Science.gov

Sample records for acid sequences reveal

  1. Buffalo (Bubalus bubalis) interleukin-2: sequence analysis reveals high nucleotide and amino acid identity with interleukin-2 of cattle and other ruminants.

    PubMed

    Sreekumar, E; Premraj, A; Saravanakumar, M; Rasool, T J

    2002-08-01

    A 4400-bp genomic sequence and a 332-bp truncated cDNA sequence of the interleukin-2 (IL-2) gene of Indian water buffalo (Bubalus bubalis) were amplified by polymerase chain reaction and cloned. The coding sequence of the buffalo IL-2 gene was assembled from the 5' end of the genomic clone and the truncated cDNA clone. This sequence had 98.5% nucleotide identity and 98% amino acid identity with cattle IL-2. Three amino acid substitutions were observed at positions 63, 124 and 135. Comparison of the predicted protein structure of buffalo IL-2 with that of human and cattle IL-2 did not reveal significant differences. The putative amino acids responsible for IL-2 receptor binding were conserved in buffalo, cattle and human IL-2. The amino acid sequence of buffalo IL-2 also showed very high identity with that of other ruminants, indicating functional cross-reactivity.

  2. Genome sequence of the deep-sea gamma-proteobacterium Idiomarina loihiensis reveals amino acid fermentation as a source of carbon and energy.

    PubMed

    Hou, Shaobin; Saw, Jimmy H; Lee, Kit Shan; Freitas, Tracey A; Belisle, Claude; Kawarabayasi, Yutaka; Donachie, Stuart P; Pikina, Alla; Galperin, Michael Y; Koonin, Eugene V; Makarova, Kira S; Omelchenko, Marina V; Sorokin, Alexander; Wolf, Yuri I; Li, Qing X; Keum, Young Soo; Campbell, Sonia; Denery, Judith; Aizawa, Shin-Ichi; Shibata, Satoshi; Malahoff, Alexander; Alam, Maqsudul

    2004-12-28

    We report the complete genome sequence of the deep-sea gamma-proteobacterium, Idiomarina loihiensis, isolated recently from a hydrothermal vent at 1,300-m depth on the Loihi submarine volcano, Hawaii. The I. loihiensis genome comprises a single chromosome of 2,839,318 base pairs, encoding 2,640 proteins, four rRNA operons, and 56 tRNA genes. A comparison of I. loihiensis to the genomes of other gamma-proteobacteria reveals abundance of amino acid transport and degradation enzymes, but a loss of sugar transport systems and certain enzymes of sugar metabolism. This finding suggests that I. loihiensis relies primarily on amino acid catabolism, rather than on sugar fermentation, for carbon and energy. Enzymes for biosynthesis of purines, pyrimidines, the majority of amino acids, and coenzymes are encoded in the genome, but biosynthetic pathways for Leu, Ile, Val, Thr, and Met are incomplete. Auxotrophy for Val and Thr was confirmed by in vivo experiments. The I. loihiensis genome contains a cluster of 32 genes encoding enzymes for exopolysaccharide and capsular polysaccharide synthesis. It also encodes diverse peptidases, a variety of peptide and amino acid uptake systems, and versatile signal transduction machinery. We propose that the source of amino acids for I. loihiensis growth are the proteinaceous particles present in the deep sea hydrothermal vent waters. I. loihiensis would colonize these particles by using the secreted exopolysaccharide, digest these proteins, and metabolize the resulting peptides and amino acids. In summary, the I. loihiensis genome reveals an integrated mechanism of metabolic adaptation to the constantly changing deep-sea hydrothermal ecosystem. PMID:15596722

  3. Low-coverage exome sequencing screen in formalin-fixed paraffin-embedded tumors reveals evidence of exposure to carcinogenic aristolochic acid

    PubMed Central

    Castells, Xavier; Karanović, Sandra; Ardin, Maude; Tomić, Karla; Xylinas, Evanguelos; Durand, Geoffroy; Villar, Stephanie; Forey, Nathalie; Le Calvez-Kelm, Florence; Voegele, Catherine; Karlović, Krešimir; Mišić, Maja; Dittrich, Damir; Dolgalev, Igor; McKay, James; Shariat, Shahrokh F.; Sidorenko, Viktoria S.; Fernandes, Andrea; Heguy, Adriana; Dickman, Kathleen G.; Olivier, Magali; Grollman, Arthur P.; Jelaković, Bojan; Zavadil, Jiri

    2015-01-01

    Background Dietary exposure to cytotoxic and carcinogenic aristolochic acid (AA) causes severe nephropathy typically associated with urological cancers. Monitoring of AA exposure uses biomarkers such as aristolactam-DNA adducts, detected by mass spectrometry in the kidney cortex, or the somatic A>T transversion pattern characteristic of exposure to AA, as revealed by previous DNA sequencing studies using fresh frozen tumors. Methods Here we report a low-coverage whole-exome sequencing method (LC-WES) optimized for multi-sample detection of the AA mutational signature, and demonstrate its utility in 17 formalin-fixed paraffin-embedded urothelial tumors obtained from 15 patients with endemic nephropathy, an environmental form of aristolochic acid nephropathy. Results LC-WES identified the AA signature, alongside signatures of age and APOBEC enzyme activity, in 15 samples sequenced at the average per-base coverage of ~10x. Analysis at 3–9x coverage revealed the signature in 91% of the positive samples. The exome-wide distribution of the predominant A>T transversions exhibited a stochastic pattern whereas 83 cancer driver genes were enriched for recurrent non-synonymous A>T mutations. In two patients, pairs of tumors from different parts of the urinary tract, including the bladder, harbored overlapping mutation patterns, suggesting tumor dissemination via cell seeding. Conclusion LC-WES analysis of archived tumor tissues is a reliable method applicable to investigations of both the exposure to AA and its biologic effects in human carcinomas. Impact By detecting cancers associated with AA exposure in high-risk populations, LC-WES can support future molecular epidemiology studies and provide evidence-base for relevant preventive measures. PMID:26383547

  4. The nucleotide sequence of HLA-B{sup *}2704 reveals a new amino acid substitution in exon 4 which is also present in HLA-B{sup *}2706

    SciTech Connect

    Rudwaleit, M.; Bowness, P.; Wordsworth, P.

    1996-12-31

    The HLA-B27 subtype HLA-B{sup *}2704 is virtually absent in Caucasians but common in Orientals, where it is associated with ankylosing spondylitis. The amino acid sequence of HLA-B{sup *}2704 has been established by peptide mapping and was shown to differ by two amino acids from HLA-B{sup *}2705, HLA-B{sup *}2704 is characterized by a serine for aspartic acid substitution at position 77 and glutamic acid for valine at position 152. To date, however, no nucleotide sequence confirming these changes at the DNA level has been published. 13 refs., 2 figs.

  5. The sequence of rat leukosialin (W3/13 antigen) reveals a molecule with O-linked glycosylation of one third of its extracellular amino acids.

    PubMed Central

    Killeen, N; Barclay, A N; Willis, A C; Williams, A F

    1987-01-01

    Leukosialin is one of the major glycoproteins of thymocytes and T lymphocytes and is notable for a very high content of O-linked carbohydrate structures. The full protein sequence for rat leukosialin as translated from cDNA clones is now reported. The molecule contains 371 amino acids with 224 residues outside the cell, one transmembrane sequence and 124 cytoplasmic residues. Data from the peptide sequence and carbohydrate composition suggest that one in three of the extracellular amino acids may be O-glycosylated with no N-linked glycosylation sites. The cDNA sequence contained a CpG rich region in the 3' coding sequence and a large 3' non-coding region which included tandem repeats of the sequence GGAT. Images Fig. 4. PMID:2965006

  6. Composition for nucleic acid sequencing

    SciTech Connect

    Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu

    2008-08-26

    The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

  7. High speed nucleic acid sequencing

    SciTech Connect

    Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu

    2011-05-17

    The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid. Each type of labeled nucleotide comprises an acceptor fluorophore attached to a phosphate portion of the nucleotide such that the fluorophore is removed upon incorporation into a growing strand. Fluorescent signal is emitted via fluorescent resonance energy transfer between the donor fluorophore and the acceptor fluorophore as each nucleotide is incorporated into the growing strand. The sequence is deduced by identifying which base is being incorporated into the growing strand.

  8. Transcriptome sequencing revealed the transcriptional organization at ribosome-mediated attenuation sites in Corynebacterium glutamicum and identified a novel attenuator involved in aromatic amino acid biosynthesis.

    PubMed

    Neshat, Armin; Mentz, Almut; Rückert, Christian; Kalinowski, Jörn

    2014-11-20

    The Gram-positive bacterium Corynebacterium glutamicum belongs to the order Corynebacteriales and is used as a producer of amino acids at industrial scales. Due to its economic importance, gene expression and particularly the regulation of amino acid biosynthesis has been investigated extensively. Applying the high-resolution technique of transcriptome sequencing (RNA-seq), recently a vast amount of data has been generated that was used to comprehensively analyze the C. glutamicum transcriptome. By analyzing RNA-seq data from a small RNA cDNA library of C. glutamicum, short transcripts in the known transcriptional attenuators sites of the trp operon, the ilvBNC operon and the leuA gene were verified. Furthermore, whole transcriptome RNA-seq data were used to elucidate the transcriptional organization of these three amino acid biosynthesis operons. In addition, we discovered and analyzed the novel attenuator aroR, located upstream of the aroF gene (cg1129). The DAHP synthase encoded by aroF catalyzes the first step in aromatic amino acid synthesis. The AroR leader peptide contains the amino acid sequence motif F-Y-F, indicating a regulatory effect by phenylalanine and tyrosine. Analysis by real-time RT-PCR suggests that the attenuator regulates the transcription of aroF in dependence of the cellular amount of tRNA loaded with phenylalanine when comparing a phenylalanine-auxotrophic C. glutamicum mutant fed with limiting and excess amounts of a phenylalanine-containing dipeptide. Additionally, the very interesting finding was made that all analyzed attenuators are leaderless transcripts. PMID:24910972

  9. High genetic diversity among strains of the unindustrialized lactic acid bacterium Carnobacterium maltaromaticum in dairy products as revealed by multilocus sequence typing.

    PubMed

    Rahman, Abdur; Cailliez-Grimal, Catherine; Bontemps, Cyril; Payot, Sophie; Chaillou, Stéphane; Revol-Junelles, Anne-Marie; Borges, Frédéric

    2014-07-01

    Dairy products are colonized with three main classes of lactic acid bacteria (LAB): opportunistic bacteria, traditional starters, and industrial starters. Most of the population structure studies were previously performed with LAB species belonging to these three classes and give interesting knowledge about the population structure of LAB at the stage where they are already industrialized. However, these studies give little information about the population structure of LAB prior their use as an industrial starter. Carnobacterium maltaromaticum is a LAB colonizing diverse environments, including dairy products. Since this bacterium was discovered relatively recently, it is not yet commercialized as an industrial starter, which makes C. maltaromaticum an interesting model for the study of unindustrialized LAB population structure in dairy products. A multilocus sequence typing scheme based on an analysis of fragments of the genes dapE, ddlA, glpQ, ilvE, pyc, pyrE, and leuS was applied to a collection of 47 strains, including 28 strains isolated from dairy products. The scheme allowed detecting 36 sequence types with a discriminatory index of 0.98. The whole population was clustered in four deeply branched lineages, in which the dairy strains were spread. Moreover, the dairy strains could exhibit a high diversity within these lineages, leading to an overall dairy population with a diversity level as high as that of the nondairy population. These results are in agreement with the hypothesis according to which the industrialization of LAB leads to a diversity reduction in dairy products.

  10. Piriform Spider Silk Sequences Reveal Unique Repetitive Elements

    PubMed Central

    Perry, David J.; Bittencourt, Daniela; Siltberg-Liberles, Jessica; Rech, Elibio L.; Lewis, Randolph V.

    2010-01-01

    Orb-weaving spider silk fibers are assembled from very large, highly repetitive proteins. The repeated segments contain, in turn, short, simple repetitive amino acid motifs that account for the physical and mechanical properties of the assembled fiber. Of the six orb-weaver silk fibroins, the piriform silk that makes the attachment discs, which lashes the joints of the web and attaches dragline silk to surfaces has not been previously characterized. Piriform silk protein cDNAs were isolated from phage libraries of three species, A. trifasciata, N. clavipes, and N. cruentata. The deduced amino acid sequences from these genes revealed two new repetitive motifs: an alternating proline motif where every other amino acid is proline, and a glutamine-rich motif of 6 to 8 amino acids. Similar to other spider silk proteins, the repeated segments are large (>200 amino acids) and highly homogenized within a species. There is also substantial sequence similarity across the genes from the three species with particular conservation of the repetitive motifs. Northern blot analysis revealed that the messenger RNA is larger than 11kb and is expressed exclusively in the piriform glands of the spider. Phylogenetic analysis of the C-terminal regions of the new proteins with published spidroins robustly shows that the pirifom sequences form an ortholog group. PMID:20954740

  11. Piriform spider silk sequences reveal unique repetitive elements.

    PubMed

    Perry, David J; Bittencourt, Daniela; Siltberg-Liberles, Jessica; Rech, Elibio L; Lewis, Randolph V

    2010-11-01

    Orb-weaving spider silk fibers are assembled from very large, highly repetitive proteins. The repeated segments contain, in turn, short, simple, and repetitive amino acid motifs that account for the physical and mechanical properties of the assembled fiber. Of the six orb-weaver silk fibroins, the piriform silk that makes the attachment discs, which lashes the joints of the web and attaches dragline silk to surfaces, has not been previously characterized. Piriform silk protein cDNAs were isolated from phage libraries of three species: A. trifasciata , N. clavipes , and N. cruentata . The deduced amino acid sequences from these genes revealed two new repetitive motifs: an alternating proline motif, where every other amino acid is proline, and a glutamine-rich motif of 6-8 amino acids. Similar to other spider silk proteins, the repeated segments are large (>200 amino acids) and highly homogenized within a species. There is also substantial sequence similarity across the genes from the three species, with particular conservation of the repetitive motifs. Northern blot analysis revealed that the mRNA is larger than 11 kb and is expressed exclusively in the piriform glands of the spider. Phylogenetic analysis of the C-terminal regions of the new proteins with published spidroins robustly shows that the piriform sequences form an ortholog group.

  12. Nemertean toxin genes revealed through transcriptome sequencing.

    PubMed

    Whelan, Nathan V; Kocot, Kevin M; Santos, Scott R; Halanych, Kenneth M

    2014-11-27

    Nemerteans are one of few animal groups that have evolved the ability to utilize toxins for both defense and subduing prey, but little is known about specific nemertean toxins. In particular, no study has identified specific toxin genes even though peptide toxins are known from some nemertean species. Information about toxin genes is needed to better understand evolution of toxins across animals and possibly provide novel targets for pharmaceutical and industrial applications. We sequenced and annotated transcriptomes of two free-living and one commensal nemertean and annotated an additional six publicly available nemertean transcriptomes to identify putative toxin genes. Approximately 63-74% of predicted open reading frames in each transcriptome were annotated with gene names, and all species had similar percentages of transcripts annotated with each higher-level GO term. Every nemertean analyzed possessed genes with high sequence similarities to known animal toxins including those from stonefish, cephalopods, and sea anemones. One toxin-like gene found in all nemerteans analyzed had high sequence similarity to Plancitoxin-1, a DNase II hepatotoxin that may function well at low pH, which suggests that the acidic body walls of some nemerteans could work to enhance the efficacy of protein toxins. The highest number of toxin-like genes found in any one species was seven and the lowest was three. The diversity of toxin-like nemertean genes found here is greater than previously documented, and these animals are likely an ideal system for exploring toxin evolution and industrial applications of toxins.

  13. Nemertean Toxin Genes Revealed through Transcriptome Sequencing

    PubMed Central

    Whelan, Nathan V.; Kocot, Kevin M.; Santos, Scott R.; Halanych, Kenneth M.

    2014-01-01

    Nemerteans are one of few animal groups that have evolved the ability to utilize toxins for both defense and subduing prey, but little is known about specific nemertean toxins. In particular, no study has identified specific toxin genes even though peptide toxins are known from some nemertean species. Information about toxin genes is needed to better understand evolution of toxins across animals and possibly provide novel targets for pharmaceutical and industrial applications. We sequenced and annotated transcriptomes of two free-living and one commensal nemertean and annotated an additional six publicly available nemertean transcriptomes to identify putative toxin genes. Approximately 63–74% of predicted open reading frames in each transcriptome were annotated with gene names, and all species had similar percentages of transcripts annotated with each higher-level GO term. Every nemertean analyzed possessed genes with high sequence similarities to known animal toxins including those from stonefish, cephalopods, and sea anemones. One toxin-like gene found in all nemerteans analyzed had high sequence similarity to Plancitoxin-1, a DNase II hepatotoxin that may function well at low pH, which suggests that the acidic body walls of some nemerteans could work to enhance the efficacy of protein toxins. The highest number of toxin-like genes found in any one species was seven and the lowest was three. The diversity of toxin-like nemertean genes found here is greater than previously documented, and these animals are likely an ideal system for exploring toxin evolution and industrial applications of toxins. PMID:25432940

  14. Chip-based sequencing nucleic acids

    SciTech Connect

    Beer, Neil Reginald

    2014-08-26

    A system for fast DNA sequencing by amplification of genetic material within microreactors, denaturing, demulsifying, and then sequencing the material, while retaining it in a PCR/sequencing zone by a magnetic field. One embodiment includes sequencing nucleic acids on a microchip that includes a microchannel flow channel in the microchip. The nucleic acids are isolated and hybridized to magnetic nanoparticles or to magnetic polystyrene-coated beads. Microreactor droplets are formed in the microchannel flow channel. The microreactor droplets containing the nucleic acids and the magnetic nanoparticles are retained in a magnetic trap in the microchannel flow channel and sequenced.

  15. Distinguishing proteins from arbitrary amino acid sequences.

    PubMed

    Yau, Stephen S-T; Mao, Wei-Guang; Benson, Max; He, Rong Lucy

    2015-01-01

    What kinds of amino acid sequences could possibly be protein sequences? From all existing databases that we can find, known proteins are only a small fraction of all possible combinations of amino acids. Beginning with Sanger's first detailed determination of a protein sequence in 1952, previous studies have focused on describing the structure of existing protein sequences in order to construct the protein universe. No one, however, has developed a criteria for determining whether an arbitrary amino acid sequence can be a protein. Here we show that when the collection of arbitrary amino acid sequences is viewed in an appropriate geometric context, the protein sequences cluster together. This leads to a new computational test, described here, that has proved to be remarkably accurate at determining whether an arbitrary amino acid sequence can be a protein. Even more, if the results of this test indicate that the sequence can be a protein, and it is indeed a protein sequence, then its identity as a protein sequence is uniquely defined. We anticipate our computational test will be useful for those who are attempting to complete the job of discovering all proteins, or constructing the protein universe. PMID:25609314

  16. Method for sequencing nucleic acid molecules

    DOEpatents

    Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu

    2006-06-06

    The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

  17. Method for sequencing nucleic acid molecules

    DOEpatents

    Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu

    2006-05-30

    The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

  18. Bovine Parathyroid Hormone: Amino Acid Sequence

    PubMed Central

    Brewer, H. Bryan; Ronan, Rosemary

    1970-01-01

    Bovine parathyroid hormone has been isolated in homogeneous form, and its complete amino acid sequence determined. The bovine hormone is a single chain, 84 amino acids long. It contains amino-terminal alanine, and carboxyl-terminal glutamine. The bovine parathyroid hormone is approximately three times the length of the newly discovered hormone, thyrocalcitonin, whose action is reciprocal to parathyroid hormone. Images PMID:5275384

  19. Predicting intrinsic disorder from amino acid sequence.

    PubMed

    Obradovic, Zoran; Peng, Kang; Vucetic, Slobodan; Radivojac, Predrag; Brown, Celeste J; Dunker, A Keith

    2003-01-01

    Blind predictions of intrinsic order and disorder were made on 42 proteins subsequently revealed to contain 9,044 ordered residues, 284 disordered residues in 26 segments of length 30 residues or less, and 281 disordered residues in 2 disordered segments of length greater than 30 residues. The accuracies of the six predictors used in this experiment ranged from 77% to 91% for the ordered regions and from 56% to 78% for the disordered segments. The average of the order and disorder predictions ranged from 73% to 77%. The prediction of disorder in the shorter segments was poor, from 25% to 66% correct, while the prediction of disorder in the longer segments was better, from 75% to 95% correct. Four of the predictors were composed of ensembles of neural networks. This enabled them to deal more efficiently with the large asymmetry in the training data through diversified sampling from the significantly larger ordered set and achieve better accuracy on ordered and long disordered regions. The exclusive use of long disordered regions for predictor training likely contributed to the disparity of the predictions on long versus short disordered regions, while averaging the output values over 61-residue windows to eliminate short predictions of order or disorder probably contributed to the even greater disparity for three of the predictors. This experiment supports the predictability of intrinsic disorder from amino acid sequence. PMID:14579347

  20. Phenolic acid esterases, coding sequences and methods

    DOEpatents

    Blum, David L.; Kataeva, Irina; Li, Xin-Liang; Ljungdahl, Lars G.

    2002-01-01

    Described herein are four phenolic acid esterases, three of which correspond to domains of previously unknown function within bacterial xylanases, from XynY and XynZ of Clostridium thermocellum and from a xylanase of Ruminococcus. The fourth specifically exemplified xylanase is a protein encoded within the genome of Orpinomyces PC-2. The amino acids of these polypeptides and nucleotide sequences encoding them are provided. Recombinant host cells, expression vectors and methods for the recombinant production of phenolic acid esterases are also provided.

  1. Method for identifying and quantifying nucleic acid sequence aberrations

    DOEpatents

    Lucas, J.N.; Straume, T.; Bogen, K.T.

    1998-07-21

    A method is disclosed for detecting nucleic acid sequence aberrations by detecting nucleic acid sequences having both a first and a second nucleic acid sequence type, the presence of the first and second sequence type on the same nucleic acid sequence indicating the presence of a nucleic acid sequence aberration. The method uses a first hybridization probe which includes a nucleic acid sequence that is complementary to a first sequence type and a first complexing agent capable of attaching to a second complexing agent and a second hybridization probe which includes a nucleic acid sequence that selectively hybridizes to the second nucleic acid sequence type over the first sequence type and includes a detectable marker for detecting the second hybridization probe. 11 figs.

  2. Method for identifying and quantifying nucleic acid sequence aberrations

    DOEpatents

    Lucas, Joe N.; Straume, Tore; Bogen, Kenneth T.

    1998-01-01

    A method for detecting nucleic acid sequence aberrations by detecting nucleic acid sequences having both a first and a second nucleic acid sequence type, the presence of the first and second sequence type on the same nucleic acid sequence indicating the presence of a nucleic acid sequence aberration. The method uses a first hybridization probe which includes a nucleic acid sequence that is complementary to a first sequence type and a first complexing agent capable of attaching to a second complexing agent and a second hybridization probe which includes a nucleic acid sequence that selectively hybridizes to the second nucleic acid sequence type over the first sequence type and includes a detectable marker for detecting the second hybridization probe.

  3. Sorbitol dehydrogenase. Full-length cDNA sequencing reveals a mRNA coding for a protein containing an additional 42 amino acids at the N-terminal end.

    PubMed

    Wen, Y; Bekhor, I

    1993-10-01

    A cDNA clone encoding rat sorbitol dehydrogenase (SDH) was isolated from a rat testis lambda ZAP II cDNA library. The full-length cDNA insert contained 2277 base pairs (bp), starting 182 bp upstream from an ATG codon where translation to the active enzyme SDH is presumed to be initiated. A second ATG codon, however, was found 126 bp upstream, aligned in the same reading frame as that of the active enzyme. Therefore, the coding sequence for SDH can be translated into an additional 42-amino-acid polypeptide linked to the N-terminal amino acid of the enzyme, generating a pre-sorbitol dehydrogenase. The sequence data indicate that the nucleotide environment around this ATG codon is more favorable towards it being the actual open reading frame (ORF) for a pre-SDH than the ATG codon preceding the nucleotide sequence for SDH. Since no known SDH starts with the additional 42 amino acids, it may be that post-translational removal of this polypeptide accompanies the release of the active enzyme. Next, the 3' untranslated region of the cDNA contained a non-coding 1021 bp downstream from the TAA stop codon. The latter sequence included three putative poly(A) signals: one at nucleotides 1362-1367, the second at nucleotides 1465-1470, and the third at nucleotides 2212-2217 [17 bp away from the poly(A) tail]. In addition to the above findings we also report a variance in one of the amino acids in the SDH cDNA sequence. This variance occurs at position 957-960, where threonine is coded for instead of aspartic acid; in the rat testis SDH cDNA, we find the sequence is ACG instead of GAC, as was reported for the rat liver SDH cDNA. Northern-blot hybridization analysis showed that SDH mRNA is a doublet, one band of 4 kb and the other of 2.3-2.4 kb, in both the rat liver and the rat lens, further confirming that the isolated SDH cDNA constituted a full-length cDNA.

  4. Optimization of short amino acid sequences classifier

    NASA Astrophysics Data System (ADS)

    Barcz, Aleksy; Szymański, Zbigniew

    This article describes processing methods used for short amino acid sequences classification. The data processed are 9-symbols string representations of amino acid sequences, divided into 49 data sets - each one containing samples labeled as reacting or not with given enzyme. The goal of the classification is to determine for a single enzyme, whether an amino acid sequence would react with it or not. Each data set is processed separately. Feature selection is performed to reduce the number of dimensions for each data set. The method used for feature selection consists of two phases. During the first phase, significant positions are selected using Classification and Regression Trees. Afterwards, symbols appearing at the selected positions are substituted with numeric values of amino acid properties taken from the AAindex database. In the second phase the new set of features is reduced using a correlation-based ranking formula and Gram-Schmidt orthogonalization. Finally, the preprocessed data is used for training LS-SVM classifiers. SPDE, an evolutionary algorithm, is used to obtain optimal hyperparameters for the LS-SVM classifier, such as error penalty parameter C and kernel-specific hyperparameters. A simple score penalty is used to adapt the SPDE algorithm to the task of selecting classifiers with best performance measures values.

  5. Methods for analyzing nucleic acid sequences

    DOEpatents

    Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu

    2011-05-17

    The present invention is directed to a method of sequencing a target nucleic acid. The method provides a complex comprising a polymerase enzyme, a target nucleic acid molecule, and a primer, wherein the complex is immobilized on a support Fluorescent label is attached to a terminal phosphate group of the nucleotide or nucleotide analog. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The time duration of the signal from labeled nucleotides or nucleotide analogs that become incorporated is distinguished from freely diffusing labels by a longer retention in the observation volume for the nucleotides or nucleotide analogs that become incorporated than for the freely diffusing labels.

  6. Next Generation Sequencing Reveals the Hidden Diversity of Zooplankton Assemblages

    PubMed Central

    Harmer, Rachel A.; Somerfield, Paul J.; Atkinson, Angus

    2013-01-01

    Background Zooplankton play an important role in our oceans, in biogeochemical cycling and providing a food source for commercially important fish larvae. However, difficulties in correctly identifying zooplankton hinder our understanding of their roles in marine ecosystem functioning, and can prevent detection of long term changes in their community structure. The advent of massively parallel next generation sequencing technology allows DNA sequence data to be recovered directly from whole community samples. Here we assess the ability of such sequencing to quantify richness and diversity of a mixed zooplankton assemblage from a productive time series site in the Western English Channel. Methodology/Principle Findings Plankton net hauls (200 µm) were taken at the Western Channel Observatory station L4 in September 2010 and January 2011. These samples were analysed by microscopy and metagenetic analysis of the 18S nuclear small subunit ribosomal RNA gene using the 454 pyrosequencing platform. Following quality control a total of 419,041 sequences were obtained for all samples. The sequences clustered into 205 operational taxonomic units using a 97% similarity cut-off. Allocation of taxonomy by comparison with the National Centre for Biotechnology Information database identified 135 OTUs to species level, 11 to genus level and 1 to order, <2.5% of sequences were classified as unknowns. By comparison a skilled microscopic analyst was able to routinely enumerate only 58 taxonomic groups. Conclusions Metagenetics reveals a previously hidden taxonomic richness, especially for Copepoda and hard-to-identify meroplankton such as Bivalvia, Gastropoda and Polychaeta. It also reveals rare species and parasites. We conclude that Next Generation Sequencing of 18S amplicons is a powerful tool for elucidating the true diversity and species richness of zooplankton communities. While this approach allows for broad diversity assessments of plankton it may become increasingly

  7. Genetic analyses of GII.17 norovirus strains in diarrheal disease outbreaks from December 2014 to March 2015 in Japan reveal a novel polymerase sequence and amino acid substitutions in the capsid region.

    PubMed

    Matsushima, Y; Ishikawa, M; Shimizu, T; Komane, A; Kasuo, S; Shinohara, M; Nagasawa, K; Kimura, H; Ryo, A; Okabe, N; Haga, K; Doan, Y H; Katayama, K; Shimizu, H

    2015-01-01

    A novel GII.P17-GII.17 variant norovirus emerged as a major cause of norovirus outbreaks from December 2014 to March 2015 in Japan. Named Hu/GII/JP/2014/GII.P17-GII.17, this variant has a newly identified GII.P17 type RNA-dependent RNA polymerase, while the capsid sequence displays amino acid substitutions around histo-blood group antigen (HBGA) binding sites. Several variants caused by mutations in the capsid region have previously been observed in the GII.4 genotype. Monitoring the GII.17 variant's geographical spread and evolution is important.

  8. Mitochondrial Genome Sequences Effectively Reveal the Phylogeny of Hylobates Gibbons

    PubMed Central

    Chan, Yi-Chiao; Roos, Christian; Inoue-Murayama, Miho; Inoue, Eiji; Shih, Chih-Chin; Pei, Kurtis Jai-Chyi; Vigilant, Linda

    2010-01-01

    Background Uniquely among hominoids, gibbons exist as multiple geographically contiguous taxa exhibiting distinctive behavioral, morphological, and karyotypic characteristics. However, our understanding of the evolutionary relationships of the various gibbons, especially among Hylobates species, is still limited because previous studies used limited taxon sampling or short mitochondrial DNA (mtDNA) sequences. Here we use mtDNA genome sequences to reconstruct gibbon phylogenetic relationships and reveal the pattern and timing of divergence events in gibbon evolutionary history. Methodology/Principal Findings We sequenced the mitochondrial genomes of 51 individuals representing 11 species belonging to three genera (Hylobates, Nomascus and Symphalangus) using the high-throughput 454 sequencing system with the parallel tagged sequencing approach. Three phylogenetic analyses (maximum likelihood, Bayesian analysis and neighbor-joining) depicted the gibbon phylogenetic relationships congruently and with strong support values. Most notably, we recover a well-supported phylogeny of the Hylobates gibbons. The estimation of divergence times using Bayesian analysis with relaxed clock model suggests a much more rapid speciation process in Hylobates than in Nomascus. Conclusions/Significance Use of more than 15 kb sequences of the mitochondrial genome provided more informative and robust data than previous studies of short mitochondrial segments (e.g., control region or cytochrome b) as shown by the reliable reconstruction of divergence patterns among Hylobates gibbons. Moreover, molecular dating of the mitogenomic divergence times implied that biogeographic change during the last five million years may be a factor promoting the speciation of Sundaland animals, including Hylobates species. PMID:21203450

  9. 77 FR 65537 - Requirements for Patent Applications Containing Nucleotide Sequence and/or Amino Acid Sequence...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-10-29

    ... Amino Acid Sequence Disclosures ACTION: Proposed collection; comment request. SUMMARY: The United States....'' SUPPLEMENTARY INFORMATION: I. Abstract Patent applications that contain nucleotide and/or amino acid...

  10. Detection of nucleic acid sequences by invader-directed cleavage

    DOEpatents

    Brow, Mary Ann D.; Hall, Jeff Steven Grotelueschen; Lyamichev, Victor; Olive, David Michael; Prudent, James Robert

    1999-01-01

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The 5' nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof. The present invention further relates to methods and devices for the separation of nucleic acid molecules based by charge.

  11. Next generation sequencing in sporadic retinoblastoma patients reveals somatic mosaicism

    PubMed Central

    Amitrano, Sara; Marozza, Annabella; Somma, Serena; Imperatore, Valentina; Hadjistilianou, Theodora; De Francesco, Sonia; Toti, Paolo; Galimberti, Daniela; Meloni, Ilaria; Cetta, Francesco; Piu, Pietro; Di Marco, Chiara; Dosa, Laura; Lo Rizzo, Caterina; Carignani, Giulia; Mencarelli, Maria Antonietta; Mari, Francesca; Renieri, Alessandra; Ariani, Francesca

    2015-01-01

    In about 50% of sporadic cases of retinoblastoma, no constitutive RB1 mutations are detected by conventional methods. However, recent research suggests that, at least in some of these cases, there is somatic mosaicism with respect to RB1 normal and mutant alleles. The increased availability of next generation sequencing improves our ability to detect the exact percentage of patients with mosaicism. Using this technology, we re-tested a series of 40 patients with sporadic retinoblastoma: 10 of them had been previously classified as constitutional heterozygotes, whereas in 30 no RB1 mutations had been found in lymphocytes. In 3 of these 30 patients, we have now identified low-level mosaic variants, varying in frequency between 8 and 24%. In 7 out of the 10 cases previously classified as heterozygous from testing blood cells, we were able to test additional tissues (ocular tissues, urine and/or oral mucosa): in three of them, next generation sequencing has revealed mosaicism. Present results thus confirm that a significant fraction (6/40; 15%) of sporadic retinoblastoma cases are due to postzygotic events and that deep sequencing is an efficient method to unambiguously distinguish mosaics. Re-testing of retinoblastoma patients through next generation sequencing can thus provide new information that may have important implications with respect to genetic counseling and family care. PMID:25712084

  12. Hybridization and sequencing of nucleic acids using base pair mismatches

    DOEpatents

    Fodor, Stephen P. A.; Lipshutz, Robert J.; Huang, Xiaohua

    2001-01-01

    Devices and techniques for hybridization of nucleic acids and for determining the sequence of nucleic acids. Arrays of nucleic acids are formed by techniques, preferably high resolution, light-directed techniques. Positions of hybridization of a target nucleic acid are determined by, e.g., epifluorescence microscopy. Devices and techniques are proposed to determine the sequence of a target nucleic acid more efficiently and more quickly through such synthesis and detection techniques.

  13. On combining protein sequences and nucleic acid sequences in phylogenetic analysis: the homeobox protein case.

    PubMed

    Agosti, D; Jacobs, D; DeSalle, R

    1996-01-01

    Amino acid encoding genes contain character state information that may be useful for phylogenetic analysis on at least two levels. The nucleotide sequence and the translated amino acid sequences have both been employed separately as character states for cladistic studies of various taxa, including studies of the genealogy of genes in multigene families. In essence, amino acid sequences and nucleic acid sequences are two different ways of character coding the information in a gene. Silent positions in the nucleotide sequence (first or third positions in codons that can accrue change without changing the identity of the amino acid that the triplet codes for) may accrue change relatively rapidly and become saturated, losing the pattern of historical divergence. On the other hand, non-silent nucleotide alterations and their accompanying amino acid changes may evolve too slowly to reveal relationships among closely related taxa. In general, the dynamics of sequence change in silent and non-silent positions in protein coding genes result in homoplasy and lack of resolution, respectively. We suggest that the combination of nucleic acid and the translated amino acid coded character states into the same data matrix for phylogenetic analysis addresses some of the problems caused by the rapid change of silent nucleotide positions and overall slow rate of change of non-silent nucleotide positions and slowly changing amino acid positions. One major theoretical problem with this approach is the apparent non-independence of the two sources of characters. However, there are at least three possible outcomes when comparing protein coding nucleic acid sequences with their translated amino acids in a phylogenetic context on a codon by codon basis. First, the two character sets for a codon may be entirely congruent with respect to the information they convey about the relationships of a certain set of taxa. Second, one character set may display no information concerning a phylogenetic

  14. Comparative RNA sequencing reveals substantial genetic variation in endangered primates

    PubMed Central

    Perry, George H.; Melsted, Páll; Marioni, John C.; Wang, Ying; Bainer, Russell; Pickrell, Joseph K.; Michelini, Katelyn; Zehr, Sarah; Yoder, Anne D.; Stephens, Matthew; Pritchard, Jonathan K.; Gilad, Yoav

    2012-01-01

    Comparative genomic studies in primates have yielded important insights into the evolutionary forces that shape genetic diversity and revealed the likely genetic basis for certain species-specific adaptations. To date, however, these studies have focused on only a small number of species. For the majority of nonhuman primates, including some of the most critically endangered, genome-level data are not yet available. In this study, we have taken the first steps toward addressing this gap by sequencing RNA from the livers of multiple individuals from each of 16 mammalian species, including humans and 11 nonhuman primates. Of the nonhuman primate species, five are lemurs and two are lorisoids, for which little or no genomic data were previously available. To analyze these data, we developed a method for de novo assembly and alignment of orthologous gene sequences across species. We assembled an average of 5721 gene sequences per species and characterized diversity and divergence of both gene sequences and gene expression levels. We identified patterns of variation that are consistent with the action of positive or directional selection, including an 18-fold enrichment of peroxisomal genes among genes whose regulation likely evolved under directional selection in the ancestral primate lineage. Importantly, we found no relationship between genetic diversity and endangered status, with the two most endangered species in our study, the black and white ruffed lemur and the Coquerel's sifaka, having the highest genetic diversity among all primates. Our observations imply that many endangered lemur populations still harbor considerable genetic variation. Timely efforts to conserve these species alongside their habitats have, therefore, strong potential to achieve long-term success. PMID:22207615

  15. Tertiary structural propensities reveal fundamental sequence/structure relationships.

    PubMed

    Zheng, Fan; Zhang, Jian; Grigoryan, Gevorg

    2015-05-01

    Extracting useful generalizations from the continually growing Protein Data Bank (PDB) is of central importance. We hypothesize that the PDB contains valuable quantitative information on the level of local tertiary structural motifs (TERMs). We show that by breaking a protein structure into its constituent TERMs, and querying the PDB to characterize the natural ensemble matching each, we can estimate the compatibility of the structure with a given amino acid sequence through a metric we term "structure score." Considering submissions from recent Critical Assessment of Structure Prediction (CASP) experiments, we found a strong correlation (R = 0.69) between structure score and model accuracy, with poorly predicted regions readily identifiable. This performance exceeds that of leading atomistic statistical energy functions. Furthermore, TERM-based analysis of two prototypical multi-state proteins rapidly produced structural insights fully consistent with prior extensive experimental studies. We thus find that TERM-based analysis should have considerable utility for protein structural biology.

  16. p53-Regulated Networks of Protein, mRNA, miRNA, and lncRNA Expression Revealed by Integrated Pulsed Stable Isotope Labeling With Amino Acids in Cell Culture (pSILAC) and Next Generation Sequencing (NGS) Analyses*

    PubMed Central

    Hünten, Sabine; Kaller, Markus; Drepper, Friedel; Oeljeklaus, Silke; Bonfert, Thomas; Erhard, Florian; Dueck, Anne; Eichner, Norbert; Friedel, Caroline C.; Meister, Gunter; Zimmer, Ralf; Warscheid, Bettina; Hermeking, Heiko

    2015-01-01

    We determined the effect of p53 activation on de novo protein synthesis using quantitative proteomics (pulsed stable isotope labeling with amino acids in cell culture/pSILAC) in the colorectal cancer cell line SW480. This was combined with mRNA and noncoding RNA expression analyses by next generation sequencing (RNA-, miR-Seq). Furthermore, genome-wide DNA binding of p53 was analyzed by chromatin-immunoprecipitation (ChIP-Seq). Thereby, we identified differentially regulated proteins (542 up, 569 down), mRNAs (1258 up, 415 down), miRNAs (111 up, 95 down) and lncRNAs (270 up, 123 down). Changes in protein and mRNA expression levels showed a positive correlation (r = 0.50, p < 0.0001). In total, we detected 133 direct p53 target genes that were differentially expressed and displayed p53 occupancy in the vicinity of their promoter. More transcriptionally induced genes displayed occupied p53 binding sites (4.3% mRNAs, 7.2% miRNAs, 6.3% lncRNAs, 5.9% proteins) than repressed genes (2.4% mRNAs, 3.2% miRNAs, 0.8% lncRNAs, 1.9% proteins), suggesting indirect mechanisms of repression. Around 50% of the down-regulated proteins displayed seed-matching sequences of p53-induced miRNAs in the corresponding 3′-UTRs. Moreover, proteins repressed by p53 significantly overlapped with those previously shown to be repressed by miR-34a. We confirmed up-regulation of the novel direct p53 target genes LINC01021, MDFI, ST14 and miR-486 and showed that ectopic LINC01021 expression inhibits proliferation in SW480 cells. Furthermore, KLF12, HMGB1 and CIT mRNAs were confirmed as direct targets of the p53-induced miR-34a, miR-205 and miR-486–5p, respectively. In line with the loss of p53 function during tumor progression, elevated expression of KLF12, HMGB1 and CIT was detected in advanced stages of cancer. In conclusion, the integration of multiple omics methods allowed the comprehensive identification of direct and indirect effectors of p53 that provide new insights and leads into the

  17. p53-Regulated Networks of Protein, mRNA, miRNA, and lncRNA Expression Revealed by Integrated Pulsed Stable Isotope Labeling With Amino Acids in Cell Culture (pSILAC) and Next Generation Sequencing (NGS) Analyses.

    PubMed

    Hünten, Sabine; Kaller, Markus; Drepper, Friedel; Oeljeklaus, Silke; Bonfert, Thomas; Erhard, Florian; Dueck, Anne; Eichner, Norbert; Friedel, Caroline C; Meister, Gunter; Zimmer, Ralf; Warscheid, Bettina; Hermeking, Heiko

    2015-10-01

    We determined the effect of p53 activation on de novo protein synthesis using quantitative proteomics (pulsed stable isotope labeling with amino acids in cell culture/pSILAC) in the colorectal cancer cell line SW480. This was combined with mRNA and noncoding RNA expression analyses by next generation sequencing (RNA-, miR-Seq). Furthermore, genome-wide DNA binding of p53 was analyzed by chromatin-immunoprecipitation (ChIP-Seq). Thereby, we identified differentially regulated proteins (542 up, 569 down), mRNAs (1258 up, 415 down), miRNAs (111 up, 95 down) and lncRNAs (270 up, 123 down). Changes in protein and mRNA expression levels showed a positive correlation (r = 0.50, p < 0.0001). In total, we detected 133 direct p53 target genes that were differentially expressed and displayed p53 occupancy in the vicinity of their promoter. More transcriptionally induced genes displayed occupied p53 binding sites (4.3% mRNAs, 7.2% miRNAs, 6.3% lncRNAs, 5.9% proteins) than repressed genes (2.4% mRNAs, 3.2% miRNAs, 0.8% lncRNAs, 1.9% proteins), suggesting indirect mechanisms of repression. Around 50% of the down-regulated proteins displayed seed-matching sequences of p53-induced miRNAs in the corresponding 3'-UTRs. Moreover, proteins repressed by p53 significantly overlapped with those previously shown to be repressed by miR-34a. We confirmed up-regulation of the novel direct p53 target genes LINC01021, MDFI, ST14 and miR-486 and showed that ectopic LINC01021 expression inhibits proliferation in SW480 cells. Furthermore, KLF12, HMGB1 and CIT mRNAs were confirmed as direct targets of the p53-induced miR-34a, miR-205 and miR-486-5p, respectively. In line with the loss of p53 function during tumor progression, elevated expression of KLF12, HMGB1 and CIT was detected in advanced stages of cancer. In conclusion, the integration of multiple omics methods allowed the comprehensive identification of direct and indirect effectors of p53 that provide new insights and leads into the

  18. Parallel Selection Revealed by Population Sequencing in Chicken

    PubMed Central

    Qanbari, Saber; Seidel, Michael; Strom, Tim-Mathias; Mayer, Klaus F.X.; Preisinger, Ruedi; Simianer, Henner

    2015-01-01

    Human-driven selection during domestication and subsequent breed formation has likely left detectable signatures within the genome of modern chicken. The elucidation of these signatures of selection is of interest from the perspective of evolutionary biology, and for identifying genes relevant to domestication and improvement that ultimately may help to further genetically improve this economically important animal. We used whole genome sequence data from 50 hens of commercial white (WL) and brown (BL) egg-laying chicken along with pool sequences of three meat-type chicken to perform a systematic screening of past selection in modern chicken. Evidence of positive selection was investigated in two steps. First, we explored evidence of parallel fixation in regions with overlapping elevated allele frequencies in replicated populations of layers and broilers, suggestive of selection during domestication or preimprovement ages. We confirmed parallel fixation in BCDO2 and TSHR genes and found four candidates including AGTR2, a gene heavily involved in “Ascites” in commercial birds. Next, we explored differentiated loci between layers and broilers suggestive of selection during improvement in chicken. This analysis revealed evidence of parallel differentiation in genes relevant to appearance and production traits exemplified with the candidate gene OPG, implicated in Osteoporosis, a disorder related to overconsumption of calcium in egg-laying hens. Our results illustrate the potential for population genetic techniques to identify genomic regions relevant to the phenotypes of importance to breeders. PMID:26568375

  19. Next generation sequencing in synovial sarcoma reveals novel gene mutations

    PubMed Central

    Vlenterie, Myrella; Hillebrandt-Roeffen, Melissa H.S.; Flucke, Uta E.; Groenen, Patricia J.T.A.; Tops, Bastiaan B.J.; Kamping, Eveline J.; Pfundt, Rolph; de Bruijn, Diederik R.H.; van Kessel, Ad H.M. Geurts; van Krieken, Han J.H.J.M.; van der Graaf, Winette T.A.; Versleijen-Jonkers, Yvonne M.H.

    2015-01-01

    Over 95% of all synovial sarcomas (SS) share a unique translocation, t(X;18), however, they show heterogeneous clinical behavior. We analyzed multiple SS to reveal additional genetic alterations besides the translocation. Twenty-six SS from 22 patients were sequenced for 409 cancer-related genes using the Comprehensive Cancer Panel (Life Technologies, USA) on an Ion Torrent platform. The detected variants were verified by Sanger sequencing and compared to matched normal DNAs. Copy number variation was assessed in six tumors using the Oncoscan array (Affymetrix, USA). In total, eight somatic mutations were detected in eight samples. These mutations have not been reported previously in SS. Two of these, in KRAS and CCND1, represent known oncogenic mutations in other malignancies. Additional mutations were detected in RNF213, SEPT9, KDR, CSMD3, MLH1 and ERBB4. DNA alterations occurred more often in adult tumors. A distinctive loss of 6q was found in a metastatic lesion progressing under pazopanib, but not in the responding lesion. Our results emphasize t(X;18) as a single initiating event in SS and as the main oncogenic driver. Our results also show the occurrence of additional genetic events, mutations or chromosomal aberrations, occurring more frequently in SS with an onset in adults. PMID:26415226

  20. Methods and compositions for efficient nucleic acid sequencing

    DOEpatents

    Drmanac, Radoje

    2002-01-01

    Disclosed are novel methods and compositions for rapid and highly efficient nucleic acid sequencing based upon hybridization with two sets of small oligonucleotide probes of known sequences. Extremely large nucleic acid molecules, including chromosomes and non-amplified RNA, may be sequenced without prior cloning or subcloning steps. The methods of the invention also solve various current problems associated with sequencing technology such as, for example, high noise to signal ratios and difficult discrimination, attaching many nucleic acid fragments to a surface, preparing many, longer or more complex probes and labelling more species.

  1. Methods and compositions for efficient nucleic acid sequencing

    DOEpatents

    Drmanac, Radoje

    2006-07-04

    Disclosed are novel methods and compositions for rapid and highly efficient nucleic acid sequencing based upon hybridization with two sets of small oligonucleotide probes of known sequences. Extremely large nucleic acid molecules, including chromosomes and non-amplified RNA, may be sequenced without prior cloning or subcloning steps. The methods of the invention also solve various current problems associated with sequencing technology such as, for example, high noise to signal ratios and difficult discrimination, attaching many nucleic acid fragments to a surface, preparing many, longer or more complex probes and labelling more species.

  2. Kit for detecting nucleic acid sequences using competitive hybridization probes

    DOEpatents

    Lucas, Joe N.; Straume, Tore; Bogen, Kenneth T.

    2001-01-01

    A kit is provided for detecting a target nucleic acid sequence in a sample, the kit comprising: a first hybridization probe which includes a nucleic acid sequence that is sufficiently complementary to selectively hybridize to a first portion of the target sequence, the first hybridization probe including a first complexing agent for forming a binding pair with a second complexing agent; and a second hybridization probe which includes a nucleic acid sequence that is sufficiently complementary to selectively hybridize to a second portion of the target sequence to which the first hybridization probe does not selectively hybridize, the second hybridization probe including a detectable marker; a third hybridization probe which includes a nucleic acid sequence that is sufficiently complementary to selectively hybridize to a first portion of the target sequence, the third hybridization probe including the same detectable marker as the second hybridization probe; and a fourth hybridization probe which includes a nucleic acid sequence that is sufficiently complementary to selectively hybridize to a second portion of the target sequence to which the third hybridization probe does not selectively hybridize, the fourth hybridization probe including the first complexing agent for forming a binding pair with the second complexing agent; wherein the first and second hybridization probes are capable of simultaneously hybridizing to the target sequence and the third and fourth hybridization probes are capable of simultaneously hybridizing to the target sequence, the detectable marker is not present on the first or fourth hybridization probes and the first, second, third, and fourth hybridization probes each include a competitive nucleic acid sequence which is sufficiently complementary to a third portion of the target sequence that the competitive sequences of the first, second, third, and fourth hybridization probes compete with each other to hybridize to the third portion of the

  3. Analysis and Annotation of Nucleic Acid Sequence

    SciTech Connect

    States, David J.

    2004-07-28

    The aims of this project were to develop improved methods for computational genome annotation and to apply these methods to improve the annotation of genomic sequence data with a specific focus on human genome sequencing. The project resulted in a substantial body of published work. Notable contributions of this project were the identification of basecalling and lane tracking as error processes in genome sequencing and contributions to improved methods for these steps in genome sequencing. This technology improved the accuracy and throughput of genome sequence analysis. Probabilistic methods for physical map construction were developed. Improved methods for sequence alignment, alternative splicing analysis, promoter identification and NF kappa B response gene prediction were also developed.

  4. Further Examples of Evolution by Gene Duplication Revealed through DNA Sequence Comparisons

    PubMed Central

    Ohta, T.

    1994-01-01

    To test the theory that evolution by gene duplication occurs as a result of positive Darwinian selection that accompanies the acceleration of mutant substitutions, DNA sequences of recent duplication were analyzed by estimating the numbers of synonymous and nonsynonymous substitutions. For the troponin C family, at the period of differentiation of the fast and slow isoforms, amino acid substitutions were shown to have been accelerated relative to synonymous substitutions. Comparison of the first exon of α-actin genes revealed that amino acid substitutions were accelerated when the smooth muscle, skeletal and cardiac isoforms differentiated. Analysis of members of the heat shock protein 70 gene family of mammals indicates that heat shock responsive genes including duplicated copies are evolving rapidly, contrary to the cognitive genes which have been evolutionarily conservative. For the α(1)-antitrypsin reactive center, the acceleration of amino acid substitution has been found for gene pairs of recent duplication. PMID:7896112

  5. Solid phase sequencing of double-stranded nucleic acids

    DOEpatents

    Fu, Dong-Jing; Cantor, Charles R.; Koster, Hubert; Smith, Cassandra L.

    2002-01-01

    This invention relates to methods for detecting and sequencing of target double-stranded nucleic acid sequences, to nucleic acid probes and arrays of probes useful in these methods, and to kits and systems which contain these probes. Useful methods involve hybridizing the nucleic acids or nucleic acids which represent complementary or homologous sequences of the target to an array of nucleic acid probes. These probe comprise a single-stranded portion, an optional double-stranded portion and a variable sequence within the single-stranded portion. The molecular weights of the hybridized nucleic acids of the set can be determined by mass spectroscopy, and the sequence of the target determined from the molecular weights of the fragments. Nucleic acids whose sequences can be determined include nucleic acids in biological samples such as patient biopsies and environmental samples. Probes may be fixed to a solid support such as a hybridization chip to facilitate automated determination of molecular weights and identification of the target sequence.

  6. Thermoadaptation trait revealed by the genome sequence of thermophilic Geobacillus kaustophilus

    PubMed Central

    Takami, Hideto; Takaki, Yoshihiro; Chee, Gab-Joo; Nishi, Shinro; Shimamura, Shigeru; Suzuki, Hiroko; Matsui, Satomi; Uchiyama, Ikuo

    2004-01-01

    We present herein the first complete genome sequence of a thermophilic Bacillus-related species, Geobacillus kaustophilus HTA426, which is composed of a 3.54 Mb chromosome and a 47.9 kb plasmid, along with a comparative analysis with five other mesophilic bacillar genomes. Upon orthologous grouping of the six bacillar sequenced genomes, it was found that 1257 common orthologous groups composed of 1308 genes (37%) are shared by all the bacilli, whereas 839 genes (24%) in the G.kaustophilus genome were found to be unique to that species. We were able to find the first prokaryotic sperm protamine P1 homolog, polyamine synthase, polyamine ABC transporter and RNA methylase in the 839 unique genes; these may contribute to thermophily by stabilizing the nucleic acids. Contrasting results were obtained from the principal component analysis (PCA) of the amino acid composition and synonymous codon usage for highlighting the thermophilic signature of the G.kaustophilus genome. Only in the PCA of the amino acid composition were the Bacillus-related species located near, but were distinguishable from, the borderline distinguishing thermophiles from mesophiles on the second principal axis. Further analysis revealed some asymmetric amino acid substitutions between the thermophiles and the mesophiles, which are possibly associated with the thermoadaptation of the organism. PMID:15576355

  7. From Artificial Amino Acids to Sequence-Defined Targeted Oligoaminoamides.

    PubMed

    Morys, Stephan; Wagner, Ernst; Lächelt, Ulrich

    2016-01-01

    Artificial oligoamino acids with appropriate protecting groups can be used for the sequential assembly of oligoaminoamides on solid-phase. With the help of these oligoamino acids multifunctional nucleic acid (NA) carriers can be designed and produced in highly defined topologies. Here we describe the synthesis of the artificial oligoamino acid Fmoc-Stp(Boc3)-OH, the subsequent assembly into sequence-defined oligomers and the formulation of tumor-targeted plasmid DNA (pDNA) polyplexes. PMID:27436323

  8. Segments of amino acid sequence similarity in beta-amylases.

    PubMed

    Friedberg, F; Rhodes, C

    1988-01-01

    In alpha-amylases from animals, plants and bacteria and in beta-amylases from plants and bacteria a number of segments exhibit amino acid sequence similarity specific to the alpha or to the beta type, respectively. In the case of the beta-amylases the similar sequence regions are extensive and they are disrupted only by short interspersed dissimilar regions. Close to the C terminus, however, no such sequence similarity exist. PMID:2464171

  9. Full-Length Isoform Sequencing Reveals Novel Transcripts and Substantial Transcriptional Overlaps in a Herpesvirus

    PubMed Central

    Tombácz, Dóra; Csabai, Zsolt; Oláh, Péter; Balázs, Zsolt; Likó, István; Zsigmond, Laura; Sharon, Donald; Snyder, Michael; Boldogkői, Zsolt

    2016-01-01

    Whole transcriptome studies have become essential for understanding the complexity of genetic regulation. However, the conventionally applied short-read sequencing platforms cannot be used to reliably distinguish between many transcript isoforms. The Pacific Biosciences (PacBio) RS II platform is capable of reading long nucleic acid stretches in a single sequencing run. The pseudorabies virus (PRV) is an excellent system to study herpesvirus gene expression and potential interactions between the transcriptional units. In this work, non-amplified and amplified isoform sequencing protocols were used to characterize the poly(A+) fraction of the lytic transcriptome of PRV, with the aim of a complete transcriptional annotation of the viral genes. The analyses revealed a previously unrecognized complexity of the PRV transcriptome including the discovery of novel protein-coding and non-coding genes, novel mono- and polycistronic transcription units, as well as extensive transcriptional overlaps between neighboring and distal genes. This study identified non-coding transcripts overlapping all three replication origins of the PRV, which might play a role in the control of DNA synthesis. We additionally established the relative expression levels of gene products. Our investigations revealed that the whole PRV genome is utilized for transcription, including both DNA strands in all coding and intergenic regions. The genome-wide occurrence of transcript overlaps suggests a crosstalk between genes through a network formed by interacting transcriptional machineries with a potential function in the control of gene expression. PMID:27685795

  10. RNA Sequencing Revealed Numerous Polyketide Synthase Genes in the Harmful Dinoflagellate Karenia mikimotoi

    PubMed Central

    Kimura, Kei; Okuda, Shujiro; Nakayama, Kei; Shikata, Tomoyuki; Takahashi, Fumio; Yamaguchi, Haruo; Skamoto, Setsuko; Yamaguchi, Mineo; Tomaru, Yuji

    2015-01-01

    The dinoflagellate Karenia mikimotoi forms blooms in the coastal waters of temperate regions and occasionally causes massive fish and invertebrate mortality. This study aimed to elucidate the toxic effect of K. mikimotoi on marine organisms by using the genomics approach; RNA-sequence libraries were constructed, and data were analyzed to identify toxin-related genes. Next-generation sequencing produced 153,406 transcript contigs from the axenic culture of K. mikimotoi. BLASTX analysis against all assembled contigs revealed that 208 contigs were polyketide synthase (PKS) sequences. Thus, K. mikimotoi was thought to have several genes encoding PKS metabolites and to likely produce toxin-like polyketide molecules. Of all the sequences, approximately 30 encoded eight PKS genes, which were remarkably similar to those of Karenia brevis. Our phylogenetic analyses showed that these genes belonged to a new group of PKS type-I genes. Phylogenetic and active domain analyses showed that the amino acid sequence of four among eight Karenia PKS genes was not similar to any of the reported PKS genes. These PKS genes might possibly be associated with the synthesis of polyketide toxins produced by Karenia species. Further, a homology search revealed 10 contigs that were similar to a toxin gene responsible for the synthesis of saxitoxin (sxtA) in the toxic dinoflagellate Alexandrium fundyense. These contigs encoded A1–A3 domains of sxtA genes. Thus, this study identified some transcripts in K. mikimotoi that might be associated with several putative toxin-related genes. The findings of this study might help understand the mechanism of toxicity of K. mikimotoi and other dinoflagellates. PMID:26561394

  11. RNA Sequencing Revealed Numerous Polyketide Synthase Genes in the Harmful Dinoflagellate Karenia mikimotoi.

    PubMed

    Kimura, Kei; Okuda, Shujiro; Nakayama, Kei; Shikata, Tomoyuki; Takahashi, Fumio; Yamaguchi, Haruo; Skamoto, Setsuko; Yamaguchi, Mineo; Tomaru, Yuji

    2015-01-01

    The dinoflagellate Karenia mikimotoi forms blooms in the coastal waters of temperate regions and occasionally causes massive fish and invertebrate mortality. This study aimed to elucidate the toxic effect of K. mikimotoi on marine organisms by using the genomics approach; RNA-sequence libraries were constructed, and data were analyzed to identify toxin-related genes. Next-generation sequencing produced 153,406 transcript contigs from the axenic culture of K. mikimotoi. BLASTX analysis against all assembled contigs revealed that 208 contigs were polyketide synthase (PKS) sequences. Thus, K. mikimotoi was thought to have several genes encoding PKS metabolites and to likely produce toxin-like polyketide molecules. Of all the sequences, approximately 30 encoded eight PKS genes, which were remarkably similar to those of Karenia brevis. Our phylogenetic analyses showed that these genes belonged to a new group of PKS type-I genes. Phylogenetic and active domain analyses showed that the amino acid sequence of four among eight Karenia PKS genes was not similar to any of the reported PKS genes. These PKS genes might possibly be associated with the synthesis of polyketide toxins produced by Karenia species. Further, a homology search revealed 10 contigs that were similar to a toxin gene responsible for the synthesis of saxitoxin (sxtA) in the toxic dinoflagellate Alexandrium fundyense. These contigs encoded A1-A3 domains of sxtA genes. Thus, this study identified some transcripts in K. mikimotoi that might be associated with several putative toxin-related genes. The findings of this study might help understand the mechanism of toxicity of K. mikimotoi and other dinoflagellates. PMID:26561394

  12. A specific indel marker for the Philippines Schistosoma japonicum revealed by analysis of mitochondrial genome sequences.

    PubMed

    Li, Juan; Chen, Fen; Sugiyama, Hiromu; Blair, David; Lin, Rui-Qing; Zhu, Xing-Quan

    2015-07-01

    In the present study, near-complete mitochondrial (mt) genome sequences for Schistosoma japonicum from different regions in the Philippines and Japan were amplified and sequenced. Comparisons among S. japonicum from the Philippines, Japan, and China revealed a geographically based length difference in mt genomes, but the mt genomic organization and gene arrangement were the same. Sequence differences among samples from the Philippines and all samples from the three endemic areas were 0.57-2.12 and 0.76-3.85 %, respectively. The most variable part of the mt genome was the non-coding region. In the coding portion of the genome, protein-coding genes varied more than rRNA genes and tRNAs. The near-complete mt genome sequences for Philippine specimens were identical in length (14,091 bp) which was 4 bp longer than those of S. japonicum samples from Japan and China. This indel provides a unique genetic marker for S. japonicum samples from the Philippines. Phylogenetic analyses based on the concatenated amino acids of 12 protein-coding genes showed that samples of S. japonicum clustered according to their geographical origins. The identified mitochondrial indel marker will be useful for tracing the source of S. japonicum infection in humans and animals in Southeast Asia.

  13. Coelacanth genome sequence reveals the evolutionary history of vertebrate genes.

    PubMed

    Noonan, James P; Grimwood, Jane; Danke, Joshua; Schmutz, Jeremy; Dickson, Mark; Amemiya, Chris T; Myers, Richard M

    2004-12-01

    The coelacanth is one of the nearest living relatives of tetrapods. However, a teleost species such as zebrafish or Fugu is typically used as the outgroup in current tetrapod comparative sequence analyses. Such studies are complicated by the fact that teleost genomes have undergone a whole-genome duplication event, as well as individual gene-duplication events. Here, we demonstrate the value of coelacanth genome sequence by complete sequencing and analysis of the protocadherin gene cluster of the Indonesian coelacanth, Latimeria menadoensis. We found that coelacanth has 49 protocadherin cluster genes organized in the same three ordered subclusters, alpha, beta, and gamma, as the 54 protocadherin cluster genes in human. In contrast, whole-genome and tandem duplications have generated two zebrafish protocadherin clusters comprised of at least 97 genes. Additionally, zebrafish protocadherins are far more prone to homogenizing gene conversion events than coelacanth protocadherins, suggesting that recombination- and duplication-driven plasticity may be a feature of teleost genomes. Our results indicate that coelacanth provides the ideal outgroup sequence against which tetrapod genomes can be measured. We therefore present L. menadoensis as a candidate for whole-genome sequencing.

  14. Amino acid sequence of anionic peroxidase from the windmill palm tree Trachycarpus fortunei.

    PubMed

    Baker, Margaret R; Zhao, Hongwei; Sakharov, Ivan Yu; Li, Qing X

    2014-12-10

    Palm peroxidases are extremely stable and have uncommon substrate specificity. This study was designed to fill in the knowledge gap about the structures of a peroxidase from the windmill palm tree Trachycarpus fortunei. The complete amino acid sequence and partial glycosylation were determined by MALDI-top-down sequencing of native windmill palm tree peroxidase (WPTP), MALDI-TOF/TOF MS/MS of WPTP tryptic peptides, and cDNA sequencing. The propeptide of WPTP contained N- and C-terminal signal sequences which contained 21 and 17 amino acid residues, respectively. Mature WPTP was 306 amino acids in length, and its carbohydrate content ranged from 21% to 29%. Comparison to closely related royal palm tree peroxidase revealed structural features that may explain differences in their substrate specificity. The results can be used to guide engineering of WPTP and its novel applications.

  15. Subclonal diversification of primary breast cancer revealed by multiregion sequencing

    PubMed Central

    Yates, Lucy R; Gerstung, Moritz; Knappskog, Stian; Desmedt, Christine; Gundem, Gunes; Loo, Peter Van; Aas, Turid; Alexandrov, Ludmil B; Larsimont, Denis; Davies, Helen; Li, Yilong; Ju, Young Seok; Ramakrishna, Manasa; Haugland, Hans Kristian; Lilleng, Peer Kaare; Nik-Zainal, Serena; McLaren, Stuart; Butler, Adam; Martin, Sancha; Glodzik, Dominic; Menzies, Andrew; Raine, Keiran; Hinton, Jonathan; Jones, David; Mudie, Laura J; Jiang, Bing; Vincent, Delphine; Greene-Colozzi, April; Adnet, Pierre-Yves; Fatima, Aquila; Maetens, Marion; Ignatiadis, Michail; Stratton, Michael R; Sotiriou, Christos; Richardson, Andrea L; Lønning, Per Eystein; Wedge, David C; Campbell, Peter J

    2015-01-01

    Sequencing cancer genomes may enable tailoring of therapeutics to the underlying biological abnormalities driving a particular patient’s tumor. However, sequencing-based strategies rely heavily on representative sampling of tumors. To understand the subclonal structure of primary breast cancer, we applied whole genome and targeted sequencing to multiple samples from each of 50 patients’ tumors (total 303). The extent of subclonal diversification varied among cases and followed spatial patterns. No strict temporal order was evident, with point mutations and rearrangements affecting the most common breast cancer genes, including PIK3CA, TP53, PTEN, BRCA2 and MYC, occurring early in some tumors and late in others. In 13/50 cancers, potentially targetable mutations were subclonal. Landmarks of disease progression, such as resisting chemotherapy and acquiring invasive or metastatic potential, arose within detectable subclones of antecedent lesions. These findings highlight the importance of including analyses of subclonal structure and tumor evolution in clinical trials of primary breast cancer. PMID:26099045

  16. Whole-genome sequencing reveals oncogenic mutations in mycosis fungoides.

    PubMed

    McGirt, Laura Y; Jia, Peilin; Baerenwald, Devin A; Duszynski, Robert J; Dahlman, Kimberly B; Zic, John A; Zwerner, Jeffrey P; Hucks, Donald; Dave, Utpal; Zhao, Zhongming; Eischen, Christine M

    2015-07-23

    The pathogenesis of mycosis fungoides (MF), the most common cutaneous T-cell lymphoma (CTCL), is unknown. Although genetic alterations have been identified, none are considered consistently causative in MF. To identify potential drivers of MF, we performed whole-genome sequencing of MF tumors and matched normal skin. Targeted ultra-deep sequencing of MF samples and exome sequencing of CTCL cell lines were also performed. Multiple mutations were identified that affected the same pathways, including epigenetic, cell-fate regulation, and cytokine signaling, in MF tumors and CTCL cell lines. Specifically, interleukin-2 signaling pathway mutations, including activating Janus kinase 3 (JAK3) mutations, were detected. Treatment with a JAK3 inhibitor significantly reduced CTCL cell survival. Additionally, the mutation data identified 2 other potential contributing factors to MF, ultraviolet light, and a polymorphism in the tumor suppressor p53 (TP53). Therefore, genetic alterations in specific pathways in MF were identified that may be viable, effective new targets for treatment.

  17. Conversion of amino-acid sequence in proteins to classical music: search for auditory patterns

    PubMed Central

    2007-01-01

    We have converted genome-encoded protein sequences into musical notes to reveal auditory patterns without compromising musicality. We derived a reduced range of 13 base notes by pairing similar amino acids and distinguishing them using variations of three-note chords and codon distribution to dictate rhythm. The conversion will help make genomic coding sequences more approachable for the general public, young children, and vision-impaired scientists. PMID:17477882

  18. IVT-seq reveals extreme bias in RNA sequencing

    PubMed Central

    2014-01-01

    Background RNA-seq is a powerful technique for identifying and quantifying transcription and splicing events, both known and novel. However, given its recent development and the proliferation of library construction methods, understanding the bias it introduces is incomplete but critical to realizing its value. Results We present a method, in vitro transcription sequencing (IVT-seq), for identifying and assessing the technical biases in RNA-seq library generation and sequencing at scale. We created a pool of over 1,000 in vitro transcribed RNAs from a full-length human cDNA library and sequenced them with polyA and total RNA-seq, the most common protocols. Because each cDNA is full length, and we show in vitro transcription is incredibly processive, each base in each transcript should be equivalently represented. However, with common RNA-seq applications and platforms, we find 50% of transcripts have more than two-fold and 10% have more than 10-fold differences in within-transcript sequence coverage. We also find greater than 6% of transcripts have regions of dramatically unpredictable sequencing coverage between samples, confounding accurate determination of their expression. We use a combination of experimental and computational approaches to show rRNA depletion is responsible for the most significant variability in coverage, and several sequence determinants also strongly influence representation. Conclusions These results show the utility of IVT-seq for promoting better understanding of bias introduced by RNA-seq. We find rRNA depletion is responsible for substantial, unappreciated biases in coverage introduced during library preparation. These biases suggest exon-level expression analysis may be inadvisable, and we recommend caution when interpreting RNA-seq results. PMID:24981968

  19. Homology of amino acid sequences of rat liver cathepsins B and H with that of papain.

    PubMed Central

    Takio, K; Towatari, T; Katunuma, N; Teller, D C; Titani, K

    1983-01-01

    The amino acid sequences of rat liver lysosomal thiol endopeptidases, cathepsins B and H, are presented and compared with that of the plant thiol protease papain. The 252-residue sequence of cathepsin B and the 220-residue sequence of cathepsin H were determined largely by automated Edman degradation of their intact polypeptide chains and of the two chains of each enzyme generated by limited proteolysis. Subfragments of the chains were produced by enzymatic digestion and by chemical cleavage of methionyl and tryptophanyl bonds. Comparison of the amino acid sequences of cathepsins B and H with each other and with that of papain demonstrates a striking homology among their primary structures. Sequence identity is extremely high in regions which, according to the three-dimensional structure of papain, constitute the catalytic site. The results not only reveal the first structural features of mammalian thiol endopeptidases but also provide insight into the evolutionary relationships among plant and mammalian thiol proteases. PMID:6574504

  20. Multilocus sequence typing reveals a novel subspeciation of Lactobacillus delbrueckii.

    PubMed

    Tanigawa, Kana; Watanabe, Koichi

    2011-03-01

    Currently, the species Lactobacillus delbrueckii is divided into four subspecies, L. delbrueckii subsp. delbrueckii, L. delbrueckii subsp. bulgaricus, L. delbrueckii subsp. indicus and L. delbrueckii subsp. lactis. These classifications were based mainly on phenotypic identification methods and few studies have used genotypic identification methods. As a result, these subspecies have not yet been reliably delineated. In this study, the four subspecies of L. delbrueckii were discriminated by phenotype and by genotypic identification [amplified-fragment length polymorphism (AFLP) and multilocus sequence typing (MLST)] methods. The MLST method developed here was based on the analysis of seven housekeeping genes (fusA, gyrB, hsp60, ileS, pyrG, recA and recG). The MLST method had good discriminatory ability: the 41 strains of L. delbrueckii examined were divided into 34 sequence types, with 29 sequence types represented by only a single strain. The sequence types were divided into eight groups. These groups could be discriminated as representing different subspecies. The results of the AFLP and MLST analyses were consistent. The type strain of L. delbrueckii subsp. delbrueckii, YIT 0080(T), was clearly discriminated from the other strains currently classified as members of this subspecies, which were located close to strains of L. delbrueckii subsp. lactis. The MLST scheme developed in this study should be a useful tool for the identification of strains of L. delbrueckii to the subspecies level. PMID:21178164

  1. Revealing the Complexity of Breast Cancer by Next Generation Sequencing

    PubMed Central

    Verigos, John; Magklara, Angeliki

    2015-01-01

    Over the last few years the increasing usage of “-omic” platforms, supported by next-generation sequencing, in the analysis of breast cancer samples has tremendously advanced our understanding of the disease. New driver and passenger mutations, rare chromosomal rearrangements and other genomic aberrations identified by whole genome and exome sequencing are providing missing pieces of the genomic architecture of breast cancer. High resolution maps of breast cancer methylomes and sequencing of the miRNA microworld are beginning to paint the epigenomic landscape of the disease. Transcriptomic profiling is giving us a glimpse into the gene regulatory networks that govern the fate of the breast cancer cell. At the same time, integrative analysis of sequencing data confirms an extensive intertumor and intratumor heterogeneity and plasticity in breast cancer arguing for a new approach to the problem. In this review, we report on the latest findings on the molecular characterization of breast cancer using NGS technologies, and we discuss their potential implications for the improvement of existing therapies. PMID:26561834

  2. Deep sequencing reveals the complete genome and evidence for transcriptional activity of the first virus-like sequences identified in Aristotelia chilensis (Maqui Berry).

    PubMed

    Villacreses, Javier; Rojas-Herrera, Marcelo; Sánchez, Carolina; Hewstone, Nicole; Undurraga, Soledad F; Alzate, Juan F; Manque, Patricio; Maracaja-Coutinho, Vinicius; Polanco, Victor

    2015-04-01

    Here, we report the genome sequence and evidence for transcriptional activity of a virus-like element in the native Chilean berry tree Aristotelia chilensis. We propose to name the endogenous sequence as Aristotelia chilensis Virus 1 (AcV1). High-throughput sequencing of the genome of this tree uncovered an endogenous viral element, with a size of 7122 bp, corresponding to the complete genome of AcV1. Its sequence contains three open reading frames (ORFs): ORFs 1 and 2 shares 66%-73% amino acid similarity with members of the Caulimoviridae virus family, especially the Petunia vein clearing virus (PVCV), Petuvirus genus. ORF1 encodes a movement protein (MP); ORF2 a Reverse Transcriptase (RT) and a Ribonuclease H (RNase H) domain; and ORF3 showed no amino acid sequence similarity with any other known virus proteins. Analogous to other known endogenous pararetrovirus sequences (EPRVs), AcV1 is integrated in the genome of Maqui Berry and showed low viral transcriptional activity, which was detected by deep sequencing technology (DNA and RNA-seq). Phylogenetic analysis of AcV1 and other pararetroviruses revealed a closer resemblance with Petuvirus. Overall, our data suggests that AcV1 could be a new member of Caulimoviridae family, genus Petuvirus, and the first evidence of this kind of virus in a fruit plant. PMID:25855242

  3. Deep Sequencing Reveals the Complete Genome and Evidence for Transcriptional Activity of the First Virus-Like Sequences Identified in Aristotelia chilensis (Maqui Berry)

    PubMed Central

    Villacreses, Javier; Rojas-Herrera, Marcelo; Sánchez, Carolina; Hewstone, Nicole; Undurraga, Soledad F.; Alzate, Juan F.; Manque, Patricio; Maracaja-Coutinho, Vinicius; Polanco, Victor

    2015-01-01

    Here, we report the genome sequence and evidence for transcriptional activity of a virus-like element in the native Chilean berry tree Aristotelia chilensis. We propose to name the endogenous sequence as Aristotelia chilensis Virus 1 (AcV1). High-throughput sequencing of the genome of this tree uncovered an endogenous viral element, with a size of 7122 bp, corresponding to the complete genome of AcV1. Its sequence contains three open reading frames (ORFs): ORFs 1 and 2 shares 66%–73% amino acid similarity with members of the Caulimoviridae virus family, especially the Petunia vein clearing virus (PVCV), Petuvirus genus. ORF1 encodes a movement protein (MP); ORF2 a Reverse Transcriptase (RT) and a Ribonuclease H (RNase H) domain; and ORF3 showed no amino acid sequence similarity with any other known virus proteins. Analogous to other known endogenous pararetrovirus sequences (EPRVs), AcV1 is integrated in the genome of Maqui Berry and showed low viral transcriptional activity, which was detected by deep sequencing technology (DNA and RNA-seq). Phylogenetic analysis of AcV1 and other pararetroviruses revealed a closer resemblance with Petuvirus. Overall, our data suggests that AcV1 could be a new member of Caulimoviridae family, genus Petuvirus, and the first evidence of this kind of virus in a fruit plant. PMID:25855242

  4. Widespread occurrence of the tfd-II genes in soil bacteria revealed by nucleotide sequence analysis of 2,4-dichlorophenoxyacetic acid degradative plasmids pDB1 and p712.

    PubMed

    Kim, Dong-Uk; Kim, Min-Sun; Lim, Jong-Sung; Ka, Jong-Ok

    2013-05-01

    Variovorax sp. strain DB1 and Pseudomonas pickettii strain 712 are 2,4-dicholorophenoxy-acetic acid (2,4-D)-degrading bacteria, which were isolated from agricultural soils in Republic of Korea and USA, respectively. Each strain harbors a 2,4-D degradative plasmid and is able to utilize 2,4-D as the sole source of carbon for its growth. The 2,4-D degradative plasmid pDB1 of strain DB1 consisted of a 65,269-bp circular molecule with a G+C content of 66.23% and had 68 ORFs. The 2,4-D degradative plasmid p712 of strain 712 was composed of a 62,798-bp circular molecule with a 62.11% G+C content and had 62 ORFs. The plasmids pDB1 and p712 share significantly homologous 2,4-D degradative genes with high similarity to the tfdR, tfdB-II, tfdC-II, tfdD-II, tfdE-II, tfdF-II, tfdK and tfdA genes of plasmid pJP4 of Alcaligenes eutrophus isolated from Australia. In a phylogenetic analysis with trfA, traL, and trbA genes, pDB1 belonged to IncP-1β with pJP4, while p712 belonged to IncP-1ε with pKJK5 and pEMT3. The results indicated that, in spite of the differences in their backbone regions, the 2,4-D catabolic genes of the two plasmids were closely related and also related to the well-known 2,4-D degradative plasmid pJP4 even though all were isolated from different geographic regions. Other similarities in the genetic organization and the presence of IS1071 suggested that these catabolic genes may be on a transposable element, leading to widespread occurrence in soil bacteria.

  5. Whole-genome sequencing reveals oncogenic mutations in mycosis fungoides

    PubMed Central

    McGirt, Laura Y.; Jia, Peilin; Baerenwald, Devin A.; Duszynski, Robert J.; Dahlman, Kimberly B.; Zic, John A.; Zwerner, Jeffrey P.; Hucks, Donald; Dave, Utpal; Zhao, Zhongming

    2015-01-01

    The pathogenesis of mycosis fungoides (MF), the most common cutaneous T-cell lymphoma (CTCL), is unknown. Although genetic alterations have been identified, none are considered consistently causative in MF. To identify potential drivers of MF, we performed whole-genome sequencing of MF tumors and matched normal skin. Targeted ultra-deep sequencing of MF samples and exome sequencing of CTCL cell lines were also performed. Multiple mutations were identified that affected the same pathways, including epigenetic, cell-fate regulation, and cytokine signaling, in MF tumors and CTCL cell lines. Specifically, interleukin-2 signaling pathway mutations, including activating Janus kinase 3 (JAK3) mutations, were detected. Treatment with a JAK3 inhibitor significantly reduced CTCL cell survival. Additionally, the mutation data identified 2 other potential contributing factors to MF, ultraviolet light, and a polymorphism in the tumor suppressor p53 (TP53). Therefore, genetic alterations in specific pathways in MF were identified that may be viable, effective new targets for treatment. PMID:26082451

  6. Subclonal diversification of primary breast cancer revealed by multiregion sequencing

    SciTech Connect

    Yates, Lucy R.; Gerstung, Moritz; Knappskog, Stian; Desmedt, Christine; Gundem, Gunes; Van Loo, Peter; Aas, Turid; Alexandrov, Ludmil B.; Larsimont, Denis; Davies, Helen; Li, Yilong; Ju, Young Seok; Ramakrishna, Manasa; Haugland, Hans Kristian; Lilleng, Peer Kaare; Nik-Zainal, Serena; McLaren, Stuart; Butler, Adam; Martin, Sancha; Glodzik, Dominic; Menzies, Andrew; Raine, Keiran; Hinton, Jonathan; Jones, David; Mudie, Laura J.; Jiang, Bing; Vincent, Delphine; Greene-Colozzi, April; Adnet, Pierre -Yves; Fatima, Aquila; Maetens, Marion; Ignatiadis, Michail; Stratton, Michael R.; Sotiriou, Christos; Richardson, Andrea L.; Lønning, Per Eystein; Wedge, David C.; Campbell, Peter J.

    2015-06-22

    Sequencing cancer genomes may enable tailoring of therapeutics to the underlying biological abnormalities driving a particular patient's tumor. However, sequencing-based strategies rely heavily on representative sampling of tumors. To understand the subclonal structure of primary breast cancer, we applied whole-genome and targeted sequencing to multiple samples from each of 50 patients' tumors (303 samples in total). The extent of subclonal diversification varied among cases and followed spatial patterns. No strict temporal order was evident, with point mutations and rearrangements affecting the most common breast cancer genes, including PIK3CA, TP53, PTEN, BRCA2 and MYC, occurring early in some tumors and late in others. In 13 out of 50 cancers, potentially targetable mutations were subclonal. Landmarks of disease progression, such as resistance to chemotherapy and the acquisition of invasive or metastatic potential, arose within detectable subclones of antecedent lesions. These findings highlight the importance of including analyses of subclonal structure and tumor evolution in clinical trials of primary breast cancer.

