Science.gov

Sample records for acid synthase genes

  1. Isolation and partial characterization of the gene for goose fatty acid synthase.

    PubMed

    Kameda, K; Goodridge, A G

    1991-01-01

    Fatty acid synthase is regulated by diet and hormones, with regulation being primarily transcriptional. In chick embryo hepatocytes in culture, triiodothyronine stimulates accumulation of enzyme and transcription of the gene. Since the 5'-flanking region of this gene is likely involved in hormonal regulation of its expression, we have isolated and partially characterized an avian fatty acid synthase gene. A genomic DNA library was constructed in a cosmid vector and screened with cDNA clones that contained sequence complementary to the 3' end of goose fatty acid synthase mRNA. A genomic clone (approximately 35 kilobase pairs (kb] was isolated, and a 6.5-kb EcoRI fragment thereof contained DNA complementary to the 3' noncoding region of fatty acid synthase mRNA. Additional cosmid libraries were screened with 5' fragments of previously isolated genomic clones, resulting in the isolation of five overlapping cosmid DNAs. The entire region of cloned DNA spans approximately 105 kb. Exon-containing fragments were identified by hybridization with end-labeled poly(A)+ RNA and by hybridization of labeled exon-containing genomic DNA fragments to fatty acid synthase mRNA. A new set of cDNA clones spanning approximately 3.2 kb was isolated from a lambda-ZAP goose liver cDNA library using the 5'-most exon-containing fragment of the 5'-most genomic DNA clone. This region of mRNA contains a 5'-untranslated sequence and a continuous open reading frame which includes a region that codes for the essential cysteine of the beta-ketoacyl synthase domain. The entire fatty acid synthase gene spans about 50 kb. The 5' 15 kb of the gene contain 7 exons. S1 nuclease and primer extension analyses were used to identify a single site for initiation of transcription, 174 nucleotides upstream from the putative translation initiation codon. Putative "TATA" and "CCAAT" boxes are located 28 and 60 base pairs (bp), respectively, upstream of the site of initiation of transcription. The 5'-flanking 597

  2. Isolation and molecular characterization of 1-aminocyclopropane-1-carboxylic acid synthase genes in Hevea brasiliensis.

    PubMed

    Zhu, Jia-Hong; Xu, Jing; Chang, Wen-Jun; Zhang, Zhi-Li

    2015-01-01

    Ethylene is an important factor that stimulates Hevea brasiliensis to produce natural rubber. 1-Aminocyclopropane-1-carboxylic acid synthase (ACS) is a rate-limiting enzyme in ethylene biosynthesis. However, knowledge of the ACS gene family of H. brasiliensis is limited. In this study, nine ACS-like genes were identified in H. brasiliensis. Sequence and phylogenetic analysis results confirmed that seven isozymes (HbACS1-7) of these nine ACS-like genes were similar to ACS isozymes with ACS activity in other plants. Expression analysis results showed that seven ACS genes were differentially expressed in roots, barks, flowers, and leaves of H. brasiliensis. However, no or low ACS gene expression was detected in the latex of H. brasiliensis. Moreover, seven genes were differentially up-regulated by ethylene treatment. These results provided relevant information to help determine the functions of the ACS gene in H. brasiliensis, particularly the functions in regulating ethylene stimulation of latex production. PMID:25690030

  3. Deletion of a Chitin Synthase Gene in a Citric Acid Producing Strain of Aspergillus niger

    SciTech Connect

    Rinker, Torri E.; Baker, Scott E.

    2007-01-29

    Citric acid production by the filamentous fungus Aspergillus niger is carried out in a process that causes the organism to drastically alter its morphology. This altered morphology includes hyphal swelling and highly limited polar growth resulting in clumps of swollen cells that eventually aggregate into pellets of approximately 100 microns in diameter. In this pelleted form, A. niger has increased citric acid production as compared to growth in filamentous form. Chitin is a crucial component of the cell wall of filamentous fungi. Alterations in the deposition or production of chitin may have profound effects on the morphology of the organism. In order to study the role of chitin synthesis in pellet formation we have deleted a chitin synthase gene (csmA) in Aspergillus niger strain ATCC 11414 using a PCR based deletion construct. This class of chitin synthases is only found in filamentous fungi and is not present in yeasts. The csmA genes contain a myosin motor domain at the N-terminus and a chitin synthesis domain at the C-terminus. They are believed to contribute to the specialized polar growth observed in filamentous fungi that is lacking in yeasts. The csmA deletion strain (csmAΔ) was subjected to minimal media with and without osmotic stabilizers as well as tested in citric acid production media. Without osmotic stabilizers, the mutant germlings were abnormally swollen, primarily in the subapical regions, and contained large vacuoles. However, this swelling is ultimately not inhibitory to growth as the germlings are able to recover and undergo polar growth. Colony formation was largely unaffected in the absence of osmotic stabilizers. In citric acid production media csmAΔ was observed to have a 2.5 fold increase in citric acid production. The controlled expression of this class of chitin synthases may be useful for improving production of organic acids in filamentous fungi.

  4. The gene controlling marijuana psychoactivity: molecular cloning and heterologous expression of Delta1-tetrahydrocannabinolic acid synthase from Cannabis sativa L.

    PubMed

    Sirikantaramas, Supaart; Morimoto, Satoshi; Shoyama, Yoshinari; Ishikawa, Yu; Wada, Yoshiko; Shoyama, Yukihiro; Taura, Futoshi

    2004-09-17

    Delta(1)-tetrahydrocannabinolic acid (THCA) synthase is the enzyme that catalyzes oxidative cyclization of cannabigerolic acid into THCA, the precursor of Delta(1)-tetrahydrocannabinol. We cloned a novel cDNA (GenBank trade mark accession number AB057805) encoding THCA synthase by reverse transcription and polymerase chain reactions from rapidly expanding leaves of Cannabis sativa. This gene consists of a 1635-nucleotide open reading frame, encoding a 545-amino acid polypeptide of which the first 28 amino acid residues constitute the signal peptide. The predicted molecular weight of the 517-amino acid mature polypeptide is 58,597 Da. Interestingly, the deduced amino acid sequence exhibited high homology to berberine bridge enzyme from Eschscholtzia californica, which is involved in alkaloid biosynthesis. The liquid culture of transgenic tobacco hairy roots harboring the cDNA produced THCA upon feeding of cannabigerolic acid, demonstrating unequivocally that this gene encodes an active THCA synthase. Overexpression of the recombinant THCA synthase was achieved using a baculovirus-insect expression system. The purified recombinant enzyme contained covalently attached FAD cofactor at a molar ratio of FAD to protein of 1:1. The mutant enzyme constructed by changing His-114 of the wild-type enzyme to Ala-114 exhibited neither absorption characteristics of flavoproteins nor THCA synthase activity. Thus, we concluded that the FAD binding residue is His-114 and that the THCA synthase reaction is FAD-dependent. This is the first report on molecular characterization of an enzyme specific to cannabinoid biosynthesis. PMID:15190053

  5. Intron-exon organization of the gene for the multifunctional animal fatty acid synthase.

    PubMed Central

    Amy, C M; Williams-Ahlf, B; Naggert, J; Smith, S

    1992-01-01

    The complete intron-exon organization of the gene encoding a multifunctional mammalian fatty acid synthase has been elucidated, and specific exons have been assigned to coding sequences for the component domains of the protein. The rat gene is interrupted by 42 introns and the sequences bordering the splice-site junctions universally follow the GT/AG rule. However, of the 41 introns that interrupt the coding region of the gene, 23 split the reading frame in phase I, 14 split the reading frame in phase 0, and only 4 split the reading frame in phase II. Remarkably, 46% of the introns interrupt codons for glycine. With only one exception, boundaries between the constituent enzymes of the multifunctional polypeptide coincide with the location of introns in the gene. The significance of the predominance of phase I introns, the almost uniformly short length of the 42 introns and the overall small size of the gene, is discussed in relation to the evolution of multifunctional proteins. Images PMID:1736293

  6. Cellulose production and cellulose synthase gene detection in acetic acid bacteria.

    PubMed

    Valera, Maria José; Torija, Maria Jesús; Mas, Albert; Mateo, Estibaliz

    2015-02-01

    The ability of acetic acid bacteria (AAB) to produce cellulose has gained much industrial interest due to the physical and chemical characteristics of bacterial cellulose. The production of cellulose occurs in the presence of oxygen and in a glucose-containing medium, but it can also occur during vinegar elaboration by the traditional method. The vinegar biofilm produced by AAB on the air-liquid interface is primarily composed of cellulose and maintains the cells in close contact with oxygen. In this study, we screened for the ability of AAB to produce cellulose using different carbon sources in the presence or absence of ethanol. The presence of cellulose in biofilms was confirmed using the fluorochrome Calcofluor by microscopy. Moreover, the process of biofilm formation was monitored under epifluorescence microscopy using the Live/Dead BacLight Kit. A total of 77 AAB strains belonging to 35 species of Acetobacter, Komagataeibacter, Gluconacetobacter, and Gluconobacter were analysed, and 30 strains were able to produce a cellulose biofilm in at least one condition. This cellulose production was correlated with the PCR amplification of the bcsA gene that encodes cellulose synthase. A total of eight degenerated primers were designed, resulting in one primer pair that was able to detect the presence of this gene in 27 AAB strains, 26 of which formed cellulose. PMID:25381910

  7. Open reading frame 3, which is adjacent to the mycocerosic acid synthase gene, is expressed as an acyl coenzyme A synthase in Mycobacterium bovis BCG.

    PubMed Central

    Fitzmaurice, A M; Kolattukudy, P E

    1997-01-01

    The aim of this study was to test for expression of a 900-bp open reading frame (ORF), ORF3, located at the 5' end of the mycocerosic acid synthase gene in Mycobacterium bovis BCG and to determine the nature of the ORF3 protein. ORF3 was expressed as a 61-kDa C-terminal fusion protein with glutathione S-transferase in Escherichia coli. Polyclonal rabbit antiserum, prepared against this fusion protein, cross-reacted with a 65-kDa protein in M. bovis BCG crude extracts. Since this protein was larger than that predicted from the nucleotide sequence (32 kDa), ORF3 was resequenced, revealing an ORF of 1,749 bp that encodes a 64.8-kDa protein containing 583 amino acids. Reverse transcription-PCR revealed that ORF3 is expressed in M. bovis BCG. The ORF3 product has a high degree of similarity to the acyladenylate family of enzymes. Immunoaffinity absorption chromatography was used to isolate the 65-kDa cross-reacting protein from M. bovis BCG. This purified protein catalyzed coenzyme A (CoA) ester synthesis of n-C10 to n-C18 fatty acids but not mycocerosic acids. ORF3 antibodies severely inhibited acyl-CoA synthase activities of the purified protein and extracts of M. bovis BCG, Mycobacterium smegmatis, and E. coli. They also showed immunological cross-reactivity with proteins in these extracts. Both the ORF3 protein and the acyl-CoA synthase activity were located in the cell cytosol or were loosely associated with the cell membrane. These results indicate that ORF3 encodes an acyl-CoA synthase-like protein. PMID:9098059

  8. Cloning and manipulation of the Escherichia coli cyclopropane fatty acid synthase gene: physiological aspects of enzyme overproduction.

    PubMed Central

    Grogan, D W; Cronan, J E

    1984-01-01

    Like many other eubacteria, cultures of Escherichia coli accumulate cyclopropane fatty acids (CFAs) at a well-defined stage of growth, due to the action of the cytoplasmic enzyme CFA synthase. We report the isolation of the putative structural gene, cfa, for this enzyme on an E. coli-ColE1 chimeric plasmid by the use of an autoradiographic colony screening technique. When introduced into a variety of E. coli strains, this plasmid, pLC18-11, induced corresponding increases in CFA content and CFA synthase activity. Subsequent manipulation of the cfa locus, facilitated by the insertion of pLC18-11 into a bacteriophage lambda vector, allowed genetic and physiological studies of CFA synthase in E. coli. Overproduction of this enzyme via multicopy cfa plasmids caused abnormally high levels of CFA in membrane phospholipid but no discernable growth perturbation. Infection with phage lambda derivatives bearing cfa caused transient overproduction of the enzyme, although pL-mediated expression of cfa could not be demonstrated in plasmids derived from such phages. CFA synthase specific activities could be raised to very high levels by using cfa runaway-replication plasmids. A variety of physiological factors were found to modulate the levels of CFA synthase in normal and gene-amplified cultures. These studies argue against several possible mechanisms for the temporal regulation of CFA formation. PMID:6325391

  9. Acid Sphingomyelinase Gene Knockout Ameliorates Hyperhomocysteinemic Glomerular Injury in Mice Lacking Cystathionine-β-Synthase

    PubMed Central

    Boini, Krishna M.; Xia, Min; Abais, Justine M.; Xu, Ming; Li, Cai-xia; Li, Pin-Lan

    2012-01-01

    Acid sphingomyelinase (ASM) has been implicated in the development of hyperhomocysteinemia (hHcys)-induced glomerular oxidative stress and injury. However, it remains unknown whether genetically engineering of ASM gene produces beneficial or detrimental action on hHcys-induced glomerular injury. The present study generated and characterized the mice lacking cystathionine β-synthase (Cbs) and Asm mouse gene by cross breeding Cbs+/− and Asm+/− mice. Given that the homozygotes of Cbs−/−/Asm−/− mice could not survive for 3 weeks. Cbs+/−/Asm+/+, Cbs+/−/Asm+/− and Cbs+/−/Asm−/− as well as their Cbs wild type littermates were used to study the role of Asm−/− under a background of Cbs+/− with hHcys. HPLC analysis revealed that plasma Hcys level was significantly elevated in Cbs heterozygous (Cbs+/−) mice with different copies of Asm gene compared to Cbs+/+ mice with different Asm gene copies. Cbs+/−/Asm+/+ mice had significantly increased renal Asm activity, ceramide production and O2.− level compared to Cbs+/+/Asm+/+, while Cbs+/−/Asm−/− mice showed significantly reduced renal Asm activity, ceramide production and O2.− level due to increased plasma Hcys levels. Confocal microscopy demonstrated that colocalization of podocin with ceramide was much lower in Cbs+/−/Asm−/− mice compared to Cbs+/−/Asm+/+ mice, which was accompanied by a reduced glomerular damage index, albuminuria and proteinuria in Cbs+/−/Asm−/− mice. Immunofluorescent analyses of the podocin, nephrin and desmin expression also illustrated less podocyte damages in the glomeruli from Cbs+/−/Asm−/− mice compared to Cbs+/−/Asm+/+ mice. In in vitro studies of podocytes, hHcys-enhanced O2.− production, desmin expression, and ceramide production as well as decreases in VEGF level and podocin expression in podocytes were substantially attenuated by prior treatment with amitriptyline, an Asm inhibitor. In conclusion, Asm gene knockout or

  10. Transcripts for genes encoding soluble acid invertase and sucrose synthase accumulate in root tip and cortical cells containing mycorrhizal arbuscules.

    PubMed

    Blee, Kristopher A; Anderson, Anne J

    2002-09-01

    Arbuscule formation by the arbuscular mycorrhizal fungus Glomus intraradices (Schenck & Smith) was limited to cortical cells immediately adjacent to the endodermis. Because these cortical cells are the first to intercept photosynthate exiting the vascular cylinder, transcript levels for sucrose metabolizing-enzymes were compared between mycorrhizal and non-mycorrhizal roots. The probes corresponded to genes encoding a soluble acid invertase with potential vacuolar targeting, which we generated from Phaseolus vulgaris roots, a Rhizobium-responsive sucrose synthase of soybean and a cell wall acid invertase of carrot. Transcripts in non-mycorrhizal roots were developmentally regulated and abundant in the root tips for all three probes but in differentiated roots of P. vulgaris they were predominantly located in phloem tissues for sucrose synthase or the endodermis and phloem for soluble acid invertase. In mycorrhizal roots increased accumulations of transcripts for sucrose synthase and vacuolar invertase were both observed in the same cortical cells bearing arbuscules that fluoresce. There was no effect on the expression of the cell wall invertase gene in fluorescent carrot cells containing arbuscules. Thus, it appears that presence of the fungal hyphae in the fluorescent arbusculated cell stimulates discrete alterations in expression of sucrose metabolizing enzymes to increase the sink potential of the cell. PMID:12175013

  11. Expression of the Rhodobacter sphaeroides hemA and hemT genes, encoding two 5-aminolevulinic acid synthase isozymes.

    PubMed Central

    Neidle, E L; Kaplan, S

    1993-01-01

    The nucleotide sequences of the Rhodobacter sphaeroides hemA and hemT genes, encoding 5-aminolevulinic acid (ALA) synthase isozymes, were determined. ALA synthase catalyzes the condensation of glycine and succinyl coenzyme A, the first and rate-limiting step in tetrapyrrole biosynthesis. The hemA and hemT structural gene sequences were 65% identical to each other, and the deduced HemA and HemT polypeptide sequences were 53% identical, with an additional 16% of aligned amino acids being similar. HemA and HemT were homologous to all characterized ALA synthases, including two human ALA synthase isozymes. In addition, they were evolutionarily related to 7-keto-8-aminopelargonic acid synthetase (BioF) and 2-amino-3-ketobutyrate coenzyme A ligase (Kbl), enzymes which catalyze similar reactions. Two hemA transcripts were identified, both expressed under photosynthetic conditions at levels approximately three times higher than those found under aerobic conditions. A single transcriptional start point was identified for both transcripts, and a consensus sequence at this location indicated that an Fnr-like protein may be involved in the transcriptional regulation of hemA. Transcription of hemT was not detected in wild-type cells under the physiological growth conditions tested. In a mutant strain in which the hemA gene had been inactivated, however, hemT was expressed. In this mutant, hemT transcripts were characterized by Northern (RNA) hybridization, primer extension, and ribonuclease protection techniques. A small open reading frame of unknown function was identified upstream of, and transcribed in the same direction as, hemA. Images PMID:8468290

  12. Mutation of L-2,3-diaminopropionic acid synthase genes blocks staphyloferrin B synthesis in Staphylococcus aureus

    PubMed Central

    2011-01-01

    Background Staphylococcus aureus synthesizes two siderophores, staphyloferrin A and staphyloferrin B, that promote iron-restricted growth. Previous work on the biosynthesis of staphyloferrin B has focused on the role of the synthetase enzymes, encoded from within the sbnA-I operon, which build the siderophore from the precursor molecules citrate, alpha-ketoglutarate and L-2,3-diaminopropionic acid. However, no information yet exists on several other enzymes, expressed from the biosynthetic cluster, that are thought to be involved in the synthesis of the precursors (or synthetase substrates) themselves. Results Using mutants carrying insertions in sbnA and sbnB, we show that these two genes are essential for the synthesis of staphyloferrin B, and that supplementation of the growth medium with L-2,3-diaminopropionic acid can bypass the block in staphyloferrin B synthesis displayed by the mutants. Several mechanisms are proposed for how the enzymes SbnA, with similarity to cysteine synthase enzymes, and SbnB, with similarity to amino acid dehydrogenases and ornithine cyclodeaminases, function together in the synthesis of this unusual nonproteinogenic amino acid L-2,3-diaminopropionic acid. Conclusions Mutation of either sbnA or sbnB result in abrogation of synthesis of staphyloferrin B, a siderophore that contributes to iron-restricted growth of S. aureus. The loss of staphyloferrin B synthesis is due to an inability to synthesize the unusual amino acid L-2,3-diaminopropionic acid which is an important, iron-liganding component of the siderophore structure. It is proposed that SbnA and SbnB function together as an L-Dap synthase in the S. aureus cell. PMID:21906287

  13. DNA Sequence and Expression Variation of Hop (Humulus lupulus) Valerophenone Synthase (VPS), a Key Gene in Bitter Acid Biosynthesis

    PubMed Central

    Castro, Consuelo B.; Whittock, Lucy D.; Whittock, Simon P.; Leggett, Grey; Koutoulis, Anthony

    2008-01-01

    Background The hop plant (Humulus lupulus) is a source of many secondary metabolites, with bitter acids essential in the beer brewing industry and others having potential applications for human health. This study investigated variation in DNA sequence and gene expression of valerophenone synthase (VPS), a key gene in the bitter acid biosynthesis pathway of hop. Methods Sequence variation was studied in 12 varieties, and expression was analysed in four of the 12 varieties in a series across the development of the hop cone. Results Nine single nucleotide polymorphisms (SNPs) were detected in VPS, seven of which were synonymous. The two non-synonymous polymorphisms did not appear to be related to typical bitter acid profiles of the varieties studied. However, real-time quantitative reverse-transcription polymerase chain reaction (qRT-PCR) analysis of VPS expression during hop cone development showed a clear link with the bitter acid content. The highest levels of VPS expression were observed in two triploid varieties, ‘Symphony’ and ‘Ember’, which typically have high bitter acid levels. Conclusions In all hop varieties studied, VPS expression was lowest in the leaves and an increase in expression was consistently observed during the early stages of cone development. PMID:18519445

  14. Molecular evolution and sequence divergence of plant chalcone synthase and chalcone synthase-Like genes.

    PubMed

    Han, Yingying; Zhao, Wenwen; Wang, Zhicui; Zhu, Jingying; Liu, Qisong

    2014-06-01

    Plant chalcone synthase (CHS) and CHS-Like (CHSL) proteins are polyketide synthases. In this study, we evaluated the molecular evolution of this gene family using representative types of CHSL genes, including stilbene synthase (STS), 2-pyrone synthase (2-PS), bibenzyl synthase (BBS), acridone synthase (ACS), biphenyl synthase (BIS), benzalacetone synthase, coumaroyl triacetic acid synthase (CTAS), and benzophenone synthase (BPS), along with their CHS homologs from the same species of both angiosperms and gymnosperms. A cDNA-based phylogeny indicated that CHSLs had diverse evolutionary patterns. STS, ACS, and 2-PS clustered with CHSs from the same species (late diverged pattern), while CTAS, BBS, BPS, and BIS were distant from their CHS homologs (early diverged pattern). The amino-acid phylogeny suggested that CHS and CHSL proteins formed clades according to enzyme function. The CHSs and CHSLs from Polygonaceae and Arachis had unique evolutionary histories. Synonymous mutation rates were lower in late diverged CHSLs than in early diverged ones, indicating that gene duplications occurred more recently in late diverged CHSLs than in early diverged ones. Relative rate tests proved that late diverged CHSLs had unequal rates to CHSs from the same species when using fatty acid synthase, which evolved from the common ancestor with the CHS superfamily, as the outgroup, while the early diverged lineages had equal rates. This indicated that late diverged CHSLs experienced more frequent mutation than early diverged CHSLs after gene duplication, allowing obtaining new functions in relatively short period of time. PMID:24849013

  15. An Intronless β-amyrin Synthase Gene is More Efficient in Oleanolic Acid Accumulation than its Paralog in Gentiana straminea.

    PubMed

    Liu, Yanling; Zhao, Zhongjuan; Xue, Zheyong; Wang, Long; Cai, Yunfei; Wang, Peng; Wei, Tiandi; Gong, Jing; Liu, Zhenhua; Li, Juan; Li, Shuo; Xiang, Fengning

    2016-01-01

    Paralogous members of the oxidosqualene cyclase (OSC) family encode a diversity of enzymes that are important in triterpenoid biosynthesis. This report describes the isolation of the Gentiana straminea gene GsAS2 that encodes a β-amyrin synthase (βAS) enzyme. Unlike its previously isolated paralog GsAS1, GsAS2 lacks introns. Its predicted protein product was is a 759 residue polypeptide that shares high homology with other known β-amyrin synthases (βASs). Heterologously expressed GsAS2 generates more β-amyrin in yeast than does GsAS1. Constitutive over-expression of GsAS2 resulted in a 5.7 fold increase in oleanolic acid accumulation, while over-expression of GsAS1 led to a 3 fold increase. Additionally, RNAi-directed suppression of GsAS2 and GsAS1 in G. straminea decreased oleonolic acid levels by 65.9% and 21% respectively, indicating that GsAS2 plays a more important role than GsAS1 in oleanolic acid biosynthesis in G. straminea. We uses a docking model to explore the catalytic mechanism of GsAS1/2 and predicted that GsAS2, with its Y560, have higher efficiency than GsAS1 and mutated versions of GsAS2 in β-amyrin produce. When the key residue in GsAS2 was mutagenized, it produced about 41.29% and 71.15% less β-amyrin than native, while the key residue in GsAS1 was mutagenized to that in GsAS2, the mutant produced 38.02% more β-amyrin than native GsAS1. PMID:27624821

  16. Proto-oncogene FBI-1 (Pokemon) and SREBP-1 synergistically activate transcription of fatty-acid synthase gene (FASN).

    PubMed

    Choi, Won-Il; Jeon, Bu-Nam; Park, Hyejin; Yoo, Jung-Yoon; Kim, Yeon-Sook; Koh, Dong-In; Kim, Myung-Hwa; Kim, Yu-Ri; Lee, Choong-Eun; Kim, Kyung-Sup; Osborne, Timothy F; Hur, Man-Wook

    2008-10-24

    FBI-1 (Pokemon/ZBTB7A) is a proto-oncogenic transcription factor of the BTB/POZ (bric-à-brac, tramtrack, and broad complex and pox virus zinc finger) domain family. Recent evidence suggested that FBI-1 might be involved in adipogenic gene expression. Coincidentally, expression of FBI-1 and fatty-acid synthase (FASN) genes are often increased in cancer and immortalized cells. Both FBI-1 and FASN are important in cancer cell proliferation. SREBP-1 is a major regulator of many adipogenic genes, and FBI-1 and SREBP-1 (sterol-responsive element (SRE)-binding protein 1) interact with each other directly via their DNA binding domains. FBI-1 enhanced the transcriptional activation of SREBP-1 on responsive promoters, pGL2-6x(SRE)-Luc and FASN gene. FBI-1 and SREBP-1 synergistically activate transcription of the FASN gene by acting on the proximal GC-box and SRE/E-box. FBI-1, Sp1, and SREBP-1 can bind to all three SRE, GC-box, and SRE/E-box. Binding competition among the three transcription factors on the GC-box and SRE/E-box appears important in the transcription regulation. FBI-1 is apparently changing the binding pattern of Sp1 and SREBP-1 on the two elements in the presence of induced SREBP-1 and drives more Sp1 binding to the proximal promoter with less of an effect on SREBP-1 binding. The changes induced by FBI-1 appear critical in the synergistic transcription activation. The molecular mechanism revealed provides insight into how proto-oncogene FBI-1 may attack the cellular regulatory mechanism of FASN gene expression to provide more phospholipid membrane components needed for rapid cancer cell proliferation. PMID:18682402

  17. Divinyl ether synthase gene and protein, and uses thereof

    DOEpatents

    Howe, Gregg A.; Itoh, Aya

    2011-09-13

    The present invention relates to divinyl ether synthase genes, proteins, and methods of their use. The present invention encompasses both native and recombinant wild-type forms of the synthase, as well as mutants and variant forms, some of which possess altered characteristics relative to the wild-type synthase. The present invention also relates to methods of using divinyl ether synthase genes and proteins, including in their expression in transgenic organisms and in the production of divinyl ether fatty acids, and to methods of suing divinyl ether fatty acids, including in the protection of plants from pathogens.

  18. Divinyl ether synthase gene, and protein and uses thereof

    DOEpatents

    Howe, Gregg A.; Itoh, Aya

    2006-12-26

    The present invention relates to divinyl ether synthase genes, proteins, and methods of their use. The present invention encompasses both native and recombinant wild-type forms of the synthase, as well as mutants and variant forms, some of which possess altered characteristics relative to the wild-type synthase. The present invention also relates to methods of using divinyl ether synthase genes and proteins, including in their expression in transgenic organisms and in the production of divinyl ether fatty acids, and to methods of suing divinyl ether fatty acids, including in the protection of plants from pathogens.

  19. Jinggangmycin increases fecundity of the brown planthopper, Nilaparvata lugens (Stål) via fatty acid synthase gene expression.

    PubMed

    Li, Lei; Jiang, Yiping; Liu, Zongyu; You, Linlin; Wu, You; Xu, Bing; Ge, Linquan; Stanley, David; Song, Qisheng; Wu, Jincai

    2016-01-01

    The antibiotic jinggangmycin (JGM) is mainly used in controlling the rice sheath blight, Rhizoctonia solani, in China. JGM also enhances reproduction of the brown planthopper (BPH), Nilaparvata lugens (Stål). To date, however, molecular mechanisms of the enhancement are unclear. Our related report documented the influence of foliar JGM sprays on ovarian protein content. Here, we used isobaric tags for relative and absolute quantitation (iTRAQ) protocols to analyze ovarian proteins of BPH females following JGM spray (JGM-S) and topical application (JGM-T). We recorded changes in expression of 284 proteins (142↑ and 142↓) in JGM-S compared to the JGM-S control group (S-control); 267 proteins were differentially expressed (130↑ and 137↓) in JGM-T compared to the JGM-T control group (T-control), of which, 22 proteins were up-regulated in both groups. Comparing the JGM-S to the JGM-T group, 114 proteins were differentially expressed (62↑ and 52↓). Based on the biological significance of fatty acids, pathway annotation and enrichment analysis, we designed a dsRNA construct to silence a gene encoding fatty acid synthase (FAS). FAS was more highly expressed in JGM-S vs S-control and JGM-S vs JGM-T groups. The dsFAS treatment reduced fecundity by about 46% and reduced ovarian and fat body fatty acid concentrations in JGM-S-treated females relative to controls. We infer FAS provides critically needed fatty acids to support JGM-enhanced fecundity in BPH. PMID:26388431

  20. Trichinella pseudospiralis vs. T. spiralis thymidylate synthase gene structure and T. pseudospiralis thymidylate synthase retrogene sequence

    PubMed Central

    2014-01-01

    Background Thymidylate synthase is a housekeeping gene, designated ancient due to its role in DNA synthesis and ubiquitous phyletic distribution. The genomic sequences were characterized coding for thymidylate synthase in two species of the genus Trichinella, an encapsulating T. spiralis and a non-encapsulating T. pseudospiralis. Methods Based on the sequence of parasitic nematode Trichinella spiralis thymidylate synthase cDNA, PCR techniques were employed. Results Each of the respective gene structures encompassed 6 exons and 5 introns located in conserved sites. Comparison with the corresponding gene structures of other eukaryotic species revealed lack of common introns that would be shared among selected fungi, nematodes, mammals and plants. The two deduced amino acid sequences were 96% identical. In addition to the thymidylate synthase gene, the intron-less retrocopy, i.e. a processed pseudogene, with sequence identical to the T. spiralis gene coding region, was found to be present within the T. pseudospiralis genome. This pseudogene, instead of the gene, was confirmed by RT-PCR to be expressed in the parasite muscle larvae. Conclusions Intron load, as well as distribution of exon and intron phases in thymidylate synthase genes from various sources, point against the theory of gene assembly by the primordial exon shuffling and support the theory of evolutionary late intron insertion into spliceosomal genes. Thymidylate synthase pseudogene expressed in T. pseudospiralis muscle larvae is designated a retrogene. PMID:24716800

  1. MicroRNA-24 can control triacylglycerol synthesis in goat mammary epithelial cells by targeting the fatty acid synthase gene.

    PubMed

    Wang, H; Luo, J; Chen, Z; Cao, W T; Xu, H F; Gou, D M; Zhu, J J

    2015-12-01

    In nonruminants it has been demonstrated that microRNA-24 (miR-24) is involved in preadipocyte differentiation, hepatic lipid, and plasma triacylglycerol synthesis. However, its role in ruminant mammary gland remains unclear. In this study we measured miR-24 expression in goat mammary gland tissue at 4 different stages of lactation and observed that it had highest expression at peak lactation when compared with the dry period. Overexpression or downregulation of miR-24 in goat mammary epithelial cells (GMEC) strongly affected fatty acid profiles; in particular, miR-24 enhanced unsaturated fatty acid concentration. Additional effects of miR-24 included changes in triacylglycerol content and the expression of fatty acid synthase, sterol regulatory element binding transcription protein 1, stearoyl-CoA desaturase, glycerol-3-phosphate acyltransferase mitochondrial, and acetyl-CoA carboxylase. Luciferase reporter assay confirmed that fatty acid synthase is a target of miR-24. Taken together, these results not only highlight the physiological importance of miR-24 in fatty acid metabolism in GMEC, but also laid the foundation for further research on regulatory mechanisms among miR-24 and other microRNA expressed in GMEC. PMID:26476938

  2. Biosynthesis of Akaeolide and Lorneic Acids and Annotation of Type I Polyketide Synthase Gene Clusters in the Genome of Streptomyces sp. NPS554

    PubMed Central

    Zhou, Tao; Komaki, Hisayuki; Ichikawa, Natsuko; Hosoyama, Akira; Sato, Seizo; Igarashi, Yasuhiro

    2015-01-01

    The incorporation pattern of biosynthetic precursors into two structurally unique polyketides, akaeolide and lorneic acid A, was elucidated by feeding experiments with 13C-labeled precursors. In addition, the draft genome sequence of the producer, Streptomyces sp. NPS554, was performed and the biosynthetic gene clusters for these polyketides were identified. The putative gene clusters contain all the polyketide synthase (PKS) domains necessary for assembly of the carbon skeletons. Combined with the 13C-labeling results, gene function prediction enabled us to propose biosynthetic pathways involving unusual carbon-carbon bond formation reactions. Genome analysis also indicated the presence of at least ten orphan type I PKS gene clusters that might be responsible for the production of new polyketides. PMID:25603349

  3. Mycocerosic acid synthase exemplifies the architecture of reducing polyketide synthases.

    PubMed

    Herbst, Dominik A; Jakob, Roman P; Zähringer, Franziska; Maier, Timm

    2016-03-24

    Polyketide synthases (PKSs) are biosynthetic factories that produce natural products with important biological and pharmacological activities. Their exceptional product diversity is encoded in a modular architecture. Modular PKSs (modPKSs) catalyse reactions colinear to the order of modules in an assembly line, whereas iterative PKSs (iPKSs) use a single module iteratively as exemplified by fungal iPKSs (fiPKSs). However, in some cases non-colinear iterative action is also observed for modPKSs modules and is controlled by the assembly line environment. PKSs feature a structural and functional separation into a condensing and a modifying region as observed for fatty acid synthases. Despite the outstanding relevance of PKSs, the detailed organization of PKSs with complete fully reducing modifying regions remains elusive. Here we report a hybrid crystal structure of Mycobacterium smegmatis mycocerosic acid synthase based on structures of its condensing and modifying regions. Mycocerosic acid synthase is a fully reducing iPKS, closely related to modPKSs, and the prototype of mycobacterial mycocerosic acid synthase-like PKSs. It is involved in the biosynthesis of C20-C28 branched-chain fatty acids, which are important virulence factors of mycobacteria. Our structural data reveal a dimeric linker-based organization of the modifying region and visualize dynamics and conformational coupling in PKSs. On the basis of comparative small-angle X-ray scattering, the observed modifying region architecture may be common also in modPKSs. The linker-based organization provides a rationale for the characteristic variability of PKS modules as a main contributor to product diversity. The comprehensive architectural model enables functional dissection and re-engineering of PKSs. PMID:26976449

  4. Differential regulation of genes encoding 1-aminocyclopropane-1-carboxylate (ACC) synthase in etiolated pea seedlings: effects of indole-3-acetic acid, wounding, and ethylene.

    PubMed

    Peck, S C; Kende, H

    1998-12-01

    Treatment of 5- to 6-day-old etiolated pea (Pisum sativum L.) seedlings with indole-3-acetic acid (IAA) induced within 15 min an increase in the transcript levels of two genes encoding 1-aminocyclopropane-1-carboxylate (ACC) synthase, Ps-ACS1 and Ps-ACS2. Simultaneous treatment with ethylene inhibited this increase and also caused a decrease in ACC synthase enzyme activity as compared to that of seedlings treated with IAA alone. These results indicate that ethylene inhibits its own biosynthesis by decreasing ACC synthase transcript levels via a negative feedback loop. Wounding of pea stems had no effect on the expression of Ps-ACS1, but led within 10 min to an increase in the mRNA levels of Ps-ACS2. This increase was also inhibited by ethylene. The wound signal was transmitted over a distance of at least 4 cm through the stem with no delay in induction or response intensity. The rapid transmission of the wound response is consistent with the possibility that a hydraulic or electric signal is responsible for the spread of the wound response. PMID:9869404

  5. Cannabidiolic-acid synthase, the chemotype-determining enzyme in the fiber-type Cannabis sativa.

    PubMed

    Taura, Futoshi; Sirikantaramas, Supaart; Shoyama, Yoshinari; Yoshikai, Kazuyoshi; Shoyama, Yukihiro; Morimoto, Satoshi

    2007-06-26

    Cannabidiolic-acid (CBDA) synthase is the enzyme that catalyzes oxidative cyclization of cannabigerolic-acid into CBDA, the dominant cannabinoid constituent of the fiber-type Cannabis sativa. We cloned a novel cDNA encoding CBDA synthase by reverse transcription and polymerase chain reactions with degenerate and gene-specific primers. Biochemical characterization of the recombinant enzyme demonstrated that CBDA synthase is a covalently flavinylated oxidase. The structural and functional properties of CBDA synthase are quite similar to those of tetrahydrocannabinolic-acid (THCA) synthase, which is responsible for the biosynthesis of THCA, the major cannabinoid in drug-type Cannabis plants. PMID:17544411

  6. The tomato terpene synthase gene family.

    PubMed

    Falara, Vasiliki; Akhtar, Tariq A; Nguyen, Thuong T H; Spyropoulou, Eleni A; Bleeker, Petra M; Schauvinhold, Ines; Matsuba, Yuki; Bonini, Megan E; Schilmiller, Anthony L; Last, Robert L; Schuurink, Robert C; Pichersky, Eran

    2011-10-01

    Compounds of the terpenoid class play numerous roles in the interactions of plants with their environment, such as attracting pollinators and defending the plant against pests. We show here that the genome of cultivated tomato (Solanum lycopersicum) contains 44 terpene synthase (TPS) genes, including 29 that are functional or potentially functional. Of these 29 TPS genes, 26 were expressed in at least some organs or tissues of the plant. The enzymatic functions of eight of the TPS proteins were previously reported, and here we report the specific in vitro catalytic activity of 10 additional tomato terpene synthases. Many of the tomato TPS genes are found in clusters, notably on chromosomes 1, 2, 6, 8, and 10. All TPS family clades previously identified in angiosperms are also present in tomato. The largest clade of functional TPS genes found in tomato, with 12 members, is the TPS-a clade, and it appears to encode only sesquiterpene synthases, one of which is localized to the mitochondria, while the rest are likely cytosolic. A few additional sesquiterpene synthases are encoded by TPS-b clade genes. Some of the tomato sesquiterpene synthases use z,z-farnesyl diphosphate in vitro as well, or more efficiently than, the e,e-farnesyl diphosphate substrate. Genes encoding monoterpene synthases are also prevalent, and they fall into three clades: TPS-b, TPS-g, and TPS-e/f. With the exception of two enzymes involved in the synthesis of ent-kaurene, the precursor of gibberellins, no other tomato TPS genes could be demonstrated to encode diterpene synthases so far. PMID:21813655

  7. Producing dicarboxylic acids using polyketide synthases

    SciTech Connect

    Katz, Leonard; Fortman, Jeffrey L; Keasling, Jay D

    2013-10-29

    The present invention provides for a polyketide synthase (PKS) capable of synthesizing a dicarboxylic acid (diacid). Such diacids include diketide-diacids and triketide-diacids. The invention includes recombinant nucleic acid encoding the PKS, and host cells comprising the PKS. The invention also includes methods for producing the diacids.

  8. Producing dicarboxylic acids using polyketide synthases

    SciTech Connect

    Katz, Leonard; Fortman, Jeffrey L.; Keasling, Jay D.

    2015-05-26

    The present invention provides for a polyketide synthase (PKS) capable of synthesizing a dicarboxylic acid (diacid). Such diacids include diketide-diacids and triketide-diacids. The invention includes recombinant nucleic acid encoding the PKS, and host cells comprising the PKS. The invention also includes methods for producing the diacids.

  9. Retinoic acid activates human inducible nitric oxide synthase gene through binding of RAR{alpha}/RXR{alpha} heterodimer to a novel retinoic acid response element in the promoter

    SciTech Connect

    Zou Fang; Liu Yan; Liu Li; Wu Kailang; Wei Wei; Zhu Ying . E-mail: yingzhu@whu.edu.cn; Wu Jianguo . E-mail: wu9988@vip.sina.com

    2007-04-06

    Human inducible nitric oxide synthase (hiNOS) catalyzes nitric oxide (NO) which has a significant effect on tumor suppression and cancer therapy. Here we revealed the detailed molecular mechanism involved in the regulation of hiNOS expression induced by retinoic acid (RA). We showed that RAR{alpha}/RXR{alpha} heterodimer was important in hiNOS promoter activation, hiNOS protein expression, and NO production. Serial deletion and site-directed mutation analysis revealed two half-sites of retinoic acid response element (RARE) spaced by 5 bp located at -172 to -156 in the hiNOS promoter. EMSA and ChIP assays demonstrated that RAR{alpha}/RXR{alpha} directly bound to this RARE of hiNOS promoter. Our results suggested the identification of a novel RARE in the hiNOS promoter and the roles of the nuclear receptors (RAR{alpha}/RXR{alpha}) in the induction of hiNOS by RA.

  10. DNase I hypersensitivity sites and nuclear protein binding on the fatty acid synthase gene: identification of an element with properties similar to known glucose-responsive elements.

    PubMed Central

    Foufelle, F; Lepetit, N; Bosc, D; Delzenne, N; Morin, J; Raymondjean, M; Ferré, P

    1995-01-01

    We have shown previously that fatty acid synthase (FAS) gene expression is positively regulated by glucose in rat adipose tissue and liver. In the present study, we have identified in the first intron of the gene a sequence closely related to known glucose-responsive elements such as in the L-pyruvate kinase and S14 genes, including a putative upstream stimulatory factor/major late transcription factor (USF/MLTF) binding site (E-box) (+ 292 nt to + 297 nt). Location of this sequence corresponds to a site of hypersensitivity to DNase I which is present in the liver but not in the spleen. Moreover, using this information from a preliminary report of the present work, others have shown that a + 283 nt to + 303 nt sequence of the FAS gene can confer glucose responsiveness to a heterologous promoter. The protein binding to this region has been investigated in vitro by a combination of DNase I footprinting and gel-retardation experiments with synthetic oligonucleotides and known nuclear proteins. DNase I footprinting experiments using a + 161 nt to + 405 nt fragment of the FAS gene demonstrate that a region from + 290 nt to + 316 nt is protected by nuclear extracts from liver and spleen. This region binds two ubiquitous nuclear factors, USF/MLTF and the CAAT-binding transcription factor/nuclear factor 1 (CTF/NF1). Binding of these factors is similar in nuclear extracts from liver which does or does not express the FAS gene as observed for glucose-responsive elements in the L-pyruvate kinase and S14 genes. This suggests a posttranslational modification of a factor of the complex after glucose stimulation. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 PMID:7772036

  11. Increase in nervonic acid content in transformed yeast and transgenic plants by introduction of a Lunaria annua L. 3-ketoacyl-CoA synthase (KCS) gene.

    PubMed

    Guo, Yiming; Mietkiewska, Elzbieta; Francis, Tammy; Katavic, Vesna; Brost, Jennifer M; Giblin, Michael; Barton, Dennis L; Taylor, David C

    2009-03-01

    Nervonic acid is a Very Long-Chain Monounsaturated Fatty Acid (VLCMFA), 24:1 Delta15 (cis-tetracos-15-enoic acid) found in the seed oils of Lunaria annua, borage, hemp, Acer (Purpleblow maple) and Tropaeolum speciosum (Flame flower). However, of these, only the "money plant" (Lunaria annua L.) has been studied and grown sparingly for future development as a niche crop and the outlook has been disappointing. Therefore, our goal was to isolate and characterize strategic new genes for high nervonic acid production in Brassica oilseed crops. To this end, we have isolated a VLCMFA-utilizing 3-Keto-Acyl-CoA Synthase (KCS; fatty acid elongase; EC 2.3.1.86) gene from Lunaria annua and functionally expressed it in yeast, with the recombinant KCS protein able to catalyze the synthesis of several VLCMFAs, including nervonic acid. Seed-specific expression of the Lunaria KCS in Arabidopsis resulted in a 30-fold increase in nervonic acid proportions in seed oils, compared to the very low quantities found in the wild-type. Similar transgenic experiments using B. carinata as the host resulted in a 7-10 fold increase in seed oil nervonic acid proportions. KCS enzyme activity assays indicated that upon using (14)C-22:1-CoA as substrate, the KCS activity from developing seeds of transgenic B. carinata was 20-30-fold higher than the low erucoyl-elongation activity exhibited by wild type control plants. There was a very good correlation between the Lun KCS transcript intensity and the resultant 22:1-CoA KCS activity in developing seed. The highest nervonic acid level in transgenic B. carinata expressing the Lunaria KCS reached 30%, compared to 2.8% in wild type plant. In addition, the erucic acid proportions in these transgenic lines were considerably lower than that found in native Lunaria oil. These results show the functional utility of the Lunaria KCS in engineering new sources of high nervonate/reduced erucic oils in the Brassicaceae. PMID:19082744

  12. Proto-oncogene FBI-1 (Pokemon) and SREBP-1 Synergistically Activate Transcription of Fatty-acid Synthase Gene (FASN)*S⃞

    PubMed Central

    Choi, Won-Il; Jeon, Bu-Nam; Park, Hyejin; Yoo, Jung-Yoon; Kim, Yeon-Sook; Koh, Dong-In; Kim, Myung-Hwa; Kim, Yu-Ri; Lee, Choong-Eun; Kim, Kyung-Sup; Osborne, Timothy F.; Hur, Man-Wook

    2008-01-01

    FBI-1 (Pokemon/ZBTB7A) is a proto-oncogenic transcription factor of the BTB/POZ (bric-à-brac, tramtrack, and broad complex and pox virus zinc finger) domain family. Recent evidence suggested that FBI-1 might be involved in adipogenic gene expression. Coincidentally, expression of FBI-1 and fatty-acid synthase (FASN) genes are often increased in cancer and immortalized cells. Both FBI-1 and FASN are important in cancer cell proliferation. SREBP-1 is a major regulator of many adipogenic genes, and FBI-1 and SREBP-1 (sterol-responsive element (SRE)-binding protein 1) interact with each other directly via their DNA binding domains. FBI-1 enhanced the transcriptional activation of SREBP-1 on responsive promoters, pGL2-6x(SRE)-Luc and FASN gene. FBI-1 and SREBP-1 synergistically activate transcription of the FASN gene by acting on the proximal GC-box and SRE/E-box. FBI-1, Sp1, and SREBP-1 can bind to all three SRE, GC-box, and SRE/E-box. Binding competition among the three transcription factors on the GC-box and SRE/E-box appears important in the transcription regulation. FBI-1 is apparently changing the binding pattern of Sp1 and SREBP-1 on the two elements in the presence of induced SREBP-1 and drives more Sp1 binding to the proximal promoter with less of an effect on SREBP-1 binding. The changes induced by FBI-1 appear critical in the synergistic transcription activation. The molecular mechanism revealed provides insight into how proto-oncogene FBI-1 may attack the cellular regulatory mechanism of FASN gene expression to provide more phospholipid membrane components needed for rapid cancer cell proliferation. PMID:18682402

  13. Induction of fatty acid synthase and S14 gene expression by glucose, xylitol and dihydroxyacetone in cultured rat hepatocytes is closely correlated with glucose 6-phosphate concentrations.

