphotypes of B. rapa ssp. chinensis, with tri-nucleotide SSRs being more prevalent in the genome of B. rapa ssp. chinensis. We determined the chromosomal locations of mono-, di-, and tri-nucleotide repeat loci. The results showed that the chromosomal distribution of SSRs in the different morphotypes is non-random and motif-dependent, and allowed us to characterize the relative variability in terms of SSR numbers and similar chromosomal distributions in centromeric/peri-centromeric heterochromatin. The differences between SSR repeats with respect to abundance and distribution indicate that SSRs are a driving force in the genomic evolution of B. rapa species. Our results provide a comprehensive view of the SSR sequence distribution and evolution for comparison among morphotypes B. rapa ssp. chinensis. PMID:27507974

  11. Phylogeny and genetic diversity of Bridgeoporus nobilissimus inferred using mitochondrial and nuclear rDNA sequences

    USGS Publications Warehouse

    Redberg, G.L.; Hibbett, D.S.; Ammirati, J.F.; Rodriguez, R.J.

    2003-01-01

    The genetic diversity and phylogeny of Bridgeoporus nobilissimus have been analyzed. DNA was extracted from spores collected from individual fruiting bodies representing six geographically distinct populations in Oregon and Washington. Spore samples collected contained low levels of bacteria, yeast and a filamentous fungal species. Using taxon-specific PCR primers, it was possible to discriminate among rDNA from bacteria, yeast, a filamentous associate and B. nobilissimus. Nuclear rDNA internal transcribed spacer (ITS) region sequences of B. nobilissimus were compared among individuals representing six populations and were found to have less than 2% variation. These sequences also were used to design dual and nested PCR primers for B. nobilissimus-specific amplification. Mitochondrial small-subunit rDNA sequences were used in a phylogenetic analysis that placed B. nobilissimus in the hymenochaetoid clade, where it was associated with Oxyporus and Schizopora.

  12. DNA sequence analysis of conserved genes reveals hybridization events that increase genetic diversity in Verticillium dahliae.

    PubMed

    Collado-Romero, Melania; Jiménez-Díaz, Rafael M; Mercado-Blanco, Jesús

    2010-01-01

    The hybrid origin of a Verticillium dahliae isolate belonging to the vegetative compatibility group (VCG) 3 is reported in this work. Moreover, new data supporting the hybrid origin of two V. dahliae var. longisporum (VDLSP) isolates are provided as well as information about putative parentals. Thus, isolates of VDLSP and V. dahliae VCG3 were found harboring multiple sequences of actin (Act), β-tubulin (β-tub), calmodulin (Cal) and histone 3 (H3) genes. Phylogenetic analysis of these sequences, the internal transcribed sequences (ITS-1 and ITS-2) of the rRNA genes and of a V. dahliae-specific sequence provided molecular evidences for the interspecific hybrid origin of those isolates. Sequence analysis suggests that some of VDLSP isolates may have resulted from hybridization events between a V. dahliae isolate of VCG1 and/or VCG4A and, probably, a closely related taxon to Verticillium alboatrum but not this one. Similarly, phylogenetic analysis and PCR markers indicated that a V. dahliae VCG3 isolate might have arisen from a hybridization event between a V. dahliae VCG1B isolate and as yet unidentified parent. This second parental probably does not belong to the Verticillium genus according to the gene sequences dissimilarities found between the VCG3 isolate and Verticillium spp. These results suggest an important role of parasexuality in diversity and evolution in the genus Verticillium and show that interspecific hybrids within this genus may not be rare in nature.

  13. Genetic diversity in three groups of barley germplasm assessed by simple sequence repeats.

    PubMed

    Matus, I A; Hayes, P M

    2002-12-01

    Genetic diversity can be measured by several criteria, including phenotype, pedigree, allelic diversity at marker loci, and allelic diversity at loci controlling phenotypes of interest. Abundance, high level of polymorphism, and ease of genotyping make simple sequence repeats (SSRs) an excellent molecular marker system for genetics diversity analyses. In this study, we used a set of mapped SSRs to survey three representative groups of barley germplasm: a sample of crop progenitor (Hordeum vulgare subsp. spontaneum) accessions, a group of mapping population parents, and a group of varieties and elite breeding lines. The objectives were to determine (i) how informative SSRs are in these three sets of barley germplasm resources and (ii) the utility of SSRs in classifying barley germplasm. A total of 687 alleles were identified at 42 SSR loci in 147 genotypes. The number of alleles per locus ranged from 4 to 31, with an average of 16.3. Crop progenitors averaged 10.3 alleles per SSR locus, mapping population parents 8.3 alleles per SSR locus, and elite breeding lines 5.8 alleles per SSR locus. There were many exclusive (unique) alleles. The polymorphism information content values for the SSRs ranged from 0.08 to 0.94. The cluster analysis indicates a high level of diversity within the crop progenitors accessions and within the mapping population parents. It also shows a lower level of diversity within the elite breeding germplasm. Our results demonstrate that this set of SSRs was highly informative and was useful in generating a meaningful classification of the germplasm that we sampled. Our long-term goal is to determine the utility of molecular marker diversity as a tool for gene discovery and efficient use of germplasm. PMID:12502254

  14. Multilocus Sequence Analysis for Assessment of Phylogenetic Diversity and Biogeography in Thalassospira Bacteria from Diverse Marine Environments

    PubMed Central

    Yuan, Jun; Du, Juan; Wang, Liping; Sun, Fengqin; Shao, Zongze

    2014-01-01

    Thalassospira bacteria are widespread and have been isolated from various marine environments. Less is known about their genetic diversity and biogeography, as well as their role in marine environments, many of them cannot be discriminated merely using the 16S rRNA gene. To address these issues, in this report, the phylogenetic analysis of 58 strains from seawater and deep sea sediments were carried out using the multilocus sequence analysis (MLSA) based on acsA, aroE, gyrB, mutL, rpoD and trpB genes, and the DNA-DNA hybridization (DDH) and average nucleotide identity (ANI) based on genome sequences. The MLSA analysis demonstrated that the 58 strains were clearly separated into 15 lineages, corresponding to seven validly described species and eight potential novel species. The DDH and ANI values further confirmed the validity of the MLSA analysis and eight potential novel species. The MLSA interspecies gap of the genus Thalassospira was determined to be 96.16–97.12% sequence identity on the basis of the combined analyses of the DDH and MLSA, while the ANIm interspecies gap was 95.76–97.20% based on the in silico DDH analysis. Meanwhile, phylogenetic analyses showed that the Thalassospira bacteria exhibited distribution pattern to a certain degree according to geographic regions. Moreover, they clustered together according to the habitats depth. For short, the phylogenetic analyses and biogeography of the Thalassospira bacteria were systematically investigated for the first time. These results will be helpful to explore further their ecological role and adaptive evolution in marine environments. PMID:25198177

  15. Heterogeneity of amino acid sequence in hippopotamus cytochrome c.

    PubMed

    Thompson, R B; Borden, D; Tarr, G E; Margoliash, E

    1978-12-25

    The amino acid sequences of chymotryptic and tryptic peptides of Hippopotamus amphibius cytochrome c were determined by a recent modification of the manual Edman sequential degradation procedure. They were ordered by comparison with the structure of the hog protein. The hippopotamus protein differs in three positions: serine, alanine, and glutamine replace alanine, glutamic acid, and lysine in positions 43, 92, and 100, respectively. Since the artiodactyl suborders diverged in the mid-Eocene some 50 million years ago, the fact that representatives of some of them show no differences in their cytochromes c (cow, sheep, and hog), while another exhibits as many as three such differences, verifies that even in relatively closely related lines of descent the rate at which cytochrome c changes in the course of evolution is not constant. Furthermore, 10.6% of the hippopotamus cytochrome c preparation was shown to contain isoleucine instead of valine at position 3, indicating that one of the four animals from which the protein was obtained was heterozygous in the cytochrome c gene. Such heterogeneity is a necessary condition of evolutionary variation and has not been previously observed in the cytochrome c of a wild mammalian population.

  16. HIV-1 intrapatient sequence diversity in the immunogenic V3 region

    SciTech Connect

    Korber, B.; Myers, G.; Wolinsky, S.; Kunstman, K.; Levy, R.; Furtado, M.; Otto, P.; Haynes, B.

    1991-11-12

    The third hypervariable domain (V3) of the human immunodeficiency virus type-1 (HIV-1) envelope protein (env) can serve as an epitope for potent type-specific neutralizing antibodies (NAbs) -- thus short peptides predicted on the most commonly found variants of the antigenic tip of the V3 loop have been considered as potential candidates for an HIV peptide vaccine. To evaluate the extent of intrapatient variation in the immunogenic crest of the V3 loop, sequence sets were analyzed from individuals for whom multiple V3 sequences were available. Several strategies for selecting the best sets of hexapeptides to represent the variable tip of the V3 loop were considered and their effectiveness was evaluated by comparing them with the sequence sets from individuals. Most individuals carried at least one, and frequently many, variants that did not match any of the sequences from among the ten most common hexapeptides. Intrapatient viral sequence variation was increased by including sequences derived from brain biopsy specimens as well as from blood. Additionally, sequences obtained from brain specimens of different individuals had common elements which were not conserved in the corresponding blood samples, suggesting that certain amino acids in the V3 loop may be requisite for viral propagation in the CNS.

  17. Mineralogical Controls on Microbial Diversity in a Sulfuric Acid Karst System

    NASA Astrophysics Data System (ADS)

    Jones, A. A.; Bennett, P.

    2011-12-01

    The role mineralogy plays on microbial community distribution, composition, niche differentiation, and accumulation is a complex and nebulous association. Microbial phylogenetic diversity and bacterial composition of communities obtained from Lower Kane Cave (LKC), WY, USA, were studied using next generation bacterial 16S rRNA sequencing techniques. The microbial consortium found within LKC was found to be primarily composed of neutrophilic sulfur-oxidizing members of the gamma- and epsilon-proteobacteria . The microbial population within LKC has been instigated in previous studies to have a significant role in the processes of sulfuric acid speleogenesis. Using a LKC biomat as the inoculant in a series of 3 nutrient limited laboratory reactor experiments, and a pure culture of Thiothrix unzii (ATCC type strain 49747) in a parallel experiment, we found that both limestone and dolostone substratum consistently had higher biomass accumulation than silicate minerals in the same reactor. At the Class level, the carbonate substratum (Calcite, Limestone, and Dolostone) had ~84% - 88.7% of phylotypes in common. Aside from Basalt (Simpson's Index, D of 0.53), the carbonate substratum produced the least diverse phylotype distributions. Feldspar and quartz were colonized by the most diverse communities with Simpson's Index values of 0.16 and 0.31. Evaluation of metabolic guild distribution shows that potential neutrophilic sulfur-oxidizers have an affinity for acid neutralizing carbonate substrata over silicate substrata. These potential sulfur-oxidizing guilds compose ~28%-38% of the total microbial community. For feldspar and chert substratum, potential sulfur-oxidizing metabolic guilds composed merely ~5% of the total microbial community. The quartz substratum, in contrast, was uniquely populated by potential acidophilic sulfur-oxidizers Acidithiobacillus and Acidithiomicrobium; composing ~19% of the total community. A quartz substratum may offer these acidophiles a

  18. Twenty-One Genome Sequences from Pseudomonas Species and 19 Genome Sequences from Diverse Bacteria Isolated from the Rhizosphere and Endosphere of Populus deltoides

    SciTech Connect

    Brown, Steven D; Utturkar, Sagar M; Klingeman, Dawn Marie; Johnson, Courtney M; Martin, Stanton; Land, Miriam L; Lu, Tse-Yuan; Schadt, Christopher Warren; Doktycz, Mitchel John; Pelletier, Dale A

    2012-01-01

    To aid in the investigation of the Populus deltoides microbiome we generated draft genome sequences for twenty one Pseudomonas and twenty one other diverse bacteria isolated from Populus deltoides roots. Genome sequences for isolates similar to Acidovorax, Bradyrhizobium, Brevibacillus, Burkholderia, Caulobacter, Chryseobacterium, Flavobacterium, Herbaspirillum, Novosphingobium, Pantoea, Phyllobacterium, Polaromonas, Rhizobium, Sphingobium and Variovorax were generated.

  19. Human liver apolipoprotein B-100 cDNA: complete nucleic acid and derived amino acid sequence.

    PubMed Central

    Law, S W; Grant, S M; Higuchi, K; Hospattankar, A; Lackner, K; Lee, N; Brewer, H B

    1986-01-01

    Human apolipoprotein B-100 (apoB-100), the ligand on low density lipoproteins that interacts with the low density lipoprotein receptor and initiates receptor-mediated endocytosis and low density lipoprotein catabolism, has been cloned, and the complete nucleic acid and derived amino acid sequences have been determined. ApoB-100 cDNAs were isolated from normal human liver cDNA libraries utilizing immunoscreening as well as filter hybridization with radiolabeled apoB-100 oligodeoxynucleotides. The apoB-100 mRNA is 14.1 kilobases long encoding a mature apoB-100 protein of 4536 amino acids with a calculated amino acid molecular weight of 512,723. ApoB-100 contains 20 potential glycosylation sites, and 12 of a total of 25 cysteine residues are located in the amino-terminal region of the apolipoprotein providing a potential globular structure of the amino terminus of the protein. ApoB-100 contains relatively few regions of amphipathic helices, but compared to other human apolipoproteins it is enriched in beta-structure. The delineation of the entire human apoB-100 sequence will now permit a detailed analysis of the conformation of the protein, the low density lipoprotein receptor binding domain(s), and the structural relationship between apoB-100 and apoB-48 and will provide the basis for the study of genetic defects in apoB-100 in patients with dyslipoproteinemias. PMID:3464946

  20. Diversity and distribution of unicellular opisthokonts along the European coast analyzed using high-throughput sequencing

    PubMed Central

    del Campo, Javier; Mallo, Diego; Massana, Ramon; de Vargas, Colomban; Richards, Thomas A.; Ruiz-Trillo, Iñaki

    2015-01-01

    Summary The opisthokonts are one of the major super-groups of eukaryotes. It comprises two major clades: 1) the Metazoa and their unicellular relatives and 2) the Fungi and their unicellular relatives. There is, however, little knowledge of the role of opisthokont microbes in many natural environments, especially among non-metazoan and non-fungal opisthokonts. Here we begin to address this gap by analyzing high throughput 18S rDNA and 18S rRNA sequencing data from different European coastal sites, sampled at different size fractions and depths. In particular, we analyze the diversity and abundance of choanoflagellates, filastereans, ichthyosporeans, nucleariids, corallochytreans and their related lineages. Our results show the great diversity of choanoflagellates in coastal waters as well as a relevant role of the ichthyosporeans and the uncultured marine opisthokonts (MAOP). Furthermore, we describe a new lineage of marine fonticulids (MAFO) that appears to be abundant in sediments. Therefore, our work points to a greater potential ecological role for unicellular opisthokonts than previously appreciated in marine environments, both in water column and sediments, and also provides evidence of novel opisthokont phylogenetic lineages. This study highlights the importance of high throughput sequencing approaches to unravel the diversity and distribution of both known and novel eukaryotic lineages. PMID:25556908

  1. Diversity and distribution of unicellular opisthokonts along the European coast analysed using high-throughput sequencing.

    PubMed

    Del Campo, Javier; Mallo, Diego; Massana, Ramon; de Vargas, Colomban; Richards, Thomas A; Ruiz-Trillo, Iñaki

    2015-09-01

    The opisthokonts are one of the major super groups of eukaryotes. It comprises two major clades: (i) the Metazoa and their unicellular relatives and (ii) the Fungi and their unicellular relatives. There is, however, little knowledge of the role of opisthokont microbes in many natural environments, especially among non-metazoan and non-fungal opisthokonts. Here, we begin to address this gap by analysing high-throughput 18S rDNA and 18S rRNA sequencing data from different European coastal sites, sampled at different size fractions and depths. In particular, we analyse the diversity and abundance of choanoflagellates, filastereans, ichthyosporeans, nucleariids, corallochytreans and their related lineages. Our results show the great diversity of choanoflagellates in coastal waters as well as a relevant representation of the ichthyosporeans and the uncultured marine opisthokonts (MAOP). Furthermore, we describe a new lineage of marine fonticulids (MAFO) that appears to be abundant in sediments. Taken together, our work points to a greater potential ecological role for unicellular opisthokonts than previously appreciated in marine environments, both in water column and sediments, and also provides evidence of novel opisthokont phylogenetic lineages. This study highlights the importance of high-throughput sequencing approaches to unravel the diversity and distribution of both known and novel eukaryotic lineages.

  2. Genetic diversity of Saccharum spontaneum from geographical regions of China assessed by simple sequence repeats.

    PubMed

    Fan, L N; Deng, H H; Luo, Q W; He, H Y; Li, Y; Wang, Q N; Huang, Z X; Wu, J T; Li, Q W; Liu, S M; Qi, Y W

    2013-11-26

    Saccharum spontaneum is the most variable wild relative of sugarcane with potential for use in sugarcane improvement programs. In order to help preserve and exploit this species, 152 accessions from eight major geographical regions in China, including Hainan, Guangdong, Guangxi, Yunnan, Sichuan, Guizhou, Fujian, and Jiangxi provinces, were investigated by analyzing 20 simple sequence repeats (SSRs), including 11 genomic SSRs (gSSRs) and nine SSRs developed from expressed sequence tags (EST-SSRs). A total of 454 alleles were generated by the 20 SSRs, with 295 and 159 alleles detected by gSSRs and EST-SSRs respectively. The Mantel test showed significant correlation between genetic matrixes among the studied accessions revealed by gSSRs versus EST-SSRs, although the average polymorphism of EST-SSRs (17.7) was much lower than that of gSSRs (26.8). Among the eight provinces, collections from Guizhou were the most diverse and those from Guangdong were the most distinct. Clustering analysis and principal component analysis accordantly classified the accessions into four groups, which were "Southwest group", "Hainan group", "Guangdong group", and "Guangxi group", based on the geographical origin of the major accessions in each group, demonstrating that geographical factors play an important role in the pattern of genetic structure of Chinese S. spontaneum. As two (Guizhou and Yunnan) of the three provinces with highest genetic diversity are located in southwest China, we concluded that southwest China is the region with the highest genetic diversity of S. spontaneum.

  3. Whole-genome sequencing of uropathogenic Escherichia coli reveals long evolutionary history of diversity and virulence.

    PubMed

    Lo, Yancy; Zhang, Lixin; Foxman, Betsy; Zöllner, Sebastian

    2015-08-01

    Uropathogenic Escherichia coli (UPEC) are phenotypically and genotypically very diverse. This diversity makes it challenging to understand the evolution of UPEC adaptations responsible for causing urinary tract infections (UTI). To gain insight into the relationship between evolutionary divergence and adaptive paths to uropathogenicity, we sequenced at deep coverage (190×) the genomes of 19 E. coli strains from urinary tract infection patients from the same geographic area. Our sample consisted of 14 UPEC isolates and 5 non-UTI-causing (commensal) rectal E. coli isolates. After identifying strain variants using de novo assembly-based methods, we clustered the strains based on pairwise sequence differences using a neighbor-joining algorithm. We examined evolutionary signals on the whole-genome phylogeny and contrasted these signals with those found on gene trees constructed based on specific uropathogenic virulence factors. The whole-genome phylogeny showed that the divergence between UPEC and commensal E. coli strains without known UPEC virulence factors happened over 32 million generations ago. Pairwise diversity between any two strains was also high, suggesting multiple genetic origins of uropathogenic strains in a small geographic region. Contrasting the whole-genome phylogeny with three gene trees constructed from common uropathogenic virulence factors, we detected no selective advantage of these virulence genes over other genomic regions. These results suggest that UPEC acquired uropathogenicity long time ago and used it opportunistically to cause extraintestinal infections.

  4. Diverse function of aromatase and the N-terminal sequence deleted form.

    PubMed

    Osawa, Y; Higashiyama, T; Toma, Y; Yarborough, C

    1997-04-01

    The diverse function of human placental aromatase including estradiol 6alpha-hydroxylase and cocaine N-demethylase activity are described, and the mechanism for the simultaneous metabolism of estradiol to 2-hydroxy- and 6alpha-hydroxyestradiol at the same active site of aromatase is postulated. Comparison of aromatase activity is also made among the wild type and N-terminal sequence deleted forms of human aromatase which are recombinantly expressed in Escherichia coli. Aromatase cytochrome P450 was reconstituted and incubated with [6alpha,7alpha-(3)H2,4-(14)C]estradiol, 7-ethoxycoumarin, and [N-methyl-(3)H3]cocaine. 6Alpha-hydroxy[7alpha-(3)H,4-(14)C]estradiol was isolated as the metabolite of estradiol and the 3H-water release method based on the 6alpha-3H label was established. The initial rate kinetics of the 6alpha-hydroxylation gave Km of 4.3 microM, Vmax of 4.02 nmol min(-1) mg(-1), and turnover rate of 0.27 min(-1). Testosterone competed dose-dependently with the 6alpha-hydroxylation and showed the Ki of 0.15 microM, suggesting that they occupy the same binding site of aromatase. The deethylation of 7-ethoxycoumarin showed Km of 200 microM, Vmax of 12.5 nmol min(-1) mg(-1) and turnover rate of 1.06 min(-1). The N-demethylation of cocaine was analysed by the 3H-release method, giving Km of 670 microM, Vmax of 4.76 nmol min(-1) mg(-1), and turnover rate of 0.49 min(-1). All activity was dose-responsively suppressed by anti-aromatase P450 monoclonal antibody MAb3-2C2. The N-terminal 38 amino acid residue deleted form of aromatase P450 was expressed in particularly high yield giving a specific activity of 397 +/- 83 pmol min(-1) mg(-1) (n = 12) of crude membrane-bound particulates with a turnover rate of 2.6 min(-1).

  5. Diverse and Widespread Contamination Evident in the Unmapped Depths of High Throughput Sequencing Data

    PubMed Central

    Lusk, Richard W.

    2014-01-01

    Trace quantities of contaminating DNA are widespread in the laboratory environment, but their presence has received little attention in the context of high throughput sequencing. This issue is highlighted by recent works that have rested controversial claims upon sequencing data that appear to support the presence of unexpected exogenous species. I used reads that preferentially aligned to alternate genomes to infer the distribution of potential contaminant species in a set of independent sequencing experiments. I confirmed that dilute samples are more exposed to contaminating DNA, and, focusing on four single-cell sequencing experiments, found that these contaminants appear to originate from a wide diversity of clades. Although negative control libraries prepared from ‘blank’ samples recovered the highest-frequency contaminants, low-frequency contaminants, which appeared to make heterogeneous contributions to samples prepared in parallel within a single experiment, were not well controlled for. I used these results to show that, despite heavy replication and plausible controls, contamination can explain all of the observations used to support a recent claim that complete genes pass from food to human blood. Contamination must be considered a potential source of signals of exogenous species in sequencing data, even if these signals are replicated in independent experiments, vary across conditions, or indicate a species which seems a priori unlikely to contaminate. Negative control libraries processed in parallel are essential to control for contaminant DNAs, but their limited ability to recover low-frequency contaminants must be recognized. PMID:25354084

  6. Combining genomic sequencing methods to explore viral diversity and reveal potential virus-host interactions.

    PubMed

    Chow, Cheryl-Emiliane T; Winget, Danielle M; White, Richard A; Hallam, Steven J; Suttle, Curtis A

    2015-01-01

    Viral diversity and virus-host interactions in oxygen-starved regions of the ocean, also known as oxygen minimum zones (OMZs), remain relatively unexplored. Microbial community metabolism in OMZs alters nutrient and energy flow through marine food webs, resulting in biological nitrogen loss and greenhouse gas production. Thus, viruses infecting OMZ microbes have the potential to modulate community metabolism with resulting feedback on ecosystem function. Here, we describe viral communities inhabiting oxic surface (10 m) and oxygen-starved basin (200 m) waters of Saanich Inlet, a seasonally anoxic fjord on the coast of Vancouver Island, British Columbia using viral metagenomics and complete viral fosmid sequencing on samples collected between April 2007 and April 2010. Of 6459 open reading frames (ORFs) predicted across all 34 viral fosmids, 77.6% (n = 5010) had no homology to reference viral genomes. These fosmids recruited a higher proportion of viral metagenomic sequences from Saanich Inlet than from nearby northeastern subarctic Pacific Ocean (Line P) waters, indicating differences in the viral communities between coastal and open ocean locations. While functional annotations of fosmid ORFs were limited, recruitment to NCBI's non-redundant "nr" database and publicly available single-cell genomes identified putative viruses infecting marine thaumarchaeal and SUP05 proteobacteria to provide potential host linkages with relevance to coupled biogeochemical cycling processes in OMZ waters. Taken together, these results highlight the power of coupled analyses of multiple sequence data types, such as viral metagenomic and fosmid sequence data with prokaryotic single cell genomes, to chart viral diversity, elucidate genomic and ecological contexts for previously unclassifiable viral sequences, and identify novel host interactions in natural and engineered ecosystems. PMID:25914678

  7. Combining genomic sequencing methods to explore viral diversity and reveal potential virus-host interactions.

    PubMed

    Chow, Cheryl-Emiliane T; Winget, Danielle M; White, Richard A; Hallam, Steven J; Suttle, Curtis A

    2015-01-01

    Viral diversity and virus-host interactions in oxygen-starved regions of the ocean, also known as oxygen minimum zones (OMZs), remain relatively unexplored. Microbial community metabolism in OMZs alters nutrient and energy flow through marine food webs, resulting in biological nitrogen loss and greenhouse gas production. Thus, viruses infecting OMZ microbes have the potential to modulate community metabolism with resulting feedback on ecosystem function. Here, we describe viral communities inhabiting oxic surface (10 m) and oxygen-starved basin (200 m) waters of Saanich Inlet, a seasonally anoxic fjord on the coast of Vancouver Island, British Columbia using viral metagenomics and complete viral fosmid sequencing on samples collected between April 2007 and April 2010. Of 6459 open reading frames (ORFs) predicted across all 34 viral fosmids, 77.6% (n = 5010) had no homology to reference viral genomes. These fosmids recruited a higher proportion of viral metagenomic sequences from Saanich Inlet than from nearby northeastern subarctic Pacific Ocean (Line P) waters, indicating differences in the viral communities between coastal and open ocean locations. While functional annotations of fosmid ORFs were limited, recruitment to NCBI's non-redundant "nr" database and publicly available single-cell genomes identified putative viruses infecting marine thaumarchaeal and SUP05 proteobacteria to provide potential host linkages with relevance to coupled biogeochemical cycling processes in OMZ waters. Taken together, these results highlight the power of coupled analyses of multiple sequence data types, such as viral metagenomic and fosmid sequence data with prokaryotic single cell genomes, to chart viral diversity, elucidate genomic and ecological contexts for previously unclassifiable viral sequences, and identify novel host interactions in natural and engineered ecosystems.

  8. High diversity of picornaviruses in rats from different continents revealed by deep sequencing.

    PubMed

    Hansen, Thomas Arn; Mollerup, Sarah; Nguyen, Nam-Phuong; White, Nicole E; Coghlan, Megan; Alquezar-Planas, David E; Joshi, Tejal; Jensen, Randi Holm; Fridholm, Helena; Kjartansdóttir, Kristín Rós; Mourier, Tobias; Warnow, Tandy; Belsham, Graham J; Bunce, Michael; Willerslev, Eske; Nielsen, Lars Peter; Vinner, Lasse; Hansen, Anders Johannes

    2016-08-17

    Outbreaks of zoonotic diseases in humans and livestock are not uncommon, and an important component in containment of such emerging viral diseases is rapid and reliable diagnostics. Such methods are often PCR-based and hence require the availability of sequence data from the pathogen. Rattus norvegicus (R. norvegicus) is a known reservoir for important zoonotic pathogens. Transmission may be direct via contact with the animal, for example, through exposure to its faecal matter, or indirectly mediated by arthropod vectors. Here we investigated the viral content in rat faecal matter (n=29) collected from two continents by analyzing 2.2 billion next-generation sequencing reads derived from both DNA and RNA. Among other virus families, we found sequences from members of the Picornaviridae to be abundant in the microbiome of all the samples. Here we describe the diversity of the picornavirus-like contigs including near-full-length genomes closely related to the Boone cardiovirus and Theiler's encephalomyelitis virus. From this study, we conclude that picornaviruses within R. norvegicus are more diverse than previously recognized. The virome of R. norvegicus should be investigated further to assess the full potential for zoonotic virus transmission.

  9. High diversity of picornaviruses in rats from different continents revealed by deep sequencing

    PubMed Central

    Hansen, Thomas Arn; Mollerup, Sarah; Nguyen, Nam-phuong; White, Nicole E; Coghlan, Megan; Alquezar-Planas, David E; Joshi, Tejal; Jensen, Randi Holm; Fridholm, Helena; Kjartansdóttir, Kristín Rós; Mourier, Tobias; Warnow, Tandy; Belsham, Graham J; Bunce, Michael; Willerslev, Eske; Nielsen, Lars Peter; Vinner, Lasse; Hansen, Anders Johannes

    2016-01-01

    Outbreaks of zoonotic diseases in humans and livestock are not uncommon, and an important component in containment of such emerging viral diseases is rapid and reliable diagnostics. Such methods are often PCR-based and hence require the availability of sequence data from the pathogen. Rattus norvegicus (R. norvegicus) is a known reservoir for important zoonotic pathogens. Transmission may be direct via contact with the animal, for example, through exposure to its faecal matter, or indirectly mediated by arthropod vectors. Here we investigated the viral content in rat faecal matter (n=29) collected from two continents by analyzing 2.2 billion next-generation sequencing reads derived from both DNA and RNA. Among other virus families, we found sequences from members of the Picornaviridae to be abundant in the microbiome of all the samples. Here we describe the diversity of the picornavirus-like contigs including near-full-length genomes closely related to the Boone cardiovirus and Theiler's encephalomyelitis virus. From this study, we conclude that picornaviruses within R. norvegicus are more diverse than previously recognized. The virome of R. norvegicus should be investigated further to assess the full potential for zoonotic virus transmission. PMID:27530749

  10. NEP: web server for epitope prediction based on antibody neutralization of viral strains with diverse sequences.

    PubMed

    Chuang, Gwo-Yu; Liou, David; Kwong, Peter D; Georgiev, Ivelin S

    2014-07-01

    Delineation of the antigenic site, or epitope, recognized by an antibody can provide clues about functional vulnerabilities and resistance mechanisms, and can therefore guide antibody optimization and epitope-based vaccine design. Previously, we developed an algorithm for antibody-epitope prediction based on antibody neutralization of viral strains with diverse sequences and validated the algorithm on a set of broadly neutralizing HIV-1 antibodies. Here we describe the implementation of this algorithm, NEP (Neutralization-based Epitope Prediction), as a web-based server. The users must supply as input: (i) an alignment of antigen sequences of diverse viral strains; (ii) neutralization data for the antibody of interest against the same set of antigen sequences; and (iii) (optional) a structure of the unbound antigen, for enhanced prediction accuracy. The prediction results can be downloaded or viewed interactively on the antigen structure (if supplied) from the web browser using a JSmol applet. Since neutralization experiments are typically performed as one of the first steps in the characterization of an antibody to determine its breadth and potency, the NEP server can be used to predict antibody-epitope information at no additional experimental costs. NEP can be accessed on the internet at http://exon.niaid.nih.gov/nep. PMID:24782517

  11. NEP: web server for epitope prediction based on antibody neutralization of viral strains with diverse sequences.

    PubMed

    Chuang, Gwo-Yu; Liou, David; Kwong, Peter D; Georgiev, Ivelin S

    2014-07-01

    Delineation of the antigenic site, or epitope, recognized by an antibody can provide clues about functional vulnerabilities and resistance mechanisms, and can therefore guide antibody optimization and epitope-based vaccine design. Previously, we developed an algorithm for antibody-epitope prediction based on antibody neutralization of viral strains with diverse sequences and validated the algorithm on a set of broadly neutralizing HIV-1 antibodies. Here we describe the implementation of this algorithm, NEP (Neutralization-based Epitope Prediction), as a web-based server. The users must supply as input: (i) an alignment of antigen sequences of diverse viral strains; (ii) neutralization data for the antibody of interest against the same set of antigen sequences; and (iii) (optional) a structure of the unbound antigen, for enhanced prediction accuracy. The prediction results can be downloaded or viewed interactively on the antigen structure (if supplied) from the web browser using a JSmol applet. Since neutralization experiments are typically performed as one of the first steps in the characterization of an antibody to determine its breadth and potency, the NEP server can be used to predict antibody-epitope information at no additional experimental costs. NEP can be accessed on the internet at http://exon.niaid.nih.gov/nep.

  12. Application of mitochondrial genes sequences for measuring the genetic diversity of Arabian oryx.

    PubMed

    Khan, Haseeb A; Arif, Ibrahim A; Shobrak, Mohammad; Homaidan, Ali A Al; Farhan, Ahmad H Al; Sadoon, Mohammad Al

    2011-01-01

    Arabian oryx (Oryx leucoryx) had faced extinction in the wild more than three decades ago and was saved by the prudent efforts of captive breeding programs. A clear understanding of the molecular diversity of contemporary Arabian oryx population is important for the long term success of captive breeding and reintroduction of this potentially endangered species. We have sequenced the segments of mitochondrial DNA including12S rRNA, 16S rRNA, cytochrome b (Cyt-b) and control region (CR) genes of 24 captive-bred and reintroduced animals. Although the sequences of 12S rRNA, 16S rRNA and Cyt-b were found to be identical for all the samples, typical sequence variations in the CR gene were observed in the form of 7 haplotypes. One of these haplotypes has been reported earlier while the remaining 6 haplotypes are novel and represent different lineages from the founders. The haplotype and nucleotide diversities were found to be 0.789 and 0.009 respectively. The genetic distances among the 7 mtDNA haplotypes varied from 0.001 to 0.017. These findings are of potential relevance to the management of captive breeding programs for the conservation of Arabian oryx. PMID:21498924

  13. High diversity of picornaviruses in rats from different continents revealed by deep sequencing.

    PubMed

    Hansen, Thomas Arn; Mollerup, Sarah; Nguyen, Nam-Phuong; White, Nicole E; Coghlan, Megan; Alquezar-Planas, David E; Joshi, Tejal; Jensen, Randi Holm; Fridholm, Helena; Kjartansdóttir, Kristín Rós; Mourier, Tobias; Warnow, Tandy; Belsham, Graham J; Bunce, Michael; Willerslev, Eske; Nielsen, Lars Peter; Vinner, Lasse; Hansen, Anders Johannes

    2016-01-01

    Outbreaks of zoonotic diseases in humans and livestock are not uncommon, and an important component in containment of such emerging viral diseases is rapid and reliable diagnostics. Such methods are often PCR-based and hence require the availability of sequence data from the pathogen. Rattus norvegicus (R. norvegicus) is a known reservoir for important zoonotic pathogens. Transmission may be direct via contact with the animal, for example, through exposure to its faecal matter, or indirectly mediated by arthropod vectors. Here we investigated the viral content in rat faecal matter (n=29) collected from two continents by analyzing 2.2 billion next-generation sequencing reads derived from both DNA and RNA. Among other virus families, we found sequences from members of the Picornaviridae to be abundant in the microbiome of all the samples. Here we describe the diversity of the picornavirus-like contigs including near-full-length genomes closely related to the Boone cardiovirus and Theiler's encephalomyelitis virus. From this study, we conclude that picornaviruses within R. norvegicus are more diverse than previously recognized. The virome of R. norvegicus should be investigated further to assess the full potential for zoonotic virus transmission. PMID:27530749

  14. Genetic diversity and relationship of chicory (Cichorium intybus L.) using sequence-related amplified polymorphism markers.

    PubMed

    Liang, X Y; Zhang, X Q; Bai, S Q; Huang, L K; Luo, X M; Ji, Y; Jiang, L F

    2014-09-26

    Chicory is a crop with economically important roles and is cultivated worldwide. The genetic diversity and relationship of 80 accessions of chicories and endives were evaluated by sequence-related amplified polymorphism (SRAP) markers to provide a theoretical basis for future breeding programs in China. The polymorphic rate was 96.83%, and the average polymorphic information content was 0.323, suggesting the rich genetic diversity of chicory. The genetic diversity degree of chicory was higher (GS = 0.677) than that of endive (GS = 0.701). The accessions with the highest genetic diversity (effective number of alleles, NE = 1.609; Nei's genetic diversity, H = 0.372; Shannon information index, I = 0.556) were from Italy. The richest genetic diversity was revealed in a chicory line (NE = 1.478, H = 0.289, I = 0.443) among the 3 types (line, wild, and cultivar). The chicory genetic structure of 8 geographical groups showed that the genetic differentiation coefficient (GST) was 14.20% and the number of immigrants per generation (Nm) was 3.020. A GST of 6.80% and an Nm of 6.853 were obtained from different types. This observation suggests that these chicory lines, especially those from the Mediterranean region, have potential for providing rich genetic resources for further breeding programs, that the chicory genetic structure among different countries obviously differs with a certain amount of gene flow, and that SRAP markers could be applied to analyze genetic relationships and classifications of Cichorium intybus and C. endivia.

  15. Genetic diversity and distribution of bradyrhizobia nodulating peanut in acid-neutral soils in Guangdong Province.

    PubMed

    Chen, Jingyu; Hu, Meijuan; Ma, Huimin; Wang, Yongshan; Wang, En Tao; Zhou, Zhifeng; Gu, Jun

    2016-09-01

    To reveal the genetic diversity and geographic distribution of peanut (Arachis hypogaea L.) rhizobia in Guangdong Province, one of the main peanut producing regions in China, 216 bradyrhizobial isolates were trapped by peanut plants inoculated with soil samples (pH 4.7-7.4) collected from ten sites in Guangdong. Based on BOX-PCR fingerprinting analysis, 71 representative isolates were selected for sequence analyses of ribosomal IGS, recA, atpD and symbiotic gene nodA. As a result, 22 genospecies were detected in the peanut rhizobia, including eight minor groups or single strains corresponding to Bradyrhizobium diazoefficiens, B. japonicum, B. yuanmingense, B. arachidis, B. guangdongense, B. guangxiense, B. iriomotense and B. liaoningense, as well as 14 novel Bradyrhizobium genospecies covering the majority of isolates. Five symbiotic clusters were obtained based on the phylogenetic relationships of nodA genes, related to the soybean-nodulating or peanut-nodulating reference strains. Biogeographic patterns, which were mainly correlated with potassium content and pH, were detected in the peanut bradyrhizobial community in Guangdong Province. These findings enriched the diversity of peanut rhizobia, and added the K content as a special determinant for peanut rhizobial distribution in acid soils. PMID:27499533

  16. An rpoD gene sequence based evaluation of cultured Pseudomonas diversity on different growth media.

    PubMed

    Ghyselinck, Jonas; Coorevits, An; Van Landschoot, Anita; Samyn, Emly; Heylen, Kim; De Vos, Paul

    2013-10-01

    The last decade has shown an increased interest in the utilization of bacteria for applications ranging from bioremediation to wastewater purification and promotion of plant growth. In order to extend the current number of micro-organism mediated applications, a continued quest for new agents is required. This study focused on the genus Pseudomonas, which is known to harbour strains with a very diverse set of interesting properties. The aim was to identify growth media that allow retrieval of a high Pseudomonas diversity, as such increasing the chance of isolating isolates with beneficial properties. Three cultivation media: trypticase soy agar (TSA), potato dextrose agar (PDA) and Pseudomonas isolation agar (PIA) were evaluated for their abilities to grow Pseudomonas strains. TSA and PDA were found to generate the largest Pseudomonas diversity. However, communities obtained with both media overlapped. Communities obtained with PIA, on the other hand, were unique. This indicated that the largest diversity is obtained by sampling from either PDA or TSA and from PIA in parallel. To evaluate biodiversity of the isolated Pseudomonas members on the media, an appropriate biomarker had to be identified. Hence, an introductory investigation of the taxonomic resolution of the 16S rRNA, rpoD, gyrB and rpoB genes was performed. The rpoD gene sequences not only had a high phylogenetic content and the highest taxonomic resolution amongst the genes investigated, it also had a gene phylogeny that related well with that of the 16S rRNA gene.

  17. Assessment of genomic diversity among wheat genotypes as determined by simple sequence repeats.

    PubMed

    Ahmad, M

    2002-08-01

    Simple sequence repeats (SSRs) have been used to examine the genomic diversity of wheat (Triticum aestivum L.) germplasm. Thirteen wheat genotypes of diverse origin were analyzed with 43 selected SSRs to provide uniform and maximum genome coverage. A total of 156 allelic variants were detected at 43 SSR loci, ranging from two to eight per locus with an average of 3.6. The polymorphic information content (PIC) values of the loci ranged from 0.10 (Xgwm264) to 0.89 (Xgwm471 and Xgwm577). Genetic similarities calculated from SSR data ranged from 30.1 ('Era' and 'Klasic') to 90.1 ('Neepawa' and 'Thatcher') between genotypes. UPGMA analysis based on genetic distance estimates produced three loose groupings that were generally consistent with available pedigree information. Cultivars 'Neepawa' and 'Thatcher' are closely related. Their genetic relationship was confirmed by the facts that they share a common ancestor and are clustered together. There were two different 'Era' genotypes, one used in the 'Otane' pedigree and one used in this study. None of the other genotypes had a close common ancestor indicating any close genetic relationships. Principal coordinate analysis also confirmed this pattern of genetic diversity. A wide range of genomic diversity was observed among all the genotypes, proving them to be prime candidates for selective breeding for specific traits and broadening the genetic base.

  18. Simple sequence repeat analysis of genetic diversity in primary core collection of peach (Prunus persica).

    PubMed

    Li, Tian-Hong; Li, Yin-Xia; Li, Zi-Chao; Zhang, Hong-Liang; Qi, Yong-Wen; Wang, Tao

    2008-01-01

    In this study, the genetic diversity of 51 cultivars in the primary core collection of peach (Prunus persica (L.) Batsch) was evaluated by using simple sequence repeats (SSRs). The phylogenetic relationships and the evolutionary history among different cultivars were determined on the basis of SSR data. Twenty-two polymorphic SSR primer pairs were selected, and a total of 111 alleles were identified in the 51 cultivars, with an average of 5 alleles per locus. According to traditional Chinese classification of peach cultivars, the 51 cultivars in the peach primary core collection belong to six variety groups. The SSR analysis revealed that the levels of the genetic diversity within each variety group were ranked as Sweet peach > Crisp peach > Flat peach > Nectarine > Honey Peach > Yellow fleshed peach. The genetic diversity among the Chinese cultivars was higher than that among the introduced cultivars. Cluster analysis by the unweighted pair group method with arithmetic averaging (UPGMA) placed the 51 cultivars into five linkage clusters. Cultivar members from the same variety group were distributed in different UPGMA clusters and some members from different variety groups were placed under the same cluster. Different variety groups could not be differentiated in accordance with SSR markers. The SSR analysis revealed rich genetic diversity in the peach primary core collection, representative of genetic resources of peach.

  19. Genetic diversity and population structure in Harpadon nehereus based on sequence-related amplified polymorphism markers.

    PubMed

    Zhu, Z H; Li, H Y; Qin, Y; Wang, R X

    2014-01-01

    In this study, the genetic diversity among ten populations of the Bombay duck was studied on the basis of sequence-related amplified polymorphism (SRAP). The ten populations were collected from the East China Sea and South China Sea areas. A total of 98 loci were obtained from 292 individuals using eight SRAP primers. The average proportion of polymorphic loci, genetic diversity (H), and Shannon's information index were 75.20%, 0.2478, and 0.3735, respectively. Nei's genetic distance and Shannon's information index between the ten populations ranged from 0.0410 to 0.3841 and from 0.2396 to 0.4506, and the averages Nei's gene diversity index (H = 0.2478) and Shannon's information index (I = 0.3735) at the population level were high. AMOVA showed that most of the variation was within populations (71.74%), and only 28.26% of the variation was between populations. The neighbor-joining tree based on genetic distance revealed that significant genealogical structure existed throughout the examined range of the Bombay duck. The results demonstrated that SRAP marker was an effective tool for the assessment of genetic diversity in the Bombay duck. The results could be used for further protection of the germplasm resource of the Bombay duck.

  20. Analysis of Plasmodium falciparum diversity in natural infections by deep sequencing

    PubMed Central

    Manske, Magnus; Miotto, Olivo; Campino, Susana; Auburn, Sarah; Almagro-Garcia, Jacob; Maslen, Gareth; O’Brien, Jack; Djimde, Abdoulaye; Doumbo, Ogobara; Zongo, Issaka; Ouedraogo, Jean-Bosco; Michon, Pascal; Mueller, Ivo; Siba, Peter; Nzila, Alexis; Borrmann, Steffen; Kiara, Steven M.; Marsh, Kevin; Jiang, Hongying; Su, Xin-Zhuan; Amaratunga, Chanaki; Fairhurst, Rick; Socheat, Duong; Nosten, Francois; Imwong, Mallika; White, Nicholas J.; Sanders, Mandy; Anastasi, Elisa; Alcock, Dan; Drury, Eleanor; Oyola, Samuel; Quail, Michael A.; Turner, Daniel J.; Rubio, Valentin Ruano; Jyothi, Dushyanth; Amenga-Etego, Lucas; Hubbart, Christina; Jeffreys, Anna; Rowlands, Kate; Sutherland, Colin; Roper, Cally; Mangano, Valentina; Modiano, David; Tan, John C.; Ferdig, Michael T.; Amambua-Ngwa, Alfred; Conway, David J.; Takala-Harrison, Shannon; Plowe, Christopher V.; Rayner, Julian C.; Rockett, Kirk A.; Clark, Taane G.; Newbold, Chris I.; Berriman, Matthew; MacInnis, Bronwyn; Kwiatkowski, Dominic P.

    2013-01-01

    Malaria elimination strategies require surveillance of the parasite population for genetic changes that demand a public health response, such as new forms of drug resistance. 1,2 Here we describe methods for large-scale analysis of genetic variation in Plasmodium falciparum by deep sequencing of parasite DNA obtained from the blood of patients with malaria, either directly or after short term culture. Analysis of 86,158 exonic SNPs that passed genotyping quality control in 227 samples from Africa, Asia and Oceania provides genome-wide estimates of allele frequency distribution, population structure and linkage disequilibrium. By comparing the genetic diversity of individual infections with that of the local parasite population, we derive a metric of within-host diversity that is related to the level of inbreeding in the population. An open-access web application has been established for exploration of regional differences in allele frequency and of highly differentiated loci in the P. falciparum genome. PMID:22722859

  1. The low incidence of diversity-generating retroelements in sequenced genomes.

    PubMed

    Schillinger, Thomas; Zingler, Nora

    2012-11-01

    The insertion of a retrotransposable element is usually associated with adverse or, at best, neutral effects on the host. Diversity-generating retroelements (DGRs) are the first elements that seem to offer a direct selective advantage to their phage or prokaryote host by exact replacement of a short, defined region of a host gene with a hypermutated variant. In a previous study, we presented the software DiGReF for identification of DGRs in genome sequences, and compiled the first comprehensive set of diversity-generating retroelements in public databases. We identified 155 elements in more than 6000 prokaryotic and phage genomes, which was a surprisingly low number. In this commentary, we will discuss the low incidence of these elements and speculate about the biological role of bacterial DGRs.

  2. The low incidence of diversity-generating retroelements in sequenced genomes

    PubMed Central

    Schillinger, Thomas; Zingler, Nora

    2012-01-01

    The insertion of a retrotransposable element is usually associated with adverse or, at best, neutral effects on the host. Diversity-generating retroelements (DGRs) are the first elements that seem to offer a direct selective advantage to their phage or prokaryote host by exact replacement of a short, defined region of a host gene with a hypermutated variant. In a previous study, we presented the software DiGReF for identification of DGRs in genome sequences, and compiled the first comprehensive set of diversity-generating retroelements in public databases. We identified 155 elements in more than 6000 prokaryotic and phage genomes, which was a surprisingly low number. In this commentary, we will discuss the low incidence of these elements and speculate about the biological role of bacterial DGRs. PMID:23481467

  3. Mitochondrial DNA sequence diversity in two groups of Italian Veneto speakers from Veneto.

    PubMed

    Mogentale-Profizi, N; Chollet, L; Stévanovitch, A; Dubut, V; Poggi, C; Pradié, M P; Spadoni, J L; Gilles, A; Béraud-Colomb, E

    2001-03-01

    Although frequencies of mitochondrial DNA (mtDNA) haplogroups in the different European populations are rather homogenous, there are a few European populations or linguistic isolates that show different mtDNA haplogroup distributions; examples are the Saami and Ladin speakers from the eastern Italian Alps. MtDNA sequence diversity was analysed from subjects from two villages in Veneto. The first, Posina, is situated in the Venetian Alps near Vicenza. The second, Barco di Pravisdomini is a village on the plains near Venice. In spite of their common Veneto dialect, the two group populations have not preserved a genetic homogeneity; particularly, they show differences in T and J haplogroups frequencies. MtDNA diversity in these two groups seems to depend more on their geographic situation.

  4. Multiple Amino Acid Sequence Alignment Nitrogenase Component 1: Insights into Phylogenetics and Structure-Function Relationships

    PubMed Central

    Howard, James B.; Kechris, Katerina J.; Rees, Douglas C.; Glazer, Alexander N.

    2013-01-01

    Amino acid residues critical for a protein's structure-function are retained by natural selection and these residues are identified by the level of variance in co-aligned homologous protein sequences. The relevant residues in the nitrogen fixation Component 1 α- and β-subunits were identified by the alignment of 95 protein sequences. Proteins were included from species encompassing multiple microbial phyla and diverse ecological niches as well as the nitrogen fixation genotypes, anf, nif, and vnf, which encode proteins associated with cofactors differing at one metal site. After adjusting for differences in sequence length, insertions, and deletions, the remaining >85% of the sequence co-aligned the subunits from the three genotypes. Six Groups, designated Anf, Vnf , and Nif I-IV, were assigned based upon genetic origin, sequence adjustments, and conserved residues. Both subunits subdivided into the same groups. Invariant and single variant residues were identified and were defined as “core” for nitrogenase function. Three species in Group Nif-III, Candidatus Desulforudis audaxviator, Desulfotomaculum kuznetsovii, and Thermodesulfatator indicus, were found to have a seleno-cysteine that replaces one cysteinyl ligand of the 8Fe:7S, P-cluster. Subsets of invariant residues, limited to individual groups, were identified; these unique residues help identify the gene of origin (anf, nif, or vnf) yet should not be considered diagnostic of the metal content of associated cofactors. Fourteen of the 19 residues that compose the cofactor pocket are invariant or single variant; the other five residues are highly variable but do not correlate with the putative metal content of the cofactor. The variable residues are clustered on one side of the cofactor, away from other functional centers in the three dimensional structure. Many of the invariant and single variant residues were not previously recognized as potentially critical and their identification provides the bases

  5. Human retroviruses and AIDS 1996. A compilation and analysis of nucleic acid and amino acid sequences

    SciTech Connect

    Myers, G.; Foley, B.; Korber, B.; Mellors, J.W.; Jeang, K.T.; Wain-Hobson, S.

    1997-04-01

    This compendium and the accompanying floppy diskettes are the result of an effort to compile and rapidly publish all relevant molecular data concerning the human immunodeficiency viruses (HIV) and related retroviruses. The scope of the compendium and database is best summarized by the five parts that it comprises: (1) Nuclear Acid Alignments and Sequences; (2) Amino Acid Alignments; (3) Analysis; (4) Related Sequences; and (5) Database Communications. Information within all the parts is updated throughout the year on the Web site, http://hiv-web.lanl.gov. While this publication could take the form of a review or sequence monograph, it is not so conceived. Instead, the literature from which the database is derived has simply been summarized and some elementary computational analyses have been performed upon the data. Interpretation and commentary have been avoided insofar as possible so that the reader can form his or her own judgments concerning the complex information. In addition to the general descriptions of the parts of the compendium, the user should read the individual introductions for each part.