  7. Subclonal diversification of primary breast cancer revealed by multiregion sequencing

    DOE PAGES

    Yates, Lucy R.; Gerstung, Moritz; Knappskog, Stian; Desmedt, Christine; Gundem, Gunes; Van Loo, Peter; Aas, Turid; Alexandrov, Ludmil B.; Larsimont, Denis; Davies, Helen; et al

    2015-06-22

    Sequencing cancer genomes may enable tailoring of therapeutics to the underlying biological abnormalities driving a particular patient's tumor. However, sequencing-based strategies rely heavily on representative sampling of tumors. To understand the subclonal structure of primary breast cancer, we applied whole-genome and targeted sequencing to multiple samples from each of 50 patients' tumors (303 samples in total). The extent of subclonal diversification varied among cases and followed spatial patterns. No strict temporal order was evident, with point mutations and rearrangements affecting the most common breast cancer genes, including PIK3CA, TP53, PTEN, BRCA2 and MYC, occurring early in some tumors and latemore » in others. In 13 out of 50 cancers, potentially targetable mutations were subclonal. Landmarks of disease progression, such as resistance to chemotherapy and the acquisition of invasive or metastatic potential, arose within detectable subclones of antecedent lesions. These findings highlight the importance of including analyses of subclonal structure and tumor evolution in clinical trials of primary breast cancer.« less

  8. Subclonal diversification of primary breast cancer revealed by multiregion sequencing.

    PubMed

    Yates, Lucy R; Gerstung, Moritz; Knappskog, Stian; Desmedt, Christine; Gundem, Gunes; Van Loo, Peter; Aas, Turid; Alexandrov, Ludmil B; Larsimont, Denis; Davies, Helen; Li, Yilong; Ju, Young Seok; Ramakrishna, Manasa; Haugland, Hans Kristian; Lilleng, Peer Kaare; Nik-Zainal, Serena; McLaren, Stuart; Butler, Adam; Martin, Sancha; Glodzik, Dominic; Menzies, Andrew; Raine, Keiran; Hinton, Jonathan; Jones, David; Mudie, Laura J; Jiang, Bing; Vincent, Delphine; Greene-Colozzi, April; Adnet, Pierre-Yves; Fatima, Aquila; Maetens, Marion; Ignatiadis, Michail; Stratton, Michael R; Sotiriou, Christos; Richardson, Andrea L; Lønning, Per Eystein; Wedge, David C; Campbell, Peter J

    2015-07-01

    The sequencing of cancer genomes may enable tailoring of therapeutics to the underlying biological abnormalities driving a particular patient's tumor. However, sequencing-based strategies rely heavily on representative sampling of tumors. To understand the subclonal structure of primary breast cancer, we applied whole-genome and targeted sequencing to multiple samples from each of 50 patients' tumors (303 samples in total). The extent of subclonal diversification varied among cases and followed spatial patterns. No strict temporal order was evident, with point mutations and rearrangements affecting the most common breast cancer genes, including PIK3CA, TP53, PTEN, BRCA2 and MYC, occurring early in some tumors and late in others. In 13 out of 50 cancers, potentially targetable mutations were subclonal. Landmarks of disease progression, such as resistance to chemotherapy and the acquisition of invasive or metastatic potential, arose within detectable subclones of antecedent lesions. These findings highlight the importance of including analyses of subclonal structure and tumor evolution in clinical trials of primary breast cancer.

  9. Molecular Dynamic Simulations Reveal the Structural Determinants of Fatty Acid Binding to Oxy-Myoglobin

    PubMed Central

    Chintapalli, Sree V.; Bhardwaj, Gaurav; Patel, Reema; Shah, Natasha; Patterson, Randen L.; van Rossum, Damian B.; Anishkin, Andriy; Adams, Sean H.

    2015-01-01

    The mechanism(s) by which fatty acids are sequestered and transported in muscle have not been fully elucidated. A potential key player in this process is the protein myoglobin (Mb). Indeed, there is a catalogue of empirical evidence supporting direct interaction of globins with fatty acid metabolites; however, the binding pocket and regulation of the interaction remains to be established. In this study, we employed a computational strategy to elucidate the structural determinants of fatty acids (palmitic & oleic acid) binding to Mb. Sequence analysis and docking simulations with a horse (Equus caballus) structural Mb reference reveals a fatty acid-binding site in the hydrophobic cleft near the heme region in Mb. Both palmitic acid and oleic acid attain a “U” shaped structure similar to their conformation in pockets of other fatty acid-binding proteins. Specifically, we found that the carboxyl head group of palmitic acid coordinates with the amino group of Lys45, whereas the carboxyl group of oleic acid coordinates with both the amino groups of Lys45 and Lys63. The alkyl tails of both fatty acids are supported by surrounding hydrophobic residues Leu29, Leu32, Phe33, Phe43, Phe46, Val67, Val68 and Ile107. In the saturated palmitic acid, the hydrophobic tail moves freely and occasionally penetrates deeper inside the hydrophobic cleft, making additional contacts with Val28, Leu69, Leu72 and Ile111. Our simulations reveal a dynamic and stable binding pocket in which the oxygen molecule and heme group in Mb are required for additional hydrophobic interactions. Taken together, these findings support a mechanism in which Mb acts as a muscle transporter for fatty acid when it is in the oxygenated state and releases fatty acid when Mb converts to deoxygenated state. PMID:26030763

  10. Amino acid sequences of proteins from Leptospira serovar pomona.

    PubMed

    Alves, S F; Lefebvre, R B; Probert, W

    2000-01-01

    This report describes a partial amino acid sequences from three putative outer envelope proteins from Leptospira serovar pomona. In order to obtain internal fragments for protein sequencing, enzymatic and chemical digestion was performed. The enzyme clostripain was used to digest the proteins 32 and 45 kDa. In situ digestion of 40 kDa molecular weight protein was accomplished using cyanogen bromide. The 32 kDa protein generated two fragments, one of 21 kDa and another of 10 kDa that yielded five residues. A fragment of 24 kDa that yielded nineteen residues of amino acids was obtained from 45 kDa protein. A fragment with a molecular weight of 20 kDa, yielding a twenty amino acids sequence from the 40 kDa protein.

  11. The genome sequencing of an albino Western lowland gorilla reveals inbreeding in the wild

    PubMed Central

    2013-01-01

    Background The only known albino gorilla, named Snowflake, was a male wild born individual from Equatorial Guinea who lived at the Barcelona Zoo for almost 40 years. He was diagnosed with non-syndromic oculocutaneous albinism, i.e. white hair, light eyes, pink skin, photophobia and reduced visual acuity. Despite previous efforts to explain the genetic cause, this is still unknown. Here, we study the genetic cause of his albinism and making use of whole genome sequencing data we find a higher inbreeding coefficient compared to other gorillas. Results We successfully identified the causal genetic variant for Snowflake’s albinism, a non-synonymous single nucleotide variant located in a transmembrane region of SLC45A2. This transporter is known to be involved in oculocutaneous albinism type 4 (OCA4) in humans. We provide experimental evidence that shows that this amino acid replacement alters the membrane spanning capability of this transmembrane region. Finally, we provide a comprehensive study of genome-wide patterns of autozygogosity revealing that Snowflake’s parents were related, being this the first report of inbreeding in a wild born Western lowland gorilla. Conclusions In this study we demonstrate how the use of whole genome sequencing can be extended to link genotype and phenotype in non-model organisms and it can be a powerful tool in conservation genetics (e.g., inbreeding and genetic diversity) with the expected decrease in sequencing cost. PMID:23721540

  12. The amino acid sequence of Staphylococcus aureus penicillinase.

    PubMed Central

    Ambler, R P

    1975-01-01

    The amino acid sequence of the penicillinase (penicillin amido-beta-lactamhydrolase, EC 3.5.2.6) from Staphylococcus aureus strain PC1 was determined. The protein consists of a single polypeptide chain of 257 residues, and the sequence was determined by characterization of tryptic, chymotryptic, peptic and CNBr peptides, with some additional evidence from thermolysin and S. aureus proteinase peptides. A mistake in the preliminary report of the sequence is corrected; residues 113-116 are now thought to be -Lys-Lys-Val-Lys- rather than -Lys-Val-Lys-Lys-. Detailed evidence for the amino acid sequence has been deposited as Supplementary Publication SUP 50056 (91 pages) at the British Library (Lending Division), Boston Spa, Wetherby, West Yorkshire LS23 7BQ, U.K., from whom copies may be obtained on the terms given in Biochem. J. (1975) 145, 5. PMID:1218078

  13. Sequence similarity network reveals common ancestry of multidomain proteins.

    PubMed

    Song, Nan; Joseph, Jacob M; Davis, George B; Durand, Dannie

    2008-04-01

    We address the problem of homology identification in complex multidomain families with varied domain architectures. The challenge is to distinguish sequence pairs that share common ancestry from pairs that share an inserted domain but are otherwise unrelated. This distinction is essential for accuracy in gene annotation, function prediction, and comparative genomics. There are two major obstacles to multidomain homology identification: lack of a formal definition and lack of curated benchmarks for evaluating the performance of new methods. We offer preliminary solutions to both problems: 1) an extension of the traditional model of homology to include domain insertions; and 2) a manually curated benchmark of well-studied families in mouse and human. We further present Neighborhood Correlation, a novel method that exploits the local structure of the sequence similarity network to identify homologs with great accuracy based on the observation that gene duplication and domain shuffling leave distinct patterns in the sequence similarity network. In a rigorous, empirical comparison using our curated data, Neighborhood Correlation outperforms sequence similarity, alignment length, and domain architecture comparison. Neighborhood Correlation is well suited for automated, genome-scale analyses. It is easy to compute, does not require explicit knowledge of domain architecture, and classifies both single and multidomain homologs with high accuracy. Homolog predictions obtained with our method, as well as our manually curated benchmark and a web-based visualization tool for exploratory analysis of the network neighborhood structure, are available at http://www.neighborhoodcorrelation.org. Our work represents a departure from the prevailing view that the concept of homology cannot be applied to genes that have undergone domain shuffling. In contrast to current approaches that either focus on the homology of individual domains or consider only families with identical domain

  14. Targeted exome sequencing for mitochondrial disorders reveals high genetic heterogeneity

    PubMed Central

    2013-01-01

    Background Mitochondrial disorders are difficult to diagnose due to extreme genetic and phenotypic heterogeneities. Methods We explored the utility of targeted next-generation sequencing for the diagnosis of mitochondrial disorders in 148 patients submitted for clinical testing. A panel of 447 nuclear genes encoding mitochondrial respiratory chain complexes, and other genes inducing secondary mitochondrial dysfunction or that cause diseases which mimic mitochondrial disorders were tested. Results We identified variants considered to be possibly disease-causing based on family segregation data and/or variants already known to cause disease in twelve genes in thirteen patients. Rare or novel variants of unknown significance were identified in 45 additional genes for various metabolic, genetic or neurogenetic disorders. Conclusions Primary mitochondrial defects were confirmed only in four patients indicating that majority of patients with suspected mitochondrial disorders are presumably not the result of direct impairment of energy production. Our results support that clinical and routine laboratory ascertainment for mitochondrial disorders are challenging due to significant overlapping non-specific clinical symptoms and lack of specific biomarkers. While next-generation sequencing shows promise for diagnosing suspected mitochondrial disorders, the challenges remain as the underlying genetic heterogeneity may be greater than suspected and it is further confounded by the similarity of symptoms with other conditions as we report here. PMID:24215330

  15. Complete cDNA and derived amino acid sequence of human factor V.

    PubMed Central

    Jenny, R J; Pittman, D D; Toole, J J; Kriz, R W; Aldape, R A; Hewick, R M; Kaufman, R J; Mann, K G

    1987-01-01

    cDNA clones encoding human factor V have been isolated from an oligo(dT)-primed human fetal liver cDNA library prepared with vector Charon 21A. The cDNA sequence of factor V from three overlapping clones includes a 6672-base-pair (bp) coding region, a 90-bp 5' untranslated region, and a 163-bp 3' untranslated region within which is a poly(A) tail. The deduced amino acid sequence consists of 2224 amino acids inclusive of a 28-amino acid leader peptide. Direct comparison with human factor VIII reveals considerable homology between proteins in amino acid sequence and domain structure: a triplicated A domain and duplicated C domain show approximately equal to 40% identity with the corresponding domains in factor VIII. As in factor VIII, the A domains of factor V share approximately 40% amino acid-sequence homology with the three highly conserved domains in ceruloplasmin. The B domain of factor V contains 35 tandem and approximately 9 additional semiconserved repeats of nine amino acids of the form Asp-Leu-Ser-Gln-Thr-Thr/Asn-Leu-Ser-Pro and 2 additional semiconserved repeats of 17 amino acids. Factor V contains 37 potential N-linked glycosylation sites, 25 of which are in the B domain, and a total of 19 cysteine residues. Images PMID:3110773

  16. Complete cDNA and derived amino acid sequence of human factor V

    SciTech Connect

    Jenny, R.J.; Pittman, D.D.; Toole, J.J.; Kriz, R.W.; Aldape, R.A.; Hewick, R.M.; Kaufman, R.J.; Mann, K.G.

    1987-07-01

    cDNA clones encoding human factor V have been isolated from an oligo(dT)-primed human fetal liver cDNA library prepared with vector Charon 21A. The cDNA sequence of factor V from three overlapping clones includes a 6672-base-pair (bp) coding region, a 90-bp 5' untranslated region, and a 163-bp 3' untranslated region within which is a poly(A)tail. The deduced amino acid sequence consists of 2224 amino acids inclusive of a 28-amino acid leader peptide. Direct comparison with human factor VIII reveals considerable homology between proteins in amino acid sequence and domain structure: a triplicated A domain and duplicated C domain show approx. 40% identity with the corresponding domains in factor VIII. As in factor VIII, the A domains of factor V share approx. 40% amino acid-sequence homology with the three highly conserved domains in ceruloplasmin. The B domain of factor V contains 35 tandem and approx. 9 additional semiconserved repeats of nine amino acids of the form Asp-Leu-Ser-Gln-Thr-Thr/Asn-Leu-Ser-Pro and 2 additional semiconserved repeats of 17 amino acids. Factor V contains 37 potential N-linked glycosylation sites, 25 of which are in the B domain, and a total of 19 cysteine residues.

  17. Transcriptome Sequencing in Response to Salicylic Acid in Salvia miltiorrhiza.

    PubMed

    Zhang, Xiaoru; Dong, Juane; Liu, Hailong; Wang, Jiao; Qi, Yuexin; Liang, Zongsuo

    2016-01-01

    Salvia miltiorrhiza is a traditional Chinese herbal medicine, whose quality and yield are often affected by diseases and environmental stresses during its growing season. Salicylic acid (SA) plays a significant role in plants responding to biotic and abiotic stresses, but the involved regulatory factors and their signaling mechanisms are largely unknown. In order to identify the genes involved in SA signaling, the RNA sequencing (RNA-seq) strategy was employed to evaluate the transcriptional profiles in S. miltiorrhiza cell cultures. A total of 50,778 unigenes were assembled, in which 5,316 unigenes were differentially expressed among 0-, 2-, and 8-h SA induction. The up-regulated genes were mainly involved in stimulus response and multi-organism process. A core set of candidate novel genes coding SA signaling component proteins was identified. Many transcription factors (e.g., WRKY, bHLH and GRAS) and genes involved in hormone signal transduction were differentially expressed in response to SA induction. Detailed analysis revealed that genes associated with defense signaling, such as antioxidant system genes, cytochrome P450s and ATP-binding cassette transporters, were significantly overexpressed, which can be used as genetic tools to investigate disease resistance. Our transcriptome analysis will help understand SA signaling and its mechanism of defense systems in S. miltiorrhiza. PMID:26808150

  18. Transcriptome Sequencing in Response to Salicylic Acid in Salvia miltiorrhiza

    PubMed Central

    Zhang, Xiaoru; Dong, Juane; Liu, Hailong; Wang, Jiao; Qi, Yuexin; Liang, Zongsuo

    2016-01-01

    Salvia miltiorrhiza is a traditional Chinese herbal medicine, whose quality and yield are often affected by diseases and environmental stresses during its growing season. Salicylic acid (SA) plays a significant role in plants responding to biotic and abiotic stresses, but the involved regulatory factors and their signaling mechanisms are largely unknown. In order to identify the genes involved in SA signaling, the RNA sequencing (RNA-seq) strategy was employed to evaluate the transcriptional profiles in S. miltiorrhiza cell cultures. A total of 50,778 unigenes were assembled, in which 5,316 unigenes were differentially expressed among 0-, 2-, and 8-h SA induction. The up-regulated genes were mainly involved in stimulus response and multi-organism process. A core set of candidate novel genes coding SA signaling component proteins was identified. Many transcription factors (e.g., WRKY, bHLH and GRAS) and genes involved in hormone signal transduction were differentially expressed in response to SA induction. Detailed analysis revealed that genes associated with defense signaling, such as antioxidant system genes, cytochrome P450s and ATP-binding cassette transporters, were significantly overexpressed, which can be used as genetic tools to investigate disease resistance. Our transcriptome analysis will help understand SA signaling and its mechanism of defense systems in S. miltiorrhiza. PMID:26808150

  19. The Microglial Sensome Revealed by Direct RNA Sequencing

    PubMed Central

    Hickman, Suzanne E.; Kingery, Nathan D.; Ohsumi, Toshiro; Borowsky, Mark; Wang, Li-chong; Means, Terry K.; Khoury, Joseph El

    2013-01-01

    Microglia, the principal neuroimmune sentinels of the brain, continuously sense changes in their environment and respond to invading pathogens, toxins and cellular debris. Microglia exhibit plasticity and can assume neurotoxic or neuroprotective priming states that determine their responses to danger. We used direct RNA sequencing, without amplification or cDNA synthesis, to determine the quantitative transcriptomes of microglia of healthy adult and aged mice. We validated our findings by fluorescent dual in-situ hybridization, unbiased proteomic analysis and quantitative PCR. We report here that microglia have a distinct transcriptomic signature and express a unique cluster of transcripts encoding proteins for sensing endogenous ligands and microbes that we term the “sensome”. With aging, sensome transcripts for endogenous ligand recognition are downregulated, whereas those involved in microbe recognition and host defense are upregulated. In addition, aging is associated with an overall increase in expression of microglial genes involved in neuroprotection. PMID:24162652

  20. Transcriptome Sequencing from Diverse Human Populations Reveals Differentiated Regulatory Architecture

    PubMed Central

    Lappalainen, Tuuli; Henn, Brenna M.; Kidd, Jeffrey M.; Yee, Muh-Ching; Grubert, Fabian; Cann, Howard M.; Snyder, Michael; Montgomery, Stephen B.; Bustamante, Carlos D.

    2014-01-01

    Large-scale sequencing efforts have documented extensive genetic variation within the human genome. However, our understanding of the origins, global distribution, and functional consequences of this variation is far from complete. While regulatory variation influencing gene expression has been studied within a handful of populations, the breadth of transcriptome differences across diverse human populations has not been systematically analyzed. To better understand the spectrum of gene expression variation, alternative splicing, and the population genetics of regulatory variation in humans, we have sequenced the genomes, exomes, and transcriptomes of EBV transformed lymphoblastoid cell lines derived from 45 individuals in the Human Genome Diversity Panel (HGDP). The populations sampled span the geographic breadth of human migration history and include Namibian San, Mbuti Pygmies of the Democratic Republic of Congo, Algerian Mozabites, Pathan of Pakistan, Cambodians of East Asia, Yakut of Siberia, and Mayans of Mexico. We discover that approximately 25.0% of the variation in gene expression found amongst individuals can be attributed to population differences. However, we find few genes that are systematically differentially expressed among populations. Of this population-specific variation, 75.5% is due to expression rather than splicing variability, and we find few genes with strong evidence for differential splicing across populations. Allelic expression analyses indicate that previously mapped common regulatory variants identified in eight populations from the International Haplotype Map Phase 3 project have similar effects in our seven sampled HGDP populations, suggesting that the cellular effects of common variants are shared across diverse populations. Together, these results provide a resource for studies analyzing functional differences across populations by estimating the degree of shared gene expression, alternative splicing, and regulatory genetics

  1. The amino-acid sequence of kangaroo pancreatic ribonuclease.

    PubMed

    Gaastra, W; Welling, G W; Beintema, J J

    1978-05-01

    Red kangaroo (Macropus rufus) ribonuclease was isolated from pancreatic tissue by affinity chromatography. The amino acid sequence was determined by automatic sequencing of overlapping large fragments and by analysis of shorter peptides obtained by digestion with a number of proteolytic enzymes. The polypeptide chain consists of 122 amino acid residues. Compared to other ribonucleases, the N-terminal residue and residue 114 are deleted. In other pancreatic ribonucleases position 114 is occupied by a cis proline residue in an external loop at the surface of the molecule. Other remarkable substitutions are the presence of a tyrosine residue at position 123 instead of a serine which forms a hydrogen bond with the pyrimidine ring of a nucleotide substrate, and a number of hydrophobichydrophilic interchanges in the sequence 51-55, which forms part of an alpha-helix in bovine ribonuclease and exhibits few substitutions in the placental mammals. Kangaroo ribonuclease contains no carbohydrate, although the enzyme possesses a recognition site for carbohydrate attachment in the sequence Asn-Val-Thr (62-64). The enzyme differs at about 35-40% of the positions from all other mammalian pancreatic ribonucleases sequenced to date, which is in agreement with the early divergence between the marsupials and the placental mammals. From fragmentary data a tentative sequence of red-necked wallaby (Macropus rufogriseus) pancreatic ribonuclease has been derived. Eight differences with the kangaroo sequence were found.

  2. Prebiotically plausible mechanisms increase compositional diversity of nucleic acid sequences

    PubMed Central

    Derr, Julien; Manapat, Michael L.; Rajamani, Sudha; Leu, Kevin; Xulvi-Brunet, Ramon; Joseph, Isaac; Nowak, Martin A.; Chen, Irene A.

    2012-01-01

    During the origin of life, the biological information of nucleic acid polymers must have increased to encode functional molecules (the RNA world). Ribozymes tend to be compositionally unbiased, as is the vast majority of possible sequence space. However, ribonucleotides vary greatly in synthetic yield, reactivity and degradation rate, and their non-enzymatic polymerization results in compositionally biased sequences. While natural selection could lead to complex sequences, molecules with some activity are required to begin this process. Was the emergence of compositionally diverse sequences a matter of chance, or could prebiotically plausible reactions counter chemical biases to increase the probability of finding a ribozyme? Our in silico simulations using a two-letter alphabet show that template-directed ligation and high concatenation rates counter compositional bias and shift the pool toward longer sequences, permitting greater exploration of sequence space and stable folding. We verified experimentally that unbiased DNA sequences are more efficient templates for ligation, thus increasing the compositional diversity of the pool. Our work suggests that prebiotically plausible chemical mechanisms of nucleic acid polymerization and ligation could predispose toward a diverse pool of longer, potentially structured molecules. Such mechanisms could have set the stage for the appearance of functional activity very early in the emergence of life. PMID:22319215

  3. The amino-acid sequence of kangaroo pancreatic ribonuclease.

    PubMed

    Gaastra, W; Welling, G W; Beintema, J J

    1978-05-01

    Red kangaroo (Macropus rufus) ribonuclease was isolated from pancreatic tissue by affinity chromatography. The amino acid sequence was determined by automatic sequencing of overlapping large fragments and by analysis of shorter peptides obtained by digestion with a number of proteolytic enzymes. The polypeptide chain consists of 122 amino acid residues. Compared to other ribonucleases, the N-terminal residue and residue 114 are deleted. In other pancreatic ribonucleases position 114 is occupied by a cis proline residue in an external loop at the surface of the molecule. Other remarkable substitutions are the presence of a tyrosine residue at position 123 instead of a serine which forms a hydrogen bond with the pyrimidine ring of a nucleotide substrate, and a number of hydrophobichydrophilic interchanges in the sequence 51-55, which forms part of an alpha-helix in bovine ribonuclease and exhibits few substitutions in the placental mammals. Kangaroo ribonuclease contains no carbohydrate, although the enzyme possesses a recognition site for carbohydrate attachment in the sequence Asn-Val-Thr (62-64). The enzyme differs at about 35-40% of the positions from all other mammalian pancreatic ribonucleases sequenced to date, which is in agreement with the early divergence between the marsupials and the placental mammals. From fragmentary data a tentative sequence of red-necked wallaby (Macropus rufogriseus) pancreatic ribonuclease has been derived. Eight differences with the kangaroo sequence were found. PMID:658039

  4. Microheterogeneity of odorant-binding proteins in the porcupine revealed by N-terminal sequencing and mass spectrometry.

    PubMed

    Ganni, M; Garibotti, M; Scaloni, A; Pucci, P; Pelosi, P

    1997-06-01

    Several odorant-binding proteins (OBP) have been previously purified from the nasal mucosa of the old world porcupine Hystrix cristata. In this paper, we report their N-terminal amino-acid sequences and accurate molecular weights, as measured by electrospray mass spectrometry. The partial amino acid sequences reveal significant similarity with OBPs of other mammalian species and segregate the eight proteins purified into two subclasses. Mass spectrometry has revealed microheterogeneity among the proteins belonging to each of these two groups, suggesting a total number of OBPs of at least nine. The molecular weight differences between OBPs cannot be readily accounted for by common post-translation modifications and indicate different gene products. Such a large number of different OBPs may represent further support to an odour discriminating role for these proteins.

  5. Nascent RNA sequencing reveals distinct features in plant transcription

    PubMed Central

    Hetzel, Jonathan; Duttke, Sascha H.; Benner, Christopher; Chory, Joanne

    2016-01-01

    Transcriptional regulation of gene expression is a major mechanism used by plants to confer phenotypic plasticity, and yet compared with other eukaryotes or bacteria, little is known about the design principles. We generated an extensive catalog of nascent and steady-state transcripts in Arabidopsis thaliana seedlings using global nuclear run-on sequencing (GRO-seq), 5′GRO-seq, and RNA-seq and reanalyzed published maize data to capture characteristics of plant transcription. De novo annotation of nascent transcripts accurately mapped start sites and unstable transcripts. Examining the promoters of coding and noncoding transcripts identified comparable chromatin signatures, a conserved “TGT” core promoter motif and unreported transcription factor-binding sites. Mapping of engaged RNA polymerases showed a lack of enhancer RNAs, promoter-proximal pausing, and divergent transcription in Arabidopsis seedlings and maize, which are commonly present in yeast and humans. In contrast, Arabidopsis and maize genes accumulate RNA polymerases in proximity of the polyadenylation site, a trend that coincided with longer genes and CpG hypomethylation. Lack of promoter-proximal pausing and a higher correlation of nascent and steady-state transcripts indicate Arabidopsis may regulate transcription predominantly at the level of initiation. Our findings provide insight into plant transcription and eukaryotic gene expression as a whole. PMID:27729530

  6. Classic Selective Sweeps Revealed by Massive Sequencing in Cattle

    PubMed Central

    Qanbari, Saber; Pausch, Hubert; Jansen, Sandra; Somel, Mehmet; Strom, Tim M.; Fries, Ruedi; Nielsen, Rasmus; Simianer, Henner

    2014-01-01

    Human driven selection during domestication and subsequent breed formation has likely left detectable signatures within the genome of modern cattle. The elucidation of these signatures of selection is of interest from the perspective of evolutionary biology, and for identifying domestication-related genes that ultimately may help to further genetically improve this economically important animal. To this end, we employed a panel of more than 15 million autosomal SNPs identified from re-sequencing of 43 Fleckvieh animals. We mainly applied two somewhat complementary statistics, the integrated Haplotype Homozygosity Score (iHS) reflecting primarily ongoing selection, and the Composite of Likelihood Ratio (CLR) having the most power to detect completed selection after fixation of the advantageous allele. We find 106 candidate selection regions, many of which are harboring genes related to phenotypes relevant in domestication, such as coat coloring pattern, neurobehavioral functioning and sensory perception including KIT, MITF, MC1R, NRG4, Erbb4, TMEM132D and TAS2R16, among others. To further investigate the relationship between genes with signatures of selection and genes identified in QTL mapping studies, we use a sample of 3062 animals to perform four genome-wide association analyses using appearance traits, body size and somatic cell count. We show that regions associated with coat coloring significantly (P<0.0001) overlap with the candidate selection regions, suggesting that the selection signals we identify are associated with traits known to be affected by selection during domestication. Results also provide further evidence regarding the complexity of the genetics underlying coat coloring in cattle. This study illustrates the potential of population genetic approaches for identifying genomic regions affecting domestication-related phenotypes and further helps to identify specific regions targeted by selection during speciation, domestication and breed formation

  7. Development of an expert system for amino acid sequence identification.

    PubMed

    Hu, L; Saulinskas, E F; Johnson, P; Harrington, P B

    1996-08-01

    An expert system for amino acid sequence identification has been developed. The algorithm uses heuristic rules developed by human experts in protein sequencing. The system is applied to the chromatographic data of phenylthiohydantoin-amino acids acquired from an automated sequencer. The peak intensities in the current cycle are compared with those in the previous cycle, while the calibration and succeeding cycles are used as ancillary identification criteria when necessary. The retention time for each chromatographic peak in each cycle is corrected by the corresponding peak in the calibration cycle at the same run. The main improvement of our system compared with the onboard software used by the Applied Biosystems 477A Protein/Peptide Sequencer is that each peak in each cycle is assigned an identification name according to the corrected retention time to be used for the comparison with different cycles. The system was developed from analyses of ribonuclease A and evaluated by runs of four other protein samples that were not used in rule development. This paper demonstrates that rules developed by human experts can be automatically applied to sequence assignment. The expert system performed more accurately than the onboard software of the protein sequencer, in that the misidentification rates for the expert system were around 7%, whereas those for the onboard software were between 13 and 21%.

  8. Analysis of putative nonulosonic acid biosynthesis pathways in Archaea reveals a complex evolutionary history.

    PubMed

    Kandiba, Lina; Eichler, Jerry

    2013-08-01

    Sialic acids and the other nonulosonic acid sugars, legionaminic acid and pseudaminic acid, are nine carbon-containing sugars that can be detected as components of the glycans decorating proteins and other molecules in Eukarya and Bacteria. Yet, despite the prevalence of N-glycosylation in Archaea and the variety of sugars recruited for the archaeal version of this post-translational modification, only a single report of a nonulosonic acid sugar in an archaeal N-linked glycan has appeared. Hence, to obtain a clearer picture of nonulosonic acid sugar biosynthesis capability in Archaea, 122 sequenced genomes were scanned for the presence of genes involved in the biogenesis of these sugars. The results reveal that while Archaea and Bacteria share a common route of sialic acid biosynthesis, numerous archaeal nonulosonic acid sugar biosynthesis pathway components were acquired from elsewhere via various routes. Still, the limited number of Archaea encoding components involved in the synthesis of nonulosonic acid sugars implies that such saccharides are not major components of glycans in this domain.

  9. Protein sequences from mastodon and Tyrannosaurus rex revealed by mass spectrometry.

    PubMed

    Asara, John M; Schweitzer, Mary H; Freimark, Lisa M; Phillips, Matthew; Cantley, Lewis C

    2007-04-13

    Fossilized bones from extinct taxa harbor the potential for obtaining protein or DNA sequences that could reveal evolutionary links to extant species. We used mass spectrometry to obtain protein sequences from bones of a 160,000- to 600,000-year-old extinct mastodon (Mammut americanum) and a 68-million-year-old dinosaur (Tyrannosaurus rex). The presence of T. rex sequences indicates that their peptide bonds were remarkably stable. Mass spectrometry can thus be used to determine unique sequences from ancient organisms from peptide fragmentation patterns, a valuable tool to study the evolution and adaptation of ancient taxa from which genomic sequences are unlikely to be obtained.

  10. The genome of RNA tumor viruses contains polyadenylic acid sequences.

    PubMed

    Green, M; Cartas, M

    1972-04-01

    The 70S genome of two RNA tumor viruses, murine sarcoma virus and avian myeloblastosis virus, binds to Millipore filters in buffer with high salt concentration and to glass fiber filters containing poly(U). These observations suggest that 70S RNA contains adenylic acid-rich sequences. When digested by pancreatic RNase, 70S RNA of murine sarcoma virus yielded poly(A) sequences that contain 91% adenylic acid. These poly(A) sequences sedimented as a relatively homogenous peak in sucrose gradients with a sedimentation coefficient of 4-5 S, but had a mobility during polyacrylamide gel electrophoresis that corresponds to molecules that sediment at 6-7 S. If we estimate a molecular weight for each sequence of 30,000-60,000 (100-200 nucleotides) and a molecular weight for viral 70S RNA of 3-12 million, each viral genome could contain 1-8 poly(A) sequences. Possible functions of poly(A) in the infecting viral RNA may include a role in the initiation of viral DNA or RNA synthesis, in protein maturation, or in the assembly of the viral genome.

  11. Molecular Phylogeny of Sequenced Saccharomycetes Reveals Polyphyly of the Alternative Yeast Codon Usage

    PubMed Central

    Mühlhausen, Stefanie; Kollmar, Martin

    2014-01-01

    The universal genetic code defines the translation of nucleotide triplets, called codons, into amino acids. In many Saccharomycetes a unique alteration of this code affects the translation of the CUG codon, which is normally translated as leucine. Most of the species encoding CUG alternatively as serine belong to the Candida genus and were grouped into a so-called CTG clade. However, the “Candida genus” is not a monophyletic group and several Candida species are known to use the standard CUG translation. The codon identity could have been changed in a single branch, the ancestor of the Candida, or to several branches independently leading to a polyphyletic alternative yeast codon usage (AYCU). In order to resolve the monophyly or polyphyly of the AYCU, we performed a phylogenomics analysis of 26 motor and cytoskeletal proteins from 60 sequenced yeast species. By investigating the CUG codon positions with respect to sequence conservation at the respective alignment positions, we were able to unambiguously assign the standard code or AYCU. Quantitative analysis of the highly conserved leucine and serine alignment positions showed that 61.1% and 17% of the CUG codons coding for leucine and serine, respectively, are at highly conserved positions, whereas only 0.6% and 2.3% of the CUG codons, respectively, are at positions conserved in the respective other amino acid. Plotting the codon usage onto the phylogenetic tree revealed the polyphyly of the AYCU with Pachysolen tannophilus and the CTG clade branching independently within a time span of 30–100 Ma. PMID:25646540

  12. Sequences Of Amino Acids For Human Serum Albumin

    NASA Technical Reports Server (NTRS)

    Carter, Daniel C.

    1992-01-01

    Sequences of amino acids defined for use in making polypeptides one-third to one-sixth as large as parent human serum albumin molecule. Smaller, chemically stable peptides have diverse applications including service as artificial human serum and as active components of biosensors and chromatographic matrices. In applications involving production of artificial sera from new sequences, little or no concern about viral contaminants. Smaller genetically engineered polypeptides more easily expressed and produced in large quantities, making commercial isolation and production more feasible and profitable.

  13. Genome Sequence of Thermofilum pendens Reveals an Exceptional Loss of Biosynthetic Pathways without Genome Reduction

    SciTech Connect

    Anderson, Iain; Rodriquez, Jason; Susanti, Dwi; Porat, I.; Reich, Claudia; Ulrich, Luke; Elkins, James G; Mavromatis, K; Lykidis, A; Kim, Edwin; Thompson, Linda S; Nolan, Matt; Land, Miriam L; Copeland, A; Lapidus, Alla L.; Lucas, Susan; Detter, J C; Zhulin, Igor B; Olsen, Gary; Whitman, W. B.; Mukhopadhyay, Biswarup; Bristow, James; Kyrpides, Nikos C

    2008-01-01

    We report the complete genome of Thermofilum pendens, a deep-branching member of class Thermoproteales of Crenarchaeota. T. pendens is a sulfur-dependent, anaerobic heterotroph isolated from a solfatara in Iceland. It was known to utilize peptides as an energy source, but the genome reveals substantial ability to grow on carbohydrates. T. pendens is the first Crenarchaeote and only the second archaeon found to have transporters of the phosphotransferase system. T. pendens is known to require an extract of Thermoproteus tenax for growth, and the genome sequence reveals that biosynthetic pathways for purines, most amino acids, and most cofactors are absent. T. pendens has fewer biosynthetic enzymes than any other free-living organism. In addition to heterotrophy, T. pendens may gain energy from sulfur reduction with hydrogen and formate as electron donors. It may also be capable of sulfur-independent growth on formate with formate hydrogenlyase. Additional novel features are the presence of a monomethylamine:corrinoid methyltransferase, the first time this enzyme has been found outside of Methanosarcinales, and a presenilin-related protein from a new subfamily. Predicted highly expressed proteins include ABC transporters for carbohydrates and peptides, and CRISPR-associated proteins, suggesting that defense against viruses is a high priority.

  14. Genome sequence of Thermofilum pendens reveals an exceptional loss of biosynthetic pathways without genome reduction

    SciTech Connect

    Kyrpides, Nikos; Anderson, Iain; Rodriguez, Jason; Susanti, Dwi; Porat, Iris; Reich, Claudia; Ulrich, Luke E.; Elkins, James G.; Mavromatis, Kostas; Lykidis, Athanasios; Kim, Edwin; Thompson, Linda S.; Nolan, Matt; Land, Miriam; Copeland, Alex; Lapidus, Alla; Lucas, Susan; Detter, Chris; Zhulin, Igor B.; Olsen, Gary J.; Whitman, William; Mukhopadhyay, Biswarup; Bristow, James; Kyrpides, Nikos

    2008-01-01

    We report the complete genome of Thermofilum pendens, a deep-branching, hyperthermophilic member of the order Thermoproteales within the archaeal kingdom Crenarchaeota. T. pendens is a sulfur-dependent, anaerobic heterotroph isolated from a solfatara in Iceland. It is an extracellular commensal, requiring an extract of Thermoproteus tenax for growth, and the genome sequence reveals that biosynthetic pathways for purines, most amino acids, and most cofactors are absent. In fact T. pendens has fewer biosynthetic enzymes than obligate intracellular parasites, although it does not display other features common among obligate parasites and thus does not appear to be in the process of becoming a parasite. It appears that T. pendens has adapted to life in an environment rich in nutrients. T. pendens was known to utilize peptides as an energy source, but the genome reveals substantial ability to grow on carbohydrates. T. pendens is the first crenarchaeote and only the second archaeon found to have a transporter of the phosphotransferase system. In addition to fermentation, T. pendens may gain energy from sulfur reduction with hydrogen and formate as electron donors. It may also be capable of sulfur-independent growth on formate with formate hydrogenlyase. Additional novel features are the presence of a monomethylamine:corrinoid methyltransferase, the first time this enzyme has been found outside of Methanosarcinales, and a presenilin-related protein. Predicted highly expressed proteins do not include housekeeping genes, and instead include ABC transporters for carbohydrates and peptides, and CRISPR-associated proteins.

  15. Nucleic acid sequence design via efficient ensemble defect optimization.

    PubMed

    Zadeh, Joseph N; Wolfe, Brian R; Pierce, Niles A

    2011-02-01

    We describe an algorithm for designing the sequence of one or more interacting nucleic acid strands intended to adopt a target secondary structure at equilibrium. Sequence design is formulated as an optimization problem with the goal of reducing the ensemble defect below a user-specified stop condition. For a candidate sequence and a given target secondary structure, the ensemble defect is the average number of incorrectly paired nucleotides at equilibrium evaluated over the ensemble of unpseudoknotted secondary structures. To reduce the computational cost of accepting or rejecting mutations to a random initial sequence, candidate mutations are evaluated on the leaf nodes of a tree-decomposition of the target structure. During leaf optimization, defect-weighted mutation sampling is used to select each candidate mutation position with probability proportional to its contribution to the ensemble defect of the leaf. As subsequences are merged moving up the tree, emergent structural defects resulting from crosstalk between sibling sequences are eliminated via reoptimization within the defective subtree starting from new random subsequences. Using a Θ(N(3) ) dynamic program to evaluate the ensemble defect of a target structure with N nucleotides, this hierarchical approach implies an asymptotic optimality bound on design time: for sufficiently large N, the cost of sequence design is bounded below by 4/3 the cost of a single evaluation of the ensemble defect for the full sequence. Hence, the design algorithm has time complexity Ω(N(3) ). For target structures containing N ∈{100,200,400,800,1600,3200} nucleotides and duplex stems ranging from 1 to 30 base pairs, RNA sequence designs at 37°C typically succeed in satisfying a stop condition with ensemble defect less than N/100. Empirically, the sequence design algorithm exhibits asymptotic optimality and the exponent in the time complexity bound is sharp.

  16. The amino acid sequence of Lady Amherst's pheasant (Chrysolophus amherstiae) and golden pheasant (Chrysolophus pictus) egg-white lysozymes.

    PubMed

    Araki, T; Kuramoto, M; Torikata, T

    1990-09-01

    The amino acids of Lady Amherst's pheasant and golden pheasant egg-white lysozymes have been sequenced. The carboxymethylated lysozymes were digested with trypsin followed by sequencing of the tryptic peptides. Lady Amherst's pheasant lysozyme proved to consist of 129 amino acid residues, and a relative molecular mass of 14,423 Da was calculated. This lysozyme had 6 amino acids substitutions when compared with hen egg-white lysozyme: Phe3 to Tyr, His15 to Leu, Gln41 to His, Asn77 to His, Gln 121 to Asn, and a newly found substitution of Ile124 to Thr. The amino acid sequence of golden pheasant lysozyme was identical to that of Lady Amherst's phesant lysozyme. The phylogenetic tree constructured by the comparison of amino acid sequences of phasianoid birds lysozymes revealed a minimum genetic distance between these pheasants and the turkey-peafowl group.

  17. The amino acid sequence of Lady Amherst's pheasant (Chrysolophus amherstiae) and golden pheasant (Chrysolophus pictus) egg-white lysozymes.

    PubMed

    Araki, T; Kuramoto, M; Torikata, T

    1990-09-01

    The amino acids of Lady Amherst's pheasant and golden pheasant egg-white lysozymes have been sequenced. The carboxymethylated lysozymes were digested with trypsin followed by sequencing of the tryptic peptides. Lady Amherst's pheasant lysozyme proved to consist of 129 amino acid residues, and a relative molecular mass of 14,423 Da was calculated. This lysozyme had 6 amino acids substitutions when compared with hen egg-white lysozyme: Phe3 to Tyr, His15 to Leu, Gln41 to His, Asn77 to His, Gln 121 to Asn, and a newly found substitution of Ile124 to Thr. The amino acid sequence of golden pheasant lysozyme was identical to that of Lady Amherst's phesant lysozyme. The phylogenetic tree constructured by the comparison of amino acid sequences of phasianoid birds lysozymes revealed a minimum genetic distance between these pheasants and the turkey-peafowl group. PMID:1368578

  18. Nanopores and nucleic acids: prospects for ultrarapid sequencing

    NASA Technical Reports Server (NTRS)

    Deamer, D. W.; Akeson, M.

    2000-01-01

    DNA and RNA molecules can be detected as they are driven through a nanopore by an applied electric field at rates ranging from several hundred microseconds to a few milliseconds per molecule. The nanopore can rapidly discriminate between pyrimidine and purine segments along a single-stranded nucleic acid molecule. Nanopore detection and characterization of single molecules represents a new method for directly reading information encoded in linear polymers. If single-nucleotide resolution can be achieved, it is possible that nucleic acid sequences can be determined at rates exceeding a thousand bases per second.

  19. In silico comparative analysis of DNA and amino acid sequences for prion protein gene.

    PubMed

    Kim, Y; Lee, J; Lee, C

    2008-01-01

    Genetic variability might contribute to species specificity of prion diseases in various organisms. In this study, structures of the prion protein gene (PRNP) and its amino acids were compared among species of which sequence data were available. Comparisons of PRNP DNA sequences among 12 species including human, chimpanzee, monkey, bovine, ovine, dog, mouse, rat, wallaby, opossum, chicken and zebrafish allowed us to identify candidate regulatory regions in intron 1 and 3'-untranslated region (UTR) in addition to the coding region. Highly conserved putative binding sites for transcription factors, such as heat shock factor 2 (HSF2) and myocite enhancer factor 2 (MEF2), were discovered in the intron 1. In 3'-UTR, the functional sequence (ATTAAA) for nucleus-specific polyadenylation was found in all the analysed species. The functional sequence (TTTTTAT) for maturation-specific polyadenylation was identically observed only in ovine, and one or two nucleotide mismatches in the other species. A comparison of the amino acid sequences in 53 species revealed a large sequence identity. Especially the octapeptide repeat region was observed in all the species but frog and zebrafish. Functional changes and susceptibility to prion diseases with various isoforms of prion protein could be caused by numeric variability and conformational changes discovered in the repeat sequences.

  20. Ontogeny of hepatic energy metabolism genes in mice as revealed by RNA-sequencing.

    PubMed

    Renaud, Helen J; Cui, Yue Julia; Lu, Hong; Zhong, Xiao-bo; Klaassen, Curtis D

    2014-01-01

    The liver plays a central role in metabolic homeostasis by coordinating synthesis, storage, breakdown, and redistribution of nutrients. Hepatic energy metabolism is dynamically regulated throughout different life stages due to different demands for energy during growth and development. However, changes in gene expression patterns throughout ontogeny for factors important in hepatic energy metabolism are not well understood. We performed detailed transcript analysis of energy metabolism genes during various stages of liver development in mice. Livers from male C57BL/6J mice were collected at twelve ages, including perinatal and postnatal time points (n = 3/age). The mRNA was quantified by RNA-Sequencing, with transcript abundance estimated by Cufflinks. One thousand sixty energy metabolism genes were examined; 794 were above detection, of which 627 were significantly changed during at least one developmental age compared to adult liver. Two-way hierarchical clustering revealed three major clusters dependent on age: GD17.5-Day 5 (perinatal-enriched), Day 10-Day 20 (pre-weaning-enriched), and Day 25-Day 60 (adolescence/adulthood-enriched). Clustering analysis of cumulative mRNA expression values for individual pathways of energy metabolism revealed three patterns of enrichment: glycolysis, ketogenesis, and glycogenesis were all perinatally-enriched; glycogenolysis was the only pathway enriched during pre-weaning ages; whereas lipid droplet metabolism, cholesterol and bile acid metabolism, gluconeogenesis, and lipid metabolism were all enriched in adolescence/adulthood. This study reveals novel findings such as the divergent expression of the fatty acid β-oxidation enzymes Acyl-CoA oxidase 1 and Carnitine palmitoyltransferase 1a, indicating a switch from mitochondrial to peroxisomal β-oxidation after weaning; as well as the dynamic ontogeny of genes implicated in obesity such as Stearoyl-CoA desaturase 1 and Elongation of very long chain fatty acids-like 3. These

  1. Ontogeny of Hepatic Energy Metabolism Genes in Mice as Revealed by RNA-Sequencing

    PubMed Central

    Renaud, Helen J.; Cui, Yue Julia; Lu, Hong; Zhong, Xiao-bo; Klaassen, Curtis D.

    2014-01-01

    The liver plays a central role in metabolic homeostasis by coordinating synthesis, storage, breakdown, and redistribution of nutrients. Hepatic energy metabolism is dynamically regulated throughout different life stages due to different demands for energy during growth and development. However, changes in gene expression patterns throughout ontogeny for factors important in hepatic energy metabolism are not well understood. We performed detailed transcript analysis of energy metabolism genes during various stages of liver development in mice. Livers from male C57BL/6J mice were collected at twelve ages, including perinatal and postnatal time points (n = 3/age). The mRNA was quantified by RNA-Sequencing, with transcript abundance estimated by Cufflinks. One thousand sixty energy metabolism genes were examined; 794 were above detection, of which 627 were significantly changed during at least one developmental age compared to adult liver. Two-way hierarchical clustering revealed three major clusters dependent on age: GD17.5–Day 5 (perinatal-enriched), Day 10–Day 20 (pre-weaning-enriched), and Day 25–Day 60 (adolescence/adulthood-enriched). Clustering analysis of cumulative mRNA expression values for individual pathways of energy metabolism revealed three patterns of enrichment: glycolysis, ketogenesis, and glycogenesis were all perinatally-enriched; glycogenolysis was the only pathway enriched during pre-weaning ages; whereas lipid droplet metabolism, cholesterol and bile acid metabolism, gluconeogenesis, and lipid metabolism were all enriched in adolescence/adulthood. This study reveals novel findings such as the divergent expression of the fatty acid β-oxidation enzymes Acyl-CoA oxidase 1 and Carnitine palmitoyltransferase 1a, indicating a switch from mitochondrial to peroxisomal β-oxidation after weaning; as well as the dynamic ontogeny of genes implicated in obesity such as Stearoyl-CoA desaturase 1 and Elongation of very long chain fatty acids-like 3

  2. The amino acid sequence of Escherichia coli cyanase.

    PubMed

    Chin, C C; Anderson, P M; Wold, F

    1983-01-10

    The amino acid sequence of the enzyme cyanase (cyanate hydrolase) from Escherichia coli has been determined by automatic Edman degradation of the intact protein and of its component peptides. The primary peptides used in the sequencing were produced by cyanogen bromide cleavage at the methionine residues, yielding 4 peptides plus free homoserine from the NH2-terminal methionine, and by trypsin cleavage at the 7 arginine residues after acetylation of the lysines. Secondary peptides required for overlaps and COOH-terminal sequences were produced by chymotrypsin or clostripain cleavage of some of the larger peptides. The complete sequence of the cyanase subunit consists of 156 amino acid residues (Mr 16,350). Based on the observation that the cysteine-containing peptide is obtained as a disulfide-linked dimer, it is proposed that the covalent structure of cyanase is made up of two subunits linked by a disulfide bond between the single cystine residue in each subunit. The native enzyme (Mr 150,000) then appears to be a complex of four or five such subunit dimers.

  3. Quantum-Sequencing: Biophysics of quantum tunneling through nucleic acids

    NASA Astrophysics Data System (ADS)

    Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant

    2014-03-01

    Tunneling microscopy and spectroscopy has extensively been used in physical surface sciences to study quantum tunneling to measure electronic local density of states of nanomaterials and to characterize adsorbed species. Quantum-Sequencing (Q-Seq) is a new method based on tunneling microscopy for electronic sequencing of single molecule of nucleic acids. A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free single-molecule sequencing method. Here, we present the unique ``electronic fingerprints'' for all nucleotides on DNA and RNA using Q-Seq along their intrinsic biophysical parameters. We have analyzed tunneling spectra for the nucleotides at different pH conditions and analyzed the HOMO, LUMO and energy gap for all of them. In addition we show a number of biophysical parameters to further characterize all nucleobases (electron and hole transition voltage and energy barriers). These results highlight the robustness of Q-Seq as a technique for next-generation sequencing.

  4. Directed evolution reveals requisite sequence elements in the functional expression of P450 2F1 in Escherichia coli.

    PubMed

    Behrendorff, James B Y H; Moore, Chad D; Kim, Keon-Hee; Kim, Dae-Hwan; Smith, Christopher A; Johnston, Wayne A; Yun, Chul-Ho; Yost, Garold S; Gillam, Elizabeth M J

    2012-09-17

    Cytochrome P450 2F1 (P450 2F1) is expressed exclusively in the human respiratory tract and is implicated in 3-methylindole (3MI)-induced pneumotoxicity via dehydrogenation of 3MI to a reactive electrophilic intermediate, 3-methyleneindolenine (3-MEI). Studies of P450 2F1 to date have been limited by the failure to express this enzyme in Escherichia coli. By contrast, P450 2F3, a caprine homologue that shares 84% sequence identity with P450 2F1 (86 amino acid differences), has been expressed in E. coli at yields greater than 250 nmol/L culture. We hypothesized that a limited number of sequence differences between P450s 2F1 and 2F3 could limit P450 2F1 expression in E. coli and that problematic P450 2F1 sequence elements could be identified by directed evolution. A library of P450 2F1/2F3 mutants was created by DNA family shuffling and screened for expression in E. coli. Three generations of DNA shuffling revealed a mutant (named JH_2F_F3_1_007) with 96.5% nucleotide sequence identity to P450 2F1 and which expressed 119 ± 40 pmol (n = 3, mean ± SD) hemoprotein in 1 mL microaerobic cultures. Across all three generations, two regions were observed where P450 2F3-derived sequence was consistently substituted for P450 2F1 sequence in expressing mutants, encoding nine amino acid differences between P450s 2F1 and 2F3: nucleotides 191-278 (amino acids 65-92) and 794-924 (amino acids 265-305). Chimeras constructed to specifically test the importance of these two regions confirmed that P450 2F3 sequence is essential in both regions for expression in E. coli but that other non-P450 2F1 sequence elements outside of these regions also improved the expression of mutant JH_2F_F3_1_007. Mutant JH_2F_F3_1_007 catalyzed the dehydrogenation of 3MI to 3-MEI as indicated by the observation of glutathione adducts after incubation in the presence of glutathione. The JH_2F_F3_1_007 protein differs from P450 2F1 at only 20 amino acids and should facilitate further studies of the structure

  5. Comment on "Protein sequences from mastodon and Tyrannosaurus rex revealed by mass spectrometry".

    PubMed

    Buckley, Mike; Walker, Angela; Ho, Simon Y W; Yang, Yue; Smith, Colin; Ashton, Peter; Oates, Jane Thomas; Cappellini, Enrico; Koon, Hannah; Penkman, Kirsty; Elsworth, Ben; Ashford, Dave; Solazzo, Caroline; Andrews, Phillip; Strahler, John; Shapiro, Beth; Ostrom, Peggy; Gandhi, Hasand; Miller, Webb; Raney, Brian; Zylber, Maria Ines; Gilbert, M Thomas P; Prigodich, Richard V; Ryan, Michael; Rijsdijk, Kenneth F; Janoo, Anwar; Collins, Matthew J

    2008-01-01

    We used authentication tests developed for ancient DNA to evaluate claims by Asara et al. (Reports, 13 April 2007, p. 280) of collagen peptide sequences recovered from mastodon and Tyrannosaurus rex fossils. Although the mastodon samples pass these tests, absence of amino acid composition data, lack of evidence for peptide deamidation, and association of alpha1(I) collagen sequences with amphibians rather than birds suggest that T. rex does not.

  6. Evolution of an Enzyme from a Noncatalytic Nucleic Acid Sequence.

    PubMed

    Gysbers, Rachel; Tram, Kha; Gu, Jimmy; Li, Yingfu

    2015-01-01

    The mechanism by which enzymes arose from both abiotic and biological worlds remains an unsolved natural mystery. We postulate that an enzyme can emerge from any sequence of any functional polymer under permissive evolutionary conditions. To support this premise, we have arbitrarily chosen a 50-nucleotide DNA fragment encoding for the Bos taurus (cattle) albumin mRNA and subjected it to test-tube evolution to derive a catalytic DNA (DNAzyme) with RNA-cleavage activity. After only a few weeks, a DNAzyme with significant catalytic activity has surfaced. Sequence comparison reveals that seven nucleotides are responsible for the conversion of the noncatalytic sequence into the enzyme. Deep sequencing analysis of DNA pools along the evolution trajectory has identified individual mutations as the progressive drivers of the molecular evolution. Our findings demonstrate that an enzyme can indeed arise from a sequence of a functional polymer via permissive molecular evolution, a mechanism that may have been exploited by nature for the creation of the enormous repertoire of enzymes in the biological world today. PMID:26091540

  7. Nucleic acid sequence detection using multiplexed oligonucleotide PCR

    SciTech Connect

    Nolan, John P.; White, P. Scott

    2006-12-26

    Methods for rapidly detecting single or multiple sequence alleles in a sample nucleic acid are described. Provided are all of the oligonucleotide pairs capable of annealing specifically to a target allele and discriminating among possible sequences thereof, and ligating to each other to form an oligonucleotide complex when a particular sequence feature is present (or, alternatively, absent) in the sample nucleic acid. The design of each oligonucleotide pair permits the subsequent high-level PCR amplification of a specific amplicon when the oligonucleotide complex is formed, but not when the oligonucleotide complex is not formed. The presence or absence of the specific amplicon is used to detect the allele. Detection of the specific amplicon may be achieved using a variety of methods well known in the art, including without limitation, oligonucleotide capture onto DNA chips or microarrays, oligonucleotide capture onto beads or microspheres, electrophoresis, and mass spectrometry. Various labels and address-capture tags may be employed in the amplicon detection step of multiplexed assays, as further described herein.

  8. Molecular cloning and amino acid sequence of human 5-lipoxygenase

    SciTech Connect

    Matsumoto, T.; Funk, C.D.; Radmark, O.; Hoeoeg, J.O.; Joernvall, H.; Samuelsson, B.

    1988-01-01

    5-Lipoxygenase (EC 1.13.11.34), a Ca/sup 2 +/- and ATP-requiring enzyme, catalyzes the first two steps in the biosynthesis of the peptidoleukotrienes and the chemotactic factor leukotriene B/sub 4/. A cDNA clone corresponding to 5-lipoxygenase was isolated from a human lung lambda gt11 expression library by immunoscreening with a polyclonal antibody. Additional clones from a human placenta lambda gt11 cDNA library were obtained by plaque hybridization with the /sup 32/P-labeled lung cDNA clone. Sequence data obtained from several overlapping clones indicate that the composite DNAs contain the complete coding region for the enzyme. From the deduced primary structure, 5-lipoxygenase encodes a 673 amino acid protein with a calculated molecular weight of 77,839. Direct analysis of the native protein and its proteolytic fragments confirmed the deduced composition, the amino-terminal amino acid sequence, and the structure of many internal segments. 5-Lipoxygenase has no apparent sequence homology with leukotriene A/sub 4/ hydrolase or Ca/sup 2 +/-binding proteins. RNA blot analysis indicated substantial amounts of an mRNA species of approx. = 2700 nucleotides in leukocytes, lung, and placenta.

  9. Characterization and amino acid sequence of a fatty acid-binding protein from human heart.

    PubMed Central

    Offner, G D; Brecher, P; Sawlivich, W B; Costello, C E; Troxler, R F

    1988-01-01

    The complete amino acid sequence of a fatty acid-binding protein from human heart was determined by automated Edman degradation of CNBr, BNPS-skatole [3'-bromo-3-methyl-2-(2-nitrobenzenesulphenyl)indolenine], hydroxylamine, Staphylococcus aureus V8 proteinase, tryptic and chymotryptic peptides, and by digestion of the protein with carboxypeptidase A. The sequence of the blocked N-terminal tryptic peptide from citraconylated protein was determined by collisionally induced decomposition mass spectrometry. The protein contains 132 amino acid residues, is enriched with respect to threonine and lysine, lacks cysteine, has an acetylated valine residue at the N-terminus, and has an Mr of 14768 and an isoelectric point of 5.25. This protein contains two short internal repeated sequences from residues 48-54 and from residues 114-119 located within regions of predicted beta-structure and decreasing hydrophobicity. These short repeats are contained within two longer repeated regions from residues 48-60 and residues 114-125, which display 62% sequence similarity. These regions could accommodate the charged and uncharged moieties of long-chain fatty acids and may represent fatty acid-binding domains consistent with the finding that human heart fatty acid-binding protein binds 2 mol of oleate or palmitate/mol of protein. Detailed evidence for the amino acid sequences of the peptides has been deposited as Supplementary Publication SUP 50143 (23 pages) at the British Library Lending Division, Boston Spa, Yorkshire LS23 7BQ, U.K., from whom copies may be obtained as indicated in Biochem. J. (1988) 249, 5. PMID:3421901

  10. Deep sequencing reveals microbiota dysbiosis of tongue coat in patients with liver carcinoma.

    PubMed

    Lu, Haifeng; Ren, Zhigang; Li, Ang; Zhang, Hua; Jiang, Jianwen; Xu, Shaoyan; Luo, Qixia; Zhou, Kai; Sun, Xiaoli; Zheng, Shusen; Li, Lanjuan

    2016-01-01

    Liver carcinoma (LC) is a common malignancy worldwide, associated with high morbidity and mortality. Characterizing microbiome profiles of tongue coat may provide useful insights and potential diagnostic marker for LC patients. Herein, we are the first time to investigate tongue coat microbiome of LC patients with cirrhosis based on 16S ribosomal RNA (rRNA) gene sequencing. After strict inclusion and exclusion criteria, 35 early LC patients with cirrhosis and 25 matched healthy subjects were enrolled. Microbiome diversity of tongue coat in LC patients was significantly increased shown by Shannon, Simpson and Chao 1 indexes. Microbiome on tongue coat was significantly distinguished LC patients from healthy subjects by principal component analysis. Tongue coat microbial profiles represented 38 operational taxonomic units assigned to 23 different genera, distinguishing LC patients. Linear discriminant analysis (LDA) effect size (LEfSe) reveals significant microbial dysbiosis of tongue coats in LC patients. Strikingly, Oribacterium and Fusobacterium could distinguish LC patients from healthy subjects. LEfSe outputs show microbial gene functions related to categories of nickel/iron_transport, amino_acid_transport, energy produced system and metabolism between LC patients and healthy subjects. These findings firstly identify microbiota dysbiosis of tongue coat in LC patients, may providing novel and non-invasive potential diagnostic biomarker of LC. PMID:27605161

  11. Deep sequencing reveals microbiota dysbiosis of tongue coat in patients with liver carcinoma

    PubMed Central

    Lu, Haifeng; Ren, Zhigang; Li, Ang; Zhang, Hua; Jiang, Jianwen; Xu, Shaoyan; Luo, Qixia; Zhou, Kai; Sun, Xiaoli; Zheng, Shusen; Li, Lanjuan

    2016-01-01

    Liver carcinoma (LC) is a common malignancy worldwide, associated with high morbidity and mortality. Characterizing microbiome profiles of tongue coat may provide useful insights and potential diagnostic marker for LC patients. Herein, we are the first time to investigate tongue coat microbiome of LC patients with cirrhosis based on 16S ribosomal RNA (rRNA) gene sequencing. After strict inclusion and exclusion criteria, 35 early LC patients with cirrhosis and 25 matched healthy subjects were enrolled. Microbiome diversity of tongue coat in LC patients was significantly increased shown by Shannon, Simpson and Chao 1 indexes. Microbiome on tongue coat was significantly distinguished LC patients from healthy subjects by principal component analysis. Tongue coat microbial profiles represented 38 operational taxonomic units assigned to 23 different genera, distinguishing LC patients. Linear discriminant analysis (LDA) effect size (LEfSe) reveals significant microbial dysbiosis of tongue coats in LC patients. Strikingly, Oribacterium and Fusobacterium could distinguish LC patients from healthy subjects. LEfSe outputs show microbial gene functions related to categories of nickel/iron_transport, amino_acid_transport, energy produced system and metabolism between LC patients and healthy subjects. These findings firstly identify microbiota dysbiosis of tongue coat in LC patients, may providing novel and non-invasive potential diagnostic biomarker of LC. PMID:27605161

  12. Metagenomic sequencing reveals the relationship between microbiota composition and quality of Chinese Rice Wine.

    PubMed

    Hong, Xutao; Chen, Jing; Liu, Lin; Wu, Huan; Tan, Haiqin; Xie, Guangfa; Xu, Qian; Zou, Huijun; Yu, Wenjing; Wang, Lan; Qin, Nan

    2016-01-01

    Chinese Rice Wine (CRW) is a common alcoholic beverage in China. To investigate the influence of microbial composition on the quality of CRW, high throughput sequencing was performed for 110 wine samples on bacterial 16S rRNA gene and fungal Internal Transcribed Spacer II (ITS2). Bioinformatic analyses demonstrated that the quality of yeast starter and final wine correlated with microbial taxonomic composition, which was exemplified by our finding that wine spoilage resulted from a high proportion of genus Lactobacillus. Subsequently, based on Lactobacillus abundance of an early stage, a model was constructed to predict final wine quality. In addition, three batches of 20 representative wine samples selected from a pool of 110 samples were further analyzed in metagenomics. The results revealed that wine spoilage was due to rapid growth of Lactobacillus brevis at the early stage of fermentation. Gene functional analysis indicated the importance of some pathways such as synthesis of biotin, malolactic fermentation and production of short-chain fatty acid. These results led to a conclusion that metabolisms of microbes influence the wine quality. Thus, nurturing of beneficial microbes and inhibition of undesired ones are both important for the mechanized brewery. PMID:27241862

  13. Metagenomic sequencing reveals the relationship between microbiota composition and quality of Chinese Rice Wine

    PubMed Central

    Hong, Xutao; Chen, Jing; Liu, Lin; Wu, Huan; Tan, Haiqin; Xie, Guangfa; Xu, Qian; Zou, Huijun; Yu, Wenjing; Wang, Lan; Qin, Nan

    2016-01-01

    Chinese Rice Wine (CRW) is a common alcoholic beverage in China. To investigate the influence of microbial composition on the quality of CRW, high throughput sequencing was performed for 110 wine samples on bacterial 16S rRNA gene and fungal Internal Transcribed Spacer II (ITS2). Bioinformatic analyses demonstrated that the quality of yeast starter and final wine correlated with microbial taxonomic composition, which was exemplified by our finding that wine spoilage resulted from a high proportion of genus Lactobacillus. Subsequently, based on Lactobacillus abundance of an early stage, a model was constructed to predict final wine quality. In addition, three batches of 20 representative wine samples selected from a pool of 110 samples were further analyzed in metagenomics. The results revealed that wine spoilage was due to rapid growth of Lactobacillus brevis at the early stage of fermentation. Gene functional analysis indicated the importance of some pathways such as synthesis of biotin, malolactic fermentation and production of short-chain fatty acid. These results led to a conclusion that metabolisms of microbes influence the wine quality. Thus, nurturing of beneficial microbes and inhibition of undesired ones are both important for the mechanized brewery. PMID:27241862

  14. Deep sequencing reveals microbiota dysbiosis of tongue coat in patients with liver carcinoma.

    PubMed

    Lu, Haifeng; Ren, Zhigang; Li, Ang; Zhang, Hua; Jiang, Jianwen; Xu, Shaoyan; Luo, Qixia; Zhou, Kai; Sun, Xiaoli; Zheng, Shusen; Li, Lanjuan

    2016-01-01

    Liver carcinoma (LC) is a common malignancy worldwide, associated with high morbidity and mortality. Characterizing microbiome profiles of tongue coat may provide useful insights and potential diagnostic marker for LC patients. Herein, we are the first time to investigate tongue coat microbiome of LC patients with cirrhosis based on 16S ribosomal RNA (rRNA) gene sequencing. After strict inclusion and exclusion criteria, 35 early LC patients with cirrhosis and 25 matched healthy subjects were enrolled. Microbiome diversity of tongue coat in LC patients was significantly increased shown by Shannon, Simpson and Chao 1 indexes. Microbiome on tongue coat was significantly distinguished LC patients from healthy subjects by principal component analysis. Tongue coat microbial profiles represented 38 operational taxonomic units assigned to 23 different genera, distinguishing LC patients. Linear discriminant analysis (LDA) effect size (LEfSe) reveals significant microbial dysbiosis of tongue coats in LC patients. Strikingly, Oribacterium and Fusobacterium could distinguish LC patients from healthy subjects. LEfSe outputs show microbial gene functions related to categories of nickel/iron_transport, amino_acid_transport, energy produced system and metabolism between LC patients and healthy subjects. These findings firstly identify microbiota dysbiosis of tongue coat in LC patients, may providing novel and non-invasive potential diagnostic biomarker of LC.

  15. New approaches for computer analysis of nucleic acid sequences.

    PubMed

    Karlin, S; Ghandour, G; Ost, F; Tavare, S; Korn, L J

    1983-09-01

    A new high-speed computer algorithm is outlined that ascertains within and between nucleic acid and protein sequences all direct repeats, dyad symmetries, and other structural relationships. Large repeats, repeats of high frequency, dyad symmetries of specified stem length and loop distance, and their distributions are determined. Significance of homologies is assessed by a hierarchy of permutation procedures. Applications are made to papovaviruses, the human papillomavirus HPV, lambda phage, the human and mouse mitochondrial genomes, and the human and mouse immunoglobulin kappa-chain genes. PMID:6577449

  16. Deep sequencing reveals global patterns of mRNA recruitment during translation initiation

    PubMed Central

    Gao, Rong; Yu, Kai; Nie, Jukui; Lian, Tengfei; Jin, Jianshi; Liljas, Anders; Su, Xiao-Dong

    2016-01-01

    In this work, we developed a method to systematically study the sequence preference of mRNAs during translation initiation. Traditionally, the dynamic process of translation initiation has been studied at the single molecule level with limited sequencing possibility. Using deep sequencing techniques, we identified the sequence preference at different stages of the initiation complexes. Our results provide a comprehensive and dynamic view of the initiation elements in the translation initiation region (TIR), including the S1 binding sequence, the Shine-Dalgarno (SD)/anti-SD interaction and the second codon, at the equilibrium of different initiation complexes. Moreover, our experiments reveal the conformational changes and regional dynamics throughout the dynamic process of mRNA recruitment. PMID:27460773

  17. Deep sequencing reveals global patterns of mRNA recruitment during translation initiation.

    PubMed

    Gao, Rong; Yu, Kai; Nie, Jukui; Lian, Tengfei; Jin, Jianshi; Liljas, Anders; Su, Xiao-Dong

    2016-07-27

    In this work, we developed a method to systematically study the sequence preference of mRNAs during translation initiation. Traditionally, the dynamic process of translation initiation has been studied at the single molecule level with limited sequencing possibility. Using deep sequencing techniques, we identified the sequence preference at different stages of the initiation complexes. Our results provide a comprehensive and dynamic view of the initiation elements in the translation initiation region (TIR), including the S1 binding sequence, the Shine-Dalgarno (SD)/anti-SD interaction and the second codon, at the equilibrium of different initiation complexes. Moreover, our experiments reveal the conformational changes and regional dynamics throughout the dynamic process of mRNA recruitment.

  18. High-throughput sequence analysis reveals structural diversity and improved potency among RNA inhibitors of HIV reverse transcriptase

    PubMed Central

    Ditzler, Mark A.; Lange, Margaret J.; Bose, Debojit; Bottoms, Christopher A.; Virkler, Katherine F.; Sawyer, Andrew W.; Whatley, Angela S.; Spollen, William; Givan, Scott A.; Burke, Donald H.

    2013-01-01

    Systematic evolution of ligands through exponential enrichment (SELEX) is a well-established method for generating nucleic acid populations that are enriched for specified functions. High-throughput sequencing (HTS) enhances the power of comparative sequence analysis to reveal details of how RNAs within these populations recognize their targets. We used HTS analysis to evaluate RNA populations selected to bind type I human immunodeficiency virus reverse transcriptase (RT). The populations are enriched in RNAs of independent lineages that converge on shared motifs and in clusters of RNAs with nearly identical sequences that share common ancestry. Both of these features informed inferences of the secondary structures of enriched RNAs, their minimal structural requirements and their stabilities in RT-aptamer complexes. Monitoring population dynamics in response to increasing selection pressure revealed RNA inhibitors of RT that are more potent than the previously identified pseudoknots. Improved potency was observed for inhibition of both purified RT in enzymatic assays and viral replication in cell-based assays. Structural and functional details of converged motifs that are obscured by simple consensus descriptions are also revealed by the HTS analysis. The approach presented here can readily be generalized for the efficient and systematic post-SELEX development of aptamers for down-stream applications. PMID:23241386

  19. Spectral-Statistical Approach for Revealing Latent Regular Structures in DNA Sequence.

    PubMed

    Chaley, Maria; Kutyrkin, Vladimir

    2016-01-01

    Methods of the spectral-statistical approach (2S-approach) for revealing latent periodicity in DNA sequences are described. The results of data analysis in the HeteroGenome database which collects the sequences similar to approximate tandem repeats in the genomes of model organisms are adduced. In consequence of further developing of the spectral-statistical approach, the techniques for recognizing latent profile periodicity are considered. These techniques are basing on extension of the notion of approximate tandem repeat. Examples of correlation of latent profile periodicity revealed in the CDSs with structural-functional properties in the proteins are given.

  20. Amino acid sequences of lower vertebrate parvalbumins and their evolution: parvalbumins of boa, turtle, and salamander.

    PubMed

    Maeda, N; Zhu, D X; Fitch, W M

    1984-11-01

    One major parvalbumin each was isolated from the skeletal muscle of two reptiles, a boa snake, Boa constrictor, and a map turtle, Graptemys geographica, while two parvalbumins were isolated from an amphibian, the salamander Amphiuma means. The amino acid sequences of all four parvalbumins were determined from the sequences of their tryptic peptides, which were ordered partially by homology to other parvalbumins. Phylogenetic study of these and 16 other parvalbumin sequences revealed that the turtle parvalbumin belongs to beta lineage, while the salamander sequences belong, one each, to the alpha and beta lineages defined by Goodman and Pechère (1977). Boa parvalbumin, however, while belonging to the beta lineage, clusters within the fish in all reasonably parsimonious trees. The most parsimonious trees show many parallel or back mutations in the evolution of many parvalbumin residues, although the residues responsible for Ca2+ binding are very well conserved. These most parsimonious trees show an actinopterygian rather than a crossoptyrigian origin of the tetrapods in both the alpha and beta groups. One of two electric eel parvalbumins is evolving more than 10 times faster than its paralogous partner, suggesting it may be on its way to becoming a pseudogene. It is concluded that varying rates of amino acid replacement, much homoplasy, considerable gene duplication, plus complicated lineages make the set of parvalbumin sequences unsuitable for systematic study of the origin of the tetrapods and other higher-taxa divergence, although it may be suitable within a genus or family.

  1. Comparisons of the Distribution of Nucleotides and Common Sequences in Deoxyribonucleic Acid from Selected Bacteriophages

    PubMed Central

    Skalka, A.; Hanson, P.

    1972-01-01

    Results from comparisons of deoxyribonucleic acid (DNA) from several classes of bacteriophages suggest that most phage chromosomes contain either a homogeneous distribution of nucleotides or are made up of a few, rather large segments of different quanine plus cytosine (G + C) contents which are internally homogeneous. Among those temperate phages tested, most contained segmented DNA. Comparisons of sequence similarities among segments from lambdoid phage DNA species revealed the following order in relatedness to λ: 82 (and 434) > 21 > 424 > φ80. Most common sequences are found in the highest G + C segments, which in λ contain head and tail genes. Hybridization tests with λ and 186 or P2 DNA species verified that the lambdoids and 186 and P2 belong to two distinct groups. There are fewer homologous sequences between the DNA species of coliphages λ and P2 or 186 than there are between the DNA species of coliphage λ and salmonella phage P22. PMID:4553679

  2. Multilocus Sequence Typing of Genital Chlamydia trachomatis in Norway Reveals Multiple New Sequence Types and a Large Genetic Diversity

    PubMed Central

    Gravningen, Kirsten; Christerson, Linus; Furberg, Anne-Sofie; Simonsen, Gunnar Skov; Ödman, Kristina; Ståhlsten, Anna; Herrmann, Björn

    2012-01-01

    Background The Chlamydia trachomatis incidence rate in Finnmark, the most northern and sparsely populated county in Norway, has been twice the national average. This population based cross-sectional study among Finnmark high school students had the following aims: i) to examine distribution of multilocus sequence types (STs) of C. trachomatis in a previously unmapped area, ii) to compare chlamydia genetic diversity in Finnmark with that of two urban regions, and iii) to compare discriminatory capacity of multilocus sequence typing (MLST) with conventional ompA sequencing in a large number of chlamydia specimens. Methodology ompA sequencing and a high-resolution MLST system based on PCR amplification and DNA sequencing of five highly variable genetic regions were used. Eighty chlamydia specimens from adolescents aged 15–20 years in Finnmark were collected in five high schools (n = 60) and from routine clinical samples in the laboratory (n = 20). These were compared to routine clinical samples from adolescents in Tromsø (n = 80) and Trondheim (n = 88), capitals of North and Central Norway, respectively. Principal Findings ompA sequencing detected 11 genotypes in 248 specimens from all three areas. MLST displayed 50 STs providing a five-fold higher resolution. Two-thirds of all STs were novel. The common ompA E/Bour genotype comprised 46% and resolved into 24 different STs. MLST identified the Swedish new variant of C. trachomatis not discriminated by ompA sequencing. Simpson's discriminatory index (D) was 0.93 for MLST, while a corrected Dc was 0.97. There were no statistically significant differences in ST genetic diversity between geographic areas. Finnmark had an atypical genovar distribution with G being predominant. This was mainly due to expansion of specific STs of which the novel ST161 was unique for Finnmark. Conclusions/Significance MLST revealed multiple new STs and a larger genetic diversity in comparison to ompA sequencing and proved

  3. [Partial sequence homology of FtsZ in phylogenetics analysis of lactic acid bacteria].

    PubMed

    Zhang, Bin; Dong, Xiu-zhu

    2005-10-01

    FtsZ is a structurally conserved protein, which is universal among the prokaryotes. It plays a key role in prokaryote cell division. A partial fragment of the ftsZ gene about 800bp in length was amplified and sequenced and a partial FtsZ protein phylogenetic tree for the lactic acid bacteria was constructed. By comparing the FtsZ phylogenetic tree with the 16S rDNA tree, it was shown that the two trees were similar in topology. Both trees revealed that Pediococcus spp. were closely related with L. casei group of Lactobacillus spp. , but less related with other lactic acid cocci such as Enterococcus and Streptococcus. The results also showed that the discriminative power of FtsZ was higher than that of 16S rDNA for either inter-species or inter-genus and could be a very useful tool in species identification of lactic acid bacteria. PMID:16342751

  4. The Complete Genome Sequence of the Lactic Acid Bacterium Lactococcus lactis ssp. lactis IL1403

    PubMed Central

    Bolotin, Alexander; Wincker, Patrick; Mauger, Stéphane; Jaillon, Olivier; Malarme, Karine; Weissenbach, Jean; Ehrlich, S. Dusko; Sorokin, Alexei

    2001-01-01

    Lactococcus lactis is a nonpathogenic AT-rich gram-positive bacterium closely related to the genus Streptococcus and is the most commonly used cheese starter. It is also the best-characterized lactic acid bacterium. We sequenced the genome of the laboratory strain IL1403, using a novel two-step strategy that comprises diagnostic sequencing of the entire genome and a shotgun polishing step. The genome contains 2,365,589 base pairs and encodes 2310 proteins, including 293 protein-coding genes belonging to six prophages and 43 insertion sequence (IS) elements. Nonrandom distribution of IS elements indicates that the chromosome of the sequenced strain may be a product of recent recombination between two closely related genomes. A complete set of late competence genes is present, indicating the ability of L. lactis to undergo DNA transformation. Genomic sequence revealed new possibilities for fermentation pathways and for aerobic respiration. It also indicated a horizontal transfer of genetic information from Lactococcus to gram-negative enteric bacteria of Salmonella-Escherichia group. [The sequence data described in this paper has been submitted to the GenBank data library under accession no. AE005176.] PMID:11337471

  5. Molecular indexing enables quantitative targeted RNA sequencing and reveals poor efficiencies in standard library preparations.

    PubMed

    Fu, Glenn K; Xu, Weihong; Wilhelmy, Julie; Mindrinos, Michael N; Davis, Ronald W; Xiao, Wenzhong; Fodor, Stephen P A

    2014-02-01

    We present a simple molecular indexing method for quantitative targeted RNA sequencing, in which mRNAs of interest are selectively captured from complex cDNA libraries and sequenced to determine their absolute concentrations. cDNA fragments are individually labeled so that each molecule can be tracked from the original sample through the library preparation and sequencing process. Multiple copies of cDNA fragments of identical sequence become distinct through labeling, and replicate clones created during PCR amplification steps can be identified and assigned to their distinct parent molecules. Selective capture enables efficient use of sequencing for deep sampling and for the absolute quantitation of rare or transient transcripts that would otherwise escape detection by standard sequencing methods. We have also constructed a set of synthetic barcoded RNA molecules, which can be introduced as controls into the sample preparation mix and used to monitor the efficiency of library construction. The quantitative targeted sequencing revealed extremely low efficiency in standard library preparations, which were further confirmed by using synthetic barcoded RNA molecules. This finding shows that standard library preparation methods result in the loss of rare transcripts and highlights the need for monitoring library efficiency and for developing more efficient sample preparation methods.

  6. Molecular indexing enables quantitative targeted RNA sequencing and reveals poor efficiencies in standard library preparations

    PubMed Central

    Fu, Glenn K.; Xu, Weihong; Wilhelmy, Julie; Mindrinos, Michael N.; Davis, Ronald W.; Xiao, Wenzhong; Fodor, Stephen P. A.

    2014-01-01

    We present a simple molecular indexing method for quantitative targeted RNA sequencing, in which mRNAs of interest are selectively captured from complex cDNA libraries and sequenced to determine their absolute concentrations. cDNA fragments are individually labeled so that each molecule can be tracked from the original sample through the library preparation and sequencing process. Multiple copies of cDNA fragments of identical sequence become distinct through labeling, and replicate clones created during PCR amplification steps can be identified and assigned to their distinct parent molecules. Selective capture enables efficient use of sequencing for deep sampling and for the absolute quantitation of rare or transient transcripts that would otherwise escape detection by standard sequencing methods. We have also constructed a set of synthetic barcoded RNA molecules, which can be introduced as controls into the sample preparation mix and used to monitor the efficiency of library construction. The quantitative targeted sequencing revealed extremely low efficiency in standard library preparations, which were further confirmed by using synthetic barcoded RNA molecules. This finding shows that standard library preparation methods result in the loss of rare transcripts and highlights the need for monitoring library efficiency and for developing more efficient sample preparation methods. PMID:24449890

  7. Metagenomic Sequencing of the Chronic Obstructive Pulmonary Disease Upper Bronchial Tract Microbiome Reveals Functional Changes Associated with Disease Severity.