    PubMed Central

    Mourrieras, F; Foufelle, F; Foretz, M; Morin, J; Bouche, S; Ferre, P

    1997-01-01

    It is now well established that the transcription of several genes belonging to the glycolytic and lipogenic pathway is stimulated in the presence of a high glucose concentration in adipocytes and hepatocytes. We have previously proposed that glucose 6-phosphate could be the signal metabolite that transduces the glucose effect. This proposal has recently been challenged and both an intermediate of the pentose phosphate pathway, xylulose 5-phosphate, and metabolites of the later part of glycolysis (3-phosphoglycerate and phosphoenolpyruvate) have been proposed. To discriminate between these possibilities, we have measured concomitantly, in primary cultures of adult rat hepatocytes, the expression of the fatty acid synthase (FAS) and S14 genes and the concentration of glucose metabolites. We have used various substrates entering at different steps of the glycolytic pathway (glucose, dihydroxyacetone) and the pentose phosphate pathway (xylitol). When compared with 5 mM glucose, 25 mM glucose induces a marked increase in both S14 and FAS gene expression, detectable as early as 2 h and peaking at 6 h. Increasing concentrations (1-5 mM) of xylitol and dihydroxyacetone in the presence of 5 mM glucose are also able to induce S14 and FAS gene expression progressively. Among the various glucose metabolites measured, glucose 6-phosphate, in contrast with xylulose 5-phosphate and metabolites of the lower part of glycolysis, is the only one that shows a clear-cut parallelism between its concentration and the degree of S14 and FAS gene expression. We conclude that glucose 6-phosphate is the most likely signal metabolite for the glucose-induced transcription of this group of genes. PMID:9291103

  14. Differential Expression of 1-Aminocyclopropane-1-Carboxylate Synthase Genes during Orchid Flower Senescence Induced by the Protein Phosphatase Inhibitor Okadaic Acid1

    PubMed Central

    Wang, Ning Ning; Yang, Shang Fa; Charng, Yee-yung

    2001-01-01

    Applying 10 pmol of okadaic acid (OA), a specific inhibitor of type 1 or type 2A serine/threonine protein phosphatases, to the orchid (Phalaenopsis species) stigma induced a dramatic increase in ethylene production and an accelerated senescence of the whole flower. Aminoethoxyvinylglycine or silver thiosulfate, inhibitors of ethylene biosynthesis or action, respectively, effectively inhibited the OA-induced ethylene production and retarded flower senescence, suggesting that the protein phosphatase inhibitor induced orchid flower senescence through an ethylene-mediated signaling pathway. OA treatment induced a differential expression pattern for the 1-aminocyclopropane-1-carboxylic acid synthase multigene family. Accumulation of Phal-ACS1 transcript in the stigma, labelum, and ovary induced by OA were higher than those induced by pollination as determined by “semiquantitative” reverse transcriptase-polymerase chain reaction. In contrast, the transcript levels of Phal-ACS2 and Phal-ACS3 induced by OA were much lower than those induced by pollination. Staurosporine, a protein kinase inhibitor, on the other hand, inhibited the OA-induced Phal-ACS1 expression in the stigma and delayed flower senescence. Our results suggest that a hyper-phosphorylation status of an unidentified protein(s) is involved in up-regulating the expression of Phal-ACS1 gene resulting in increased ethylene production and accelerated the senescence process of orchid flower. PMID:11351088

  15. Synergism in the effect of prior jasmonic acid application on herbivore-induced volatile emission by Lima bean plants: transcription of a monoterpene synthase gene and volatile emission

    PubMed Central

    Menzel, Tila R.; Weldegergis, Berhane T.; David, Anja; Boland, Wilhelm; Gols, Rieta; van Loon, Joop J. A.; Dicke, Marcel

    2014-01-01

    Jasmonic acid (JA) plays a central role in induced plant defence e.g. by regulating the biosynthesis of herbivore-induced plant volatiles that mediate the attraction of natural enemies of herbivores. Moreover, exogenous application of JA can be used to elicit plant defence responses similar to those induced by biting-chewing herbivores and mites that pierce cells and consume their contents. In the present study, we used Lima bean (Phaseolus lunatus) plants to explore how application of a low dose of JA followed by minor herbivory by spider mites (Tetranychus urticae) affects transcript levels of P. lunatus (E)-β-ocimene synthase (PlOS), emission of (E)-β-ocimene and nine other plant volatiles commonly associated with herbivory. Furthermore, we investigated the plant’s phytohormonal response. Application of a low dose of JA increased PlOS transcript levels in a synergistic manner when followed by minor herbivory for both simultaneous and sequential infestation. Emission of (E)-β-ocimene was also increased, and only JA, but not SA, levels were affected by treatments. Projection to latent structures-discriminant analysis (PLS-DA) of other volatiles showed overlap between treatments. Thus, a low-dose JA application results in a synergistic effect on gene transcription and an increased emission of a volatile compound involved in indirect defence after herbivore infestation. PMID:25318119

  16. Isoprene synthase genes form a monophyletic clade of acyclic terpene synthases in the TPS-B terpene synthase family.

    PubMed

    Sharkey, Thomas D; Gray, Dennis W; Pell, Heather K; Breneman, Steven R; Topper, Lauren

    2013-04-01

    Many plants emit significant amounts of isoprene, which is hypothesized to help leaves tolerate short episodes of high temperature. Isoprene emission is found in all major groups of land plants including mosses, ferns, gymnosperms, and angiosperms; however, within these groups isoprene emission is variable. The patchy distribution of isoprene emission implies an evolutionary pattern characterized by many origins or many losses. To better understand the evolution of isoprene emission, we examine the phylogenetic relationships among isoprene synthase and monoterpene synthase genes in the angiosperms. In this study we identify nine new isoprene synthases within the rosid angiosperms. We also document the capacity of a myrcene synthase in Humulus lupulus to produce isoprene. Isoprene synthases and (E)-β-ocimene synthases form a monophyletic group within the Tps-b clade of terpene synthases. No asterid genes fall within this clade. The chemistry of isoprene synthase and ocimene synthase is similar and likely affects the apparent relationships among Tps-b enzymes. The chronology of rosid evolution suggests a Cretaceous origin followed by many losses of isoprene synthase over the course of evolutionary history. The phylogenetic pattern of Tps-b genes indicates that isoprene emission from non-rosid angiosperms likely arose independently. PMID:23550753

  17. Sugar/osmoticum levels modulate differential abscisic acid-independent expression of two stress-responsive sucrose synthase genes in Arabidopsis.

    PubMed Central

    Déjardin, A; Sokolov, L N; Kleczkowski, L A

    1999-01-01

    Sucrose synthase (Sus) is a key enzyme of sucrose metabolism. Two Sus-encoding genes (Sus1 and Sus2) from Arabidopsis thaliana were found to be profoundly and differentially regulated in leaves exposed to environmental stresses (cold stress, drought or O(2) deficiency). Transcript levels of Sus1 increased on exposure to cold and drought, whereas Sus2 mRNA was induced specifically by O(2) deficiency. Both cold and drought exposures induced the accumulation of soluble sugars and caused a decrease in leaf osmotic potential, whereas O(2) deficiency was characterized by a nearly complete depletion in sugars. Feeding abscisic acid (ABA) to detached leaves or subjecting Arabidopsis ABA-deficient mutants to cold stress conditions had no effect on the expression profiles of Sus1 or Sus2, whereas feeding metabolizable sugars (sucrose or glucose) or non-metabolizable osmotica [poly(ethylene glycol), sorbitol or mannitol] mimicked the effects of osmotic stress on Sus1 expression in detached leaves. By using various sucrose/mannitol solutions, we demonstrated that Sus1 was up-regulated by a decrease in leaf osmotic potential rather than an increase in sucrose concentration itself. We suggest that Sus1 expression is regulated via an ABA-independent signal transduction pathway that is related to the perception of a decrease in leaf osmotic potential during stresses. In contrast, the expression of Sus2 was independent of sugar/osmoticum effects, suggesting the involvement of a signal transduction mechanism distinct from that regulating Sus1 expression. The differential stress-responsive regulation of Sus genes in leaves might represent part of a general cellular response to the allocation of carbohydrates during acclimation processes. PMID:10567234

  18. Thymidylate synthase gene of herpesvirus ateles.

    PubMed Central

    Richter, J; Puchtler, I; Fleckenstein, B

    1988-01-01

    The putative thymidylate synthase (TS) gene of herpesvirus ateles, a T-lymphotropic tumor virus of New World primates, has a single large open reading frame encoding a polypeptide of 32.9 kilodaltons. The gene is transcribed into an unspliced 2.4-kilobase mRNA that is abundantly expressed late in virus replication. The AT-rich 5' untranslated leader sequence of TS mRNA in herpesvirus ateles-infected cells is remarkable in length (1,184 nucleotides), containing 29 minicistrons; this may indicate a role in translation regulation. Images PMID:3404583

  19. Geranyl diphosphate synthase molecules, and nucleic acid molecules encoding same

    SciTech Connect

    Croteau, Rodney Bruce; Burke, Charles Cullen

    2008-06-24

    In one aspect, the present invention provides isolated nucleic acid molecules that each encode a geranyl diphosphate synthase protein, wherein each isolated nucleic acid molecule hybridizes to a nucleic acid molecule consisting of the sequence set forth in SEQ ID NO:1 under conditions of 5.times.SSC at 45.degree. C. for one hour. The present invention also provides isolated geranyl diphosphate synthase proteins, and methods for altering the level of expression of geranyl diphosphate synthase protein in a host cell.

  20. Trans-chalcone and quercetin down-regulate fatty acid synthase gene expression and reduce ergosterol content in the human pathogenic dermatophyte Trichophyton rubrum

    PubMed Central

    2013-01-01

    Background Fatty acid synthase (FAS) is a promising antifungal target due to its marked structural differences between fungal and mammalian cells. The aim of this study was to evaluate the antifungal activity of flavonoids described in the scientific literature as FAS inhibitors (quercetin, trans-chalcone, ellagic acid, luteolin, galangin, and genistein) against the dermatophyte Trichophyton rubrum and their effects on fatty acid and ergosterol synthesis. Methods The antifungal activity of the natural products was tested by the microdilution assay for determination of the minimum inhibitory concentration (MIC). The effect of the compounds on the cell membrane was evaluated using a protoplast regeneration assay. Ergosterol content was quantified by spectrophotometry. Inhibition of FAS by flavonoids was evaluated by an enzymatic assay to determine IC50 values. Quantitative RT-PCR was used to measure transcription levels of the FAS1 and ERG6 genes involved in fatty acid and ergosterol biosynthesis, respectively, during exposure of T. rubrum to the flavonoids tested. Results The flavonoids quercetin and trans-chalcone were effective against T. rubrum, with MICs of 125 and 7.5 μg/mL for the wild-type strain (MYA3108) and of 63 and 1.9 μg/mL for the ABC transporter mutant strain (ΔTruMDR2), respectively. The MICs of the fluconazole and cerulenin controls were 63 and 125 μg/mL for the wild-type strain and 30 and 15 μg/mL for the mutant strain, respectively. Quercetin and trans-chalcone also reduced ergosterol content in the two strains, indicating that interference with fatty acid and ergosterol synthesis caused cell membrane disruption. The MIC of quercetin reduced the number of regenerated protoplasts by 30.26% (wild-type strain) and by 91.66% (mutant strain). Half the MIC (0.5 MIC) of quercetin did not reduce the number of regenerated wild-type fungal colonies, but caused a 36.19% reduction in the number of mutant strain protoplasts. In contrast, the MIC and 0

  1. Evolutionary Dynamics of the Cellulose Synthase Gene Superfamily in Grasses.

    PubMed

    Schwerdt, Julian G; MacKenzie, Katrin; Wright, Frank; Oehme, Daniel; Wagner, John M; Harvey, Andrew J; Shirley, Neil J; Burton, Rachel A; Schreiber, Miriam; Halpin, Claire; Zimmer, Jochen; Marshall, David F; Waugh, Robbie; Fincher, Geoffrey B

    2015-07-01

    Phylogenetic analyses of cellulose synthase (CesA) and cellulose synthase-like (Csl) families from the cellulose synthase gene superfamily were used to reconstruct their evolutionary origins and selection histories. Counterintuitively, genes encoding primary cell wall CesAs have undergone extensive expansion and diversification following an ancestral duplication from a secondary cell wall-associated CesA. Selection pressure across entire CesA and Csl clades appears to be low, but this conceals considerable variation within individual clades. Genes in the CslF clade are of particular interest because some mediate the synthesis of (1,3;1,4)-β-glucan, a polysaccharide characteristic of the evolutionarily successful grasses that is not widely distributed elsewhere in the plant kingdom. The phylogeny suggests that duplication of either CslF6 and/or CslF7 produced the ancestor of a highly conserved cluster of CslF genes that remain located in syntenic regions of all the grass genomes examined. A CslF6-specific insert encoding approximately 55 amino acid residues has subsequently been incorporated into the gene, or possibly lost from other CslFs, and the CslF7 clade has undergone a significant long-term shift in selection pressure. Homology modeling and molecular dynamics of the CslF6 protein were used to define the three-dimensional dispositions of individual amino acids that are subject to strong ongoing selection, together with the position of the conserved 55-amino acid insert that is known to influence the amounts and fine structures of (1,3;1,4)-β-glucans synthesized. These wall polysaccharides are attracting renewed interest because of their central roles as sources of dietary fiber in human health and for the generation of renewable liquid biofuels. PMID:25999407

  2. Identification of a 1-aminocyclopropane-1-carboxylic acid synthase gene linked to the female (F) locus that enhances female sex expression in cucumber.

    PubMed Central

    Trebitsh, T; Staub, J E; O'Neill, S D

    1997-01-01

    Sex determination in cucumber (Cucumis sativus L.) is controlled largely by three genes: F, m, and a. The F and m loci interact to produce monoecious (M_f_) or gynoecious (M_f_) sex phenotypes. Ethylene and factors that induce ethylene biosynthesis, such as 1-aminocyclopropane-1-carboxylate (ACC) and auxin, also enhance female sex expression. A genomic sequence (CS-ACS1) encoding ACC synthase was amplified from genomic DNA by a polymerase chain reaction using degenerate oligonucleotide primers. Expression of CS-ACS1 is induced by auxin, but not by ACC, in wounded and intact shoot apices. Southern blo hybridization analysis of near-isogenic gynoecious (MMFF) and monoecious (MMff) lines derived from divers genetic backgrounds revealed the existence of an additional ACC synthase (CS-ACS1G) genomic sequence in the gynoecious lines. Sex phenotype analysis of a segregating F2 population detected a 100% correlation between the CS-ACS1G marker and the presence of the F locus. The CS-ACS1G gene is located in linkage group B coincident with the F locus, and in the population tested there was no recombination between the CS-ACS1G gene and the F locus. Collectively, these data suggest that CS-ACS1G is closely linked to the F locus and may play a pivotal role in the determination of sex in cucumber flowers. PMID:9085580

  3. Modified cellulose synthase gene from 'Arabidopsis thaliana' confers herbicide resistance to plants

    SciTech Connect

    Somerville, Chris R.; Scieble, Wolf

    2000-10-11

    Cellulose synthase ('CS'), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl) phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  4. Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants

    DOEpatents

    Somerville, Chris R.; Scheible, Wolf

    2007-07-10

    Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  5. Identification and characterization of a novel gene (CTPsH) homologous to murine CTP synthase gene

    SciTech Connect

    Yang, B.Z.; Dng, J.H.; Roe, C.R.

    1994-09-01

    CTP synthase (CTPs) plays an important role in pyrimidine metabolism in eukaryotic cells. Alteration of this enzyme was associated with multidrug resistant phenotype of cancer cells to several cytotoxic pyrimidine ribonucleosides. In order to elucidate the mechanism of this type of drug resistance, a murine CTP synthase cDNA has been previously isolated from a mouse liver cDNA library. Here report the identification of a new gene which is highly similar to mouse CTPs gene. A cDNA clone, designated CTPsH, contained an open reading frame of 1758 nucleotides that predicts a polypeptide of 586 amino acids with an M(r) of 66,002.6. The predicted amino acid sequence shares 79% identity with mouse liver CTPs gene. Both genes are expressed in a wide variety of tissues, as judged by RNA blot analysis, but the relative levels of the two mRNAs differ. So far this is the only gene which shares many features with murine CTPs gene. The availability of the CTPsH would provide an opportunity to characterize the biological function of this gene. The possible role of this new gene (CTPsH) in drug resistance of malignant cells is under investigation.

  6. Tight linkage of genes that encode the two glutamate synthase subunits of Escherichia coli K-12.

    PubMed Central

    Lozoya, E; Sanchez-Pescador, R; Covarrubias, A; Vichido, I; Bolivar, F

    1980-01-01

    A hybrid deoxyribonucleic acid molecule, plasmid pRSP20, which was isolated from the Clarke and Carbon Escherichia coli gene bank, was shown to complement the gltB31 mutation, which affects the synthesis of glutamate synthase in E. coli strain PA340. We present evidence which demonstrates that plasmid pRSP20 carries an 8-megadalton E. coli chromosomal fragment, including the genes encoding the two unequal glutamate synthase subunits. Polypeptides with molecular weights of about 135,000 and 53,000, which comigrated with purified E. coli glutamate synthase subunit polypeptides and immunoprecipitated with antibodies to E. coli glutamate synthase, were synthesized by minicells carrying the pRSP20 plasmid. Images PMID:6107287

  7. Inhibition of de novo Palmitate Synthesis by Fatty Acid Synthase Induces Apoptosis in Tumor Cells by Remodeling Cell Membranes, Inhibiting Signaling Pathways, and Reprogramming Gene Expression

    PubMed Central

    Ventura, Richard; Mordec, Kasia; Waszczuk, Joanna; Wang, Zhaoti; Lai, Julie; Fridlib, Marina; Buckley, Douglas; Kemble, George; Heuer, Timothy S.

    2015-01-01

    Inhibition of de novo palmitate synthesis via fatty acid synthase (FASN) inhibition provides an unproven approach to cancer therapy with a strong biological rationale. FASN expression increases with tumor progression and associates with chemoresistance, tumor metastasis, and diminished patient survival in numerous tumor types. TVB-3166, an orally-available, reversible, potent, and selective FASN inhibitor induces apoptosis, inhibits anchorage-independent cell growth under lipid-rich conditions, and inhibits in-vivo xenograft tumor growth. Dose-dependent effects are observed between 20–200 nM TVB-3166, which agrees with the IC50 in biochemical FASN and cellular palmitate synthesis assays. Mechanistic studies show that FASN inhibition disrupts lipid raft architecture, inhibits biological pathways such as lipid biosynthesis, PI3K–AKT–mTOR and β-catenin signal transduction, and inhibits expression of oncogenic effectors such as c-Myc; effects that are tumor-cell specific. Our results demonstrate that FASN inhibition has anti-tumor activities in biologically diverse preclinical tumor models and provide mechanistic and pharmacologic evidence that FASN inhibition presents a promising therapeutic strategy for treating a variety of cancers, including those expressing mutant K-Ras, ErbB2, c-Met, and PTEN. The reported findings inform ongoing studies to link mechanisms of action with defined tumor types and advance the discovery of biomarkers supporting development of FASN inhibitors as cancer therapeutics. Research in context Fatty acid synthase (FASN) is a vital enzyme in tumor cell biology; the over-expression of FASN is associated with diminished patient prognosis and resistance to many cancer therapies. Our data demonstrate that selective and potent FASN inhibition with TVB-3166 leads to selective death of tumor cells, without significant effect on normal cells, and inhibits in vivo xenograft tumor growth at well-tolerated doses. Candidate biomarkers for

  8. Altered expression of the caffeine synthase gene in a naturally caffeine-free mutant of Coffea arabica

    PubMed Central

    2009-01-01

    In this work, we studied the biosynthesis of caffeine by examining the expression of genes involved in this biosynthetic pathway in coffee fruits containing normal or low levels of this substance. The amplification of gene-specific transcripts during fruit development revealed that low-caffeine fruits had a lower expression of the theobromine synthase and caffeine synthase genes and also contained an extra transcript of the caffeine synthase gene. This extra transcript contained only part of exon 1 and all of exon 3. The sequence of the mutant caffeine synthase gene revealed the substitution of isoleucine for valine in the enzyme active site that probably interfered with enzymatic activity. These findings indicate that the absence of caffeine in these mutants probably resulted from a combination of transcriptional regulation and the presence of mutations in the caffeine synthase amino acid sequence. PMID:21637458

  9. Differential expression of two genes for 1-aminocyclopropane-1-carboxylate synthase in tomato fruits.

    PubMed Central

    Olson, D C; White, J A; Edelman, L; Harkins, R N; Kende, H

    1991-01-01

    1-Aminocyclopropane-1-carboxylate synthase (ACC synthase; S-adenosyl-L-methionine methylthioadenosine-lyase, EC 4.4.1.14) is the regulated enzyme in the biosynthetic pathway of the plant hormone ethylene. A full-length cDNA encoding this enzyme has been cloned from tomato fruits [Van Der Straeten, D., Van Wiemeersch, L., Goodman, H. M. & Van Montagu, M. Proc. Natl. Acad. Sci. USA (1990) 87, 4859-4863]. We report here the complete nucleotide and derived amino acid sequences of a cDNA encoding a second isoform of ACC synthase from tomato fruits. The cDNAs coding for both isoforms contain highly conserved regions that are surrounded by regions of low homology, especially at the 5' and 3' ends. Gene-specific probes were constructed to examine the expression of transcripts encoding the two ACC synthase isoforms under two conditions of enhanced ethylene formation--namely, during fruit ripening and in response to mechanical stress (wounding). The level of mRNA encoding both isoforms, ACC synthase 1 and 2, increased during ripening. In contrast, wounding caused an increase in only the level of mRNA coding for ACC synthase 1. Blot analysis of genomic DNA digested with restriction enzymes confirmed that ACC synthase 1 and 2 are encoded by different genes. Images PMID:1711229

  10. Metabolic engineering of Pseudomonas putida for production of docosahexaenoic acid based on a myxobacterial PUFA synthase.

    PubMed

    Gemperlein, Katja; Zipf, Gregor; Bernauer, Hubert S; Müller, Rolf; Wenzel, Silke C

    2016-01-01

    Long-chain polyunsaturated fatty acids (LC-PUFAs) can be produced de novo via polyketide synthase-like enzymes known as PUFA synthases, which are encoded by pfa biosynthetic gene clusters originally discovered from marine microorganisms. Recently similar gene clusters were detected and characterized in terrestrial myxobacteria revealing several striking differences. As the identified myxobacterial producers are difficult to handle genetically and grow very slowly we aimed to establish heterologous expression platforms for myxobacterial PUFA synthases. Here we report the heterologous expression of the pfa gene cluster from Aetherobacter fasciculatus (SBSr002) in the phylogenetically distant model host bacteria Escherichia coli and Pseudomonas putida. The latter host turned out to be the more promising PUFA producer revealing higher production rates of n-6 docosapentaenoic acid (DPA) and docosahexaenoic acid (DHA). After several rounds of genetic engineering of expression plasmids combined with metabolic engineering of P. putida, DHA production yields were eventually increased more than threefold. Additionally, we applied synthetic biology approaches to redesign and construct artificial versions of the A. fasciculatus pfa gene cluster, which to the best of our knowledge represents the first example of a polyketide-like biosynthetic gene cluster modulated and synthesized for P. putida. Combination with the engineering efforts described above led to a further increase in LC-PUFA production yields. The established production platform based on synthetic DNA now sets the stage for flexible engineering of the complex PUFA synthase. PMID:26617065

  11. The Tomato Terpene Synthase Gene Family1[W][OA

    PubMed Central

    Falara, Vasiliki; Akhtar, Tariq A.; Nguyen, Thuong T.H.; Spyropoulou, Eleni A.; Bleeker, Petra M.; Schauvinhold, Ines; Matsuba, Yuki; Bonini, Megan E.; Schilmiller, Anthony L.; Last, Robert L.; Schuurink, Robert C.; Pichersky, Eran

    2011-01-01

    Compounds of the terpenoid class play numerous roles in the interactions of plants with their environment, such as attracting pollinators and defending the plant against pests. We show here that the genome of cultivated tomato (Solanum lycopersicum) contains 44 terpene synthase (TPS) genes, including 29 that are functional or potentially functional. Of these 29 TPS genes, 26 were expressed in at least some organs or tissues of the plant. The enzymatic functions of eight of the TPS proteins were previously reported, and here we report the specific in vitro catalytic activity of 10 additional tomato terpene synthases. Many of the tomato TPS genes are found in clusters, notably on chromosomes 1, 2, 6, 8, and 10. All TPS family clades previously identified in angiosperms are also present in tomato. The largest clade of functional TPS genes found in tomato, with 12 members, is the TPS-a clade, and it appears to encode only sesquiterpene synthases, one of which is localized to the mitochondria, while the rest are likely cytosolic. A few additional sesquiterpene synthases are encoded by TPS-b clade genes. Some of the tomato sesquiterpene synthases use z,z-farnesyl diphosphate in vitro as well, or more efficiently than, the e,e-farnesyl diphosphate substrate. Genes encoding monoterpene synthases are also prevalent, and they fall into three clades: TPS-b, TPS-g, and TPS-e/f. With the exception of two enzymes involved in the synthesis of ent-kaurene, the precursor of gibberellins, no other tomato TPS genes could be demonstrated to encode diterpene synthases so far. PMID:21813655

  12. Plasticity and Evolution of (+)-3-Carene Synthase and (−)-Sabinene Synthase Functions of a Sitka Spruce Monoterpene Synthase Gene Family Associated with Weevil Resistance*

    PubMed Central

    Roach, Christopher R.; Hall, Dawn E.; Zerbe, Philipp; Bohlmann, Jörg

    2014-01-01

    The monoterpene (+)-3-carene is associated with resistance of Sitka spruce against white pine weevil, a major North American forest insect pest of pine and spruce. High and low levels of (+)-3-carene in, respectively, resistant and susceptible Sitka spruce genotypes are due to variation of (+)-3-carene synthase gene copy number, transcript and protein expression levels, enzyme product profiles, and enzyme catalytic efficiency. A family of multiproduct (+)-3-carene synthase-like genes of Sitka spruce include the three (+)-3-carene synthases, PsTPS-3car1, PsTPS-3car2, PsTPS-3car3, and the (−)-sabinene synthase PsTPS-sab. Of these, PsTPS-3car2 is responsible for the relatively higher levels of (+)-3-carene in weevil-resistant trees. Here, we identified features of the PsTPS-3car1, PsTPS-3car2, PsTPS-3car3, and PsTPS-sab proteins that determine different product profiles. A series of domain swap and site-directed mutations, supported by structural comparisons, identified the amino acid in position 596 as critical for product profiles dominated by (+)-3-carene in PsTPS-3car1, PsTPS-3car2, and PsTPS-3car3, or (−)-sabinene in PsTPS-sab. A leucine in this position promotes formation of (+)-3-carene, whereas phenylalanine promotes (−)-sabinene. Homology modeling predicts that position 596 directs product profiles through differential stabilization of the reaction intermediate. Kinetic analysis revealed position 596 also plays a role in catalytic efficiency. Mutations of position 596 with different side chain properties resulted in a series of enzymes with different product profiles, further highlighting the inherent plasticity and potential for evolution of alternative product profiles of these monoterpene synthases of conifer defense against insects. PMID:25016016

  13. [Intraspecific polymorphism of the sucrose synthase genes in Russian and Kazakhstan potato cultivars].

    PubMed

    Slugina, M A; Boris, K V; Kakimzhanova, A A; Kochieva, E Z

    2014-06-01

    In 12 different Russian and Kazakhstan potato cultivars, the polymorphism of the glycosyltransferase domain of the sucrose synthase gene was first examined, as well as the polymorphism of the sucrose synthase domain fragment of the same gene in the potato cultivars of Kazakhstan breed. It was demonstrated that the examined sequences contained point mutations, as well as insertions and deletions, including those not described earlier. Amino acid substitutions specific to heat- and drought-tolerant varieties were also identified and could be associated with the development of abiotic stress resistance. PMID:25715458

  14. The chsA gene, encoding a class-I chitin synthase from Ampelomyces quisqualis.

    PubMed

    Weiss, N; Sztejnberg, A; Yarden, O

    1996-02-01

    Degenerate oligodeoxyribonucleotide primers, designed on the basis of conserved regions of the chitin synthase gene family, were used to amplify a fragment of the Ampelomyces quisqualis (Aq) chsA gene. Subsequently, the PCR product was used as a probe in order to identify and isolate genomic clones harboring the entire chsA gene. Aq chsA is 2786-nt long, has one intron and encodes a 910-amino-acid polypeptide belonging to the class-I chitin synthases. Low-stringency Southern hybridizations to Aq genomic DNA provided evidence for the presence of additional DNA fragments resembling chsA in the fungal genome, suggesting the presence of a multigene family of chitin synthases in Aq. PMID:8626074

  15. Cyclopropane fatty acid synthase from Oenococcus oeni: expression in Lactococcus lactis subsp. cremoris and biochemical characterization.

    PubMed

    To, Thi Mai Huong; Grandvalet, Cosette; Alexandre, Hervé; Tourdot-Maréchal, Raphaëlle

    2015-11-01

    Bacterial cyclopropane fatty acid synthases (CFA synthases) catalyze the transfer of a methyl group from S-adenosyl-L-methionine (AdoMet) to the double bond of a lipid chain, thereby forming a cyclopropane ring. CFAs contribute to resistance to acidity, dryness, and osmotic imbalance in many bacteria. This work describes the first biochemical characterization of a lactic acid bacterium CFA synthase. We have overexpressed Oenococcus oeni CFA synthase in E. coli in order to purify the enzyme. The optimum cyclopropanation activity was obtained at pH 5.6 and 35.8 °C. The high K(m) (AdoMet) value obtained (2.26 mM) demonstrates the low affinity of O. oeni enzyme toward the L. lactis subsp. cremoris unsaturated phospholipids. These results explain the partial complementation of the L. lactis subsp. cremoris cfa mutant by the O. oeni cfa gene and suggest a probable substrate specificity of the O. oeni enzyme. The current study reveals an essential hypothesis about the specificity of O. oeni CFA synthase which could play a key function in the acid tolerance mechanisms of this enological bacterium. PMID:26294376

  16. Producing a trimethylpentanoic acid using hybrid polyketide synthases

    SciTech Connect

    Katz, Leonard; Fortman, Jeffrey L; Keasling, Jay D

    2014-10-07

    The present invention provides for a polyketide synthase (PKS) capable of synthesizing trimethylpentanoic acid. The present invention also provides for a host cell comprising the PKS and when cultured produces the trimethylpentanoic acid. The present invention also provides for a method of producing the trimethylpentanoic acid, comprising: providing a host cell of the present invention, and culturing said host cell in a suitable culture medium such that the trimethylpentanoic acid is produced, optionally isolating the trimethylpentanoic acid, and optionally, reducing the isolated trimethylpentanoic acid into a trimethylpentanol or an iso-octane.

  17. Nucleotide sequence variation of chitin synthase genes among ectomycorrhizal fungi and its potential use in taxonomy.

    PubMed Central

    Mehmann, B; Brunner, I; Braus, G H

    1994-01-01

    DNA sequences of single-copy genes coding for chitin synthases (UDP-N-acetyl-D-glucosamine:chitin 4-beta-N-acetylglucosaminyltransferase; EC 2.4.1.16) were used to characterize ectomycorrhizal fungi. Degenerate primers deduced from short, completely conserved amino acid stretches flanking a region of about 200 amino acids of zymogenic chitin synthases allowed the amplification of DNA fragments of several members of this gene family. Different DNA band patterns were obtained from basidiomycetes because of variation in the number and length of amplified fragments. Cloning and sequencing of the most prominent DNA fragments revealed that these differences were due to various introns at conserved positions. The presence of introns in basidiomycetous fungi therefore has a potential use in identification of genera by analyzing PCR-generated DNA fragment patterns. Analyses of the nucleotide sequences of cloned fragments revealed variations in nucleotide sequences from 4 to 45%. By comparison of the deduced amino acid sequences, the majority of the DNA fragments were identified as members of genes for chitin synthase class II. The deduced amino acid sequences from species of the same genus differed only in one amino acid residue, whereas identity between the amino acid sequences of ascomycetous and basidiomycetous fungi within the same taxonomic class was found to be approximately 43 to 66%. Phylogenetic analysis of the amino acid sequence of class II chitin synthase-encoding gene fragments by using parsimony confirmed the current taxonomic groupings. In addition, our data revealed a fourth class of putative zymogenic chitin synthesis. Images PMID:7944356

  18. Increased production of wax esters in transgenic tobacco plants by expression of a fatty acid reductase:wax synthase gene fusion.

    PubMed

    Aslan, Selcuk; Hofvander, Per; Dutta, Paresh; Sun, Chuanxin; Sitbon, Folke

    2015-12-01

    Wax esters are hydrophobic lipids consisting of a fatty acid moiety linked to a fatty alcohol with an ester bond. Plant-derived wax esters are today of particular concern for their potential as cost-effective and sustainable sources of lubricants. However, this aspect is hampered by the fact that the level of wax esters in plants generally is too low to allow commercial exploitation. To investigate whether wax ester biosynthesis can be increased in plants using transgenic approaches, we have here exploited a fusion between two bacterial genes together encoding a single wax ester-forming enzyme, and targeted the resulting protein to chloroplasts in stably transformed tobacco (Nicotiana benthamiana) plants. Compared to wild-type controls, transgenic plants showed both in leaves and stems a significant increase in the total level of wax esters, being eight-fold at the whole plant level. The profiles of fatty acid methyl ester and fatty alcohol in wax esters were related, and C16 and C18 molecules constituted predominant forms. Strong transformants displayed certain developmental aberrations, such as stunted growth and chlorotic leaves and stems. These negative effects were associated with an accumulation of fatty alcohols, suggesting that an adequate balance between formation and esterification of fatty alcohols is crucial for a high wax ester production. The results show that wax ester engineering in transgenic plants is feasible, and suggest that higher yields may become achieved in the near future. PMID:26138876

  19. The Arabidopsis Trehalose-6-P Synthase AtTPS1 Gene Is a Regulator of Glucose, Abscisic Acid, and Stress Signaling1

    PubMed Central

    Avonce, Nelson; Leyman, Barbara; Mascorro-Gallardo, José O.; Van Dijck, Patrick; Thevelein, Johan M.; Iturriaga, Gabriel

    2004-01-01

    In Arabidopsis (Arabidopsis thaliana), trehalose is present at almost undetectable levels, excluding its role as an osmoprotectant. Here, we report that overexpression of AtTPS1 in Arabidopsis using the 35S promoter led to a small increase in trehalose and trehalose-6-P levels. In spite of this, transgenic plants displayed a dehydration tolerance phenotype without any visible morphological alterations, except for delayed flowering. Moreover, seedlings overexpressing AtTPS1 exhibited glucose (Glc)- and abscisic acid (ABA)-insensitive phenotypes. Transgenic seedlings germinated on Glc were visibly larger with green well-expanded cotyledonary leaves and fully developed roots, in contrast with wild-type seedlings showing growth retardation and absence of photosynthetic tissue. An ABA dose-response experiment revealed a higher germination rate for transgenic plants overexpressing AtTPS1 showing insensitive germination kinetics at 2.5 μm ABA. Interestingly, germination in the presence of Glc did not trigger an increase in ABA content in plants overexpressing AtTPS1. Expression analysis by quantitative reverse transcription-PCR in transgenic plants showed up-regulation of the ABI4 and CAB1 genes. In the presence of Glc, CAB1 expression remained high, whereas ABI4, HXK1, and ApL3 levels were down-regulated in the AtTPS1-overexpressing lines. Analysis of AtTPS1 expression in HXK1-antisense or HXK1-sense transgenic lines suggests the possible involvement of AtTPS1 in the hexokinase-dependent Glc-signaling pathway. These data strongly suggest that AtTPS1 has a pivotal role in the regulation of Glc and ABA signaling during vegetative development. PMID:15516499

  20. A geraniol-synthase gene from Cinnamomum tenuipilum.

    PubMed

    Yang, Tao; Li, Jing; Wang, Hao-Xin; Zeng, Ying

    2005-02-01

    Geraniol may accumulate up to 86-98% of the leaf essential oils in geraniol chemotypes of the evergreen camphor tree Cinnamomum tenuipilum. A similarity-based cloning strategy yielded a cDNA clone that appeared to encode a terpene synthase and which could be phylogenetically grouped within the angiosperm monoterpene synthase/subfamily. After its expression in Escherichia coli and enzyme assay with prenyl diphosphates as substrates, the enzyme encoded by the putative C. tenuipilum monoterpene synthase gene was shown to specifically convert geranyl diphosphate to geraniol as a single product by GC-MS analysis. Biochemical characterization of the partially purified recombinant protein revealed a strong dependency for Mg2+ and Mn2+, and an apparent Michaelis constant of 55.8 microM for geranyl diphosphate. Thus, a new member of the monoterpene synthase family was identified and designated as CtGES. The genome contains a single copy of CtGES gene. Expression of CtGES was exclusively observed in the geraniol chemotype of C. tenuipilum. Furthermore, in situ hybridization analysis demonstrated that CtGES mRNA was localized in the oil cells of the leaves. PMID:15680985

  1. Light/Dark Profiles of Sucrose Phosphate Synthase, Sucrose Synthase, and Acid Invertase in Leaves of Sugar Beets

    PubMed Central

    Vassey, Terry L.

    1989-01-01

    The activity of sucrose phosphate synthase, sucrose synthase, and acid invertase was monitored in 1- to 2-month-old sugar beet (Beta vulgaris L.) leaves. Sugar beet leaves achieve full laminar length in 13 days. Therefore, leaves were harvested at 2-day intervals for 15 days. Sucrose phosphate synthase activity was not detectable for 6 days in the dark-grown leaves. Once activity was measurable, sucrose phosphate synthase activity never exceeded half that observed in the light-grown leaves. After 8 days in the dark, leaves which were illuminated for 30 minutes showed no significant change in sucrose phosphate synthase activity. Leaves illuminated for 24 hours after 8 days in darkness, however, recovered sucrose phosphate synthase activity to 80% of that of normally grown leaves. Sucrose synthase and acid invertase activity in the light-grown leaves both increased for the first 7 days and then decreased as the leaves matured. In contrast, the activity of sucrose synthase oscillated throughout the growth period in the dark-grown leaves. Acid invertase activity in the dark-grown leaves seemed to be the same as the activity found in the light-grown leaves. PMID:16666537

  2. Mechanistic studies of 3-deoxy-D-manno-octulosonic acid 8-phosphate synthase

    SciTech Connect

    Dotson, G.D.; Woodard, R.W.

    1994-12-01

    The enzyme 3-deOXY-D-manno-octulosonic acid 8-phosphate synthase (KDO 8-P synthase) catalyses the condensation of arabinose 5-phosphate (A 5-P) with phosphoenolpyruvate (PEP) to give the unique eight-carbon acidic sugar 3-deoxy-D-nianno-octulosonic acid 8-phosphate (KDO 8-P) found only in gram-negative bacteria and required for lipid A maturation and cellular growth. The E. coli gene kdsA that encodes KDO 8-P synthase has been amplified by standard PCR methodologies. The synthetic gene, subcloned into the expression vector pT7-7 was used to infect E. coli BL 21 (DE 3). Purification of crude supernatant from this transformant on Q Sepharose yields >200 mg of near-homogeneous KDO 8-P synthase per liter of cell culture. To explore the mechanism of KDO 8-P synthase, we prepared (E)- and (Z)-(3{sup 2}H)PEP, (2-{sup 13}C)PEP, and (2-{sup 13}C,{sup 18}O)PEP chemically from the appropriately labeled 3-bromopyruvates by reaction with trimethylphosphite under Perkow reaction conditions. Our {sup 1}H-NMR analysis of the stereochemistry at C3 of the KDO 8-Ps, obtained by separate incubation of (E)- and (Z)-(3-{sup 2}H)PEP with A 5-P in the presence of KDO 8-P synthase, demonstrated that the reaction is stereospecific with respect to both the C3 of PEP and the C1 carbonyl of A 5-P. (Z)-(3-{sup 2}H)PEP gave predominantly (3S)-(3{sup 2}H)KDO 8-P and (E)-(3-{sup 2}H)PEP gave predominantly (3R)-(3{sup 2}H)KDO-8P, which indicates condensation of the si face of PEP upon the re face of A 5-P-an orientation analogous to that seen with the similar aldehyde Iyase DAH 7-P synthase. The fate of the enolic oxygen of (2-{sup 13}C, {sup 18}O)PEP, during the course of the KDO 8-P synthase-catalyzed reaction as monitored by both {sup 13}C- and {sup 31}P-NMR spectroscopy demonstrated that the inorganic phosphate (Pi) and not the KDO 8-P contained the {sup 18}O.

  3. Evidence for a cyclic diguanylic acid-dependent cellulose synthase in plants.

    PubMed Central

    Amor, Y; Mayer, R; Benziman, M; Delmer, D

    1991-01-01

    Because numerous attempts to detect an activity for a cellulose synthase in plants have failed, we have taken a different approach toward detecting polypeptides involved in this process. The uniqueness of the structure and function of cyclic diguanylic acid (c-di-GMP) as an activator of the cellulose synthase of the bacterium Acetobacter xylinum makes it an attractive probe to use in a search for a c-di-GMP receptor that might be involved in the process in plants. Direct photolabeling with 32P-c-di-GMP has been used, therefore, to identify in plants two membrane polypeptides of 83 and 48 kD derived from cotton fibers that possess properties consistent with their being components of a c-di-GMP-dependent cellulose synthase. Based upon several criteria, the 48-kD species is proposed to be derived by proteolytic cleavage of the 83-kD polypeptide. Both polypeptides bind c-di-GMP with high affinity and specificity and show antigenic relatedness to the bacterial cellulose synthase, and the N-terminal sequence of the 48-kD polypeptide also indicates relatedness to the bacterial synthase. Ability to detect both cotton fiber polypeptides by photolabeling increases markedly in extracts derived from fibers entering the active phase of secondary wall cellulose synthesis. These results provide a basis for future work aimed at identifying and characterizing genes involved in cellulose synthesis in plants. PMID:1668373

  4. A MUTATION IN A 3-KETO-ACYL-ACP SYNTHASE II GENE IS ASSOCIATED WITH ELEVATED PALMITIC ACID LEVELS IN SOYBEAN SEEDS

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Palmitic acid is the major saturated fatty acid component of soybean [Glycine max, (L.) Merr.] oil, typically accounting for ~11 % of total seed oil content. Several genetic loci have been shown to control the seed palmitate content of soybean. One such locus, fap2, mediates an elevated seed palmit...

  5. [BIOINFORMATIC SEARCH AND PHYLOGENETIC ANALYSIS OF THE CELLULOSE SYNTHASE GENES OF FLAX (LINUM USITATISSIMUM)].

    PubMed

    Pydiura, N A; Bayer, G Ya; Galinousky, D V; Yemets, A I; Pirko, Ya V; Podvitski, T A; Anisimova, N V; Khotyleva, L V; Kilchevsky, A V; Blume, Ya B

    2015-01-01

    A bioinformatic search of sequences encoding cellulose synthase genes in the flax genome, and their comparison to dicots orthologs was carried out. The analysis revealed 32 cellulose synthase gene candidates, 16 of which are highly likely to encode cellulose synthases, and the remaining 16--cellulose synthase-like proteins (Csl). Phylogenetic analysis of gene products of cellulose synthase genes allowed distinguishing 6 groups of cellulose synthase genes of different classes: CesA1/10, CesA3, CesA4, CesA5/6/2/9, CesA7 and CesA8. Paralogous sequences within classes CesA1/10 and CesA5/6/2/9 which are associated with the primary cell wall formation are characterized by a greater similarity within these classes than orthologous sequences. Whereas the genes controlling the biosynthesis of secondary cell wall cellulose form distinct clades: CesA4, CesA7, and CesA8. The analysis of 16 identified flax cellulose synthase gene candidates shows the presence of at least 12 different cellulose synthase gene variants in flax genome which are represented in all six clades of cellulose synthase genes. Thus, at this point genes of all ten known cellulose synthase classes are identify in flax genome, but their correct classification requires additional research. PMID:26638491

  6. Transcriptional regulation of Bacillus subtilis citrate synthase genes.

    PubMed Central

    Jin, S; Sonenshein, A L

    1994-01-01

    The Bacillus subtilis citrate synthase genes citA and citZ were repressed during early exponential growth phase in nutrient broth medium and were induced as cells reached the end of exponential phase. Both genes were also induced by treatment of cells with the drug decoyinine. After induction, the steady-state level of citZ mRNA was about five times higher than that of citA mRNA. At least some of the citZ transcripts read through into the isocitrate dehydrogenase (citC) gene. Transcription from an apparent promoter site located near the 3' end of the citZ gene also contributed to expression of citC. In minimal medium, citA transcription was about 6-fold lower when glucose was the sole carbon source than it was when succinate was the carbon source. Expression of the citZ gene was repressed 2-fold by glucose and 10-fold when glucose and glutamate were present simultaneously. This latter synergistic repression is similar to the effect of glucose and glutamate on steady-state citrate synthase enzyme activity. CitR, a protein of the LysR family, appeared to be a repressor of citA but not of citZ. Images PMID:8045899

  7. Cloning and nucleotide sequence of the gene coding for citrate synthase from a thermotolerant Bacillus sp

    SciTech Connect

    Schendel, F.J.; August, P.R.; Anderson, C.R.; Flickinger, M.C. ); Hanson, R.S. )

    1992-01-01

    Acetate salts are emerging as potentially attractive bulk chemicals for a variety of environmental applications, for example, as catalysts to facilitate combustion of high-sulfur coal by electrical utilities and as the biodegradable noncorrosive highway deicing salt calcium magnesium acetate. The structural gene coding for citrate synthase from the gram-positive soil isolate Bacillus sp. strain C4 (ATCC 55182) capable of secreting acetic acid at pH 5.0 to 7.0 in the presence of dolime has been cloned from a genomic library by complementation of an Escherichia coli auxotrophic mutant lacking citrate synthase. The nucleotide sequence of the entire 3.1-kb HindIII fragment has been determined, and one major open reading frame was found coding for citrate synthase (ctsA). Citrate synthase from Bacillus sp. strain C4 was found to be a dimer (M{sub r}, 84,500) with a sub unit with an M{sub r} of 42,000. The N-terminal sequence was found to be identical with that predicted from the gene sequence. The kinetics were best fit to a bisubstrate enzyme with an ordered mechanism. Bacillus sp. strain C4 citrate synthase was not activated by potassium chloride and was not inhibited by NADH, ATP, ADP, or AMP at levels up to 1 mM. The predicted amino acid sequence was compared with that of the E. coli, Acinetobacter anitratum, Pseudomonas aeruginosa, Rickettsia prowazekii, porcine heart, and Saccharomyces cerevisiae cytoplasmic and mitochondrial enzymes.

  8. Arabidopsis MYC2 Interacts with DELLA Proteins in Regulating Sesquiterpene Synthase Gene Expression[W][OA

    PubMed Central

    Hong, Gao-Jie; Xue, Xue-Yi; Mao, Ying-Bo; Wang, Ling-Jian; Chen, Xiao-Ya

    2012-01-01

    Arabidopsis thaliana flowers emit volatile terpenes, which may function in plant–insect interactions. Here, we report that Arabidopsis MYC2, a basic helix-loop-helix transcription factor, directly binds to promoters of the sesquiterpene synthase genes TPS21 and TPS11 and activates their expression. Expression of TPS21 and TPS11 can be induced by the phytohormones gibberellin (GA) and jasmonate (JA), and both inductions require MYC2. The induction of TPS21 and TPS11 results in increased emission of sesquiterpene, especially (E)-β-caryophyllene. DELLAs, the GA signaling repressors, negatively affect sesquiterpene biosynthesis, as the sesquiterpene synthase genes were repressed in plants overaccumulating REPRESSOR OF GA1-3 (RGA), one of the Arabidopsis DELLAs, and upregulated in a penta DELLA-deficient mutant. Yeast two-hybrid and coimmunoprecipitation assays demonstrated that DELLAs, represented by RGA, directly interact with MYC2. In yeast cells, the N terminus of MYC2 was responsible for binding to RGA. MYC2 has been proposed as a major mediator of JA signaling and crosstalk with abscisic acid, ethylene, and light signaling pathways. Our results demonstrate that MYC2 is also connected to GA signaling in regulating a subset of genes. In Arabidopsis inflorescences, it integrates both GA and JA signals into transcriptional regulation of sesquiterpene synthase genes and promotes sesquiterpene production. PMID:22669881

  9. Subcellular localization of dinoflagellate polyketide synthases and fatty acid synthase activity.

    PubMed

    Van Dolah, Frances M; Zippay, Mackenzie L; Pezzolesi, Laura; Rein, Kathleen S; Johnson, Jillian G; Morey, Jeanine S; Wang, Zhihong; Pistocchi, Rossella

    2013-12-01

    Dinoflagellates are prolific producers of polyketide secondary metabolites. Dinoflagellate polyketide synthases (PKSs) have sequence similarity to Type I PKSs, megasynthases that encode all catalytic domains on a single polypeptide. However, in dinoflagellate PKSs identified to date, each catalytic domain resides on a separate transcript, suggesting multiprotein complexes similar to Type II PKSs. Here, we provide evidence through coimmunoprecipitation that single-domain ketosynthase and ketoreductase proteins interact, suggesting a predicted multiprotein complex. In Karenia brevis (C.C. Davis) Gert Hansen & Ø. Moestrup, previously observed chloroplast localization of PKSs suggested that brevetoxin biosynthesis may take place in the chloroplast. Here, we report that PKSs are present in both cytosol and chloroplast. Furthermore, brevetoxin is not present in isolated chloroplasts, raising the question of what chloroplast-localized PKS enzymes might be doing. Antibodies to K. brevis PKSs recognize cytosolic and chloroplast proteins in Ostreopsis cf. ovata Fukuyo, and Coolia monotis Meunier, which produce different suites of polyketide toxins, suggesting that these PKSs may share common pathways. Since PKSs are closely related to fatty acid synthases (FAS), we sought to determine if fatty acid biosynthesis colocalizes with either chloroplast or cytosolic PKSs. [(3) H]acetate labeling showed fatty acids are synthesized in the cytosol, with little incorporation in chloroplasts, consistent with a Type I FAS system. However, although 29 sequences in a K. brevis expressed sequence tag database have similarity (BLASTx e-value <10(-10) ) to PKSs, no transcripts for either Type I (cytosolic) or Type II (chloroplast) FAS are present. Further characterization of the FAS complexes may help to elucidate the functions of the PKS enzymes identified in dinoflagellates. PMID:27007632

  10. 7-deoxyloganetic acid synthase catalyzes a key 3 step oxidation to form 7-deoxyloganetic acid in Catharanthus roseus iridoid biosynthesis.

    PubMed

    Salim, Vonny; Wiens, Brent; Masada-Atsumi, Sayaka; Yu, Fang; De Luca, Vincenzo

    2014-05-01

    Iridoids are key intermediates required for the biosynthesis of monoterpenoid indole alkaloids (MIAs), as well as quinoline alkaloids. Although most iridoid biosynthetic genes have been identified, one remaining three step oxidation required to form the carboxyl group of 7-deoxyloganetic acid has yet to be characterized. Here, it is reported that virus-induced gene silencing of 7-deoxyloganetic acid synthase (7DLS, CYP76A26) in Catharanthus roseus greatly decreased levels of secologanin and the major MIAs, catharanthine and vindoline in silenced leaves. Functional expression of this gene in Saccharomyces cerevisiae confirmed its function as an authentic 7DLS that catalyzes the 3 step oxidation of iridodial-nepetalactol to form 7-deoxyloganetic acid. The identification of CYP76A26 removes a key bottleneck for expression of iridoid and related MIA pathways in various biological backgrounds. PMID:24594312

  11. Cloning, sequencing, and enhanced expression of the dihydropteroate synthase gene of Escherichia coli MC4100.

    PubMed Central

    Dallas, W S; Gowen, J E; Ray, P H; Cox, M J; Dev, I K

    1992-01-01

    The Escherichia coli gene coding for dihydropteroate synthase (DHPS) has been cloned and sequenced. The protein has 282 amino acids and a compositional molecular mass of 30,314 daltons. Increased expression of the enzyme was realized by using a T7 expression system. The enzyme was purified and crystallized. A temperature-sensitive mutant was isolated and found to express a DHPS with a lower specific activity and lower affinities for para-aminobenzoic acid and sulfathiazole. The allele had a point mutation that changed a phenylalanine codon to a leucine codon, and the mutation was in a codon that is conserved among published DHPS sequences. Images PMID:1522070

  12. Binding Modes of Zaragozic Acid A to Human Squalene Synthase and Staphylococcal Dehydrosqualene Synthase*

    PubMed Central

    Liu, Chia-I; Jeng, Wen-Yih; Chang, Wei-Jung; Ko, Tzu-Ping; Wang, Andrew H.-J.