  6. Sequence diversity of the peptaibol antibiotic suzukacillin-A from the mold Trichoderma viride.

    PubMed

    Krause, Corina; Kirschbaum, Jochen; Jung, Günther; Brückner, Hans

    2006-05-01

    From the culture broth of the mold Trichoderma viride, strain 63 C-I, the polypeptide antibiotic suzukacillin (SZ) was isolated. A peptide mixture named SZ-A was obtained by crystallization from crude SZ. Individual peptides from SZ-A were isolated by semipreparative HPLC and sequences were determined by HPLC-ESI-MS. The data confirm a general sequence of SZ-A published previously and in addition establish the individual sequences of 15 acetylated eicosa peptides with C-terminal alcohols. The major peptide SZ-A4 (21% of all peptides) shows the sequence:Ac-Aib-Ala-Aib-Ala-Aib-Ala(6)-Gln-Aib-Lx(9)-Aib-Gly-Aib(12)-Aib-Pro-Vx(15)-Aib-Vx(17)-Gln-Gln-Fol. Amino acid exchanges of the peptaibol are located in position 6 (Ala/Aib), 9 (Vx/Lx), 12 (Aib/Lx), 17 (Aib/Vx) and possibly at position15 (Val/Iva) (uncommon abbreviations: Aib (alpha-aminoisobutyric acid); Iva (D-isovaline); Lx (L-leucine or L-isoleucine); Vx (L-valine or D-isovaline); Fol (L-phenylalaninol)). PMID:16245259

  7. Identification of tropomyosins as major allergens in antarctic krill and mantis shrimp and their amino acid sequence characteristics.

    PubMed

    Motoyama, Kanna; Suma, Yota; Ishizaki, Shoichiro; Nagashima, Yuji; Lu, Ying; Ushio, Hideki; Shiomi, Kazuo

    2008-01-01

    Tropomyosin represents a major allergen of decapod crustaceans such as shrimps and crabs, and its highly conserved amino acid sequence (>90% identity) is a molecular basis of the immunoglobulin E (IgE) cross-reactivity among decapods. At present, however, little information is available about allergens in edible crustaceans other than decapods. In this study, the major allergen in two species of edible crustaceans, Antarctic krill Euphausia superba and mantis shrimp Oratosquilla oratoria that are taxonomically distinct from decapods, was demonstrated to be tropomyosin by IgE-immunoblotting using patient sera. The cross-reactivity of the tropomyosins from both species with decapod tropomyosins was also confirmed by inhibition IgE immunoblotting. Sequences of the tropomyosins from both species were determined by complementary deoxyribonucleic acid cloning. The mantis shrimp tropomyosin has high sequence identity (>90% identity) with decapod tropomyosins, especially with fast-type tropomyosins. On the other hand, the Antarctic krill tropomyosin is characterized by diverse alterations in region 13-42, the amino acid sequence of which is highly conserved for decapod tropomyosins, and hence, it shares somewhat lower sequence identity (82.4-89.8% identity) with decapod tropomyosins than the mantis shrimp tropomyosin. Quantification by enzyme-linked immunosorbent assay revealed that Antarctic krill contains tropomyosin at almost the same level as decapods, suggesting that its allergenicity is equivalent to decapods. However, mantis shrimp was assumed to be substantially not allergenic because of the extremely low content of tropomyosin. PMID:18521668

  8. Photobiont diversity in lichens from metal-rich substrata based on ITS rDNA sequences.

    PubMed

    Backor, Martin; Peksa, Ondrej; Skaloud, Pavel; Backorová, Miriam

    2010-05-01

    The photobiont is considered as the more sensitive partner of lichen symbiosis in metal pollution. For this reason the presence of a metal tolerant photobiont in lichens may be a key factor of ecological success of lichens growing on metal polluted substrata. The photobiont inventory was examined for terricolous lichen community growing in Cu mine-spoil heaps derived by historical mining. Sequences of internal transcribed spacer (ITS) were phylogenetically analyzed using maximum likelihood analyses. A total of 50 ITS algal sequences were obtained from 22 selected lichen taxa collected at three Cu mine-spoil heaps and two control localities. Algae associated with Cladonia and Stereocaulon were identified as members of several Asterochloris lineages, photobionts of cetrarioid lichens clustered with Trebouxia hypogymniae ined. We did not find close relationship between heavy metal content (in localities as well as lichen thalli) and photobiont diversity. Presence of multiple algal genotypes in single lichen thallus has been confirmed. PMID:20031214

  9. Plasmid Diversity and Adaptation Analyzed by Massive Sequencing of Escherichia coli Plasmids.

    PubMed

    de Toro, María; Garcilláon-Barcia, M Pilar; De La Cruz, Fernando

    2014-12-01

    Whole-genome sequencing is revolutionizing the analysis of bacterial genomes. It leads to a massive increase in the amount of available data to be analyzed. Bacterial genomes are usually composed of one main chromosome and a number of accessory chromosomes, called plasmids. A recently developed methodology called PLACNET (for plasmid constellation networks) allows the reconstruction of the plasmids of a given genome. Thus, it opens an avenue for plasmidome analysis on a global scale. This work reviews our knowledge of the genetic determinants for plasmid propagation (conjugation and related functions), their diversity, and their prevalence in the variety of plasmids found by whole-genome sequencing. It focuses on the results obtained from a collection of 255 Escherichia coli plasmids reconstructed by PLACNET. The plasmids found in E. coli represent a nonaleatory subset of the plasmids found in proteobacteria. Potential reasons for the prevalence of some specific plasmid groups will be discussed and, more importantly, additional questions will be posed.

  10. Genetic diversity of Moringa peregrina species in Saudi Arabia with ITS sequences.

    PubMed

    Alaklabi, Abdullah

    2015-03-01

    The genus Moringa was the family of Moringaceae and Moringa oleifera and Moringa peregrina are the most famous species of Moringa. M. peregrina is widely grown in Saudi Arabia, Iran and India. Therefore, based on these reports, this study aimed to investigate the first systematic attempt to regulate the genetic diversity of the species M. peregrina in Saudi Arabian samples collected from several geographic locations using internal transcribed sequences. Genomic DNA was separated by CTAB extraction method and PCR was performed. Later on, DNA sequencing was performed for PCR products with ITS. In conclusion, the present study affords the first report on genetic stability of M. peregrina using ITS analysis in Saudi Arabia. Further studies are suggested in order to study in different regions.

  11. Uncultivated microbial eukaryotic diversity: a method to link ssu rRNA gene sequences with morphology.

    PubMed

    Hirst, Marissa B; Kita, Kelley N; Dawson, Scott C

    2011-01-01

    Protists have traditionally been identified by cultivation and classified taxonomically based on their cellular morphologies and behavior. In the past decade, however, many novel protist taxa have been identified using cultivation independent ssu rRNA sequence surveys. New rRNA "phylotypes" from uncultivated eukaryotes have no connection to the wealth of prior morphological descriptions of protists. To link phylogenetically informative sequences with taxonomically informative morphological descriptions, we demonstrate several methods for combining whole cell rRNA-targeted fluorescent in situ hybridization (FISH) with cytoskeletal or organellar immunostaining. Either eukaryote or ciliate-specific ssu rRNA probes were combined with an anti-α-tubulin antibody or phalloidin, a common actin stain, to define cytoskeletal features of uncultivated protists in several environmental samples. The eukaryote ssu rRNA probe was also combined with Mitotracker® or a hydrogenosomal-specific anti-Hsp70 antibody to localize mitochondria and hydrogenosomes, respectively, in uncultivated protists from different environments. Using rRNA probes in combination with immunostaining, we linked ssu rRNA phylotypes with microtubule structure to describe flagellate and ciliate morphology in three diverse environments, and linked Naegleria spp. to their amoeboid morphology using actin staining in hay infusion samples. We also linked uncultivated ciliates to morphologically similar Colpoda-like ciliates using tubulin immunostaining with a ciliate-specific rRNA probe. Combining rRNA-targeted FISH with cytoskeletal immunostaining or stains targeting specific organelles provides a fast, efficient, high throughput method for linking genetic sequences with morphological features in uncultivated protists. When linked to phylotype, morphological descriptions of protists can both complement and vet the increasing number of sequences from uncultivated protists, including those of novel lineages

  12. Uncultivated microbial eukaryotic diversity: a method to link ssu rRNA gene sequences with morphology.

    PubMed

    Hirst, Marissa B; Kita, Kelley N; Dawson, Scott C

    2011-01-01

    Protists have traditionally been identified by cultivation and classified taxonomically based on their cellular morphologies and behavior. In the past decade, however, many novel protist taxa have been identified using cultivation independent ssu rRNA sequence surveys. New rRNA "phylotypes" from uncultivated eukaryotes have no connection to the wealth of prior morphological descriptions of protists. To link phylogenetically informative sequences with taxonomically informative morphological descriptions, we demonstrate several methods for combining whole cell rRNA-targeted fluorescent in situ hybridization (FISH) with cytoskeletal or organellar immunostaining. Either eukaryote or ciliate-specific ssu rRNA probes were combined with an anti-α-tubulin antibody or phalloidin, a common actin stain, to define cytoskeletal features of uncultivated protists in several environmental samples. The eukaryote ssu rRNA probe was also combined with Mitotracker® or a hydrogenosomal-specific anti-Hsp70 antibody to localize mitochondria and hydrogenosomes, respectively, in uncultivated protists from different environments. Using rRNA probes in combination with immunostaining, we linked ssu rRNA phylotypes with microtubule structure to describe flagellate and ciliate morphology in three diverse environments, and linked Naegleria spp. to their amoeboid morphology using actin staining in hay infusion samples. We also linked uncultivated ciliates to morphologically similar Colpoda-like ciliates using tubulin immunostaining with a ciliate-specific rRNA probe. Combining rRNA-targeted FISH with cytoskeletal immunostaining or stains targeting specific organelles provides a fast, efficient, high throughput method for linking genetic sequences with morphological features in uncultivated protists. When linked to phylotype, morphological descriptions of protists can both complement and vet the increasing number of sequences from uncultivated protists, including those of novel lineages

  13. Allelic diversity and population structure in Oenococcus oeni as determined from sequence analysis of housekeeping genes.

    PubMed

    de Las Rivas, Blanca; Marcobal, Angela; Muñoz, Rosario

    2004-12-01

    Oenococcus oeni is the organism of choice for promoting malolactic fermentation in wine. The population biology of O. oeni is poorly understood and remains unclear. For a better understanding of the mode of genetic variation within this species, we investigated by using multilocus sequence typing (MLST) with the gyrB, pgm, ddl, recP, and mleA genes the genetic diversity and genetic relationships among 18 O. oeni strains isolated in various years from wines of the United States, France, Germany, Spain, and Italy. These strains have also been characterized by ribotyping and restriction fragment length polymorphism (RFLP) analysis of the PCR-amplified 16S-23S rRNA gene intergenic spacer region (ISR). Ribotyping grouped the strains into two groups; however, the RFLP analysis of the ISRs showed no differences in the strains analyzed. In contrast, MLST in oenococci had a good discriminatory ability, and we have found a higher genetic diversity than indicated by ribotyping analysis. All sequence types were represented by a single strain, and all the strains could be distinguished from each other because they had unique combinations of alleles. Strains assumed to be identical showed the same sequence type. Phylogenetic analyses indicated a panmictic population structure in O. oeni. Sequences were analyzed for evidence of recombination by split decomposition analysis and analysis of clustered polymorphisms. All results indicated that recombination plays a major role in creating the genetic heterogeneity of O. oeni. A low standardized index of association value indicated that the O. oeni genes analyzed are close to linkage equilibrium. This study constitutes the first step in the development of an MLST method for O. oeni and the first example of the application of MLST to a nonpathogenic food production bacteria. PMID:15574919

  14. Transcriptome Sequencing in Response to Salicylic Acid in Salvia miltiorrhiza.

    PubMed

    Zhang, Xiaoru; Dong, Juane; Liu, Hailong; Wang, Jiao; Qi, Yuexin; Liang, Zongsuo

    2016-01-01

    Salvia miltiorrhiza is a traditional Chinese herbal medicine, whose quality and yield are often affected by diseases and environmental stresses during its growing season. Salicylic acid (SA) plays a significant role in plants responding to biotic and abiotic stresses, but the involved regulatory factors and their signaling mechanisms are largely unknown. In order to identify the genes involved in SA signaling, the RNA sequencing (RNA-seq) strategy was employed to evaluate the transcriptional profiles in S. miltiorrhiza cell cultures. A total of 50,778 unigenes were assembled, in which 5,316 unigenes were differentially expressed among 0-, 2-, and 8-h SA induction. The up-regulated genes were mainly involved in stimulus response and multi-organism process. A core set of candidate novel genes coding SA signaling component proteins was identified. Many transcription factors (e.g., WRKY, bHLH and GRAS) and genes involved in hormone signal transduction were differentially expressed in response to SA induction. Detailed analysis revealed that genes associated with defense signaling, such as antioxidant system genes, cytochrome P450s and ATP-binding cassette transporters, were significantly overexpressed, which can be used as genetic tools to investigate disease resistance. Our transcriptome analysis will help understand SA signaling and its mechanism of defense systems in S. miltiorrhiza. PMID:26808150

  15. Transcriptome Sequencing in Response to Salicylic Acid in Salvia miltiorrhiza

    PubMed Central

    Zhang, Xiaoru; Dong, Juane; Liu, Hailong; Wang, Jiao; Qi, Yuexin; Liang, Zongsuo

    2016-01-01

    Salvia miltiorrhiza is a traditional Chinese herbal medicine, whose quality and yield are often affected by diseases and environmental stresses during its growing season. Salicylic acid (SA) plays a significant role in plants responding to biotic and abiotic stresses, but the involved regulatory factors and their signaling mechanisms are largely unknown. In order to identify the genes involved in SA signaling, the RNA sequencing (RNA-seq) strategy was employed to evaluate the transcriptional profiles in S. miltiorrhiza cell cultures. A total of 50,778 unigenes were assembled, in which 5,316 unigenes were differentially expressed among 0-, 2-, and 8-h SA induction. The up-regulated genes were mainly involved in stimulus response and multi-organism process. A core set of candidate novel genes coding SA signaling component proteins was identified. Many transcription factors (e.g., WRKY, bHLH and GRAS) and genes involved in hormone signal transduction were differentially expressed in response to SA induction. Detailed analysis revealed that genes associated with defense signaling, such as antioxidant system genes, cytochrome P450s and ATP-binding cassette transporters, were significantly overexpressed, which can be used as genetic tools to investigate disease resistance. Our transcriptome analysis will help understand SA signaling and its mechanism of defense systems in S. miltiorrhiza. PMID:26808150

  16. Diversity and spatiotemporal dynamics of bacterial communities: physicochemical and other drivers along an acid mine drainage.

    PubMed

    Volant, Aurélie; Bruneel, Odile; Desoeuvre, Angélique; Héry, Marina; Casiot, Corinne; Bru, Noëlle; Delpoux, Sophie; Fahy, Anne; Javerliat, Fabien; Bouchez, Olivier; Duran, Robert; Bertin, Philippe N; Elbaz-Poulichet, Françoise; Lauga, Béatrice

    2014-10-01

    Deciphering the biotic and abiotic factors that control microbial community structure over time and along an environmental gradient is a pivotal question in microbial ecology. Carnoulès mine (France), which is characterized by acid waters and very high concentrations of arsenic, iron, and sulfate, provides an excellent opportunity to study these factors along the pollution gradient of Reigous Creek. To this end, biodiversity and spatiotemporal distribution of bacterial communities were characterized using T-RFLP fingerprinting and high-throughput sequencing. Patterns of spatial and temporal variations in bacterial community composition linked to changes in the physicochemical conditions suggested that species-sorting processes were at work in the acid mine drainage. Arsenic, temperature, and sulfate appeared to be the most important factors that drove the composition of bacterial communities along this continuum. Time series investigation along the pollution gradient also highlighted habitat specialization for some major members of the community (Acidithiobacillus and Thiomonas), dispersal for Acidithiobacillus, and evidence of extinction/re-thriving processes for Gallionella. Finally, pyrosequencing revealed a broader phylogenetic range of taxa than previous clone library-based diversity. Overall, our findings suggest that in addition to environmental filtering processes, additional forces (dispersal, birth/death events) could operate in AMD community.

  17. Diversity of lactic acid bacteria isolated from Brazilian water buffalo mozzarella cheese.

    PubMed

    Silva, Luana Faria; Casella, Tiago; Gomes, Elisangela Soares; Nogueira, Mara Correa Lelles; De Dea Lindner, Juliano; Penna, Ana Lúcia Barretto

    2015-02-01

    The water buffalo mozzarella cheese is a typical Italian cheese which has been introduced in the thriving Brazilian market in the last 10 y, with good acceptance by its consumers. Lactic acid bacteria (LAB) play an important role in the technological and sensory quality of mozzarella cheese. In this study, the aim was to evaluate the diversity of the autochthones viable LAB isolated from water buffalo mozzarella cheese under storage. Samples were collected in 3 independent trials in a dairy industry located in the southeast region of Brazil, on the 28th day of storage, at 4 ºC. The LAB were characterized by Gram staining, catalase test, capacity to assimilate citrate, and production of CO2 from glucose. The diversity of LAB was evaluated by RAPD-PCR (randomly amplified polymorphic DNA-polymerase chain reaction), 16S rRNA gene sequencing, and by Vitek 2 system. Twenty LAB strains were isolated and clustered into 12 different clusters, and identified as Streptococcus thermophilus, Enterococcus faecium, Enterococcus durans, Leuconostoc mesenteroides subsp. mesenteroides, Lactobacillus fermentum, Lactobacillus casei, Lactobacillus delbrueckii subsp. bulgaricus, and Lactobacillus helveticus. Enterococcus species were dominant and citrate-positive. Only the strains of L. mesenteroides subsp. mesenteroides and L. fermentum produced CO2 from glucose and were citrate-positive, while L. casei was only citrate positive. This is the first report which elucidates the LAB diversity involved in Brazilian water buffalo mozzarella cheese. Furthermore, the results show that despite the absence of natural whey cultures as starters in production, the LAB species identified are the ones typically found in mozzarella cheese.

  18. Shotgun metagenomic sequencing based microbial diversity assessment of Lasundra hot spring, India.

    PubMed

    Mangrola, Amit V; Dudhagara, Pravin; Koringa, Prakash; Joshi, C G; Patel, Rajesh K

    2015-06-01

    This is the first report on the metagenomic approach for unveiling the microbial diversity of Lasundra hot spring, Gujarat State, India. High-throughput sequencing of community DNA was performed on an Ion Torrent PGM platform. Metagenome consisted of 606,867 sequences represent 98,567,305 bps size with an average length of 162 bps and 46% G + C content. Metagenome sequence information is available at EBI under EBI Metagenomic database with accession no. ERP009313. MG-RAST assisted community analysis revealed that 99.21% sequences were bacterial origin, 0.43% was fit to eukaryotes and 0.11% belongs to archaea. A total of 29 bacterial, 20 eukaryotic and 4 archaeal phyla were detected. Abundant genera were Bacillus (86.7%), Geobacillus (2.4%), Paenibacillus (1.0%), Clostridium (0.7%) and Listeria (0.5%), that represent 91.52% in metagenome. In functional analysis, Cluster of Orthologous Group (COG) based annotation revealed that 45.4% was metabolism connected and 19.6% falls in poorly characterized group. Subsystem based annotation approach suggests that the 14.0% was carbohydrates, 7.0% was protein metabolism and 3.0% genes for various stress responses together with the versatile presence of commercially useful traits. PMID:26484181

  19. Global Diversity Lines–A Five-Continent Reference Panel of Sequenced Drosophila melanogaster Strains

    PubMed Central

    Grenier, Jennifer K.; Arguello, J. Roman; Moreira, Margarida Cardoso; Gottipati, Srikanth; Mohammed, Jaaved; Hackett, Sean R.; Boughton, Rachel; Greenberg, Anthony J.; Clark, Andrew G.

    2015-01-01

    Reference collections of multiple Drosophila lines with accumulating collections of “omics” data have proven especially valuable for the study of population genetics and complex trait genetics. Here we present a description of a resource collection of 84 strains of Drosophila melanogaster whose genome sequences were obtained after 12 generations of full-sib inbreeding. The initial rationale for this resource was to foster development of a systems biology platform for modeling metabolic regulation by the use of natural polymorphisms as perturbations. As reference lines, they are amenable to repeated phenotypic measurements, and already a large collection of metabolic traits have been assayed. Another key feature of these strains is their widespread geographic origin, coming from Beijing, Ithaca, Netherlands, Tasmania, and Zimbabwe. After obtaining 12.5× coverage of paired-end Illumina sequence reads, SNP and indel calls were made with the GATK platform. Thorough quality control was enabled by deep sequencing one line to >100×, and single-nucleotide polymorphisms and indels were validated using ddRAD-sequencing as an orthogonal platform. In addition, a series of preliminary population genetic tests were performed with these single-nucleotide polymorphism data for assessment of data quality. We found 83 segregating inversions among the lines, and as expected these were especially abundant in the African sample. We anticipate that this will make a useful addition to the set of reference D. melanogaster strains, thanks to its geographic structuring and unusually high level of genetic diversity. PMID:25673134

  20. Assessing Diversity of DNA Structure-Related Sequence Features in Prokaryotic Genomes

    PubMed Central

    Huang, Yongjie; Mrázek, Jan

    2014-01-01

    Prokaryotic genomes are diverse in terms of their nucleotide and oligonucleotide composition as well as presence of various sequence features that can affect physical properties of the DNA molecule. We present a survey of local sequence patterns which have a potential to promote non-canonical DNA conformations (i.e. different from standard B-DNA double helix) and interpret the results in terms of relationships with organisms' habitats, phylogenetic classifications, and other characteristics. Our present work differs from earlier similar surveys not only by investigating a wider range of sequence patterns in a large number of genomes but also by using a more realistic null model to assess significant deviations. Our results show that simple sequence repeats and Z-DNA-promoting patterns are generally suppressed in prokaryotic genomes, whereas palindromes and inverted repeats are over-represented. Representation of patterns that promote Z-DNA and intrinsic DNA curvature increases with increasing optimal growth temperature (OGT), and decreases with increasing oxygen requirement. Additionally, representations of close direct repeats, palindromes and inverted repeats exhibit clear negative trends with increasing OGT. The observed relationships with environmental characteristics, particularly OGT, suggest possible evolutionary scenarios of structural adaptation of DNA to particular environmental niches. PMID:24408877

  1. A flexible and economical barcoding approach for highly multiplexed amplicon sequencing of diverse target genes.

    PubMed

    Herbold, Craig W; Pelikan, Claus; Kuzyk, Orest; Hausmann, Bela; Angel, Roey; Berry, David; Loy, Alexander

    2015-01-01

    High throughput sequencing of phylogenetic and functional gene amplicons provides tremendous insight into the structure and functional potential of complex microbial communities. Here, we introduce a highly adaptable and economical PCR approach to barcoding and pooling libraries of numerous target genes. In this approach, we replace gene- and sequencing platform-specific fusion primers with general, interchangeable barcoding primers, enabling nearly limitless customized barcode-primer combinations. Compared to barcoding with long fusion primers, our multiple-target gene approach is more economical because it overall requires lower number of primers and is based on short primers with generally lower synthesis and purification costs. To highlight our approach, we pooled over 900 different small-subunit rRNA and functional gene amplicon libraries obtained from various environmental or host-associated microbial community samples into a single, paired-end Illumina MiSeq run. Although the amplicon regions ranged in size from approximately 290 to 720 bp, we found no significant systematic sequencing bias related to amplicon length or gene target. Our results indicate that this flexible multiplexing approach produces large, diverse, and high quality sets of amplicon sequence data for modern studies in microbial ecology. PMID:26236305

  2. Targeted high-throughput growth hormone 1 gene sequencing reveals high within-breed genetic diversity in South African goats.

    PubMed

    Ncube, K T; Mdladla, K; Dzomba, E F; Muchadeyi, F C

    2016-06-01

    This study assessed the genetic diversity in the growth hormone 1 gene (GH1) within and between South African goat breeds. Polymerase chain reaction-targeted gene amplification together with Illumina MiSeq next-generation sequencing (NGS) was used to generate the full length (2.54 kb) of the growth hormone 1 gene and screen for SNPs in the South African Boer (SAB) (n = 17), Tankwa (n = 15) and South African village (n = 35) goat populations. A range of 27-58 SNPs per population were observed. Mutations resulting in amino acid changes were observed at exons 2 and 5. Higher within-breed diversity of 97.37% was observed within the population category consisting of SA village ecotypes and the Tankwa goats. Highest pairwise FST values ranging from 0.148 to 0.356 were observed between the SAB and both the South African village and Tankwa feral goat populations. Phylogenetic analysis indicated nine genetic clusters, which reflected close relationships between the South African populations and the other international breeds with the exception of the Italian Sarda breeds. Results imply greater potential for within-population selection programs, particularly with SA village goats. PMID:26919178

  3. Natural vs. random protein sequences: Discovering combinatorics properties on amino acid words.

    PubMed

    Santoni, Daniele; Felici, Giovanni; Vergni, Davide

    2016-02-21

    Casual mutations and natural selection have driven the evolution of protein amino acid sequences that we observe at present in nature. The question about which is the dominant force of proteins evolution is still lacking of an unambiguous answer. Casual mutations tend to randomize protein sequences while, in order to have the correct functionality, one expects that selection mechanisms impose rigid constraints on amino acid sequences. Moreover, one also has to consider that the space of all possible amino acid sequences is so astonishingly large that it could be reasonable to have a well tuned amino acid sequence indistinguishable from a random one. In order to study the possibility to discriminate between random and natural amino acid sequences, we introduce different measures of association between pairs of amino acids in a sequence, and apply them to a dataset of 1047 natural protein sequences and 10,470 random sequences, carefully generated in order to preserve the relative length and amino acid distribution of the natural proteins. We analyze the multidimensional measures with machine learning techniques and show that, to a reasonable extent, natural protein sequences can be differentiated from random ones.

  4. Natural vs. random protein sequences: Discovering combinatorics properties on amino acid words.

    PubMed

    Santoni, Daniele; Felici, Giovanni; Vergni, Davide

    2016-02-21

    Casual mutations and natural selection have driven the evolution of protein amino acid sequences that we observe at present in nature. The question about which is the dominant force of proteins evolution is still lacking of an unambiguous answer. Casual mutations tend to randomize protein sequences while, in order to have the correct functionality, one expects that selection mechanisms impose rigid constraints on amino acid sequences. Moreover, one also has to consider that the space of all possible amino acid sequences is so astonishingly large that it could be reasonable to have a well tuned amino acid sequence indistinguishable from a random one. In order to study the possibility to discriminate between random and natural amino acid sequences, we introduce different measures of association between pairs of amino acids in a sequence, and apply them to a dataset of 1047 natural protein sequences and 10,470 random sequences, carefully generated in order to preserve the relative length and amino acid distribution of the natural proteins. We analyze the multidimensional measures with machine learning techniques and show that, to a reasonable extent, natural protein sequences can be differentiated from random ones. PMID:26656109

  5. Exploring fungal diversity in deep-sea sediments from Okinawa Trough using high-throughput Illumina sequencing

    NASA Astrophysics Data System (ADS)

    Zhang, Xiao-Yong; Wang, Guang-Hua; Xu, Xin-Ya; Nong, Xu-Hua; Wang, Jie; Amin, Muhammad; Qi, Shu-Hua

    2016-10-01

    The present study investigated the fungal diversity in four different deep-sea sediments from Okinawa Trough using high-throughput Illumina sequencing of the nuclear ribosomal internal transcribed spacer-1 (ITS1). A total of 40,297 fungal ITS1 sequences clustered into 420 operational taxonomic units (OTUs) with 97% sequence similarity and 170 taxa were recovered from these sediments. Most ITS1 sequences (78%) belonged to the phylum Ascomycota, followed by Basidiomycota (17.3%), Zygomycota (1.5%) and Chytridiomycota (0.8%), and a small proportion (2.4%) belonged to unassigned fungal phyla. Compared with previous studies on fungal diversity of sediments from deep-sea environments by culture-dependent approach and clone library analysis, the present result suggested that Illumina sequencing had been dramatically accelerating the discovery of fungal community of deep-sea sediments. Furthermore, our results revealed that Sordariomycetes was the most diverse and abundant fungal class in this study, challenging the traditional view that the diversity of Sordariomycetes phylotypes was low in the deep-sea environments. In addition, more than 12 taxa accounted for 21.5% sequences were found to be rarely reported as deep-sea fungi, suggesting the deep-sea sediments from Okinawa Trough harbored a plethora of different fungal communities compared with other deep-sea environments. To our knowledge, this study is the first exploration of the fungal diversity in deep-sea sediments from Okinawa Trough using high-throughput Illumina sequencing.

  6. Extracellular DNA amplicon sequencing reveals high levels of benthic eukaryotic diversity in the central Red Sea.

    PubMed

    Pearman, John K; Irigoien, Xabier; Carvalho, Susana

    2016-04-01

    The present study aims to characterize the benthic eukaryotic biodiversity patterns at a coarse taxonomic level in three areas of the central Red Sea (a lagoon, an offshore area in Thuwal and a shallow coastal area near Jeddah) based on extracellular DNA. High-throughput amplicon sequencing targeting the V9 region of the 18S rRNA gene was undertaken for 32 sediment samples. High levels of alpha-diversity were detected with 16,089 operational taxonomic units (OTUs) being identified. The majority of the OTUs were assigned to Metazoa (29.2%), Alveolata (22.4%) and Stramenopiles (17.8%). Stramenopiles (Diatomea) and Alveolata (Ciliophora) were frequent in a lagoon and in shallower coastal stations, whereas metazoans (Arthropoda: Maxillopoda) were dominant in deeper offshore stations. Only 24.6% of total OTUs were shared among all areas. Beta-diversity was generally lower between the lagoon and Jeddah (nearshore) than between either of those and the offshore area, suggesting a nearshore-offshore biodiversity gradient. The current approach allowed for a broad-range of benthic eukaryotic biodiversity to be analysed with significantly less labour than would be required by other traditional taxonomic approaches. Our findings suggest that next generation sequencing techniques have the potential to provide a fast and standardised screening of benthic biodiversity at large spatial and temporal scales.

  7. Inter simple sequence repeat (ISSR) analysis of genetic diversity in tef [Eragrostis tef (Zucc.) Trotter].

    PubMed

    Assefa, Kebebew; Merker, Arnulf; Tefera, Hailu

    2003-01-01

    The DNA polymorphism among 92 selected tef genotypes belonging to eight origin groups was assessed using eight inter simple sequence repeat (ISSR) primers. The objectives were to examine the possibility of using ISSR markers for unravelling genetic diversity in tef, and to assess the extent and pattern of genetic diversity in the test germplasm with respect to origin groups. The eight primers were able to separate or distinguish all of the 92 tef genotypes based on a total of 110 polymorphic bands among the test lines. The Jaccard similarity coefficient among the test genotypes ranged from 0.26 to 0.86, and at about 60 % similarity level the clustering of this matrix using the unweighted pair-group method based on arithmetic average (UPGMA) resulted in the formation of six major clusters of 2 to 37 lines with further eight lines remaining ungrouped. The standardized Nei genetic distance among the eight groups of origin ranged between 0.03 and 0.32. The UPGMA clustering using the standardized genetic distance matrix resulted in the identification of three clusters of the eight groups of origin with bootstrap values ranging from 56 to 97. The overall mean Shannon Weaver diversity index of the test lines was 0.73, indicating better resolution of genetic diversity in tef with ISSR markers than with phenotypic (morphological) traits used in previous studies. This can be attributed mainly to the larger number of loci generated for evaluation with ISSR analysis as compared to the few number of phenotypic traits amenable for assessment and which are further greatly affected by environment and genotype x environment interaction. Analysis of variance of mean Shannon Weaver diversity indices revealed substantial (P < or = 0.05) variation in the level of diversity among the eight groups of origin. In conclusion, our results indicate that ISSR can be useful as DNA-based molecular markers for studying genetic diversity and phylogenetic relationships, DNA fingerprinting for the

  8. Genetic diversity of wild soybean populations in Dongying, China, by simple sequence repeat analysis.

    PubMed

    Wang, Y H; Zhang, X J; Fan, S J

    2015-09-28

    Annual wild soybean (Glycine soja Sieb. et Zucc.), the ancestor of cultivated soybean (G. max), is believed to be a potential gene source for further improvement of soybean to cope with environmental stress. In this study, 10 simple sequence repeat (SSR) markers were used to evaluate the genetic diversity and population genetic structure in five wild soybean populations using 195 accessions collected from Dongying, China. Ten SSR markers yielded 90 bands, with an average of nine bands per marker. The percentage of polymorphic loci (P) was 97.78%, the distribution of expected heterozygosity (HE) was 0.1994-0.4460 with an average of 0.3262, and the distribution from Shannon's information index (I) was 0.3595-0.6506 with an average of 0.5386. The results showed that wild soybean had a high degree of genetic diversity at the species level. Nei's differentiation coefficient (FST) was 0.1533, and gene flow (Nm) was 1.3805, which indicated that genetic variation mainly existed within populations and that there was a certain level of gene exchange between populations. Some genetic differentiation occurred among populations, although this was not significant. Cluster analysis indicated that there was no significant correlation between the genetic structure of wild soybean populations and their geographic distribution, and the clustering results may be relatively consistent with the habitats of the accessions. In the present study, the genetic diversity of wild soybeans showed a broad genetic base and enables suggestions for the conservation of this plant to be made.

  9. Utility of Metagenomic Next-Generation Sequencing for Characterization of HIV and Human Pegivirus Diversity

    PubMed Central

    Naccache, Samia N.; Kabre, Beniwende; Federman, Scot; Mbanya, Dora; Kaptué, Lazare; Chiu, Charles Y.; Brennan, Catherine A.; Hackett, John

    2015-01-01

    Given the dynamic changes in HIV-1 complexity and diversity, next-generation sequencing (NGS) has the potential to revolutionize strategies for effective HIV global surveillance. In this study, we explore the utility of metagenomic NGS to characterize divergent strains of HIV-1 and to simultaneously screen for other co-infecting viruses. Thirty-five HIV-1-infected Cameroonian blood donor specimens with viral loads of >4.4 log10 copies/ml were selected to include a diverse representation of group M strains. Random-primed NGS libraries, prepared from plasma specimens, resulted in greater than 90% genome coverage for 88% of specimens. Correct subtype designations based on NGS were concordant with sub-region PCR data in 31 of 35 (89%) cases. Complete genomes were assembled for 25 strains, including circulating recombinant forms with relatively limited data available (7 CRF11_cpx, 2 CRF13_cpx, 1 CRF18_cpx, and 1 CRF37_cpx), as well as 9 unique recombinant forms. HPgV (formerly designated GBV-C) co-infection was detected in 9 of 35 (25%) specimens, of which eight specimens yielded complete genomes. The recovered HPgV genomes formed a diverse cluster with genotype 1 sequences previously reported from Ghana, Uganda, and Japan. The extensive genome coverage obtained by NGS improved accuracy and confidence in phylogenetic classification of the HIV-1 strains present in the study population relative to conventional sub-region PCR. In addition, these data demonstrate the potential for metagenomic analysis to be used for routine characterization of HIV-1 and identification of other viral co-infections. PMID:26599538

  10. Rare recombination events generate sequence diversity among balancer chromosomes in Drosophila melanogaster

    PubMed Central

    Miller, Danny E.; Cook, Kevin R.; Yeganeh Kazemi, Nazanin; Smith, Clarissa B.; Cockrell, Alexandria J.; Hawley, R. Scott; Bergman, Casey M.

    2016-01-01

    Multiply inverted balancer chromosomes that suppress exchange with their homologs are an essential part of the Drosophila melanogaster genetic toolkit. Despite their widespread use, the organization of balancer chromosomes has not been characterized at the molecular level, and the degree of sequence variation among copies of balancer chromosomes is unknown. To map inversion breakpoints and study potential diversity in descendants of a structurally identical balancer chromosome, we sequenced a panel of laboratory stocks containing the most widely used X chromosome balancer, First Multiple 7 (FM7). We mapped the locations of FM7 breakpoints to precise euchromatic coordinates and identified the flanking sequence of breakpoints in heterochromatic regions. Analysis of SNP variation revealed megabase-scale blocks of sequence divergence among currently used FM7 stocks. We present evidence that this divergence arose through rare double-crossover events that replaced a female-sterile allele of the singed gene (snX2) on FM7c with a sequence from balanced chromosomes. We propose that although double-crossover events are rare in individual crosses, many FM7c chromosomes in the Bloomington Drosophila Stock Center have lost snX2 by this mechanism on a historical timescale. Finally, we characterize the original allele of the Bar gene (B1) that is carried on FM7, and validate the hypothesis that the origin and subsequent reversion of the B1 duplication are mediated by unequal exchange. Our results reject a simple nonrecombining, clonal mode for the laboratory evolution of balancer chromosomes and have implications for how balancer chromosomes should be used in the design and interpretation of genetic experiments in Drosophila. PMID:26903656

  11. Rare recombination events generate sequence diversity among balancer chromosomes in Drosophila melanogaster.

    PubMed

    Miller, Danny E; Cook, Kevin R; Yeganeh Kazemi, Nazanin; Smith, Clarissa B; Cockrell, Alexandria J; Hawley, R Scott; Bergman, Casey M

    2016-03-01

    Multiply inverted balancer chromosomes that suppress exchange with their homologs are an essential part of the Drosophila melanogaster genetic toolkit. Despite their widespread use, the organization of balancer chromosomes has not been characterized at the molecular level, and the degree of sequence variation among copies of balancer chromosomes is unknown. To map inversion breakpoints and study potential diversity in descendants of a structurally identical balancer chromosome, we sequenced a panel of laboratory stocks containing the most widely used X chromosome balancer, First Multiple 7 (FM7). We mapped the locations of FM7 breakpoints to precise euchromatic coordinates and identified the flanking sequence of breakpoints in heterochromatic regions. Analysis of SNP variation revealed megabase-scale blocks of sequence divergence among currently used FM7 stocks. We present evidence that this divergence arose through rare double-crossover events that replaced a female-sterile allele of the singed gene (sn(X2)) on FM7c with a sequence from balanced chromosomes. We propose that although double-crossover events are rare in individual crosses, many FM7c chromosomes in the Bloomington Drosophila Stock Center have lost sn(X2) by this mechanism on a historical timescale. Finally, we characterize the original allele of the Bar gene (B(1)) that is carried on FM7, and validate the hypothesis that the origin and subsequent reversion of the B(1) duplication are mediated by unequal exchange. Our results reject a simple nonrecombining, clonal mode for the laboratory evolution of balancer chromosomes and have implications for how balancer chromosomes should be used in the design and interpretation of genetic experiments in Drosophila. PMID:26903656

  12. Rare recombination events generate sequence diversity among balancer chromosomes in Drosophila melanogaster.

    PubMed

    Miller, Danny E; Cook, Kevin R; Yeganeh Kazemi, Nazanin; Smith, Clarissa B; Cockrell, Alexandria J; Hawley, R Scott; Bergman, Casey M

    2016-03-01

    Multiply inverted balancer chromosomes that suppress exchange with their homologs are an essential part of the Drosophila melanogaster genetic toolkit. Despite their widespread use, the organization of balancer chromosomes has not been characterized at the molecular level, and the degree of sequence variation among copies of balancer chromosomes is unknown. To map inversion breakpoints and study potential diversity in descendants of a structurally identical balancer chromosome, we sequenced a panel of laboratory stocks containing the most widely used X chromosome balancer, First Multiple 7 (FM7). We mapped the locations of FM7 breakpoints to precise euchromatic coordinates and identified the flanking sequence of breakpoints in heterochromatic regions. Analysis of SNP variation revealed megabase-scale blocks of sequence divergence among currently used FM7 stocks. We present evidence that this divergence arose through rare double-crossover events that replaced a female-sterile allele of the singed gene (sn(X2)) on FM7c with a sequence from balanced chromosomes. We propose that although double-crossover events are rare in individual crosses, many FM7c chromosomes in the Bloomington Drosophila Stock Center have lost sn(X2) by this mechanism on a historical timescale. Finally, we characterize the original allele of the Bar gene (B(1)) that is carried on FM7, and validate the hypothesis that the origin and subsequent reversion of the B(1) duplication are mediated by unequal exchange. Our results reject a simple nonrecombining, clonal mode for the laboratory evolution of balancer chromosomes and have implications for how balancer chromosomes should be used in the design and interpretation of genetic experiments in Drosophila.

  13. Phylogenetic Analysis of Geographically Diverse Radopholus similis via rDNA Sequence Reveals a Monomorphic Motif

    PubMed Central

    Kaplan, D. T.; Thomas, W. K.; Frisse, L. M.; Sarah, J. L.; Stanton, J. M.; Speijer, P. R.; Marin, D. H.; Opperman, C. H.

    2000-01-01

    The nucleic acid sequences of rDNA ITS1 and the rDNA D2/D3 expansion segment were compared for 57 burrowing nematode isolates collected from Australia, Cameroon, Central America, Cuba, Dominican Republic, Florida, Guadeloupe, Hawaii, Nigeria, Honduras, Indonesia, Ivory Coast, Puerto Rico, South Africa, and Uganda. Of the 57 isolates, 55 were morphologically similar to Radopholus similis and seven were citrus-parasitic. The nucleic acid sequences for PCR-amplified ITS1 and for the D2/D3 expansion segment of the 28S rDNA gene were each identical for all putative R. similis. Sequence divergence for both the ITS1 and the D2/D3 was concordant with morphological differences that distinguish R. similis from other burrowing nematode species. This result substantiates previous observations that the R. similis genome is highly conserved across geographic regions. Autapomorphies that would delimit phylogenetic lineages of non-citrus-parasitic R. similis from those that parasitize citrus were not observed. The data presented herein support the concept that R. similis is comprised of two pathotypes-one that parasitizes citrus and one that does not. PMID:19270959

  14. First insights into the microbial diversity in the omasum and reticulum of bovine using Illumina sequencing.

    PubMed

    Peng, Shuai; Yin, Jigang; Liu, Xiaolei; Jia, Boyin; Chang, Zhiguang; Lu, Huijun; Jiang, Ning; Chen, Qijun

    2015-08-01

    The digestive systems of mammals harbor a complex gut microbiome, comprising bacteria and other microorganisms that confer metabolic and immunological benefits to the host. Ruminants that digest plant-based foods have a four-compartment stomach consisting of the rumen, reticulum, omasum, and abomasum. The microorganisms in the stomach are essential for providing the host with critical nutrients. However, the majority of these microorganisms are unknown species. The microbiome of the stomach is diverse, and the majority of these organisms cannot be cultured. Next-generation sequencing (NGS) combined with bioinformatic analysis tools have allowed the dissection of the composition of the microbiome in samples collected from a specific environment. In this study, for the first time, the bacterial composition in two compartments, the reticulum and the omasum, of bovine were analyzed using a metagenomic approach and compared to the bacterial composition of the rumen. These data will assist in understanding the biology of ruminants and benefit the agricultural industry. The diversity and composition of the bacterial community in samples collected from the rumen, reticulum, and omasum of bovines in the Changchun Region of Northeast China were analyzed by sequencing the V3 region of the 16S rRNA gene using a barcoded Illumina paired-end sequencing technique, and the primary composition of the microbiome in the rumen, reticulum, and omasum of the bovines was determined. These microbiomes contained 17 phyla and 107 genera in all three samples. Five phyla, Bacteroidetes, Firmicutes, Proteobacteria, Spirochaetes, and Lentisphaerae, were the most abundant taxonomic groups. Additionally, the different stomach compartments harbored different compositions of the microorganisms.

  15. First insights into the microbial diversity in the omasum and reticulum of bovine using Illumina sequencing.

    PubMed

    Peng, Shuai; Yin, Jigang; Liu, Xiaolei; Jia, Boyin; Chang, Zhiguang; Lu, Huijun; Jiang, Ning; Chen, Qijun

    2015-08-01

    The digestive systems of mammals harbor a complex gut microbiome, comprising bacteria and other microorganisms that confer metabolic and immunological benefits to the host. Ruminants that digest plant-based foods have a four-compartment stomach consisting of the rumen, reticulum, omasum, and abomasum. The microorganisms in the stomach are essential for providing the host with critical nutrients. However, the majority of these microorganisms are unknown species. The microbiome of the stomach is diverse, and the majority of these organisms cannot be cultured. Next-generation sequencing (NGS) combined with bioinformatic analysis tools have allowed the dissection of the composition of the microbiome in samples collected from a specific environment. In this study, for the first time, the bacterial composition in two compartments, the reticulum and the omasum, of bovine were analyzed using a metagenomic approach and compared to the bacterial composition of the rumen. These data will assist in understanding the biology of ruminants and benefit the agricultural industry. The diversity and composition of the bacterial community in samples collected from the rumen, reticulum, and omasum of bovines in the Changchun Region of Northeast China were analyzed by sequencing the V3 region of the 16S rRNA gene using a barcoded Illumina paired-end sequencing technique, and the primary composition of the microbiome in the rumen, reticulum, and omasum of the bovines was determined. These microbiomes contained 17 phyla and 107 genera in all three samples. Five phyla, Bacteroidetes, Firmicutes, Proteobacteria, Spirochaetes, and Lentisphaerae, were the most abundant taxonomic groups. Additionally, the different stomach compartments harbored different compositions of the microorganisms. PMID:25604266

  16. Sequence Diversity, Intersubgroup Relationships, and Origins of the Mouse Leukemia Gammaretroviruses of Laboratory and Wild Mice

    PubMed Central

    Bamunusinghe, Devinka; Naghashfar, Zohreh; Buckler-White, Alicia; Plishka, Ronald; Baliji, Surendranath; Liu, Qingping; Kassner, Joshua; Oler, Andrew J.; Hartley, Janet

    2016-01-01

    ABSTRACT Mouse leukemia viruses (MLVs) are found in the common inbred strains of laboratory mice and in the house mouse subspecies of Mus musculus. Receptor usage and envelope (env) sequence variation define three MLV host range subgroups in laboratory mice: ecotropic, polytropic, and xenotropic MLVs (E-, P-, and X-MLVs, respectively). These exogenous MLVs derive from endogenous retroviruses (ERVs) that were acquired by the wild mouse progenitors of laboratory mice about 1 million years ago. We analyzed the genomes of seven MLVs isolated from Eurasian and American wild mice and three previously sequenced MLVs to describe their relationships and identify their possible ERV progenitors. The phylogenetic tree based on the receptor-determining regions of env produced expected host range clusters, but these clusters are not maintained in trees generated from other virus regions. Colinear alignments of the viral genomes identified segmental homologies to ERVs of different host range subgroups. Six MLVs show close relationships to a small xenotropic ERV subgroup largely confined to the inbred mouse Y chromosome. env variations define three E-MLV subtypes, one of which carries duplications of various sizes, sequences, and locations in the proline-rich region of env. Outside the env region, all E-MLVs are related to different nonecotropic MLVs. These results document the diversity in gammaretroviruses isolated from globally distributed Mus subspecies, provide insight into their origins and relationships, and indicate that recombination has had an important role in the evolution of these mutagenic and pathogenic agents. IMPORTANCE Laboratory mice carry mouse leukemia viruses (MLVs) of three host range groups which were acquired from their wild mouse progenitors. We sequenced the complete genomes of seven infectious MLVs isolated from geographically separated Eurasian and American wild mice and compared them with endogenous germ line retroviruses (ERVs) acquired early in

  17. Diversity, population structure, and evolution of local peach cultivars in China identified by simple sequence repeats.

    PubMed

    Shen, Z J; Ma, R J; Cai, Z X; Yu, M L; Zhang, Z

    2015-01-15

    The fruit peach originated in China and has a history of domestication of more than 4000 years. Numerous local cultivars were selected during the long course of cultivation, and a great morphological diversity exists. To study the diversity and genetic background of local peach cultivars in China, a set of 158 accessions from different ecological regions, together with 27 modern varieties and 10 wild accessions, were evaluated using 49 simple sequence repeats (SSRs) covering the peach genome. Broad diversity was also observed in local cultivars at the SSR level. A total of 648 alleles were amplified with an average of 13.22 observed alleles per locus. The number of genotypes detected ranged from 9 (UDP96015) to 58 (BPPCT008) with an average of 27.00 genotypes per marker. Eight subpopulations divided by STRUCTURE basically coincided with the dendrogram of genetic relationships and could be explained by the traditional groups. The 8 subpopulations were juicy honey peach, southwestern peach I, wild peach, Buddha peach + southwestern peach II, northern peach, southern crisp peach, ornamental peach, and Prunus davidiana + P. kansuensis. Most modern varieties carried the genetic backgrounds of juicy honey peach and southwestern peach I, while others carried diverse genetic backgrounds, indicating that local cultivars were partly used in modern breeding programs. Based on the traditional evolution pathway, a modified pathway for the development of local peach cultivars in China was proposed using the genetic background of subpopulations that were identified by SSRs. Current status and prospects of utilization of Chinese local peach cultivars were also discussed according to the SSR information.

  18. Determining the Cellular Diversity of Hepatitis C Virus Quasispecies by Single-Cell Viral Sequencing

    PubMed Central

    McLauchlan, John

    2013-01-01

    Single-cell genomics is emerging as an important tool in cellular biology. We describe for the first time a system to investigate RNA virus quasispecies diversity at the cellular level utilizing hepatitis C virus (HCV) replicons. A high-fidelity nested reverse transcription (RT)-PCR assay was developed, and validation using control transcripts of known copy number indicated a detection limit of 3 copies of viral RNA/reaction. This system was used to determine the cellular diversity of subgenomic JFH-1 HCV replicons constitutively expressed in Huh7 cells. Each cell contained a unique quasispecies that was much less diverse than the quasispecies of the bulk cell population from which the single cells were derived, suggesting the occurrence of independent evolution at the cellular level. An assessment of the replicative fitness of the predominant single-cell quasispecies variants indicated a modest reduction in fitness compared to the wild type. Real-time RT-PCR methods capable of determining single-cell viral loads were developed and indicated an average of 113 copies of replicon RNA per cell, correlating with calculated RNA copy numbers in the bulk cell population. This study introduces a single-cell RNA viral-sequencing method with numerous potential applications to explore host-virus interactions during infection. HCV quasispecies diversity varied greatly between cells in vitro, suggesting different within-cell evolutionary pathways. Such divergent trajectories in vivo could have implications for the evolution and establishment of antiviral-resistant variants and host immune escape mutants. PMID:24049174

  19. Ecological coherence of diversity patterns derived from classical fingerprinting and Next Generation Sequencing techniques.

    PubMed

    Gobet, Angélique; Boetius, Antje; Ramette, Alban

    2014-09-01

    Changes in richness and bacterial community structure obtained via 454 Massively Parallel Tag Sequencing (MPTS) and Automated Ribosomal Intergenic Analysis (ARISA) were systematically compared to determine whether and how the ecological knowledge obtained from both molecular techniques could be combined. We evaluated community changes over time and depth in marine coastal sands at different levels of taxonomic resolutions, sequence corrections and sequence abundances. Although richness over depth layers or sampling dates greatly varied [∼ 30% and 70-80% new operational taxonomic units (OTU) between two samples with ARISA and MPTS respectively], overall patterns of community variations were similar with both approaches. Alpha-diversity estimated by ARISA-derived OTU was most similar to that obtained from MPTS-derived OTU defined at the order level. Similar patterns of OTU replacement were also found with MPTS at the family level and with 20-25% rare types removed. Using ARISA or MPTS datasets with lower resolution, such as those containing only resident OTU, yielded a similar set of significant contextual variables explaining bacterial community changes. Hence, ARISA as a rapid and low-cost fingerprinting technique represents a valid starting point for more in-depth exploration of community composition when complemented by the detailed taxonomic description offered by MPTS.