    PubMed

    Cameron, Simon J S; Lewis, Keir E; Huws, Sharon A; Lin, Wanchang; Hegarty, Matthew J; Lewis, Paul D; Mur, Luis A J; Pachebat, Justin A

    2016-01-01

    Chronic Obstructive Pulmonary Disease (COPD) is a major source of mortality and morbidity worldwide. The microbiome associated with this disease may be an important component of the disease, though studies to date have been based on sequencing of the 16S rRNA gene, and have revealed unequivocal results. Here, we employed metagenomic sequencing of the upper bronchial tract (UBT) microbiome to allow for greater elucidation of its taxonomic composition, and revealing functional changes associated with the disease. The bacterial metagenomes within sputum samples from eight COPD patients and ten 'healthy' smokers (Controls) were sequenced, and suggested significant changes in the abundance of bacterial species, particularly within the Streptococcus genus. The functional capacity of the COPD UBT microbiome indicated an increased capacity for bacterial growth, which could be an important feature in bacterial-associated acute exacerbations. Regression analyses correlated COPD severity (FEV1% of predicted) with differences in the abundance of Streptococcus pneumoniae and functional classifications related to a reduced capacity for bacterial sialic acid metabolism. This study suggests that the COPD UBT microbiome could be used in patient risk stratification and in identifying novel monitoring and treatment methods, but study of a longitudinal cohort will be required to unequivocally relate these features of the microbiome with COPD severity. PMID:26872143

  8. Metagenomic Sequencing of the Chronic Obstructive Pulmonary Disease Upper Bronchial Tract Microbiome Reveals Functional Changes Associated with Disease Severity

    PubMed Central

    Cameron, Simon J. S.; Lewis, Keir E.; Huws, Sharon A.; Lin, Wanchang; Hegarty, Matthew J.; Lewis, Paul D.; Mur, Luis A. J.; Pachebat, Justin A.

    2016-01-01

    Chronic Obstructive Pulmonary Disease (COPD) is a major source of mortality and morbidity worldwide. The microbiome associated with this disease may be an important component of the disease, though studies to date have been based on sequencing of the 16S rRNA gene, and have revealed unequivocal results. Here, we employed metagenomic sequencing of the upper bronchial tract (UBT) microbiome to allow for greater elucidation of its taxonomic composition, and revealing functional changes associated with the disease. The bacterial metagenomes within sputum samples from eight COPD patients and ten ‘healthy’ smokers (Controls) were sequenced, and suggested significant changes in the abundance of bacterial species, particularly within the Streptococcus genus. The functional capacity of the COPD UBT microbiome indicated an increased capacity for bacterial growth, which could be an important feature in bacterial-associated acute exacerbations. Regression analyses correlated COPD severity (FEV1% of predicted) with differences in the abundance of Streptococcus pneumoniae and functional classifications related to a reduced capacity for bacterial sialic acid metabolism. This study suggests that the COPD UBT microbiome could be used in patient risk stratification and in identifying novel monitoring and treatment methods, but study of a longitudinal cohort will be required to unequivocally relate these features of the microbiome with COPD severity. PMID:26872143

  9. Metagenomic Sequencing of the Chronic Obstructive Pulmonary Disease Upper Bronchial Tract Microbiome Reveals Functional Changes Associated with Disease Severity.

    PubMed

    Cameron, Simon J S; Lewis, Keir E; Huws, Sharon A; Lin, Wanchang; Hegarty, Matthew J; Lewis, Paul D; Mur, Luis A J; Pachebat, Justin A

    2016-01-01

    Chronic Obstructive Pulmonary Disease (COPD) is a major source of mortality and morbidity worldwide. The microbiome associated with this disease may be an important component of the disease, though studies to date have been based on sequencing of the 16S rRNA gene, and have revealed unequivocal results. Here, we employed metagenomic sequencing of the upper bronchial tract (UBT) microbiome to allow for greater elucidation of its taxonomic composition, and revealing functional changes associated with the disease. The bacterial metagenomes within sputum samples from eight COPD patients and ten 'healthy' smokers (Controls) were sequenced, and suggested significant changes in the abundance of bacterial species, particularly within the Streptococcus genus. The functional capacity of the COPD UBT microbiome indicated an increased capacity for bacterial growth, which could be an important feature in bacterial-associated acute exacerbations. Regression analyses correlated COPD severity (FEV1% of predicted) with differences in the abundance of Streptococcus pneumoniae and functional classifications related to a reduced capacity for bacterial sialic acid metabolism. This study suggests that the COPD UBT microbiome could be used in patient risk stratification and in identifying novel monitoring and treatment methods, but study of a longitudinal cohort will be required to unequivocally relate these features of the microbiome with COPD severity.

  10. Characterisation of Drosophila CMP-sialic acid synthetase activity reveals unusual enzymatic properties

    PubMed Central

    Mertsalov, Ilya B.; Novikov, Boris N.; Scott, Hilary; Dangott, Lawrence; Panin, Vladislav M.

    2016-01-01

    CMP-sialic acid synthetase (CSAS) is a key enzyme of the sialylation pathway. CSAS produces the activated sugar donor, CMP-sialic acid, which serves as a substrate for sialyltransferases to modify glycan termini with sialic acid. Unlike other animal CMP-Sia synthetases that normally localize in the nucleus, Drosophila melanogaster CSAS (DmCSAS) localizes in the cell secretory compartment, predominantly in the Golgi, which suggests that this enzyme has properties distinct from those of its vertebrate counterparts. To test this hypothesis, we purified recombinant DmCSAS and characterised its activity in vitro. Our experiments revealed several unique features of this enzyme. DmCSAS displays specificity for N-acetylneuraminic acid as a substrate, shows preference for lower pH and can function with a broad range of metal cofactors. When tested at a pH corresponding to the Golgi compartment, the enzyme showed significant activity with several metal cations, including Zn2+, Fe2+, Co2+ and Mn2+, while the activity with Mg2+ was found to be low. Protein sequence analysis and site-specific mutagenesis identified an aspartic acid residue that is necessary for enzymatic activity and predicted to be involved in coordinating a metal cofactor. DmCSAS enzymatic activity was found to be essential in vivo for rescuing the phenotype of DmCSAS mutants. Finally, our experiments revealed a steep dependence of the enzymatic activity on temperature. Taken together, our results indicate that DmCSAS underwent evolutionary adaptation to pH and ionic environment different from that of counterpart synthetases in vertebrates. Our data also suggest that environmental temperatures can regulate Drosophila sialylation, thus modulating neural transmission. PMID:27114558

  11. Characterization of expressed class II MHC sequences in the banner-tailed kangaroo rat (Dipodomys spectabilis) reveals multiple DRB loci.

    PubMed

    Busch, Joseph D; Waser, Peter M; DeWoody, J Andrew

    2008-11-01

    Genes of the major histocompatibility complex (MHC) are exceptionally polymorphic due to the combined effects of natural and sexual selection. Most research in wild populations has focused on the second exon of a single class II locus (DRB), but complete gene sequences can provide an illuminating backdrop for studies of intragenic selection, recombination, and organization. To this end, we characterized class II loci in the banner-tailed kangaroo rat (Dipodomys spectabilis). Seven DRB-like sequences (provisionally named MhcDisp-DRB*01 through *07) were isolated from spleen cDNA and most likely comprise > or =5 loci; this multiformity is quite unlike the situation in muroid rodents such as Mus, Rattus, and Peromyscus. In silico translation revealed the presence of important structural residues for glycosylation sites, salt bonds, and CD4+ T-cell recognition. Amino-acid distances varied widely among the seven sequences (2-34%). Nuclear DNA sequences from the Disp-DRB*07 locus (approximately 10 kb) revealed a conventional exon/intron structure as well as a number of microsatellites and short interspersed nuclear elements (B4, Alu, and IDL-Geo subfamilies). Rates of nucleotide substitution at Disp-DRB*07 are similar in both exons and introns (pi = 0.015 and 0.012, respectively), which suggests relaxed selection and may indicate that this locus is an expressed pseudogene. Finally, we performed BLASTn searches against Dipodomys ordii genomic sequences (unassembled reads) and find 90-97% nucleotide similarity between the two kangaroo rat species. Collectively, these data suggest that class II diversity in heteromyid rodents is based on polylocism and departs from the muroid architecture.

  12. Predicting protein disorder by analyzing amino acid sequence

    PubMed Central

    Yang, Jack Y; Yang, Mary Qu

    2008-01-01

    Background Many protein regions and some entire proteins have no definite tertiary structure, presenting instead as dynamic, disorder ensembles under different physiochemical circumstances. These proteins and regions are known as Intrinsically Unstructured Proteins (IUP). IUP have been associated with a wide range of protein functions, along with roles in diseases characterized by protein misfolding and aggregation. Results Identifying IUP is important task in structural and functional genomics. We exact useful features from sequences and develop machine learning algorithms for the above task. We compare our IUP predictor with PONDRs (mainly neural-network-based predictors), disEMBL (also based on neural networks) and Globplot (based on disorder propensity). Conclusion We find that augmenting features derived from physiochemical properties of amino acids (such as hydrophobicity, complexity etc.) and using ensemble method proved beneficial. The IUP predictor is a viable alternative software tool for identifying IUP protein regions and proteins. PMID:18831799

  13. Massive parallel IGHV gene sequencing reveals a germinal center pathway in origins of human multiple myeloma.

    PubMed

    Cowan, Graeme; Weston-Bell, Nicola J; Bryant, Dean; Seckinger, Anja; Hose, Dirk; Zojer, Niklas; Sahota, Surinder S

    2015-05-30

    Human multiple myeloma (MM) is characterized by accumulation of malignant terminally differentiated plasma cells (PCs) in the bone marrow (BM), raising the question when during maturation neoplastic transformation begins. Immunoglobulin IGHV genes carry imprints of clonal tumor history, delineating somatic hypermutation (SHM) events that generally occur in the germinal center (GC). Here, we examine MM-derived IGHV genes using massive parallel deep sequencing, comparing them with profiles in normal BM PCs. In 4/4 presentation IgG MM, monoclonal tumor-derived IGHV sequences revealed significant evidence for intraclonal variation (ICV) in mutation patterns. IGHV sequences of 2/2 normal PC IgG populations revealed dominant oligoclonal expansions, each expansion also displaying mutational ICV. Clonal expansions in MM and in normal BM PCs reveal common IGHV features. In such MM, the data fit a model of tumor origins in which neoplastic transformation is initiated in a GC B-cell committed to terminal differentiation but still targeted by on-going SHM. Strikingly, the data parallel IGHV clonal sequences in some monoclonal gammopathy of undetermined significance (MGUS) known to display on-going SHM imprints. Since MGUS generally precedes MM, these data suggest origins of MGUS and MM with IGHV gene mutational ICV from the same GC B-cell, arising via a distinctive pathway.

  14. Single-cell genome and metatranscriptome sequencing reveal metabolic interactions of an alkane-degrading methanogenic community

    PubMed Central

    Embree, Mallory; Nagarajan, Harish; Movahedi, Narjes; Chitsaz, Hamidreza; Zengler, Karsten

    2014-01-01

    Microbial interactions have a key role in global geochemical cycles. Although we possess significant knowledge about the general biochemical processes occurring in microbial communities, we are often unable to decipher key functions of individual microorganisms within the environment in part owing to the inability to cultivate or study them in isolation. Here, we circumvent this shortcoming through the use of single-cell genome sequencing and a novel low-input metatranscriptomics protocol to reveal the intricate metabolic capabilities and microbial interactions of an alkane-degrading methanogenic community. This methanogenic consortium oxidizes saturated hydrocarbons under anoxic conditions through a thus-far-uncharacterized biochemical process. The genome sequence of a dominant bacterial member of this community, belonging to the genus Smithella, was sequenced and served as the basis for subsequent analysis through metabolic reconstruction. Metatranscriptomic data generated from less than 500 pg of mRNA highlighted metabolically active genes during anaerobic alkane oxidation in comparison with growth on fatty acids. These data sets suggest that Smithella is not activating hexadecane by fumarate addition. Differential expression assisted in the identification of hypothetical proteins with no known homology that may be involved in hexadecane activation. Additionally, the combination of 16S rDNA sequence and metatranscriptomic data enabled the study of other prevalent organisms within the consortium and their interactions with Smithella, thus yielding a comprehensive characterization of individual constituents at the genome scale during methanogenic alkane oxidation. PMID:24152715

  15. Comparative sequence and genetic analyses of asparagus BACs reveal no microsynteny with onion or rice.

    PubMed

    Jakse, Jernej; Telgmann, Alexa; Jung, Christian; Khar, Anil; Melgar, Sergio; Cheung, Foo; Town, Christopher D; Havey, Michael J

    2006-12-01

    The Poales (includes the grasses) and Asparagales [includes onion (Allium cepa L.) and asparagus (Asparagus officinalis L.)] are the two most economically important monocot orders. The Poales are a member of the commelinoid monocots, a group of orders sister to the Asparagales. Comparative genomic analyses have revealed a high degree of synteny among the grasses; however, it is not known if this synteny extends to other major monocot groups such as the Asparagales. Although we previously reported no evidence for synteny at the recombinational level between onion and rice, microsynteny may exist across shorter genomic regions in the grasses and Asparagales. We sequenced nine asparagus BACs to reveal physically linked genic-like sequences and determined their most similar positions in the onion and rice genomes. Four of the asparagus BACs were selected using molecular markers tightly linked to the sex-determining M locus on chromosome 5 of asparagus. These BACs possessed only two putative coding regions and had long tracts of degenerated retroviral elements and transposons. Five asparagus BACs were selected after hybridization of three onion cDNAs that mapped to three different onion chromosomes. Genic-like sequences that were physically linked on the cDNA-selected BACs or genetically linked on the M-linked BACs showed significant similarities (e < -20) to expressed sequences on different rice chromosomes, revealing no evidence for microsynteny between asparagus and rice across these regions. Genic-like sequences that were linked in asparagus were used to identify highly similar (e < -20) expressed sequence tags (ESTs) of onion. These onion ESTs mapped to different onion chromosomes and no relationship was observed between physical or genetic linkages in asparagus and genetic linkages in onion. These results further indicate that synteny among grass genomes does not extend to a sister order in the monocots and that asparagus may not be an appropriate smaller genome

  16. Comparative sequence and genetic analyses of asparagus BACs reveal no microsynteny with onion or rice.

    PubMed

    Jakse, Jernej; Telgmann, Alexa; Jung, Christian; Khar, Anil; Melgar, Sergio; Cheung, Foo; Town, Christopher D; Havey, Michael J

    2006-12-01

    The Poales (includes the grasses) and Asparagales [includes onion (Allium cepa L.) and asparagus (Asparagus officinalis L.)] are the two most economically important monocot orders. The Poales are a member of the commelinoid monocots, a group of orders sister to the Asparagales. Comparative genomic analyses have revealed a high degree of synteny among the grasses; however, it is not known if this synteny extends to other major monocot groups such as the Asparagales. Although we previously reported no evidence for synteny at the recombinational level between onion and rice, microsynteny may exist across shorter genomic regions in the grasses and Asparagales. We sequenced nine asparagus BACs to reveal physically linked genic-like sequences and determined their most similar positions in the onion and rice genomes. Four of the asparagus BACs were selected using molecular markers tightly linked to the sex-determining M locus on chromosome 5 of asparagus. These BACs possessed only two putative coding regions and had long tracts of degenerated retroviral elements and transposons. Five asparagus BACs were selected after hybridization of three onion cDNAs that mapped to three different onion chromosomes. Genic-like sequences that were physically linked on the cDNA-selected BACs or genetically linked on the M-linked BACs showed significant similarities (e < -20) to expressed sequences on different rice chromosomes, revealing no evidence for microsynteny between asparagus and rice across these regions. Genic-like sequences that were linked in asparagus were used to identify highly similar (e < -20) expressed sequence tags (ESTs) of onion. These onion ESTs mapped to different onion chromosomes and no relationship was observed between physical or genetic linkages in asparagus and genetic linkages in onion. These results further indicate that synteny among grass genomes does not extend to a sister order in the monocots and that asparagus may not be an appropriate smaller genome

  17. Fatty Acid Profile and Unigene-Derived Simple Sequence Repeat Markers in Tung Tree (Vernicia fordii)

    PubMed Central

    Zhang, Lin; Jia, Baoguang; Tan, Xiaofeng; Thammina, Chandra S.; Long, Hongxu; Liu, Min; Wen, Shanna; Song, Xianliang; Cao, Heping

    2014-01-01

    Tung tree (Vernicia fordii) provides the sole source of tung oil widely used in industry. Lack of fatty acid composition and molecular markers hinders biochemical, genetic and breeding research. The objectives of this study were to determine fatty acid profiles and develop unigene-derived simple sequence repeat (SSR) markers in tung tree. Fatty acid profiles of 41 accessions showed that the ratio of α-eleostearic acid was increasing continuously with a parallel trend to the amount of tung oil accumulation while the ratios of other fatty acids were decreasing in different stages of the seeds and that α-eleostearic acid (18∶3) consisted of 77% of the total fatty acids in tung oil. Transcriptome sequencing identified 81,805 unigenes from tung cDNA library constructed using seed mRNA and discovered 6,366 SSRs in 5,404 unigenes. The di- and tri-nucleotide microsatellites accounted for 92% of the SSRs with AG/CT and AAG/CTT being the most abundant SSR motifs. Fifteen polymorphic genic-SSR markers were developed from 98 unigene loci tested in 41 cultivated tung accessions by agarose gel and capillary electrophoresis. Genbank database search identified 10 of them putatively coding for functional proteins. Quantitative PCR demonstrated that all 15 polymorphic SSR-associated unigenes were expressed in tung seeds and some of them were highly correlated with oil composition in the seeds. Dendrogram revealed that most of the 41 accessions were clustered according to the geographic region. These new polymorphic genic-SSR markers will facilitate future studies on genetic diversity, molecular fingerprinting, comparative genomics and genetic mapping in tung tree. The lipid profiles in the seeds of 41 tung accessions will be valuable for biochemical and breeding studies. PMID:25167054

  18. Heterogeneity of amino acid sequence in hippopotamus cytochrome c.

    PubMed

    Thompson, R B; Borden, D; Tarr, G E; Margoliash, E

    1978-12-25

    The amino acid sequences of chymotryptic and tryptic peptides of Hippopotamus amphibius cytochrome c were determined by a recent modification of the manual Edman sequential degradation procedure. They were ordered by comparison with the structure of the hog protein. The hippopotamus protein differs in three positions: serine, alanine, and glutamine replace alanine, glutamic acid, and lysine in positions 43, 92, and 100, respectively. Since the artiodactyl suborders diverged in the mid-Eocene some 50 million years ago, the fact that representatives of some of them show no differences in their cytochromes c (cow, sheep, and hog), while another exhibits as many as three such differences, verifies that even in relatively closely related lines of descent the rate at which cytochrome c changes in the course of evolution is not constant. Furthermore, 10.6% of the hippopotamus cytochrome c preparation was shown to contain isoleucine instead of valine at position 3, indicating that one of the four animals from which the protein was obtained was heterozygous in the cytochrome c gene. Such heterogeneity is a necessary condition of evolutionary variation and has not been previously observed in the cytochrome c of a wild mammalian population.

  19. The amino-acid sequence of the alpha-crystallin A chains of red kangaroo and Virginia opossum.

    PubMed

    De Jong, W W; Terwindt, E C

    1976-08-16

    The amino acid sequence of the A chain of the eye lens protein alpha-crystallin from the red kangaroo (Macropus rufus) was completely determined by manual Edman degradation of tryptic, thermolytic and cyanogen bromide peptides. The sequence of the alpha-crystallin A chain from the Virginia opossum (Didelphis marsupialis) was deduced from amino acid analyses and partial Edman degradation of peptides. The 173-residue A chains of kangaroo and opossum differ in six positions, whereas comparison with the bovine alpha-crystallin A chain reveals 17 and 22 substitutions, respectively. Most substitutions occur in the COOH-terminal part of the chain.

  20. Multilocus sequence typing of Mycoplasma bovis reveals host-specific genotypes in cattle versus bison.

    PubMed

    Register, Karen B; Thole, Luke; Rosenbush, Ricardo F; Minion, F Chris

    2015-01-30

    Mycoplasma bovis is a primary agent of mastitis, pneumonia and arthritis in cattle and the bacterium most frequently isolated from the polymicrobial syndrome known as bovine respiratory disease complex. Recently, M. bovis has emerged as a significant health problem in bison, causing necrotic pharyngitis, pneumonia, dystocia and abortion. Whether isolates from cattle and bison comprise genetically distinct populations is unknown. This study describes the development of a highly discriminatory multilocus sequencing typing (MLST) method for M. bovis and its use to investigate the population structure of the bacterium. Genome sequences from six M. bovis isolates were used for selection of gene targets. Seven of 44 housekeeping genes initially evaluated were selected as targets on the basis of sequence variability and distribution within the genome. For each gene target sequence, four to seven alleles could be distinguished that collectively define 32 sequence types (STs) from a collection of 94 cattle isolates and 42 bison isolates. A phylogeny based on concatenated target gene sequences of each isolate revealed that bison isolates are genetically distinct from strains that infect cattle, suggesting recent disease outbreaks in bison may be due to the emergence of unique genetic variants. No correlation was found between ST and disease presentation or geographic origin. MLST data reported here were used to populate a newly created and publicly available, curated database to which researchers can contribute. The MLST scheme and database provide novel tools for exploring the population structure of M. bovis and tracking the evolution and spread of strains.

  1. Human liver apolipoprotein B-100 cDNA: complete nucleic acid and derived amino acid sequence.

    PubMed Central

    Law, S W; Grant, S M; Higuchi, K; Hospattankar, A; Lackner, K; Lee, N; Brewer, H B

    1986-01-01

    Human apolipoprotein B-100 (apoB-100), the ligand on low density lipoproteins that interacts with the low density lipoprotein receptor and initiates receptor-mediated endocytosis and low density lipoprotein catabolism, has been cloned, and the complete nucleic acid and derived amino acid sequences have been determined. ApoB-100 cDNAs were isolated from normal human liver cDNA libraries utilizing immunoscreening as well as filter hybridization with radiolabeled apoB-100 oligodeoxynucleotides. The apoB-100 mRNA is 14.1 kilobases long encoding a mature apoB-100 protein of 4536 amino acids with a calculated amino acid molecular weight of 512,723. ApoB-100 contains 20 potential glycosylation sites, and 12 of a total of 25 cysteine residues are located in the amino-terminal region of the apolipoprotein providing a potential globular structure of the amino terminus of the protein. ApoB-100 contains relatively few regions of amphipathic helices, but compared to other human apolipoproteins it is enriched in beta-structure. The delineation of the entire human apoB-100 sequence will now permit a detailed analysis of the conformation of the protein, the low density lipoprotein receptor binding domain(s), and the structural relationship between apoB-100 and apoB-48 and will provide the basis for the study of genetic defects in apoB-100 in patients with dyslipoproteinemias. PMID:3464946

  2. Whole-exome sequencing reveals GPIHBP1 mutations in infantile colitis with severe hypertriglyceridemia.

    PubMed

    Gonzaga-Jauregui, Claudia; Mir, Sabina; Penney, Samantha; Jhangiani, Shalini; Midgen, Craig; Finegold, Milton; Muzny, Donna M; Wang, Min; Bacino, Carlos A; Gibbs, Richard A; Lupski, James R; Kellermayer, Richard; Hanchard, Neil A

    2014-07-01

    Severe congenital hypertriglyceridemia (HTG) is a rare disorder caused by mutations in genes affecting lipoprotein lipase (LPL) activity. Here we report a 5-week-old Hispanic girl with severe HTG (12,031 mg/dL, normal limit 150 mg/dL) who presented with the unusual combination of lower gastrointestinal bleeding and milky plasma. Initial colonoscopy was consistent with colitis, which resolved with reduction of triglycerides. After negative sequencing of the LPL gene, whole-exome sequencing revealed novel compound heterozygous mutations in GPIHBP1. Our study broadens the phenotype of GPIHBP1-associated HTG, reinforces the effectiveness of whole-exome sequencing in Mendelian diagnoses, and implicates triglycerides in gastrointestinal mucosal injury.

  3. Whole-Exome Sequencing Reveals GPIHBP1 Mutations in Infantile Colitis With Severe Hypertriglyceridemia

    PubMed Central

    Gonzaga-Jauregui, Claudia; Mir, Sabina; Penney, Samantha; Jhangiani, Shalini; Midgen, Craig; Finegold, Milton; Muzny, Donna M.; Wang, Min; Bacino, Carlos A.; Gibbs, Richard A.; Lupski, James R.; Kellermayer, Richard; Hanchard, Neil A.

    2014-01-01

    Severe congenital hypertriglyceridemia (HTG) is a rare disorder caused by mutations in genes affecting lipoprotein lipase (LPL) activity. Here we report a 5-week-old Hispanic girl with severe HTG (12,031 mg/dL, normal limit 150 mg/dL) who presented with the unusual combination of lower gastrointestinal bleeding and milky plasma. Initial colonoscopy was consistent with colitis, which resolved with reduction of triglycerides. After negative sequencing of the LPL gene, whole-exome sequencing revealed novel compound heterozygous mutations in GPIHBP1. Our study broadens the phenotype of GPIHBP1-associated HTG, reinforces the effectiveness of whole-exome sequencing in Mendelian diagnoses, and implicates triglycer-ides in gastrointestinal mucosal injury. PMID:24614124

  4. Relationships amongst bluetongue viruses revealed by comparisons of capsid and outer coat protein nucleotide sequences.

    PubMed

    Gould, A R; Pritchard, L I

    1990-08-01

    Sequence data from the gene segments coding for the capsid protein. VP3, of all eight Australian bluetongue virus serotypes were compared. The high degree of nucleotide sequence homology for VP3 genes amongst BTV isolates from the same geographic region supported previous studies (Gould, 1987; 1988b, c; Gould et al., 1988b) and was proposed as a basis for "topotyping" a bluetongue virus isolate (Gould et al., 1989). The complete nucleotide sequences which coded for the VP2 outer coat proteins of South African BTV serotypes 1 and 3 (vaccine strains) were determined and compared to cognate gene sequences from North American and Australian BTVs. These VP2 comparisons demonstrated that BTVs of the same serotype, but from different geographical regions, were closely related at the nucleotide and amino acid levels. However, close inter-relationships were also demonstrated amongst other BTVs irrespective of serotype or geographic origin. These data enabled phylogenic relationships of the BTV serotypes to be analysed using VP2 nucleotide sequences as a determinant.

  5. Sequencing-based typing reveals new insight in HLA-DPA1 polymorphism.

    PubMed

    Rozemuller, E H; Bouwens, A G; van Oort, E; Versluis, L F; Marsh, S G; Bodmer, J G; Tilanus, M G

    1995-01-01

    An HLA-DPA1 sequencing-based typing (SBT) system has been developed to identify DPA1 alleles. Up to now eight DPA1 alleles have been defined. Six can be discriminated based upon exon 2 polymorphism. The three subtypes of DPA1*01: DPA1*0101, DPA1*0102 and DPA1*0103, have identical exon 2 sequences but show differences in exon 4. Exon 4 sequences were known for only the three DPA1*01 subtypes and for DPA1*0201. We now present additional sequence information for exon 4 and the unknown segments at the 3' end of exon 2. Additionally with the use of this sequencing technique it is also possible to identify previously unidentified polymorphism. We have studied the exon 2 and exon 4 polymorphism of DPA1 in 40 samples which include all known DPA1 alleles. A new allele, DPA1*01 new, was identified which differs by one nucleotide in exon 2 from DPA1*0103, resulting in an aspartic acid at codon 28. The DPA1*01 subtypes DPA1*0101 and DPA1*0102 could not be confirmed in samples which previously were used to define these subtypes, and consequently they do not exist. The exon 4 sequence of DPA1*0201 is corrected based on sequence data of DAUDI, the cell line in which DPA1*0202 was originally defined. The exon 4 regions of the remaining four alleles were resolved: the exon 4 regions of the alleles DPA1*02021 and DPA1*02022 were found to be identical to the--corrected--DPA1*0201 whereas the exon 4 region of DPA1*0301 differs by one nucleotide compared to DPA1*0103. The DPA1*0401 exon 4 region differs by one nucleotide compared to the corrected DPA1*0201.(ABSTRACT TRUNCATED AT 250 WORDS)

  6. NUCLEAR MONOPLOIDY AND ASEXUAL PROPAGATION OF NANNOCHLOROPSIS OCEANICA (EUSTIGMATOPHYCEAE) AS REVEALED BY ITS GENOME SEQUENCE(1).

    PubMed

    Pan, Kehou; Qin, Junjie; Li, Si; Dai, Wenkui; Zhu, Baohua; Jin, Yuanchun; Yu, Wengong; Yang, Guanpin; Li, Dongfang

    2011-12-01

    Species in genus Nannochloropsis are promising candidates for both biofuel and biomass production due to their ability to accumulate rich fatty acids and grow fast; however, their sexual reproduction has not been studied. It is clear that the construction of their metabolic pathways, such as that of polyunsaturated fatty acid (PUFA) biosynthesis, and understanding of their biological characteristics, such as nuclear ploidy and reproductive strategy, will certainly facilitate their genetic improvement through gene engineering and mutation and clonal expansion. In this study, the genome of N. oceanica S. Suda et Miyashita was sequenced with the next-generation Illumina GA sequencing technologies. The genome was ∼30 Mb in size, which contained 11,129 protein-encoding genes. Of them, 59.65% were annotated by aligning with those in diverse protein databases, and 29.68% were assigned at least one function described in the Kyoto Encyclopedia of Genes and Genomes (KEGG) database. Less frequent polymorphic nucleotides (one in 22.06 kb) and the obvious deviation from 1:1 (major:minor, minor ≥10) expectation indicated the nuclear monoploidy of N. oceanica. The lack of the majority of meiosis-specific proteins implied the asexual reproduction of this alga. In combination, the nuclear monoploidy and asexual propagation led us to favor the hypothesis that N. oceanica was a premeiotic or ameiotic alga. In addition, sequence similarity-based searching identified the elongase- and desaturase-encoding genes involved in the biosynthesis of long-chain PUFAs, which provided the genetic basis of its rich content of eicosapentaenoic acid (EPA). The functional genes and their metabolic pathways profiled against its genome sequence will facilitate its integrative investigations.

  7. NUCLEAR MONOPLOIDY AND ASEXUAL PROPAGATION OF NANNOCHLOROPSIS OCEANICA (EUSTIGMATOPHYCEAE) AS REVEALED BY ITS GENOME SEQUENCE(1).

    PubMed

    Pan, Kehou; Qin, Junjie; Li, Si; Dai, Wenkui; Zhu, Baohua; Jin, Yuanchun; Yu, Wengong; Yang, Guanpin; Li, Dongfang

    2011-12-01

    Species in genus Nannochloropsis are promising candidates for both biofuel and biomass production due to their ability to accumulate rich fatty acids and grow fast; however, their sexual reproduction has not been studied. It is clear that the construction of their metabolic pathways, such as that of polyunsaturated fatty acid (PUFA) biosynthesis, and understanding of their biological characteristics, such as nuclear ploidy and reproductive strategy, will certainly facilitate their genetic improvement through gene engineering and mutation and clonal expansion. In this study, the genome of N. oceanica S. Suda et Miyashita was sequenced with the next-generation Illumina GA sequencing technologies. The genome was ∼30 Mb in size, which contained 11,129 protein-encoding genes. Of them, 59.65% were annotated by aligning with those in diverse protein databases, and 29.68% were assigned at least one function described in the Kyoto Encyclopedia of Genes and Genomes (KEGG) database. Less frequent polymorphic nucleotides (one in 22.06 kb) and the obvious deviation from 1:1 (major:minor, minor ≥10) expectation indicated the nuclear monoploidy of N. oceanica. The lack of the majority of meiosis-specific proteins implied the asexual reproduction of this alga. In combination, the nuclear monoploidy and asexual propagation led us to favor the hypothesis that N. oceanica was a premeiotic or ameiotic alga. In addition, sequence similarity-based searching identified the elongase- and desaturase-encoding genes involved in the biosynthesis of long-chain PUFAs, which provided the genetic basis of its rich content of eicosapentaenoic acid (EPA). The functional genes and their metabolic pathways profiled against its genome sequence will facilitate its integrative investigations. PMID:27020366

  8. Canine amino acid transport system Xc(-): cDNA sequence, distribution and cystine transport activity in lens epithelial cells.

    PubMed

    Maruo, Takuya; Kanemaki, Nobuyuki; Onda, Ken; Sato, Reiichiro; Ichihara, Nobuteru; Ochiai, Hideharu

    2014-04-01

    The cystine transport activity of a lens epithelial cell line originated from a canine mature cataract was investigated. The distinct cystine transport activity was observed, which was inhibited to 28% by extracellular 1 mM glutamate. The cDNA sequences of canine cysteine/glutamate exchanger (xCT) and 4F2hc were determined. The predicted amino acid sequences were 527 and 533 amino acid polypeptides, respectively. The amino acid sequences of canine xCT and 4F2hc showed high similarities (>80%) to those of humans. The expression of xCT in lens epithelial cell line was confirmed by western blot analysis. RT-PCR analysis revealed high level expression only in the brain, and it was below the detectable level in other tissues.

  9. Massively parallel tag sequencing reveals the complexity of anaerobic marine protistan communities

    PubMed Central

    Stoeck, Thorsten; Behnke, Anke; Christen, Richard; Amaral-Zettler, Linda; Rodriguez-Mora, Maria J; Chistoserdov, Andrei; Orsi, William; Edgcomb, Virginia P

    2009-01-01

    Background Recent advances in sequencing strategies make possible unprecedented depth and scale of sampling for molecular detection of microbial diversity. Two major paradigm-shifting discoveries include the detection of bacterial diversity that is one to two orders of magnitude greater than previous estimates, and the discovery of an exciting 'rare biosphere' of molecular signatures ('species') of poorly understood ecological significance. We applied a high-throughput parallel tag sequencing (454 sequencing) protocol adopted for eukaryotes to investigate protistan community complexity in two contrasting anoxic marine ecosystems (Framvaren Fjord, Norway; Cariaco deep-sea basin, Venezuela). Both sampling sites have previously been scrutinized for protistan diversity by traditional clone library construction and Sanger sequencing. By comparing these clone library data with 454 amplicon library data, we assess the efficiency of high-throughput tag sequencing strategies. We here present a novel, highly conservative bioinformatic analysis pipeline for the processing of large tag sequence data sets. Results The analyses of ca. 250,000 sequence reads revealed that the number of detected Operational Taxonomic Units (OTUs) far exceeded previous richness estimates from the same sites based on clone libraries and Sanger sequencing. More than 90% of this diversity was represented by OTUs with less than 10 sequence tags. We detected a substantial number of taxonomic groups like Apusozoa, Chrysomerophytes, Centroheliozoa, Eustigmatophytes, hyphochytriomycetes, Ichthyosporea, Oikomonads, Phaeothamniophytes, and rhodophytes which remained undetected by previous clone library-based diversity surveys of the sampling sites. The most important innovations in our newly developed bioinformatics pipeline employ (i) BLASTN with query parameters adjusted for highly variable domains and a complete database of public ribosomal RNA (rRNA) gene sequences for taxonomic assignments of tags; (ii

  10. Reconstruction of the lipid metabolism for the microalga Monoraphidium neglectum from its genome sequence reveals characteristics suitable for biofuel production

    PubMed Central

    2013-01-01

    Background Microalgae are gaining importance as sustainable production hosts in the fields of biotechnology and bioenergy. A robust biomass accumulating strain of the genus Monoraphidium (SAG 48.87) was investigated in this work as a potential feedstock for biofuel production. The genome was sequenced, annotated, and key enzymes for triacylglycerol formation were elucidated. Results Monoraphidium neglectum was identified as an oleaginous species with favourable growth characteristics as well as a high potential for crude oil production, based on neutral lipid contents of approximately 21% (dry weight) under nitrogen starvation, composed of predominantly C18:1 and C16:0 fatty acids. Further characterization revealed growth in a relatively wide pH range and salt concentrations of up to 1.0% NaCl, in which the cells exhibited larger structures. This first full genome sequencing of a member of the Selenastraceae revealed a diploid, approximately 68 Mbp genome with a G + C content of 64.7%. The circular chloroplast genome was assembled to a 135,362 bp single contig, containing 67 protein-coding genes. The assembly of the mitochondrial genome resulted in two contigs with an approximate total size of 94 kb, the largest known mitochondrial genome within algae. 16,761 protein-coding genes were assigned to the nuclear genome. Comparison of gene sets with respect to functional categories revealed a higher gene number assigned to the category “carbohydrate metabolic process” and in “fatty acid biosynthetic process” in M. neglectum when compared to Chlamydomonas reinhardtii and Nannochloropsis gaditana, indicating a higher metabolic diversity for applications in carbohydrate conversions of biotechnological relevance. Conclusions The genome of M. neglectum, as well as the metabolic reconstruction of crucial lipid pathways, provides new insights into the diversity of the lipid metabolism in microalgae. The results of this work provide a platform to encourage the

  11. Intraspecific genetic variation in Paramecium revealed by mitochondrial cytochrome C oxidase I sequences.

    PubMed

    Barth, Dana; Krenek, Sascha; Fokin, Sergei I; Berendonk, Thomas U

    2006-01-01

    Studies of intraspecific genetic diversity of ciliates, such as population genetics and biogeography, are particularly hampered by the lack of suitable DNA markers. For example, sequences of the non-coding ribosomal internal transcribed spacer (ITS) regions are often too conserved for intraspecific analyses. We have therefore identified primers for the mitochondrial cytochrome c oxidase I (COI) gene and applied them for intraspecific investigations in Paramecium caudatum and Paramecium multimicronucleatum. Furthermore, we obtained sequences of the ITS regions from the same strains and carried out comparative sequence analyses of both data sets. The mitochondrial sequences revealed substantially higher variation in both Paramecium species, with intraspecific divergences up to 7% in P. caudatum and 9.5% in P. multimicronucleatum. Moreover, an initial survey of the population structure discovered different mitochondrial haplotypes of P. caudatum in one pond, thereby demonstrating the potential of this genetic marker for population genetic analyses. Our primers successfully amplified the COI gene of other Paramecium. This is the first report of intraspecific variation in free-living protozoans based on mitochondrial sequence data. Our results show that the high variation in mitochondrial DNA makes it a suitable marker for intraspecific and population genetic studies.

  12. Phylogenetic Analysis of Geographically Diverse Radopholus similis via rDNA Sequence Reveals a Monomorphic Motif

    PubMed Central

    Kaplan, D. T.; Thomas, W. K.; Frisse, L. M.; Sarah, J. L.; Stanton, J. M.; Speijer, P. R.; Marin, D. H.; Opperman, C. H.

    2000-01-01

    The nucleic acid sequences of rDNA ITS1 and the rDNA D2/D3 expansion segment were compared for 57 burrowing nematode isolates collected from Australia, Cameroon, Central America, Cuba, Dominican Republic, Florida, Guadeloupe, Hawaii, Nigeria, Honduras, Indonesia, Ivory Coast, Puerto Rico, South Africa, and Uganda. Of the 57 isolates, 55 were morphologically similar to Radopholus similis and seven were citrus-parasitic. The nucleic acid sequences for PCR-amplified ITS1 and for the D2/D3 expansion segment of the 28S rDNA gene were each identical for all putative R. similis. Sequence divergence for both the ITS1 and the D2/D3 was concordant with morphological differences that distinguish R. similis from other burrowing nematode species. This result substantiates previous observations that the R. similis genome is highly conserved across geographic regions. Autapomorphies that would delimit phylogenetic lineages of non-citrus-parasitic R. similis from those that parasitize citrus were not observed. The data presented herein support the concept that R. similis is comprised of two pathotypes-one that parasitizes citrus and one that does not. PMID:19270959

  13. Genetic relationships among Enterococcus faecalis isolates from different sources as revealed by multilocus sequence typing.

    PubMed

    Chen, X; Song, Y Q; Xu, H Y; Menghe, B L G; Zhang, H P; Sun, Z H

    2015-08-01

    Enterococcus faecalis is part of the natural gut flora of humans and other mammals; some isolates are also used in food production. So, it is important to evaluate the genetic diversity and phylogenetic relationships among E. faecalis isolates from different sources. Multilocus sequence typing protocol was used to compare 39 E. faecalis isolates from Chinese traditional food products (including dairy products, acidic gruel) and 4 published E. faecalis isolates from other sources including human-derived isolates employing 5 housekeeping genes (groEL, clpX, recA, rpoB, and pepC). A total of 23 unique sequence types were identified, which were grouped into 5 clonal complexes and 10 singletons. The value of standardized index of association of the alleles (IA(S)=0.1465) and network structure indicated a high frequency of intraspecies recombination across these isolates. Enterococcus faecalis lineages also exhibited clearly source-clustered distributions. The isolates from dairy source were clustered together. However, the relationship between isolates from acidic gruel and one isolate from a human source was close. The MLST scheme presented in this study provides a sharable and continuously growing sequence database enabling global comparison of strains from different sources, and will further advance our understanding of the microbial ecology of this important species.

  14. Genetic relationships among Enterococcus faecalis isolates from different sources as revealed by multilocus sequence typing.

    PubMed

    Chen, X; Song, Y Q; Xu, H Y; Menghe, B L G; Zhang, H P; Sun, Z H

    2015-08-01

    Enterococcus faecalis is part of the natural gut flora of humans and other mammals; some isolates are also used in food production. So, it is important to evaluate the genetic diversity and phylogenetic relationships among E. faecalis isolates from different sources. Multilocus sequence typing protocol was used to compare 39 E. faecalis isolates from Chinese traditional food products (including dairy products, acidic gruel) and 4 published E. faecalis isolates from other sources including human-derived isolates employing 5 housekeeping genes (groEL, clpX, recA, rpoB, and pepC). A total of 23 unique sequence types were identified, which were grouped into 5 clonal complexes and 10 singletons. The value of standardized index of association of the alleles (IA(S)=0.1465) and network structure indicated a high frequency of intraspecies recombination across these isolates. Enterococcus faecalis lineages also exhibited clearly source-clustered distributions. The isolates from dairy source were clustered together. However, the relationship between isolates from acidic gruel and one isolate from a human source was close. The MLST scheme presented in this study provides a sharable and continuously growing sequence database enabling global comparison of strains from different sources, and will further advance our understanding of the microbial ecology of this important species. PMID:26074239

  15. Human retroviruses and AIDS 1996. A compilation and analysis of nucleic acid and amino acid sequences

    SciTech Connect

    Myers, G.; Foley, B.; Korber, B.; Mellors, J.W.; Jeang, K.T.; Wain-Hobson, S.

    1997-04-01

    This compendium and the accompanying floppy diskettes are the result of an effort to compile and rapidly publish all relevant molecular data concerning the human immunodeficiency viruses (HIV) and related retroviruses. The scope of the compendium and database is best summarized by the five parts that it comprises: (1) Nuclear Acid Alignments and Sequences; (2) Amino Acid Alignments; (3) Analysis; (4) Related Sequences; and (5) Database Communications. Information within all the parts is updated throughout the year on the Web site, http://hiv-web.lanl.gov. While this publication could take the form of a review or sequence monograph, it is not so conceived. Instead, the literature from which the database is derived has simply been summarized and some elementary computational analyses have been performed upon the data. Interpretation and commentary have been avoided insofar as possible so that the reader can form his or her own judgments concerning the complex information. In addition to the general descriptions of the parts of the compendium, the user should read the individual introductions for each part.

  16. Genome sequence of the pattern forming Paenibacillus vortex bacterium reveals potential for thriving in complex environments

    PubMed Central

    2010-01-01

    Background The pattern-forming bacterium Paenibacillus vortex is notable for its advanced social behavior, which is reflected in development of colonies with highly intricate architectures. Prior to this study, only two other Paenibacillus species (Paenibacillus sp. JDR-2 and Paenibacillus larvae) have been sequenced. However, no genomic data is available on the Paenibacillus species with pattern-forming and complex social motility. Here we report the de novo genome sequence of this Gram-positive, soil-dwelling, sporulating bacterium. Results The complete P. vortex genome was sequenced by a hybrid approach using 454 Life Sciences and Illumina, achieving a total of 289× coverage, with 99.8% sequence identity between the two methods. The sequencing results were validated using a custom designed Agilent microarray expression chip which represented the coding and the non-coding regions. Analysis of the P. vortex genome revealed 6,437 open reading frames (ORFs) and 73 non-coding RNA genes. Comparative genomic analysis with 500 complete bacterial genomes revealed exceptionally high number of two-component system (TCS) genes, transcription factors (TFs), transport and defense related genes. Additionally, we have identified genes involved in the production of antimicrobial compounds and extracellular degrading enzymes. Conclusions These findings suggest that P. vortex has advanced faculties to perceive and react to a wide range of signaling molecules and environmental conditions, which could be associated with its ability to reconfigure and replicate complex colony architectures. Additionally, P. vortex is likely to serve as a rich source of genes important for agricultural, medical and industrial applications and it has the potential to advance the study of social microbiology within Gram-positive bacteria. PMID:21167037

  17. Distinct genetic lineages of Bactrocera caudata (Insecta: Tephritidae) revealed by COI and 16S DNA sequences.

    PubMed

    Lim, Phaik-Eem; Tan, Ji; Suana, I Wayan; Eamsobhana, Praphathip; Yong, Hoi Sen

    2012-01-01

    The fruit fly Bactrocera caudata is a pest species of economic importance in Asia. Its larvae feed on the flowers of Cucurbitaceae such as Cucurbita moschata. To-date it is distinguished from related species based on morphological characters. Specimens of B. caudata from Peninsular Malaysia and Indonesia (Bali and Lombok) were analysed using the partial DNA sequences of cytochrome c oxidase subunit I (COI) and 16S rRNA genes. Both gene sequences revealed that B. caudata from Peninsular Malaysia was distinctly different from B. caudata of Bali and Lombok, without common haplotype between them. Phylogenetic analysis revealed two distinct clades, indicating distinct genetic lineage. The uncorrected 'p' distance for COI sequences between B. caudata of Malaysia-Thailand-China and B. caudata of Bali-Lombok was 5.65%, for 16S sequences from 2.76 to 2.99%, and for combined COI and 16S sequences 4.45 to 4.46%. The 'p' values are distinctly different from intraspecific 'p' distance (0-0.23%). Both the B. caudata lineages are distinctly separated from related species in the subgenus Zeugodacus - B. ascita, B. scutellata, B. ishigakiensis, B. diaphora, B. tau, B. cucurbitae, and B. depressa. Molecular phylogenetic analysis indicates that the B. caudata lineages are closely related to B. ascita sp. B, and form a clade with B. scutellata, B. ishigakiensis, B. diaphora and B. ascita sp. A. This study provides additional baseline for the phylogenetic relationships of Bactrocera fruit flies of the subgenus Zeugodacus. Both the COI and 16S genes could be useful markers for the molecular differentiation and phylogenetic analysis of tephritid fruit flies.

  18. Distinct genetic lineages of Bactrocera caudata (Insecta: Tephritidae) revealed by COI and 16S DNA sequences.

    PubMed

    Lim, Phaik-Eem; Tan, Ji; Suana, I Wayan; Eamsobhana, Praphathip; Yong, Hoi Sen

    2012-01-01

    The fruit fly Bactrocera caudata is a pest species of economic importance in Asia. Its larvae feed on the flowers of Cucurbitaceae such as Cucurbita moschata. To-date it is distinguished from related species based on morphological characters. Specimens of B. caudata from Peninsular Malaysia and Indonesia (Bali and Lombok) were analysed using the partial DNA sequences of cytochrome c oxidase subunit I (COI) and 16S rRNA genes. Both gene sequences revealed that B. caudata from Peninsular Malaysia was distinctly different from B. caudata of Bali and Lombok, without common haplotype between them. Phylogenetic analysis revealed two distinct clades, indicating distinct genetic lineage. The uncorrected 'p' distance for COI sequences between B. caudata of Malaysia-Thailand-China and B. caudata of Bali-Lombok was 5.65%, for 16S sequences from 2.76 to 2.99%, and for combined COI and 16S sequences 4.45 to 4.46%. The 'p' values are distinctly different from intraspecific 'p' distance (0-0.23%). Both the B. caudata lineages are distinctly separated from related species in the subgenus Zeugodacus - B. ascita, B. scutellata, B. ishigakiensis, B. diaphora, B. tau, B. cucurbitae, and B. depressa. Molecular phylogenetic analysis indicates that the B. caudata lineages are closely related to B. ascita sp. B, and form a clade with B. scutellata, B. ishigakiensis, B. diaphora and B. ascita sp. A. This study provides additional baseline for the phylogenetic relationships of Bactrocera fruit flies of the subgenus Zeugodacus. Both the COI and 16S genes could be useful markers for the molecular differentiation and phylogenetic analysis of tephritid fruit flies. PMID:22615962

  19. Distinct Genetic Lineages of Bactrocera caudata (Insecta: Tephritidae) Revealed by COI and 16S DNA Sequences

    PubMed Central

    Lim, Phaik-Eem; Tan, Ji; Suana, I. Wayan; Eamsobhana, Praphathip; Yong, Hoi Sen

    2012-01-01

    The fruit fly Bactrocera caudata is a pest species of economic importance in Asia. Its larvae feed on the flowers of Cucurbitaceae such as Cucurbita moschata. To-date it is distinguished from related species based on morphological characters. Specimens of B. caudata from Peninsular Malaysia and Indonesia (Bali and Lombok) were analysed using the partial DNA sequences of cytochrome c oxidase subunit I (COI) and 16S rRNA genes. Both gene sequences revealed that B. caudata from Peninsular Malaysia was distinctly different from B. caudata of Bali and Lombok, without common haplotype between them. Phylogenetic analysis revealed two distinct clades, indicating distinct genetic lineage. The uncorrected ‘p’ distance for COI sequences between B. caudata of Malaysia-Thailand-China and B. caudata of Bali-Lombok was 5.65%, for 16S sequences from 2.76 to 2.99%, and for combined COI and 16S sequences 4.45 to 4.46%. The ‘p’ values are distinctly different from intraspecific ‘p’ distance (0–0.23%). Both the B. caudata lineages are distinctly separated from related species in the subgenus Zeugodacus – B. ascita, B. scutellata, B. ishigakiensis, B. diaphora, B. tau, B. cucurbitae, and B. depressa. Molecular phylogenetic analysis indicates that the B. caudata lineages are closely related to B. ascita sp. B, and form a clade with B. scutellata, B. ishigakiensis, B. diaphora and B. ascita sp. A. This study provides additional baseline for the phylogenetic relationships of Bactrocera fruit flies of the subgenus Zeugodacus. Both the COI and 16S genes could be useful markers for the molecular differentiation and phylogenetic analysis of tephritid fruit flies. PMID:22615962

  20. Whole-genome sequencing of six dog breeds from continuous altitudes reveals adaptation to high-altitude hypoxia

    PubMed Central

    Gou, Xiao; Wang, Zhen; Li, Ning; Qiu, Feng; Xu, Ze; Yan, Dawei; Yang, Shuli; Jia, Jia; Kong, Xiaoyan; Wei, Zehui; Lu, Shaoxiong; Lian, Linsheng; Wu, Changxin; Wang, Xueyan; Li, Guozhi; Ma, Teng; Jiang, Qiang; Zhao, Xue; Yang, Jiaqiang; Liu, Baohong; Wei, Dongkai; Li, Hong; Yang, Jianfa; Yan, Yulin; Zhao, Guiying; Dong, Xinxing; Li, Mingli; Deng, Weidong; Leng, Jing; Wei, Chaochun; Wang, Chuan; Mao, Huaming; Zhang, Hao; Ding, Guohui; Li, Yixue

    2014-01-01

    The hypoxic environment imposes severe selective pressure on species living at high altitude. To understand the genetic bases of adaptation to high altitude in dogs, we performed whole-genome sequencing of 60 dogs including five breeds living at continuous altitudes along the Tibetan Plateau from 800 to 5100 m as well as one European breed. More than 150× sequencing coverage for each breed provides us with a comprehensive assessment of the genetic polymorphisms of the dogs, including Tibetan Mastiffs. Comparison of the breeds from different altitudes reveals strong signals of population differentiation at the locus of hypoxia-related genes including endothelial Per-Arnt-Sim (PAS) domain protein 1 (EPAS1) and beta hemoglobin cluster. Notably, four novel nonsynonymous mutations specific to high-altitude dogs are identified at EPAS1, one of which occurred at a quite conserved site in the PAS domain. The association testing between EPAS1 genotypes and blood-related phenotypes on additional high-altitude dogs reveals that the homozygous mutation is associated with decreased blood flow resistance, which may help to improve hemorheologic fitness. Interestingly, EPAS1 was also identified as a selective target in Tibetan highlanders, though no amino acid changes were found. Thus, our results not only indicate parallel evolution of humans and dogs in adaptation to high-altitude hypoxia, but also provide a new opportunity to study the role of EPAS1 in the adaptive processes. PMID:24721644

  1. Sequence of the human 40-kDa keratin reveals an unusual structure with very high sequence identity to the corresponding bovine keratin.

    PubMed Central

    Eckert, R L

    1988-01-01

    The complete amino acid and DNA sequences of the human 40-kDa keratin are reported. The DNA sequence encodes a protein of 44,098 Da, which is unique in that it lacks the terminal non-alpha-helical tail segment found in all other keratins. When the human 40-kDa keratin amino acid sequence is compared to the corresponding bovine keratin, the overall identity is 89%. The coil-forming regions are 89% identical and the head regions are 88% identical. This similarity is also evident in the DNA sequence of the coding region, the 5' upstream sequences, and the 3' noncoding sequences. The high degree of cross-species identity between bovine and human 40-kDa keratins suggests that there is strong evolutionary pressure to conserve the structure of this keratin. This in turn suggests an important and universal role for this intermediate filament subunit in all species. Images PMID:2448790

  2. Natural vs. random protein sequences: Discovering combinatorics properties on amino acid words.

    PubMed

    Santoni, Daniele; Felici, Giovanni; Vergni, Davide

    2016-02-21

    Casual mutations and natural selection have driven the evolution of protein amino acid sequences that we observe at present in nature. The question about which is the dominant force of proteins evolution is still lacking of an unambiguous answer. Casual mutations tend to randomize protein sequences while, in order to have the correct functionality, one expects that selection mechanisms impose rigid constraints on amino acid sequences. Moreover, one also has to consider that the space of all possible amino acid sequences is so astonishingly large that it could be reasonable to have a well tuned amino acid sequence indistinguishable from a random one. In order to study the possibility to discriminate between random and natural amino acid sequences, we introduce different measures of association between pairs of amino acids in a sequence, and apply them to a dataset of 1047 natural protein sequences and 10,470 random sequences, carefully generated in order to preserve the relative length and amino acid distribution of the natural proteins. We analyze the multidimensional measures with machine learning techniques and show that, to a reasonable extent, natural protein sequences can be differentiated from random ones.

  3. Natural vs. random protein sequences: Discovering combinatorics properties on amino acid words.

    PubMed

    Santoni, Daniele; Felici, Giovanni; Vergni, Davide

    2016-02-21

    Casual mutations and natural selection have driven the evolution of protein amino acid sequences that we observe at present in nature. The question about which is the dominant force of proteins evolution is still lacking of an unambiguous answer. Casual mutations tend to randomize protein sequences while, in order to have the correct functionality, one expects that selection mechanisms impose rigid constraints on amino acid sequences. Moreover, one also has to consider that the space of all possible amino acid sequences is so astonishingly large that it could be reasonable to have a well tuned amino acid sequence indistinguishable from a random one. In order to study the possibility to discriminate between random and natural amino acid sequences, we introduce different measures of association between pairs of amino acids in a sequence, and apply them to a dataset of 1047 natural protein sequences and 10,470 random sequences, carefully generated in order to preserve the relative length and amino acid distribution of the natural proteins. We analyze the multidimensional measures with machine learning techniques and show that, to a reasonable extent, natural protein sequences can be differentiated from random ones. PMID:26656109

  4. Sequence-defined bioactive macrocycles via an acid-catalysed cascade reaction

    NASA Astrophysics Data System (ADS)

    Porel, Mintu; Thornlow, Dana N.; Phan, Ngoc N.; Alabi, Christopher A.

    2016-06-01

    Synthetic macrocycles derived from sequence-defined oligomers are a unique structural class whose ring size, sequence and structure can be tuned via precise organization of the primary sequence. Similar to peptides and other peptidomimetics, these well-defined synthetic macromolecules become pharmacologically relevant when bioactive side chains are incorporated into their primary sequence. In this article, we report the synthesis of oligothioetheramide (oligoTEA) macrocycles via a one-pot acid-catalysed cascade reaction. The versatility of the cyclization chemistry and modularity of the assembly process was demonstrated via the synthesis of >20 diverse oligoTEA macrocycles. Structural characterization via NMR spectroscopy revealed the presence of conformational isomers, which enabled the determination of local chain dynamics within the macromolecular structure. Finally, we demonstrate the biological activity of oligoTEA macrocycles designed to mimic facially amphiphilic antimicrobial peptides. The preliminary results indicate that macrocyclic oligoTEAs with just two-to-three cationic charge centres can elicit potent antibacterial activity against Gram-positive and Gram-negative bacteria.

  5. Multilocus Sequence Analysis of Nectar Pseudomonads Reveals High Genetic Diversity and Contrasting Recombination Patterns

    PubMed Central

    Álvarez-Pérez, Sergio; de Vega, Clara; Herrera, Carlos M.

    2013-01-01

    The genetic and evolutionary relationships among floral nectar-dwelling Pseudomonas ‘sensu stricto’ isolates associated to South African and Mediterranean plants were investigated by multilocus sequence analysis (MLSA) of four core housekeeping genes (rrs, gyrB, rpoB and rpoD). A total of 35 different sequence types were found for the 38 nectar bacterial isolates characterised. Phylogenetic analyses resulted in the identification of three main clades [nectar groups (NGs) 1, 2 and 3] of nectar pseudomonads, which were closely related to five intrageneric groups: Pseudomonas oryzihabitans (NG 1); P. fluorescens, P. lutea and P. syringae (NG 2); and P. rhizosphaerae (NG 3). Linkage disequilibrium analysis pointed to a mostly clonal population structure, even when the analysis was restricted to isolates from the same floristic region or belonging to the same NG. Nevertheless, signatures of recombination were observed for NG 3, which exclusively included isolates retrieved from the floral nectar of insect-pollinated Mediterranean plants. In contrast, the other two NGs comprised both South African and Mediterranean isolates. Analyses relating diversification to floristic region and pollinator type revealed that there has been more unique evolution of the nectar pseudomonads within the Mediterranean region than would be expected by chance. This is the first work analysing the sequence of multiple loci to reveal geno- and ecotypes of nectar bacteria. PMID:24116076

  6. Multilocus sequence analysis of nectar pseudomonads reveals high genetic diversity and contrasting recombination patterns.

    PubMed

    Alvarez-Pérez, Sergio; de Vega, Clara; Herrera, Carlos M

    2013-01-01

    The genetic and evolutionary relationships among floral nectar-dwelling Pseudomonas 'sensu stricto' isolates associated to South African and Mediterranean plants were investigated by multilocus sequence analysis (MLSA) of four core housekeeping genes (rrs, gyrB, rpoB and rpoD). A total of 35 different sequence types were found for the 38 nectar bacterial isolates characterised. Phylogenetic analyses resulted in the identification of three main clades [nectar groups (NGs) 1, 2 and 3] of nectar pseudomonads, which were closely related to five intrageneric groups: Pseudomonas oryzihabitans (NG 1); P. fluorescens, P. lutea and P. syringae (NG 2); and P. rhizosphaerae (NG 3). Linkage disequilibrium analysis pointed to a mostly clonal population structure, even when the analysis was restricted to isolates from the same floristic region or belonging to the same NG. Nevertheless, signatures of recombination were observed for NG 3, which exclusively included isolates retrieved from the floral nectar of insect-pollinated Mediterranean plants. In contrast, the other two NGs comprised both South African and Mediterranean isolates. Analyses relating diversification to floristic region and pollinator type revealed that there has been more unique evolution of the nectar pseudomonads within the Mediterranean region than would be expected by chance. This is the first work analysing the sequence of multiple loci to reveal geno- and ecotypes of nectar bacteria.

  7. Multilocus sequence analysis of nectar pseudomonads reveals high genetic diversity and contrasting recombination patterns.

    PubMed

    Alvarez-Pérez, Sergio; de Vega, Clara; Herrera, Carlos M

    2013-01-01

    The genetic and evolutionary relationships among floral nectar-dwelling Pseudomonas 'sensu stricto' isolates associated to South African and Mediterranean plants were investigated by multilocus sequence analysis (MLSA) of four core housekeeping genes (rrs, gyrB, rpoB and rpoD). A total of 35 different sequence types were found for the 38 nectar bacterial isolates characterised. Phylogenetic analyses resulted in the identification of three main clades [nectar groups (NGs) 1, 2 and 3] of nectar pseudomonads, which were closely related to five intrageneric groups: Pseudomonas oryzihabitans (NG 1); P. fluorescens, P. lutea and P. syringae (NG 2); and P. rhizosphaerae (NG 3). Linkage disequilibrium analysis pointed to a mostly clonal population structure, even when the analysis was restricted to isolates from the same floristic region or belonging to the same NG. Nevertheless, signatures of recombination were observed for NG 3, which exclusively included isolates retrieved from the floral nectar of insect-pollinated Mediterranean plants. In contrast, the other two NGs comprised both South African and Mediterranean isolates. Analyses relating diversification to floristic region and pollinator type revealed that there has been more unique evolution of the nectar pseudomonads within the Mediterranean region than would be expected by chance. This is the first work analysing the sequence of multiple loci to reveal geno- and ecotypes of nectar bacteria. PMID:24116076

  8. Appearances Can Be Deceptive: Revealing a Hidden Viral Infection with Deep Sequencing in a Plant Quarantine Context

    PubMed Central

    Candresse, Thierry; Filloux, Denis; Muhire, Brejnev; Julian, Charlotte; Galzi, Serge; Fort, Guillaume; Bernardo, Pauline; Daugrois, Jean-Heindrich; Fernandez, Emmanuel; Martin, Darren P.; Varsani, Arvind; Roumagnac, Philippe

    2014-01-01

    Comprehensive inventories of plant viral diversity are essential for effective quarantine and sanitation efforts. The safety of regulated plant material exchanges presently relies heavily on techniques such as PCR or nucleic acid hybridisation, which are only suited to the detection and characterisation of specific, well characterised pathogens. Here, we demonstrate the utility of sequence-independent next generation sequencing (NGS) of both virus-derived small interfering RNAs (siRNAs) and virion-associated nucleic acids (VANA) for the detailed identification and characterisation of viruses infecting two quarantined sugarcane plants. Both plants originated from Egypt and were known to be infected with Sugarcane streak Egypt Virus (SSEV; Genus Mastrevirus, Family Geminiviridae), but were revealed by the NGS approaches to also be infected by a second highly divergent mastrevirus, here named Sugarcane white streak Virus (SWSV). This novel virus had escaped detection by all routine quarantine detection assays and was found to also be present in sugarcane plants originating from Sudan. Complete SWSV genomes were cloned and sequenced from six plants and all were found to share >91% genome-wide identity. With the exception of two SWSV variants, which potentially express unusually large RepA proteins, the SWSV isolates display genome characteristics very typical to those of all other previously described mastreviruses. An analysis of virus-derived siRNAs for SWSV and SSEV showed them to be strongly influenced by secondary structures within both genomic single stranded DNA and mRNA transcripts. In addition, the distribution of siRNA size frequencies indicates that these mastreviruses are likely subject to both transcriptional and post-transcriptional gene silencing. Our study stresses the potential advantages of NGS-based virus metagenomic screening in a plant quarantine setting and indicates that such techniques could dramatically reduce the numbers of non

  9. Deep Sequencing Reveals Novel Genetic Variants in Children with Acute Liver Failure and Tissue Evidence of Impaired Energy Metabolism

    PubMed Central

    Valencia, C. Alexander; Wang, Xinjian; Wang, Jin; Peters, Anna; Simmons, Julia R.; Moran, Molly C.; Mathur, Abhinav; Husami, Ammar; Qian, Yaping; Sheridan, Rachel; Bove, Kevin E.; Witte, David; Huang, Taosheng; Miethke, Alexander G.

    2016-01-01

    Background & Aims The etiology of acute liver failure (ALF) remains elusive in almost half of affected children. We hypothesized that inherited mitochondrial and fatty acid oxidation disorders were occult etiological factors in patients with idiopathic ALF and impaired energy metabolism. Methods Twelve patients with elevated blood molar lactate/pyruvate ratio and indeterminate etiology were selected from a retrospective cohort of 74 subjects with ALF because their fixed and frozen liver samples were available for histological, ultrastructural, molecular and biochemical analysis. Results A customized next-generation sequencing panel for 26 genes associated with mitochondrial and fatty acid oxidation defects revealed mutations and sequence variants in five subjects. Variants involved the genes ACAD9, POLG, POLG2, DGUOK, and RRM2B; the latter not previously reported in subjects with ALF. The explanted livers of the patients with heterozygous, truncating insertion mutations in RRM2B showed patchy micro- and macrovesicular steatosis, decreased mitochondrial DNA (mtDNA) content <30% of controls, and reduced respiratory chain complex activity; both patients had good post-transplant outcome. One infant with severe lactic acidosis was found to carry two heterozygous variants in ACAD9, which was associated with isolated complex I deficiency and diffuse hypergranular hepatocytes. The two subjects with heterozygous variants of unknown clinical significance in POLG and DGUOK developed ALF following drug exposure. Their hepatocytes displayed abnormal mitochondria by electron microscopy. Conclusion Targeted next generation sequencing and correlation with histological, ultrastructural and functional studies on liver tissue in children with elevated lactate/pyruvate ratio expand the spectrum of genes associated with pediatric ALF. PMID:27483465

  10. Complete genome sequence of Fer-de-Lance Virus reveals a novel gene in reptilian Paramyxoviruses

    USGS Publications Warehouse

    Kurath, G.; Batts, W.N.; Ahne, W.; Winton, J.R.

    2004-01-01

    The complete RNA genome sequence of the archetype reptilian paramyxovirus, Fer-de-Lance virus (FDLV), has been determined. The genome is 15,378 nucleotides in length and consists of seven nonoverlapping genes in the order 3??? N-U-P-M-F-HN-L 5???, coding for the nucleocapsid, unknown, phospho-, matrix, fusion, hemagglutinin-neuraminidase, and large polymerase proteins, respectively. The gene junctions contain highly conserved transcription start and stop signal sequences and tri-nucleotide intergenic regions similar to those of other Paramyxoviridae. The FDLV P gene expression strategy is like that of rubulaviruses, which express the accessory V protein from the primary transcript and edit a portion of the mRNA to encode P and I proteins. There is also an overlapping open reading frame potentially encoding a small basic protein in the P gene. The gene designated U (unknown), encodes a deduced protein of 19.4 kDa that has no counterpart in other paramyxoviruses and has no similarity with sequences in the National Center for Biotechnology Information database. Active transcription of the U gene in infected cells was demonstrated by Northern blot analysis, and bicistronic N-U mRNA was also evident. The genomes of two other snake paramyxovirus genotypes were also found to have U genes, with 11 to 16% nucleotide divergence from the FDLV U gene. Pairwise comparisons of amino acid identities and phylogenetic analyses of all deduced FDLV protein sequences with homologous sequences from other Paramyxoviridae indicate that FDLV represents a new genus within the subfamily Paramyxovirinae. We suggest the name Ferlavirus for the new genus, with FDLV as the type species.

  11. Exome sequencing of ion channel genes reveals complex variant profiles confounding personal risk assessment in epilepsy

    PubMed Central

    Klassen, Tara; Davis, Caleb; Goldman, Alica; Burgess, Dan; Chen, Tim; Wheeler, David; McPherson, John; Bourquin, Traci; Lewis, Lora; Villasana, Donna; Morgan, Margaret; Muzny, Donna; Gibbs, Richard; Noebels, Jeffrey

    2011-01-01

    Ion channel mutations are an important cause of rare Mendelian disorders affecting brain, heart, and other tissues. We performed parallel exome sequencing of 237 channel genes in a well characterized human sample, comparing variant profiles of unaffected individuals to those with the most common neuronal excitability disorder, sporadic idiopathic epilepsy. Rare missense variation in known Mendelian disease genes is prevalent in both groups at similar complexity, revealing that even deleterious ion channel mutations confer uncertain risk to an individual depending on the other variants with which they are combined. Our findings indicate that variant discovery via large scale sequencing efforts is only a first step in illuminating the complex allelic architecture underlying personal disease risk. We propose that in silico modeling of channel variation in realistic cell and network models will be crucial to future strategies assessing mutation profile pathogenicity and drug response in individuals with a broad spectrum of excitability disorders. PMID:21703448

  12. Metagenome sequence analysis of filamentous microbial communities obtained from geochemically distinct geothermal channels reveals specialization of three aquificales lineages.

    PubMed

    Takacs-Vesbach, Cristina; Inskeep, William P; Jay, Zackary J; Herrgard, Markus J; Rusch, Douglas B; Tringe, Susannah G; Kozubal, Mark A; Hamamura, Natsuko; Macur, Richard E; Fouke, Bruce W; Reysenbach, Anna-Louise; McDermott, Timothy R; Jennings, Ryan deM; Hengartner, Nicolas W; Xie, Gary

    2013-01-01

    The Aquificales are thermophilic microorganisms that inhabit hydrothermal systems worldwide and are considered one of the earliest lineages of the domain Bacteria. We analyzed metagenome sequence obtained from six thermal "filamentous streamer" communities (∼40 Mbp per site), which targeted three different groups of Aquificales found in Yellowstone National Park (YNP). Unassembled metagenome sequence and PCR-amplified 16S rRNA gene libraries revealed that acidic, sulfidic sites were dominated by Hydrogenobaculum (Aquificaceae) populations, whereas the circum-neutral pH (6.5-7.8) sites containing dissolved sulfide were dominated by Sulfurihydrogenibium spp. (Hydrogenothermaceae). Thermocrinis (Aquificaceae) populations were found primarily in the circum-neutral sites with undetectable sulfide, and to a lesser extent in one sulfidic system at pH 8. Phylogenetic analysis of assembled sequence containing 16S rRNA genes as well as conserved protein-encoding genes revealed that the composition and function of these communities varied across geochemical conditions. Each Aquificales lineage contained genes for CO2 fixation by the reverse-TCA cycle, but only the Sulfurihydrogenibium populations perform citrate cleavage using ATP citrate lyase (Acl). The Aquificaceae populations use an alternative pathway catalyzed by two separate enzymes, citryl-CoA synthetase (Ccs), and citryl-CoA lyase (Ccl). All three Aquificales lineages contained evidence of aerobic respiration, albeit due to completely different types of heme Cu oxidases (subunit I) involved in oxygen reduction. The distribution of Aquificales populations and differences among functional genes involved in energy generation and electron transport is consistent with the hypothesis that geochemical parameters (e.g., pH, sulfide, H2, O2) have resulted in niche specialization among members of the Aquificales.

  13. Metagenome Sequence Analysis of Filamentous Microbial Communities Obtained from Geochemically Distinct Geothermal Channels Reveals Specialization of Three Aquificales Lineages

    PubMed Central

    Takacs-Vesbach, Cristina; Inskeep, William P.; Jay, Zackary J.; Herrgard, Markus J.; Rusch, Douglas B.; Tringe, Susannah G.; Kozubal, Mark A.; Hamamura, Natsuko; Macur, Richard E.; Fouke, Bruce W.; Reysenbach, Anna-Louise; McDermott, Timothy R.; Jennings, Ryan deM.; Hengartner, Nicolas W.; Xie, Gary

    2013-01-01

    The Aquificales are thermophilic microorganisms that inhabit hydrothermal systems worldwide and are considered one of the earliest lineages of the domain Bacteria. We analyzed metagenome sequence obtained from six thermal “filamentous streamer” communities (∼40 Mbp per site), which targeted three different groups of Aquificales found in Yellowstone National Park (YNP). Unassembled metagenome sequence and PCR-amplified 16S rRNA gene libraries revealed that acidic, sulfidic sites were dominated by Hydrogenobaculum (Aquificaceae) populations, whereas the circum-neutral pH (6.5–7.8) sites containing dissolved sulfide were dominated by Sulfurihydrogenibium spp. (Hydrogenothermaceae). Thermocrinis (Aquificaceae) populations were found primarily in the circum-neutral sites with undetectable sulfide, and to a lesser extent in one sulfidic system at pH 8. Phylogenetic analysis of assembled sequence containing 16S rRNA genes as well as conserved protein-encoding genes revealed that the composition and function of these communities varied across geochemical conditions. Each Aquificales lineage contained genes for CO2 fixation by the reverse-TCA cycle, but only the Sulfurihydrogenibium populations perform citrate cleavage using ATP citrate lyase (Acl). The Aquificaceae populations use an alternative pathway catalyzed by two separate enzymes, citryl-CoA synthetase (Ccs), and citryl-CoA lyase (Ccl). All three Aquificales lineages contained evidence of aerobic respiration, albeit due to completely different types of heme Cu oxidases (subunit I) involved in oxygen reduction. The distribution of Aquificales populations and differences among functional genes involved in energy generation and electron transport is consistent with the hypothesis that geochemical parameters (e.g., pH, sulfide, H2, O2) have resulted in niche specialization among members of the Aquificales. PMID:23755042

  14. Metagenome sequence analysis of filamentous microbial communities obtained from geochemically distinct geothermal channels reveals specialization of three aquificales lineages.

    PubMed

    Takacs-Vesbach, Cristina; Inskeep, William P; Jay, Zackary J; Herrgard, Markus J; Rusch, Douglas B; Tringe, Susannah G; Kozubal, Mark A; Hamamura, Natsuko; Macur, Richard E; Fouke, Bruce W; Reysenbach, Anna-Louise; McDermott, Timothy R; Jennings, Ryan deM; Hengartner, Nicolas W; Xie, Gary

    2013-01-01

    The Aquificales are thermophilic microorganisms that inhabit hydrothermal systems worldwide and are considered one of the earliest lineages of the domain Bacteria. We analyzed metagenome sequence obtained from six thermal "filamentous streamer" communities (∼40 Mbp per site), which targeted three different groups of Aquificales found in Yellowstone National Park (YNP). Unassembled metagenome sequence and PCR-amplified 16S rRNA gene libraries revealed that acidic, sulfidic sites were dominated by Hydrogenobaculum (Aquificaceae) populations, whereas the circum-neutral pH (6.5-7.8) sites containing dissolved sulfide were dominated by Sulfurihydrogenibium spp. (Hydrogenothermaceae). Thermocrinis (Aquificaceae) populations were found primarily in the circum-neutral sites with undetectable sulfide, and to a lesser extent in one sulfidic system at pH 8. Phylogenetic analysis of assembled sequence containing 16S rRNA genes as well as conserved protein-encoding genes revealed that the composition and function of these communities varied across geochemical conditions. Each Aquificales lineage contained genes for CO2 fixation by the reverse-TCA cycle, but only the Sulfurihydrogenibium populations perform citrate cleavage using ATP citrate lyase (Acl). The Aquificaceae populations use an alternative pathway catalyzed by two separate enzymes, citryl-CoA synthetase (Ccs), and citryl-CoA lyase (Ccl). All three Aquificales lineages contained evidence of aerobic respiration, albeit due to completely different types of heme Cu oxidases (subunit I) involved in oxygen reduction. The distribution of Aquificales populations and differences among functional genes involved in energy generation and electron transport is consistent with the hypothesis that geochemical parameters (e.g., pH, sulfide, H2, O2) have resulted in niche specialization among members of the Aquificales. PMID:23755042

  15. Peptide Vocabulary Analysis Reveals Ultra-Conservation and Homonymity in Protein Sequences

    PubMed Central

    Gatherer, Derek

    2007-01-01

    A new algorithm is presented for vocabulary analysis (word detection) in texts of human origin. It performs at 60%–70% overall accuracy and greater than 80% accuracy for longer words, and approximately 85% sensitivity on Alice in Wonderland, a considerable improvement on previous methods. When applied to protein sequences, it detects short sequences analogous to words in human texts, i.e. intolerant to changes in spelling (mutation), and relatively context-independent in their meaning (function). Some of these are homonyms of up to 7 amino acids, which can assume different structures in different proteins. Others are ultra-conserved stretches of up to 18 amino acids within proteins of less than 40% overall identity, reflecting extreme constraint or convergent evolution. Different species are found to have qualitatively different major peptide vocabularies, e.g. some are dominated by large gene families, while others are rich in simple repeats or dominated by internally repetitive proteins. This suggests the possibility of a peptide vocabulary signature, analogous to genome signatures in DNA. Homonyms may be useful in detecting convergent evolution and positive selection in protein evolution. Ultra-conserved words may be useful in identifying structures intolerant to substitution over long periods of evolutionary time. PMID:20066129

  16. Penicillium arizonense, a new, genome sequenced fungal species, reveals a high chemical diversity in secreted metabolites

    PubMed Central

    Grijseels, Sietske; Nielsen, Jens Christian; Randelovic, Milica; Nielsen, Jens; Nielsen, Kristian Fog; Workman, Mhairi; Frisvad, Jens Christian

    2016-01-01

    A new soil-borne species belonging to the Penicillium section Canescentia is described, Penicillium arizonense sp. nov. (type strain CBS 141311T = IBT 12289T). The genome was sequenced and assembled into 33.7 Mb containing 12,502 predicted genes. A phylogenetic assessment based on marker genes confirmed the grouping of P. arizonense within section Canescentia. Compared to related species, P. arizonense proved to encode a high number of proteins involved in carbohydrate metabolism, in particular hemicellulases. Mining the genome for genes involved in secondary metabolite biosynthesis resulted in the identification of 62 putative biosynthetic gene clusters. Extracts of P. arizonense were analysed for secondary metabolites and austalides, pyripyropenes, tryptoquivalines, fumagillin, pseurotin A, curvulinic acid and xanthoepocin were detected. A comparative analysis against known pathways enabled the proposal of biosynthetic gene clusters in P. arizonense responsible for the synthesis of all detected compounds except curvulinic acid. The capacity to produce biomass degrading enzymes and the identification of a high chemical diversity in secreted bioactive secondary metabolites, offers a broad range of potential industrial applications for the new species P. arizonense. The description and availability of the genome sequence of P. arizonense, further provides the basis for biotechnological exploitation of this species. PMID:27739446

  17. Transcriptomic Sequencing Reveals a Set of Unique Genes Activated by Butyrate-Induced Histone Modification.

    PubMed

    Li, Cong-Jun; Li, Robert W; Baldwin, Ransom L; Blomberg, Le Ann; Wu, Sitao; Li, Weizhong

    2016-01-01

    Butyrate is a nutritional element with strong epigenetic regulatory activity as a histone deacetylase inhibitor. Based on the analysis of differentially expressed genes in the bovine epithelial cells using RNA sequencing technology, a set of unique genes that are activated only after butyrate treatment were revealed. A complementary bioinformatics analysis of the functional category, pathway, and integrated network, using Ingenuity Pathways Analysis, indicated that these genes activated by butyrate treatment are related to major cellular functions, including cell morphological changes, cell cycle arrest, and apoptosis. Our results offered insight into the butyrate-induced transcriptomic changes and will accelerate our discerning of the molecular fundamentals of epigenomic regulation. PMID:26819550

  18. Transcriptomic Sequencing Reveals a Set of Unique Genes Activated by Butyrate-Induced Histone Modification

    PubMed Central

    Li, Cong-Jun; Li, Robert W.; Baldwin, Ransom L.; Blomberg, Le Ann; Wu, Sitao; Li, Weizhong

    2016-01-01

    Butyrate is a nutritional element with strong epigenetic regulatory activity as a histone deacetylase inhibitor. Based on the analysis of differentially expressed genes in the bovine epithelial cells using RNA sequencing technology, a set of unique genes that are activated only after butyrate treatment were revealed. A complementary bioinformatics analysis of the functional category, pathway, and integrated network, using Ingenuity Pathways Analysis, indicated that these genes activated by butyrate treatment are related to major cellular functions, including cell morphological changes, cell cycle arrest, and apoptosis. Our results offered insight into the butyrate-induced transcriptomic changes and will accelerate our discerning of the molecular fundamentals of epigenomic regulation. PMID:26819550

  19. 3-d structure-based amino acid sequence alignment of esterases, lipases and related proteins

    SciTech Connect

    Gentry, M.K.; Doctor, B.P.; Cygler, M.; Schrag, J.D.; Sussman, J.L.

    1993-05-13

    Acetylcholinesterase and butyrylcholinesterase, enzymes with potential as pretreatment drugs for organophosphate toxicity, are members of a larger family of homologous proteins that includes carboxylesterases, cholesterol esterases, lipases, and several nonhydrolytic proteins. A computer-generated alignment of 18 of the proteins, the acetylcholinesases, butyrylcholinesterases, carboxylesterases, some esterases, and the nonenzymatic proteins has been previously presented. More recently, the three-dimensional structures of two enzymes enzymes in this group, acetylcholinesterase from Torpedo californica and lipase from Geotrichum candidum, have been determined. Based on the x-ray structures and the superposition of these two enzymes, it was possible to obtain an improved amino acid sequence alignment of 32 members of this family of proteins. Examination of this alignment reveals that 24 amino acids are invariant in all of the hydrolytic proteins, and an additional 49 are well conserved. Conserved amino acids include those of the active site, the disulfide bridges, the salt bridges, in the core of the proteins, and at the edges of secondary structural elements. Comparison of the three-dimensional structures makes it possible to find a well-defined structural basis for the conservation of many of these amino acids.