    2012-01-01

    Zaragozic acids (ZAs) belong to a family of fungal metabolites with nanomolar inhibitory activity toward squalene synthase (SQS). The enzyme catalyzes the committed step of sterol synthesis and has attracted attention as a potential target for antilipogenic and antiinfective therapies. Here, we have determined the structure of ZA-A complexed with human SQS. ZA-A binding induces a local conformational change in the substrate binding site, and its C-6 acyl group also extends over to the cofactor binding cavity. In addition, ZA-A effectively inhibits a homologous bacterial enzyme, dehydrosqualene synthase (CrtM), which synthesizes the precursor of staphyloxanthin in Staphylococcus aureus to cope with oxidative stress. Size reduction at Tyr248 in CrtM further increases the ZA-A binding affinity, and it reveals a similar overall inhibitor binding mode to that of human SQS/ZA-A except for the C-6 acyl group. These structures pave the way for further improving selectivity and development of a new generation of anticholesterolemic and antimicrobial inhibitors. PMID:22474324

  13. Binding modes of zaragozic acid A to human squalene synthase and staphylococcal dehydrosqualene synthase.

    PubMed

    Liu, Chia-I; Jeng, Wen-Yih; Chang, Wei-Jung; Ko, Tzu-Ping; Wang, Andrew H-J

    2012-05-25

    Zaragozic acids (ZAs) belong to a family of fungal metabolites with nanomolar inhibitory activity toward squalene synthase (SQS). The enzyme catalyzes the committed step of sterol synthesis and has attracted attention as a potential target for antilipogenic and antiinfective therapies. Here, we have determined the structure of ZA-A complexed with human SQS. ZA-A binding induces a local conformational change in the substrate binding site, and its C-6 acyl group also extends over to the cofactor binding cavity. In addition, ZA-A effectively inhibits a homologous bacterial enzyme, dehydrosqualene synthase (CrtM), which synthesizes the precursor of staphyloxanthin in Staphylococcus aureus to cope with oxidative stress. Size reduction at Tyr(248) in CrtM further increases the ZA-A binding affinity, and it reveals a similar overall inhibitor binding mode to that of human SQS/ZA-A except for the C-6 acyl group. These structures pave the way for further improving selectivity and development of a new generation of anticholesterolemic and antimicrobial inhibitors. PMID:22474324

  14. Nitroaromatic amino acids as inhibitors of neuronal nitric oxide synthase.

    PubMed

    Cowart, M; Kowaluk, E A; Daanen, J F; Kohlhaas, K L; Alexander, K M; Wagenaar, F L; Kerwin, J F

    1998-07-01

    Nitric oxide (NO.) is an important biomodulator of many physiological processes. The inhibition of inappropriate production of NO. by the isoforms of nitric oxide synthase (NOS) has been proposed as a therapeutic approach for the treatment of stroke, inflammation, and other processes. In this study, certain 2-nitroaryl-substituted amino acid analogues were discovered to inhibit NOS. Analogues bearing a 5-methyl substituent on the aromatic ring demonstrated maximal inhibitory potency. For two selected inhibitors, investigation of the kinetics of the enzyme showed the inhibition to be competitive with l-arginine. Additionally, functional NOS inhibition in tissue preparations was demonstrated. PMID:9651169

  15. Evolutionary Dynamics of the Cellulose Synthase Gene Superfamily in Grasses1[OPEN

    PubMed Central

    Schwerdt, Julian G.; Wright, Frank; Oehme, Daniel; Wagner, John M.; Shirley, Neil J.; Burton, Rachel A.; Schreiber, Miriam; Zimmer, Jochen; Marshall, David F.; Waugh, Robbie; Fincher, Geoffrey B.

    2015-01-01

    Phylogenetic analyses of cellulose synthase (CesA) and cellulose synthase-like (Csl) families from the cellulose synthase gene superfamily were used to reconstruct their evolutionary origins and selection histories. Counterintuitively, genes encoding primary cell wall CesAs have undergone extensive expansion and diversification following an ancestral duplication from a secondary cell wall-associated CesA. Selection pressure across entire CesA and Csl clades appears to be low, but this conceals considerable variation within individual clades. Genes in the CslF clade are of particular interest because some mediate the synthesis of (1,3;1,4)-β-glucan, a polysaccharide characteristic of the evolutionarily successful grasses that is not widely distributed elsewhere in the plant kingdom. The phylogeny suggests that duplication of either CslF6 and/or CslF7 produced the ancestor of a highly conserved cluster of CslF genes that remain located in syntenic regions of all the grass genomes examined. A CslF6-specific insert encoding approximately 55 amino acid residues has subsequently been incorporated into the gene, or possibly lost from other CslFs, and the CslF7 clade has undergone a significant long-term shift in selection pressure. Homology modeling and molecular dynamics of the CslF6 protein were used to define the three-dimensional dispositions of individual amino acids that are subject to strong ongoing selection, together with the position of the conserved 55-amino acid insert that is known to influence the amounts and fine structures of (1,3;1,4)-β-glucans synthesized. These wall polysaccharides are attracting renewed interest because of their central roles as sources of dietary fiber in human health and for the generation of renewable liquid biofuels. PMID:25999407

  16. The type I fatty acid and polyketide synthases: a tale of two megasynthases

    PubMed Central

    Tsai, Shiou-Chuan

    2008-01-01

    This review chronicles the synergistic growth of the fields of fatty acid and polyketide synthesis over the last century. In both animal fatty acid synthases and modular polyketide synthases, similar catalytic elements are covalently linked in the same order in megasynthases. Whereas in fatty acid synthases the basic elements of the design remain immutable, guaranteeing the faithful production of saturated fatty acids, in the modular polyketide synthases, the potential of the basic design has been exploited to the full for the elaboration of a wide range of secondary metabolites of extraordinary structural diversity. PMID:17898897

  17. Salmonella typhimurium mutants defective in acetohydroxy acid synthases I and II.

    PubMed

    Shaw, K J; Berg, C M; Sobol, T J

    1980-03-01

    An analysis of transposon-induced mutants shows that Salmonella typhimurium possesses two major isozymes of acetohydroxy acid synthase, the enzymes which mediate the first common step in isoleucine and valine biosynthesis. A third (minor) acetohydroxy acid synthase is present, but its significance in isoleucine and valine synthesis may be negligible. Mutants defective in acetohydroxy acid synthase II (ilvG::Tn10) require isoleucine, alpha-ketobutyrate, or threonine for growth, a mutant defective in acetohydroxy acid synthase I (ilvB::Tn5) is a prototroph, and a double mutant (ilvG::Tn10 ilvB::Tn5) requires isoleucine plus valine for growth. PMID:6245063

  18. Surrogate Splicing for Functional Analysis of Sesquiterpene Synthase Genes1[w

    PubMed Central

    Wu, Shuiqin; Schoenbeck, Mark A.; Greenhagen, Bryan T.; Takahashi, Shunji; Lee, Sungbeom; Coates, Robert M.; Chappell, Joseph

    2005-01-01

    A method for the recovery of full-length cDNAs from predicted terpene synthase genes containing introns is described. The approach utilizes Agrobacterium-mediated transient expression coupled with a reverse transcription-polydeoxyribonucleotide chain reaction assay to facilitate expression cloning of processed transcripts. Subsequent expression of intronless cDNAs in a suitable prokaryotic host provides for direct functional testing of the encoded gene product. The method was optimized by examining the expression of an intron-containing β-glucuronidase gene agroinfiltrated into petunia (Petunia hybrida) leaves, and its utility was demonstrated by defining the function of two previously uncharacterized terpene synthases. A tobacco (Nicotiana tabacum) terpene synthase-like gene containing six predicted introns was characterized as having 5-epi-aristolochene synthase activity, while an Arabidopsis (Arabidopsis thaliana) gene previously annotated as a terpene synthase was shown to possess a novel sesquiterpene synthase activity for α-barbatene, thujopsene, and β-chamigrene biosynthesis. PMID:15965019

  19. Bacterial delta-aminolevulinic acid synthase activity is not essential for leghemoglobin formation in the soybean/Bradyrhizobium japonicum symbiosis

    SciTech Connect

    Guerinot, M.L.; Chelm, B.K.

    1986-03-01

    Previous studies of legume nodules have indicated that formation of the heme moiety of leghemoglobin is a function of the bacterial symbiont. The authors now show that a hemA mutant of Bradyrhizobium japonicum that cannot carry out the first step in heme biosynthesis forms fully effective nodules on soybeans. The bacterial mutant strain was constructed by first isolated the wild-type hemA gene encoding delta-aminolevulinic acid synthase (EC 2.3.1.37) from a cosmid library, using a fragment of the Rhizobium meliloti hemA gene as a hybridization probe. A deletion of the hemA gene region, generated in vitro, then was used to construct the analogous chromosomal mutation by gene-directed mutagenesis. The mutant strain had no delta-aminolevulinic acid synthase activity and was unable to grow in minimal medium unless delta-aminolevulinic acid was added. Despite its auxotrophy, the mutant strain incited nodules that appeared normal, contained heme, and were capable of high levels of acetylene reduction. These results rule out bacterial delta-aminolevulinic acid synthase activity as the exclusive source of delta-aminolevulinic acid for heme formation in soybean nodules.

  20. Arabidopsis peroxisomal citrate synthase is required for fatty acid respiration and seed germination.

    PubMed

    Pracharoenwattana, Itsara; Cornah, Johanna E; Smith, Steven M

    2005-07-01

    We tested the hypothesis that peroxisomal citrate synthase (CSY) is required for carbon transfer from peroxisomes to mitochondria during respiration of triacylglycerol in Arabidopsis thaliana seedlings. Two genes encoding peroxisomal CSY are expressed in Arabidopsis seedlings, and seeds from plants with both CSY genes disrupted were dormant and did not metabolize triacylglycerol. Germination was achieved by removing the seed coat and supplying sucrose, but the seedlings still did not use triacylglycerol. The mutant seedlings were resistant to 2,4-dichlorophenoxybutyric acid, indicating a block in peroxisomal beta-oxidation, and were unable to develop further after transfer to soil. The mutant phenotype was complemented with a cDNA encoding CSY with either its native peroxisomal targeting sequence (PTS2) or a heterologous PTS1 sequence from pumpkin (Cucurbita pepo) malate synthase. These results suggest that peroxisomal CSY in Arabidopsis is not only a key enzyme of the glyoxylate cycle but also catalyzes an essential step in the respiration of fatty acids. We conclude that citrate is exported from the peroxisome during fatty acid respiration, whereas in yeast, acetylcarnitine is exported. PMID:15923350

  1. Identification and characterization of two chitin synthase genes in African malaria mosquito, Anopheles gambiae.

    PubMed

    Zhang, Xin; Zhang, Jianzhen; Park, Yoonseong; Zhu, Kun Yan

    2012-09-01

    Chitin synthase (CHS) represents an attractive target site for combating insect pests as insect growth and development are strictly dependent on precisely tuned chitin biosynthesis and this pathway is absent in humans and other vertebrates. Current knowledge on CHS in insects, especially their structures, functions, and regulations is still very limited. We report the identification and characterization of two chitin synthase genes, AgCHS1 and AgCHS2, in African malaria mosquito, Anopheles gambiae. AgCHS1 and AgCHS2 were predicted to encode proteins of 1,578 and 1,586 amino acid residues, respectively. Their deduced amino acid sequences show high similarities to other insect chitin synthases. Transcriptional analysis indicated that AgCHS1 was expressed in egg, larval, pupal and adult stages whereas AgCHS2 appeared to be expressed at relatively low levels, particularly during the larval stages as examined by reverse transcription (RT)-PCR and real-time quantitative PCR. Relatively high expression was detected in the carcass followed by the foregut and hindgut for AgCHS1, and the foregut (cardia included) followed by the midgut for AgCHS2. Fluorescence in situ hybridization (FISH) and immunohistochemical analysis revealed new information including the localization of the two enzymes in the ommatidia of the compound eyes, and AgCHS2 in the thoracic and abdominal inter-segmental regions of pupal integument. PMID:22683441

  2. Cloning and characterisation of rosmarinic acid synthase from Melissa officinalis L.

    PubMed

    Weitzel, Corinna; Petersen, Maike

    2011-05-01

    Lemon balm (Melissa officinalis L.; Lamiaceae) is a well-known medicinal plant mainly due to two groups of compounds, the essential oil and the phenylpropanoid derivatives. The prominent phenolic compound is rosmarinic acid (RA), an ester of caffeic acid and 3,4-dihydroxyphenyllactic acid. RA shows a number of interesting biological activities. Rosmarinic acid synthase (RAS; 4-coumaroyl-CoA:hydroxyphenyllactic acid hydroxycinnamoyltransferase) catalyses the ester formation. Cell cultures of M. officinalis have been established in order to characterise the formation of RA in an important diploid medicinal plant. RAS activity as well as the expression of the RAS gene are closely correlated with the accumulation of RA in suspension cultures of M. officinalis. The RAS cDNA and gene (MoRAS) were isolated. The RAS gene was shown to be intron-free. MoRAS belongs to the BAHD superfamily of acyltransferases. Southern-blot analysis suggests the presence of only one RAS gene copy in the M. officinalis genome. The enzyme was characterised with respect to enzyme properties, substrate preferences and kinetic data in crude plant extracts and as heterologously synthesised protein from Escherichia coli. PMID:21354582

  3. Fatty Acid Synthase Impacts the Pathobiology of Candida parapsilosis In Vitro and during Mammalian Infection

    PubMed Central

    Nguyen, Long Nam; Trofa, David; Nosanchuk, Joshua D.

    2009-01-01

    Cytosolic fungal fatty acid synthase is composed of two subunits α and β, which are encoded by Fas1 and Fas2 genes. In this study, the Fas2 genes of the human pathogen Candida parapsilosis were deleted using a modified SAT1 flipper technique. CpFas2 was essential in media lacking exogenous fatty acids and the growth of Fas2 disruptants (Fas2 KO) was regulated by the supplementation of different long chain fatty acids, such as myristic acid (14∶0), palmitic acid (16∶0), and Tween 80, in a dose-specific manner. Lipidomic analysis revealed that Fas2 KO cells were severely restricted in production of unsaturated fatty acids. The Fas2 KO strains were unable to form normal biofilms and were more efficiently killed by murine-like macrophages, J774.16, than the wild type, heterozygous and reconstituted strains. Furthermore, Fas2 KO yeast were significantly less virulent in a systemic murine infection model. The Fas2 KO cells were also hypersensitive to human serum, and inhibition of CpFas2 in WT C. parapsilosis by cerulenin significantly decreased fungal growth in human serum. This study demonstrates that CpFas2 is essential for C. parapsilosis growth in the absence of exogenous fatty acids, is involved in unsaturated fatty acid production, influences fungal virulence, and represents a promising antifungal drug target. PMID:20027295

  4. Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

    PubMed

    Noar, Roslyn D; Daub, Margaret E

    2016-01-01

    Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity) for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity) to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that they may encode

  5. Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis

    PubMed Central

    Noar, Roslyn D.; Daub, Margaret E.

    2016-01-01

    Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity) for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity) to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that they may encode

  6. Expression of Allene Oxide Synthase Determines Defense Gene Activation in Tomato1

    PubMed Central

    Sivasankar, Sobhana; Sheldrick, Bay; Rothstein, Steven J.

    2000-01-01

    Allene oxide synthase (AOS; hydroperoxide dehydratase; EC 4.2.1.92) catalyzes the first step in the biosynthesis of jasmonic acid from lipoxygenase-derived hydroperoxides of free fatty acids. Using the AOS cDNA from tomato (Lycopersicon esculentum), in which the role of jasmonic acid in wound-induced defense gene activation has been best described, we examined the kinetics of AOS induction in response to wounding and elicitors, in parallel with that of the wound-inducible PIN II (proteinase inhibitor II) gene. AOS was induced in leaves by wounding, systemin, 12-oxophytodienoic acid, and methyl jasmonate. The levels of AOS mRNA started declining by 4 h after induction, whereas the levels of PIN II mRNA continued to increase up to 20 h after induction. Salicylic acid inhibited AOS and PIN II expression, and the addition of 12-oxophytodienoic acid or methyl jasmonate did not prevent the inhibition of PIN II expression in the presence of salicylic acid. Ethylene induced the expression of AOS, but the presence of ethylene alone did not produce an optimal induction of PIN II. The addition of silver thiosulfate, an ethylene action inhibitor, prevented the wound-induced expression of both AOS and PIN II. Products of hydroperoxide lyase affected neither AOS nor PIN II, but induced expression of prosystemin. Based on these results, we propose an updated model for defense gene activation in tomato. PMID:10759530

  7. Total synthesis of the squalene synthase inhibitor zaragozic acid C.

    PubMed

    Nakamura, Seiichi

    2005-01-01

    Zaragozic acids and squalestatins were documented by Merck, Glaxo, and Tokyo Noko University/Mitsubishi Kasei Corporation as part of a program aimed at identifying novel inhibitors of squalene synthase, as well as farnesyl transferase. These natural products have attracted considerable attention from numerous synthetic chemists because of their therapeutic potential and novel architecture. This review highlights our total syntheses of zaragozic acid C by two convergent strategies. The key steps in our first-generation synthesis involve 1) simultaneous creation of the C4 and C5 quaternary stereocenters through the Sn(OTf)2-promoted aldol coupling reaction between the alpha-keto ester and silyl ketene thioacetal derived from L- and D-tartaric acids, respectively; and 2) construction of the bicyclic core structure via acid-catalyzed internal ketalization under kinetically controlled conditions. The second-generation strategy relies on a tandem carbonyl ylide formation/1,3-dipolar cycloaddition approach and features elongation of the C1 alkyl side chain through an olefin cross-metathesis as well as high convergency and flexibility. PMID:15635219

  8. Fatty Acid Synthase Inhibitor C75 Ameliorates Experimental Colitis

    PubMed Central

    Matsuo, Shingo; Yang, Weng-Lang; Aziz, Monowar; Kameoka, Shingo; Wang, Ping

    2014-01-01

    Abnormalities of lipid metabolism through overexpression of fatty acid synthase (FASN), which catalyzes the formation of long-chain fatty acids, are associated with the development of inflammatory bowel disease (IBD). C75 is a synthetic α-methylene-γ-butyrolactone compound that inhibits FASN activity. We hypothesized that C75 treatment could effectively reduce the severity of experimental colitis. Male C57BL/6 mice were fed 4% dextran sodium sulfate (DSS) for 7 d. C75 (5 mg/kg body weight) or dimethyl sulfoxide (DMSO) (vehicle) was administered intraperitoneally from d 2 to 6. Clinical parameters were monitored daily. Mice were euthanized on d 8 for histological evaluation and measurements of colon length, chemokine, cytokine and inflammatory mediator expression. C75 significantly reduced body weight loss from 23% to 15% on d 8, compared with the vehicle group. The fecal bleeding, diarrhea and colon histological damage scores in the C75-treated group were significantly lower than scores in the vehicle animals. Colon shortening was significantly improved after C75 treatment. C75 protected colon tissues from DSS-induced apoptosis by inhibiting caspase-3 activity. Macrophage inflammatory protein 2, keratinocyte-derived chemokine, myeloperoxidase activity and proinflammatory cytokines (tumor necrosis factor-α, interleukin [IL]-1β and IL-6) in the colon were significantly downregulated in the C75-treated group, compared with the vehicle group. Treatment with C75 in colitis mice inhibited the elevation of FASN, cyclooxygenase-2 and inducible nitric oxide synthase expression as well as IκB degradation in colon tissues. C75 administration alleviates the severity of colon damage and inhibits the activation of inflammatory pathways in DSS-induced colitis. Thus, inhibition of FASN may represent an attractive therapeutic potential for treating IBD. PMID:24306512

  9. Differential expression of biphenyl synthase gene family members in fire-blight-infected apple 'Holsteiner Cox'.

    PubMed

    Chizzali, Cornelia; Gaid, Mariam M; Belkheir, Asma K; Hänsch, Robert; Richter, Klaus; Flachowsky, Henryk; Peil, Andreas; Hanke, Magda-Viola; Liu, Benye; Beerhues, Ludger

    2012-02-01

    Fire blight, caused by the bacterium Erwinia amylovora, is a devastating disease of apple (Malus × domestica). The phytoalexins of apple are biphenyls and dibenzofurans, whose carbon skeleton is formed by biphenyl synthase (BIS), a type III polyketide synthase. In the recently published genome sequence of apple 'Golden Delicious', nine BIS genes and four BIS gene fragments were detected. The nine genes fall into four subfamilies, referred to as MdBIS1 to MdBIS4. In a phylogenetic tree, the BIS amino acid sequences from apple and Sorbus aucuparia formed an individual cluster within the clade of the functionally diverse type III polyketide synthases. cDNAs encoding MdBIS1 to MdBIS4 were cloned from fire-blight-infected shoots of apple 'Holsteiner Cox,' heterologously expressed in Escherichia coli, and functionally analyzed. Benzoyl-coenzyme A and salicoyl-coenzyme A were the preferred starter substrates. In response to inoculation with E. amylovora, the BIS3 gene was expressed in stems of cv Holsteiner Cox, with highest transcript levels in the transition zone between necrotic and healthy tissues. The transition zone was the accumulation site of biphenyl and dibenzofuran phytoalexins. Leaves contained transcripts for BIS2 but failed to form immunodetectable amounts of BIS protein. In cell cultures of apple 'Cox Orange,' expression of the BIS1 to BIS3 genes was observed after the addition of an autoclaved E. amylovora suspension. Using immunofluorescence localization under a confocal laser-scanning microscope, the BIS3 protein in the transition zone of stems was detected in the parenchyma of the bark. Dot-shaped immunofluorescence was confined to the junctions between neighboring cortical parenchyma cells. PMID:22158676

  10. Quinic acids from Aster caucasicus and from transgenic callus expressing a beta-amyrin synthase.

    PubMed

    Pecchia, Paola; Cammareri, Maria; Malafronte, Nicola; Consiglio, M Federica; Gualtieri, Maria Josefina; Conicella, Clara

    2011-11-01

    Several different classes of secondary metabolites, including flavonoids, triterpenoid saponins and quinic acid derivatives, are found in Aster spp. (Fam. Asteraceae). Several Aster compounds revealed biological as well as pharmacological activities. In this work, a phytochemical investigation of A. caucasicus evidenced the presence of quinic acid derivatives, as well as the absence of triterpene saponins. To combine in one species the production of different phytochemicals, including triterpenes, an Agrobacterium-mediated transformation of A. caucasicus was set up to introduce A. sedifolius beta-amyrin synthase (AsOXA1)-encoding gene under the control of the constitutive promoter CaMV35S. The quali-quantitative analysis of transgenic calli with ectopic expression of AsOXA1 showed, in one sample, a negligible amount of triterpene saponins combined with higher amount of quinic acid derivatives as compared with the wild type callus. PMID:22224284

  11. Anti-cancer drugs targeting fatty acid synthase (FAS).

    PubMed

    Pandey, Puspa R; Liu, Wen; Xing, Fei; Fukuda, Koji; Watabe, Kounosuke

    2012-05-01

    Fatty acid synthase (FAS) is a key enzyme of the fatty acid biosynthetic pathway which catalyzes de novo lipid synthesis. FAS expression in normal adult tissues is generally very low or undetectable as majority of fatty acids obtained are from dietary sources, whereas it is significantly upregulated in cancer cells despite adequate nutritional lipid supply. Activation of FAS provides rapidly proliferating tumor cells sufficient amount of lipids for membrane biogenesis and confers growth and survival advantage possibly acting as a metabolic oncogene. Importantly, inhibition of FAS in cancer cells using the pharmacological FAS inhibitors results in tumor cell death by apoptosis whereas normal cells are resistant. Due to this differential expression of FAS, the inhibitors of this enzyme are selectively toxic to tumor cells and therefore FAS is considered an attractive therapeutic target for cancer. Several FAS inhibitors are already patented and commercially available; however, the potential toxicity of these FAS inhibitors remains to be tested in clinical trials. In this review, we discuss some of the potent FAS inhibitors along with their patent information, the mechanism of anti-cancer effects and the development of more specific and potent FAS inhibitors with lower side effects that are expected to emerge as anti-cancer treatment in the near future. PMID:22338595

  12. Coexpressing Escherichia coli cyclopropane synthase with Sterculia foetida Lysophosphatidic acid acyltransferase enhances cyclopropane fatty acid accumulation.

    PubMed

    Yu, Xiao-Hong; Prakash, Richa Rawat; Sweet, Marie; Shanklin, John

    2014-01-01

    Cyclopropane fatty acids (CPAs) are desirable as renewable chemical feedstocks for the production of paints, plastics, and lubricants. Toward our goal of creating a CPA-accumulating crop, we expressed nine higher plant cyclopropane synthase (CPS) enzymes in the seeds of fad2fae1 Arabidopsis (Arabidopsis thaliana) and observed accumulation of less than 1% CPA. Surprisingly, expression of the Escherichia coli CPS gene resulted in the accumulation of up to 9.1% CPA in the seed. Coexpression of a Sterculia foetida lysophosphatidic acid acyltransferase (SfLPAT) increases CPA accumulation up to 35% in individual T1 seeds. However, seeds with more than 9% CPA exhibit wrinkled seed morphology and reduced size and oil accumulation. Seeds with more than 11% CPA exhibit strongly decreased seed germination and establishment, and no seeds with CPA more than 15% germinated. That previous reports suggest that plant CPS prefers the stereospecific numbering (sn)-1 position whereas E. coli CPS acts on sn-2 of phospholipids prompted us to investigate the preferred positions of CPS on phosphatidylcholine (PC) and triacylglycerol. Unexpectedly, in planta, E. coli CPS acts primarily on the sn-1 position of PC; coexpression of SfLPAT results in the incorporation of CPA at the sn-2 position of lysophosphatidic acid. This enables a cycle that enriches CPA at both sn-1 and sn-2 positions of PC and results in increased accumulation of CPA. These data provide proof of principle that CPA can accumulate to high levels in transgenic seeds and sets the stage for the identification of factors that will facilitate the movement of CPA from PC into triacylglycerol to produce viable seeds with additional CPA accumulation. PMID:24204024

  13. Transcriptional regulation of the Arabidopsis thaliana chalcone synthase gene

    SciTech Connect

    Feinbaum, R.L.; Ausubel, F.M.

    1988-05-01

    The authors cloned an Arabiodpsis thaliana chalcone synthase (CHS) gene on the basis of cross-hybridization with a Petroselinum hortense CHS cDNA clone. The protein sequence deduced from the A. thaliana CHS DNA sequence is at least 85% homologous to the CHS sequences from P. hortense, Antirrhinum majus, and Petunia hybrida. Southern blot analysis indicated that CHS is a single-copy gene in A. thaliana. High-intensity light treatment of A. thaliana plants for 24 h caused a 50-fold increase in CHS enzyme activity and an accumulation of visibly detectable levels of anthocyanin pigments in the vegetative structures of these plants. A corresponding increase in the steady-state level of CHS mRNA was detected after high-intensity light treatment for the same period of time. The accumulation of CHS mRNA in response to high-intensity light was due, at least in part, to an increased rate of transcription of the CHS gene as demonstrated by nuclear runoff experiment.

  14. Expression of fatty acid synthase in nonalcoholic fatty liver disease

    PubMed Central

    Dorn, Christoph; Riener, Marc-Oliver; Kirovski, Georgi; Saugspier, Michael; Steib, Kathrin; Weiss, Thomas S; Gäbele, Erwin; Kristiansen, Glen; Hartmann, Arndt; Hellerbrand, Claus

    2010-01-01

    Nonalcoholic fatty liver disease (NAFLD) is characterized by hepatic lipid accumulation which starts with simple hepatic steatosis and may progress toward inflammation (nonalcoholic steatohepatitis [NASH]). Fatty acid synthase (FASN) catalyzes the last step in fatty acid biosynthesis, and thus, it is believed to be a major determinant of the maximal hepatic capacity to generate fatty acids by de novo lipogenesis. The aim of this study was to analyze the correlation between hepatic steatosis and inflammation with FASN expression. In vitro incubation of primary human hepatocytes with fatty acids dose-dependently induced cellular lipid-accumulation and FASN expression, while stimulation with TNF did not affect FASN levels. Further, hepatic FASN expression was significantly increased in vivo in a murine model of hepatic steatosis without significant inflammation but not in a murine NASH model as compared to control mice. Also, FASN expression was not increased in mice subjected to bile duct ligation, an experimental model characterized by severe hepatocellular damage and inflammation. Furthermore, FASN expression was analyzed in 102 human control or NAFLD livers applying tissue micro array technology and immunohistochemistry, and correlated significantly with the degree of hepatic steatosis, but not with inflammation or ballooning of hepatocytes. Quantification of FASN mRNA expression in human liver samples confirmed significantly higher FASN levels in hepatic steatosis but not in NASH, and expression of SREBP1, which is the main transcriptional regulator of FASN, paralleled FASN expression levels in human and experimental NAFLD. In conclusion, the transcriptional induction of FASN expression in hepatic steatosis is impaired in NASH, while hepatic inflammation in the absence of steatosis does not affect FASN expression, suggesting that FASN may serve as a new diagnostic marker or therapeutic target for the progression of NAFLD. PMID:20606731

  15. Expression of fatty acid synthase in nonalcoholic fatty liver disease.

    PubMed

    Dorn, Christoph; Riener, Marc-Oliver; Kirovski, Georgi; Saugspier, Michael; Steib, Kathrin; Weiss, Thomas S; Gäbele, Erwin; Kristiansen, Glen; Hartmann, Arndt; Hellerbrand, Claus

    2010-01-01

    Nonalcoholic fatty liver disease (NAFLD) is characterized by hepatic lipid accumulation which starts with simple hepatic steatosis and may progress toward inflammation (nonalcoholic steatohepatitis [NASH]). Fatty acid synthase (FASN) catalyzes the last step in fatty acid biosynthesis, and thus, it is believed to be a major determinant of the maximal hepatic capacity to generate fatty acids by de novo lipogenesis. The aim of this study was to analyze the correlation between hepatic steatosis and inflammation with FASN expression. In vitro incubation of primary human hepatocytes with fatty acids dose-dependently induced cellular lipid-accumulation and FASN expression, while stimulation with TNF did not affect FASN levels. Further, hepatic FASN expression was significantly increased in vivo in a murine model of hepatic steatosis without significant inflammation but not in a murine NASH model as compared to control mice. Also, FASN expression was not increased in mice subjected to bile duct ligation, an experimental model characterized by severe hepatocellular damage and inflammation. Furthermore, FASN expression was analyzed in 102 human control or NAFLD livers applying tissue micro array technology and immunohistochemistry, and correlated significantly with the degree of hepatic steatosis, but not with inflammation or ballooning of hepatocytes. Quantification of FASN mRNA expression in human liver samples confirmed significantly higher FASN levels in hepatic steatosis but not in NASH, and expression of SREBP1, which is the main transcriptional regulator of FASN, paralleled FASN expression levels in human and experimental NAFLD. In conclusion, the transcriptional induction of FASN expression in hepatic steatosis is impaired in NASH, while hepatic inflammation in the absence of steatosis does not affect FASN expression, suggesting that FASN may serve as a new diagnostic marker or therapeutic target for the progression of NAFLD. PMID:20606731

  16. Human platelet/erythroleukemia cell prostaglandin G/H synthase: cDNA cloning, expression, and gene chromosomal assignment.

    PubMed

    Funk, C D; Funk, L B; Kennedy, M E; Pong, A S; Fitzgerald, G A

    1991-06-01

    Platelets metabolize arachidonic acid to thromboxane A2, a potent platelet aggregator and vasoconstrictor compound. The first step of this transformation is catalyzed by prostaglandin (PG) G/H synthase, a target site for nonsteroidal antiinflammatory drugs. We have isolated the cDNA for both human platelet and human erythroleukemia cell PGG/H synthase using the polymerase chain reaction and conventional screening procedures. The cDNA encoding the full-length protein was expressed in COS-M6 cells. Microsomal fractions from transfected cells produced prostaglandin endoperoxide-derived products which were inhibited by indomethacin and aspirin. Mutagenesis of the serine residue at position 529, the putative aspirin acetylation site, to an asparagine reduced cyclooxygenase activity to barely detectable levels, an effect observed previously with the expressed sheep vesicular gland enzyme. Platelet-derived growth factor and phorbol ester differentially regulated the expression of PGG/H synthase mRNA levels in the megakaryocytic/platelet-like HEL cell line. The PGG/H synthase gene was assigned to chromosome 9 by analysis of a human--hamster somatic hybrid DNA panel. The availability of platelet PGG/H synthase cDNA should enhance our understanding of the important structure/function domains of this protein and its gene regulation. PMID:1907252

  17. Human platelet/erythroleukemia cell prostaglandin G/H synthase: cDNA cloning, expression, and gene chromosomal assignment

    SciTech Connect

    Funk, C.D.; Funk, L.B.; Kennedy, M.E.; Pong, A.S.; Fitzgerald, G.A. )

    1991-06-01

    Platelets metabolize arachidonic acid to thromboxane A{sub 2}, a potent platelet aggregator and vasoconstrictor compound. The first step of this transformation is catalyzed by prostaglandin (PG) G/H synthase, a target site for nonsteroidal antiinflammatory drugs. We have isolated the cDNA for both human platelet and human erythroleukemia cell PGG/H synthase using the polymerase chain reaction and conventional screening procedures. The cDNA encoding the full-length protein was expressed in COS-M6 cells. Microsomal fractions from transfected cells produced prostaglandin endoperoxide derived products which were inhibited by indomethacin and aspirin. Mutagenesis of the serine residue at position 529, the putative aspirin acetylation site, to an asparagine reduced cyclooxygenase activity to barely detectable levels, an effect observed previously with the expressed sheep vesicular gland enzyme. Platelet-derived growth factor and phorbol ester differentially regulated the expression of PGG/H synthase mRNA levels in the megakaryocytic/platelet-like HEL cell line. The PGG/H synthase gene was assigned to chromosome 9 by analysis of a human-hamster somatic hybrid DNA panel. The availability of platelet PGG/H synthase cDNA should enhance our understanding of the important structure/function domains of this protein and it gene regulation.

  18. Mutation of Cellulose Synthase Gene Improves the Nutritive Value of Rice Straw

    PubMed Central

    Su, Yanjing; Zhao, Guoqi; Wei, Zhenwu; Yan, Changjie; Liu, Sujiao

    2012-01-01

    Rice straw is an important roughage resource for ruminants in many rice-producing countries. In this study, a rice brittle mutant (BM, mutation in OsCesA4, encoding cellulose synthase) and its wild type (WT) were employed to investigate the effects of a cellulose synthase gene mutation on rice straw morphological fractions, chemical composition, stem histological structure and in situ digestibility. The morphological fractions investigation showed that BM had a higher leaf sheath proportion (43.70% vs 38.21%, p<0.01) and a lower leaf blade proportion (25.21% vs 32.14%, p<0.01) than WT. Chemical composition analysis showed that BM rice straw was significantly (p<0.01) higher in CP (crude protein), hemicellulose and acid insoluble ash (AIA) contents, but lower in dry matter (DM), acid detergent fiber (ADFom) and cellulose contents when compared to WT. No significant difference (p>0.05) was detected in neutral detergent fiber (NDFom) and ADL contents for both strains. Histological structure observation indicated that BM stems had fewer sclerenchyma cells and a thinner sclerenchyma cell wall than WT. The results of in situ digestion showed that BM had higher DM, NDFom, cellulose and hemicellulose disappearance at 24 or 48 h of incubation (p<0.05). The effective digestibility of BM rice straw DM and NDFom was greater than that of WT (31.4% vs 26.7% for DM, 29.1% vs 24.3% for NDFom, p<0.05), but the rate of digestion of the slowly digested fraction of BM rice straw DM and NDF was decreased. These results indicated that the mutation in the cellulose synthase gene could improve the nutritive value of rice straw for ruminants. PMID:25049629

  19. RNA interference-based gene silencing of phytoene synthase impairs growth, carotenoids, and plastid phenotype in Oncidium hybrid orchid.

    PubMed

    Liu, Jian-Xin; Chiou, Chung-Yi; Shen, Chin-Hui; Chen, Peng-Jen; Liu, Yao-Chung; Jian, Chin-Der; Shen, Xiao-Lan; Shen, Fu-Quan; Yeh, Kai-Wun

    2014-01-01

    Phytoene synthase (PSY) is the first rate-limiting regulatory enzyme in the carotenoid biosynthesis pathway. In order to modify the floral color pattern by reducing carotenoid contents, a phytoene synthase-RNAi construct was delivered into protocorm-like body (PLB) of Oncidium hybrid orchid. The transgenic orchids show down-regulated level of PSY and geranyl synthase gene. They displayed semi-dwarf phenotype and brilliant green leaves. The microscopic anatomy revealed development-arrested plastids with rare grana. The total carotenoid content was decreased and the efficiency of the photosynthetic electron transport was declined. The chlorophyll level and the expression of chlorophyll biosynthetic genes, such as OgGLUTR and OgCS were dramatically reduced. HPLC analysis showed that the endogenous level of gibberellic acid and abscisic acid in the dwarf transformants are 4-fold lower than in wild type plants. In addition, chilling tolerance of the transgenic Oncidium plants was reduced. The data showed that down-regulation of PSY resulted in alterations of gene expression in enzymes involved in many metabolic pathways, such as carotenoid, gibberellic acid, abscisic acid and chlorophyll biosynthetic pathway as well as causes predominant defects in plant growth and development. PMID:25221736

  20. Interspecific Variation in the Promoter Region of A Sucrose Synthase Gene in the Genus Saccharum

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Sucrose synthase is an important enzyme of sucrose metabolism in sugarcane, a polyploid interspecific hybrid of the genus Saccharum. One of the genes for sucrose synthase (Sus2, homologous to maize Sh1) is more highly expressed in sucrose-storing hybrids than in low sucrose S. spontaneum. We amplifi...

  1. MOLECULAR CLONING AND CHARACTERIZATION OF CHROMOSOME-ENCODED CITRATE SYNTHASE GENE FROM SINORHIZOBIUM FREDII USDA257

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Citrate synthase, a key metabolic enzyme that condenses acetyl-CoA and oxaloacetate to citrate, plays an important role in nodulation and nitrogen fixation. We have isolated a citrate synthase gene by screening a Sinorhizobium fredii USDA257 cosmid library with a heterologous probe from S. meliloti....

  2. A gene from the cellulose synthase-like C family encodes a β-1,4 glucan synthase

    PubMed Central

    Cocuron, Jean-Christophe; Lerouxel, Olivier; Drakakaki, Georgia; Alonso, Ana P.; Liepman, Aaron H.; Keegstra, Kenneth; Raikhel, Natasha; Wilkerson, Curtis G.

    2007-01-01

    Despite the central role of xyloglucan (XyG) in plant cell wall structure and function, important details of its biosynthesis are not understood. To identify the gene(s) responsible for synthesizing the β-1,4 glucan backbone of XyG, we exploited a property of nasturtium (Tropaeolum majus) seed development. During the last stages of nasturtium seed maturation, a large amount of XyG is deposited as a reserve polysaccharide. A cDNA library was produced from mRNA isolated during the deposition of XyG, and partial sequences of 10,000 cDNA clones were determined. A single member of the C subfamily from the large family of cellulose synthase-like (CSL) genes was found to be overrepresented in the cDNA library. Heterologous expression of this gene in the yeast Pichia pastoris resulted in the production of a β-1,4 glucan, confirming that the CSLC protein has glucan synthase activity. The Arabidopsis CSLC4 gene, which is the gene with the highest sequence similarity to the nasturtium CSL gene, is coordinately expressed with other genes involved in XyG biosynthesis. These and other observations provide a compelling case that the CSLC gene family encode proteins that synthesize the XyG backbone. PMID:17488821

  3. Isolation of developing secondary xylem specific cellulose synthase genes and their expression profiles during hormone signalling in Eucalyptus tereticornis.

    PubMed

    Sundari, Balachandran Karpaga Raja; Dasgupta, Modhumita Ghosh

    2014-08-01

    Cellulose synthases (CesA) represent a group of β-1, 4 glycosyl transferases involved in cellulose biosynthesis. Recent reports in higher plants have revealed that two groups of CesA gene families exist, which are associated with either primary or secondary cell wall deposition. The present study aimed at identifying developing secondary xylem specific cellulose synthase genes from Eucalyptus tereticornis, a species predominantly used in paper and pulp industries in the tropics. The differential expression analysis of the three EtCesA genes using qRT-PCR revealed 49 to 87 fold relative expression in developing secondary xylem tissues. Three full length gene sequences of EtCesA1, EtCesA2 and EtCesA3 were isolated with the size of 2940, 3114 and 3123 bp, respectively. Phytohormone regulation of all three EtCesA genes were studied by exogenous application of gibberellic acid, naphthalene acetic acid, indole acetic acid and 2, 4-epibrassinolide in internode tissues derived from three-month-old rooted cuttings. All three EtCesA transcripts were upregulated by indole acetic acid and gibberellic acid. This study demonstrates that the increased cellulose deposition in the secondary wood induced by hormones can be attributed to the upregulation of xylem specific CesAs. PMID:25189235

  4. Fatty acid synthase as a potential therapeutic target in cancer

    PubMed Central

    Flavin, Richard; Peluso, Stephane; Nguyen, Paul L; Loda, Massimo

    2011-01-01

    Fatty acid synthase (FASN) is a key enzyme involved in neoplastic lipogenesis. Overexpression of FASN is common in many cancers, and accumulating evidence suggests that it is a metabolic oncogene with an important role in tumor growth and survival, making it an attractive target for cancer therapy. Early small-molecule FASN inhibitors such as cerulenin, C75 and orlistat have been shown to induce apoptosis in several cancer cell lines and to induce tumor growth delay in several cancer xenograft models but their mechanism is still not well understood. These molecules suffer from pharmacological limitations and weight loss as a side effect that prevent their development as systemic drugs. Several potent inhibitors have recently been reported that may help to unravel and exploit the full potential of FASN as a target for cancer therapy in the near future. Furthermore, novel sources of FASN inhibitors, such as green tea and dietary soy, make both dietary manipulation and chemoprevention potential alternative modes of therapy in the future. PMID:20373869

  5. Sugar-Dependent Gibberellin-Induced Chalcone Synthase Gene Expression in Petunia Corollas.

    PubMed Central

    Moalem-Beno, D.; Tamari, G.; Leitner-Dagan, Y.; Borochov, A.; Weiss, D.

    1997-01-01

    The induction of anthocyanin synthesis and anthocyanin biosynthetic gene expression in detached petunia (Petunia hybrida) corollas by gibberellic acid (GA3) requires sucrose. Neither sucrose nor GA3 alone can induce these processes. We found that GA3 enhances sucrose uptake by 20 to 30%, and we tested whether this is the mechanism by which the hormone induces gene expression. Changing the intracellular level of sucrose with the inhibitors p-chloromercuribenzenesulfonic acid and vanadate did not inhibit the induction of chalcone synthase gene (chs) expression by GA3. Growing detached corollas in various sucrose concentrations did not affect the induction of the gene but did affect its level of expression and the level of anthocyanin accumulated. Only metabolic sugars promoted GA3-induced anthocyanin accumulation. Mannitol and sorbitol had no effect and 3-O-methylglucose only slightly promoted chs expression and anthocyanin accumulation. Our results do not support the suggestion that sugars act as specific signals in the activation of anthocyanin biosynthetic gene expression during petunia corolla development. We suggest that sugars are essential as general sources of carbohydrates for carbon metabolism, upon which the induction of pigmentation is dependent. PMID:12223616

  6. Insertional mutagenesis and characterization of a polyketide synthase gene (PKS1) required for melanin biosynthesis in Bipolaris oryzae.

    PubMed

    Moriwaki, Akihiro; Kihara, Junichi; Kobayashi, Tsutomu; Tokunaga, Toshiko; Arase, Sakae; Honda, Yuichi

    2004-09-01

    A polyketide synthase gene named PKS1, involved in the melanin biosynthesis pathway of the phytopathogenic fungus Bipolaris oryzae, was isolated using restriction enzyme-mediated integration. Sequence analysis showed that the PKS1 encodes a putative protein that has 2155 amino acids and significant similarity to other fungal polyketide synthases. Targeted disruption of the PKS1 gene showed that it is necessary for melanin biosynthesis in B. oryzae. Northern blot analysis showed that PKS1 transcripts were specifically enhanced by near-ultraviolet radiation (300-400 nm) and that its temporal transcriptional patterns were similar to those of THR1 and SCD1 genes involved in the melanin biosynthesis pathway of B. oryzae. PMID:15336395

  7. Identification of a second cellulose synthase gene (acsAII) in Acetobacter xylinum.

    PubMed Central

    Saxena, I M; Brown, R M

    1995-01-01

    A second cellulose synthase gene (acsAII) coding for a 175-kDa polypeptide that is similar in size and sequence to the acsAB gene product has been identified in Acetobacter xylinum AY201. Evidence for the presence of this gene was obtained during analysis of A. xylinum mutants in which the acsAB gene was disrupted (I.M. Saxena, K. Kudlicka, K. Okuda, and R.M. Brown, Jr., J. Bacteriol. 176:5735-5752, 1994). Although these mutants produced no detectable cellulose, they exhibited significant cellulose synthase activity in vitro. The acsAII gene was isolated by using an acsAB gene fragment as a probe. The acsAII gene coded for cellulose synthase activity as determined from sequence analysis and study of mutants in which this gene was disrupted. A mutant in which only the acsAII gene was disrupted showed no significant differences in either the in vivo cellulose production or the in vitro cellulose synthase activity compared with wild-type cells. Mutants in which both the acsAII and acsAB genes were disrupted produced no cellulose in vivo and exhibited negligible cellulose synthase activity in vitro, thus confirming that the cellulose synthase activity observed in the acsAB mutants was coded by the acsAII gene. These results establish the presence of an additional gene for cellulose synthase expressed in cells of A. xylinum, yet this gene is not required for cellulose production when cells are grown under laboratory conditions. PMID:7665515

  8. Transcriptional regulation of the squalene synthase gene (ERG9) in the yeast Saccharomyces cerevisiae.

    PubMed

    Kennedy, M A; Barbuch, R; Bard, M

    1999-04-14

    The ergosterol biosynthetic pathway is a specific branch of the mevalonate pathway. Since the cells requirement for sterols is greater than for isoprenoids, sterol biosynthesis must be regulated independently of isoprenoid biosynthesis. In this study we explored the transcriptional regulation of squalene synthase (ERG9) in Saccharomyces cerevisiae, the first enzyme dedicated to the synthesis of sterols. A mutant search was performed to identify genes that were involved in the regulation of the expression of an ERG9-lacZ promoter fusion. Mutants with phenotypes consistent with known sterol biosynthetic mutations (ERG3, ERG7, ERG24) increased expression of ERG9. In addition, treatment of wild-type cells with the sterol inhibitors zaragozic acid and ketoconazole, which target squalene synthase and the C-14 sterol demethylase respectively, also caused an increase in ERG9 expression. The data also demonstrate that heme mutants increased ERG9 expression while anaerobic conditions decreased expression. Additionally, the heme activator protein transcription factors HAP1 and HAP2/3/4, the yeast activator protein transcription factor yAP-1, and the phospholipid transcription factor complex INO2/4 regulate ERG9 expression. ERG9 expression is decreased in hap1, hap2/3/4, and yap-1 mutants while ino2/4 mutants showed an increase in ERG9 expression. This study demonstrates that ERG9 transcription is regulated by several diverse factors, consistent with the idea that as the first step dedicated to the synthesis of sterols, squalene synthase gene expression and ultimately sterol biosynthesis is highly regulated. PMID:10209263

  9. Sulfate metabolism in Tuber borchii: characterization of a putative sulfate transporter and the homocysteine synthase genes.