  20. High-throughput nucleotide sequence analysis of diverse bacterial communities in leachates of decomposing pig carcasses

    PubMed Central

    Yang, Seung Hak; Lim, Joung Soo; Khan, Modabber Ahmed; Kim, Bong Soo; Choi, Dong Yoon; Lee, Eun Young; Ahn, Hee Kwon

    2015-01-01

    The leachate generated by the decomposition of animal carcass has been implicated as an environmental contaminant surrounding the burial site. High-throughput nucleotide sequencing was conducted to investigate the bacterial communities in leachates from the decomposition of pig carcasses. We acquired 51,230 reads from six different samples (1, 2, 3, 4, 6 and 14 week-old carcasses) and found that sequences representing the phylum Firmicutes predominated. The diversity of bacterial 16S rRNA gene sequences in the leachate was the highest at 6 weeks, in contrast to those at 2 and 14 weeks. The relative abundance of Firmicutes was reduced, while the proportion of Bacteroidetes and Proteobacteria increased from 3–6 weeks. The representation of phyla was restored after 14 weeks. However, the community structures between the samples taken at 1–2 and 14 weeks differed at the bacterial classification level. The trend in pH was similar to the changes seen in bacterial communities, indicating that the pH of the leachate could be related to the shift in the microbial community. The results indicate that the composition of bacterial communities in leachates of decomposing pig carcasses shifted continuously during the study period and might be influenced by the burial site. PMID:26500442

  1. Identification and characterization of rhizospheric microbial diversity by 16S ribosomal RNA gene sequencing

    PubMed Central

    Naveed, Muhammad; Mubeen, Samavia; khan, SamiUllah; Ahmed, Iftikhar; Khalid, Nauman; Suleria, Hafiz Ansar Rasul; Bano, Asghari; Mumtaz, Abdul Samad

    2014-01-01

    In the present study, samples of rhizosphere and root nodules were collected from different areas of Pakistan to isolate plant growth promoting rhizobacteria. Identification of bacterial isolates was made by 16S rRNA gene sequence analysis and taxonomical confirmation on EzTaxon Server. The identified bacterial strains were belonged to 5 genera i.e. Ensifer, Bacillus, Pseudomona, Leclercia and Rhizobium. Phylogenetic analysis inferred from 16S rRNA gene sequences showed the evolutionary relationship of bacterial strains with the respective genera. Based on phylogenetic analysis, some candidate novel species were also identified. The bacterial strains were also characterized for morphological, physiological, biochemical tests and glucose dehydrogenase (gdh) gene that involved in the phosphate solublization using cofactor pyrroloquinolone quinone (PQQ). Seven rhizoshperic and 3 root nodulating stains are positive for gdh gene. Furthermore, this study confirms a novel association between microbes and their hosts like field grown crops, leguminous and non-leguminous plants. It was concluded that a diverse group of bacterial population exist in the rhizosphere and root nodules that might be useful in evaluating the mechanisms behind plant microbial interactions and strains QAU-63 and QAU-68 have sequence similarity of 97 and 95% which might be declared as novel after further taxonomic characterization. PMID:25477935

  2. Identification and characterization of rhizospheric microbial diversity by 16S ribosomal RNA gene sequencing.

    PubMed

    Naveed, Muhammad; Mubeen, Samavia; Khan, SamiUllah; Ahmed, Iftikhar; Khalid, Nauman; Suleria, Hafiz Ansar Rasul; Bano, Asghari; Mumtaz, Abdul Samad

    2014-01-01

    In the present study, samples of rhizosphere and root nodules were collected from different areas of Pakistan to isolate plant growth promoting rhizobacteria. Identification of bacterial isolates was made by 16S rRNA gene sequence analysis and taxonomical confirmation on EzTaxon Server. The identified bacterial strains were belonged to 5 genera i.e. Ensifer, Bacillus, Pseudomona, Leclercia and Rhizobium. Phylogenetic analysis inferred from 16S rRNA gene sequences showed the evolutionary relationship of bacterial strains with the respective genera. Based on phylogenetic analysis, some candidate novel species were also identified. The bacterial strains were also characterized for morphological, physiological, biochemical tests and glucose dehydrogenase (gdh) gene that involved in the phosphate solublization using cofactor pyrroloquinolone quinone (PQQ). Seven rhizoshperic and 3 root nodulating stains are positive for gdh gene. Furthermore, this study confirms a novel association between microbes and their hosts like field grown crops, leguminous and non-leguminous plants. It was concluded that a diverse group of bacterial population exist in the rhizosphere and root nodules that might be useful in evaluating the mechanisms behind plant microbial interactions and strains QAU-63 and QAU-68 have sequence similarity of 97 and 95% which might be declared as novel after further taxonomic characterization.

  3. Sequence Diversity of VP4 and VP7 Genes of Human Rotavirus Strains in Saudi Arabia.

    PubMed

    Abdel-Moneim, Ahmed S; Al-Malky, Mater I R; Alsulaimani, Adnan A A; Abuelsaad, Abdelaziz S A; Mohamed, Imad; Ismail, Ayman K

    2015-12-01

    Group A rotavirus is responsible for inducing severe diarrhea in young children worldwide. Rotavirus vaccines are used to control the disease in many countries. In the current study, the sequences of human rotavirus G and P types in Saudi Arabia are reported and compared to different relevant published sequences. In addition, the VP4 and VP7 genes of the G1P[8] strains are compared to different antigenic epitopes of the rotavirus vaccines. Stool samples were collected from children under 2 years suffering from severe diarrhea. Screening of the rotavirus-positive samples was performed with rapid antigen detection kit. RNA was amplified from rotavirus-positive samples by reverse transcriptase polymerase chain reaction assay for both VP4 and VP7 genes. Direct sequencing of the VP4 and VP7 genes was conducted and the obtained sequences were compared to each other and to the rotavirus vaccines. Both G1P[8] G1P[4] genotypes were detected. Phylogenetic analysis revealed that the detected strains belong to G1 lineage 1 and 2, P[8] lineage 3, and to P[4] lineage 5. Multiple amino acid substitutions were detected between the Saudi RVA strains and the commonly used vaccines. The current findings emphasize the importance of the continuous surveillance of the circulating rotavirus strains, which is crucial for monitoring virus evolution and helping in predicting the protection level afforded by rotavirus vaccines.

  4. Detection and isolation of nucleic acid sequences using a bifunctional hybridization probe

    DOEpatents

    Lucas, Joe N.; Straume, Tore; Bogen, Kenneth T.

    2000-01-01

    A method for detecting and isolating a target sequence in a sample of nucleic acids is provided using a bifunctional hybridization probe capable of hybridizing to the target sequence that includes a detectable marker and a first complexing agent capable of forming a binding pair with a second complexing agent. A kit is also provided for detecting a target sequence in a sample of nucleic acids using a bifunctional hybridization probe according to this method.

  5. Amino acid sequence of horseshoe crab, Tachypleus tridentatus, striated muscle troponin C.

    PubMed

    Kobayashi, T; Kagami, O; Takagi, T; Konishi, K

    1989-05-01

    The amino acid sequence of troponin C obtained from horseshoe crab, Tachypleus tridentatus, striated muscle was determined by sequence analysis and alignments of chemically and enzymatically cleaved peptides. Troponin C is composed of 153 amino acid residues with a blocked N-terminus and contains no tryptophan or cysteine residue. The site I, one of the four Ca2+-binding sites, is considered to have lost its ability to bind Ca2+ owing to the replacements of certain amino acid residues.

  6. Expanding the diversity of unnatural cell surface sialic acids

    SciTech Connect

    Luchansky, Sarah J.; Goon, Scarlett; Bertozzi, Carolyn R.

    2003-10-30

    Novel chemical reactivity can be introduced onto cell surfaces through metabolic oligosaccharide engineering. This technique exploits the substrate promiscuity of cellular biosynthetic enzymes to deliver unnatural monosaccharides bearing bioorthogonal functional groups into cellular glycans. For example, derivatives of N-acetylmannosamine (ManNAc) are converted by the cellular biosynthetic machinery into the corresponding sialic acids and subsequently delivered to the cell surface in the form of sialoglycoconjugates. Analogs of N-acetylglucosamine (GlcNAc) and N-acetylgalactosamine (GalNAc) are also metabolized and incorporated into cell surface glycans, likely through the sialic acid and GalNAc salvage pathways, respectively. Furthermore, GlcNAc analogs can be incorporated into nucleocytoplasmic proteins in place of {beta}-O-GlcNAc residues. These pathways have been exploited to integrate unique electrophiles such as ketones and azides into the target glycoconjugate class. These functional groups can be further elaborated in a chemoselective fashion by condensation with hydrazides and by Staudinger ligation, respectively, thereby introducing detectable probes onto the cell. In conclusion, sialic acid derivatives are efficient vehicles for delivery of bulky functional groups to cell surfaces and masking of their hydroxyl groups improves their cellular uptake and utilization. Furthermore, the successful introduction of photoactivatable aryl azides into cell surface glycans opens up new avenues for studying sialic acid-binding proteins and elucidating the role of sialic acid in essential processes such as signaling and cell adhesion.

  7. Using Whole Genome Analysis to Examine Recombination across Diverse Sequence Types of Staphylococcus aureus

    PubMed Central

    Driebe, Elizabeth M.; Sahl, Jason W.; Roe, Chandler; Bowers, Jolene R.; Schupp, James M.; Gillece, John D.; Kelley, Erin; Price, Lance B.; Pearson, Talima R.; Hepp, Crystal M.; Brzoska, Pius M.; Cummings, Craig A.; Furtado, Manohar R.; Andersen, Paal S.; Stegger, Marc; Engelthaler, David M.; Keim, Paul S.

    2015-01-01

    Staphylococcus aureus is an important clinical pathogen worldwide and understanding this organism's phylogeny and, in particular, the role of recombination, is important both to understand the overall spread of virulent lineages and to characterize outbreaks. To further elucidate the phylogeny of S. aureus, 35 diverse strains were sequenced using whole genome sequencing. In addition, 29 publicly available whole genome sequences were included to create a single nucleotide polymorphism (SNP)-based phylogenetic tree encompassing 11 distinct lineages. All strains of a particular sequence type fell into the same clade with clear groupings of the major clonal complexes of CC8, CC5, CC30, CC45 and CC1. Using a novel analysis method, we plotted the homoplasy density and SNP density across the whole genome and found evidence of recombination throughout the entire chromosome, but when we examined individual clonal lineages we found very little recombination. However, when we analyzed three branches of multiple lineages, we saw intermediate and differing levels of recombination between them. These data demonstrate that in S. aureus, recombination occurs across major lineages that subsequently expand in a clonal manner. Estimated mutation rates for the CC8 and CC5 lineages were different from each other. While the CC8 lineage rate was similar to previous studies, the CC5 lineage was 100-fold greater. Fifty known virulence genes were screened in all genomes in silico to determine their distribution across major clades. Thirty-three genes were present variably across clades, most of which were not constrained by ancestry, indicating horizontal gene transfer or gene loss. PMID:26161978

  8. Characterization of fatty acid-producing wastewater microbial communities using next generation sequencing technologies

    EPA Science Inventory

    While wastewater represents a viable source of bacterial biodiesel production, very little is known on the composition of these microbial communities. We studied the taxonomic diversity and succession of microbial communities in bioreactors accumulating fatty acids using 454-pyro...

  9. Characterisation of the microbial diversity in a pig manure storage pit using small subunit rDNA sequence analysis.

    PubMed

    Snell-Castro, Raúl; Godon, Jean-Jacques; Delgenès, Jean-Philippe; Dabert, Patrick

    2005-04-01

    The microbial community structure of pig manure slurry (PMS) was determined with comparative analysis of 202 bacterial, 44 archaeal and 33 eukaryotic small subunit (SSU) rDNA partial sequences. Based on a criterion of 97% of sequence similarity, the phylogenetic analyses revealed a total of 108, eight and five phylotypes for the Bacteria, Archaea and Eukarya lineages, respectively. Only 36% of the bacterial phylotypes were closely related (>or=97% similarity) to any previously known sequence in databases. The bacterial groups most often represented in terms of phylotype and clone abundance were the Eubacterium (22% of total sequences), the Clostridium (15% of sequences), the Bacillus-Lactobacillus-Streptococcus subdivision (20% of sequences), theMycoplasma and relatives (10% of sequences) and the Flexibacter-Cytophaga-Bacteroides (20% of sequences). The global microbial community structure and phylotype diversity show a close relationship to the pig gastrointestinal tract ecosystem whereas phylotypes from the Acholeplasma-Anaeroplasma and the Clostridium purinolyticum groups appear to be better represented in manure. Archaeal diversity was dominated by three phylotypes clustering with a group of uncultured microorganisms of unknown activity and only distantly related to the Thermoplasmales and relatives. Other Archaea were methanogenic H2/CO2 utilisers. No known acetoclastic Archaea methanogen was found. Eukaryotic diversity was represented by a pluricellular nematode, two Alveolata, a Blastocystis and an Entamoebidae. Manure slurry physico-chemical characteristics were analysed. Possible inhibitory effects of acetate, sulphide and ammonia concentrations on the microbial anaerobic ecosystem are discussed. PMID:16329909

  10. Diversity of bacteria in ships ballast water as revealed by next generation DNA sequencing.

    PubMed

    Brinkmeyer, Robin

    2016-06-15

    The bacterial diversity in ballast water from five general cargo ships calling at the Port of Houston was determined with ion semiconductor DNA sequencing (Ion Torrent PGM) of PCR amplified 16S rRNA genes. Phylogenetic analysis revealed that the composition of bacteria in ballast water did not resemble that of typical marine habitats or even open ocean waters where BWEs occur. The predominant group of bacteria in ships conducting BWEs was the Roseobacter clade within the Alphaproteobacteria. In contrast, Gammaproteobacteria were predominant in the ship that did not conduct a BWE. All the ships contained human, fish, and terrestrial plant pathogens as well as bacteria indicative of fecal or activated sludge contamination. Most of the 60 pathogens had not been detected in ballast water previously. Among these were the human pathogens Corynebacterium diptheriae and several Legionella species and the fish pathogens Francisella piscicida and Piscirickettsia salmonis. PMID:27076378

  11. Neuronal subtypes and diversity revealed by single-nucleus RNA sequencing of the human brain

    PubMed Central

    Lake, Blue B.; Ai, Rizi; Kaeser, Gwendolyn E.; Salathia, Neeraj S.; Yung, Yun C.; Liu, Rui; Wildberg, Andre; Gao, Derek; Fung, Ho-Lim; Chen, Song; Vijayaraghavan, Raakhee; Wong, Julian; Chen, Allison; Sheng, Xiaoyan; Kaper, Fiona; Shen, Richard; Ronaghi, Mostafa; Fan, Jian-Bing; Wang, Wei; Chun, Jerold; Zhang, Kun

    2016-01-01

    The human brain has enormously complex cellular diversity and connectivities fundamental to our neural functions, yet difficulties in interrogating individual neurons has impeded understanding of the underlying transcriptional landscape. We developed a scalable approach to sequence and quantify RNA molecules in isolated neuronal nuclei from post-mortem brain, generating 3,227 sets of single neuron data from six distinct regions of the cerebral cortex. Using an iterative clustering and classification approach, we identified 16 neuronal subtypes that were further annotated on the basis of known markers and cortical cytoarchitecture. These data demonstrate a robust and scalable method for identifying and categorizing single nuclear transcriptomes, revealing shared genes sufficient to distinguish novel and orthologous neuronal subtypes as well as regional identity within the human brain. PMID:27339989

  12. Genetic diversity and population structure of Castanopsis eyrei based on simple sequence repeat markers.

    PubMed

    Mao, L H; Zhou, X L; Fang, Y M

    2016-01-01

    Castanopsis eyrei (Fagaceae) is one of the dominant tree species in mid-subtropical, evergreen, broad-leaved forests. We obtained 14 pairs of simple sequence repeat (SSR) primers from previous studies, which were used to analyze 90 C. eyrei individuals from three populations at different altitudes. Low heterozygosity was detected (Fis = 0.6124), and the observed heterozygosity was lower than the expected heterozygosity, possibly because of inbreeding and/or the population substructure. The genetic differentiation between populations was relatively low (Fst = 0.0645); only 7% of the total genetic variation occurred between populations. The medium-altitude population had higher genetic diversity than the low-altitude or high-altitude populations. PMID:27173332

  13. Neuronal subtypes and diversity revealed by single-nucleus RNA sequencing of the human brain.

    PubMed

    Lake, Blue B; Ai, Rizi; Kaeser, Gwendolyn E; Salathia, Neeraj S; Yung, Yun C; Liu, Rui; Wildberg, Andre; Gao, Derek; Fung, Ho-Lim; Chen, Song; Vijayaraghavan, Raakhee; Wong, Julian; Chen, Allison; Sheng, Xiaoyan; Kaper, Fiona; Shen, Richard; Ronaghi, Mostafa; Fan, Jian-Bing; Wang, Wei; Chun, Jerold; Zhang, Kun

    2016-06-24

    The human brain has enormously complex cellular diversity and connectivities fundamental to our neural functions, yet difficulties in interrogating individual neurons has impeded understanding of the underlying transcriptional landscape. We developed a scalable approach to sequence and quantify RNA molecules in isolated neuronal nuclei from a postmortem brain, generating 3227 sets of single-neuron data from six distinct regions of the cerebral cortex. Using an iterative clustering and classification approach, we identified 16 neuronal subtypes that were further annotated on the basis of known markers and cortical cytoarchitecture. These data demonstrate a robust and scalable method for identifying and categorizing single nuclear transcriptomes, revealing shared genes sufficient to distinguish previously unknown and orthologous neuronal subtypes as well as regional identity and transcriptomic heterogeneity within the human brain. PMID:27339989

  14. Diversity of bacteria in ships ballast water as revealed by next generation DNA sequencing.

    PubMed

    Brinkmeyer, Robin

    2016-06-15

    The bacterial diversity in ballast water from five general cargo ships calling at the Port of Houston was determined with ion semiconductor DNA sequencing (Ion Torrent PGM) of PCR amplified 16S rRNA genes. Phylogenetic analysis revealed that the composition of bacteria in ballast water did not resemble that of typical marine habitats or even open ocean waters where BWEs occur. The predominant group of bacteria in ships conducting BWEs was the Roseobacter clade within the Alphaproteobacteria. In contrast, Gammaproteobacteria were predominant in the ship that did not conduct a BWE. All the ships contained human, fish, and terrestrial plant pathogens as well as bacteria indicative of fecal or activated sludge contamination. Most of the 60 pathogens had not been detected in ballast water previously. Among these were the human pathogens Corynebacterium diptheriae and several Legionella species and the fish pathogens Francisella piscicida and Piscirickettsia salmonis.

  15. Diversity of lactic acid bacteria associated with traditional fermented dairy products in Mongolia.

    PubMed

    Yu, J; Wang, W H; Menghe, B L G; Jiri, M T; Wang, H M; Liu, W J; Bao, Q H; Lu, Q; Zhang, J C; Wang, F; Xu, H Y; Sun, T S; Zhang, H P

    2011-07-01

    Spontaneous milk fermentation has a long history in Mongolia, and beneficial microorganisms have been handed down from one generation to the next for use in fermented dairy products. The objective of this study was to investigate the diversity of lactic acid bacteria (LAB) communities in fermented yak, mare, goat, and cow milk products by analyzing 189 samples collected from 13 different regions in Mongolia. The LAB counts in these samples varied from 3.41 to 9.03 log cfu/mL. Fermented yak and mare milks had almost identical mean numbers of LAB, which were significantly higher than those in fermented goat milk but slightly lower than those in fermented cow milk. In total, 668 isolates were obtained from these samples using de Man, Rogosa, and Sharpe agar and M17 agar. Each isolate was considered to be presumptive LAB based on gram-positive and catalase-negative properties, and was identified at the species level by 16S rRNA gene sequencing, multiplex PCR assay, and restriction fragment length polymorphism analysis. All isolates from Mongolian dairy products were accurately identified as Enterococcus faecalis (1 strain), Enterococcus durans (3 strains), Lactobacillus brevis (3 strains), Lactobacillus buchneri (2 strains), Lactobacillus casei (16 strains), Lactobacillus delbrueckii ssp. bulgaricus (142 strains), Lactobacillus diolivorans (17 strains), Lactobacillus fermentum (42 strains), Lactobacillus helveticus (183 strains), Lactobacillus kefiri (6 strains), Lactobacillus plantarum ssp. plantarum (7 strains), Lactococcus lactis ssp. lactis (7 strains), Leuconostoc lactis (22 strains), Leuconostoc mesenteroides (21 strains), Streptococcus thermophilus (195 strains), and Weissella cibaria (1 strain). The predominant LAB were Strep. thermophilus and Lb. helveticus, which were isolated from all sampling sites. The results demonstrate that traditional fermented dairy products from different regions of Mongolia have complex compositions of LAB species. Such diversity of

  16. Seasonal diversity and dynamics of haptophytes in the Skagerrak, Norway, explored by high-throughput sequencing.

    PubMed

    Egge, Elianne Sirnaes; Johannessen, Torill Vik; Andersen, Tom; Eikrem, Wenche; Bittner, Lucie; Larsen, Aud; Sandaa, Ruth-Anne; Edvardsen, Bente

    2015-06-01

    Microalgae in the division Haptophyta play key roles in the marine ecosystem and in global biogeochemical processes. Despite their ecological importance, knowledge on seasonal dynamics, community composition and abundance at the species level is limited due to their small cell size and few morphological features visible under the light microscope. Here, we present unique data on haptophyte seasonal diversity and dynamics from two annual cycles, with the taxonomic resolution and sampling depth obtained with high-throughput sequencing. From outer Oslofjorden, S Norway, nano- and picoplanktonic samples were collected monthly for 2 years, and the haptophytes targeted by amplification of RNA/cDNA with Haptophyta-specific 18S rDNA V4 primers. We obtained 156 operational taxonomic units (OTUs), from c. 400.000 454 pyrosequencing reads, after rigorous bioinformatic filtering and clustering at 99.5%. Most OTUs represented uncultured and/or not yet 18S rDNA-sequenced species. Haptophyte OTU richness and community composition exhibited high temporal variation and significant yearly periodicity. Richness was highest in September-October (autumn) and lowest in April-May (spring). Some taxa were detected all year, such as Chrysochromulina simplex, Emiliania huxleyi and Phaeocystis cordata, whereas most calcifying coccolithophores only appeared from summer to early winter. We also revealed the seasonal dynamics of OTUs representing putative novel classes (clades HAP-3-5) or orders (clades D, E, F). Season, light and temperature accounted for 29% of the variation in OTU composition. Residual variation may be related to biotic factors, such as competition and viral infection. This study provides new, in-depth knowledge on seasonal diversity and dynamics of haptophytes in North Atlantic coastal waters. PMID:25893259

  17. Whole mitochondrial genome sequencing of domestic horses reveals incorporation of extensive wild horse diversity during domestication

    PubMed Central

    2011-01-01

    Background DNA target enrichment by micro-array capture combined with high throughput sequencing technologies provides the possibility to obtain large amounts of sequence data (e.g. whole mitochondrial DNA genomes) from multiple individuals at relatively low costs. Previously, whole mitochondrial genome data for domestic horses (Equus caballus) were limited to only a few specimens and only short parts of the mtDNA genome (especially the hypervariable region) were investigated for larger sample sets. Results In this study we investigated whole mitochondrial genomes of 59 domestic horses from 44 breeds and a single Przewalski horse (Equus przewalski) using a recently described multiplex micro-array capture approach. We found 473 variable positions within the domestic horses, 292 of which are parsimony-informative, providing a well resolved phylogenetic tree. Our divergence time estimate suggests that the mitochondrial genomes of modern horse breeds shared a common ancestor around 93,000 years ago and no later than 38,000 years ago. A Bayesian skyline plot (BSP) reveals a significant population expansion beginning 6,000-8,000 years ago with an ongoing exponential growth until the present, similar to other domestic animal species. Our data further suggest that a large sample of wild horse diversity was incorporated into the domestic population; specifically, at least 46 of the mtDNA lineages observed in domestic horses (73%) already existed before the beginning of domestication about 5,000 years ago. Conclusions Our study provides a window into the maternal origins of extant domestic horses and confirms that modern domestic breeds present a wide sample of the mtDNA diversity found in ancestral, now extinct, wild horse populations. The data obtained allow us to detect a population expansion event coinciding with the beginning of domestication and to estimate both the minimum number of female horses incorporated into the domestic gene pool and the time depth of the

  18. Seasonal diversity and dynamics of haptophytes in the Skagerrak, Norway, explored by high-throughput sequencing.

    PubMed

    Egge, Elianne Sirnaes; Johannessen, Torill Vik; Andersen, Tom; Eikrem, Wenche; Bittner, Lucie; Larsen, Aud; Sandaa, Ruth-Anne; Edvardsen, Bente

    2015-06-01

    Microalgae in the division Haptophyta play key roles in the marine ecosystem and in global biogeochemical processes. Despite their ecological importance, knowledge on seasonal dynamics, community composition and abundance at the species level is limited due to their small cell size and few morphological features visible under the light microscope. Here, we present unique data on haptophyte seasonal diversity and dynamics from two annual cycles, with the taxonomic resolution and sampling depth obtained with high-throughput sequencing. From outer Oslofjorden, S Norway, nano- and picoplanktonic samples were collected monthly for 2 years, and the haptophytes targeted by amplification of RNA/cDNA with Haptophyta-specific 18S rDNA V4 primers. We obtained 156 operational taxonomic units (OTUs), from c. 400.000 454 pyrosequencing reads, after rigorous bioinformatic filtering and clustering at 99.5%. Most OTUs represented uncultured and/or not yet 18S rDNA-sequenced species. Haptophyte OTU richness and community composition exhibited high temporal variation and significant yearly periodicity. Richness was highest in September-October (autumn) and lowest in April-May (spring). Some taxa were detected all year, such as Chrysochromulina simplex, Emiliania huxleyi and Phaeocystis cordata, whereas most calcifying coccolithophores only appeared from summer to early winter. We also revealed the seasonal dynamics of OTUs representing putative novel classes (clades HAP-3-5) or orders (clades D, E, F). Season, light and temperature accounted for 29% of the variation in OTU composition. Residual variation may be related to biotic factors, such as competition and viral infection. This study provides new, in-depth knowledge on seasonal diversity and dynamics of haptophytes in North Atlantic coastal waters.

  19. Dietary supplementation of usnic acid, an antimicrobial compound in lichens, does not affect rumen bacterial diversity or density in reindeer.

    PubMed

    Glad, Trine; Barboza, Perry; Mackie, Roderick I; Wright, André-Denis G; Brusetti, Lorenzo; Mathiesen, Svein D; Sundset, Monica A

    2014-06-01

    Reindeer (Rangifer tarandus tarandus) may include large proportions of lichens in their winter diet. These dietary lichens are rich in phenolic secondary compounds, the most well-known being the antimicrobial usnic acid. Previous studies have shown that reindeer host rumen bacteria resistant to usnic acid and that usnic acid is quickly detoxified in their rumen. In the present study, reindeer (n = 3) were sampled before, during, and after usnic acid supplementation to determine the effect on their rumen microbial ecology. Ad libitum intake of usnic acid averaged up to 278 mg/kg body mass. Population densities of rumen bacteria and methanogenic archaea determined by real-time PCR, ranged from 1.36 × 10(9) to 11.8 × 10(9) and 9.0 × 10(5) to 1.35 × 10(8) cells/g wet weight, respectively, and the two populations did not change significantly during usnic acid supplementation (repeated measures ANOVA) or vary significantly between the rumen liquid and particle fraction (paired t test). Rumen bacterial community structure determined by denaturing gradient gel electrophoresis did not change in response to intake of usnic acid. Firmicutes (38.7 %) and Bacteriodetes (27.4 %) were prevalent among the 16S rRNA gene sequences (n = 62) from the DGGE gels, but representatives of the phyla Verrucomicrobia (14.5 %) and Proteobacteria (1.6 %) were also detected. Rapid detoxification of the usnic acid or resistance to usnic acid may explain why the diversity of the dominant bacterial populations and the bacterial density in the reindeer rumen does not change during usnic acid supplementation.

  20. Molecular Diversity Assessment Using Sequence Related Amplified Polymorphism (SRAP) Markers in Vicia faba L.

    PubMed Central

    Alghamdi, Salem S.; Al-Faifi, Sulieman A.; Migdadi, Hussein M.; Khan, Muhammad Altaf; El-Harty, Ehab H.; Ammar, Megahed H.

    2012-01-01

    Sequence-related amplified polymorphism (SRAP) markers were used to assess the genetic diversity and relationship among 58 faba bean (Vicia faba L.) genotypes. Fourteen SRAP primer combinations amplified a total of 1036 differently sized well-resolved peaks (fragments), of which all were polymorphic with a 0.96 PIC value and discriminated all of the 58 faba bean genotypes. An average pairwise similarity of 21% was revealed among the genotypes ranging from 2% to 65%. At a similarity of 28%, UPGMA clustered the genotypes into three main groups comprising 78% of the genotypes. The local landraces and most of the Egyptian genotypes in addition to the Sudan genotypes were grouped in the first main cluster. The advanced breeding lines were scattered in the second and third main clusters with breeding lines from the ICARDA and genotypes introduced from Egypt. At a similarity of 47%, all the genotypes formed separated clusters with the exceptions of Hassawi 1 and Hassawi 2. Group analysis of the genotypes according to their geographic origin and type showed that the landraces were grouped according to their origin, while others were grouped according to their seed type. To our knowledge, this is the first application of SRAP markers for the assessment of genetic diversity in faba bean. Such information will be useful to determine optimal breeding strategies to allow continued progress in faba bean breeding. PMID:23211669

  1. AFM studies in diverse ionic environments of nucleosomes reconstituted on the 601 positioning sequence.

    PubMed

    Nazarov, Igor; Chekliarova, Iana; Rychkov, Georgy; Ilatovskiy, Andrey V; Crane-Robinson, Colyn; Tomilin, Alexey

    2016-02-01

    Atomic force microscopy (AFM) was used to study mononucleosomes reconstituted from a DNA duplex of 353 bp containing the strong 601 octamer positioning sequence, together with recombinant human core histone octamers. Three parameters were measured: 1) the length of DNA wrapped around the core histones; 2) the number of superhelical turns, calculated from the total angle through which the DNA is bent, and 3) the volume of the DNA-histone core. This approach allowed us to define in detail the structural diversity of nucleosomes caused by disassembly of the octasome to form subnucleosomal structures containing hexasomes, tetrasomes and disomes. At low ionic strength (TE buffer) and in the presence of physiological concentrations of monovalent cations, the majority of the particles were subnucleosomal, but physiological concentrations of bivalent cations resulted in about half of the nucleosomes being canonical octasomes in which the exiting DNA duplexes cross orthogonally. The dominance of this last species explains why bivalent but not monovalent cations can induce the initial step towards compaction and convergence of neighboring nucleosomes in nucleosomal arrays to form the chromatin fiber in the absence of linker histone. The observed nucleosome structural diversity may reflect the functional plasticity of nucleosomes under physiological conditions.

  2. Genetic diversity among Puccinia melanocephala isolates from Brazil assessed using simple sequence repeat markers.

    PubMed

    Peixoto-Junior, R F; Creste, S; Landell, M G A; Nunes, D S; Sanguino, A; Campos, M F; Vencovsky, R; Tambarussi, E V; Figueira, A

    2014-09-26

    Brown rust (causal agent Puccinia melanocephala) is an important sugarcane disease that is responsible for large losses in yield worldwide. Despite its importance, little is known regarding the genetic diversity of this pathogen in the main Brazilian sugarcane cultivation areas. In this study, we characterized the genetic diversity of 34 P. melanocephala isolates from 4 Brazilian states using loci identified from an enriched simple sequence repeat (SSR) library. The aggressiveness of 3 isolates from major sugarcane cultivation areas was evaluated by inoculating an intermediately resistant and a susceptible cultivar. From the enriched library, 16 SSR-specific primers were developed, which produced scorable alleles. Of these, 4 loci were polymorphic and 12 were monomorphic for all isolates evaluated. The molecular characterization of the 34 isolates of P. melanocephala conducted using 16 SSR loci revealed the existence of low genetic variability among the isolates. The average estimated genetic distance was 0.12. Phenetic analysis based on Nei's genetic distance clustered the isolates into 2 major groups. Groups I and II included 18 and 14 isolates, respectively, and both groups contained isolates from all 4 geographic regions studied. Two isolates did not cluster with these groups. It was not possible to obtain clusters according to location or state of origin. Analysis of disease severity data revealed that the isolates did not show significant differences in aggressiveness between regions.

  3. Genetic diversity of Sogatella furcifera (Hemiptera: Delphacidae) in China detected by inter-simple sequence repeats.

    PubMed

    Xie, Jia-Nan; Guo, Jian-Jun; Jin, Dao-Chao; Wang, Xue-Jian

    2014-01-01

    The white-backed planthopper (WBPH), Sogatella furcifera (Horváth) is a serious pest causing grievous damage to rice plants. In the present study, inter-simple sequence repeats were employed to investigate the genetic diversity of 108 samples from 27 WBPH geographic populations in China. Ten primers were screened out with 147 amplified bands, average percentage of polymorphic bands, polymorphic information content, and marker index were 78.9, 0.456, and 6.753% respectively. The results indicated that genetic diversity was different among populations, but genetic variation was as low as 0.2% among the populations and as high as 99.8% within the same geographic population. Among the examined WBPH populations, genetic distances were weakly correlated to geographic distance, and there was no correlation between genetic identity and elevation. Cluster analysis showed that the 27 WBPH populations studied could be lumped into four clusters, with which the results of principal coordinate analysis (were almost consistent. In conclusion, the molecular genetic data demonstrated that the region consisting of Yunnan, Guizhou, Guangdong, and Guangxi was the first landing area of WBPH in its migrating process from overwintering sites to China.

  4. Molecular identification of the microbial diversity in two sequencing batch reactors with activated sludge.

    PubMed

    Denecke, Martin; Eilmus, Sascha; Röder, Nadine; Roesch, Christopher; Bothe, Hermann

    2012-02-01

    The diversity of the microbial community was identified in two lab-scale, ideally mixed sequencing batch reactors which were run for 115 days. One of the reactors was intermittently aerated (2 h aerobically/2 h anaerobically) whereas the other was consistently aerated. The amount of biomass as dry matter, the degradation of organic carbon determined by chemical oxygen demand and nitrogen-degradation activity were followed over the operation of the two reactors and did not show significant differences between the two approaches at the end of the experiment. At this point, the composition of the microbial community was determined by a terminal restriction fragment length polymorphism approach using multiple restriction enzymes by which organisms were retrieved to the lowest taxonomic level. The microbial composition was then significantly different. The species richness was at least five-fold higher in the intermittently aerated reactor than in the permanently kept aerobic approach which is in line with the observation that ecosystem disturbances result in higher diversity. PMID:21786107

  5. Genetic diversity analysis of okra (Abelmoschus esculentus L.) by inter-simple sequence repeat (ISSR) markers.

    PubMed

    Yuan, C Y; Zhang, C; Wang, P; Hu, S; Chang, H P; Xiao, W J; Lu, X T; Jiang, S B; Ye, J Z; Guo, X H

    2014-04-25

    Okra (Abelmoschus esculentus L.) is not only a nutrient-rich vegetable but also an important medicinal herb. Inter-simple sequence repeat (ISSR) markers were employed to investigate the genetic diversity and differentiation of 24 okra genotypes. In this study, the PCR products were separated by electrophoresis on 8% nondenaturing polyacrylamide gel and visualized by silver staining. The 22 ISSR primers produced 289 amplified DNA fragments, and 145 (50%) fragments were polymorphic. The 289 markers were used to construct the dendrogram based on the unweighted pair-group method with arithmetic average (UPGMA) cluster analysis. The dendrogram indicated that 24 okras were clustered into 4 geographically distinct groups. The average polymorphism information content (PIC) was 0.531929, which showed that the majority of primers were informative. The high values of allele frequency, genetic diversity, and heterozygosity showed that primer-sample combinations produced measurable fragments. The mean distances ranged from 0.045455 to 0.454545. The dendrogram indicated that the ISSR markers succeeded in distinguishing most of the 24 varieties in relation to their genetic backgrounds and geographical origins.

  6. AFM studies in diverse ionic environments of nucleosomes reconstituted on the 601 positioning sequence.

    PubMed

    Nazarov, Igor; Chekliarova, Iana; Rychkov, Georgy; Ilatovskiy, Andrey V; Crane-Robinson, Colyn; Tomilin, Alexey

    2016-02-01

    Atomic force microscopy (AFM) was used to study mononucleosomes reconstituted from a DNA duplex of 353 bp containing the strong 601 octamer positioning sequence, together with recombinant human core histone octamers. Three parameters were measured: 1) the length of DNA wrapped around the core histones; 2) the number of superhelical turns, calculated from the total angle through which the DNA is bent, and 3) the volume of the DNA-histone core. This approach allowed us to define in detail the structural diversity of nucleosomes caused by disassembly of the octasome to form subnucleosomal structures containing hexasomes, tetrasomes and disomes. At low ionic strength (TE buffer) and in the presence of physiological concentrations of monovalent cations, the majority of the particles were subnucleosomal, but physiological concentrations of bivalent cations resulted in about half of the nucleosomes being canonical octasomes in which the exiting DNA duplexes cross orthogonally. The dominance of this last species explains why bivalent but not monovalent cations can induce the initial step towards compaction and convergence of neighboring nucleosomes in nucleosomal arrays to form the chromatin fiber in the absence of linker histone. The observed nucleosome structural diversity may reflect the functional plasticity of nucleosomes under physiological conditions. PMID:26586109

  7. Genetic diversity analysis of okra (Abelmoschus esculentus L.) by inter-simple sequence repeat (ISSR) markers.

    PubMed

    Yuan, C Y; Zhang, C; Wang, P; Hu, S; Chang, H P; Xiao, W J; Lu, X T; Jiang, S B; Ye, J Z; Guo, X H

    2014-01-01

    Okra (Abelmoschus esculentus L.) is not only a nutrient-rich vegetable but also an important medicinal herb. Inter-simple sequence repeat (ISSR) markers were employed to investigate the genetic diversity and differentiation of 24 okra genotypes. In this study, the PCR products were separated by electrophoresis on 8% nondenaturing polyacrylamide gel and visualized by silver staining. The 22 ISSR primers produced 289 amplified DNA fragments, and 145 (50%) fragments were polymorphic. The 289 markers were used to construct the dendrogram based on the unweighted pair-group method with arithmetic average (UPGMA) cluster analysis. The dendrogram indicated that 24 okras were clustered into 4 geographically distinct groups. The average polymorphism information content (PIC) was 0.531929, which showed that the majority of primers were informative. The high values of allele frequency, genetic diversity, and heterozygosity showed that primer-sample combinations produced measurable fragments. The mean distances ranged from 0.045455 to 0.454545. The dendrogram indicated that the ISSR markers succeeded in distinguishing most of the 24 varieties in relation to their genetic backgrounds and geographical origins. PMID:24841648

  8. Analysis of Plasmodium falciparum diversity in natural infections by deep sequencing.

    PubMed

    Manske, Magnus; Miotto, Olivo; Campino, Susana; Auburn, Sarah; Almagro-Garcia, Jacob; Maslen, Gareth; O'Brien, Jack; Djimde, Abdoulaye; Doumbo, Ogobara; Zongo, Issaka; Ouedraogo, Jean-Bosco; Michon, Pascal; Mueller, Ivo; Siba, Peter; Nzila, Alexis; Borrmann, Steffen; Kiara, Steven M; Marsh, Kevin; Jiang, Hongying; Su, Xin-Zhuan; Amaratunga, Chanaki; Fairhurst, Rick; Socheat, Duong; Nosten, Francois; Imwong, Mallika; White, Nicholas J; Sanders, Mandy; Anastasi, Elisa; Alcock, Dan; Drury, Eleanor; Oyola, Samuel; Quail, Michael A; Turner, Daniel J; Ruano-Rubio, Valentin; Jyothi, Dushyanth; Amenga-Etego, Lucas; Hubbart, Christina; Jeffreys, Anna; Rowlands, Kate; Sutherland, Colin; Roper, Cally; Mangano, Valentina; Modiano, David; Tan, John C; Ferdig, Michael T; Amambua-Ngwa, Alfred; Conway, David J; Takala-Harrison, Shannon; Plowe, Christopher V; Rayner, Julian C; Rockett, Kirk A; Clark, Taane G; Newbold, Chris I; Berriman, Matthew; MacInnis, Bronwyn; Kwiatkowski, Dominic P

    2012-07-19

    Malaria elimination strategies require surveillance of the parasite population for genetic changes that demand a public health response, such as new forms of drug resistance. Here we describe methods for the large-scale analysis of genetic variation in Plasmodium falciparum by deep sequencing of parasite DNA obtained from the blood of patients with malaria, either directly or after short-term culture. Analysis of 86,158 exonic single nucleotide polymorphisms that passed genotyping quality control in 227 samples from Africa, Asia and Oceania provides genome-wide estimates of allele frequency distribution, population structure and linkage disequilibrium. By comparing the genetic diversity of individual infections with that of the local parasite population, we derive a metric of within-host diversity that is related to the level of inbreeding in the population. An open-access web application has been established for the exploration of regional differences in allele frequency and of highly differentiated loci in the P. falciparum genome.

  9. Genetic diversity of wild soybean populations in Dongying, China, by simple sequence repeat analysis.

    PubMed

    Wang, Y H; Zhang, X J; Fan, S J

    2015-01-01

    Annual wild soybean (Glycine soja Sieb. et Zucc.), the ancestor of cultivated soybean (G. max), is believed to be a potential gene source for further improvement of soybean to cope with environmental stress. In this study, 10 simple sequence repeat (SSR) markers were used to evaluate the genetic diversity and population genetic structure in five wild soybean populations using 195 accessions collected from Dongying, China. Ten SSR markers yielded 90 bands, with an average of nine bands per marker. The percentage of polymorphic loci (P) was 97.78%, the distribution of expected heterozygosity (HE) was 0.1994-0.4460 with an average of 0.3262, and the distribution from Shannon's information index (I) was 0.3595-0.6506 with an average of 0.5386. The results showed that wild soybean had a high degree of genetic diversity at the species level. Nei's differentiation coefficient (FST) was 0.1533, and gene flow (Nm) was 1.3805, which indicated that genetic variation mainly existed within populations and that there was a certain level of gene exchange between populations. Some genetic differentiation occurred among populations, although this was not significant. Cluster analysis indicated that there was no significant correlation between the genetic structure of wild soybean populations and their geographic distribution, and the clustering results may be relatively consistent with the habitats of the accessions. In the present study, the genetic diversity of wild soybeans showed a broad genetic base and enables suggestions for the conservation of this plant to be made. PMID:26436402

  10. Trichomonas vaginalis acidic phospholipase A2: isolation and partial amino acid sequence.

    PubMed

    Escobedo-Guajardo, Brenda L; González-Salazar, Francisco; Palacios-Corona, Rebeca; Torres de la Cruz, Víctor M; Morales-Vallarta, Mario; Mata-Cárdenas, Benito D; Garza-González, Jesús N; Rivera-Silva, Gerardo; Vargas-Villarreal, Javier

    2013-12-01

    Sexually transmitted diseases are a major cause of acute disease worldwide, and trichomoniasis is the most common and curable disease, generating more than 170 million cases annually worldwide. Trichomonas vaginalis is the causal agent of trichomoniasis and has the ability to destroy in vitro cell monolayers of the vaginal mucosa, where the phospholipases A2 (PLA2) have been reported as potential virulence factors. These enzymes have been partially characterized from the subcellular fraction S30 of pathogenic T. vaginalis strains. The main objective of this study was to purify a phospholipase A2 from T. vaginalis, make a partial characterization, obtain a partial amino acid sequence, and determine its enzymatic participation as hemolytic factor causing lysis of erythrocytes. Trichomonas S30, RF30 and UFF30 sub-fractions from GT-15 strain have the capacity to hydrolyze [2-(14)C-PA]-PC at pH 6.0. Proteins from the UFF30 sub-fraction were separated by affinity chromatography into two eluted fractions with detectable PLA A2 activity. The EDTA-eluted fraction was analyzed by HPLC using on-line HPLC-tandem mass spectrometry and two protein peaks were observed at 8.2 and 13 kDa. Peptide sequences were identified from the proteins present in the eluted EDTA UFF30 fraction; bioinformatic analysis using Protein Link Global Server charged with T. vaginalis protein database suggests that eluted peptides correspond a putative ubiquitin protein in the 8.2 kDa fraction and a phospholipase preserved in the 13 kDa fraction. The EDTA-eluted fraction hydrolyzed [2-(14)C-PA]-PC lyses erythrocytes from Sprague-Dawley in a time and dose-dependent manner. The acidic hemolytic activity decreased by 84% with the addition of 100 μM of Rosenthal's inhibitor. PMID:24338313

  11. Trichomonas vaginalis acidic phospholipase A2: isolation and partial amino acid sequence.

    PubMed

    Escobedo-Guajardo, Brenda L; González-Salazar, Francisco; Palacios-Corona, Rebeca; Torres de la Cruz, Víctor M; Morales-Vallarta, Mario; Mata-Cárdenas, Benito D; Garza-González, Jesús N; Rivera-Silva, Gerardo; Vargas-Villarreal, Javier

    2013-12-01

    Sexually transmitted diseases are a major cause of acute disease worldwide, and trichomoniasis is the most common and curable disease, generating more than 170 million cases annually worldwide. Trichomonas vaginalis is the causal agent of trichomoniasis and has the ability to destroy in vitro cell monolayers of the vaginal mucosa, where the phospholipases A2 (PLA2) have been reported as potential virulence factors. These enzymes have been partially characterized from the subcellular fraction S30 of pathogenic T. vaginalis strains. The main objective of this study was to purify a phospholipase A2 from T. vaginalis, make a partial characterization, obtain a partial amino acid sequence, and determine its enzymatic participation as hemolytic factor causing lysis of erythrocytes. Trichomonas S30, RF30 and UFF30 sub-fractions from GT-15 strain have the capacity to hydrolyze [2-(14)C-PA]-PC at pH 6.0. Proteins from the UFF30 sub-fraction were separated by affinity chromatography into two eluted fractions with detectable PLA A2 activity. The EDTA-eluted fraction was analyzed by HPLC using on-line HPLC-tandem mass spectrometry and two protein peaks were observed at 8.2 and 13 kDa. Peptide sequences were identified from the proteins present in the eluted EDTA UFF30 fraction; bioinformatic analysis using Protein Link Global Server charged with T. vaginalis protein database suggests that eluted peptides correspond a putative ubiquitin protein in the 8.2 kDa fraction and a phospholipase preserved in the 13 kDa fraction. The EDTA-eluted fraction hydrolyzed [2-(14)C-PA]-PC lyses erythrocytes from Sprague-Dawley in a time and dose-dependent manner. The acidic hemolytic activity decreased by 84% with the addition of 100 μM of Rosenthal's inhibitor.

  12. Sequence diversity among badnavirus isolates infecting black pepper and related species in India.

    PubMed

    Bhat, A I; Sasi, Shina; Revathy, K A; Deeshma, K P; Saji, K V

    2014-01-01

    The badnavirus, piper yellow mottle virus (PYMoV) is known to infect black pepper (Piper nigrum), betelvine (P. betle) and Indian long pepper (P. longum) in India and other parts of the world. Occurrence of PYMoV or other badnaviruses in other species of Piper and its variability is not reported so far. We have analysed sequence variability in the conserved putative reverse transcriptase (RT)/ribonuclease H (RNase H) coding region of the virus using specific badnavirus primers from 13 virus isolates of black pepper collected from different cultivars and regions and one isolate each from 23 other species of Piper. Of these, four species failed to produce expected amplicon while amplicon from four other species showed more similarities to plant sequences than to badnaviruses. Of the remaining, isolates from black pepper, P. argyrophyllum, P. attenuatum, P. barberi, P. betle, P. colubrinum, P. galeatum, P. longum, P. ornatum, P. sarmentosum and P. trichostachyon showed an identity of >85 % at the nucleotide and >90 % at the amino acid level with PYMoV indicating that they are isolates of PYMoV. On the other hand high sequence variability of 21-43 % at nucleotide and 17-46 % at amino acid level compared to PYMoV was found among isolates infecting P. bababudani, P. chaba, P. peepuloides, P. mullesua and P. thomsonii suggesting the presence of new badnaviruses. Phylogenetic analyses showed close clustering of all PYMoV isolates that were well separated from other known badnaviruses. This is the first report of occurrence of PYMoV in eight Piper spp and likely occurrence of four new species in five Piper spp. PMID:25674613

  13. A nucleic acid sequence-based amplification system for detection of Listeria monocytogenes hlyA sequences.

    PubMed Central

    Blais, B W; Turner, G; Sooknanan, R; Malek, L T

    1997-01-01

    A nucleic acid sequence-based amplification system primarily targeting mRNA from the Listeria monocytogenes hlyA gene was developed. This system enabled the detection of low numbers (< 10 CFU/g) of L. monocytogenes cells inoculated into a variety of dairy and egg products after 48 h of enrichment in modified listeria enrichment broth. PMID:8979357

  14. Deep sequencing reveals exceptional diversity and modes of transmission for bacterial sponge symbionts

    PubMed Central

    Webster, Nicole S; Taylor, Michael W; Behnam, Faris; Lücker, Sebastian; Rattei, Thomas; Whalan, Stephen; Horn, Matthias; Wagner, Michael

    2010-01-01

    Marine sponges contain complex bacterial communities of considerable ecological and biotechnological importance, with many of these organisms postulated to be specific to sponge hosts. Testing this hypothesis in light of the recent discovery of the rare microbial biosphere, we investigated three Australian sponges by massively parallel 16S rRNA gene tag pyrosequencing. Here we show bacterial diversity that is unparalleled in an invertebrate host, with more than 250 000 sponge-derived sequence tags being assigned to 23 bacterial phyla and revealing up to 2996 operational taxonomic units (95% sequence similarity) per sponge species. Of the 33 previously described ‘sponge-specific’ clusters that were detected in this study, 48% were found exclusively in adults and larvae – implying vertical transmission of these groups. The remaining taxa, including ‘Poribacteria’, were also found at very low abundance among the 135 000 tags retrieved from surrounding seawater. Thus, members of the rare seawater biosphere may serve as seed organisms for widely occurring symbiont populations in sponges and their host association might have evolved much more recently than previously thought. PMID:21966903

  15. Oceanic 18S rDNA sequences from picoplankton reveal unsuspected eukaryotic diversity.

    PubMed

    Moon-van der Staay, S Y; De Wachter, R; Vaulot, D

    2001-02-01

    Picoplankton--cells with a diameter of less than 3 microm--are the dominant contributors to both primary production and biomass in open oceanic regions. However, compared with the prokaryotes, the eukaryotic component of picoplankton is still poorly known. Recent discoveries of new eukaryotic algal taxa based on picoplankton cultures suggest the existence of many undiscovered taxa. Conventional approaches based on phenotypic criteria have limitations in depicting picoplankton composition due to their tiny size and lack of distinctive taxonomic characters. Here we analyse, using an approach that has been very successful for prokaryotes but has so far seldom been applied to eukaryotes, 35 full sequences of the small-subunit (18S) ribosomal RNA gene derived from a picoplanktonic assemblage collected at a depth of 75 m in the equatorial Pacific Ocean, and show that there is a high diversity of picoeukaryotes. Most of the sequences were previously unknown but could still be assigned to important marine phyla including prasinophytes, haptophytes, dinoflagellates, stramenopiles, choanoflagellates and acantharians. We also found a novel lineage, closely related to dinoflagellates and not previously described.