  20. High-throughput sequencing reveals an altered T cell repertoire in X-linked agammaglobulinemia.

    PubMed

    Ramesh, Manish; Simchoni, Noa; Hamm, David; Cunningham-Rundles, Charlotte

    2015-12-01

    To examine the T cell receptor structure in the absence of B cells, the TCR β CDR3 was sequenced from DNA of 15 X-linked agammaglobulinemia (XLA) subjects and 18 male controls, using the Illumina HiSeq platform and the ImmunoSEQ analyzer. V gene usage and the V-J combinations, derived from both productive and non-productive sequences, were significantly different between XLA samples and controls. Although the CDR3 length was similar for XLA and control samples, the CDR3 region of the XLA T cell receptor contained significantly fewer deletions and insertions in V, D, and J gene segments, differences intrinsic to the V(D)J recombination process and not due to peripheral T cell selection. XLA CDR3s demonstrated fewer charged amino acid residues, more sharing of CDR3 sequences, and almost completely lacked a population of highly modified Vβ gene segments found in control DNA, suggesting both a skewed and contracted T cell repertoire in XLA.

  1. Focused Evolution of HIV-1 Neutralizing Antibodies Revealed by Structures and Deep Sequencing

    SciTech Connect

    Wu, Xueling; Zhou, Tongqing; Zhu, Jiang; Zhang, Baoshan; Georgiev, Ivelin; Wang, Charlene; Chen, Xuejun; Longo, Nancy S.; Louder, Mark; McKee, Krisha; O’Dell, Sijy; Perfetto, Stephen; Schmidt, Stephen D.; Shi, Wei; Wu, Lan; Yang, Yongping; Yang, Zhi-Yong; Yang, Zhongjia; Zhang, Zhenhai; Bonsignori, Mattia; Crump, John A.; Kapiga, Saidi H.; Sam, Noel E.; Haynes, Barton F.; Simek, Melissa; Burton, Dennis R.; Koff, Wayne C.; Doria-Rose, Nicole A.; Connors, Mark; Mullikin, James C.; Nabel, Gary J.; Roederer, Mario; Shapiro, Lawrence; Kwong, Peter D.; Mascola, John R.

    2013-03-04

    Antibody VRC01 is a human immunoglobulin that neutralizes about 90% of HIV-1 isolates. To understand how such broadly neutralizing antibodies develop, we used x-ray crystallography and 454 pyrosequencing to characterize additional VRC01-like antibodies from HIV-1-infected individuals. Crystal structures revealed a convergent mode of binding for diverse antibodies to the same CD4-binding-site epitope. A functional genomics analysis of expressed heavy and light chains revealed common pathways of antibody-heavy chain maturation, confined to the IGHV1-2*02 lineage, involving dozens of somatic changes, and capable of pairing with different light chains. Broadly neutralizing HIV-1 immunity associated with VRC01-like antibodies thus involves the evolution of antibodies to a highly affinity-matured state required to recognize an invariant viral structure, with lineages defined from thousands of sequences providing a genetic roadmap of their development.

  2. Bacterial populations on brewery filling hall surfaces as revealed by next-generation sequencing.

    PubMed

    Priha, Outi; Raulio, Mari; Maukonen, Johanna; Vehviläinen, Anna-Kaisa; Storgårds, Erna

    2016-01-01

    Due to the presence of moisture and nutrients, brewery filling line surfaces are susceptible to unwanted microbial attachment. Knowledge of the attaching microbes will aid in designing hygienic control of the process. In this study the bacterial diversity present on brewery filling line surfaces was revealed by next generation sequencing. The two filling lines studied maintained their characteristic bacterial community throughout three sampling times (13-163 days). On the glass bottle line, γ-proteobacteria dominated (35-82% of all OTUs), whereas on the canning line α-, β- and γ-proteobacteria and actinobacteria were most common. The most frequently detected genera were Acinetobacter, Propinobacterium and Pseudomonas. The halophilic genus Halomonas was commonly detected, which might be due to its tolerance to alkaline foam cleaners. This study has revealed a detailed overall picture of the bacterial groups present on filling line surfaces. Further effort should be given to determine the efficacy of washing procedures on different bacterial groups. PMID:27064426

  3. RNase-mediated protein footprint sequencing reveals protein-binding sites throughout the human transcriptome.

    PubMed

    Silverman, Ian M; Li, Fan; Alexander, Anissa; Goff, Loyal; Trapnell, Cole; Rinn, John L; Gregory, Brian D

    2014-01-07

    Although numerous approaches have been developed to map RNA-binding sites of individual RNA-binding proteins (RBPs), few methods exist that allow assessment of global RBP-RNA interactions. Here, we describe PIP-seq, a universal, high-throughput, ribonuclease-mediated protein footprint sequencing approach that reveals RNA-protein interaction sites throughout a transcriptome of interest. We apply PIP-seq to the HeLa transcriptome and compare binding sites found using different cross-linkers and ribonucleases. From this analysis, we identify numerous putative RBP-binding motifs, reveal novel insights into co-binding by RBPs, and uncover a significant enrichment for disease-associated polymorphisms within RBP interaction sites.

  4. Nuclear species-diagnostic SNP markers mined from 454 amplicon sequencing reveal admixture genomic structure of modern citrus varieties.

    PubMed

    Curk, Franck; Ancillo, Gema; Ollitrault, Frédérique; Perrier, Xavier; Jacquemoud-Collet, Jean-Pierre; Garcia-Lor, Andres; Navarro, Luis; Ollitrault, Patrick

    2015-01-01

    Most cultivated Citrus species originated from interspecific hybridisation between four ancestral taxa (C. reticulata, C. maxima, C. medica, and C. micrantha) with limited further interspecific recombination due to vegetative propagation. This evolution resulted in admixture genomes with frequent interspecific heterozygosity. Moreover, a major part of the phenotypic diversity of edible citrus results from the initial differentiation between these taxa. Deciphering the phylogenomic structure of citrus germplasm is therefore essential for an efficient utilization of citrus biodiversity in breeding schemes. The objective of this work was to develop a set of species-diagnostic single nucleotide polymorphism (SNP) markers for the four Citrus ancestral taxa covering the nine chromosomes, and to use these markers to infer the phylogenomic structure of secondary species and modern cultivars. Species-diagnostic SNPs were mined from 454 amplicon sequencing of 57 gene fragments from 26 genotypes of the four basic taxa. Of the 1,053 SNPs mined from 28,507 kb sequence, 273 were found to be highly diagnostic for a single basic taxon. Species-diagnostic SNP markers (105) were used to analyse the admixture structure of varieties and rootstocks. This revealed C. maxima introgressions in most of the old and in all recent selections of mandarins, and suggested that C. reticulata × C. maxima reticulation and introgression processes were important in edible mandarin domestication. The large range of phylogenomic constitutions between C. reticulata and C. maxima revealed in mandarins, tangelos, tangors, sweet oranges, sour oranges, grapefruits, and orangelos is favourable for genetic association studies based on phylogenomic structures of the germplasm. Inferred admixture structures were in agreement with previous hypotheses regarding the origin of several secondary species and also revealed the probable origin of several acid citrus varieties. The developed species-diagnostic SNP

  5. Nuclear Species-Diagnostic SNP Markers Mined from 454 Amplicon Sequencing Reveal Admixture Genomic Structure of Modern Citrus Varieties

    PubMed Central

    Curk, Franck; Ancillo, Gema; Ollitrault, Frédérique; Perrier, Xavier; Jacquemoud-Collet, Jean-Pierre; Garcia-Lor, Andres; Navarro, Luis; Ollitrault, Patrick

    2015-01-01

    Most cultivated Citrus species originated from interspecific hybridisation between four ancestral taxa (C. reticulata, C. maxima, C. medica, and C. micrantha) with limited further interspecific recombination due to vegetative propagation. This evolution resulted in admixture genomes with frequent interspecific heterozygosity. Moreover, a major part of the phenotypic diversity of edible citrus results from the initial differentiation between these taxa. Deciphering the phylogenomic structure of citrus germplasm is therefore essential for an efficient utilization of citrus biodiversity in breeding schemes. The objective of this work was to develop a set of species-diagnostic single nucleotide polymorphism (SNP) markers for the four Citrus ancestral taxa covering the nine chromosomes, and to use these markers to infer the phylogenomic structure of secondary species and modern cultivars. Species-diagnostic SNPs were mined from 454 amplicon sequencing of 57 gene fragments from 26 genotypes of the four basic taxa. Of the 1,053 SNPs mined from 28,507 kb sequence, 273 were found to be highly diagnostic for a single basic taxon. Species-diagnostic SNP markers (105) were used to analyse the admixture structure of varieties and rootstocks. This revealed C. maxima introgressions in most of the old and in all recent selections of mandarins, and suggested that C. reticulata × C. maxima reticulation and introgression processes were important in edible mandarin domestication. The large range of phylogenomic constitutions between C. reticulata and C. maxima revealed in mandarins, tangelos, tangors, sweet oranges, sour oranges, grapefruits, and orangelos is favourable for genetic association studies based on phylogenomic structures of the germplasm. Inferred admixture structures were in agreement with previous hypotheses regarding the origin of several secondary species and also revealed the probable origin of several acid citrus varieties. The developed species-diagnostic SNP

  6. Nuclear species-diagnostic SNP markers mined from 454 amplicon sequencing reveal admixture genomic structure of modern citrus varieties.

    PubMed

    Curk, Franck; Ancillo, Gema; Ollitrault, Frédérique; Perrier, Xavier; Jacquemoud-Collet, Jean-Pierre; Garcia-Lor, Andres; Navarro, Luis; Ollitrault, Patrick

    2015-01-01

    Most cultivated Citrus species originated from interspecific hybridisation between four ancestral taxa (C. reticulata, C. maxima, C. medica, and C. micrantha) with limited further interspecific recombination due to vegetative propagation. This evolution resulted in admixture genomes with frequent interspecific heterozygosity. Moreover, a major part of the phenotypic diversity of edible citrus results from the initial differentiation between these taxa. Deciphering the phylogenomic structure of citrus germplasm is therefore essential for an efficient utilization of citrus biodiversity in breeding schemes. The objective of this work was to develop a set of species-diagnostic single nucleotide polymorphism (SNP) markers for the four Citrus ancestral taxa covering the nine chromosomes, and to use these markers to infer the phylogenomic structure of secondary species and modern cultivars. Species-diagnostic SNPs were mined from 454 amplicon sequencing of 57 gene fragments from 26 genotypes of the four basic taxa. Of the 1,053 SNPs mined from 28,507 kb sequence, 273 were found to be highly diagnostic for a single basic taxon. Species-diagnostic SNP markers (105) were used to analyse the admixture structure of varieties and rootstocks. This revealed C. maxima introgressions in most of the old and in all recent selections of mandarins, and suggested that C. reticulata × C. maxima reticulation and introgression processes were important in edible mandarin domestication. The large range of phylogenomic constitutions between C. reticulata and C. maxima revealed in mandarins, tangelos, tangors, sweet oranges, sour oranges, grapefruits, and orangelos is favourable for genetic association studies based on phylogenomic structures of the germplasm. Inferred admixture structures were in agreement with previous hypotheses regarding the origin of several secondary species and also revealed the probable origin of several acid citrus varieties. The developed species-diagnostic SNP

  7. Detection and isolation of nucleic acid sequences using a bifunctional hybridization probe

    DOEpatents

    Lucas, Joe N.; Straume, Tore; Bogen, Kenneth T.

    2000-01-01

    A method for detecting and isolating a target sequence in a sample of nucleic acids is provided using a bifunctional hybridization probe capable of hybridizing to the target sequence that includes a detectable marker and a first complexing agent capable of forming a binding pair with a second complexing agent. A kit is also provided for detecting a target sequence in a sample of nucleic acids using a bifunctional hybridization probe according to this method.

  8. Sequence characterization of S100A8 gene reveals structural differences of protein and transcriptional factor binding sites in water buffalo and yak.

    PubMed

    Kathiravan, P; Goyal, S; Kataria, R S; Mishra, B P; Jayakumar, S; Joshi, B K

    2011-01-01

    The present study was undertaken to characterize the structure of S100A8 gene and its promoter in water buffalo and yak. Sequence data of 2.067 kb, 2.071 kb, and 2.052 kb with respect to complete S100A8 gene including 5' flanking region was generated in river buffalo, swamp buffalo, and yak, respectively. BLAST analysis of coding DNA sequences (CDS) of S100A8 gene revealed 95% homology of buffalo sequence with cattle, 85% with pig and horse, 83% with dog, 72-73% with murines, and around 79% with primates and humans. Phylogenetic analysis of predicted CDS revealed distinct clustering of murines, primates, and domestic animals with bovines and bubalines forming a subcluster among farm animals. In silico translation of predicted CDS revealed a sequence of 89 amino acids with 7 amino acid changes between cattle and buffalo and 2 changes between cattle and yak. The search for Pfam family revealed the N-terminal calcium binding domain and the noncanonical EF hand domain in the carboxy terminus, with more variations being observed in the N-terminal domain among different species. Two amino acid changes observed in carboxy terminal EF hand domain resulted in altered secondary structure of yak S100A8 protein. Analysis of S100A8 gene promoter revealed 14 putative motifs for transcriptional factor binding sites. Two putative motifs viz. C/EBP and v-Myb were found to be absent in swamp buffalo as compared to river buffalo and cattle. Differences in the structure of S100A8 protein and the transcriptional factor binding sites identified in the present study need to be analyzed further for their functional significance in yak and swamp buffalo respectively.

  9. Genome sequencing reveals fine scale diversification and reticulation history during speciation in Sus

    PubMed Central

    2013-01-01

    Background Elucidating the process of speciation requires an in-depth understanding of the evolutionary history of the species in question. Studies that rely upon a limited number of genetic loci do not always reveal actual evolutionary history, and often confuse inferences related to phylogeny and speciation. Whole-genome data, however, can overcome this issue by providing a nearly unbiased window into the patterns and processes of speciation. In order to reveal the complexity of the speciation process, we sequenced and analyzed the genomes of 10 wild pigs, representing morphologically or geographically well-defined species and subspecies of the genus Sus from insular and mainland Southeast Asia, and one African common warthog. Results Our data highlight the importance of past cyclical climatic fluctuations in facilitating the dispersal and isolation of populations, thus leading to the diversification of suids in one of the most species-rich regions of the world. Moreover, admixture analyses revealed extensive, intra- and inter-specific gene-flow that explains previous conflicting results obtained from a limited number of loci. We show that these multiple episodes of gene-flow resulted from both natural and human-mediated dispersal. Conclusions Our results demonstrate the importance of past climatic fluctuations and human mediated translocations in driving and complicating the process of speciation in island Southeast Asia. This case study demonstrates that genomics is a powerful tool to decipher the evolutionary history of a genus, and reveals the complexity of the process of speciation. PMID:24070215

  10. Amino acid sequence of horseshoe crab, Tachypleus tridentatus, striated muscle troponin C.

    PubMed

    Kobayashi, T; Kagami, O; Takagi, T; Konishi, K

    1989-05-01

    The amino acid sequence of troponin C obtained from horseshoe crab, Tachypleus tridentatus, striated muscle was determined by sequence analysis and alignments of chemically and enzymatically cleaved peptides. Troponin C is composed of 153 amino acid residues with a blocked N-terminus and contains no tryptophan or cysteine residue. The site I, one of the four Ca2+-binding sites, is considered to have lost its ability to bind Ca2+ owing to the replacements of certain amino acid residues.

  11. Multiple genome sequences reveal adaptations of a phototrophic bacterium to sediment microenvironments.

    SciTech Connect

    Oda, Yasuhiro; Larimer, Frank W; Chain, Patrick S. G.; Malfatti, Stephanie; Shin, Maria V; Vergez, Lisa; Hauser, Loren John; Land, Miriam L; Braatsch, Stephan; Beatty, Thomas; Pelletier, Dale A; Schaefer, Amy L; Harwood, Caroline S

    2008-11-01

    The bacterial genus Rhodopseudomonas is comprised of photosynthetic bacteria found widely distributed in aquatic sediments. Members of the genus catalyze hydrogen gas production, carbon dioxide sequestration, and biomass turnover. The genome sequence of Rhodopseudomonas palustris CGA009 revealed a surprising richness of metabolic versatility that would seem to explain its ability to live in a heterogeneous environment like sediment. However, there is considerable genotypic diversity among Rhodopseudomonas isolates. Here we report the complete genome sequences of four additional members of the genus isolated from a restricted geographical area. The sequences confirm that the isolates belong to a coherent taxonomic unit, but they also have significant differences. Whole genome alignments show that the circular chromosomes of the isolates consist of a collinear backbone with a moderate number of genomic rearrangements that impact local gene order and orientation. There are 3,319 genes, 70% of the genes in each genome, shared by four or more strains. Between 10% and 18% of the genes in each genome are strain specific. Some of these genes suggest specialized physiological traits, which we verified experimentally, that include expanded light harvesting, oxygen respiration, and nitrogen fixation capabilities, as well as anaerobic fermentation. Strain-specific adaptations include traits that may be useful in bioenergy applications. This work suggests that against a backdrop of metabolic versatility that is a defining characteristic of Rhodopseudomonas, different ecotypes have evolved to take advantage of physical and chemical conditions in sediment microenvironments that are too small for human observation.

  12. Molecular characterization of coprophilous fungal communities reveals sequences related to root-associated fungal endophytes.

    PubMed

    Herrera, José; Poudel, Ravin; Khidir, Hana H

    2011-02-01

    This paper reports the use of molecular methods to characterize the coprophilous fungal communities (CFC) that inhabit the dung of four species of mammalian herbivores at two sites, Sevilleta National Wildlife Refuge (SNWR) in New Mexico and Wind Cave National Park (WCNP) in South Dakota. Results reveal that CFC from domesticated cattle (Bos taurus) at SNWR, and bison (Bison bison) and black-tailed prairie dogs (Cynomys ludovicianus) at WCNP were diverse but dominated primarily by members within eight taxonomic orders, including the rarely cultured and anaerobic order Neocallimastigales. In addition, 7.7% (138 of 1,788) of the sequences obtained from all dung samples were at least 97% similar to root-associated fungal (RAF) sequences previously described from blue grama (Bouteloua gracilis), a common forage grass found throughout North America and growing at both study sites. In contrast, 95.8% (295 of 308) of the sequences and four of the total seven operational taxonomic units obtained from pronghorn antelope (Antilocapra americana) dung belonged to the Pleosporalean order. We hypothesize that some herbivore vectors disperse non-systemic (non-clavicipitaceous) fungal endophytes. These dispersal events, it is argued, are most likely to occur via herbivores that occasionally forage and masticate root tissue, especially in arid regions where aboveground vegetation is sparse. The results of this study suggest that some (possibly many) members of the RAF community can expand their ecological role to include colonizing dung. PMID:20842497

  13. Whole-Genome Sequencing Reveals Genetic Variation in the Asian House Rat

    PubMed Central

    Teng, Huajing; Zhang, Yaohua; Shi, Chengmin; Mao, Fengbiao; Hou, Lingling; Guo, Hongling; Sun, Zhongsheng; Zhang, Jianxu

    2016-01-01

    Whole-genome sequencing of wild-derived rat species can provide novel genomic resources, which may help decipher the genetics underlying complex phenotypes. As a notorious pest, reservoir of human pathogens, and colonizer, the Asian house rat, Rattus tanezumi, is successfully adapted to its habitat. However, little is known regarding genetic variation in this species. In this study, we identified over 41,000,000 single-nucleotide polymorphisms, plus insertions and deletions, through whole-genome sequencing and bioinformatics analyses. Moreover, we identified over 12,000 structural variants, including 143 chromosomal inversions. Further functional analyses revealed several fixed nonsense mutations associated with infection and immunity-related adaptations, and a number of fixed missense mutations that may be related to anticoagulant resistance. A genome-wide scan for loci under selection identified various genes related to neural activity. Our whole-genome sequencing data provide a genomic resource for future genetic studies of the Asian house rat species and have the potential to facilitate understanding of the molecular adaptations of rats to their ecological niches. PMID:27172215

  14. Sequencing papaya X and Yh chromosomes reveals molecular basis of incipient sex chromosome evolution.

    PubMed

    Wang, Jianping; Na, Jong-Kuk; Yu, Qingyi; Gschwend, Andrea R; Han, Jennifer; Zeng, Fanchang; Aryal, Rishi; VanBuren, Robert; Murray, Jan E; Zhang, Wenli; Navajas-Pérez, Rafael; Feltus, F Alex; Lemke, Cornelia; Tong, Eric J; Chen, Cuixia; Wai, Ching Man; Singh, Ratnesh; Wang, Ming-Li; Min, Xiang Jia; Alam, Maqsudul; Charlesworth, Deborah; Moore, Paul H; Jiang, Jiming; Paterson, Andrew H; Ming, Ray

    2012-08-21

    Sex determination in papaya is controlled by a recently evolved XY chromosome pair, with two slightly different Y chromosomes controlling the development of males (Y) and hermaphrodites (Y(h)). To study the events of early sex chromosome evolution, we sequenced the hermaphrodite-specific region of the Y(h) chromosome (HSY) and its X counterpart, yielding an 8.1-megabase (Mb) HSY pseudomolecule, and a 3.5-Mb sequence for the corresponding X region. The HSY is larger than the X region, mostly due to retrotransposon insertions. The papaya HSY differs from the X region by two large-scale inversions, the first of which likely caused the recombination suppression between the X and Y(h) chromosomes, followed by numerous additional chromosomal rearrangements. Altogether, including the X and/or HSY regions, 124 transcription units were annotated, including 50 functional pairs present in both the X and HSY. Ten HSY genes had functional homologs elsewhere in the papaya autosomal regions, suggesting movement of genes onto the HSY, whereas the X region had none. Sequence divergence between 70 transcripts shared by the X and HSY revealed two evolutionary strata in the X chromosome, corresponding to the two inversions on the HSY, the older of which evolved about 7.0 million years ago. Gene content differences between the HSY and X are greatest in the older stratum, whereas the gene content and order of the collinear regions are identical. Our findings support theoretical models of early sex chromosome evolution.

  15. Molecular characterization of coprophilous fungal communities reveals sequences related to root-associated fungal endophytes.

    PubMed

    Herrera, José; Poudel, Ravin; Khidir, Hana H

    2011-02-01

    This paper reports the use of molecular methods to characterize the coprophilous fungal communities (CFC) that inhabit the dung of four species of mammalian herbivores at two sites, Sevilleta National Wildlife Refuge (SNWR) in New Mexico and Wind Cave National Park (WCNP) in South Dakota. Results reveal that CFC from domesticated cattle (Bos taurus) at SNWR, and bison (Bison bison) and black-tailed prairie dogs (Cynomys ludovicianus) at WCNP were diverse but dominated primarily by members within eight taxonomic orders, including the rarely cultured and anaerobic order Neocallimastigales. In addition, 7.7% (138 of 1,788) of the sequences obtained from all dung samples were at least 97% similar to root-associated fungal (RAF) sequences previously described from blue grama (Bouteloua gracilis), a common forage grass found throughout North America and growing at both study sites. In contrast, 95.8% (295 of 308) of the sequences and four of the total seven operational taxonomic units obtained from pronghorn antelope (Antilocapra americana) dung belonged to the Pleosporalean order. We hypothesize that some herbivore vectors disperse non-systemic (non-clavicipitaceous) fungal endophytes. These dispersal events, it is argued, are most likely to occur via herbivores that occasionally forage and masticate root tissue, especially in arid regions where aboveground vegetation is sparse. The results of this study suggest that some (possibly many) members of the RAF community can expand their ecological role to include colonizing dung.

  16. Single Nucleus Genome Sequencing Reveals High Similarity among Nuclei of an Endomycorrhizal Fungus

    PubMed Central

    Zhang, Zhonghua; Ivanov, Sergey; Saunders, Diane G. O.; Mu, Desheng; Pang, Erli; Cao, Huifen; Cha, Hwangho; Lin, Tao; Zhou, Qian; Shang, Yi; Li, Ying; Sharma, Trupti; van Velzen, Robin; de Ruijter, Norbert; Aanen, Duur K.; Win, Joe; Kamoun, Sophien; Bisseling, Ton; Geurts, René; Huang, Sanwen

    2014-01-01

    Nuclei of arbuscular endomycorrhizal fungi have been described as highly diverse due to their asexual nature and absence of a single cell stage with only one nucleus. This has raised fundamental questions concerning speciation, selection and transmission of the genetic make-up to next generations. Although this concept has become textbook knowledge, it is only based on studying a few loci, including 45S rDNA. To provide a more comprehensive insight into the genetic makeup of arbuscular endomycorrhizal fungi, we applied de novo genome sequencing of individual nuclei of Rhizophagus irregularis. This revealed a surprisingly low level of polymorphism between nuclei. In contrast, within a nucleus, the 45S rDNA repeat unit turned out to be highly diverged. This finding demystifies a long-lasting hypothesis on the complex genetic makeup of arbuscular endomycorrhizal fungi. Subsequent genome assembly resulted in the first draft reference genome sequence of an arbuscular endomycorrhizal fungus. Its length is 141 Mbps, representing over 27,000 protein-coding gene models. We used the genomic sequence to reinvestigate the phylogenetic relationships of Rhizophagus irregularis with other fungal phyla. This unambiguously demonstrated that Glomeromycota are more closely related to Mucoromycotina than to its postulated sister Dikarya. PMID:24415955

  17. Multilocus sequence analysis reveals high genetic diversity in clinical isolates of Burkholderia cepacia complex from India

    PubMed Central

    Gautam, Vikas; Patil, Prashant P.; Kumar, Sunil; Midha, Samriti; Kaur, Mandeep; Kaur, Satinder; Singh, Meenu; Mali, Swapna; Shastri, Jayanthi; Arora, Anita; Ray, Pallab; Patil, Prabhu B.

    2016-01-01

    Burkholderia cepacia complex (Bcc) is a complex group of bacteria causing opportunistic infections in immunocompromised and cystic fibrosis (CF) patients. Herein, we report multilocus sequence typing and analysis of the 57 clinical isolates of Bcc collected over the period of seven years (2005–2012) from several hospitals across India. A total of 21 sequence types (ST) including two STs from cystic fibrosis patient’s isolates and twelve novel STs were identified in the population reflecting the extent of genetic diversity. Multilocus sequence analysis revealed two lineages in population, a major lineage belonging to B. cenocepacia and a minor lineage belonging to B. cepacia. Split-decomposition analysis suggests absence of interspecies recombination and intraspecies recombination contributed in generating genotypic diversity amongst isolates. Further linkage disequilibrium analysis indicates that recombination takes place at a low frequency, which is not sufficient to break down the clonal relationship. This knowledge of the genetic structure of Bcc population from a rapidly developing country will be invaluable in the epidemiology, surveillance and understanding global diversity of this group of a pathogen. PMID:27767197

  18. Whole-Genome Sequencing Reveals Genetic Variation in the Asian House Rat.

    PubMed

    Teng, Huajing; Zhang, Yaohua; Shi, Chengmin; Mao, Fengbiao; Hou, Lingling; Guo, Hongling; Sun, Zhongsheng; Zhang, Jianxu

    2016-07-07

    Whole-genome sequencing of wild-derived rat species can provide novel genomic resources, which may help decipher the genetics underlying complex phenotypes. As a notorious pest, reservoir of human pathogens, and colonizer, the Asian house rat, Rattus tanezumi, is successfully adapted to its habitat. However, little is known regarding genetic variation in this species. In this study, we identified over 41,000,000 single-nucleotide polymorphisms, plus insertions and deletions, through whole-genome sequencing and bioinformatics analyses. Moreover, we identified over 12,000 structural variants, including 143 chromosomal inversions. Further functional analyses revealed several fixed nonsense mutations associated with infection and immunity-related adaptations, and a number of fixed missense mutations that may be related to anticoagulant resistance. A genome-wide scan for loci under selection identified various genes related to neural activity. Our whole-genome sequencing data provide a genomic resource for future genetic studies of the Asian house rat species and have the potential to facilitate understanding of the molecular adaptations of rats to their ecological niches.

  19. Whole genome sequencing reveals a novel CRISPR system in industrial Clostridium acetobutylicum.

    PubMed

    Peng, Lixin; Pei, Jianxin; Pang, Hao; Guo, Yuan; Lin, Lihua; Huang, Ribo

    2014-11-01

    Clostridium acetobutylicum is an important organism for biobutanol production. Due to frequent exposure to bacteriophages during fermentation, industrial C. acetobutylicum strains require a strong immune response against foreign genetic invaders. In the present study, a novel CRISPR system was reported in a C. acetobutylicum GXAS18-1 strain by whole genome sequencing, and several specific characteristics of the CRISPR system were revealed as follows: (1) multiple CRISPR loci were confirmed within the whole bacterial genome, while only one cluster of CRISPR-associated genes (Cas) was found in the current strain; (2) similar leader sequences at the 5' end of the multiple CRISPR loci were identified as promoter elements by promoter prediction, suggesting that these CRISPR loci were under the control of the same transcriptional factor; (3) homology analysis indicated that the present Cas genes shared only low sequence similarity with the published Cas families; and (4) concerning gene similarity and gene cluster order, these Cas genes belonged to the csm family and originated from the euryarchaeota by horizontal gene transfer.

  20. Analysis of mammalian gene batteries reveals both stable ancestral cores and highly dynamic regulatory sequences

    PubMed Central

    Ettwiller, Laurence; Budd, Aidan; Spitz, François; Wittbrodt, Joachim

    2008-01-01

    Background Changes in gene regulation are suspected to comprise one of the driving forces for evolution. To address the extent of cis-regulatory changes and how they impact on gene regulatory networks across eukaryotes, we systematically analyzed the evolutionary dynamics of target gene batteries controlled by 16 different transcription factors. Results We found that gene batteries show variable conservation within vertebrates, with slow and fast evolving modules. Hence, while a key gene battery associated with the cell cycle is conserved throughout metazoans, the POU5F1 (Oct4) and SOX2 batteries in embryonic stem cells show strong conservation within mammals, with the striking exception of rodents. Within the genes composing a given gene battery, we could identify a conserved core that likely reflects the ancestral function of the corresponding transcription factor. Interestingly, we show that the association between a transcription factor and its target genes is conserved even when we exclude conserved sequence similarities of their promoter regions from our analysis. This supports the idea that turnover, either of the transcription factor binding site or its direct neighboring sequence, is a pervasive feature of proximal regulatory sequences. Conclusions Our study reveals the dynamics of evolutionary changes within metazoan gene networks, including both the composition of gene batteries and the architecture of target gene promoters. This variation provides the playground required for evolutionary innovation around conserved ancestral core functions. PMID:19087242

  1. Ecological roles of dominant and rare prokaryotes in acid mine drainage revealed by metagenomics and metatranscriptomics

    DOE PAGES

    Hua, Zheng-Shuang; Han, Yu-Jiao; Chen, Lin-Xing; Liu, Jun; Hu, Min; Li, Sheng-Jin; Kuang, Jia-Liang; Chain, Patrick SG; Huang, Li-Nan; Shu, Wen-Sheng

    2014-11-07

    Here we report that high-throughput sequencing is expanding our knowledge of microbial diversity in the environment. Still, understanding the metabolic potentials and ecological roles of rare and uncultured microbes in natural communities remains a major challenge. To this end, we applied a ‘divide and conquer’ strategy that partitioned a massive metagenomic data set (>100 Gbp) into subsets based on K-mer frequency in sequence assembly to a low-diversity acid mine drainage (AMD) microbial community and, by integrating with an additional metatranscriptomic assembly, successfully obtained 11 draft genomes most of which represent yet uncultured and/or rare taxa (relative abundance <1%). We reportmore » the first genome of a naturally occurring Ferrovum population (relative abundance >90%) and its metabolic potentials and gene expression profile, providing initial molecular insights into the ecological role of these lesser known, but potentially important, microorganisms in the AMD environment. Gene transcriptional analysis of the active taxa revealed major metabolic capabilities executed in situ, including carbon- and nitrogen-related metabolisms associated with syntrophic interactions, iron and sulfur oxidation, which are key in energy conservation and AMD generation, and the mechanisms of adaptation and response to the environmental stresses (heavy metals, low pH and oxidative stress). Remarkably, nitrogen fixation and sulfur oxidation were performed by the rare taxa, indicating their critical roles in the overall functioning and assembly of the AMD community. Finally, our study demonstrates the potential of the ‘divide and conquer’ strategy in high-throughput sequencing data assembly for genome reconstruction and functional partitioning analysis of both dominant and rare species in natural microbial assemblages.« less

  2. Ecological roles of dominant and rare prokaryotes in acid mine drainage revealed by metagenomics and metatranscriptomics

    PubMed Central

    Hua, Zheng-Shuang; Han, Yu-Jiao; Chen, Lin-Xing; Liu, Jun; Hu, Min; Li, Sheng-Jin; Kuang, Jia-Liang; Chain, Patrick SG; Huang, Li-Nan; Shu, Wen-Sheng

    2015-01-01

    High-throughput sequencing is expanding our knowledge of microbial diversity in the environment. Still, understanding the metabolic potentials and ecological roles of rare and uncultured microbes in natural communities remains a major challenge. To this end, we applied a ‘divide and conquer' strategy that partitioned a massive metagenomic data set (>100 Gbp) into subsets based on K-mer frequency in sequence assembly to a low-diversity acid mine drainage (AMD) microbial community and, by integrating with an additional metatranscriptomic assembly, successfully obtained 11 draft genomes most of which represent yet uncultured and/or rare taxa (relative abundance <1%). We report the first genome of a naturally occurring Ferrovum population (relative abundance >90%) and its metabolic potentials and gene expression profile, providing initial molecular insights into the ecological role of these lesser known, but potentially important, microorganisms in the AMD environment. Gene transcriptional analysis of the active taxa revealed major metabolic capabilities executed in situ, including carbon- and nitrogen-related metabolisms associated with syntrophic interactions, iron and sulfur oxidation, which are key in energy conservation and AMD generation, and the mechanisms of adaptation and response to the environmental stresses (heavy metals, low pH and oxidative stress). Remarkably, nitrogen fixation and sulfur oxidation were performed by the rare taxa, indicating their critical roles in the overall functioning and assembly of the AMD community. Our study demonstrates the potential of the ‘divide and conquer' strategy in high-throughput sequencing data assembly for genome reconstruction and functional partitioning analysis of both dominant and rare species in natural microbial assemblages. PMID:25361395

  3. Ecological roles of dominant and rare prokaryotes in acid mine drainage revealed by metagenomics and metatranscriptomics

    SciTech Connect

    Hua, Zheng-Shuang; Han, Yu-Jiao; Chen, Lin-Xing; Liu, Jun; Hu, Min; Li, Sheng-Jin; Kuang, Jia-Liang; Chain, Patrick SG; Huang, Li-Nan; Shu, Wen-Sheng

    2014-11-07

    Here we report that high-throughput sequencing is expanding our knowledge of microbial diversity in the environment. Still, understanding the metabolic potentials and ecological roles of rare and uncultured microbes in natural communities remains a major challenge. To this end, we applied a ‘divide and conquer’ strategy that partitioned a massive metagenomic data set (>100 Gbp) into subsets based on K-mer frequency in sequence assembly to a low-diversity acid mine drainage (AMD) microbial community and, by integrating with an additional metatranscriptomic assembly, successfully obtained 11 draft genomes most of which represent yet uncultured and/or rare taxa (relative abundance <1%). We report the first genome of a naturally occurring Ferrovum population (relative abundance >90%) and its metabolic potentials and gene expression profile, providing initial molecular insights into the ecological role of these lesser known, but potentially important, microorganisms in the AMD environment. Gene transcriptional analysis of the active taxa revealed major metabolic capabilities executed in situ, including carbon- and nitrogen-related metabolisms associated with syntrophic interactions, iron and sulfur oxidation, which are key in energy conservation and AMD generation, and the mechanisms of adaptation and response to the environmental stresses (heavy metals, low pH and oxidative stress). Remarkably, nitrogen fixation and sulfur oxidation were performed by the rare taxa, indicating their critical roles in the overall functioning and assembly of the AMD community. Finally, our study demonstrates the potential of the ‘divide and conquer’ strategy in high-throughput sequencing data assembly for genome reconstruction and functional partitioning analysis of both dominant and rare species in natural microbial assemblages.

  4. Exome sequencing reveals novel and recurrent mutations with clinical impact in blastic plasmacytoid dendritic cell neoplasm.

    PubMed

    Menezes, J; Acquadro, F; Wiseman, M; Gómez-López, G; Salgado, R N; Talavera-Casañas, J G; Buño, I; Cervera, J V; Montes-Moreno, S; Hernández-Rivas, J M; Ayala, R; Calasanz, M J; Larrayoz, M J; Brichs, L F; Gonzalez-Vicent, M; Pisano, D G; Piris, M A; Álvarez, S; Cigudosa, J C

    2014-04-01

    Blastic plasmacytoid dendritic cell neoplasm (BPDCN) is a very rare disease that currently lacks genomic and genetic biomarkers to assist in its clinical management. We performed whole-exome sequencing (WES) of three BPDCN cases. Based on these data, we designed a resequencing approach to identify mutations in 38 selected genes in 25 BPDCN samples. WES revealed 37-99 deleterious gene mutations per exome with no common affected genes between patients, but with clear overlap in terms of molecular and disease pathways (hematological and dermatological disease). We identified for the first time deleterious mutations in IKZF3, HOXB9, UBE2G2 and ZEB2 in human leukemia. Target sequencing identified 29 recurring genes, ranging in prevalence from 36% for previously known genes, such as TET2, to 12-16% for newly identified genes, such as IKZF3 or ZEB2. Half of the tumors had mutations affecting either the DNA methylation or chromatin remodeling pathways. The clinical analysis revealed that patients with mutations in DNA methylation pathway had a significantly reduced overall survival (P=0.047). We provide the first mutational profiling of BPDCN. The data support the current WHO classification of the disease as a myeloid disorder and provide a biological rationale for the incorporation of epigenetic therapies for its treatment.

  5. Revealing glacier flow and surge dynamics from animated satellite image sequences: examples from the Karakoram

    NASA Astrophysics Data System (ADS)

    Paul, F.

    2015-04-01

    Although animated images are very popular on the Internet, they have so far found only limited use for glaciological applications. With long time-series of satellite images becoming increasingly available and glaciers being well recognized for their rapid changes and variable flow dynamics, animated sequences of multiple satellite images reveal glacier dynamics in a time-lapse mode, making the otherwise slow changes of glacier movement visible and understandable for a wide public. For this study animated image sequences were created from freely available image quick-looks of orthorectified Landsat scenes for four regions in the central Karakoram mountain range. The animations play automatically in a web-browser and might help to demonstrate glacier flow dynamics for educational purposes. The animations revealed highly complex patterns of glacier flow and surge dynamics over a 15-year time period (1998-2013). In contrast to other regions, surging glaciers in the Karakoram are often small (around 10 km2), steep, debris free, and advance for several years at comparably low annual rates (a few hundred m a-1). The advance periods of individual glaciers are generally out of phase, indicating a limited climatic control on their dynamics. On the other hand, nearly all other glaciers in the region are either stable or slightly advancing, indicating balanced or even positive mass budgets over the past few years to decades.

  6. Multilocus sequence typing of hospital-associated Enterococcus faecium from Brazil reveals their unique evolutionary history.

    PubMed

    Titze-de-Almeida, Ricardo; Van Belkum, Alex; Felipe, Maria Sueli Soares; Zanella, Rosemeire C; Top, Janetta; Willems, Rob J L

    2006-01-01

    We studied the genetic relationships between vancomycin-susceptible (n = 11) and -resistant Enterococcus faecium (VRE, n = 20) recovered from Brazil using a multilocus sequence typing (MLST) scheme. Grouping of allelic profiles revealed six clusters of related sequence types (STs) that differ in no more than two of the seven alleles. Of these, one cluster harbored 16 of the 20 isolates recovered during the first VRE outbreak in Brazil. The ampicillin and gentamicin resistance profiles were stable in the isolates that clustered within the groups I-III. Comparison with the allelic profiles of 139 E. faecium from different geographical regions and origins found in the international database http://www.mlst.net revealed that the Brazilian outbreak clone did not cluster in the previously named complex-17. This genetic complex contains hospital epidemic and clinical isolates recovered from different countries and continents. Twenty two of the 31 Brazilian isolates, including the VRE outbreak clone, clustered apart from the E. faecium isolates from the database, suggesting that these Brazilian isolates have a distinct evolutionary history. PMID:16922628

  7. Polyploid genome of Camelina sativa revealed by isolation of fatty acid synthesis genes

    PubMed Central

    2010-01-01

    Background Camelina sativa, an oilseed crop in the Brassicaceae family, has inspired renewed interest due to its potential for biofuels applications. Little is understood of the nature of the C. sativa genome, however. A study was undertaken to characterize two genes in the fatty acid biosynthesis pathway, fatty acid desaturase (FAD) 2 and fatty acid elongase (FAE) 1, which revealed unexpected complexity in the C. sativa genome. Results In C. sativa, Southern analysis indicates the presence of three copies of both FAD2 and FAE1 as well as LFY, a known single copy gene in other species. All three copies of both CsFAD2 and CsFAE1 are expressed in developing seeds, and sequence alignments show that previously described conserved sites are present, suggesting that all three copies of both genes could be functional. The regions downstream of CsFAD2 and upstream of CsFAE1 demonstrate co-linearity with the Arabidopsis genome. In addition, three expressed haplotypes were observed for six predicted single-copy genes in 454 sequencing analysis and results from flow cytometry indicate that the DNA content of C. sativa is approximately three-fold that of diploid Camelina relatives. Phylogenetic analyses further support a history of duplication and indicate that C. sativa and C. microcarpa might share a parental genome. Conclusions There is compelling evidence for triplication of the C. sativa genome, including a larger chromosome number and three-fold larger measured genome size than other Camelina relatives, three isolated copies of FAD2, FAE1, and the KCS17-FAE1 intergenic region, and three expressed haplotypes observed for six predicted single-copy genes. Based on these results, we propose that C. sativa be considered an allohexaploid. The characterization of fatty acid synthesis pathway genes will allow for the future manipulation of oil composition of this emerging biofuel crop; however, targeted manipulations of oil composition and general development of C. sativa should

  8. Molecular cloning, encoding sequence, and expression of vaccinia virus nucleic acid-dependent nucleoside triphosphatase gene.

    PubMed Central

    Rodriguez, J F; Kahn, J S; Esteban, M

    1986-01-01

    A rabbit poxvirus genomic library contained within the expression vector lambda gt11 was screened with polyclonal antiserum prepared against vaccinia virus nucleic acid-dependent nucleoside triphosphatase (NTPase)-I enzyme. Five positive phage clones containing from 0.72- to 2.5-kilobase-pair (kbp) inserts expressed a beta-galactosidase fusion protein that was reactive by immunoblotting with the NTPase-I antibody. Hybridization analysis allowed the location of this gene within the vaccinia HindIIID restriction fragment. From the known nucleotide sequence of the 16-kbp vaccinia HindIIID fragment, we identified a region that contains a 1896-base open reading frame coding for a 631-amino acid protein. Analysis of the complete sequence revealed a highly basic protein, with hydrophilic COOH and NH2 termini, various hydrophobic domains, and no significant homology to other known proteins. Translational studies demonstrate that NTPase-I belongs to a late class of viral genes. This protein is highly conserved among Orthopoxviruses. Images PMID:3025846

  9. Partial amino acid sequences around sulfhydryl groups of soybean beta-amylase.

    PubMed

    Nomura, K; Mikami, B; Morita, Y

    1987-08-01

    Sulfhydryl (SH) groups of soybean beta-amylase were modified with 5-(iodoaceto-amidoethyl)aminonaphthalene-1-sulfonate (IAEDANS) and the SH-containing peptides exhibiting fluorescence were purified after chymotryptic digestion of the modified enzyme. The sequence analysis of the peptides derived from the modification of all SH groups in the denatured enzyme revealed the existence of six SH groups, in contrast to five reported previously. One of them was found to have extremely low reactivity toward SH-reagents without reduction. In the native state, IAEDANS reacted with 2 mol of SH groups per mol of the enzyme (SH1 and SH2) accompanied with inactivation of the enzyme owing to the modification of SH2 located near the active site of this enzyme. The selective modification of SH2 with IAEDANS was attained after the blocking of SH1 with 5,5'-dithiobis-(2-nitrobenzoic acid). The amino acid sequences of the peptides containing SH1 and SH2 were determined to be Cys-Ala-Asn-Pro-Gln and His-Gln-Cys-Gly-Gly-Asn-Val-Gly-Asp-Ile-Val-Asn-Ile-Pro-Ile-Pro-Gln-Trp, respectively.

  10. Molecular cloning, encoding sequence, and expression of vaccinia virus nucleic acid-dependent nucleoside triphosphatase gene.

    PubMed

    Rodriguez, J F; Kahn, J S; Esteban, M

    1986-12-01

    A rabbit poxvirus genomic library contained within the expression vector lambda gt11 was screened with polyclonal antiserum prepared against vaccinia virus nucleic acid-dependent nucleoside triphosphatase (NTPase)-I enzyme. Five positive phage clones containing from 0.72- to 2.5-kilobase-pair (kbp) inserts expressed a beta-galactosidase fusion protein that was reactive by immunoblotting with the NTPase-I antibody. Hybridization analysis allowed the location of this gene within the vaccinia HindIIID restriction fragment. From the known nucleotide sequence of the 16-kbp vaccinia HindIIID fragment, we identified a region that contains a 1896-base open reading frame coding for a 631-amino acid protein. Analysis of the complete sequence revealed a highly basic protein, with hydrophilic COOH and NH2 termini, various hydrophobic domains, and no significant homology to other known proteins. Translational studies demonstrate that NTPase-I belongs to a late class of viral genes. This protein is highly conserved among Orthopoxviruses.

  11. Purification, amino acid sequence and characterisation of kangaroo IGF-I.

    PubMed

    Yandell, C A; Francis, G L; Wheldrake, J F; Upton, Z

    1998-01-01

    Insulin-like growth factor-I (IGF-I) and IGF-II have been purified to homogeneity from kangaroo (Macropus fuliginosus) serum, thus this represents the first report of the purification, sequencing and characterisation of marsupial IGFs. N-Terminal protein sequencing reveals that there are six amino acid differences between kangaroo and human IGF-I. Kangaroo IGF-II has been partially sequenced and no differences were found between human and kangaroo IGF-II in the 53 residues identified. Thus the IGFs appear to be remarkably structurally conserved during mammalian radiation. In addition, in vitro characterisation of kangaroo IGF-I demonstrated that the functional properties of human, kangaroo and chicken IGF-I are very similar. In an assay measuring the ability of the proteins to stimulate protein synthesis in rat L6 myoblasts, all IGF-I proteins were found to be equally potent. The ability of all three proteins to compete for binding with radiolabelled human IGF-I to type-1 IGF receptors in L6 myoblasts and in Sminthopsis crassicaudata transformed lung fibroblasts, a marsupial cell line, was comparable. Furthermore, kangaroo and human IGF-I react equally in a human IGF-I RIA using a human reference standard, radiolabelled human IGF-I and a polyclonal antibody raised against recombinant human IGF-I. This study indicates that not only is the primary structure of eutherian and metatherian IGF-I conserved, but also the proteins appear to be functionally similar.

  12. Targeted Sequencing Reveals Large-Scale Sequence Polymorphism in Maize Candidate Genes for Biomass Production and Composition

    PubMed Central

    Ulpinnis, Chris; Scholz, Uwe; Altmann, Thomas

    2015-01-01

    A major goal of maize genomic research is to identify sequence polymorphisms responsible for phenotypic variation in traits of economic importance. Large-scale detection of sequence variation is critical for linking genes, or genomic regions, to phenotypes. However, due to its size and complexity, it remains expensive to generate whole genome sequences of sufficient coverage for divergent maize lines, even with access to next generation sequencing (NGS) technology. Because methods involving reduction of genome complexity, such as genotyping-by-sequencing (GBS), assess only a limited fraction of sequence variation, targeted sequencing of selected genomic loci offers an attractive alternative. We therefore designed a sequence capture assay to target 29 Mb genomic regions and surveyed a total of 4,648 genes possibly affecting biomass production in 21 diverse inbred maize lines (7 flints, 14 dents). Captured and enriched genomic DNA was sequenced using the 454 NGS platform to 19.6-fold average depth coverage, and a broad evaluation of read alignment and variant calling methods was performed to select optimal procedures for variant discovery. Sequence alignment with the B73 reference and de novo assembly identified 383,145 putative single nucleotide polymorphisms (SNPs), of which 42,685 were non-synonymous alterations and 7,139 caused frameshifts. Presence/absence variation (PAV) of genes was also detected. We found that substantial sequence variation exists among genomic regions targeted in this study, which was particularly evident within coding regions. This diversification has the potential to broaden functional diversity and generate phenotypic variation that may lead to new adaptations and the modification of important agronomic traits. Further, annotated SNPs identified here will serve as useful genetic tools and as candidates in searches for phenotype-altering DNA variation. In summary, we demonstrated that sequencing of captured DNA is a powerful approach for

  13. Two groups of rhinoviruses revealed by a panel of antiviral compounds present sequence divergence and differential pathogenicity.

    PubMed Central

    Andries, K; Dewindt, B; Snoeks, J; Wouters, L; Moereels, H; Lewi, P J; Janssen, P A

    1990-01-01

    A variety of chemically different compounds inhibit the replication of several serotypes of rhinoviruses (common-cold viruses). We noticed that one of these antiviral compounds, WIN 51711, had an antiviral spectrum clearly distinctive from a consensus spectrum or other capsid-binding compounds, although all of them were shown to share the same binding site. A systematic evaluation of all known rhinovirus capsid-binding compounds against all serotyped rhinoviruses was therefore initiated. Multivariate analysis of the results revealed the existence of two groups of rhinoviruses, which we will call antiviral groups A and B. The differential sensitivity of members of these groups to antiviral compounds suggests the existence of a dimorphic binding site. The antiviral groups turned out to be a reflection of a divergence of rhinovirus serotypes on a much broader level. Similarities in antiviral spectra were highly correlated with sequence similarities, not only of amino acids lining the antiviral compound-binding-site, but also of amino acids of the whole VP1 protein. Furthermore, analysis of epidemiological data indicated that group B rhinoviruses produced more than twice as many clinical infections per serotype than group A rhinoviruses did. Rhinoviruses belonging to the minor receptor group were without exception all computed to lie in the same region of antiviral group B. PMID:2154596

  14. Giraffe genome sequence reveals clues to its unique morphology and physiology

    PubMed Central

    Agaba, Morris; Ishengoma, Edson; Miller, Webb C.; McGrath, Barbara C.; Hudson, Chelsea N.; Bedoya Reina, Oscar C.; Ratan, Aakrosh; Burhans, Rico; Chikhi, Rayan; Medvedev, Paul; Praul, Craig A.; Wu-Cavener, Lan; Wood, Brendan; Robertson, Heather; Penfold, Linda; Cavener, Douglas R.

    2016-01-01

    The origins of giraffe's imposing stature and associated cardiovascular adaptations are unknown. Okapi, which lacks these unique features, is giraffe's closest relative and provides a useful comparison, to identify genetic variation underlying giraffe's long neck and cardiovascular system. The genomes of giraffe and okapi were sequenced, and through comparative analyses genes and pathways were identified that exhibit unique genetic changes and likely contribute to giraffe's unique features. Some of these genes are in the HOX, NOTCH and FGF signalling pathways, which regulate both skeletal and cardiovascular development, suggesting that giraffe's stature and cardiovascular adaptations evolved in parallel through changes in a small number of genes. Mitochondrial metabolism and volatile fatty acids transport genes are also evolutionarily diverged in giraffe and may be related to its unusual diet that includes toxic plants. Unexpectedly, substantial evolutionary changes have occurred in giraffe and okapi in double-strand break repair and centrosome functions. PMID:27187213

  15. Giraffe genome sequence reveals clues to its unique morphology and physiology.

    PubMed

    Agaba, Morris; Ishengoma, Edson; Miller, Webb C; McGrath, Barbara C; Hudson, Chelsea N; Bedoya Reina, Oscar C; Ratan, Aakrosh; Burhans, Rico; Chikhi, Rayan; Medvedev, Paul; Praul, Craig A; Wu-Cavener, Lan; Wood, Brendan; Robertson, Heather; Penfold, Linda; Cavener, Douglas R

    2016-01-01

    The origins of giraffe's imposing stature and associated cardiovascular adaptations are unknown. Okapi, which lacks these unique features, is giraffe's closest relative and provides a useful comparison, to identify genetic variation underlying giraffe's long neck and cardiovascular system. The genomes of giraffe and okapi were sequenced, and through comparative analyses genes and pathways were identified that exhibit unique genetic changes and likely contribute to giraffe's unique features. Some of these genes are in the HOX, NOTCH and FGF signalling pathways, which regulate both skeletal and cardiovascular development, suggesting that giraffe's stature and cardiovascular adaptations evolved in parallel through changes in a small number of genes. Mitochondrial metabolism and volatile fatty acids transport genes are also evolutionarily diverged in giraffe and may be related to its unusual diet that includes toxic plants. Unexpectedly, substantial evolutionary changes have occurred in giraffe and okapi in double-strand break repair and centrosome functions. PMID:27187213

  16. Exome sequencing of extended families with autism reveals genes shared across neurodevelopmental and neuropsychiatric disorders

    PubMed Central

    2014-01-01

    Background Autism spectrum disorders (ASDs) comprise a range of neurodevelopmental conditions of varying severity, characterized by marked qualitative difficulties in social relatedness, communication, and behavior. Despite overwhelming evidence of high heritability, results from genetic studies to date show that ASD etiology is extremely heterogeneous and only a fraction of autism genes have been discovered. Methods To help unravel this genetic complexity, we performed whole exome sequencing on 100 ASD individuals from 40 families with multiple distantly related affected individuals. All families contained a minimum of one pair of ASD cousins. Each individual was captured with the Agilent SureSelect Human All Exon kit, sequenced on the Illumina Hiseq 2000, and the resulting data processed and annotated with Burrows-Wheeler Aligner (BWA), Genome Analysis Toolkit (GATK), and SeattleSeq. Genotyping information on each family was utilized in order to determine genomic regions that were identical by descent (IBD). Variants identified by exome sequencing which occurred in IBD regions and present in all affected individuals within each family were then evaluated to determine which may potentially be disease related. Nucleotide alterations that were novel and rare (minor allele frequency, MAF, less than 0.05) and predicted to be detrimental, either by altering amino acids or splicing patterns, were prioritized. Results We identified numerous potentially damaging, ASD associated risk variants in genes previously unrelated to autism. A subset of these genes has been implicated in other neurobehavioral disorders including depression (SLIT3), epilepsy (CLCN2, PRICKLE1), intellectual disability (AP4M1), schizophrenia (WDR60), and Tourette syndrome (OFCC1). Additional alterations were found in previously reported autism candidate genes, including three genes with alterations in multiple families (CEP290, CSMD1, FAT1, and STXBP5). Compiling a list of ASD candidate genes from the

  17. Identification of tropomyosins as major allergens in antarctic krill and mantis shrimp and their amino acid sequence characteristics.

    PubMed

    Motoyama, Kanna; Suma, Yota; Ishizaki, Shoichiro; Nagashima, Yuji; Lu, Ying; Ushio, Hideki; Shiomi, Kazuo

    2008-01-01

    Tropomyosin represents a major allergen of decapod crustaceans such as shrimps and crabs, and its highly conserved amino acid sequence (>90% identity) is a molecular basis of the immunoglobulin E (IgE) cross-reactivity among decapods. At present, however, little information is available about allergens in edible crustaceans other than decapods. In this study, the major allergen in two species of edible crustaceans, Antarctic krill Euphausia superba and mantis shrimp Oratosquilla oratoria that are taxonomically distinct from decapods, was demonstrated to be tropomyosin by IgE-immunoblotting using patient sera. The cross-reactivity of the tropomyosins from both species with decapod tropomyosins was also confirmed by inhibition IgE immunoblotting. Sequences of the tropomyosins from both species were determined by complementary deoxyribonucleic acid cloning. The mantis shrimp tropomyosin has high sequence identity (>90% identity) with decapod tropomyosins, especially with fast-type tropomyosins. On the other hand, the Antarctic krill tropomyosin is characterized by diverse alterations in region 13-42, the amino acid sequence of which is highly conserved for decapod tropomyosins, and hence, it shares somewhat lower sequence identity (82.4-89.8% identity) with decapod tropomyosins than the mantis shrimp tropomyosin. Quantification by enzyme-linked immunosorbent assay revealed that Antarctic krill contains tropomyosin at almost the same level as decapods, suggesting that its allergenicity is equivalent to decapods. However, mantis shrimp was assumed to be substantially not allergenic because of the extremely low content of tropomyosin. PMID:18521668

  18. GAWK, a novel human pituitary polypeptide: isolation, immunocytochemical localization and complete amino acid sequence.

    PubMed

    Benjannet, S; Leduc, R; Lazure, C; Seidah, N G; Marcinkiewicz, M; Chrétien, M

    1985-01-16

    During the course of reverse-phase high pressure liquid chromatography (RP-HPLC) purification of a postulated big ACTH (1) from human pituitary gland extracts, a highly purified peptide bearing no resemblance to any known polypeptide was isolated. The complete sequence of this 74 amino acid polypeptide, called GAWK, has been determined. Search on a computer data bank on the possible homology to any known protein or fragment, using a mutation data matrix, failed to reveal any homology greater than 30%. An antibody produced against a synthetic fragment allowed us to detect several immunoreactive forms. The antisera also enabled us to localize the polypeptide, by immunocytochemistry, in the anterior lobe of the pituitary gland.

  19. Trichomonas vaginalis acidic phospholipase A2: isolation and partial amino acid sequence.

    PubMed

    Escobedo-Guajardo, Brenda L; González-Salazar, Francisco; Palacios-Corona, Rebeca; Torres de la Cruz, Víctor M; Morales-Vallarta, Mario; Mata-Cárdenas, Benito D; Garza-González, Jesús N; Rivera-Silva, Gerardo; Vargas-Villarreal, Javier

    2013-12-01

    Sexually transmitted diseases are a major cause of acute disease worldwide, and trichomoniasis is the most common and curable disease, generating more than 170 million cases annually worldwide. Trichomonas vaginalis is the causal agent of trichomoniasis and has the ability to destroy in vitro cell monolayers of the vaginal mucosa, where the phospholipases A2 (PLA2) have been reported as potential virulence factors. These enzymes have been partially characterized from the subcellular fraction S30 of pathogenic T. vaginalis strains. The main objective of this study was to purify a phospholipase A2 from T. vaginalis, make a partial characterization, obtain a partial amino acid sequence, and determine its enzymatic participation as hemolytic factor causing lysis of erythrocytes. Trichomonas S30, RF30 and UFF30 sub-fractions from GT-15 strain have the capacity to hydrolyze [2-(14)C-PA]-PC at pH 6.0. Proteins from the UFF30 sub-fraction were separated by affinity chromatography into two eluted fractions with detectable PLA A2 activity. The EDTA-eluted fraction was analyzed by HPLC using on-line HPLC-tandem mass spectrometry and two protein peaks were observed at 8.2 and 13 kDa. Peptide sequences were identified from the proteins present in the eluted EDTA UFF30 fraction; bioinformatic analysis using Protein Link Global Server charged with T. vaginalis protein database suggests that eluted peptides correspond a putative ubiquitin protein in the 8.2 kDa fraction and a phospholipase preserved in the 13 kDa fraction. The EDTA-eluted fraction hydrolyzed [2-(14)C-PA]-PC lyses erythrocytes from Sprague-Dawley in a time and dose-dependent manner. The acidic hemolytic activity decreased by 84% with the addition of 100 μM of Rosenthal's inhibitor. PMID:24338313

  20. Trichomonas vaginalis acidic phospholipase A2: isolation and partial amino acid sequence.

    PubMed

    Escobedo-Guajardo, Brenda L; González-Salazar, Francisco; Palacios-Corona, Rebeca; Torres de la Cruz, Víctor M; Morales-Vallarta, Mario; Mata-Cárdenas, Benito D; Garza-González, Jesús N; Rivera-Silva, Gerardo; Vargas-Villarreal, Javier

    2013-12-01

    Sexually transmitted diseases are a major cause of acute disease worldwide, and trichomoniasis is the most common and curable disease, generating more than 170 million cases annually worldwide. Trichomonas vaginalis is the causal agent of trichomoniasis and has the ability to destroy in vitro cell monolayers of the vaginal mucosa, where the phospholipases A2 (PLA2) have been reported as potential virulence factors. These enzymes have been partially characterized from the subcellular fraction S30 of pathogenic T. vaginalis strains. The main objective of this study was to purify a phospholipase A2 from T. vaginalis, make a partial characterization, obtain a partial amino acid sequence, and determine its enzymatic participation as hemolytic factor causing lysis of erythrocytes. Trichomonas S30, RF30 and UFF30 sub-fractions from GT-15 strain have the capacity to hydrolyze [2-(14)C-PA]-PC at pH 6.0. Proteins from the UFF30 sub-fraction were separated by affinity chromatography into two eluted fractions with detectable PLA A2 activity. The EDTA-eluted fraction was analyzed by HPLC using on-line HPLC-tandem mass spectrometry and two protein peaks were observed at 8.2 and 13 kDa. Peptide sequences were identified from the proteins present in the eluted EDTA UFF30 fraction; bioinformatic analysis using Protein Link Global Server charged with T. vaginalis protein database suggests that eluted peptides correspond a putative ubiquitin protein in the 8.2 kDa fraction and a phospholipase preserved in the 13 kDa fraction. The EDTA-eluted fraction hydrolyzed [2-(14)C-PA]-PC lyses erythrocytes from Sprague-Dawley in a time and dose-dependent manner. The acidic hemolytic activity decreased by 84% with the addition of 100 μM of Rosenthal's inhibitor.

  1. High Throughput Sequencing of T Cell Antigen Receptors Reveals a Conserved TCR Repertoire

    PubMed Central

    Hou, Xianliang; Lu, Chong; Chen, Sisi; Xie, Qian; Cui, Guangying; Chen, Jianing; Chen, Zhi; Wu, Zhongwen; Ding, Yulong; Ye, Ping; Dai, Yong; Diao, Hongyan

    2016-01-01

    Abstract The T-cell receptor (TCR) repertoire is a mirror of the human immune system that reflects processes caused by infections, cancer, autoimmunity, and aging. Next-generation sequencing has become a powerful tool for deep TCR profiling. Herein, we used this technology to study the repertoire features of TCR beta chain in the blood of healthy individuals. Peripheral blood samples were collected from 10 healthy donors. T cells were isolated with anti-human CD3 magnetic beads according to the manufacturer's protocol. We then combined multiplex-PCR, Illumina sequencing, and IMGT/High V-QUEST to analyze the characteristics and polymorphisms of the TCR. Most of the individual T cell clones were present at very low frequencies, suggesting that they had not undergone clonal expansion. The usage frequencies of the TCR beta variable, beta joining, and beta diversity gene segments were similar among T cells from different individuals. Notably, the usage frequency of individual nucleotides and amino acids within complementarity-determining region (CDR3) intervals was remarkably consistent between individuals. Moreover, our data show that terminal deoxynucleotidyl transferase activity was biased toward the insertion of G (31.92%) and C (27.14%) over A (21.82%) and T (19.12%) nucleotides. Some conserved features could be observed in the composition of CDR3, which may inform future studies of human TCR gene recombination. PMID:26962778

  2. tax and rex Sequences of bovine leukaemia virus from globally diverse isolates: rex amino acid sequence more variable than tax.

    PubMed

    McGirr, K M; Buehring, G C

    2005-02-01

    Bovine leukaemia virus (BLV) is an important agricultural problem with high costs to the dairy industry. Here, we examine the variation of the tax and rex genes of BLV. The tax and rex genes share 420 bases and have overlapping reading frames. The tax gene encodes a protein that functions as a transactivator of the BLV promoter, is required for viral replication, acts on cellular promoters, and is responsible for oncogenesis. The rex facilitates the export of viral mRNAs from the nucleus and regulates transcription. We have sequenced five new isolates of the tax/rex gene. We examined the five new and three previously published tax/rex DNA and predicted amino acid sequences of BLV isolates from cattle in representative regions worldwide. The highest variation among nucleic acid sequences for tax and rex was 7% and 5%, respectively; among predicted amino acid sequences for Tax and Rex, 9% and 11%, respectively. Significantly more nucleotide changes resulted in predicted amino acid changes in the rex gene than in the tax gene (P < or = 0.0006). This variability is higher than previously reported for any region of the viral genome. This research may also have implications for the development of Tax-based vaccines. PMID:15702995

  3. A nucleic acid sequence-based amplification system for detection of Listeria monocytogenes hlyA sequences.

    PubMed Central

    Blais, B W; Turner, G; Sooknanan, R; Malek, L T

    1997-01-01

    A nucleic acid sequence-based amplification system primarily targeting mRNA from the Listeria monocytogenes hlyA gene was developed. This system enabled the detection of low numbers (< 10 CFU/g) of L. monocytogenes cells inoculated into a variety of dairy and egg products after 48 h of enrichment in modified listeria enrichment broth. PMID:8979357

  4. Limited Variation in BK Virus T-Cell Epitopes Revealed by Next-Generation Sequencing.

    PubMed

    Sahoo, Malaya K; Tan, Susanna K; Chen, Sharon F; Kapusinszky, Beatrix; Concepcion, Katherine R; Kjelson, Lynn; Mallempati, Kalyan; Farina, Heidi M; Fernández-Viña, Marcelo; Tyan, Dolly; Grimm, Paul C; Anderson, Matthew W; Concepcion, Waldo; Pinsky, Benjamin A

    2015-10-01

    BK virus (BKV) infection causing end-organ disease remains a formidable challenge to the hematopoietic cell transplant (HCT) and kidney transplant fields. As BKV-specific treatments are limited, immunologic-based therapies may be a promising and novel therapeutic option for transplant recipients with persistent BKV infection. Here, we describe a whole-genome, deep-sequencing methodology and bioinformatics pipeline that identify BKV variants across the genome and at BKV-specific HLA-A2-, HLA-B0702-, and HLA-B08-restricted CD8 T-cell epitopes. BKV whole genomes were amplified using long-range PCR with four inverse primer sets, and fragmentation libraries were sequenced on the Ion Torrent Personal Genome Machine (PGM). An error model and variant-calling algorithm were developed to accurately identify rare variants. A total of 65 samples from 18 pediatric HCT and kidney recipients with quantifiable BKV DNAemia underwent whole-genome sequencing. Limited genetic variation was observed. The median number of amino acid variants identified per sample was 8 (range, 2 to 37; interquartile range, 10), with the majority of variants (77%) detected at a frequency of <5%. When normalized for length, there was no statistical difference in the median number of variants across all genes. Similarly, the predominant virus population within samples harbored T-cell epitopes similar to the reference BKV strain that was matched for the BKV genotype. Despite the conservation of epitopes, low-level variants in T-cell epitopes were detected in 77.7% (14/18) of patients. Understanding epitope variation across the whole genome provides insight into the virus-immune interface and may help guide the development of protocols for novel immunologic-based therapies.

  5. The complete genome sequence of Staphylothermus marinus reveals differences in sulfur metabolism among heterotrophic Crenarchaeota

    SciTech Connect

    Anderson, Iain; Lakshmi, Lakshmi Dharmarajan; Rodriquez, Jason; Hooper, Sean; Porat, I.; Ulrich, Luke; Mavromatis, K; Sun, Hui; Land, Miriam L; Lapidus, Alla L.; Lucas, Susan; Barry, Kerrie; Huber, Harald; Zhulin, Igor B; Whitman, W. B.; Mukhopadhyay, Biswarup; Woese, Carl; Bristow, James; Kyrpides, Nikos C

    2009-01-01

    Background Staphylothermus marinus is an anaerobic, sulfur-reducing peptide fermenter of the archaeal phylum Crenarchaeota. It is the third heterotrophic, obligate sulfur reducing crenarchaeote to be sequenced and provides an opportunity for comparative analysis of the three genomes. Results The 1.57 Mbp genome of the hyperthermophilic crenarchaeote Staphylothermus marinus has been completely sequenced. The main energy generating pathways likely involve 2-oxoacid:ferredoxin oxidoreductases and ADP-forming acetyl-CoA synthases. S. marinus possesses several enzymes not present in other crenarchaeotes including a sodium ion-translocating decarboxylase likely to be involved in amino acid degradation. S. marinus lacks sulfur-reducing enzymes present in the other two sulfur-reducing crenarchaeotes that have been sequenced Thermofilum pendens and Hyperthermus butylicus. Instead it has three operons similar to the mbh and mbx operons of Pyrococcus furiosus, which may play a role in sulfur reduction and/or hydrogen production. The two marine organisms, S. marinus and H. butylicus, possess more sodium-dependent transporters than T. pendens and use symporters for potassium uptake while T. pendens uses an ATP-dependent potassium transporter. T. pendens has adapted to a nutrient-rich environment while H. butylicus is adapted to a nutrient-poor environment, and S. marinus lies between these two extremes. Conclusion The three heterotrophic sulfur-reducing crenarchaeotes have adapted to their habitats, terrestrial vs. marine, via their transporter content, and they have also adapted to environments with differing levels of nutrients. Despite the fact that they all use sulfur as an electron acceptor, they are likely to have different pathways for sulfur reduction.

  6. Limited Variation in BK Virus T-Cell Epitopes Revealed by Next-Generation Sequencing

    PubMed Central

    Sahoo, Malaya K.; Tan, Susanna K.; Chen, Sharon F.; Kapusinszky, Beatrix; Concepcion, Katherine R.; Kjelson, Lynn; Mallempati, Kalyan; Farina, Heidi M.; Fernández-Viña, Marcelo; Tyan, Dolly; Grimm, Paul C.; Anderson, Matthew W.; Concepcion, Waldo

    2015-01-01

    BK virus (BKV) infection causing end-organ disease remains a formidable challenge to the hematopoietic cell transplant (HCT) and kidney transplant fields. As BKV-specific treatments are limited, immunologic-based therapies may be a promising and novel therapeutic option for transplant recipients with persistent BKV infection. Here, we describe a whole-genome, deep-sequencing methodology and bioinformatics pipeline that identify BKV variants across the genome and at BKV-specific HLA-A2-, HLA-B0702-, and HLA-B08-restricted CD8 T-cell epitopes. BKV whole genomes were amplified using long-range PCR with four inverse primer sets, and fragmentation libraries were sequenced on the Ion Torrent Personal Genome Machine (PGM). An error model and variant-calling algorithm were developed to accurately identify rare variants. A total of 65 samples from 18 pediatric HCT and kidney recipients with quantifiable BKV DNAemia underwent whole-genome sequencing. Limited genetic variation was observed. The median number of amino acid variants identified per sample was 8 (range, 2 to 37; interquartile range, 10), with the majority of variants (77%) detected at a frequency of <5%. When normalized for length, there was no statistical difference in the median number of variants across all genes. Similarly, the predominant virus population within samples harbored T-cell epitopes similar to the reference BKV strain that was matched for the BKV genotype. Despite the conservation of epitopes, low-level variants in T-cell epitopes were detected in 77.7% (14/18) of patients. Understanding epitope variation across the whole genome provides insight into the virus-immune interface and may help guide the development of protocols for novel immunologic-based therapies. PMID:26202116

  7. Identification of novel peptide substrates for protein farnesyltransferase reveals two substrate classes with distinct sequence selectivities

    PubMed Central

    Hougland, James L.; Hicks, Katherine A.; Hartman, Heather L.; Kelly, Rebekah A.; Watt, Terry J.; Fierke, Carol A.

    2010-01-01

    Prenylation is a post-translational modification essential for the proper localization and function of many proteins. Farnesylation, the attachment of a 15-carbon farnesyl group near the C-terminus of protein substrates, is catalyzed by protein farnesyltransferase (FTase). Farnesylation has received significant interest as a target for pharmaceutical development and farnesyltransferase inhibitors (FTIs) are in clinical trials as cancer therapeutics. However, as the total complement of prenylated proteins is unknown, the FTase substrates responsible for FTI efficacy are not yet understood. Identifying novel prenylated proteins within the human proteome constitutes an important step towards understanding prenylation-dependent cellular processes. Based on sequence preferences for FTase derived from analysis of known farnesylated proteins, we selected and screened a library of small peptides representing the C-termini of 213 human proteins for activity with FTase. We identified 77 novel FTase substrates that exhibit multiple-turnover reactivity within this library; our library also contained 85 peptides that can be farnesylated by FTase only under single-turnover conditions. Based on these results, a second library was designed that yielded an additional 29 novel multiple-turnover FTase substrates and 45 single-turnover substrates. The two classes of substrates exhibit different specificity requirements. Efficient multiple-turnover reactivity correlates with the presence of a nonpolar amino acid at the a2 position and a Phe, Met, or Gln at the terminal X residue, consistent with the proposed Ca1a2X sequence model. In contrast, the sequences of the single-turnover substrates vary significantly more at both the a2 and X residues and are not well-described by current farnesylation algorithms. These results improve the definition of prenyltransferase substrate specificity, test the efficacy of substrate algorithms, and provide valuable information about therapeutic targets

  8. The complete genome sequence of Staphylothermus marinus reveals differences in sulfur metabolism among heterotrophic Crenarchaeota

    SciTech Connect

    Anderson, iain J.; Dharmarajan, Lakshmi; Rodriguez, Jason; Hooper, Sean; Porat, Iris; Ulrich, Luke E.; Elkins, James G.; Mavromatis, Kostas; Sun, Hui; Land, Miriam; Lapidus, Alla; Lucas, Susan; Barry, Kerrie; Huber, Harald; Zhulin, Igor B.; Whitman, William B.; Mukhopadhyay, Biswarup; Woese, Carl; Bristow, James; Kyrpides, Nikos

    2008-09-05

    Staphylothermus marinus is an anaerobic, sulfur-reducing peptide fermenter of the archaeal phylum Crenarchaeota. It is the third heterotrophic, obligate sulfur reducing crenarchaeote to be sequenced and provides an opportunity for comparative analysis of the three genomes. The 1.57 Mbp genome of the hyperthermophilic crenarchaeote Staphylothermus marinus has been completely sequenced. The main energy generating pathways likely involve 2-oxoacid:ferredoxin oxidoreductases and ADP-forming acetyl-CoA synthases. S. marinus possesses several enzymes not present in other crenarchaeotes including a sodium ion-translocating decarboxylase likely to be involved in amino acid degradation. S. marinus lacks sulfur-reducing enzymes present in the other two sulfur-reducing crenarchaeotes that have been sequenced - Thermofilum pendens and Hyperthermus butylicus. Instead it has three operons similar to the mbh and mbx operons of Pyrococcus furiosus, which may play a role in sulfur reduction and/or hydrogen production. The two marine organisms, S. marinus and H. butylicus, possess more sodium-dependent transporters than T. pendens and use symporters for potassium uptake while T. pendens uses an ATP-dependent potassium transporter. T. pendens has adapted to a nutrient-rich environment while H. butylicus is adapted to a nutrient-poor environment, and S. marinus lies between these two extremes. The three heterotrophic sulfur-reducing crenarchaeotes have adapted to their habitats, terrestrial vs. marine, via their transporter content, and they have also adapted to environments with differing levels of nutrients. Despite the fact that they all use sulfur as an electron acceptor, they are likely to have different pathways for sulfur reduction.

  9. Sequence-Specific Electrical Purification of Nucleic Acids with Nanoporous Gold Electrodes.

    PubMed

    Daggumati, Pallavi; Appelt, Sandra; Matharu, Zimple; Marco, Maria L; Seker, Erkin

    2016-06-22

    Nucleic-acid-based biosensors have enabled rapid and sensitive detection of pathogenic targets; however, these devices often require purified nucleic acids for analysis since the constituents of complex biological fluids adversely affect sensor performance. This purification step is typically performed outside the device, thereby increasing sample-to-answer time and introducing contaminants. We report a novel approach using a multifunctional matrix, nanoporous gold (np-Au), which enables both detection of specific target sequences in a complex biological sample and their subsequent purification. The np-Au electrodes modified with 26-mer DNA probes (via thiol-gold chemistry) enabled sensitive detection and capture of complementary DNA targets in the presence of complex media (fetal bovine serum) and other interfering DNA fragments in the range of 50-1500 base pairs. Upon capture, the noncomplementary DNA fragments and serum constituents of varying sizes were washed away. Finally, the surface-bound DNA-DNA hybrids were released by electrochemically cleaving the thiol-gold linkage, and the hybrids were iontophoretically eluted from the nanoporous matrix. The optical and electrophoretic characterization of the analytes before and after the detection-purification process revealed that low target DNA concentrations (80 pg/μL) can be successfully detected in complex biological fluids and subsequently released to yield pure hybrids free of polydisperse digested DNA fragments and serum biomolecules. Taken together, this multifunctional platform is expected to enable seamless integration of detection and purification of nucleic acid biomarkers of pathogens and diseases in miniaturized diagnostic devices.

  10. Amino acid sequence analysis and characterization of a ribonuclease from starfish Asterias amurensis.

    PubMed

    Motoyoshi, Naomi; Kobayashi, Hiroko; Itagaki, Tadashi; Inokuchi, Norio

    2016-09-01

    The aim of this study was to phylogenetically characterize the location of the RNase T2 enzyme in the starfish (Asterias amurensis). We isolated an RNase T2 ribonuclease (RNase Aa) from the ovaries of starfish and determined its amino acid sequence by protein chemistry and cloning cDNA encoding RNase Aa. The isolated protein had 231 amino acid residues, a predicted molecular mass of 25,906 Da, and an optimal pH of 5.0. RNase Aa preferentially released guanylic acid from the RNA. The catalytic sites of the RNase T2 family are conserved in RNase Aa; furthermore, the distribution of the cysteine residues in RNase Aa is similar to that in other animal and plant T2 RNases. RNase Aa is cleaved at two points: 21 residues from the N-terminus and 29 residues from the C-terminus; however, both fragments may remain attached to the protein via disulfide bridges, leading to the maintenance of its conformation, as suggested by circular dichroism spectrum analysis. The phylogenetic analysis revealed that starfish RNase Aa is evolutionarily an intermediate between protozoan and oyster RNases. PMID:26920046

  11. Host-Associated Genomic Features of the Novel Uncultured Intracellular Pathogen Ca. Ichthyocystis Revealed by Direct Sequencing of Epitheliocysts.

    PubMed

    Qi, Weihong; Vaughan, Lloyd; Katharios, Pantelis; Schlapbach, Ralph; Seth-Smith, Helena M B

    2016-01-01

    Advances in single-cell and mini-metagenome sequencing have enabled important investigations into uncultured bacteria. In this study, we applied the mini-metagenome sequencing method to assemble genome drafts of the uncultured causative agents of epitheliocystis, an emerging infectious disease in the Mediterranean aquaculture species gilthead seabream. We sequenced multiple cyst samples and constructed 11 genome drafts from a novel beta-proteobacterial lineage, Candidatus Ichthyocystis. The draft genomes demonstrate features typical of pathogenic bacteria with an obligate intracellular lifestyle: a reduced genome of up to 2.6 Mb, reduced G + C content, and reduced metabolic capacity. Reconstruction of metabolic pathways reveals that Ca Ichthyocystis genomes lack all amino acid synthesis pathways, compelling them to scavenge from the fish host. All genomes encode type II, III, and IV secretion systems, a large repertoire of predicted effectors, and a type IV pilus. These are all considered to be virulence factors, required for adherence, invasion, and host manipulation. However, no evidence of lipopolysaccharide synthesis could be found. Beyond the core functions shared within the genus, alignments showed distinction into different species, characterized by alternative large gene families. These comprise up to a third of each genome, appear to have arisen through duplication and diversification, encode many effector proteins, and are seemingly critical for virulence. Thus, Ca Ichthyocystis represents a novel obligatory intracellular pathogenic beta-proteobacterial lineage. The methods used: mini-metagenome analysis and manual annotation, have generated important insights into the lifestyle and evolution of the novel, uncultured pathogens, elucidating many putative virulence factors including an unprecedented array of novel gene families. PMID:27190004

  12. Host-Associated Genomic Features of the Novel Uncultured Intracellular Pathogen Ca. Ichthyocystis Revealed by Direct Sequencing of Epitheliocysts

    PubMed Central

    Qi, Weihong; Vaughan, Lloyd; Katharios, Pantelis; Schlapbach, Ralph; Seth-Smith, Helena M.B.