    PubMed

    Zeppa, Sabrina; Marchionni, C; Saltarelli, R; Guidi, C; Ceccaroli, P; Pierleoni, R; Zambonelli, A; Stocchi, V

    2010-04-01

    The homocysteine synthase (tbhos) and putative sulfate transporter (tbsul1) genes have been characterized in order to understand the sulfate metabolism and regulation in the ectomycorrhizal fungus Tuber borchii. The analyses of tbsul1 and tbhos nucleotide and deduced amino acid sequences led to the identification of the typical domains shown in homologous proteins. Sulfate starvation condition upregulates both genes. The real-time PCR assay of tbsul1 revealed that gene expression was about threefold higher in mycelia grown under sulfate starvation for 2 days than in the mycelial control and in the same starvation condition, the sulfate uptake increased. Real-time PCR and enzymatic assays showed regulation of tbhos when sulfur sources were lacking, suggesting that a transcriptional regulation of this gene rather than a post-transcriptional one occurred. Furthermore, the tbsul1 and tbhos expression patterns were evaluated during the truffle life cycle, revealing an over-expression in the mature ascomata for both genes. In the ectomycorrhizal tissue, only tbhos was upregulated suggesting its substantial role in T. borchii cysteine synthesis. The regulation of tbsul1 and tbhos occurs primarily at the transcriptional level both during vegetative and fruiting phases and these genes could be directly involved in VOCs production. PMID:20039042

  10. RNA Sequencing Revealed Numerous Polyketide Synthase Genes in the Harmful Dinoflagellate Karenia mikimotoi

    PubMed Central

    Kimura, Kei; Okuda, Shujiro; Nakayama, Kei; Shikata, Tomoyuki; Takahashi, Fumio; Yamaguchi, Haruo; Skamoto, Setsuko; Yamaguchi, Mineo; Tomaru, Yuji

    2015-01-01

    The dinoflagellate Karenia mikimotoi forms blooms in the coastal waters of temperate regions and occasionally causes massive fish and invertebrate mortality. This study aimed to elucidate the toxic effect of K. mikimotoi on marine organisms by using the genomics approach; RNA-sequence libraries were constructed, and data were analyzed to identify toxin-related genes. Next-generation sequencing produced 153,406 transcript contigs from the axenic culture of K. mikimotoi. BLASTX analysis against all assembled contigs revealed that 208 contigs were polyketide synthase (PKS) sequences. Thus, K. mikimotoi was thought to have several genes encoding PKS metabolites and to likely produce toxin-like polyketide molecules. Of all the sequences, approximately 30 encoded eight PKS genes, which were remarkably similar to those of Karenia brevis. Our phylogenetic analyses showed that these genes belonged to a new group of PKS type-I genes. Phylogenetic and active domain analyses showed that the amino acid sequence of four among eight Karenia PKS genes was not similar to any of the reported PKS genes. These PKS genes might possibly be associated with the synthesis of polyketide toxins produced by Karenia species. Further, a homology search revealed 10 contigs that were similar to a toxin gene responsible for the synthesis of saxitoxin (sxtA) in the toxic dinoflagellate Alexandrium fundyense. These contigs encoded A1–A3 domains of sxtA genes. Thus, this study identified some transcripts in K. mikimotoi that might be associated with several putative toxin-related genes. The findings of this study might help understand the mechanism of toxicity of K. mikimotoi and other dinoflagellates. PMID:26561394

  11. Cellulose synthase gene expression profiling of Physcomitrella patens.

    PubMed

    Tran, M L; Roberts, A W

    2016-05-01

    The cellulose synthase (CESA) gene family of seed plants comprises six clades that encode isoforms with conserved expression patterns and distinct functions in cellulose synthesis complex (CSC) formation and primary and secondary cell wall synthesis. In mosses, which have rosette CSCs like those of seed plants but lack lignified secondary cell walls, the CESA gene family diversified independently and includes no members of the six functionally distinct seed plant clades. There are seven CESA isoforms encoded in the genome of the moss Physcomitrella patens. However, only PpCESA5 has been characterised functionally, and little information is available on the expression of other PpCESA family members. We have profiled PpCESA expression through quantitative RT-PCR, analysis of promoter-reporter lines, and cluster analysis of public microarray data in an effort to identify expression and co-expression patterns that could help reveal the functions of PpCESA isoforms in protein complex formation and development of specific tissues. In contrast to the tissue-specific expression observed for seed plant CESAs, each of the PpCESAs was broadly expressed throughout most developing tissues. Although a few statistically significant differences in expression of PpCESAs were noted when some tissues and hormone treatments were compared, no strong co-expression patterns were observed. Along with CESA phylogenies and lack of single PpCESA mutant phenotypes reported elsewhere, broad overlapping expression of the PpCESAs indicates a high degree of inter-changeability and is consistent with a different pattern of functional specialisation in the evolution of the seed plant and moss CESA families. PMID:26572930

  12. Chalcone synthase genes from milk thistle (Silybum marianum): isolation and expression analysis.

    PubMed

    Sanjari, Sepideh; Shobbar, Zahra Sadat; Ebrahimi, Mohsen; Hasanloo, Tahereh; Sadat-Noori, Seyed-Ahmad; Tirnaz, Soodeh

    2015-12-01

    Silymarin is a flavonoid compound derived from milk thistle (Silybum marianum) seeds which has several pharmacological applications. Chalcone synthase (CHS) is a key enzyme in the biosynthesis of flavonoids; thereby, the identification of CHS encoding genes in milk thistle plant can be of great importance. In the current research, fragments of CHS genes were amplified using degenerate primers based on the conserved parts of Asteraceae CHS genes, and then cloned and sequenced. Analysis of the resultant nucleotide and deduced amino acid sequences led to the identification of two different members of CHS gene family,SmCHS1 and SmCHS2. Third member, full-length cDNA (SmCHS3) was isolated by rapid amplification of cDNA ends (RACE), whose open reading frame contained 1239 bp including exon 1 (190 bp) and exon 2 (1049 bp), encoding 63 and 349 amino acids, respectively. In silico analysis of SmCHS3 sequence contains all the conserved CHS sites and shares high homology with CHS proteins from other plants.Real-time PCR analysis indicated that SmCHS1 and SmCHS3 had the highest transcript level in petals in the early flowering stage and in the stem of five upper leaves, followed by five upper leaves in the mid-flowering stage which are most probably involved in anthocyanin and silymarin biosynthesis. PMID:26690515

  13. Acyl-carrier protein - Phosphopantetheinyltransferase partnerships in fungal fatty acid synthases

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The synthesis of fatty acids is an essential primary metabolic process for energy storage and cellular structural integrity. Assembly of saturated fatty acids is achieved by fatty acid synthases (FASs) that combine acetyl- and malonyl-CoAs by repetitive decarboxylative Claisen condensations with su...

  14. Chloropropionyl-CoA: a mechanism-based inhibitor of HMG-CoA synthase and fatty acid synthase

    SciTech Connect

    Miziorko, H.M.; Ahmad, F.; Behnke, C.E.

    1986-05-01

    Recent work on the mechanisms of inactivation of HMG-CoA synthase and fatty acid synthase by chloropropionyl-CoA (Cl-prop-CoA) suggests that this analog is a mechanism-based (suicide) inhibitor; the acyl group is enzymatically converted to an acrylyl derivative prior to alkylation of the target proteins. When Cl-(/sup 3/H)prop-CoA is incubated with the target enzymes, /sup 3/H/sub 2/O is produced concomitantly with enzyme inactivation; this suggests that deprotonation and chloride elimination to form an acrylyl moiety occurs. Difficulty in cleanly synthesizing acrylyl-CoA complicates direct demonstration of the intermediacy of this species. However, synthesis of a functionally equivalent reactive substrate analog, S-acrylyl-N-acetylcysteamine has been accomplished. This analog irreversibly inhibits both HMG-CoA synthase and fatty acid synthase in a site directed fashion. Concentrations required for effective inhibition (K/sub i/ values of 1.9 mM and 3.6 mM, respectively) are much higher than observed with Cl-prop-CoA. Maximal rates of inactivation (as vertical bar ..-->.. infinity) are comparable to those measured with Cl-prop-CoA, indicating that an acrylyl derivative is kinetically competent to function as an intermediate, as required if Cl-prop-CoA is a mechanism-based inhibitor. S-acrylyl-N-acetylcysteamine also inactivates HMG-CoA lyase. In this case, kinetic studies indicate that a bimolecular process is involved (k/sub 2/ = 86.7M/sup -1/min/sup -1/ at 30/sup 0/, pH 7.0).

  15. Molecular and biochemical characterization of benzalacetone synthase and chalcone synthase genes and their proteins from raspberry (Rubus idaeus L.).

    PubMed

    Zheng, Desen; Hrazdina, Geza

    2008-02-15

    Two new members of the polyketide synthase (PKS) gene family (RiPKS4 and RiPKS5) were cloned from raspberry fruits (Rubus idaeus L., cv Royalty) and expressed in Escherichia coli. Characterization of the recombinant enzyme products indicated that RiPKS4 is a bifunctional polyketide synthase producing both 4-hydroxybenzalacetone and naringenin chalcone. The recombinant RiPKS4 protein, like the native protein from raspberry fruits [W. Borejsza-Wysocki, G. Hrazdina, Plant Physiol. 1996;110: 791-799] accepted p-coumaryl-CoA and ferulyl-CoA as starter substrates and catalyzed the formation of both naringenin chalcone, 4-hydroxy-benzalacetone and 3-methoxy-4-hydroxy-benzalacetone. Although activity of RiPKS4 was higher with ferulyl-CoA than with p-coumaryl-CoA, the corresponding product, 3-methoxy-4-hydroxy phenylbutanone could not be detected in raspberries to date. Sequence analysis of the genes and proteins suggested that this feature of RiPKS4 was created by variation in the C-terminus due to DNA recombination at the 3' region of its coding sequence. RiPKS5 is a typical chalcone synthase (CHS) that uses p-coumaryl-CoA only as starter substrate and produces naringenin chalcone exclusively as the reaction product. PMID:18068110

  16. Molecular Evolution and Functional Divergence of Soluble Starch Synthase Genes in Cassava (Manihot Esculenta Crantz)

    PubMed Central

    Yang, Zefeng; Wang, Yifan; Xu, Shuhui; Xu, Chenwu; Yan, Changjie

    2013-01-01

    Soluble starch synthases (SSs) are major enzymes involved in starch biosynthesis in plants. Cassava starch has many remarkable characteristics, which should be influenced by the evolution of SS genes in this starchy root crop. In this work, we performed a comprehensive phylogenetic and evolutionary analysis of the soluble starch synthases in cassava. Genome-wide identification showed that there are 9 genes encoding soluble starch synthases in cassava. All of the soluble starch synthases encoded by these genes contain both Glyco_transf_5 and Glycos_transf_1 domains, and a correlation analysis showed evidence of coevolution between these 2 domains in cassava SS genes. The SS genes in land plants can be divided into 6 subfamilies that were formed before the origin of seed plants, and species-specific expansion has contributed to the evolution of this family in cassava. A functional divergence analysis for this family provided statistical evidence for shifted evolutionary rates between the subfamilies of land plant soluble starch synthases. Although the main selective pressure acting on land plant SS genes was purifying selection, our results also revealed that point mutation with positive selection contributed to the evolution of 2 SS genes in cassava. The remarkable cassava starch characteristics might be the result of both the duplication and adaptive selection of SS genes. PMID:23888108

  17. Evolution of ketosynthase domains of polyketide synthase genes in the Cladonia chlorophaea species complex (Cladoniaceae).

    PubMed

    Timsina, Brinda A; Hausner, Georg; Piercey-Normore, Michele D

    2014-11-01

    Lichen-forming fungi synthesize a diversity of polyketides, but only a few non-reducing polyketide synthase (PKS) genes from a lichen-forming fungus have been linked with a specific polyketide. While it is a challenge to link the large number of PKS paralogs in fungi with specific products, it might be expected that the PKS paralogs from closely related species would be similar because of recent evolutionary divergence. The objectives of this study were to reconstruct a PKS gene phylogeny of the Cladonia chlorophaea species complex based on the ketosynthase domain, a species phylogeny of the complex, and to explore the presence of PKS gene paralogs among members of the species complex. DNA was isolated from 51 individuals of C. chlorophaea and allies to screen for the presence of 13 PKS paralogs. A 128 sequence PKS gene phylogeny using deduced amino acid sequences estimated from the 13 PKS paralogs and sequences subjected to BLASTx comparisons showed losses of each of two PKS domains (reducing and methylation). This research provided insight into the evolution of PKS genes in the C. chlorophaea group, species evolution in the group, and it identified potential directions for further investigation of polyketide synthesis in the C. chlorophaea species complex. PMID:25442293

  18. Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites*

    PubMed Central

    Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

    2012-01-01

    To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi’an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi’an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%–99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites. PMID:23024043

  19. Acetohydroxyacid synthase activity and transcripts profiling reveal tissue-specific regulation of ahas genes in sunflower.

    PubMed

    Ochogavía, Ana C; Breccia, Gabriela; Vega, Tatiana; Felitti, Silvina A; Picardi, Liliana A; Nestares, Graciela

    2014-07-01

    Acetohydroxyacid synthase (AHAS) is the target site of several herbicides and catalyses the first step in the biosynthesis of branched chain amino acid. Three genes coding for AHAS catalytic subunit (ahas1, ahas2 and ahas3) have been reported for sunflower. The aim of this work was to study the expression pattern of ahas genes family and AHAS activity in sunflower (Helianthus annuus L.). Different organs (leaves, hypocotyls, roots, flowers and embryos) were evaluated at several developmental stages. The transcriptional profile was studied through RT-qPCR. The highest expression for ahas1 was shown in leaves, where all the induced and natural gene mutations conferring herbicide resistance were found. The maximal expression of ahas2 and ahas3 occurred in immature flowers and embryos. The highest AHAS activity was found in leaves and immature embryos. Correlation analysis among ahas gene expression and AHAS activity was discussed. Our results show that differences in ahas genes expression are tissue-specific and temporally regulated. Moreover, the conservation of multiple AHAS isoforms in sunflower seems to result from different expression requirements controlled by tissue-specific regulatory mechanisms at different developmental stages. PMID:24908515

  20. Direct transfer of starter substrates from type I fatty acid synthase to type III polyketide synthases in phenolic lipid synthesis.

    PubMed

    Miyanaga, Akimasa; Funa, Nobutaka; Awakawa, Takayoshi; Horinouchi, Sueharu

    2008-01-22

    Alkylresorcinols and alkylpyrones, which have a polar aromatic ring and a hydrophobic alkyl chain, are phenolic lipids found in plants, fungi, and bacteria. In the Gram-negative bacterium Azotobacter vinelandii, phenolic lipids in the membrane of dormant cysts are essential for encystment. The aromatic moieties of the phenolic lipids in A. vinelandii are synthesized by two type III polyketide synthases (PKSs), ArsB and ArsC, which are encoded by the ars operon. However, details of the synthesis of hydrophobic acyl chains, which might serve as starter substrates for the type III polyketide synthases (PKSs), were unknown. Here, we show that two type I fatty acid synthases (FASs), ArsA and ArsD, which are members of the ars operon, are responsible for the biosynthesis of C(22)-C(26) fatty acids from malonyl-CoA. In vivo and in vitro reconstitution of phenolic lipid synthesis systems with the Ars enzymes suggested that the C(22)-C(26) fatty acids produced by ArsA and ArsD remained attached to the ACP domain of ArsA and were transferred hand-to-hand to the active-site cysteine residues of ArsB and ArsC. The type III PKSs then used the fatty acids as starter substrates and carried out two or three extensions with malonyl-CoA to yield the phenolic lipids. The phenolic lipids in A. vinelandii were thus found to be synthesized solely from malonyl-CoA by the four members of the ars operon. This is the first demonstration that a type I FAS interacts directly with a type III PKS through substrate transfer. PMID:18199837

  1. Characterization and analysis of the cotton cyclopropane fatty acid synthase family and their contribution to cyclopropane fatty acid synthesis

    SciTech Connect

    Yu X. H.; Shanklin J.; Rawat, R.

    2011-05-01

    Cyclopropane fatty acids (CPA) have been found in certain gymnosperms, Malvales, Litchi and other Sapindales. The presence of their unique strained ring structures confers physical and chemical properties characteristic of unsaturated fatty acids with the oxidative stability displayed by saturated fatty acids making them of considerable industrial interest. While cyclopropenoid fatty acids (CPE) are well-known inhibitors of fatty acid desaturation in animals, CPE can also inhibit the stearoyl-CoA desaturase and interfere with the maturation and reproduction of some insect species suggesting that in addition to their traditional role as storage lipids, CPE can contribute to the protection of plants from herbivory. Three genes encoding cyclopropane synthase homologues GhCPS1, GhCPS2 and GhCPS3 were identified in cotton. Determination of gene transcript abundance revealed differences among the expression of GhCPS1, 2 and 3 showing high, intermediate and low levels, respectively, of transcripts in roots and stems; whereas GhCPS1 and 2 are both expressed at low levels in seeds. Analyses of fatty acid composition in different tissues indicate that the expression patterns of GhCPS1 and 2 correlate with cyclic fatty acid (CFA) distribution. Deletion of the N-terminal oxidase domain lowered GhCPS's ability to produce cyclopropane fatty acid by approximately 70%. GhCPS1 and 2, but not 3 resulted in the production of cyclopropane fatty acids upon heterologous expression in yeast, tobacco BY2 cell and Arabidopsis seed. In cotton GhCPS1 and 2 gene expression correlates with the total CFA content in roots, stems and seeds. That GhCPS1 and 2 are expressed at a similar level in seed suggests both of them can be considered potential targets for gene silencing to reduce undesirable seed CPE accumulation. Because GhCPS1 is more active in yeast than the published Sterculia CPS and shows similar activity when expressed in model plant systems, it represents a strong candidate gene for

  2. Characterization and analysis of the cotton cyclopropane fatty acid synthase family and their contribution to cyclopropane fatty acid synthesis

    PubMed Central

    2011-01-01

    Background Cyclopropane fatty acids (CPA) have been found in certain gymnosperms, Malvales, Litchi and other Sapindales. The presence of their unique strained ring structures confers physical and chemical properties characteristic of unsaturated fatty acids with the oxidative stability displayed by saturated fatty acids making them of considerable industrial interest. While cyclopropenoid fatty acids (CPE) are well-known inhibitors of fatty acid desaturation in animals, CPE can also inhibit the stearoyl-CoA desaturase and interfere with the maturation and reproduction of some insect species suggesting that in addition to their traditional role as storage lipids, CPE can contribute to the protection of plants from herbivory. Results Three genes encoding cyclopropane synthase homologues GhCPS1, GhCPS2 and GhCPS3 were identified in cotton. Determination of gene transcript abundance revealed differences among the expression of GhCPS1, 2 and 3 showing high, intermediate and low levels, respectively, of transcripts in roots and stems; whereas GhCPS1 and 2 are both expressed at low levels in seeds. Analyses of fatty acid composition in different tissues indicate that the expression patterns of GhCPS1 and 2 correlate with cyclic fatty acid (CFA) distribution. Deletion of the N-terminal oxidase domain lowered GhCPS's ability to produce cyclopropane fatty acid by approximately 70%. GhCPS1 and 2, but not 3 resulted in the production of cyclopropane fatty acids upon heterologous expression in yeast, tobacco BY2 cell and Arabidopsis seed. Conclusions In cotton GhCPS1 and 2 gene expression correlates with the total CFA content in roots, stems and seeds. That GhCPS1 and 2 are expressed at a similar level in seed suggests both of them can be considered potential targets for gene silencing to reduce undesirable seed CPE accumulation. Because GhCPS1 is more active in yeast than the published Sterculia CPS and shows similar activity when expressed in model plant systems, it

  3. Arabidopsis thaliana contains a single gene encoding squalene synthase.

    PubMed

    Busquets, Antoni; Keim, Verónica; Closa, Marta; del Arco, Ana; Boronat, Albert; Arró, Montserrat; Ferrer, Albert

    2008-05-01

    Squalene synthase (SQS) catalyzes the condensation of two molecules of farnesyl diphosphate (FPP) to produce squalene (SQ), the first committed precursor for sterol, brassinosteroid, and triterpene biosynthesis. Arabidopsis thaliana contains two SQS-annotated genomic sequences, At4g34640 (SQS1) and At4g34650 (SQS2), organized in a tandem array. Here we report that the SQS1 gene is widely expressed in all tissues throughout plant development, whereas SQS2 is primarily expressed in the vascular tissue of leaf and cotyledon petioles, and the hypocotyl of seedlings. Neither the complete A. thaliana SQS2 protein nor the chimeric SQS resulting from the replacement of the 69 C-terminal residues of SQS2 by the 111 C-terminal residues of the Schizosaccharomyces pombe SQS were able to confer ergosterol prototrophy to a Saccharomyces cerevisiae erg9 mutant strain lacking SQS activity. A soluble form of SQS2 expressed in Escherichia coli and purified was unable to synthesize SQ from FPP in the presence of NADPH and either Mg2+ or Mn2+. These results demonstrated that SQS2 has no SQS activity, so that SQS1 is the only functional SQS in A. thaliana. Mutational studies revealed that the lack of SQS activity of SQS2 cannot be exclusively attributed to the presence of an unusual Ser replacing the highly conserved Phe at position 287. Expression of green fluorescent protein (GFP)-tagged versions of SQS1 in onion epidermal cells demonstrated that SQS1 is targeted to the endoplasmic reticulum (ER) membrane and that this location is exclusively dependent on the presence of the SQS1 C-terminal hydrophobic trans-membrane domain. PMID:18236008

  4. A Homologue of the 3-Oxoacyl-(Acyl Carrier Protein) Synthase III Gene Located in the Glycosylation Island of Pseudomonas syringae pv. tabaci Regulates Virulence Factors via N-Acyl Homoserine Lactone and Fatty Acid Synthesis▿

    PubMed Central

    Taguchi, Fumiko; Ogawa, Yujiro; Takeuchi, Kasumi; Suzuki, Tomoko; Toyoda, Kazuhiro; Shiraishi, Tomonori; Ichinose, Yuki

    2006-01-01

    Pseudomonas syringae pv. tabaci 6605 possesses a genetic region involved in flagellin glycosylation. This region is composed of three open reading frames: orf1, orf2, and orf3. Our previous study revealed that orf1 and orf2 encode glycosyltransferases; on the other hand, orf3 has no role in posttranslational modification of flagellin. Although the function of Orf3 remained unclear, an orf3 deletion mutant (Δorf3 mutant) had reduced virulence on tobacco plants. Orf3 shows significant homology to a 3-oxoacyl-(acyl carrier protein) synthase III in the fatty acid elongation cycle. The Δorf3 mutant had a significantly reduced ability to form acyl homoserine lactones (AHLs), which are quorum-sensing molecules, suggesting that Orf3 is required for AHL synthesis. In comparison with the wild-type strain, swarming motility, biosurfactant production, and tolerance to H2O2 and antibiotics were enhanced in the Δorf3 mutant. A scanning electron micrograph of inoculated bacteria on the tobacco leaf surface revealed that there is little extracellular polymeric substance matrix surrounding the cells in the Δorf3 mutant. The phenotypes of the Δorf3 mutant and an AHL synthesis (ΔpsyI) mutant were similar, although the mutant-specific characteristics were more extreme in the Δorf3 mutant. The swarming motility of the Δorf3 mutant was greater than that of the ΔpsyI mutant. This was attributed to the synergistic effects of the overproduction of biosurfactants and/or alternative fatty acid metabolism in the Δorf3 mutant. Furthermore, the amounts of iron and biosurfactant seem to be involved in biofilm development under quorum-sensing regulation in P. syringae pv. tabaci 6605. PMID:17028280

  5. Cloning and Characterization of Farnesyl Diphosphate Synthase Gene Involved in Triterpenoids Biosynthesis from Poria cocos

    PubMed Central

    Wang, Jianrong; Li, Yangyuan; Liu, Danni

    2014-01-01

    Poria cocos (P. cocos) has long been used as traditional Chinese medicine and triterpenoids are the most important pharmacologically active constituents of this fungus. Farnesyl pyrophosphate synthase (FPS) is a key enzyme of triterpenoids biosynthesis. The gene encoding FPS was cloned from P. cocos by degenerate PCR, inverse PCR and cassette PCR. The open reading frame of the gene is 1086 bp in length, corresponding to a predicted polypeptide of 361 amino acid residues with a molecular weight of 41.2 kDa. Comparison of the P. cocos FPS deduced amino acid sequence with other species showed the highest identity with Ganoderma lucidum (74%). The predicted P. cocos FPS shares at least four conserved regions involved in the enzymatic activity with the FPSs of varied species. The recombinant protein was expressed in Pichia pastoris and purified. Gas chromatography analysis showed that the recombinant FPS could catalyze the formation of farnesyl diphosphate (FPP) from geranyl diphosphate (GPP) and isopentenyl diphosphate (IPP). Furthermore, the expression profile of the FPS gene and content of total triterpenoids under different stages of development and methyl jasmonate treatments were determined. The results indicated that there is a positive correlation between the activity of FPS and the amount of total triterpenoids produced in P. cocos. PMID:25474088

  6. Functional Inducible Nitric Oxide Synthase Gene Variants Associate With Hypertension

    PubMed Central

    Nikkari, Seppo T.; Määttä, Kirsi M.; Kunnas, Tarja A.

    2015-01-01

    Abstract Increased inducible nitric oxide synthase (iNOS) activity and expression has been associated with hypertension, but less is known whether the 2 known functional polymorphic sites in the iNOS gene (g.–1026 C/A (rs2779249), g.2087 G/A (rs2297518)) affect susceptibility to hypertension. The objective of this study was to investigate the association between the genetic variants of iNOS and diagnosed hypertension in a Finnish cohort. This study included 320 hypertensive cases and 439 healthy controls. All participants were 50-year-old men and women and the data were collected from the Tampere adult population cardiovascular risk study (TAMRISK). DNA was extracted from buccal swabs and iNOS single nucleotide polymorphisms (SNPs) were analyzed using KASP genotyping PCR. Data analysis was done by logistic regression. At the age of 50 years, the SNP rs2779249 (C/A) associated significantly with hypertension (P = 0.009); specifically, subjects carrying the A-allele had higher risk of hypertension compared to those carrying the CC genotype (OR = 1.47; CI = 1.08–2.01; P = 0.015). In addition, a 15-year follow-up period (35, 40, and 45 years) of the same individuals showed that carriers of the A-allele had more often hypertension in all of the studied age-groups. The highest risk for developing hypertension was obtained among 35-year-old subjects (odds ratio [OR] 3.83; confidence interval [CI] = 1.20–12.27; P = 0.024). Those carrying variant A had also significantly higher readings of both systolic (P = 0.047) and diastolic (P = 0.048) blood pressure during the follow-up. No significant associations between rs2297518 (G/A) variants alone and hypertension were found. However, haplotype analysis of rs2779249 and rs2297518 revealed that individuals having haplotype H3 which combines both A alleles (CA–GA, 19.7% of individuals) was more commonly found in the hypertensive group than in the normotensive group (OR = 2.01; CI = 1

  7. A transgenic Neospora caninum strain based on mutations of the dihydrofolate reductase-thymidylate synthase gene.

    PubMed

    Pereira, Luiz Miguel; Baroni, Luciana; Yatsuda, Ana Patrícia

    2014-03-01

    Neospora caninum is an Apicomplexa parasite related to abortion and losses of fertility in cattle. The amenability of Toxoplasma gondii and Plasmodium to genetic manipulation offers several tools to determine the invasion and replication processes, which support posterior strategies related to the combat of these diseases. For Plasmodium the use of pyrimethamine as an auxiliary drug on malaria treatment has been affected by the rise of resistant strains and the analyses on Dihydrofolate reductase-thymidylate synthase (DHFR-TS) gene indicated several point mutations. In this work we developed a method for stable insertion of genes based on resistance to pyrimethamine. For that, the coding sequence of NcDHFR-TS (Dihydrofolate reductase-thymidylate synthase) was point mutated in two amino acids, generating DHFRM2M3. The DHFRM2M3 flanked by the promoter and 3'UTR of Ncdhfr-ts (Ncdhfr-DHFRM2M3) conferred resistance to pyrimethamine after transfection. For illustration of stability and expression, the cassette Ncdhfr-DHFRM2M3 was ligated to the reporter gene Lac-Z (β-galactosidase enzyme) controlled by the N. caninum tubulin promoter and was transfected and selected in N. caninum. The cassette was integrated into the genome and the selected tachyzoites expressed Lac-Z, allowing the detection of tachyzoites by the CPRG reaction and X-gal precipitation. The obtainment of transgenic N. caninum resistant to pyrimethamine confirms the effects on DHFR-TS among the Apicomplexa members and will support future approaches on pholate inhibitors for N. caninum prophylaxis. The construction of stable tachyzoites based on vectors with N. caninum promoters initiates the molecular manipulation of this parasite independently of T. gondii. PMID:24440296

  8. Homology analyses of the protein sequences of fatty acid synthases from chicken liver, rat mammary gland, and yeast

    SciTech Connect

    Chang, Soo-Ik ); Hammes, G.G. )

    1989-11-01

    Homology analyses of the protein sequences of chicken liver and rat mammary gland fatty acid synthases were carried out. The amino acid sequences of the chicken and rat enzymes are 67% identical. If conservative substitutions are allowed, 78% of the amino acids are matched. A region of low homologies exists between the functional domains, in particular around amino acid residues 1059-1264 of the chicken enzyme. Homologies between the active sites of chicken and rat and of chicken and yeast enzymes have been analyzed by an alignment method. A high degree of homology exists between the active sites of the chicken and rat enzymes. However, the chicken and yeast enzymes show a lower degree of homology. The DADPH-binding dinucleotide folds of the {beta}-ketoacyl reductase and the enoyl reductase sites were identified by comparison with a known consensus sequence for the DADP- and FAD-binding dinucleotide folds. The active sites of all of the enzymes are primarily in hydrophobic regions of the protein. This study suggests that the genes for the functional domains of fatty acid synthase were originally separated, and these genes were connected to each other by using different connecting nucleotide sequences in different species. An alternative explanation for the differences in rat and chicken is a common ancestry and mutations in the joining regions during evolution.

  9. Enhanced acetohydroxy acid synthase III activity in an ilvH mutant of Escherichia coli K-12.

    PubMed Central

    Ricca, E; Limauro, D; Lago, C T; de Felice, M

    1988-01-01

    The acetohydroxy acid synthase III isozyme, which catalyzes the first common step in the biosynthesis of isoleucine, leucine, and valine in Escherichia coli K-12, is composed of two subunits, the ilvI and ilvH gene products. A missense mutation in ilvH (ilvH612), which reduced the sensitivity of the enzyme to the end product inhibition by valine, also increased its specific activity and lowered the Km for alpha-acetolactate synthesis. The mutation increased the sensitivity of acetohydroxy acid synthase III to dialysis and heat treatment and reduced the requirement for thiamine pyrophosphate addition to the assay mixture for activity. A strain carrying the ilvH612 mutation grew better than a homologous ilvH+ strain in the presence of leucine. The data indicate that this is a consequence of a more active acetohydroxy acid synthase III isozyme rather than the result of an alteration of the leucine-mediated repression of the ilvIH operon. PMID:3053650

  10. Cloning and sequence analysis of the Blumea balsamifera DC farnesyl diphosphate synthase gene.

    PubMed

    Pang, Y X; Guan, L L; Wu, L F; Chen, Z X; Wang, K; Xie, X L; Yu, F L; Chen, X L; Zhang, Y B; Jiang, Q

    2014-01-01

    Blumea balsamifera DC is a member of the Compositae family and is frequently used as traditional Chinese medicine. Blumea balsamifera is rich in monoterpenes, which possess a variety of pharmacological activities, such as antioxidant, anti-bacteria, and anti-viral activities. Farnesyl diphosphate synthase (FPS) is a key enzyme in the biosynthetic pathway of terpenes, playing an important regulatory role in plant growth, such as resistance and secondary metabolism. Based on the conserved oligo amino acid residues of published FPS genes from other higher plant species, a cDNA sequence, designated BbFPS, was isolated from B. balsamifera DC using polymerase chain reaction. The clones were an average of 1.6 kb and contained an open reading frame that predicted a polypeptide of 342 amino acids with 89.07% identity to FPS from other plants. The deduced amino acid sequence was dominated by hydrophobic regions and contained 2 highly conserved DDxxD motifs that are essential for proper functioning of FPS. Phylogenetic analysis indicated that FPS grouped with other composite families. Prediction of secondary structure and subcellular localization suggested that alpha helices made up 70% of the amino acids of the sequence. PMID:25501197

  11. Cyclopentanedi- and tricarboxylic acids as squalene synthase inhibitors: syntheses and evaluation.

    PubMed

    Shen, W; Garvey, D S; Cohen, J; Stein, H; Rosenberg, S H

    1998-04-21

    Based on earlier lead squalene synthase inhibitor A-87049 (3) and zaragozic acids, a series of cyclopentanedi- and tricarboxylic acids were synthesized and evaluated against the enzyme. Some exhibited good potency and SAR revealed the importance of conformation and substitution pattern of these synthetic inhibitors. PMID:9871507

  12. Regulation of the cellulose synthase-like gene family by light in the maize mesocotyl.

    PubMed

    van Erp, Harrie; Walton, Jonathan D

    2009-03-01

    The cellulose synthase-like (ZmCSL) gene family of maize was annotated and its expression studied in the maize mesocotyl. A total of 28 full-length CSL genes and another 13 partial sequences were annotated; four are predicted to be pseudogenes. Maize has all of the CSL subfamilies that are present in rice, but the CSLC subfamily is expanded from 6 in rice to 12 in maize, and the CSLH subfamily might be reduced from 3 to 1. Unlike rice, maize has a gene in the CSLG subfamily, based on its sequence similarity to two genes annotated as CSLG in poplar. Light regulation of glycan synthase enzyme activities and CSL gene expression were analyzed in the mesocotyl. A Golgi-localized glucan synthase activity is reduced by ~50% 12 h after exposure to light. beta-1,4-Mannan synthase activity is reduced even more strongly (>85%), whereas beta-1,4-xylan synthase, callose synthase, and latent IDPase activity respond only slightly, if at all, to light. At least 17 of the CSL genes (42%) are expressed in the mesocotyl, of which four are up-regulated at least twofold, seven are down-regulated at least twofold, and six are not affected by light. The results contribute to our understanding of the structure of the CSL gene family in an important food and biofuel plant, show that a large percentage of the CSL genes are expressed in the specialized tissues of the mesocotyl, and demonstrate that members of the CSL gene family are differentially subject to photobiological regulation. PMID:19130077

  13. Presence of two transcribed malate synthase genes in an n-alkane-utilizing yeast, Candida tropicalis.

    PubMed

    Hikida, M; Atomi, H; Fukuda, Y; Aoki, A; Hishida, T; Teranishi, Y; Ueda, M; Tanaka, A

    1991-12-01

    The presence of two genomic DNA regions encoding malate synthase (MS) was shown by Southern blot analysis of the genomic DNA from an n-alkane-assimilating yeast, Candida tropicalis, using a partial MS cDNA probe, in accordance with the fact that two types of partial MS cDNAs have previously been isolated. This was also confirmed by the restriction mapping of the two genes screened from the yeast lambda EMBL library. Nucleotide sequence analysis of the respective genomic DNAs, named MS-1 gene and MS-2 gene, revealed that both regions encoding MS had the same length of 1,653 base pairs, corresponding to 551 amino acids (molecular mass of MS-1, 62,448 Da; MS-2, 62,421 Da). Although 29 nucleotide pairs differed in the sequences of the coding regions, the number of amino acid replacements was only one: 159Asn (MS-1)----159Ser (MS-2). In the 5'-flanking regions, there were replacements of four nucleotide pairs, deletion of one pair, and insertion of four pairs. In spite of the fact that two genomic genes were present and transcribed, RNA blot analysis demonstrated that only one band (about 2 kb) was observable even when the carbon sources in the cultivation medium were changed. A comparison of the amino acid sequences was made with MSs of rape (Brassica napus L.), cucumber seed, pumpkin seed, Escherichia coli, and Hansenula polymorpha. A high homology was observed among these enzymes, the results indicating that the protein structure was relatively well conserved through the evolution of the molecule.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:1794980

  14. Characterization of Two Polyketide Synthase Genes Involved in Zearalenone Biosynthesis in Gibberella zeae

    PubMed Central

    Gaffoor, Iffa; Trail, Frances

    2006-01-01

    Zearalenone, a mycotoxin produced by several Fusarium spp., is most commonly found as a contaminant in stored grain and has chronic estrogenic effects on mammals. Zearalenone is a polyketide derived from the sequential condensation of multiple acetate units by a polyketide synthase (PKS), but the genetics of its biosynthesis are not understood. We cloned two genes, designated ZEA1 and ZEA2, which encode polyketide synthases that participate in the biosynthesis of zearalenone by Gibberella zeae (anamorph Fusarium graminearum). Disruption of either gene resulted in the loss of zearalenone production under inducing conditions. ZEA1 and ZEA2 are transcribed divergently from a common promoter region. Quantitative PCR analysis of both PKS genes and six flanking genes supports the view that the two polyketide synthases make up the core biosynthetic unit for zearalenone biosynthesis. An appreciation of the genetics of zearalenone biosynthesis is needed to understand how zearalenone is synthesized under field conditions that result in the contamination of grain. PMID:16517624

  15. Studies on the chalcone synthase gene of two higher plants: petroselinum hortense and matthiola incana

    SciTech Connect

    Hemleben, V.; Frey, M.; Rall, S.; Koch, M.; Kittel, M.; Kreuzaler, F.; Ragg, H.; Fautz, E.; Hahlbrock, K.

    1982-01-01

    Two higher plant systems are presented which allow to study coordinated gene expression of the light-induced metabolic pathway of flavonoid biosynthesis: tissue culture cells of Petroselinum hortense (Apiaceae) and different developmental stages of various genotypes of Matthiola incana (Brassicaceae). The gene structure of the chalcone synthase is mainly studied. A cDNA clone (pLF56) of parsley has been constructed and characterized conferring the chalcone synthase gene sequence. Strong cross hybridization between the parsley cDNA and Matthiola DNA allowed to identify a HindIII fragment (6000 bp) identical in size for parsley and different Matthiola wild type lines and a mutant line.

  16. Geranyl diphosphate synthase from mint

    SciTech Connect

    Croteau, Rodney Bruce; Wildung, Mark Raymond; Burke, Charles Cullen; Gershenzon, Jonathan

    1999-01-01

    A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate.

  17. Geranyl diphosphate synthase from mint

    SciTech Connect

    Croteau, R.B.; Wildung, M.R.; Burke, C.C.; Gershenzon, J.

    1999-03-02

    A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate. 5 figs.

  18. Sequence analysis of the chitin synthase A gene of the Dutch elm pathogen Ophiostoma novo-ulmi indicates a close association with the human pathogen Sporothrix schenckii.

    PubMed

    Hintz, W E

    1999-09-01

    Degenerate oligonucleotide primers were designed according to conserved regions of the chitin synthase gene family and used to amplify a 621 basepair (bp) fragment from genomic DNA of Ophiostoma novo-ulmi, the causal agent of Dutch elm disease. The amplification product was used as a hybridization probe to screen a library of genomic DNA sequences and to retrieve a full-length chitin synthase gene (chsA). The putative coding region of the gene was 2619 bp long, lacked introns, and encoded a polypeptide of 873 amino acids. Based on the similarity of the predicted amino acid sequence to the full-length chsC gene of Aspergillus nidulans and chsA gene of Ampelomyces quisqualis, the O. novo-ulmi chsA was classified as a Class I chitin synthase. The phylogenies constructed, according to a subregion of all available chitin synthases, showed that O. novo-ulmi consistently clustered most closely with the human pathogen Sporothrix schenckii, recently classified as a member of the mitosporic Ophiostomataceae. Disruption of the chsA gene locus had no obvious effects on the growth or morphology of the fungus. PMID:10524253

  19. Cloning and characterization of the nicotianamine synthase gene in Eruca vesicaria subsp sativa.

    PubMed

    Huang, B L; Cheng, C; Zhang, G Y; Su, J J; Zhi, Y; Xu, S S; Cai, D T; Zhang, X K; Huang, B Q

    2015-01-01

    Nicotianamine (NA) is a ubiquitous metabolite in plants that bind heavy metals, is crucial for metal homeostasis, and is also an important metal chelator that facilitates long-distance metal transport and sequestration. NA synthesis is catalyzed by the enzyme nicotianamine synthase (NAS). Eruca vesicaria subsp sativa is highly tolerant to Ni, Pb, and Zn. In this study, a gene encoding EvNAS was cloned and characterized in E. vesicaria subsp sativa. The full-length EvNAS cDNA sequence contained a 111-bp 5'-untranslated region (UTR), a 155-bp 3'-UTR, and a 966-bp open reading frame encoding 322-amino acid residues. The EvNAS genomic sequence contained no introns, which is similar to previously reported NAS genes. The deduced translation of EvNAS contained a well-conserved NAS domain (1-279 amino acids) and an LIKI-CGEAEG box identical to some Brassica NAS and to the LIRL-box in most plant NAS, which is essential for DNA binding. Phylogenetic analysis indicated that EvNAS was most closely related to Brassica rapa NAS3 within the Cruciferae, followed by Thlaspi NAS1, Camelina NAS3, and Arabidopsis NAS3. A reverse transcription-polymerase chain reaction indicated that EvNAS expression was greatest in the leaves, followed by the flower buds and hypocotyls. EvNAS was moderately expressed in the roots. PMID:26782459

  20. Polypeptide composition of bacterial cyclic diguanylic acid-dependent cellulose synthase and the occurrence of immunologically crossreacting proteins in higher plants

    SciTech Connect

    Mayer, R.; Ross, P.; Weinhouse, H.; Amikam, D.; Volman, G.; Ohana, P.; Benziman, M. ); Calhoon, R.D.; Wong, Hing C.; Emerick, A.W. )

    1991-06-15

    To comprehend the catalytic and regulatory mechanism of the cyclic diguanylic acid (c-di-GMP)-dependent cellulose synthase of Acetobacter xylinum and its relatedness to similar enzymes in other organisms, the structure of this enzyme was analyzed at the polypeptide level. The enzyme, purified 350-fold by enzyme-product entrapment, contains three major peptides (90, 67, and 54 kDa), which, based on direct photoaffinity and immunochemical labeling and amino acid sequence analysis, are constituents of the native cellulose synthase. Labeling of purified synthase with either ({sup 32}P)c-di-GMP or ({alpha}-{sup 32}P)UDP-glucose indicates that activator- and substrate-specific binding sites are most closely associated with the 67- and 54-kDa peptides, respectively, whereas marginal photolabeling is detected in the 90-k-Da peptide. However, antibodies raised against a protein derived from the cellulose synthase structural gene (bcsB) specifically label all three peptides. The authors suggest that the structurally related 67- and 54-kDa peptides are fragments proteolytically derived from the 90-kDa peptide encoded by bcsB. The anti-cellulose synthase antibodies crossreact with a similar set of peptides derived from other cellulose-producing microorganisms and plants such as Agrobacterium tumefaciens, Rhizobium leguminosarum, mung bean, peas, barley, and cotton. The occurrence of such cellulose synthase-like structures in plant species suggests that a common enzymatic mechanism for cellulose biogenesis is employed throughout nature.

  1. Homologous cloning, characterization and expression of a new halophyte phytochelatin synthase gene in Suaeda salsa

    NASA Astrophysics Data System (ADS)

    Cong, Ming; Zhao, Jianmin; Lü, Jiasen; Ren, Zhiming; Wu, Huifeng

    2016-01-01

    The halophyte Suaeda salsa can grow in heavy metal-polluted areas along intertidal zones having high salinity. Since phytochelatins can eff ectively chelate heavy metals, it was hypothesized that S. salsa possessed a phytochelatin synthase (PCS) gene. In the present study, the cDNA of PCS was obtained from S. salsa (designated as SsPCS) using homologous cloning and the rapid amplification of cDNA ends (RACE). A sequence analysis revealed that SsPCS consisted of 1 916 bp nucleotides, encoding a polypeptide of 492 amino acids with one phytochelatin domain and one phytochelatin C domain. A similarity analysis suggested that SsPCS shared up to a 58.6% identity with other PCS proteins and clustered with PCS proteins from eudicots. There was a new kind of metal ion sensor motif in its C-terminal domain. The SsPCS transcript was more highly expressed in elongated and fibered roots and stems (P <0.05) than in leaves. Lead and mercury exposure significantly enhanced the mRNA expression of SsPCS (P <0.05). To the best of our knowledge, SsPCS is the second PCS gene cloned from a halophyte, and it might contain a diff erent metal sensing capability than the first PCS from Thellungiella halophila. This study provided a new view of halophyte PCS genes in heavy metal tolerance.

  2. Homologous cloning, characterization and expression of a new halophyte phytochelatin synthase gene in Suaeda salsa

    NASA Astrophysics Data System (ADS)

    Cong, Ming; Zhao, Jianmin; Lü, Jiasen; Ren, Zhiming; Wu, Huifeng

    2016-09-01

    The halophyte Suaeda salsa can grow in heavy metal-polluted areas along intertidal zones having high salinity. Since phytochelatins can eff ectively chelate heavy metals, it was hypothesized that S. salsa possessed a phytochelatin synthase (PCS) gene. In the present study, the cDNA of PCS was obtained from S. salsa (designated as SsPCS) using homologous cloning and the rapid amplification of cDNA ends (RACE). A sequence analysis revealed that SsPCS consisted of 1 916 bp nucleotides, encoding a polypeptide of 492 amino acids with one phytochelatin domain and one phytochelatin C domain. A similarity analysis suggested that SsPCS shared up to a 58.6% identity with other PCS proteins and clustered with PCS proteins from eudicots. There was a new kind of metal ion sensor motif in its C-terminal domain. The SsPCS transcript was more highly expressed in elongated and fibered roots and stems ( P<0.05) than in leaves. Lead and mercury exposure significantly enhanced the mRNA expression of SsPCS ( P<0.05). To the best of our knowledge, SsPCS is the second PCS gene cloned from a halophyte, and it might contain a diff erent metal sensing capability than the first PCS from Thellungiella halophila. This study provided a new view of halophyte PCS genes in heavy metal tolerance.

  3. [Full-length cDNA cloning of flavonol synthase genes of Carthamus tinctorius and construction plant expression vector].

    PubMed

    Yang, Wen-ting; Liu, Xiu-ming; Wan, Qiu; Yao, Na; Wang, Nan; Zhang, Xue-meng; Jiao, Zhong-da; Li, Hai-yan; Li, Xiao-kun

    2015-02-01

    Flavonol synthase (FLS) is one of the key enzymes in flavonoids metabolic pathways. In this study, middle sequence was obtained from Carthamus tinctorius transcriptome sequencing results. Full-length cDNAs of FLS was cloned from petals of C. tinctorius to FLS by using RT-PCR and RACE technology. Its full-length cDNA was 1,201 bp, with an open reading frame of 1,101 bp and 336 encoded amino acids. The phylogenetic analysis showed that, FLS gene encoded amino acids in C. tinctorius were highly homologous with amino acids in congeneric Compositae species, especially Rudbeckia laciniata. The pBASTA-FLS plant expression vector was successfully built by the molecular biology method, which lays a foundation for further studying biology functions of the gene and biosynthesis mechanism of flavonoids. PMID:26137682

  4. Assessing the allelotypic effect of two aminocyclopropane carboxylic acid synthase-encoding genes MdACS1 and MdACS3a on fruit ethylene production and softening in Malus

    PubMed Central

    Dougherty, Laura; Zhu, Yuandi; Xu, Kenong

    2016-01-01

    Phytohormone ethylene largely determines apple fruit shelf life and storability. Previous studies demonstrated that MdACS1 and MdACS3a, which encode 1-aminocyclopropane-1-carboxylic acid synthases (ACS), are crucial in apple fruit ethylene production. MdACS1 is well-known to be intimately involved in the climacteric ethylene burst in fruit ripening, while MdACS3a has been regarded a main regulator for ethylene production transition from system 1 (during fruit development) to system 2 (during fruit ripening). However, MdACS3a was also shown to have limited roles in initiating the ripening process lately. To better assess their roles, fruit ethylene production and softening were evaluated at five time points during a 20-day post-harvest period in 97 Malus accessions and in 34 progeny from 2 controlled crosses. Allelotyping was accomplished using an existing marker (ACS1) for MdACS1 and two markers (CAPS866 and CAPS870) developed here to specifically detect the two null alleles (ACS3a-G289V and Mdacs3a) of MdACS3a. In total, 952 Malus accessions were allelotyped with the three markers. The major findings included: The effect of MdACS1 was significant on fruit ethylene production and softening while that of MdACS3a was less detectable; allele MdACS1–2 was significantly associated with low ethylene and slow softening; under the same background of the MdACS1 allelotypes, null allele Mdacs3a (not ACS3a-G289V) could confer a significant delay of ethylene peak; alleles MdACS1–2 and Mdacs3a (excluding ACS3a-G289V) were highly enriched in M. domestica and M. hybrid when compared with those in M. sieversii. These findings are of practical implications in developing apples of low and delayed ethylene profiles by utilizing the beneficial alleles MdACS1-2 and Mdacs3a. PMID:27231553

  5. Assessing the allelotypic effect of two aminocyclopropane carboxylic acid synthase-encoding genes MdACS1 and MdACS3a on fruit ethylene production and softening in Malus.

    PubMed

    Dougherty, Laura; Zhu, Yuandi; Xu, Kenong

    2016-01-01

    Phytohormone ethylene largely determines apple fruit shelf life and storability. Previous studies demonstrated that MdACS1 and MdACS3a, which encode 1-aminocyclopropane-1-carboxylic acid synthases (ACS), are crucial in apple fruit ethylene production. MdACS1 is well-known to be intimately involved in the climacteric ethylene burst in fruit ripening, while MdACS3a has been regarded a main regulator for ethylene production transition from system 1 (during fruit development) to system 2 (during fruit ripening). However, MdACS3a was also shown to have limited roles in initiating the ripening process lately. To better assess their roles, fruit ethylene production and softening were evaluated at five time points during a 20-day post-harvest period in 97 Malus accessions and in 34 progeny from 2 controlled crosses. Allelotyping was accomplished using an existing marker (ACS1) for MdACS1 and two markers (CAPS866 and CAPS870) developed here to specifically detect the two null alleles (ACS3a-G289V and Mdacs3a) of MdACS3a. In total, 952 Malus accessions were allelotyped with the three markers. The major findings included: The effect of MdACS1 was significant on fruit ethylene production and softening while that of MdACS3a was less detectable; allele MdACS1-2 was significantly associated with low ethylene and slow softening; under the same background of the MdACS1 allelotypes, null allele Mdacs3a (not ACS3a-G289V) could confer a significant delay of ethylene peak; alleles MdACS1-2 and Mdacs3a (excluding ACS3a-G289V) were highly enriched in M. domestica and M. hybrid when compared with those in M. sieversii. These findings are of practical implications in developing apples of low and delayed ethylene profiles by utilizing the beneficial alleles MdACS1-2 and Mdacs3a. PMID:27231553

  6. Functional analyses of cellulose synthase genes in flax (Linum usitatissimum) by virus-induced gene silencing.

    PubMed

    Chantreau, Maxime; Chabbert, Brigitte; Billiard, Sylvain; Hawkins, Simon; Neutelings, Godfrey

    2015-12-01

    Flax (Linum usitatissimum) bast fibres are located in the stem cortex where they play an important role in mechanical support. They contain high amounts of cellulose and so are used for linen textiles and in the composite industry. In this study, we screened the annotated flax genome and identified 14 distinct cellulose synthase (CESA) genes using orthologous sequences previously identified. Transcriptomics of 'primary cell wall' and 'secondary cell wall' flax CESA genes showed that some were preferentially expressed in different organs and stem tissues providing clues as to their biological role(s) in planta. The development for the first time in flax of a virus-induced gene silencing (VIGS) approach was used to functionally evaluate the biological role of different CESA genes in stem tissues. Quantification of transcript accumulation showed that in many cases, silencing not only affected targeted CESA clades, but also had an impact on other CESA genes. Whatever the targeted clade, inactivation by VIGS affected plant growth. In contrast, only clade 1- and clade 6-targeted plants showed modifications in outer-stem tissue organization and secondary cell wall formation. In these plants, bast fibre number and structure were severely impacted, suggesting that the targeted genes may play an important role in the establishment of the fibre cell wall. Our results provide new fundamental information about cellulose biosynthesis in flax that should facilitate future plant improvement/engineering. PMID:25688574

  7. Purification and characterization of cannabidiolic-acid synthase from Cannabis sativa L.. Biochemical analysis of a novel enzyme that catalyzes the oxidocyclization of cannabigerolic acid to cannabidiolic acid.