  16. Oceanic 18S rDNA sequences from picoplankton reveal unsuspected eukaryotic diversity

    NASA Astrophysics Data System (ADS)

    Moon-van der Staay, Seung Yeo; De WachterRDanielVaulot, RupertDe WachterR.Daniel

    2001-02-01

    Picoplankton-cells with a diameter of less than 3µm-are the dominant contributors to both primary production and biomass in open oceanic regions. However, compared with the prokaryotes, the eukaryotic component of picoplankton is still poorly known. Recent discoveries of new eukaryotic algal taxa based on picoplankton cultures suggest the existence of many undiscovered taxa. Conventional approaches based on phenotypic criteria have limitations in depicting picoplankton composition due to their tiny size and lack of distinctive taxonomic characters. Here we analyse, using an approach that has been very successful for prokaryotes but has so far seldom been applied to eukaryotes, 35 full sequences of the small-subunit (18S) ribosomal RNA gene derived from a picoplanktonic assemblage collected at a depth of 75m in the equatorial Pacific Ocean, and show that there is a high diversity of picoeukaryotes. Most of the sequences were previously unknown but could still be assigned to important marine phyla including prasinophytes, haptophytes, dinoflagellates, stramenopiles, choanoflagellates and acantharians. We also found a novel lineage, closely related to dinoflagellates and not previously described.

  17. Differential distribution and occurrence of simple sequence repeats in diverse geminivirus genomes.

    PubMed

    George, B; Mashhood Alam, Ch; Jain, S K; Sharfuddin, Ch; Chakraborty, S

    2012-12-01

    Microsatellites are tandem repeat sequences with repeat unit of one to six base pairs. Although, microsatellites have been studied in eukaryotes as well as prokaryotes, information on their occurrence on virus genomes is limited. We examined microsatellite distribution in 263 complete geminivirus genomes. Results indicated microsatellites to be an important component of geminiviral genomes. For each geminiviral genome, mono- and dinucleotide repeats were found to be highly predominant. Occurrence of microsatellites within geminiviral genome is significantly lesser than organisms with higher genome sizes and their number decreased with an increase in the length of repeat unit. Repeats of AT/TA, GT/TG, CT/TC, CTT/TTC, and GAA/AAG occurred with high frequency, whereas CG/GC, CGA/AGC, AAC/CAA, and GCT/TCG repeats had rare incidence. Interesting observation related to differential distribution of simple sequence repeats in genomic components of begomoviruses has been noted. We discussed the possible reasons for the observed divergence. To our knowledge, this is the first analysis of microsatellites occurring in any ssDNA viral genome for such purposes and represents a general approach for analysis of other viral genomes. The presence of microsatellites in geminiviral genomes may be used to obtain information regarding viral genetic diversity, evolution, and strain (isolate) identification.

  18. Genetic diversity and relationship of Mauremys mutica and M. annamensis assessed by DNA barcoding sequences.

    PubMed

    Zhao, Jian; Li, Wei; Wen, Ping; Zhang, Dandan; Zhu, Xinping

    2016-09-01

    The mitochondrial DNA cytochrome c oxidase subunit I gene (COI) has been used as an efficient barcoding tool for species identification of animals. In this study, the barcoding sequences were used to assess the genetic diversity and relationship of Mauremy mutica and M. annamensis. Four currently recognized groups of M. mutica were classified into two groups in this study, with 6% intergroup distances, the S group and the N group, consistent to the calling of "southern turtle" and "northern turtle" in folk of China. The north population and Taiwan population formed the N group, and further, the Taiwan population was differentiated as a monophyly originated from the north population, consistent to the calling of "big green head" for the Taiwan population and "small green head" for the north population. The Vietnam, Hainan population, and M. annamensis formed the S group, and the barcoding sequences could not distinguish them from each other. Based on the molecular data and phenotypes of existing hybrids, hybrid origin of M. annamensis may be another possibility. PMID:26260182

  19. Single-molecule sequencing to track plasmid diversity of hospital-associated carbapenemase-producing Enterobacteriaceae.

    PubMed

    Conlan, Sean; Thomas, Pamela J; Deming, Clayton; Park, Morgan; Lau, Anna F; Dekker, John P; Snitkin, Evan S; Clark, Tyson A; Luong, Khai; Song, Yi; Tsai, Yu-Chih; Boitano, Matthew; Dayal, Jyoti; Brooks, Shelise Y; Schmidt, Brian; Young, Alice C; Thomas, James W; Bouffard, Gerard G; Blakesley, Robert W; Mullikin, James C; Korlach, Jonas; Henderson, David K; Frank, Karen M; Palmore, Tara N; Segre, Julia A

    2014-09-17

    Public health officials have raised concerns that plasmid transfer between Enterobacteriaceae species may spread resistance to carbapenems, an antibiotic class of last resort, thereby rendering common health care-associated infections nearly impossible to treat. To determine the diversity of carbapenemase-encoding plasmids and assess their mobility among bacterial species, we performed comprehensive surveillance and genomic sequencing of carbapenem-resistant Enterobacteriaceae in the National Institutes of Health (NIH) Clinical Center patient population and hospital environment. We isolated a repertoire of carbapenemase-encoding Enterobacteriaceae, including multiple strains of Klebsiella pneumoniae, Klebsiella oxytoca, Escherichia coli, Enterobacter cloacae, Citrobacter freundii, and Pantoea species. Long-read genome sequencing with full end-to-end assembly revealed that these organisms carry the carbapenem resistance genes on a wide array of plasmids. K. pneumoniae and E. cloacae isolated simultaneously from a single patient harbored two different carbapenemase-encoding plasmids, indicating that plasmid transfer between organisms was unlikely within this patient. We did, however, find evidence of horizontal transfer of carbapenemase-encoding plasmids between K. pneumoniae, E. cloacae, and C. freundii in the hospital environment. Our data, including full plasmid identification, challenge assumptions about horizontal gene transfer events within patients and identify possible connections between patients and the hospital environment. In addition, we identified a new carbapenemase-encoding plasmid of potentially high clinical impact carried by K. pneumoniae, E. coli, E. cloacae, and Pantoea species, in unrelated patients and in the hospital environment. PMID:25232178

  20. Chromosomal Organization and Sequence Diversity of Genes Encoding Lachrymatory Factor Synthase in Allium cepa L.

    PubMed

    Masamura, Noriya; McCallum, John; Khrustaleva, Ludmila; Kenel, Fernand; Pither-Joyce, Meegham; Shono, Jinji; Suzuki, Go; Mukai, Yasuhiko; Yamauchi, Naoki; Shigyo, Masayoshi

    2012-06-01

    Lachrymatory factor synthase (LFS) catalyzes the formation of lachrymatory factor, one of the most distinctive traits of bulb onion (Allium cepa L.). Therefore, we used LFS as a model for a functional gene in a huge genome, and we examined the chromosomal organization of LFS in A. cepa by multiple approaches. The first-level analysis completed the chromosomal assignment of LFS gene to chromosome 5 of A. cepa via the use of a complete set of A. fistulosum-shallot (A. cepa L. Aggregatum group) monosomic addition lines. Subsequent use of an F(2) mapping population from the interspecific cross A. cepa × A. roylei confirmed the assignment of an LFS locus to this chromosome. Sequence comparison of two BAC clones bearing LFS genes, LFS amplicons from diverse germplasm, and expressed sequences from a doubled haploid line revealed variation consistent with duplicated LFS genes. Furthermore, the BAC-FISH study using the two BAC clones as a probe showed that LFS genes are localized in the proximal region of the long arm of the chromosome. These results suggested that LFS in A. cepa is transcribed from at least two loci and that they are localized on chromosome 5. PMID:22690373

  1. Sequence-specific polypeptoids: A diverse family of heteropolymers with stable secondary structure

    PubMed Central

    Kirshenbaum, Kent; Barron, Annelise E.; Goldsmith, Richard A.; Armand, Philippe; Bradley, Erin K.; Truong, Kiet T. V.; Dill, Ken A.; Cohen, Fred E.; Zuckermann, Ronald N.

    1998-01-01

    We have synthesized and characterized a family of structured oligo-N-substituted-glycines (peptoids) up to 36 residues in length by using an efficient solid-phase protocol to incorporate chemically diverse side chains in a sequence-specific fashion. We investigated polypeptoids containing side chains with a chiral center adjacent to the main chain nitrogen. Some of these sequences have stable secondary structure, despite the achirality of the polymer backbone and its lack of hydrogen bond donors. In both aqueous and organic solvents, peptoid oligomers as short as five residues give rise to CD spectra that strongly resemble those of peptide α-helices. Differential scanning calorimetry and CD measurements show that polypeptoid secondary structure is highly stable and that unfolding is reversible and cooperative. Thermodynamic parameters obtained for unfolding are similar to those obtained for the α-helix to coil transitions of peptides. This class of biomimetic polymers may enable the design of self-assembling macromolecules with novel structures and functions. PMID:9539732

  2. Evaluation of cytochrome b mtDNA sequences in genetic diversity studies of Channa marulius (Channidae: Perciformes).

    PubMed

    Habib, Maria; Lakra, W S; Mohindra, Vindhya; Khare, Praveen; Barman, A S; Singh, Akanksha; Lal, Kuldeep K; Punia, Peyush; Khan, Asif A

    2011-02-01

    Channa marulius (Hamilton, 1822) is a commercially important freshwater fish and a potential candidate species for aquaculture. The present study evaluated partial Cytochrome b gene sequence of mtDNA for determining the genetic variation in wild populations of C. marulius. Genomic DNA extracted from C. marulius samples (n = 23) belonging to 3 distant rivers; Mahanadi, Teesta and Yamuna was analyzed. Sequencing of 307 bp Cytochrome b mtDNA fragment revealed the presence of 5 haplotypes with haplotype diversity value of 0.763 and nucleotide diversity value of 0.0128. Single population specific haplotype was observed in Mahanadi and Yamuna samples and 3 haplotypes in Teesta samples. The analysis of data demonstrated the suitability of partial Cytochrome b sequence in determining the genetic diversity in C. marulius population. PMID:20443065

  3. Evaluation of cytochrome b mtDNA sequences in genetic diversity studies of Channa marulius (Channidae: Perciformes).

    PubMed

    Habib, Maria; Lakra, W S; Mohindra, Vindhya; Khare, Praveen; Barman, A S; Singh, Akanksha; Lal, Kuldeep K; Punia, Peyush; Khan, Asif A

    2011-02-01

    Channa marulius (Hamilton, 1822) is a commercially important freshwater fish and a potential candidate species for aquaculture. The present study evaluated partial Cytochrome b gene sequence of mtDNA for determining the genetic variation in wild populations of C. marulius. Genomic DNA extracted from C. marulius samples (n = 23) belonging to 3 distant rivers; Mahanadi, Teesta and Yamuna was analyzed. Sequencing of 307 bp Cytochrome b mtDNA fragment revealed the presence of 5 haplotypes with haplotype diversity value of 0.763 and nucleotide diversity value of 0.0128. Single population specific haplotype was observed in Mahanadi and Yamuna samples and 3 haplotypes in Teesta samples. The analysis of data demonstrated the suitability of partial Cytochrome b sequence in determining the genetic diversity in C. marulius population.

  4. Application of culture culture-independent molecular biology based methods to evaluate acetic acid bacteria diversity during vinegar processing.

    PubMed

    Ilabaca, Carolina; Navarrete, Paola; Mardones, Pamela; Romero, Jaime; Mas, Albert

    2008-08-15

    Acetic acid bacteria (AAB) are considered fastidious microorganisms because they are difficult to isolate and cultivate. Different molecular approaches were taken to detect AAB diversity, independently of their capacity to grow in culture media. Those methods were tested in samples that originated during traditional vinegar production. Bacterial diversity was assessed by analysis of 16S rRNA gene, obtained by PCR amplifications of DNA extracted directly from the acetification container. Bacterial composition was analyzed by RFLP-PCR of 16S rRNA gene, Temporal Temperature Gradient Gel Electrophoresis (TTGE) separation of amplicons containing region V3-V5 of 16S rRNA gene and cloning of those amplicons. TTGE bands and clones were grouped based on their electrophoretic pattern similarity and sequenced to be compared with reference strains. The main microorganism identified in vinegar was Acetobacter pasteurianus, which at the end of the acetification process was considered to be the only microorganism present. The diversity was the highest at 2% acetic acid, where indefinite species of Gluconacetobacter xylinus/europaeus/intermedius were also present.

  5. Addicting diverse bacteria to a noncanonical amino acid.

    PubMed

    Tack, Drew S; Ellefson, Jared W; Thyer, Ross; Wang, Bo; Gollihar, Jimmy; Forster, Matthew T; Ellington, Andrew D

    2016-03-01

    Engineered orthogonal translation systems have greatly enabled the expansion of the genetic code using noncanonical amino acids (NCAAs). However, the impact of NCAAs on organismal evolution remains unclear, in part because it is difficult to force the adoption of new genetic codes in organisms. By reengineering TEM-1 β-lactamase to be dependent on a NCAA, we maintained bacterial NCAA dependence for hundreds of generations without escape. PMID:26780407

  6. Identification of random nucleic acid sequence aberrations using dual capture probes which hybridize to different chromosome regions

    DOEpatents

    Lucas, Joe N.; Straume, Tore; Bogen, Kenneth T.

    1998-01-01

    A method is provided for detecting nucleic acid sequence aberrations using two immobilization steps. According to the method, a nucleic acid sequence aberration is detected by detecting nucleic acid sequences having both a first nucleic acid sequence type (e.g., from a first chromosome) and a second nucleic acid sequence type (e.g., from a second chromosome), the presence of the first and the second nucleic acid sequence type on the same nucleic acid sequence indicating the presence of a nucleic acid sequence aberration. In the method, immobilization of a first hybridization probe is used to isolate a first set of nucleic acids in the sample which contain the first nucleic acid sequence type. Immobilization of a second hybridization probe is then used to isolate a second set of nucleic acids from within the first set of nucleic acids which contain the second nucleic acid sequence type. The second set of nucleic acids are then detected, their presence indicating the presence of a nucleic acid sequence aberration.

  7. Identification of random nucleic acid sequence aberrations using dual capture probes which hybridize to different chromosome regions

    DOEpatents

    Lucas, J.N.; Straume, T.; Bogen, K.T.

    1998-03-24

    A method is provided for detecting nucleic acid sequence aberrations using two immobilization steps. According to the method, a nucleic acid sequence aberration is detected by detecting nucleic acid sequences having both a first nucleic acid sequence type (e.g., from a first chromosome) and a second nucleic acid sequence type (e.g., from a second chromosome), the presence of the first and the second nucleic acid sequence type on the same nucleic acid sequence indicating the presence of a nucleic acid sequence aberration. In the method, immobilization of a first hybridization probe is used to isolate a first set of nucleic acids in the sample which contain the first nucleic acid sequence type. Immobilization of a second hybridization probe is then used to isolate a second set of nucleic acids from within the first set of nucleic acids which contain the second nucleic acid sequence type. The second set of nucleic acids are then detected, their presence indicating the presence of a nucleic acid sequence aberration. 14 figs.

  8. Diverse gene sequences are overexpressed in werner syndrome fibroblasts undergoing premature replicative senescence.

    PubMed Central

    Murano, S; Thweatt, R; Shmookler Reis, R J; Jones, R A; Moerman, E J; Goldstein, S

    1991-01-01

    Genes that play a role in the senescent arrest of cellular replication are likely to be overexpressed in human diploid fibroblasts (HDF) derived from subjects with Werner syndrome (WS) because these cells have a severely curtailed replicative life span. To identify some of these genes, a cDNA library was constructed from WS HDF after they had been serum depleted and repleted (5 days in medium containing 1% serum followed by 24 h in medium containing 20% serum). Differential screening of 7,500 colonies revealed 102 clones that hybridized preferentially with [32P]cDNA derived from RNA of WS cells compared with [32P]cDNA derived from normal HDF. Cross-hybridization and partial DNA sequence determination identified 18 independent gene sequences, 9 of them known and 9 unknown. The known genes included alpha 1(I) procollagen, alpha 2(I) procollagen, fibronectin, ferritin heavy chain, insulinlike growth factor-binding protein-3 (IGFBP-3), osteonectin, human tissue plasminogen activator inhibitor type I, thrombospondin, and alpha B-crystallin. The nine unknown clones included two novel gene sequences and seven additional sequences that contained both novel segments and the Alu class of repetitive short interspersed nuclear elements; five of these seven Alu+ clones also contained the long interpersed nuclear element I (KpnI) family of repetitive elements. Northern (RNA) analysis, using the 18 sequences as probes, showed higher levels of these mRNAs in WS HDF than in normal HDF. Five selected mRNAs studied in greater detail [alpha 1(I) procollagen, fibronectin, insulinlike growth factor-binding protein-3, WS3-10, and WS9-14] showed higher mRNA levels in both WS and late-passage normal HDF than in early-passage normal HDF at various intervals following serum depletion/repletion and after subculture and growth from sparse to high-density confluent arrest. These results indicate that senescence of both WS and normal HDF is accompanied by overexpression of similar sets of

  9. The amino acid sequence of elephant (Elephas maximus) myoglobin and the phylogeny of Proboscidea.

    PubMed

    Dene, H; Goodman, M; Romero-Herrera, A E

    1980-02-13

    The complete amino acid sequence of skeletal myoglobin from the Asian elephant (Elephas maximus) is reported. The functional significance of variations seen when this sequence is compared with that of sperm whale myoglobin is explored in the light of the crystallographic model available for the latter molecule. The phylogenetic implications of the elephant myoglobin amino acid sequence are evaluated by using the maximum parsimony technique. A similar analysis is also presented which incorporates all of the proteins sequenced from the elephant. These results are discussed with respect to current views on proboscidean phylogeny.

  10. Assessing genetic diversity among Brettanomyces yeasts by DNA fingerprinting and whole-genome sequencing.

    PubMed

    Crauwels, Sam; Zhu, Bo; Steensels, Jan; Busschaert, Pieter; De Samblanx, Gorik; Marchal, Kathleen; Willems, Kris A; Verstrepen, Kevin J; Lievens, Bart

    2014-07-01

    Brettanomyces yeasts, with the species Brettanomyces (Dekkera) bruxellensis being the most important one, are generally reported to be spoilage yeasts in the beer and wine industry due to the production of phenolic off flavors. However, B. bruxellensis is also known to be a beneficial contributor in certain fermentation processes, such as the production of certain specialty beers. Nevertheless, despite its economic importance, Brettanomyces yeasts remain poorly understood at the genetic and genomic levels. In this study, the genetic relationship between more than 50 Brettanomyces strains from all presently known species and from several sources was studied using a combination of DNA fingerprinting techniques. This revealed an intriguing correlation between the B. bruxellensis fingerprints and the respective isolation source. To further explore this relationship, we sequenced a (beneficial) beer isolate of B. bruxellensis (VIB X9085; ST05.12/22) and compared its genome sequence with the genome sequences of two wine spoilage strains (AWRI 1499 and CBS 2499). ST05.12/22 was found to be substantially different from both wine strains, especially at the level of single nucleotide polymorphisms (SNPs). In addition, there were major differences in the genome structures between the strains investigated, including the presence of large duplications and deletions. Gene content analysis revealed the presence of 20 genes which were present in both wine strains but absent in the beer strain, including many genes involved in carbon and nitrogen metabolism, and vice versa, no genes that were missing in both AWRI 1499 and CBS 2499 were found in ST05.12/22. Together, this study provides tools to discriminate Brettanomyces strains and provides a first glimpse at the genetic diversity and genome plasticity of B. bruxellensis.

  11. Assessing Genetic Diversity among Brettanomyces Yeasts by DNA Fingerprinting and Whole-Genome Sequencing

    PubMed Central

    Crauwels, Sam; Zhu, Bo; Steensels, Jan; Busschaert, Pieter; De Samblanx, Gorik; Marchal, Kathleen; Willems, Kris A.

    2014-01-01

    Brettanomyces yeasts, with the species Brettanomyces (Dekkera) bruxellensis being the most important one, are generally reported to be spoilage yeasts in the beer and wine industry due to the production of phenolic off flavors. However, B. bruxellensis is also known to be a beneficial contributor in certain fermentation processes, such as the production of certain specialty beers. Nevertheless, despite its economic importance, Brettanomyces yeasts remain poorly understood at the genetic and genomic levels. In this study, the genetic relationship between more than 50 Brettanomyces strains from all presently known species and from several sources was studied using a combination of DNA fingerprinting techniques. This revealed an intriguing correlation between the B. bruxellensis fingerprints and the respective isolation source. To further explore this relationship, we sequenced a (beneficial) beer isolate of B. bruxellensis (VIB X9085; ST05.12/22) and compared its genome sequence with the genome sequences of two wine spoilage strains (AWRI 1499 and CBS 2499). ST05.12/22 was found to be substantially different from both wine strains, especially at the level of single nucleotide polymorphisms (SNPs). In addition, there were major differences in the genome structures between the strains investigated, including the presence of large duplications and deletions. Gene content analysis revealed the presence of 20 genes which were present in both wine strains but absent in the beer strain, including many genes involved in carbon and nitrogen metabolism, and vice versa, no genes that were missing in both AWRI 1499 and CBS 2499 were found in ST05.12/22. Together, this study provides tools to discriminate Brettanomyces strains and provides a first glimpse at the genetic diversity and genome plasticity of B. bruxellensis. PMID:24814796

  12. Complete ecological isolation and cryptic diversity in Polynucleobacter bacteria not resolved by 16S rRNA gene sequences

    PubMed Central

    Hahn, Martin W; Jezberová, Jitka; Koll, Ulrike; Saueressig-Beck, Tanja; Schmidt, Johanna

    2016-01-01

    Transplantation experiments and genome comparisons were used to determine if lineages of planktonic Polynucleobacter almost indistinguishable by their 16S ribosomal RNA (rRNA) sequences differ distinctively in their ecophysiological and genomic traits. The results of three transplantation experiments differing in complexity of biotic interactions revealed complete ecological isolation between some of the lineages. This pattern fits well to the previously detected environmental distribution of lineages along chemical gradients, as well as to differences in gene content putatively providing adaptation to chemically distinct habitats. Patterns of distribution of iron transporter genes across 209 Polynucleobacter strains obtained from freshwater systems and representing a broad pH spectrum further emphasize differences in habitat-specific adaptations. Genome comparisons of six strains sharing ⩾99% 16S rRNA similarities suggested that each strain represents a distinct species. Comparison of sequence diversity among genomes with sequence diversity among 240 cultivated Polynucleobacter strains indicated a large cryptic species complex not resolvable by 16S rRNA sequences. The revealed ecological isolation and cryptic diversity in Polynucleobacter bacteria is crucial in the interpretation of diversity studies on freshwater bacterioplankton based on ribosomal sequences. PMID:26943621

  13. Complete ecological isolation and cryptic diversity in Polynucleobacter bacteria not resolved by 16S rRNA gene sequences.

    PubMed

    Hahn, Martin W; Jezberová, Jitka; Koll, Ulrike; Saueressig-Beck, Tanja; Schmidt, Johanna

    2016-07-01

    Transplantation experiments and genome comparisons were used to determine if lineages of planktonic Polynucleobacter almost indistinguishable by their 16S ribosomal RNA (rRNA) sequences differ distinctively in their ecophysiological and genomic traits. The results of three transplantation experiments differing in complexity of biotic interactions revealed complete ecological isolation between some of the lineages. This pattern fits well to the previously detected environmental distribution of lineages along chemical gradients, as well as to differences in gene content putatively providing adaptation to chemically distinct habitats. Patterns of distribution of iron transporter genes across 209 Polynucleobacter strains obtained from freshwater systems and representing a broad pH spectrum further emphasize differences in habitat-specific adaptations. Genome comparisons of six strains sharing ⩾99% 16S rRNA similarities suggested that each strain represents a distinct species. Comparison of sequence diversity among genomes with sequence diversity among 240 cultivated Polynucleobacter strains indicated a large cryptic species complex not resolvable by 16S rRNA sequences. The revealed ecological isolation and cryptic diversity in Polynucleobacter bacteria is crucial in the interpretation of diversity studies on freshwater bacterioplankton based on ribosomal sequences. PMID:26943621

  14. Complete ecological isolation and cryptic diversity in Polynucleobacter bacteria not resolved by 16S rRNA gene sequences.

    PubMed

    Hahn, Martin W; Jezberová, Jitka; Koll, Ulrike; Saueressig-Beck, Tanja; Schmidt, Johanna

    2016-07-01

    Transplantation experiments and genome comparisons were used to determine if lineages of planktonic Polynucleobacter almost indistinguishable by their 16S ribosomal RNA (rRNA) sequences differ distinctively in their ecophysiological and genomic traits. The results of three transplantation experiments differing in complexity of biotic interactions revealed complete ecological isolation between some of the lineages. This pattern fits well to the previously detected environmental distribution of lineages along chemical gradients, as well as to differences in gene content putatively providing adaptation to chemically distinct habitats. Patterns of distribution of iron transporter genes across 209 Polynucleobacter strains obtained from freshwater systems and representing a broad pH spectrum further emphasize differences in habitat-specific adaptations. Genome comparisons of six strains sharing ⩾99% 16S rRNA similarities suggested that each strain represents a distinct species. Comparison of sequence diversity among genomes with sequence diversity among 240 cultivated Polynucleobacter strains indicated a large cryptic species complex not resolvable by 16S rRNA sequences. The revealed ecological isolation and cryptic diversity in Polynucleobacter bacteria is crucial in the interpretation of diversity studies on freshwater bacterioplankton based on ribosomal sequences.

  15. Bacterial diversity in native habitats of the medicinal fungus Ophiocordyceps sinensis on Tibetan Plateau as determined using Illumina sequencing data.

    PubMed

    Yang, Rui-Heng; Wang, Xiao-Liang; Su, Jin-He; Li, Yi; Jiang, Si-Ping; Gu, Fei; Yao, Yi-Jian

    2015-03-01

    Ophiocordyceps sinensis is one of the most well-known traditional Chinese medicinal fungi. In this study, bacterial diversity in the soils of native habitats of O. sinensis was investigated using Illumina sequencing data. A total of 525,000 sequences of V6-16S rRNA were analyzed. The number of OTUs from each sample ranged from 13,858 to 15,978 at 97% sequence similarity cut-off. The results demonstrated that the deep sequencing approach provides improved access to rare genotypes. Richness indices and Shannon's diversity index did not differ significantly between samples collected from locations where O. sinensis was present (Os1-3) and not present (NOs1-3). Classified bacterial sequences were grouped into 23 phyla including Proteobacteria, Actinobacteria, Acidobacteria, Verrucomicrobia, etc. The Venn diagram revealed that 7183 OTUs belonging to 14 phyla were shared by Os, NOs and MP (mycelial pellicle wrapping the sclerotium of O. sinensis) samples, possibly representing a core microbiome existing in native habitats of O. sinensis, and that 863 belonging to 12 phyla were shared by Os and MP samples, possibly related to the occurrence of O. sinensis. Overall, the results revealed a high bacterial diversity in the soil samples and the relationships between the bacterial diversity and O. sinensis merit further investigation. PMID:25743069

  16. Facile Analysis and Sequencing of Linear and Branched Peptide Boronic Acids by MALDI Mass Spectrometry

    PubMed Central

    Crumpton, Jason; Zhang, Wenyu; Santos, Webster

    2011-01-01

    Interest in peptides incorporating boronic acid moieties is increasing due to their potential as therapeutics/diagnostics for a variety of diseases such as cancer. The utility of peptide boronic acids may be expanded with access to vast libraries that can be deconvoluted rapidly and economically. Unfortunately, current detection protocols using mass spectrometry are laborious and confounded by boronic acid trimerization, which requires time consuming analysis of dehydration products. These issues are exacerbated when the peptide sequence is unknown, as with de novo sequencing, and especially when multiple boronic acid moieties are present. Thus, a rapid, reliable and simple method for peptide identification is of utmost importance. Herein, we report the identification and sequencing of linear and branched peptide boronic acids containing up to five boronic acid groups by matrix-assisted laser desorption/ionization mass spectrometry (MALDI-MS). Protocols for preparation of pinacol boronic esters were adapted for efficient MALDI analysis of peptides. Additionally, a novel peptide boronic acid detection strategy was developed in which 2,5-dihydroxybenzoic acid (DHB) served as both matrix and derivatizing agent in a convenient, in situ, on-plate esterification. Finally, we demonstrate that DHB-modified peptide boronic acids from a single bead can be analyzed by MALDI-MSMS analysis, validating our approach for the identification and sequencing of branched peptide boronic acid libraries. PMID:21449540

  17. Evolution of an Enzyme from a Noncatalytic Nucleic Acid Sequence.

    PubMed

    Gysbers, Rachel; Tram, Kha; Gu, Jimmy; Li, Yingfu

    2015-01-01

    The mechanism by which enzymes arose from both abiotic and biological worlds remains an unsolved natural mystery. We postulate that an enzyme can emerge from any sequence of any functional polymer under permissive evolutionary conditions. To support this premise, we have arbitrarily chosen a 50-nucleotide DNA fragment encoding for the Bos taurus (cattle) albumin mRNA and subjected it to test-tube evolution to derive a catalytic DNA (DNAzyme) with RNA-cleavage activity. After only a few weeks, a DNAzyme with significant catalytic activity has surfaced. Sequence comparison reveals that seven nucleotides are responsible for the conversion of the noncatalytic sequence into the enzyme. Deep sequencing analysis of DNA pools along the evolution trajectory has identified individual mutations as the progressive drivers of the molecular evolution. Our findings demonstrate that an enzyme can indeed arise from a sequence of a functional polymer via permissive molecular evolution, a mechanism that may have been exploited by nature for the creation of the enormous repertoire of enzymes in the biological world today. PMID:26091540

  18. The okra (Abelmoschus esculentus) transcriptome as a source for gene sequence information and molecular markers for diversity analysis.

    PubMed

    Schafleitner, Roland; Kumar, Sanjeet; Lin, Chen-Yu; Hegde, Satish Gajanana; Ebert, Andreas

    2013-03-15

    A combined leaf and pod transcriptome of okra (Abelmoschus esculentus (L.) Moench) has been produced by RNA sequencing and short read assembly. More than 150,000 unigenes were obtained, comprising some 46 million base pairs of sequence information. More than 55% of the unigenes were annotated through sequence comparison with databases. The okra transcriptome sequences were mined for simple sequence repeat (SSR) markers. From 935 non-redundant SSR motifs identified in the unigene set, 199 were chosen for testing in a germplasm set, resulting in 161 polymorphic SSR markers. From this set, 19 markers were selected for a diversity analysis on 65 okra accessions comprising three different species, revealing 58 different genotypes and resulted in clustering of the accessions according to species and geographic origin. The okra gene sequence information and the marker resource are made available to the research community for functional genomics and breeding research.

  19. Sequence diversity and enzyme activity of ferric-chelate reductase LeFRO1 in tomato.

    PubMed

    Kong, Danyu; Chen, Chunlin; Wu, Huilan; Li, Ye; Li, Junming; Ling, Hong-Qing

    2013-11-20

    Ferric-chelate reductase which functions in the reduction of ferric to ferrous iron on root surface is a critical protein for iron homeostasis in strategy I plants. LeFRO1 is a major ferric-chelate reductase involved in iron uptake in tomato. To identify the natural variations of LeFRO1 and to assess their effect on the ferric-chelate reductase activity, we cloned the coding sequences of LeFRO1 from 16 tomato varieties collected from different regions, and detected three types of LeFRO1 (LeFRO1(MM), LeFRO1(Ailsa) and LeFRO1(Monita)) with five amino acid variations at the positions 21, 24, 112, 195 and 582. Enzyme activity assay revealed that the three types of LeFRO1 possessed different ferric-chelate reductase activity (LeFRO1(Ailsa) > LeFRO1(MM) > LeFRO1(Monita)). The 112th amino acid residue Ala of LeFRO1 is critical for maintaining the high activity of ferric-chelate reductase, because modification of this amino acid resulted in a significant reduction of enzyme activity. Further, we showed that the combination of the amino acid residue Ile at the site 24 with Lys at the site 582 played a positive role in the enzyme activity of LeFRO1. In conclusion, the findings are helpful to understand the natural adaptation mechanisms of plants to iron-limiting stress, and may provide new knowledge to select and manipulate LeFRO1 for improving the iron deficiency tolerance in tomato.

  20. Fungal diversity in oxygen-depleted regions of the Arabian Sea revealed by targeted environmental sequencing combined with cultivation.

    PubMed

    Jebaraj, Cathrine S; Raghukumar, Chandralata; Behnke, Anke; Stoeck, Thorsten

    2010-03-01

    In order to study fungal diversity in oxygen minimum zones of the Arabian Sea, we analyzed 1440 cloned small subunit rRNA gene (18S rRNA gene) sequences obtained from environmental samples using three different PCR primer sets. Restriction fragment length polymorphism (RFLP) analyses yielded 549 distinct RFLP patterns, 268 of which could be assigned to fungi (Dikarya and zygomycetes) after sequence analyses. The remaining 281 RFLP patterns represented a variety of nonfungal taxa, even when using putatively fungal-specific primers. A substantial number of fungal sequences were closely related to environmental sequences from a range of other anoxic marine habitats, but distantly related to known sequences of described fungi. Community similarity analyses suggested distinctively different structures of fungal communities from normoxic sites, seasonally anoxic sites and permanently anoxic sites, suggesting different adaptation strategies of fungal communities to prevailing oxygen conditions. Additionally, we obtained 26 fungal cultures from the study sites, most of which were closely related (>97% sequence similarity) to well-described Dikarya. This indicates that standard cultivation mainly produces more of what is already known. However, two of these cultures were highly divergent to known sequences and seem to represent novel fungal groups on high taxonomic levels. Interestingly, none of the cultured isolates is identical to any of the environmental sequences obtained. Our study demonstrates the importance of a multiple-primer approach combined with cultivation to obtain deeper insights into the true fungal diversity in environmental samples and to enable adequate intersample comparisons of fungal communities.

  1. Computer Simulation of the Determination of Amino Acid Sequences in Polypeptides

    ERIC Educational Resources Information Center

    Daubert, Stephen D.; Sontum, Stephen F.

    1977-01-01

    Describes a computer program that generates a random string of amino acids and guides the student in determining the correct sequence of a given protein by using experimental analytic data for that protein. (MLH)

  2. Analysis of the genetic diversity of beach plums by simple sequence repeat markers.

    PubMed

    Wang, X M; Wu, W L; Zhang, C H; Zhang, Y P; Li, W L; Huang, T

    2015-08-19

    The purpose of this study was to measure the genetic diversity of wild beach plum and cultivated species, and to determine the species relationships using SSRs markers. An analysis of genetic diversity from ten beach plum germplasms was carried out using 11 simple sequence repeat (SSR) primers selected from 35 primers to generate distinct PCR products. From this plant material, 44 allele variations were detected, with 3-5 alleles identified from each primer. The analysis showed that the genetic similarity coefficient varied from 0.721 ± 0.155 to 0.848 ± 0.136 within each of the ten beach plum germplasms and changed within the range of 0.551 ± 0.084 to 0.695 ± 0.073 between any two pairs of germplasms. According to the genetic dissimilarity coefficient matrix, a cluster analysis of SSRs using the unweighted pair group mean average method in the NTSYSpc 2.10 software revealed that the ten germplasms could be divided into two groups at the dissimilarity coefficient of 0.606. Class I included 77.8, 12.5, 30, and 33.3% of MM, MI, NY, and CM, respectively. Class II contains the remaining 9 beach plum germplasms. The markers generated by 11 SSR primers proved very effective in distinguishing the beach plum germplasm resources. It was clear that the geographical distribution did not correspond with the genetic relationships among the different beach plum strains. This result will be of value to beach plum breeding programs.

  3. Genetic diversity among air yam (Dioscorea bulbifera) varieties based on single sequence repeat markers.

    PubMed

    Silva, D M; Siqueira, M V B M; Carrasco, N F; Mantello, C C; Nascimento, W F; Veasey, E A

    2016-01-01

    Dioscorea is the largest genus in the Dioscoreaceae family, and includes a number of economically important species including the air yam, D. bulbifera L. This study aimed to develop new single sequence repeat primers and characterize the genetic diversity of local varieties that originated in several municipalities of Brazil. We developed an enriched genomic library for D. bulbifera resulting in seven primers, six of which were polymorphic, and added four polymorphic loci developed for other Dioscorea species. This resulted in 10 polymorphic primers to evaluate 42 air yam accessions. Thirty-three alleles (bands) were found, with an average of 3.3 alleles per locus. The discrimination power ranged from 0.113 to 0.834, with an average of 0.595. Both principal coordinate and cluster analyses (using the Jaccard Index) failed to clearly separate the accessions according to their origins. However, the 13 accessions from Conceição dos Ouros, Minas Gerais State were clustered above zero on the principal coordinate 2 axis, and were also clustered into one subgroup in the cluster analysis. Accessions from Ubatuba, São Paulo State were clustered below zero on the same principal coordinate 2 axis, except for one accession, although they were scattered in several subgroups in the cluster analysis. Therefore, we found little spatial structure in the accessions, although those from Conceição dos Ouros and Ubatuba exhibited some spatial structure, and that there is a considerable level of genetic diversity in D. bulbifera maintained by traditional farmers in Brazil. PMID:27323077

  4. DNA sequence analyses reveal abundant diversity, endemism and evidence for Asian origin of the porcini mushrooms.

    PubMed

    Feng, Bang; Xu, Jianping; Wu, Gang; Hosen, Md Iqbal; Zeng, Nian-Kai; Li, Yan-Chun; Tolgor, Bau; Kost, Gerhard W; Yang, Zhu L

    2012-01-01

    The wild gourmet mushroom Boletus edulis and its close allies are of significant ecological and economic importance. They are found throughout the Northern Hemisphere, but despite their ubiquity there are still many unresolved issues with regard to the taxonomy, systematics and biogeography of this group of mushrooms. Most phylogenetic studies of Boletus so far have characterized samples from North America and Europe and little information is available on samples from other areas, including the ecologically and geographically diverse regions of China. Here we analyzed DNA sequence variation in three gene markers from samples of these mushrooms from across China and compared our findings with those from other representative regions. Our results revealed fifteen novel phylogenetic species (about one-third of the known species) and a newly identified lineage represented by Boletus sp. HKAS71346 from tropical Asia. The phylogenetic analyses support eastern Asia as the center of diversity for the porcini sensu stricto clade. Within this clade, B. edulis is the only known holarctic species. The majority of the other phylogenetic species are geographically restricted in their distributions. Furthermore, molecular dating and geological evidence suggest that this group of mushrooms originated during the Eocene in eastern Asia, followed by dispersal to and subsequent speciation in other parts of Asia, Europe, and the Americas from the middle Miocene through the early Pliocene. In contrast to the ancient dispersal of porcini in the strict sense in the Northern Hemisphere, the occurrence of B. reticulatus and B. edulis sensu lato in the Southern Hemisphere was probably due to recent human-mediated introductions.

  5. Repulsive parallel MCMC algorithm for discovering diverse motifs from large sequence sets

    PubMed Central

    Ikebata, Hisaki; Yoshida, Ryo

    2015-01-01

    Motivation: The motif discovery problem consists of finding recurring patterns of short strings in a set of nucleotide sequences. This classical problem is receiving renewed attention as most early motif discovery methods lack the ability to handle large data of recent genome-wide ChIP studies. New ChIP-tailored methods focus on reducing computation time and pay little regard to the accuracy of motif detection. Unlike such methods, our method focuses on increasing the detection accuracy while maintaining the computation efficiency at an acceptable level. The major advantage of our method is that it can mine diverse multiple motifs undetectable by current methods. Results: The repulsive parallel Markov chain Monte Carlo (RPMCMC) algorithm that we propose is a parallel version of the widely used Gibbs motif sampler. RPMCMC is run on parallel interacting motif samplers. A repulsive force is generated when different motifs produced by different samplers near each other. Thus, different samplers explore different motifs. In this way, we can detect much more diverse motifs than conventional methods can. Through application to 228 transcription factor ChIP-seq datasets of the ENCODE project, we show that the RPMCMC algorithm can find many reliable cofactor interacting motifs that existing methods are unable to discover. Availability and implementation: A C++ implementation of RPMCMC and discovered cofactor motifs for the 228 ENCODE ChIP-seq datasets are available from http://daweb.ism.ac.jp/yoshidalab/motif. Contact: ikebata.hisaki@ism.ac.jp, yoshidar@ism.ac.jp Supplementary information: Supplementary data are available from Bioinformatics online. PMID:25583120

  6. Sequence, structure and functional diversity of PD-(D/E)XK phosphodiesterase superfamily.

    PubMed

    Steczkiewicz, Kamil; Muszewska, Anna; Knizewski, Lukasz; Rychlewski, Leszek; Ginalski, Krzysztof

    2012-08-01

    Proteins belonging to PD-(D/E)XK phosphodiesterases constitute a functionally diverse superfamily with representatives involved in replication, restriction, DNA repair and tRNA-intron splicing. Their malfunction in humans triggers severe diseases, such as Fanconi anemia and Xeroderma pigmentosum. To date there have been several attempts to identify and classify new PD-(D/E)KK phosphodiesterases using remote homology detection methods. Such efforts are complicated, because the superfamily exhibits extreme sequence and structural divergence. Using advanced homology detection methods supported with superfamily-wide domain architecture and horizontal gene transfer analyses, we provide a comprehensive reclassification of proteins containing a PD-(D/E)XK domain. The PD-(D/E)XK phosphodiesterases span over 21,900 proteins, which can be classified into 121 groups of various families. Eleven of them, including DUF4420, DUF3883, DUF4263, COG5482, COG1395, Tsp45I, HaeII, Eco47II, ScaI, HpaII and Replic_Relax, are newly assigned to the PD-(D/E)XK superfamily. Some groups of PD-(D/E)XK proteins are present in all domains of life, whereas others occur within small numbers of organisms. We observed multiple horizontal gene transfers even between human pathogenic bacteria or from Prokaryota to Eukaryota. Uncommon domain arrangements greatly elaborate the PD-(D/E)XK world. These include domain architectures suggesting regulatory roles in Eukaryotes, like stress sensing and cell-cycle regulation. Our results may inspire further experimental studies aimed at identification of exact biological functions, specific substrates and molecular mechanisms of reactions performed by these highly diverse proteins.

  7. The amino acid sequence of monal pheasant lysozyme and its activity.

    PubMed

    Araki, T; Matsumoto, T; Torikata, T

    1998-10-01

    The amino acid sequence of monal pheasant lysozyme and its activity were analyzed. Carboxymethylated lysozyme was digested with trypsin and the resulting peptides were sequenced. The established amino acid sequence had one amino acid substitution at position 102 (Arg to Gly) comparing with Indian peafowl lysozyme and four amino acid substitutions at positions 3 (Phe to Tyr), 15 (His to Leu), 41 (Gln to His), and 121 (Gln to His) with chicken lysozyme. Analysis of the time-courses of reaction using N-acetylglucosamine pentamer as a substrate showed a difference of binding free energy change (-0.4 kcal/mol) at subsites A between monal pheasant and Indian peafowl lysozyme. This was assumed to be caused by the amino acid substitution at subsite A with loss of a positive charge at position 102 (Arg102 to Gly).

  8. The amino acid sequence of monal pheasant lysozyme and its activity.

    PubMed

    Araki, T; Matsumoto, T; Torikata, T

    1998-10-01

    The amino acid sequence of monal pheasant lysozyme and its activity were analyzed. Carboxymethylated lysozyme was digested with trypsin and the resulting peptides were sequenced. The established amino acid sequence had one amino acid substitution at position 102 (Arg to Gly) comparing with Indian peafowl lysozyme and four amino acid substitutions at positions 3 (Phe to Tyr), 15 (His to Leu), 41 (Gln to His), and 121 (Gln to His) with chicken lysozyme. Analysis of the time-courses of reaction using N-acetylglucosamine pentamer as a substrate showed a difference of binding free energy change (-0.4 kcal/mol) at subsites A between monal pheasant and Indian peafowl lysozyme. This was assumed to be caused by the amino acid substitution at subsite A with loss of a positive charge at position 102 (Arg102 to Gly). PMID:9836434

  9. cDNA-derived amino acid sequences of myoglobins from nine species of whales and dolphins.

    PubMed

    Iwanami, Kentaro; Mita, Hajime; Yamamoto, Yasuhiko; Fujise, Yoshihiro; Yamada, Tadasu; Suzuki, Tomohiko

    2006-10-01

    We determined the myoglobin (Mb) cDNA sequences of nine cetaceans, of which six are the first reports of Mb sequences: sei whale (Balaenoptera borealis), Bryde's whale (Balaenoptera edeni), pygmy sperm whale (Kogia breviceps), Stejneger's beaked whale (Mesoplodon stejnegeri), Longman's beaked whale (Indopacetus pacificus), and melon-headed whale (Peponocephala electra), and three confirm the previously determined chemical amino acid sequences: sperm whale (Physeter macrocephalus), common minke whale (Balaenoptera acutorostrata) and pantropical spotted dolphin (Stenella attenuata). We found two types of Mb in the skeletal muscle of pantropical spotted dolphin: Mb I with the same amino acid sequence as that deposited in the protein database, and Mb II, which differs at two amino acid residues compared with Mb I. Using an alignment of the amino acid or cDNA sequences of cetacean Mb, we constructed a phylogenetic tree by the NJ method. Clustering of cetacean Mb amino acid and cDNA sequences essentially follows the classical taxonomy of cetaceans, suggesting that Mb sequence data is valid for classification of cetaceans at least to the family level. PMID:16962803

  10. Studies on monotreme proteins. VII. Amino acid sequence of myoglobin from the platypus, Ornithoryhynchus anatinus.

    PubMed

    Fisher, W K; Thompson, E O

    1976-03-01

    Myoglobin isolated from skeletal muscle of the platypus contains 153 amino acid residues. The complete amino acid sequence has been determined following cleavage with cyanogen bromide and further digestion of the four fragments with trypsin, chymotrypsin, pepsin and thermolysin. Sequences of the purified peptides were determined by the dansyl-Edman procedure. The amino acid sequence showed 25 differences from human myoglobin and 24 from kangaroo myoglobin. Amino acid sequences in myoglobins are more conserved than sequences in the alpha- and beta-globin chains, and platypus myoglobin shows a similar number of variations in sequence to kangaroo myoglobin when compared with myoglobin of other species. The date of divergence of the platypus from other mammals was estimated at 102 +/- 31 million years, based on the number of amino acid differences between species and allowing for mutations during the evolutionary period. This estimate differs widely from the estimate given by similar treatment of the alpha- and beta-chain sequences and a constant rate of mutation of globin chains is not supported. PMID:962722

  11. Multiple Genome Sequences of Important Beer-Spoiling Lactic Acid Bacteria

    PubMed Central

    Geissler, Andreas J.; Vogel, Rudi F.

    2016-01-01

    Seven strains of important beer-spoiling lactic acid bacteria were sequenced using single-molecule real-time sequencing. Complete genomes were obtained for strains of Lactobacillus paracollinoides, Lactobacillus lindneri, and Pediococcus claussenii. The analysis of these genomes emphasizes the role of plasmids as the genomic foundation of beer-spoiling ability. PMID:27795248

  12. Diversity of the causal genes in hearing impaired Algerian individuals identified by whole exome sequencing

    PubMed Central

    Ammar-Khodja, Fatima; Bonnet, Crystel; Dahmani, Malika; Ouhab, Sofiane; Lefèvre, Gaelle M; Ibrahim, Hassina; Hardelin, Jean-Pierre; Weil, Dominique; Louha, Malek; Petit, Christine

    2015-01-01

    The genetic heterogeneity of congenital hearing disorders makes molecular diagnosis expensive and time-consuming using conventional techniques such as Sanger sequencing of DNA. In order to design an appropriate strategy of molecular diagnosis in the Algerian population, we explored the diversity of the involved mutations by studying 65 families affected by autosomal recessive forms of nonsyndromic hearing impairment (DFNB forms), which are the most prevalent early onset forms. We first carried out a systematic screening for mutations in GJB2 and the recurrent p.(Arg34*) mutation in TMC1, which were found in 31 (47.7%) families and 1 (1.5%) family, respectively. We then performed whole exome sequencing in nine of the remaining families, and identified the causative mutations in all the patients analyzed, either in the homozygous state (eight families) or in the compound heterozygous state (one family): (c.709C>T: p.(Arg237*)) and (c.2122C>T: p.(Arg708*)) in OTOF, (c.1334T>G: p.(Leu445Trp)) in SLC26A4, (c.764T>A: p.(Met255Lys)) in GIPC3, (c.518T>A: p.(Cys173Ser)) in LHFPL5, (c.5336T>C: p.(Leu1779Pro)) in MYO15A, (c.1807G>T: p.(Val603Phe)) in OTOA, (c.6080dup: p.(Asn2027Lys*9)) in PTPRQ, and (c.6017del: p.(Gly2006Alafs*13); c.7188_7189ins14: p.(Val2397Leufs*2)) in GPR98. Notably, 7 of these 10 mutations affecting 8 different genes had not been reported previously. These results highlight for the first time the genetic heterogeneity of the early onset forms of nonsyndromic deafness in Algerian families. PMID:26029705

  13. PCR Primers to Study the Diversity of Expressed Fungal Genes Encoding Lignocellulolytic Enzymes in Soils Using High-Throughput Sequencing

    PubMed Central

    Barbi, Florian; Bragalini, Claudia; Vallon, Laurent; Prudent, Elsa; Dubost, Audrey; Fraissinet-Tachet, Laurence; Marmeisse, Roland; Luis, Patricia

    2014-01-01

    Plant biomass degradation in soil is one of the key steps of carbon cycling in terrestrial ecosystems. Fungal saprotrophic communities play an essential role in this process by producing hydrolytic enzymes active on the main components of plant organic matter. Open questions in this field regard the diversity of the species involved, the major biochemical pathways implicated and how these are affected by external factors such as litter quality or climate changes. This can be tackled by environmental genomic approaches involving the systematic sequencing of key enzyme-coding gene families using soil-extracted RNA as material. Such an approach necessitates the design and evaluation of gene family-specific PCR primers producing sequence fragments compatible with high-throughput sequencing approaches. In the present study, we developed and evaluated PCR primers for the specific amplification of fungal CAZy Glycoside Hydrolase gene families GH5 (subfamily 5) and GH11 encoding endo-β-1,4-glucanases and endo-β-1,4-xylanases respectively as well as Basidiomycota class II peroxidases, corresponding to the CAZy Auxiliary Activity family 2 (AA2), active on lignin. These primers were experimentally validated using DNA extracted from a wide range of Ascomycota and Basidiomycota species including 27 with sequenced genomes. Along with the published primers for Glycoside Hydrolase GH7 encoding enzymes active on cellulose, the newly design primers were shown to be compatible with the Illumina MiSeq sequencing technology. Sequences obtained from RNA extracted from beech or spruce forest soils showed a high diversity and were uniformly distributed in gene trees featuring the global diversity of these gene families. This high-throughput sequencing approach using several degenerate primers constitutes a robust method, which allows the simultaneous characterization of the diversity of different fungal transcripts involved in plant organic matter degradation and may lead to the

  14. PCR primers to study the diversity of expressed fungal genes encoding lignocellulolytic enzymes in soils using high-throughput sequencing.