    2016-01-01

    Advances in single-cell and mini-metagenome sequencing have enabled important investigations into uncultured bacteria. In this study, we applied the mini-metagenome sequencing method to assemble genome drafts of the uncultured causative agents of epitheliocystis, an emerging infectious disease in the Mediterranean aquaculture species gilthead seabream. We sequenced multiple cyst samples and constructed 11 genome drafts from a novel beta-proteobacterial lineage, Candidatus Ichthyocystis. The draft genomes demonstrate features typical of pathogenic bacteria with an obligate intracellular lifestyle: a reduced genome of up to 2.6 Mb, reduced G + C content, and reduced metabolic capacity. Reconstruction of metabolic pathways reveals that Ca. Ichthyocystis genomes lack all amino acid synthesis pathways, compelling them to scavenge from the fish host. All genomes encode type II, III, and IV secretion systems, a large repertoire of predicted effectors, and a type IV pilus. These are all considered to be virulence factors, required for adherence, invasion, and host manipulation. However, no evidence of lipopolysaccharide synthesis could be found. Beyond the core functions shared within the genus, alignments showed distinction into different species, characterized by alternative large gene families. These comprise up to a third of each genome, appear to have arisen through duplication and diversification, encode many effector proteins, and are seemingly critical for virulence. Thus, Ca. Ichthyocystis represents a novel obligatory intracellular pathogenic beta-proteobacterial lineage. The methods used: mini-metagenome analysis and manual annotation, have generated important insights into the lifestyle and evolution of the novel, uncultured pathogens, elucidating many putative virulence factors including an unprecedented array of novel gene families. PMID:27190004

  13. Unique features revealed by the genome sequence of Acinetobacter sp. ADP1, a versatile and naturally transformation competent bacterium.

    PubMed

    Barbe, Valérie; Vallenet, David; Fonknechten, Nuria; Kreimeyer, Annett; Oztas, Sophie; Labarre, Laurent; Cruveiller, Stéphane; Robert, Catherine; Duprat, Simone; Wincker, Patrick; Ornston, L Nicholas; Weissenbach, Jean; Marlière, Philippe; Cohen, Georges N; Médigue, Claudine

    2004-01-01

    Acinetobacter sp. strain ADP1 is a nutritionally versatile soil bacterium closely related to representatives of the well-characterized Pseudomonas aeruginosa and Pseudomonas putida. Unlike these bacteria, the Acinetobacter ADP1 is highly competent for natural transformation which affords extraordinary convenience for genetic manipulation. The circular chromosome of the Acinetobacter ADP1, presented here, encodes 3325 predicted coding sequences, of which 60% have been classified based on sequence similarity to other documented proteins. The close evolutionary proximity of Acinetobacter and Pseudomonas species, as judged by the sequences of their 16S RNA genes and by the highest level of bidirectional best hits, contrasts with the extensive divergence in the GC content of their DNA (40 versus 62%). The chromosomes also differ significantly in size, with the Acinetobacter ADP1 chromosome <60% of the length of the Pseudomonas counterparts. Genome analysis of the Acinetobacter ADP1 revealed genes for metabolic pathways involved in utilization of a large variety of compounds. Almost all of these genes, with orthologs that are scattered in other species, are located in five major 'islands of catabolic diversity', now an apparent 'archipelago of catabolic diversity', within one-quarter of the overall genome. Acinetobacter ADP1 displays many features of other aerobic soil bacteria with metabolism oriented toward the degradation of organic compounds found in their natural habitat. A distinguishing feature of this genome is the absence of a gene corresponding to pyruvate kinase, the enzyme that generally catalyzes the terminal step in conversion of carbohydrates to pyruvate for respiration by the citric acid cycle. This finding supports the view that the cycle itself is centrally geared to the catabolic capabilities of this exceptionally versatile organism. PMID:15514110

  14. Identification of random nucleic acid sequence aberrations using dual capture probes which hybridize to different chromosome regions

    DOEpatents

    Lucas, Joe N.; Straume, Tore; Bogen, Kenneth T.

    1998-01-01

    A method is provided for detecting nucleic acid sequence aberrations using two immobilization steps. According to the method, a nucleic acid sequence aberration is detected by detecting nucleic acid sequences having both a first nucleic acid sequence type (e.g., from a first chromosome) and a second nucleic acid sequence type (e.g., from a second chromosome), the presence of the first and the second nucleic acid sequence type on the same nucleic acid sequence indicating the presence of a nucleic acid sequence aberration. In the method, immobilization of a first hybridization probe is used to isolate a first set of nucleic acids in the sample which contain the first nucleic acid sequence type. Immobilization of a second hybridization probe is then used to isolate a second set of nucleic acids from within the first set of nucleic acids which contain the second nucleic acid sequence type. The second set of nucleic acids are then detected, their presence indicating the presence of a nucleic acid sequence aberration.

  15. Identification of random nucleic acid sequence aberrations using dual capture probes which hybridize to different chromosome regions

    DOEpatents

    Lucas, J.N.; Straume, T.; Bogen, K.T.

    1998-03-24

    A method is provided for detecting nucleic acid sequence aberrations using two immobilization steps. According to the method, a nucleic acid sequence aberration is detected by detecting nucleic acid sequences having both a first nucleic acid sequence type (e.g., from a first chromosome) and a second nucleic acid sequence type (e.g., from a second chromosome), the presence of the first and the second nucleic acid sequence type on the same nucleic acid sequence indicating the presence of a nucleic acid sequence aberration. In the method, immobilization of a first hybridization probe is used to isolate a first set of nucleic acids in the sample which contain the first nucleic acid sequence type. Immobilization of a second hybridization probe is then used to isolate a second set of nucleic acids from within the first set of nucleic acids which contain the second nucleic acid sequence type. The second set of nucleic acids are then detected, their presence indicating the presence of a nucleic acid sequence aberration. 14 figs.

  16. Correction: Synergism between genome sequencing, tandem mass spectrometry and bio-inspired synthesis reveals insights into nocardioazine B biogenesis.

    PubMed

    Alqahtani, Norah; Porwal, Suheel K; James, Elle D; Bis, Dana M; Karty, Jonathan A; Lane, Amy L; Viswanathan, Rajesh

    2015-09-21

    Correction for 'Synergism between genome sequencing, tandem mass spectrometry and bio-inspired synthesis reveals insights into nocardioazine B biogenesis' by Norah Alqahtani et al., Org. Biomol. Chem., 2015, 13, 7177-7192.

  17. Marine protist diversity in European coastal waters and sediments as revealed by high-throughput sequencing.

    PubMed

    Massana, Ramon; Gobet, Angélique; Audic, Stéphane; Bass, David; Bittner, Lucie; Boutte, Christophe; Chambouvet, Aurélie; Christen, Richard; Claverie, Jean-Michel; Decelle, Johan; Dolan, John R; Dunthorn, Micah; Edvardsen, Bente; Forn, Irene; Forster, Dominik; Guillou, Laure; Jaillon, Olivier; Kooistra, Wiebe H C F; Logares, Ramiro; Mahé, Frédéric; Not, Fabrice; Ogata, Hiroyuki; Pawlowski, Jan; Pernice, Massimo C; Probert, Ian; Romac, Sarah; Richards, Thomas; Santini, Sébastien; Shalchian-Tabrizi, Kamran; Siano, Raffaele; Simon, Nathalie; Stoeck, Thorsten; Vaulot, Daniel; Zingone, Adriana; de Vargas, Colomban

    2015-10-01

    Although protists are critical components of marine ecosystems, they are still poorly characterized. Here we analysed the taxonomic diversity of planktonic and benthic protist communities collected in six distant European coastal sites. Environmental deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) from three size fractions (pico-, nano- and micro/mesoplankton), as well as from dissolved DNA and surface sediments were used as templates for tag pyrosequencing of the V4 region of the 18S ribosomal DNA. Beta-diversity analyses split the protist community structure into three main clusters: picoplankton-nanoplankton-dissolved DNA, micro/mesoplankton and sediments. Within each cluster, protist communities from the same site and time clustered together, while communities from the same site but different seasons were unrelated. Both DNA and RNA-based surveys provided similar relative abundances for most class-level taxonomic groups. Yet, particular groups were overrepresented in one of the two templates, such as marine alveolates (MALV)-I and MALV-II that were much more abundant in DNA surveys. Overall, the groups displaying the highest relative contribution were Dinophyceae, Diatomea, Ciliophora and Acantharia. Also, well represented were Mamiellophyceae, Cryptomonadales, marine alveolates and marine stramenopiles in the picoplankton, and Monadofilosa and basal Fungi in sediments. Our extensive and systematic sequencing of geographically separated sites provides the most comprehensive molecular description of coastal marine protist diversity to date.

  18. Modeling of the Ebola virus delta peptide reveals a potential lytic sequence motif.

    PubMed

    Gallaher, William R; Garry, Robert F

    2015-01-20

    Filoviruses, such as Ebola and Marburg viruses, cause severe outbreaks of human infection, including the extensive epidemic of Ebola virus disease (EVD) in West Africa in 2014. In the course of examining mutations in the glycoprotein gene associated with 2014 Ebola virus (EBOV) sequences, a differential level of conservation was noted between the soluble form of glycoprotein (sGP) and the full length glycoprotein (GP), which are both encoded by the GP gene via RNA editing. In the region of the proteins encoded after the RNA editing site sGP was more conserved than the overlapping region of GP when compared to a distant outlier species, Tai Forest ebolavirus. Half of the amino acids comprising the "delta peptide", a 40 amino acid carboxy-terminal fragment of sGP, were identical between otherwise widely divergent species. A lysine-rich amphipathic peptide motif was noted at the carboxyl terminus of delta peptide with high structural relatedness to the cytolytic peptide of the non-structural protein 4 (NSP4) of rotavirus. EBOV delta peptide is a candidate viroporin, a cationic pore-forming peptide, and may contribute to EBOV pathogenesis.

  19. Modeling of the Ebola Virus Delta Peptide Reveals a Potential Lytic Sequence Motif

    PubMed Central

    Gallaher, William R.; Garry, Robert F.

    2015-01-01

    Filoviruses, such as Ebola and Marburg viruses, cause severe outbreaks of human infection, including the extensive epidemic of Ebola virus disease (EVD) in West Africa in 2014. In the course of examining mutations in the glycoprotein gene associated with 2014 Ebola virus (EBOV) sequences, a differential level of conservation was noted between the soluble form of glycoprotein (sGP) and the full length glycoprotein (GP), which are both encoded by the GP gene via RNA editing. In the region of the proteins encoded after the RNA editing site sGP was more conserved than the overlapping region of GP when compared to a distant outlier species, Tai Forest ebolavirus. Half of the amino acids comprising the “delta peptide”, a 40 amino acid carboxy-terminal fragment of sGP, were identical between otherwise widely divergent species. A lysine-rich amphipathic peptide motif was noted at the carboxyl terminus of delta peptide with high structural relatedness to the cytolytic peptide of the non-structural protein 4 (NSP4) of rotavirus. EBOV delta peptide is a candidate viroporin, a cationic pore-forming peptide, and may contribute to EBOV pathogenesis. PMID:25609303

  20. The amino acid sequence of elephant (Elephas maximus) myoglobin and the phylogeny of Proboscidea.

    PubMed

    Dene, H; Goodman, M; Romero-Herrera, A E

    1980-02-13

    The complete amino acid sequence of skeletal myoglobin from the Asian elephant (Elephas maximus) is reported. The functional significance of variations seen when this sequence is compared with that of sperm whale myoglobin is explored in the light of the crystallographic model available for the latter molecule. The phylogenetic implications of the elephant myoglobin amino acid sequence are evaluated by using the maximum parsimony technique. A similar analysis is also presented which incorporates all of the proteins sequenced from the elephant. These results are discussed with respect to current views on proboscidean phylogeny.

  1. Amino acid sequence of rabbit kidney neutral endopeptidase 24.11 (enkephalinase) deduced from a complementary DNA.

    PubMed Central

    Devault, A; Lazure, C; Nault, C; Le Moual, H; Seidah, N G; Chrétien, M; Kahn, P; Powell, J; Mallet, J; Beaumont, A

    1987-01-01

    Neutral endopeptidase (EC 3.4.24.11) is a major constituent of kidney brush border membranes. It is also present in the brain where it has been shown to be involved in the inactivation of opioid peptides, methionine- and leucine-enkephalins. For this reason this enzyme is often called 'enkephalinase'. In order to characterize the primary structure of the enzyme, oligonucleotide probes were designed from partial amino acid sequences and used to isolate clones from kidney cDNA libraries. Sequencing of the cDNA inserts revealed the complete primary structure of the enzyme. Neutral endopeptidase consists of 750 amino acids. It contains a short N-terminal cytoplasmic domain (27 amino acids), a single membrane-spanning segment (23 amino acids) and an extracellular domain that comprises most of the protein mass. The comparison of the primary structure of neutral endopeptidase with that of thermolysin, a bacterial Zn-metallopeptidase, indicates that most of the amino acid residues involved in Zn coordination and catalytic activity in thermolysin are found within highly honmologous sequences in neutral endopeptidase. Images Fig. 1. Fig. 3. PMID:2440677

  2. Analysis of expressed sequence tags from Maize mosaic rhabdovirus-infected gut tissues of Peregrinus maidis reveals the presence of key components of insect innate immunity.

    PubMed

    Whitfield, A E; Rotenberg, D; Aritua, V; Hogenhout, S A

    2011-04-01

    The corn planthopper, Peregrinus maidis, causes direct feeding damage to plants and transmits Maize mosaic rhabdovirus (MMV) in a persistent-propagative manner. MMV must cross several insect tissue layers for successful transmission to occur, and the gut serves as an important barrier for rhabdovirus transmission. In order to facilitate the identification of proteins that may interact with MMV either by facilitating acquisition or responding to virus infection, we generated and analysed the gut transcriptome of P. maidis. From two normalized cDNA libraries, we generated a P. maidis gut transcriptome composed of 20,771 expressed sequence tags (ESTs). Assembly of the sequences yielded 1860 contigs and 14,032 singletons, and biological roles were assigned to 5793 (36%). Comparison of P. maidis ESTs with other insect amino acid sequences revealed that P. maidis shares greatest sequence similarity with another hemipteran, the brown planthopper Nilaparvata lugens. We identified 202 P. maidis transcripts with putative homology to proteins associated with insect innate immunity, including those implicated in the Toll, Imd, JAK/STAT, Jnk and the small-interfering RNA-mediated pathways. Sequence comparisons between our P. maidis gut EST collection and the currently available National Center for Biotechnology Information EST database collection for Ni. lugens revealed that a pathogen recognition receptor in the Imd pathway, peptidoglycan recognition protein-long class (PGRP-LC), is present in these two members of the family Delphacidae; however, these recognition receptors are lacking in the model hemipteran Acyrthosiphon pisum. In addition, we identified sequences in the P. maidis gut transcriptome that share significant amino acid sequence similarities with the rhabdovirus receptor molecule, acetylcholine receptor (AChR), found in other hosts. This EST analysis sheds new light on immune response pathways in hemipteran guts that will be useful for further dissecting innate

  3. An apolipoprotein influencing triglycerides in humans and mice revealed by comparative sequencing.

    PubMed

    Pennacchio, L A; Olivier, M; Hubacek, J A; Cohen, J C; Cox, D R; Fruchart, J C; Krauss, R M; Rubin, E M

    2001-10-01

    Comparison of genomic DNA sequences from human and mouse revealed a new apolipoprotein (APO) gene (APOAV) located proximal to the well-characterized APOAI/CIII/AIV gene cluster on human 11q23. Mice expressing a human APOAV transgene showed a decrease in plasma triglyceride concentrations to one-third of those in control mice; conversely, knockout mice lacking Apoav had four times as much plasma triglycerides as controls. In humans, single nucleotide polymorphisms (SNPs) across the APOAV locus were found to be significantly associated with plasma triglyceride levels in two independent studies. These findings indicate that APOAV is an important determinant of plasma triglyceride levels, a major risk factor for coronary artery disease.

  4. Diversity of bacteria in ships ballast water as revealed by next generation DNA sequencing.

    PubMed

    Brinkmeyer, Robin

    2016-06-15

    The bacterial diversity in ballast water from five general cargo ships calling at the Port of Houston was determined with ion semiconductor DNA sequencing (Ion Torrent PGM) of PCR amplified 16S rRNA genes. Phylogenetic analysis revealed that the composition of bacteria in ballast water did not resemble that of typical marine habitats or even open ocean waters where BWEs occur. The predominant group of bacteria in ships conducting BWEs was the Roseobacter clade within the Alphaproteobacteria. In contrast, Gammaproteobacteria were predominant in the ship that did not conduct a BWE. All the ships contained human, fish, and terrestrial plant pathogens as well as bacteria indicative of fecal or activated sludge contamination. Most of the 60 pathogens had not been detected in ballast water previously. Among these were the human pathogens Corynebacterium diptheriae and several Legionella species and the fish pathogens Francisella piscicida and Piscirickettsia salmonis. PMID:27076378

  5. The genetic basis for ecological adaptation of the Atlantic herring revealed by genome sequencing.

    PubMed

    Martinez Barrio, Alvaro; Lamichhaney, Sangeet; Fan, Guangyi; Rafati, Nima; Pettersson, Mats; Zhang, He; Dainat, Jacques; Ekman, Diana; Höppner, Marc; Jern, Patric; Martin, Marcel; Nystedt, Björn; Liu, Xin; Chen, Wenbin; Liang, Xinming; Shi, Chengcheng; Fu, Yuanyuan; Ma, Kailong; Zhan, Xiao; Feng, Chungang; Gustafson, Ulla; Rubin, Carl-Johan; Sällman Almén, Markus; Blass, Martina; Casini, Michele; Folkvord, Arild; Laikre, Linda; Ryman, Nils; Ming-Yuen Lee, Simon; Xu, Xun; Andersson, Leif

    2016-01-01

    Ecological adaptation is of major relevance to speciation and sustainable population management, but the underlying genetic factors are typically hard to study in natural populations due to genetic differentiation caused by natural selection being confounded with genetic drift in subdivided populations. Here, we use whole genome population sequencing of Atlantic and Baltic herring to reveal the underlying genetic architecture at an unprecedented detailed resolution for both adaptation to a new niche environment and timing of reproduction. We identify almost 500 independent loci associated with a recent niche expansion from marine (Atlantic Ocean) to brackish waters (Baltic Sea), and more than 100 independent loci showing genetic differentiation between spring- and autumn-spawning populations irrespective of geographic origin. Our results show that both coding and non-coding changes contribute to adaptation. Haplotype blocks, often spanning multiple genes and maintained by selection, are associated with genetic differentiation. PMID:27138043

  6. The genetic basis for ecological adaptation of the Atlantic herring revealed by genome sequencing

    PubMed Central

    Martinez Barrio, Alvaro; Lamichhaney, Sangeet; Fan, Guangyi; Rafati, Nima; Pettersson, Mats; Zhang, He; Dainat, Jacques; Ekman, Diana; Höppner, Marc; Jern, Patric; Martin, Marcel; Nystedt, Björn; Liu, Xin; Chen, Wenbin; Liang, Xinming; Shi, Chengcheng; Fu, Yuanyuan; Ma, Kailong; Zhan, Xiao; Feng, Chungang; Gustafson, Ulla; Rubin, Carl-Johan; Sällman Almén, Markus; Blass, Martina; Casini, Michele; Folkvord, Arild; Laikre, Linda; Ryman, Nils; Ming-Yuen Lee, Simon; Xu, Xun; Andersson, Leif

    2016-01-01

    Ecological adaptation is of major relevance to speciation and sustainable population management, but the underlying genetic factors are typically hard to study in natural populations due to genetic differentiation caused by natural selection being confounded with genetic drift in subdivided populations. Here, we use whole genome population sequencing of Atlantic and Baltic herring to reveal the underlying genetic architecture at an unprecedented detailed resolution for both adaptation to a new niche environment and timing of reproduction. We identify almost 500 independent loci associated with a recent niche expansion from marine (Atlantic Ocean) to brackish waters (Baltic Sea), and more than 100 independent loci showing genetic differentiation between spring- and autumn-spawning populations irrespective of geographic origin. Our results show that both coding and non-coding changes contribute to adaptation. Haplotype blocks, often spanning multiple genes and maintained by selection, are associated with genetic differentiation. DOI: http://dx.doi.org/10.7554/eLife.12081.001 PMID:27138043

  7. Neuronal subtypes and diversity revealed by single-nucleus RNA sequencing of the human brain

    PubMed Central

    Lake, Blue B.; Ai, Rizi; Kaeser, Gwendolyn E.; Salathia, Neeraj S.; Yung, Yun C.; Liu, Rui; Wildberg, Andre; Gao, Derek; Fung, Ho-Lim; Chen, Song; Vijayaraghavan, Raakhee; Wong, Julian; Chen, Allison; Sheng, Xiaoyan; Kaper, Fiona; Shen, Richard; Ronaghi, Mostafa; Fan, Jian-Bing; Wang, Wei; Chun, Jerold; Zhang, Kun

    2016-01-01

    The human brain has enormously complex cellular diversity and connectivities fundamental to our neural functions, yet difficulties in interrogating individual neurons has impeded understanding of the underlying transcriptional landscape. We developed a scalable approach to sequence and quantify RNA molecules in isolated neuronal nuclei from post-mortem brain, generating 3,227 sets of single neuron data from six distinct regions of the cerebral cortex. Using an iterative clustering and classification approach, we identified 16 neuronal subtypes that were further annotated on the basis of known markers and cortical cytoarchitecture. These data demonstrate a robust and scalable method for identifying and categorizing single nuclear transcriptomes, revealing shared genes sufficient to distinguish novel and orthologous neuronal subtypes as well as regional identity within the human brain. PMID:27339989

  8. The Complete Genome Sequences, Unique Mutational Spectra, and Developmental Potency of Adult Neurons Revealed by Cloning.

    PubMed

    Hazen, Jennifer L; Faust, Gregory G; Rodriguez, Alberto R; Ferguson, William C; Shumilina, Svetlana; Clark, Royden A; Boland, Michael J; Martin, Greg; Chubukov, Pavel; Tsunemoto, Rachel K; Torkamani, Ali; Kupriyanov, Sergey; Hall, Ira M; Baldwin, Kristin K

    2016-03-16

    Somatic mutation in neurons is linked to neurologic disease and implicated in cell-type diversification. However, the origin, extent, and patterns of genomic mutation in neurons remain unknown. We established a nuclear transfer method to clonally amplify the genomes of neurons from adult mice for whole-genome sequencing. Comprehensive mutation detection and independent validation revealed that individual neurons harbor ∼100 unique mutations from all classes but lack recurrent rearrangements. Most neurons contain at least one gene-disrupting mutation and rare (0-2) mobile element insertions. The frequency and gene bias of neuronal mutations differ from other lineages, potentially due to novel mechanisms governing postmitotic mutation. Fertile mice were cloned from several neurons, establishing the compatibility of mutated adult neuronal genomes with reprogramming to pluripotency and development. PMID:26948891

  9. The heterogeneity of human CD127(+) innate lymphoid cells revealed by single-cell RNA sequencing.

    PubMed

    Björklund, Åsa K; Forkel, Marianne; Picelli, Simone; Konya, Viktoria; Theorell, Jakob; Friberg, Danielle; Sandberg, Rickard; Mjösberg, Jenny

    2016-04-01

    Innate lymphoid cells (ILCs) are increasingly appreciated as important participants in homeostasis and inflammation. Substantial plasticity and heterogeneity among ILC populations have been reported. Here we have delineated the heterogeneity of human ILCs through single-cell RNA sequencing of several hundreds of individual tonsil CD127(+) ILCs and natural killer (NK) cells. Unbiased transcriptional clustering revealed four distinct populations, corresponding to ILC1 cells, ILC2 cells, ILC3 cells and NK cells, with their respective transcriptomes recapitulating known as well as unknown transcriptional profiles. The single-cell resolution additionally divulged three transcriptionally and functionally diverse subpopulations of ILC3 cells. Our systematic comparison of single-cell transcriptional variation within and between ILC populations provides new insight into ILC biology during homeostasis, with additional implications for dysregulation of the immune system.

  10. The Complete Genome Sequences, Unique Mutational Spectra, and Developmental Potency of Adult Neurons Revealed by Cloning.

    PubMed

    Hazen, Jennifer L; Faust, Gregory G; Rodriguez, Alberto R; Ferguson, William C; Shumilina, Svetlana; Clark, Royden A; Boland, Michael J; Martin, Greg; Chubukov, Pavel; Tsunemoto, Rachel K; Torkamani, Ali; Kupriyanov, Sergey; Hall, Ira M; Baldwin, Kristin K

    2016-03-16

    Somatic mutation in neurons is linked to neurologic disease and implicated in cell-type diversification. However, the origin, extent, and patterns of genomic mutation in neurons remain unknown. We established a nuclear transfer method to clonally amplify the genomes of neurons from adult mice for whole-genome sequencing. Comprehensive mutation detection and independent validation revealed that individual neurons harbor ∼100 unique mutations from all classes but lack recurrent rearrangements. Most neurons contain at least one gene-disrupting mutation and rare (0-2) mobile element insertions. The frequency and gene bias of neuronal mutations differ from other lineages, potentially due to novel mechanisms governing postmitotic mutation. Fertile mice were cloned from several neurons, establishing the compatibility of mutated adult neuronal genomes with reprogramming to pluripotency and development.

  11. Whole exome sequencing reveals the mutational spectrum of testicular germ cell tumours

    PubMed Central

    Litchfield, Kevin; Summersgill, Brenda; Yost, Shawn; Sultana, Razvan; Labreche, Karim; Dudakia, Darshna; Renwick, Anthony; Seal, Sheila; Al-Saadi, Reem; Broderick, Peter; Turner, Nicholas C.; Houlston, Richard S; Huddart, Robert; Shipley, Janet; Turnbull, Clare

    2014-01-01

    Testicular germ cell tumours (TGCTs) are the most common cancer in young men. Here we perform whole exome sequencing of 42 TGCTs to comprehensively study the mutational profile of TGCT. The mutation rate is uniformly low in all of the tumours (mean 0.5 mutations per megabase [Mb]) as compared to the common cancers, consistent with the embryological origin of TGCT. In addition to expected copy number gain of chromosome 12p and mutation of KIT we identify recurrent mutations in the tumour suppressor gene CDC27 (11.9%). Copy number analysis reveals recurring amplification of the spermatocyte development gene FSIP2 (15.3%) and a 0.4Mb region at Xq28 (15.3%). Two treatment-refractory patients are shown to harbour XRCC2 mutations, a gene strongly implicated in defining cisplatin resistance. Our findings provide further insights into genes involved in the development and progression of TGCT. PMID:25609015

  12. Whole-exome sequencing reveals the mutational spectrum of testicular germ cell tumours.

    PubMed

    Litchfield, Kevin; Summersgill, Brenda; Yost, Shawn; Sultana, Razvan; Labreche, Karim; Dudakia, Darshna; Renwick, Anthony; Seal, Sheila; Al-Saadi, Reem; Broderick, Peter; Turner, Nicholas C; Houlston, Richard S; Huddart, Robert; Shipley, Janet; Turnbull, Clare

    2015-01-01

    Testicular germ cell tumours (TGCTs) are the most common cancer in young men. Here we perform whole-exome sequencing (WES) of 42 TGCTs to comprehensively study the cancer's mutational profile. The mutation rate is uniformly low in all of the tumours (mean 0.5 mutations per Mb) as compared with common cancers, consistent with the embryological origin of TGCT. In addition to expected copy number gain of chromosome 12p and mutation of KIT, we identify recurrent mutations in the tumour suppressor gene CDC27 (11.9%). Copy number analysis reveals recurring amplification of the spermatocyte development gene FSIP2 (15.3%) and a 0.4 Mb region at Xq28 (15.3%). Two treatment-refractory patients are shown to harbour XRCC2 mutations, a gene strongly implicated in defining cisplatin resistance. Our findings provide further insights into genes involved in the development and progression of TGCT.

  13. The genetic basis for ecological adaptation of the Atlantic herring revealed by genome sequencing.

    PubMed

    Martinez Barrio, Alvaro; Lamichhaney, Sangeet; Fan, Guangyi; Rafati, Nima; Pettersson, Mats; Zhang, He; Dainat, Jacques; Ekman, Diana; Höppner, Marc; Jern, Patric; Martin, Marcel; Nystedt, Björn; Liu, Xin; Chen, Wenbin; Liang, Xinming; Shi, Chengcheng; Fu, Yuanyuan; Ma, Kailong; Zhan, Xiao; Feng, Chungang; Gustafson, Ulla; Rubin, Carl-Johan; Sällman Almén, Markus; Blass, Martina; Casini, Michele; Folkvord, Arild; Laikre, Linda; Ryman, Nils; Ming-Yuen Lee, Simon; Xu, Xun; Andersson, Leif

    2016-05-03

    Ecological adaptation is of major relevance to speciation and sustainable population management, but the underlying genetic factors are typically hard to study in natural populations due to genetic differentiation caused by natural selection being confounded with genetic drift in subdivided populations. Here, we use whole genome population sequencing of Atlantic and Baltic herring to reveal the underlying genetic architecture at an unprecedented detailed resolution for both adaptation to a new niche environment and timing of reproduction. We identify almost 500 independent loci associated with a recent niche expansion from marine (Atlantic Ocean) to brackish waters (Baltic Sea), and more than 100 independent loci showing genetic differentiation between spring- and autumn-spawning populations irrespective of geographic origin. Our results show that both coding and non-coding changes contribute to adaptation. Haplotype blocks, often spanning multiple genes and maintained by selection, are associated with genetic differentiation.

  14. Neuronal subtypes and diversity revealed by single-nucleus RNA sequencing of the human brain.

    PubMed

    Lake, Blue B; Ai, Rizi; Kaeser, Gwendolyn E; Salathia, Neeraj S; Yung, Yun C; Liu, Rui; Wildberg, Andre; Gao, Derek; Fung, Ho-Lim; Chen, Song; Vijayaraghavan, Raakhee; Wong, Julian; Chen, Allison; Sheng, Xiaoyan; Kaper, Fiona; Shen, Richard; Ronaghi, Mostafa; Fan, Jian-Bing; Wang, Wei; Chun, Jerold; Zhang, Kun

    2016-06-24

    The human brain has enormously complex cellular diversity and connectivities fundamental to our neural functions, yet difficulties in interrogating individual neurons has impeded understanding of the underlying transcriptional landscape. We developed a scalable approach to sequence and quantify RNA molecules in isolated neuronal nuclei from a postmortem brain, generating 3227 sets of single-neuron data from six distinct regions of the cerebral cortex. Using an iterative clustering and classification approach, we identified 16 neuronal subtypes that were further annotated on the basis of known markers and cortical cytoarchitecture. These data demonstrate a robust and scalable method for identifying and categorizing single nuclear transcriptomes, revealing shared genes sufficient to distinguish previously unknown and orthologous neuronal subtypes as well as regional identity and transcriptomic heterogeneity within the human brain. PMID:27339989

  15. Single-Cell RNA-Sequencing Reveals a Continuous Spectrum of Differentiation in Hematopoietic Cells

    PubMed Central

    Macaulay, Iain C.; Svensson, Valentine; Labalette, Charlotte; Ferreira, Lauren; Hamey, Fiona; Voet, Thierry; Teichmann, Sarah A.; Cvejic, Ana

    2016-01-01

    Summary The transcriptional programs that govern hematopoiesis have been investigated primarily by population-level analysis of hematopoietic stem and progenitor cells, which cannot reveal the continuous nature of the differentiation process. Here we applied single-cell RNA-sequencing to a population of hematopoietic cells in zebrafish as they undergo thrombocyte lineage commitment. By reconstructing their developmental chronology computationally, we were able to place each cell along a continuum from stem cell to mature cell, refining the traditional lineage tree. The progression of cells along this continuum is characterized by a highly coordinated transcriptional program, displaying simultaneous suppression of genes involved in cell proliferation and ribosomal biogenesis as the expression of lineage specific genes increases. Within this program, there is substantial heterogeneity in the expression of the key lineage regulators. Overall, the total number of genes expressed, as well as the total mRNA content of the cell, decreases as the cells undergo lineage commitment. PMID:26804912

  16. The complete genome sequence of Chromobacterium violaceum reveals remarkable and exploitable bacterial adaptability

    PubMed Central

    2003-01-01

    Chromobacterium violaceum is one of millions of species of free-living microorganisms that populate the soil and water in the extant areas of tropical biodiversity around the world. Its complete genome sequence reveals (i) extensive alternative pathways for energy generation, (ii) ≈500 ORFs for transport-related proteins, (iii) complex and extensive systems for stress adaptation and motility, and (iv) widespread utilization of quorum sensing for control of inducible systems, all of which underpin the versatility and adaptability of the organism. The genome also contains extensive but incomplete arrays of ORFs coding for proteins associated with mammalian pathogenicity, possibly involved in the occasional but often fatal cases of human C. violaceum infection. There is, in addition, a series of previously unknown but important enzymes and secondary metabolites including paraquat-inducible proteins, drug and heavy-metal-resistance proteins, multiple chitinases, and proteins for the detoxification of xenobiotics that may have biotechnological applications. PMID:14500782

  17. Diversity of bacteria in ships ballast water as revealed by next generation DNA sequencing.

    PubMed

    Brinkmeyer, Robin

    2016-06-15

    The bacterial diversity in ballast water from five general cargo ships calling at the Port of Houston was determined with ion semiconductor DNA sequencing (Ion Torrent PGM) of PCR amplified 16S rRNA genes. Phylogenetic analysis revealed that the composition of bacteria in ballast water did not resemble that of typical marine habitats or even open ocean waters where BWEs occur. The predominant group of bacteria in ships conducting BWEs was the Roseobacter clade within the Alphaproteobacteria. In contrast, Gammaproteobacteria were predominant in the ship that did not conduct a BWE. All the ships contained human, fish, and terrestrial plant pathogens as well as bacteria indicative of fecal or activated sludge contamination. Most of the 60 pathogens had not been detected in ballast water previously. Among these were the human pathogens Corynebacterium diptheriae and several Legionella species and the fish pathogens Francisella piscicida and Piscirickettsia salmonis.

  18. High Quality Maize Centromere 10 Sequence Reveals Evidence of Frequent Recombination Events

    PubMed Central

    Wolfgruber, Thomas K.; Nakashima, Megan M.; Schneider, Kevin L.; Sharma, Anupma; Xie, Zidian; Albert, Patrice S.; Xu, Ronghui; Bilinski, Paul; Dawe, R. Kelly; Ross-Ibarra, Jeffrey; Birchler, James A.; Presting, Gernot G.

    2016-01-01

    The ancestral centromeres of maize contain long stretches of the tandemly arranged CentC repeat. The abundance of tandem DNA repeats and centromeric retrotransposons (CR) has presented a significant challenge to completely assembling centromeres using traditional sequencing methods. Here, we report a nearly complete assembly of the 1.85 Mb maize centromere 10 from inbred B73 using PacBio technology and BACs from the reference genome project. The error rates estimated from overlapping BAC sequences are 7 × 10−6 and 5 × 10−5 for mismatches and indels, respectively. The number of gaps in the region covered by the reassembly was reduced from 140 in the reference genome to three. Three expressed genes are located between 92 and 477 kb from the inferred ancestral CentC cluster, which lies within the region of highest centromeric repeat density. The improved assembly increased the count of full-length CR from 5 to 55 and revealed a 22.7 kb segmental duplication that occurred approximately 121,000 years ago. Our analysis provides evidence of frequent recombination events in the form of partial retrotransposons, deletions within retrotransposons, chimeric retrotransposons, segmental duplications including higher order CentC repeats, a deleted CentC monomer, centromere-proximal inversions, and insertion of mitochondrial sequences. Double-strand DNA break (DSB) repair is the most plausible mechanism for these events and may be the major driver of centromere repeat evolution and diversity. In many cases examined here, DSB repair appears to be mediated by microhomology, suggesting that tandem repeats may have evolved to efficiently repair frequent DSBs in centromeres. PMID:27047500

  19. High Quality Maize Centromere 10 Sequence Reveals Evidence of Frequent Recombination Events.

    PubMed

    Wolfgruber, Thomas K; Nakashima, Megan M; Schneider, Kevin L; Sharma, Anupma; Xie, Zidian; Albert, Patrice S; Xu, Ronghui; Bilinski, Paul; Dawe, R Kelly; Ross-Ibarra, Jeffrey; Birchler, James A; Presting, Gernot G

    2016-01-01

    The ancestral centromeres of maize contain long stretches of the tandemly arranged CentC repeat. The abundance of tandem DNA repeats and centromeric retrotransposons (CR) has presented a significant challenge to completely assembling centromeres using traditional sequencing methods. Here, we report a nearly complete assembly of the 1.85 Mb maize centromere 10 from inbred B73 using PacBio technology and BACs from the reference genome project. The error rates estimated from overlapping BAC sequences are 7 × 10(-6) and 5 × 10(-5) for mismatches and indels, respectively. The number of gaps in the region covered by the reassembly was reduced from 140 in the reference genome to three. Three expressed genes are located between 92 and 477 kb from the inferred ancestral CentC cluster, which lies within the region of highest centromeric repeat density. The improved assembly increased the count of full-length CR from 5 to 55 and revealed a 22.7 kb segmental duplication that occurred approximately 121,000 years ago. Our analysis provides evidence of frequent recombination events in the form of partial retrotransposons, deletions within retrotransposons, chimeric retrotransposons, segmental duplications including higher order CentC repeats, a deleted CentC monomer, centromere-proximal inversions, and insertion of mitochondrial sequences. Double-strand DNA break (DSB) repair is the most plausible mechanism for these events and may be the major driver of centromere repeat evolution and diversity. In many cases examined here, DSB repair appears to be mediated by microhomology, suggesting that tandem repeats may have evolved to efficiently repair frequent DSBs in centromeres. PMID:27047500

  20. Unprecedented High-Resolution View of Bacterial Operon Architecture Revealed by RNA Sequencing

    PubMed Central

    Creecy, James P.; Maddox, Scott M.; Grissom, Joe E.; Conkle, Trevor L.; Shadid, Tyler M.; Teramoto, Jun; San Miguel, Phillip; Shimada, Tomohiro; Ishihama, Akira; Mori, Hirotada

    2014-01-01

    ABSTRACT We analyzed the transcriptome of Escherichia coli K-12 by strand-specific RNA sequencing at single-nucleotide resolution during steady-state (logarithmic-phase) growth and upon entry into stationary phase in glucose minimal medium. To generate high-resolution transcriptome maps, we developed an organizational schema which showed that in practice only three features are required to define operon architecture: the promoter, terminator, and deep RNA sequence read coverage. We precisely annotated 2,122 promoters and 1,774 terminators, defining 1,510 operons with an average of 1.98 genes per operon. Our analyses revealed an unprecedented view of E. coli operon architecture. A large proportion (36%) of operons are complex with internal promoters or terminators that generate multiple transcription units. For 43% of operons, we observed differential expression of polycistronic genes, despite being in the same operons, indicating that E. coli operon architecture allows fine-tuning of gene expression. We found that 276 of 370 convergent operons terminate inefficiently, generating complementary 3′ transcript ends which overlap on average by 286 nucleotides, and 136 of 388 divergent operons have promoters arranged such that their 5′ ends overlap on average by 168 nucleotides. We found 89 antisense transcripts of 397-nucleotide average length, 7 unannotated transcripts within intergenic regions, and 18 sense transcripts that completely overlap operons on the opposite strand. Of 519 overlapping transcripts, 75% correspond to sequences that are highly conserved in E. coli (>50 genomes). Our data extend recent studies showing unexpected transcriptome complexity in several bacteria and suggest that antisense RNA regulation is widespread. PMID:25006232

  1. Genome sequence of the necrotrophic plant pathogen Pythium ultimum reveals original pathogenicity mechanisms and effector repertoire

    PubMed Central

    2010-01-01

    Background Pythium ultimum is a ubiquitous oomycete plant pathogen responsible for a variety of diseases on a broad range of crop and ornamental species. Results The P. ultimum genome (42.8 Mb) encodes 15,290 genes and has extensive sequence similarity and synteny with related Phytophthora species, including the potato blight pathogen Phytophthora infestans. Whole transcriptome sequencing revealed expression of 86% of genes, with detectable differential expression of suites of genes under abiotic stress and in the presence of a host. The predicted proteome includes a large repertoire of proteins involved in plant pathogen interactions, although, surprisingly, the P. ultimum genome does not encode any classical RXLR effectors and relatively few Crinkler genes in comparison to related phytopathogenic oomycetes. A lower number of enzymes involved in carbohydrate metabolism were present compared to Phytophthora species, with the notable absence of cutinases, suggesting a significant difference in virulence mechanisms between P. ultimum and more host-specific oomycete species. Although we observed a high degree of orthology with Phytophthora genomes, there were novel features of the P. ultimum proteome, including an expansion of genes involved in proteolysis and genes unique to Pythium. We identified a small gene family of cadherins, proteins involved in cell adhesion, the first report of these in a genome outside the metazoans. Conclusions Access to the P. ultimum genome has revealed not only core pathogenic mechanisms within the oomycetes but also lineage-specific genes associated with the alternative virulence and lifestyles found within the pythiaceous lineages compared to the Peronosporaceae. PMID:20626842

  2. The Complete Genome Sequence of Fibrobacter succinogenes S85 Reveals a Cellulolytic and Metabolic Specialist

    PubMed Central

    Suen, Garret; Weimer, Paul J.; Stevenson, David M.; Aylward, Frank O.; Boyum, Julie; Deneke, Jan; Drinkwater, Colleen; Ivanova, Natalia N.; Mikhailova, Natalia; Chertkov, Olga; Goodwin, Lynne A.; Currie, Cameron R.; Mead, David; Brumm, Phillip J.

    2011-01-01

    Fibrobacter succinogenes is an important member of the rumen microbial community that converts plant biomass into nutrients usable by its host. This bacterium, which is also one of only two cultivated species in its phylum, is an efficient and prolific degrader of cellulose. Specifically, it has a particularly high activity against crystalline cellulose that requires close physical contact with this substrate. However, unlike other known cellulolytic microbes, it does not degrade cellulose using a cellulosome or by producing high extracellular titers of cellulase enzymes. To better understand the biology of F. succinogenes, we sequenced the genome of the type strain S85 to completion. A total of 3,085 open reading frames were predicted from its 3.84 Mbp genome. Analysis of sequences predicted to encode for carbohydrate-degrading enzymes revealed an unusually high number of genes that were classified into 49 different families of glycoside hydrolases, carbohydrate binding modules (CBMs), carbohydrate esterases, and polysaccharide lyases. Of the 31 identified cellulases, none contain CBMs in families 1, 2, and 3, typically associated with crystalline cellulose degradation. Polysaccharide hydrolysis and utilization assays showed that F. succinogenes was able to hydrolyze a number of polysaccharides, but could only utilize the hydrolytic products of cellulose. This suggests that F. succinogenes uses its array of hemicellulose-degrading enzymes to remove hemicelluloses to gain access to cellulose. This is reflected in its genome, as F. succinogenes lacks many of the genes necessary to transport and metabolize the hydrolytic products of non-cellulose polysaccharides. The F. succinogenes genome reveals a bacterium that specializes in cellulose as its sole energy source, and provides insight into a novel strategy for cellulose degradation. PMID:21526192

  3. mRNA deep sequencing reveals 75 new genes and a complex transcriptional landscape in Mimivirus.

    PubMed

    Legendre, Matthieu; Audic, Stéphane; Poirot, Olivier; Hingamp, Pascal; Seltzer, Virginie; Byrne, Deborah; Lartigue, Audrey; Lescot, Magali; Bernadac, Alain; Poulain, Julie; Abergel, Chantal; Claverie, Jean-Michel

    2010-05-01

    Mimivirus, a virus infecting Acanthamoeba, is the prototype of the Mimiviridae, the latest addition to the nucleocytoplasmic large DNA viruses. The Mimivirus genome encodes close to 1000 proteins, many of them never before encountered in a virus, such as four amino-acyl tRNA synthetases. To explore the physiology of this exceptional virus and identify the genes involved in the building of its characteristic intracytoplasmic "virion factory," we coupled electron microscopy observations with the massively parallel pyrosequencing of the polyadenylated RNA fractions of Acanthamoeba castellanii cells at various time post-infection. We generated 633,346 reads, of which 322,904 correspond to Mimivirus transcripts. This first application of deep mRNA sequencing (454 Life Sciences [Roche] FLX) to a large DNA virus allowed the precise delineation of the 5' and 3' extremities of Mimivirus mRNAs and revealed 75 new transcripts including several noncoding RNAs. Mimivirus genes are expressed across a wide dynamic range, in a finely regulated manner broadly described by three main temporal classes: early, intermediate, and late. This RNA-seq study confirmed the AAAATTGA sequence as an early promoter element, as well as the presence of palindromes at most of the polyadenylation sites. It also revealed a new promoter element correlating with late gene expression, which is also prominent in Sputnik, the recently described Mimivirus "virophage." These results-validated genome-wide by the hybridization of total RNA extracted from infected Acanthamoeba cells on a tiling array (Agilent)--will constitute the foundation on which to build subsequent functional studies of the Mimivirus/Acanthamoeba system. PMID:20360389

  4. mRNA deep sequencing reveals 75 new genes and a complex transcriptional landscape in Mimivirus

    PubMed Central

    Legendre, Matthieu; Audic, Stéphane; Poirot, Olivier; Hingamp, Pascal; Seltzer, Virginie; Byrne, Deborah; Lartigue, Audrey; Lescot, Magali; Bernadac, Alain; Poulain, Julie; Abergel, Chantal; Claverie, Jean-Michel

    2010-01-01

    Mimivirus, a virus infecting Acanthamoeba, is the prototype of the Mimiviridae, the latest addition to the nucleocytoplasmic large DNA viruses. The Mimivirus genome encodes close to 1000 proteins, many of them never before encountered in a virus, such as four amino-acyl tRNA synthetases. To explore the physiology of this exceptional virus and identify the genes involved in the building of its characteristic intracytoplasmic “virion factory,” we coupled electron microscopy observations with the massively parallel pyrosequencing of the polyadenylated RNA fractions of Acanthamoeba castellanii cells at various time post-infection. We generated 633,346 reads, of which 322,904 correspond to Mimivirus transcripts. This first application of deep mRNA sequencing (454 Life Sciences [Roche] FLX) to a large DNA virus allowed the precise delineation of the 5′ and 3′ extremities of Mimivirus mRNAs and revealed 75 new transcripts including several noncoding RNAs. Mimivirus genes are expressed across a wide dynamic range, in a finely regulated manner broadly described by three main temporal classes: early, intermediate, and late. This RNA-seq study confirmed the AAAATTGA sequence as an early promoter element, as well as the presence of palindromes at most of the polyadenylation sites. It also revealed a new promoter element correlating with late gene expression, which is also prominent in Sputnik, the recently described Mimivirus “virophage.” These results—validated genome-wide by the hybridization of total RNA extracted from infected Acanthamoeba cells on a tiling array (Agilent)—will constitute the foundation on which to build subsequent functional studies of the Mimivirus/Acanthamoeba system. PMID:20360389

  5. Genetic sequence data reveals widespread sharing of Leucocytozoon lineages in corvids.

    PubMed

    Freund, Dave; Wheeler, Sarah S; Townsend, Andrea K; Boyce, Walter M; Ernest, Holly B; Cicero, Carla; Sehgal, Ravinder N M

    2016-09-01

    Leucocytozoon, a widespread hemosporidian blood parasite that infects a broad group of avian families, has been studied in corvids (family: Corvidae) for over a century. Current taxonomic classification indicates that Leucocytozoon sakharoffi infects crows and related Corvus spp., while Leucocytozoon berestneffi infects magpies (Pica spp.) and blue jays (Cyanocitta sp.). This intrafamily host specificity was based on the experimental transmissibility of the parasites, as well as slight differences in their morphology and life cycle development. Genetic sequence data from Leucocytozoon spp. infecting corvids is scarce, and until the present study, sequence data has not been analyzed to confirm the current taxonomic distinctions. Here, we predict the phylogenetic relationships of Leucocytozoon cytochrome b lineages recovered from infected American Crows (Corvus brachyrhynchos), yellow-billed magpies (Pica nuttalli), and Steller's jays (Cyanocitta stelleri) to explore the host specificity pattern of L. sakharoffi and L. berestneffi. Phylogenetic reconstruction revealed a single large clade containing nearly every lineage recovered from the three host species, while showing no evidence of the expected distinction between L. sakharoffi and L. berestneffi. In addition, five of the detected lineages were recovered from both crows and magpies. This absence of the previously described host specificity in corvid Leucocytozoon spp. suggests that L. sakharoffi and L. berestneffi be reexamined from a taxonomic perspective.

  6. Deep sequencing reveals exceptional diversity and modes of transmission for bacterial sponge symbionts

    PubMed Central

    Webster, Nicole S; Taylor, Michael W; Behnam, Faris; Lücker, Sebastian; Rattei, Thomas; Whalan, Stephen; Horn, Matthias; Wagner, Michael

    2010-01-01

    Marine sponges contain complex bacterial communities of considerable ecological and biotechnological importance, with many of these organisms postulated to be specific to sponge hosts. Testing this hypothesis in light of the recent discovery of the rare microbial biosphere, we investigated three Australian sponges by massively parallel 16S rRNA gene tag pyrosequencing. Here we show bacterial diversity that is unparalleled in an invertebrate host, with more than 250 000 sponge-derived sequence tags being assigned to 23 bacterial phyla and revealing up to 2996 operational taxonomic units (95% sequence similarity) per sponge species. Of the 33 previously described ‘sponge-specific’ clusters that were detected in this study, 48% were found exclusively in adults and larvae – implying vertical transmission of these groups. The remaining taxa, including ‘Poribacteria’, were also found at very low abundance among the 135 000 tags retrieved from surrounding seawater. Thus, members of the rare seawater biosphere may serve as seed organisms for widely occurring symbiont populations in sponges and their host association might have evolved much more recently than previously thought. PMID:21966903

  7. Widespread Polycistronic Transcripts in Fungi Revealed by Single-Molecule mRNA Sequencing

    PubMed Central

    Salamov, Asaf; Zhang, Jiwei; Meng, Xiandong; Zhao, Zhiying; Kang, Dongwan; Underwood, Jason; Grigoriev, Igor V.; Figueroa, Melania; Schilling, Jonathan S.; Chen, Feng; Wang, Zhong

    2015-01-01

    Genes in prokaryotic genomes are often arranged into clusters and co-transcribed into polycistronic RNAs. Isolated examples of polycistronic RNAs were also reported in some higher eukaryotes but their presence was generally considered rare. Here we developed a long-read sequencing strategy to identify polycistronic transcripts in several mushroom forming fungal species including Plicaturopsis crispa, Phanerochaete chrysosporium, Trametes versicolor, and Gloeophyllum trabeum. We found genome-wide prevalence of polycistronic transcription in these Agaricomycetes, involving up to 8% of the transcribed genes. Unlike polycistronic mRNAs in prokaryotes, these co-transcribed genes are also independently transcribed. We show that polycistronic transcription may interfere with expression of the downstream tandem gene. Further comparative genomic analysis indicates that polycistronic transcription is conserved among a wide range of mushroom forming fungi. In summary, our study revealed, for the first time, the genome prevalence of polycistronic transcription in a phylogenetic range of higher fungi. Furthermore, we systematically show that our long-read sequencing approach and combined bioinformatics pipeline is a generic powerful tool for precise characterization of complex transcriptomes that enables identification of mRNA isoforms not recovered via short-read assembly. PMID:26177194

  8. De novo sequences of Haloquadratum walsbyi from Lake Tyrrell, Australia, reveal a variable genomic landscape.

    PubMed

    Tully, Benjamin J; Emerson, Joanne B; Andrade, Karen; Brocks, Jochen J; Allen, Eric E; Banfield, Jillian F; Heidelberg, Karla B

    2015-01-01

    Hypersaline systems near salt saturation levels represent an extreme environment, in which organisms grow and survive near the limits of life. One of the abundant members of the microbial communities in hypersaline systems is the square archaeon, Haloquadratum walsbyi. Utilizing a short-read metagenome from Lake Tyrrell, a hypersaline ecosystem in Victoria, Australia, we performed a comparative genomic analysis of H. walsbyi to better understand the extent of variation between strains/subspecies. Results revealed that previously isolated strains/subspecies do not fully describe the complete repertoire of the genomic landscape present in H. walsbyi. Rearrangements, insertions, and deletions were observed for the Lake Tyrrell derived Haloquadratum genomes and were supported by environmental de novo sequences, including shifts in the dominant genomic landscape of the two most abundant strains. Analysis pertaining to halomucins indicated that homologs for this large protein are not a feature common for all species of Haloquadratum. Further, we analyzed ATP-binding cassette transporters (ABC-type transporters) for evidence of niche partitioning between different strains/subspecies. We were able to identify unique and variable transporter subunits from all five genomes analyzed and the de novo environmental sequences, suggesting that differences in nutrient and carbon source acquisition may play a role in maintaining distinct strains/subspecies.

  9. Digital inventory of Arabidopsis transcripts revealed by 61 RNA sequencing samples.

    PubMed

    Sun, Xiaoyong; Yang, Qiuying; Deng, Zhiping; Ye, Xinfu

    2014-10-01

    Alternative splicing is an essential biological process to generate proteome diversity and phenotypic complexity. Recent improvements in RNA sequencing accuracy and computational algorithms have provided unprecedented opportunities to examine the expression levels of Arabidopsis (Arabidopsis thaliana) transcripts. In this article, we analyzed 61 RNA sequencing samples from 10 totally independent studies of Arabidopsis and calculated the transcript expression levels in different tissues, treatments, developmental stages, and varieties. These data provide a comprehensive profile of Arabidopsis transcripts with single-base resolution. We quantified the expression levels of 40,745 transcripts annotated in The Arabidopsis Information Resource 10, comprising 73% common transcripts, 15% rare transcripts, and 12% nondetectable transcripts. In addition, we investigated diverse common transcripts in detail, including ubiquitous transcripts, dominant/subordinate transcripts, and switch transcripts, in terms of their expression and transcript ratio. Interestingly, alternative splicing was the highly enriched function for the genes related to dominant/subordinate transcripts and switch transcripts. In addition, motif analysis revealed that TC motifs were enriched in dominant transcripts but not in subordinate transcripts. These motifs were found to have a strong relationship with transcription factor activity. Our results shed light on the complexity of alternative splicing and the diversity of the contributing factors. PMID:25118256

  10. Genome sequencing reveals complex secondary metabolome in the marine actinomycete Salinispora tropica

    PubMed Central

    Udwary, Daniel W.; Zeigler, Lisa; Asolkar, Ratnakar N.; Singan, Vasanth; Lapidus, Alla; Fenical, William; Jensen, Paul R.; Moore, Bradley S.

    2007-01-01

    Recent fermentation studies have identified actinomycetes of the marine-dwelling genus Salinispora as prolific natural product producers. To further evaluate their biosynthetic potential, we sequenced the 5,183,331-bp S. tropica CNB-440 circular genome and analyzed all identifiable secondary natural product gene clusters. Our analysis shows that S. tropica dedicates a large percentage of its genome (≈9.9%) to natural product assembly, which is greater than previous Streptomyces genome sequences as well as other natural product-producing actinomycetes. The S. tropica genome features polyketide synthase systems of every known formally classified family, nonribosomal peptide synthetases, and several hybrid clusters. Although a few clusters appear to encode molecules previously identified in Streptomyces species, the majority of the 17 biosynthetic loci are novel. Specific chemical information about putative and observed natural product molecules is presented and discussed. In addition, our bioinformatic analysis not only was critical for the structure elucidation of the polyene macrolactam salinilactam A, but its structural analysis aided the genome assembly of the highly repetitive slm loci. This study firmly establishes the genus Salinispora as a rich source of drug-like molecules and importantly reveals the powerful interplay between genomic analysis and traditional natural product isolation studies. PMID:17563368

  11. Whole-exome sequencing revealed two novel mutations in Usher syndrome.

    PubMed

    Koparir, Asuman; Karatas, Omer Faruk; Atayoglu, Ali Timucin; Yuksel, Bayram; Sagiroglu, Mahmut Samil; Seven, Mehmet; Ulucan, Hakan; Yuksel, Adnan; Ozen, Mustafa

    2015-06-01

    Usher syndrome is a clinically and genetically heterogeneous autosomal recessive inherited disorder accompanied by hearing loss and retinitis pigmentosa (RP). Since the associated genes are various and quite large, we utilized whole-exome sequencing (WES) as a diagnostic tool to identify the molecular basis of Usher syndrome. DNA from a 12-year-old male diagnosed with Usher syndrome was analyzed by WES. Mutations detected were confirmed by Sanger sequencing. The pathogenicity of these mutations was determined by in silico analysis. A maternally inherited deleterious frameshift mutation, c.14439_14454del in exon 66 and a paternally inherited non-sense c.10830G>A stop-gain SNV in exon 55 of USH2A were found as two novel compound heterozygous mutations. Both of these mutations disrupt the C terminal of USH2A protein. As a result, WES revealed two novel compound heterozygous mutations in a Turkish USH2A patient. This approach gave us an opportunity to have an appropriate diagnosis and provide genetic counseling to the family within a reasonable time.

  12. Genomic View of Bipolar Disorder Revealed by Whole Genome Sequencing in a Genetic Isolate

    PubMed Central

    Georgi, Benjamin; Craig, David; Kember, Rachel L.; Liu, Wencheng; Lindquist, Ingrid; Nasser, Sara; Brown, Christopher; Egeland, Janice A.; Paul, Steven M.; Bućan, Maja

    2014-01-01

    Bipolar disorder is a common, heritable mental illness characterized by recurrent episodes of mania and depression. Despite considerable effort to elucidate the genetic underpinnings of bipolar disorder, causative genetic risk factors remain elusive. We conducted a comprehensive genomic analysis of bipolar disorder in a large Old Order Amish pedigree. Microsatellite genotypes and high-density SNP-array genotypes of 388 family members were combined with whole genome sequence data for 50 of these subjects, comprising 18 parent-child trios. This study design permitted evaluation of candidate variants within the context of haplotype structure by resolving the phase in sequenced parent-child trios and by imputation of variants into multiple unsequenced siblings. Non-parametric and parametric linkage analysis of the entire pedigree as well as on smaller clusters of families identified several nominally significant linkage peaks, each of which included dozens of predicted deleterious variants. Close inspection of exonic and regulatory variants in genes under the linkage peaks using family-based association tests revealed additional credible candidate genes for functional studies and further replication in population-based cohorts. However, despite the in-depth genomic characterization of this unique, large and multigenerational pedigree from a genetic isolate, there was no convergence of evidence implicating a particular set of risk loci or common pathways. The striking haplotype and locus heterogeneity we observed has profound implications for the design of studies of bipolar and other related disorders. PMID:24625924

  13. Determinants of spontaneous mutation in the bacterium Escherichia coli as revealed by whole-genome sequencing.

    PubMed

    Foster, Patricia L; Lee, Heewook; Popodi, Ellen; Townes, Jesse P; Tang, Haixu

    2015-11-01

    A complete understanding of evolutionary processes requires that factors determining spontaneous mutation rates and spectra be identified and characterized. Using mutation accumulation followed by whole-genome sequencing, we found that the mutation rates of three widely diverged commensal Escherichia coli strains differ only by about 50%, suggesting that a rate of 1-2 × 10(-3) mutations per generation per genome is common for this bacterium. Four major forces are postulated to contribute to spontaneous mutations: intrinsic DNA polymerase errors, endogenously induced DNA damage, DNA damage caused by exogenous agents, and the activities of error-prone polymerases. To determine the relative importance of these factors, we studied 11 strains, each defective for a major DNA repair pathway. The striking result was that only loss of the ability to prevent or repair oxidative DNA damage significantly impacted mutation rates or spectra. These results suggest that, with the exception of oxidative damage, endogenously induced DNA damage does not perturb the overall accuracy of DNA replication in normally growing cells and that repair pathways may exist primarily to defend against exogenously induced DNA damage. The thousands of mutations caused by oxidative damage recovered across the entire genome revealed strong local-sequence biases of these mutations. Specifically, we found that the identity of the 3' base can affect the mutability of a purine by oxidative damage by as much as eightfold.

  14. Sequence-based Network Completion Reveals the Integrality of Missing Reactions in Metabolic Networks.

    PubMed

    Krumholz, Elias W; Libourel, Igor G L

    2015-07-31

    Genome-scale metabolic models are central in connecting genotypes to metabolic phenotypes. However, even for well studied organisms, such as Escherichia coli, draft networks do not contain a complete biochemical network. Missing reactions are referred to as gaps. These gaps need to be filled to enable functional analysis, and gap-filling choices influence model predictions. To investigate whether functional networks existed where all gap-filling reactions were supported by sequence similarity to annotated enzymes, four draft networks were supplemented with all reactions from the Model SEED database for which minimal sequence similarity was found in their genomes. Quadratic programming revealed that the number of reactions that could partake in a gap-filling solution was vast: 3,270 in the case of E. coli, where 72% of the metabolites in the draft network could connect a gap-filling solution. Nonetheless, no network could be completed without the inclusion of orphaned enzymes, suggesting that parts of the biochemistry integral to biomass precursor formation are uncharacterized. However, many gap-filling reactions were well determined, and the resulting networks showed improved prediction of gene essentiality compared with networks generated through canonical gap filling. In addition, gene essentiality predictions that were sensitive to poorly determined gap-filling reactions were of poor quality, suggesting that damage to the network structure resulting from the inclusion of erroneous gap-filling reactions may be predictable.

  15. A single-nucleotide substitution mutator phenotype revealed by exome sequencing of human colon adenomas.

    PubMed

    Nikolaev, Sergey I; Sotiriou, Sotirios K; Pateras, Ioannis S; Santoni, Federico; Sougioultzis, Stavros; Edgren, Henrik; Almusa, Henrikki; Robyr, Daniel; Guipponi, Michel; Saarela, Janna; Gorgoulis, Vassilis G; Antonarakis, Stylianos E; Halazonetis, Thanos D

    2012-12-01

    Oncogene-induced DNA replication stress is thought to drive genomic instability in cancer. In particular, replication stress can explain the high prevalence of focal genomic deletions mapping within very large genes in human tumors. However, the origin of single-nucleotide substitutions (SNS) in nonfamilial cancers is strongly debated. Some argue that cancers have a mutator phenotype, whereas others argue that the normal DNA replication error rates are sufficient to explain the number of observed SNSs. Here, we sequenced the exomes of 24, mostly precancerous, colon polyps. Analysis of the sequences revealed mutations in the APC, CTNNB1, and BRAF genes as the presumptive cancer-initiating events and many passenger SNSs. We used the number of SNSs in the various lesions to calculate mutation rates for normal colon and adenomas and found that colon adenomas exhibit a mutator phenotype. Interestingly, the SNSs in the adenomas mapped more often than expected within very large genes, where focal deletions in response to DNA replication stress also map. We propose that single-stranded DNA generated in response to oncogene-induced replication stress compromises the repair of deaminated cytosines and other damaged bases, leading to the observed SNS mutator phenotype.

  16. Determinants of spontaneous mutation in the bacterium Escherichia coli as revealed by whole-genome sequencing

    PubMed Central

    Foster, Patricia L.; Lee, Heewook; Popodi, Ellen; Townes, Jesse P.; Tang, Haixu

    2015-01-01

    A complete understanding of evolutionary processes requires that factors determining spontaneous mutation rates and spectra be identified and characterized. Using mutation accumulation followed by whole-genome sequencing, we found that the mutation rates of three widely diverged commensal Escherichia coli strains differ only by about 50%, suggesting that a rate of 1–2 × 10−3 mutations per generation per genome is common for this bacterium. Four major forces are postulated to contribute to spontaneous mutations: intrinsic DNA polymerase errors, endogenously induced DNA damage, DNA damage caused by exogenous agents, and the activities of error-prone polymerases. To determine the relative importance of these factors, we studied 11 strains, each defective for a major DNA repair pathway. The striking result was that only loss of the ability to prevent or repair oxidative DNA damage significantly impacted mutation rates or spectra. These results suggest that, with the exception of oxidative damage, endogenously induced DNA damage does not perturb the overall accuracy of DNA replication in normally growing cells and that repair pathways may exist primarily to defend against exogenously induced DNA damage. The thousands of mutations caused by oxidative damage recovered across the entire genome revealed strong local-sequence biases of these mutations. Specifically, we found that the identity of the 3′ base can affect the mutability of a purine by oxidative damage by as much as eightfold. PMID:26460006

  17. RNA sequencing reveals retinal transcriptome changes in STZ-induced diabetic rats.

    PubMed

    Liu, Yuan-Jie; Lian, Zhi-Yun; Liu, Geng; Zhou, Hong-Ying; Yang, Hui-Jun

    2016-03-01

    The present study aimed to investigate changes in retinal gene expression in streptozotocin (STZ)‑induced diabetic rats using next‑generation sequencing, utilize transcriptome signatures to investigate the molecular mechanisms of diabetic retinopathy (DR), and identify novel strategies for the treatment of DR. Diabetes was chemically induced in 10‑week‑old male Sprague‑Dawley rats using STZ. Flash‑electroretinography (F‑ERG) was performed to evaluate the visual function of the rats. The retinas of the rats were removed to perform high throughput RNA sequence (RNA‑seq) analysis. The a‑wave, b‑wave, oscillatory potential 1 (OP1), OP2 and ∑OP amplitudes were significantly reduced in the diabetic group, compared with those of the control group (P<0.05). Furthermore, the implicit b‑wave duration 16 weeks post‑STZ induction were significantly longer in the diabetic rats, compared with the control rats (P<0.001). A total of 868 genes were identified, of which 565 were upregulated and 303 were downregulated. Among the differentially expressed genes (DEGs), 94 apoptotic genes and apoptosis regulatory genes, and 19 inflammatory genes were detected. The results of the KEGG pathway significant enrichment analysis revealed enrichment in cell adhesion molecules, complement and coagulation cascades, and antigen processing and presentation. Diabetes alters several transcripts in the retina, and RNA‑seq provides novel insights into the molecular mechanisms underlying DR. PMID:26781437

  18. Facile Analysis and Sequencing of Linear and Branched Peptide Boronic Acids by MALDI Mass Spectrometry

    PubMed Central

    Crumpton, Jason; Zhang, Wenyu; Santos, Webster

    2011-01-01

    Interest in peptides incorporating boronic acid moieties is increasing due to their potential as therapeutics/diagnostics for a variety of diseases such as cancer. The utility of peptide boronic acids may be expanded with access to vast libraries that can be deconvoluted rapidly and economically. Unfortunately, current detection protocols using mass spectrometry are laborious and confounded by boronic acid trimerization, which requires time consuming analysis of dehydration products. These issues are exacerbated when the peptide sequence is unknown, as with de novo sequencing, and especially when multiple boronic acid moieties are present. Thus, a rapid, reliable and simple method for peptide identification is of utmost importance. Herein, we report the identification and sequencing of linear and branched peptide boronic acids containing up to five boronic acid groups by matrix-assisted laser desorption/ionization mass spectrometry (MALDI-MS). Protocols for preparation of pinacol boronic esters were adapted for efficient MALDI analysis of peptides. Additionally, a novel peptide boronic acid detection strategy was developed in which 2,5-dihydroxybenzoic acid (DHB) served as both matrix and derivatizing agent in a convenient, in situ, on-plate esterification. Finally, we demonstrate that DHB-modified peptide boronic acids from a single bead can be analyzed by MALDI-MSMS analysis, validating our approach for the identification and sequencing of branched peptide boronic acid libraries. PMID:21449540

  19. Identification and localization of amino acid substitutions between two phenobarbital-inducible rat hepatic microsomal cytochromes P-450 by micro sequence analyses.

    PubMed Central

    Yuan, P M; Ryan, D E; Levin, W; Shively, J E

    1983-01-01

    Two isozymes of rat liver microsomal cytochrome P-450--P-450b and P-450e--were compared by micro sequence analyses of their NH2 termini and tryptic fragments. These two phenobarbital-inducible hemoproteins, which are immunochemically indistinguishable with antibody against cytochrome P-450b, have extensive sequence homology. Automated Edman degradation of the native proteins revealed identical amino acids for the first 35 residues. Sequence determinations of the tryptic peptides, which constitute approximately 75% of each protein molecule, have thus far shown 10 amino acid differences between the two isozymes. Results of our amino acid sequence analyses established that two of the cDNAs, pcP-450pb1 and pcP-450pb4, reported by Fujii-Kuriyama et al. [Fujii-Kuriyama, Y., Mizukami, Y., Kamajiri, K., Sogawa, K. & Muramatsu, M. (1982) Proc. Natl. Acad. Sci. USA 79, 2793-2797] encode cytochrome P-450b whereas pcP-450pb2, a third cDNA whose nucleotide sequence differed slightly from that of the other two (six amino acid substitutions), encodes cytochrome P-450e. In addition to establishing the identity of these cloned cDNAs we provide direct evidence for seven additional amino acid differences between cytochromes P-450b and P-450e that occur beyond the region (Arg358) encoded by the cloned cDNA for cytochrome P-450e. Together, the amino acid sequences determined by micro sequence analysis and recombinant DNA techniques reveal 13 amino acid differences between these two isozymes. This report highlights the complementary nature of two different molecular approaches to elucidation of the amino acid sequences of isozymes with extensive structural homology. PMID:6572377

  20. Unprecedented high-resolution view of bacterial operon architecture revealed by RNA sequencing.

    PubMed

    Conway, Tyrrell; Creecy, James P; Maddox, Scott M; Grissom, Joe E; Conkle, Trevor L; Shadid, Tyler M; Teramoto, Jun; San Miguel, Phillip; Shimada, Tomohiro; Ishihama, Akira; Mori, Hirotada; Wanner, Barry L

    2014-01-01

    We analyzed the transcriptome of Escherichia coli K-12 by strand-specific RNA sequencing at single-nucleotide resolution during steady-state (logarithmic-phase) growth and upon entry into stationary phase in glucose minimal medium. To generate high-resolution transcriptome maps, we developed an organizational schema which showed that in practice only three features are required to define operon architecture: the promoter, terminator, and deep RNA sequence read coverage. We precisely annotated 2,122 promoters and 1,774 terminators, defining 1,510 operons with an average of 1.98 genes per operon. Our analyses revealed an unprecedented view of E. coli operon architecture. A large proportion (36%) of operons are complex with internal promoters or terminators that generate multiple transcription units. For 43% of operons, we observed differential expression of polycistronic genes, despite being in the same operons, indicating that E. coli operon architecture allows fine-tuning of gene expression. We found that 276 of 370 convergent operons terminate inefficiently, generating complementary 3' transcript ends which overlap on average by 286 nucleotides, and 136 of 388 divergent operons have promoters arranged such that their 5' ends overlap on average by 168 nucleotides. We found 89 antisense transcripts of 397-nucleotide average length, 7 unannotated transcripts within intergenic regions, and 18 sense transcripts that completely overlap operons on the opposite strand. Of 519 overlapping transcripts, 75% correspond to sequences that are highly conserved in E. coli (>50 genomes). Our data extend recent studies showing unexpected transcriptome complexity in several bacteria and suggest that antisense RNA regulation is widespread. Importance: We precisely mapped the 5' and 3' ends of RNA transcripts across the E. coli K-12 genome by using a single-nucleotide analytical approach. Our resulting high-resolution transcriptome maps show that ca. one-third of E. coli operons are

  1. Sequence of the cDNA and 5'-flanking region for human acid alpha-glucosidase, detection of an intron in the 5' untranslated leader sequence, definition of 18-bp polymorphisms, and differences with previous cDNA and amino acid sequences.

    PubMed

    Martiniuk, F; Mehler, M; Tzall, S; Meredith, G; Hirschhorn, R

    1990-03-01

    Acid maltase or acid alpha-glucosidase (GAA) is a lysosomal enzyme that hydrolyzes glycogen to glucose and is deficient in glycogen storage disease type II. Previously, we isolated a partial cDNA (1.9 kb) for human GAA; we have now used this cDNA to isolate and determine sequence in longer cDNAs from four additional independent cDNA libraries. Primer extension studies indicated that the mRNA extended approximately 200 bp 5' of the cDNA sequence obtained. Therefore, we isolated a genomic fragment containing 5' cDNA sequences that overlapped the previous cDNA sequence and extended an additional 24 bp to an initiation codon within a Kozak consensus sequence. The sequence of the genomic clone revealed an intron-exon junction 32 bp 5' to the ATG, indicating that the 5' leader sequence was interrupted by an intron. The remaining 186 bp of 5' untranslated sequence was identified approximately 3 kb upstream. The promoter region upstream from the start site of transcription was GC rich and contained areas of homology to Sp1 binding sites but no identifiable CAAT or TATA box. The combined data gave a nucleotide sequence of 2,856 bp for the coding region from the ATG to a stop codon, predicting a protein of 952 amino acids. The 3' untranslated region contained 555 bp with a polyadenylation signal at 3,385 bp followed by 16 bp prior to a poly(A) tail. This sequence of the GAA coding region differs from that reported by Hoefsloot et al. (1988) in three areas that change a total of 42 amino acids. Direct determination of the amino acid sequence in one of these areas confirmed the nucleotide sequence reported here but also disagreed with the directly determined amino acid sequence reported by Hoefsloot et al. (1988). At two other areas, changes in base pairs predicted new restriction sites that were identified in cDNAs from several independent libraries. The amino acid changes in all three ares increased the homology to rabbit-human isomaltase. Therefore, we believe that our

  2. Integrated exome and transcriptome sequencing reveals ZAK isoform usage in gastric cancer

    PubMed Central

    Liu, Jinfeng; McCleland, Mark; Stawiski, Eric W.; Gnad, Florian; Mayba, Oleg; Haverty, Peter M.; Durinck, Steffen; Chen, Ying-Jiun; Klijn, Christiaan; Jhunjhunwala, Suchit; Lawrence, Michael; Liu, Hanbin; Wan, Yinan; Chopra, Vivek; Yaylaoglu, Murat B.; Yuan, Wenlin; Ha, Connie; Gilbert, Houston N.; Reeder, Jens; Pau, Gregoire; Stinson, Jeremy; Stern, Howard M.; Manning, Gerard; Wu, Thomas D.; Neve, Richard M.; de Sauvage, Frederic J.; Modrusan, Zora; Seshagiri, Somasekar; Firestein, Ron; Zhang, Zemin

    2014-01-01

    Gastric cancer is the second leading cause of worldwide cancer mortality, yet the underlying genomic alterations remain poorly understood. Here we perform exome and transcriptome sequencing and SNP array assays to characterize 51 primary gastric tumours and 32 cell lines. Meta-analysis of exome data and previously published data sets reveals 24 significantly mutated genes in microsatellite stable (MSS) tumours and 16 in microsatellite instable (MSI) tumours. Over half the patients in our collection could potentially benefit from targeted therapies. We identify 55 splice site mutations accompanied by aberrant splicing products, in addition to mutation-independent differential isoform usage in tumours. ZAK kinase isoform TV1 is preferentially upregulated in gastric tumours and cell lines relative to normal samples. This pattern is also observed in colorectal, bladder and breast cancers. Overexpression of this particular isoform activates multiple cancer-related transcription factor reporters, while depletion of ZAK in gastric cell lines inhibits proliferation. These results reveal the spectrum of genomic and transcriptomic alterations in gastric cancer, and identify isoform-specific oncogenic properties of ZAK. PMID:24807215

  3. Stacking sequence and interlayer coupling in few-layer graphene revealed by in situ imaging

    PubMed Central

    Wang, Zhu-Jun; Dong, Jichen; Cui, Yi; Eres, Gyula; Timpe, Olaf; Fu, Qiang; Ding, Feng; Schloegl, R.; Willinger, Marc-Georg

    2016-01-01

    In the transition from graphene to graphite, the addition of each individual graphene layer modifies the electronic structure and produces a different material with unique properties. Controlled growth of few-layer graphene is therefore of fundamental interest and will provide access to materials with engineered electronic structure. Here we combine isothermal growth and etching experiments with in situ scanning electron microscopy to reveal the stacking sequence and interlayer coupling strength in few-layer graphene. The observed layer-dependent etching rates reveal the relative strength of the graphene–graphene and graphene–substrate interaction and the resulting mode of adlayer growth. Scanning tunnelling microscopy and density functional theory calculations confirm a strong coupling between graphene edge atoms and platinum. Simulated etching confirms that etching can be viewed as reversed growth. This work demonstrates that real-time imaging under controlled atmosphere is a powerful method for designing synthesis protocols for sp2 carbon nanostructures in between graphene and graphite. PMID:27759024

  4. Computer Simulation of the Determination of Amino Acid Sequences in Polypeptides

    ERIC Educational Resources Information Center

    Daubert, Stephen D.; Sontum, Stephen F.

    1977-01-01

    Describes a computer program that generates a random string of amino acids and guides the student in determining the correct sequence of a given protein by using experimental analytic data for that protein. (MLH)

  5. Amino acid sequence and glycosylation of functional unit RtH2-e from Rapana thomasiana (gastropod) hemocyanin.

    PubMed

    Stoeva, Stanka; Idakieva, Krasimira; Betzel, Christian; Genov, Nicolay; Voelter, Wolfgang

    2002-03-15

    The complete amino acid sequence of Rapana thomasiana hemocyanin functional unit RtH2-e was determined by direct sequencing and matrix-assisted laser desorption ionization mass spectrometry of peptides obtained by cleavage with EndoLysC proteinase, chymotrypsin, and trypsin. The single-polypeptide chain of RtH2-e consists of 413 amino acid residues and contains two consensus sequences NXS/T (positions 11-19 and 127-129), potential sites for N-glycosylation. Monosaccharide analysis of RtH2-e revealed a carbohydrate content of about 1.1% and the presence of xylose, fucose, mannose, and N-acetylglucosamine, demonstrating that only N-linked carbohydrate chains of high-mannose type seem to be present. On basis of the monosaccharide composition and MALDI-MS analysis of native and PNGase-F-treated chymotryptic glycopeptide fragment of RtH2-e the oligosaccharide Man(5)GlcNAc(2), attached to Asn(127), is suggested. Multiple sequence alignments with other molluscan hemocyanin e functional units revealed an identity of 63% to the cephalopod Octopus dofleini and of 69% to the gastropod Haliotis tuberculata. The present results are discussed in view of the recently determined X-ray structure of the functional unit g of the O. dofleini hemocyanin. PMID:11888200

  6. The amino acid sequence of monal pheasant lysozyme and its activity.

    PubMed

    Araki, T; Matsumoto, T; Torikata, T

    1998-10-01

    The amino acid sequence of monal pheasant lysozyme and its activity were analyzed. Carboxymethylated lysozyme was digested with trypsin and the resulting peptides were sequenced. The established amino acid sequence had one amino acid substitution at position 102 (Arg to Gly) comparing with Indian peafowl lysozyme and four amino acid substitutions at positions 3 (Phe to Tyr), 15 (His to Leu), 41 (Gln to His), and 121 (Gln to His) with chicken lysozyme. Analysis of the time-courses of reaction using N-acetylglucosamine pentamer as a substrate showed a difference of binding free energy change (-0.4 kcal/mol) at subsites A between monal pheasant and Indian peafowl lysozyme. This was assumed to be caused by the amino acid substitution at subsite A with loss of a positive charge at position 102 (Arg102 to Gly).

  7. The amino acid sequence of monal pheasant lysozyme and its activity.

    PubMed

    Araki, T; Matsumoto, T; Torikata, T

    1998-10-01

    The amino acid sequence of monal pheasant lysozyme and its activity were analyzed. Carboxymethylated lysozyme was digested with trypsin and the resulting peptides were sequenced. The established amino acid sequence had one amino acid substitution at position 102 (Arg to Gly) comparing with Indian peafowl lysozyme and four amino acid substitutions at positions 3 (Phe to Tyr), 15 (His to Leu), 41 (Gln to His), and 121 (Gln to His) with chicken lysozyme. Analysis of the time-courses of reaction using N-acetylglucosamine pentamer as a substrate showed a difference of binding free energy change (-0.4 kcal/mol) at subsites A between monal pheasant and Indian peafowl lysozyme. This was assumed to be caused by the amino acid substitution at subsite A with loss of a positive charge at position 102 (Arg102 to Gly). PMID:9836434

  8. cDNA-derived amino acid sequences of myoglobins from nine species of whales and dolphins.

    PubMed

    Iwanami, Kentaro; Mita, Hajime; Yamamoto, Yasuhiko; Fujise, Yoshihiro; Yamada, Tadasu; Suzuki, Tomohiko

    2006-10-01

    We determined the myoglobin (Mb) cDNA sequences of nine cetaceans, of which six are the first reports of Mb sequences: sei whale (Balaenoptera borealis), Bryde's whale (Balaenoptera edeni), pygmy sperm whale (Kogia breviceps), Stejneger's beaked whale (Mesoplodon stejnegeri), Longman's beaked whale (Indopacetus pacificus), and melon-headed whale (Peponocephala electra), and three confirm the previously determined chemical amino acid sequences: sperm whale (Physeter macrocephalus), common minke whale (Balaenoptera acutorostrata) and pantropical spotted dolphin (Stenella attenuata). We found two types of Mb in the skeletal muscle of pantropical spotted dolphin: Mb I with the same amino acid sequence as that deposited in the protein database, and Mb II, which differs at two amino acid residues compared with Mb I. Using an alignment of the amino acid or cDNA sequences of cetacean Mb, we constructed a phylogenetic tree by the NJ method. Clustering of cetacean Mb amino acid and cDNA sequences essentially follows the classical taxonomy of cetaceans, suggesting that Mb sequence data is valid for classification of cetaceans at least to the family level. PMID:16962803

  9. Studies on monotreme proteins. VII. Amino acid sequence of myoglobin from the platypus, Ornithoryhynchus anatinus.

    PubMed

    Fisher, W K; Thompson, E O

    1976-03-01

    Myoglobin isolated from skeletal muscle of the platypus contains 153 amino acid residues. The complete amino acid sequence has been determined following cleavage with cyanogen bromide and further digestion of the four fragments with trypsin, chymotrypsin, pepsin and thermolysin. Sequences of the purified peptides were determined by the dansyl-Edman procedure. The amino acid sequence showed 25 differences from human myoglobin and 24 from kangaroo myoglobin. Amino acid sequences in myoglobins are more conserved than sequences in the alpha- and beta-globin chains, and platypus myoglobin shows a similar number of variations in sequence to kangaroo myoglobin when compared with myoglobin of other species. The date of divergence of the platypus from other mammals was estimated at 102 +/- 31 million years, based on the number of amino acid differences between species and allowing for mutations during the evolutionary period. This estimate differs widely from the estimate given by similar treatment of the alpha- and beta-chain sequences and a constant rate of mutation of globin chains is not supported. PMID:962722

  10. A Sequence-Independent Strategy for Amplification and Characterisation of Episomal Badnavirus Sequences Reveals Three Previously Uncharacterised Yam Badnaviruses

    PubMed Central

    Bömer, Moritz; Turaki, Aliyu A.; Silva, Gonçalo; Kumar, P. Lava; Seal, Susan E.