    PubMed

    Taura, F; Morimoto, S; Shoyama, Y

    1996-07-19

    We identified a unique enzyme that catalyzes the oxidocyclization of cannabigerolic acid to cannabidiolic acid (CBDA) in Cannabis sativa L. (CBDA strain). The enzyme, named CBDA synthase, was purified to apparent homogeneity by a four-step procedure: ammonium sulfate precipitation followed by chromatography on DEAE-cellulose, phenyl-Sepharose CL-4B, and hydroxylapatite. The active enzyme consists of a single polypeptide with a molecular mass of 74 kDa and a pI of 6.1. The NH2-terminal amino acid sequence of CBDA synthase is similar to that of Delta1-tetrahydrocannabinolic-acid synthase. CBDA synthase does not require coenzymes, molecular oxygen, hydrogen peroxide, and metal ion cofactors for the oxidocyclization reaction. These results indicate that CBDA synthase is neither an oxygenase nor a peroxidase and that the enzymatic cyclization does not proceed via oxygenated intermediates. CBDA synthase catalyzes the formation of CBDA from cannabinerolic acid as well as cannabigerolic acid, although the kcat for the former (0.03 s-1) is lower than that for the latter (0.19 s-1). Therefore, we conclude that CBDA is predominantly biosynthesized from cannabigerolic acid rather than cannabinerolic acid. PMID:8663284

  8. Fatty acid synthase-positive hepatocytes and subsequent steatosis in rat livers by irinotecan

    PubMed Central

    SAWANO, TAKEYUKI; SHIMIZU, TAKESHI; YAMADA, TOSHIYUKI; NANASHIMA, NAOKI; MIURA, TAKUYA; MOROHASHI, SATOKO; KUDO, DAISUKE; HUI, FENG MAO; KIJIMA, HIROSHI; HAKAMADA, KENICHI; TSUCHIDA, SHIGEKI

    2015-01-01

    Using a rat model, we investigated factors contributing to the pathogenesis of irinotecan-associated fatty liver disease. Male Sprague-Dawley rats were administered 200 mg/kg irinotecan by intraperitoneal injection on days 1–4, but not on days 5–7. This schedule was repeated 3 times. Rats were sacrificed 4, 18 and 25 days after the last injection, and liver steatosis was evaluated by hematoxylin and eosin (H&E) staining, microarray analysis and immunohistochemistry. Panacinar intrahepatocyte vacuoles were absent on days 4 and 25, but present on day 18, and this alteration was more prominent around the bile ducts than the central veins. Microarray analysis showed that the expression of genes involved in the synthesis of cholesterol and fatty acids was upregulated on day 4. Immunohistochemistry detected fatty acid synthase (Fasn)-strongly positive hepatocytes as well as the activation of liver progenitor cells on day 4, whereas intracellular vacuoles were evident in carbonic anhydrase 3 (CA3)-positive hepatocytes on day 18. Thus, irinotecan-induced liver steatosis was preceded by Fasn-strongly-positive hepatocytes and liver progenitor cell activation. The magnitude of the decrease in the number of Fasn-strongly positive hepatocytes between days 4 and 18 was similar to that of the increase in the number of CA3-positive hepatocytes accompanying vacuoles. PMID:25708528

  9. P300 acetyltransferase regulates fatty acid synthase expression, lipid metabolism and prostate cancer growth.

    PubMed

    Gang, Xiaokun; Yang, Yinhui; Zhong, Jian; Jiang, Kui; Pan, Yunqian; Karnes, R Jeffrey; Zhang, Jun; Xu, Wanhai; Wang, Guixia; Huang, Haojie

    2016-03-22

    De novo fatty acid (FA) synthesis is required for prostate cancer (PCa) survival and progression. As a key enzyme for FA synthesis fatty acid synthase (FASN) is often overexpressed in human prostate cancers and its expression correlates with worse prognosis and poor survival. P300 is an acetyltransferase that acts as a transcription co-activator. Increasing evidence suggests that P300 is a major PCa promoter, although the underlying mechanism remains poorly understood. Here, we demonstrated that P300 binds to and increases histone H3 lysine 27 acetylation (H3K27Ac) in the FASN gene promoter. We provided evidence that P300 transcriptionally upregulates FASN expression and promotes lipid accumulation in human PCa cells in culture and Pten knockout prostate tumors in mice. Pharmacological inhibition of P300 decreased FASN expression and lipid droplet accumulation in PCa cells. Immunohistochemistry analysis revealed that expression of P300 protein positively correlates with FASN protein levels in a cohort of human PCa specimens. We further showed that FASN is a key mediator of P300-induced growth of PCa cells in culture and in mice. Together, our findings demonstrate P300 as a key factor that regulates FASN expression, lipid accumulation and cell growth in PCa. They also suggest that this regulatory pathway can serve as a new therapeutic target for PCa treatment. PMID:26934656

  10. P300 acetyltransferase regulates fatty acid synthase expression, lipid metabolism and prostate cancer growth

    PubMed Central

    Zhong, Jian; Jiang, Kui; Pan, Yunqian; Karnes, R. Jeffrey; Zhang, Jun; Xu, Wanhai; Wang, Guixia; Huang, Haojie

    2016-01-01

    De novo fatty acid (FA) synthesis is required for prostate cancer (PCa) survival and progression. As a key enzyme for FA synthesis fatty acid synthase (FASN) is often overexpressed in human prostate cancers and its expression correlates with worse prognosis and poor survival. P300 is an acetyltransferase that acts as a transcription co-activator. Increasing evidence suggests that P300 is a major PCa promoter, although the underlying mechanism remains poorly understood. Here, we demonstrated that P300 binds to and increases histone H3 lysine 27 acetylation (H3K27Ac) in the FASN gene promoter. We provided evidence that P300 transcriptionally upregulates FASN expression and promotes lipid accumulation in human PCa cells in culture and Pten knockout prostate tumors in mice. Pharmacological inhibition of P300 decreased FASN expression and lipid droplet accumulation in PCa cells. Immunohistochemistry analysis revealed that expression of P300 protein positively correlates with FASN protein levels in a cohort of human PCa specimens. We further showed that FASN is a key mediator of P300-induced growth of PCa cells in culture and in mice. Together, our findings demonstrate P300 as a key factor that regulates FASN expression, lipid accumulation and cell growth in PCa. They also suggest that this regulatory pathway can serve as a new therapeutic target for PCa treatment. PMID:26934656

  11. Chitin synthase gene FgCHS8 affects virulence and fungal cell wall sensitivity to environmental stress in Fusarium graminearum.

    PubMed

    Zhang, Ya-Zhou; Chen, Qing; Liu, Cai-Hong; Liu, Yu-Bin; Yi, Pan; Niu, Ke-Xin; Wang, Yan-Qing; Wang, An-Qi; Yu, Hai-Yue; Pu, Zhi-En; Jiang, Qian-Tao; Wei, Yu-Ming; Qi, Peng-Fei; Zheng, You-Liang

    2016-05-01

    Fusarium graminearum is the major causal agent of Fusarium head blight (FHB) of wheat and barley and is considered to be one of the most devastating plant diseases worldwide. Chitin is a critical component of the fungal cell wall and is polymerized from UDP-N-acetyl-alpha-D-glucosamine by chitin synthase. We characterized FgCHS8, a new class of the chitin synthase gene in F. graminearum. Disruption of FgCHS8 resulted in reduced accumulation of chitin, decreased chitin synthase activity, and had no effect on conidia growth when compared with the wild-type isolate. ΔFgCHS8 had a growth rate comparable to that of the wild-type isolate in vitro. However, ΔFgCHS8 had reduced growth when grown on agar supplemented with either 0.025% SDS or 0.9 mM salicylic acid. ΔFgCHS8 produced significantly less deoxynivalenol and exhibited reduced pathogenicity in wheat spikes. Re-introduction of a functional FgCHS8 gene into the ΔFgCHS8 mutant strain restored the wild-type phenotypes. Fluorescence microscopy revealed that FgCHS8 protein was initially expressed in the septa zone, and then gradually distributed over the entire cellular membrane, indicating that FgCHS8 was required for cell wall development. Our results demonstrated that FgCHS8 is important for cell wall sensitivity to environmental stress factors and deoxynivalenol production in F. graminearum. PMID:27109372

  12. The Gene CBO0515 from Clostridium botulinum Strain Hall A Encodes the Rare Enzyme N5-(Carboxyethyl) Ornithine Synthase, EC 1.5.1.24▿

    PubMed Central

    Thompson, John; Hill, Karen K.; Smith, Theresa J.; Pikis, Andreas

    2010-01-01

    Sequencing of the genome of Clostridium botulinum strain Hall A revealed a gene (CBO0515), whose putative amino acid sequence was suggestive of the rare enzyme N5-(1-carboxyethyl) ornithine synthase. To test this hypothesis, CBO0515 has been cloned, and the encoded polypeptide was purified and characterized. This unusual gene appears to be confined to proteolytic strains assigned to group 1 of C. botulinum. PMID:19933367

  13. The maize An2 gene is induced by Fusarium attack and encodes an ent-copalyl diphosphate synthase.

    PubMed

    Harris, L J; Saparno, A; Johnston, A; Prisic, S; Xu, M; Allard, S; Kathiresan, A; Ouellet, T; Peters, R J

    2005-12-01

    Using the technique of differential display, a maize transcript was identified whose silk tissue expression is induced in the presence of the ear rot pathogen Fusarium graminearum. The 3445 nt transcript includes a 727 nt 5' untranslated leader with the potential for extensive secondary structure and represents the maize gene An2. An2 encodes a copalyl diphosphate synthase (CPS)-like protein with 60% amino acid sequence identity with the maize An1 gene product involved in gibberellin (GA) biosynthesis. Recombinant expression and functional analysis demonstrated that both AN1 and AN2 are ent-copalyl diphosphate (ent-CPP) synthases (ent-CPS). Notably, the presence of an additional ent-CPS gene is consistent with previous reports that maize GA biosynthesis can proceed in the absence of An1. In addition, northern blot analysis showed that An2 transcript levels were strongly up-regulated by Fusarium attack, with an increase in silk, husk and ear tip tissues as early as 6 h after inoculation of silk channels with spore suspensions of various Fusarium sp. Gene expression of a third maize CPS-like gene, Cpsl1, is not affected by Fusarium infection. The Fusarium-inducible nature of An2 is also consistent with a previous report that cell-free extracts from maize seedlings produce ent-CPP derived diterpenes in response to Fusarium infection. However, it is not known whether An2 is involved in defense-related secondary metabolism in addition to GA synthesis. PMID:16307364

  14. Cyclopropane fatty acid synthase mutants of probiotic human-derived Lactobacillus reuteri are defective in TNF inhibition

    PubMed Central

    Saulnier, Delphine; Thomas, Carissa M; Versalovic, James

    2011-01-01

    Although commensal microbes have been shown to modulate host immune responses, many of the bacterial factors that mediate immune regulation remain unidentified. Select strains of human-derived Lactobacillus reuteri synthesize immunomodulins that potently inhibit production of the inflammatory cytokine TNF. In this study, genetic and genomic approaches were used to identify and investigate L. reuteri genes required for human TNF immunomodulatory activity. Analysis of membrane fatty acids from multiple L. reuteri strains cultured in MRS medium showed that only TNF inhibitory strains produced the cyclopropane fatty acid (CFA) lactobacillic acid. The enzyme cyclopropane fatty acid synthase is required for synthesis of CFAs such as lactobacillic acid, therefore the cfa gene was inactivated and supernatants from the cfa mutant strain were assayed for TNF inhibitory activity. We found that supernatants from the wild-type strain, but not the cfa mutant, suppressed TNF production by activated THP-1 human monocytoid cells. Although this suggested a direct role for lactobacillic acid in immunomodulation, purified lactobacillic acid did not suppress TNF at physiologically relevant concentrations. We further analyzed TNF inhibitory and TNF non-inhibitory strains under different growth conditions and found that lactobacillic acid production did not correlate with TNF inhibition. These results indicate that cfa indirectly contributed to L. reuteri immunomodulatory activity and suggest that other mechanisms, such as decreased membrane fluidity or altered expression of immunomodulins, result in the loss of TNF inhibitory activity. By increasing our understanding of immunomodulation by probiotic species, beneficial microbes can be rationally selected to alleviate intestinal inflammation. PMID:21637024

  15. Parallel evolution of the glycogen synthase 1 (muscle) gene Gys1 between Old World and New World fruit bats (Order: Chiroptera).

    PubMed

    Fang, Lu; Shen, Bin; Irwin, David M; Zhang, Shuyi

    2014-10-01

    Glycogen synthase, which catalyzes the synthesis of glycogen, is especially important for Old World (Pteropodidae) and New World (Phyllostomidae) fruit bats that ingest high-carbohydrate diets. Glycogen synthase 1, encoded by the Gys1 gene, is the glycogen synthase isozyme that functions in muscles. To determine whether Gys1 has undergone adaptive evolution in bats with carbohydrate-rich diets, in comparison to insect-eating sister bat taxa, we sequenced the coding region of the Gys1 gene from 10 species of bats, including two Old World fruit bats (Pteropodidae) and a New World fruit bat (Phyllostomidae). Our results show no evidence for positive selection in the Gys1 coding sequence on the ancestral Old World and the New World Artibeus lituratus branches. Tests for convergent evolution indicated convergence of the sequences and one parallel amino acid substitution (T395A) was detected on these branches, which was likely driven by natural selection. PMID:25001420

  16. Small-Interfering RNAs from Natural Antisense Transcripts Derived from a Cellulose Synthase Gene Modulate Cell Wall Biosynthesis in Barley

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Viral-induced gene silencing of members of the cellulose synthase/cellulose synthase-like (CesA/Csl) gene superfamily in barley (Hordeum vulgare cv. Blackhulless) using the Barley Stripe Mosaic Virus reduced theincorporation of D-14C-Glc into cellulose and into mixed-linkage (1'3),(1'4)-'-D-glucans ...

  17. Zaragozic acids: a family of fungal metabolites that are picomolar competitive inhibitors of squalene synthase.

    PubMed

    Bergstrom, J D; Kurtz, M M; Rew, D J; Amend, A M; Karkas, J D; Bostedor, R G; Bansal, V S; Dufresne, C; VanMiddlesworth, F L; Hensens, O D

    1993-01-01

    Three closely related fungal metabolites, zaragozic acids A, B, and C, that are potent inhibitors of squalene synthase have been isolated and characterized. Zaragozic acids A, B, and C were produced from an unidentified sterile fungal culture, Sporormiella intermedia, and Leptodontium elatius, respectively. The structures of the zaragozic acids and their trimethyl esters were determined by a combination of physical and chemical techniques. The zaragozic acids are characterized by a novel 2,8-dioxobicyclo[3.2.1]octane-4,6,7- trihydroxyl-3,4,5-tricarboxylic acid core and differ from each other in the structures of the 6-acyl and 1-alkyl side chains. They were found to be potent competitive inhibitors of rat liver squalene synthase with apparent Ki values of 78 pM, 29 pM, and 45 pM, respectively. They inhibited cholesterol synthesis in Hep G2 cells, and zaragozic acid A was an inhibitor of acute hepatic cholesterol synthesis in the mouse (50% inhibitory dose of 200 micrograms/kg of body weight). Inhibition of squalene synthase in cells and in vivo was accompanied by an accumulation of label from [3H]mevalonate into farnesyl diphosphate, farnesol, and organic acids. These data indicate that the zaragozic acids are a previously unreported class of therapeutic agents with potential for the treatment of hypercholesterolemia. PMID:8419946

  18. Microbial Type I Fatty Acid Synthases (FAS): Major Players in a Network of Cellular FAS Systems

    PubMed Central

    Schweizer, Eckhart; Hofmann, Jörg

    2004-01-01

    The present review focuses on microbial type I fatty acid synthases (FASs), demonstrating their structural and functional diversity. Depending on their origin and biochemical function, multifunctional type I FAS proteins form dimers or hexamers with characteristic organization of their catalytic domains. A single polypeptide may contain one or more sets of the eight FAS component functions. Alternatively, these functions may split up into two different and mutually complementing subunits. Targeted inactivation of the individual yeast FAS acylation sites allowed us to define their roles during the overall catalytic process. In particular, their pronounced negative cooperativity is presumed to coordinate the FAS initiation and chain elongation reactions. Expression of the unlinked genes, FAS1 and FAS2, is in part constitutive and in part subject to repression by the phospholipid precursors inositol and choline. The interplay of the involved regulatory proteins, Rap1, Reb1, Abf1, Ino2/Ino4, Opi1, Sin3 and TFIIB, has been elucidated in considerable detail. Balanced levels of subunits α and β are ensured by an autoregulatory effect of FAS1 on FAS2 expression and by posttranslational degradation of excess FAS subunits. The functional specificity of type I FAS multienzymes usually requires the presence of multiple FAS systems within the same cell. De novo synthesis of long-chain fatty acids, mitochondrial fatty acid synthesis, acylation of certain secondary metabolites and coenzymes, fatty acid elongation, and the vast diversity of mycobacterial lipids each result from specific FAS activities. The microcompartmentalization of FAS activities in type I multienzymes may thus allow for both the controlled and concerted action of multiple FAS systems within the same cell. PMID:15353567

  19. Identification and Characterization of a Novel Trehalose Synthase Gene Derived from Saline-Alkali Soil Metagenomes

    PubMed Central

    Zhang, Yang; Li, Yanping; Xu, Xian; Li, Shuang; He Huang

    2013-01-01

    A novel trehalose synthase (TreS) gene was identified from a metagenomic library of saline-alkali soil by a simple activity-based screening system. Sequence analysis revealed that TreS encodes a protein of 552 amino acids, with a deduced molecular weight of 63.3 kDa. After being overexpressed in Escherichia coli and purified, the enzymatic properties of TreS were investigated. The recombinant TreS displayed its optimal activity at pH 9.0 and 45 °C, and the addition of most common metal ions (1 or 30 mM) had no inhibition effect on the enzymatic activity evidently, except for the divalent metal ions Zn2+ and Hg2+. Kinetic analysis showed that the recombinant TreS had a 4.1-fold higher catalytic efficientcy (Kcat/Km) for maltose than for trehalose. The maximum conversion rate of maltose into trehalose by the TreS was reached more than 78% at a relatively high maltose concentration (30%), making it a good candidate in the large-scale production of trehalsoe after further study. In addition, five amino acid residues, His172, Asp201, Glu251, His318 and Asp319, were shown to be conserved in the TreS, which were also important for glycosyl hydrolase family 13 enzyme catalysis. PMID:24146994

  20. Novel terpenes generated by heterologous expression of bacterial terpene synthase genes in an engineered Streptomyces host.

    PubMed

    Yamada, Yuuki; Arima, Shiho; Nagamitsu, Tohru; Johmoto, Kohei; Uekusa, Hidehiro; Eguchi, Tadashi; Shin-ya, Kazuo; Cane, David E; Ikeda, Haruo

    2015-06-01

    Mining of bacterial genome data has revealed numerous presumptive terpene synthases. Heterologous expression of several putative terpene synthase genes in an engineered Streptomyces host has revealed 13 newly discovered terpenes whose GC-MS and NMR data did not match with any known compounds in spectroscopic databases. Each of the genes encoding the corresponding terpene synthases were silent in their parent microorganisms. Heterologous expression and detailed NMR spectroscopic analysis allowed assignment of the structures of 13 new cyclic terpenes. Among these newly identified compounds, two were found to be linear triquinane sesquiterpenes that have never previously been isolated from bacteria or any other source. The remaining 11 new compounds were shown to be diterpene hydrocarbons and alcohol, including hydropyrene (1), hydropyrenol (2), tsukubadiene (11) and odyverdienes A (12) and B (13) each displaying a novel diterpene skeleton that had not previously been reported. PMID:25605043

  1. Novel terpenes generated by heterologous expression of bacterial terpene synthase genes in an engineered Streptomyces host

    PubMed Central

    Yamada, Yuuki; Arima, Shiho; Nagamitsu, Tohru; Johmoto, Kohei; Uekusa, Hidehiro; Eguchi, Tadashi; Shin’ya, Kazuo; Cane, David E.; Ikeda, Haruo

    2016-01-01

    Mining of bacterial genome data has revealed numerous presumptive terpene synthases. Heterologous expression of several putative terpene synthase genes in an engineered Streptomyces host has revealed 13 newly discovered terpenes whose GC-MS and NMR data did not match any known compounds in the spectroscopic databases. Each of the genes encoding the corresponding terpene synthases were silent in their parent microorganisms. Heterologous expression and detailed NMR spectroscopic analysis allowed assignment of the structures of 13 new cyclic terpenes. Among these newly identified compounds, two were found to be linear triquinane sesquiterpenes that have never previously been isolated from bacteria or any other source. The remaining 11 new compounds were shown to be diterpene hydrocarbons and alcohol, including hydropyrene (1), hydropyrenol (2), tsukubadiene (11), and odyverdienes A (12) and B (13) each displaying a novel diterpene skeleton that had not previously been reported. PMID:25605043

  2. Selective protection and relative importance of the carboxylic acid groups of zaragozic acid A for squalene synthase inhibition.

    PubMed

    Biftu, T; Acton, J J; Berger, G D; Bergstrom, J D; Dufresne, C; Kurtz, M M; Marquis, R W; Parsons, W H; Rew, D R; Wilson, K E

    1994-02-01

    Chemistry that allows selective modification of the carboxylic acid groups of the squalene synthase inhibitor zaragozic acid A (1) was developed and applied to the synthesis of compounds modified at the 3-,4-,5-,3,4-,3,5-, and 4,5-positions. A key step in this procedure is the selective debenzylation by transfer hydrogenolysis in the presence of other olefinic groups. These compounds were tested in the rat squalene synthase assay and in vivo mouse model. Modification at C3 retains significant enzyme potency and enhances oral activity, indicating that C3 is not essential for squalene synthase activity. Modification at C4 and C5 results in significant loss in enzyme activity. In contrast, substitution at C3 or C4 enhances in vivo activity. Furthermore, disubstitution at the C3 and C4 positions results in additive in vivo potency. PMID:8308869

  3. Identification and Characterization of CPS1 as a Hyaluronic Acid Synthase Contributing to the Pathogenesis of Cryptococcus neoformans Infection▿

    PubMed Central

    Jong, Ambrose; Wu, Chun-Hua; Chen, Han-Min; Luo, Feng; Kwon-Chung, Kyung J.; Chang, Yun C.; LaMunyon, Craig W.; Plaas, Anna; Huang, Sheng-He

    2007-01-01

    Cryptococcus neoformans is a pathogenic yeast that often causes devastating meningoencephalitis in immunocompromised individuals. We have previously identified the C. neoformans CPS1 gene, which is required for a capsular layer on the outer cell wall. In this report, we investigate the function of the CPS1 gene and its pathogenesis. We demonstrated that treatment of yeast with either 4-methylumbelliferone or hyaluronidase resulted in a reduction of the level of C. neoformans binding to human brain microvascular endothelial cells (HBMEC). Yeast extracellular structures were also altered accordingly in hyaluronidase-treated cells. Furthermore, observation of yeast strains with different hyaluronic acid contents showed that the ability to bind to HBMEC is proportional to the hyaluronic acid content. A killing assay with Caenorhabditis elegans demonstrated that the CPS1 wild-type strain is more virulent than the cps1Δ strain. When CPS1 is expressed in Saccharomyces cerevisiae and Escherichia coli, hyaluronic acid can be detected in the cells. Additionally, we determined by fluorophore-assisted carbohydrate electrophoretic analysis that hyaluronic acid is a component of the C. neoformans capsule. The size of hyaluronic acid molecules is evaluated by gel filtration and transmission electron microscopy studies. Together, our results support that C. neoformans CPS1 encodes hyaluronic acid synthase and that its product, hyaluronic acid, plays a role as an adhesion molecule during the association of endothelial cells with yeast. PMID:17545316

  4. Recent Progress on the Construction and Testing of a Fusion Poly(hydroxyalkanoate) Synthase Gene

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Poly(hydroxyalkanoates) (PHAs) are biodegradable polyesters produced by some bacteria. Two genes in Allochromatium vinosum, phaE and phaC, respectively code for the two subunits of the enzyme complex, PHA synthase, which catalyzes the polymerization of precursors into PHA. We hypothesized that by ...

  5. Molecular and phylogenetic characterization of the homoeologous EPSP Synthase genes of allohexaploid wheat, Triticum aestivum (L.)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: 5-Enolpyruvylshikimate-3-phosphate synthase (EPSPS) is the sixth and penultimate enzyme in the shikimate biosynthesis pathway. The EPSPS genes of allohexaploid wheat (Triticum aestivum, AABBDD) have not been well characterized. Herein, the three homoeologous copies of the wheat EPSPS gen...

  6. Self-consistent synthesis of the squalene synthase inhibitor zaragozic acid C via controlled oligomerization.

    PubMed

    Nicewicz, David A; Satterfield, Andrew D; Schmitt, Daniel C; Johnson, Jeffrey S

    2008-12-24

    Despite the prevalence of repeating subunits in chiral natural products, stereocontrolled oligomerization is a largely unexplored strategy for construction of carbon skeletal frameworks. This report describes the use of silyl glyoxylates as dipolar glycolic acid synthons in a controlled oligomerization reaction for the efficient construction of the squalene synthase inhibitor zaragozic acid C. This new methodology allows rapid, stereocontrolled formation of the carbon skeleton with a desirable protecting group scheme while minimizing functional group repair and oxidation state manipulations. PMID:19053214

  7. Cloning and Expression of Poly(hydroxyalkanoate) Synthase Genes from Photosynthetic bacterium Allochromatium vinosum ATCC 35206

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Poly(hydroxyalkanoate) (PHA) synthases catalyze the polymerization of beta-hydroxy fatty acids to form PHA biopolyesters. These enzymes are grouped into four classes (classes I to IV) based on their subunit composition and substrate specificity. Since PHA biopolymers are naturally synthesized by b...

  8. Free radical oxidation of (E)-retinoic acid by prostaglandin H synthase.

    PubMed

    Samokyszyn, V M; Chen, T; Maddipati, K R; Franz, T J; Lehman, P A; Lloyd, R V

    1995-01-01

    Cooxidative metabolism of all-trans (E)-retinoic acid (RA) by prostaglandin H synthase was investigated employing ram seminal vesicle microsomes (RSVM) or purified, RSVM-derived enzyme. RA was shown to undergo hydroperoxide [H2O2 or 5-phenyl-4-penten-1-yl hydroperoxide (PPHP)]- or arachidonic acid-dependent cooxidation by microsomal prostaglandin H (PGH) synthase as evidenced by UV spectroscopic analysis of reaction mixtures. Cooxidation of RA by microsomal or purified PGH synthase, using PPHP as substrate, was characterized by uptake of dioxygen which was first order with respect to enzyme concentration. Dioxygen uptake was inhibited by the peroxidase reducing substrate 2-methoxyphenol. In addition, O2 uptake was inhibited by the spin trap nitrosobenzene. ESR spin trapping studies, using alpha-phenyl-N-tert-butylnitrone (PBN) as the spin trap, demonstrated the formation of RA-PBN adducts, characterized by hyperfine coupling constants of alpha H = 3.2 G and alpha N = 15.8 G. Reverse phase HPLC analysis of reaction mixtures demonstrated the formation of 4-hydroxy-RA, 5,6-epoxy-RA, 4-oxo-RA, (13Z)-retinoic acid, and other geometric isomers which were identified on the basis of cochromatography with synthetic standards, UV spectroscopy, and/or mass spectrometry. Mechanisms are proposed for the hydroperoxide-dependent, PGH synthase-catalyzed oxidation of RA that are consistent with these results. PMID:7548765

  9. {alpha}-Lipoic acid prevents lipotoxic cardiomyopathy in acyl CoA-synthase transgenic mice

    SciTech Connect

    Lee, Young; Naseem, R. Haris; Park, Byung-Hyun; Garry, Daniel J.; Richardson, James A.; Schaffer, Jean E.; Unger, Roger H. . E-mail: roger.unger@utsouthwestern.edu

    2006-05-26

    {alpha}-Lipoic acid ({alpha}-LA) mimics the hypothalamic actions of leptin on food intake, energy expenditure, and activation of AMP-activated protein kinase (AMPK). To determine if, like leptin, {alpha}-LA protects against cardiac lipotoxicity, {alpha}-LA was fed to transgenic mice with cardiomyocyte-specific overexpression of the acyl CoA synthase (ACS) gene. Untreated ACS-transgenic mice died prematurely with increased triacylglycerol content and dilated cardiomyopathy, impaired systolic function and myofiber disorganization, apoptosis, and interstitial fibrosis on microscopy. In {alpha}-LA-treated ACS-transgenic mice heart size, echocardiogram and TG content were normal. Plasma TG fell 50%, hepatic-activated phospho-AMPK rose 6-fold, sterol regulatory element-binding protein-1c declined 50%, and peroxisome proliferator-activated receptor-{gamma} cofactor-1{alpha} mRNA rose 4-fold. Since food restriction did not prevent lipotoxicity, we conclude that {alpha}-LA treatment, like hyperleptinemia, protects the heart of ACS-transgenic mice from lipotoxicity.

  10. Apoptotic effect of tannic acid on fatty acid synthase over-expressed human breast cancer cells.

    PubMed

    Nie, Fangyuan; Liang, Yan; Jiang, Bing; Li, Xiabing; Xun, Hang; He, Wei; Lau, Hay Tong; Ma, Xiaofeng

    2016-02-01

    Breast cancer is one of the most common cancers and is the second leading cause of cancer mortality in women worldwide. Novel therapies and chemo-therapeutic drugs are urgently needed to be developed for the treatment of breast cancer. Increasing evidence suggests that fatty acid synthase (FAS) plays an important role in breast cancer, for the expression of FAS is significantly higher in human breast cancer cells than in normal cells. Tannic acid (TA), a natural polyphenol, possesses significant biological functions, including bacteriostasis, hemostasis, and anti-oxidant. Our previous studies demonstrated that TA is a natural FAS inhibitor whose inhibitory activity is stronger than that of classical FAS inhibitors, such as C75 and cerulenin. This study further assessed the effect and therapeutic potential of TA on FAS over-expressed breast cancer cells, and as a result, TA had been proven to possess the functions of inhibiting intracellular FAS activity, down-regulating FAS expression in human breast cancer MDA-MB-231 and MCF-7 cells, and inducing cancer cell apoptosis. Since high-expressed FAS is recognized as a molecular marker for breast cancer and plays an important role in cancer prognosis, these findings suggest that TA is a potential drug candidate for treatment of breast cancer. PMID:26349913

  11. Massive production of farnesol-derived dicarboxylic acids in mice treated with the squalene synthase inhibitor zaragozic acid A.

    PubMed

    Vaidya, S; Bostedor, R; Kurtz, M M; Bergstrom, J D; Bansal, V S

    1998-07-01

    The zaragozic acids are potent inhibitors of squalene synthase. In vivo studies in mice confirmed our earlier observations that inhibition of squalene synthase by zaragozic acid A was accompanied by an increase in the incorporation of label from [3H]mevalonate into farnesyl-diphosphate (FPP)-derived isoprenoic acids (J. D. Bergstrom et al., 1993, Proc. Natl. Acad. Sci. USA 90, 80-84). Farnesyl-diphosphate-derived metabolites appear transiently in the liver. We were unable to detect any farnesol formation in the zaragozic acid-treated animals which indicates that FPP is readily converted to farnesoic acid and dicarboxylic acids in the liver. These metabolites were found to be produced only in the liver and not in the kidney. trans-3,7-Dimethyl-2-octaen-1,8-dioic acid and 3, 7-dimethyloctan-1,8-dioic acid were identified as the major end products of farnesyl-diphosphate metabolism in the urine of mice treated with zaragozic acid A. Quantitative analysis of these FPP-derived dicarboxylic acids by gas-liquid chromatography revealed that approximately 11 mg of total dicarboxylic acids is excreted per day into the urine of a mouse after 3 days of treatment with zaragozic acid A. PMID:9647670

  12. Tolerance to toxic metals by a gene family of phytochelatin synthases from plants and yeast.

    PubMed

    Clemens, S; Kim, E J; Neumann, D; Schroeder, J I

    1999-06-15

    Phytochelatins play major roles in metal detoxification in plants and fungi. However, genes encoding phytochelatin synthases have not yet been identified. By screening for plant genes mediating metal tolerance we identified a wheat cDNA, TaPCS1, whose expression in Saccharomyces cerevisiae results in a dramatic increase in cadmium tolerance. TaPCS1 encodes a protein of approximately 55 kDa with no similarity to proteins of known function. We identified homologs of this new gene family from Arabidopsis thaliana, Schizosaccharomyces pombe, and interestingly also Caenorhabditis elegans. The Arabidopsis and S.pombe genes were also demonstrated to confer substantial increases in metal tolerance in yeast. PCS-expressing cells accumulate more Cd2+ than controls. PCS expression mediates Cd2+ tolerance even in yeast mutants that are either deficient in vacuolar acidification or impaired in vacuolar biogenesis. PCS-induced metal resistance is lost upon exposure to an inhibitor of glutathione biosynthesis, a process necessary for phytochelatin formation. Schizosaccharomyces pombe cells disrupted in the PCS gene exhibit hypersensitivity to Cd2+ and Cu2+ and are unable to synthesize phytochelatins upon Cd2+ exposure as determined by HPLC analysis. Saccharomyces cerevisiae cells expressing PCS produce phytochelatins. Moreover, the recombinant purified S.pombe PCS protein displays phytochelatin synthase activity. These data demonstrate that PCS genes encode phytochelatin synthases and mediate metal detoxification in eukaryotes. PMID:10369673

  13. Lineage-Specific Expansion of the Chalcone Synthase Gene Family in Rosids

    PubMed Central

    Zavala, Kattina; Opazo, Juan C.

    2015-01-01

    Rosids are a monophyletic group that includes approximately 70,000 species in 140 families, and they are found in a variety of habitats and life forms. Many important crops such as fruit trees and legumes are rosids. The evolutionary success of this group may have been influenced by their ability to produce flavonoids, secondary metabolites that are synthetized through a branch of the phenylpropanoid pathway where chalcone synthase is a key enzyme. In this work, we studied the evolution of the chalcone synthase gene family in 12 species belonging to the rosid clade. Our results show that the last common ancestor of the rosid clade possessed six chalcone synthase gene lineages that were differentially retained during the evolutionary history of the group. In fact, of the six gene lineages that were present in the last common ancestor, 7 species retained 2 of them, whereas the other 5 only retained one gene lineage. We also show that one of the gene lineages was disproportionately expanded in species that belonged to the order Fabales (soybean, barrel medic and Lotus japonicas). Based on the available literature, we suggest that this gene lineage possesses stress-related biological functions (e.g., response to UV light, pathogen defense). We propose that the observed expansion of this clade was a result of a selective pressure to increase the amount of enzymes involved in the production of phenylpropanoid pathway-derived secondary metabolites, which is consistent with the hypothesis that suggested that lineage-specific expansions fuel plant adaptation. PMID:26181912

  14. Identification, cloning and expression of the mouse N-acetylglutamate synthase gene.

    PubMed Central

    Caldovic, Ljubica; Morizono, Hiroki; Yu, Xiaolin; Thompson, Mark; Shi, Dashuang; Gallegos, Rene; Allewell, Norma M; Malamy, Michael H; Tuchman, Mendel

    2002-01-01

    In ureotelic animals, N-acetylglutamate (NAG) is an essential allosteric activator of carbamylphosphate synthetase I (CPSI), the first enzyme in the urea cycle. NAG synthase (NAGS; EC 2.3.1.1) catalyses the formation of NAG from glutamate and acetyl-CoA in liver and intestinal mitochondria. This enzyme is supposed to regulate ureagenesis by producing variable amounts of NAG, thus modulating CPSI activity. Moreover, inherited deficiencies in NAGS have been associated with hyperammonaemia, probably due to the loss of CPSI activity. Although the existence of the NAGS protein in mammals has been known for decades, the gene has remained elusive. We identified the mouse (Mus musculus) and human NAGS genes using their similarity to the respective Neurospora crassa gene. NAGS was cloned from a mouse liver cDNA library and was found to encode a 2.3 kb message, highly expressed in liver and small intestine with lower expression levels in kidney, spleen and testis. The deduced amino acid sequence contains a putative mitochondrial targeting signal at the N-terminus. The cDNA sequence complements an argA (NAGS)-deficient Escherichia coli strain, reversing its arginine auxotrophy. His-tagged versions of the pre-protein and two putative mature proteins were each overexpressed in E. coli, and purified to apparent homogeneity by using a nickel-affinity column. The pre-protein and the two putative mature proteins catalysed the NAGS reaction but one of the putative mature enzymes had significantly higher activity than the pre-protein. The addition of l-arginine increased the catalytic activity of the purified recombinant NAGS enzymes by approx. 2-6-fold. PMID:12049647

  15. Identification, cloning and expression of the mouse N-acetylglutamate synthase gene.

    PubMed

    Caldovic, Ljubica; Morizono, Hiroki; Yu, Xiaolin; Thompson, Mark; Shi, Dashuang; Gallegos, Rene; Allewell, Norma M; Malamy, Michael H; Tuchman, Mendel

    2002-06-15

    In ureotelic animals, N-acetylglutamate (NAG) is an essential allosteric activator of carbamylphosphate synthetase I (CPSI), the first enzyme in the urea cycle. NAG synthase (NAGS; EC 2.3.1.1) catalyses the formation of NAG from glutamate and acetyl-CoA in liver and intestinal mitochondria. This enzyme is supposed to regulate ureagenesis by producing variable amounts of NAG, thus modulating CPSI activity. Moreover, inherited deficiencies in NAGS have been associated with hyperammonaemia, probably due to the loss of CPSI activity. Although the existence of the NAGS protein in mammals has been known for decades, the gene has remained elusive. We identified the mouse (Mus musculus) and human NAGS genes using their similarity to the respective Neurospora crassa gene. NAGS was cloned from a mouse liver cDNA library and was found to encode a 2.3 kb message, highly expressed in liver and small intestine with lower expression levels in kidney, spleen and testis. The deduced amino acid sequence contains a putative mitochondrial targeting signal at the N-terminus. The cDNA sequence complements an argA (NAGS)-deficient Escherichia coli strain, reversing its arginine auxotrophy. His-tagged versions of the pre-protein and two putative mature proteins were each overexpressed in E. coli, and purified to apparent homogeneity by using a nickel-affinity column. The pre-protein and the two putative mature proteins catalysed the NAGS reaction but one of the putative mature enzymes had significantly higher activity than the pre-protein. The addition of l-arginine increased the catalytic activity of the purified recombinant NAGS enzymes by approx. 2-6-fold. PMID:12049647

  16. Wound-induced terpene synthase gene expression in Sitka spruce that exhibit resistance or susceptibility to attack by the white pine weevil.

    PubMed

    Byun-McKay, Ashley; Godard, Kimberley-Ann; Toudefallah, Morteza; Martin, Diane M; Alfaro, Rene; King, John; Bohlmann, Joerg; Plant, Aine L

    2006-03-01

    We analyzed the expression pattern of various terpene synthase (TPS) genes in response to a wounding injury applied to the apical leader of Sitka spruce (Picea sitchensis Bong. Carr.) genotypes known to be resistant (R) or susceptible (S) to white pine weevil (Pissodes strobi Peck.) attack. The purpose was to test if differences in constitutive or wound-induced TPS expression can be associated with established weevil resistance. All wounding treatments were conducted on 9-year-old R and S trees growing under natural field conditions within the range of variation for weevil R and S genotypes. Representative cDNAs of the monoterpene synthase (mono-TPS), sesquiterpene synthase (sesqui-TPS), and diterpene synthase (di-TPS) classes were isolated from Sitka spruce to assess TPS transcript levels. Based on amino acid sequence similarity, the cDNAs resemble Norway spruce (Picea abies) (-)-linalool synthase (mono-TPS; PsTPS-Linl) and levopimaradiene/abietadiene synthase (di-TPS; PsTPS-LASl), and grand fir (Abies grandis) delta-selinene synthase (sesqui-TPS; PsTPS-Sell). One other mono-TPS was functionally identified as (-)-limonene synthase (PsTPS-Lim). No significant difference in constitutive expression levels for these TPSs was detected between R and S trees. However, over a postwounding period of 16 d, only R trees exhibited significant transcript accumulation for the mono- and sesqui-TPS tested. Both R and S trees exhibited a significant accumulation of PsTPS-LASl transcripts. An assessment of traumatic resin duct formation in wounded leaders showed that both R and S trees responded by forming traumatic resin ducts; however, the magnitude of this response was significantly greater in R trees. Collectively, our data imply that the induced resinosis response is an important aspect of defense in weevil R Sitka spruce trees growing under natural conditions. PMID:16415217

  17. Coexpressing Escherichia coli Cyclopropane Synthase with Sterculia foetida Lysophosphatidic Acid Acyltransferase Enhances Cyclopropane Fatty Acid Accumulation1[W][OPEN

    PubMed Central

    Yu, Xiao-Hong; Prakash, Richa Rawat; Sweet, Marie; Shanklin, John

    2014-01-01

    Cyclopropane fatty acids (CPAs) are desirable as renewable chemical feedstocks for the production of paints, plastics, and lubricants. Toward our goal of creating a CPA-accumulating crop, we expressed nine higher plant cyclopropane synthase (CPS) enzymes in the seeds of fad2fae1 Arabidopsis (Arabidopsis thaliana) and observed accumulation of less than 1% CPA. Surprisingly, expression of the Escherichia coli CPS gene resulted in the accumulation of up to 9.1% CPA in the seed. Coexpression of a Sterculia foetida lysophosphatidic acid acyltransferase (SfLPAT) increases CPA accumulation up to 35% in individual T1 seeds. However, seeds with more than 9% CPA exhibit wrinkled seed morphology and reduced size and oil accumulation. Seeds with more than 11% CPA exhibit strongly decreased seed germination and establishment, and no seeds with CPA more than 15% germinated. That previous reports suggest that plant CPS prefers the stereospecific numbering (sn)-1 position whereas E. coli CPS acts on sn-2 of phospholipids prompted us to investigate the preferred positions of CPS on phosphatidylcholine (PC) and triacylglycerol. Unexpectedly, in planta, E. coli CPS acts primarily on the sn-1 position of PC; coexpression of SfLPAT results in the incorporation of CPA at the sn-2 position of lysophosphatidic acid. This enables a cycle that enriches CPA at both sn-1 and sn-2 positions of PC and results in increased accumulation of CPA. These data provide proof of principle that CPA can accumulate to high levels in transgenic seeds and sets the stage for the identification of factors that will facilitate the movement of CPA from PC into triacylglycerol to produce viable seeds with additional CPA accumulation. PMID:24204024

  18. Crystallization of Δ{sup 1}-tetrahydrocannabinolic acid (THCA) synthase from Cannabis sativa

    SciTech Connect

    Shoyama, Yoshinari; Takeuchi, Ayako; Taura, Futoshi; Tamada, Taro; Adachi, Motoyasu; Kuroki, Ryota; Shoyama, Yukihiro; Morimoto, Satoshi

    2005-08-01

    Δ{sup 1}-Tetrahydrocannabinolic acid (THCA) synthase from C. sativa was crystallized. The crystal diffracted to 2.7 Å resolution with sufficient quality for further structure determination. Δ{sup 1}-Tetrahydrocannabinolic acid (THCA) synthase is a novel oxidoreductase that catalyzes the biosynthesis of the psychoactive compound THCA in Cannabis sativa (Mexican strain). In order to investigate the structure–function relationship of THCA synthase, this enzyme was overproduced in insect cells, purified and finally crystallized in 0.1 M HEPES buffer pH 7.5 containing 1.4 M sodium citrate. A single crystal suitable for X-ray diffraction measurement was obtained in 0.09 M HEPES buffer pH 7.5 containing 1.26 M sodium citrate. The crystal diffracted to 2.7 Å resolution at beamline BL41XU, SPring-8. The crystal belonged to the primitive cubic space group P432, with unit-cell parameters a = b = c = 178.2 Å. The calculated Matthews coefficient was approximately 4.1 or 2.0 Å{sup 3} Da{sup −1} assuming the presence of one or two molecules of THCA synthase in the asymmetric unit, respectively.

  19. SFH2 regulates fatty acid synthase activity in the yeast Saccharomyces cerevisiae and is critical to prevent saturated fatty acid accumulation in response to haem and oleic acid depletion.

    PubMed

    Desfougères, Thomas; Ferreira, Thierry; Bergès, Thierry; Régnacq, Matthieu

    2008-01-01

    The yeast Saccharomyces cerevisiae is a facultative anaerobic organism. Under anaerobiosis, sustained growth relies on the presence of exogenously supplied unsaturated fatty acids and ergosterol that yeast is unable to synthesize in the absence of oxygen or upon haem depletion. In the absence of exogenous supplementation with unsaturated fatty acid, a net accumulation of SFA (saturated fatty acid) is observed that induces significant modification of phospholipid profile [Ferreira, Régnacq, Alimardani, Moreau-Vauzelle and Bergès (2004) Biochem. J. 378, 899-908]. In the present paper, we focus on the role of SFH2/CSR1, a hypoxic gene related to SEC14 and its involvement in lipid metabolism upon haem depletion in the absence of oleic acid supplementation. We observed that inactivation of SFH2 results in enhanced accumulation of SFA and phospholipid metabolism alterations. It results in premature growth arrest and leads to an exacerbated sensitivity to exogenous SFA. This phenotype is suppressed in the presence of exogenous oleic acid, or by a controlled expression of FAS1, one of the two genes encoding FAS. We present several lines of evidence to suggest that Sfh2p and oleic acid regulate SFA synthase in yeast at different levels: whereas oleic acid acts on FAS2 at the transcriptional level, we show that Sfh2p inhibits fatty acid synthase activity in response to haem depletion. PMID:17803462

  20. Analysis of genetic variability and relationships among Mentha L. using the limonene synthase gene, LS.

    PubMed

    Wang, Hai Tang; Yu, Xu; Liu, Yan; Liang, Cheng-Yuan; Li, Wei-Lin

    2013-07-25

    The genus Mentha comprises a group of aromatic plants with worldwide distribution. Because of frequent interspecific hybridization, the genetic relationships within the genus are not clearly understood. Limonene synthase, which catalyses the first committed step in the essential oil monoterpene biosynthetic pathway, is considered to be a possible rate limiting enzyme. With the homology-based cloning method, primers were designed according to cDNA sequence to amplify full-length DNA sequences in 13 Mentha samples from five species, using Perilla as an outgroup. Analyses of gene structure, length variation, GC-content, Ts/Tv ratio and evolutionary diversity were carried out. Consensus phylogenetic trees were obtained using maximum likelihood, neighbor-joining, and maximum parsimony, respectively, based on the full-length genomic DNA sequences, complete ORF coding sequences and predicted amino acid sequences. The results presented here based on the sequence of MhLS provide the first credibly supported genetic relationships for Mentha, which enables a basis for further mint taxonomy, cultivation and breeding. PMID:23612253

  1. Molecular characterization and expression analyses of an anthocyanin synthase gene from Magnolia sprengeri Pamp.

    PubMed

    Shi, Shou-Guo; Li, Shan-Ju; Kang, Yong-Xiang; Liu, Jian-Jun

    2015-01-01

    Anthocyanin synthase (ANS), which catalyzes the conversion of colorless leucoanthocyanins into colored anthocyanins, is a key enzyme in the anthocyanin biosynthetic pathway. It plays important roles in plant development and defense. An ANS gene designated as MsANS was cloned from Magnolia sprengeri using rapid amplification of complementary DNA (cDNA) ends technology. The full-length MsANS is 1171-bp long and contains a 1080-bp open reading frame encoding a 360 amino acid polypeptide. In a sequence alignment analysis, the deduced MsANS protein showed high identity to ANS proteins from other plants: Prunus salicina var. cordata (74 % identity), Ampelopsis grossedentata (74 % identity), Pyrus communis (73 % identity), and Prunus avium (73 % identity). A structural analysis showed that MsANS belongs to 2-oxoglutarate (2OG)- and ferrous iron-dependent oxygenase family because it contains three binding sites for 2OG. Real-time quantitative polymerase chain reaction analyses showed that the transcript level of MsANS was 26-fold higher in red petals than in white petals. The accumulation of anthocyanins in petals of white, pink, and red M. sprengeri flowers was analyzed by HPLC. The main anthocyanin was cyanidin-3-o-glucoside chloride, and the red petals contained the highest concentration of this pigment. PMID:25315387

  2. Borna disease virus P protein inhibits nitric oxide synthase gene expression in astrocytes

    SciTech Connect

    Peng Guiqing; Zhang Fengmin; Zhang Qi; Wu Kailang; Zhu Fan; Wu Jianguo

    2007-09-30

    Borna disease virus (BDV) is one of the potential infectious agents involved in the development of central nervous system (CNS) diseases. Neurons and astrocytes are the main targets of BDV infection, but little is known about the roles of BDV infection in the biological effects of astrocytes. Here we reported that BDV inhibits the activation of inducible nitric oxide synthase (iNOS) in murine astrocytes induced by bacterial LPS and PMA. To determine which protein of BDV is responsible for the regulation of iNOS expression, we co-transfected murine astrocytes with reporter plasmid iNOS-luciferase and plasmid expressing individual BDV proteins. Results from analyses of reporter activities revealed that only the phosphoprotein (P) of BDV had an inhibitory effect on the activation of iNOS. In addition, P protein inhibits nitric oxide production through regulating iNOS expression. We also reported that the nuclear factor kappa B (NF-{kappa}B) binding element, AP-1 recognition site, and interferon-stimulated response element (ISRE) on the iNOS promoter were involved in the repression of iNOS gene expression regulated by the P protein. Functional analysis indicated that sequences from amino acids 134 to 174 of the P protein are necessary for the regulation of iNOS. These data suggested that BDV may suppress signal transduction pathways, which resulted in the inhibition of iNOS activation in astrocytes.