    PubMed

    Barbi, Florian; Bragalini, Claudia; Vallon, Laurent; Prudent, Elsa; Dubost, Audrey; Fraissinet-Tachet, Laurence; Marmeisse, Roland; Luis, Patricia

    2014-01-01

    Plant biomass degradation in soil is one of the key steps of carbon cycling in terrestrial ecosystems. Fungal saprotrophic communities play an essential role in this process by producing hydrolytic enzymes active on the main components of plant organic matter. Open questions in this field regard the diversity of the species involved, the major biochemical pathways implicated and how these are affected by external factors such as litter quality or climate changes. This can be tackled by environmental genomic approaches involving the systematic sequencing of key enzyme-coding gene families using soil-extracted RNA as material. Such an approach necessitates the design and evaluation of gene family-specific PCR primers producing sequence fragments compatible with high-throughput sequencing approaches. In the present study, we developed and evaluated PCR primers for the specific amplification of fungal CAZy Glycoside Hydrolase gene families GH5 (subfamily 5) and GH11 encoding endo-β-1,4-glucanases and endo-β-1,4-xylanases respectively as well as Basidiomycota class II peroxidases, corresponding to the CAZy Auxiliary Activity family 2 (AA2), active on lignin. These primers were experimentally validated using DNA extracted from a wide range of Ascomycota and Basidiomycota species including 27 with sequenced genomes. Along with the published primers for Glycoside Hydrolase GH7 encoding enzymes active on cellulose, the newly design primers were shown to be compatible with the Illumina MiSeq sequencing technology. Sequences obtained from RNA extracted from beech or spruce forest soils showed a high diversity and were uniformly distributed in gene trees featuring the global diversity of these gene families. This high-throughput sequencing approach using several degenerate primers constitutes a robust method, which allows the simultaneous characterization of the diversity of different fungal transcripts involved in plant organic matter degradation and may lead to the

  15. Reverse taxonomy: an approach towards determining the diversity of meiobenthic organisms based on ribosomal RNA signature sequences

    PubMed Central

    Markmann, Melanie; Tautz, Diethard

    2005-01-01

    Organisms living in or on the sediment layer of water bodies constitute the benthos fauna, which is known to harbour a large number of species of diverse taxonomic groups. The benthos plays a significant role in the nutrient cycle and it is, therefore, of high ecological relevance. Here, we have explored a DNA-taxonomic approach to access the meiobenthic organismic diversity, by focusing on obtaining signature sequences from a part of the large ribosomal subunit rRNA (28S), the D3–D5 region. To obtain a broad representation of taxa, benthos samples were taken from 12 lakes in Germany, representing different ecological conditions. In a first approach, we have extracted whole DNA from these samples, amplified the respective fragment by PCR, cloned the fragments and sequenced individual clones. However, we found a relatively large number of recombinant clones that must be considered PCR artefacts. In a second approach we have, therefore, directly sequenced PCR fragments that were obtained from DNA extracts of randomly picked individual organisms. In total, we have obtained 264 new unique sequences, which can be readily placed into taxon groups, based on phylogenetic comparison with currently available database sequences. The group with the highest taxon abundance were nematodes and protozoa, followed by chironomids. However, we find also that we have by far not exhausted the diversity of organisms in the samples. Still, our data provide a framework within which a meiobenthos DNA signature sequence database can be constructed, that will allow to develop the necessary techniques for studying taxon diversity in the context of ecological analysis. Since many taxa in our analysis are initially only identified via their signature sequences, but not yet their morphology, we propose to call this approach ‘reverse taxonomy’. PMID:16214749

  16. Palynological composition of a Lower Cretaceous South American tropical sequence: Climatic implications and diversity comparisons with other latitudes.

    USGS Publications Warehouse

    Mejia-Velasquez, Paula J.; Dilcher, David L.; Jaramillo, Carlos A.; Fortini, Lucas B.; Manchester, Steven R.

    2012-01-01

    Premise of the study: Reconstruction of floristic patterns during the early diversification of angiosperms is impeded by the scarce fossil record, especially in tropical latitudes. Here we collected quantitative palynological data from a stratigraphic sequence in tropical South America to provide floristic and climatic insights into such tropical environments during the Early Cretaceous. Methods: We reconstructed the floristic composition of an Aptian-Albian tropical sequence from central Colombia using quantitative palynology (rarefied species richness and abundance) and used it to infer its predominant climatic conditions. Additionally, we compared our results with available quantitative data from three other sequences encompassing 70 floristic assemblages to determine latitudinal diversity patterns. Key results: Abundance of humidity indicators was higher than that of aridity indicators (61% vs. 10%). Additionally, we found an angiosperm latitudinal diversity gradient (LDG) for the Aptian, but not for the Albian, and an inverted LDG of the overall diversity for the Albian. Angiosperm species turnover during the Albian, however, was higher in humid tropics. Conclusions: There were humid climates in northwestern South America during the Aptian-Albian interval contrary to the widespread aridity expected for the tropical belt. The Albian inverted overall LDG is produced by a faster increase in per-sample angiosperm and pteridophyte diversity in temperate latitudes. However, humid tropical sequences had higher rates of floristic turnover suggesting a higher degree of morphological variation than in temperate regions.

  17. Bacterial diversity assessment of pristine mangrove microbial community from Dhulibhashani, Sundarbans using 16S rRNA gene tag sequencing.

    PubMed

    Basak, Pijush; Pramanik, Arnab; Sengupta, Sohan; Nag, Sudip; Bhattacharyya, Anish; Roy, Debojyoti; Pattanayak, Rudradip; Ghosh, Abhrajyoti; Chattopadhyay, Dhrubajyoti; Bhattacharyya, Maitree

    2016-03-01

    The global knowledge of microbial diversity and function in Sundarbans ecosystem is still scarce, despite global advancement in understanding the microbial diversity. In the present study, we have analyzed the diversity and distribution of bacteria in the tropical mangrove sediments of Sundarbans using 16S rRNA gene amplicon sequencing. Metagenome is comprised of 1,53,926 sequences with 108.8 Mbp data and with 55 ± 2% G + C content. Metagenome sequence data are available at NCBI under the Bioproject database with accession no. PRJNA245459. Bacterial community metagenome sequences were analyzed by MG-RAST software representing the presence of 56,547 species belonging to 44 different phyla. The taxonomic analysis revealed the dominance of phyla Proteobacteria within our dataset. Further taxonomic analysis revealed abundance of Bacteroidetes, Acidobactreia, Firmicutes, Actinobacteria, Nitrospirae, Cyanobacteria, Planctomycetes and Fusobacteria group as the predominant bacterial assemblages in this largely pristine mangrove habitat. The distribution of different community datasets obtained from four sediment samples originated from one sampling station at two different depths providing better understanding of the sediment bacterial diversity and its relationship to the ecosystem dynamics of this pristine mangrove sediment of Dhulibhashani in, Sundarbans.

  18. Evaluation of genetic diversity and pedigree within crapemyrtle (Lagerstroemia spp.) cultivars using simple sequence repeat (SSR) markers

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Genetic diversity was estimated for 93 crapemyrtle (Lagerstroemia spp.) cultivars (51 L. indica cultivars, 5 L. fauriei cultivars, and 37 interspecific hybrids) using 78 simple sequence repeat (SSR) markers. SSR loci were highly variable among the cultivars, detecting an average of 6.6 alleles per l...

  19. MALDI-TOF Mass Spectrometry for Multilocus Sequence Typing of Escherichia coli Reveals Diversity among Isolates Carrying blaCMY₋₂-Like Genes.

    PubMed

    Tagg, Kaitlin A; Ginn, Andrew N; Partridge, Sally R; Iredell, Jonathan R

    2015-01-01

    Effective surveillance and management of pathogenic Escherichia coli relies on robust and reproducible typing methods such as multilocus sequence typing (MLST). Typing of E. coli by MLST enables tracking of pathogenic clones that are known to carry virulence factors or spread resistance, such as the globally-prevalent ST131 lineage. Standard MLST for E. coli requires sequencing of seven alleles, or a whole genome, and can take several days. Here, we have developed and validated a nucleic-acid-based MALDI-TOF mass spectrometry (MS) method for MLST as a rapid alternative to sequencing that requires minimal operator expertise. Identification of alleles was 99.6% concordant with sequencing. We employed MLST by MALDI-TOF MS to investigate diversity among 62 E. coli isolates from Sydney, Australia, carrying a blaCMY-2-like gene on an IncI1 plasmid to determine whether any dominant clonal lineages are associated with the spread of this globally-disseminated resistance gene. Thirty-four known sequence types were identified, including lineages associated with human disease, animal and environmental sources. This suggests that the dissemination of blaCMY-2-like-genes is more complex than the simple spread of successful pathogenic clones. E. coli MLST by MALDI-TOF MS, employed here for the first time, can be utilised as an automated tool for large-scale population analyses or for targeted screening for known high-risk clones in a diagnostic setting. PMID:26588228

  20. MALDI-TOF Mass Spectrometry for Multilocus Sequence Typing of Escherichia coli Reveals Diversity among Isolates Carrying blaCMY-2-Like Genes

    PubMed Central

    Tagg, Kaitlin A.; Ginn, Andrew N.; Partridge, Sally R.; Iredell, Jonathan R.

    2015-01-01

    Effective surveillance and management of pathogenic Escherichia coli relies on robust and reproducible typing methods such as multilocus sequence typing (MLST). Typing of E. coli by MLST enables tracking of pathogenic clones that are known to carry virulence factors or spread resistance, such as the globally-prevalent ST131 lineage. Standard MLST for E. coli requires sequencing of seven alleles, or a whole genome, and can take several days. Here, we have developed and validated a nucleic-acid-based MALDI-TOF mass spectrometry (MS) method for MLST as a rapid alternative to sequencing that requires minimal operator expertise. Identification of alleles was 99.6% concordant with sequencing. We employed MLST by MALDI-TOF MS to investigate diversity among 62 E. coli isolates from Sydney, Australia, carrying a blaCMY-2-like gene on an IncI1 plasmid to determine whether any dominant clonal lineages are associated with the spread of this globally-disseminated resistance gene. Thirty-four known sequence types were identified, including lineages associated with human disease, animal and environmental sources. This suggests that the dissemination of blaCMY-2-like-genes is more complex than the simple spread of successful pathogenic clones. E. coli MLST by MALDI-TOF MS, employed here for the first time, can be utilised as an automated tool for large-scale population analyses or for targeted screening for known high-risk clones in a diagnostic setting. PMID:26588228

  1. Diversity and Variation of Bacterial Community Revealed by MiSeq Sequencing in Chinese Dark Teas

    PubMed Central

    Fu, Jianyu; Lv, Haipeng; Chen, Feng

    2016-01-01

    Chinese dark teas (CDTs) are now among the popular tea beverages worldwide due to their unique health benefits. Because the production of CDTs involves fermentation that is characterized by the effect of microbes, microorganisms are believed to play critical roles in the determination of the chemical characteristics of CDTs. Some dominant fungi have been identified from CDTs. In contrast, little, if anything, is known about the composition of bacterial community in CDTs. This study was set to investigate the diversity and variation of bacterial community in four major types of CDTs from China. First, the composition of the bacterial community of CDTs was determined using MiSeq sequencing. From the four typical CDTs, a total of 238 genera that belong to 128 families of bacteria were detected, including most of the families of beneficial bacteria known to be associated with fermented food. While different types of CDTs had generally distinct bacterial structures, the two types of brick teas produced from adjacent regions displayed strong similarity in bacterial composition, suggesting that the producing environment and processing condition perhaps together influence bacterial succession in CDTs. The global characterization of bacterial communities in CDTs is an essential first step for us to understand their function in fermentation and their potential impact on human health. Such knowledge will be important guidance for improving the production of CDTs with higher quality and elevated health benefits. PMID:27690376

  2. Genetic diversity in Passiflora species assessed by morphological and its sequence analysis.

    PubMed

    Ramaiya, Shiamala Devi; Bujang, Japar Sidik; Zakaria, Muta Harah

    2014-01-01

    This study used morphological characterization and phylogenetic analysis of the internal transcribed spacer (ITS) region of nuclear ribosomal DNA to investigate the phylogeny of Passiflora species. The samples were collected from various regions of East Malaysia, and discriminant function analysis based on linear combinations of morphological variables was used to classify the Passiflora species. The biplots generated five distinct groups discriminated by morphological variables. The group consisted of cultivars of P. edulis with high levels of genetic similarity; in contrast, P. foetida was highly divergent from other species in the morphological biplots. The final dataset of aligned sequences from nine studied Passiflora accessions and 30 other individuals obtained from GenBank database (NCBI) yielded one most parsimonious tree with two strongly supported clades. Maximum parsimony (MP) tree showed the phylogenetic relationships within this subgenus Passiflora support the classification at the series level. The constructed phylogenic tree also confirmed the divergence of P. foetida from all other species and the closeness of wild and cultivated species. The phylogenetic relationships were consistent with results of morphological assessments. The results of this study indicate that ITS region analysis represents a useful tool for evaluating genetic diversity in Passiflora at the species level. PMID:25050402

  3. Genetic Diversity in Passiflora Species Assessed by Morphological and ITS Sequence Analysis

    PubMed Central

    Ramaiya, Shiamala Devi; Bujang, Japar Sidik; Zakaria, Muta Harah

    2014-01-01

    This study used morphological characterization and phylogenetic analysis of the internal transcribed spacer (ITS) region of nuclear ribosomal DNA to investigate the phylogeny of Passiflora species. The samples were collected from various regions of East Malaysia, and discriminant function analysis based on linear combinations of morphological variables was used to classify the Passiflora species. The biplots generated five distinct groups discriminated by morphological variables. The group consisted of cultivars of P. edulis with high levels of genetic similarity; in contrast, P. foetida was highly divergent from other species in the morphological biplots. The final dataset of aligned sequences from nine studied Passiflora accessions and 30 other individuals obtained from GenBank database (NCBI) yielded one most parsimonious tree with two strongly supported clades. Maximum parsimony (MP) tree showed the phylogenetic relationships within this subgenus Passiflora support the classification at the series level. The constructed phylogenic tree also confirmed the divergence of P. foetida from all other species and the closeness of wild and cultivated species. The phylogenetic relationships were consistent with results of morphological assessments. The results of this study indicate that ITS region analysis represents a useful tool for evaluating genetic diversity in Passiflora at the species level. PMID:25050402

  4. Determination of the Diversity of Rhodopirellula Isolates from European Seas by Multilocus Sequence Analysis ▿ †

    PubMed Central

    Winkelmann, Nadine; Jaekel, Ulrike; Meyer, Carolin; Serrano, Wilbert; Rachel, Reinhard; Rosselló-Mora, Ramon; Harder, Jens

    2010-01-01

    In the biogeography of microorganisms, the habitat size of an attached-living bacterium has never been investigated. We approached this theme with a multilocus sequence analysis (MLSA) study of new strains of Rhodopirellula sp., an attached-living planctomycete. The development of an MLSA for Rhodopirellula baltica enabled the characterization of the genetic diversity at the species level, beyond the resolution of the 16S rRNA gene. The alleles of the nine housekeeping genes acsA, guaA, trpE, purH, glpF, fumC, icd, glyA, and mdh indicated the presence of 13 genetically defined operational taxonomic units (OTUs) in our culture collection. The MLSA-based OTUs coincided with the taxonomic units defined by DNA-DNA hybridization experiments. BOX-PCR supported the MLSA-based differentiation of two closely related OTUs. This study established a taxon-area relationship of cultivable Rhodopirellula species. In European seas, three closely related species covered the Baltic Sea and the eastern North Sea, the North Atlantic region, and the southern North Sea to the Mediterranean. The last had regional genotypes, as revealed by BOX-PCR. This suggests a limited habitat size of attached-living Rhodopirellula species. PMID:19948850

  5. Determination of the diversity of Rhodopirellula isolates from European seas by multilocus sequence analysis.

    PubMed

    Winkelmann, Nadine; Jaekel, Ulrike; Meyer, Carolin; Serrano, Wilbert; Rachel, Reinhard; Rosselló-Mora, Ramon; Harder, Jens

    2010-02-01

    In the biogeography of microorganisms, the habitat size of an attached-living bacterium has never been investigated. We approached this theme with a multilocus sequence analysis (MLSA) study of new strains of Rhodopirellula sp., an attached-living planctomycete. The development of an MLSA for Rhodopirellula baltica enabled the characterization of the genetic diversity at the species level, beyond the resolution of the 16S rRNA gene. The alleles of the nine housekeeping genes acsA, guaA, trpE, purH, glpF, fumC, icd, glyA, and mdh indicated the presence of 13 genetically defined operational taxonomic units (OTUs) in our culture collection. The MLSA-based OTUs coincided with the taxonomic units defined by DNA-DNA hybridization experiments. BOX-PCR supported the MLSA-based differentiation of two closely related OTUs. This study established a taxon-area relationship of cultivable Rhodopirellula species. In European seas, three closely related species covered the Baltic Sea and the eastern North Sea, the North Atlantic region, and the southern North Sea to the Mediterranean. The last had regional genotypes, as revealed by BOX-PCR. This suggests a limited habitat size of attached-living Rhodopirellula species.

  6. Evaluation of the Microbial Diversity in Amyotrophic Lateral Sclerosis Using High-Throughput Sequencing

    PubMed Central

    Fang, Xin; Wang, Xin; Yang, Shaoguo; Meng, Fanjing; Wang, Xiaolei; Wei, Hua; Chen, Tingtao

    2016-01-01

    More and more evidences indicate that diseases of the central nervous system have been seriously affected by fecal microbes. However, little work is done to explore interaction between amyotrophic lateral sclerosis (ALS) and fecal microbes. In the present study, high-throughput sequencing method was used to compare the intestinal microbial diversity of healthy people and ALS patients. The principal coordinate analysis, Venn and unweighted pair-group method using arithmetic averages (UPGMA) showed an obvious microbial changes between healthy people (group H) and ALS patients (group A), and the average ratios of Bacteroides, Faecalibacterium, Anaerostipes, Prevotella, Escherichia, and Lachnospira at genus level between ALS patients and healthy people were 0.78, 2.18, 3.41, 0.35, 0.79, and 13.07. Furthermore, the decreased Firmicutes/Bacteroidetes ratio at phylum level using LEfSE (LDA > 4.0), together with the significant increased genus Dorea (harmful microorganisms) and significant reduced genus Oscillibacter, Anaerostipes, Lachnospiraceae (beneficial microorganisms) in ALS patients, indicated that the imbalance in intestinal microflora constitution had a strong association with the pathogenesis of ALS. PMID:27703453

  7. Whole-exome sequencing of pancreatic cancer defines genetic diversity and therapeutic targets

    PubMed Central

    Witkiewicz, Agnieszka K.; McMillan, Elizabeth A.; Balaji, Uthra; Baek, GuemHee; Lin, Wan-Chi; Mansour, John; Mollaee, Mehri; Wagner, Kay-Uwe; Koduru, Prasad; Yopp, Adam; Choti, Michael A.; Yeo, Charles J.; McCue, Peter; White, Michael A.; Knudsen, Erik S.

    2015-01-01

    Pancreatic ductal adenocarcinoma (PDA) has a dismal prognosis and insights into both disease etiology and targeted intervention are needed. A total of 109 micro-dissected PDA cases were subjected to whole-exome sequencing. Microdissection enriches tumour cellularity and enhances mutation calling. Here we show that environmental stress and alterations in DNA repair genes associate with distinct mutation spectra. Copy number alterations target multiple tumour suppressive/oncogenic loci; however, amplification of MYC is uniquely associated with poor outcome and adenosquamous subtype. We identify multiple novel mutated genes in PDA, with select genes harbouring prognostic significance. RBM10 mutations associate with longer survival in spite of histological features of aggressive disease. KRAS mutations are observed in >90% of cases, but codon Q61 alleles are selectively associated with improved survival. Oncogenic BRAF mutations are mutually exclusive with KRAS and define sensitivity to vemurafenib in PDA models. High-frequency alterations in Wnt signalling, chromatin remodelling, Hedgehog signalling, DNA repair and cell cycle processes are observed. Together, these data delineate new genetic diversity of PDA and provide insights into prognostic determinants and therapeutic targets. PMID:25855536

  8. Evolutionary Analysis of Sequence Divergence and Diversity of Duplicate Genes in Aspergillus fumigatus

    PubMed Central

    Yang, Ence; Hulse, Amanda M.; Cai, James J.

    2012-01-01

    Gene duplication as a major source of novel genetic material plays an important role in evolution. In this study, we focus on duplicate genes in Aspergillus fumigatus, a ubiquitous filamentous fungus causing life-threatening human infections. We characterize the extent and evolutionary patterns of the duplicate genes in the genome of A. fumigatus. Our results show that A. fumigatus contains a large amount of duplicate genes with pronounced sequence divergence between two copies, and approximately 10% of them diverge asymmetrically, i.e. two copies of a duplicate gene pair diverge at significantly different rates. We use a Bayesian approach of the McDonald-Kreitman test to infer distributions of selective coefficients γ(=2Nes) and find that (1) the values of γ for two copies of duplicate genes co-vary positively and (2) the average γ for the two copies differs between genes from different gene families. This analysis highlights the usefulness of combining divergence and diversity data in studying the evolution of duplicate genes. Taken together, our results provide further support and refinement to the theories of gene duplication. Through characterizing the duplicate genes in the genome of A. fumigatus, we establish a computational framework, including parameter settings and methods, for comparative study of genetic redundancy and gene duplication between different fungal species. PMID:23225993

  9. Complete Genome Sequence of Streptomyces clavuligerus F613-1, an Industrial Producer of Clavulanic Acid.

    PubMed

    Cao, Guangxiang; Zhong, Chuanqing; Zong, Gongli; Fu, Jiafang; Liu, Zhong; Zhang, Guimin; Qin, Ronghuo

    2016-01-01

    Streptomyces clavuligerus strain F613-1 is an industrial strain with high-yield clavulanic acid production. In this study, the complete genome sequence of S. clavuligerus strain F613-1 was determined, including one linear chromosome and one linear plasmid, carrying numerous sets of genes involving in the biosynthesis of clavulanic acid.

  10. Complete Genome Sequence of Streptomyces clavuligerus F613-1, an Industrial Producer of Clavulanic Acid.

    PubMed

    Cao, Guangxiang; Zhong, Chuanqing; Zong, Gongli; Fu, Jiafang; Liu, Zhong; Zhang, Guimin; Qin, Ronghuo

    2016-01-01

    Streptomyces clavuligerus strain F613-1 is an industrial strain with high-yield clavulanic acid production. In this study, the complete genome sequence of S. clavuligerus strain F613-1 was determined, including one linear chromosome and one linear plasmid, carrying numerous sets of genes involving in the biosynthesis of clavulanic acid. PMID:27660792

  11. Complete Genome Sequence of Streptomyces clavuligerus F613-1, an Industrial Producer of Clavulanic Acid

    PubMed Central

    Zhong, Chuanqing; Zong, Gongli; Fu, Jiafang; Liu, Zhong; Zhang, Guimin; Qin, Ronghuo

    2016-01-01

    Streptomyces clavuligerus strain F613-1 is an industrial strain with high-yield clavulanic acid production. In this study, the complete genome sequence of S. clavuligerus strain F613-1 was determined, including one linear chromosome and one linear plasmid, carrying numerous sets of genes involving in the biosynthesis of clavulanic acid. PMID:27660792

  12. Intermediary Metabolism in Protists: a Sequence-based View of Facultative Anaerobic Metabolism in Evolutionarily Diverse Eukaryotes

    PubMed Central

    Ginger, Michael L.; Fritz-Laylin, Lillian K.; Fulton, Chandler; Cande, W. Zacheus; Dawson, Scott C.

    2011-01-01

    Protists account for the bulk of eukaryotic diversity. Through studies of gene and especially genome sequences the molecular basis for this diversity can be determined. Evident from genome sequencing are examples of versatile metabolism that go far beyond the canonical pathways described for eukaryotes in textbooks. In the last 2–3 years, genome sequencing and transcript profiling has unveiled several examples of heterotrophic and phototrophic protists that are unexpectedly well-equipped for ATP production using a facultative anaerobic metabolism, including some protists that can (Chlamydomonas reinhardtii) or are predicted (Naegleria gruberi, Acanthamoeba castellanii, Amoebidium parasiticum) to produce H2 in their metabolism. It is possible that some enzymes of anaerobic metabolism were acquired and distributed among eukaryotes by lateral transfer, but it is also likely that the common ancestor of eukaryotes already had far more metabolic versatility than was widely thought a few years ago. The discussion of core energy metabolism in unicellular eukaryotes is the subject of this review. Since genomic sequencing has so far only touched the surface of protist diversity, it is anticipated that sequences of additional protists may reveal an even wider range of metabolic capabilities, while simultaneously enriching our understanding of the early evolution of eukaryotes. PMID:21036663

  13. Intermediary metabolism in protists: a sequence-based view of facultative anaerobic metabolism in evolutionarily diverse eukaryotes.

    PubMed

    Ginger, Michael L; Fritz-Laylin, Lillian K; Fulton, Chandler; Cande, W Zacheus; Dawson, Scott C

    2010-12-01

    Protists account for the bulk of eukaryotic diversity. Through studies of gene and especially genome sequences the molecular basis for this diversity can be determined. Evident from genome sequencing are examples of versatile metabolism that go far beyond the canonical pathways described for eukaryotes in textbooks. In the last 2-3 years, genome sequencing and transcript profiling has unveiled several examples of heterotrophic and phototrophic protists that are unexpectedly well-equipped for ATP production using a facultative anaerobic metabolism, including some protists that can (Chlamydomonas reinhardtii) or are predicted (Naegleria gruberi, Acanthamoeba castellanii, Amoebidium parasiticum) to produce H(2) in their metabolism. It is possible that some enzymes of anaerobic metabolism were acquired and distributed among eukaryotes by lateral transfer, but it is also likely that the common ancestor of eukaryotes already had far more metabolic versatility than was widely thought a few years ago. The discussion of core energy metabolism in unicellular eukaryotes is the subject of this review. Since genomic sequencing has so far only touched the surface of protist diversity, it is anticipated that sequences of additional protists may reveal an even wider range of metabolic capabilities, while simultaneously enriching our understanding of the early evolution of eukaryotes.

  14. Parvalbumins from coelacanth muscle. III. Amino acid sequence of the major component.

    PubMed

    Jauregui-Adell, J; Pechere, J F

    1978-09-26

    The primary structure of the major parvalbumin (pI = 4.52) from coelacanth muscle (Latimeria chalumnae) has been determined. Sequence analysis of the tryptic peptides, in some cases obtained with beta-trypsin, accounts for the total amino acid content of the protein. Chymotryptic peptides provide appropriate sequence overlaps, to complete the localization of the tryptic peptides. Examination of the amino acid sequence of this protein shows the typical structure of a beta-parvalbumin. Its position in the dendrogram of related calcium-binding proteins corresponds to that usually accepted for crossopterygians.

  15. Sequence Diversity in the pe_pgrs Genes of Mycobacterium tuberculosis Is Independent of Human T Cell Recognition

    PubMed Central

    Copin, Richard; Coscollá, Mireia; Seiffert, Salome N.; Bothamley, Graham; Sutherland, Jayne; Mbayo, Georgetta; Gagneux, Sebastien; Ernst, Joel D.

    2014-01-01

    ABSTRACT The Mycobacterium tuberculosis genome includes the large family of pe_pgrs genes, whose functions are unknown. Because of precedents in other pathogens in which gene families showing high sequence variation are involved in antigenic variation, a similar role has been proposed for the pe_pgrs genes. However, the impact of immune selection on pe_pgrs genes has not been examined. Here, we sequenced 27 pe_pgrs genes in 94 clinical strains from five phylogenetic lineages of the M. tuberculosis complex (MTBC). We found that pe_pgrs genes were overall more diverse than the remainder of the MTBC genome, but individual members of the family varied widely in their nucleotide diversity and insertion/deletion (indel) content: some were more, and others were much less, diverse than the genome average. Individual pe_pgrs genes also differed in the ratio of nonsynonymous to synonymous mutations, suggesting that different selection pressures act on individual pe_pgrs genes. Using bioinformatic methods, we tested whether sequence diversity in pe_pgrs genes might be selected by human T cell recognition, the major mechanism of adaptive immunity to MTBC. We found that the large majority of predicted human T cell epitopes were confined to the conserved PE domain and experimentally confirmed the antigenicity of this domain in tuberculosis patients. In contrast, despite being genetically diverse, the PGRS domains harbored few predicted T cell epitopes. These results indicate that human T cell recognition is not a significant force driving sequence diversity in pe_pgrs genes, which is consistent with the previously reported conservation of human T cell epitopes in the MTBC. PMID:24425732

  16. Hepatitis C Virus (HCV) NS3 sequence diversity and antiviral resistance-associated variant frequency in HCV/HIV coinfection.

    PubMed

    Jabara, Cassandra B; Hu, Fengyu; Mollan, Katie R; Williford, Sara E; Menezes, Prema; Yang, Yan; Eron, Joseph J; Fried, Michael W; Hudgens, Michael G; Jones, Corbin D; Swanstrom, Ronald; Lemon, Stanley M

    2014-10-01

    HIV coinfection accelerates disease progression in chronic hepatitis C and reduces sustained antiviral responses (SVR) to interferon-based therapy. New direct-acting antivirals (DAAs) promise higher SVR rates, but the selection of preexisting resistance-associated variants (RAVs) may lead to virologic breakthrough or relapse. Thus, pretreatment frequencies of RAVs are likely determinants of treatment outcome but typically are below levels at which the viral sequence can be accurately resolved. Moreover, it is not known how HIV coinfection influences RAV frequency. We adopted an accurate high-throughput sequencing strategy to compare nucleotide diversity in HCV NS3 protease-coding sequences in 20 monoinfected and 20 coinfected subjects with well-controlled HIV infection. Differences in mean pairwise nucleotide diversity (π), Tajima's D statistic, and Shannon entropy index suggested that the genetic diversity of HCV is reduced in coinfection. Among coinfected subjects, diversity correlated positively with increases in CD4(+) T cells on antiretroviral therapy, suggesting T cell responses are important determinants of diversity. At a median sequencing depth of 0.084%, preexisting RAVs were readily identified. Q80K, which negatively impacts clinical responses to simeprevir, was encoded by more than 99% of viral RNAs in 17 of the 40 subjects. RAVs other than Q80K were identified in 39 of 40 subjects, mostly at frequencies near 0.1%. RAV frequency did not differ significantly between monoinfected and coinfected subjects. We conclude that HCV genetic diversity is reduced in patients with well-controlled HIV infection, likely reflecting impaired T cell immunity. However, RAV frequency is not increased and should not adversely influence the outcome of DAA therapy.

  17. ShoRAH: estimating the genetic diversity of a mixed sample from next-generation sequencing data

    PubMed Central

    2011-01-01

    Background With next-generation sequencing technologies, experiments that were considered prohibitive only a few years ago are now possible. However, while these technologies have the ability to produce enormous volumes of data, the sequence reads are prone to error. This poses fundamental hurdles when genetic diversity is investigated. Results We developed ShoRAH, a computational method for quantifying genetic diversity in a mixed sample and for identifying the individual clones in the population, while accounting for sequencing errors. The software was run on simulated data and on real data obtained in wet lab experiments to assess its reliability. Conclusions ShoRAH is implemented in C++, Python, and Perl and has been tested under Linux and Mac OS X. Source code is available under the GNU General Public License at http://www.cbg.ethz.ch/software/shorah. PMID:21521499

  18. Sequencing and computational analysis of complete genome sequences of Citrus yellow mosaic badna virus from acid lime and pummelo.

    PubMed

    Borah, Basanta K; Johnson, A M Anthony; Sai Gopal, D V R; Dasgupta, Indranil

    2009-08-01

    Citrus yellow mosaic badna virus (CMBV), a member of the Family Caulimoviridae, Genus Badnavirus, is the causative agent of Citrus mosaic disease in India. Although the virus has been detected in several citrus species, only two full-length genomes, one each from Sweet orange and Rangpur lime, are available in publicly accessible databases. In order to obtain a better understanding of the genetic variability of the virus in other citrus mosaic-affected citrus species, we performed the cloning and sequence analysis of complete genomes of CMBV from two additional citrus species, Acid lime and Pummelo. We show that CMBV genomes from the two hosts share high homology with previously reported CMBV sequences and hence conclude that the new isolates represent variants of the virus present in these species. Based on in silico sequence analysis, we predict the possible function of the protein encoded by one of the five ORFs.

  19. Multilocus Sequence Analysis for the Assessment of Phylogenetic Diversity and Biogeography in Hyphomonas Bacteria from Diverse Marine Environments

    PubMed Central

    Li, Guizhen; Liu, Yang; Sun, Fengqin; Shao, Zongze

    2014-01-01

    Hyphomonas, a genus of budding, prosthecate bacteria, are primarily found in the marine environment. Seven type strains, and 35 strains from our collections of Hyphomonas, isolated from the Pacific Ocean, Atlantic Ocean, Arctic Ocean, South China Sea and the Baltic Sea, were investigated in this study using multilocus sequence analysis (MLSA). The phylogenetic structure of these bacteria was evaluated using the 16S rRNA gene, and five housekeeping genes (leuA, clpA, pyrH, gatA and rpoD) as well as their concatenated sequences. Our results showed that each housekeeping gene and the concatenated gene sequence all yield a higher taxonomic resolution than the 16S rRNA gene. The 42 strains assorted into 12 groups. Each group represents an independent species, which was confirmed by virtual DNA-DNA hybridization (DDH) estimated from draft genome sequences. Hyphomonas MLSA interspecies and intraspecies boundaries ranged from 93.3% to 96.3%, similarity calculated using a combined DDH and MLSA approach. Furthermore, six novel species (groups I, II, III, IV, V and XII) of the genus Hyphomonas exist, based on sequence similarities of the MLSA and DDH values. Additionally, we propose that the leuA gene (93.0% sequence similarity across our dataset) alone could be used as a fast and practical means for identifying species within Hyphomonas. Finally, Hyphomonas' geographic distribution shows that strains from the same area tend to cluster together as discrete species. This study provides a framework for the discrimination and phylogenetic analysis of the genus Hyphomonas for the first time, and will contribute to a more thorough understanding of the biological and ecological roles of this genus. PMID:25019154

  20. Multilocus sequence analysis for the assessment of phylogenetic diversity and biogeography in hyphomonas bacteria from diverse marine environments.

    PubMed

    Li, Chongping; Lai, Qiliang; Li, Guizhen; Liu, Yang; Sun, Fengqin; Shao, Zongze

    2014-01-01

    Hyphomonas, a genus of budding, prosthecate bacteria, are primarily found in the marine environment. Seven type strains, and 35 strains from our collections of Hyphomonas, isolated from the Pacific Ocean, Atlantic Ocean, Arctic Ocean, South China Sea and the Baltic Sea, were investigated in this study using multilocus sequence analysis (MLSA). The phylogenetic structure of these bacteria was evaluated using the 16S rRNA gene, and five housekeeping genes (leuA, clpA, pyrH, gatA and rpoD) as well as their concatenated sequences. Our results showed that each housekeeping gene and the concatenated gene sequence all yield a higher taxonomic resolution than the 16S rRNA gene. The 42 strains assorted into 12 groups. Each group represents an independent species, which was confirmed by virtual DNA-DNA hybridization (DDH) estimated from draft genome sequences. Hyphomonas MLSA interspecies and intraspecies boundaries ranged from 93.3% to 96.3%, similarity calculated using a combined DDH and MLSA approach. Furthermore, six novel species (groups I, II, III, IV, V and XII) of the genus Hyphomonas exist, based on sequence similarities of the MLSA and DDH values. Additionally, we propose that the leuA gene (93.0% sequence similarity across our dataset) alone could be used as a fast and practical means for identifying species within Hyphomonas. Finally, Hyphomonas' geographic distribution shows that strains from the same area tend to cluster together as discrete species. This study provides a framework for the discrimination and phylogenetic analysis of the genus Hyphomonas for the first time, and will contribute to a more thorough understanding of the biological and ecological roles of this genus.

  1. Amino acid sequence of anionic peroxidase from the windmill palm tree Trachycarpus fortunei.

    PubMed

    Baker, Margaret R; Zhao, Hongwei; Sakharov, Ivan Yu; Li, Qing X

    2014-12-10

    Palm peroxidases are extremely stable and have uncommon substrate specificity. This study was designed to fill in the knowledge gap about the structures of a peroxidase from the windmill palm tree Trachycarpus fortunei. The complete amino acid sequence and partial glycosylation were determined by MALDI-top-down sequencing of native windmill palm tree peroxidase (WPTP), MALDI-TOF/TOF MS/MS of WPTP tryptic peptides, and cDNA sequencing. The propeptide of WPTP contained N- and C-terminal signal sequences which contained 21 and 17 amino acid residues, respectively. Mature WPTP was 306 amino acids in length, and its carbohydrate content ranged from 21% to 29%. Comparison to closely related royal palm tree peroxidase revealed structural features that may explain differences in their substrate specificity. The results can be used to guide engineering of WPTP and its novel applications.

  2. Amino acid sequence of a new mitochondrially synthesized proteolipid of the ATP synthase of Saccharomyces cerevisiae.

    PubMed Central

    Velours, J; Esparza, M; Hoppe, J; Sebald, W; Guerin, B

    1984-01-01

    The purification and the amino acid sequence of a proteolipid translated on ribosomes in yeast mitochondria is reported. This protein, which is a subunit of the ATP synthase, was purified by extraction with chloroform/methanol (2/1) and subsequent chromatography on phosphocellulose and reverse phase h.p.l.c. A mol. wt. of 5500 was estimated by chromatography on Bio-Gel P-30 in 80% formic acid. The complete amino acid sequence of this protein was determined by automated solid phase Edman degradation of the whole protein and of fragments obtained after cleavage with cyanogen bromide. The sequence analysis indicates a length of 48 amino acid residues. The calculated mol. wt. of 5870 corresponds to the value found by gel chromatography. This polypeptide contains three basic residues and no negatively charged side chain. The three basic residues are clustered at the C terminus. The primary structure of this protein is in full agreement with the predicted amino acid sequence of the putative polypeptide encoded by the mitochondrial aap1 gene recently discovered in Saccharomyces cerevisiae. Moreover, this protein shows 50% homology with the amino acid sequence of a putative polypeptide encoded by an unidentified reading frame also discovered near the mitochondrial ATPase subunit 6 gene in Aspergillus nidulans. Images Fig. 2. PMID:6323165

  3. TranslatorX: multiple alignment of nucleotide sequences guided by amino acid translations.

    PubMed

    Abascal, Federico; Zardoya, Rafael; Telford, Maximilian J

    2010-07-01

    We present TranslatorX, a web server designed to align protein-coding nucleotide sequences based on their corresponding amino acid translations. Many comparisons between biological sequences (nucleic acids and proteins) involve the construction of multiple alignments. Alignments represent a statement regarding the homology between individual nucleotides or amino acids within homologous genes. As protein-coding DNA sequences evolve as triplets of nucleotides (codons) and it is known that sequence similarity degrades more rapidly at the DNA than at the amino acid level, alignments are generally more accurate when based on amino acids than on their corresponding nucleotides. TranslatorX novelties include: (i) use of all documented genetic codes and the possibility of assigning different genetic codes for each sequence; (ii) a battery of different multiple alignment programs; (iii) translation of ambiguous codons when possible; (iv) an innovative criterion to clean nucleotide alignments with GBlocks based on protein information; and (v) a rich output, including Jalview-powered graphical visualization of the alignments, codon-based alignments coloured according to the corresponding amino acids, measures of compositional bias and first, second and third codon position specific alignments. The TranslatorX server is freely available at http://translatorx.co.uk.

  4. Complete amino acid sequence and structure characterization of the taste-modifying protein, miraculin.

    PubMed

    Theerasilp, S; Hitotsuya, H; Nakajo, S; Nakaya, K; Nakamura, Y; Kurihara, Y

    1989-04-25

    The taste-modifying protein, miraculin, has the unusual property of modifying sour taste into sweet taste. The complete amino acid sequence of miraculin purified from miracle fruits by a newly developed method (Theerasilp, S., and Kurihara, Y. (1988) J. Biol. Chem. 263, 11536-11539) was determined by an automatic Edman degradation method. Miraculin was a single polypeptide with 191 amino acid residues. The calculated molecular weight based on the amino acid sequence and the carbohydrate content (13.9%) was 24,600. Asn-42 and Asn-186 were linked N-glycosidically to carbohydrate chains. High homology was found between the amino acid sequences of miraculin and soybean trypsin inhibitor. PMID:2708331

  5. Species diversity of fishes in naturally acidic lakes in New Jersey

    SciTech Connect

    Graham, J.H. )

    1993-11-01

    Fish communities in acidic lakes of New Jersey have fewer species than do those in more alkaline lakes of comparable size. This conclusion is based on a multiple regression analysis of published data on fish communities, area, and pH in 85 lakes. Some interesting patterns emerge, however, when species are partitioned into introduced and native species. As expected, diversity of introduced species declines with increasing acidity. The number of native species in a particular lake, however, is independent of pH (range of 4.1 to 9.1). Although diversity of native species is not influenced by pH, species composition changes. The lack of a significant relationship between species diversity of native species and pH can be attributed to the replacement of acid-intolerant species by tolerant species. The smaller number of introduced species in acidic lakes is attributable to both fewer species stocked and a greater frequency of failure for those that were stocked. Species introduction records for largemouth bass Micropterus salmoides and bluegill Lepomis macrochirus, which are not native to New Jersey, reveal far more failed introduction in acidic waters than in neutral or alkaline waters. 54 refs., 6 figs., 5 tabs.

  6. Homology of amino acid sequences of rat liver cathepsins B and H with that of papain.

    PubMed Central

    Takio, K; Towatari, T; Katunuma, N; Teller, D C; Titani, K

    1983-01-01

    The amino acid sequences of rat liver lysosomal thiol endopeptidases, cathepsins B and H, are presented and compared with that of the plant thiol protease papain. The 252-residue sequence of cathepsin B and the 220-residue sequence of cathepsin H were determined largely by automated Edman degradation of their intact polypeptide chains and of the two chains of each enzyme generated by limited proteolysis. Subfragments of the chains were produced by enzymatic digestion and by chemical cleavage of methionyl and tryptophanyl bonds. Comparison of the amino acid sequences of cathepsins B and H with each other and with that of papain demonstrates a striking homology among their primary structures. Sequence identity is extremely high in regions which, according to the three-dimensional structure of papain, constitute the catalytic site. The results not only reveal the first structural features of mammalian thiol endopeptidases but also provide insight into the evolutionary relationships among plant and mammalian thiol proteases. PMID:6574504

  7. Sequence diversity on four ORFs of citrus tristeza virus correlates with pathogenicity

    PubMed Central

    Herrera-Isidrón, Lisset; Ochoa-Sánchez, Juan Carlos; Rivera-Bustamante, Rafael; Martínez-Soriano, Juan Pablo

    2009-01-01

    The molecular characterization of isolates of citrus tristeza virus (CTV) from eight locations in Mexico was undertaken by analyzing five regions located at the opposite ends of the virus genome. Two regions have been previously used to study CTV variability (coat protein and p23), while the other three correspond to other genomic segments (p349-B, p349-C and p13). Our comparative nucleotide analyses included CTV sequences from different geographical origins already deposited in the GenBank databases. The largest nucleotide differences were located in two fragments located at the 5' end of the genome (p349-B and p349-C). Phylogenetic analyses on those five regions showed that the degree of nucleotide divergence among strains tended to correlate with their pathogenicity. Two main groups were defined: mild, with almost no noticeable effects on the indicator plants and severe, with drastic symptoms. Mild isolates clustered together in every analyzed ORF sharing a genetic distance below 0.022, in contrast with the severe isolates, which showed a more disperse distribution and a genetic distance of 0.276. Analyses of the p349-B and p349-C regions evidenced two lineages within the severe group: severe common subgroup (most of severe isolates) and severe divergent subgroup (T36-like isolates). This study represents the first attempt to analyze the genetic variability of CTV in Mexico by constructing phylogenetic trees based on new genomic regions that use group-specific nucleotide and amino acid sequences. These results may be useful to implement specific assays for strain discrimination. Moreover, it would be an excellent reference for the CTV situation in México to face the recent arrival of brown citrus aphid. PMID:19642988

  8. Complete cDNA and derived amino acid sequence of human factor V.

    PubMed Central

    Jenny, R J; Pittman, D D; Toole, J J; Kriz, R W; Aldape, R A; Hewick, R M; Kaufman, R J; Mann, K G

    1987-01-01

    cDNA clones encoding human factor V have been isolated from an oligo(dT)-primed human fetal liver cDNA library prepared with vector Charon 21A. The cDNA sequence of factor V from three overlapping clones includes a 6672-base-pair (bp) coding region, a 90-bp 5' untranslated region, and a 163-bp 3' untranslated region within which is a poly(A) tail. The deduced amino acid sequence consists of 2224 amino acids inclusive of a 28-amino acid leader peptide. Direct comparison with human factor VIII reveals considerable homology between proteins in amino acid sequence and domain structure: a triplicated A domain and duplicated C domain show approximately equal to 40% identity with the corresponding domains in factor VIII. As in factor VIII, the A domains of factor V share approximately 40% amino acid-sequence homology with the three highly conserved domains in ceruloplasmin. The B domain of factor V contains 35 tandem and approximately 9 additional semiconserved repeats of nine amino acids of the form Asp-Leu-Ser-Gln-Thr-Thr/Asn-Leu-Ser-Pro and 2 additional semiconserved repeats of 17 amino acids. Factor V contains 37 potential N-linked glycosylation sites, 25 of which are in the B domain, and a total of 19 cysteine residues. Images PMID:3110773

  9. Complete cDNA and derived amino acid sequence of human factor V

    SciTech Connect

    Jenny, R.J.; Pittman, D.D.; Toole, J.J.; Kriz, R.W.; Aldape, R.A.; Hewick, R.M.; Kaufman, R.J.; Mann, K.G.

    1987-07-01

    cDNA clones encoding human factor V have been isolated from an oligo(dT)-primed human fetal liver cDNA library prepared with vector Charon 21A. The cDNA sequence of factor V from three overlapping clones includes a 6672-base-pair (bp) coding region, a 90-bp 5' untranslated region, and a 163-bp 3' untranslated region within which is a poly(A)tail. The deduced amino acid sequence consists of 2224 amino acids inclusive of a 28-amino acid leader peptide. Direct comparison with human factor VIII reveals considerable homology between proteins in amino acid sequence and domain structure: a triplicated A domain and duplicated C domain show approx. 40% identity with the corresponding domains in factor VIII. As in factor VIII, the A domains of factor V share approx. 40% amino acid-sequence homology with the three highly conserved domains in ceruloplasmin. The B domain of factor V contains 35 tandem and approx. 9 additional semiconserved repeats of nine amino acids of the form Asp-Leu-Ser-Gln-Thr-Thr/Asn-Leu-Ser-Pro and 2 additional semiconserved repeats of 17 amino acids. Factor V contains 37 potential N-linked glycosylation sites, 25 of which are in the B domain, and a total of 19 cysteine residues.

  10. Molecular characterization of insulin from squamate reptiles reveals sequence diversity and possible adaptive evolution.

    PubMed

    Yamagishi, Genki; Yoshida, Ayaka; Kobayashi, Aya; Park, Min Kyun

    2016-01-01

    The Squamata are the most adaptive and prosperous group among ectothermic amniotes, reptiles, due to their species-richness and geographically wide habitat. Although the molecular mechanisms underlying their prosperity remain largely unknown, unique features have been reported from hormones that regulate energy metabolism. Insulin, a central anabolic hormone, is one such hormone, as its roles and effectiveness in regulation of blood glucose levels remain to be examined in squamates. In the present study, cDNAs coding for insulin were isolated from multiple species that represent various groups of squamates. The deduced amino acid sequences showed a high degree of divergence, with four lineages showing obviously higher number of amino acid substitutions than most of vertebrates, from teleosts to mammals. Among 18 sites presented to comprise the two receptor binding surfaces (one with 12 sites and the other with 6 sites), substitutions were observed in 13 sites. Among them was the substitution of HisB10, which results in the loss of the ability to hexamerize. Furthermore, three of these substitutions were reported to increase mitogenicity in human analogues. These substitutions were also reported from insulin of hystricomorph rodents and agnathan fishes, whose mitogenic potency have been shown to be increased. The estimated value of the non-synonymous-to-synonymous substitution ratio (ω) for the Squamata clade was larger than those of the other reptiles and aves. Even higher values were estimated for several lineages among squamates. These results, together with the regulatory mechanisms of digestion and nutrient assimilation in squamates, suggested a possible adaptive process through the molecular evolution of squamate INS. Further studies on the roles of insulin, in relation to the physiological and ecological traits of squamate species, will provide an insight into the molecular mechanisms that have led to the adaptivity and prosperity of squamates.

  11. Diversity of Δ12 Fatty Acid Desaturases in Santalaceae and Their Role in Production of Seed Oil Acetylenic Fatty Acids*

    PubMed Central

    Okada, Shoko; Zhou, Xue-Rong; Damcevski, Katherine; Gibb, Nerida; Wood, Craig; Hamberg, Mats; Haritos, Victoria S.

    2013-01-01

    Plants in the Santalaceae family, including the native cherry Exocarpos cupressiformis and sweet quandong Santalum acuminatum, accumulate ximenynic acid (trans-11-octadecen-9-ynoic acid) in their seed oil and conjugated polyacetylenic fatty acids in root tissue. Twelve full-length genes coding for microsomal Δ12 fatty acid desaturases (FADs) from the two Santalaceae species were identified by degenerate PCR. Phylogenetic analysis of the predicted amino acid sequences placed five Santalaceae FADs with Δ12 FADs, which include Arabidopsis thaliana FAD2. When expressed in yeast, the major activity of these genes was Δ12 desaturation of oleic acid, but unusual activities were also observed: i.e. Δ15 desaturation of linoleic acid as well as trans-Δ12 and trans-Δ11 desaturations of stearolic acid (9-octadecynoic acid). The trans-12-octadecen-9-ynoic acid product was also detected in quandong seed oil. The two other FAD groups (FADX and FADY) were present in both species; in a phylogenetic tree of microsomal FAD enzymes, FADX and FADY formed a unique clade, suggesting that are highly divergent. The FADX group enzymes had no detectable Δ12 FAD activity but instead catalyzed cis-Δ13 desaturation of stearolic acid when expressed in yeast. No products were detected for the FADY group when expressed recombinantly. Quantitative PCR analysis showed that the FADY genes were expressed in leaf rather than developing seed of the native cherry. FADs with promiscuous and unique activities have been identified in Santalaceae and explain the origin of some of the unusual lipids found in this plant family. PMID:24062307

  12. Diversity of Δ12 fatty acid desaturases in santalaceae and their role in production of seed oil acetylenic fatty acids.