    2016-01-01

    Yam (Dioscorea spp.) plants are potentially hosts to a diverse range of badnavirus species (genus Badnavirus, family Caulimoviridae), but their detection is complicated by the existence of integrated badnavirus sequences in some yam genomes. To date, only two badnavirus genomes have been characterised, namely, Dioscorea bacilliform AL virus (DBALV) and Dioscorea bacilliform SN virus (DBSNV). A further 10 tentative species in yam have been described based on their partial reverse transcriptase (RT)-ribonuclease H (RNaseH) sequences, generically referred to here as Dioscorea bacilliform viruses (DBVs). Further characterisation of DBV species is necessary to determine which represent episomal viruses and which are only present as integrated badnavirus sequences in some yam genomes. In this study, a sequence-independent multiply-primed rolling circle amplification (RCA) method was evaluated for selective amplification of episomal DBV genomes. This resulted in the identification and characterisation of nine complete genomic sequences (7.4–7.7 kbp) of existing and previously undescribed DBV phylogenetic groups from Dioscorea alata and Dioscorea rotundata accessions. These new yam badnavirus genomes expand our understanding of the diversity and genomic organisation of DBVs, and assist the development of improved diagnostic tools. Our findings also suggest that mixed badnavirus infections occur relatively often in West African yam germplasm. PMID:27399761

  11. A Sequence-Independent Strategy for Amplification and Characterisation of Episomal Badnavirus Sequences Reveals Three Previously Uncharacterised Yam Badnaviruses.

    PubMed

    Bömer, Moritz; Turaki, Aliyu A; Silva, Gonçalo; Kumar, P Lava; Seal, Susan E

    2016-01-01

    Yam (Dioscorea spp.) plants are potentially hosts to a diverse range of badnavirus species (genus Badnavirus, family Caulimoviridae), but their detection is complicated by the existence of integrated badnavirus sequences in some yam genomes. To date, only two badnavirus genomes have been characterised, namely, Dioscorea bacilliform AL virus (DBALV) and Dioscorea bacilliform SN virus (DBSNV). A further 10 tentative species in yam have been described based on their partial reverse transcriptase (RT)-ribonuclease H (RNaseH) sequences, generically referred to here as Dioscorea bacilliform viruses (DBVs). Further characterisation of DBV species is necessary to determine which represent episomal viruses and which are only present as integrated badnavirus sequences in some yam genomes. In this study, a sequence-independent multiply-primed rolling circle amplification (RCA) method was evaluated for selective amplification of episomal DBV genomes. This resulted in the identification and characterisation of nine complete genomic sequences (7.4-7.7 kbp) of existing and previously undescribed DBV phylogenetic groups from Dioscorea alata and Dioscorea rotundata accessions. These new yam badnavirus genomes expand our understanding of the diversity and genomic organisation of DBVs, and assist the development of improved diagnostic tools. Our findings also suggest that mixed badnavirus infections occur relatively often in West African yam germplasm. PMID:27399761

  12. Cloning and nucleotide sequencing of a novel 7 beta-(4-carboxybutanamido)cephalosporanic acid acylase gene of Bacillus laterosporus and its expression in Escherichia coli and Bacillus subtilis.

    PubMed

    Aramori, I; Fukagawa, M; Tsumura, M; Iwami, M; Ono, H; Kojo, H; Kohsaka, M; Ueda, Y; Imanaka, H

    1991-12-01

    A strain of Bacillus species which produced an enzyme named glutaryl 7-ACA acylase which converts 7 beta-(4-carboxybutanamido)cephalosporanic acid (glutaryl 7-ACA) to 7-amino cephalosporanic acid (7-ACA) was isolated from soil. The gene for the glutaryl 7-ACA acylase was cloned with pHSG298 in Escherichia coli JM109, and the nucleotide sequence was determined by the M13 dideoxy chain termination method. The DNA sequence revealed only one large open reading frame composed of 1,902 bp corresponding to 634 amino acid residues. The deduced amino acid sequence contained a potential signal sequence in its amino-terminal region. Expression of the gene for glutaryl 7-ACA acylase was performed in both E. coli and Bacillus subtilis. The enzyme preparations purified from either recombinant strain of E. coli or B. subtilis were shown to be identical with each other as regards the profile of sodium dodecyl sulfate-polyacrylamide gel electrophoresis and were composed of a single peptide with the molecular size of 70 kDa. Determination of the amino-terminal sequence of the two enzyme preparations revealed that both amino-terminal sequences (the first nine amino acids) were identical and completely coincided with residues 28 to 36 of the open reading frame. Extracellular excretion of the enzyme was observed in a recombinant strain of B. subtilis. PMID:1744041

  13. Molecular characterization of insulin from squamate reptiles reveals sequence diversity and possible adaptive evolution.

    PubMed

    Yamagishi, Genki; Yoshida, Ayaka; Kobayashi, Aya; Park, Min Kyun

    2016-01-01

    The Squamata are the most adaptive and prosperous group among ectothermic amniotes, reptiles, due to their species-richness and geographically wide habitat. Although the molecular mechanisms underlying their prosperity remain largely unknown, unique features have been reported from hormones that regulate energy metabolism. Insulin, a central anabolic hormone, is one such hormone, as its roles and effectiveness in regulation of blood glucose levels remain to be examined in squamates. In the present study, cDNAs coding for insulin were isolated from multiple species that represent various groups of squamates. The deduced amino acid sequences showed a high degree of divergence, with four lineages showing obviously higher number of amino acid substitutions than most of vertebrates, from teleosts to mammals. Among 18 sites presented to comprise the two receptor binding surfaces (one with 12 sites and the other with 6 sites), substitutions were observed in 13 sites. Among them was the substitution of HisB10, which results in the loss of the ability to hexamerize. Furthermore, three of these substitutions were reported to increase mitogenicity in human analogues. These substitutions were also reported from insulin of hystricomorph rodents and agnathan fishes, whose mitogenic potency have been shown to be increased. The estimated value of the non-synonymous-to-synonymous substitution ratio (ω) for the Squamata clade was larger than those of the other reptiles and aves. Even higher values were estimated for several lineages among squamates. These results, together with the regulatory mechanisms of digestion and nutrient assimilation in squamates, suggested a possible adaptive process through the molecular evolution of squamate INS. Further studies on the roles of insulin, in relation to the physiological and ecological traits of squamate species, will provide an insight into the molecular mechanisms that have led to the adaptivity and prosperity of squamates.

  14. Re-sequencing regions of the ovine Y chromosome in domestic and wild sheep reveals novel paternal haplotypes.

    PubMed

    Meadows, J R S; Kijas, J W

    2009-02-01

    The male-specific region of the ovine Y chromosome (MSY) remains poorly characterized, yet sequence variants from this region have the potential to reveal the wild progenitor of domestic sheep or examples of domestic and wild paternal introgression. The 5' promoter region of the sex-determining gene SRY was re-sequenced using a subset of wild sheep including bighorn (Ovis canadensis), thinhorn (Ovis dalli spp.), urial (Ovis vignei), argali (Ovis ammon), mouflon (Ovis musimon) and domestic sheep (Ovis aries). Seven novel SNPs (oY2-oY8) were revealed; these were polymorphic between but not within species. Re-sequencing and fragment analysis was applied to the MSY microsatellite SRYM18. It contains a complex compound repeat structure and sequencing of three novel size fragments revealed that a pentanucleotide element remained fixed, whilst a dinucleotide element displayed variability within species. Comparison of the sequence between species revealed that urial and argali sheep grouped more closely to the mouflon and domestic breeds than the pachyceriforms (bighorn and thinhorn). SNP and microsatellite data were combined to define six previously undetected haplotypes. Analysis revealed the mouflon as the only species to share a haplotype with domestic sheep, consistent with its status as a feral domesticate that has undergone male-mediated exchange with domestic animals. A comparison of the remaining wild species and domestic sheep revealed that O. aries is free from signatures of wild sheep introgression.

  15. Multiple Genome Sequences of Important Beer-Spoiling Lactic Acid Bacteria

    PubMed Central

    Geissler, Andreas J.; Vogel, Rudi F.

    2016-01-01

    Seven strains of important beer-spoiling lactic acid bacteria were sequenced using single-molecule real-time sequencing. Complete genomes were obtained for strains of Lactobacillus paracollinoides, Lactobacillus lindneri, and Pediococcus claussenii. The analysis of these genomes emphasizes the role of plasmids as the genomic foundation of beer-spoiling ability. PMID:27795248

  16. Computational sequence analysis of predicted long dsRNA transcriptomes of major crops reveals sequence complementarity with human genes.

    PubMed

    Jensen, Peter D; Zhang, Yuanji; Wiggins, B Elizabeth; Petrick, Jay S; Zhu, Jin; Kerstetter, Randall A; Heck, Gregory R; Ivashuta, Sergey I

    2013-01-01

    Long double-stranded RNAs (long dsRNAs) are precursors for the effector molecules of sequence-specific RNA-based gene silencing in eukaryotes. Plant cells can contain numerous endogenous long dsRNAs. This study demonstrates that such endogenous long dsRNAs in plants have sequence complementarity to human genes. Many of these complementary long dsRNAs have perfect sequence complementarity of at least 21 nucleotides to human genes; enough complementarity to potentially trigger gene silencing in targeted human cells if delivered in functional form. However, the number and diversity of long dsRNA molecules in plant tissue from crops such as lettuce, tomato, corn, soy and rice with complementarity to human genes that have a long history of safe consumption supports a conclusion that long dsRNAs do not present a significant dietary risk.

  17. Amino acid sequence of an intracellular, phosphate-starvation-induced ribonuclease from cultured tomato (Lycopersicon esculentum) cells.

    PubMed

    Löffler, A; Glund, K; Irie, M

    1993-06-15

    The primary structure of an intracellular ribonuclease (RNase LX) from cultured tomato (Lycopersicon esculentum) cells has been determined. Previous studies have shown that the protein is located inside the tomato cells but outside the vacuoles and that its synthesis is induced after depleting the cells for phosphate [Löffler, A., Abel, S., Jost, W., Beintema, J. J., Glund, K. (1992) Plant Physiol. 98, 1472-1478]. Sequence analysis was carried out by analysis of peptides isolated after enzymatic and chemical cleavage of the protein. RNase LX consists of 213 amino acids and has a molecular mass of 24300 Da and an isoelectric point of 5.33. The enzyme contains 10 half-cystines and there are no potential N-glycosylation sites detectable in the sequence. RNase LX, as compared to an extracellular tomato RNase (RNase LE), which is also phosphate regulated and the amino acid sequence of which was recently established [Jost, W., Bak, H., Glund, K., Terpstra, P. & Beintema, J. J. (1991) Eur. J. Biochem. 198, 1-6] has 60% of all amino acids identical and in identical positions, revealing a high degree of similarity between both proteins. In contrast to RNase LE, RNase LX has a C-terminal extension of nine amino acids. The C-terminal tetrapeptide HDEF may be a retention signal of the protein in the endoplasmic reticulum. PMID:8319673

  18. Rational design of translational pausing without altering the amino acid sequence dramatically promotes soluble protein expression: a strategic demonstration.

    PubMed

    Chen, Wei; Jin, Jingjie; Gu, Wei; Wei, Bo; Lei, Yun; Xiong, Sheng; Zhang, Gong

    2014-11-10

    The production of many pharmaceutical and industrial proteins in prokaryotic hosts is hindered by the insolubility of industrial expression products resulting from misfolding. Even with a correct primary sequence, an improper translation elongation rate in a heterologous expression system is an important cause of misfolding. In silico analysis revealed that most of the endogenous Escherichia coli genes display translational pausing sites that promote correct folding, and almost 1/5 genes have pausing sites at the 3'-termini of their coding sequence. Therefore, we established a novel strategy to efficiently promote the expression of soluble and active proteins without altering the amino acid sequence or expression conditions. This strategy uses the rational design of translational pausing based on structural information solely through synonymous substitutions, i.e. no change on the amino acids sequence. We demonstrated this strategy on a promising antiviral candidate, Cyanovirin-N (CVN), which could not be efficiently expressed in any previously reported system. By introducing silent mutations, we increased the soluble expression level in E. coli by 2000-fold without altering the CVN protein sequence, and the specific activity was slightly higher for the optimized CVN than for the wild-type variant. This strategy introduces new possibilities for the production of bioactive recombinant proteins.

  19. Genome and Transcriptome Sequences Reveal the Specific Parasitism of the Nematophagous Purpureocillium lilacinum 36-1

    PubMed Central

    Xie, Jialian; Li, Shaojun; Mo, Chenmi; Xiao, Xueqiong; Peng, Deliang; Wang, Gaofeng; Xiao, Yannong

    2016-01-01

    Purpureocillium lilacinum is a promising nematophagous ascomycete able to adapt diverse environments and it is also an opportunistic fungus that infects humans. A microbial inoculant of P. lilacinum has been registered to control plant parasitic nematodes. However, the molecular mechanism of the toxicological processes is still unclear because of the relatively few reports on the subject. In this study, using Illumina paired-end sequencing, the draft genome sequence and the transcriptome of P. lilacinum strain 36-1 infecting nematode-eggs were determined. Whole genome alignment indicated that P. lilacinum 36-1 possessed a more dynamic genome in comparison with P. lilacinum India strain. Moreover, a phylogenetic analysis showed that the P. lilacinum 36-1 had a closer relation to entomophagous fungi. The protein-coding genes in P. lilacinum 36-1 occurred much more frequently than they did in other fungi, which was a result of the depletion of repeat-induced point mutations (RIP). Comparative genome and transcriptome analyses revealed the genes that were involved in pathogenicity, particularly in the recognition, adhesion of nematode-eggs, downstream signal transduction pathways and hydrolase genes. By contrast, certain numbers of cellulose and xylan degradation genes and a lack of polysaccharide lyase genes showed the potential of P. lilacinum 36-1 as an endophyte. Notably, the expression of appressorium-formation and antioxidants-related genes exhibited similar infection patterns in P. lilacinum strain 36-1 to those of the model entomophagous fungi Metarhizium spp. These results uncovered the specific parasitism of P. lilacinum and presented the genes responsible for the infection of nematode-eggs. PMID:27486440

  20. Genome and Transcriptome Sequences Reveal the Specific Parasitism of the Nematophagous Purpureocillium lilacinum 36-1.

    PubMed

    Xie, Jialian; Li, Shaojun; Mo, Chenmi; Xiao, Xueqiong; Peng, Deliang; Wang, Gaofeng; Xiao, Yannong

    2016-01-01

    Purpureocillium lilacinum is a promising nematophagous ascomycete able to adapt diverse environments and it is also an opportunistic fungus that infects humans. A microbial inoculant of P. lilacinum has been registered to control plant parasitic nematodes. However, the molecular mechanism of the toxicological processes is still unclear because of the relatively few reports on the subject. In this study, using Illumina paired-end sequencing, the draft genome sequence and the transcriptome of P. lilacinum strain 36-1 infecting nematode-eggs were determined. Whole genome alignment indicated that P. lilacinum 36-1 possessed a more dynamic genome in comparison with P. lilacinum India strain. Moreover, a phylogenetic analysis showed that the P. lilacinum 36-1 had a closer relation to entomophagous fungi. The protein-coding genes in P. lilacinum 36-1 occurred much more frequently than they did in other fungi, which was a result of the depletion of repeat-induced point mutations (RIP). Comparative genome and transcriptome analyses revealed the genes that were involved in pathogenicity, particularly in the recognition, adhesion of nematode-eggs, downstream signal transduction pathways and hydrolase genes. By contrast, certain numbers of cellulose and xylan degradation genes and a lack of polysaccharide lyase genes showed the potential of P. lilacinum 36-1 as an endophyte. Notably, the expression of appressorium-formation and antioxidants-related genes exhibited similar infection patterns in P. lilacinum strain 36-1 to those of the model entomophagous fungi Metarhizium spp. These results uncovered the specific parasitism of P. lilacinum and presented the genes responsible for the infection of nematode-eggs. PMID:27486440

  1. Whole mitochondrial genome sequencing of domestic horses reveals incorporation of extensive wild horse diversity during domestication

    PubMed Central

    2011-01-01

    Background DNA target enrichment by micro-array capture combined with high throughput sequencing technologies provides the possibility to obtain large amounts of sequence data (e.g. whole mitochondrial DNA genomes) from multiple individuals at relatively low costs. Previously, whole mitochondrial genome data for domestic horses (Equus caballus) were limited to only a few specimens and only short parts of the mtDNA genome (especially the hypervariable region) were investigated for larger sample sets. Results In this study we investigated whole mitochondrial genomes of 59 domestic horses from 44 breeds and a single Przewalski horse (Equus przewalski) using a recently described multiplex micro-array capture approach. We found 473 variable positions within the domestic horses, 292 of which are parsimony-informative, providing a well resolved phylogenetic tree. Our divergence time estimate suggests that the mitochondrial genomes of modern horse breeds shared a common ancestor around 93,000 years ago and no later than 38,000 years ago. A Bayesian skyline plot (BSP) reveals a significant population expansion beginning 6,000-8,000 years ago with an ongoing exponential growth until the present, similar to other domestic animal species. Our data further suggest that a large sample of wild horse diversity was incorporated into the domestic population; specifically, at least 46 of the mtDNA lineages observed in domestic horses (73%) already existed before the beginning of domestication about 5,000 years ago. Conclusions Our study provides a window into the maternal origins of extant domestic horses and confirms that modern domestic breeds present a wide sample of the mtDNA diversity found in ancestral, now extinct, wild horse populations. The data obtained allow us to detect a population expansion event coinciding with the beginning of domestication and to estimate both the minimum number of female horses incorporated into the domestic gene pool and the time depth of the

  2. EEG microstate sequences in healthy humans at rest reveal scale-free dynamics.

    PubMed

    Van de Ville, Dimitri; Britz, Juliane; Michel, Christoph M

    2010-10-19

    Recent findings identified electroencephalography (EEG) microstates as the electrophysiological correlates of fMRI resting-state networks. Microstates are defined as short periods (100 ms) during which the EEG scalp topography remains quasi-stable; that is, the global topography is fixed but strength might vary and polarity invert. Microstates represent the subsecond coherent activation within global functional brain networks. Surprisingly, these rapidly changing EEG microstates correlate significantly with activity in fMRI resting-state networks after convolution with the hemodynamic response function that constitutes a strong temporal smoothing filter. We postulate here that microstate sequences should reveal scale-free, self-similar dynamics to explain this remarkable effect and thus that microstate time series show dependencies over long time ranges. To that aim, we deploy wavelet-based fractal analysis that allows determining scale-free behavior. We find strong statistical evidence that microstate sequences are scale free over six dyadic scales covering the 256-ms to 16-s range. The degree of long-range dependency is maintained when shuffling the local microstate labels but becomes indistinguishable from white noise when equalizing microstate durations, which indicates that temporal dynamics are their key characteristic. These results advance the understanding of temporal dynamics of brain-scale neuronal network models such as the global workspace model. Whereas microstates can be considered the "atoms of thoughts," the shortest constituting elements of cognition, they carry a dynamic signature that is reminiscent at characteristic timescales up to multiple seconds. The scale-free dynamics of the microstates might be the basis for the rapid reorganization and adaptation of the functional networks of the brain. PMID:20921381

  3. Population-scale sequencing reveals genetic differentiation due to local adaptation in Atlantic herring

    PubMed Central

    Lamichhaney, Sangeet; Barrio, Alvaro Martinez; Rafati, Nima; Sundström, Görel; Rubin, Carl-Johan; Gilbert, Elizabeth R.; Berglund, Jonas; Wetterbom, Anna; Laikre, Linda; Webster, Matthew T.; Grabherr, Manfred; Ryman, Nils; Andersson, Leif

    2012-01-01

    The Atlantic herring (Clupea harengus), one of the most abundant marine fishes in the world, has historically been a critical food source in Northern Europe. It is one of the few marine species that can reproduce throughout the brackish salinity gradient of the Baltic Sea. Previous studies based on few genetic markers have revealed a conspicuous lack of genetic differentiation between geographic regions, consistent with huge population sizes and minute genetic drift. Here, we present a cost-effective genome-wide study in a species that lacks a genome sequence. We first assembled a muscle transcriptome and then aligned genomic reads to the transcripts, creating an “exome assembly,” capturing both exons and flanking sequences. We then resequenced pools of fish from a wide geographic range, including the Northeast Atlantic, as well as different regions in the Baltic Sea, aligned the reads to the exome assembly, and identified 440,817 SNPs. The great majority of SNPs showed no appreciable differences in allele frequency among populations; however, several thousand SNPs showed striking differences, some approaching fixation for different alleles. The contrast between low genetic differentiation at most loci and striking differences at others implies that the latter category primarily reflects natural selection. A simulation study confirmed that the distribution of the fixation index FST deviated significantly from expectation for selectively neutral loci. This study provides insights concerning the population structure of an important marine fish and establishes the Atlantic herring as a model for population genetic studies of adaptation and natural selection. PMID:23134729

  4. Molecular cloning and sequence analysis of complementary DNA encoding rat mammary gland medium-chain S-acyl fatty acid synthetase thio ester hydrolase

    SciTech Connect

    Safford, R.; de Silva, J.; Lucas, C.; Windust, J.H.C.; Shedden, J.; James, C.M.; Sidebottom, C.M.; Slabas, A.R.; Tombs, M.P.; Hughes, S.G.

    1987-03-10

    Poly(A) + RNA from pregnant rat mammary glands was size-fractionated by sucrose gradient centrifugation, and fractions enriched in medium-chain S-acyl fatty acid synthetase thio ester hydrolase (MCH) were identified by in vitro translation and immunoprecipitation. A cDNA library was constructed, in pBR322, from enriched poly(A) + RNA and screened with two oligonucleotide probes deduced from rat MCH amino acid sequence data. Cross-hybridizing clones were isolated and found to contain cDNA inserts ranging from approx. 1100 to 1550 base pairs (bp). A 1550-bp cDNA insert, from clone 43H09, was confirmed to encode MCH by hybrid-select translation/immunoprecipitation studies and by comparison of the amino acid sequence deduced from the DNA sequence of the clone to the amino acid sequence of the MCH peptides. Northern blot analysis revealed the size of the MCH mRNA to be 1500 nucleotides, and it is therefore concluded that the 1550-bp insert (including G x C tails) of clone 43H09 represents a full- or near-full-length copy of the MCH gene. The rat MCH sequence is the first reported sequence of a thioesterase from a mammalian source, but comparison of the deduced amino acid sequences of MCH and the recently published mallard duck medium-chain S-acyl fatty acid synthetase thioesterase reveals significant homology. In particular, a seven amino acid sequence containing the proposed active serine of the duck thioesterase is found to be perfectly conserved in rat MCH.

  5. Exploration of the arrest peptide sequence space reveals arrest-enhanced variants.

    PubMed

    Cymer, Florian; Hedman, Rickard; Ismail, Nurzian; von Heijne, Gunnar

    2015-04-17

    Translational arrest peptides (APs) are short stretches of polypeptides that induce translational stalling when synthesized on a ribosome. Mechanical pulling forces acting on the nascent chain can weaken or even abolish stalling. APs can therefore be used as in vivo force sensors, making it possible to measure the forces that act on a nascent chain during translation with single-residue resolution. It is also possible to score the relative strengths of APs by subjecting them to a given pulling force and ranking them according to stalling efficiency. Using the latter approach, we now report an extensive mutagenesis scan of a strong mutant variant of the Mannheimia succiniciproducens SecM AP and identify mutations that further increase the stalling efficiency. Combining three such mutations, we designed an AP that withstands the strongest pulling force we are able to generate at present. We further show that diproline stretches in a nascent protein act as very strong APs when translation is carried out in the absence of elongation factor P. Our findings highlight critical residues in APs, show that certain amino acid sequences induce very strong translational arrest and provide a toolbox of APs of varying strengths that can be used for in vivo force measurements.

  6. First draft genome sequencing of indole acetic acid producing and plant growth promoting fungus Preussia sp. BSL10.

    PubMed

    Khan, Abdul Latif; Asaf, Sajjad; Khan, Abdur Rahim; Al-Harrasi, Ahmed; Al-Rawahi, Ahmed; Lee, In-Jung

    2016-05-10

    Preussia sp. BSL10, family Sporormiaceae, was actively producing phytohormone (indole-3-acetic acid) and extra-cellular enzymes (phosphatases and glucosidases). The fungus was also promoting the growth of arid-land tree-Boswellia sacra. Looking at such prospects of this fungus, we sequenced its draft genome for the first time. The Illumina based sequence analysis reveals an approximate genome size of 31.4Mbp for Preussia sp. BSL10. Based on ab initio gene prediction, total 32,312 coding sequences were annotated consisting of 11,967 coding genes, pseudogenes, and 221 tRNA genes. Furthermore, 321 carbohydrate-active enzymes were predicted and classified into many functional families. PMID:26995610

  7. High-throughput RNA sequencing reveals structural differences of orthologous brain-expressed genes between western lowland gorillas and humans.

    PubMed

    Lipovich, Leonard; Hou, Zhuo-Cheng; Jia, Hui; Sinkler, Christopher; McGowen, Michael; Sterner, Kirstin N; Weckle, Amy; Sugalski, Amara B; Pipes, Lenore; Gatti, Domenico L; Mason, Christopher E; Sherwood, Chet C; Hof, Patrick R; Kuzawa, Christopher W; Grossman, Lawrence I; Goodman, Morris; Wildman, Derek E

    2016-02-01

    The human brain and human cognitive abilities are strikingly different from those of other great apes despite relatively modest genome sequence divergence. However, little is presently known about the interspecies divergence in gene structure and transcription that might contribute to these phenotypic differences. To date, most comparative studies of gene structure in the brain have examined humans, chimpanzees, and macaque monkeys. To add to this body of knowledge, we analyze here the brain transcriptome of the western lowland gorilla (Gorilla gorilla gorilla), an African great ape species that is phylogenetically closely related to humans, but with a brain that is approximately one-third the size. Manual transcriptome curation from a sample of the planum temporale region of the neocortex revealed 12 protein-coding genes and one noncoding-RNA gene with exons in the gorilla unmatched by public transcriptome data from the orthologous human loci. These interspecies gene structure differences accounted for a total of 134 amino acids in proteins found in the gorilla that were absent from protein products of the orthologous human genes. Proteins varying in structure between human and gorilla were involved in immunity and energy metabolism, suggesting their relevance to phenotypic differences. This gorilla neocortical transcriptome comprises an empirical, not homology- or prediction-driven, resource for orthologous gene comparisons between human and gorilla. These findings provide a unique repository of the sequences and structures of thousands of genes transcribed in the gorilla brain, pointing to candidate genes that may contribute to the traits distinguishing humans from other closely related great apes. PMID:26132897

  8. Genome sequencing of Listeria monocytogenes "Quargel" listeriosis outbreak strains reveals two different strains with distinct in vitro virulence potential.

    PubMed

    Rychli, Kathrin; Müller, Anneliese; Zaiser, Andreas; Schoder, Dagmar; Allerberger, Franz; Wagner, Martin; Schmitz-Esser, Stephan

    2014-01-01

    A large listeriosis outbreak occurred in Austria, Germany and the Czech Republic in 2009 and 2010. The outbreak was traced back to a traditional Austrian curd cheese called "Quargel" which was contaminated with two distinct serovar 1/2a Listeria monocytogenes strains (QOC1 and QOC2). In this study we sequenced and analysed the genomes of both outbreak strains in order to investigate the extent of genetic diversity between the two strains belonging to MLST sequence types 398 (QOC2) and 403 (QOC1). Both genomes are highly similar, but also display distinct properties: The QOC1 genome is approximately 74 kbp larger than the QOC2 genome. In addition, the strains harbour 93 (QOC1) and 45 (QOC2) genes encoding strain-specific proteins. A 21 kbp region showing highest similarity to plasmid pLMIV encoding three putative internalins is integrated in the QOC1 genome. In contrast to QOC1, strain QOC2 harbours a vip homologue, which encodes a LPXTG surface protein involved in cell invasion. In accordance, in vitro virulence assays revealed distinct differences in invasion efficiency and intracellular proliferation within different cell types. The higher virulence potential of QOC1 in non-phagocytic cells may be explained by the presence of additional internalins in the pLMIV-like region, whereas the higher invasion capability of QOC2 into phagocytic cells may be due to the presence of a vip homologue. In addition, both strains show differences in stress-related gene content. Strain QOC1 encodes a so-called stress survival islet 1, whereas strain QOC2 harbours a homologue of the uncharacterized LMOf2365_0481 gene. Consistently, QOC1 shows higher resistance to acidic, alkaline and gastric stress. In conclusion, our results show that strain QOC1 and QOC2 are distinct and did not recently evolve from a common ancestor.

  9. High-throughput RNA sequencing reveals structural differences of orthologous brain-expressed genes between western lowland gorillas and humans.

    PubMed

    Lipovich, Leonard; Hou, Zhuo-Cheng; Jia, Hui; Sinkler, Christopher; McGowen, Michael; Sterner, Kirstin N; Weckle, Amy; Sugalski, Amara B; Pipes, Lenore; Gatti, Domenico L; Mason, Christopher E; Sherwood, Chet C; Hof, Patrick R; Kuzawa, Christopher W; Grossman, Lawrence I; Goodman, Morris; Wildman, Derek E

    2016-02-01

    The human brain and human cognitive abilities are strikingly different from those of other great apes despite relatively modest genome sequence divergence. However, little is presently known about the interspecies divergence in gene structure and transcription that might contribute to these phenotypic differences. To date, most comparative studies of gene structure in the brain have examined humans, chimpanzees, and macaque monkeys. To add to this body of knowledge, we analyze here the brain transcriptome of the western lowland gorilla (Gorilla gorilla gorilla), an African great ape species that is phylogenetically closely related to humans, but with a brain that is approximately one-third the size. Manual transcriptome curation from a sample of the planum temporale region of the neocortex revealed 12 protein-coding genes and one noncoding-RNA gene with exons in the gorilla unmatched by public transcriptome data from the orthologous human loci. These interspecies gene structure differences accounted for a total of 134 amino acids in proteins found in the gorilla that were absent from protein products of the orthologous human genes. Proteins varying in structure between human and gorilla were involved in immunity and energy metabolism, suggesting their relevance to phenotypic differences. This gorilla neocortical transcriptome comprises an empirical, not homology- or prediction-driven, resource for orthologous gene comparisons between human and gorilla. These findings provide a unique repository of the sequences and structures of thousands of genes transcribed in the gorilla brain, pointing to candidate genes that may contribute to the traits distinguishing humans from other closely related great apes.

  10. Draft Genome Sequences of Two Novel Acidimicrobiaceae Members from an Acid Mine Drainage Biofilm Metagenome

    PubMed Central

    Pinto, Ameet J.; Sharp, Jonathan O.; Yoder, Michael J.

    2016-01-01

    Bacteria belonging to the family Acidimicrobiaceae are frequently encountered in heavy metal-contaminated acidic environments. However, their phylogenetic and metabolic diversity is poorly resolved. We present draft genome sequences of two novel and phylogenetically distinct Acidimicrobiaceae members assembled from an acid mine drainage biofilm metagenome. PMID:26769942

  11. Complete Genome Sequence of Streptomyces clavuligerus F613-1, an Industrial Producer of Clavulanic Acid.

    PubMed

    Cao, Guangxiang; Zhong, Chuanqing; Zong, Gongli; Fu, Jiafang; Liu, Zhong; Zhang, Guimin; Qin, Ronghuo

    2016-01-01

    Streptomyces clavuligerus strain F613-1 is an industrial strain with high-yield clavulanic acid production. In this study, the complete genome sequence of S. clavuligerus strain F613-1 was determined, including one linear chromosome and one linear plasmid, carrying numerous sets of genes involving in the biosynthesis of clavulanic acid.

  12. Complete Genome Sequence of Streptomyces clavuligerus F613-1, an Industrial Producer of Clavulanic Acid.

    PubMed

    Cao, Guangxiang; Zhong, Chuanqing; Zong, Gongli; Fu, Jiafang; Liu, Zhong; Zhang, Guimin; Qin, Ronghuo

    2016-01-01

    Streptomyces clavuligerus strain F613-1 is an industrial strain with high-yield clavulanic acid production. In this study, the complete genome sequence of S. clavuligerus strain F613-1 was determined, including one linear chromosome and one linear plasmid, carrying numerous sets of genes involving in the biosynthesis of clavulanic acid. PMID:27660792

  13. Complete Genome Sequence of Streptomyces clavuligerus F613-1, an Industrial Producer of Clavulanic Acid

    PubMed Central

    Zhong, Chuanqing; Zong, Gongli; Fu, Jiafang; Liu, Zhong; Zhang, Guimin; Qin, Ronghuo

    2016-01-01

    Streptomyces clavuligerus strain F613-1 is an industrial strain with high-yield clavulanic acid production. In this study, the complete genome sequence of S. clavuligerus strain F613-1 was determined, including one linear chromosome and one linear plasmid, carrying numerous sets of genes involving in the biosynthesis of clavulanic acid. PMID:27660792

  14. Parvalbumins from coelacanth muscle. III. Amino acid sequence of the major component.

    PubMed

    Jauregui-Adell, J; Pechere, J F

    1978-09-26

    The primary structure of the major parvalbumin (pI = 4.52) from coelacanth muscle (Latimeria chalumnae) has been determined. Sequence analysis of the tryptic peptides, in some cases obtained with beta-trypsin, accounts for the total amino acid content of the protein. Chymotryptic peptides provide appropriate sequence overlaps, to complete the localization of the tryptic peptides. Examination of the amino acid sequence of this protein shows the typical structure of a beta-parvalbumin. Its position in the dendrogram of related calcium-binding proteins corresponds to that usually accepted for crossopterygians.

  15. Transcriptomic changes in human renal proximal tubular cells revealed under hypoxic conditions by RNA sequencing.

    PubMed

    Yu, Wenmin; Li, Yiping; Wang, Zhi; Liu, Lei; Liu, Jing; Ding, Fengan; Zhang, Xiaoyi; Cheng, Zhengyuan; Chen, Pingsheng; Dou, Jun

    2016-09-01

    Chronic hypoxia often occurs among patients with chronic kidney disease (CKD). Renal proximal tubular cells may be the primary target of a hypoxic insult. However, the underlying transcriptional mechanisms remain undefined. In this study, we revealed the global changes in gene expression in HK‑2 human renal proximal tubular cells under hypoxic and normoxic conditions. We analyzed the transcriptome of HK‑2 cells exposed to hypoxia for 24 h using RNA sequencing. A total of 279 differentially expressed genes was examined, as these genes could potentially explain the differences in HK‑2 cells between hypoxic and normoxic conditions. Moreover, 17 genes were validated by qPCR, and the results were highly concordant with the RNA seqencing results. Gene Ontology and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses were performed to better understand the functions of these differentially expressed genes. The upregulated genes appeared to be significantly enriched in the pathyway of extracellular matrix (ECM)-receptor interaction, and in paticular, the pathway of renal cell carcinoma was upregulated under hypoxic conditions. The downregulated genes were enriched in the signaling pathway related to antigen processing and presentation; however, the pathway of glutathione metabolism was downregulated. Our analysis revealed numerous novel transcripts and alternative splicing events. Simultaneously, we also identified a large number of single nucleotide polymorphisms, which will be a rich resource for future marker development. On the whole, our data indicate that transcriptome analysis provides valuable information for a more in depth understanding of the molecular mechanisms in CKD and renal cell carcinoma. PMID:27432315

  16. Genome sequencing and analysis reveals possible determinants of Staphylococcus aureus nasal carriage

    PubMed Central

    Sivaraman, Karthikeyan; Venkataraman, Nitya; Tsai, Jennifer; Dewell, Scott; Cole, Alexander M

    2008-01-01

    Background Nasal carriage of Staphylococcus aureus is a major risk factor in clinical and community settings due to the range of etiologies caused by the organism. We have identified unique immunological and ultrastructural properties associated with nasal carriage isolates denoting a role for bacterial factors in nasal carriage. However, despite extensive molecular level characterizations by several groups suggesting factors necessary for colonization on nasal epithelium, genetic determinants of nasal carriage are unknown. Herein, we have set a genomic foundation for unraveling the bacterial determinants of nasal carriage in S. aureus. Results MLST analysis revealed no lineage specific differences between carrier and non-carrier strains suggesting a role for mobile genetic elements. We completely sequenced a model carrier isolate (D30) and a model non-carrier strain (930918-3) to identify differential gene content. Comparison revealed the presence of 84 genes unique to the carrier strain and strongly suggests a role for Type VII secretion systems in nasal carriage. These genes, along with a putative pathogenicity island (SaPIBov) present uniquely in the carrier strains are likely important in affecting carriage. Further, PCR-based genotyping of other clinical isolates for a specific subset of these 84 genes raise the possibility of nasal carriage being caused by multiple gene sets. Conclusion Our data suggest that carriage is likely a heterogeneic phenotypic trait and implies a role for nucleotide level polymorphism in carriage. Complete genome level analyses of multiple carriage strains of S. aureus will be important in clarifying molecular determinants of S. aureus nasal carriage. PMID:18808706

  17. 18S rDNA Sequences from Microeukaryotes Reveal Oil Indicators in Mangrove Sediment

    PubMed Central

    Santos, Henrique F.; Cury, Juliano C.; Carmo, Flavia L.; Rosado, Alexandre S.; Peixoto, Raquel S.

    2010-01-01

    Background Microeukaryotes are an effective indicator of the presence of environmental contaminants. However, the characterisation of these organisms by conventional tools is often inefficient, and recent molecular studies have revealed a great diversity of microeukaryotes. The full extent of this diversity is unknown, and therefore, the distribution, ecological role and responses to anthropogenic effects of microeukaryotes are rather obscure. The majority of oil from oceanic oil spills (e.g., the May 2010 accident in the Gulf of Mexico) converges on coastal ecosystems such as mangroves, which are threatened with worldwide disappearance, highlighting the need for efficient tools to indicate the presence of oil in these environments. However, no studies have used molecular methods to assess the effects of oil contamination in mangrove sediment on microeukaryotes as a group. Methodology/Principal Findings We evaluated the population dynamics and the prevailing 18S rDNA phylotypes of microeukaryotes in mangrove sediment microcosms with and without oil contamination, using PCR/DGGE and clone libraries. We found that microeukaryotes are useful for monitoring oil contamination in mangroves. Our clone library analysis revealed a decrease in both diversity and species richness after contamination. The phylogenetic group that showed the greatest sensitivity to oil was the Nematoda. After contamination, a large increase in the abundance of the groups Bacillariophyta (diatoms) and Biosoecida was detected. The oil-contaminated samples were almost entirely dominated by organisms related to Bacillariophyta sp. and Cafeteria minima, which indicates that these groups are possible targets for biomonitoring oil in mangroves. The DGGE fingerprints also indicated shifts in microeukaryote profiles; specific band sequencing indicated the appearance of Bacillariophyta sp. only in contaminated samples and Nematoda only in non-contaminated sediment. Conclusions/Significance We believe that

  18. Fingerprinting the Asterid Species Using Subtracted Diversity Array Reveals Novel Species-Specific Sequences

    PubMed Central

    Mantri, Nitin; Olarte, Alexandra; Li, Chun Guang; Xue, Charlie; Pang, Edwin C. K.

    2012-01-01

    Background Asterids is one of the major plant clades comprising of many commercially important medicinal species. One of the major concerns in medicinal plant industry is adulteration/contamination resulting from misidentification of herbal plants. This study reports the construction and validation of a microarray capable of fingerprinting medicinally important species from the Asterids clade. Methodology/Principal Findings Pooled genomic DNA of 104 non-asterid angiosperm and non-angiosperm species was subtracted from pooled genomic DNA of 67 asterid species. Subsequently, 283 subtracted DNA fragments were used to construct an Asterid-specific array. The validation of Asterid-specific array revealed a high (99.5%) subtraction efficiency. Twenty-five Asterid species (mostly medicinal) representing 20 families and 9 orders within the clade were hybridized onto the array to reveal its level of species discrimination. All these species could be successfully differentiated using their hybridization patterns. A number of species-specific probes were identified for commercially important species like tea, coffee, dandelion, yarrow, motherwort, Japanese honeysuckle, valerian, wild celery, and yerba mate. Thirty-seven polymorphic probes were characterized by sequencing. A large number of probes were novel species-specific probes whilst some of them were from chloroplast region including genes like atpB, rpoB, and ndh that have extensively been used for fingerprinting and phylogenetic analysis of plants. Conclusions/Significance Subtracted Diversity Array technique is highly efficient in fingerprinting species with little or no genomic information. The Asterid-specific array could fingerprint all 25 species assessed including three species that were not used in constructing the array. This study validates the use of chloroplast genes for bar-coding (fingerprinting) plant species. In addition, this method allowed detection of several new loci that can be explored to solve

  19. Whole-Genome Sequencing Reveals Diverse Models of Structural Variations in Esophageal Squamous Cell Carcinoma.

    PubMed

    Cheng, Caixia; Zhou, Yong; Li, Hongyi; Xiong, Teng; Li, Shuaicheng; Bi, Yanghui; Kong, Pengzhou; Wang, Fang; Cui, Heyang; Li, Yaoping; Fang, Xiaodong; Yan, Ting; Li, Yike; Wang, Juan; Yang, Bin; Zhang, Ling; Jia, Zhiwu; Song, Bin; Hu, Xiaoling; Yang, Jie; Qiu, Haile; Zhang, Gehong; Liu, Jing; Xu, Enwei; Shi, Ruyi; Zhang, Yanyan; Liu, Haiyan; He, Chanting; Zhao, Zhenxiang; Qian, Yu; Rong, Ruizhou; Han, Zhiwei; Zhang, Yanlin; Luo, Wen; Wang, Jiaqian; Peng, Shaoliang; Yang, Xukui; Li, Xiangchun; Li, Lin; Fang, Hu; Liu, Xingmin; Ma, Li; Chen, Yunqing; Guo, Shiping; Chen, Xing; Xi, Yanfeng; Li, Guodong; Liang, Jianfang; Yang, Xiaofeng; Guo, Jiansheng; Jia, JunMei; Li, Qingshan; Cheng, Xiaolong; Zhan, Qimin; Cui, Yongping

    2016-02-01

    Comprehensive identification of somatic structural variations (SVs) and understanding their mutational mechanisms in cancer might contribute to understanding biological differences and help to identify new therapeutic targets. Unfortunately, characterization of complex SVs across the whole genome and the mutational mechanisms underlying esophageal squamous cell carcinoma (ESCC) is largely unclear. To define a comprehensive catalog of somatic SVs, affected target genes, and their underlying mechanisms in ESCC, we re-analyzed whole-genome sequencing (WGS) data from 31 ESCCs using Meerkat algorithm to predict somatic SVs and Patchwork to determine copy-number changes. We found deletions and translocations with NHEJ and alt-EJ signature as the dominant SV types, and 16% of deletions were complex deletions. SVs frequently led to disruption of cancer-associated genes (e.g., CDKN2A and NOTCH1) with different mutational mechanisms. Moreover, chromothripsis, kataegis, and breakage-fusion-bridge (BFB) were identified as contributing to locally mis-arranged chromosomes that occurred in 55% of ESCCs. These genomic catastrophes led to amplification of oncogene through chromothripsis-derived double-minute chromosome formation (e.g., FGFR1 and LETM2) or BFB-affected chromosomes (e.g., CCND1, EGFR, ERBB2, MMPs, and MYC), with approximately 30% of ESCCs harboring BFB-derived CCND1 amplification. Furthermore, analyses of copy-number alterations reveal high frequency of whole-genome duplication (WGD) and recurrent focal amplification of CDCA7 that might act as a potential oncogene in ESCC. Our findings reveal molecular defects such as chromothripsis and BFB in malignant transformation of ESCCs and demonstrate diverse models of SVs-derived target genes in ESCCs. These genome-wide SV profiles and their underlying mechanisms provide preventive, diagnostic, and therapeutic implications for ESCCs. PMID:26833333

  20. Whole-Genome Sequencing Reveals Diverse Models of Structural Variations in Esophageal Squamous Cell Carcinoma

    PubMed Central

    Cheng, Caixia; Zhou, Yong; Li, Hongyi; Xiong, Teng; Li, Shuaicheng; Bi, Yanghui; Kong, Pengzhou; Wang, Fang; Cui, Heyang; Li, Yaoping; Fang, Xiaodong; Yan, Ting; Li, Yike; Wang, Juan; Yang, Bin; Zhang, Ling; Jia, Zhiwu; Song, Bin; Hu, Xiaoling; Yang, Jie; Qiu, Haile; Zhang, Gehong; Liu, Jing; Xu, Enwei; Shi, Ruyi; Zhang, Yanyan; Liu, Haiyan; He, Chanting; Zhao, Zhenxiang; Qian, Yu; Rong, Ruizhou; Han, Zhiwei; Zhang, Yanlin; Luo, Wen; Wang, Jiaqian; Peng, Shaoliang; Yang, Xukui; Li, Xiangchun; Li, Lin; Fang, Hu; Liu, Xingmin; Ma, Li; Chen, Yunqing; Guo, Shiping; Chen, Xing; Xi, Yanfeng; Li, Guodong; Liang, Jianfang; Yang, Xiaofeng; Guo, Jiansheng; Jia, JunMei; Li, Qingshan; Cheng, Xiaolong; Zhan, Qimin; Cui, Yongping

    2016-01-01

    Comprehensive identification of somatic structural variations (SVs) and understanding their mutational mechanisms in cancer might contribute to understanding biological differences and help to identify new therapeutic targets. Unfortunately, characterization of complex SVs across the whole genome and the mutational mechanisms underlying esophageal squamous cell carcinoma (ESCC) is largely unclear. To define a comprehensive catalog of somatic SVs, affected target genes, and their underlying mechanisms in ESCC, we re-analyzed whole-genome sequencing (WGS) data from 31 ESCCs using Meerkat algorithm to predict somatic SVs and Patchwork to determine copy-number changes. We found deletions and translocations with NHEJ and alt-EJ signature as the dominant SV types, and 16% of deletions were complex deletions. SVs frequently led to disruption of cancer-associated genes (e.g., CDKN2A and NOTCH1) with different mutational mechanisms. Moreover, chromothripsis, kataegis, and breakage-fusion-bridge (BFB) were identified as contributing to locally mis-arranged chromosomes that occurred in 55% of ESCCs. These genomic catastrophes led to amplification of oncogene through chromothripsis-derived double-minute chromosome formation (e.g., FGFR1 and LETM2) or BFB-affected chromosomes (e.g., CCND1, EGFR, ERBB2, MMPs, and MYC), with approximately 30% of ESCCs harboring BFB-derived CCND1 amplification. Furthermore, analyses of copy-number alterations reveal high frequency of whole-genome duplication (WGD) and recurrent focal amplification of CDCA7 that might act as a potential oncogene in ESCC. Our findings reveal molecular defects such as chromothripsis and BFB in malignant transformation of ESCCs and demonstrate diverse models of SVs-derived target genes in ESCCs. These genome-wide SV profiles and their underlying mechanisms provide preventive, diagnostic, and therapeutic implications for ESCCs. PMID:26833333

  1. Complete genome sequence analysis of novel human bocavirus reveals genetic recombination between human bocavirus 2 and human bocavirus 4.

    PubMed

    Khamrin, Pattara; Okitsu, Shoko; Ushijima, Hiroshi; Maneekarn, Niwat

    2013-07-01

    Epidemiological surveillance of human bocavirus (HBoV) was conducted on fecal specimens collected from hospitalized children with diarrhea in Chiang Mai, Thailand in 2011. By partial sequence analysis of VP1 gene, an unusual strain of HBoV (CMH-S011-11), was initially identified as HBoV4. The complete genome sequence of CMH-S011-11 was performed and analyzed further to clarify whether it was a recombinant strain or a new HBoV variant. Analysis of complete genome sequence revealed that the coding sequence starting from NS1, NP1 to VP1/VP2 was 4795 nucleotides long. Interestingly, the nucleotide sequence of NS1 gene of CMH-S011-11 was most closely related to the HBoV2 reference strains detected in Pakistan, which contradicted to the initial genotyping result of the partial VP1 region in the previous study. In addition, comparison of NP1 nucleotide sequence of CMH-S011-11 with those of other HBoV1-4 reference strains also revealed a high level of sequence identity with HBoV2. On the other hand, nucleotide sequence of VP1/VP2 gene of CMH-S011-11 was most closely related to those of HBoV4 reference strains detected in Nigeria. The overall full-length sequence analysis revealed that this CMH-S011-11 was grouped within HBoV4 species, but located in a separate branch from other HBoV4 prototype strains. Recombination analysis revealed that CMH-S011-11 was the result of recombination between HBoV2 and HBoV4 strains with the break point located near the start codon of VP2.

  2. Genome sequence comparison reveals a candidate gene involved in male-hermaphrodite differentiation in papaya (Carica papaya) trees.

    PubMed

    Ueno, Hiroki; Urasaki, Naoya; Natsume, Satoshi; Yoshida, Kentaro; Tarora, Kazuhiko; Shudo, Ayano; Terauchi, Ryohei; Matsumura, Hideo

    2015-04-01

    The sex type of papaya (Carica papaya) is determined by the pair of sex chromosomes (XX, female; XY, male; and XY(h), hermaphrodite), in which there is a non-recombining genomic region in the Y and Y(h) chromosomes. This region is presumed to be involved in determination of males and hermaphrodites; it is designated as the male-specific region in the Y chromosome (MSY) and the hermaphrodite-specific region in the Y(h) chromosome (HSY). Here, we identified the genes determining male and hermaphrodite sex types by comparing MSY and HSY genomic sequences. In the MSY and HSY genomic regions, we identified 14,528 nucleotide substitutions and 965 short indels with a large gap and two highly diverged regions. In the predicted genes expressed in flower buds, we found no nucleotide differences leading to amino acid changes between the MSY and HSY. However, we found an HSY-specific transposon insertion in a gene (SVP like) showing a similarity to the Short Vegetative Phase (SVP) gene. Study of SVP-like transcripts revealed that the MSY allele encoded an intact protein, while the HSY allele encoded a truncated protein. Our findings demonstrated that the SVP-like gene is a candidate gene for male-hermaphrodite determination in papaya.

  3. The Complete Genome Sequence of Thermococcus onnurineus NA1 Reveals a Mixed Heterotrophic and Carboxydotrophic Metabolism▿ †

    PubMed Central

    Lee, Hyun Sook; Kang, Sung Gyun; Bae, Seung Seob; Lim, Jae Kyu; Cho, Yona; Kim, Yun Jae; Jeon, Jeong Ho; Cha, Sun-Shin; Kwon, Kae Kyoung; Kim, Hyung-Tae; Park, Cheol-Joo; Lee, Hee-Wook; Kim, Seung Il; Chun, Jongsik; Colwell, Rita R.; Kim, Sang-Jin; Lee, Jung-Hyun

    2008-01-01

    Members of the genus Thermococcus, sulfur-reducing hyperthermophilic archaea, are ubiquitously present in various deep-sea hydrothermal vent systems and are considered to play a significant role in the microbial consortia. We present the complete genome sequence and feature analysis of Thermococcus onnurineus NA1 isolated from a deep-sea hydrothermal vent area, which reveal clues to its physiology. Based on results of genomic analysis, T. onnurineus NA1 possesses the metabolic pathways for organotrophic growth on peptides, amino acids, or sugars. More interesting was the discovery that the genome encoded unique proteins that are involved in carboxydotrophy to generate energy by oxidation of CO to CO2, thereby providing a mechanistic basis for growth with CO as a substrate. This lithotrophic feature in combination with carbon fixation via RuBisCO (ribulose 1,5-bisphosphate carboxylase/oxygenase) introduces a new strategy with a complementing energy supply for T. onnurineus NA1 potentially allowing it to cope with nutrient stress in the surrounding of hydrothermal vents, providing the first genomic evidence for the carboxydotrophy in Thermococcus. PMID:18790866

  4. Sequencing and computational analysis of complete genome sequences of Citrus yellow mosaic badna virus from acid lime and pummelo.

    PubMed

    Borah, Basanta K; Johnson, A M Anthony; Sai Gopal, D V R; Dasgupta, Indranil

    2009-08-01

    Citrus yellow mosaic badna virus (CMBV), a member of the Family Caulimoviridae, Genus Badnavirus, is the causative agent of Citrus mosaic disease in India. Although the virus has been detected in several citrus species, only two full-length genomes, one each from Sweet orange and Rangpur lime, are available in publicly accessible databases. In order to obtain a better understanding of the genetic variability of the virus in other citrus mosaic-affected citrus species, we performed the cloning and sequence analysis of complete genomes of CMBV from two additional citrus species, Acid lime and Pummelo. We show that CMBV genomes from the two hosts share high homology with previously reported CMBV sequences and hence conclude that the new isolates represent variants of the virus present in these species. Based on in silico sequence analysis, we predict the possible function of the protein encoded by one of the five ORFs.

  5. Unique Features of a Japanese ‘Candidatus Liberibacter asiaticus’ Strain Revealed by Whole Genome Sequencing

    PubMed Central

    Katoh, Hiroshi; Miyata, Shin-ichi; Inoue, Hiromitsu; Iwanami, Toru

    2014-01-01

    Citrus greening (huanglongbing) is the most destructive disease of citrus worldwide. It is spread by citrus psyllids and is associated with phloem-limited bacteria of three species of α-Proteobacteria, namely, ‘Candidatus Liberibacter asiaticus’, ‘Ca. L. americanus’, and ‘Ca. L. africanus’. Recent findings suggested that some Japanese strains lack the bacteriophage-type DNA polymerase region (DNA pol), in contrast to the Floridian psy62 strain. The whole genome sequence of the pol-negative ‘Ca. L. asiaticus’ Japanese isolate Ishi-1 was determined by metagenomic analysis of DNA extracted from ‘Ca. L. asiaticus’-infected psyllids and leaf midribs. The 1.19-Mb genome has an average 36.32% GC content. Annotation revealed 13 operons encoding rRNA and 44 tRNA genes, but no typical bacterial pathogenesis-related genes were located within the genome, similar to the Floridian psy62 and Chinese gxpsy. In contrast to other ‘Ca. L. asiaticus’ strains, the genome of the Japanese Ishi-1 strain lacks a prophage-related region. PMID:25180586

  6. Virus evolution during chronic hepatitis B virus infection as revealed by ultradeep sequencing data.

    PubMed

    Jones, Leandro R; Sede, Mariano; Manrique, Julieta M; Quarleri, Jorge

    2016-02-01

    Despite chronic hepatitis B virus (HBV) infection (CHB) being a leading cause of liver cirrhosis and cancer, HBV evolution during CHB is not fully understood. Recent studies have indicated that virus diversity progressively increases along the course of CHB and that some virus mutations correlate with severe liver conditions such as chronic hepatitis, cirrhosis and hepatocellular carcinoma. Using ultradeep sequencing (UDS) data from an intrafamilial case, we detected such mutations at low frequencies among three immunotolerant patients and at high frequencies in an inactive carrier. Furthermore, our analyses indicated that the HBV population from the seroconverter patient underwent many genetic changes in response to virus clearance. Together, these data indicate a potential use of UDS for developing non-invasive biomarkers for monitoring disease changes over time or in response to specific therapies. In addition, our analyses revealed that virus clearance seemed not to require the virus effective population size to decline. A detailed genetic analysis of the viral lineages arising during and after the clearance suggested that mutations at or close to critical elements of the core promoter (enhancer II, epsilon encapsidation signal, TA2, TA3 and direct repeat 1-hormone response element) might be responsible for a sustained replication. This hypothesis requires the decline in virus load to be explained by constant clearance of virus-producing hepatocytes, consistent with the sustained progress towards serious liver conditions experienced by many CHB patients. PMID:26581478

  7. Deep sequencing reveals unique small RNA repertoire that is regulated during head regeneration in Hydra magnipapillata

    PubMed Central

    Krishna, Srikar; Nair, Aparna; Cheedipudi, Sirisha; Poduval, Deepak; Dhawan, Jyotsna; Palakodeti, Dasaradhi; Ghanekar, Yashoda

    2013-01-01

    Small non-coding RNAs such as miRNAs, piRNAs and endo-siRNAs fine-tune gene expression through post-transcriptional regulation, modulating important processes in development, differentiation, homeostasis and regeneration. Using deep sequencing, we have profiled small non-coding RNAs in Hydra magnipapillata and investigated changes in small RNA expression pattern during head regeneration. Our results reveal a unique repertoire of small RNAs in hydra. We have identified 126 miRNA loci; 123 of these miRNAs are unique to hydra. Less than 50% are conserved across two different strains of Hydra vulgaris tested in this study, indicating a highly diverse nature of hydra miRNAs in contrast to bilaterian miRNAs. We also identified siRNAs derived from precursors with perfect stem–loop structure and that arise from inverted repeats. piRNAs were the most abundant small RNAs in hydra, mapping to transposable elements, the annotated transcriptome and unique non-coding regions on the genome. piRNAs that map to transposable elements and the annotated transcriptome display a ping–pong signature. Further, we have identified several miRNAs and piRNAs whose expression is regulated during hydra head regeneration. Our study defines different classes of small RNAs in this cnidarian model system, which may play a role in orchestrating gene expression essential for hydra regeneration. PMID:23166307

  8. Genome-sequence analysis of Acinetobacter johnsonii MB44 reveals potential nematode-virulent factors.

    PubMed

    Tian, Shijing; Ali, Muhammad; Xie, Li; Li, Lin

    2016-01-01

    Acinetobacter johnsonii is generally recognized as a nonpathogenic bacterium although it is often found in hospital environments. However, a newly identified isolate of this species from a frost-plant-tissue sample, namely, A. johnsonii MB44, showed significant nematicidal activity against the model organism Caenorhabditis elegans. To expand our understanding of this bacterial species, we generated a draft genome sequence of MB44 and analyzed its genomic features related to nematicidal attributes. The 3.36 Mb long genome contains 3636 predicted protein-coding genes and 95 RNA genes (including 14 rRNA genes), with a G + C content of 41.37 %. Genomic analysis of the prediction of nematicidal proteins using the software MP3 revealed a total of 108 potential virulence proteins. Some of these proteins were homologous to the known virulent proteins identified from Acinetobacter baumannii, a pathogenic species of the genus Acinetobacter. These virulent proteins included the outer membrane protein A, the phospholipase D, and penicillin-binding protein 7/8. Moreover, one siderophore biosynthesis gene cluster and one capsular polysaccharide gene cluster, which were predicted to be important virulence factors for C. elegans, were identified in the MB44 genome. The current study demonstrated that A. johnsonii MB44, with its nematicidal activity, could be an opportunistic pathogen to animals. PMID:27429894

  9. Whole genome sequence of Staphylococcus saprophyticus reveals the pathogenesis of uncomplicated urinary tract infection.

    PubMed

    Kuroda, Makoto; Yamashita, Atsushi; Hirakawa, Hideki; Kumano, Miyuki; Morikawa, Kazuya; Higashide, Masato; Maruyama, Atsushi; Inose, Yumiko; Matoba, Kimio; Toh, Hidehiro; Kuhara, Satoru; Hattori, Masahira; Ohta, Toshiko

    2005-09-13

    Staphylococcus saprophyticus is a uropathogenic Staphylococcus frequently isolated from young female outpatients presenting with uncomplicated urinary tract infections. We sequenced the whole genome of S. saprophyticus type strain ATCC 15305, which harbors a circular chromosome of 2,516,575 bp with 2,446 ORFs and two plasmids. Comparative genomic analyses with the strains of two other species, Staphylococcus aureus and Staphylococcus epidermidis, as well as experimental data, revealed the following characteristics of the S. saprophyticus genome. S. saprophyticus does not possess any virulence factors found in S. aureus, such as coagulase, enterotoxins, exoenzymes, and extracellular matrix-binding proteins, although it does have a remarkable paralog expansion of transport systems related to highly variable ion contents in the urinary environment. A further unique feature is that only a single ORF is predictable as a cell wall-anchored protein, and it shows positive hemagglutination and adherence to human bladder cell associated with initial colonization in the urinary tract. It also shows significantly high urease activity in S. saprophyticus. The uropathogenicity of S. saprophyticus can be attributed to its genome that is needed for its survival in the human urinary tract by means of novel cell wall-anchored adhesin and redundant uro-adaptive transport systems, together with urease.

  10. Family Based Whole Exome Sequencing Reveals the Multifaceted Role of Notch Signaling in Congenital Heart Disease

    PubMed Central

    Chetaille, Philippe; Prince, Andrea; Godard, Beatrice; Leclerc, Severine; Sobreira, Nara; Ling, Hua; Awadalla, Philip; Thibeault, Maryse; Khairy, Paul; Samuels, Mark E.; Andelfinger, Gregor

    2016-01-01

    Left-ventricular outflow tract obstructions (LVOTO) encompass a wide spectrum of phenotypically heterogeneous heart malformations which frequently cluster in families. We performed family based whole-exome and targeted re-sequencing on 182 individuals from 51 families with multiple affected members. Central to our approach is the family unit which serves as a reference to identify causal genotype-phenotype correlations. Screening a multitude of 10 overlapping phenotypes revealed disease associated and co-segregating variants in 12 families. These rare or novel protein altering mutations cluster predominantly in genes (NOTCH1, ARHGAP31, MAML1, SMARCA4, JARID2, JAG1) along the Notch signaling cascade. This is in line with a significant enrichment (Wilcoxon, p< 0.05) of variants with a higher pathogenicity in the Notch signaling pathway in patients compared to controls. The significant enrichment of novel protein truncating and missense mutations in NOTCH1 highlights the allelic and phenotypic heterogeneity in our pediatric cohort. We identified novel co-segregating pathogenic mutations in NOTCH1 associated with left and right-sided cardiac malformations in three independent families with a total of 15 affected individuals. In summary, our results suggest that a small but highly pathogenic fraction of family specific mutations along the Notch cascade are a common cause of LVOTO. PMID:27760138

  11. Phylogeny of Darwin’s finches as revealed by mtDNA sequences

    PubMed Central

    Sato, Akie; O’hUigin, Colm; Figueroa, Felipe; Grant, Peter R.; Grant, B. Rosemary; Tichy, Herbert; Klein, Jan

    1999-01-01

    Darwin’s finches comprise a group of passerine birds first collected by Charles Darwin during his visit to the Galápagos Archipelago. The group, a textbook example of adaptive radiation (the diversification of a founding population into an array of species differentially adapted to diverse environmental niches), encompasses 14 currently recognized species, of which 13 live on the Galápagos Islands and one on the Cocos Island in the Pacific Ocean. Although Darwin’s finches have been studied extensively by morphologists, ecologists, and ethologists, their phylogenetic relationships remain uncertain. Here, sequences of two mtDNA segments, the cytochrome b and the control region, have been used to infer the evolutionary history of the group. The data reveal the Darwin’s finches to be a monophyletic group with the warbler finch being the species closest to the founding stock, followed by the vegetarian finch, and then by two sister groups, the ground and the tree finches. The Cocos finch is related to the tree finches of the Galápagos Islands. The traditional classification of ground finches into six species and tree finches into five species is not reflected in the molecular data. In these two groups, ancestral polymorphisms have not, as yet, been sorted out among the cross-hybridizing species. PMID:10220425

  12. Methylome sequencing in triple-negative breast cancer reveals distinct methylation clusters with prognostic value.

    PubMed

    Stirzaker, Clare; Zotenko, Elena; Song, Jenny Z; Qu, Wenjia; Nair, Shalima S; Locke, Warwick J; Stone, Andrew; Armstong, Nicola J; Robinson, Mark D; Dobrovic, Alexander; Avery-Kiejda, Kelly A; Peters, Kate M; French, Juliet D; Stein, Sandra; Korbie, Darren J; Trau, Matt; Forbes, John F; Scott, Rodney J; Brown, Melissa A; Francis, Glenn D; Clark, Susan J

    2015-02-02

    Epigenetic alterations in the cancer methylome are common in breast cancer and provide novel options for tumour stratification. Here, we perform whole-genome methylation capture sequencing on small amounts of DNA isolated from formalin-fixed, paraffin-embedded tissue from triple-negative breast cancer (TNBC) and matched normal samples. We identify differentially methylated regions (DMRs) enriched with promoters associated with transcription factor binding sites and DNA hypersensitive sites. Importantly, we stratify TNBCs into three distinct methylation clusters associated with better or worse prognosis and identify 17 DMRs that show a strong association with overall survival, including DMRs located in the Wilms tumour 1 (WT1) gene, bi-directional-promoter and antisense WT1-AS. Our data reveal that coordinated hypermethylation can occur in oestrogen receptor-negative disease, and that characterizing the epigenetic framework provides a potential signature to stratify TNBCs. Together, our findings demonstrate the feasibility of profiling the cancer methylome with limited archival tissue to identify regulatory regions associated with cancer.

  13. Whole genome sequence of Staphylococcus saprophyticus reveals the pathogenesis of uncomplicated urinary tract infection

    PubMed Central

    Kuroda, Makoto; Yamashita, Atsushi; Hirakawa, Hideki; Kumano, Miyuki; Morikawa, Kazuya; Higashide, Masato; Maruyama, Atsushi; Inose, Yumiko; Matoba, Kimio; Toh, Hidehiro; Kuhara, Satoru; Hattori, Masahira; Ohta, Toshiko

    2005-01-01

    Staphylococcus saprophyticus is a uropathogenic Staphylococcus frequently isolated from young female outpatients presenting with uncomplicated urinary tract infections. We sequenced the whole genome of S. saprophyticus type strain ATCC 15305, which harbors a circular chromosome of 2,516,575 bp with 2,446 ORFs and two plasmids. Comparative genomic analyses with the strains of two other species, Staphylococcus aureus and Staphylococcus epidermidis, as well as experimental data, revealed the following characteristics of the S. saprophyticus genome. S. saprophyticus does not possess any virulence factors found in S. aureus, such as coagulase, enterotoxins, exoenzymes, and extracellular matrix-binding proteins, although it does have a remarkable paralog expansion of transport systems related to highly variable ion contents in the urinary environment. A further unique feature is that only a single ORF is predictable as a cell wall-anchored protein, and it shows positive hemagglutination and adherence to human bladder cell associated with initial colonization in the urinary tract. It also shows significantly high urease activity in S. saprophyticus. The uropathogenicity of S. saprophyticus can be attributed to its genome that is needed for its survival in the human urinary tract by means of novel cell wall-anchored adhesin and redundant uro-adaptive transport systems, together with urease. PMID:16135568

  14. RNA sequencing analysis of human podocytes reveals glucocorticoid regulated gene networks targeting non-immune pathways

    PubMed Central

    Jiang, Lulu; Hindmarch, Charles C. T.; Rogers, Mark; Campbell, Colin; Waterfall, Christy; Coghill, Jane; Mathieson, Peter W.; Welsh, Gavin I.

    2016-01-01

    Glucocorticoids are steroids that reduce inflammation and are used as immunosuppressive drugs for many diseases. They are also the mainstay for the treatment of minimal change nephropathy (MCN), which is characterised by an absence of inflammation. Their mechanisms of action remain elusive. Evidence suggests that immunomodulatory drugs can directly act on glomerular epithelial cells or ‘podocytes’, the cell type which is the main target of injury in MCN. To understand the nature of glucocorticoid effects on non-immune cell functions, we generated RNA sequencing data from human podocyte cell lines and identified the genes that are significantly regulated in dexamethasone-treated podocytes compared to vehicle-treated cells. The upregulated genes are of functional relevance to cytoskeleton-related processes, whereas the downregulated genes mostly encode pro-inflammatory cytokines and growth factors. We observed a tendency for dexamethasone-upregulated genes to be downregulated in MCN patients. Integrative analysis revealed gene networks composed of critical signaling pathways that are likely targeted by dexamethasone in podocytes. PMID:27774996

  15. Exome sequencing reveals a nebulin nonsense mutation in a dog model of nemaline myopathy.

    PubMed

    Evans, Jacquelyn M; Cox, Melissa L; Huska, Jonathan; Li, Frank; Gaitero, Luis; Guo, Ling T; Casal, Margaret L; Granzier, Henk L; Shelton, G Diane; Clark, Leigh Anne

    2016-10-01

    Nemaline myopathy (NM) is a congenital muscle disorder associated with muscle weakness, hypotonia, and rod bodies in the skeletal muscle fibers. Mutations in 10 genes have been implicated in human NM, but spontaneous cases in dogs have not been genetically characterized. We identified a novel recessive myopathy in a family of line-bred American bulldogs (ABDs); rod bodies in muscle biopsies established this as NM. Using SNP profiles from the nuclear family, we evaluated inheritance patterns at candidate loci and prioritized TNNT1 and NEB for further investigation. Whole exome sequencing of the dam, two affected littermates, and an unaffected littermate revealed a nonsense mutation in NEB (g.52734272 C>A, S8042X). Whole tissue gel electrophoresis and western blots confirmed a lack of full-length NEB in affected tissues, suggesting nonsense-mediated decay. The pathogenic variant was absent from 120 dogs of 24 other breeds and 100 unrelated ABDs, suggesting that it occurred recently and may be private to the family. This study presents the first molecularly characterized large animal model of NM, which could provide new opportunities for therapeutic approaches. PMID:27215641

  16. Whole exome sequencing of urachal adenocarcinoma reveals recurrent NF1 mutations

    PubMed Central

    Singh, Harshabad; Liu, Yang; Xiao, Xiuli; Lin, Ling; Kim, Jaegil; Van Hummelen, Paul; Wu, Chin-Lee; Bass, Adam J.; Saylor, Philip J.

    2016-01-01

    Urachal adenocarcinoma is a rare bladder malignancy arising from the urachal remnant. Given its rarity and the lack of knowledge about its genetic characteristics, optimal management of this cancer is not well defined. Practice patterns vary and outcomes remain poor. In order to identify the genomic underpinnings of this malignancy, we performed whole exome sequencing using seven tumor/normal pairs of formalin fixed archival specimens. We identified recurrent evidence of MAP-kinase pathway activation as three patients had neurofibromin 1 (NF1) mutations, with one of these patients also harboring an oncogenic KRAS G13D mutation. We also observed recurrent evidence of Wnt/β-catenin pathway activation as three patients had oncogenic mutations in APC or RNF43. In addition, somatic copy number analysis revealed focal chromosome 12p amplifications in three samples, resembling findings from testicular germ cell tumors. We describe the genomic landscape of this malignancy in our institutional cohort and propose investigation of the therapeutic potential for MAP-K pathway inhibition in the subset of patients who show evidence of its activation. PMID:27078850

  17. Phylogeny of Darwin's finches as revealed by mtDNA sequences.

    PubMed

    Sato, A; O'hUigin, C; Figueroa, F; Grant, P R; Grant, B R; Tichy, H; Klein, J

    1999-04-27

    Darwin's finches comprise a group of passerine birds first collected by Charles Darwin during his visit to the Galápagos Archipelago. The group, a textbook example of adaptive radiation (the diversification of a founding population into an array of species differentially adapted to diverse environmental niches), encompasses 14 currently recognized species, of which 13 live on the Galápagos Islands and one on the Cocos Island in the Pacific Ocean. Although Darwin's finches have been studied extensively by morphologists, ecologists, and ethologists, their phylogenetic relationships remain uncertain. Here, sequences of two mtDNA segments, the cytochrome b and the control region, have been used to infer the evolutionary history of the group. The data reveal the Darwin's finches to be a monophyletic group with the warbler finch being the species closest to the founding stock, followed by the vegetarian finch, and then by two sister groups, the ground and the tree finches. The Cocos finch is related to the tree finches of the Galápagos Islands. The traditional classification of ground finches into six species and tree finches into five species is not reflected in the molecular data. In these two groups, ancestral polymorphisms have not, as yet, been sorted out among the cross-hybridizing species.

  18. Exome sequencing reveals AMER1 as a frequently mutated gene in colorectal cancer

    PubMed Central

    Sanz-Pamplona, Rebeca; Lopez-Doriga, Adriana; Paré-Brunet, Laia; Lázaro, Kira; Bellido, Fernando; Alonso, M. Henar; Aussó, Susanna; Guinó, Elisabet; Beltrán, Sergi; Castro-Giner, Francesc; Gut, Marta; Sanjuan, Xavier; Closa, Adria; Cordero, David; Morón-Duran, Francisco D.; Soriano, Antonio; Salazar, Ramón; Valle, Laura; Moreno, Victor

    2015-01-01

    PURPOSE Somatic mutations occur at early stages of adenoma and accumulate throughout colorectal cancer (CRC) progression. The aim of this study was to characterize the mutational landscape of stage II tumors and to search for novel recurrent mutations likely implicated in CRC tumorigenesis. DESIGN The exomic DNA of 42 stage II, microsatellite stable, colon tumors and their paired mucosae were sequenced. Other molecular data available in the discovery dataset (gene expression, methylation, and CNV) was used to further characterize these tumors. Additional datasets comprising 553 CRC samples were used to validate the discovered mutations. RESULTS As a result, 4,886 somatic single nucleotide variants (SNVs) were found. Almost all SNVs were private changes, with few mutations shared by more than one tumor, thus revealing tumor-specific mutational landscapes. Nevertheless, these diverse mutations converged into common cellular pathways such as cell cycle or apoptosis. Among this mutational heterogeneity, variants resulting in early stop-codons in the AMER1 (also known as FAM123B or WTX) gene emerged as recurrent mutations in CRC. Loses of AMER1 by other mechanisms apart from mutations such as methylation and copy number aberrations were also found. Tumors lacking this tumor suppressor gene exhibited a mesenchymal phenotype characterized by inhibition of the canonical Wnt pathway. CONCLUSION In silico and experimental validation in independent datasets confirmed the existence of functional mutations in AMER1 in approximately 10% of analyzed CRC tumors. Moreover, these tumors exhibited a characteristic phenotype. PMID:26071483

  19. Flow sorting and exome sequencing reveal the oncogenome of primary Hodgkin and Reed-Sternberg cells.

    PubMed

    Reichel, Jonathan; Chadburn, Amy; Rubinstein, Paul G; Giulino-Roth, Lisa; Tam, Wayne; Liu, Yifang; Gaiolla, Rafael; Eng, Kenneth; Brody, Joshua; Inghirami, Giorgio; Carlo-Stella, Carmelo; Santoro, Armando; Rahal, Daoud; Totonchy, Jennifer; Elemento, Olivier; Cesarman, Ethel; Roshal, Mikhail

    2015-02-12

    Classical Hodgkin lymphoma (cHL) is characterized by sparsely distributed Hodgkin and Reed-Sternberg (HRS) cells amid reactive host background, complicating the acquisition of neoplastic DNA without extensive background contamination. We overcame this limitation by using flow-sorted HRS and intratumor T cells and optimized low-input exome sequencing of 10 patient samples to reveal alterations in genes involved in antigen presentation, chromosome integrity, transcriptional regulation, and ubiquitination. β-2-microglobulin (B2M) is the most commonly altered gene in HRS cells, with 7 of 10 cases having inactivating mutations that lead to loss of major histocompatibility complex class I (MHC-I) expression. Enforced wild-type B2M expression in a cHL cell line restored MHC-I expression. In an extended cohort of 145 patients, the absence of B2M protein in the HRS cells was associated with lower stage of disease, younger age at diagnosis, and better overall and progression-free survival. B2M-deficient cases encompassed most of the nodular sclerosis subtype cases and only a minority of mixed cellularity cases, suggesting that B2M deficiency determines the tumor microenvironment and may define a major subset of cHL that has more uniform clinical and morphologic features. In addition, we report previously unknown genetic alterations that may render selected patients sensitive to specific targeted therapies. PMID:25488972

  20. Sequencing chromosomal abnormalities reveals neurodevelopmental loci that confer risk across diagnostic boundaries

    PubMed Central

    Talkowski, Michael E.; Rosenfeld, Jill A.; Blumenthal, Ian; Pillalamarri, Vamsee; Chiang, Colby; Heilbut, Adrian; Ernst, Carl; Hanscom, Carrie; Rossin, Elizabeth; Lindgren, Amelia; Pereira, Shahrin; Ruderfer, Douglas; Kirby, Andrew; Ripke, Stephan; Harris, David; Lee, Ji-Hyun; Ha, Kyungsoo; Kim, Hyung-Goo; Solomon, Benjamin D.; Gropman, Andrea L.; Lucente, Diane; Sims, Katherine; Ohsumi, Toshiro K.; Borowsky, Mark L.; Loranger, Stephanie; Quade, Bradley; Lage, Kasper; Miles, Judith; Wu, Bai-Lin; Shen, Yiping; Neale, Benjamin; Shaffer, Lisa G.; Daly, Mark J.; Morton, Cynthia C.; Gusella, James F.

    2012-01-01

    SUMMARY Balanced chromosomal abnormalities (BCAs) represent a reservoir of single gene disruptions in neurodevelopmental disorders (NDD). We sequenced BCAs in autism and related NDDs, revealing disruption of 33 loci in four general categories: 1) genes associated with abnormal neurodevelopment (e.g., AUTS2, FOXP1, CDKL5), 2) single gene contributors to microdeletion syndromes (MBD5, SATB2, EHMT1, SNURF-SNRPN), 3) novel risk loci (e.g., CHD8, KIRREL3, ZNF507), and 4) genes associated with later onset psychiatric disorders (e.g., TCF4, ZNF804A, PDE10A, GRIN2B, ANK3). We also discovered profoundly increased burden of copy number variants among 19,556 neurodevelopmental cases compared to 13,991 controls (p = 2.07×10−47) and enrichment of polygenic risk alleles from autism and schizophrenia genome-wide association studies (p = 0.0018 and 0.0009, respectively). Our findings suggest a polygenic risk model of autism incorporating loci of strong effect and indicate that some neurodevelopmental genes are sensitive to perturbation by multiple mutational mechanisms, leading to variable phenotypic outcomes that manifest at different life stages. PMID:22521361

  1. Targeted next-generation sequencing reveals multiple deleterious variants in OPLL-associated genes

    PubMed Central

    Chen, Xin; Guo, Jun; Cai, Tao; Zhang, Fengshan; Pan, Shengfa; Zhang, Li; Wang, Shaobo; Zhou, Feifei; Diao, Yinze; Zhao, Yanbin; Chen, Zhen; Liu, Xiaoguang; Chen, Zhongqiang; Liu, Zhongjun; Sun, Yu; Du, Jie

    2016-01-01

    Ossification of the posterior longitudinal ligament of the spine (OPLL), which is characterized by ectopic bone formation in the spinal ligaments, can cause spinal-cord compression. To date, at least 11 susceptibility genes have been genetically linked to OPLL. In order to identify potential deleterious alleles in these OPLL-associated genes, we designed a capture array encompassing all coding regions of the target genes for next-generation sequencing (NGS) in a cohort of 55 unrelated patients with OPLL. By bioinformatics analyses, we successfully identified three novel and five extremely rare variants (MAF < 0.005). These variants were predicted to be deleterious by commonly used various algorithms, thereby resulting in missense mutations in four OPLL-associated genes (i.e., COL6A1, COL11A2, FGFR1, and BMP2). Furthermore, potential effects of the patient with p.Q89E of BMP2 were confirmed by a markedly increased BMP2 level in peripheral blood samples. Notably, seven of the variants were found to be associated with the patients with continuous subtype changes by cervical spinal radiological analyses. Taken together, our findings revealed for the first time that deleterious coding variants of the four OPLL-associated genes are potentially pathogenic in the patients with OPLL. PMID:27246988

  2. Amino acid sequence of a new mitochondrially synthesized proteolipid of the ATP synthase of Saccharomyces cerevisiae.

    PubMed Central

    Velours, J; Esparza, M; Hoppe, J; Sebald, W; Guerin, B

    1984-01-01

    The purification and the amino acid sequence of a proteolipid translated on ribosomes in yeast mitochondria is reported. This protein, which is a subunit of the ATP synthase, was purified by extraction with chloroform/methanol (2/1) and subsequent chromatography on phosphocellulose and reverse phase h.p.l.c. A mol. wt. of 5500 was estimated by chromatography on Bio-Gel P-30 in 80% formic acid. The complete amino acid sequence of this protein was determined by automated solid phase Edman degradation of the whole protein and of fragments obtained after cleavage with cyanogen bromide. The sequence analysis indicates a length of 48 amino acid residues. The calculated mol. wt. of 5870 corresponds to the value found by gel chromatography. This polypeptide contains three basic residues and no negatively charged side chain. The three basic residues are clustered at the C terminus. The primary structure of this protein is in full agreement with the predicted amino acid sequence of the putative polypeptide encoded by the mitochondrial aap1 gene recently discovered in Saccharomyces cerevisiae. Moreover, this protein shows 50% homology with the amino acid sequence of a putative polypeptide encoded by an unidentified reading frame also discovered near the mitochondrial ATPase subunit 6 gene in Aspergillus nidulans. Images Fig. 2. PMID:6323165

  3. TranslatorX: multiple alignment of nucleotide sequences guided by amino acid translations.

    PubMed

    Abascal, Federico; Zardoya, Rafael; Telford, Maximilian J

    2010-07-01

    We present TranslatorX, a web server designed to align protein-coding nucleotide sequences based on their corresponding amino acid translations. Many comparisons between biological sequences (nucleic acids and proteins) involve the construction of multiple alignments. Alignments represent a statement regarding the homology between individual nucleotides or amino acids within homologous genes. As protein-coding DNA sequences evolve as triplets of nucleotides (codons) and it is known that sequence similarity degrades more rapidly at the DNA than at the amino acid level, alignments are generally more accurate when based on amino acids than on their corresponding nucleotides. TranslatorX novelties include: (i) use of all documented genetic codes and the possibility of assigning different genetic codes for each sequence; (ii) a battery of different multiple alignment programs; (iii) translation of ambiguous codons when possible; (iv) an innovative criterion to clean nucleotide alignments with GBlocks based on protein information; and (v) a rich output, including Jalview-powered graphical visualization of the alignments, codon-based alignments coloured according to the corresponding amino acids, measures of compositional bias and first, second and third codon position specific alignments. The TranslatorX server is freely available at http://translatorx.co.uk.