  3. Characterization and Biological Function of the ISOCHORISMATE SYNTHASE2 Gene of Arabidopsis1[OA

    PubMed Central

    Garcion, Christophe; Lohmann, Antje; Lamodière, Elisabeth; Catinot, Jérémy; Buchala, Antony; Doermann, Peter; Métraux, Jean-Pierre

    2008-01-01

    Salicylic acid (SA) is an important mediator of plant defense response. In Arabidopsis (Arabidopsis thaliana), this compound was proposed to derive mainly from isochorismate, itself produced from chorismate through the activity of ISOCHORISMATE SYNTHASE1 (ICS1). Null ics1 mutants still accumulate some SA, suggesting the existence of an enzymatic activity redundant with ICS1 or of an alternative ICS-independent SA biosynthetic route. Here, we studied the role of ICS2, a second ICS gene of the Arabidopsis genome, in the production of SA. We have shown that ICS2 encodes a functional ICS enzyme and that, similar to ICS1, ICS2 is targeted to the plastids. Comparison of SA accumulation in the ics1, ics2, and ics1 ics2 mutants indicates that ICS2 participates in the synthesis of SA, but in limited amounts that become clearly detectable only when ICS1 is lacking. This unequal redundancy relationship was also observed for phylloquinone, another isochorismate-derived end product. Furthermore, detection of SA in the double ics1 ics2 double mutant that is completely devoid of phylloquinone provides genetic evidence of the existence of an ICS-independent SA biosynthetic pathway in Arabidopsis. PMID:18451262

  4. Mining for Nonribosomal Peptide Synthetase and Polyketide Synthase Genes Revealed a High Level of Diversity in the Sphagnum Bog Metagenome

    PubMed Central

    Müller, Christina A.; Oberauner-Wappis, Lisa; Peyman, Armin; Amos, Gregory C. A.; Wellington, Elizabeth M. H.

    2015-01-01

    Sphagnum bog ecosystems are among the oldest vegetation forms harboring a specific microbial community and are known to produce an exceptionally wide variety of bioactive substances. Although the Sphagnum metagenome shows a rich secondary metabolism, the genes have not yet been explored. To analyze nonribosomal peptide synthetases (NRPSs) and polyketide synthases (PKSs), the diversity of NRPS and PKS genes in Sphagnum-associated metagenomes was investigated by in silico data mining and sequence-based screening (PCR amplification of 9,500 fosmid clones). The in silico Illumina-based metagenomic approach resulted in the identification of 279 NRPSs and 346 PKSs, as well as 40 PKS-NRPS hybrid gene sequences. The occurrence of NRPS sequences was strongly dominated by the members of the Protebacteria phylum, especially by species of the Burkholderia genus, while PKS sequences were mainly affiliated with Actinobacteria. Thirteen novel NRPS-related sequences were identified by PCR amplification screening, displaying amino acid identities of 48% to 91% to annotated sequences of members of the phyla Proteobacteria, Actinobacteria, and Cyanobacteria. Some of the identified metagenomic clones showed the closest similarity to peptide synthases from Burkholderia or Lysobacter, which are emerging bacterial sources of as-yet-undescribed bioactive metabolites. This report highlights the role of the extreme natural ecosystems as a promising source for detection of secondary compounds and enzymes, serving as a source for biotechnological applications. PMID:26002894

  5. Mining for Nonribosomal Peptide Synthetase and Polyketide Synthase Genes Revealed a High Level of Diversity in the Sphagnum Bog Metagenome.

    PubMed

    Müller, Christina A; Oberauner-Wappis, Lisa; Peyman, Armin; Amos, Gregory C A; Wellington, Elizabeth M H; Berg, Gabriele

    2015-08-01

    Sphagnum bog ecosystems are among the oldest vegetation forms harboring a specific microbial community and are known to produce an exceptionally wide variety of bioactive substances. Although the Sphagnum metagenome shows a rich secondary metabolism, the genes have not yet been explored. To analyze nonribosomal peptide synthetases (NRPSs) and polyketide synthases (PKSs), the diversity of NRPS and PKS genes in Sphagnum-associated metagenomes was investigated by in silico data mining and sequence-based screening (PCR amplification of 9,500 fosmid clones). The in silico Illumina-based metagenomic approach resulted in the identification of 279 NRPSs and 346 PKSs, as well as 40 PKS-NRPS hybrid gene sequences. The occurrence of NRPS sequences was strongly dominated by the members of the Protebacteria phylum, especially by species of the Burkholderia genus, while PKS sequences were mainly affiliated with Actinobacteria. Thirteen novel NRPS-related sequences were identified by PCR amplification screening, displaying amino acid identities of 48% to 91% to annotated sequences of members of the phyla Proteobacteria, Actinobacteria, and Cyanobacteria. Some of the identified metagenomic clones showed the closest similarity to peptide synthases from Burkholderia or Lysobacter, which are emerging bacterial sources of as-yet-undescribed bioactive metabolites. This report highlights the role of the extreme natural ecosystems as a promising source for detection of secondary compounds and enzymes, serving as a source for biotechnological applications. PMID:26002894

  6. Likelihood analysis of the chalcone synthase genes suggests the role of positive selection in morning glories (Ipomoea).

    PubMed

    Yang, Ji; Gu, Hongya; Yang, Ziheng

    2004-01-01

    Chalcone synthase (CHS) is a key enzyme in the biosynthesis of flavonoides, which are important for the pigmentation of flowers and act as attractants to pollinators. Genes encoding CHS constitute a multigene family in which the copy number varies among plant species and functional divergence appears to have occurred repeatedly. In morning glories (Ipomoea), five functional CHS genes (A-E) have been described. Phylogenetic analysis of the Ipomoea CHS gene family revealed that CHS A, B, and C experienced accelerated rates of amino acid substitution relative to CHS D and E. To examine whether the CHS genes of the morning glories underwent adaptive evolution, maximum-likelihood models of codon substitution were used to analyze the functional sequences in the Ipomoea CHS gene family. These models used the nonsynonymous/synonymous rate ratio (omega = d(N)/ d(S)) as an indicator of selective pressure and allowed the ratio to vary among lineages or sites. Likelihood ratio test suggested significant variation in selection pressure among amino acid sites, with a small proportion of them detected to be under positive selection along the branches ancestral to CHS A, B, and C. Positive Darwinian selection appears to have promoted the divergence of subfamily ABC and subfamily DE and is at least partially responsible for a rate increase following gene duplication. PMID:14743314

  7. Biosynthesis of riboflavin: cloning, sequencing, and expression of the gene coding for 3,4-dihydroxy-2-butanone 4-phosphate synthase of Escherichia coli.

    PubMed Central

    Richter, G; Volk, R; Krieger, C; Lahm, H W; Röthlisberger, U; Bacher, A

    1992-01-01

    3,4-Dihydroxy-2-butanone 4-phosphate is biosynthesized from ribulose 5-phosphate and serves as the biosynthetic precursor for the xylene ring of riboflavin. The gene coding for 3,4-dihydroxy-2-butanone 4-phosphate synthase of Escherichia coli has been cloned and sequenced. The gene codes for a protein of 217 amino acid residues with a calculated molecular mass of 23,349.6 Da. The enzyme was purified to near homogeneity from a recombinant E. coli strain and had a specific activity of 1,700 nmol mg-1 h-1. The N-terminal amino acid sequence and the amino acid composition of the protein were in agreement with the deduced sequence. The molecular mass as determined by ion spray mass spectrometry was 23,351 +/- 2 Da, which is in agreement with the predicted mass. The previously reported loci htrP, "luxH-like," and ribB at 66 min of the E. coli chromosome are all identical to the gene coding for 3,4-dihydroxy-2-butanone 4-phosphate synthase, but their role had not been hitherto determined. Sequence homology indicates that gene luxH of Vibrio harveyi and the central open reading frame of the Bacillus subtilis riboflavin operon code for 3,4-dihydroxy-2-butanone 4-phosphate synthase. Images PMID:1597419

  8. Assignment of the gene encoding glycogen synthase (GYS) to human chromosome 19, band q13,3

    SciTech Connect

    Lehto, M. Helsinki Univ. ); Stoffel, M.; Espinosa, R. III; Beau, M.M. le; Bell, G.I. ); Groop, L. )

    1993-02-01

    The enzyme glycogen synthase (UDP glocose:glycogen 4-[alpha]-D-glucosyltransferase, EC 2.4.1.11) catalyzes the formation of glycogen from uridine diphosphate glucose (UPDG). Impaired activation of muscle glycogen synthase by insulin has been noted in patients with genetic risk of developing non-insulin-dependent diabets mellitus (NIDDM) and this may represent an early defect in the pathogenesis of this disorder. As such, glycogen synthase represents a candidate gene for contributing to genetic susceptibility. As a first step in studying the role of glycogen synthase in the genetics of NIDDM, we have isolated a cosmid encoding the human glycogen synthase gene (gene symbol GYS) and determined its chromosomal localization by fluorescence in situ hybridization. 4 refs., 1 fig.

  9. Over-expression of a grape stilbene synthase gene in tomato induces parthenocarpy and causes abnormal pollen development.

    PubMed

    Ingrosso, Ilaria; Bonsegna, Stefania; De Domenico, Stefania; Laddomada, Barbara; Blando, Federica; Santino, Angelo; Giovinazzo, Giovanna

    2011-10-01

    A novel strategy to induce parthenocarpy in tomato fruits by the induction of resveratrol biosynthesis in flower tissues was exploited. Two transgenic tomato lines were considered: a higher resveratrol-producing (35SS) line, constitutively expressing a grape stilbene synthase cDNA, and a lower resveratrol-producing (LoxS) line, expressing stilbene synthase under a fruit-specific promoter. The expression of the stilbene synthase gene affected flavonoid metabolism in a different manner in the transgenic lines, and in one of these, the 35SS line, resulted in complete male sterility. Resveratrol was synthesised either in 35SS or LoxS tomato flowers, at an even higher extent (about 8-10 times) in the former line. We further investigated whether stilbene synthase expression may have resulted in impaired naringenin accumulation during flower development. In the 35SS flowers, naringenin was significantly impaired by about 50%, probably due to metabolic competition. Conversely, the amount of glycosylated flavonols increased in transgenic flowers, thereby excluding the diminished production of flavonols as a reason for parthenocarpy in tomato. We further investigated whether resveratrol synthesis may have resulted changes to pollen structure. Microscopic observations revealed the presence of few and abnormal flake-like pollen grains in 35SS flowers with no germination capability. Finally, the analysis of coumaric and ferulic acids, the precursors of lignin and sporopollenin biosynthesis, revealed significant depletion of these compounds, therefore suggesting an impairment in structural compounds as a reason for pollen ablation. These overall outcomes, to the best of our knowledge, reveal for the first time the major role displayed by resveratrol synthesis on parthenocarpy in tomato fruits. PMID:21843947

  10. Sonic hedgehog signaling directly targets Hyaluronic Acid Synthase 2, an essential regulator of phalangeal joint patterning.

    PubMed

    Liu, Jiang; Li, Qiang; Kuehn, Michael R; Litingtung, Ying; Vokes, Steven A; Chiang, Chin

    2013-03-15

    Sonic hedgehog (Shh) signal, mediated by the Gli family of transcription factors, plays an essential role in the growth and patterning of the limb. Through analysis of the early limb bud transcriptome, we identified a posteriorly-enriched gene, Hyaluronic Acid Synthase 2 (Has2), which encodes a key enzyme for the synthesis of hyaluronan (HA), as a direct target of Gli transcriptional regulation during early mouse limb development. Has2 expression in the limb bud is lost in Shh null and expanded anteriorly in Gli3 mutants. We identified an ∼3kb Has2 promoter fragment that contains two strong Gli-binding consensus sequences, and mutation of either site abrogated the ability of Gli1 to activate Has2 promoter in a cell-based assay. Additionally, this promoter fragment is sufficient to direct expression of a reporter gene in the posterior limb mesenchyme. Chromatin immunoprecipitation of DNA-Gli3 protein complexes from limb buds indicated that Gli3 strongly binds to the Has2 promoter region, suggesting that Has2 is a direct transcriptional target of the Shh signaling pathway. We also showed that Has2 conditional mutant (Has2cko) hindlimbs display digit-specific patterning defects with longitudinally shifted phalangeal joints and impaired chondrogenesis. Has2cko limbs show less capacity for mesenchymal condensation with mislocalized distributions of chondroitin sulfate proteoglycans (CSPGs), aggrecan and link protein. Has2cko limb phenotype displays striking resemblance to mutants with defective chondroitin sulfation suggesting tight developmental control of HA on CSPG function. Together, our study identifies Has2 as a novel downstream target of Shh signaling required for joint patterning and chondrogenesis. PMID:23313125

  11. Association of Fatty Acid Synthase Polymorphisms and Expression with Outcomes after Radical Prostatectomy

    PubMed Central

    Cheng, Jinrong; Ondracek, Rochelle Payne; Mehedint, Diana C.; Kasza, Karin A.; Xu, Bo; Gill, Simpal; Azabdaftari, Gissou; Yao, Song; Morrison, Carl D.; Mohler, James L.; Marshall, James R.

    2016-01-01

    Fatty acid synthase (FASN), selectively overexpressed in prostate cancer cells, has been described as linked to the aggressiveness of prostate cancer (PCa). Constitutional genetic variation of the FASN gene and the expression levels of FASN protein in cancer cells could thus be expected to predict outcome after radical prostatectomy (RP). This study evaluates the associations of malignant tissue status, neoadjuvant androgen deprivation treatment (NADT) and single nucleotide polymorphisms of FASN with FASN protein expression in prostate tissue. The study then examines the associations of FASN single nucleotide polymorphisms (SNPs) and gene expression with 3 measures of post-prostatectomy outcome. Seven tagging FASN SNPs were genotyped in 659 European American men who underwent RP at Roswell Park Cancer Institute (RPCI) between 1993 and 2005. FASN protein expression was assessed using immunohistochemistry. The patients were followed for an average of 6.9 years (range: 0.1 to 20.6 years). Outcome was assessed using 3 endpoints: biochemical failure, treatment failure and development of distant metastatic PCa. Cox proportional hazards analyses were used to evaluate the associations of the tagging SNPs and FASN expression with these endpoints. Bivariate associations with outcomes were considered; the associations also were controlled for known aggressiveness indicators. Overall, no SNPs were associated with any known aggressiveness indicators. FASN staining intensity was stronger in malignant than in benign tissue, and neoadjuvant androgen deprivation therapy (NADT) was associated with decreased FASN staining in both benign and malignant tissue. The relationships of FASN SNPs and staining intensity with outcome were less clear. One SNP, rs4246444, showed a weak association with outcome. FASN staining intensity also showed a weak and seemingly contradictory relationship with outcome. Additional study with longer follow-up and populations that include more metastatic

  12. Inhibition of Mycobacterium tuberculosis dihydrodipicolinate synthase by alpha-ketopimelic acid and its other structural analogues

    PubMed Central

    Shrivastava, Priyanka; Navratna, Vikas; Silla, Yumnam; Dewangan, Rikeshwer P.; Pramanik, Atreyi; Chaudhary, Sarika; Rayasam, GeethaVani; Kumar, Anuradha; Gopal, Balasubramanian; Ramachandran, Srinivasan

    2016-01-01

    The Mycobacterium tuberculosis dihydrodipicolinate synthase (Mtb-dapA) is an essential gene. Mtb-DapA catalyzes the aldol condensation between pyruvate and L-aspartate-beta-semialdehyde (ASA) to yield dihydrodipicolinate. In this work we tested the inhibitory effects of structural analogues of pyruvate on recombinant Mtb-DapA (Mtb-rDapA) using a coupled assay with recombinant dihydrodipicolinate reductase (Mtb-rDapB). Alpha-ketopimelic acid (α-KPA) showed maximum inhibition of 88% and IC50 of 21 μM in the presence of pyruvate (500 μM) and ASA (400 μM). Competition experiments with pyruvate and ASA revealed competition of α-KPA with pyruvate. Liquid chromatography-mass spectrometry (LC-MS) data with multiple reaction monitoring (MRM) showed that the relative abundance peak of final product, 2,3,4,5-tetrahydrodipicolinate, was decreased by 50%. Thermal shift assays showed 1 °C Tm shift of Mtb-rDapA upon binding α-KPA. The 2.4 Å crystal structure of Mtb-rDapA-α-KPA complex showed the interaction of critical residues at the active site with α-KPA. Molecular dynamics simulations over 500 ns of pyruvate docked to Mtb-DapA and of α-KPA-bound Mtb-rDapA revealed formation of hydrogen bonds with pyruvate throughout in contrast to α-KPA. Molecular descriptors analysis showed that ligands with polar surface area of 91.7 Å2 are likely inhibitors. In summary, α-hydroxypimelic acid and other analogues could be explored further as inhibitors of Mtb-DapA. PMID:27501775

  13. Inhibition of Mycobacterium tuberculosis dihydrodipicolinate synthase by alpha-ketopimelic acid and its other structural analogues.

    PubMed

    Shrivastava, Priyanka; Navratna, Vikas; Silla, Yumnam; Dewangan, Rikeshwer P; Pramanik, Atreyi; Chaudhary, Sarika; Rayasam, GeethaVani; Kumar, Anuradha; Gopal, Balasubramanian; Ramachandran, Srinivasan

    2016-01-01

    The Mycobacterium tuberculosis dihydrodipicolinate synthase (Mtb-dapA) is an essential gene. Mtb-DapA catalyzes the aldol condensation between pyruvate and L-aspartate-beta-semialdehyde (ASA) to yield dihydrodipicolinate. In this work we tested the inhibitory effects of structural analogues of pyruvate on recombinant Mtb-DapA (Mtb-rDapA) using a coupled assay with recombinant dihydrodipicolinate reductase (Mtb-rDapB). Alpha-ketopimelic acid (α-KPA) showed maximum inhibition of 88% and IC50 of 21 μM in the presence of pyruvate (500 μM) and ASA (400 μM). Competition experiments with pyruvate and ASA revealed competition of α-KPA with pyruvate. Liquid chromatography-mass spectrometry (LC-MS) data with multiple reaction monitoring (MRM) showed that the relative abundance peak of final product, 2,3,4,5-tetrahydrodipicolinate, was decreased by 50%. Thermal shift assays showed 1 °C Tm shift of Mtb-rDapA upon binding α-KPA. The 2.4 Å crystal structure of Mtb-rDapA-α-KPA complex showed the interaction of critical residues at the active site with α-KPA. Molecular dynamics simulations over 500 ns of pyruvate docked to Mtb-DapA and of α-KPA-bound Mtb-rDapA revealed formation of hydrogen bonds with pyruvate throughout in contrast to α-KPA. Molecular descriptors analysis showed that ligands with polar surface area of 91.7 Å(2) are likely inhibitors. In summary, α-hydroxypimelic acid and other analogues could be explored further as inhibitors of Mtb-DapA. PMID:27501775

  14. Identification of 6-Hydroxymellein Synthase and Accessory Genes in the Lichen Cladonia uncialis.

    PubMed

    Abdel-Hameed, Mona; Bertrand, Robert L; Piercey-Normore, Michele D; Sorensen, John L

    2016-06-24

    A transcribed polyketide synthase (PKS) gene has been identified in the lichen Cladonia uncialis. The complete nucleotide sequence of this PKS was determined from the amplified cDNA, and an assignment of individual domains was accomplished by homology searching using AntiSMASH. A scan of the complete genome sequence of C. uncialis revealed the accessory genes associated with this PKS gene. A homology search has identified that several genes in this cluster are similar to genes responsible for the biosynthesis of terrein in Aspergillus terreus. This permitted assignment of putative function to each of the genes in this new C. uncialis cluster. It is proposed that this gene cluster is responsible for the biosynthesis of a halogenated iscoumarin. This is the first report linking a gene cluster to a halogenated metabolite in lichen. PMID:27264554

  15. Regulation of Expression of Citrate Synthase by the Retinoic Acid Receptor-Related Orphan Receptor α (RORα)

    PubMed Central

    Crumbley, Christine; Wang, Yongjun; Banerjee, Subhashis; Burris, Thomas P.

    2012-01-01

    The retinoic acid receptor-related orphan receptor α (RORα) is a member of the nuclear receptor superfamily of transcription factors that plays an important role in regulation of the circadian rhythm and metabolism. Mice lacking a functional RORα display a range of metabolic abnormalities including decreased serum cholesterol and plasma triglycerides. Citrate synthase (CS) is a key enzyme of the citric acid cycle that provides energy for cellular function. Additionally, CS plays a critical role in providing citrate derived acetyl-CoA for lipogenesis and cholesterologenesis. Here, we identified a functional RORα response element (RORE) in the promoter of the CS gene. ChIP analysis demonstrates RORα occupancy of the CS promoter and a putative RORE binds to RORα effectively in an electrophoretic mobility shift assay and confers RORα responsiveness to a reporter gene in a cotransfection assay. We also observed a decrease in CS gene expression and CS enzymatic activity in the staggerer mouse, which has a mutation of in the Rora gene resulting in nonfunctional RORα protein. Furthermore, we found that SR1001 a RORα inverse agonist eliminated the circadian pattern of expression of CS mRNA in mice. These data suggest that CS is a direct RORα target gene and one mechanism by which RORα regulates lipid metabolism is via regulation of CS expression. PMID:22485150

  16. Discovery, biosynthesis, and mechanism of action of the zaragozic acids: potent inhibitors of squalene synthase.

    PubMed

    Bergstrom, J D; Dufresne, C; Bills, G F; Nallin-Omstead, M; Byrne, K

    1995-01-01

    The zaragozic acids (ZAs), a family of fungal metabolites containing a novel 4,6,7-trihydroxy-2,8-dioxobicyclo[3.2.1]octane-3,4,5-tricarboxylic acid core, were discovered independently by two separate groups screening natural product sources to discover inhibitors of squalene synthase. This family of compounds all contain the same core but differ in their 1-alkyl and their 6-acyl side chains. Production of the ZAs is distributed over an extensive taxonomic range of Ascomycotina or their anamorphic states. The zaragozic acids are very potent inhibitors of squalene synthase that inhibit cholesterol synthesis and lower plasma cholesterol levels in primates. They also inhibit fungal ergosterol synthesis and are potent fungicidal compounds. The biosynthesis of the zaragozic acids appears to proceed through alkyl citrate intermediates and new members of the family have been produced through directed biosynthesis. These potent natural product based inhibitors of squalene synthase have potential to be developed either as cholesterol lowering agents and/or as antifungal agents. PMID:8561474

  17. Expression of cellulose synthase-like (Csl) genes in insect cells reveals that CslA family members encode mannan synthases

    PubMed Central

    Liepman, Aaron H.; Wilkerson, Curtis G.; Keegstra, Kenneth

    2005-01-01

    Glucuronoarabinoxylan, xyloglucan, and galactomannan are noncellulosic polysaccharides found in plant cell walls. All consist of β-linked glycan backbones substituted with sugar side chains. Although considerable progress has been made in characterizing the structure of these polysaccharides, little is known about the biosynthetic enzymes that produce them. Cellulose synthase-like (Csl) genes are hypothesized to encode Golgi-localized β-glycan synthases that polymerize the backbones of noncellulosic polysaccharides. To investigate this hypothesis, we used heterologous expression in Drosophila Schneider 2 (S2) cells to systematically analyze the functions of the gene products of a group of Csl genes from Arabidopsis and rice (Oryza sativa L.), including members from five Csl gene families (CslA, CslC, CslD, CslE, and CslH). Our analyses indicate that several members of the CslA gene family encode β-mannan synthases. Recombinant CslA proteins produce β-linked mannan polymers when supplied GDP-mannose. The same proteins can produce β-linked glucomannan heteropolymers when supplied both GDP-mannose and GDP-glucose. One CslA protein also produced β-linked glucan polymers when supplied GDP-glucose alone. Heterologous expression studies of additional candidate glycan synthases in insect cells or other systems may help identify other noncellulosic polysaccharide biosynthetic enzymes. PMID:15647349

  18. Binding Pocket Alterations in Dihydrofolate Synthase Confer Resistance to para-Aminosalicylic Acid in Clinical Isolates of Mycobacterium tuberculosis

    PubMed Central

    Zhao, Fei; Wang, Xu-De; Erber, Luke N.; Luo, Ming; Guo, Ai-zhen; Yang, Shan-shan; Gu, Jing; Turman, Breanna J.; Gao, Yun-rong; Li, Dong-fang; Cui, Zong-qiang; Zhang, Zhi-ping; Bi, Li-jun; Baughn, Anthony D.

    2014-01-01

    The mechanistic basis for the resistance of Mycobacterium tuberculosis to para-aminosalicylic acid (PAS), an important agent in the treatment of multidrug-resistant tuberculosis, has yet to be fully defined. As a substrate analog of the folate precursor para-aminobenzoic acid, PAS is ultimately bioactivated to hydroxy dihydrofolate, which inhibits dihydrofolate reductase and disrupts the operation of folate-dependent metabolic pathways. As a result, the mutation of dihydrofolate synthase, an enzyme needed for the bioactivation of PAS, causes PAS resistance in M. tuberculosis strain H37Rv. Here, we demonstrate that various missense mutations within the coding sequence of the dihydropteroate (H2Pte) binding pocket of dihydrofolate synthase (FolC) confer PAS resistance in laboratory isolates of M. tuberculosis and Mycobacterium bovis. From a panel of 85 multidrug-resistant M. tuberculosis clinical isolates, 5 were found to harbor mutations in the folC gene within the H2Pte binding pocket, resulting in PAS resistance. While these alterations in the H2Pte binding pocket resulted in reduced dihydrofolate synthase activity, they also abolished the bioactivation of hydroxy dihydropteroate to hydroxy dihydrofolate. Consistent with this model for abolished bioactivation, the introduction of a wild-type copy of folC fully restored PAS susceptibility in folC mutant strains. Confirmation of this novel PAS resistance mechanism will be beneficial for the development of molecular method-based diagnostics for M. tuberculosis clinical isolates and for further defining the mode of action of this important tuberculosis drug. PMID:24366731

  19. Functional characterization of the Ginkgo biloba chalcone synthase gene promoter in transgenic tobacco.

    PubMed

    Li, L L; Cheng, H; Yuan, H H; Xu, F; Cheng, S Y; Cao, F L

    2014-01-01

    The regulative sequence (2273 bp) of the chalcone synthase gene promoter of biloba was cloned by genomic walking. A 2273-bp promoter 5' upstream translation start site of GbCHS was cloned and designated as GbCHSP. pBI121+CHSP:GUS and pBI121-35S:GUS were constructed and transformed into tobacco by LBA4404. We found that GbCHSP could drive transient expression of GUS in tobacco and differentially expressed in root, stem and leaf tissues of this plant. GUS activity regulated by the CHSP promoter were located in tissues (apical meristems) at the growing points of roots and stems. pBI121+CHSP:GUS could be induced by wounding, copper, UV-B, abscisic acid, and ethephon treatments of transgenic seedlings. This activity was weakly inhibited by gibberellin. Deletion analysis of the CHSP promoter in transgenic tobacco showed that CHSP1 complete promoter conferred a GUS expression and activity similar to that of 35 S(CaMV). GUS activity dropped dramatically when there were CHSP4, CHSP5 constructs and was almost totally absent when the CHSP6 construct was present. We conclude that the upstream sequence -1548 to -306 of GbCHSP is the main region for transcriptional regulation of the CHS gene and that it is activated by hormone and stress factors in G. biloba. These results will help us to understand the transcriptional regulatory mechanisms involved in GbCHS expression and flavonoid accumulation in G. biloba. PMID:24841790

  20. Molecular cloning and characterization of three isoprenyl diphosphate synthase genes from alfalfa.

    PubMed

    Sun, Yan; Long, Ruicai; Kang, Junmei; Zhang, Tiejun; Zhang, Ze; Zhou, He; Yang, Qingchuan

    2013-02-01

    Isoprenoid is the precursor for the biosynthesis of saponins, abscisic acid, gibberellins, chlorophylls and many other products in plants. Saponins are an important group of bioactive plant natural products. The alfalfa (Medicago sativa L.) saponins are glycosides of different triterpene aglycones and possess many biological activities. We isolated three genes (MsFPPS, MsGPPS and MsGGPPS) encoding isoprenyl diphosphate synthases (IDS) from alfalfa via a homology-based PCR approach. The enzyme activity assay of purified recombined MsFPPS and MsGGPPS expressed in Escherichia coli indicated that they all had IDS activity. Expression analysis of the three genes in different alfalfa tissues using real time PCR displayed that they were expressed in all tissues although they had a different expression patterns. MsFPPS and MsGPS displayed a significant increase in transcript level in response to methyl jasmonate, but the transcript level of MsGGPPS decreased obviously. To elucidate the functions of the three IDSs, their overexpression driven by a constitutive cauliflower mosaic virus-35S promoter in tobacco plants was applied and analyzed. The T(0) transgenic plants of MsFPPS showed high levels of squalene content when compared with control. However, no differences were detected in T(0) transgenic plants of MsGPPS and MsGGPPS. In addition, the overexpression of MsFPPS induced senescence response in transgenic plant leaves. This result may indicate that MsFPPS performs a role not only in phytosterol and triterpene biosynthesis, but also in growth regulation. PMID:23238915

  1. Coordinate expression of transcriptionally regulated isocitrate lyase and malate synthase genes in Brassica napus L.

    PubMed Central

    Comai, L; Dietrich, R A; Maslyar, D J; Baden, C S; Harada, J J

    1989-01-01

    We have analyzed the temporal and spatial expression of genes encoding the glycoxylate cycle enzymes isocitrate lyase and malate synthase in Brassica napus L. to determine whether they are coordinately expressed. Both enzymes participate in reactions associated with lipid mobilization in oilseed plant seedlings and are sequestered in a specialized organelle, the glyoxysome. We have identified an isocitrate lyase cDNA clone containing the complete protein coding region. RNA blot and in situ hybridization studies with isocitrate lyase and malate synthase cDNA clones from B. napus showed that the genes exhibit similar expression patterns. The mRNAs begin to accumulate during late embryogeny, reach maximal levels in seedling cotyledons, are not detected at significant amounts in leaves, and are distributed similarly in cotyledons and axes of seedlings. Furthermore, transcription studies with isolated nuclei indicate that the genes are controlled primarily although not exclusively at the transcriptional level. We conclude that glyoxysome biogenesis is regulated in part through the coordinate expression of isocitrate lyase and malate synthase genes. PMID:2535504

  2. Functional replacement of the Saccharomyces cerevisiae fatty acid synthase with a bacterial type II system allows flexible product profiles.

    PubMed

    Fernandez-Moya, Ruben; Leber, Christopher; Cardenas, Javier; Da Silva, Nancy A

    2015-12-01

    The native yeast type I fatty acid synthase (FAS) is a complex, rigid enzyme, and challenging to engineer for the production of medium- or short-chain fatty acids. Introduction of a type II FAS is a promising alternative as it allows expression control for each discrete enzyme and the addition of heterologous thioesterases. In this study, the native Saccharomyces cerevisiae FAS was functionally replaced by the Escherichia coli type II FAS (eFAS) system. The E. coli acpS + acpP (together), fabB, fabD, fabG, fabH, fabI, fabZ, and tesA were expressed in individual S. cerevisiae strains, and enzyme activity was confirmed by in vitro activity assays. Eight genes were then integrated into the yeast genome, while tesA or an alternate thioesterase gene, fatB from Ricinus communis or TEII from Rattus novergicus, was expressed from a multi-copy plasmid. Native FAS activity was eliminated by knocking out the yeast FAS2 gene. The strains expressing only the eFAS as de novo fatty acid source grew without fatty acid supplementation demonstrating that this type II FAS is able to functionally replace the native yeast FAS. The engineered strain expressing the R. communis fatB thioesterase increased total fatty acid titer 1.7-fold and shifted the fatty acid profile towards C14 production, increasing it from <1% in the native strain to more than 30% of total fatty acids, and reducing C18 production from 39% to 8%. PMID:26084339

  3. Fatty acid synthase is required for mammary gland development and milk production during lactation

    PubMed Central

    Suburu, Janel; Shi, Lihong; Wu, Jiansheng; Wang, Shihua; Samuel, Michael; Thomas, Michael J.; Kock, Nancy D.; Yang, Guangyu; Kridel, Steven

    2014-01-01

    The mammary gland is one of the few adult tissues that strongly induce de novo fatty acid synthesis upon physiological stimulation, suggesting that fatty acid is important for milk production during lactation. The committed enzyme to perform this function is fatty acid synthase (FASN). To determine whether de novo fatty acid synthesis is obligatory or dietary fat is sufficient for mammary gland development and function during lactation, Fasn was specifically knocked out in mouse mammary epithelial cells. We found that deletion of Fasn hindered the development and induced the premature involution of the lactating mammary gland and significantly decreased medium- and long-chain fatty acids and total fatty acid contents in the milk. Consequently, pups nursing from Fasn knockout mothers experienced growth retardation and preweanling death, which was rescued by cross-fostering pups to a lactating wild-type mother. These results demonstrate that FASN is essential for the development, functional competence, and maintenance of the lactating mammary gland. PMID:24668799

  4. Molecular cloning and expression profile of ß-ketoacyl-acp synthase gene from tung tree (Vernicia fordii Hemsl.)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Tung tree (Vernicia fordii) is an important woody oil tree. Tung tree seeds contain 50-60% oil with approximately 80 mole a-eleostearic acid (9cis, 11trans, 13trans octadecatrienoic acid). Fatty acid synthesis is catalyzed by the concerted action of acetyl-CoA carboxylase and fatty acid synthase, a ...

  5. Identification and Characterization of the Sucrose Synthase 2 Gene (Sus2) in Durum Wheat

    PubMed Central

    Volpicella, Mariateresa; Fanizza, Immacolata; Leoni, Claudia; Gadaleta, Agata; Nigro, Domenica; Gattulli, Bruno; Mangini, Giacomo; Blanco, Antonio; Ceci, Luigi R.

    2016-01-01

    Sucrose transport is the central system for the allocation of carbon resources in vascular plants. Sucrose synthase (SUS), which reversibly catalyzes sucrose synthesis and cleavage, represents a key enzyme in the control of the flow of carbon into starch biosynthesis. In the present study the genomic identification and characterization of the Sus2-2A and Sus2-2B genes coding for SUS in durum wheat (cultivars Ciccio and Svevo) is reported. The genes were analyzed for their expression in different tissues and at different seed maturation stages, in four tetraploid wheat genotypes (Svevo, Ciccio, Primadur, and 5-BIL42). The activity of the encoded proteins was evaluated by specific activity assays on endosperm extracts and their structure established by modeling approaches. The combined results of sucrose synthase 2 expression and activity levels were then considered in the light of their possible involvement in starch yield. PMID:27014292

  6. Cloning of an anthocyanidin synthase gene homolog from blackcurrant (Ribes nigrum L.) and its expression at different fruit stages.

    PubMed

    Li, X-G; Wang, J; Yu, Z-Y

    2015-01-01

    Anthocyanidin synthase (ANS), a 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase, catalyzes the penultimate step in anthocyanin biosynthesis, from leucoanthocyanidins to anthocyanidins, the first colored compound in the anthocyanin pathway. In this study, a full-length, 1427-bp long cDNA named RnANS1, which is homologous to the anthocyanidin synthase gene, was cloned from blackcurrant using a homologous cloning strategy. RnANS1 is highly homologous to other plant ANS genes at both the nucleotide and amino acid sequence levels. The deduced protein contains domains conserved in the 2OG and Fe(II)-dependent oxygenase, and is phylogenetically closely related to Paeonia suffruticosa and Paeonia lactiflora. The expression of RnANS1 was upregulated during fruit maturation, and correlated with the accumulation of anthocyanins and soluble carbohydrates in the fruit. Further characterization of the structure and expression patterns of RnANS1 will clarify our understanding of anthocyanin biosynthesis in blackcurrant, and support the development of molecular approaches to manipulate anthocyanin production in this plant. PMID:25867421

  7. Molecular cloning and expression analysis of an 1-aminocyclopropane-1-carboxylate synthase gene from Oncidium Gower Ramsey.

    PubMed

    Shi, Le-Song; Liu, Jin-Ping

    2016-01-01

    1-aminocyclopropane-1-carboxylic acid (ACC) synthase (ACS) is a rate-limiting enzyme in the biosynthesis of ethylene which regulates many aspects of the plant development and responses to biotic and abiotic stresses. In this study, a full-length cDNA of ACC synthase, OnACS2, was cloned from the senescing flower of Oncidium Gower Ramsey by RACE. The full-length cDNA of OnACS2 (GenBank accession no. JQ822087) was 1557 bp in length with an open reading frame (ORF) of 1308 bp encoding for a protein of 435 amino acid residues. The predicted OnACS2 protein had a molecular mass of 49.1 kDa with pI value of 7.51. Phylogenetic analysis indicated its evolutionary relationships with corresponding orthologous sequences in orchids, Hosta ventricosa and monocots. Real-time PCR assay demonstrated that OnACS2 was constitutively expressed in all tested organs with the highest transcript level in the gynandria. Differential expression pattern of OnACS2 gene correlated to the ethylene production and the subsequent occurrence of senescent symptoms in flower suggested that OnACS2 probably played an important role in the initiation of flower senescence. PMID:26631967

  8. Genome-wide identification of galactinol synthase (GolS) genes in Solanum lycopersicum and Brachypodium distachyon.

    PubMed

    Filiz, Ertugrul; Ozyigit, Ibrahim Ilker; Vatansever, Recep

    2015-10-01

    GolS genes stand as potential candidate genes for molecular breeding and/or engineering programs in order for improving abiotic stress tolerance in plant species. In this study, a total of six galactinol synthase (GolS) genes/proteins were retrieved for Solanum lycopersicum and Brachypodium distachyon. GolS protein sequences were identified to include glyco_transf_8 (PF01501) domain structure, and to have a close molecular weight (36.40-39.59kDa) and amino acid length (318-347 aa) with a slightly acidic pI (5.35-6.40). The sub-cellular location was mainly predicted as cytoplasmic. S. lycopersicum genes located on chr 1 and 2, and included one segmental duplication while genes of B. distachyon were only on chr 1 with one tandem duplication. GolS sequences were found to have well conserved motif structures. Cis-acting analysis was performed for three abiotic stress responsive elements, including ABA responsive element (ABRE), dehydration and cold responsive elements (DRE/CRT) and low-temperature responsive element (LTRE). ABRE elements were found in all GolS genes, except for SlGolS4; DRE/CRT was not detected in any GolS genes and LTRE element found in SlGolS1 and BdGolS1 genes. AU analysis in UTR and ORF regions indicated that SlGolS and BdGolS mRNAs may have a short half-life. SlGolS3 and SlGolS4 genes may generate more stable transcripts since they included AATTAAA motif for polyadenylation signal POLASIG2. Seconder structures of SlGolS proteins were well conserved than that of BdGolS. Some structural divergences were detected in 3D structures and predicted binding sites exhibited various patterns in GolS proteins. PMID:26232767

  9. Heterologous Expression of Methylketone Synthase1 and Methylketone Synthase2 Leads to Production of Methylketones and Myristic Acid in Transgenic Plants1[W][OPEN

    PubMed Central

    Yu, Geng; Pichersky, Eran

    2014-01-01

    Some plants produce methylketones as potent defense compounds against various insects. Wild tomato (Solanum habrochaites), a relative of the cultivated tomato (Solanum lycopersicum), synthesizes large amounts of 2-methylketones in its glandular trichomes, but cultivated tomato trichomes contain little or no methylketones. Two enzymes, Solanum habrochaites methylketone synthase1 (ShMKS1) and ShMKS2, are required to convert β-ketoacyl acyl-carrier protein intermediates of the fatty acid biosynthetic pathway to methylketones. ShMKS2 is a thioesterase that hydrolyzes β-ketoacyl acyl-carrier protein, and ShMKS1 is a decarboxylase that converts the resulting 3-ketoacids to 2-methylketones. We introduced ShMKS2 by itself or together with ShMKS1 to Arabidopsis (Arabidopsis thaliana), tobacco (Nicotiana tabacum), and cultivated tomato under the control of the 35S, Rubisco small subunit, and tomato trichome-specific promoters. Young tobacco and Arabidopsis plants expressing both genes under the control of 35S and Rubisco small subunit promoters produced methylketones in their leaves but had serious growth defects. As plants matured, they ceased to produce methylketones. Tobacco plants but not Arabidopsis or tomato plants expressing only ShMKS2 under the 35S promoter also synthesized methylketones, but at a lower rate. Transgenic cultivated tomato plants expressing ShMKS1 and ShMKS2 under trichome-specific promoters had slightly elevated levels of methylketone. Trace amounts of myristic acid were also detected in transgenic plants constitutively expressing ShMKS2 with or without ShMKS1. These results suggest that increases in methylketone production in plants will require the targeting of the pathway to self-contained structures in the plant and may also require increasing the flux of fatty acid biosynthesis. PMID:24390393

  10. In vitro selection of transgenic sugarcane callus utilizing a plant gene encoding a mutant form of acetolactate synthase.

    PubMed

    van der Vyver, Christell; Conradie, Tobie; Kossmann, Jens; Lloyd, James

    2013-04-01

    Selection genes are routinely used in plant genetic transformation protocols to ensure the survival of transformed cells by limiting the regeneration of non-transgenic cells. In order to find alternatives to the use of antibiotics as selection agents, we followed a targeted approach utilizing a plant gene, encoding a mutant form of the enzyme acetolactate synthase, to convey resistance to herbicides. The sensitivity of sugarcane callus (Saccharum spp. hybrids, cv. NCo310) to a number of herbicides from the sulfonylurea and imidazolinone classes was tested. Callus growth was most affected by sulfonylurea herbicides, particularly 3.6 μg/l chlorsulfuron. Herbicide-resistant transgenic sugarcane plants containing mutant forms of a tobacco acetolactate synthase (als) gene were obtained following biolistic transformation. Post-bombardment, putative transgenic callus was selectively proliferated on MS medium containing 3 mg/l 2,4-dichlorophenoxyacetic acid (2,4-D), 20 g/l sucrose, 0.5 g/l casein, and 3.6 μg/l chlorsulfuron. Plant regeneration and rooting was done on MS medium lacking 2,4-D under similar selection conditions. Thirty vigorously growing putative transgenic plants were successfully ex vitro-acclimatized and established under glasshouse conditions. Glasshouse spraying of putative transgenic plants with 100 mg/l chlorsulfuron dramatically decreased the amount of non-transgenic plants that had escaped the in vitro selection regime. PCR analysis showed that six surviving plants were als-positive and that five of these expressed the mutant als gene. This report is the first to describe a selection system for sugarcane transformation that uses a selectable marker gene of plant origin targeted by a sulfonylurea herbicide. PMID:23543883

  11. Root parasitic plant Orobanche aegyptiaca and shoot parasitic plant Cuscuta australis obtained Brassicaceae-specific strictosidine synthase-like genes by horizontal gene transfer

    PubMed Central

    2014-01-01

    Background Besides gene duplication and de novo gene generation, horizontal gene transfer (HGT) is another important way of acquiring new genes. HGT may endow the recipients with novel phenotypic traits that are important for species evolution and adaption to new ecological niches. Parasitic systems expectedly allow the occurrence of HGT at relatively high frequencies due to their long-term physical contact. In plants, a number of HGT events have been reported between the organelles of parasites and the hosts, but HGT between host and parasite nuclear genomes has rarely been found. Results A thorough transcriptome screening revealed that a strictosidine synthase-like (SSL) gene in the root parasitic plant Orobanche aegyptiaca and the shoot parasitic plant Cuscuta australis showed much higher sequence similarities with those in Brassicaceae than with those in their close relatives, suggesting independent gene horizontal transfer events from Brassicaceae to these parasites. These findings were strongly supported by phylogenetic analysis and their identical unique amino acid residues and deletions. Intriguingly, the nucleus-located SSL genes in Brassicaceae belonged to a new member of SSL gene family, which were originated from gene duplication. The presence of introns indicated that the transfer occurred directly by DNA integration in both parasites. Furthermore, positive selection was detected in the foreign SSL gene in O. aegyptiaca but not in C. australis. The expression of the foreign SSL genes in these two parasitic plants was detected in multiple development stages and tissues, and the foreign SSL gene was induced after wounding treatment in C. australis stems. These data imply that the foreign genes may still retain certain functions in the recipient species. Conclusions Our study strongly supports that parasitic plants can gain novel nuclear genes from distantly related host species by HGT and the foreign genes may execute certain functions in the new hosts

  12. Widespread occurrence and genomic context of unusually small polyketide synthase genes in microbial consortia associated with marine sponges.

    PubMed

    Fieseler, Lars; Hentschel, Ute; Grozdanov, Lubomir; Schirmer, Andreas; Wen, Gaiping; Platzer, Matthias; Hrvatin, Sinisa; Butzke, Daniel; Zimmermann, Katrin; Piel, Jörn

    2007-04-01

    Numerous marine sponges harbor enormous amounts of as-yet-uncultivated bacteria in their tissues. There is increasing evidence that these symbionts play an important role in the synthesis of protective metabolites, many of which are of great pharmacological interest. In this study, genes for the biosynthesis of polyketides, one of the most important classes of bioactive natural products, were systematically investigated in 20 demosponge species from different oceans. Unexpectedly, the sponge metagenomes were dominated by a ubiquitously present, evolutionarily distinct, and highly sponge-specific group of polyketide synthases (PKSs). Open reading frames resembling animal fatty acid genes were found on three corresponding DNA regions isolated from the metagenomes of Theonella swinhoei and Aplysina aerophoba. Their architecture suggests that methyl-branched fatty acids are the metabolic product. According to a phylogenetic analysis of housekeeping genes, at least one of the PKSs belongs to a bacterium of the Deinococcus-Thermus phylum. The results provide new insights into the chemistry of sponge symbionts and allow inference of a detailed phylogeny of the diverse functional PKS types present in sponge metagenomes. Based on these qualitative and quantitative data, we propose a significantly simplified strategy for the targeted isolation of biomedically relevant PKS genes from complex sponge-symbiont associations. PMID:17293531

  13. The glycogen synthase 2 gene (Gys2) displays parallel evolution between Old World and New World fruit bats.

    PubMed

    Qian, Yamin; Fang, Tao; Shen, Bin; Zhang, Shuyi

    2014-01-01

    Frugivorous and nectarivorous bats rely largely on hepatic glycogenesis and glycogenolysis for postprandial blood glucose disposal and maintenance of glucose homeostasis during short time starvation, respectively. The glycogen synthase 2 encoded by the Gys2 gene plays a critical role in liver glycogen synthesis. To test whether the Gys2 gene has undergone adaptive evolution in bats with carbohydrate-rich diets in relation to their insect-eating sister taxa, we sequenced the coding region of the Gys2 gene in a number of bat species, including three Old World fruit bats (OWFBs) (Pteropodidae) and two New World fruit bats (NWFBs) (Phyllostomidae). Our results showed that the Gys2 coding sequences are highly conserved across all bat species we examined, and no evidence of positive selection was detected in the ancestral branches leading to OWFBs and NWFBs. Our explicit convergence test showed that posterior probabilities of convergence between several branches of OWFBs, and the NWFBs were markedly higher than that of divergence. Three parallel amino acid substitutions (Q72H, K371Q, and E666D) were detected among branches of OWFBs and NWFBs. Tests for parallel evolution showed that two parallel substitutions (Q72H and E666D) were driven by natural selection, while the K371Q was more likely to be fixed randomly. Thus, our results suggested that the Gys2 gene has undergone parallel evolution on amino acid level between OWFBs and NWFBs in relation to their carbohydrate metabolism. PMID:24258790

  14. Improvement of dolichol-linked oligosaccharide biosynthesis by the squalene synthase inhibitor zaragozic acid.

    PubMed

    Haeuptle, Micha A; Welti, Michael; Troxler, Heinz; Hülsmeier, Andreas J; Imbach, Timo; Hennet, Thierry

    2011-02-25

    The majority of congenital disorders of glycosylation (CDG) are caused by defects of dolichol (Dol)-linked oligosaccharide assembly, which lead to under-occupancy of N-glycosylation sites. Most mutations encountered in CDG are hypomorphic, thus leaving residual activity to the affected biosynthetic enzymes. We hypothesized that increased cellular levels of Dol-linked substrates might compensate for the low biosynthetic activity and thereby improve the output of protein N-glycosylation in CDG. To this end, we investigated the potential of the squalene synthase inhibitor zaragozic acid A to redirect the flow of the polyisoprene pathway toward Dol by lowering cholesterol biosynthesis. The addition of zaragozic acid A to CDG fibroblasts with a Dol-P-Man synthase defect led to the formation of longer Dol-P species and to increased Dol-P-Man levels. This treatment was shown to decrease the pathologic accumulation of incomplete Dol pyrophosphate-GlcNAc(2)Man(5) in Dol-P-Man synthase-deficient fibroblasts. Zaragozic acid A treatment also decreased the amount of truncated protein N-linked oligosaccharides in these CDG fibroblasts. The increased cellular levels of Dol-P-Man and possibly the decreased cholesterol levels in zaragozic acid A-treated cells also led to increased availability of the glycosylphosphatidylinositol anchor as shown by the elevated cell-surface expression of the CD59 protein. This study shows that manipulation of the cellular Dol pool, as achieved by zaragozic acid A addition, may represent a valuable approach to improve N-linked glycosylation in CDG cells. PMID:21183681

  15. Improvement of Dolichol-linked Oligosaccharide Biosynthesis by the Squalene Synthase Inhibitor Zaragozic Acid*

    PubMed Central

    Haeuptle, Micha A.; Welti, Michael; Troxler, Heinz; Hülsmeier, Andreas J.; Imbach, Timo; Hennet, Thierry

    2011-01-01

    The majority of congenital disorders of glycosylation (CDG) are caused by defects of dolichol (Dol)-linked oligosaccharide assembly, which lead to under-occupancy of N-glycosylation sites. Most mutations encountered in CDG are hypomorphic, thus leaving residual activity to the affected biosynthetic enzymes. We hypothesized that increased cellular levels of Dol-linked substrates might compensate for the low biosynthetic activity and thereby improve the output of protein N-glycosylation in CDG. To this end, we investigated the potential of the squalene synthase inhibitor zaragozic acid A to redirect the flow of the polyisoprene pathway toward Dol by lowering cholesterol biosynthesis. The addition of zaragozic acid A to CDG fibroblasts with a Dol-P-Man synthase defect led to the formation of longer Dol-P species and to increased Dol-P-Man levels. This treatment was shown to decrease the pathologic accumulation of incomplete Dol pyrophosphate-GlcNAc2Man5 in Dol-P-Man synthase-deficient fibroblasts. Zaragozic acid A treatment also decreased the amount of truncated protein N-linked oligosaccharides in these CDG fibroblasts. The increased cellular levels of Dol-P-Man and possibly the decreased cholesterol levels in zaragozic acid A-treated cells also led to increased availability of the glycosylphosphatidylinositol anchor as shown by the elevated cell-surface expression of the CD59 protein. This study shows that manipulation of the cellular Dol pool, as achieved by zaragozic acid A addition, may represent a valuable approach to improve N-linked glycosylation in CDG cells. PMID:21183681

  16. Hydroxymethylbilane synthase: Complete genomic sequence and amplifiable polymorphisms in the human gene

    SciTech Connect

    Yoo, Hanwook; Warner, C.A.; Chen, Chiahsiang; Desnick, R.J. )

    1993-01-01

    Acute intermittent porphyria (AIP), an autosomal dominant inborn error of heme biosynthesis, results from the half-normal activity of the heme biosynthetic enzyme hydroxymethylbilane synthase (HMB-synthase). Heterozygous individuals are prone to life-threatening acute neurologic attacks, which are precipitated by certain drugs and other metabolic, hormonal, and nutritional factors. Since the biochemical diagnosis of heterozygous individuals has been problematic, recent efforts have focused on the identification of mutations and diagnostically useful restriction fragment length polymorphisms (RFLPS) in the HMB-synthase gene. To facilitate these endeavors, the human HMB-synthase gene, including 1.1 kb of the 5[prime] flanking region, was isolated and completely sequenced in both orientations. The 10,024-bp gene contained 15 exons ranging in size from 39 to 438 bp and 14 introns ranging from 87 to 2913 bp. All intron/exon boundaries conformed to the GT/AG consensus rule. There were six Alu repetitive elements, one of the J and five of the Sa subfamilies. Analysis of the 1. I -kb 5[prime]flanking region revealed putative regulatory elements for the housekeeping promoter including AP1, AP4, SP1, TRE, ENH, and CAC. This region contained 10 HpaII sites and had an overall GC content of 54%. Three new polymorphic sites were identified by the single-strand conformation polymorphism (SSCP) technique, a common BsmAI site in intron 3 (3581 A/G), a common HinfI RFLP in intron 10 (7064 C/A), and a rare MnlI site in intron 14 (7998G/A). The allele frequencies of five previously known and the new polymorphic sites in a normal Caucasian population indicated that the intron 1 and intron 3 RFLPs were in linkage disequilibrium; however, the Hint I site segregated independently. 54 refs., 6 figs., 3 tabs.