    PubMed

    Okada, Shoko; Zhou, Xue-Rong; Damcevski, Katherine; Gibb, Nerida; Wood, Craig; Hamberg, Mats; Haritos, Victoria S

    2013-11-01

    Plants in the Santalaceae family, including the native cherry Exocarpos cupressiformis and sweet quandong Santalum acuminatum, accumulate ximenynic acid (trans-11-octadecen-9-ynoic acid) in their seed oil and conjugated polyacetylenic fatty acids in root tissue. Twelve full-length genes coding for microsomal Δ12 fatty acid desaturases (FADs) from the two Santalaceae species were identified by degenerate PCR. Phylogenetic analysis of the predicted amino acid sequences placed five Santalaceae FADs with Δ12 FADs, which include Arabidopsis thaliana FAD2. When expressed in yeast, the major activity of these genes was Δ12 desaturation of oleic acid, but unusual activities were also observed: i.e. Δ15 desaturation of linoleic acid as well as trans-Δ12 and trans-Δ11 desaturations of stearolic acid (9-octadecynoic acid). The trans-12-octadecen-9-ynoic acid product was also detected in quandong seed oil. The two other FAD groups (FADX and FADY) were present in both species; in a phylogenetic tree of microsomal FAD enzymes, FADX and FADY formed a unique clade, suggesting that are highly divergent. The FADX group enzymes had no detectable Δ12 FAD activity but instead catalyzed cis-Δ13 desaturation of stearolic acid when expressed in yeast. No products were detected for the FADY group when expressed recombinantly. Quantitative PCR analysis showed that the FADY genes were expressed in leaf rather than developing seed of the native cherry. FADs with promiscuous and unique activities have been identified in Santalaceae and explain the origin of some of the unusual lipids found in this plant family. PMID:24062307

  13. Phylogenetic Diversity of the Bacillus pumilus Group and the Marine Ecotype Revealed by Multilocus Sequence Analysis

    PubMed Central

    Dong, Chunming; Sun, Fengqin; Wang, Liping; Li, Guangyu; Shao, Zongze

    2013-01-01

    Bacteria closely related to Bacillus pumilus cannot be distinguished from such other species as B. safensis, B. stratosphericus, B. altitudinis and B. aerophilus simply by 16S rRNA gene sequence. In this report, 76 marine strains were subjected to phylogenetic analysis based on 7 housekeeping genes to understand the phylogeny and biogeography in comparison with other origins. A phylogenetic tree based on the 7 housekeeping genes concatenated in the order of gyrB-rpoB-pycA-pyrE-mutL-aroE-trpB was constructed and compared with trees based on the single genes. All these trees exhibited a similar topology structure with small variations. Our 79 strains were divided into 6 groups from A to F; Group A was the largest and contained 49 strains close to B. altitudinis. Additional two large groups were presented by B. safensis and B. pumilus respectively. Among the housekeeping genes, gyrB and pyrE showed comparatively better resolution power and may serve as molecular markers to distinguish these closely related strains. Furthermore, a recombinant phylogenetic tree based on the gyrB gene and containing 73 terrestrial and our isolates was constructed to detect the relationship between marine and other sources. The tree clearly showed that the bacteria of marine origin were clustered together in all the large groups. In contrast, the cluster belonging to B. safensis was mainly composed of bacteria of terrestrial origin. Interestingly, nearly all the marine isolates were at the top of the tree, indicating the possibility of the recent divergence of this bacterial group in marine environments. We conclude that B. altitudinis bacteria are the most widely spread of the B. pumilus group in marine environments. In summary, this report provides the first evidence regarding the systematic evolution of this bacterial group, and knowledge of their phylogenetic diversity will help in the understanding of their ecological role and distribution in marine environments. PMID:24244618

  14. Fingerprinting the Asterid Species Using Subtracted Diversity Array Reveals Novel Species-Specific Sequences

    PubMed Central

    Mantri, Nitin; Olarte, Alexandra; Li, Chun Guang; Xue, Charlie; Pang, Edwin C. K.

    2012-01-01

    Background Asterids is one of the major plant clades comprising of many commercially important medicinal species. One of the major concerns in medicinal plant industry is adulteration/contamination resulting from misidentification of herbal plants. This study reports the construction and validation of a microarray capable of fingerprinting medicinally important species from the Asterids clade. Methodology/Principal Findings Pooled genomic DNA of 104 non-asterid angiosperm and non-angiosperm species was subtracted from pooled genomic DNA of 67 asterid species. Subsequently, 283 subtracted DNA fragments were used to construct an Asterid-specific array. The validation of Asterid-specific array revealed a high (99.5%) subtraction efficiency. Twenty-five Asterid species (mostly medicinal) representing 20 families and 9 orders within the clade were hybridized onto the array to reveal its level of species discrimination. All these species could be successfully differentiated using their hybridization patterns. A number of species-specific probes were identified for commercially important species like tea, coffee, dandelion, yarrow, motherwort, Japanese honeysuckle, valerian, wild celery, and yerba mate. Thirty-seven polymorphic probes were characterized by sequencing. A large number of probes were novel species-specific probes whilst some of them were from chloroplast region including genes like atpB, rpoB, and ndh that have extensively been used for fingerprinting and phylogenetic analysis of plants. Conclusions/Significance Subtracted Diversity Array technique is highly efficient in fingerprinting species with little or no genomic information. The Asterid-specific array could fingerprint all 25 species assessed including three species that were not used in constructing the array. This study validates the use of chloroplast genes for bar-coding (fingerprinting) plant species. In addition, this method allowed detection of several new loci that can be explored to solve

  15. Whole-Genome Sequencing Reveals Diverse Models of Structural Variations in Esophageal Squamous Cell Carcinoma.

    PubMed

    Cheng, Caixia; Zhou, Yong; Li, Hongyi; Xiong, Teng; Li, Shuaicheng; Bi, Yanghui; Kong, Pengzhou; Wang, Fang; Cui, Heyang; Li, Yaoping; Fang, Xiaodong; Yan, Ting; Li, Yike; Wang, Juan; Yang, Bin; Zhang, Ling; Jia, Zhiwu; Song, Bin; Hu, Xiaoling; Yang, Jie; Qiu, Haile; Zhang, Gehong; Liu, Jing; Xu, Enwei; Shi, Ruyi; Zhang, Yanyan; Liu, Haiyan; He, Chanting; Zhao, Zhenxiang; Qian, Yu; Rong, Ruizhou; Han, Zhiwei; Zhang, Yanlin; Luo, Wen; Wang, Jiaqian; Peng, Shaoliang; Yang, Xukui; Li, Xiangchun; Li, Lin; Fang, Hu; Liu, Xingmin; Ma, Li; Chen, Yunqing; Guo, Shiping; Chen, Xing; Xi, Yanfeng; Li, Guodong; Liang, Jianfang; Yang, Xiaofeng; Guo, Jiansheng; Jia, JunMei; Li, Qingshan; Cheng, Xiaolong; Zhan, Qimin; Cui, Yongping

    2016-02-01

    Comprehensive identification of somatic structural variations (SVs) and understanding their mutational mechanisms in cancer might contribute to understanding biological differences and help to identify new therapeutic targets. Unfortunately, characterization of complex SVs across the whole genome and the mutational mechanisms underlying esophageal squamous cell carcinoma (ESCC) is largely unclear. To define a comprehensive catalog of somatic SVs, affected target genes, and their underlying mechanisms in ESCC, we re-analyzed whole-genome sequencing (WGS) data from 31 ESCCs using Meerkat algorithm to predict somatic SVs and Patchwork to determine copy-number changes. We found deletions and translocations with NHEJ and alt-EJ signature as the dominant SV types, and 16% of deletions were complex deletions. SVs frequently led to disruption of cancer-associated genes (e.g., CDKN2A and NOTCH1) with different mutational mechanisms. Moreover, chromothripsis, kataegis, and breakage-fusion-bridge (BFB) were identified as contributing to locally mis-arranged chromosomes that occurred in 55% of ESCCs. These genomic catastrophes led to amplification of oncogene through chromothripsis-derived double-minute chromosome formation (e.g., FGFR1 and LETM2) or BFB-affected chromosomes (e.g., CCND1, EGFR, ERBB2, MMPs, and MYC), with approximately 30% of ESCCs harboring BFB-derived CCND1 amplification. Furthermore, analyses of copy-number alterations reveal high frequency of whole-genome duplication (WGD) and recurrent focal amplification of CDCA7 that might act as a potential oncogene in ESCC. Our findings reveal molecular defects such as chromothripsis and BFB in malignant transformation of ESCCs and demonstrate diverse models of SVs-derived target genes in ESCCs. These genome-wide SV profiles and their underlying mechanisms provide preventive, diagnostic, and therapeutic implications for ESCCs. PMID:26833333

  16. Whole-Genome Sequencing Reveals Diverse Models of Structural Variations in Esophageal Squamous Cell Carcinoma

    PubMed Central

    Cheng, Caixia; Zhou, Yong; Li, Hongyi; Xiong, Teng; Li, Shuaicheng; Bi, Yanghui; Kong, Pengzhou; Wang, Fang; Cui, Heyang; Li, Yaoping; Fang, Xiaodong; Yan, Ting; Li, Yike; Wang, Juan; Yang, Bin; Zhang, Ling; Jia, Zhiwu; Song, Bin; Hu, Xiaoling; Yang, Jie; Qiu, Haile; Zhang, Gehong; Liu, Jing; Xu, Enwei; Shi, Ruyi; Zhang, Yanyan; Liu, Haiyan; He, Chanting; Zhao, Zhenxiang; Qian, Yu; Rong, Ruizhou; Han, Zhiwei; Zhang, Yanlin; Luo, Wen; Wang, Jiaqian; Peng, Shaoliang; Yang, Xukui; Li, Xiangchun; Li, Lin; Fang, Hu; Liu, Xingmin; Ma, Li; Chen, Yunqing; Guo, Shiping; Chen, Xing; Xi, Yanfeng; Li, Guodong; Liang, Jianfang; Yang, Xiaofeng; Guo, Jiansheng; Jia, JunMei; Li, Qingshan; Cheng, Xiaolong; Zhan, Qimin; Cui, Yongping

    2016-01-01

    Comprehensive identification of somatic structural variations (SVs) and understanding their mutational mechanisms in cancer might contribute to understanding biological differences and help to identify new therapeutic targets. Unfortunately, characterization of complex SVs across the whole genome and the mutational mechanisms underlying esophageal squamous cell carcinoma (ESCC) is largely unclear. To define a comprehensive catalog of somatic SVs, affected target genes, and their underlying mechanisms in ESCC, we re-analyzed whole-genome sequencing (WGS) data from 31 ESCCs using Meerkat algorithm to predict somatic SVs and Patchwork to determine copy-number changes. We found deletions and translocations with NHEJ and alt-EJ signature as the dominant SV types, and 16% of deletions were complex deletions. SVs frequently led to disruption of cancer-associated genes (e.g., CDKN2A and NOTCH1) with different mutational mechanisms. Moreover, chromothripsis, kataegis, and breakage-fusion-bridge (BFB) were identified as contributing to locally mis-arranged chromosomes that occurred in 55% of ESCCs. These genomic catastrophes led to amplification of oncogene through chromothripsis-derived double-minute chromosome formation (e.g., FGFR1 and LETM2) or BFB-affected chromosomes (e.g., CCND1, EGFR, ERBB2, MMPs, and MYC), with approximately 30% of ESCCs harboring BFB-derived CCND1 amplification. Furthermore, analyses of copy-number alterations reveal high frequency of whole-genome duplication (WGD) and recurrent focal amplification of CDCA7 that might act as a potential oncogene in ESCC. Our findings reveal molecular defects such as chromothripsis and BFB in malignant transformation of ESCCs and demonstrate diverse models of SVs-derived target genes in ESCCs. These genome-wide SV profiles and their underlying mechanisms provide preventive, diagnostic, and therapeutic implications for ESCCs. PMID:26833333

  17. Amino acid sequence heterogeneity of the chromosomal encoded Borrelia burgdorferi sensu lato major antigen P100.

    PubMed

    Fellinger, W; Farencena, A; Redl, B; Sambri, V; Cevenini, R; Stöffler, G

    1995-04-01

    The entire nucleotide sequence of the chromosomal encoded major antigen p100 of the European Borrelia garinii isolate B29 was determined and the deduced amino acid sequence was compared to the homologous antigen p83 of the North American Borrelia burgdorferi sensu stricto strain B31 and the p100 of the European Borrelia afzelii (group VS461) strain PKo. p100 of strain B29 shows 87% amino acid sequence identity to strain B31 and 79.2% to strain PKo, p100 of strain B31 and PKo shows 62.5% identity to each other. In addition, partial nucleotide sequences of the most heterogeneous region of the p100 gene of two other Borrelia garinii isolates (PBi and VS286) have been determined and the deduced amino acid sequences were compared with all p100 of Borrelia garinii published so far. We found an amino acid sequence identity between 88.6 and 100% within the same genospecies. The N-terminal part of the p100 proteins is highly conserved whereas a striking heterogeneous region within the C-terminal part of the proteins was observed.

  18. Microbial diversity and metabolite composition of Belgian red-brown acidic ales.

    PubMed

    Snauwaert, Isabel; Roels, Sanne P; Van Nieuwerburg, Filip; Van Landschoot, Anita; De Vuyst, Luc; Vandamme, Peter

    2016-03-16

    Belgian red-brown acidic ales are sour and alcoholic fermented beers, which are produced by mixed-culture fermentation and blending. The brews are aged in oak barrels for about two years, after which mature beer is blended with young, non-aged beer to obtain the end-products. The present study evaluated the microbial community diversity of Belgian red-brown acidic ales at the end of the maturation phase of three subsequent brews of three different breweries. The microbial diversity was compared with the metabolite composition of the brews at the end of the maturation phase. Therefore, mature brew samples were subjected to 454 pyrosequencing of the 16S rRNA gene (bacteria) and the internal transcribed spacer region (yeasts) and a broad range of metabolites was quantified. The most important microbial species present in the Belgian red-brown acidic ales investigated were Pediococcus damnosus, Dekkera bruxellensis, and Acetobacter pasteurianus. In addition, this culture-independent analysis revealed operational taxonomic units that were assigned to an unclassified fungal community member, Candida, and Lactobacillus. The main metabolites present in the brew samples were L-lactic acid, D-lactic acid, and ethanol, whereas acetic acid was produced in lower quantities. The most prevailing aroma compounds were ethyl acetate, isoamyl acetate, ethyl hexanoate, and ethyl octanoate, which might be of impact on the aroma of the end-products. PMID:26802571

  19. Detection and isolation of nucleic acid sequences using competitive hybridization probes

    DOEpatents

    Lucas, Joe N.; Straume, Tore; Bogen, Kenneth T.

    1997-01-01

    A method for detecting a target nucleic acid sequence in a sample is provided using hybridization probes which competitively hybridize to a target nucleic acid. According to the method, a target nucleic acid sequence is hybridized to first and second hybridization probes which are complementary to overlapping portions of the target nucleic acid sequence, the first hybridization probe including a first complexing agent capable of forming a binding pair with a second complexing agent and the second hybridization probe including a detectable marker. The first complexing agent attached to the first hybridization probe is contacted with a second complexing agent, the second complexing agent being attached to a solid support such that when the first and second complexing agents are attached, target nucleic acid sequences hybridized to the first hybridization probe become immobilized on to the solid support. The immobilized target nucleic acids are then separated and detected by detecting the detectable marker attached to the second hybridization probe. A kit for performing the method is also provided.

  20. Detection and isolation of nucleic acid sequences using competitive hybridization probes

    DOEpatents

    Lucas, J.N.; Straume, T.; Bogen, K.T.

    1997-04-01

    A method for detecting a target nucleic acid sequence in a sample is provided using hybridization probes which competitively hybridize to a target nucleic acid. According to the method, a target nucleic acid sequence is hybridized to first and second hybridization probes which are complementary to overlapping portions of the target nucleic acid sequence, the first hybridization probe including a first complexing agent capable of forming a binding pair with a second complexing agent and the second hybridization probe including a detectable marker. The first complexing agent attached to the first hybridization probe is contacted with a second complexing agent, the second complexing agent being attached to a solid support such that when the first and second complexing agents are attached, target nucleic acid sequences hybridized to the first hybridization probe become immobilized on to the solid support. The immobilized target nucleic acids are then separated and detected by detecting the detectable marker attached to the second hybridization probe. A kit for performing the method is also provided. 7 figs.

  1. Phylogenetic Diversity of Lactic Acid Bacteria Associated with Paddy Rice Silage as Determined by 16S Ribosomal DNA Analysis

    PubMed Central

    Ennahar, Saïd; Cai, Yimin; Fujita, Yasuhito

    2003-01-01

    A total of 161 low-G+C-content gram-positive bacteria isolated from whole-crop paddy rice silage were classified and subjected to phenotypic and genetic analyses. Based on morphological and biochemical characters, these presumptive lactic acid bacterium (LAB) isolates were divided into 10 groups that included members of the genera Enterococcus, Lactobacillus, Lactococcus, Leuconostoc, Pediococcus, and Weissella. Analysis of the 16S ribosomal DNA (rDNA) was used to confirm the presence of the predominant groups indicated by phenotypic analysis and to determine the phylogenetic affiliation of representative strains. The virtually complete 16S rRNA gene was PCR amplified and sequenced. The sequences from the various LAB isolates showed high degrees of similarity to those of the GenBank reference strains (between 98.7 and 99.8%). Phylogenetic trees based on the 16S rDNA sequence displayed high consistency, with nodes supported by high bootstrap values. With the exception of one species, the genetic data was in agreement with the phenotypic identification. The prevalent LAB, predominantly homofermentative (66%), consisted of Lactobacillus plantarum (24%), Lactococcus lactis (22%), Leuconostoc pseudomesenteroides (20%), Pediococcus acidilactici (11%), Lactobacillus brevis (11%), Enterococcus faecalis (7%), Weissella kimchii (3%), and Pediococcus pentosaceus (2%). The present study, the first to fully document rice-associated LAB, showed a very diverse community of LAB with a relatively high number of species involved in the fermentation process of paddy rice silage. The comprehensive 16S rDNA-based approach to describing LAB community structure was valuable in revealing the large diversity of bacteria inhabiting paddy rice silage and enabling the future design of appropriate inoculants aimed at improving its fermentation quality. PMID:12514026

  2. Whole-Genome Sequencing of Kaposi's Sarcoma-Associated Herpesvirus from Zambian Kaposi's Sarcoma Biopsy Specimens Reveals Unique Viral Diversity

    PubMed Central

    Olp, Landon N.; Jeanniard, Adrien; Marimo, Clemence; West, John T.

    2015-01-01

    ABSTRACT Kaposi's sarcoma-associated herpesvirus (KSHV) is the etiological agent for Kaposi's sarcoma (KS). Both KSHV and KS are endemic in sub-Saharan Africa where approximately 84% of global KS cases occur. Nevertheless, whole-genome sequencing of KSHV has only been completed using isolates from Western countries—where KS is not endemic. The lack of whole-genome KSHV sequence data from the most clinically important geographical region, sub-Saharan Africa, represents an important gap since it remains unclear whether genomic diversity has a role on KSHV pathogenesis. We hypothesized that distinct KSHV genotypes might be present in sub-Saharan Africa compared to Western countries. Using a KSHV-targeted enrichment protocol followed by Illumina deep-sequencing, we generated and analyzed 16 unique Zambian, KS-derived, KSHV genomes. We enriched KSHV DNA over cellular DNA 1,851 to 18,235-fold. Enrichment provided coverage levels up to 24,740-fold; therefore, supporting highly confident polymorphism analysis. Multiple alignment of the 16 newly sequenced KSHV genomes showed low level variability across the entire central conserved region. This variability resulted in distinct phylogenetic clustering between Zambian KSHV genomic sequences and those derived from Western countries. Importantly, the phylogenetic segregation of Zambian from Western sequences occurred irrespective of inclusion of the highly variable genes K1 and K15. We also show that four genes within the more conserved region of the KSHV genome contained polymorphisms that partially, but not fully, contributed to the unique Zambian KSHV whole-genome phylogenetic structure. Taken together, our data suggest that the whole KSHV genome should be taken into consideration for accurate viral characterization. IMPORTANCE Our results represent the largest number of KSHV whole-genomic sequences published to date and the first time that multiple genomes have been sequenced from sub-Saharan Africa, a geographic area

  3. Ligation with nucleic acid sequence-based amplification.

    PubMed

    Ong, Carmichael; Tai, Warren; Sarma, Aartik; Opal, Steven M; Artenstein, Andrew W; Tripathi, Anubhav

    2012-01-01

    This work presents a novel method for detecting nucleic acid targets using a ligation step along with an isothermal, exponential amplification step. We use an engineered ssDNA with two variable regions on the ends, allowing us to design the probe for optimal reaction kinetics and primer binding. This two-part probe is ligated by T4 DNA Ligase only when both parts bind adjacently to the target. The assay demonstrates that the expected 72-nt RNA product appears only when the synthetic target, T4 ligase, and both probe fragments are present during the ligation step. An extraneous 38-nt RNA product also appears due to linear amplification of unligated probe (P3), but its presence does not cause a false-positive result. In addition, 40 mmol/L KCl in the final amplification mix was found to be optimal. It was also found that increasing P5 in excess of P3 helped with ligation and reduced the extraneous 38-nt RNA product. The assay was also tested with a single nucleotide polymorphism target, changing one base at the ligation site. The assay was able to yield a negative signal despite only a single-base change. Finally, using P3 and P5 with longer binding sites results in increased overall sensitivity of the reaction, showing that increasing ligation efficiency can improve the assay overall. We believe that this method can be used effectively for a number of diagnostic assays. PMID:22449695

  4. The amino acid sequence of mitogenic lectin-B from the roots of pokeweed (Phytolacca americana).

    PubMed

    Yamaguchi, K; Yurino, N; Kino, M; Ishiguro, M; Funatsu, G

    1997-04-01

    The complete amino acid sequence of pokeweed lectin-B (PL-B) has been analyzed by first sequencing seven lysylendopeptidase peptides derived from the reduced and S-pyridylethylated PL-B and then connecting them by analyzing the arginylendopeptidase peptides from the reduced and S-carboxymethylated PL-B. PL-B consists of 295 amino acid residues and two oligosaccharides linked to Asn96 and Asn139, and has a molecular mass of 34,493 Da. PL-B is composed of seven repetitive chitin-binding domains having 48-79% sequence homology with each other. Twelve amino acid residues including eight cysteine residues in these domains are absolutely conserved in all other chitin-binding domains of plant lectins and class I chitinases. Also, it was strongly suggested that the extremely high hemagglutinating and mitogenic activities of PL-B may be ascribed to its seven-domain structure.

  5. ConSurf 2010: calculating evolutionary conservation in sequence and structure of proteins and nucleic acids.

    PubMed

    Ashkenazy, Haim; Erez, Elana; Martz, Eric; Pupko, Tal; Ben-Tal, Nir

    2010-07-01

    It is informative to detect highly conserved positions in proteins and nucleic acid sequence/structure since they are often indicative of structural and/or functional importance. ConSurf (http://consurf.tau.ac.il) and ConSeq (http://conseq.tau.ac.il) are two well-established web servers for calculating the evolutionary conservation of amino acid positions in proteins using an empirical Bayesian inference, starting from protein structure and sequence, respectively. Here, we present the new version of the ConSurf web server that combines the two independent servers, providing an easier and more intuitive step-by-step interface, while offering the user more flexibility during the process. In addition, the new version of ConSurf calculates the evolutionary rates for nucleic acid sequences. The new version is freely available at: http://consurf.tau.ac.il/.

  6. Morphological and sequence-related amplified polymorphism-based molecular diversity of local and exotic wheat genotypes.

    PubMed

    Abdelkhalik, S M; Salem, A K M; Abdelaziz, A R; Ammar, M H

    2016-04-28

    Assessing genetic diversity is a prerequisite for the genetic improvement of wheat. Molecular markers offer accurate and reproducible means for assessing genetic diversity. Field performance and sequence-related amplified polymorphism (SRAP)-based assessment of molecular diversity was carried out on a set of 10 local and introduced bread wheat (Triticum sativum L.) genotypes grown in the middle arid region of Saudi Arabia. The results revealed highly significant differences among the studied phenological traits and revealed a significant amount of genetic diversity across the tested genotypes. The overall performance revealed the superiority of KSU 102 in terms of yield and its components, with a yield potential of 8.7 tons/ha. Highly significant and positive correlations were observed among grain yield and biological yield, and also, spike length and spike weight. Thirteen SRAP primer combinations successfully amplified 954 fragments. The total number of genetic loci analyzed was 312. The overall polymorphism ratio was 99.67%, ranging from 98 to 100%. The polymorphic information content values ranged from 0.67 for ME11 x EM5 to 0.97 for ME9 x EM4 and ME11 x EM6, respectively. The wheat genotypes were clustered based on their genetic constitution and origin. The results demonstrate the power of SRAP primers for detecting molecular diversity and for varietal discrimination. The results show that high levels of genetic diversity exist, and suggest the potential of the tested materials for wheat crop improvement in the arid central region of Saudi Arabia.

  7. Amino acid repeats cause extraordinary coding sequence variation in the social amoeba Dictyostelium discoideum.

    PubMed

    Scala, Clea; Tian, Xiangjun; Mehdiabadi, Natasha J; Smith, Margaret H; Saxer, Gerda; Stephens, Katie; Buzombo, Prince; Strassmann, Joan E; Queller, David C

    2012-01-01

    Protein sequences are normally the most conserved elements of genomes owing to purifying selection to maintain their functions. We document an extraordinary amount of within-species protein sequence variation in the model eukaryote Dictyostelium discoideum stemming from triplet DNA repeats coding for long strings of single amino acids. D. discoideum has a very large number of such strings, many of which are polyglutamine repeats, the same sequence that causes various human neurological disorders in humans, like Huntington's disease. We show here that D. discoideum coding repeat loci are highly variable among individuals, making D. discoideum a candidate for the most variable proteome. The coding repeat loci are not significantly less variable than similar non-coding triplet repeats. This pattern is consistent with these amino-acid repeats being largely non-functional sequences evolving primarily by mutation and drift. PMID:23029418

  8. Conservation of Shannon's redundancy for proteins. [information theory applied to amino acid sequences

    NASA Technical Reports Server (NTRS)

    Gatlin, L. L.

    1974-01-01

    Concepts of information theory are applied to examine various proteins in terms of their redundancy in natural originators such as animals and plants. The Monte Carlo method is used to derive information parameters for random protein sequences. Real protein sequence parameters are compared with the standard parameters of protein sequences having a specific length. The tendency of a chain to contain some amino acids more frequently than others and the tendency of a chain to contain certain amino acid pairs more frequently than other pairs are used as randomness measures of individual protein sequences. Non-periodic proteins are generally found to have random Shannon redundancies except in cases of constraints due to short chain length and genetic codes. Redundant characteristics of highly periodic proteins are discussed. A degree of periodicity parameter is derived.

  9. Shark myoglobins. II. Isolation, characterization and amino acid sequence of myoglobin from Galeorhinus japonicus.

    PubMed

    Suzuki, T; Suzuki, T; Yata, T

    1985-01-01

    Native oxymyoglobin (MbO2) was isolated from red muscle of G. japonicus by chromatographic separation from metmyoglobin (metMb) on DEAE-cellulose and the amino acid sequence of the major chain was determined with the aid of sequence homology with that of G. australis. It was shown to differ in amino acid sequence from that of G. australis by 10 replacements, to be acetylated at the amino terminus and to contain glutamine at the distal (E7) residue. It was also shown to have a spectrum very similar to that of mammalian MbO2. However, the pH-dependence for the autoxidation of MbO2 was seen to be quite different from that of sperm whale (Physeter catodon) MbO2. Although the sequence homology between sperm whale and G. japonicus myoglobins is about 40%, their hydropathy profiles were very similar, indicating that they have a similar geometry in their globin folding.

  10. Semiconductor Sequencing Reveals the Diversity of Bacterial Communities in an Amazon Reservoir Considered as a Methane Source

    NASA Astrophysics Data System (ADS)

    Graças, D. A.; Ramos, R. T.; Sá, P. G.; Baraúna, R. A.; Schneider, M. C.; Silva, A.

    2013-05-01

    The Amazon region has enormous hydro potential which is used for power generation. In fact, there are several hydroelectric power stations (HPS) already installed and many under construction or designed. It's in the Amazon which the HPS of Tucuruí, fifth largest in the world, is located. The construction of this hydroelectric dam flooded an area of 2,400 km2 of forest that decomposing, releasing greenhouse gases such as methane (CH4). Methane is the most abundant organic gas in the atmosphere and the second most important greenhouse gas. In this study, we use semicondutor sequencing to assess the bacterial diversity along a water column of 70 meters deep in the Tucuruí reservoir. One liter of water was collected every 10 meters along the water column for total DNA extraction. A fragment of approximately 150 base pairs of the 16S rRNA gene was amplified by polymerase chain reaction using universal primers. These fragments were then paralleled sequenced in Ion Torrent® platform using barcodes on the 316 chip. After the quality filters, about 237 thousands reads were obtained, representing more than 300 Mbp. For bacterial diversity analysis, we used only reads longer than 100 base pairs. The taxonomic diversity was obtained from the Ribosomal Database Project Classifier and alpha diversity analysis (diversity indices and rarefaction) was performed using the RDP pyrosequencing pipeline. Although it is recommended for data pyrosequencing, that pipeline is able to process data obtained from semiconductor sequencing once all of them are fasta files. Over 75% of the sequences were not classified in any phylum, which leads us to believe that there is a huge diversity in the bacterial environment whose function is still unclear. Among the sequences that could be classified, there is a predominance of proteobacteria in all layers, but in higher concentrations at the lower layers. Cyanobacteria accounted for about 3% in the layers of 0m and 10m, leading us to conclude that

  11. Estimates of Soil Bacterial Ribosome Content and Diversity Are Significantly Affected by the Nucleic Acid Extraction Method Employed

    PubMed Central

    Wüst, Pia K.; Nacke, Heiko; Kaiser, Kristin; Marhan, Sven; Sikorski, Johannes; Kandeler, Ellen; Daniel, Rolf

    2016-01-01

    Modern sequencing technologies allow high-resolution analyses of total and potentially active soil microbial communities based on their DNA and RNA, respectively. In the present study, quantitative PCR and 454 pyrosequencing were used to evaluate the effects of different extraction methods on the abundance and diversity of 16S rRNA genes and transcripts recovered from three different types of soils (leptosol, stagnosol, and gleysol). The quality and yield of nucleic acids varied considerably with respect to both the applied extraction method and the analyzed type of soil. The bacterial ribosome content (calculated as the ratio of 16S rRNA transcripts to 16S rRNA genes) can serve as an indicator of the potential activity of bacterial cells and differed by 2 orders of magnitude between nucleic acid extracts obtained by the various extraction methods. Depending on the extraction method, the relative abundances of dominant soil taxa, in particular Actinobacteria and Proteobacteria, varied by a factor of up to 10. Through this systematic approach, the present study allows guidelines to be deduced for the selection of the appropriate extraction protocol according to the specific soil properties, the nucleic acid of interest, and the target organisms. PMID:26896137

  12. Conversion of amino-acid sequence in proteins to classical music: search for auditory patterns

    PubMed Central

    2007-01-01

    We have converted genome-encoded protein sequences into musical notes to reveal auditory patterns without compromising musicality. We derived a reduced range of 13 base notes by pairing similar amino acids and distinguishing them using variations of three-note chords and codon distribution to dictate rhythm. The conversion will help make genomic coding sequences more approachable for the general public, young children, and vision-impaired scientists. PMID:17477882

  13. Deep sequencing extends the diversity of human papillomaviruses in human skin.

    PubMed

    Bzhalava, Davit; Mühr, Laila Sara Arroyo; Lagheden, Camilla; Ekström, Johanna; Forslund, Ola; Dillner, Joakim; Hultin, Emilie

    2014-07-24

    Most viruses in human skin are known to be human papillomaviruses (HPVs). Previous sequencing of skin samples has identified 273 different cutaneous HPV types, including 47 previously unknown types. In the present study, we wished to extend prior studies using deeper sequencing. This deeper sequencing without prior PCR of a pool of 142 whole genome amplified skin lesions identified 23 known HPV types, 3 novel putative HPV types and 4 non-HPV viruses. The complete sequence was obtained for one of the known putative types and almost the complete sequence was obtained for one of the novel putative types. In addition, sequencing of amplimers from HPV consensus PCR of 326 skin lesions detected 385 different HPV types, including 226 previously unknown putative types. In conclusion, metagenomic deep sequencing of human skin samples identified no less than 396 different HPV types in human skin, out of which 229 putative HPV types were previously unknown.

  14. Visible sensing of nucleic acid sequences using a genetically encodable unmodified mRNA probe.

    PubMed

    Narita, Atsushi; Ogawa, Kazumasa; Sando, Shinsuke; Aoyama, Yasuhiro

    2006-01-01

    We previously reported a molecular beacon-mRNA (MB-mRNA) strategy for nucleic acid detection/sensing in a cell-free translation system using unmodified RNA as a probe. Here in this presentation, we report that a combination with RNase H activity, which induces an additional process of irreversible cleavage of MB-domain, achieves an improved sequence selectivity (one nucleotide selectivity) and an enhanced sensitivity. This improved system finally enabled visible sensing of target nucleic acid sequence at a single nucleotide resolution under isothermal conditions.

  15. IMGT/HighV-QUEST Statistical Significance of IMGT Clonotype (AA) Diversity per Gene for Standardized Comparisons of Next Generation Sequencing Immunoprofiles of Immunoglobulins and T Cell Receptors.

    PubMed

    Aouinti, Safa; Malouche, Dhafer; Giudicelli, Véronique; Kossida, Sofia; Lefranc, Marie-Paule

    2015-01-01

    The adaptive immune responses of humans and of other jawed vertebrate species (gnasthostomata) are characterized by the B and T cells and their specific antigen receptors, the immunoglobulins (IG) or antibodies and the T cell receptors (TR) (up to 2.1012 different IG and TR per individual). IMGT, the international ImMunoGeneTics information system (http://www.imgt.org), was created in 1989 by Marie-Paule Lefranc (Montpellier University and CNRS) to manage the huge and complex diversity of these antigen receptors. IMGT built on IMGT-ONTOLOGY concepts of identification (keywords), description (labels), classification (gene and allele nomenclature) and numerotation (IMGT unique numbering), is at the origin of immunoinformatics, a science at the interface between immunogenetics and bioinformatics. IMGT/HighV-QUEST, the first web portal, and so far the only one, for the next generation sequencing (NGS) analysis of IG and TR, is the paradigm for immune repertoire standardized outputs and immunoprofiles of the adaptive immune responses. It provides the identification of the variable (V), diversity (D) and joining (J) genes and alleles, analysis of the V-(D)-J junction and complementarity determining region 3 (CDR3) and the characterization of the 'IMGT clonotype (AA)' (AA for amino acid) diversity and expression. IMGT/HighV-QUEST compares outputs of different batches, up to one million nucleotide sequencesfor the statistical module. These high throughput IG and TR repertoire immunoprofiles are of prime importance in vaccination, cancer, infectious diseases, autoimmunity and lymphoproliferative disorders, however their comparative statistical analysis still remains a challenge. We present a standardized statistical procedure to analyze IMGT/HighV-QUEST outputs for the evaluation of the significance of the IMGT clonotype (AA) diversity differences in proportions, per gene of a given group, between NGS IG and TR repertoire immunoprofiles. The procedure is generic and

  16. Compare Identity By Sequence Relationships of the Ames Diversity Panel using TYPSimSelector [abstract

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Maize genetic diversity has been exploited by mankind for 10,000 years. Scientific approaches applied to it by breeders for over a century transformed it into the world’s number one crop. Maize genomic diversity provides a rich resource of interest to evolutionary and population geneticists, constit...

  17. Genetic diversity and molecular evolution of Naga King Chili inferred from internal transcribed spacer sequence of nuclear ribosomal DNA.

    PubMed

    Kehie, Mechuselie; Kumaria, Suman; Devi, Khumuckcham Sangeeta; Tandon, Pramod

    2016-02-01

    Sequences of the Internal Transcribed Spacer (ITS1-5.8S-ITS2) of nuclear ribosomal DNAs were explored to study the genetic diversity and molecular evolution of Naga King Chili. Our study indicated the occurrence of nucleotide polymorphism and haplotypic diversity in the ITS regions. The present study demonstrated that the variability of ITS1 with respect to nucleotide diversity and sequence polymorphism exceeded that of ITS2. Sequence analysis of 5.8S gene revealed a much conserved region in all the accessions of Naga King Chili. However, strong phylogenetic information of this species is the distinct 13 bp deletion in the 5.8S gene which discriminated Naga King Chili from the rest of the Capsicum sp. Neutrality test results implied a neutral variation, and population seems to be evolving at drift-mutation equilibrium and free from directed selection pressure. Furthermore, mismatch analysis showed multimodal curve indicating a demographic equilibrium. Phylogenetic relationships revealed by Median Joining Network (MJN) analysis denoted a clear discrimination of Naga King Chili from its closest sister species (Capsicum chinense and Capsicum frutescens). The absence of star-like network of haplotypes suggested an ancient population expansion of this chili. PMID:26862481

  18. Massively parallel rRNA gene sequencing exacerbates the potential for biased community diversity comparisons due to variable library sizes

    SciTech Connect

    Gihring, Thomas; Green, Stefan; Schadt, Christopher Warren

    2011-01-01

    Technologies for massively parallel sequencing are revolutionizing microbial ecology and are vastly increasing the scale of ribosomal RNA (rRNA) gene studies. Although pyrosequencing has increased the breadth and depth of possible rRNA gene sampling, one drawback is that the number of reads obtained per sample is difficult to control. Pyrosequencing libraries typically vary widely in the number of sequences per sample, even within individual studies, and there is a need to revisit the behaviour of richness estimators and diversity indices with variable gene sequence library sizes. Multiple reports and review papers have demonstrated the bias in non-parametric richness estimators (e.g. Chao1 and ACE) and diversity indices when using clone libraries. However, we found that biased community comparisons are accumulating in the literature. Here we demonstrate the effects of sample size on Chao1, ACE, CatchAll, Shannon, Chao-Shen and Simpson's estimations specifically using pyrosequencing libraries. The need to equalize the number of reads being compared across libraries is reiterated, and investigators are directed towards available tools for making unbiased diversity comparisons.

  19. Deep COI sequencing of standardized benthic samples unveils overlooked diversity of Jordanian coral reefs in the northern Red Sea.

    PubMed

    Al-Rshaidat, Mamoon M D; Snider, Allison; Rosebraugh, Sydney; Devine, Amanda M; Devine, Thomas D; Plaisance, Laetitia; Knowlton, Nancy; Leray, Matthieu

    2016-09-01

    High-throughput sequencing (HTS) of DNA barcodes (metabarcoding), particularly when combined with standardized sampling protocols, is one of the most promising approaches for censusing overlooked cryptic invertebrate communities. We present biodiversity estimates based on sequencing of the cytochrome c oxidase subunit 1 (COI) gene for coral reefs of the Gulf of Aqaba, a semi-enclosed system in the northern Red Sea. Samples were obtained from standardized sampling devices (Autonomous Reef Monitoring Structures (ARMS)) deployed for 18 months. DNA barcoding of non-sessile specimens >2 mm revealed 83 OTUs in six phyla, of which only 25% matched a reference sequence in public databases. Metabarcoding of the 2 mm - 500 μm and sessile bulk fractions revealed 1197 OTUs in 15 animal phyla, of which only 4.9% matched reference barcodes. These results highlight the scarcity of COI data for cryptobenthic organisms of the Red Sea. Compared with data obtained using similar methods, our results suggest that Gulf of Aqaba reefs are less diverse than two Pacific coral reefs but much more diverse than an Atlantic oyster reef at a similar latitude. The standardized approaches used here show promise for establishing baseline data on biodiversity, monitoring the impacts of environmental change, and quantifying patterns of diversity at regional and global scales. PMID:27584940

  20. Genetic diversity and molecular evolution of Naga King Chili inferred from internal transcribed spacer sequence of nuclear ribosomal DNA

    PubMed Central

    Kehie, Mechuselie; Kumaria, Suman; Devi, Khumuckcham Sangeeta; Tandon, Pramod

    2015-01-01

    Sequences of the Internal Transcribed Spacer (ITS1-5.8S-ITS2) of nuclear ribosomal DNAs were explored to study the genetic diversity and molecular evolution of Naga King Chili. Our study indicated the occurrence of nucleotide polymorphism and haplotypic diversity in the ITS regions. The present study demonstrated that the variability of ITS1 with respect to nucleotide diversity and sequence polymorphism exceeded that of ITS2. Sequence analysis of 5.8S gene revealed a much conserved region in all the accessions of Naga King Chili. However, strong phylogenetic information of this species is the distinct 13 bp deletion in the 5.8S gene which discriminated Naga King Chili from the rest of the Capsicum sp. Neutrality test results implied a neutral variation, and population seems to be evolving at drift–mutation equilibrium and free from directed selection pressure. Furthermore, mismatch analysis showed multimodal curve indicating a demographic equilibrium. Phylogenetic relationships revealed by Median Joining Network (MJN) analysis denoted a clear discrimination of Naga King Chili from its closest sister species (Capsicumchinense and Capsicumfrutescens). The absence of star-like network of haplotypes suggested an ancient population expansion of this chili. PMID:26862481

  1. Diverse and dynamic populations of cyanobacterial podoviruses in the Chesapeake Bay unveiled through DNA polymerase gene sequences.

    PubMed

    Chen, Feng; Wang, Kui; Huang, Sijun; Cai, Haiyuan; Zhao, Meiru; Jiao, Nianzhi; Wommack, K Eric

    2009-11-01

    Many podoviruses have been isolated which infect marine picocyanobacteria, and they may play a potentially important role in regulating the biomass and population composition of picocyanobacteria. However, little is known about the diversity and population dynamics of autochthonous cyanopodoviruses in marine environments. Using a set of newly designed PCR primers which specifically amplify the DNA pol from cyanopodoviruses, a total of 221 DNA pol sequences were retrieved from eight Chesapeake Bay virioplankton communities collected at different times and locations. All DNA pol sequences clustered with the eight known podoviruses that infect different marine picocyanobacteria, and could be divided into at least 10 different subclusters (I-X). The presence of these cyanopodovirus genotypes based on PCR-amplification of DNA pol gene sequences was supported by the existence of similar DNA pol genotypes with metagenome libraries of Chesapeake Bay virioplankton assemblages. The composition of cyanopodoviruses in the Bay also exhibited distinct winter and summer patterns which were likely related to corresponding seasonal changes in the composition of cyanobacterial populations. Our study suggests that diverse and dynamic populations of cyanopodoviruses are present in the estuarine environment. The PCR method developed in this study provides a specific and sensitive tool to explore the abundance, distribution and phylogenetic diversity of cyanopodoviruses in aquatic environments. Linking the dynamics of host and viral populations in the natural environment is critical to broader characterization of the ecological role of virioplankton within microbial communities.

  2. Deep COI sequencing of standardized benthic samples unveils overlooked diversity of Jordanian coral reefs in the northern Red Sea.

    PubMed

    Al-Rshaidat, Mamoon M D; Snider, Allison; Rosebraugh, Sydney; Devine, Amanda M; Devine, Thomas D; Plaisance, Laetitia; Knowlton, Nancy; Leray, Matthieu

    2016-09-01

    High-throughput sequencing (HTS) of DNA barcodes (metabarcoding), particularly when combined with standardized sampling protocols, is one of the most promising approaches for censusing overlooked cryptic invertebrate communities. We present biodiversity estimates based on sequencing of the cytochrome c oxidase subunit 1 (COI) gene for coral reefs of the Gulf of Aqaba, a semi-enclosed system in the northern Red Sea. Samples were obtained from standardized sampling devices (Autonomous Reef Monitoring Structures (ARMS)) deployed for 18 months. DNA barcoding of non-sessile specimens >2 mm revealed 83 OTUs in six phyla, of which only 25% matched a reference sequence in public databases. Metabarcoding of the 2 mm - 500 μm and sessile bulk fractions revealed 1197 OTUs in 15 animal phyla, of which only 4.9% matched reference barcodes. These results highlight the scarcity of COI data for cryptobenthic organisms of the Red Sea. Compared with data obtained using similar methods, our results suggest that Gulf of Aqaba reefs are less diverse than two Pacific coral reefs but much more diverse than an Atlantic oyster reef at a similar latitude. The standardized approaches used here show promise for establishing baseline data on biodiversity, monitoring the impacts of environmental change, and quantifying patterns of diversity at regional and global scales.

  3. Amino acid and cDNA sequences of lysozyme from Hyalophora cecropia

    PubMed Central

    Engström, Å.; Xanthopoulos, K. G.; Boman, H. G.; Bennich, H.

    1985-01-01

    The amino acid and cDNA sequences of lysozyme from the giant silk moth Hyalophora cecropia have been determined. This enzyme is one of several immune proteins produced by the diapausing pupae after injection of bacteria. Cecropia lysozyme is composed of 120 amino acids, has a mol. wt. of 13.8 kd and shows great similarity with vertebrate lysozymes of the chicken type. The amino acid residues responsible for the catalytic activity and for the binding of substrate are essentially conserved. Three allelic variants of the Cecropia enzyme are identified. A comparison of the chicken and the Cecropia lysozymes shows that there is a 40% identity at both the amino acid and the nucleotide level. Some evolutionary aspects of the sequence data are discussed. PMID:16453632

  4. Genome Sequencing of Mycobacterium abscessus Isolates from Patients in the United States and Comparisons to Globally Diverse Clinical Strains

    PubMed Central

    Davidson, Rebecca M.; Hasan, Nabeeh A.; Reynolds, Paul R.; Totten, Sarah; Garcia, Benjamin; Levin, Adrah; Ramamoorthy, Preveen; Heifets, Leonid; Daley, Charles L.

    2014-01-01

    Nontuberculous mycobacterial infections caused by Mycobacterium abscessus are responsible for a range of disease manifestations from pulmonary to skin infections and are notoriously difficult to treat, due to innate resistance to many antibiotics. Previous population studies of clinical M. abscessus isolates utilized multilocus sequence typing or pulsed-field gel electrophoresis, but high-resolution examinations of genetic diversity at the whole-genome level have not been well characterized, particularly among clinical isolates derived in the United States. We performed whole-genome sequencing of 11 clinical M. abscessus isolates derived from eight U.S. patients with pulmonary nontuberculous mycobacterial infections, compared them to 30 globally diverse clinical isolates, and investigated intrapatient genomic diversity and evolution. Phylogenomic analyses revealed a cluster of closely related U.S. and Western European M. abscessus subsp. abscessus isolates that are genetically distinct from other European isolates and all Asian isolates. Large-scale variation analyses suggested genome content differences of 0.3 to 8.3%, relative to the reference strain ATCC 19977T. Longitudinally sampled isolates showed very few single-nucleotide polymorphisms and correlated genomic deletion patterns, suggesting homogeneous infection populations. Our study explores the genomic diversity of clinical M. abscessus strains from multiple continents and provides insight into the genome plasticity of an opportunistic pathogen. PMID:25056330

  5. Genome sequencing of Mycobacterium abscessus isolates from patients in the united states and comparisons to globally diverse clinical strains.

    PubMed

    Davidson, Rebecca M; Hasan, Nabeeh A; Reynolds, Paul R; Totten, Sarah; Garcia, Benjamin; Levin, Adrah; Ramamoorthy, Preveen; Heifets, Leonid; Daley, Charles L; Strong, Michael

    2014-10-01

    Nontuberculous mycobacterial infections caused by Mycobacterium abscessus are responsible for a range of disease manifestations from pulmonary to skin infections and are notoriously difficult to treat, due to innate resistance to many antibiotics. Previous population studies of clinical M. abscessus isolates utilized multilocus sequence typing or pulsed-field gel electrophoresis, but high-resolution examinations of genetic diversity at the whole-genome level have not been well characterized, particularly among clinical isolates derived in the United States. We performed whole-genome sequencing of 11 clinical M. abscessus isolates derived from eight U.S. patients with pulmonary nontuberculous mycobacterial infections, compared them to 30 globally diverse clinical isolates, and investigated intrapatient genomic diversity and evolution. Phylogenomic analyses revealed a cluster of closely related U.S. and Western European M. abscessus subsp. abscessus isolates that are genetically distinct from other European isolates and all Asian isolates. Large-scale variation analyses suggested genome content differences of 0.3 to 8.3%, relative to the reference strain ATCC 19977(T). Longitudinally sampled isolates showed very few single-nucleotide polymorphisms and correlated genomic deletion patterns, suggesting homogeneous infection populations. Our study explores the genomic diversity of clinical M. abscessus strains from multiple continents and provides insight into the genome plasticity of an opportunistic pathogen. PMID:25056330

  6. Four novel papillomavirus sequences support a broad diversity among equine papillomaviruses.

    PubMed

    Lange, Christian E; Vetsch, Elisabeth; Ackermann, Mathias; Favrot, Claude; Tobler, Kurt

    2013-06-01

    Papillomaviruses appear to be species-specific pathogens, and it was suggested that each animal species might harbour its own set of papillomaviruses. However, all approaches addressing the underlying evolutionary phenomena still suffer from very limited data about animal papillomaviruses. In case of the horse for example, only three equine papillomaviruses (EcPVs) have been identified. To further address the situation in this host, suspected papillomavirus-associated lesions were tested for EcPV DNA. Four novel EcPV types were detected and their genomes entirely cloned and sequenced. They display the characteristic organization, with early (E) and late (L) regions harbouring the seven classical open reading frames divided by non-coding regions. They were named EcPVs 4, 5, 6 and 7, according to their dissimilarity to other papillomaviruses. Most L1 nucleotide identities were shared with EcPV2 in case of EcPV4 (62 %) and EcPV5 (60 %) or with EcPV3 in case of EcPV6 (70 %) and EcPV7 (71 %). Thus, EcPVs 4 and 5 may establish novel species within the genus Dyoiota, while EcPVs 6 and 7 might fit into the genus Dyorho and belong to the same species as EcPV3. They were found in genital plaques (EcPV4), aural plaques (EcPV5, EcPV6) or penile masses (EcPV7). Interestingly, PCR analysis revealed the DNA of EcPV2 and EcPV4 as well as of EcPV3 and EcPV6 together in the same tissue samples, respectively. In conclusion, the DNA of four novel EcPV types was identified and cloned. They cluster with the known types and support broad genetic EcPV diversity in at least two of the known clades. Furthermore, PCR assays also provide evidence for EcPV co-infections in horses.

  7. Draft genome sequence of the docosahexaenoic acid producing thraustochytrid Aurantiochytrium sp. T66.

    PubMed

    Liu, Bin; Ertesvåg, Helga; Aasen, Inga Marie; Vadstein, Olav; Brautaset, Trygve; Heggeset, Tonje Marita Bjerkan

    2016-06-01

    Thraustochytrids are unicellular, marine protists, and there is a growing industrial interest in these organisms, particularly because some species, including strains belonging to the genus Aurantiochytrium, accumulate high levels of docosahexaenoic acid (DHA). Here, we report the draft genome sequence of Aurantiochytrium sp. T66 (ATCC PRA-276), with a size of 43 Mbp, and 11,683 predicted protein-coding sequences. The data has been deposited at DDBJ/EMBL/Genbank under the accession LNGJ00000000. The genome sequence will contribute new insight into DHA biosynthesis and regulation, providing a basis for metabolic engineering of thraustochytrids. PMID:27222814

  8. Draft genome sequence of the docosahexaenoic acid producing thraustochytrid Aurantiochytrium sp. T66.

    PubMed

    Liu, Bin; Ertesvåg, Helga; Aasen, Inga Marie; Vadstein, Olav; Brautaset, Trygve; Heggeset, Tonje Marita Bjerkan

    2016-06-01

    Thraustochytrids are unicellular, marine protists, and there is a growing industrial interest in these organisms, particularly because some species, including strains belonging to the genus Aurantiochytrium, accumulate high levels of docosahexaenoic acid (DHA). Here, we report the draft genome sequence of Aurantiochytrium sp. T66 (ATCC PRA-276), with a size of 43 Mbp, and 11,683 predicted protein-coding sequences. The data has been deposited at DDBJ/EMBL/Genbank under the accession LNGJ00000000. The genome sequence will contribute new insight into DHA biosynthesis and regulation, providing a basis for metabolic engineering of thraustochytrids.