  4. Sequence analysis reveals genomic factors affecting EST-SSR primer performance and polymorphism

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Search for simple sequence repeat (SSR) motifs and design of flanking primers in expressed sequence tag (EST) sequences can be easily done at a large scale using bioinformatics programs. However, failed amplification and/or detection, along with lack of polymorphism, is often seen among randomly sel...

  5. Genome sequence of the button mushroom Agaricus bisporus reveals mechanisms governing adaptation to a humic-rich ecological niche.

    PubMed

    Morin, Emmanuelle; Kohler, Annegret; Baker, Adam R; Foulongne-Oriol, Marie; Lombard, Vincent; Nagy, Laszlo G; Ohm, Robin A; Patyshakuliyeva, Aleksandrina; Brun, Annick; Aerts, Andrea L; Bailey, Andrew M; Billette, Christophe; Coutinho, Pedro M; Deakin, Greg; Doddapaneni, Harshavardhan; Floudas, Dimitrios; Grimwood, Jane; Hildén, Kristiina; Kües, Ursula; Labutti, Kurt M; Lapidus, Alla; Lindquist, Erika A; Lucas, Susan M; Murat, Claude; Riley, Robert W; Salamov, Asaf A; Schmutz, Jeremy; Subramanian, Venkataramanan; Wösten, Han A B; Xu, Jianping; Eastwood, Daniel C; Foster, Gary D; Sonnenberg, Anton S M; Cullen, Dan; de Vries, Ronald P; Lundell, Taina; Hibbett, David S; Henrissat, Bernard; Burton, Kerry S; Kerrigan, Richard W; Challen, Michael P; Grigoriev, Igor V; Martin, Francis

    2012-10-23

    Agaricus bisporus is the model fungus for the adaptation, persistence, and growth in the humic-rich leaf-litter environment. Aside from its ecological role, A. bisporus has been an important component of the human diet for over 200 y and worldwide cultivation of the "button mushroom" forms a multibillion dollar industry. We present two A. bisporus genomes, their gene repertoires and transcript profiles on compost and during mushroom formation. The genomes encode a full repertoire of polysaccharide-degrading enzymes similar to that of wood-decayers. Comparative transcriptomics of mycelium grown on defined medium, casing-soil, and compost revealed genes encoding enzymes involved in xylan, cellulose, pectin, and protein degradation are more highly expressed in compost. The striking expansion of heme-thiolate peroxidases and β-etherases is distinctive from Agaricomycotina wood-decayers and suggests a broad attack on decaying lignin and related metabolites found in humic acid-rich environment. Similarly, up-regulation of these genes together with a lignolytic manganese peroxidase, multiple copper radical oxidases, and cytochrome P450s is consistent with challenges posed by complex humic-rich substrates. The gene repertoire and expression of hydrolytic enzymes in A. bisporus is substantially different from the taxonomically related ectomycorrhizal symbiont Laccaria bicolor. A common promoter motif was also identified in genes very highly expressed in humic-rich substrates. These observations reveal genetic and enzymatic mechanisms governing adaptation to the humic-rich ecological niche formed during plant degradation, further defining the critical role such fungi contribute to soil structure and carbon sequestration in terrestrial ecosystems. Genome sequence will expedite mushroom breeding for improved agronomic characteristics. PMID:23045686

  6. Genome sequence of the button mushroom Agaricus bisporus reveals mechanisms governing adaptation to a humic-rich ecological niche

    SciTech Connect

    Morin, Emmanuelle; Kohler, Annegret; Baker, Adam R.; Foulongne-Oriol, Marie; Lombard, Vincent; Nagy, Laszlo G.; Ohm, Robin A.; Patyshakuliyeva, Aleksandrina; Brun, Annick; Aerts, Andrea L.; Bailey, Andrew M.; Billette, Christophe; Coutinho, Pedro M.; Deakin, Greg; Doddapaneni, Harshavardhan; Floudas, Dimitrios; Grimwood, Jane; Hilden, Kristiina; Kues, Ursula; LaButti, Kurt M.; Lapidus, Alla; Lindquist, Erika A.; Lucas, Susan M.; Murat, Claude; Riley, Robert W.; Salamov, Asaf A.; Schmutz, Jeremy; Subramanian, Venkataramanan; Wosten, Han A. B.; Xu, Jianping; Eastwood, Daniel C.; Foster, Gary D.; Sonnenberg, Anton S. M.; Cullen, Dan; de Vries, Ronald P.; Lundell, Taina; Hibbett, David S.; Henrissat, Bernard; Burton, Kerry S.; Kerrigan, Richard W.; Challen, Michael P.; Grigoriev, Igor V.; Martin, Francis

    2012-04-27

    Agaricus bisporus is the model fungus for the adaptation, persistence, and growth in the humic-rich leaf-litter environment. Aside from its ecological role, A. bisporus has been an important component of the human diet for over 200 y and worldwide cultivation of the button mushroom forms a multibillion dollar industry. We present two A. bisporus genomes, their gene repertoires and transcript profiles on compost and during mushroom formation. The genomes encode a full repertoire of polysaccharide-degrading enzymes similar to that of wood-decayers. Comparative transcriptomics of mycelium grown on defined medium, casing-soil, and compost revealed genes encoding enzymes involved in xylan, cellulose, pectin, and protein degradation are more highly expressed in compost. The striking expansion of heme-thiolate peroxidases and etherases is distinctive from Agaricomycotina wood-decayers and suggests a broad attack on decaying lignin and related metabolites found in humic acid-rich environment. Similarly, up-regulation of these genes together with a lignolytic manganese peroxidase, multiple copper radical oxidases, and cytochrome P450s is consistent with challenges posed by complex humic-rich substrates. The gene repertoire and expression of hydrolytic enzymes in A. bisporus is substantially different from the taxonomically related ectomycorrhizal symbiont Laccaria bicolor. A common promoter motif was also identified in genes very highly expressed in humic-rich substrates. These observations reveal genetic and enzymatic mechanisms governing adaptation to the humic-rich ecological niche formed during plant degradation, further defining the critical role such fungi contribute to soil structure and carbon sequestration in terrestrial ecosystems. Genome sequence will expedite mushroom breeding for improved agronomic characteristics.

  7. Genome sequence of the button mushroom Agaricus bisporus reveals mechanisms governing adaptation to a humic-rich ecological niche.

    PubMed

    Morin, Emmanuelle; Kohler, Annegret; Baker, Adam R; Foulongne-Oriol, Marie; Lombard, Vincent; Nagy, Laszlo G; Ohm, Robin A; Patyshakuliyeva, Aleksandrina; Brun, Annick; Aerts, Andrea L; Bailey, Andrew M; Billette, Christophe; Coutinho, Pedro M; Deakin, Greg; Doddapaneni, Harshavardhan; Floudas, Dimitrios; Grimwood, Jane; Hildén, Kristiina; Kües, Ursula; Labutti, Kurt M; Lapidus, Alla; Lindquist, Erika A; Lucas, Susan M; Murat, Claude; Riley, Robert W; Salamov, Asaf A; Schmutz, Jeremy; Subramanian, Venkataramanan; Wösten, Han A B; Xu, Jianping; Eastwood, Daniel C; Foster, Gary D; Sonnenberg, Anton S M; Cullen, Dan; de Vries, Ronald P; Lundell, Taina; Hibbett, David S; Henrissat, Bernard; Burton, Kerry S; Kerrigan, Richard W; Challen, Michael P; Grigoriev, Igor V; Martin, Francis

    2012-10-23

    Agaricus bisporus is the model fungus for the adaptation, persistence, and growth in the humic-rich leaf-litter environment. Aside from its ecological role, A. bisporus has been an important component of the human diet for over 200 y and worldwide cultivation of the "button mushroom" forms a multibillion dollar industry. We present two A. bisporus genomes, their gene repertoires and transcript profiles on compost and during mushroom formation. The genomes encode a full repertoire of polysaccharide-degrading enzymes similar to that of wood-decayers. Comparative transcriptomics of mycelium grown on defined medium, casing-soil, and compost revealed genes encoding enzymes involved in xylan, cellulose, pectin, and protein degradation are more highly expressed in compost. The striking expansion of heme-thiolate peroxidases and β-etherases is distinctive from Agaricomycotina wood-decayers and suggests a broad attack on decaying lignin and related metabolites found in humic acid-rich environment. Similarly, up-regulation of these genes together with a lignolytic manganese peroxidase, multiple copper radical oxidases, and cytochrome P450s is consistent with challenges posed by complex humic-rich substrates. The gene repertoire and expression of hydrolytic enzymes in A. bisporus is substantially different from the taxonomically related ectomycorrhizal symbiont Laccaria bicolor. A common promoter motif was also identified in genes very highly expressed in humic-rich substrates. These observations reveal genetic and enzymatic mechanisms governing adaptation to the humic-rich ecological niche formed during plant degradation, further defining the critical role such fungi contribute to soil structure and carbon sequestration in terrestrial ecosystems. Genome sequence will expedite mushroom breeding for improved agronomic characteristics.

  8. Genome sequence of the button mushroom Agaricus bisporus reveals mechanisms governing adaptation to a humic-rich ecological niche

    PubMed Central

    Morin, Emmanuelle; Kohler, Annegret; Baker, Adam R.; Foulongne-Oriol, Marie; Lombard, Vincent; Nagye, Laszlo G.; Ohm, Robin A.; Patyshakuliyeva, Aleksandrina; Brun, Annick; Aerts, Andrea L.; Bailey, Andrew M.; Billette, Christophe; Coutinho, Pedro M.; Deakin, Greg; Doddapaneni, Harshavardhan; Floudas, Dimitrios; Grimwood, Jane; Hildén, Kristiina; Kües, Ursula; LaButti, Kurt M.; Lapidus, Alla; Lindquist, Erika A.; Lucas, Susan M.; Murat, Claude; Riley, Robert W.; Salamov, Asaf A.; Schmutz, Jeremy; Subramanian, Venkataramanan; Wösten, Han A. B.; Xu, Jianping; Eastwood, Daniel C.; Foster, Gary D.; Sonnenberg, Anton S. M.; Cullen, Dan; de Vries, Ronald P.; Lundell, Taina; Hibbett, David S.; Henrissat, Bernard; Burton, Kerry S.; Kerrigan, Richard W.; Challen, Michael P.; Grigoriev, Igor V.; Martin, Francis

    2012-01-01

    Agaricus bisporus is the model fungus for the adaptation, persistence, and growth in the humic-rich leaf-litter environment. Aside from its ecological role, A. bisporus has been an important component of the human diet for over 200 y and worldwide cultivation of the “button mushroom” forms a multibillion dollar industry. We present two A. bisporus genomes, their gene repertoires and transcript profiles on compost and during mushroom formation. The genomes encode a full repertoire of polysaccharide-degrading enzymes similar to that of wood-decayers. Comparative transcriptomics of mycelium grown on defined medium, casing-soil, and compost revealed genes encoding enzymes involved in xylan, cellulose, pectin, and protein degradation are more highly expressed in compost. The striking expansion of heme-thiolate peroxidases and β-etherases is distinctive from Agaricomycotina wood-decayers and suggests a broad attack on decaying lignin and related metabolites found in humic acid-rich environment. Similarly, up-regulation of these genes together with a lignolytic manganese peroxidase, multiple copper radical oxidases, and cytochrome P450s is consistent with challenges posed by complex humic-rich substrates. The gene repertoire and expression of hydrolytic enzymes in A. bisporus is substantially different from the taxonomically related ectomycorrhizal symbiont Laccaria bicolor. A common promoter motif was also identified in genes very highly expressed in humic-rich substrates. These observations reveal genetic and enzymatic mechanisms governing adaptation to the humic-rich ecological niche formed during plant degradation, further defining the critical role such fungi contribute to soil structure and carbon sequestration in terrestrial ecosystems. Genome sequence will expedite mushroom breeding for improved agronomic characteristics. PMID:23045686

  9. Complete amino acid sequence and structure characterization of the taste-modifying protein, miraculin.

    PubMed

    Theerasilp, S; Hitotsuya, H; Nakajo, S; Nakaya, K; Nakamura, Y; Kurihara, Y

    1989-04-25

    The taste-modifying protein, miraculin, has the unusual property of modifying sour taste into sweet taste. The complete amino acid sequence of miraculin purified from miracle fruits by a newly developed method (Theerasilp, S., and Kurihara, Y. (1988) J. Biol. Chem. 263, 11536-11539) was determined by an automatic Edman degradation method. Miraculin was a single polypeptide with 191 amino acid residues. The calculated molecular weight based on the amino acid sequence and the carbohydrate content (13.9%) was 24,600. Asn-42 and Asn-186 were linked N-glycosidically to carbohydrate chains. High homology was found between the amino acid sequences of miraculin and soybean trypsin inhibitor. PMID:2708331

  10. Differences between EcoRI nonspecific and "star" sequence complexes revealed by osmotic stress.

    PubMed

    Sidorova, Nina Y; Rau, Donald C

    2004-10-01

    The binding of the restriction endonuclease EcoRI to DNA is exceptionally specific. Even a single basepair change ("star" sequence) from the recognition sequence, GAATTC, decreases the binding free energy of EcoRI to values nearly indistinguishable from nonspecific binding. The difference in the number of waters sequestered by the protein-DNA complexes of the "star" sequences TAATTC and CAATTC and by the specific sequence complex determined from the dependence of binding free energy on water activity is also practically indistinguishable at low osmotic pressures from the 110 water molecules sequestered by nonspecific sequence complexes. Novel measurements of the dissociation rates of noncognate sequence complexes and competition equilibrium show that sequestered water can be removed from "star" sequence complexes by high osmotic pressure, but not from a nonspecific complex. By 5 Osm, the TAATTC "star" sequence complex has lost almost 90 of the approximately 110 waters initially present. It is more difficult to remove water from the CAATTC "star" sequence complex. The sequence dependence of water loss correlates with the known sequence dependence of "star" cleavage activity.

  11. Transcriptomic changes during tuber dormancy release process revealed by RNA sequencing in potato.

    PubMed

    Liu, Bailin; Zhang, Ning; Wen, Yikai; Jin, Xin; Yang, Jiangwei; Si, Huaijun; Wang, Di

    2015-03-20

    Potato tuber dormancy release is a critical development process that allows potato to produce new plant. The first Illumina RNA sequencing to generate the expressed mRNAs at dormancy tuber (DT), dormancy release tuber (DRT) and sprouting tuber (ST) was performed. We identified 26,639 genes including 5,912 (3,450 up-regulated while 2,462 down-regulated) and 3,885 (2,141 up-regulated while 1,744 down-regulated) genes were differentially expressed from DT vs DRT and DRT vs ST. The RNA-Seq results were further verified using qRT-PCR. We found reserve mobilization events were activated before the bud emergence (DT vs DRT) and highlighted after dormancy release (DRT vs ST). Overexpressed genes related to metabolism of auxin, gibberellic acid, cytokinin and barssinosteriod were dominated in DT vs DRT, whereas overexpressed genes involved in metabolism of ethylene, jasmonate and salicylate were prominent in DRT vs ST. Various histone and cyclin isoforms associated genes involved in cell division/cycle were mainly up-regulated in DT vs DRT. Dormancy release process was also companied by stress response and redox regulation, those genes related to biotic stress, cell wall and second metabolism was preferentially overexpressed in DRT vs ST, which might accelerate dormancy breaking and sprout outgrowth. The metabolic processes activated during tuber dormancy release were also supported by plant seed models. These results represented the first comprehensive picture of a large number of genes involved in tuber dormancy release process.

  12. Amino acid sequence of Coprinus macrorhizus peroxidase and cDNA sequence encoding Coprinus cinereus peroxidase. A new family of fungal peroxidases.

    PubMed

    Baunsgaard, L; Dalbøge, H; Houen, G; Rasmussen, E M; Welinder, K G

    1993-04-01

    Sequence analysis and cDNA cloning of Coprinus peroxidase (CIP) were undertaken to expand the understanding of the relationships of structure, function and molecular genetics of the secretory heme peroxidases from fungi and plants. Amino acid sequencing of Coprinus macrorhizus peroxidase, and cDNA sequencing of Coprinus cinereus peroxidase showed that the mature proteins are identical in amino acid sequence, 343 residues in size and preceded by a 20-residue signal peptide. Their likely identity to peroxidase from Arthromyces ramosus is discussed. CIP has an 8-residue, glycine-rich N-terminal extension blocked with a pyroglutamate residue which is absent in other fungal peroxidases. The presence of pyroglutamate, formed by cyclization of glutamine, and the finding of a minor fraction of a variant form lacking the N-terminal residue, indicate that signal peptidase cleavage is followed by further enzymic processing. CIP is 40-45% identical in amino-acid sequence to 11 lignin peroxidases from four fungal species, and 42-43% identical to the two known Mn-peroxidases. Like these white-rot fungal peroxidases, CIP has an additional segment of approximately 40 residues at the C-terminus which is absent in plant peroxidases. Although CIP is much more similar to horseradish peroxidase (HRP C) in substrate specificity, specific activity and pH optimum than to white-rot fungal peroxidases, the sequences of CIP and HRP C showed only 18% identity. Hence, CIP qualifies as the first member of a new family of fungal peroxidases. The nine invariant residues present in all plant, fungal and bacterial heme peroxidases are also found in CIP. The present data support the hypothesis that only one chromosomal CIP gene exists. In contrast, a large number of secretory plant and fungal peroxidases are expressed from several peroxidase gene clusters. Analyses of three batches of CIP protein and of 49 CIP clones revealed the existence of only two highly similar alleles indicating less

  13. Analysis of the chromatin domain organisation around the plastocyanin gene reveals an MAR-specific sequence element in Arabidopsis thaliana.

    PubMed

    van Drunen, C M; Oosterling, R W; Keultjes, G M; Weisbeek, P J; van Driel, R; Smeekens, S C

    1997-10-01

    The Arabidopsis thaliana genome is currently being sequenced, eventually leading towards the unravelling of all potential genes. We wanted to gain more insight into the way this genome might be organized at the ultrastructural level. To this extent we identified matrix attachment regions demarking potential chromatin domains, in a 16 kb region around the plastocyanin gene. The region was cloned and sequenced revealing six genes in addition to the plastocyanin gene. Using an heterologous in vitro nuclear matrix binding assay, to search for evolutionary conserved matrix attachment regions (MARs), we identified three such MARs. These three MARs divide the region into two small chromatin domains of 5 kb, each containing two genes. Comparison of the sequence of the three MARs revealed a degenerated 21 bp sequence that is shared between these MARs and that is not found elsewhere in the region. A similar sequence element is also present in four other MARs of Arabidopsis.Therefore, this sequence may constitute a landmark for the position of MARs in the genome of this plant. In a genomic sequence database of Arabidopsis the 21 bp element is found approximately once every 10 kb. The compactness of the Arabidopsis genome could account for the high incidence of MARs and MRSs we observed.

  14. Amino acid sequence heterogeneity of the chromosomal encoded Borrelia burgdorferi sensu lato major antigen P100.

    PubMed

    Fellinger, W; Farencena, A; Redl, B; Sambri, V; Cevenini, R; Stöffler, G

    1995-04-01

    The entire nucleotide sequence of the chromosomal encoded major antigen p100 of the European Borrelia garinii isolate B29 was determined and the deduced amino acid sequence was compared to the homologous antigen p83 of the North American Borrelia burgdorferi sensu stricto strain B31 and the p100 of the European Borrelia afzelii (group VS461) strain PKo. p100 of strain B29 shows 87% amino acid sequence identity to strain B31 and 79.2% to strain PKo, p100 of strain B31 and PKo shows 62.5% identity to each other. In addition, partial nucleotide sequences of the most heterogeneous region of the p100 gene of two other Borrelia garinii isolates (PBi and VS286) have been determined and the deduced amino acid sequences were compared with all p100 of Borrelia garinii published so far. We found an amino acid sequence identity between 88.6 and 100% within the same genospecies. The N-terminal part of the p100 proteins is highly conserved whereas a striking heterogeneous region within the C-terminal part of the proteins was observed.

  15. Amino acid sequences of lysozymes newly purified from invertebrates imply wide distribution of a novel class in the lysozyme family.

    PubMed

    Ito, Y; Yoshikawa, A; Hotani, T; Fukuda, S; Sugimura, K; Imoto, T

    1999-01-01

    Lysozymes were purified from three invertebrates: a marine bivalve, a marine conch, and an earthworm. The purified lysozymes all showed a similar molecular weight of 13 kDa on SDS/PAGE. Their N-terminal sequences up to the 33rd residue determined here were apparently homologous among them; in addition, they had a homology with a partial sequence of a starfish lysozyme which had been reported before. The complete sequence of the bivalve lysozyme was determined by peptide mapping and subsequent sequence analysis. This was composed of 123 amino acids including as many as 14 cysteine residues and did not show a clear homology with the known types of lysozymes. However, the homology search of this protein on the protein or nucleic acid database revealed two homologous proteins. One of them was a gene product, CELF22 A3.6 of C. elegans, which was a functionally unknown protein. The other was an isopeptidase of a medicinal leech, named destabilase. Thus, a new type of lysozyme found in at least four species across the three classes of the invertebrates demonstrates a novel class of protein/lysozyme family in invertebrates. The bivalve lysozyme, first characterized here, showed extremely high protein stability and hen lysozyme-like enzymatic features.

  16. Amino acid sequences of lysozymes newly purified from invertebrates imply wide distribution of a novel class in the lysozyme family.

    PubMed

    Ito, Y; Yoshikawa, A; Hotani, T; Fukuda, S; Sugimura, K; Imoto, T

    1999-01-01

    Lysozymes were purified from three invertebrates: a marine bivalve, a marine conch, and an earthworm. The purified lysozymes all showed a similar molecular weight of 13 kDa on SDS/PAGE. Their N-terminal sequences up to the 33rd residue determined here were apparently homologous among them; in addition, they had a homology with a partial sequence of a starfish lysozyme which had been reported before. The complete sequence of the bivalve lysozyme was determined by peptide mapping and subsequent sequence analysis. This was composed of 123 amino acids including as many as 14 cysteine residues and did not show a clear homology with the known types of lysozymes. However, the homology search of this protein on the protein or nucleic acid database revealed two homologous proteins. One of them was a gene product, CELF22 A3.6 of C. elegans, which was a functionally unknown protein. The other was an isopeptidase of a medicinal leech, named destabilase. Thus, a new type of lysozyme found in at least four species across the three classes of the invertebrates demonstrates a novel class of protein/lysozyme family in invertebrates. The bivalve lysozyme, first characterized here, showed extremely high protein stability and hen lysozyme-like enzymatic features. PMID:9914527

  17. Untangling the Effect of Fatty Acid Addition at Species Level Revealed Different Transcriptional Responses of the Biogas Microbial Community Members.

    PubMed

    Treu, Laura; Campanaro, Stefano; Kougias, Panagiotis G; Zhu, Xinyu; Angelidaki, Irini

    2016-06-01

    In the present study, RNA-sequencing was used to elucidate the change of anaerobic digestion metatranscriptome after long chain fatty acids (oleate) exposure. To explore the general transcriptional behavior of the microbiome, the analysis was first performed on shotgun reads without considering a reference metagenome. As a second step, RNA reads were aligned on the genes encoded by the microbial community, revealing the expression of more than 51 000 different transcripts. The present study is the first research which was able to dissect the transcriptional behavior at a single species level by considering the 106 microbial genomes previously identified. The exploration of the metabolic pathways confirmed the importance of Syntrophomonas species in fatty acids degradation, and also highlighted the presence of protective mechanisms toward the long chain fatty acid effects in bacteria belonging to Clostridiales, Rykenellaceae, and in species of the genera Halothermothrix and Anaerobaculum. Additionally, an interesting transcriptional activation of the chemotaxis genes was evidenced in seven species belonging to Clostridia, Halothermothrix, and Tepidanaerobacter. Surprisingly, methanogens revealed a very versatile behavior different from each other, even among similar species of the Methanoculleus genus, while a strong increase of the expression level in Methanosarcina sp. was evidenced after oleate addition.

  18. Targeted massively parallel sequencing of angiosarcomas reveals frequent activation of the mitogen activated protein kinase pathway

    PubMed Central

    Murali, Rajmohan; Chandramohan, Raghu; Möller, Inga; Scholz, Simone L.; Berger, Michael; Huberman, Kety; Viale, Agnes; Pirun, Mono; Socci, Nicholas D.; Bouvier, Nancy; Bauer, Sebastian; Artl, Monika; Schilling, Bastian; Schimming, Tobias; Sucker, Antje; Schwindenhammer, Benjamin; Grabellus, Florian; Speicher, Michael R.; Schaller, Jörg; Hillen, Uwe; Schadendorf, Dirk; Mentzel, Thomas; Cheng, Donavan T.; Wiesner, Thomas; Griewank, Klaus G.

    2015-01-01

    Angiosarcomas are rare malignant mesenchymal tumors of endothelial differentiation. The clinical behavior is usually aggressive and the prognosis for patients with advanced disease is poor with no effective therapies. The genetic bases of these tumors have been partially revealed in recent studies reporting genetic alterations such as amplifications of MYC (primarily in radiation-associated angiosarcomas), inactivating mutations in PTPRB and R707Q hotspot mutations of PLCG1. Here, we performed a comprehensive genomic analysis of 34 angiosarcomas using a clinically-approved, hybridization-based targeted next-generation sequencing assay for 341 well-established oncogenes and tumor suppressor genes. Over half of the angiosarcomas (n = 18, 53%) harbored genetic alterations affecting the MAPK pathway, involving mutations in KRAS, HRAS, NRAS, BRAF, MAPK1 and NF1, or amplifications in MAPK1/CRKL, CRAF or BRAF. The most frequently detected genetic aberrations were mutations in TP53 in 12 tumors (35%) and losses of CDKN2A in 9 tumors (26%). MYC amplifications were generally mutually exclusive of TP53 alterations and CDKN2A loss and were identified in 8 tumors (24%), most of which (n = 7, 88%) arose post-irradiation. Previously reported mutations in PTPRB (n = 10, 29%) and one (3%) PLCG1 R707Q mutation were also identified. Our results demonstrate that angiosarcomas are a genetically heterogeneous group of tumors, harboring a wide range of genetic alterations. The high frequency of genetic events affecting the MAPK pathway suggests that targeted therapies inhibiting MAPK signaling may be promising therapeutic avenues in patients with advanced angiosarcomas. PMID:26440310

  19. Temporal Dynamics of Avian Populations during Pleistocene Revealed by Whole-Genome Sequences.

    PubMed

    Nadachowska-Brzyska, Krystyna; Li, Cai; Smeds, Linnea; Zhang, Guojie; Ellegren, Hans

    2015-05-18

    Global climate fluctuations have significantly influenced the distribution and abundance of biodiversity. During unfavorable glacial periods, many species experienced range contraction and fragmentation, expanding again during interglacials. An understanding of the evolutionary consequences of both historical and ongoing climate changes requires knowledge of the temporal dynamics of population numbers during such climate cycles. Variation in abundance should have left clear signatures in the patterns of intraspecific genetic variation in extant species, from which historical effective population sizes (N(e)) can be estimated. We analyzed whole-genome sequences of 38 avian species in a pairwise sequentially Markovian coalescent (PSMC, [5]) framework to quantitatively reveal changes in N(e) from approximately 10 million to 10 thousand years ago. Significant fluctuations in N(e) over time were evident for most species. The most pronounced pattern observed in many species was a severe reduction in N(e) coinciding with the beginning of the last glacial period (LGP). Among species, N(e) varied by at least three orders of magnitude, exceeding 1 million in the most abundant species. Several species on the IUCN Red List of Threatened Species showed long-term reduction in population size, predating recent declines. We conclude that cycles of population expansions and contractions have been a common feature of many bird species during the Quaternary period, likely coinciding with climate cycles. Population size reduction should have increased the risk of extinction but may also have promoted speciation. Species that have experienced long-term declines may be especially vulnerable to recent anthropogenic threats. PMID:25891404

  20. Molecular Plasticity of Male and Female Murine Gonadotropes Revealed by mRNA Sequencing.

    PubMed

    Qiao, Sen; Nordström, Karl; Muijs, Leon; Gasparoni, Gilles; Tierling, Sascha; Krause, Elmar; Walter, Jörn; Boehm, Ulrich

    2016-03-01

    Gonadotropes in the anterior pituitary gland are of particular importance within the hypothalamic-pituitary-gonadal axis because they provide a means of communication and thus a functional link between the brain and the gonads. Recent results indicate that female gonadotropes may be organized in the form of a network that shows plasticity and adapts to the altered endocrine conditions of different physiological states. However, little is known about functional changes on the molecular level within gonadotropes during these different conditions. In this study we capitalize on a binary genetic strategy in order to fluorescently label murine gonadotrope cells. Using this mouse model allows to produce an enriched gonadotrope population using fluorescence activated cell sorting to perform mRNA sequencing. By using this strategy, we analyze and compare the expression profile of murine gonadotropes in different genders and developmental and hormonal stages. We find that gonadotropes taken from juvenile males and females, from cycling females at diestrus and at proestrus, from lactating females, and from adult males each have unique gene expression patterns with approximately 100 to approximately 500 genes expressed only in one particular stage. We also demonstrate extensive gene-expression profile changes with up to approximately 2200 differentially expressed genes when comparing female and male development, juveniles and adults, and cycling females. Differentially expressed genes were significantly enriched in the GnRH signaling, calcium signaling, and MAPK signaling pathways by Kyoto Encyclopedia of Genes and Genomes analysis. Our data provide an unprecedented molecular view of the primary gonadotropes and reveal a high degree of molecular plasticity within the gonadotrope population.

  1. Temporal Dynamics of Avian Populations during Pleistocene Revealed by Whole-Genome Sequences

    PubMed Central

    Nadachowska-Brzyska, Krystyna; Li, Cai; Smeds, Linnea; Zhang, Guojie; Ellegren, Hans

    2015-01-01

    Summary Global climate fluctuations have significantly influenced the distribution and abundance of biodiversity [1]. During unfavorable glacial periods, many species experienced range contraction and fragmentation, expanding again during interglacials [2–4]. An understanding of the evolutionary consequences of both historical and ongoing climate changes requires knowledge of the temporal dynamics of population numbers during such climate cycles. Variation in abundance should have left clear signatures in the patterns of intraspecific genetic variation in extant species, from which historical effective population sizes (Ne) can be estimated [3]. We analyzed whole-genome sequences of 38 avian species in a pairwise sequentially Markovian coalescent (PSMC, [5]) framework to quantitatively reveal changes in Ne from approximately 10 million to 10 thousand years ago. Significant fluctuations in Ne over time were evident for most species. The most pronounced pattern observed in many species was a severe reduction in Ne coinciding with the beginning of the last glacial period (LGP). Among species, Ne varied by at least three orders of magnitude, exceeding 1 million in the most abundant species. Several species on the IUCN Red List of Threatened Species showed long-term reduction in population size, predating recent declines. We conclude that cycles of population expansions and contractions have been a common feature of many bird species during the Quaternary period, likely coinciding with climate cycles. Population size reduction should have increased the risk of extinction but may also have promoted speciation. Species that have experienced long-term declines may be especially vulnerable to recent anthropogenic threats. PMID:25891404

  2. DNA sequence analyses reveal abundant diversity, endemism and evidence for Asian origin of the porcini mushrooms.

    PubMed

    Feng, Bang; Xu, Jianping; Wu, Gang; Hosen, Md Iqbal; Zeng, Nian-Kai; Li, Yan-Chun; Tolgor, Bau; Kost, Gerhard W; Yang, Zhu L

    2012-01-01

    The wild gourmet mushroom Boletus edulis and its close allies are of significant ecological and economic importance. They are found throughout the Northern Hemisphere, but despite their ubiquity there are still many unresolved issues with regard to the taxonomy, systematics and biogeography of this group of mushrooms. Most phylogenetic studies of Boletus so far have characterized samples from North America and Europe and little information is available on samples from other areas, including the ecologically and geographically diverse regions of China. Here we analyzed DNA sequence variation in three gene markers from samples of these mushrooms from across China and compared our findings with those from other representative regions. Our results revealed fifteen novel phylogenetic species (about one-third of the known species) and a newly identified lineage represented by Boletus sp. HKAS71346 from tropical Asia. The phylogenetic analyses support eastern Asia as the center of diversity for the porcini sensu stricto clade. Within this clade, B. edulis is the only known holarctic species. The majority of the other phylogenetic species are geographically restricted in their distributions. Furthermore, molecular dating and geological evidence suggest that this group of mushrooms originated during the Eocene in eastern Asia, followed by dispersal to and subsequent speciation in other parts of Asia, Europe, and the Americas from the middle Miocene through the early Pliocene. In contrast to the ancient dispersal of porcini in the strict sense in the Northern Hemisphere, the occurrence of B. reticulatus and B. edulis sensu lato in the Southern Hemisphere was probably due to recent human-mediated introductions.

  3. Draft Genome Sequence of Ustilago trichophora RK089, a Promising Malic Acid Producer.

    PubMed

    Zambanini, Thiemo; Buescher, Joerg M; Meurer, Guido; Wierckx, Nick; Blank, Lars M

    2016-01-01

    The basidiomycetous smut fungus Ustilago trichophora RK089 produces malate from glycerol. De novo genome sequencing revealed a 20.7-Mbp genome (301 gap-closed contigs, 246 scaffolds). A comparison to the genome of Ustilago maydis 521 revealed all essential genes for malate production from glycerol contributing to metabolic engineering for improving malate production. PMID:27469969

  4. Draft Genome Sequence of Ustilago trichophora RK089, a Promising Malic Acid Producer

    PubMed Central

    Zambanini, Thiemo; Buescher, Joerg M.; Meurer, Guido; Blank, Lars M.

    2016-01-01

    The basidiomycetous smut fungus Ustilago trichophora RK089 produces malate from glycerol. De novo genome sequencing revealed a 20.7-Mbp genome (301 gap-closed contigs, 246 scaffolds). A comparison to the genome of Ustilago maydis 521 revealed all essential genes for malate production from glycerol contributing to metabolic engineering for improving malate production. PMID:27469969

  5. Detection and isolation of nucleic acid sequences using competitive hybridization probes

    DOEpatents

    Lucas, Joe N.; Straume, Tore; Bogen, Kenneth T.

    1997-01-01

    A method for detecting a target nucleic acid sequence in a sample is provided using hybridization probes which competitively hybridize to a target nucleic acid. According to the method, a target nucleic acid sequence is hybridized to first and second hybridization probes which are complementary to overlapping portions of the target nucleic acid sequence, the first hybridization probe including a first complexing agent capable of forming a binding pair with a second complexing agent and the second hybridization probe including a detectable marker. The first complexing agent attached to the first hybridization probe is contacted with a second complexing agent, the second complexing agent being attached to a solid support such that when the first and second complexing agents are attached, target nucleic acid sequences hybridized to the first hybridization probe become immobilized on to the solid support. The immobilized target nucleic acids are then separated and detected by detecting the detectable marker attached to the second hybridization probe. A kit for performing the method is also provided.

  6. Detection and isolation of nucleic acid sequences using competitive hybridization probes

    DOEpatents

    Lucas, J.N.; Straume, T.; Bogen, K.T.

    1997-04-01

    A method for detecting a target nucleic acid sequence in a sample is provided using hybridization probes which competitively hybridize to a target nucleic acid. According to the method, a target nucleic acid sequence is hybridized to first and second hybridization probes which are complementary to overlapping portions of the target nucleic acid sequence, the first hybridization probe including a first complexing agent capable of forming a binding pair with a second complexing agent and the second hybridization probe including a detectable marker. The first complexing agent attached to the first hybridization probe is contacted with a second complexing agent, the second complexing agent being attached to a solid support such that when the first and second complexing agents are attached, target nucleic acid sequences hybridized to the first hybridization probe become immobilized on to the solid support. The immobilized target nucleic acids are then separated and detected by detecting the detectable marker attached to the second hybridization probe. A kit for performing the method is also provided. 7 figs.

  7. Sequence analysis of four acidic beta-crystallin subunits of amphibian lenses: phylogenetic comparison between beta- and gamma-crystallins.

    PubMed

    Lu, S F; Pan, F M; Chiou, S H

    1996-04-16

    beta-Crystallins composed of the most heterogeneous group of subunit chains among the three major crystallin families of vertebrates, i.e. alpha-, beta- and gamma-crystallins, are less well understood at the structural and functional levels than the other two. They comprise a multigene family with at least three basic (betaB1-3) and four acidic (betaA1-4) subunit polypeptides. In order to facilitate the determination of the primary sequences of all these ubiquitous crystallin subunits present in all vertebrate species, cDNA mixture was synthesized from the poly(A)+ mRNA isolated from bullfrog eye lenses. We report here a protocol of Rapid Amplification of cDNA Ends (RACE) was used to amplify cDNAs encoding beta-crystallin acidic subunit polypeptides by polymerase chain reaction (PCR). Four complete full-length reading frames with two each of 597 and 648 base pairs, which cover four deduced protein sequences of 198 (betaA1-1 and betaA1-2) and 215 (betaA3-1 and betaA3-2) amino acids including the universal initiating methionine, were revealed by nucleotide sequencing. They show about 96-98% sequence similarity among themselves and 76-80%, 80-83% to the homologous betaA1/A3 crystallins of bovine and human species respectively, revealing the close structural relationship among acidic subunits of all beta-crystallins even from remotely related species. In this study a phylogenetic comparison based on amino-acid sequences of various betaA1/A3 crystallins plus the major basic beta-crystallin (betaBp) and gamma-crystallin from different vertebrate species is made using a combination of distance matrix and approximate parsimony methods, which correctly groups these betaA crystallin chains together as one family distinct from basic beta-crystallins and gamma-crystallin and further corroborates the supposition that beta- and gamma-crystallins form a superfamily with a common ancestry.

  8. Sequence-specific interaction between HIV-1 matrix protein and viral genomic RNA revealed by in vitro genetic selection.

    PubMed Central

    Purohit, P; Dupont, S; Stevenson, M; Green, M R

    2001-01-01

    The human immunodeficiency virus type-1 matrix protein (HIV-1 MA) is a multifunctional structural protein synthesized as part of the Pr55 gag polyprotein. We have used in vitro genetic selection to identify an RNA consensus sequence that specifically interacts with MA (Kd = 5 x 10(-7) M). This 13-nt MA binding consensus sequence bears a high degree of homology (77%) to a region (nt 1433-1446) within the POL open reading frame of the HIV-1 genome (consensus sequence from 38 HIV-1 strains). Chemical interference experiments identified the nucleotides within the MA binding consensus sequence involved in direct contact with MA. We further demonstrate that this RNA-protein interaction is mediated through a stretch of basic amino acids within MA. Mutations that disrupt the interaction between MA and its RNA binding site within the HIV-1 genome resulted in a measurable decrease in viral replication. PMID:11345436

  9. Ligation with nucleic acid sequence-based amplification.

    PubMed

    Ong, Carmichael; Tai, Warren; Sarma, Aartik; Opal, Steven M; Artenstein, Andrew W; Tripathi, Anubhav

    2012-01-01

    This work presents a novel method for detecting nucleic acid targets using a ligation step along with an isothermal, exponential amplification step. We use an engineered ssDNA with two variable regions on the ends, allowing us to design the probe for optimal reaction kinetics and primer binding. This two-part probe is ligated by T4 DNA Ligase only when both parts bind adjacently to the target. The assay demonstrates that the expected 72-nt RNA product appears only when the synthetic target, T4 ligase, and both probe fragments are present during the ligation step. An extraneous 38-nt RNA product also appears due to linear amplification of unligated probe (P3), but its presence does not cause a false-positive result. In addition, 40 mmol/L KCl in the final amplification mix was found to be optimal. It was also found that increasing P5 in excess of P3 helped with ligation and reduced the extraneous 38-nt RNA product. The assay was also tested with a single nucleotide polymorphism target, changing one base at the ligation site. The assay was able to yield a negative signal despite only a single-base change. Finally, using P3 and P5 with longer binding sites results in increased overall sensitivity of the reaction, showing that increasing ligation efficiency can improve the assay overall. We believe that this method can be used effectively for a number of diagnostic assays. PMID:22449695

  10. The amino acid sequence of mitogenic lectin-B from the roots of pokeweed (Phytolacca americana).

    PubMed

    Yamaguchi, K; Yurino, N; Kino, M; Ishiguro, M; Funatsu, G

    1997-04-01

    The complete amino acid sequence of pokeweed lectin-B (PL-B) has been analyzed by first sequencing seven lysylendopeptidase peptides derived from the reduced and S-pyridylethylated PL-B and then connecting them by analyzing the arginylendopeptidase peptides from the reduced and S-carboxymethylated PL-B. PL-B consists of 295 amino acid residues and two oligosaccharides linked to Asn96 and Asn139, and has a molecular mass of 34,493 Da. PL-B is composed of seven repetitive chitin-binding domains having 48-79% sequence homology with each other. Twelve amino acid residues including eight cysteine residues in these domains are absolutely conserved in all other chitin-binding domains of plant lectins and class I chitinases. Also, it was strongly suggested that the extremely high hemagglutinating and mitogenic activities of PL-B may be ascribed to its seven-domain structure.

  11. ConSurf 2010: calculating evolutionary conservation in sequence and structure of proteins and nucleic acids.

    PubMed

    Ashkenazy, Haim; Erez, Elana; Martz, Eric; Pupko, Tal; Ben-Tal, Nir

    2010-07-01

    It is informative to detect highly conserved positions in proteins and nucleic acid sequence/structure since they are often indicative of structural and/or functional importance. ConSurf (http://consurf.tau.ac.il) and ConSeq (http://conseq.tau.ac.il) are two well-established web servers for calculating the evolutionary conservation of amino acid positions in proteins using an empirical Bayesian inference, starting from protein structure and sequence, respectively. Here, we present the new version of the ConSurf web server that combines the two independent servers, providing an easier and more intuitive step-by-step interface, while offering the user more flexibility during the process. In addition, the new version of ConSurf calculates the evolutionary rates for nucleic acid sequences. The new version is freely available at: http://consurf.tau.ac.il/.

  12. Single-cell Sequencing of Thiomargarita Reveals Genomic Flexibility for Adaptation to Dynamic Redox Conditions.

    PubMed

    Winkel, Matthias; Salman-Carvalho, Verena; Woyke, Tanja; Richter, Michael; Schulz-Vogt, Heide N; Flood, Beverly E; Bailey, Jake V; Mußmann, Marc

    2016-01-01

    Large, colorless sulfur-oxidizing bacteria (LSB) of the family Beggiatoaceae form thick mats at sulfidic sediment surfaces, where they efficiently detoxify sulfide before it enters the water column. The genus Thiomargarita harbors the largest known free-living bacteria with cell sizes of up to 750 μm in diameter. In addition to their ability to oxidize reduced sulfur compounds, some Thiomargarita spp. are known to store large amounts of nitrate, phosphate and elemental sulfur internally. To date little is known about their energy yielding metabolic pathways, and how these pathways compare to other Beggiatoaceae. Here, we present a draft single-cell genome of a chain-forming "Candidatus Thiomargarita nelsonii Thio36", and conduct a comparative analysis to five draft and one full genome of other members of the Beggiatoaceae. "Ca. T. nelsonii Thio36" is able to respire nitrate to both ammonium and dinitrogen, which allows them to flexibly respond to environmental changes. Genes for sulfur oxidation and inorganic carbon fixation confirmed that "Ca. T. nelsonii Thio36" can function as a chemolithoautotroph. Carbon can be fixed via the Calvin-Benson-Bassham cycle, which is common among the Beggiatoaceae. In addition we found key genes of the reductive tricarboxylic acid cycle that point toward an alternative CO2 fixation pathway. Surprisingly, "Ca. T. nelsonii Thio36" also encodes key genes of the C2-cycle that convert 2-phosphoglycolate to 3-phosphoglycerate during photorespiration in higher plants and cyanobacteria. Moreover, we identified a novel trait of a flavin-based energy bifurcation pathway coupled to a Na(+)-translocating membrane complex (Rnf). The coupling of these pathways may be key to surviving long periods of anoxia. As other Beggiatoaceae "Ca. T. nelsonii Thio36" encodes many genes similar to those of (filamentous) cyanobacteria. In summary, the genome of "Ca. T. nelsonii Thio36" provides additional insight into the ecology of giant sulfur

  13. Amino acid repeats cause extraordinary coding sequence variation in the social amoeba Dictyostelium discoideum.

    PubMed

    Scala, Clea; Tian, Xiangjun; Mehdiabadi, Natasha J; Smith, Margaret H; Saxer, Gerda; Stephens, Katie; Buzombo, Prince; Strassmann, Joan E; Queller, David C

    2012-01-01

    Protein sequences are normally the most conserved elements of genomes owing to purifying selection to maintain their functions. We document an extraordinary amount of within-species protein sequence variation in the model eukaryote Dictyostelium discoideum stemming from triplet DNA repeats coding for long strings of single amino acids. D. discoideum has a very large number of such strings, many of which are polyglutamine repeats, the same sequence that causes various human neurological disorders in humans, like Huntington's disease. We show here that D. discoideum coding repeat loci are highly variable among individuals, making D. discoideum a candidate for the most variable proteome. The coding repeat loci are not significantly less variable than similar non-coding triplet repeats. This pattern is consistent with these amino-acid repeats being largely non-functional sequences evolving primarily by mutation and drift. PMID:23029418

  14. Conservation of Shannon's redundancy for proteins. [information theory applied to amino acid sequences

    NASA Technical Reports Server (NTRS)

    Gatlin, L. L.

    1974-01-01

    Concepts of information theory are applied to examine various proteins in terms of their redundancy in natural originators such as animals and plants. The Monte Carlo method is used to derive information parameters for random protein sequences. Real protein sequence parameters are compared with the standard parameters of protein sequences having a specific length. The tendency of a chain to contain some amino acids more frequently than others and the tendency of a chain to contain certain amino acid pairs more frequently than other pairs are used as randomness measures of individual protein sequences. Non-periodic proteins are generally found to have random Shannon redundancies except in cases of constraints due to short chain length and genetic codes. Redundant characteristics of highly periodic proteins are discussed. A degree of periodicity parameter is derived.

  15. Shark myoglobins. II. Isolation, characterization and amino acid sequence of myoglobin from Galeorhinus japonicus.

    PubMed

    Suzuki, T; Suzuki, T; Yata, T

    1985-01-01

    Native oxymyoglobin (MbO2) was isolated from red muscle of G. japonicus by chromatographic separation from metmyoglobin (metMb) on DEAE-cellulose and the amino acid sequence of the major chain was determined with the aid of sequence homology with that of G. australis. It was shown to differ in amino acid sequence from that of G. australis by 10 replacements, to be acetylated at the amino terminus and to contain glutamine at the distal (E7) residue. It was also shown to have a spectrum very similar to that of mammalian MbO2. However, the pH-dependence for the autoxidation of MbO2 was seen to be quite different from that of sperm whale (Physeter catodon) MbO2. Although the sequence homology between sperm whale and G. japonicus myoglobins is about 40%, their hydropathy profiles were very similar, indicating that they have a similar geometry in their globin folding.

  16. Whole genome sequencing of a begomovirus-resistant tomato inbred reveals introgressions from wild Solanum species

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The low cost of next generation sequencing (NGS) technology and the availability of a large number of well annotated plant genomes has made sequencing technology useful to breeding programs. With the published high quality tomato reference genome of the processing cultivar Heinz 1706, we can now uti...

  17. Significance of satellite DNA revealed by conservation of a widespread repeat DNA sequence among angiosperms.

    PubMed

    Mehrotra, Shweta; Goel, Shailendra; Raina, Soom Nath; Rajpal, Vijay Rani

    2014-08-01

    The analysis of plant genome structure and evolution requires comprehensive characterization of repetitive sequences that make up the majority of plant nuclear DNA. In the present study, we analyzed the nature of pCtKpnI-I and pCtKpnI-II tandem repeated sequences, reported earlier in Carthamus tinctorius. Interestingly, homolog of pCtKpnI-I repeat sequence was also found to be present in widely divergent families of angiosperms. pCtKpnI-I showed high sequence similarity but low copy number among various taxa of different families of angiosperms analyzed. In comparison, pCtKpnI-II was specific to the genus Carthamus and was not present in any other taxa analyzed. The molecular structure of pCtKpnI-I was analyzed in various unrelated taxa of angiosperms to decipher the evolutionary conserved nature of the sequence and its possible functional role.

  18. Draft Genome Sequence of the Deep-Sea Basidiomycetous Yeast Cryptococcus sp. Strain Mo29 Reveals Its Biotechnological Potential

    PubMed Central

    Rédou, Vanessa; Kumar, Abhishek; Hainaut, Matthieu; Henrissat, Bernard; Record, Eric; Barbier, Georges

    2016-01-01

    Cryptococcus sp. strain Mo29 was isolated from the Rainbow hydrothermal site on the Mid-Atlantic Ridge. Here, we present the draft genome sequence of this basidiomycetous yeast strain, which has highlighted its biotechnological potential as revealed by the presence of genes involved in the synthesis of secondary metabolites and biotechnologically important enzymes. PMID:27389259

  19. Complete Genome Sequence of the Filamentous Fungus Aspergillus westerdijkiae Reveals the Putative Biosynthetic Gene Cluster of Ochratoxin A

    PubMed Central

    Chakrabortti, Alolika; Li, Jinming

    2016-01-01

    Ochratoxin A (OTA) is a common mycotoxin that contaminates food and agricultural products. Sequencing of the complete genome of Aspergillus westerdijkiae, a major producer of OTA, reveals more than 50 biosynthetic gene clusters, including a putative OTA biosynthetic gene cluster that encodes a dozen of enzymes, transporters, and regulatory proteins. PMID:27635003

  20. Complete Genome Sequence of the Filamentous Fungus Aspergillus westerdijkiae Reveals the Putative Biosynthetic Gene Cluster of Ochratoxin A.

    PubMed

    Chakrabortti, Alolika; Li, Jinming; Liang, Zhao-Xun

    2016-01-01

    Ochratoxin A (OTA) is a common mycotoxin that contaminates food and agricultural products. Sequencing of the complete genome of Aspergillus westerdijkiae, a major producer of OTA, reveals more than 50 biosynthetic gene clusters, including a putative OTA biosynthetic gene cluster that encodes a dozen of enzymes, transporters, and regulatory proteins. PMID:27635003

  1. Visible sensing of nucleic acid sequences using a genetically encodable unmodified mRNA probe.

    PubMed

    Narita, Atsushi; Ogawa, Kazumasa; Sando, Shinsuke; Aoyama, Yasuhiro

    2006-01-01

    We previously reported a molecular beacon-mRNA (MB-mRNA) strategy for nucleic acid detection/sensing in a cell-free translation system using unmodified RNA as a probe. Here in this presentation, we report that a combination with RNase H activity, which induces an additional process of irreversible cleavage of MB-domain, achieves an improved sequence selectivity (one nucleotide selectivity) and an enhanced sensitivity. This improved system finally enabled visible sensing of target nucleic acid sequence at a single nucleotide resolution under isothermal conditions.

  2. Amino acid and cDNA sequences of lysozyme from Hyalophora cecropia

    PubMed Central

    Engström, Å.; Xanthopoulos, K. G.; Boman, H. G.; Bennich, H.

    1985-01-01

    The amino acid and cDNA sequences of lysozyme from the giant silk moth Hyalophora cecropia have been determined. This enzyme is one of several immune proteins produced by the diapausing pupae after injection of bacteria. Cecropia lysozyme is composed of 120 amino acids, has a mol. wt. of 13.8 kd and shows great similarity with vertebrate lysozymes of the chicken type. The amino acid residues responsible for the catalytic activity and for the binding of substrate are essentially conserved. Three allelic variants of the Cecropia enzyme are identified. A comparison of the chicken and the Cecropia lysozymes shows that there is a 40% identity at both the amino acid and the nucleotide level. Some evolutionary aspects of the sequence data are discussed. PMID:16453632

  3. Transcriptome Sequencing Reveals Wide Expression Reprogramming of Basal and Unknown Genes in Leptospira biflexa Biofilms.

    PubMed

    Iraola, Gregorio; Spangenberg, Lucía; Lopes Bastos, Bruno; Graña, Martín; Vasconcelos, Larissa; Almeida, Áurea; Greif, Gonzalo; Robello, Carlos; Ristow, Paula; Naya, Hugo

    2016-01-01

    The genus Leptospira is composed of pathogenic and saprophytic spirochetes. Pathogenic Leptospira is the etiological agent of leptospirosis, a globally spread neglected disease. A key ecological feature of some pathogenic species is their ability to survive both within and outside the host. For most leptospires, the ability to persist outside the host is associated with biofilm formation, a most important bacterial strategy to face and overcome hostile environmental conditions. The architecture and biochemistry of leptospiral biofilms are rather well understood; however, the genetic program underpinning biofilm formation remains mostly unknown. In this work, we used the saprophyte Leptospira biflexa as a model organism to assess over- and underrepresented transcripts during the biofilm state, using transcriptome sequencing (RNA-seq) technology. Our results showed that some basal biological processes like DNA replication and cell division are downregulated in the mature biofilm. Additionally, we identified significant expression reprogramming for genes involved in motility, sugar/lipid metabolism, and iron scavenging, as well as for outer membrane-encoding genes. A careful manual annotation process allowed us to assign molecular functions to many previously uncharacterized genes that are probably involved in biofilm metabolism. We also provided evidence for the presence of small regulatory RNAs in this species. Finally, coexpression networks were reconstructed to pinpoint functionally related gene clusters that may explain how biofilm maintenance is regulated. Beyond elucidating some genetic aspects of biofilm formation, this work reveals a number of pathways whose functional dissection may impact our understanding of leptospiral biology, in particular how these organisms adapt to environmental changes. IMPORTANCE In this work, we describe the first transcriptome based on RNA-seq technology focused on studying transcriptional changes associated with biofilm growth

  4. Transcriptome Sequencing Reveals Wide Expression Reprogramming of Basal and Unknown Genes in Leptospira biflexa Biofilms

    PubMed Central

    Spangenberg, Lucía; Lopes Bastos, Bruno; Graña, Martín; Vasconcelos, Larissa; Almeida, Áurea; Greif, Gonzalo; Robello, Carlos; Ristow, Paula

    2016-01-01

    ABSTRACT The genus Leptospira is composed of pathogenic and saprophytic spirochetes. Pathogenic Leptospira is the etiological agent of leptospirosis, a globally spread neglected disease. A key ecological feature of some pathogenic species is their ability to survive both within and outside the host. For most leptospires, the ability to persist outside the host is associated with biofilm formation, a most important bacterial strategy to face and overcome hostile environmental conditions. The architecture and biochemistry of leptospiral biofilms are rather well understood; however, the genetic program underpinning biofilm formation remains mostly unknown. In this work, we used the saprophyte Leptospira biflexa as a model organism to assess over- and underrepresented transcripts during the biofilm state, using transcriptome sequencing (RNA-seq) technology. Our results showed that some basal biological processes like DNA replication and cell division are downregulated in the mature biofilm. Additionally, we identified significant expression reprogramming for genes involved in motility, sugar/lipid metabolism, and iron scavenging, as well as for outer membrane-encoding genes. A careful manual annotation process allowed us to assign molecular functions to many previously uncharacterized genes that are probably involved in biofilm metabolism. We also provided evidence for the presence of small regulatory RNAs in this species. Finally, coexpression networks were reconstructed to pinpoint functionally related gene clusters that may explain how biofilm maintenance is regulated. Beyond elucidating some genetic aspects of biofilm formation, this work reveals a number of pathways whose functional dissection may impact our understanding of leptospiral biology, in particular how these organisms adapt to environmental changes. IMPORTANCE In this work, we describe the first transcriptome based on RNA-seq technology focused on studying transcriptional changes associated with biofilm

  5. Transcriptome Sequencing Reveals Wide Expression Reprogramming of Basal and Unknown Genes in Leptospira biflexa Biofilms.

    PubMed

    Iraola, Gregorio; Spangenberg, Lucía; Lopes Bastos, Bruno; Graña, Martín; Vasconcelos, Larissa; Almeida, Áurea; Greif, Gonzalo; Robello, Carlos; Ristow, Paula; Naya, Hugo

    2016-01-01

    The genus Leptospira is composed of pathogenic and saprophytic spirochetes. Pathogenic Leptospira is the etiological agent of leptospirosis, a globally spread neglected disease. A key ecological feature of some pathogenic species is their ability to survive both within and outside the host. For most leptospires, the ability to persist outside the host is associated with biofilm formation, a most important bacterial strategy to face and overcome hostile environmental conditions. The architecture and biochemistry of leptospiral biofilms are rather well understood; however, the genetic program underpinning biofilm formation remains mostly unknown. In this work, we used the saprophyte Leptospira biflexa as a model organism to assess over- and underrepresented transcripts during the biofilm state, using transcriptome sequencing (RNA-seq) technology. Our results showed that some basal biological processes like DNA replication and cell division are downregulated in the mature biofilm. Additionally, we identified significant expression reprogramming for genes involved in motility, sugar/lipid metabolism, and iron scavenging, as well as for outer membrane-encoding genes. A careful manual annotation process allowed us to assign molecular functions to many previously uncharacterized genes that are probably involved in biofilm metabolism. We also provided evidence for the presence of small regulatory RNAs in this species. Finally, coexpression networks were reconstructed to pinpoint functionally related gene clusters that may explain how biofilm maintenance is regulated. Beyond elucidating some genetic aspects of biofilm formation, this work reveals a number of pathways whose functional dissection may impact our understanding of leptospiral biology, in particular how these organisms adapt to environmental changes. IMPORTANCE In this work, we describe the first transcriptome based on RNA-seq technology focused on studying transcriptional changes associated with biofilm growth

  6. The cDNA-derived amino acid sequence of hemoglobin II from Lucina pectinata.

    PubMed

    Torres-Mercado, Elineth; Renta, Jessicca Y; Rodríguez, Yolanda; López-Garriga, Juan; Cadilla, Carmen L

    2003-11-01

    Hemoglobin II from the clam Lucina pectinata is an oxygen-reactive protein with a unique structural organization in the heme pocket involving residues Gln65 (E7), Tyr30 (B10), Phe44 (CD1), and Phe69 (E11). We employed the reverse transcriptase-polymerase chain reaction (RT-PCR) and methods to synthesize various cDNA(HbII). An initial 300-bp cDNA clone was amplified from total RNA by RT-PCR using degenerate oligonucleotides. Gene-specific primers derived from the HbII-partial cDNA sequence were used to obtain the 5' and 3' ends of the cDNA by RACE. The length of the HbII cDNA, estimated from overlapping clones, was approximately 2114 bases. Northern blot analysis revealed that the mRNA size of HbII agrees with the estimated size using cDNA data. The coding region of the full-length HbII cDNA codes for 151 amino acids. The calculated molecular weight of HbII, including the heme group and acetylated N-terminal residue, is 17,654.07 Da.

  7. The High-throughput sequencing of Sillago japonica mitochondrial genome reveals the phylogenetic position within the genus Sillago.

    PubMed

    Niu, Sufang; Wu, Renxie; Liu, Yong; Wang, Xuefeng

    2016-09-01

    The complete mitogenome of Sillago japonica was determined through high-throughput DNA sequencing technology. The circular mtDNA molecule was 16 645 bp in size and encoded 13 protein-coding genes, 2 rRNAs, 22 tRNAs and 2 non-coding regions, with the gene arrangement and content identical to other typical vertebrate mitogenomes. The identity analysis revealed that the mitogenome sequence of S. japonica shared a relatively high sequence identity to S. asiatica (81.5%) compared with S. aeolus (77.5%), S. indica (77.1%), and S. sihama (76.3%). The neighbor-joining tree of complete mitogenome sequence showed that S. japonica firstly clustered together with S. asiatica, then grouped with S. indica and S. sihama, and finally gathered with S. aeolus. Taken together, the results absolutely supported the evolutionary position of S. japonica and provided new insights into phylogenetic relationships of Sillago.

  8. The phylogenetic relationship of tetrapod, coelacanth, and lungfish revealed by the sequences of forty-four nuclear genes.

    PubMed

    Takezaki, Naoko; Figueroa, Felipe; Zaleska-Rutczynska, Zofia; Takahata, Naoyuki; Klein, Jan

    2004-08-01

    The origin of tetrapods is a major outstanding issue in vertebrate phylogeny. Each of the three possible principal hypotheses (coelacanth, lungfish, or neither being the sister group of tetrapods) has found support in different sets of data. In an attempt to resolve the controversy, sequences of 44 nuclear genes encoding amino acid residues at 10,404 positions were obtained and analyzed. However, this large set of sequences did not support conclusively one of the three hypotheses. Apparently, the coelacanth, lungfish, and tetrapod lineages diverged within such a short time interval that at this level of analysis, their relationships appear to be an irresolvable trichotomy.

  9. Draft genome sequence of the docosahexaenoic acid producing thraustochytrid Aurantiochytrium sp. T66.

    PubMed

    Liu, Bin; Ertesvåg, Helga; Aasen, Inga Marie; Vadstein, Olav; Brautaset, Trygve; Heggeset, Tonje Marita Bjerkan

    2016-06-01

    Thraustochytrids are unicellular, marine protists, and there is a growing industrial interest in these organisms, particularly because some species, including strains belonging to the genus Aurantiochytrium, accumulate high levels of docosahexaenoic acid (DHA). Here, we report the draft genome sequence of Aurantiochytrium sp. T66 (ATCC PRA-276), with a size of 43 Mbp, and 11,683 predicted protein-coding sequences. The data has been deposited at DDBJ/EMBL/Genbank under the accession LNGJ00000000. The genome sequence will contribute new insight into DHA biosynthesis and regulation, providing a basis for metabolic engineering of thraustochytrids. PMID:27222814

  10. Draft genome sequence of the docosahexaenoic acid producing thraustochytrid Aurantiochytrium sp. T66.

    PubMed

    Liu, Bin; Ertesvåg, Helga; Aasen, Inga Marie; Vadstein, Olav; Brautaset, Trygve; Heggeset, Tonje Marita Bjerkan

    2016-06-01

    Thraustochytrids are unicellular, marine protists, and there is a growing industrial interest in these organisms, particularly because some species, including strains belonging to the genus Aurantiochytrium, accumulate high levels of docosahexaenoic acid (DHA). Here, we report the draft genome sequence of Aurantiochytrium sp. T66 (ATCC PRA-276), with a size of 43 Mbp, and 11,683 predicted protein-coding sequences. The data has been deposited at DDBJ/EMBL/Genbank under the accession LNGJ00000000. The genome sequence will contribute new insight into DHA biosynthesis and regulation, providing a basis for metabolic engineering of thraustochytrids.

  11. Dietary Intake and Plasma Metabolomic Analysis of Polyunsaturated Fatty Acids in Bipolar Subjects Reveal Dysregulation of Linoleic Acid Metabolism

    PubMed Central

    Evans, Simon J.; Ringrose, Rachel N.; Harrington, Gloria J; Mancuso, Peter; Burant, Charles F; McInnis, Melvin G

    2014-01-01

    Polyunsaturated fatty acids (PUFA) profiles associate with risk for mood disorders. This poses the hypothesis of metabolic differences between patients and unaffected healthy controls that relate to the primary illness or are secondary to medication use or dietary intake. However, dietary manipulation or supplementation studies show equivocal results improving mental health outcomes. This study investigates dietary patterns and metabolic profiles relevant to PUFA metabolism, in bipolar I individuals compared to non-psychiatric controls. We collected seven-day diet records and performed metabolomic analysis of fasted plasma collected immediately after diet recording. Regression analyses adjusted for age, gender and energy intake found that bipolar individuals had significantly lower intake of selenium and PUFAs, including eicosapentaenoic acid (EPA) (n-3), docosahexaenoic acid (DHA) (n-3), arachidonic acid (AA) (n-6) and docosapentaenoic acid (DPA) (n-3/n-6 mix); and significantly increased intake of the saturated fats, eicosanoic and docosanoic acid. Regression analysis of metabolomic data derived from plasma samples, correcting for age, gender, BMI, psychiatric medication use and dietary PUFA intake, revealed that bipolar individuals had reduced 13S-HpODE, a major peroxidation product of the n-6, linoleic acid (LA), reduced eicosadienoic acid (EDA), an elongation product of LA; reduced prostaglandins G2, F2 alpha and E1, synthesized from n-6 PUFA; and reduced EPA. These observations remained significant or near significant after Bonferroni correction and are consistent with metabolic variances between bipolar and control individuals with regard to PUFA metabolism. These findings suggest that specific dietary interventions aimed towards correcting these metabolic disparities may impact health outcomes for individuals with bipolar disorder. PMID:24953860

  12. Characterization and phylogenetic analysis of α-gliadin gene sequences reveals significant genomic divergence in Triticeae species.

    PubMed

    Li, Guang-Rong; Lang, Tao; Yang, En-Nian; Liu, Cheng; Yang, Zu-Jun

    2014-12-01

    Although the unique properties of wheat α-gliadin gene family are well characterized, little is known about the evolution and genomic divergence of α-gliadin gene family within the Triticeae. We isolated a total of 203 α-gliadin gene sequences from 11 representative diploid and polyploid Triticeae species, and found 108 sequences putatively functional. Our results indicate that α-gliadin genes may have possibly originated from wild Secale species, where the sequences contain the shortest repetitive domains and display minimum variation. A miniature inverted-repeat transposable element insertion is reported for the first time in α-gliadin gene sequence of Thinopyrum intermedium in this study, indicating that the transposable element might have contributed to the diversification of α-gliadin genes family among Triticeae genomes. The phylogenetic analyses revealed that the α-gliadin gene sequences of Dasypyrum, Australopyrum, Lophopyrum, Eremopyrum and Pseudoroengeria species have amplified several times. A search for four typical toxic epitopes for celiac disease within the Triticeae α-gliadin gene sequences showed that the α-gliadins of wild Secale, Australopyrum and Agropyron genomes lack all four epitopes, while other Triticeae species have accumulated these epitopes, suggesting that the evolution of these toxic epitopes sequences occurred during the course of speciation, domestication or polyploidization of Triticeae. PMID:25572231

  13. AcalPred: a sequence-based tool for discriminating between acidic and alkaline enzymes.

    PubMed

    Lin, Hao; Chen, Wei; Ding, Hui

    2013-01-01

    The structure and activity of enzymes are influenced by pH value of their surroundings. Although many enzymes work well in the pH range from 6 to 8, some specific enzymes have good efficiencies only in acidic (pH<5) or alkaline (pH>9) solution. Studies have demonstrated that the activities of enzymes correlate with their primary sequences. It is crucial to judge enzyme adaptation to acidic or alkaline environment from its amino acid sequence in molecular mechanism clarification and the design of high efficient enzymes. In this study, we developed a sequence-based method to discriminate acidic enzymes from alkaline enzymes. The analysis of variance was used to choose the optimized discriminating features derived from g-gap dipeptide compositions. And support vector machine was utilized to establish the prediction model. In the rigorous jackknife cross-validation, the overall accuracy of 96.7% was achieved. The method can correctly predict 96.3% acidic and 97.1% alkaline enzymes. Through the comparison between the proposed method and previous methods, it is demonstrated that the proposed method is more accurate. On the basis of this proposed method, we have built an online web-server called AcalPred which can be freely accessed from the website (http://lin.uestc.edu.cn/server/AcalPred). We believe that the AcalPred will become a powerful tool to study enzyme adaptation to acidic or alkaline environment.

  14. AcalPred: A Sequence-Based Tool for Discriminating between Acidic and Alkaline Enzymes

    PubMed Central

    Lin, Hao; Chen, Wei; Ding, Hui

    2013-01-01

    The structure and activity of enzymes are influenced by pH value of their surroundings. Although many enzymes work well in the pH range from 6 to 8, some specific enzymes have good efficiencies only in acidic (pH<5) or alkaline (pH>9) solution. Studies have demonstrated that the activities of enzymes correlate with their primary sequences. It is crucial to judge enzyme adaptation to acidic or alkaline environment from its amino acid sequence in molecular mechanism clarification and the design of high efficient enzymes. In this study, we developed a sequence-based method to discriminate acidic enzymes from alkaline enzymes. The analysis of variance was used to choose the optimized discriminating features derived from g-gap dipeptide compositions. And support vector machine was utilized to establish the prediction model. In the rigorous jackknife cross-validation, the overall accuracy of 96.7% was achieved. The method can correctly predict 96.3% acidic and 97.1% alkaline enzymes. Through the comparison between the proposed method and previous methods, it is demonstrated that the proposed method is more accurate. On the basis of this proposed method, we have built an online web-server called AcalPred which can be freely accessed from the website (http://lin.uestc.edu.cn/server/AcalPred). We believe that the AcalPred will become a powerful tool to study enzyme adaptation to acidic or alkaline environment. PMID:24130738

  15. De Novo transcriptome sequencing reveals important molecular networks and metabolic pathways of the plant, Chlorophytum borivilianum.

    PubMed

    Kalra, Shikha; Puniya, Bhanwar Lal; Kulshreshtha, Deepika; Kumar, Sunil; Kaur, Jagdeep; Ramachandran, Srinivasan; Singh, Kashmir

    2013-01-01

    Chlorophytum borivilianum, an endangered medicinal plant species is highly recognized for its aphrodisiac properties provided by saponins present in the plant. The transcriptome information of this species is limited and only few hundred expressed sequence tags (ESTs) are available in the public databases. To gain molecular insight of this plant, high throughput transcriptome sequencing of leaf RNA was carried out using Illumina's HiSeq 2000 sequencing platform. A total of 22,161,444 single end reads were retrieved after quality filtering. Available (e.g., De-Bruijn/Eulerian graph) and in-house developed bioinformatics tools were used for assembly and annotation of transcriptome. A total of 101,141 assembled transcripts were obtained, with coverage size of 22.42 Mb and average length of 221 bp. Guanine-cytosine (GC) content was found to be 44%. Bioinformatics analysis, using non-redundant proteins, gene ontology (GO), enzyme commission (EC) and kyoto encyclopedia of genes and genomes (KEGG) databases, extracted all the known enzymes involved in saponin and flavonoid biosynthesis. Few genes of the alkaloid biosynthesis, along with anticancer and plant defense genes, were also discovered. Additionally, several cytochrome P450 (CYP450) and glycosyltransferase unique sequences were also found. We identified simple sequence repeat motifs in transcripts with an abundance of di-nucleotide simple sequence repeat (SSR; 43.1%) markers. Large scale expression profiling through Reads per Kilobase per Million mapped reads (RPKM) showed major genes involved in different metabolic pathways of the plant. Genes, expressed sequence tags (ESTs) and unique sequences from this study provide an important resource for the scientific community, interested in the molecular genetics and functional genomics of C. borivilianum.

  16. Antibody-specific model of amino acid substitution for immunological inferences from alignments of antibody sequences.

    PubMed

    Mirsky, Alexander; Kazandjian, Linda; Anisimova, Maria

    2015-03-01

    Antibodies are glycoproteins produced by the immune system as a dynamically adaptive line of defense against invading pathogens. Very elegant and specific mutational mechanisms allow B lymphocytes to produce a large and diversified repertoire of antibodies, which is modified and enhanced throughout all adulthood. One of these mechanisms is somatic hypermutation, which stochastically mutates nucleotides in the antibody genes, forming new sequences with different properties and, eventually, higher affinity and selectivity to the pathogenic target. As somatic hypermutation involves fast mutation of antibody sequences, this process can be described using a Markov substitution model of molecular evolution. Here, using large sets of antibody sequences from mice and humans, we infer an empirical amino acid substitution model AB, which is specific to antibody sequences. Compared with existing general amino acid models, we show that the AB model provides significantly better description for the somatic evolution of mice and human antibody sequences, as demonstrated on large next generation sequencing (NGS) antibody data. General amino acid models are reflective of conservation at the protein level due to functional constraints, with most frequent amino acids exchanges taking place between residues with the same or similar physicochemical properties. In contrast, within the variable part of antibody sequences we observed an elevated frequency of exchanges between amino acids with distinct physicochemical properties. This is indicative of a sui generis mutational mechanism, specific to antibody somatic hypermutation. We illustrate this property of antibody sequences by a comparative analysis of the network modularity implied by the AB model and general amino acid substitution models. We recommend using the new model for computational studies of antibody sequence maturation, including inference of alignments and phylogenetic trees describing antibody somatic hypermutation in

  17. Microbial structures, functions, and metabolic pathways in wastewater treatment bioreactors revealed using high-throughput sequencing.

    PubMed

    Ye, Lin; Zhang, Tong; Wang, Taitao; Fang, Zhiwei

    2012-12-18

    The objective of this study was to explore microbial community structures, functional profiles, and metabolic pathways in a lab-scale and a full-scale wastewater treatment bioreactors. In order to do this, over 12 gigabases of metagenomic sequence data and 600,000 paired-end sequences of bacterial 16S rRNA gene were generated with the Illumina HiSeq 2000 platform, using DNA extracted from activated sludge in the two bioreactors. Three kinds of sequences (16S rRNA gene amplicons, 16S rRNA gene sequences obtained from metagenomic sequencing, and predicted proteins) were used to conduct taxonomic assignments. Specially, relative abundances of ammonia-oxidizing archaea (AOA) and ammonia-oxidizing bacteria (AOB) were analyzed. Compared with quantitative real-time PCR (qPCR), metagenomic sequencing was demonstrated to be a better approach to quantify AOA and AOB in activated sludge samples. It was found that AOB were more abundant than AOA in both reactors. Furthermore, the analysis of the metabolic profiles indicated that the overall patterns of metabolic pathways in the two reactors were quite similar (73.3% of functions shared). However, for some pathways (such as carbohydrate metabolism and membrane transport), the two reactors differed in the number of pathway-specific genes.

  18. DNA sequence analysis of conserved genes reveals hybridization events that increase genetic diversity in Verticillium dahliae.

    PubMed

    Collado-Romero, Melania; Jiménez-Díaz, Rafael M; Mercado-Blanco, Jesús

    2010-01-01

    The hybrid origin of a Verticillium dahliae isolate belonging to the vegetative compatibility group (VCG) 3 is reported in this work. Moreover, new data supporting the hybrid origin of two V. dahliae var. longisporum (VDLSP) isolates are provided as well as information about putative parentals. Thus, isolates of VDLSP and V. dahliae VCG3 were found harboring multiple sequences of actin (Act), β-tubulin (β-tub), calmodulin (Cal) and histone 3 (H3) genes. Phylogenetic analysis of these sequences, the internal transcribed sequences (ITS-1 and ITS-2) of the rRNA genes and of a V. dahliae-specific sequence provided molecular evidences for the interspecific hybrid origin of those isolates. Sequence analysis suggests that some of VDLSP isolates may have resulted from hybridization events between a V. dahliae isolate of VCG1 and/or VCG4A and, probably, a closely related taxon to Verticillium alboatrum but not this one. Similarly, phylogenetic analysis and PCR markers indicated that a V. dahliae VCG3 isolate might have arisen from a hybridization event between a V. dahliae VCG1B isolate and as yet unidentified parent. This second parental probably does not belong to the Verticillium genus according to the gene sequences dissimilarities found between the VCG3 isolate and Verticillium spp. These results suggest an important role of parasexuality in diversity and evolution in the genus Verticillium and show that interspecific hybrids within this genus may not be rare in nature.

  19. Microbial structures, functions, and metabolic pathways in wastewater treatment bioreactors revealed using high-throughput sequencing.

    PubMed

    Ye, Lin; Zhang, Tong; Wang, Taitao; Fang, Zhiwei

    2012-12-18

    The objective of this study was to explore microbial community structures, functional profiles, and metabolic pathways in a lab-scale and a full-scale wastewater treatment bioreactors. In order to do this, over 12 gigabases of metagenomic sequence data and 600,000 paired-end sequences of bacterial 16S rRNA gene were generated with the Illumina HiSeq 2000 platform, using DNA extracted from activated sludge in the two bioreactors. Three kinds of sequences (16S rRNA gene amplicons, 16S rRNA gene sequences obtained from metagenomic sequencing, and predicted proteins) were used to conduct taxonomic assignments. Specially, relative abundances of ammonia-oxidizing archaea (AOA) and ammonia-oxidizing bacteria (AOB) were analyzed. Compared with quantitative real-time PCR (qPCR), metagenomic sequencing was demonstrated to be a better approach to quantify AOA and AOB in activated sludge samples. It was found that AOB were more abundant than AOA in both reactors. Furthermore, the analysis of the metabolic profiles indicated that the overall patterns of metabolic pathways in the two reactors were quite similar (73.3% of functions shared). However, for some pathways (such as carbohydrate metabolism and membrane transport), the two reactors differed in the number of pathway-specific genes. PMID:23151157

  20. Novel lineages of Southern Ocean deep-sea foraminifera revealed by environmental DNA sequencing

    NASA Astrophysics Data System (ADS)

    Pawlowski, Jan; Fontaine, Delia; da Silva, Ana Aranda; Guiard, Jackie

    2011-10-01

    Diversity of deep-sea foraminifera is commonly studied based on analysis of agglutinated and calcareous tests preserved in the dried sediment samples. Soft-walled and agglutinated monothalamous (single-chambered) foraminifera are usually ignored because they are poorly preserved and difficult to identify. Moreover, the assemblage examined is usually limited to sediment size fraction larger than 63 or 125 μm. To overcome these problems, we analysed the foraminiferal assemblage based on ribosomal DNA sequences amplified specifically from total DNA extracted from unsieved and fine fraction (<32 μm) of sediment samples from three sites in Southern Ocean. We obtained 392 sequences, representing 123 phylotypes of foraminifera. Over 90% of phylotypes (112) could not be assigned to any previously sequenced species or genera. Among these new phylotypes, 20 belong to the clade of multi-chambered calcareous Rotaliida and agglutinated Textulariida, while 94 branch among the radiation of monothalamous species. Many new phylotypes clustered together with other environmental foraminiferal sequences and sequences of unknown origin. Eight new lineages of environmental foraminiferal sequences (ENFOR 1-8) were distinguished. The morphology of species included in these novel lineages is unknown, but we can speculate that they are tiny, amoeboid protists present in the deep-sea sediments. Their diversity may be as high as that of better known large-sized foraminifera. Documenting this hidden component of deep-sea foraminiferal assemblages is a major challenge for the future.