  17. A conserved amino acid residue critical for product and substrate specificity in plant triterpene synthases.

    PubMed

    Salmon, Melissa; Thimmappa, Ramesha B; Minto, Robert E; Melton, Rachel E; Hughes, Richard K; O'Maille, Paul E; Hemmings, Andrew M; Osbourn, Anne

    2016-07-26

    Triterpenes are structurally complex plant natural products with numerous medicinal applications. They are synthesized through an origami-like process that involves cyclization of the linear 30 carbon precursor 2,3-oxidosqualene into different triterpene scaffolds. Here, through a forward genetic screen in planta, we identify a conserved amino acid residue that determines product specificity in triterpene synthases from diverse plant species. Mutation of this residue results in a major change in triterpene cyclization, with production of tetracyclic rather than pentacyclic products. The mutated enzymes also use the more highly oxygenated substrate dioxidosqualene in preference to 2,3-oxidosqualene when expressed in yeast. Our discoveries provide new insights into triterpene cyclization, revealing hidden functional diversity within triterpene synthases. They further open up opportunities to engineer novel oxygenated triterpene scaffolds by manipulating the precursor supply. PMID:27412861

  18. A conserved amino acid residue critical for product and substrate specificity in plant triterpene synthases

    PubMed Central

    Salmon, Melissa; Thimmappa, Ramesha B.; Minto, Robert E.; Melton, Rachel E.; O’Maille, Paul E.; Hemmings, Andrew M.; Osbourn, Anne

    2016-01-01

    Triterpenes are structurally complex plant natural products with numerous medicinal applications. They are synthesized through an origami-like process that involves cyclization of the linear 30 carbon precursor 2,3-oxidosqualene into different triterpene scaffolds. Here, through a forward genetic screen in planta, we identify a conserved amino acid residue that determines product specificity in triterpene synthases from diverse plant species. Mutation of this residue results in a major change in triterpene cyclization, with production of tetracyclic rather than pentacyclic products. The mutated enzymes also use the more highly oxygenated substrate dioxidosqualene in preference to 2,3-oxidosqualene when expressed in yeast. Our discoveries provide new insights into triterpene cyclization, revealing hidden functional diversity within triterpene synthases. They further open up opportunities to engineer novel oxygenated triterpene scaffolds by manipulating the precursor supply. PMID:27412861

  19. Cloning and transformation analysis of isoflavone synthase gene into Minshan Trifolium pratense.

    PubMed

    Hu, H H; Jing, C Q; Liu, R; Li, W D; Feng, H G

    2015-01-01

    The aim of this study was to clone the isoflavone synthase (IFS) gene and establish the recombinant Minshan Trifolium pratense. The IFS gene was cloned from the callus of Minshan T. pratense using reverse transcription-polymerase chain reaction. The plant expression vector pRI101-AN-IFS was constructed and introduced into Agrobacterium tumefaciens strain LBA4404, and then screened under cephalosporin. IFS expression was detected by reverse transcription-polymerase chain reaction. The IFS gene was cloned successfully. Sequence analysis indicated that IFS gene had high homology with similar genes from other plants. The IFS-overexpressing callus was obtained by introducing the LBA4404-harboring IFS-pRI101-AN-IFS vector into T. pratense calluses. PMID:26345862

  20. Functional Analysis of the Polyketide Synthase Genes in the Filamentous Fungus Gibberella zeae (Anamorph Fusarium graminearum)

    PubMed Central

    Gaffoor, Iffa; Brown, Daren W.; Plattner, Ron; Proctor, Robert H.; Qi, Weihong; Trail, Frances

    2005-01-01

    Polyketides are a class of secondary metabolites that exhibit a vast diversity of form and function. In fungi, these compounds are produced by large, multidomain enzymes classified as type I polyketide synthases (PKSs). In this study we identified and functionally disrupted 15 PKS genes from the genome of the filamentous fungus Gibberella zeae. Five of these genes are responsible for producing the mycotoxins zearalenone, aurofusarin, and fusarin C and the black perithecial pigment. A comprehensive expression analysis of the 15 genes revealed diverse expression patterns during grain colonization, plant colonization, sexual development, and mycelial growth. Expression of one of the PKS genes was not detected under any of 18 conditions tested. This is the first study to genetically characterize a complete set of PKS genes from a single organism. PMID:16278459

  1. Pneumocystis jiroveci dihydropteroate synthase gene mutations among colonized individuals and Pneumocystis pneumonia patients from Spain.

    PubMed

    Friaza, Vicente; Morilla, Rubén; Respaldiza, Nieves; de la Horra, Carmen; Calderón, Enrique J

    2010-11-01

    Cotrimoxazole, an association of trimethoprim and sulfamethoxazole, and dapsone, are mainstays for the prophylaxis and treatment of Pneumocystis pneumonia (PcP). The inability to culture Pneumocystis prevents routine susceptibility testing and detection of drug resistance. Instead, molecular techniques have been used to detect Pneumocystis jiroveci dihydropteroate synthase (DHPS) mutations that cause sulfa resistance in other microorganisms. The most frequent DHPS mutations occur at nucleotide positions 165 and 171, which lead to an amino acid change at positions 55 and 57. Several studies suggest that these mutations are associated with the failure of chemoprophylaxis for PcP. The aim was to establish the frequency and characteristics of P jiroveci DHPS mutations among colonized individuals and PcP patients from Spain. A total of 50 colonized individuals and 25 PcP patients were studied. DHPS polymorphisms were identified by restriction fragment length polymorphism assay. The analysis provided a rate of 28% of DHPS gene mutations in our population, with the presence of all possible polymorphisms described. The presence of mutations was higher in PcP patients than in colonized subjects (40% vs 22%), probably because of the chemoprophylaxis used in PcP patients. The comparison between patients with and without DHPS mutations did not show statistical differences due to age, sex, steroid use, sulfa drug exposure, or smoking. A high rate of DHPS mutations in our area of Spain, not only confined to patients previously exposed to sulfa drugs, is shown in this study. As well as PcP patients, colonized individuals who harbor P jiroveci strains with DHPS mutations could play a major role in the transmission cycle of these mutations, representing a reservoir and source of infection for susceptible individuals. Further research is thus warranted to assess the true scope of the problem and to design rational preventive strategies. PMID:21084778

  2. [Cloning, expression and functional identification of a type III polyketide synthase gene from Huperzia serrata].

    PubMed

    Ye, Jin-cui; Zhang, Ping; Sun, Jie-yin; Guo, Chao-tan; Chen, Guo-shen; Abe, Ikuro; Noguchi, Hiroshi

    2011-10-01

    A cDNA encoding novel type III polyketide synthase (PKS) was cloned and sequenced from young leaves of Chinese club moss Huperzia serrata (Thunb.) Trev. by RT-PCR using degenerated primers based on the conserved sequences of known CHSs, and named as H. serrata PKS2. The terminal sequences of cDNA were obtained by the 3'- and 5'-RACE method. The full-length cDNA of H. serrata PKS2 contained a 1212 bp open reading frame encoding a 46.4 kDa protein with 404 amino acids. The deduced amino acid sequence of H. serrata PKS2 showed 50%-66% identities to those of other chalcone synthase super family enzymes of plant origin. The recombinant H. serrata PKS2 was functionally expressed in Escherichia coli with an additional hexahistidine tag at the N-terminus and showed unusually versatile catalytic potency to produce various aromatic tetraketides, including chalcones, benzophenones, phloroglucinols, and acridones. In particular, the enzyme accepted bulky starter substrates N-methylanthraniloyl-CoA, and carried out three condensations with malonyl-CoA to produce 1, 3-dihydroxy-N-methylacridone. Interestingly, H. serrata PKS2 lacks most of the consensus active site sequences with acridone synthase from Ruta graveolens (Rutaceae). PMID:22242464

  3. Identification and molecular characterization of nitric oxide synthase (NOS) gene in the intertidal copepod Tigriopus japonicus.

    PubMed

    Jeong, Chang-Bum; Kang, Hye-Min; Seo, Jung Soo; Park, Heum Gi; Rhee, Jae-Sung; Lee, Jae-Seong

    2016-02-10

    In copepods, no information has been reported on the structure or molecular characterization of the nitric oxide synthase (NOS) gene. In the intertidal copepod Tigriopus japonicus, we identified a NOS gene that is involved in immune responses of vertebrates and invertebrates. In silico analyses revealed that nitric oxide (NO) synthase domains, such as the oxygenase and reductase domains, are highly conserved in the T. japonicus NOS gene. The T. japonicus NOS gene was highly transcribed in the nauplii stages, implying that it plays a role in protecting the host during the early developmental stages. To examine the involvement of the T. japonicus NOS gene in the innate immune response, the copepods were exposed to lipopolysaccharide (LPS) and two Vibrio sp. After exposure to different concentrations of LPS and Vibrio sp., T. japonicus NOS transcription was significantly increased over time in a dose-dependent manner, and the NO/nitrite concentration increased as well. Taken together, our findings suggest that T. japonicus NOS transcription is induced in response to an immune challenge as part of the conserved innate immunity. PMID:26611530

  4. Truncating mutation in the nitric oxide synthase 1 gene is associated with infantile achalasia.

    PubMed

    Shteyer, Eyal; Edvardson, Simon; Wynia-Smith, Sarah L; Pierri, Ciro Leonardo; Zangen, Tzili; Hashavya, Saar; Begin, Michal; Yaacov, Barak; Cinamon, Yuval; Koplewitz, Benjamin Z; Vromen, Amos; Elpeleg, Orly; Smith, Brian C

    2015-03-01

    Nitric oxide is thought to have a role in the pathogenesis of achalasia. We performed a genetic analysis of 2 siblings with infant-onset achalasia. Exome analysis revealed that they were homozygous for a premature stop codon in the gene encoding nitric oxide synthase 1. Kinetic analyses and molecular modeling showed that the truncated protein product has defects in folding, nitric oxide production, and binding of cofactors. Heller myotomy had no effect in these patients, but sildenafil therapy increased their ability to drink. The finding recapitulates the previously reported phenotype of nitric oxide synthase 1-deficient mice, which have achalasia. Nitric oxide signaling appears to be involved in the pathogenesis of achalasia in humans. PMID:25479138

  5. Canola engineered with a microalgal polyketide synthase-like system produces oil enriched in docosahexaenoic acid.

    PubMed

    Walsh, Terence A; Bevan, Scott A; Gachotte, Daniel J; Larsen, Cory M; Moskal, William A; Merlo, P A Owens; Sidorenko, Lyudmila V; Hampton, Ronnie E; Stoltz, Virginia; Pareddy, Dayakar; Anthony, Geny I; Bhaskar, Pudota B; Marri, Pradeep R; Clark, Lauren M; Chen, Wei; Adu-Peasah, Patrick S; Wensing, Steven T; Zirkle, Ross; Metz, James G

    2016-08-01

    Dietary omega-3 long-chain polyunsaturated fatty acids (LC-PUFAs), docosahexaenoic acid (DHA, C22:6) and eicosapentaenoic acid (EPA, C20:5) are usually derived from marine fish. Although production of both EPA and DHA has been engineered into land plants, including Arabidopsis, Camelina sativa and Brassica juncea, neither has been produced in commercially relevant amounts in a widely grown crop. We report expression of a microalgal polyketide synthase-like PUFA synthase system, comprising three multidomain polypeptides and an accessory enzyme, in canola (Brassica napus) seeds. This transgenic enzyme system is expressed in the cytoplasm, and synthesizes DHA and EPA de novo from malonyl-CoA without substantially altering plastidial fatty acid production. Furthermore, there is no significant impact of DHA and EPA production on seed yield in either the greenhouse or the field. Canola oil processed from field-grown grain contains 3.7% DHA and 0.7% EPA, and can provide more than 600 mg of omega-3 LC-PUFAs in a 14 g serving. PMID:27398790

  6. Automating gene library synthesis by structure-based combinatorial protein engineering: examples from plant sesquiterpene synthases.

    PubMed

    Dokarry, Melissa; Laurendon, Caroline; O'Maille, Paul E

    2012-01-01

    Structure-based combinatorial protein engineering (SCOPE) is a homology-independent recombination method to create multiple crossover gene libraries by assembling defined combinations of structural elements ranging from single mutations to domains of protein structure. SCOPE was originally inspired by DNA shuffling, which mimics recombination during meiosis, where mutations from parental genes are "shuffled" to create novel combinations in the resulting progeny. DNA shuffling utilizes sequence identity between parental genes to mediate template-switching events (the annealing and extension of one parental gene fragment on another) in PCR reassembly reactions to generate crossovers and hence recombination between parental genes. In light of the conservation of protein structure and degeneracy of sequence, SCOPE was developed to enable the "shuffling" of distantly related genes with no requirement for sequence identity. The central principle involves the use of oligonucleotides to encode for crossover regions to choreograph template-switching events during PCR assembly of gene fragments to create chimeric genes. This approach was initially developed to create libraries of hybrid DNA polymerases from distantly related parents, and later developed to create a combinatorial mutant library of sesquiterpene synthases to explore the catalytic landscapes underlying the functional divergence of related enzymes. This chapter presents a simplified protocol of SCOPE that can be integrated with different mutagenesis techniques and is suitable for automation by liquid-handling robots. Two examples are presented to illustrate the application of SCOPE to create gene libraries using plant sesquiterpene synthases as the model system. In the first example, we outline how to create an active-site library as a series of complex mixtures of diverse mutants. In the second example, we outline how to create a focused library as an array of individual clones to distil minimal combinations of

  7. Rhizobacteria activates (+)-δ-cadinene synthase genes and induces systemic resistance in cotton against beet armyworm (Spodoptera exigua).

    PubMed

    Zebelo, Simon; Song, Yuanyuan; Kloepper, Joseph W; Fadamiro, Henry

    2016-04-01

    Gossypol is an important allelochemical produced by the subepidermal glands of some cotton varieties and important for their ability to respond to changing biotic stress by exhibiting antibiosis against some cotton pests. Plant growth-promoting rhizobacteria (PGPR) are root-colonizing bacteria that increase plant growth and often elicit defence against plant pathogens and insect pests. Little is known about the effect of PGPR on cotton plant-insect interactions and the potential biochemical and molecular mechanisms by which PGPR enhance cotton plant defence. Here, we report that PGPR (Bacillus spp.) treated cotton plants showed significantly higher levels of gossypol compared with untreated plants. Similarly, the transcript levels of the genes (i.e. (+)-δ-cadinene synthase gene family) involved in the biosynthesis of gossypol were higher in PGPR-treated plants than in untreated plants. Furthermore, the levels of jasmonic acid, an octadecanoid-derived defence-related phytohormone and the transcript level of jasmonic acid responsive genes were higher in PGPR-treated plants than in untreated plants. Most intriguingly, Spodoptera exigua showed reduced larval feeding and development on PGPR-treated plants. These findings demonstrate that treatment of plants with rhizobacteria may induce significant biochemical and molecular changes with potential ramifications for plant-insect interactions. PMID:26715260

  8. Analysis of the mitochondrial ATP synthase beta-subunit gene in Drosophilidae: structure, transcriptional regulatory features and developmental pattern of expression in Drosophila melanogaster.

    PubMed Central

    Peña, P; Ugalde, C; Calleja, M; Garesse, R

    1995-01-01

    We have cloned and determined the structure of the gene encoding the H(+)-ATP synthase beta subunit in two distantly related Drosophila species, D. melanogaster and D. virilis. The gene contains three exons that are extremely well conserved at the amino acid level, not only in the region encoding the mature protein but also in that encoding the leader peptide. Primer extension analysis indicates that the 5' untranslated region is extremely short, and reveals the presence of multiple initiation sites of transcription in both Drosophila species. The promoters of D. melanogaster and D. virilis H(+)-ATP synthase beta-subunit genes contain a conserved region surrounding the initiation transcription sites. Nucleotide sequence analysis has revealed the absence of canonical TATA and CCAAT boxes and the presence of several putative regulatory elements in both promoter regions, including GAGA, GATA and Ets binding sites. We have analysed the pattern of gene expression during D. melanogaster development. The mRNA is stored in oocytes, and activation of transcription takes place after 10 h of development. The expression of the nuclear-encoded H(+)-ATP synthase beta subunit is strictly coordinated with the expression of subunits 6 and 8 of the same complex that are encoded in the mitochondrial genome. Images Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 8 PMID:8554535

  9. Functional Characterization of the Xanthophyllomyces dendrorhous Farnesyl Pyrophosphate Synthase and Geranylgeranyl Pyrophosphate Synthase Encoding Genes That Are Involved in the Synthesis of Isoprenoid Precursors

    PubMed Central

    Niklitschek, Mauricio; Sepúlveda, Dionisia; Rojas, María Cecilia; Baeza, Marcelo; Cifuentes, Víctor

    2014-01-01

    The yeast Xanthophyllomyces dendrorhous synthesizes the carotenoid astaxanthin, which has applications in biotechnology because of its antioxidant and pigmentation properties. However, wild-type strains produce too low amounts of carotenoids to be industrially competitive. Considering this background, it is indispensable to understand how the synthesis of astaxanthin is controlled and regulated in this yeast. In this work, the steps leading to the synthesis of the carotenoid precursor geranylgeranyl pyrophosphate (GGPP, C20) in X. dendrorhous from isopentenyl pyrophosphate (IPP, C5) and dimethylallyl pyrophosphate (DMAPP, C5) was characterized. Two prenyl transferase encoding genes, FPS and crtE, were expressed in E. coli. The enzymatic assays using recombinant E. coli protein extracts demonstrated that FPS and crtE encode a farnesyl pyrophosphate (FPP, C15) synthase and a GGPP-synthase, respectively. X. dendrorhous FPP-synthase produces geranyl pyrophosphate (GPP, C10) from IPP and DMAPP and FPP from IPP and GPP, while the X. dendrorhous GGPP-synthase utilizes only FPP and IPP as substrates to produce GGPP. Additionally, the FPS and crtE genes were over-expressed in X. dendrorhous, resulting in an increase of the total carotenoid production. Because the parental strain is diploid, the deletion of one of the alleles of these genes did not affect the total carotenoid production, but the composition was significantly altered. These results suggest that the over-expression of these genes might provoke a higher carbon flux towards carotenogenesis, most likely involving an earlier formation of a carotenogenic enzyme complex. Conversely, the lower carbon flux towards carotenogenesis in the deletion mutants might delay or lead to a partial formation of a carotenogenic enzyme complex, which could explain the accumulation of astaxanthin carotenoid precursors in these mutants. In conclusion, the FPS and the crtE genes represent good candidates to manipulate to favor

  10. Crystallization of Delta1-tetrahydrocannabinolic acid (THCA) synthase from Cannabis sativa.

    PubMed

    Shoyama, Yoshinari; Takeuchi, Ayako; Taura, Futoshi; Tamada, Taro; Adachi, Motoyasu; Kuroki, Ryota; Shoyama, Yukihiro; Morimoto, Satoshi

    2005-08-01

    Delta1-Tetrahydrocannabinolic acid (THCA) synthase is a novel oxidoreductase that catalyzes the biosynthesis of the psychoactive compound THCA in Cannabis sativa (Mexican strain). In order to investigate the structure-function relationship of THCA synthase, this enzyme was overproduced in insect cells, purified and finally crystallized in 0.1 M HEPES buffer pH 7.5 containing 1.4 M sodium citrate. A single crystal suitable for X-ray diffraction measurement was obtained in 0.09 M HEPES buffer pH 7.5 containing 1.26 M sodium citrate. The crystal diffracted to 2.7 A resolution at beamline BL41XU, SPring-8. The crystal belonged to the primitive cubic space group P432, with unit-cell parameters a = b = c = 178.2 A. The calculated Matthews coefficient was approximately 4.1 or 2.0 A3 Da(-1) assuming the presence of one or two molecules of THCA synthase in the asymmetric unit, respectively. PMID:16511162

  11. Crystallization of Δ1-tetrahydrocannabinolic acid (THCA) synthase from Cannabis sativa

    PubMed Central

    Shoyama, Yoshinari; Takeuchi, Ayako; Taura, Futoshi; Tamada, Taro; Adachi, Motoyasu; Kuroki, Ryota; Shoyama, Yukihiro; Morimoto, Satoshi

    2005-01-01

    Δ1-Tetrahydrocannabinolic acid (THCA) synthase is a novel oxidoreductase that catalyzes the biosynthesis of the psychoactive compound THCA in Cannabis sativa (Mexican strain). In order to investigate the structure–function relationship of THCA synthase, this enzyme was overproduced in insect cells, purified and finally crystallized in 0.1 M HEPES buffer pH 7.5 containing 1.4 M sodium citrate. A single crystal suitable for X-ray diffraction measurement was obtained in 0.09 M HEPES buffer pH 7.5 containing 1.26 M sodium citrate. The crystal diffracted to 2.7 Å resolution at beamline BL41XU, SPring-8. The crystal belonged to the primitive cubic space group P432, with unit-cell parameters a = b = c = 178.2 Å. The calculated Matthews coefficient was approximately 4.1 or 2.0 Å3 Da−1 assuming the presence of one or two molecules of THCA synthase in the asymmetric unit, respectively. PMID:16511162

  12. β-Ketoacyl-acyl Carrier Protein Synthase I (KASI) Plays Crucial Roles in the Plant Growth and Fatty Acids Synthesis in Tobacco

    PubMed Central

    Yang, Tianquan; Xu, Ronghua; Chen, Jianghua; Liu, Aizhong

    2016-01-01

    Fatty acids serve many functions in plants, but the effects of some key genes involved in fatty acids biosynthesis on plants growth and development are not well understood yet. To understand the functions of 3-ketoacyl-acyl-carrier protein synthase I (KASI) in tobacco, we isolated two KASI homologs, which we have designated NtKASI-1 and NtKASI-2. Expression analysis showed that these two KASI genes were transcribed constitutively in all tissues examined. Over-expression of NtKASI-1 in tobacco changed the fatty acid content in leaves, whereas over-expressed lines of NtKASI-2 exhibited distinct phenotypic features such as slightly variegated leaves and reduction of the fatty acid content in leaves, similar to the silencing plants of NtKASI-1 gene. Interestingly, the silencing of NtKASI-2 gene had no discernibly altered phenotypes compared to wild type. The double silencing plants of these two genes enhanced the phenotypic changes during vegetative and reproductive growth compared to wild type. These results uncovered that these two KASI genes had the partially functional redundancy, and that the KASI genes played a key role in regulating fatty acids synthesis and in mediating plant growth and development in tobacco. PMID:27509494

  13. β-Ketoacyl-acyl Carrier Protein Synthase I (KASI) Plays Crucial Roles in the Plant Growth and Fatty Acids Synthesis in Tobacco.

    PubMed

    Yang, Tianquan; Xu, Ronghua; Chen, Jianghua; Liu, Aizhong

    2016-01-01

    Fatty acids serve many functions in plants, but the effects of some key genes involved in fatty acids biosynthesis on plants growth and development are not well understood yet. To understand the functions of 3-ketoacyl-acyl-carrier protein synthase I (KASI) in tobacco, we isolated two KASI homologs, which we have designated NtKASI-1 and NtKASI-2. Expression analysis showed that these two KASI genes were transcribed constitutively in all tissues examined. Over-expression of NtKASI-1 in tobacco changed the fatty acid content in leaves, whereas over-expressed lines of NtKASI-2 exhibited distinct phenotypic features such as slightly variegated leaves and reduction of the fatty acid content in leaves, similar to the silencing plants of NtKASI-1 gene. Interestingly, the silencing of NtKASI-2 gene had no discernibly altered phenotypes compared to wild type. The double silencing plants of these two genes enhanced the phenotypic changes during vegetative and reproductive growth compared to wild type. These results uncovered that these two KASI genes had the partially functional redundancy, and that the KASI genes played a key role in regulating fatty acids synthesis and in mediating plant growth and development in tobacco. PMID:27509494

  14. Increased Production of Fatty Acids and Triglycerides in Aspergillus oryzae by Enhancing Expressions of Fatty Acid Synthesis-Related Genes

    SciTech Connect

    Tamano, Koichi; Bruno, Kenneth S.; Karagiosis, Sue A.; Culley, David E.; Deng, Shuang; Collett, James R.; Umemura, Myco; Koike, Hideaki; Baker, Scott E.; Machida, Masa

    2013-01-01

    Microbial production of fats and oils is being developedas a means of converting biomass to biofuels. Here we investigate enhancing expression of enzymes involved in the production of fatty acids and triglycerides as a means to increase production of these compounds in Aspergillusoryzae. Examination of the A.oryzaegenome demonstrates that it contains twofatty acid synthases and several other genes that are predicted to be part of this biosynthetic pathway. We enhancedthe expressionof fatty acid synthesis-related genes by replacing their promoters with thepromoter fromthe constitutively highly expressedgene tef1. We demonstrate that by simply increasing the expression of the fatty acid synthasegenes we successfullyincreasedtheproduction of fatty acids and triglyceridesby more than two fold. Enhancement of expression of the fatty acid pathway genes ATP-citrate lyase and palmitoyl-ACP thioesteraseincreasedproductivity to a lesser extent.Increasing expression ofacetyl-CoA carboxylase caused no detectable change in fatty acid levels. Increases in message level for each gene were monitored usingquantitative real-time RT-PCR. Our data demonstrates that a simple increase in the abundance of fatty acid synthase genes can increase the detectable amount of fatty acids.

  15. Carnosol and Carnosic Acids from Salvia officinalis Inhibit Microsomal Prostaglandin E2 Synthase-1

    PubMed Central

    Bauer, Julia; Kuehnl, Susanne; Rollinger, Judith M.; Scherer, Olga; Northoff, Hinnak; Stuppner, Hermann; Werz, Oliver; Koeberle, Andreas

    2012-01-01

    Prostaglandin E2 (PGE2), the most relevant eicosanoid promoting inflammation and tumorigenesis, is formed by cyclooxygenases (COXs) and PGE2 synthases from free arachidonic acid. Preparations of the leaves of Salvia officinalis are commonly used in folk medicine as an effective antiseptic and anti-inflammatory remedy and possess anticancer activity. Here, we demonstrate that a standard ethyl acetate extract of S. officinalis efficiently suppresses the formation of PGE2 in a cell-free assay by direct interference with microsomal PGE2 synthase (mPGES)-1. Bioactivity-guided fractionation of the extract yielded closely related fractions that potently suppressed mPGES-1 with IC50 values between 1.9 and 3.5 μg/ml. Component analysis of these fractions revealed the diterpenes carnosol and carnosic acid as potential bioactive principles inhibiting mPGES-1 activity with IC50 values of 5.0 μM. Using a human whole-blood assay as a robust cell-based model, carnosic acid, but not carnosol, blocked PGE2 generation upon stimulation with lipopolysaccharide (IC50 = 9.3 μM). Carnosic acid neither inhibited the concomitant biosynthesis of other prostanoids [6-keto PGF1α, 12(S)-hydroxy-5-cis-8,10-trans-heptadecatrienoic acid, and thromboxane B2] in human whole blood nor affected the activities of COX-1/2 in a cell-free assay. Together, S. officinalis extracts and its ingredients carnosol and carnosic acid inhibit PGE2 formation by selectively targeting mPGES-1. We conclude that the inhibitory effect of carnosic acid on PGE2 formation, observed in the physiologically relevant whole-blood model, may critically contribute to the anti-inflammatory and anticarcinogenic properties of S. officinalis. PMID:22511203

  16. Promoter regulatory domain identification of cassava starch synthase IIb gene in transgenic tobacco.

    PubMed

    Guan, Zhihui; Chen, Xin; Xie, Hairong; Wang, Wenquan

    2016-05-01

    Soluble starch synthase is a key enzyme in the starch biosynthesis pathway, and its enzyme activity significantly influences starch components in cassava storage root. However, studies on the regulation mechanism of soluble starch synthase gene are rare. In this study, we cloned the 5' flanking sequence of the MeSSIIb gene and predicted the distribution of cis-elements. The region from -453 to -1 was considered the primary core promoter by the quantitative detection of GUS activity in transgenic tobacco plants containing 5' truncated promoters fused with the GUS gene. Analysis results clarified that the region from -531 to -454 significantly repressed promoter activity. The region from -453 to -388 was a repressive domain of ethylene, and some unknown drought responsive cis-elements were located in the region from -387 to -1. These findings will provide useful information on the functional assay and transcriptional regulation mechanisms of the MeSSIIb gene. PMID:26919397

  17. Diversity of benzyl- and alkylsuccinate synthase genes in hydrocarbon-impacted environments and enrichment cultures.

    PubMed

    Callaghan, Amy V; Davidova, Irene A; Savage-Ashlock, Kristen; Parisi, Victoria A; Gieg, Lisa M; Suflita, Joseph M; Kukor, Jerome J; Wawrik, Boris

    2010-10-01

    Hydrocarbon-degrading microorganisms play an important role in the natural attenuation of spilled petroleum in a variety of anoxic environments. The role of benzylsuccinate synthase (BSS) in aromatic hydrocarbon degradation and its use as a biomarker for field investigations are well documented. The recent discovery of alkylsuccinate synthase (ASS) allows the opportunity to test whether its encoding gene, assA, can serve as a comparable biomarker of anaerobic alkane degradation. Degenerate assA- and bssA-targeted PCR primers were designed in order to survey the diversity of genes associated with aromatic and aliphatic hydrocarbon biodegradation in petroleum-impacted environments and enrichment cultures. DNA was extracted from an anaerobic alkane-degrading isolate (Desulfoglaeba alkenexedens ALDC), hydrocarbon-contaminated river and aquifer sediments, a paraffin-degrading enrichment, and a propane-utilizing mixed culture. Partial assA and bssA genes were PCR amplified, cloned, and sequenced, yielding several novel clades of assA genes. These data expand the range of alkane-degrading conditions for which relevant gene sequences are available and indicate that considerable diversity of assA genes can be found in hydrocarbon-impacted environments. The detection of genes associated with anaerobic alkane degradation in conjunction with the in situ detection of alkylsuccinate metabolites was also demonstrated. Comparable molecular signals of assA/bssA were not found when environmental metagenome databases of uncontaminated sites were searched. These data confirm that the assA gene is a useful biomarker for anaerobic alkane metabolism. PMID:20504044

  18. Molecular evolution of the hyaluronan synthase 2 gene in mammals: implications for adaptations to the subterranean niche and cancer resistance.

    PubMed

    Faulkes, Christopher G; Davies, Kalina T J; Rossiter, Stephen J; Bennett, Nigel C

    2015-05-01

    The naked mole-rat (NMR) Heterocephalus glaber is a unique and fascinating mammal exhibiting many unusual adaptations to a subterranean lifestyle. The recent discovery of their resistance to cancer and exceptional longevity has opened up new and important avenues of research. Part of this resistance to cancer has been attributed to the fact that NMRs produce a modified form of hyaluronan--a key constituent of the extracellular matrix--that is thought to confer increased elasticity of the skin as an adaptation for living in narrow tunnels. This so-called high molecular mass hyaluronan (HMM-HA) stems from two apparently unique substitutions in the hyaluronan synthase 2 enzyme (HAS2). To test whether other subterranean mammals with similar selection pressures also show molecular adaptation in their HAS2 gene, we sequenced the HAS2 gene for 11 subterranean mammals and closely related species, and combined these with data from 57 other mammals. Comparative screening revealed that one of the two putatively important HAS2 substitutions in the NMR predicted to have a significant effect on hyaluronan synthase function was uniquely shared by all African mole-rats. Interestingly, we also identified multiple other amino acid substitutions in key domains of the HAS2 molecule, although the biological consequences of these for hyaluronan synthesis remain to be determined. Despite these results, we found evidence of strong purifying selection acting on the HAS2 gene across all mammals, and the NMR remains unique in its particular HAS2 sequence. Our results indicate that more work is needed to determine whether the apparent cancer resistance seen in NMR is shared by other members of the African mole-rat clade. PMID:25948568

  19. Molecular evolution of the hyaluronan synthase 2 gene in mammals: implications for adaptations to the subterranean niche and cancer resistance

    PubMed Central

    Faulkes, Christopher G.; Davies, Kalina T. J.; Rossiter, Stephen J.; Bennett, Nigel C.

    2015-01-01

    The naked mole-rat (NMR) Heterocephalus glaber is a unique and fascinating mammal exhibiting many unusual adaptations to a subterranean lifestyle. The recent discovery of their resistance to cancer and exceptional longevity has opened up new and important avenues of research. Part of this resistance to cancer has been attributed to the fact that NMRs produce a modified form of hyaluronan—a key constituent of the extracellular matrix—that is thought to confer increased elasticity of the skin as an adaptation for living in narrow tunnels. This so-called high molecular mass hyaluronan (HMM-HA) stems from two apparently unique substitutions in the hyaluronan synthase 2 enzyme (HAS2). To test whether other subterranean mammals with similar selection pressures also show molecular adaptation in their HAS2 gene, we sequenced the HAS2 gene for 11 subterranean mammals and closely related species, and combined these with data from 57 other mammals. Comparative screening revealed that one of the two putatively important HAS2 substitutions in the NMR predicted to have a significant effect on hyaluronan synthase function was uniquely shared by all African mole-rats. Interestingly, we also identified multiple other amino acid substitutions in key domains of the HAS2 molecule, although the biological consequences of these for hyaluronan synthesis remain to be determined. Despite these results, we found evidence of strong purifying selection acting on the HAS2 gene across all mammals, and the NMR remains unique in its particular HAS2 sequence. Our results indicate that more work is needed to determine whether the apparent cancer resistance seen in NMR is shared by other members of the African mole-rat clade. PMID:25948568

  20. Identification and characterization of granule bound starch synthase I (GBSSI) gene of tartary buckwheat (Fagopyrum tataricum Gaertn.).

    PubMed

    Wang, Xun; Feng, Bo; Xu, Zhibin; Sestili, Francesco; Zhao, Guojun; Xiang, Chao; Lafiandra, Domenico; Wang, Tao

    2014-01-25

    Tartary buckwheat (Fagopyrum tataricum Gaertn.) is increasingly considered as an important functional food material because of its rich nutraceutical compounds. Reserve starch is the major component of tartary buckwheat seed. However, the gene sequences and the molecular mechanism of tartary buckwheat starch synthesis are unknown so far. In this study, the complete genomic sequence and full-size cDNA coding tartary buckwheat granule-bound starch synthase I (FtGBSSI), which is responsible for amylose synthesis, were isolated and analyzed. The genomic sequence of the FtGBSSI contained 3947 nucleotides and was composed of 14 exons and 13 introns. The cDNA coding sequence of FtGBSSI shared 63.3%-75.1% identities with those of dicots and 56.6%-57.5% identities with monocots (Poaceae). In deduced amino acid sequence of FtGBSSI, eight motifs conserved among plant starch synthases were identified. A cleavage at the site IVC↓G of FtGBSSI protein produces the chloroplast transit sequence of 78 amino acids and the mature protein of 527 amino acids. The FtGBSSI mature protein showed an identity of 73.4%-77.8% with dicot plants, and 67.6%-70.4% with monocot plants (Poaceae). The mature protein was composed of 20 α-helixes and 16 β-strands, and folds into two main domains, N- and C-terminal domains. The critical residues which are involved in ADP and sugar binding were predicted. These results will be useful to modulate starch composition of buckwheat kernels with the aim to produce novel improved varieties in future breeding programs. PMID:24211386

  1. Inhibition of Fatty Acid Synthase Sensitizes Prostate Cancer Cells to Radiotherapy.

    PubMed

    Rae, Colin; Haberkorn, Uwe; Babich, John W; Mairs, Robert J

    2015-11-01

    Many common human cancers, including colon, prostate and breast cancer, express high levels of fatty acid synthase compared to normal human tissues. This elevated expression is associated with protection against apoptosis, increased metastasis and poor prognosis. Inhibitors of fatty acid synthase, such as the cerulenin synthetic analog C75, decrease prostate cancer cell proliferation, increase apoptosis and decrease tumor growth in experimental models. Although radiotherapy is widely used in the treatment of prostate cancer patients, the risk of damage to neighboring normal organs limits the radiation dose that can be delivered. In this study, we examined the potential of fatty acid synthase inhibition to sensitize prostate cancer cells to radiotherapy. The efficacy of C75 alone or in combination with X irradiation was examined in monolayers and in multicellular tumor spheroids. Treatment with C75 alone decreased clonogenic survival, an effect that was abrogated by the antioxidant. C75 treatment also delayed spheroid growth in a concentration-dependent manner. The radiosensitizing effect of C75 was indicated by combination index values between 0.65 and 0.71 and the reduced surviving fraction of clonogens, in response to 2 Gy X irradiation, from 0.51 to 0.30 and 0.11 in the presence of 25 and 35 μM C75, respectively. This increased sensitivity to radiation was reduced by the presence of the antioxidant. The C75 treatment also enhanced the spheroid growth delay induced by X irradiation in a supra-additive manner. The level of radiation-induced apoptosis in prostate cancer cells was increased further by C75, which induced cell cycle arrest in the G2/M phase, but only at a concentration greater than that required for radiosensitization. Radiation-induced G2/M blockade was not affected by C75 treatment. These results suggest the potential use of fatty acid synthase inhibition to enhance the efficacy of radiotherapy of prostate carcinoma and that C75-dependent cell

  2. Reduced food intake and body weight in mice treated with fatty acid synthase inhibitors.

    PubMed

    Loftus, T M; Jaworsky, D E; Frehywot, G L; Townsend, C A; Ronnett, G V; Lane, M D; Kuhajda, F P

    2000-06-30

    With the escalation of obesity-related disease, there is great interest in defining the mechanisms that control appetite and body weight. We have identified a link between anabolic energy metabolism and appetite control. Both systemic and intracerebroventricular treatment of mice with fatty acid synthase (FAS) inhibitors (cerulenin and a synthetic compound C75) led to inhibition of feeding and dramatic weight loss. C75 inhibited expression of the prophagic signal neuropeptide Y in the hypothalamus and acted in a leptin-independent manner that appears to be mediated by malonyl-coenzyme A. Thus, FAS may represent an important link in feeding regulation and may be a potential therapeutic target. PMID:10875926

  3. Functional characterization of amyrin synthase involved in ursolic acid biosynthesis in Catharanthus roseus leaf epidermis.

    PubMed

    Yu, Fang; Thamm, Antje M K; Reed, Darwin; Villa-Ruano, Nemesio; Quesada, Alfonso Lara; Gloria, Edmundo Lozoya; Covello, Patrick; De Luca, Vincenzo

    2013-07-01

    Catharanthus roseus accumulates high levels of the pentacyclic triterpene, ursolic acid, as a component of its wax exudate on the leaf surface. Bioinformatic analyses of transcripts derived from the leaf epidermis provide evidence for the specialized role of this tissue in the biosynthesis of ursolic acid. Cloning and functional expression in yeast of a triterpene synthase derived from this tissue showed it to be predominantly an α-amyrin synthase (CrAS), since the α-amyrin to β-amyrin reaction products accumulated in a 5:1 ratio. Expression analysis of CrAS showed that triterpene biosynthesis occurs predominantly in the youngest leaf tissues and in the earliest stages of seedling development. Further studies using laser capture microdissection to harvest RNA from epidermis, mesophyll, idioblasts, laticifers and vasculature of leaves showed the leaf epidermis to be the preferred sites of CrAS expression and provide conclusive evidence for the involvement of this tissue in the biosynthesis of ursolic acid in C. roseus. PMID:22652241

  4. Natural fatty acid synthase inhibitors as potent therapeutic agents for cancers: A review.

    PubMed

    Zhang, Jia-Sui; Lei, Jie-Ping; Wei, Guo-Qing; Chen, Hui; Ma, Chao-Ying; Jiang, He-Zhong

    2016-09-01

    Context Fatty acid synthase (FAS) is the only mammalian enzyme to catalyse the synthesis of fatty acid. The expression level of FAS is related to cancer progression, aggressiveness and metastasis. In recent years, research on natural FAS inhibitors with significant bioactivities and low side effects has increasingly become a new trend. Herein, we present recent research progress on natural fatty acid synthase inhibitors as potent therapeutic agents. Objective This paper is a mini overview of the typical natural FAS inhibitors and their possible mechanism of action in the past 10 years (2004-2014). Method The information was collected and compiled through major databases including Web of Science, PubMed, and CNKI. Results Many natural products induce cancer cells apoptosis by inhibiting FAS expression, with fewer side effects than synthetic inhibitors. Conclusion Natural FAS inhibitors are widely distributed in plants (especially in herbs and foods). Some natural products (mainly phenolics) possessing potent biological activities and stable structures are available as lead compounds to synthesise promising FAS inhibitors. PMID:26864638

  5. Cytosylglucuronic acid synthase (cytosine: UDP-glucuronosyltransferase) from Streptomyces griseochromogenes, the first prokaryotic UDP-glucuronosyltransferase.

    PubMed Central

    Gould, S J; Guo, J

    1994-01-01

    Cytosylglucuronic acid synthase (cytosine: UDP-glucuronosyltransferase), the first prokaryotic UDP-GT and a key enzyme in the biosynthesis of the antibiotic blasticidin S, was purified 870-fold. It has optimum activity at a pH of 8.4 to 8.6, Kms of 6.0 (UDP-glucuronic acid) and 243 (cytosine) microM, and a maximum rate of metabolism of 14.6 mumol/min/mg. The apparent M(r) is 43,000. Activity was slightly enhanced by Mg2+ or Ca2+ but was not inhibited by EDTA. Activity was strongly inhibited by UDP. Cytosylglucuronic acid differs from eukaryotic UDP-glucuronosyltransferases in being a soluble protein with no apparent phospholipid requirement. Images PMID:8113166

  6. Coordinated responses of phytochelatin synthase and metallothionein genes in black mangrove, Avicennia germinans, exposed to cadmium and copper.

    PubMed

    Gonzalez-Mendoza, Daniel; Moreno, Adriana Quiroz; Zapata-Perez, Omar

    2007-08-01

    To evaluate the role of phytochelatins and metallothioneins in heavy metal tolerance of black mangrove Avicennia germinans, 3-month-old seedlings were exposed to cadmium or copper for 30 h, under hydroponic conditions. Degenerate Mt2 and PCS primers were synthesized based on amino acid and nucleotide alignment sequences reported for Mt2 and PCS in other plant species found in GenBank. Total RNA was isolated from A. germinans leaves and two partial fragments of metallothionein and phytochelatin synthase genes were isolated. Gene expression was evaluated with reverse transcripatase-polymerase chain reaction (RT-PCR) amplification technique. Temporal analysis showed that low Cd2+ and Cu2+ concentrations caused a slight (but not significant) increase in AvMt2 expression after a 16 h exposure time, while AvPCS expression showed a significant increase under the same conditions but only after 4h. Results strongly suggest that the rapid increase in AvPCS expression may contribute to Cd2+ and Cu2+ detoxification. Moreover, we found that A. germinans has the capacity to over-express both genes (AvMt2 and AvPCS), which may constitute a coordinated detoxification response mechanism targeting non-essential metals. Nonetheless, our results confirm that AvPCS was the most active gene involved in the regulation of essential metals (e.g., Cu2+) in A. germinans leaves. PMID:17582515

  7. Isolation of an Arabidopsis thaliana gene encoding cycloartenol synthase by functional expression in a yeast mutant lacking lanosterol synthase by the use of a chromatographic screen.

    PubMed

    Corey, E J; Matsuda, S P; Bartel, B

    1993-12-15

    Whereas vertebrates and fungi synthesize sterols from epoxysqualene through the intermediate lanosterol, plants cyclize epoxysqualene to cycloartenol as the initial sterol. We report the cloning and characterization of CAS1, an Arabidopsis thaliana gene encoding cycloartenol synthase [(S)-2,3-epoxysqualene mutase (cyclizing, cycloartenol forming), EC 5.4.99.8]. A yeast mutant lacking lanosterol synthase [(S)-2,3-epoxysqualene mutase (cyclizing, lanosterol forming), EC 5.4.99.7] was transformed with an A. thaliana cDNA yeast expression library, and colonies were assayed for epoxysqualene mutase activity by thin-layer chromatography. One out of approximately 10,000 transformants produced a homogenate that cyclized 2,3-epoxysqualene to the plant sterol cycloartenol. This activity was shown to be plasmid dependent. The plasmid insert contains a 2277-bp open reading frame capable of encoding an 86-kDa protein with significant homology to lanosterol synthase from Candida albicans and squalene-hopene cyclase (EC 5.4.99.-) from Bacillus acidocalcarius. The method used to clone this gene should be generally applicable to genes responsible for secondary metabolite biosynthesis. PMID:7505443

  8. Lanosterol Synthase Gene Polymorphisms and Changes in Endogenous Ouabain in the Response to Low Sodium Intake.

    PubMed

    Lanzani, Chiara; Gatti, Guido; Citterio, Lorena; Messaggio, Elisabetta; Delli Carpini, Simona; Simonini, Marco; Casamassima, Nunzia; Zagato, Laura; Brioni, Elena; Hamlyn, John M; Manunta, Paolo

    2016-02-01

    Circulating levels of endogenous ouabain (EO), a vasopressor hormone of adrenocortical origin, are increased by sodium depletion. Furthermore, lanosterol synthase, an enzyme involved in cholesterol biosynthesis, has a missense polymorphism (rs2254524 V642L) that affects EO biosynthesis in adrenocortical cells. Here, we investigated the hypothesis that lanosterol synthase rs2254524 alleles in vivo impact the blood pressure (BP) and EO responses evoked by a low dietary Na intake (<100 mEq/d, 2 weeks) among patients with mild essential hypertension. During the low salt diet, the declines in both systolic BP (SBP: -8.7±1.7 versus -3.0±1.5; P=0.013) and diastolic BP (DBP: -5.1±0.98 versus -1.4±0.94 mm Hg; P<0.05), and the slope of the long-term pressure-natriuresis relationship affected significantly the presence of the lanosterol synthase rs2254524 A variant (AA: 0.71±0.22, AC 0.09±0.13, and CC 0.04±0.11 mEq/mm Hg/24 h; P=0.028). In addition, BP rose in ≈25% of the patients in response to the low salt diet and this was associated with increased circulating EO. Lanosterol synthase gene polymorphisms influence both the salt sensitivity of BP and changes in circulating EO in response to a low salt diet. The response of BP and EO to the low salt diet is markedly heterogeneous. Approximately 25% of patients experienced adverse effects, that is, increased BP and EO when salt intake was reduced and may be at increased long-term risk. The augmented response of EO to the low salt diet further supports the view that adrenocortical function is abnormal in some essential hypertensives. PMID:26667413

  9. Polyester synthases: natural catalysts for plastics.

    PubMed Central

    Rehm, Bernd H A

    2003-01-01

    Polyhydroxyalkanoates (PHAs) are biopolyesters composed of hydroxy fatty acids, which represent a complex class of storage polyesters. They are synthesized by a wide range of different Gram-positive and Gram-negative bacteria, as well as by some Archaea, and are deposited as insoluble cytoplasmic inclusions. Polyester synthases are the key enzymes of polyester biosynthesis and catalyse the conversion of (R)-hydroxyacyl-CoA thioesters to polyesters with the concomitant release of CoA. These soluble enzymes turn into amphipathic enzymes upon covalent catalysis of polyester-chain formation. A self-assembly process is initiated resulting in the formation of insoluble cytoplasmic inclusions with a phospholipid monolayer and covalently attached polyester synthases at the surface. Surface-attached polyester synthases show a marked increase in enzyme activity. These polyester synthases have only recently been biochemically characterized. An overview of these recent findings is provided. At present, 59 polyester synthase structural genes from 45 different bacteria have been cloned and the nucleotide sequences have been obtained. The multiple alignment of the primary structures of these polyester synthases show an overall identity of 8-96% with only eight strictly conserved amino acid residues. Polyester synthases can been assigned to four classes based on their substrate specificity and subunit composition. The current knowledge on the organization of the polyester synthase genes, and other genes encoding proteins related to PHA metabolism, is compiled. In addition, the primary structures of the 59 PHA synthases are aligned and analysed with respect to highly conserved amino acids, and biochemical features of polyester synthases are described. The proposed catalytic mechanism based on similarities to alpha/beta-hydrolases and mutational analysis is discussed. Different threading algorithms suggest that polyester synthases belong to the alpha/beta-hydrolase superfamily, with

  10. Colonic Fatty Acid Synthase is Down-regulated in Sprague-Dawley Rats Fed Soy Protein Isolate

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Fatty Acid Synthase (FAS), a key enzyme in the fatty acid biosynthetic pathway, is over-expressed in multiple cancers. The aim of this study was to evaluate the effects of dietary proteins [soy protein isolate (SPI) and casein (CAS), latter is the control] on the expression of FAS in the colonic muc...