  9. Molecular characterization and sequence diversity of genes encoding the large subunit of the ADP-glucose pyrophosphorylase in wheat (Triticum aestivum L.).

    PubMed

    Rose, Meghan K; Huang, Xiu-Qiang; Brûlé-Babel, Anita

    2016-02-01

    The large subunit of ADP glucose pyrophosphorylase (AGPase), the rate limiting enzyme in starch biosynthesis in Triticum aestivum L., is encoded by the ADP glucose pyrophosphorylase large subunit (AGP-L) gene. This was the first report on the development of three genome-specific primer sets for isolating the complete genomic sequence of all three homoeologous AGP-L genes on group 1 chromosomes. All three AGP-L genes consisted of 15 introns and 15 exons. The lengths of the structural genes from start to stop codon were 3334 bp for AGP-L-A1, 3351 bp for AGP-L-B1, and 3340 bp for AGP-L-D1. The coding region was 1569 bases long in all three genomes. All three AGP-L genes encoded 522 amino acid residues including the transit peptide sequences with 62 amino acid residues and the mature protein with 460 amino acid residues. The mature protein of three AGP-L genes was highly conserved. Three AGP-L genes were sequenced in 47 diverse spring and winter wheat genotypes. One and two haplotypes were found for AGP-L-D1 and AGP-L-A1, respectively. In total, 67 SNPs (single nucleotide polymorphisms) and 13 indels (insertions or deletions) forming five haplotypes were identified for AGP-L-B1. All 13 indels and 58 of the 67 SNPs among the 47 genotypes were located in the non-coding regions, while the remaining nine SNPs were synonymous substitutions in the coding region. Significant LD was found among the 45 SNPs and ten indels located from intron 2 to intron 3. Association analysis indicated that four SNPs were strongly associated with seed number per spike and thousand kernel weight.

  10. Distribution and diversity of Verrucomicrobia methanotrophs in geothermal and acidic environments.

    PubMed

    Sharp, Christine E; Smirnova, Angela V; Graham, Jaime M; Stott, Matthew B; Khadka, Roshan; Moore, Tim R; Grasby, Stephen E; Strack, Maria; Dunfield, Peter F

    2014-06-01

    Recently, methanotrophic members of the phylum Verrucomicrobia have been described, but little is known about their distribution in nature. We surveyed methanotrophic bacteria in geothermal springs and acidic wetlands via pyrosequencing of 16S rRNA gene amplicons. Putative methanotrophic Verrucomicrobia were found in samples covering a broad temperature range (22.5-81.6°C), but only in acidic conditions (pH 1.8-5.0) and only in geothermal environments, not in acidic bogs or fens. Phylogenetically, three 16S rRNA gene sequence clusters of putative methanotrophic Verrucomicrobia were observed. Those detected in high-temperature geothermal samples (44.1-81.6°C) grouped with known thermoacidiphilic 'Methylacidiphilum' isolates. A second group dominated in moderate-temperature geothermal samples (22.5-40.1°C) and a representative mesophilic methanotroph from this group was isolated (strain LP2A). Genome sequencing verified that strain LP2A possessed particulate methane monooxygenase, but its 16S rRNA gene sequence identity to 'Methylacidiphilum infernorum' strain V4 was only 90.6%. A third group clustered distantly with known methanotrophic Verrucomicrobia. Using pmoA-gene targeted quantitative polymerase chain reaction, two geothermal soil profiles showed a dominance of LP2A-like pmoA sequences in the cooler surface layers and 'Methylacidiphilum'-like pmoA sequences in deeper, hotter layers. Based on these results, there appears to be a thermophilic group and a mesophilic group of methanotrophic Verrucomicrobia. However, both were detected only in acidic geothermal environments.

  11. In silico comparative analysis of DNA and amino acid sequences for prion protein gene.

    PubMed

    Kim, Y; Lee, J; Lee, C

    2008-01-01

    Genetic variability might contribute to species specificity of prion diseases in various organisms. In this study, structures of the prion protein gene (PRNP) and its amino acids were compared among species of which sequence data were available. Comparisons of PRNP DNA sequences among 12 species including human, chimpanzee, monkey, bovine, ovine, dog, mouse, rat, wallaby, opossum, chicken and zebrafish allowed us to identify candidate regulatory regions in intron 1 and 3'-untranslated region (UTR) in addition to the coding region. Highly conserved putative binding sites for transcription factors, such as heat shock factor 2 (HSF2) and myocite enhancer factor 2 (MEF2), were discovered in the intron 1. In 3'-UTR, the functional sequence (ATTAAA) for nucleus-specific polyadenylation was found in all the analysed species. The functional sequence (TTTTTAT) for maturation-specific polyadenylation was identically observed only in ovine, and one or two nucleotide mismatches in the other species. A comparison of the amino acid sequences in 53 species revealed a large sequence identity. Especially the octapeptide repeat region was observed in all the species but frog and zebrafish. Functional changes and susceptibility to prion diseases with various isoforms of prion protein could be caused by numeric variability and conformational changes discovered in the repeat sequences.

  12. AcalPred: a sequence-based tool for discriminating between acidic and alkaline enzymes.

    PubMed

    Lin, Hao; Chen, Wei; Ding, Hui

    2013-01-01

    The structure and activity of enzymes are influenced by pH value of their surroundings. Although many enzymes work well in the pH range from 6 to 8, some specific enzymes have good efficiencies only in acidic (pH<5) or alkaline (pH>9) solution. Studies have demonstrated that the activities of enzymes correlate with their primary sequences. It is crucial to judge enzyme adaptation to acidic or alkaline environment from its amino acid sequence in molecular mechanism clarification and the design of high efficient enzymes. In this study, we developed a sequence-based method to discriminate acidic enzymes from alkaline enzymes. The analysis of variance was used to choose the optimized discriminating features derived from g-gap dipeptide compositions. And support vector machine was utilized to establish the prediction model. In the rigorous jackknife cross-validation, the overall accuracy of 96.7% was achieved. The method can correctly predict 96.3% acidic and 97.1% alkaline enzymes. Through the comparison between the proposed method and previous methods, it is demonstrated that the proposed method is more accurate. On the basis of this proposed method, we have built an online web-server called AcalPred which can be freely accessed from the website (http://lin.uestc.edu.cn/server/AcalPred). We believe that the AcalPred will become a powerful tool to study enzyme adaptation to acidic or alkaline environment.

  13. AcalPred: A Sequence-Based Tool for Discriminating between Acidic and Alkaline Enzymes

    PubMed Central

    Lin, Hao; Chen, Wei; Ding, Hui

    2013-01-01

    The structure and activity of enzymes are influenced by pH value of their surroundings. Although many enzymes work well in the pH range from 6 to 8, some specific enzymes have good efficiencies only in acidic (pH<5) or alkaline (pH>9) solution. Studies have demonstrated that the activities of enzymes correlate with their primary sequences. It is crucial to judge enzyme adaptation to acidic or alkaline environment from its amino acid sequence in molecular mechanism clarification and the design of high efficient enzymes. In this study, we developed a sequence-based method to discriminate acidic enzymes from alkaline enzymes. The analysis of variance was used to choose the optimized discriminating features derived from g-gap dipeptide compositions. And support vector machine was utilized to establish the prediction model. In the rigorous jackknife cross-validation, the overall accuracy of 96.7% was achieved. The method can correctly predict 96.3% acidic and 97.1% alkaline enzymes. Through the comparison between the proposed method and previous methods, it is demonstrated that the proposed method is more accurate. On the basis of this proposed method, we have built an online web-server called AcalPred which can be freely accessed from the website (http://lin.uestc.edu.cn/server/AcalPred). We believe that the AcalPred will become a powerful tool to study enzyme adaptation to acidic or alkaline environment. PMID:24130738

  14. Development of Genomic Microsatellite Markers in Carthamus tinctorius L. (Safflower) Using Next Generation Sequencing and Assessment of Their Cross-Species Transferability and Utility for Diversity Analysis

    PubMed Central

    Variath, Murali Tottekkad; Joshi, Gopal; Bali, Sapinder; Agarwal, Manu; Kumar, Amar; Jagannath, Arun; Goel, Shailendra

    2015-01-01

    Background Safflower (Carthamus tinctorius L.), an Asteraceae member, yields high quality edible oil rich in unsaturated fatty acids and is resilient to dry conditions. The crop holds tremendous potential for improvement through concerted molecular breeding programs due to the availability of significant genetic and phenotypic diversity. Genomic resources that could facilitate such breeding programs remain largely underdeveloped in the crop. The present study was initiated to develop a large set of novel microsatellite markers for safflower using next generation sequencing. Principal Findings Low throughput genome sequencing of safflower was performed using Illumina paired end technology providing ~3.5X coverage of the genome. Analysis of sequencing data allowed identification of 23,067 regions harboring perfect microsatellite loci. The safflower genome was found to be rich in dinucleotide repeats followed by tri-, tetra-, penta- and hexa-nucleotides. Primer pairs were designed for 5,716 novel microsatellite sequences with repeat length ≥ 20 bases and optimal flanking regions. A subset of 325 microsatellite loci was tested for amplification, of which 294 loci produced robust amplification. The validated primers were used for assessment of 23 safflower accessions belonging to diverse agro-climatic zones of the world leading to identification of 93 polymorphic primers (31.6%). The numbers of observed alleles at each locus ranged from two to four and mean polymorphism information content was found to be 0.3075. The polymorphic primers were tested for cross-species transferability on nine wild relatives of cultivated safflower. All primers except one showed amplification in at least two wild species while 25 primers amplified across all the nine species. The UPGMA dendrogram clustered C. tinctorius accessions and wild species separately into two major groups. The proposed progenitor species of safflower, C. oxyacantha and C. palaestinus were genetically closer to

  15. Antibody-specific model of amino acid substitution for immunological inferences from alignments of antibody sequences.

    PubMed

    Mirsky, Alexander; Kazandjian, Linda; Anisimova, Maria

    2015-03-01

    Antibodies are glycoproteins produced by the immune system as a dynamically adaptive line of defense against invading pathogens. Very elegant and specific mutational mechanisms allow B lymphocytes to produce a large and diversified repertoire of antibodies, which is modified and enhanced throughout all adulthood. One of these mechanisms is somatic hypermutation, which stochastically mutates nucleotides in the antibody genes, forming new sequences with different properties and, eventually, higher affinity and selectivity to the pathogenic target. As somatic hypermutation involves fast mutation of antibody sequences, this process can be described using a Markov substitution model of molecular evolution. Here, using large sets of antibody sequences from mice and humans, we infer an empirical amino acid substitution model AB, which is specific to antibody sequences. Compared with existing general amino acid models, we show that the AB model provides significantly better description for the somatic evolution of mice and human antibody sequences, as demonstrated on large next generation sequencing (NGS) antibody data. General amino acid models are reflective of conservation at the protein level due to functional constraints, with most frequent amino acids exchanges taking place between residues with the same or similar physicochemical properties. In contrast, within the variable part of antibody sequences we observed an elevated frequency of exchanges between amino acids with distinct physicochemical properties. This is indicative of a sui generis mutational mechanism, specific to antibody somatic hypermutation. We illustrate this property of antibody sequences by a comparative analysis of the network modularity implied by the AB model and general amino acid substitution models. We recommend using the new model for computational studies of antibody sequence maturation, including inference of alignments and phylogenetic trees describing antibody somatic hypermutation in

  16. Captured metagenomics: large-scale targeting of genes based on ‘sequence capture’ reveals functional diversity in soils

    PubMed Central

    Manoharan, Lokeshwaran; Kushwaha, Sandeep K.; Hedlund, Katarina; Ahrén, Dag

    2015-01-01

    Microbial enzyme diversity is a key to understand many ecosystem processes. Whole metagenome sequencing (WMG) obtains information on functional genes, but it is costly and inefficient due to large amount of sequencing that is required. In this study, we have applied a captured metagenomics technique for functional genes in soil microorganisms, as an alternative to WMG. Large-scale targeting of functional genes, coding for enzymes related to organic matter degradation, was applied to two agricultural soil communities through captured metagenomics. Captured metagenomics uses custom-designed, hybridization-based oligonucleotide probes that enrich functional genes of interest in metagenomic libraries where only probe-bound DNA fragments are sequenced. The captured metagenomes were highly enriched with targeted genes while maintaining their target diversity and their taxonomic distribution correlated well with the traditional ribosomal sequencing. The captured metagenomes were highly enriched with genes related to organic matter degradation; at least five times more than similar, publicly available soil WMG projects. This target enrichment technique also preserves the functional representation of the soils, thereby facilitating comparative metagenomics projects. Here, we present the first study that applies the captured metagenomics approach in large scale, and this novel method allows deep investigations of central ecosystem processes by studying functional gene abundances. PMID:26490729

  17. Captured metagenomics: large-scale targeting of genes based on 'sequence capture' reveals functional diversity in soils.

    PubMed

    Manoharan, Lokeshwaran; Kushwaha, Sandeep K; Hedlund, Katarina; Ahrén, Dag

    2015-12-01

    Microbial enzyme diversity is a key to understand many ecosystem processes. Whole metagenome sequencing (WMG) obtains information on functional genes, but it is costly and inefficient due to large amount of sequencing that is required. In this study, we have applied a captured metagenomics technique for functional genes in soil microorganisms, as an alternative to WMG. Large-scale targeting of functional genes, coding for enzymes related to organic matter degradation, was applied to two agricultural soil communities through captured metagenomics. Captured metagenomics uses custom-designed, hybridization-based oligonucleotide probes that enrich functional genes of interest in metagenomic libraries where only probe-bound DNA fragments are sequenced. The captured metagenomes were highly enriched with targeted genes while maintaining their target diversity and their taxonomic distribution correlated well with the traditional ribosomal sequencing. The captured metagenomes were highly enriched with genes related to organic matter degradation; at least five times more than similar, publicly available soil WMG projects. This target enrichment technique also preserves the functional representation of the soils, thereby facilitating comparative metagenomics projects. Here, we present the first study that applies the captured metagenomics approach in large scale, and this novel method allows deep investigations of central ecosystem processes by studying functional gene abundances.

  18. The value of short amino acid sequence matches for prediction of protein allergenicity.

    PubMed

    Silvanovich, Andre; Nemeth, Margaret A; Song, Ping; Herman, Rod; Tagliani, Laura; Bannon, Gary A

    2006-03-01

    Typically, genetically engineered crops contain traits encoded by one or a few newly expressed proteins. The allergenicity assessment of newly expressed proteins is an important component in the safety evaluation of genetically engineered plants. One aspect of this assessment involves sequence searches that compare the amino acid sequence of the protein to all known allergens. Analyses are performed to determine the potential for immunologically based cross-reactivity where IgE directed against a known allergen could bind to the protein and elicit a clinical reaction in sensitized individuals. Bioinformatic searches are designed to detect global sequence similarity and short contiguous amino acid sequence identity. It has been suggested that potential allergen cross-reactivity may be predicted by identifying matches as short as six to eight contiguous amino acids between the protein of interest and a known allergen. A series of analyses were performed, and match probabilities were calculated for different size peptides to determine if there was a scientifically justified search window size that identified allergen sequence characteristics. Four probability modeling methods were tested: (1) a mock protein and a mock allergen database, (2) a mock protein and genuine allergen database, (3) a genuine allergen and genuine protein database, and (4) a genuine allergen and genuine protein database combined with a correction for repeating peptides. These analyses indicated that searches for short amino acid sequence matches of eight amino acids or fewer to identify proteins as potential cross-reactive allergens is a product of chance and adds little value to allergy assessments for newly expressed proteins.

  19. Comparison of the amino acid sequence of the major immunogen from three serotypes of foot and mouth disease virus.

    PubMed Central

    Makoff, A J; Paynter, C A; Rowlands, D J; Boothroyd, J C

    1982-01-01

    Cloned cDNA molecules from three serotypes of FMDV have been sequenced around the VP1-coding region. The predicted amino acid sequences for VP1 were compared with the published sequences and variable regions identified. The amino acid sequences were also analysed for hydrophilic regions. Two of the variable regions, numbered 129-160 and 193-204 overlapped hydrophilic regions, and were therefore identified as potentially immunogenic. These regions overlap regions shown by others to be immunogenic. PMID:6298715

  20. Comparison of the Diversity of Basidiomycetes from Dead Wood of the Manchurian fir (Abies holophylla) as Evaluated by Fruiting Body Collection, Mycelial Isolation, and 454 Sequencing.

    PubMed

    Jang, Yeongseon; Jang, Seokyoon; Min, Mihee; Hong, Joo-Hyun; Lee, Hanbyul; Lee, Hwanhwi; Lim, Young Woon; Kim, Jae-Jin

    2015-10-01

    In this study, three different methods (fruiting body collection, mycelial isolation, and 454 sequencing) were implemented to determine the diversity of wood-inhabiting basidiomycetes from dead Manchurian fir (Abies holophylla). The three methods recovered similar species richness (26 species from fruiting bodies, 32 species from mycelia, and 32 species from 454 sequencing), but Fisher's alpha, Shannon-Wiener, Simpson's diversity indices of fungal communities indicated fruiting body collection and mycelial isolation displayed higher diversity compared with 454 sequencing. In total, 75 wood-inhabiting basidiomycetes were detected. The most frequently observed species were Heterobasidion orientale (fruiting body collection), Bjerkandera adusta (mycelial isolation), and Trichaptum fusco-violaceum (454 sequencing). Only two species, Hymenochaete yasudae and Hypochnicium karstenii, were detected by all three methods. This result indicated that Manchurian fir harbors a diverse basidiomycetous fungal community and for complete estimation of fungal diversity, multiple methods should be used. Further studies are required to understand their ecology in the context of forest ecosystems.

  1. Triazine-Based Sequence-Defined Polymers with Side-Chain Diversity and Backbone-Backbone Interaction Motifs.

    PubMed

    Grate, Jay W; Mo, Kai-For; Daily, Michael D

    2016-03-14

    Sequence control in polymers, well-known in nature, encodes structure and functionality. Here we introduce a new architecture, based on the nucleophilic aromatic substitution chemistry of cyanuric chloride, that creates a new class of sequence-defined polymers dubbed TZPs. Proof of concept is demonstrated with two synthesized hexamers, having neutral and ionizable side chains. Molecular dynamics simulations show backbone-backbone interactions, including H-bonding motifs and pi-pi interactions. This architecture is arguably biomimetic while differing from sequence-defined polymers having peptide bonds. The synthetic methodology supports the structural diversity of side chains known in peptides, as well as backbone-backbone hydrogen-bonding motifs, and will thus enable new macromolecules and materials with useful functions. PMID:26865312

  2. DNA-binding proteins from marine bacteria expand the known sequence diversity of TALE-like repeats.

    PubMed

    de Lange, Orlando; Wolf, Christina; Thiel, Philipp; Krüger, Jens; Kleusch, Christian; Kohlbacher, Oliver; Lahaye, Thomas

    2015-11-16

    Transcription Activator-Like Effectors (TALEs) of Xanthomonas bacteria are programmable DNA binding proteins with unprecedented target specificity. Comparative studies into TALE repeat structure and function are hindered by the limited sequence variation among TALE repeats. More sequence-diverse TALE-like proteins are known from Ralstonia solanacearum (RipTALs) and Burkholderia rhizoxinica (Bats), but RipTAL and Bat repeats are conserved with those of TALEs around the DNA-binding residue. We study two novel marine-organism TALE-like proteins (MOrTL1 and MOrTL2), the first to date of non-terrestrial origin. We have assessed their DNA-binding properties and modelled repeat structures. We found that repeats from these proteins mediate sequence specific DNA binding conforming to the TALE code, despite low sequence similarity to TALE repeats, and with novel residues around the BSR. However, MOrTL1 repeats show greater sequence discriminating power than MOrTL2 repeats. Sequence alignments show that there are only three residues conserved between repeats of all TALE-like proteins including the two new additions. This conserved motif could prove useful as an identifier for future TALE-likes. Additionally, comparing MOrTL repeats with those of other TALE-likes suggests a common evolutionary origin for the TALEs, RipTALs and Bats.

  3. Assessing diversity of the female urine microbiota by high throughput sequencing of 16S rDNA amplicons

    PubMed Central

    2011-01-01

    Background Urine within the urinary tract is commonly regarded as "sterile" in cultivation terms. Here, we present a comprehensive in-depth study of bacterial 16S rDNA sequences associated with urine from healthy females by means of culture-independent high-throughput sequencing techniques. Results Sequencing of the V1V2 and V6 regions of the 16S ribosomal RNA gene using the 454 GS FLX system was performed to characterize the possible bacterial composition in 8 culture-negative (<100,000 CFU/ml) healthy female urine specimens. Sequences were compared to 16S rRNA databases and showed significant diversity, with the predominant genera detected being Lactobacillus, Prevotella and Gardnerella. The bacterial profiles in the female urine samples studied were complex; considerable variation between individuals was observed and a common microbial signature was not evident. Notably, a significant amount of sequences belonging to bacteria with a known pathogenic potential was observed. The number of operational taxonomic units (OTUs) for individual samples varied substantially and was in the range of 20 - 500. Conclusions Normal female urine displays a noticeable and variable bacterial 16S rDNA sequence richness, which includes fastidious and anaerobic bacteria previously shown to be associated with female urogenital pathology. PMID:22047020

  4. DNA-binding proteins from marine bacteria expand the known sequence diversity of TALE-like repeats.

    PubMed

    de Lange, Orlando; Wolf, Christina; Thiel, Philipp; Krüger, Jens; Kleusch, Christian; Kohlbacher, Oliver; Lahaye, Thomas

    2015-11-16

    Transcription Activator-Like Effectors (TALEs) of Xanthomonas bacteria are programmable DNA binding proteins with unprecedented target specificity. Comparative studies into TALE repeat structure and function are hindered by the limited sequence variation among TALE repeats. More sequence-diverse TALE-like proteins are known from Ralstonia solanacearum (RipTALs) and Burkholderia rhizoxinica (Bats), but RipTAL and Bat repeats are conserved with those of TALEs around the DNA-binding residue. We study two novel marine-organism TALE-like proteins (MOrTL1 and MOrTL2), the first to date of non-terrestrial origin. We have assessed their DNA-binding properties and modelled repeat structures. We found that repeats from these proteins mediate sequence specific DNA binding conforming to the TALE code, despite low sequence similarity to TALE repeats, and with novel residues around the BSR. However, MOrTL1 repeats show greater sequence discriminating power than MOrTL2 repeats. Sequence alignments show that there are only three residues conserved between repeats of all TALE-like proteins including the two new additions. This conserved motif could prove useful as an identifier for future TALE-likes. Additionally, comparing MOrTL repeats with those of other TALE-likes suggests a common evolutionary origin for the TALEs, RipTALs and Bats. PMID:26481363

  5. Complete metagenome sequencing based bacterial diversity and functional insights from basaltic hot spring of Unkeshwar, Maharashtra, India.

    PubMed

    Mehetre, Gajanan T; Paranjpe, Aditi S; Dastager, Syed G; Dharne, Mahesh S

    2016-03-01

    Unkeshwar hot springs are located at geographical South East Deccan Continental basalt of India. Here, we report the microbial community analysis of this hot spring using whole metagenome shotgun sequencing approach. The analysis revealed a total of 848,096 reads with 212.87 Mbps with 50.87% G + C content. Metagenomic sequences were deposited in SRA database with accession number (SUB1242219). Community analysis revealed 99.98% sequences belonging to bacteria and 0.01% to archaea and 0.01% to Viruses. The data obtained revealed 41 phyla including bacteria and Archaea and including 719 different species. In taxonomic analysis, the dominant phyla were found as, Actinobacteria (56%), Verrucomicrobia (24%), Bacteriodes (13%), Deinococcus-Thermus (3%) and firmicutes (2%) and Viruses (2%). Furthermore, functional annotation using pathway information revealed dynamic potential of hot spring community in terms of metabolism, environmental information processing, cellular processes and other important aspects. Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis of each contig sequence by assigning KEGG Orthology (KO) numbers revealed contig sequences that were assigned to metabolism, organismal system, Environmental Information Processing, cellular processes and human diseases with some unclassified sequences. The Unkeshwar hot springs offer rich phylogenetic diversity and metabolic potential for biotechnological applications. PMID:26981391

  6. Complete metagenome sequencing based bacterial diversity and functional insights from basaltic hot spring of Unkeshwar, Maharashtra, India

    PubMed Central

    Mehetre, Gajanan T.; Paranjpe, Aditi S.; Dastager, Syed G.; Dharne, Mahesh S.

    2015-01-01

    Unkeshwar hot springs are located at geographical South East Deccan Continental basalt of India. Here, we report the microbial community analysis of this hot spring using whole metagenome shotgun sequencing approach. The analysis revealed a total of 848,096 reads with 212.87 Mbps with 50.87% G + C content. Metagenomic sequences were deposited in SRA database with accession number (SUB1242219). Community analysis revealed 99.98% sequences belonging to bacteria and 0.01% to archaea and 0.01% to Viruses. The data obtained revealed 41 phyla including bacteria and Archaea and including 719 different species. In taxonomic analysis, the dominant phyla were found as, Actinobacteria (56%), Verrucomicrobia (24%), Bacteriodes (13%), Deinococcus-Thermus (3%) and firmicutes (2%) and Viruses (2%). Furthermore, functional annotation using pathway information revealed dynamic potential of hot spring community in terms of metabolism, environmental information processing, cellular processes and other important aspects. Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis of each contig sequence by assigning KEGG Orthology (KO) numbers revealed contig sequences that were assigned to metabolism, organismal system, Environmental Information Processing, cellular processes and human diseases with some unclassified sequences. The Unkeshwar hot springs offer rich phylogenetic diversity and metabolic potential for biotechnological applications. PMID:26981391

  7. In search of actionable targets for agrigenomics and microalgal biofuel production: sequence-structural diversity studies on algal and higher plants with a focus on GPAT protein.

    PubMed

    Misra, Namrata; Panda, Prasanna Kumar

    2013-04-01

    The triacylglycerol (TAG) pathway provides several targets for genetic engineering to optimize microalgal lipid productivity. GPAT (glycerol-3-phosphate acyltransferase) is a crucial enzyme that catalyzes the initial step of TAG biosynthesis. Despite many recent biochemical studies, a comprehensive sequence-structure analysis of GPAT across diverse lipid-yielding organisms is lacking. Hence, we performed a comparative genomic analysis of plastid-located GPAT proteins from 7 microalgae and 3 higher plants species. The close evolutionary relationship observed between red algae/diatoms and green algae/plant lineages in the phylogenetic tree were further corroborated by motif and gene structure analysis. The predicted molecular weight, amino acid composition, Instability Index, and hydropathicity profile gave an overall representation of the biochemical features of GPAT protein across the species under study. Furthermore, homology models of GPAT from Chlamydomonas reinhardtii, Arabidopsis thaliana, and Glycine max provided deep insights into the protein architecture and substrate binding sites. Despite low sequence identity found between algal and plant GPATs, the developed models exhibited strikingly conserved topology consisting of 14α helices and 9β sheets arranged in two domains. However, subtle variations in amino acids of fatty acyl binding site were identified that might influence the substrate selectivity of GPAT. Together, the results will provide useful resources to understand the functional and evolutionary relationship of GPAT and potentially benefit in development of engineered enzyme for augmenting algal biofuel production.

  8. Ancient DNA analyses reveal high mitochondrial DNA sequence diversity and parallel morphological evolution of late pleistocene cave bears.

    PubMed

    Hofreiter, Michael; Capelli, Cristian; Krings, Matthias; Waits, Lisette; Conard, Nicholas; Münzel, Susanne; Rabeder, Gernot; Nagel, Doris; Paunovic, Maja; Jambrĕsić, Gordana; Meyer, Sonja; Weiss, Gunter; Pääbo, Svante

    2002-08-01

    Cave bears (Ursus spelaeus) existed in Europe and western Asia until the end of the last glaciation some 10,000 years ago. To investigate the genetic diversity, population history, and relationship among different cave bear populations, we have determined mitochondrial DNA sequences from 12 cave bears that range in age from about 26,500 to at least 49,000 years and originate from nine caves. The samples include one individual from the type specimen population, as well as two small-sized high-Alpine bears. The results show that about 49,000 years ago, the mtDNA diversity among cave bears was about 1.8-fold lower than the current species-wide diversity of brown bears (Ursus arctos). However, the current brown bear mtDNA gene pool consists of three clades, and cave bear mtDNA diversity is similar to the diversity observed within each of these clades. The results also show that geographically separated populations of the high-Alpine cave bear form were polyphyletic with respect to their mtDNA. This suggests that small size may have been an ancestral trait in cave bears and that large size evolved at least twice independently.

  9. Phylogenetic affiliation of SSU rRNA genes generated by massively parallel sequencing: new insights into the freshwater protist diversity.

    PubMed

    Taib, Najwa; Mangot, Jean-François; Domaizon, Isabelle; Bronner, Gisèle; Debroas, Didier

    2013-01-01

    Recent advances in next-generation sequencing (NGS) technologies spur progress in determining the microbial diversity in various ecosystems by highlighting, for example, the rare biosphere. Currently, high-throughput pyrotag sequencing of PCR-amplified SSU rRNA gene regions is mainly used to characterize bacterial and archaeal communities, and rarely to characterize protist communities. In addition, although taxonomic assessment through phylogeny is considered as the most robust approach, similarity and probabilistic approaches remain the most commonly used for taxonomic affiliation. In a first part of this work, a tree-based method was compared with different approaches of taxonomic affiliation (BLAST and RDP) of 18S rRNA gene sequences and was shown to be the most accurate for near full-length sequences and for 400 bp amplicons, with the exception of amplicons covering the V5-V6 region. Secondly, the applicability of this method was tested by running a full scale test using an original pyrosequencing dataset of 18S rRNA genes of small lacustrine protists (0.2-5 µm) from eight freshwater ecosystems. Our results revealed that i) fewer than 5% of the operational taxonomic units (OTUs) identified through clustering and phylogenetic affiliation had been previously detected in lakes, based on comparison to sequence in public databases; ii) the sequencing depth provided by the NGS coupled with a phylogenetic approach allowed to shed light on clades of freshwater protists rarely or never detected with classical molecular ecology approaches; and iii) phylogenetic methods are more robust in describing the structuring of under-studied or highly divergent populations. More precisely, new putative clades belonging to Mamiellophyceae, Foraminifera, Dictyochophyceae and Euglenida were detected. Beyond the study of protists, these results illustrate that the tree-based approach for NGS based diversity characterization allows an in-depth description of microbial communities

  10. Diversity of acid stress resistant variants of Listeria monocytogenes and the potential role of ribosomal protein S21 encoded by rpsU

    PubMed Central

    Metselaar, Karin I.; den Besten, Heidy M. W.; Boekhorst, Jos; van Hijum, Sacha A. F. T.; Zwietering, Marcel H.; Abee, Tjakko

    2015-01-01

    The dynamic response of microorganisms to environmental conditions depends on the behavior of individual cells within the population. Adverse environments can select for stable stress resistant subpopulations. In this study, we aimed to get more insight in the diversity within Listeria monocytogenes LO28 populations, and the genetic basis for the increased resistance of stable resistant fractions isolated after acid exposure. Phenotypic cluster analysis of 23 variants resulted in three clusters and four individual variants and revealed multiple-stress resistance, with both unique and overlapping features related to stress resistance, growth, motility, biofilm formation, and virulence indicators. A higher glutamate decarboxylase activity correlated with increased acid resistance. Whole genome sequencing revealed mutations in rpsU, encoding ribosomal protein S21 in the largest phenotypic cluster, while mutations in ctsR, which were previously shown to be responsible for increased resistance of heat and high hydrostatic pressure resistant variants, were not found in the acid resistant variants. This underlined that large population diversity exists within one L. monocytogenes strain and that different adverse conditions drive selection for different variants. The finding that acid stress selects for rpsU variants provides potential insights in the mechanisms underlying population diversity of L. monocytogenes. PMID:26005439

  11. Cross-comparison of Protein Recognition of Sialic Acid Diversity on Two Novel Sialoglycan Microarrays*

    PubMed Central

    Padler-Karavani, Vered; Song, Xuezheng; Yu, Hai; Hurtado-Ziola, Nancy; Huang, Shengshu; Muthana, Saddam; Chokhawala, Harshal A.; Cheng, Jiansong; Verhagen, Andrea; Langereis, Martijn A.; Kleene, Ralf; Schachner, Melitta; de Groot, Raoul J.; Lasanajak, Yi; Matsuda, Haruo; Schwab, Richard; Chen, Xi; Smith, David F.; Cummings, Richard D.; Varki, Ajit

    2012-01-01

    DNA and protein arrays are commonly accepted as powerful exploratory tools in research. This has mainly been achieved by the establishment of proper guidelines for quality control, allowing cross-comparison between different array platforms. As a natural extension, glycan microarrays were subsequently developed, and recent advances using such arrays have greatly enhanced our understanding of protein-glycan recognition in nature. However, although it is assumed that biologically significant protein-glycan binding is robustly detected by glycan microarrays, there are wide variations in the methods used to produce, present, couple, and detect glycans, and systematic cross-comparisons are lacking. We address these issues by comparing two arrays that together represent the marked diversity of sialic acid modifications, linkages, and underlying glycans in nature, including some identical motifs. We compare and contrast binding interactions with various known and novel plant, vertebrate, and viral sialic acid-recognizing proteins and present a technical advance for assessing specificity using mild periodate oxidation of the sialic acid chain. These data demonstrate both the diversity of sialic acids and the analytical power of glycan arrays, showing that different presentations in different formats provide useful and complementary interpretations of glycan-binding protein specificity. They also highlight important challenges and questions for the future of glycan array technology and suggest that glycan arrays with similar glycan structures cannot be simply assumed to give similar results. PMID:22549775

  12. Quantitative detection of Aspergillus spp. by real-time nucleic acid sequence-based amplification.

    PubMed

    Zhao, Yanan; Perlin, David S

    2013-01-01

    Rapid and quantitative detection of Aspergillus from clinical samples may facilitate an early diagnosis of invasive pulmonary aspergillosis (IPA). As nucleic acid-based detection is a viable option, we demonstrate that Aspergillus burdens can be rapidly and accurately detected by a novel real-time nucleic acid assay other than qPCR by using the combination of nucleic acid sequence-based amplification (NASBA) and the molecular beacon (MB) technology. Here, we detail a real-time NASBA assay to determine quantitative Aspergillus burdens in lungs and bronchoalveolar lavage (BAL) fluids of rats with experimental IPA.

  13. Genetic Diversity and Phylogenetic Evolution of Tibetan Sheep Based on mtDNA D-Loop Sequences

    PubMed Central

    Yue, Yaojing; Guo, Xian; Guo, Tingting; Chu, Min; Wang, Fan; Han, Jilong; Feng, Ruilin; Sun, Xiaoping; Niu, Chune; Yang, Bohui; Guo, Jian; Yuan, Chao

    2016-01-01

    The molecular and population genetic evidence of the phylogenetic status of the Tibetan sheep (Ovis aries) is not well understood, and little is known about this species’ genetic diversity. This knowledge gap is partly due to the difficulty of sample collection. This is the first work to address this question. Here, the genetic diversity and phylogenetic relationship of 636 individual Tibetan sheep from fifteen populations were assessed using 642 complete sequences of the mitochondrial DNA D-loop. Samples were collected from the Qinghai-Tibetan Plateau area in China, and reference data were obtained from the six reference breed sequences available in GenBank. The length of the sequences varied considerably, between 1031 and 1259 bp. The haplotype diversity and nucleotide diversity were 0.992±0.010 and 0.019±0.001, respectively. The average number of nucleotide differences was 19.635. The mean nucleotide composition of the 350 haplotypes was 32.961% A, 29.708% T, 22.892% C, 14.439% G, 62.669% A+T, and 37.331% G+C. Phylogenetic analysis showed that all four previously defined haplogroups (A, B, C, and D) were found in the 636 individuals of the fifteen Tibetan sheep populations but that only the D haplogroup was found in Linzhou sheep. Further, the clustering analysis divided the fifteen Tibetan sheep populations into at least two clusters. The estimation of the demographic parameters from the mismatch analyses showed that haplogroups A, B, and C had at least one demographic expansion in Tibetan sheep. These results contribute to the knowledge of Tibetan sheep populations and will help inform future conservation programs about the Tibetan sheep native to the Qinghai-Tibetan Plateau. PMID:27463976

  14. Genetic Diversity and Phylogenetic Evolution of Tibetan Sheep Based on mtDNA D-Loop Sequences.

    PubMed

    Liu, Jianbin; Ding, Xuezhi; Zeng, Yufeng; Yue, Yaojing; Guo, Xian; Guo, Tingting; Chu, Min; Wang, Fan; Han, Jilong; Feng, Ruilin; Sun, Xiaoping; Niu, Chune; Yang, Bohui; Guo, Jian; Yuan, Chao

    2016-01-01

    The molecular and population genetic evidence of the phylogenetic status of the Tibetan sheep (Ovis aries) is not well understood, and little is known about this species' genetic diversity. This knowledge gap is partly due to the difficulty of sample collection. This is the first work to address this question. Here, the genetic diversity and phylogenetic relationship of 636 individual Tibetan sheep from fifteen populations were assessed using 642 complete sequences of the mitochondrial DNA D-loop. Samples were collected from the Qinghai-Tibetan Plateau area in China, and reference data were obtained from the six reference breed sequences available in GenBank. The length of the sequences varied considerably, between 1031 and 1259 bp. The haplotype diversity and nucleotide diversity were 0.992±0.010 and 0.019±0.001, respectively. The average number of nucleotide differences was 19.635. The mean nucleotide composition of the 350 haplotypes was 32.961% A, 29.708% T, 22.892% C, 14.439% G, 62.669% A+T, and 37.331% G+C. Phylogenetic analysis showed that all four previously defined haplogroups (A, B, C, and D) were found in the 636 individuals of the fifteen Tibetan sheep populations but that only the D haplogroup was found in Linzhou sheep. Further, the clustering analysis divided the fifteen Tibetan sheep populations into at least two clusters. The estimation of the demographic parameters from the mismatch analyses showed that haplogroups A, B, and C had at least one demographic expansion in Tibetan sheep. These results contribute to the knowledge of Tibetan sheep populations and will help inform future conservation programs about the Tibetan sheep native to the Qinghai-Tibetan Plateau. PMID:27463976

  15. Draft Genome Sequence of the Butyric Acid Producer Clostridium tyrobutyricum Strain CIP I-776 (IFP923)

    PubMed Central

    Clément, Benjamin; Lopes Ferreira, Nicolas

    2016-01-01

    Here, we report the draft genome sequence of Clostridium tyrobutyricum CIP I-776 (IFP923), an efficient producer of butyric acid. The genome consists of a single chromosome of 3.19 Mb and provides useful data concerning the metabolic capacities of the strain. PMID:26941139

  16. Amino acid sequence of the encephalitogenic basic protein from human myelin

    PubMed Central

    Carnegie, P. R.

    1971-01-01

    Myelin from the central nervous system contains an unusual basic protein, which can induce experimental autoimmune encephalomyelitis. The basic protein from human brain was digested with trypsin and other enzymes and the sequence of the 170 amino acids was determined. The localization of the encephalitogenic determinants was described. Possible roles for the protein in the structure and function of myelin are discussed. PMID:4108501

  17. Evolution of phosphagen kinase V. cDNA-derived amino acid sequences of two molluscan arginine kinases from the chiton Liolophura japonica and the turbanshell Battilus cornutus.

    PubMed

    Suzuki, T; Ban, T; Furukohri, T

    1997-06-20

    The cDNAs of arginine kinases from the chiton Liolophura japonica (Polyplacophora) and the turbanshell Battilus cornutus (Gastropoda) were amplified by polymerase chain reaction (PCR), and the complete nucleotide sequences of 1669 and 1624 bp, respectively, were determined. The open reading frame for Liolophura arginine kinase is 1050 nucleotides in length and encodes a protein with 349 amino acid residues, and that for Battilus is 1077 nucleotides and 358 residues. The validity of the cDNA-derived amino acid sequence was supported by chemical sequencing of internal tryptic peptides. The molecular masses were calculated to be 39,057 and 39,795 Da, respectively. The amino acid sequence of Liolophura arginine kinase showed 65-68% identity with those of Battilus and Nordotis (abalone) arginine kinases, and the homology between Battilus and Nordotis was 79%. Molluscan arginine kinases also show lower, but significant homology (38-43%) with rabbit creatine kinase. The sequences of arginine kinases could be used as a molecular clock to elucidate the phylogeny of Mollusca, one of the most diverse animal phyla.

  18. Complete genome sequencing and comparative genomic analysis of functionally diverse Lysinibacillus sphaericus III(3)7.

    PubMed

    Rey, Andrés; Silva-Quintero, Laura; Dussán, Jenny

    2016-09-01

    Lysinibacillus sphaericus III(3)7 is a native Colombian strain, the first one isolated from soil samples. This strain has shown high levels of pathogenic activity against Culex quinquefaciatus larvae in laboratory assays compared to other members of the same species. Using Pacific Biosciences sequencing technology we sequenced, annotated (de novo) and described the genome of strain III(3)7, achieving a complete genome sequence status. We then performed a comparative analysis between the newly sequenced genome and the ones previously reported for Colombian isolates L. sphaericus OT4b.31, CBAM5 and OT4b.25, with the inclusion of L. sphaericus C3-41 that has been used as a reference genome for most of previous genome sequencing projects. We concluded that L. sphaericus III(3)7 is highly similar with strain OT4b.25 and shares high levels of synteny with isolates CBAM5 and C3-41. PMID:27419068

  19. Insights into the genetic structure and diversity of 38 South Asian Indians from deep whole-genome sequencing.

    PubMed

    Wong, Lai-Ping; Lai, Jason Kuan-Han; Saw, Woei-Yuh; Ong, Rick Twee-Hee; Cheng, Anthony Youzhi; Pillai, Nisha Esakimuthu; Liu, Xuanyao; Xu, Wenting; Chen, Peng; Foo, Jia-Nee; Tan, Linda Wei-Lin; Koo, Seok-Hwee; Soong, Richie; Wenk, Markus Rene; Lim, Wei-Yen; Khor, Chiea-Chuen; Little, Peter; Chia, Kee-Seng; Teo, Yik-Ying

    2014-05-01

    South Asia possesses a significant amount of genetic diversity due to considerable intergroup differences in culture and language. There have been numerous reports on the genetic structure of Asian Indians, although these have mostly relied on genotyping microarrays or targeted sequencing of the mitochondria and Y chromosomes. Asian Indians in Singapore are primarily descendants of immigrants from Dravidian-language-speaking states in south India, and 38 individuals from the general population underwent deep whole-genome sequencing with a target coverage of 30X as part of the Singapore Sequencing Indian Project (SSIP). The genetic structure and diversity of these samples were compared against samples from the Singapore Sequencing Malay Project and populations in Phase 1 of the 1,000 Genomes Project (1 KGP). SSIP samples exhibited greater intra-population genetic diversity and possessed higher heterozygous-to-homozygous genotype ratio than other Asian populations. When compared against a panel of well-defined Asian Indians, the genetic makeup of the SSIP samples was closely related to South Indians. However, even though the SSIP samples clustered distinctly from the Europeans in the global population structure analysis with autosomal SNPs, eight samples were assigned to mitochondrial haplogroups that were predominantly present in Europeans and possessed higher European admixture than the remaining samples. An analysis of the relative relatedness between SSIP with two archaic hominins (Denisovan, Neanderthal) identified higher ancient admixture in East Asian populations than in SSIP. The data resource for these samples is publicly available and is expected to serve as a valuable complement to the South Asian samples in Phase 3 of 1 KGP.

  20. Sequence-specific formation of d-amino acids in a monoclonal antibody during light exposure.

    PubMed

    Mozziconacci, Olivier; Schöneich, Christian

    2014-11-01

    The photoirradiation of a monoclonal antibody 1 (mAb1) at λ = 254 nm and λmax = 305 nm resulted in the sequence-specific generation of d-Val, d-Tyr, and potentially d-Ala and d-Arg, in the heavy chain sequence [95-101] YCARVVY. d-Amino acid formation is most likely the product of reversible intermediary carbon-centered radical formation at the (α)C-positions of the respective amino acids ((α)C(•) radicals) through the action of Cys thiyl radicals (CysS(•)). The latter can be generated photochemically either through direct homolysis of cystine or through photoinduced electron transfer from Trp and/or Tyr residues. The potential of mAb1 sequences to undergo epimerization was first evaluated through covalent H/D exchange during photoirradiation in D2O, and proteolytic peptides exhibiting deuterium incorporation were monitored by HPLC-MS/MS analysis. Subsequently, mAb1 was photoirradiated in H2O, and peptides, for which deuterium incorporation in D2O had been documented, were purified by HPLC and subjected to hydrolysis and amino acid analysis. Importantly, not all peptide sequences which incorporated deuterium during photoirradiation in D2O also exhibited photoinduced d-amino acid formation. For example, the heavy chain sequence [12-18] VQPGGSL showed significant deuterium incorporation during photoirradiation in D2O, but no photoinduced formation of d-amino acids was detected. Instead this sequence contained ca. 22% d-Val in both a photoirradiated and a control sample. This observation could indicate that d-Val may have been generated either during production and/or storage or during sample preparation. While sample preparation did not lead to the formation of d-Val or other d-amino acids in the control sample for the heavy chain sequence [95-101] YCARVVY, we may have to consider that during hydrolysis N-terminal residues (such as in VQPGGSL) may be more prone to epimerization. We conclude that the photoinduced, radical-dependent formation of d-amino acids

  1. High conopeptide diversity in Conus tribblei revealed through analysis of venom duct transcriptome using two high-throughput sequencing platforms

    PubMed Central

    Barghi, Neda; Concepcion, Gisela P.; Olivera, Baldomero M.; Lluisma, Arturo O.

    2015-01-01

    The venom of each species of Conus contains different kinds of pharmacologically-active peptides which are mostly unique to that species. Collectively, the ~500 – 700 species of Conus produce a large number of these peptides, perhaps exceeding 140,000 different types in total. To date, however, only a small fraction of this diversity has been characterized via transcriptome sequencing. In addition, the sampling of this chemical diversity has not been uniform across the different lineages in the genus. In this study, we used high-throughput transcriptome sequencing approach to further investigate the diversity of Conus venom peptides. We chose a species, Conus tribblei, as a representative of a poorly studied clade of Conus. Using the Roche 454 and Illumina platforms, we discovered 136 unique and novel putative conopeptides belonging to 30 known gene superfamilies and 6 new conopeptide groups, the greatest diversity so far observed from a transcriptome. Most of the identified peptides exhibited divergence from the known conopeptides and some contained cysteine frameworks observed for the first time in cone snails. In addition, several enzymes involved in post-translational modification of conopeptides and also some proteins involved in efficient delivery of the conopeptides to prey were identified as well. Interestingly, a number of conopeptides highly similar to the conopeptides identified in a phylogenetically distant species, the generalist feeder Conus californicus, were observed. The high diversity of conopeptides and the presence of conopeptides similar to those in C. californicus suggest that C. tribblei may have a broad range of prey preferences. PMID:25117477

  2. The complete amino acid sequence of chitinase-B from the leaves of pokeweed (Phytolacca americana).

    PubMed

    Tanigawa, M; Yamagami, T; Funatsu, G

    1995-05-01

    The complete amino acid sequence of pokeweed leaf chitinase-B (PLC-B) has been determined by first sequencing all 19 tryptic peptides derived from the reduced and S-carboxymethylated (RCm-) PLC-B and then connecting them by analyzing the chymotryptic peptides from three fragments produced by cyanogen bromide cleavage of RCm-PLC-B. PLC-B consists of 274 amino acid residues and has a molecular mass of 29,473 Da. Six cysteine residues are linked by disulfide bonds between Cys20 and Cys67, Cys50 and Cys57, and Cys159 and Cys188. From 58-68% sequence homology of PLC-B with five class III chitinases, it was concluded that PLC-B is a basic class III chitinase.

  3. Seed traits, fatty acid profile and genetic diversity assessment in Pongamia pinnata (L.) Pierre germplasm.

    PubMed

    Sharma, Shyam Sundar; Islam, Md Aminul; Malik, Anoop Anand; Kumar, Kamlesh; Negi, Madan Singh; Tripathi, Shashi Bhushan

    2016-04-01

    Phenotypic variation of important seed traits like seed length, seed breadth, seed thickness, 100 seed weight and seed oil content were recorded in a total of 157 collected accessions of Pongamia. Out of these, fatty acid profiles of 38 accessions selected based on their high and low oil content was analyzed. Fatty acid profile revealed high variability in stearic, oleic and linoleic acid which varied from 0.42 to 10.61 %, 34.34 to 74.58 %, and 7.00 to 31.28 % respectively. Variations in palmitic and linolenic acid were small. Iodine value, saponification number and cetane number (CN) of fatty acid methyl esters (FAME) of seed oil ranges from 186.99 to 201.25, 81.13 to 108.19 and 46.16 to 56.47 respectively. Fatty acid compositions, degree of unsaturation and CN are the important parameters, which are used to determine quality of FAME were used as biodiesel. Some of the Pongamia accessions identified were higher in oil content while some accessions showed higher degree of unsaturation and a few of them had CN values higher than 55. Genetic diversity analysis with six TE-AFLP primers generated a total of 334 bands out of which 174 (52.10 %) were polymorphic. The genetic similarity ranged from 0.11 to 0.47. These findings clearly showed high level of genetic diversity and all economically desirable traits were not present in a single genotype of Pongamia. All these traits could be selected from these CPTs and transfer to a single elite variety through selection and breeding programme and could be utilized for large scale multiplication and plantation to produce high quantity and quality biodiesel in future. PMID:27436911

  4. Pyruvate decarboxylase from Pisum sativum. Properties, nucleotide and amino acid sequences.

    PubMed

    Mücke, U; Wohlfarth, T; Fiedler, U; Bäumlein, H; Rücknagel, K P; König, S

    1996-04-15

    To study the molecular structure and function of pyruvate decarboxylase (PDC) from plants the protein was isolated from pea seeds and partially characterised. The active enzyme which occurs in the form of higher oligomers consists of two different subunits appearing in SDS/PAGE and mass spectroscopy experiments. For further experiments, like X-ray crystallography, it was necessary to elucidate the protein sequence. Partial cDNA clones encoding pyruvate decarboxylase from seeds of Pisum sativum cv. Miko have been obtained by means of polymerase chain reaction techniques. The first sequences were found using degenerate oligonucleotide primers designated according to conserved amino acid sequences of known pyruvate decarboxylases. The missing parts of one cDNA were amplified applying the 3'- and 5'-rapid amplification of cDNA ends systems. The amino acid sequence deduced from the entire cDNA sequence displays strong similarity to pyruvate decarboxylases from other organisms, especially from plants. A molecular mass of 64 kDa was calculated for this protein correlating with estimations for the smaller subunit of the oligomeric enzyme. The PCR experiments led to at least three different clones representing the middle part of the PDC cDNA indicating the existence of three isozymes. Two of these isoforms could be confirmed on the protein level by sequencing tryptic peptides. Only anaerobically treated roots showed a positive signal for PDC mRNA in Northern analysis although the cDNA from imbibed seeds was successfully used for PCR.