  1. Biogeography revealed by mariner-like transposable element sequences via a Bayesian coalescent approach.

    PubMed

    Nakagome, Shigeki; Nakajima, Yumiko; Mano, Shuhei

    2013-09-01

    Genetic diversity of natural populations is useful in biogeographical studies. Here, we apply a Bayesian method based on the coalescent model to dating biogeographical events by using published DNA sequences of wild silkworms, Bombyx mandarina, and the domesticated model organisms B. mori, both of which categorized into the order of Lepidoptera, sampled from China, Korea, and Japan. The sequences consist of the BmTNML locus and the flanking intergenic regions. The BmTNML locus is composed of cecropia-type mariner-like element (MLE) with inverted terminal repeats, and three different transposable elements (TE), including L1BM, BMC1 retrotransposons, and BmamaT1, are inserted into the MLE. Based on the genealogy defined by TE insertions/deletions (indels), we estimated times to the most recent common ancestor and these indels events using the flanking, MLE, and indels sequences, respectively. These estimates by using MLE sequences strongly correlated with those by using flanking sequences, implying that cecropia-type MLEs can be used as a molecular clock. MLEs are thought to have transmitted horizontally among different species. By using a pair of published cecropia-type MLE sequences from lepidopteran insect, an emperor moth, and a coral in Ryukyu Islands, we demonstrated dating of horizontal transmission between species which are distantly related but inhabiting geographically close region. PMID:23989494

  2. The value of short amino acid sequence matches for prediction of protein allergenicity.

    PubMed

    Silvanovich, Andre; Nemeth, Margaret A; Song, Ping; Herman, Rod; Tagliani, Laura; Bannon, Gary A

    2006-03-01

    Typically, genetically engineered crops contain traits encoded by one or a few newly expressed proteins. The allergenicity assessment of newly expressed proteins is an important component in the safety evaluation of genetically engineered plants. One aspect of this assessment involves sequence searches that compare the amino acid sequence of the protein to all known allergens. Analyses are performed to determine the potential for immunologically based cross-reactivity where IgE directed against a known allergen could bind to the protein and elicit a clinical reaction in sensitized individuals. Bioinformatic searches are designed to detect global sequence similarity and short contiguous amino acid sequence identity. It has been suggested that potential allergen cross-reactivity may be predicted by identifying matches as short as six to eight contiguous amino acids between the protein of interest and a known allergen. A series of analyses were performed, and match probabilities were calculated for different size peptides to determine if there was a scientifically justified search window size that identified allergen sequence characteristics. Four probability modeling methods were tested: (1) a mock protein and a mock allergen database, (2) a mock protein and genuine allergen database, (3) a genuine allergen and genuine protein database, and (4) a genuine allergen and genuine protein database combined with a correction for repeating peptides. These analyses indicated that searches for short amino acid sequence matches of eight amino acids or fewer to identify proteins as potential cross-reactive allergens is a product of chance and adds little value to allergy assessments for newly expressed proteins.

  3. Comparison of the amino acid sequence of the major immunogen from three serotypes of foot and mouth disease virus.

    PubMed Central

    Makoff, A J; Paynter, C A; Rowlands, D J; Boothroyd, J C

    1982-01-01

    Cloned cDNA molecules from three serotypes of FMDV have been sequenced around the VP1-coding region. The predicted amino acid sequences for VP1 were compared with the published sequences and variable regions identified. The amino acid sequences were also analysed for hydrophilic regions. Two of the variable regions, numbered 129-160 and 193-204 overlapped hydrophilic regions, and were therefore identified as potentially immunogenic. These regions overlap regions shown by others to be immunogenic. PMID:6298715

  4. Single-cell Sequencing of Thiomargarita Reveals Genomic Flexibility for Adaptation to Dynamic Redox Conditions.

    PubMed

    Winkel, Matthias; Salman-Carvalho, Verena; Woyke, Tanja; Richter, Michael; Schulz-Vogt, Heide N; Flood, Beverly E; Bailey, Jake V; Mußmann, Marc

    2016-01-01

    Large, colorless sulfur-oxidizing bacteria (LSB) of the family Beggiatoaceae form thick mats at sulfidic sediment surfaces, where they efficiently detoxify sulfide before it enters the water column. The genus Thiomargarita harbors the largest known free-living bacteria with cell sizes of up to 750 μm in diameter. In addition to their ability to oxidize reduced sulfur compounds, some Thiomargarita spp. are known to store large amounts of nitrate, phosphate and elemental sulfur internally. To date little is known about their energy yielding metabolic pathways, and how these pathways compare to other Beggiatoaceae. Here, we present a draft single-cell genome of a chain-forming "Candidatus Thiomargarita nelsonii Thio36", and conduct a comparative analysis to five draft and one full genome of other members of the Beggiatoaceae. "Ca. T. nelsonii Thio36" is able to respire nitrate to both ammonium and dinitrogen, which allows them to flexibly respond to environmental changes. Genes for sulfur oxidation and inorganic carbon fixation confirmed that "Ca. T. nelsonii Thio36" can function as a chemolithoautotroph. Carbon can be fixed via the Calvin-Benson-Bassham cycle, which is common among the Beggiatoaceae. In addition we found key genes of the reductive tricarboxylic acid cycle that point toward an alternative CO2 fixation pathway. Surprisingly, "Ca. T. nelsonii Thio36" also encodes key genes of the C2-cycle that convert 2-phosphoglycolate to 3-phosphoglycerate during photorespiration in higher plants and cyanobacteria. Moreover, we identified a novel trait of a flavin-based energy bifurcation pathway coupled to a Na(+)-translocating membrane complex (Rnf). The coupling of these pathways may be key to surviving long periods of anoxia. As other Beggiatoaceae "Ca. T. nelsonii Thio36" encodes many genes similar to those of (filamentous) cyanobacteria. In summary, the genome of "Ca. T. nelsonii Thio36" provides additional insight into the ecology of giant sulfur

  5. Single-cell sequencing of Thiomargarita reveals genomic flexibility for adaptation to dynamic redox conditions

    DOE PAGES

    Winkel, Matthias; Salman-Carvalho, Verena; Woyke, Tanja; Richter, Michael; Schulz-Vogt, Heide N.; Flood, Beverly E.; Bailey, Jake V.; Mußmann, Marc

    2016-06-21

    Large, colorless sulfur-oxidizing bacteria (LSB) of the family Beggiatoaceae form thick mats at sulfidic sediment surfaces, where they efficiently detoxify sulfide before it enters the water column. The genus Thiomargarita harbors the largest known free-living bacteria with cell sizes of up to 750 μm in diameter. In addition to their ability to oxidize reduced sulfur compounds, some Thiornargarita spp. are known to store large amounts of nitrate, phosphate and elemental sulfur internally. To date little is known about their energy yielding metabolic pathways, and how these pathways compare to other Beggiatoaceae. Here, we present a draft single-cell genome of amore » chain-forming "Candidatus Thiomargarita nelsonii Thio36", and conduct a comparative analysis to five draft and one full genome of other members of the Beggiatoaceae. "Ca. T. nelsonii Thio36" is able to respire nitrate to both ammonium and dinitrogen, which allows them to flexibly respond to environmental changes. Genes for sulfur oxidation and inorganic carbon fixation confirmed that "Ca. T. nelsonii Thio36" can function as a chemolithoautotroph. Carbon can be fixed via the Calvin-Benson-Bassham cycle, which is common among the Beggiatoaceae. In addition we found key genes of the reductive tricarboxylic acid cycle that point toward an alternative CO2 fixation pathway. Surprisingly, "Ca. T. nelsonii Thio36" also encodes key genes of the C2-cycle that convert 2-phosphoglycolate to 3-phosphoglycerate during photorespiration in higher plants and cyanobacteria. Moreover, we identified a novel trait of a flavin-based energy bifurcation pathway coupled to a Na+-translocating membrane complex (Rnf). The coupling of these pathways may be key to surviving long periods of anoxia. As other Beggiatoaceae "Ca. T. nelsonii Thio36" encodes many genes similar to those of (filamentous) cyanobacteria. In conclusion, the genome of "Ca. T. nelsonii Thio36" provides additional insight into the ecology of giant sulfur

  6. Single-cell Sequencing of Thiomargarita Reveals Genomic Flexibility for Adaptation to Dynamic Redox Conditions

    PubMed Central

    Winkel, Matthias; Salman-Carvalho, Verena; Woyke, Tanja; Richter, Michael; Schulz-Vogt, Heide N.; Flood, Beverly E.; Bailey, Jake V.; Mußmann, Marc

    2016-01-01

    Large, colorless sulfur-oxidizing bacteria (LSB) of the family Beggiatoaceae form thick mats at sulfidic sediment surfaces, where they efficiently detoxify sulfide before it enters the water column. The genus Thiomargarita harbors the largest known free-living bacteria with cell sizes of up to 750 μm in diameter. In addition to their ability to oxidize reduced sulfur compounds, some Thiomargarita spp. are known to store large amounts of nitrate, phosphate and elemental sulfur internally. To date little is known about their energy yielding metabolic pathways, and how these pathways compare to other Beggiatoaceae. Here, we present a draft single-cell genome of a chain-forming “Candidatus Thiomargarita nelsonii Thio36”, and conduct a comparative analysis to five draft and one full genome of other members of the Beggiatoaceae. “Ca. T. nelsonii Thio36” is able to respire nitrate to both ammonium and dinitrogen, which allows them to flexibly respond to environmental changes. Genes for sulfur oxidation and inorganic carbon fixation confirmed that “Ca. T. nelsonii Thio36” can function as a chemolithoautotroph. Carbon can be fixed via the Calvin–Benson–Bassham cycle, which is common among the Beggiatoaceae. In addition we found key genes of the reductive tricarboxylic acid cycle that point toward an alternative CO2 fixation pathway. Surprisingly, “Ca. T. nelsonii Thio36” also encodes key genes of the C2-cycle that convert 2-phosphoglycolate to 3-phosphoglycerate during photorespiration in higher plants and cyanobacteria. Moreover, we identified a novel trait of a flavin-based energy bifurcation pathway coupled to a Na+-translocating membrane complex (Rnf). The coupling of these pathways may be key to surviving long periods of anoxia. As other Beggiatoaceae “Ca. T. nelsonii Thio36” encodes many genes similar to those of (filamentous) cyanobacteria. In summary, the genome of “Ca. T. nelsonii Thio36” provides additional insight into the ecology of

  7. Fungal communities from the calcareous deep-sea sediments in the Southwest India Ridge revealed by Illumina sequencing technology.

    PubMed

    Zhang, Likui; Kang, Manyu; Huang, Yangchao; Yang, Lixiang

    2016-05-01

    The diversity and ecological significance of bacteria and archaea in deep-sea environments have been thoroughly investigated, but eukaryotic microorganisms in these areas, such as fungi, are poorly understood. To elucidate fungal diversity in calcareous deep-sea sediments in the Southwest India Ridge (SWIR), the internal transcribed spacer (ITS) regions of rRNA genes from two sediment metagenomic DNA samples were amplified and sequenced using the Illumina sequencing platform. The results revealed that 58-63 % and 36-42 % of the ITS sequences (97 % similarity) belonged to Basidiomycota and Ascomycota, respectively. These findings suggest that Basidiomycota and Ascomycota are the predominant fungal phyla in the two samples. We also found that Agaricomycetes, Leotiomycetes, and Pezizomycetes were the major fungal classes in the two samples. At the species level, Thelephoraceae sp. and Phialocephala fortinii were major fungal species in the two samples. Despite the low relative abundance, unidentified fungal sequences were also observed in the two samples. Furthermore, we found that there were slight differences in fungal diversity between the two sediment samples, although both were collected from the SWIR. Thus, our results demonstrate that calcareous deep-sea sediments in the SWIR harbor diverse fungi, which augment the fungal groups in deep-sea sediments. This is the first report of fungal communities in calcareous deep-sea sediments in the SWIR revealed by Illumina sequencing.

  8. Complete amino acid sequence of human plasma Zn-. cap alpha. /sub 2/-glycoprotein and its homology to histocompatibility antigens

    SciTech Connect

    Araki, T.; Gejyo, F.; Takagaki, K.; Haupt, H.; Schwick, H.G.; Buergi, W.; Marti, T.; Schaller, J.; Rickli, E.; Brossmer, R.

    1988-02-01

    In the present study the complete amino acid sequence of human plasma Zn-..cap alpha../sub 2/-glycoprotein was determined. This protein whose biological function is unknown consists of a single polypeptide chain of 276 amino acid residues including 8 tryptophan residues and has a pyroglutamyl residue at the amino terminus. The location of the two disulfide bonds in the polypeptide chain was also established. The three glycans, whose structure was elucidated with the aid of 500 MHz /sup 1/H NMR spectroscopy, were sialylated N-biantennas. The molecular weight calculated from the polypeptide and carbohydrate structure is 38,478, which is close to the reported value of approx. = 41,000 based on physicochemical measurements. The predicted secondary structure appeared to comprised of 23% ..cap alpha..-helix, 27% ..beta..-sheet, and 22% ..beta..-turns. The three N-glycans were found to be located in ..beta..-turn regions. An unexpected finding was made by computer analysis of the sequence data; this revealed that Zn-..cap alpha../sub 2/-glycoprotein is closely related to antigens of the major histocompatibility complex in amino acid sequence and in domain structure. There was an unusually high degree of sequence homology with the ..cap alpha.. chains of class I histocompatibility antigens. Moreover, this plasma protein was shown to be a member of the immunoglobulin gene superfamily. Zn-..cap alpha../sub 2/-glycoprotein appears to be truncated secretory major histocompatibility complex-related molecule, and it may have a role in the expression of the immune response.

  9. Whole-genome sequencing reveals novel insights into sulfur oxidation in the extremophile Acidithiobacillus thiooxidans

    PubMed Central

    2014-01-01

    Background Acidithiobacillus thiooxidans (A. thiooxidans), a chemolithoautotrophic extremophile, is widely used in the industrial recovery of copper (bioleaching or biomining). The organism grows and survives by autotrophically utilizing energy derived from the oxidation of elemental sulfur and reduced inorganic sulfur compounds (RISCs). However, the lack of genetic manipulation systems has restricted our exploration of its physiology. With the development of high-throughput sequencing technology, the whole genome sequence analysis of A. thiooxidans has allowed preliminary models to be built for genes/enzymes involved in key energy pathways like sulfur oxidation. Results The genome of A. thiooxidans A01 was sequenced and annotated. It contains key sulfur oxidation enzymes involved in the oxidation of elemental sulfur and RISCs, such as sulfur dioxygenase (SDO), sulfide quinone reductase (SQR), thiosulfate:quinone oxidoreductase (TQO), tetrathionate hydrolase (TetH), sulfur oxidizing protein (Sox) system and their associated electron transport components. Also, the sulfur oxygenase reductase (SOR) gene was detected in the draft genome sequence of A. thiooxidans A01, and multiple sequence alignment was performed to explore the function of groups of related protein sequences. In addition, another putative pathway was found in the cytoplasm of A. thiooxidans, which catalyzes sulfite to sulfate as the final product by phosphoadenosine phosphosulfate (PAPS) reductase and adenylylsulfate (APS) kinase. This differs from its closest relative Acidithiobacillus caldus, which is performed by sulfate adenylyltransferase (SAT). Furthermore, real-time quantitative PCR analysis showed that most of sulfur oxidation genes were more strongly expressed in the S0 medium than that in the Na2S2O3 medium at the mid-log phase. Conclusion Sulfur oxidation model of A. thiooxidans A01 has been constructed based on previous studies from other sulfur oxidizing strains and its genome sequence

  10. Plasmodium knowlesi genome sequences from clinical isolates reveal extensive genomic dimorphism.

    PubMed

    Pinheiro, Miguel M; Ahmed, Md Atique; Millar, Scott B; Sanderson, Theo; Otto, Thomas D; Lu, Woon Chan; Krishna, Sanjeev; Rayner, Julian C; Cox-Singh, Janet

    2015-01-01

    Plasmodium knowlesi is a newly described zoonosis that causes malaria in the human population that can be severe and fatal. The study of P. knowlesi parasites from human clinical isolates is relatively new and, in order to obtain maximum information from patient sample collections, we explored the possibility of generating P. knowlesi genome sequences from archived clinical isolates. Our patient sample collection consisted of frozen whole blood samples that contained excessive human DNA contamination and, in that form, were not suitable for parasite genome sequencing. We developed a method to reduce the amount of human DNA in the thawed blood samples in preparation for high throughput parasite genome sequencing using Illumina HiSeq and MiSeq sequencing platforms. Seven of fifteen samples processed had sufficiently pure P. knowlesi DNA for whole genome sequencing. The reads were mapped to the P. knowlesi H strain reference genome and an average mapping of 90% was obtained. Genes with low coverage were removed leaving 4623 genes for subsequent analyses. Previously we identified a DNA sequence dimorphism on a small fragment of the P. knowlesi normocyte binding protein xa gene on chromosome 14. We used the genome data to assemble full-length Pknbpxa sequences and discovered that the dimorphism extended along the gene. An in-house algorithm was developed to detect SNP sites co-associating with the dimorphism. More than half of the P. knowlesi genome was dimorphic, involving genes on all chromosomes and suggesting that two distinct types of P. knowlesi infect the human population in Sarawak, Malaysian Borneo. We use P. knowlesi clinical samples to demonstrate that Plasmodium DNA from archived patient samples can produce high quality genome data. We show that analyses, of even small numbers of difficult clinical malaria isolates, can generate comprehensive genomic information that will improve our understanding of malaria parasite diversity and pathobiology.

  11. Exome Sequencing Reveals Novel Rare Variants in the Ryanodine Receptor and Calcium Channel Genes in Malignant Hyperthermia Families

    PubMed Central

    Kim, Jerry H.; Jarvik, Gail P.; Browning, Brian L.; Rajagopalan, Ramakrishnan; Gordon, Adam S.; Rieder, Mark J.; Robertson, Peggy D.; Nickerson, Deborah A.; Fisher, Nickla A.; Hopkins, Philip M.

    2014-01-01

    Background About half of malignant hyperthermia (MH) cases are associated with skeletal muscle ryanodine receptor 1 (RYR1) and calcium channel, voltage-dependent, L type, α1S subunit (CACNA1S) gene mutations, leaving many with an unknown cause. We chose to apply a sequencing approach to uncover causal variants in unknown cases. Sequencing the exome, the protein-coding region of the genome, has power at low sample sizes and identified the cause of over a dozen Mendelian disorders. Methods We considered four families with multiple MH cases but in whom no mutations in RYR1 and CACNA1S had been identified by Sanger sequencing of complementary DNA. Exome sequencing of two affecteds per family, chosen for maximum genetic distance, were compared. Variants were ranked by allele frequency, protein change, and measures of conservation among mammals to assess likelihood of causation. Finally, putative pathogenic mutations were genotyped in other family members to verify cosegregation with MH. Results Exome sequencing revealed 1 rare RYR1 nonsynonymous variant in each of 3 families (Asp1056His, Val2627Met, Val4234Leu), and 1 CACNA1S variant (Thr1009Lys) in a 4th family. These were not seen in variant databases or in our control population sample of 5379 exomes. Follow-up sequencing in other family members verified cosegregation of alleles with MH. Conclusions Using both exome sequencing and allele frequency data from large sequencing efforts may aid genetic diagnosis of MH. In our sample, it was more sensitive for variant detection in known genes than Sanger sequencing of complementary DNA, and allows for the possibility of novel gene discovery. PMID:24013571

  12. Serology in the Digital Age: Using Long Synthetic Peptides Created from Nucleic Acid Sequences as Antigens in Microarrays

    PubMed Central

    Rizwan, Muhammad; Rönnberg, Bengt; Cistjakovs, Maksims; Lundkvist, Åke; Pipkorn, Rudiger; Blomberg, Jonas

    2016-01-01

    Background: Antibodies to microbes, or to autoantigens, are important markers of disease. Antibody detection (serology) can reveal both past and recent infections. There is a great need for development of rational ways of detecting and quantifying antibodies, both for humans and animals. Traditionally, serology using synthetic antigens covers linear epitopes using up to 30 amino acid peptides. Methods: We here report that peptides of 100 amino acids or longer (“megapeptides”), designed and synthesized for optimal serological performance, can successfully be used as detection antigens in a suspension multiplex immunoassay (SMIA). Megapeptides can quickly be created just from pathogen sequences. A combination of rational sequencing and bioinformatic routines for definition of diagnostically-relevant antigens can, thus, rapidly yield efficient serological diagnostic tools for an emerging infectious pathogen. Results: We designed megapeptides using bioinformatics and viral genome sequences. These long peptides were tested as antigens for the presence of antibodies in human serum to the filo-, herpes-, and polyoma virus families in a multiplex microarray system. All of these virus families contain recently discovered or emerging infectious viruses. Conclusion: Long synthetic peptides can be useful as serological diagnostic antigens, serving as biomarkers, in suspension microarrays. PMID:27600087

  13. Quantitative detection of Aspergillus spp. by real-time nucleic acid sequence-based amplification.

    PubMed

    Zhao, Yanan; Perlin, David S

    2013-01-01

    Rapid and quantitative detection of Aspergillus from clinical samples may facilitate an early diagnosis of invasive pulmonary aspergillosis (IPA). As nucleic acid-based detection is a viable option, we demonstrate that Aspergillus burdens can be rapidly and accurately detected by a novel real-time nucleic acid assay other than qPCR by using the combination of nucleic acid sequence-based amplification (NASBA) and the molecular beacon (MB) technology. Here, we detail a real-time NASBA assay to determine quantitative Aspergillus burdens in lungs and bronchoalveolar lavage (BAL) fluids of rats with experimental IPA.

  14. Analyses of mitochondrial amino acid sequence datasets support the proposal that specimens of Hypodontus macropi from three species of macropodid hosts represent distinct species

    PubMed Central

    2013-01-01

    Background Hypodontus macropi is a common intestinal nematode of a range of kangaroos and wallabies (macropodid marsupials). Based on previous multilocus enzyme electrophoresis (MEE) and nuclear ribosomal DNA sequence data sets, H. macropi has been proposed to be complex of species. To test this proposal using independent molecular data, we sequenced the whole mitochondrial (mt) genomes of individuals of H. macropi from three different species of hosts (Macropus robustus robustus, Thylogale billardierii and Macropus [Wallabia] bicolor) as well as that of Macropicola ocydromi (a related nematode), and undertook a comparative analysis of the amino acid sequence datasets derived from these genomes. Results The mt genomes sequenced by next-generation (454) technology from H. macropi from the three host species varied from 13,634 bp to 13,699 bp in size. Pairwise comparisons of the amino acid sequences predicted from these three mt genomes revealed differences of 5.8% to 18%. Phylogenetic analysis of the amino acid sequence data sets using Bayesian Inference (BI) showed that H. macropi from the three different host species formed distinct, well-supported clades. In addition, sliding window analysis of the mt genomes defined variable regions for future population genetic studies of H. macropi in different macropodid hosts and geographical regions around Australia. Conclusions The present analyses of inferred mt protein sequence datasets clearly supported the hypothesis that H. macropi from M. robustus robustus, M. bicolor and T. billardierii represent distinct species. PMID:24261823

  15. Torque measurements reveal sequence-specific cooperative transitions in supercoiled DNA

    PubMed Central

    Oberstrass, Florian C.; Fernandes, Louis E.; Bryant, Zev

    2012-01-01

    B-DNA becomes unstable under superhelical stress and is able to adopt a wide range of alternative conformations including strand-separated DNA and Z-DNA. Localized sequence-dependent structural transitions are important for the regulation of biological processes such as DNA replication and transcription. To directly probe the effect of sequence on structural transitions driven by torque, we have measured the torsional response of a panel of DNA sequences using single molecule assays that employ nanosphere rotational probes to achieve high torque resolution. The responses of Z-forming d(pGpC)n sequences match our predictions based on a theoretical treatment of cooperative transitions in helical polymers. “Bubble” templates containing 50–100 bp mismatch regions show cooperative structural transitions similar to B-DNA, although less torque is required to disrupt strand–strand interactions. Our mechanical measurements, including direct characterization of the torsional rigidity of strand-separated DNA, establish a framework for quantitative predictions of the complex torsional response of arbitrary sequences in their biological context. PMID:22474350

  16. Analysis of environmental 18S ribosomal RNA sequences reveals unknown diversity of the cosmopolitan phylum Telonemia.

    PubMed

    Shalchian-Tabrizi, Kamran; Kauserud, Håvard; Massana, Ramon; Klaveness, Dag; Jakobsen, Kjetill S

    2007-04-01

    Telonemia has recently been described as a new eukaryotic phylum with uncertain evolutionary origin. So far, only two Telonemia species, Telonema subtilis and Telonema antarcticum, have been described, but there are substantial variations in size and morphology among Telonema isolates and field observations, indicating a hidden diversity of Telonemia-like species and populations. In this study, we investigated the diversity and the global distribution of this group by analyzing 18S rDNA sequences from marine environmental clone libraries published in GenBank as well as several unpublished sequences from the Indian Ocean. Phylogenetic analyses of the identified sequences suggest that the Telonemia phylum includes several undescribed 18S rDNA phylotypes, probably corresponding to a number of different species and/or populations. The Telonemia phylotypes form two main groups, here referred to as Telonemia Groups 1 and 2. Some of the closely related sequences originate from separate oceans, indicating worldwide distributions of various Telonemia phylotypes, while other phylotypes seem to have limited geographical distribution. Further investigations of the evolutionary relationships within Telonemia should be conducted on isolated cultures of Telonema-like strains using multi-locus sequencing and morphological data. PMID:17196879

  17. Forward Genetics by Genome Sequencing Reveals That Rapid Cyanide Release Deters Insect Herbivory of Sorghum bicolor

    PubMed Central

    Krothapalli, Kartikeya; Buescher, Elizabeth M.; Li, Xu; Brown, Elliot; Chapple, Clint; Dilkes, Brian P.; Tuinstra, Mitchell R.

    2013-01-01

    Whole genome sequencing has allowed rapid progress in the application of forward genetics in model species. In this study, we demonstrated an application of next-generation sequencing for forward genetics in a complex crop genome. We sequenced an ethyl methanesulfonate-induced mutant of Sorghum bicolor defective in hydrogen cyanide release and identified the causal mutation. A workflow identified the causal polymorphism relative to the reference BTx623 genome by integrating data from single nucleotide polymorphism identification, prior information about candidate gene(s) implicated in cyanogenesis, mutation spectra, and polymorphisms likely to affect phenotypic changes. A point mutation resulting in a premature stop codon in the coding sequence of dhurrinase2, which encodes a protein involved in the dhurrin catabolic pathway, was responsible for the acyanogenic phenotype. Cyanogenic glucosides are not cyanogenic compounds but their cyanohydrins derivatives do release cyanide. The mutant accumulated the glucoside, dhurrin, but failed to efficiently release cyanide upon tissue disruption. Thus, we tested the effects of cyanide release on insect herbivory in a genetic background in which accumulation of cyanogenic glucoside is unchanged. Insect preference choice experiments and herbivory measurements demonstrate a deterrent effect of cyanide release capacity, even in the presence of wild-type levels of cyanogenic glucoside accumulation. Our gene cloning method substantiates the value of (1) a sequenced genome, (2) a strongly penetrant and easily measurable phenotype, and (3) a workflow to pinpoint a causal mutation in crop genomes and accelerate in the discovery of gene function in the postgenomic era. PMID:23893483

  18. The Large Mitochondrial Genome of Symbiodinium minutum Reveals Conserved Noncoding Sequences between Dinoflagellates and Apicomplexans.

    PubMed

    Shoguchi, Eiichi; Shinzato, Chuya; Hisata, Kanako; Satoh, Nori; Mungpakdee, Sutada

    2015-08-01

    Even though mitochondrial genomes, which characterize eukaryotic cells, were first discovered more than 50 years ago, mitochondrial genomics remains an important topic in molecular biology and genome sciences. The Phylum Alveolata comprises three major groups (ciliates, apicomplexans, and dinoflagellates), the mitochondrial genomes of which have diverged widely. Even though the gene content of dinoflagellate mitochondrial genomes is reportedly comparable to that of apicomplexans, the highly fragmented and rearranged genome structures of dinoflagellates have frustrated whole genomic analysis. Consequently, noncoding sequences and gene arrangements of dinoflagellate mitochondrial genomes have not been well characterized. Here we report that the continuous assembled genome (∼326 kb) of the dinoflagellate, Symbiodinium minutum, is AT-rich (∼64.3%) and that it contains three protein-coding genes. Based upon in silico analysis, the remaining 99% of the genome comprises transcriptomic noncoding sequences. RNA edited sites and unique, possible start and stop codons clarify conserved regions among dinoflagellates. Our massive transcriptome analysis shows that almost all regions of the genome are transcribed, including 27 possible fragmented ribosomal RNA genes and 12 uncharacterized small RNAs that are similar to mitochondrial RNA genes of the malarial parasite, Plasmodium falciparum. Gene map comparisons show that gene order is only slightly conserved between S. minutum and P. falciparum. However, small RNAs and intergenic sequences share sequence similarities with P. falciparum, suggesting that the function of noncoding sequences has been preserved despite development of very different genome structures.

  19. The Large Mitochondrial Genome of Symbiodinium minutum Reveals Conserved Noncoding Sequences between Dinoflagellates and Apicomplexans

    PubMed Central

    Shoguchi, Eiichi; Shinzato, Chuya; Hisata, Kanako; Satoh, Nori; Mungpakdee, Sutada

    2015-01-01

    Even though mitochondrial genomes, which characterize eukaryotic cells, were first discovered more than 50 years ago, mitochondrial genomics remains an important topic in molecular biology and genome sciences. The Phylum Alveolata comprises three major groups (ciliates, apicomplexans, and dinoflagellates), the mitochondrial genomes of which have diverged widely. Even though the gene content of dinoflagellate mitochondrial genomes is reportedly comparable to that of apicomplexans, the highly fragmented and rearranged genome structures of dinoflagellates have frustrated whole genomic analysis. Consequently, noncoding sequences and gene arrangements of dinoflagellate mitochondrial genomes have not been well characterized. Here we report that the continuous assembled genome (∼326 kb) of the dinoflagellate, Symbiodinium minutum, is AT-rich (∼64.3%) and that it contains three protein-coding genes. Based upon in silico analysis, the remaining 99% of the genome comprises transcriptomic noncoding sequences. RNA edited sites and unique, possible start and stop codons clarify conserved regions among dinoflagellates. Our massive transcriptome analysis shows that almost all regions of the genome are transcribed, including 27 possible fragmented ribosomal RNA genes and 12 uncharacterized small RNAs that are similar to mitochondrial RNA genes of the malarial parasite, Plasmodium falciparum. Gene map comparisons show that gene order is only slightly conserved between S. minutum and P. falciparum. However, small RNAs and intergenic sequences share sequence similarities with P. falciparum, suggesting that the function of noncoding sequences has been preserved despite development of very different genome structures. PMID:26199191

  20. Draft Genome Sequence of the Butyric Acid Producer Clostridium tyrobutyricum Strain CIP I-776 (IFP923)

    PubMed Central

    Clément, Benjamin; Lopes Ferreira, Nicolas

    2016-01-01

    Here, we report the draft genome sequence of Clostridium tyrobutyricum CIP I-776 (IFP923), an efficient producer of butyric acid. The genome consists of a single chromosome of 3.19 Mb and provides useful data concerning the metabolic capacities of the strain. PMID:26941139

  1. Amino acid sequence of the encephalitogenic basic protein from human myelin

    PubMed Central

    Carnegie, P. R.

    1971-01-01

    Myelin from the central nervous system contains an unusual basic protein, which can induce experimental autoimmune encephalomyelitis. The basic protein from human brain was digested with trypsin and other enzymes and the sequence of the 170 amino acids was determined. The localization of the encephalitogenic determinants was described. Possible roles for the protein in the structure and function of myelin are discussed. PMID:4108501

  2. Bovine thrombospondin-2: complete complementary deoxyribonucleic acid sequence and immunolocalization in the external zones of the adrenal cortex.

    PubMed

    Danik, M; Chinn, A M; Lafeuillade, B; Keramidas, M; Aguesse-Germon, S; Penhoat, A; Chen, H; Mosher, D F; Chambaz, E M; Feige, J J

    1999-06-01

    Given the variety of biological functions in the adrenal cortex that are controlled by ACTH, we hypothesized that some extracellular proteins act as biological relays for this systemic hormone. One candidate protein [corticotropin-induced secreted protein (CISP)] was purified from the conditioned medium of bovine adrenocortical cells on the basis of a 5- to 14-fold increase in its synthesis after the addition of ACTH. We report here the cloning of overlapping complementary DNAs that span the sequence encoding the full-length protein (1170 amino acids). The deduced CISP protein sequence is 89% identical to that of human thrombospondin-2 (TSP2), but only 61% identical to that of bovine TSP1, confirming that CISP is the bovine ortholog of TSP2. The bovine TSP2 sequence aligned perfectly with human, mouse, and chicken TSP2 sequences, except for a gap of 2 amino acids located in a linker region. All 58 cysteine residues that are conserved in other species were present in the bovine sequence as well as most of the functional domains. Most endocrine tissues (adrenal cortex, testis, ovary, and placenta) appeared to express TSP2, as determined by Western blot analysis. The highest levels of TSP2 protein were found in the adrenal cortex, followed by the heart, spleen, brain, and kidney. A differential extent of N-glycosylation or tissular proteolytic maturation may be responsible for the mol wt differences observed between bovine TSP2 detected in the medium from primary cultures and that in fresh tissue extracts. The immunohistochemical analysis of the distribution of TSP2 in the bovine adrenal gland revealed that the protein is much more abundant in the external zones (zona glomerulosa and zona fasciculata) than in the internal reticularis zone, a pattern similar to that reported for ACTH receptors. This distribution clearly suggests that TSP2 is a candidate relay protein for a subset of ACTH actions in the adrenal cortex. PMID:10342868

  3. Sequence-specific formation of d-amino acids in a monoclonal antibody during light exposure.

    PubMed

    Mozziconacci, Olivier; Schöneich, Christian

    2014-11-01

    The photoirradiation of a monoclonal antibody 1 (mAb1) at λ = 254 nm and λmax = 305 nm resulted in the sequence-specific generation of d-Val, d-Tyr, and potentially d-Ala and d-Arg, in the heavy chain sequence [95-101] YCARVVY. d-Amino acid formation is most likely the product of reversible intermediary carbon-centered radical formation at the (α)C-positions of the respective amino acids ((α)C(•) radicals) through the action of Cys thiyl radicals (CysS(•)). The latter can be generated photochemically either through direct homolysis of cystine or through photoinduced electron transfer from Trp and/or Tyr residues. The potential of mAb1 sequences to undergo epimerization was first evaluated through covalent H/D exchange during photoirradiation in D2O, and proteolytic peptides exhibiting deuterium incorporation were monitored by HPLC-MS/MS analysis. Subsequently, mAb1 was photoirradiated in H2O, and peptides, for which deuterium incorporation in D2O had been documented, were purified by HPLC and subjected to hydrolysis and amino acid analysis. Importantly, not all peptide sequences which incorporated deuterium during photoirradiation in D2O also exhibited photoinduced d-amino acid formation. For example, the heavy chain sequence [12-18] VQPGGSL showed significant deuterium incorporation during photoirradiation in D2O, but no photoinduced formation of d-amino acids was detected. Instead this sequence contained ca. 22% d-Val in both a photoirradiated and a control sample. This observation could indicate that d-Val may have been generated either during production and/or storage or during sample preparation. While sample preparation did not lead to the formation of d-Val or other d-amino acids in the control sample for the heavy chain sequence [95-101] YCARVVY, we may have to consider that during hydrolysis N-terminal residues (such as in VQPGGSL) may be more prone to epimerization. We conclude that the photoinduced, radical-dependent formation of d-amino acids

  4. Whole genome sequencing reveals extensive community-level transmission of group A Streptococcus in remote communities.

    PubMed

    Bowen, A C; Harris, T; Holt, D C; Giffard, P M; Carapetis, J R; Campbell, P T; McVERNON, J; Tong, S Y C

    2016-07-01

    Impetigo is common in remote Indigenous children of northern Australia, with the primary driver in this context being Streptococcus pyogenes [or group A Streptococcus (GAS)]. To reduce the high burden of impetigo, the transmission dynamics of GAS must be more clearly elucidated. We performed whole genome sequencing on 31 GAS isolates collected in a single community from children in 11 households with ⩾2 GAS-infected children. We aimed to determine whether transmission was occurring principally within households or across the community. The 31 isolates were represented by nine multilocus sequence types and isolates within each sequence type differed from one another by only 0-3 single nucleotide polymorphisms. There was evidence of extensive transmission both within households and across the community. Our findings suggest that strategies to reduce the burden of impetigo in this setting will need to extend beyond individual households, and incorporate multi-faceted, community-wide approaches. PMID:26833141

  5. Genome sequence of Wickerhamomyces anomalus DSM 6766 reveals genetic basis of biotechnologically important antimicrobial activities.

    PubMed

    Schneider, Jessica; Rupp, Oliver; Trost, Eva; Jaenicke, Sebastian; Passoth, Volkmar; Goesmann, Alexander; Tauch, Andreas; Brinkrolf, Karina

    2012-05-01

    The ascomycetous yeast Wickerhamomyces anomalus (formerly Pichia anomala and Hansenula anomala) exhibits antimicrobial activities and flavoring features that are responsible for its frequent association with food, beverage and feed products. However, limited information on the genetic background of this yeast and its multiple capabilities are currently available. Here, we present the draft genome sequence of the neotype strain W. anomalus DSM 6766. On the basis of pyrosequencing, a de novo assembly of this strain resulted in a draft genome sequence with a total size of 25.47 Mbp. An automatic annotation using RAPYD generated 11 512 protein-coding sequences. This annotation provided the basis to analyse metabolic capabilities, phylogenetic relationships, as well as biotechnologically important features and yielded novel candidate genes of W. anomalus DSM 6766 coding for proteins participating in antimicrobial activities. PMID:22292503

  6. Synthetic long read sequencing reveals the composition and intraspecies diversity of the human microbiome

    PubMed Central

    Kuleshov, Volodymyr; Jiang, Chao; Zhou, Wenyu; Jahanbani, Fereshteh; Batzoglou, Serafim; Snyder, Michael

    2016-01-01

    Identifying bacterial strains in metagenome and microbiome samples using computational analyses of short-read sequence remains a difficult problem. Here, we present an analysis of a human gut microbiome using on Tru-seq synthetic long reads combined with new computational tools for metagenomic long-read assembly, variant-calling and haplotyping (Nanoscope and Lens). Our analysis identifies 178 bacterial species of which 51 were not found using short sequence reads alone. We recover bacterial contigs that comprise multiple operons, including 22 contigs of >1Mbp. Extensive intraspecies variation among microbial strains in the form of haplotypes that span up to hundreds of Kbp can be observed using our approach. Our method incorporates synthetic long-read sequencing technology with standard shotgun approaches to move towards rapid, precise and comprehensive analyses of metagenome and microbiome samples. PMID:26655498

  7. Whole genome sequencing reveals extensive community-level transmission of group A Streptococcus in remote communities.

    PubMed

    Bowen, A C; Harris, T; Holt, D C; Giffard, P M; Carapetis, J R; Campbell, P T; McVERNON, J; Tong, S Y C

    2016-07-01

    Impetigo is common in remote Indigenous children of northern Australia, with the primary driver in this context being Streptococcus pyogenes [or group A Streptococcus (GAS)]. To reduce the high burden of impetigo, the transmission dynamics of GAS must be more clearly elucidated. We performed whole genome sequencing on 31 GAS isolates collected in a single community from children in 11 households with ⩾2 GAS-infected children. We aimed to determine whether transmission was occurring principally within households or across the community. The 31 isolates were represented by nine multilocus sequence types and isolates within each sequence type differed from one another by only 0-3 single nucleotide polymorphisms. There was evidence of extensive transmission both within households and across the community. Our findings suggest that strategies to reduce the burden of impetigo in this setting will need to extend beyond individual households, and incorporate multi-faceted, community-wide approaches.

  8. The complete amino acid sequence of chitinase-B from the leaves of pokeweed (Phytolacca americana).

    PubMed

    Tanigawa, M; Yamagami, T; Funatsu, G

    1995-05-01

    The complete amino acid sequence of pokeweed leaf chitinase-B (PLC-B) has been determined by first sequencing all 19 tryptic peptides derived from the reduced and S-carboxymethylated (RCm-) PLC-B and then connecting them by analyzing the chymotryptic peptides from three fragments produced by cyanogen bromide cleavage of RCm-PLC-B. PLC-B consists of 274 amino acid residues and has a molecular mass of 29,473 Da. Six cysteine residues are linked by disulfide bonds between Cys20 and Cys67, Cys50 and Cys57, and Cys159 and Cys188. From 58-68% sequence homology of PLC-B with five class III chitinases, it was concluded that PLC-B is a basic class III chitinase.

  9. DNA Methylation Profiling at Single-Base Resolution Reveals Gestational Folic Acid Supplementation Influences the Epigenome of Mouse Offspring Cerebellum

    PubMed Central

    Barua, Subit; Kuizon, Salomon; Brown, W. Ted; Junaid, Mohammed A.

    2016-01-01

    It is becoming increasingly more evident that lifestyle, environmental factors, and maternal nutrition during gestation can influence the epigenome of the developing fetus and thus modulate the physiological outcome. Variations in the intake of maternal nutrients affecting one-carbon metabolism may influence brain development and exert long-term effects on the health of the progeny. In this study, we investigated whether supplementation with high maternal folic acid during gestation alters DNA methylation and gene expression in the cerebellum of mouse offspring. We used reduced representation bisulfite sequencing to analyze the DNA methylation profile at the single-base resolution level. The genome-wide DNA methylation analysis revealed that supplementation with higher maternal folic acid resulted in distinct methylation patterns (P < 0.05) of CpG and non-CpG sites in the cerebellum of offspring. Such variations of methylation and gene expression in the cerebellum of offspring were highly sex-specific, including several genes of the neuronal pathways. These findings demonstrate that alterations in the level of maternal folic acid during gestation can influence methylation and gene expression in the cerebellum of offspring. Such changes in the offspring epigenome may alter neurodevelopment and influence the functional outcome of neurologic and psychiatric diseases. PMID:27199632

  10. DNA Methylation Profiling at Single-Base Resolution Reveals Gestational Folic Acid Supplementation Influences the Epigenome of Mouse Offspring Cerebellum.

    PubMed

    Barua, Subit; Kuizon, Salomon; Brown, W Ted; Junaid, Mohammed A

    2016-01-01

    It is becoming increasingly more evident that lifestyle, environmental factors, and maternal nutrition during gestation can influence the epigenome of the developing fetus and thus modulate the physiological outcome. Variations in the intake of maternal nutrients affecting one-carbon metabolism may influence brain development and exert long-term effects on the health of the progeny. In this study, we investigated whether supplementation with high maternal folic acid during gestation alters DNA methylation and gene expression in the cerebellum of mouse offspring. We used reduced representation bisulfite sequencing to analyze the DNA methylation profile at the single-base resolution level. The genome-wide DNA methylation analysis revealed that supplementation with higher maternal folic acid resulted in distinct methylation patterns (P < 0.05) of CpG and non-CpG sites in the cerebellum of offspring. Such variations of methylation and gene expression in the cerebellum of offspring were highly sex-specific, including several genes of the neuronal pathways. These findings demonstrate that alterations in the level of maternal folic acid during gestation can influence methylation and gene expression in the cerebellum of offspring. Such changes in the offspring epigenome may alter neurodevelopment and influence the functional outcome of neurologic and psychiatric diseases. PMID:27199632

  11. [Classification of nucleotide sequences over their frequency dictionaries reveals a relation between the structure of sequences and taxonomy of their bearers].

    PubMed

    Gorban', A N; Popova, T G; Sadovskiĭ, M G

    2003-01-01

    Classification of 16S RNA sequences over their frequency dictionaries, both real ones, and transformed ones was studied. Two entities were considered to be close each other from the point of view of their structure, if their frequency dictionaries were close, in Eucledian metric. A transformation procedure of a frequency dictionary has been implemented that reveals the peculiarities of information structure of a nucleotide sequence. A comparative study of two classification developed over the real frequency dictionary vs. that one developed over the transformed frequency dictionary was carried out. The strong correlation is revealed between the classification and the taxonomy of 16S RNA bearer. For the classes isolated, the information valuable words were identified. These words are the main factors of a difference between the classes. The frequency dictionaries containing the words of the length 3 exhibit the best correlation between a class and a genus. A genus, as a rule, is included into the same class, and the exclusion are sporadic. A development of hierarchy classification over the transformed frequency dictionaries separated one or two taxonomy groups, as each stage of classification. The unexpectedly frequent, or contrary, unexpectedly rare occurred of words (of the length 3) in entities under consideration make the structure difference between the classes of the nucleotide sequences.

  12. Genotypic Resistance Tests Sequences Reveal the Role of Marginalized Populations in HIV-1 Transmission in Switzerland.

    PubMed

    Shilaih, Mohaned; Marzel, Alex; Yang, Wan Lin; Scherrer, Alexandra U; Schüpbach, Jörg; Böni, Jürg; Yerly, Sabine; Hirsch, Hans H; Aubert, Vincent; Cavassini, Matthias; Klimkait, Thomas; Vernazza, Pietro L; Bernasconi, Enos; Furrer, Hansjakob; Günthard, Huldrych F; Kouyos, Roger

    2016-01-01

    Targeting hard-to-reach/marginalized populations is essential for preventing HIV-transmission. A unique opportunity to identify such populations in Switzerland is provided by a database of all genotypic-resistance-tests from Switzerland, including both sequences from the Swiss HIV Cohort Study (SHCS) and non-cohort sequences. A phylogenetic tree was built using 11,127 SHCS and 2,875 Swiss non-SHCS sequences. Demographics were imputed for non-SHCS patients using a phylogenetic proximity approach. Factors associated with non-cohort outbreaks were determined using logistic regression. Non-B subtype (univariable odds-ratio (OR): 1.9; 95% confidence interval (CI): 1.8-2.1), female gender (OR: 1.6; 95% CI: 1.4-1.7), black ethnicity (OR: 1.9; 95% CI: 1.7-2.1) and heterosexual transmission group (OR:1.8; 95% CI: 1.6-2.0), were all associated with underrepresentation in the SHCS. We found 344 purely non-SHCS transmission clusters, however, these outbreaks were small (median 2, maximum 7 patients) with a strong overlap with the SHCS'. 65% of non-SHCS sequences were part of clusters composed of >= 50% SHCS sequences. Our data suggests that marginalized-populations are underrepresented in the SHCS. However, the limited size of outbreaks among non-SHCS patients in-care implies that no major HIV outbreak in Switzerland was missed by the SHCS surveillance. This study demonstrates the potential of sequence data to assess and extend the scope of infectious-disease surveillance. PMID:27297284

  13. Genotypic Resistance Tests Sequences Reveal the Role of Marginalized Populations in HIV-1 Transmission in Switzerland

    PubMed Central

    Shilaih, Mohaned; Marzel, Alex; Yang, Wan Lin; Scherrer, Alexandra U.; Schüpbach, Jörg; Böni, Jürg; Yerly, Sabine; Hirsch, Hans H.; Aubert, Vincent; Cavassini, Matthias; Klimkait, Thomas; Vernazza, Pietro L.; Bernasconi, Enos; Furrer, Hansjakob; Günthard, Huldrych F.; Kouyos, Roger; Battegay, Manuel; Braun, Dominique; Bucher, Heiner; Burton-Jeangros, Claudine; Calmy, Alexandra; Dollenmaier, Günter; Egger, Matthias; Elzi, Luigia; Fehr, Jan; Fellay, Jaque; Fux, Christoph; Gorgievski, Meri; Haerry, David; Hasse, Barbara; Hoffmann, Matthias; Hösli, Irene; Kahlert, Christian; Kaiser, Laurent; Keiser, Olivia; Kovari, Helen; Ledergerber, Bruno; Martinetti, Gladys; de Tejada, Begoña Martinez; Marzolini, Catia; Metzner, Karin; Müller, Nicolas; Nadal, David; Nicca, Dunja; Pantaleo, Giuseppe; Rauch, Andre; Regenass, Stephan; Rudin, Christoph; Schöni-Affolter, Franziska; Schmid, Patrick; Speck, Roberto; Stöckle, Marcel; Tarr, Philip; Trkola, Alexandra; Weber, Reiner

    2016-01-01

    Targeting hard-to-reach/marginalized populations is essential for preventing HIV-transmission. A unique opportunity to identify such populations in Switzerland is provided by a database of all genotypic-resistance-tests from Switzerland, including both sequences from the Swiss HIV Cohort Study (SHCS) and non-cohort sequences. A phylogenetic tree was built using 11,127 SHCS and 2,875 Swiss non-SHCS sequences. Demographics were imputed for non-SHCS patients using a phylogenetic proximity approach. Factors associated with non-cohort outbreaks were determined using logistic regression. Non-B subtype (univariable odds-ratio (OR): 1.9; 95% confidence interval (CI): 1.8–2.1), female gender (OR: 1.6; 95% CI: 1.4–1.7), black ethnicity (OR: 1.9; 95% CI: 1.7–2.1) and heterosexual transmission group (OR:1.8; 95% CI: 1.6–2.0), were all associated with underrepresentation in the SHCS. We found 344 purely non-SHCS transmission clusters, however, these outbreaks were small (median 2, maximum 7 patients) with a strong overlap with the SHCS’. 65% of non-SHCS sequences were part of clusters composed of >= 50% SHCS sequences. Our data suggests that marginalized-populations are underrepresented in the SHCS. However, the limited size of outbreaks among non-SHCS patients in-care implies that no major HIV outbreak in Switzerland was missed by the SHCS surveillance. This study demonstrates the potential of sequence data to assess and extend the scope of infectious-disease surveillance. PMID:27297284

  14. Re-sequencing of a virulent strain of Campylobacter jejuni NCTC11168 reveals potential virulence factors.

    PubMed

    Cooper, Kerry K; Cooper, Margarethe A; Zuccolo, Andrea; Joens, Lynn A

    2013-01-01

    In vitro passage of Campylobacter jejuni strains results in phenotypic changes and a general loss of virulence, as is the case with the genome-sequenced strain C. jejuni NCTC11168. Re-sequencing of a virulent strain of NCTC11168 identified 41 SNPs or indels involving 20 genes, four intergenic regions and three pseudogenes. The genes include six motility genes, two chemotaxis genes, three hypothetical genes and a capsule biosynthesis gene, which might have a critical role in C. jejuni virulence. Additionally, we found an insertion in both Cj0676 and Cj1470c, pseudogenes in avirulent NCTC11168, but functional proteins in virulent NCTC11168.

  15. Microbial Analysis of Arctic Snow and Frost Flowers: What Next Generation Sequencing Method Can Reveal

    NASA Astrophysics Data System (ADS)

    Mortazavi, R.; Attiya, S.; Ariya, P. A.

    2014-12-01

    We herein examined and identified the population of the microbial communities of Arctic snow types and frost flower during the spring 2009 campaign of the Ocean-Atmosphere-Sea Ice-Snowpack (OASIS) program in Barrow, Alaska, USA. In addition to conventional microbial identification techniques (culture-isolation-PCR amplification-sequencing) we deployed a state-of-the-art genomic Next Generation Sequencing (NGS) technique to examine the true bacterial communities in Arctic samples. Our results have indicated that diverse community of microbial exists in Arctic with many originating from distinct ecological environment. The alterations observed in the texture of Arctic samples by microbial has further signified their importance in ecosystem.

  16. Pyruvate decarboxylase from Pisum sativum. Properties, nucleotide and amino acid sequences.

    PubMed

    Mücke, U; Wohlfarth, T; Fiedler, U; Bäumlein, H; Rücknagel, K P; König, S

    1996-04-15

    To study the molecular structure and function of pyruvate decarboxylase (PDC) from plants the protein was isolated from pea seeds and partially characterised. The active enzyme which occurs in the form of higher oligomers consists of two different subunits appearing in SDS/PAGE and mass spectroscopy experiments. For further experiments, like X-ray crystallography, it was necessary to elucidate the protein sequence. Partial cDNA clones encoding pyruvate decarboxylase from seeds of Pisum sativum cv. Miko have been obtained by means of polymerase chain reaction techniques. The first sequences were found using degenerate oligonucleotide primers designated according to conserved amino acid sequences of known pyruvate decarboxylases. The missing parts of one cDNA were amplified applying the 3'- and 5'-rapid amplification of cDNA ends systems. The amino acid sequence deduced from the entire cDNA sequence displays strong similarity to pyruvate decarboxylases from other organisms, especially from plants. A molecular mass of 64 kDa was calculated for this protein correlating with estimations for the smaller subunit of the oligomeric enzyme. The PCR experiments led to at least three different clones representing the middle part of the PDC cDNA indicating the existence of three isozymes. Two of these isoforms could be confirmed on the protein level by sequencing tryptic peptides. Only anaerobically treated roots showed a positive signal for PDC mRNA in Northern analysis although the cDNA from imbibed seeds was successfully used for PCR.

  17. Allelic polymorphism in arabian camel ribonuclease and the amino acid sequence of bactrian camel ribonuclease.

    PubMed

    Welling, G W; Mulder, H; Beintema, J J

    1976-04-01

    Pancreatic ribonucleases from several species (whitetail deer, roe deer, guinea pig, and arabian camel) exhibit more than one amino acid at particular positions in their amino acid sequences. Since these enzymes were isolated from pooled pancreas, the origin of this heterogeneity is not clear. The pancreatic ribonucleases from 11 individual arabian camels (Camelus dromedarius) have been investigated with respect to the lysine-glutamine heterogeneity at position 103 (Welling et al., 1975). Six ribonucleases showed only one basic band and five showed two bands after polyacrylamide gel electrophoresis, suggesting a gene frequency of about 0.75 for the Lys gene and about 0.25 for the Gln gene. The amino acid sequence of bactrian camel (Camelus bactrianus) ribonuclease isolated from individual pancreatic tissue was determined and compared with that of arabian camel ribonuclease. The only difference was observed at position 103. In the ribonucleases from two unrelated bactrian camels, only glutamine was observed at that position. PMID:962846

  18. A Possible Mechanism of Zika Virus Associated Microcephaly: Imperative Role of Retinoic Acid Response Element (RARE) Consensus Sequence Repeats in the Viral Genome.

    PubMed

    Kumar, Ashutosh; Singh, Himanshu N; Pareek, Vikas; Raza, Khursheed; Dantham, Subrahamanyam; Kumar, Pavan; Mochan, Sankat; Faiq, Muneeb A

    2016-01-01

    Owing to the reports of microcephaly as a consistent outcome in the fetuses of pregnant women infected with ZIKV in Brazil, Zika virus (ZIKV)-microcephaly etiomechanistic relationship has recently been implicated. Researchers, however, are still struggling to establish an embryological basis for this interesting causal handcuff. The present study reveals robust evidence in favor of a plausible ZIKV-microcephaly cause-effect liaison. The rationale is based on: (1) sequence homology between ZIKV genome and the response element of an early neural tube developmental marker "retinoic acid" in human DNA and (2) comprehensive similarities between the details of brain defects in ZIKV-microcephaly and retinoic acid embryopathy. Retinoic acid is considered as the earliest factor for regulating anteroposterior axis of neural tube and positioning of structures in developing brain through retinoic acid response elements (RARE) consensus sequence (5'-AGGTCA-3') in promoter regions of retinoic acid-dependent genes. We screened genomic sequences of already reported virulent ZIKV strains (including those linked to microcephaly) and other viruses available in National Institute of Health genetic sequence database (GenBank) for the RARE consensus repeats and obtained results strongly bolstering our hypothesis that ZIKV strains associated with microcephaly may act through precipitation of dysregulation in retinoic acid-dependent genes by introducing extra stretches of RARE consensus sequence repeats in the genome of developing brain cells. Additional support to our hypothesis comes from our findings that screening of other viruses for RARE consensus sequence repeats is positive only for those known to display neurotropism and cause fetal brain defects (for which maternal-fetal transmission during developing stage may be required). The numbers of RARE sequence repeats appeared to match with the virulence of screened positive viruses. Although, bioinformatic evidence and embryological

  19. A Possible Mechanism of Zika Virus Associated Microcephaly: Imperative Role of Retinoic Acid Response Element (RARE) Consensus Sequence Repeats in the Viral Genome.

    PubMed

    Kumar, Ashutosh; Singh, Himanshu N; Pareek, Vikas; Raza, Khursheed; Dantham, Subrahamanyam; Kumar, Pavan; Mochan, Sankat; Faiq, Muneeb A

    2016-01-01

    Owing to the reports of microcephaly as a consistent outcome in the fetuses of pregnant women infected with ZIKV in Brazil, Zika virus (ZIKV)-microcephaly etiomechanistic relationship has recently been implicated. Researchers, however, are still struggling to establish an embryological basis for this interesting causal handcuff. The present study reveals robust evidence in favor of a plausible ZIKV-microcephaly cause-effect liaison. The rationale is based on: (1) sequence homology between ZIKV genome and the response element of an early neural tube developmental marker "retinoic acid" in human DNA and (2) comprehensive similarities between the details of brain defects in ZIKV-microcephaly and retinoic acid embryopathy. Retinoic acid is considered as the earliest factor for regulating anteroposterior axis of neural tube and positioning of structures in developing brain through retinoic acid response elements (RARE) consensus sequence (5'-AGGTCA-3') in promoter regions of retinoic acid-dependent genes. We screened genomic sequences of already reported virulent ZIKV strains (including those linked to microcephaly) and other viruses available in National Institute of Health genetic sequence database (GenBank) for the RARE consensus repeats and obtained results strongly bolstering our hypothesis that ZIKV strains associated with microcephaly may act through precipitation of dysregulation in retinoic acid-dependent genes by introducing extra stretches of RARE consensus sequence repeats in the genome of developing brain cells. Additional support to our hypothesis comes from our findings that screening of other viruses for RARE consensus sequence repeats is positive only for those known to display neurotropism and cause fetal brain defects (for which maternal-fetal transmission during developing stage may be required). The numbers of RARE sequence repeats appeared to match with the virulence of screened positive viruses. Although, bioinformatic evidence and embryological

  20. Ecophysiology of Thioploca ingrica as revealed by the complete genome sequence supplemented with proteomic evidence.

    PubMed

    Kojima, Hisaya; Ogura, Yoshitoshi; Yamamoto, Nozomi; Togashi, Tomoaki; Mori, Hiroshi; Watanabe, Tomohiro; Nemoto, Fumiko; Kurokawa, Ken; Hayashi, Tetsuya; Fukui, Manabu

    2015-05-01

    Large sulfur-oxidizing bacteria, which accumulate a high concentration of nitrate, are important constituents of aquatic sediment ecosystems. No representative of this group has been isolated in pure culture, and only fragmented draft genome sequences are available for these microorganisms. In this study, we successfully reconstituted the genome of Thioploca ingrica from metagenomic sequences, thereby generating the first complete genome sequence from this group. The Thioploca samples for the metagenomic analysis were obtained from a freshwater lake in Japan. A PCR-free paired-end library was constructed from the DNA extracted from the samples and was sequenced on the Illumina MiSeq platform. By closing gaps within and between the scaffolds, we obtained a circular chromosome and a plasmid-like element. The reconstituted chromosome was 4.8 Mbp in length with a 41.2% GC content. A sulfur oxidation pathway identical to that suggested for the closest relatives of Thioploca was deduced from the reconstituted genome. A full set of genes required for respiratory nitrate reduction to dinitrogen gas was also identified. We further performed a proteomic analysis of the Thioploca sample and detected many enzymes/proteins involved in sulfur oxidation, nitrate respiration and inorganic carbon fixation as major components of the protein extracts from the sample, suggesting that these metabolic activities are strongly associated with the physiology of T. ingrica in lake sediment.

  1. Sequencing of diverse mandarin, pummelo and orange genomes reveals complex history of admixture during citrus domestication

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cultivated citrus are selections from, or hybrids of, wild progenitor species whose identities and contributions to citrus domestication remain controversial. Here we sequence and compare citrus genomes—a high-quality reference haploid clementine genome and mandarin, pummelo, sweet-orange and sour-o...

  2. Transcription profile of boar spermatozoa as revealed by RNA-sequencing

    Technology Transfer Automated Retrieval System (TEKTRAN)

    High-throughput RNA sequencing (RNA-Seq) overcomes the limitations of the current hybridization-based techniques to detect the actual pool of RNA transcripts in spermatozoa. The application of this technology in livestock can speed the discovery of potential predictors of male fertility. As a first ...

  3. Exome Sequencing Reveals Primary Immunodeficiencies in Children with Community-Acquired Pseudomonas aeruginosa Sepsis

    PubMed Central

    Asgari, Samira; McLaren, Paul J.; Peake, Jane; Wong, Melanie; Wong, Richard; Bartha, Istvan; Francis, Joshua R.; Abarca, Katia; Gelderman, Kyra A.; Agyeman, Philipp; Aebi, Christoph; Berger, Christoph; Fellay, Jacques; Schlapbach, Luregn J.; Posfay-Barbe, Klara

    2016-01-01

    One out of three pediatric sepsis deaths in high income countries occur in previously healthy children. Primary immunodeficiencies (PIDs) have been postulated to underlie fulminant sepsis, but this concept remains to be confirmed in clinical practice. Pseudomonas aeruginosa (P. aeruginosa) is a common bacterium mostly associated with health care-related infections in immunocompromised individuals. However, in rare cases, it can cause sepsis in previously healthy children. We used exome sequencing and bioinformatic analysis to systematically search for genetic factors underpinning severe P. aeruginosa infection in the pediatric population. We collected blood samples from 11 previously healthy children, with no family history of immunodeficiency, who presented with severe sepsis due to community-acquired P. aeruginosa bacteremia. Genomic DNA was extracted from blood or tissue samples obtained intravitam or postmortem. We obtained high-coverage exome sequencing data and searched for rare loss-of-function variants. After rigorous filtrations, 12 potentially causal variants were identified. Two out of eight (25%) fatal cases were found to carry novel pathogenic variants in PID genes, including BTK and DNMT3B. This study demonstrates that exome sequencing allows to identify rare, deleterious human genetic variants responsible for fulminant sepsis in apparently healthy children. Diagnosing PIDs in such patients is of high relevance to survivors and affected families. We propose that unusually severe and fatal sepsis cases in previously healthy children should be considered for exome/genome sequencing to search for underlying PIDs. PMID:27703454

  4. Transcriptomic sequencing reveals a set of unique genes activated by butyrate-induced histone modification

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Butyrate is a nutritional element with strong epigenetic regulatory activity as an inhibitor of histone deacetylases (HDACs). Based on the analysis of differentially expressed genes induced by butyrate in the bovine epithelial cell using deep RNA-sequencing technology (RNA-seq), a set of unique gen...

  5. Oil palm genome sequence reveals divergence of interfertile species in Old and New worlds.

    PubMed

    Singh, Rajinder; Ong-Abdullah, Meilina; Low, Eng-Ti Leslie; Manaf, Mohamad Arif Abdul; Rosli, Rozana; Nookiah, Rajanaidu; Ooi, Leslie Cheng-Li; Ooi, Siew-Eng; Chan, Kuang-Lim; Halim, Mohd Amin; Azizi, Norazah; Nagappan, Jayanthi; Bacher, Blaire; Lakey, Nathan; Smith, Steven W; He, Dong; Hogan, Michael; Budiman, Muhammad A; Lee, Ernest K; DeSalle, Rob; Kudrna, David; Goicoechea, Jose Luis; Wing, Rod A; Wilson, Richard K; Fulton, Robert S; Ordway, Jared M; Martienssen, Robert A; Sambanthamurthi, Ravigadevi

    2013-08-15

    Oil palm is the most productive oil-bearing crop. Although it is planted on only 5% of the total world vegetable oil acreage, palm oil accounts for 33% of vegetable oil and 45% of edible oil worldwide, but increased cultivation competes with dwindling rainforest reserves. We report the 1.8-gigabase (Gb) genome sequence of the African oil palm Elaeis guineensis, the predominant source of worldwide oil production. A total of 1.535 Gb of assembled sequence and transcriptome data from 30 tissue types were used to predict at least 34,802 genes, including oil biosynthesis genes and homologues of WRINKLED1 (WRI1), and other transcriptional regulators, which are highly expressed in the kernel. We also report the draft sequence of the South American oil palm Elaeis oleifera, which has the same number of chromosomes (2n = 32) and produces fertile interspecific hybrids with E. guineensis but seems to have diverged in the New World. Segmental duplications of chromosome arms define the palaeotetraploid origin of palm trees. The oil palm sequence enables the discovery of genes for important traits as well as somaclonal epigenetic alterations that restrict the use of clones in commercial plantings, and should therefore help to achieve sustainability for biofuels and edible oils, reducing the rainforest footprint of this tropical plantation crop.

  6. Reduced representation bisulphite sequencing of the ten bovine somatic tissues reveals DNA methylation patterns

    Technology Transfer Automated Retrieval System (TEKTRAN)

    As a major component epigenetics, DNA methylation has been proved that widely functions in individual development and various diseases. It has been well studied in model organisms and human but includes limited data for the economic animals. Using reduced representation bisulphite sequencing (RRBS),...

  7. Comment on "Protein sequences from mastodon and Tyrannosaurus rex revealed by mass spectrometry".

    PubMed

    Pevzner, Pavel A; Kim, Sangtae; Ng, Julio

    2008-08-22

    Asara et al. (Reports, 13 April 2007, p. 280) reported sequencing of Tyrannosaurus rex proteins and used them to establish the evolutionary relationships between birds and dinosaurs. We argue that the reported T. rex peptides may represent statistical artifacts and call for complete data release to enable experimental and computational verification of their findings.

  8. Whole-Genome Sequence of Stenotrophomonas maltophilia ZBG7B Reveals Its Biotechnological Potential

    PubMed Central

    Chong, Teik-Min; Adrian, Tan-Guan-Sheng; Kher, Heng Leong; Hong, Kar-Wai; Grandclément, Catherine; Faure, Denis; Yin, Wai-Fong; Dessaux, Yves

    2015-01-01

    Stenotrophomonas maltophilia ZBG7B was isolated from vineyard soil of Zellenberg, France. Here, we present the draft genome sequence of this bacterial strain, which has facilitated the prediction of function for several genes encoding biotechnologically important enzymes, such as xylosidase, xylanase, laccase, and chitinase. PMID:26659682

  9. Whole-genome sequencing reveals the diversity of cattle copy number variations and multicopy genes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Structural and functional impacts of copy number variations (CNVs) on livestock genomes are not yet well understood. We identified 1853 CNV regions using population-scale sequencing data generated from 75 cattle representing 8 breeds (Angus, Brahman, Gir, Holstein, Jersey, Limousin, Nelore, Romagnol...

  10. Population sequencing reveals breed and sub-species specific CNVs in cattle

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Individualized copy number variation (CNV) maps have highlighted the need for population surveys of cattle to detect rare and common variants. While SNP and comparative genomic hybridization (CGH) arrays have provided preliminary data, next-generation sequence (NGS) data analysis offers an increased...

  11. Population sequencing reveals breed and sub-species specific CNVs in cattle

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Individualized copy number variation (CNV) maps have highlighted the need for population surveys of cattle to detect the rare and common variants. While SNP and comparative genomic hybridization (CGH) arrays have provided preliminary data, next-generation sequence (NGS) data analysis offers an incre...

  12. Whole exome sequencing reveals concomitant mutations of multiple FA genes in individual Fanconi anemia patients

    PubMed Central

    2014-01-01

    Background Fanconi anemia (FA) is a rare inherited genetic syndrome with highly variable clinical manifestations. Fifteen genetic subtypes of FA have been identified. Traditional complementation tests for grouping studies have been used generally in FA patients and in stepwise methods to identify the FA type, which can result in incomplete genetic information from FA patients. Methods We diagnosed five pediatric patients with FA based on clinical manifestations, and we performed exome sequencing of peripheral blood specimens from these patients and their family members. The related sequencing data were then analyzed by bioinformatics, and the FANC gene mutations identified by exome sequencing were confirmed by PCR re-sequencing. Results Homozygous and compound heterozygous mutations of FANC genes were identified in all of the patients. The FA subtypes of the patients included FANCA, FANCM and FANCD2. Interestingly, four FA patients harbored multiple mutations in at least two FA genes, and some of these mutations have not been previously reported. These patients’ clinical manifestations were vastly different from each other, as were their treatment responses to androstanazol and prednisone. This finding suggests that heterozygous mutation(s) in FA genes could also have diverse biological and/or pathophysiological effects on FA patients or FA gene carriers. Interestingly, we were not able to identify de novo mutations in the genes implicated in DNA repair pathways when the sequencing data of patients were compared with those of their parents. Conclusions Our results indicate that Chinese FA patients and carriers might have higher and more complex mutation rates in FANC genes than have been conventionally recognized. Testing of the fifteen FANC genes in FA patients and their family members should be a regular clinical practice to determine the optimal care for the individual patient, to counsel the family and to obtain a better understanding of FA pathophysiology

  13. Combining genomic sequencing methods to explore viral diversity and reveal potential virus-host interactions.

    PubMed

    Chow, Cheryl-Emiliane T; Winget, Danielle M; White, Richard A; Hallam, Steven J; Suttle, Curtis A

    2015-01-01

    Viral diversity and virus-host interactions in oxygen-starved regions of the ocean, also known as oxygen minimum zones (OMZs), remain relatively unexplored. Microbial community metabolism in OMZs alters nutrient and energy flow through marine food webs, resulting in biological nitrogen loss and greenhouse gas production. Thus, viruses infecting OMZ microbes have the potential to modulate community metabolism with resulting feedback on ecosystem function. Here, we describe viral communities inhabiting oxic surface (10 m) and oxygen-starved basin (200 m) waters of Saanich Inlet, a seasonally anoxic fjord on the coast of Vancouver Island, British Columbia using viral metagenomics and complete viral fosmid sequencing on samples collected between April 2007 and April 2010. Of 6459 open reading frames (ORFs) predicted across all 34 viral fosmids, 77.6% (n = 5010) had no homology to reference viral genomes. These fosmids recruited a higher proportion of viral metagenomic sequences from Saanich Inlet than from nearby northeastern subarctic Pacific Ocean (Line P) waters, indicating differences in the viral communities between coastal and open ocean locations. While functional annotations of fosmid ORFs were limited, recruitment to NCBI's non-redundant "nr" database and publicly available single-cell genomes identified putative viruses infecting marine thaumarchaeal and SUP05 proteobacteria to provide potential host linkages with relevance to coupled biogeochemical cycling processes in OMZ waters. Taken together, these results highlight the power of coupled analyses of multiple sequence data types, such as viral metagenomic and fosmid sequence data with prokaryotic single cell genomes, to chart viral diversity, elucidate genomic and ecological contexts for previously unclassifiable viral sequences, and identify novel host interactions in natural and engineered ecosystems. PMID:25914678

  14. Combining genomic sequencing methods to explore viral diversity and reveal potential virus-host interactions.

    PubMed

    Chow, Cheryl-Emiliane T; Winget, Danielle M; White, Richard A; Hallam, Steven J; Suttle, Curtis A

    2015-01-01

    Viral diversity and virus-host interactions in oxygen-starved regions of the ocean, also known as oxygen minimum zones (OMZs), remain relatively unexplored. Microbial community metabolism in OMZs alters nutrient and energy flow through marine food webs, resulting in biological nitrogen loss and greenhouse gas production. Thus, viruses infecting OMZ microbes have the potential to modulate community metabolism with resulting feedback on ecosystem function. Here, we describe viral communities inhabiting oxic surface (10 m) and oxygen-starved basin (200 m) waters of Saanich Inlet, a seasonally anoxic fjord on the coast of Vancouver Island, British Columbia using viral metagenomics and complete viral fosmid sequencing on samples collected between April 2007 and April 2010. Of 6459 open reading frames (ORFs) predicted across all 34 viral fosmids, 77.6% (n = 5010) had no homology to reference viral genomes. These fosmids recruited a higher proportion of viral metagenomic sequences from Saanich Inlet than from nearby northeastern subarctic Pacific Ocean (Line P) waters, indicating differences in the viral communities between coastal and open ocean locations. While functional annotations of fosmid ORFs were limited, recruitment to NCBI's non-redundant "nr" database and publicly available single-cell genomes identified putative viruses infecting marine thaumarchaeal and SUP05 proteobacteria to provide potential host linkages with relevance to coupled biogeochemical cycling processes in OMZ waters. Taken together, these results highlight the power of coupled analyses of multiple sequence data types, such as viral metagenomic and fosmid sequence data with prokaryotic single cell genomes, to chart viral diversity, elucidate genomic and ecological contexts for previously unclassifiable viral sequences, and identify novel host interactions in natural and engineered ecosystems.

  15. The sequence of a subtilisin-type protease (aerolysin) from the hyperthermophilic archaeum Pyrobaculum aerophilum reveals sites important to thermostability.

    PubMed Central

    Völkl, P.; Markiewicz, P.; Stetter, K. O.; Miller, J. H.

    1994-01-01

    The hyperthermophilic archaeum Pyrobaculum aerophilum grows optimally at 100 degrees C and pH 7.0. Cell homogenates exhibit strong proteolytic activity within a temperature range of 80-130 degrees C. During an analysis of cDNA and genomic sequence tags, a genomic clone was recovered showing strong sequence homology to alkaline subtilisins of Bacillus sp. The total DNA sequence of the gene encoding the protease (named "aerolysin") was determined. Multiple sequence alignment with 15 different serine-type proteases showed greatest homology with subtilisins from gram-positive bacteria rather than archaeal or eukaryal serine proteases. Models of secondary and tertiary structure based on sequence alignments and the tertiary structures of subtilisin Carlsberg, BPN', thermitase, and protease K were generated for P. aerophilum subtilisin. This allowed identification of sites potentially contributing to the thermostability of the protein. One common transition put alanines at the beginning and end of surface alpha-helices. Aspartic acids were found at the N-terminus of several surface helices, possibly increasing stability by interacting with the helix dipole. Several of the substitutions in regions expected to form surface loops were adjacent to each other in the tertiary structure model. PMID:7987227

  16. Characterization of DNA-binding sequences for CcaR in the cephamycin-clavulanic acid supercluster of Streptomyces clavuligerus.

    PubMed

    Santamarta, I; López-García, M T; Kurt, A; Nárdiz, N; Alvarez-Álvarez, R; Pérez-Redondo, R; Martín, J F; Liras, P

    2011-08-01

    RT-PCR analysis of the genes in the clavulanic acid cluster revealed three transcriptional polycistronic units that comprised the ceaS2-bls2-pah2-cas2, cyp-fd-orf12-orf13 and oppA2-orf16 genes, whereas oat2, car, oppA1, claR, orf14, gcaS and pbpA were expressed as monocistronic transcripts. Quantitative RT-PCR of Streptomyces clavuligerus ATCC 27064 and the mutant S. clavuligerus ccaR::aph showed that, in the mutant, there was a 1000- to 10,000-fold lower transcript level for the ceaS2 to cas2 polycistronic transcript that encoded CeaS2, the first enzyme of the clavulanic acid pathway that commits arginine to clavulanic acid biosynthesis. Smaller decreases in expression were observed in the ccaR mutant for other genes in the cluster. Two-dimensional electrophoresis and MALDI-TOF analysis confirmed the absence in the mutant strain of proteins CeaS2, Bls2, Pah2 and Car that are required for clavulanic acid biosynthesis, and CefF and IPNS that are required for cephamycin biosynthesis. Gel shift electrophoresis using recombinant r-CcaR protein showed that it bound to the ceaS2 and claR promoter regions in the clavulanic acid cluster, and to the lat, cefF, cefD-cmcI and ccaR promoter regions in the cephamycin C gene cluster. Footprinting experiments indicated that triple heptameric conserved sequences were protected by r-CcaR, and allowed identification of heptameric sequences as CcaR binding sites.

  17. Molecular annotation of ketol-acid reductoisomerases from Streptomyces reveals a novel amino acid biosynthesis interlock mediated by enzyme promiscuity

    PubMed Central

    Verdel-Aranda, Karina; López-Cortina, Susana T; Hodgson, David A; Barona-Gómez, Francisco

    2015-01-01

    The 6-phosphogluconate dehydrogenase superfamily oxidize and reduce a wide range of substrates, making their functional annotation challenging. Ketol-acid reductoisomerase (KARI), encoded by the ilvC gene in branched-chain amino acids biosynthesis, is a promiscuous reductase enzyme within this superfamily. Here, we obtain steady-state enzyme kinetic parameters for 10 IlvC homologues from the genera Streptomyces and Corynebacterium, upon eight selected chemically diverse substrates, including some not normally recognized by enzymes of this superfamily. This biochemical data suggested a Streptomyces biosynthetic interlock between proline and the branched-chain amino acids, mediated by enzyme substrate promiscuity, which was confirmed via mutagenesis and complementation analyses of the proC, ilvC1 and ilvC2 genes in Streptomyces coelicolor. Moreover, both ilvC orthologues and paralogues were analysed, such that the relationship between gene duplication and functional diversification could be explored. The KARI paralogues present in S. coelicolor and Streptomyces lividans, despite their conserved high sequence identity (97%), were shown to be more promiscuous, suggesting a recent functional diversification. In contrast, the KARI paralogue from Streptomyces viridifaciens showed selectivity towards the synthesis of valine precursors, explaining its recruitment within the biosynthetic gene cluster of valanimycin. These results allowed us to assess substrate promiscuity indices as a tool to annotate new molecular functions with metabolic implications. PMID:25296650

  18. Nucleotide sequence of Crithidia fasciculata cytosol 5S ribosomal ribonucleic acid.

    PubMed

    MacKay, R M; Gray, M W; Doolittle, W F

    1980-11-11

    The complete nucleotide sequence of the cytosol 5S ribosomal ribonucleic acid of the trypanosomatid protozoan Crithidia fasciculata has been determined by a combination of T1-oligonucleotide catalog and gel sequencing techniques. The sequence is: GAGUACGACCAUACUUGAGUGAAAACACCAUAUCCCGUCCGAUUUGUGAAGUUAAGCACC CACAGGCUUAGUUAGUACUGAGGUCAGUGAUGACUCGGGAACCCUGAGUGCCGUACUCCCOH. This 5S ribosomal RNA is unique in having GAUU in place of the GAAC or GAUC found in all other prokaryotic and eukaryotic 5S RNAs, and thought to be involved in interactions with tRNAs. Comparisons to other eukaryotic cytosol 5S ribosomal RNA sequences indicate that the four major eukaryotic kingdoms (animals, plants, fungi, and protists) are about equally remote from each other, and that the latter kingdom may be the most internally diverse.

  19. Pattern recognition in nucleic acid sequences. II. An efficient method for finding locally stable secondary structures.

    PubMed Central

    Kanehisa, M I; Goad, W B

    1982-01-01

    We present a method for calculating all possible single hairpin loop secondary structures in a nucleic acid sequence by the order of N2 operations where N is the total number of bases. Each structure may contain any number of bulges and internal loops. Most natural sequences are found to be indistinguishable from random sequences in the potential of forming secondary structures, which is defined by the frequency of possible secondary structures calculated by the method. There is a strong correlation between the higher G+C content and the higher structure forming potential. Interestingly, the removal of intervening sequences in mRNAs is almost always accompanied by an increase in the G+C content, which may suggest an involvement of structural stabilization in the mRNA maturation. PMID:6174936

  20. Sequence-Based Screening for Rare Enzymes: New Insights into the World of AMDases Reveal a Conserved Motif and 58 Novel Enzymes Clustering in Eight Distinct Families

    PubMed Central

    Maimanakos, Janine; Chow, Jennifer; Gaßmeyer, Sarah K.; Güllert, Simon; Busch, Florian; Kourist, Robert; Streit, Wolfgang R.

    2016-01-01

    Arylmalonate Decarboxylases (AMDases, EC 4.1.1.76) are very rare and mostly underexplored enzymes. Currently only four known and biochemically characterized representatives exist. However, their ability to decarboxylate α-disubstituted malonic acid derivatives to optically pure products without cofactors makes them attractive and promising candidates for the use as biocatalysts in industrial processes. Until now, AMDases could not be separated from other members of the aspartate/glutamate racemase superfamily based on their gene sequences. Within this work, a search algorithm was developed that enables a reliable prediction of AMDase activity for potential candidates. Based on specific sequence patterns and screening methods 58 novel AMDase candidate genes could be identified in this work. Thereby, AMDases with the conserved sequence pattern of Bordetella bronchiseptica’s prototype appeared to be limited to the classes of Alpha-, Beta-, and Gamma-proteobacteria. Amino acid homologies and comparison of gene surrounding sequences enabled the classification of eight enzyme clusters. Particularly striking is the accumulation of genes coding for different transporters of the tripartite tricarboxylate transporters family, TRAP transporters and ABC transporters as well as genes coding for mandelate racemases/muconate lactonizing enzymes that might be involved in substrate uptake or degradation of AMDase products. Further, three novel AMDases were characterized which showed a high enantiomeric excess (>99%) of the (R)-enantiomer of flurbiprofen. These are the recombinant AmdA and AmdV from Variovorax sp. strains HH01 and HH02, originated from soil, and AmdP from Polymorphum gilvum found by a data base search. Altogether our findings give new insights into the class of AMDases and reveal many previously unknown enzyme candidates with high potential for bioindustrial processes. PMID:27610105

  1. Sequence-Based Screening for Rare Enzymes: New Insights into the World of AMDases Reveal a Conserved Motif and 58 Novel Enzymes Clustering in Eight Distinct Families.

    PubMed

    Maimanakos, Janine; Chow, Jennifer; Gaßmeyer, Sarah K; Güllert, Simon; Busch, Florian; Kourist, Robert; Streit, Wolfgang R

    2016-01-01

    Arylmalonate Decarboxylases (AMDases, EC 4.1.1.76) are very rare and mostly underexplored enzymes. Currently only four known and biochemically characterized representatives exist. However, their ability to decarboxylate α-disubstituted malonic acid derivatives to optically pure products without cofactors makes them attractive and promising candidates for the use as biocatalysts in industrial processes. Until now, AMDases could not be separated from other members of the aspartate/glutamate racemase superfamily based on their gene sequences. Within this work, a search algorithm was developed that enables a reliable prediction of AMDase activity for potential candidates. Based on specific sequence patterns and screening methods 58 novel AMDase candidate genes could be identified in this work. Thereby, AMDases with the conserved sequence pattern of Bordetella bronchiseptica's prototype appeared to be limited to the classes of Alpha-, Beta-, and Gamma-proteobacteria. Amino acid homologies and comparison of gene surrounding sequences enabled the classification of eight enzyme clusters. Particularly striking is the accumulation of genes coding for different transporters of the tripartite tricarboxylate transporters family, TRAP