  5. Allelic polymorphism in arabian camel ribonuclease and the amino acid sequence of bactrian camel ribonuclease.

    PubMed

    Welling, G W; Mulder, H; Beintema, J J

    1976-04-01

    Pancreatic ribonucleases from several species (whitetail deer, roe deer, guinea pig, and arabian camel) exhibit more than one amino acid at particular positions in their amino acid sequences. Since these enzymes were isolated from pooled pancreas, the origin of this heterogeneity is not clear. The pancreatic ribonucleases from 11 individual arabian camels (Camelus dromedarius) have been investigated with respect to the lysine-glutamine heterogeneity at position 103 (Welling et al., 1975). Six ribonucleases showed only one basic band and five showed two bands after polyacrylamide gel electrophoresis, suggesting a gene frequency of about 0.75 for the Lys gene and about 0.25 for the Gln gene. The amino acid sequence of bactrian camel (Camelus bactrianus) ribonuclease isolated from individual pancreatic tissue was determined and compared with that of arabian camel ribonuclease. The only difference was observed at position 103. In the ribonucleases from two unrelated bactrian camels, only glutamine was observed at that position. PMID:962846

  6. Integrated Analysis of Whole Genome and Transcriptome Sequencing Reveals Diverse Transcriptomic Aberrations Driven by Somatic Genomic Changes in Liver Cancers

    PubMed Central

    Shiraishi, Yuichi; Fujimoto, Akihiro; Furuta, Mayuko; Tanaka, Hiroko; Chiba, Ken-ichi; Boroevich, Keith A.; Abe, Tetsuo; Kawakami, Yoshiiku; Ueno, Masaki; Gotoh, Kunihito; Ariizumi, Shun-ichi; Shibuya, Tetsuo; Nakano, Kaoru; Sasaki, Aya; Maejima, Kazuhiro; Kitada, Rina; Hayami, Shinya; Shigekawa, Yoshinobu; Marubashi, Shigeru; Yamada, Terumasa; Kubo, Michiaki; Ishikawa, Osamu; Aikata, Hiroshi; Arihiro, Koji; Ohdan, Hideki; Yamamoto, Masakazu; Yamaue, Hiroki; Chayama, Kazuaki; Tsunoda, Tatsuhiko; Miyano, Satoru; Nakagawa, Hidewaki

    2014-01-01

    Recent studies applying high-throughput sequencing technologies have identified several recurrently mutated genes and pathways in multiple cancer genomes. However, transcriptional consequences from these genomic alterations in cancer genome remain unclear. In this study, we performed integrated and comparative analyses of whole genomes and transcriptomes of 22 hepatitis B virus (HBV)-related hepatocellular carcinomas (HCCs) and their matched controls. Comparison of whole genome sequence (WGS) and RNA-Seq revealed much evidence that various types of genomic mutations triggered diverse transcriptional changes. Not only splice-site mutations, but also silent mutations in coding regions, deep intronic mutations and structural changes caused splicing aberrations. HBV integrations generated diverse patterns of virus-human fusion transcripts depending on affected gene, such as TERT, CDK15, FN1 and MLL4. Structural variations could drive over-expression of genes such as WNT ligands, with/without creating gene fusions. Furthermore, by taking account of genomic mutations causing transcriptional aberrations, we could improve the sensitivity of deleterious mutation detection in known cancer driver genes (TP53, AXIN1, ARID2, RPS6KA3), and identified recurrent disruptions in putative cancer driver genes such as HNF4A, CPS1, TSC1 and THRAP3 in HCCs. These findings indicate genomic alterations in cancer genome have diverse transcriptomic effects, and integrated analysis of WGS and RNA-Seq can facilitate the interpretation of a large number of genomic alterations detected in cancer genome. PMID:25526364

  7. Molecular evolution and diversity of Conus peptide toxins, as revealed by gene structure and intron sequence analyses.

    PubMed

    Wu, Yun; Wang, Lei; Zhou, Maojun; You, Yuwen; Zhu, Xiaoyan; Qiang, Yuanyuan; Qin, Mengying; Luo, Shaonan; Ren, Zhenghua; Xu, Anlong

    2013-01-01

    Cone snails, which are predatory marine gastropods, produce a cocktail of venoms used for predation, defense and competition. The major venom component, conotoxin, has received significant attention because it is useful in neuroscience research, drug development and molecular diversity studies. In this study, we report the genomic characterization of nine conotoxin gene superfamilies from 18 Conus species and investigate the relationships among conotoxin gene structure, molecular evolution and diversity. The I1, I2, M, O2, O3, P, S, and T superfamily precursors all contain three exons and two introns, while A superfamily members contain two exons and one intron. The introns are conserved within a certain gene superfamily, and also conserved across different Conus species, but divergent among different superfamilies. The intronic sequences contain many simple repeat sequences and regulatory elements that may influence conotoxin gene expression. Furthermore, due to the unique gene structure of conotoxins, the base substitution rates and the number of positively selected sites vary greatly among exons. Many more point mutations and trinucleotide indels were observed in the mature peptide exon than in the other exons. In addition, the first example of alternative splicing in conotoxin genes was found. These results suggest that the diversity of conotoxin genes has been shaped by point mutations and indels, as well as rare gene recombination or alternative splicing events, and that the unique gene structures could have made a contribution to the evolution of conotoxin genes.

  8. [Microbial diversity and ammonia-oxidizing microorganism of a soil sample near an acid mine drainage lake].

    PubMed

    Liu, Ying; Wang, Li-Hua; Hao, Chun-Bo; Li, Lu; Li, Si-Yuan; Feng, Chuan-Ping

    2014-06-01

    The main physicochemical parameters of the soil sample which was collected near an acid mine drainage reservoir in Anhui province was analyzed. The microbial diversity and community structure was studied through the construction of bacteria and archaea 16S rRNA gene clone libraries and ammonia monooxygenase gene clone library of archaea. The functional groups which were responsible for the process of ammonia oxidation were also discussed. The results indicated that the soil sample had extreme low pH value (pH < 3) and high ions concentration, which was influenced by the acid mine drainage (AMD). All the 16S rRNA gene sequences of bacteria clone library fell into 11 phyla, and Acidobacteria played the most significant role in the ecosystem followed by Verrucomicrobia. A great number of acidophilic bacteria existed in the soil sample, such as Candidatus Koribacter versatilis and Holophaga sp.. The archaea clone library consisted of 2 phyla (Thaumarchaeota and Euryarchaeota). The abundance of Thaumarchaeota was remarkably higher than Euryarchaeota. The ammonia oxidation in the soil environment was probably driven by ammonia-oxidizing archaea, and new species of ammonia-oxidizing archaea existed in the soil sample.

  9. A high load of non-neutral amino-acid polymorphisms explains high protein diversity despite moderate effective population size in a marine bivalve with sweepstakes reproduction.

    PubMed

    Harrang, Estelle; Lapègue, Sylvie; Morga, Benjamin; Bierne, Nicolas

    2013-02-01

    Marine bivalves show among the greatest allozyme diversity ever reported in Eukaryotes, putting them historically at the heart of the neutralist-selectionist controversy on the maintenance of genetic variation. Although it is now acknowledged that this high diversity is most probably a simple consequence of a large population size, convincing support for this explanation would require a rigorous assessment of the silent nucleotide diversity in natural populations of marine bivalves, which has not yet been done. This study investigated DNA sequence polymorphism in a set of 37 nuclear loci in wild samples of the flat oyster Ostrea edulis. Silent diversity was found to be only moderate (0.7%), and there was no departure from demographic equilibrium under the Wright-Fisher model, suggesting that the effective population size might not be as large as might have been expected. In accordance with allozyme heterozygosity, nonsynonymous diversity was comparatively very high (0.3%), so that the nonsynonymous to silent diversity ratio reached a value rarely observed in any other organism. We estimated that one-quarter of amino acid-changing mutations behave as neutral in O. edulis, and as many as one-third are sufficiently weakly selected to segregate at low frequency in the polymorphism. Finally, we inferred that one oyster is expected to carry more than 4800 non-neutral alleles (or 4.2 cM(-1)). We conclude that a high load of segregating non-neutral amino-acid polymorphisms contributes to high protein diversity in O. edulis. The high fecundity of marine bivalves together with an unpredictable and highly variable success of reproduction and recruitment (sweepstakes reproduction) might produce a greater decoupling between Ne and N than in other organisms with lower fecundities, and we suggest this could explain why a higher segregating load could be maintained for a given silent mutation effective size.

  10. A High Load of Non-neutral Amino-Acid Polymorphisms Explains High Protein Diversity Despite Moderate Effective Population Size in a Marine Bivalve With Sweepstakes Reproduction

    PubMed Central

    Harrang, Estelle; Lapègue, Sylvie; Morga, Benjamin; Bierne, Nicolas

    2013-01-01

    Marine bivalves show among the greatest allozyme diversity ever reported in Eukaryotes, putting them historically at the heart of the neutralist−selectionist controversy on the maintenance of genetic variation. Although it is now acknowledged that this high diversity is most probably a simple consequence of a large population size, convincing support for this explanation would require a rigorous assessment of the silent nucleotide diversity in natural populations of marine bivalves, which has not yet been done. This study investigated DNA sequence polymorphism in a set of 37 nuclear loci in wild samples of the flat oyster Ostrea edulis. Silent diversity was found to be only moderate (0.7%), and there was no departure from demographic equilibrium under the Wright-Fisher model, suggesting that the effective population size might not be as large as might have been expected. In accordance with allozyme heterozygosity, nonsynonymous diversity was comparatively very high (0.3%), so that the nonsynonymous to silent diversity ratio reached a value rarely observed in any other organism. We estimated that one-quarter of amino acid-changing mutations behave as neutral in O. edulis, and as many as one-third are sufficiently weakly selected to segregate at low frequency in the polymorphism. Finally, we inferred that one oyster is expected to carry more than 4800 non-neutral alleles (or 4.2 cM−1). We conclude that a high load of segregating non-neutral amino-acid polymorphisms contributes to high protein diversity in O. edulis. The high fecundity of marine bivalves together with an unpredictable and highly variable success of reproduction and recruitment (sweepstakes reproduction) might produce a greater decoupling between Ne and N than in other organisms with lower fecundities, and we suggest this could explain why a higher segregating load could be maintained for a given silent mutation effective size. PMID:23390609

  11. Diversity analysis in Cannabis sativa based on large-scale development of expressed sequence tag-derived simple sequence repeat markers.

    PubMed

    Gao, Chunsheng; Xin, Pengfei; Cheng, Chaohua; Tang, Qing; Chen, Ping; Wang, Changbiao; Zang, Gonggu; Zhao, Lining

    2014-01-01

    Cannabis sativa L. is an important economic plant for the production of food, fiber, oils, and intoxicants. However, lack of sufficient simple sequence repeat (SSR) markers has limited the development of cannabis genetic research. Here, large-scale development of expressed sequence tag simple sequence repeat (EST-SSR) markers was performed to obtain more informative genetic markers, and to assess genetic diversity in cannabis (Cannabis sativa L.). Based on the cannabis transcriptome, 4,577 SSRs were identified from 3,624 ESTs. From there, a total of 3,442 complementary primer pairs were designed as SSR markers. Among these markers, trinucleotide repeat motifs (50.99%) were the most abundant, followed by hexanucleotide (25.13%), dinucleotide (16.34%), tetranucloetide (3.8%), and pentanucleotide (3.74%) repeat motifs, respectively. The AAG/CTT trinucleotide repeat (17.96%) was the most abundant motif detected in the SSRs. One hundred and seventeen EST-SSR markers were randomly selected to evaluate primer quality in 24 cannabis varieties. Among these 117 markers, 108 (92.31%) were successfully amplified and 87 (74.36%) were polymorphic. Forty-five polymorphic primer pairs were selected to evaluate genetic diversity and relatedness among the 115 cannabis genotypes. The results showed that 115 varieties could be divided into 4 groups primarily based on geography: Northern China, Europe, Central China, and Southern China. Moreover, the coefficient of similarity when comparing cannabis from Northern China with the European group cannabis was higher than that when comparing with cannabis from the other two groups, owing to a similar climate. This study outlines the first large-scale development of SSR markers for cannabis. These data may serve as a foundation for the development of genetic linkage, quantitative trait loci mapping, and marker-assisted breeding of cannabis.

  12. Diversity analysis in Cannabis sativa based on large-scale development of expressed sequence tag-derived simple sequence repeat markers.

    PubMed

    Gao, Chunsheng; Xin, Pengfei; Cheng, Chaohua; Tang, Qing; Chen, Ping; Wang, Changbiao; Zang, Gonggu; Zhao, Lining

    2014-01-01

    Cannabis sativa L. is an important economic plant for the production of food, fiber, oils, and intoxicants. However, lack of sufficient simple sequence repeat (SSR) markers has limited the development of cannabis genetic research. Here, large-scale development of expressed sequence tag simple sequence repeat (EST-SSR) markers was performed to obtain more informative genetic markers, and to assess genetic diversity in cannabis (Cannabis sativa L.). Based on the cannabis transcriptome, 4,577 SSRs were identified from 3,624 ESTs. From there, a total of 3,442 complementary primer pairs were designed as SSR markers. Among these markers, trinucleotide repeat motifs (50.99%) were the most abundant, followed by hexanucleotide (25.13%), dinucleotide (16.34%), tetranucloetide (3.8%), and pentanucleotide (3.74%) repeat motifs, respectively. The AAG/CTT trinucleotide repeat (17.96%) was the most abundant motif detected in the SSRs. One hundred and seventeen EST-SSR markers were randomly selected to evaluate primer quality in 24 cannabis varieties. Among these 117 markers, 108 (92.31%) were successfully amplified and 87 (74.36%) were polymorphic. Forty-five polymorphic primer pairs were selected to evaluate genetic diversity and relatedness among the 115 cannabis genotypes. The results showed that 115 varieties could be divided into 4 groups primarily based on geography: Northern China, Europe, Central China, and Southern China. Moreover, the coefficient of similarity when comparing cannabis from Northern China with the European group cannabis was higher than that when comparing with cannabis from the other two groups, owing to a similar climate. This study outlines the first large-scale development of SSR markers for cannabis. These data may serve as a foundation for the development of genetic linkage, quantitative trait loci mapping, and marker-assisted breeding of cannabis. PMID:25329551

  13. [Species diversity and interspecific association in development sequence of Hippophae rhamnoides plantations in Loess hilly region].

    PubMed

    Guo, Lian-jin; Zhang, Wen-hui; Liu, Guo-bin

    2007-01-01

    Based on field investigation, this paper analyzed the characteristics of species diversity and interspecific association at different development stages of Hippophcze rhamnoides plantations. The results showed that the species diversities of shrub layer, grass layer, and whole community of H. rharnnoides plantations were all fluctuated in "S" shape. At different development stages, the species richness and diversity were higher in grass layer than in shruh layer. The shrub species diversity was lower on hare land, but increased gradually with development stage. Shrub evenness index was higher in 13-year forest stand, while grass diversity index was higher in 3-year plantation, lower in 8-year plantation, and higher in 25-year plantation. The positive and negative absolute values of interspecific association between H. rharnnoides and other principal species changed in parabola shape, and the notable degree and the interspecific association intensity were weaker in 13-year plantation, showing that the species substitution rate was slower, competition was less, and community composition and its structure were relatively stable. To improve ecological environment, the H. rhamnoides plantations younger than 13 years old should he given priority to protection, while for those of 25 years old, moderate thinning should be made to promote the regeneration.

  14. Pattern recognition in nucleic acid sequences. II. An efficient method for finding locally stable secondary structures.

    PubMed Central

    Kanehisa, M I; Goad, W B

    1982-01-01

    We present a method for calculating all possible single hairpin loop secondary structures in a nucleic acid sequence by the order of N2 operations where N is the total number of bases. Each structure may contain any number of bulges and internal loops. Most natural sequences are found to be indistinguishable from random sequences in the potential of forming secondary structures, which is defined by the frequency of possible secondary structures calculated by the method. There is a strong correlation between the higher G+C content and the higher structure forming potential. Interestingly, the removal of intervening sequences in mRNAs is almost always accompanied by an increase in the G+C content, which may suggest an involvement of structural stabilization in the mRNA maturation. PMID:6174936

  15. Diversity-generating retroelement homing regenerates target sequences for repeated rounds of codon rewriting and protein diversification.

    PubMed

    Guo, Huatao; Tse, Longping V; Barbalat, Roman; Sivaamnuaiphorn, Sameer; Xu, Min; Doulatov, Sergei; Miller, Jeff F

    2008-09-26

    Diversity-generating retroelements (DGRs) introduce vast amounts of sequence diversity into target genes. During mutagenic homing, adenine residues are converted to random nucleotides in a unidirectional, reverse transcriptase-dependent transposition process from a donor template repeat (TR) to a recipient variable repeat (VR). Using a Bordetella bacteriophage DGR as a model, we demonstrate that homing occurs through a TR-containing RNA intermediate and is RecA independent. Marker transfer studies show that cDNA integration at the 3' end of VR occurs within a (G/C)(14) element, and deletion analysis demonstrates that the reaction is independent of 5' end cDNA integration. cDNA integration at the 5' end of VR requires only short stretches of sequence homology. We propose that homing occurs through a unique target DNA-primed reverse transcription mechanism that precisely regenerates target sequences. This nonproliferative "copy and replace" mechanism enables repeated rounds of protein diversification and optimization of ligand-receptor interactions.

  16. Diversity-Generating Retroelement Homing Regenerates Target Sequences for Repeated Rounds of Codon Rewriting and Protein Diversification

    PubMed Central

    Guo, Huatao; Tse, Longping V.; Barbalat, Roman; Sivaamnuaiphorn, Sameer; Xu, Min; Doulatov, Sergei; Miller, Jeff F.

    2009-01-01

    SUMMARY Diversity-generating retroelements (DGRs) introduce vast amounts of sequence diversity into target genes. During mutagenic homing, adenine residues are converted to random nucleotides in a unidirectional, reverse transcriptase-dependent transposition process from a donor template repeat (TR) to a recipient variable repeat (VR). Using a Bordetella bacteriophage DGR as a model, we demonstrate that homing occurs through a TR-containing RNA intermediate and is RecA-independent. Marker transfer studies show that cDNA integration at the 3′ end of VR occurs within a (G/C)14 element, and deletion analysis demonstrates that the reaction is independent of 5′-end cDNA integration. cDNA integration at the 5′ end of VR requires only short stretches of sequence homology. We propose that homing occurs through a unique target DNA-primed reverse transcription (TPRT) mechanism that precisely regenerates target sequences. This non-proliferative, “copy and replace” mechanism enables repeated rounds of protein diversification and optimization of ligand-receptor interactions. PMID:18922465

  17. Comparative population genetics of the panicoid grasses: sequence polymorphism, linkage disequilibrium and selection in a diverse sample of sorghum bicolor.

    PubMed Central

    Hamblin, Martha T; Mitchell, Sharon E; White, Gemma M; Gallego, Javier; Kukatla, Rakesh; Wing, Rod A; Paterson, Andrew H; Kresovich, Stephen

    2004-01-01

    Levels of genetic variation and linkage disequilibrium (LD) are critical factors in association mapping methods as well as in identification of loci that have been targets of selection. Maize, an outcrosser, has a high level of sequence variation and a limited extent of LD. Sorghum, a closely related but largely self-pollinating panicoid grass, is expected to have higher levels of LD. As a first step in estimation of population genetic parameters in sorghum, we surveyed 27 diverse S. bicolor accessions for sequence variation at a total of 29,186 bp in 95 short regions derived from genetically mapped RFLPs located throughout the genome. Consistent with its higher level of inbreeding, the extent of LD is at least severalfold greater in sorghum than in maize. Total sequence variation in sorghum is about fourfold lower than that in maize, while synonymous variation is fivefold lower, suggesting a smaller effective population size in sorghum. Because we surveyed a species-wide sample, the mating system, which primarily affects population-level diversity, may not be primarily responsible for this difference. Comparisons of polymorphism and divergence suggest that both directional and diversifying selection have played important roles in shaping variation in the sorghum genome. PMID:15166170

  18. High-Throughput Sequencing Analysis of the Endophytic Bacterial Diversity and Dynamics in Roots of the Halophyte Salicornia europaea.

    PubMed

    Zhao, Shuai; Zhou, Na; Zhao, Zheng-Yong; Zhang, Ke; Tian, Chang-Yan

    2016-05-01

    Endophytic bacterial communities of halophyte Salicornia europaea roots were analyzed by 16S rRNA gene pyrosequencing. A total of 20,151 partial 16S rRNA gene sequences were obtained. These sequences revealed huge amounts of operational taxonomic units (OTUs), that is, 747-1405 OTUs in a root sample, at 3 % cut-off level. Root endophytes mainly comprised four phyla, among which Proteobacteria was the most represented, followed by Bacteroidetes, Actinobacteria, and Firmicutes. Gammaproteobacteria was the most abundant class of Proteobacteria, followed by Betaproteobacteria and Alphaproteobacteria. Genera Pantoea, Halomonas, Azomonas, Serpens, and Pseudomonas were shared by all growth periods. A marked difference in endophytic bacterial communities was evident in roots from different host life-history stages. Gammaproteobacteria increased during the five periods, while Betaproteobacteria decreased. The richest endophytic bacteria diversity was detected in the seedling stage. Endophytic bacteria diversity was reduced during the flowering stage and fruiting stage. The five libraries contained 2321 different OTUs with 41 OTUs in common. As a whole, this study first surveys communities of endophytic bacteria by tracing crucial stages in the process of halophyte growth using high-throughput sequencing methods. PMID:26787546

  19. Genetic diversity of Taenia asiatica from Thailand and other geographical locations as revealed by cytochrome c oxidase subunit 1 sequences.

    PubMed

    Anantaphruti, Malinee Thairungroj; Thaenkham, Urusa; Watthanakulpanich, Dorn; Phuphisut, Orawan; Maipanich, Wanna; Yoonuan, Tippayarat; Nuamtanong, Supaporn; Pubampen, Somjit; Sanguankiat, Surapol

    2013-02-01

    Twelve 924 bp cytochrome c oxidase subunit 1 (cox1) mitochondrial DNA sequences from Taenia asiatica isolates from Thailand were aligned and compared with multiple sequence isolates from Thailand and 6 other countries from the GenBank database. The genetic divergence of T. asiatica was also compared with Taenia saginata database sequences from 6 different countries in Asia, including Thailand, and 3 countries from other continents. The results showed that there were minor genetic variations within T. asiatica species, while high intraspecies variation was found in T. saginata. There were only 2 haplotypes and 1 polymorphic site found in T. asiatica, but 8 haplotypes and 9 polymorphic sites in T. saginata. Haplotype diversity was very low, 0.067, in T. asiatica and high, 0.700, in T. saginata. The very low genetic diversity suggested that T. asiatica may be at a risk due to the loss of potential adaptive alleles, resulting in reduced viability and decreased responses to environmental changes, which may endanger the species. PMID:23467439

  20. Diverse and related 16S rRNA-encoding DNA sequences in prostate tissues of men with chronic prostatitis.

    PubMed

    Riley, D E; Berger, R E; Miner, D C; Krieger, J N

    1998-06-01

    Treatment of chronic prostatitis/chronic pelvic pain syndrome is often empirical because clinical culture methods fail to detect prostate-associated pathogens in >90% of patients. Previously, we tested a variety of specific-microorganism PCRs and began a DNA sequence study after we found that 77% of prostatitis patients were PCR positive for prokaryotic rRNA-encoding DNA sequences (rDNAs) despite negative cultures using optimal techniques. In the present study, 36 rDNA clones from 23 rDNA-positive patients were sequenced. This study represents more than twice the total rDNA sequence and more than twice the number of patients in the previous study. The increased number of patients and clones sequenced allowed enhanced phylogenetic analyses and refinements in our view of rDNA species inhabiting the prostate. A continuum of related rDNAs that might be arbitrarily described as two major groups of rDNAs and several minor groups was found. Sequences termed Pros A, identified in 8 (35%) of 23 rDNA-positive patients, grouped with Aeromonas spp. in phylogenetic studies. Sequences termed Pros B, identified in 17 (74%) of 23 rDNA-positive patients, were distinct from previously reported sequences, although all were >90% similar to known gram-negative bacteria. Of the nine patients for whom multiple rDNAs were sequenced, six had biopsy specimens containing rDNAs from more than one species. Four (17%) patients had rDNAs different from those of the Pros A and Pros B groups. Of these four, one patient had rDNA similar to that of Flavobacterium spp., another had rDNA similar to that of Pseudomonas testosteroni, and two patients had rDNAs <70% similar to known rDNAs. These findings suggest that the prostate can harbor bacteria undetectable by traditional approaches. Most of these diverse sequences are not reported in environments outside the prostate. The sequence similarities suggest adaptation of limited groups of bacteria to the microenvironment of the prostate. Further studies

  1. Deciphering the Diversities of Astroviruses and Noroviruses in Wastewater Treatment Plant Effluents by a High-Throughput Sequencing Method.

    PubMed

    Prevost, B; Lucas, F S; Ambert-Balay, K; Pothier, P; Moulin, L; Wurtzer, S

    2015-10-01

    Although clinical epidemiology lists human enteric viruses to be among the primary causes of acute gastroenteritis in the human population, their circulation in the environment remains poorly investigated. These viruses are excreted by the human population into sewers and may be released into rivers through the effluents of wastewater treatment plants (WWTPs). In order to evaluate the viral diversity and loads in WWTP effluents of the Paris, France, urban area, which includes about 9 million inhabitants (approximately 15% of the French population), the seasonal occurrence of astroviruses and noroviruses in 100 WWTP effluent samples was investigated over 1 year. The coupling of these measurements with a high-throughput sequencing approach allowed the specific estimation of the diversity of human astroviruses (human astrovirus genotype 1 [HAstV-1], HAstV-2, HAstV-5, and HAstV-6), 7 genotypes of noroviruses (NoVs) of genogroup I (NoV GI.1 to NoV GI.6 and NoV GI.8), and 16 genotypes of NoVs of genogroup II (NoV GII.1 to NoV GII.7, NoV GII.9, NoV GII.12 to NoV GII.17, NoV GII.20, and NoV GII.21) in effluent samples. Comparison of the viral diversity in WWTP effluents to the viral diversity found by analysis of clinical data obtained throughout France underlined the consistency between the identified genotypes. However, some genotypes were locally present in effluents and were not found in the analysis of the clinical data. These findings could highlight an underestimation of the diversity of enteric viruses circulating in the human population. Consequently, analysis of WWTP effluents could allow the exploration of viral diversity not only in environmental waters but also in a human population linked to a sewerage network in order to better comprehend viral epidemiology and to forecast seasonal outbreaks.

  2. Deciphering the Diversities of Astroviruses and Noroviruses in Wastewater Treatment Plant Effluents by a High-Throughput Sequencing Method

    PubMed Central

    Prevost, B.; Lucas, F. S.; Ambert-Balay, K.; Pothier, P.; Wurtzer, S.

    2015-01-01

    Although clinical epidemiology lists human enteric viruses to be among the primary causes of acute gastroenteritis in the human population, their circulation in the environment remains poorly investigated. These viruses are excreted by the human population into sewers and may be released into rivers through the effluents of wastewater treatment plants (WWTPs). In order to evaluate the viral diversity and loads in WWTP effluents of the Paris, France, urban area, which includes about 9 million inhabitants (approximately 15% of the French population), the seasonal occurrence of astroviruses and noroviruses in 100 WWTP effluent samples was investigated over 1 year. The coupling of these measurements with a high-throughput sequencing approach allowed the specific estimation of the diversity of human astroviruses (human astrovirus genotype 1 [HAstV-1], HAstV-2, HAstV-5, and HAstV-6), 7 genotypes of noroviruses (NoVs) of genogroup I (NoV GI.1 to NoV GI.6 and NoV GI.8), and 16 genotypes of NoVs of genogroup II (NoV GII.1 to NoV GII.7, NoV GII.9, NoV GII.12 to NoV GII.17, NoV GII.20, and NoV GII.21) in effluent samples. Comparison of the viral diversity in WWTP effluents to the viral diversity found by analysis of clinical data obtained throughout France underlined the consistency between the identified genotypes. However, some genotypes were locally present in effluents and were not found in the analysis of the clinical data. These findings could highlight an underestimation of the diversity of enteric viruses circulating in the human population. Consequently, analysis of WWTP effluents could allow the exploration of viral diversity not only in environmental waters but also in a human population linked to a sewerage network in order to better comprehend viral epidemiology and to forecast seasonal outbreaks. PMID:26253673

  3. Deciphering the Diversities of Astroviruses and Noroviruses in Wastewater Treatment Plant Effluents by a High-Throughput Sequencing Method.

    PubMed

    Prevost, B; Lucas, F S; Ambert-Balay, K; Pothier, P; Moulin, L; Wurtzer, S

    2015-10-01

    Although clinical epidemiology lists human enteric viruses to be among the primary causes of acute gastroenteritis in the human population, their circulation in the environment remains poorly investigated. These viruses are excreted by the human population into sewers and may be released into rivers through the effluents of wastewater treatment plants (WWTPs). In order to evaluate the viral diversity and loads in WWTP effluents of the Paris, France, urban area, which includes about 9 million inhabitants (approximately 15% of the French population), the seasonal occurrence of astroviruses and noroviruses in 100 WWTP effluent samples was investigated over 1 year. The coupling of these measurements with a high-throughput sequencing approach allowed the specific estimation of the diversity of human astroviruses (human astrovirus genotype 1 [HAstV-1], HAstV-2, HAstV-5, and HAstV-6), 7 genotypes of noroviruses (NoVs) of genogroup I (NoV GI.1 to NoV GI.6 and NoV GI.8), and 16 genotypes of NoVs of genogroup II (NoV GII.1 to NoV GII.7, NoV GII.9, NoV GII.12 to NoV GII.17, NoV GII.20, and NoV GII.21) in effluent samples. Comparison of the viral diversity in WWTP effluents to the viral diversity found by analysis of clinical data obtained throughout France underlined the consistency between the identified genotypes. However, some genotypes were locally present in effluents and were not found in the analysis of the clinical data. These findings could highlight an underestimation of the diversity of enteric viruses circulating in the human population. Consequently, analysis of WWTP effluents could allow the exploration of viral diversity not only in environmental waters but also in a human population linked to a sewerage network in order to better comprehend viral epidemiology and to forecast seasonal outbreaks. PMID:26253673

  4. Analysis of bacterial diversity in acidic pond water and compost after treatment of artificial acid mine drainage for metal removal.

    PubMed

    Morales, Teresita A; Dopson, Mark; Athar, Rana; Herbert, Roger B

    2005-06-01

    The microbial population of a sludge amended leaf compost material utilized for treatment of artificial acid mine drainage was studied by culture-independent molecular methods. Iron-rich and sulfurous wastewater (artificial acid mine drainage) was circulated through a column bioreactor for 16 months. After 12 months the column was inoculated with a mixed culture from an acidic pond receiving acid mine drainage from a tailings impoundment at a decommissioned site in Kristineberg, North Sweden. Hydrogen sulfide odor and the formation of black precipitates indicated that sulfate-reduction occurred in the column. 16S rDNA gene analysis by denaturing gradient gel electrophoresis, cloning, and sequencing as well as fluorescent in situ hybridization confirmed the presence of microorganisms closely related to sulfate-reducing bacteria and microorganisms from the genera Pseudoxanthmonas, Dechlorosoma, Desulfovibrio, Agrobacterium, Methylocapsa, Rhodococcus, Sulfobacillus, and some unidentified bacteria. Sulfate-reducing bacteria were found in the column bioreactor 2 weeks after inoculation, but not thereafter. This suggests they were in low abundance, even though sulfate remediation rates were significant. Instead, the population contained species similar to those previously found to utilize humic substances released from the compost material. PMID:15818559

  5. Diverse Array of New Viral Sequences Identified in Worldwide Populations of the Asian Citrus Psyllid (Diaphorina citri) Using Viral Metagenomics

    PubMed Central

    Nouri, Shahideh; Salem, Nidá; Nigg, Jared C.

    2015-01-01

    ABSTRACT The Asian citrus psyllid, Diaphorina citri, is the natural vector of the causal agent of Huanglongbing (HLB), or citrus greening disease. Together; HLB and D. citri represent a major threat to world citrus production. As there is no cure for HLB, insect vector management is considered one strategy to help control the disease, and D. citri viruses might be useful. In this study, we used a metagenomic approach to analyze viral sequences associated with the global population of D. citri. By sequencing small RNAs and the transcriptome coupled with bioinformatics analysis, we showed that the virus-like sequences of D. citri are diverse. We identified novel viral sequences belonging to the picornavirus superfamily, the Reoviridae, Parvoviridae, and Bunyaviridae families, and an unclassified positive-sense single-stranded RNA virus. Moreover, a Wolbachia prophage-related sequence was identified. This is the first comprehensive survey to assess the viral community from worldwide populations of an agricultural insect pest. Our results provide valuable information on new putative viruses, some of which may have the potential to be used as biocontrol agents. IMPORTANCE Insects have the most species of all animals, and are hosts to, and vectors of, a great variety of known and unknown viruses. Some of these most likely have the potential to be important fundamental and/or practical resources. In this study, we used high-throughput next-generation sequencing (NGS) technology and bioinformatics analysis to identify putative viruses associated with Diaphorina citri, the Asian citrus psyllid. D. citri is the vector of the bacterium causing Huanglongbing (HLB), currently the most serious threat to citrus worldwide. Here, we report several novel viral sequences associated with D. citri. PMID:26676774

  6. Genetic diversity and variance of Stentor coeruleus (Ciliophora: Heterotrichea) inferred from inter-simple sequence repeat (ISSR) fingerprinting.

    PubMed

    Zhang, Wen-Jing; Lin, Yuan-Shao; Cao, Wen-Qing; Yang, Jun

    2012-01-01

    We used inter-simple sequence repeat fingerprinting to analyze the genetic structure of 16 populations of Stentor coeruleus from three lakes and three ponds in China. Using 14 polymorphic primers, a total of 99 discernible DNA fragments were detected, among which 76 (76.77%) were polymorphic, indicating median genetic diversity in these populations. Further, both Nei's gene diversity (h) and Shannon's information index (I) between the different populations revealed a median genetic diversity. At the same time, gene flow was interpreted to be low. The main factors responsible for the median level of diversity and low gene flow within populations are probably due to a low frequency of sexual recombinations. Analysis of molecular variance showed that there was high genetic differentiation among the five water bodies. Both cluster analysis and a nonmetric multidimensional scaling analysis suggested that genotypes isolated from the same locations displayed a higher genetic similarity than those from different ones, separating populations into subgroups according to their geographical locations. However, there is a weak positive correlation between the genetic distance and geographical distance. PMID:22239713

  7. Genetic diversity of wild Prunus cerasifera Ehrhart (wild cherry plum) in China revealed by simple-sequence repeat markers.

    PubMed

    Zhao, Y; Li, Y; Liu, Y; Yang, Y F

    2015-07-28

    Simple-sequence repeat (SSR) markers were employed to assess the genetic diversity of wild Prunus cerasifera Ehrhart (wild cherry plum) in China. Fourteen SSR primer pairs generated a total of 94 alleles (90 were polymorphic, accounting for 95.74%), with a mean of 6.71 alleles per locus. The number of alleles detected at each locus ranged from 2 at BPPCT 028 to 13 at BPPCT 002, with an average of 6.71 alleles per locus. Nei's genetic diversity ranged from 0.0938 to 0.4951 and Shannon's information index ranged from 0.1706 to 0.6882, with averages of 0.3295 and 0.4899, respectively. The SSR data indicated moderate genetic diversity of P. cerasifera in China. In the unweighted pair group method with arithmetic mean phylogenetic tree, the 40 forms of P. cerasifera were divided into 3 genetic clusters. However, the 3 clades determined using SSR data were not consistent with the classification based on morphological characters, such as fruit color. Because of the endangered status and the moderate genetic diversity of P. cerasifera in China, both in situ and ex situ conservation strategies should be adopted.

  8. On the use of high-throughput sequencing for the study of cyanobacterial diversity in Antarctic aquatic mats.

    PubMed

    Pessi, Igor Stelmach; Maalouf, Pedro De Carvalho; Laughinghouse, Haywood Dail; Baurain, Denis; Wilmotte, Annick

    2016-06-01

    The study of Antarctic cyanobacterial diversity has been mostly limited to morphological identification and traditional molecular techniques. High-throughput sequencing (HTS) allows a much better understanding of microbial distribution in the environment, but its application is hampered by several methodological and analytical challenges. In this work, we explored the use of HTS as a tool for the study of cyanobacterial diversity in Antarctic aquatic mats. Our results highlight the importance of using artificial communities to validate the parameters of the bioinformatics procedure used to analyze natural communities, since pipeline-dependent biases had a strong effect on the observed community structures. Analysis of microbial mats from five Antarctic lakes and an aquatic biofilm from the Sub-Antarctic showed that HTS is a valuable tool for the assessment of cyanobacterial diversity. The majority of the operational taxonomic units retrieved were related to filamentous taxa such as Leptolyngbya and Phormidium, which are common genera in Antarctic lacustrine microbial mats. However, other phylotypes related to different taxa such as Geitlerinema, Pseudanabaena, Synechococcus, Chamaesiphon, Calothrix, and Coleodesmium were also found. Results revealed a much higher diversity than what had been reported using traditional methods and also highlighted remarkable differences between the cyanobacterial communities of the studied lakes. The aquatic biofilm from the Sub-Antarctic had a distinct cyanobacterial community from the Antarctic lakes, which in turn displayed a salinity-dependent community structure at the phylotype level.

  9. Genetic diversity and population structure of black Dahe pig based on DNA sequences analyses of mitochondrial and nuclear genes.

    PubMed

    Tang, Lizhou; Yu, Long; Wang, Junjie; Liu, Chao; Shi, Xiaodong; Ding, Wei; Zhu, Lei; Guo, Songchang

    2016-01-01

    To investigate the genetic diversity and population structure of black Dahe pigs, we collected 175 samples from 5 local populations and sequenced them using a combination of two selected molecular markers for mitochondrial cytochrome b and Major Histocompatibility Complex (MHC) DRB. Overall, the results of AMOVA and phylogenetic tree and gene flow analyses detected high levels of gene flow among the five populations, particularly individual pigs from Dahe town (Pop1) or Yingshang town (Pop2) to other populations (Pop3, Pop4, and Pop5). The genetic diversity analyses showed that the diversity indices of the five populations did not vary significantly, but they were much lower than those of other Chinese pig species. These results suggest that distinct gene flow, unstable population pattern, and lower genetic diversity have been influenced mainly by human introductions for economic ends. These findings provide genetic information that could be used for the preservation and further genetic improvement of the black Dahe pig, as well as an important reference for the evaluation, conservation, and utilization of the genetic resources of this breed.

  10. On the use of high-throughput sequencing for the study of cyanobacterial diversity in Antarctic aquatic mats.

    PubMed

    Pessi, Igor Stelmach; Maalouf, Pedro De Carvalho; Laughinghouse, Haywood Dail; Baurain, Denis; Wilmotte, Annick

    2016-06-01

    The study of Antarctic cyanobacterial diversity has been mostly limited to morphological identification and traditional molecular techniques. High-throughput sequencing (HTS) allows a much better understanding of microbial distribution in the environment, but its application is hampered by several methodological and analytical challenges. In this work, we explored the use of HTS as a tool for the study of cyanobacterial diversity in Antarctic aquatic mats. Our results highlight the importance of using artificial communities to validate the parameters of the bioinformatics procedure used to analyze natural communities, since pipeline-dependent biases had a strong effect on the observed community structures. Analysis of microbial mats from five Antarctic lakes and an aquatic biofilm from the Sub-Antarctic showed that HTS is a valuable tool for the assessment of cyanobacterial diversity. The majority of the operational taxonomic units retrieved were related to filamentous taxa such as Leptolyngbya and Phormidium, which are common genera in Antarctic lacustrine microbial mats. However, other phylotypes related to different taxa such as Geitlerinema, Pseudanabaena, Synechococcus, Chamaesiphon, Calothrix, and Coleodesmium were also found. Results revealed a much higher diversity than what had been reported using traditional methods and also highlighted remarkable differences between the cyanobacterial communities of the studied lakes. The aquatic biofilm from the Sub-Antarctic had a distinct cyanobacterial community from the Antarctic lakes, which in turn displayed a salinity-dependent community structure at the phylotype level. PMID:27273529

  11. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization.

    PubMed

    Anahtar, Melis N; Bowman, Brittany A; Kwon, Douglas S

    2016-01-01

    There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information. PMID:27168460

  12. Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization

    PubMed Central

    Anahtar, Melis N.; Bowman, Brittany A.; Kwon, Douglas S.

    2016-01-01

    There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information. PMID:27168460

  13. Design of nucleic acid sequences for DNA computing based on a thermodynamic approach.

    PubMed

    Tanaka, Fumiaki; Kameda, Atsushi; Yamamoto, Masahito; Ohuchi, Azuma

    2005-01-01

    We have developed an algorithm for designing multiple sequences of nucleic acids that have a uniform melting temperature between the sequence and its complement and that do not hybridize non-specifically with each other based on the minimum free energy (DeltaG (min)). Sequences that satisfy these constraints can be utilized in computations, various engineering applications such as microarrays, and nano-fabrications. Our algorithm is a random generate-and-test algorithm: it generates a candidate sequence randomly and tests whether the sequence satisfies the constraints. The novelty of our algorithm is that the filtering method uses a greedy search to calculate DeltaG (min). This effectively excludes inappropriate sequences before DeltaG (min) is calculated, thereby reducing computation time drastically when compared with an algorithm without the filtering. Experimental results in silico showed the superiority of the greedy search over the traditional approach based on the hamming distance. In addition, experimental results in vitro demonstrated that the experimental free energy (DeltaG (exp)) of 126 sequences correlated well with DeltaG (min) (|R| = 0.90) than with the hamming distance (|R| = 0.80). These results validate the rationality of a thermodynamic approach. We implemented our algorithm in a graphic user interface-based program written in Java.

  14. Diversity and dynamics of dominant and rare bacterial taxa in replicate sequencing batch reactors operated under different solids retention time.

    PubMed

    Bagchi, Samik; Tellez, Berenice G; Rao, Hari Ananda; Lamendella, Regina; Saikaly, Pascal E

    2015-03-01

    In this study, 16S rRNA gene pyrosequencing was applied in order to provide a better insight on the diversity and dynamics of total, dominant, and rare bacterial taxa in replicate lab-scale sequencing batch reactors (SBRs) operated at different solids retention time (SRT). Rank-abundance curves showed few dominant operational taxonomic units (OTUs) and a long tail of rare OTUs in all reactors. Results revealed that there was no detectable effect of SRT (2 vs. 10 days) on Shannon diversity index and OTU richness of both dominant and rare taxa. Nonmetric multidimensional scaling analysis showed that the total, dominant, and rare bacterial taxa were highly dynamic during the entire period of stable reactor performance. Also, the rare taxa were more dynamic than the dominant taxa despite expected low invasion rates because of the use of sterile synthetic media. PMID:25326778

  15. Assessment of genetic diversity by simple sequence repeat markers among forty elite varieties in the germplasm for malting barley breeding*

    PubMed Central

    Wang, Jun-mei; Yang, Jian-ming; Zhu, Jing-huan; Jia, Qiao-jun; Tao, Yue-zhi

    2010-01-01

    The genetic diversity and relationship among 40 elite barley varieties were analyzed based on simple sequence repeat (SSR) genotyping data. The amplified fragments from SSR primers were highly polymorphic in the barley accessions investigated. A total of 85 alleles were detected at 35 SSR loci, and allelic variations existed at 29 SSR loci. The allele number per locus ranged from 1 to 5 with an average of 2.4 alleles per locus detected from the 40 barley accessions. A cluster analysis based on the genetic similarity coefficients was conducted and the 40 varieties were classified into two groups. Seven malting barley varieties from China fell into the same subgroup. It was found that the genetic diversity within the Chinese malting barley varieties was narrower than that in other barley germplasm sources, suggesting the importance and feasibility of introducing elite genotypes from different origins for malting barley breeding in China. PMID:20872987

  16. Diversity and dynamics of dominant and rare bacterial taxa in replicate sequencing batch reactors operated under different solids retention time.

    PubMed

    Bagchi, Samik; Tellez, Berenice G; Rao, Hari Ananda; Lamendella, Regina; Saikaly, Pascal E

    2015-03-01

    In this study, 16S rRNA gene pyrosequencing was applied in order to provide a better insight on the diversity and dynamics of total, dominant, and rare bacterial taxa in replicate lab-scale sequencing batch reactors (SBRs) operated at different solids retention time (SRT). Rank-abundance curves showed few dominant operational taxonomic units (OTUs) and a long tail of rare OTUs in all reactors. Results revealed that there was no detectable effect of SRT (2 vs. 10 days) on Shannon diversity index and OTU richness of both dominant and rare taxa. Nonmetric multidimensional scaling analysis showed that the total, dominant, and rare bacterial taxa were highly dynamic during the entire period of stable reactor performance. Also, the rare taxa were more dynamic than the dominant taxa despite expected low invasion rates because of the use of sterile synthetic media.

  17. Assessment of genetic diversity by simple sequence repeat markers among forty elite varieties in the germplasm for malting barley breeding.

    PubMed

    Wang, Jun-mei; Yang, Jian-ming; Zhu, Jing-huan; Jia, Qiao-jun; Tao, Yue-zhi

    2010-10-01

    The genetic diversity and relationship among 40 elite barley varieties were analyzed based on simple sequence repeat (SSR) genotyping data. The amplified fragments from SSR primers were highly polymorphic in the barley accessions investigated. A total of 85 alleles were detected at 35 SSR loci, and allelic variations existed at 29 SSR loci. The allele number per locus ranged from 1 to 5 with an average of 2.4 alleles per locus detected from the 40 barley accessions. A cluster analysis based on the genetic similarity coefficients was conducted and the 40 varieties were classified into two groups. Seven malting barley varieties from China fell into the same subgroup. It was found that the genetic diversity within the Chinese malting barley varieties was narrower than that in other barley germplasm sources, suggesting the importance and feasibility of introducing elite genotypes from different origins for malting barley breeding in China. PMID:20872987

  18. Natural variation in Brachypodium disctachyon: Deep Sequencing of Highly Diverse Natural Accessions (2013 DOE JGI Genomics of Energy and Environment 8th Annual User Meeting)

    SciTech Connect

    Gordon, Sean

    2013-03-01

    Sean Gordon of the USDA on "Natural variation in Brachypodium disctachyon: Deep Sequencing of Highly Diverse Natural Accessions" at the 8th Annual Genomics of Energy & Environment Meeting on March 27, 2013 in Walnut Creek, Calif.

  19. Preparation of Nucleic Acid Libraries for Personalized Sequencing Systems Using an Integrated Microfluidic Hub Technology (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)

    ScienceCinema

    Patel, Kamlesh D [Ken; SNL,

    2016-07-12

    Kamlesh (Ken) Patel from Sandia National Laboratories (Livermore, California) presents "Preparation of Nucleic Acid Libraries for Personalized Sequencing Systems Using an Integrated Microfluidic Hub Technology " at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

  20. Preparation of Nucleic Acid Libraries for Personalized Sequencing Systems Using an Integrated Microfluidic Hub Technology (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)

    SciTech Connect

    Patel, Kamlesh D; SNL,

    2012-06-01

    Kamlesh (Ken) Patel from Sandia National Laboratories (Livermore, California) presents "Preparation of Nucleic Acid Libraries for Personalized Sequencing Systems Using an Integrated Microfluidic Hub Technology " at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

  1. Genetic diversity, genetic structure and demographic history of Cycas simplicipinna (Cycadaceae) assessed by DNA sequences and SSR markers

    PubMed Central

    2014-01-01

    Background Cycas simplicipinna (T. Smitinand) K. Hill. (Cycadaceae) is an endangered species in China. There were seven populations and 118 individuals that we could collect were genotyped in this study. Here, we assessed the genetic diversity, genetic structure and demographic history of this species. Results Analyses of data of DNA sequences (two maternally inherited intergenic spacers of chloroplast, cpDNA and one biparentally inherited internal transcribed spacer region ITS4-ITS5, nrDNA) and sixteen microsatellite loci (SSR) were conducted in the species. Of the 118 samples, 86 individuals from the seven populations were used for DNA sequencing and 115 individuals from six populations were used for the microsatellite study. We found high genetic diversity at the species level, low genetic diversity within each of the seven populations and high genetic differentiation among the populations. There was a clear genetic structure within populations of C. simplicipinna. A demographic history inferred from DNA sequencing data indicates that C. simplicipinna experienced a recent population contraction without retreating to a common refugium during the last glacial period. The results derived from SSR data also showed that C. simplicipinna underwent past effective population contraction, likely during the Pleistocene. Conclusions Some genetic features of C. simplicipinna such as having high genetic differentiation among the populations, a clear genetic structure and a recent population contraction could provide guidelines for protecting this endangered species from extinction. Furthermore, the genetic features with population dynamics of the species in our study would help provide insights and guidelines for protecting other endangered species effectively. PMID:25016306

  2. Staphylococcus epidermidis pan-genome sequence analysis reveals diversity of skin commensal and hospital infection-associated isolates

    PubMed Central

    2012-01-01

    Background While Staphylococcus epidermidis is commonly isolated from healthy human skin, it is also the most frequent cause of nosocomial infections on indwelling medical devices. Despite its importance, few genome sequences existed and the most frequent hospital-associated lineage, ST2, had not been fully sequenced. Results We cultivated 71 commensal S. epidermidis isolates from 15 skin sites and compared them with 28 nosocomial isolates from venous catheters and blood cultures. We produced 21 commensal and 9 nosocomial draft genomes, and annotated and compared their gene content, phylogenetic relatedness and biochemical functions. The commensal strains had an open pan-genome with 80% core genes and 20% variable genes. The variable genome was characterized by an overabundance of transposable elements, transcription factors and transporters. Biochemical diversity, as assayed by antibiotic resistance and in vitro biofilm formation, demonstrated the varied phenotypic consequences of this genomic diversity. The nosocomial isolates exhibited both large-scale rearrangements and single-nucleotide variation. We showed that S. epidermidis genomes separate into two phylogenetic groups, one consisting only of commensals. The formate dehydrogenase gene, present only in commensals, is a discriminatory marker between the two groups. Conclusions Commensal skin S. epidermidis have an open pan-genome and show considerable diversity between isolates, even when derived from a single individual or body site. For ST2, the most common nosocomial lineage, we detect variation between three independent isolates sequenced. Finally, phylogenetic analyses revealed a previously unrecognized group of S. epidermidis strains characterized by reduced virulence and formate dehydrogenase, which we propose as a clinical molecular marker. PMID:22830599

  3. Studies on adenosine triphosphate transphosphorylases. Amino acid sequence of rabbit muscle ATP-AMP transphosphorylase.

    PubMed

    Kuby, S A; Palmieri, R H; Frischat, A; Fischer, A H; Wu, L H; Maland, L; Manship, M

    1984-05-22

    The total amino acid sequence of rabbit muscle adenylate kinase has been determined, and the single polypeptide chain of 194 amino acid residues starts with N-acetylmethionine and ends with leucyllysine at its carboxyl terminus, in agreement with the earlier data on its amino acid composition [Mahowald, T. A., Noltmann, E. A., & Kuby, S. A. (1962) J. Biol. Chem. 237, 1138-1145] and its carboxyl-terminus sequence [Olson, O. E., & Kuby, S. A. (1964) J. Biol. Chem. 239, 460-467]. Elucidation of the primary structure was based on tryptic and chymotryptic cleavages of the performic acid oxidized protein, cyanogen bromide cleavages of the 14C-labeled S-carboxymethylated protein at its five methionine sites (followed by maleylation of peptide fragments), and tryptic cleavages at its 12 arginine sites of the maleylated 14C-labeled S-carboxymethylated protein. Calf muscle myokinase, whose sequence has also been established, differs primarily from the rabbit muscle myokinase's sequence in the following: His-30 is replaced by Gln-30; Lys-56 is replaced by