  11. Polymerase chain reaction comparison of the gene for strictosidine synthase from ten Rauvolfia species.

    PubMed

    Bracher, D; Kutchan, T M

    1992-05-01

    The gene for strictosidine synthase, str1, has been analyzed by the polymerase chain reaction in ten species of Rauvolfia, the origins of which span the tropical belt: R. cambodiana (Indochina), R. canescens (India), R. chinensis (China), R. heterophylla (Central America), R. mannii (West Africa), R. nitida (West Indies), R. praecox (Brasil), R. serpentina (India), R. sumatrana (Indonesia) and R. verticillata (Indochina). Restriction endonuclease analysis of the gene fragments produced with genomic DNA from each of the ten species as template revealed that str1 is highly conserved in the Rauvolfia species investigated. These results suggest that there is a stringent selection pressure on the gene for this key enzyme of indole alkaloid biosynthesis. PMID:24202981

  12. Saponin biosynthesis in Saponaria vaccaria. cDNAs encoding beta-amyrin synthase and a triterpene carboxylic acid glucosyltransferase.

    PubMed

    Meesapyodsuk, Dauenpen; Balsevich, John; Reed, Darwin W; Covello, Patrick S

    2007-02-01

    Saponaria vaccaria (Caryophyllaceae), a soapwort, known in western Canada as cowcockle, contains bioactive oleanane-type saponins similar to those found in soapbark tree (Quillaja saponaria; Rosaceae). To improve our understanding of the biosynthesis of these saponins, a combined polymerase chain reaction and expressed sequence tag approach was taken to identify the genes involved. A cDNA encoding a beta-amyrin synthase (SvBS) was isolated by reverse transcription-polymerase chain reaction and characterized by expression in yeast (Saccharomyces cerevisiae). The SvBS gene is predominantly expressed in leaves. A S. vaccaria developing seed expressed sequence tag collection was developed and used for the isolation of a full-length cDNA bearing sequence similarity to ester-forming glycosyltransferases. The gene product of the cDNA, classified as UGT74M1, was expressed in Escherichia coli, purified, and identified as a triterpene carboxylic acid glucosyltransferase. UGT74M1 is expressed in roots and leaves and appears to be involved in monodesmoside biosynthesis in S. vaccaria. PMID:17172290

  13. Volatile emissions of scented Alstroemeria genotypes are dominated by terpenes, and a myrcene synthase gene is highly expressed in scented Alstroemeria flowers.

    PubMed

    Aros, Danilo; Gonzalez, Veronica; Allemann, Rudolf K; Müller, Carsten T; Rosati, Carlo; Rogers, Hilary J

    2012-04-01

    Native to South America, Alstroemeria flowers are known for their colourful tepals, and Alstroemeria hybrids are an important cut flower. However, in common with many commercial cut flowers, virtually all the commercial Alstroemeria hybrids are not scented. The cultivar 'Sweet Laura' is one of very few scented commercial Alstroemeria hybrids. Characterization of the volatile emission profile of these cut flowers revealed three major terpene compounds: (E)-caryophyllene, humulene (also known as α-caryophyllene), an ocimene-like compound, and several minor peaks, one of which was identified as myrcene. The profile is completely different from that of the parental scented species A. caryophyllaea. Volatile emission peaked at anthesis in both scented genotypes, coincident in cv. 'Sweet Laura' with the maximal expression of a putative terpene synthase gene AlstroTPS. This gene was preferentially expressed in floral tissues of both cv. 'Sweet Laura' and A. caryophyllaea. Characterization of the AlstroTPS gene structure from cv. 'Sweet Laura' placed it as a member of the class III terpene synthases, and the predicted 567 amino acid sequence placed it into the subfamily TPS-b. The conserved sequences R(28)(R)X(8)W and D(321)DXXD are the putative Mg(2+)-binding sites, and in vitro assay of AlstroTPS expressed in Escherichia coli revealed that the encoded enzyme possesses myrcene synthase activity, consistent with a role for AlstroTPS in scent production in Alstroemeria cv. 'Sweet Laura' flowers. PMID:22268153

  14. Transcriptional modulation of squalene synthase genes in barley treated with PGPR

    PubMed Central

    Yousaf, Anam; Qadir, Abdul; Anjum, Tehmina; Ahmad, Aqeel

    2015-01-01

    Phytosterol contents and food quality of plant produce is directly associated with transcription of gene squalene synthase (SS). In current study, barley plants were treated with different rhizobacterial strains under semi controlled (27 ± 3°C) greenhouse conditions in order to modulate expression of SS gene. Plant samples were analyzed through semi-quantitative PCR to evaluate effect of rhizobacterial application on transcriptional status of SS. Results revealed that among four SS genes (i.e., SSA, SS1, SS2, and SS3), the most expressive gene was SSA; while, SS2 was screened out as the second best induced gene due to Acetobacter aceti. The most efficient bacterial strain which recorded maximum gene expression was A. aceti AC8. Moreover, AC7 was reported as the least efficient bacterial species for inducing SS gene expression. AC8 enhanced the share of SSA and SS2 up to 43 and 31%, respectively. The study also described ribosomal sequence of the most efficient bacterial strain AC8, which was used to determine its phylogenetic relationships with other microbial strains. The study would be helpful to improve quality of plant produce by modulating transcription of SS genes. PMID:26388880

  15. Localization of polyketide synthase encoding genes to the toxic dinoflagellate Karenia brevis

    PubMed Central

    Snyder, Richard V.; Guerrero, Maria A.; Sinigalliano, Christopher D.; Winshell, Jamie; Perez, Roberto; Lopez, Jose V.; Rein, Kathleen S.

    2008-01-01

    Karenia brevis is a toxic marine dinoflagellate endemic to the Gulf of Mexico. Blooms of this harmful alga cause fish kills, marine mammal mortalities and neurotoxic shellfish poisonings. These harmful effects are attributed to a suite of polyketide secondary metabolites known as the brevetoxins. The carbon framework of all polyketides is assembled by a polyketide synthase (PKS). Previously, PKS encoding genes were amplified from K. brevis culture and their similarity to a PKS gene from the closely related protist, Cryptosporidium parvum, suggested that these genes originate from the dinoflagellate. However, K. brevis has not been grown axenically. The associated bacteria might be the source of the toxins or the PKS genes. Herein we report the localization of PKS encoding genes by a combination of flow cytometry/PCR and fluorescence in situ hybridization (FISH). Two genes localized exclusively to K. brevis cells while a third localized to both K. brevis and associated bacteria. While these genes have not yet been linked to toxin production, the work describes the first definitive evidence of resident PKS genes in any dinoflagellate. PMID:16051286

  16. Transcriptional modulation of squalene synthase genes in barley treated with PGPR.

    PubMed

    Yousaf, Anam; Qadir, Abdul; Anjum, Tehmina; Ahmad, Aqeel

    2015-01-01

    Phytosterol contents and food quality of plant produce is directly associated with transcription of gene squalene synthase (SS). In current study, barley plants were treated with different rhizobacterial strains under semi controlled (27 ± 3°C) greenhouse conditions in order to modulate expression of SS gene. Plant samples were analyzed through semi-quantitative PCR to evaluate effect of rhizobacterial application on transcriptional status of SS. Results revealed that among four SS genes (i.e., SSA, SS1, SS2, and SS3), the most expressive gene was SSA; while, SS2 was screened out as the second best induced gene due to Acetobacter aceti. The most efficient bacterial strain which recorded maximum gene expression was A. aceti AC8. Moreover, AC7 was reported as the least efficient bacterial species for inducing SS gene expression. AC8 enhanced the share of SSA and SS2 up to 43 and 31%, respectively. The study also described ribosomal sequence of the most efficient bacterial strain AC8, which was used to determine its phylogenetic relationships with other microbial strains. The study would be helpful to improve quality of plant produce by modulating transcription of SS genes. PMID:26388880

  17. Functional Analysis of the Brassica napus L. Phytoene Synthase (PSY) Gene Family

    PubMed Central

    López-Emparán, Ada; Quezada-Martinez, Daniela; Zúñiga-Bustos, Matías; Cifuentes, Víctor; Iñiguez-Luy, Federico; Federico, María Laura

    2014-01-01

    Phytoene synthase (PSY) has been shown to catalyze the first committed and rate-limiting step of carotenogenesis in several crop species, including Brassica napus L. Due to its pivotal role, PSY has been a prime target for breeding and metabolic engineering the carotenoid content of seeds, tubers, fruits and flowers. In Arabidopsis thaliana, PSY is encoded by a single copy gene but small PSY gene families have been described in monocot and dicotyledonous species. We have recently shown that PSY genes have been retained in a triplicated state in the A- and C-Brassica genomes, with each paralogue mapping to syntenic locations in each of the three “Arabidopsis-like” subgenomes. Most importantly, we have shown that in B. napus all six members are expressed, exhibiting overlapping redundancy and signs of subfunctionalization among photosynthetic and non photosynthetic tissues. The question of whether this large PSY family actually encodes six functional enzymes remained to be answered. Therefore, the objectives of this study were to: (i) isolate, characterize and compare the complete protein coding sequences (CDS) of the six B. napus PSY genes; (ii) model their predicted tridimensional enzyme structures; (iii) test their phytoene synthase activity in a heterologous complementation system and (iv) evaluate their individual expression patterns during seed development. This study further confirmed that the six B. napus PSY genes encode proteins with high sequence identity, which have evolved under functional constraint. Structural modeling demonstrated that they share similar tridimensional protein structures with a putative PSY active site. Significantly, all six B. napus PSY enzymes were found to be functional. Taking into account the specific patterns of expression exhibited by these PSY genes during seed development and recent knowledge of PSY suborganellar localization, the selection of transgene candidates for metabolic engineering the carotenoid content of

  18. Functional analysis of the Brassica napus L. phytoene synthase (PSY) gene family.

    PubMed

    López-Emparán, Ada; Quezada-Martinez, Daniela; Zúñiga-Bustos, Matías; Cifuentes, Víctor; Iñiguez-Luy, Federico; Federico, María Laura

    2014-01-01

    Phytoene synthase (PSY) has been shown to catalyze the first committed and rate-limiting step of carotenogenesis in several crop species, including Brassica napus L. Due to its pivotal role, PSY has been a prime target for breeding and metabolic engineering the carotenoid content of seeds, tubers, fruits and flowers. In Arabidopsis thaliana, PSY is encoded by a single copy gene but small PSY gene families have been described in monocot and dicotyledonous species. We have recently shown that PSY genes have been retained in a triplicated state in the A- and C-Brassica genomes, with each paralogue mapping to syntenic locations in each of the three "Arabidopsis-like" subgenomes. Most importantly, we have shown that in B. napus all six members are expressed, exhibiting overlapping redundancy and signs of subfunctionalization among photosynthetic and non photosynthetic tissues. The question of whether this large PSY family actually encodes six functional enzymes remained to be answered. Therefore, the objectives of this study were to: (i) isolate, characterize and compare the complete protein coding sequences (CDS) of the six B. napus PSY genes; (ii) model their predicted tridimensional enzyme structures; (iii) test their phytoene synthase activity in a heterologous complementation system and (iv) evaluate their individual expression patterns during seed development. This study further confirmed that the six B. napus PSY genes encode proteins with high sequence identity, which have evolved under functional constraint. Structural modeling demonstrated that they share similar tridimensional protein structures with a putative PSY active site. Significantly, all six B. napus PSY enzymes were found to be functional. Taking into account the specific patterns of expression exhibited by these PSY genes during seed development and recent knowledge of PSY suborganellar localization, the selection of transgene candidates for metabolic engineering the carotenoid content of oilseeds

  19. Homology study of two polyhydroxyalkanoate (PHA) synthases from Pseudomonas aureofaciens.

    PubMed

    Umeda, F; Nishikawa, T; Miyasaka, H; Maeda, I; Kawase, M; Yagi, K

    2001-11-01

    Recently, we have cloned and analyzed two polyhydroxyalkanoate (PHA) synthase genes (phaC1 and phaC2 in the pha cluster) from Pseudomonas aureofaciens. In this report, the deduced amino acid (AA) sequences of PHA synthase 1 and PHA synthase 2 from P. aureofaciens are compared with those from three other bacterial strains (Pseudomonas sp. 61-3, P. oleovorans and P. aeruginosa) containing the homologous pha cluster. The level of homology of either PHA synthase 1 or PHA synthase 2 was high with each enzyme from these three bacterial strains. Furthermore, multialignment of PHA synthase AA sequences implied that both enzymes of PHA synthase 1 and PHA synthase 2 were highly conserved in the four strains including P. aureofaciens. PMID:11916262

  20. Functional Characterization of New Polyketide Synthase Genes Involved in Ochratoxin A Biosynthesis in Aspergillus Ochraceus fc-1

    PubMed Central

    Wang, Liuqing; Wang, Yan; Wang, Qi; Liu, Fei; Selvaraj, Jonathan Nimal; Liu, Lingna; Xing, Fuguo; Zhao, Yueju; Zhou, Lu; Liu, Yang

    2015-01-01

    Ochratoxin A (OTA), a potentially carcinogenic mycotoxin which contaminates grains, is produced by several Aspergillus species. A comparative sequence analysis of the OTA-producing Aspergillus ochraceus fc-1 strain and other Aspergillus species was performed. Two new OTA-related polyketide synthase (PKS) (AoOTApks) genes were identified. The predicted amino acid sequence of AoOTApks-1 displayed high similarity to previously identified PKSs from OTA-producing A. carbonarius ITEM 5010 (67%; [PI] No. 173482) and A. niger CBS 513.88 (62%; XP_001397313). However, the predicted amino acid sequence of AoOTApks-2 displayed lower homology with A. niger CBS 513.88 (38%) and A. carbonarius ITEM 5010 (28%). A phylogenetic analysis of the β-ketosynthase and acyl-transferase domains of the AoOTApks proteins indicated that they shared a common origin with other OTA-producing species, such as A. carbonarius, A. niger, and A. westerdijkiae. A real-time reverse-transcription PCR analysis showed that the expression of AoOTApks-1 and -2 was positively correlated with the OTA concentration. The pks gene deleted mutants ∆AoOTApks-1 and ∆AoOTApks-2 produced nil and lesser OTA than the wild-type strain, respectively. Our study suggests that AoOTApks-1 could be involved in OTA biosynthesis, while AoOTApks-2 might be indirectly involved in OTA production. PMID:26213966

  1. Function of heterologous Mycobacterium tuberculosis InhA, a type 2 fatty acid synthase enzyme involved in extending C20 fatty acids to C60-to-C90 mycolic acids, during de novo lipoic acid synthesis in Saccharomyces cerevisiae.

    PubMed

    Gurvitz, Aner; Hiltunen, J Kalervo; Kastaniotis, Alexander J

    2008-08-01

    We describe the physiological function of heterologously expressed Mycobacterium tuberculosis InhA during de novo lipoic acid synthesis in yeast (Saccharomyces cerevisiae) mitochondria. InhA, representing 2-trans-enoyl-acyl carrier protein reductase and the target for the front-line antituberculous drug isoniazid, is involved in the activity of dissociative type 2 fatty acid synthase (FASII) that extends associative type 1 fatty acid synthase (FASI)-derived C(20) fatty acids to form C(60)-to-C(90) mycolic acids. Mycolic acids are major constituents of the protective layer around the pathogen that contribute to virulence and resistance to certain antimicrobials. Unlike FASI, FASII is thought to be incapable of de novo biosynthesis of fatty acids. Here, the genes for InhA (Rv1484) and four similar proteins (Rv0927c, Rv3485c, Rv3530c, and Rv3559c) were expressed in S. cerevisiae etr1Delta cells lacking mitochondrial 2-trans-enoyl-thioester reductase activity. The phenotype of the yeast mutants includes the inability to produce sufficient levels of lipoic acid, form mitochondrial cytochromes, respire, or grow on nonfermentable carbon sources. Yeast etr1Delta cells expressing mitochondrial InhA were able to respire, grow on glycerol, and produce lipoic acid. Commensurate with a role in mitochondrial de novo fatty acid biosynthesis, InhA could accept in vivo much shorter acyl-thioesters (C(4) to C(8)) than was previously thought (>C(12)). Moreover, InhA functioned in the absence of AcpM or protein-protein interactions with its native FASII partners KasA, KasB, FabD, and FabH. None of the four proteins similar to InhA complemented the yeast mutant phenotype. We discuss the implications of our findings with reference to lipoic acid synthesis in M. tuberculosis and the potential use of yeast FASII mutants for investigating the physiological function of drug-targeted pathogen enzymes involved in fatty acid biosynthesis. PMID:18552191

  2. 3-Ketoacyl-acyl carrier protein synthase III from spinach (Spinacia oleracea) is not similar to other condensing enzymes of fatty acid synthase.

    PubMed Central

    Tai, H; Jaworski, J G

    1993-01-01

    A cDNA clone encoding spinach (Spinacia oleracea) 3-ketoacyl-acyl carrier protein synthase III (KAS III), which catalyzes the initial condensing reaction in fatty acid biosynthesis, was isolated. Based on the amino acid sequence of tryptic digests of purified spinach KAS III, degenerate polymerase chain reaction (PCR) primers were designed and used to amplify a 612-bp fragment from first-strand cDNA of spinach leaf RNA. A root cDNA library was probed with the PCR fragment, and a 1920-bp clone was isolated. Its deduced amino acid sequence matched the sequences of the tryptic digests obtained from the purified KAS III. Northern analysis confirmed that it was expressed in both leaf and root. The clone contained a 1218-bp open reading frame coding for 405 amino acids. The identity of the clone was confirmed by expression in Escherichia coli BL 21 as a glutathione S-transferase fusion protein. The deduced amino acid sequence was 48 and 45% identical with the putative KAS III of Porphyra umbilicalis and KAS III of E. coli, respectively. It also had a strong local homology to the plant chalcone synthases but had little homology with other KAS isoforms from plants, bacteria, or animals. PMID:8290632

  3. Gene structure, phylogeny and expression profile of the sucrose synthase gene family in cacao (Theobroma cacao L.).

    PubMed

    Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui

    2015-09-01

    In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family. PMID:26440085

  4. Inhibition of the fungal fatty acid synthase type I multienzyme complex

    PubMed Central

    Johansson, Patrik; Wiltschi, Birgit; Kumari, Preeti; Kessler, Brigitte; Vonrhein, Clemens; Vonck, Janet; Oesterhelt, Dieter; Grininger, Martin

    2008-01-01

    Fatty acids are among the major building blocks of living cells, making lipid biosynthesis a potent target for compounds with antibiotic or antineoplastic properties. We present the crystal structure of the 2.6-MDa Saccharomyces cerevisiae fatty acid synthase (FAS) multienzyme in complex with the antibiotic cerulenin, representing, to our knowledge, the first structure of an inhibited fatty acid megasynthase. Cerulenin attacks the FAS ketoacyl synthase (KS) domain, forming a covalent bond to the active site cysteine C1305. The inhibitor binding causes two significant conformational changes of the enzyme. First, phenylalanine F1646, shielding the active site, flips and allows access to the nucleophilic cysteine. Second, methionine M1251, placed in the center of the acyl-binding tunnel, rotates and unlocks the inner part of the fatty acid binding cavity. The importance of the rotational movement of the gatekeeping M1251 side chain is reflected by the cerulenin resistance and the changed product spectrum reported for S. cerevisiae strains mutated in the adjacent glycine G1250. Platensimycin and thiolactomycin are two other potent inhibitors of KSs. However, in contrast to cerulenin, they show selectivity toward the prokaryotic FAS system. Because the flipped F1646 characterizes the catalytic state accessible for platensimycin and thiolactomycin binding, we superimposed structures of inhibited bacterial enzymes onto the S. cerevisiae FAS model. Although almost all side chains involved in inhibitor binding are conserved in the FAS multienzyme, a different conformation of the loop K1413–K1423 of the KS domain might explain the observed low antifungal properties of platensimycin and thiolactomycin. PMID:18725634

  5. Isoniazid affects multiple components of the type II fatty acid synthase system of Mycobacterium tuberculosis.

    PubMed

    Slayden, R A; Lee, R E; Barry, C E

    2000-11-01

    Genetic and biochemical evidence has implicated two different target enzymes for isoniazid (INH) within the unique type II fatty acid synthase (FAS) system involved in the production of mycolic acids. These two components are an enoyl acyl carrier protein (ACP) reductase, InhA, and a beta-ketoacyl-ACP synthase, KasA. We compared the consequences of INH treatment of Mycobacterium tuberculosis (MTB) with two inhibitors having well-defined targets: triclosan (TRC), which inhibits InhA; and thiolactomycin (TLM), which inhibits KasA. INH and TLM, but not TRC, upregulate the expression of an operon containing five FAS II components, including kasA and acpM. Although all three compounds inhibit mycolic acid synthesis, treatment with INH and TLM, but not with TRC, results in the accumulation of ACP-bound lipid precursors to mycolic acids that were 26 carbons long and fully saturated. TLM-resistant mutants of MTB were more cross-resistant to INH than TRC-resistant mutants. Overexpression of KasA conferred more resistance to TLM and INH than to TRC. Overexpression of InhA conferred more resistance to TRC than to INH and TLM. Co-overexpression of both InhA and KasA resulted in strongly enhanced levels of INH resistance, in addition to cross-resistance to both TLM and TRC. These results suggest that these components of the FAS II complex are not independently regulated and that alterations in the expression level of InhA affect expression levels of KasA. Nonetheless, INH appeared to resemble TLM more closely in overall mode of action, and KasA levels appeared to be tightly correlated with INH sensitivity. PMID:11069675

  6. Development of intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase for discriminating Curcuma species.

    PubMed

    Kita, Tomoko; Komatsu, Katsuko; Zhu, Shu; Iida, Osamu; Sugimura, Koji; Kawahara, Nobuo; Taguchi, Hiromu; Masamura, Noriya; Cai, Shao-Qing

    2016-03-01

    Various Curcuma rhizomes have been used as medicines or spices in Asia since ancient times. It is very difficult to distinguish them morphologically, especially when they are boiled and dried, which causes misidentification leading to a loss of efficacy. We developed a method for discriminating Curcuma species by intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase. This method could apply to identification of not only fresh plants but also samples of crude drugs or edible spices. By applying this method to Curcuma specimens and samples, and constructing a dendrogram based on these markers, seven Curcuma species were clearly distinguishable. Moreover, Curcuma longa specimens were geographically distinguishable. On the other hand, Curcuma kwangsiensis (gl type) specimens also showed intraspecies polymorphism, which may have occurred as a result of hybridization with other Curcuma species. The molecular method we developed is a potential tool for global classification of the genus Curcuma. PMID:26471689

  7. (E)-β-farnesene synthase genes affect aphid (Myzus persicae) infestation in tobacco (Nicotiana tabacum).

    PubMed

    Yu, Xiudao; Jones, Huw D; Ma, Youzhi; Wang, Genping; Xu, Zhaoshi; Zhang, Baoming; Zhang, Yongjun; Ren, Guangwei; Pickett, John A; Xia, Lanqin

    2012-03-01

    Aphids are major agricultural pests which cause significant yield losses of the crop plants each year. (E)-β-farnesene (EβF) is the alarm pheromone involved in the chemical communication between aphids and particularly in the avoidance of predation. In the present study, two EβF synthase genes were isolated from sweet wormwood and designated as AaβFS1 and AaβFS2, respectively. Overexpression of AaβFS1 or AaβFS2 in tobacco plants resulted in the emission of EβF ranging from 1.55 to 4.65 ng/day/g fresh tissues. Tritrophic interactions involving the peach aphids (Myzus persicae), predatory lacewings (Chrysopa septempunctata) demonstrated that the transgenic tobacco expressing AaβFS1 and AaβFS2 could repel peach aphids, but not as strongly as expected. However, AaβFS1 and AaβFS2 lines exhibited strong and statistically significant attraction to lacewings. Further experiments combining aphids and lacewing larvae in an octagon arrangement showed transgenic tobacco plants could repel aphids and attract lacewing larvae, thus minimizing aphid infestation. Therefore, we demonstrated a potentially valuable strategy of using EβF synthase genes from sweet wormwood for aphid control in tobacco or other economic important crops in an environmentally benign way. PMID:21847661

  8. Mutations in the gene encoding starch synthase II profoundly alter amylopectin structure in pea embryos.

    PubMed Central

    Craig, J; Lloyd, J R; Tomlinson, K; Barber, L; Edwards, A; Wang, T L; Martin, C; Hedley, C L; Smith, A M

    1998-01-01

    Mutations at the rug5 (rugosus5) locus have been used to elucidate the role of the major soluble isoform of starch synthase II (SSII) in amylopectin synthesis in the developing pea embryo. The SSII gene maps to the rug5 locus, and the gene in one of three rug5 mutant lines has been shown to carry a base pair substitution that introduces a stop codon into the open reading frame. All three mutant alleles cause a dramatic reduction or loss of the SSII protein. The mutations have pleiotropic effects on the activities of other isoforms of starch synthase but apparently not on those of other enzymes of starch synthesis. These mutations result in abnormal starch granule morphology and amylopectin structure. Amylopectin contains fewer chains of intermediate length (B2 and B3 chains) and more very short and very long chains than does amylopectin from wild-type embryos. The results suggest that SSII may play a specific role in the synthesis of B2 and B3 chains of amylopectin. The extent to which these findings can be extrapolated to other species is discussed. PMID:9501114

  9. Three 1-Aminocyclopropane-1-Carboxylate Synthase Genes Regulated by Primary and Secondary Pollination Signals in Orchid Flowers1

    PubMed Central

    Bui, Anhthu Q.; Neill, Sharman D. O'

    1998-01-01

    The temporal and spatial expression patterns of three 1-aminocyclopropane-1-carboxylate (ACC) synthase genes were investigated in pollinated orchid (Phalaenopsis spp.) flowers. Pollination signals initiate a cascade of development events in multiple floral organs, including the induction of ethylene biosynthesis, which coordinates several postpollination developmental responses. The initiation and propagation of ethylene biosynthesis is regulated by the coordinated expression of three distinct ACC synthase genes in orchid flowers. One ACC synthase gene (Phal-ACS1) is regulated by ethylene and participates in amplification and interorgan transmission of the pollination signal, as we have previously described in a related orchid genus. Two additional ACC synthase genes (Phal-ACS2 and Phal-ACS3) are expressed primarily in the stigma and ovary of pollinated orchid flowers. Phal-ACS2 mRNA accumulated in the stigma within 1 h after pollination, whereas Phal-ACS1 mRNA was not detected until 6 h after pollination. Similar to the expression of Phal-ACS2, the Phal-ACS3 gene was expressed within 2 h after pollination in the ovary. Exogenous application of auxin, but not ACC, mimicked pollination by stimulating a rapid increase in ACC synthase activity in the stigma and ovary and inducing Phal-ACS2 and Phal-ACS3 mRNA accumulation in the stigma and ovary, respectively. These results provide the basis for an expanded model of interorgan regulation of three ACC synthase genes that respond to both primary (Phal-ACS2 and Phal-ACS3) and secondary (Phal-ACS1) pollination signals. PMID:9449850

  10. Three 1-aminocyclopropane-1-carboxylate synthase genes regulated by primary and secondary pollination signals in orchid flowers.

    PubMed

    Bui, A Q; O'Neill, S D

    1998-01-01

    The temporal and spatial expression patterns of three 1-aminocyclopropane-1-carboxylate (ACC) synthase genes were investigated in pollinated orchid (Phalaenopsis spp.) flowers. Pollination signals initiate a cascade of development events in multiple floral organs, including the induction of ethylene biosynthesis, which coordinates several postpollination developmental responses. The initiation and propagation of ethylene biosynthesis is regulated by the coordinated expression of three distinct ACC synthase genes in orchid flowers. One ACC synthase gene (Phal-ACS1) is regulated by ethylene and participates in amplification and interorgan transmission of the pollination signal, as we have previously described in a related orchid genus. Two additional ACC synthase genes (Phal-ACS2 and Phal-ACS3) are expressed primarily in the stigma and ovary of pollinated orchid flowers. Phal-ACS2 mRNA accumulated in the stigma within 1 h after pollination, whereas Phal-ACS1 mRNA was not detected until 6 h after pollination. Similar to the expression of Phal-ACS2, the Phal-ACS3 gene was expressed within 2 h after pollination in the ovary. Exogenous application of auxin, but not ACC, mimicked pollination by stimulating a rapid increase in ACC synthase activity in the stigma and ovary and inducing Phal-ACS2 and Phal-ACS3 mRNA accumulation in the stigma and ovary, respectively. These results provide the basis for an expanded model of interorgan regulation of three ACC synthase genes that respond to both primary (Phal-ACS2 and Phal-ACS3) and secondary (Phal-ACS1) pollination signals. PMID:9449850

  11. Cardiovascular roles of nitric oxide: A review of insights from nitric oxide synthase gene disrupted mice†

    PubMed Central

    Liu, Victor W.T.; Huang, Paul L.

    2009-01-01

    Nitric oxide (NO) is a gaseous molecule that plays many key roles in the cardiovascular system. Each of the enzymes that generate NO—neuronal, inducible and endothelial NO synthase—has been genetically disrupted in mice. This review discusses the cardiovascular phenotypes of each of the NO synthase (NOS) gene knockout mice, and the insights gained into the roles of NO in the cardiovascular system. Mice lacking the endothelial isoform are hypertensive, have endothelial dysfunction and show a more severe outcome in response to vascular injury, to stroke and cerebral ischaemia, and to diet-induced atherosclerosis. Mice lacking the neuronal isoform show a less severe outcome in response to stroke and cerebral ischaemia but have increased diet-induced atherosclerosis. Mice lacking the inducible isoform show reduced hypotension to septic shock. Together, NOS gene knockout mice have been useful tools that complement our other approaches to studying the multiple roles of NO in the cardiovascular system. PMID:17658499

  12. Point mutations in dihydrofolate reductase and dihydropteroate synthase genes of Plasmodium falciparum isolates from Venezuela.

    PubMed

    Urdaneta, L; Plowe, C; Goldman, I; Lal, A A

    1999-09-01

    The present study was designed to characterize mutations in dihydrofolate reductase (DHFR) and dihydropteroate synthase (DHPS) genes of Plasmodium falciparum in the Bolivar region of Venezuela, where high levels of clinical resistance to sulfadoxine-pyrimethamine (SP, Fansidar; F. Hoffman-La Roche, Basel, Switzerland) has been documented. We used a nested mutation-specific polymerase chain reaction and restriction digestion methods to measure 1) the prevalence of DHFR mutations at 16, 50, 51, 59, 108, and 164 codon positions, and 2) the prevalence of mutations in the 436, 437, 581, and 613 codon sites in DHPS gene. In the case of the DHFR gene, of the 54 parasite isolates analyzed, we detected the presence of Asn-108 and Ile-51 in 96% of the isolates and Arg-50 mutation in 64% of the isolates. Each of these mutations has been associated with high level of resistance to pyrimethamine. Only 2 samples (4%) showed the wild type Ser-108 mutation and none showed Thr-108 and Val-16 mutations that are specific for resistance to cycloguanil. In the case of DHPS gene, we found a mutation at position 437 (Gly) in 100% of the isolates and Gly-581 in 96% of the isolates. The simultaneous presence of mutations Asn-108 and Ile-51 in the DHFR gene and Gly-437 and Gly-581 in the DHPS gene in 96% of the samples tested suggested that a cumulative effect of mutations could be the major mechanism conferring high SP resistance in this area. PMID:10497990

  13. Two Origins for the Gene Encoding α-Isopropylmalate Synthase in Fungi

    PubMed Central

    Larson, Erica M.; Idnurm, Alexander

    2010-01-01

    Background The biosynthesis of leucine is a biochemical pathway common to prokaryotes, plants and fungi, but absent from humans and animals. The pathway is a proposed target for antimicrobial therapy. Methodology/Principal Findings Here we identified the leuA gene encoding α-isopropylmalate synthase in the zygomycete fungus Phycomyces blakesleeanus using a genetic mapping approach with crosses between wild type and leucine auxotrophic strains. To confirm the function of the gene, Phycomyces leuA was used to complement the auxotrophic phenotype exhibited by mutation of the leu3+ gene of the ascomycete fungus Schizosaccharomyces pombe. Phylogenetic analysis revealed that the leuA gene in Phycomyces, other zygomycetes, and the chytrids is more closely related to homologs in plants and photosynthetic bacteria than ascomycetes or basidiomycetes, and suggests that the Dikarya have acquired the gene more recently. Conclusions/Significance The identification of leuA in Phycomyces adds to the growing body of evidence that some primary metabolic pathways or parts of them have arisen multiple times during the evolution of fungi, probably through horizontal gene transfer events. PMID:20657649

  14. Induction of Malate Synthase Gene Expression in Senescent and Detached Organs of Cucumber.

    PubMed Central

    Graham, IA; Leaver, CJ; Smith, SM

    1992-01-01

    Expression of the malate synthase (MS) gene is activated in cotyledons of cucumber seedlings during postgerminative growth and then repressed as the cotyledons become photosynthetic. MS gene expression is subsequently reactivated in the cotyledons as they senesce a few weeks later. In situ hybridization revealed that MS RNA is distributed throughout the organ during postgerminative growth and senescence, showing that the same cells express the gene at different stages of development. MS RNA also appears in senescing leaves and petals of cucumber plants. In addition, we found that MS RNA appears in mature expanded leaves and roots when they are removed from the plant and incubated in darkness for several days, thus providing a potential experimental system for the manipulation of MS gene expression. Leaves from transgenic Nicotiana plumbaginifolia containing the cucumber MS promoter fused to the [beta]-glucuronidase (GUS) reporter gene accumulated GUS activity when detached, demonstrating an activation of transcription from the MS promoter following leaf excision. These results are discussed in terms of the metabolic regulation of MS gene expression. PMID:12297649

  15. Characterization of two chitin synthase genes of the red flour beetle, Tribolium castaneum, and alternate exon usage in one of the genes during development.

    PubMed

    Arakane, Yasuyuki; Hogenkamp, David G; Zhu, Yu Cheng; Kramer, Karl J; Specht, Charles A; Beeman, Richard W; Kanost, Michael R; Muthukrishnan, Subbaratnam

    2004-03-01

    Two chitin synthase (CHS) genes of the red flour beetle, Tribolium castaneum, were sequenced and their transcription patterns during development examined. By screening a BAC library of genomic DNA from T. castaneum (Tc) with a DNA probe encoding the catalytic domain of a putative Tribolium CHS, several clones that contained CHS genes were identified. Two distinct PCR products were amplified from these BAC clones and confirmed to be highly similar to CHS genes from other insects, nematodes and fungi. The DNA sequences of these genes, TcCHS1 and TcCHS2, were determined by amplification of overlapping PCR fragments from two of the BAC DNAs and mapped to different linkage groups. Each ORF was identified and full-length cDNAs were also amplified, cloned and sequenced. TcCHS1 and TcCHS2 encode transmembrane proteins of 1558 and 1464 amino acids, respectively. The TcCHS1 gene was found to use alternate exons, each encoding 59 amino acids, a feature not found in the TcCHS2 gene. During development, Tribolium expressed TcCHS1 predominantly in the embryonic and pupal stages, whereas TcCHS2 was prevalent in the late larval and adult stages. The alternate exon 8a of TcCHS1 was utilized over a much broader range of development than exon 8b. We propose that the two isoforms of the TcCHS1 enzyme are used predominantly for the formation of chitin in embryonic and pupal cuticles, whereas TcCHS2 is utilized primarily for the synthesis of peritrophic membrane-associated chitin in the midgut. PMID:14871625

  16. Molecular cloning and sequence analysis of the Plasmodium falciparum dihydrofolate reductase-thymidylate synthase gene.

    PubMed Central

    Bzik, D J; Li, W B; Horii, T; Inselburg, J

    1987-01-01

    Genomic DNA clones that coded for the bifunctional dihydrofolate reductase (DHFR) and thymidylate synthase (TS) (DHFR-TS) activities from a pyrimethamine-sensitive strain of Plasmodium falciparum were isolated and sequenced. The deduced DHFR-TS protein contained 608 amino acids (71,682 Da). The coding region for DHFR-TS contained no intervening sequences and had a high A + T content (75%). The DHFR domain, in the amino-terminal portion of the protein, was joined by a 94-amino acid junction sequence to the TS domain in the carboxyl-terminal portion of the protein. The TS domain was more conserved than the DHFR domain and both P. falciparum domains were more homologous to eukaryotic than to prokaryotic forms of the enzymes. Predicted secondary structures of the DHFR and TS domains were nearly identical to the structures identified in other DHFR and TS enzymes. PMID:2825189

  17. Molecular cloning and sequence analysis of the Plasmodium falciparum dihydrofolate reductase-thymidylate synthase gene.

    PubMed

    Bzik, D J; Li, W B; Horii, T; Inselburg, J

    1987-12-01

    Genomic DNA clones that coded for the bifunctional dihydrofolate reductase (DHFR) and thymidylate synthase (TS) (DHFR-TS) activities from a pyrimethamine-sensitive strain of Plasmodium falciparum were isolated and sequenced. The deduced DHFR-TS protein contained 608 amino acids (71,682 Da). The coding region for DHFR-TS contained no intervening sequences and had a high A + T content (75%). The DHFR domain, in the amino-terminal portion of the protein, was joined by a 94-amino acid junction sequence to the TS domain in the carboxyl-terminal portion of the protein. The TS domain was more conserved than the DHFR domain and both P. falciparum domains were more homologous to eukaryotic than to prokaryotic forms of the enzymes. Predicted secondary structures of the DHFR and TS domains were nearly identical to the structures identified in other DHFR and TS enzymes. PMID:2825189

  18. A functional cellulose synthase from ascidian epidermis

    PubMed Central

    Matthysse, Ann G.; Deschet, Karine; Williams, Melanie; Marry, Mazz; White, Alan R.; Smith, William C.

    2004-01-01

    Among animals, urochordates (e.g., ascidians) are unique in their ability to biosynthesize cellulose. In ascidians cellulose is synthesized in the epidermis and incorporated into a protective coat know as the tunic. A putative cellulose synthase-like gene was first identified in the genome sequences of the ascidian Ciona intestinalis. We describe here a cellulose synthase gene from the ascidian Ciona savignyi that is expressed in the epidermis. The predicted C. savignyi cellulose synthase amino acid sequence showed conserved features found in all cellulose synthases, including plants, but was most similar to cellulose synthases from bacteria, fungi, and Dictyostelium discoidium. However, unlike other known cellulose synthases, the predicted C. savignyi polypeptide has a degenerate cellulase-like region near the carboxyl-terminal end. An expression construct carrying the C. savignyi cDNA was found to restore cellulose biosynthesis to a cellulose synthase (CelA) minus mutant of Agrobacterium tumefaciens, showing that the predicted protein has cellulose synthase activity. The lack of cellulose biosynthesis in all other groups of metazoans and the similarity of the C. savignyi cellulose synthase to enzymes from cellulose-producing organisms support the hypothesis that the urochordates acquired the cellulose biosynthetic pathway by horizontal transfer. PMID:14722352

  19. UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6.

    PubMed

    Miyata, Maiko; Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko; Sugiura, Kazumitsu; Furukawa, Koichi; Furukawa, Keiko

    2014-03-01

    Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes. PMID:24548412

  20. Zaragozic acids D and D2: potent inhibitors of squalene synthase and of Ras farnesyl-protein transferase.

    PubMed

    Dufresne, C; Wilson, K E; Singh, S B; Zink, D L; Bergstrom, J D; Rew, D; Polishook, J D; Meinz, M; Huang, L; Silverman, K C

    1993-11-01

    Two new zaragozic acids, D and D2, have been isolated from the keratinophilic fungus Amauroascus niger. Zaragozic acids D [4] and D2 [5] are related to the previously described zaragozic acids A [1], B [2], and C [3] and are potent inhibitors of squalene synthase. Furthermore, all the zaragozic acids (A, B, C, D, and D2) are also active against farnesyl transferase. Zaragozic acids D and D2 inhibit farnesyl transferase with IC50 values of 100 nM, while zaragozic acids A and B are less potent. PMID:8289063

  1. ACTIVATION OF VASCULAR ENDOTHELIAL NITRIC OXIDE SYNTHASE AND HEME OXYGENASE-1 EXPRESSION BY ELECTROPHILIC NITRO-FATTY ACIDS

    PubMed Central

    Khoo, Nicholas K.H.; Rudolph, Volker; Cole, Marsha P.; Golin-Bisello, Franca; Schopfer, Francisco J.; Woodcock, Steven R.; Batthyany, Carlos; Freeman, Bruce A.

    2010-01-01

    Reactive oxygen species mediate a decrease in nitric oxide (NO) bioavailability and endothelial dysfunction, with secondary oxidized and nitrated byproducts of these reactions contributing to the pathogenesis of numerous vascular diseases. While oxidized lipids and lipoproteins exacerbate inflammatory reactions in the vasculature, in stark contrast the nitration of polyunsaturated fatty acids and complex lipids yield electrophilic products that exhibit pluripotent anti-inflammatory signaling capabilities acting via both cGMP-dependent and -independent mechanisms. Herein we report that nitro-oleic acid (OA-NO2) treatment increases expression of endothelial nitric oxide synthase (eNOS) and heme oxygenase 1 (HO-1) in the vasculature, thus transducing vascular protective effects associated with enhanced NO production. Administration of OA-NO2 via osmotic pump results in a significant increase in eNOS and HO-1 mRNA in mouse aortas. Moreover, HPLC-MS/MS analysis showed that NO2-FAs are rapidly metabolized in cultured endothelial cells (ECs) and treatment with NO2-FAs stimulated the phosphorylation of eNOS at Ser1179. These post-translational modifications of eNOS, in concert with elevated eNOS gene expression, contributed to an increase in endothelial NO production. In aggregate, OA-NO2-induced eNOS and HO-1 expression by vascular cells can induce beneficial effects on endothelial function and provide a new strategy for treating various vascular inflammatory and hypertensive disorders. PMID:19857569

  2. Common polymorphisms in nitric oxide synthase (NOS) genes influence quality of aging and longevity in humans.

    PubMed

    Montesanto, Alberto; Crocco, Paolina; Tallaro, Federica; Pisani, Francesca; Mazzei, Bruno; Mari, Vincenzo; Corsonello, Andrea; Lattanzio, Fabrizia; Passarino, Giuseppe; Rose, Giuseppina

    2013-04-01

    Nitric oxide (NO) triggers multiple signal transduction pathways and contributes to the control of numerous cellular functions. Previous studies have shown in model organisms that the alteration of NO production has important effects on aging and lifespan. We studied in a large sample (763 subjects, age range 19-107 years) the variability of the three human genes (NOS1, -2, -3) coding for the three isoforms of the NADPH-dependent enzymes named NO synthases (NOS) which are responsible of NO synthesis. We have then verified if the variability of these genes is associated with longevity, and with a number of geriatric parameters. We found that gene variation of NOS1 and NOS2 was associated with longevity. In addition NOS1 rs1879417 was also found to be associated with a lower cognitive performance, while NOS2 rs2297518 polymorphism showed to be associated with physical performance. Moreover, SNPs in the NOS1 and NOS3 genes were respectively associated with the presence of depression symptoms and disability, two of the main factors affecting quality of life in older individuals. On the whole, our study shows that genetic variability of NOS genes has an effect on common age related phenotypes and longevity in humans as well as previously reported for model organisms. PMID:23572278

  3. Chromosomal Organization and Sequence Diversity of Genes Encoding Lachrymatory Factor Synthase in Allium cepa L.

    PubMed

    Masamura, Noriya; McCallum, John; Khrustaleva, Ludmila; Kenel, Fernand; Pither-Joyce, Meegham; Shono, Jinji; Suzuki, Go; Mukai, Yasuhiko; Yamauchi, Naoki; Shigyo, Masayoshi

    2012-06-01

    Lachrymatory factor synthase (LFS) catalyzes the formation of lachrymatory factor, one of the most distinctive traits of bulb onion (Allium cepa L.). Therefore, we used LFS as a model for a functional gene in a huge genome, and we examined the chromosomal organization of LFS in A. cepa by multiple approaches. The first-level analysis completed the chromosomal assignment of LFS gene to chromosome 5 of A. cepa via the use of a complete set of A. fistulosum-shallot (A. cepa L. Aggregatum group) monosomic addition lines. Subsequent use of an F(2) mapping population from the interspecific cross A. cepa × A. roylei confirmed the assignment of an LFS locus to this chromosome. Sequence comparison of two BAC clones bearing LFS genes, LFS amplicons from diverse germplasm, and expressed sequences from a doubled haploid line revealed variation consistent with duplicated LFS genes. Furthermore, the BAC-FISH study using the two BAC clones as a probe showed that LFS genes are localized in the proximal region of the long arm of the chromosome. These results suggested that LFS in A. cepa is transcribed from at least two loci and that they are localized on chromosome 5. PMID:22690373

  4. Evaluating the Effect of Expressing a Peanut Resveratrol Synthase Gene in Rice.

    PubMed

    Zheng, Shigang; Zhao, Shanchang; Li, Zhen; Wang, Qingguo; Yao, Fangyin; Yang, Lianqun; Pan, Jiaowen; Liu, Wei

    2015-01-01

    Resveratrol (Res) is a type of natural plant stilbenes and phytoalexins that only exists in a few plant species. Studies have shown that the Res could be biosynthesized and accumulated within plants, once the complete metabolic pathway and related enzymes, such as the key enzyme resveratrol synthase (RS), existed. In this study, a RS gene named PNRS1 was cloned from the peanut, and the activity was confirmed in E. coli. Using transgenic approach, the PNRS1 transgenic rice was obtained. In T3 generation, the Res production and accumulation were further detected by HPLC. Our data revealed that compared to the wild type rice which trans-resveratrol was undetectable, in transgenic rice, the trans-resveratrol could be synthesized and achieved up to 0.697 μg/g FW in seedlings and 3.053 μg/g DW in seeds. Furthermore, the concentration of trans-resveratrol in transgenic rice seedlings could be induced up to eight or four-fold higher by ultraviolet (UV-C) or dark, respectively. Simultaneously, the endogenous increased of Res also showed the advantages in protecting the host plant from UV-C caused damage or dark-induced senescence. Our data indicated that Res was involved in host-defense responses against environmental stresses in transgenic rice. Here the results describes the processes of a peanut resveratrol synthase gene transformed into rice, and the detection of trans-resveratrol in transgenic rice, and the role of trans-resveratrol as a phytoalexin in transgenic rice when treated by UV-C and dark. These findings present new outcomes of transgenic approaches for functional genes and their corresponding physiological functions, and shed some light on broadening available resources of Res, nutritional improvement of crops, and new variety cultivation by genetic engineering. PMID:26302213

  5. Evaluating the Effect of Expressing a Peanut Resveratrol Synthase Gene in Rice

    PubMed Central

    Li, Zhen; Wang, Qingguo; Yao, Fangyin; Yang, Lianqun; Pan, Jiaowen; Liu, Wei

    2015-01-01

    Resveratrol (Res) is a type of natural plant stilbenes and phytoalexins that only exists in a few plant species. Studies have shown that the Res could be biosynthesized and accumulated within plants, once the complete metabolic pathway and related enzymes, such as the key enzyme resveratrol synthase (RS), existed. In this study, a RS gene named PNRS1 was cloned from the peanut, and the activity was confirmed in E. coli. Using transgenic approach, the PNRS1 transgenic rice was obtained. In T3 generation, the Res production and accumulation were further detected by HPLC. Our data revealed that compared to the wild type rice which trans-resveratrol was undetectable, in transgenic rice, the trans-resveratrol could be synthesized and achieved up to 0.697 μg/g FW in seedlings and 3.053 μg/g DW in seeds. Furthermore, the concentration of trans-resveratrol in transgenic rice seedlings could be induced up to eight or four-fold higher by ultraviolet (UV-C) or dark, respectively. Simultaneously, the endogenous increased of Res also showed the advantages in protecting the host plant from UV-C caused damage or dark-induced senescence. Our data indicated that Res was involved in host-defense responses against environmental stresses in transgenic rice. Here the results describes the processes of a peanut resveratrol synthase gene transformed into rice, and the detection of trans-resveratrol in transgenic rice, and the role of trans-resveratrol as a phytoalexin in transgenic rice when treated by UV-C and dark. These findings present new outcomes of transgenic approaches for functional genes and their corresponding physiological functions, and shed some light on broadening available resources of Res, nutritional improvement of crops, and new variety cultivation by genetic engineering. PMID:26302213

  6. Nicotianamine synthase overexpression positively modulates iron homeostasis-related genes in high iron rice

    PubMed Central

    Wang, Meng; Gruissem, Wilhelm; Bhullar, Navreet K.

    2013-01-01

    Nearly one-third of the world population, mostly women and children, suffer from iron malnutrition and its consequences, such as anemia or impaired mental development. Biofortification of rice, which is a staple crop for nearly half of the world's population, can significantly contribute in alleviating iron deficiency. NFP rice (transgenic rice expressing nicotianamine synthase, ferritin and phytase genes) has a more than six-fold increase in iron content in polished rice grains, resulting from the synergistic action of nicotianamine synthase (NAS) and ferritin transgenes. We investigated iron homeostasis in NFP plants by analyzing the expression of 28 endogenous rice genes known to be involved in the homeostasis of iron and other metals, in iron-deficient and iron-sufficient conditions. RNA was collected from different tissues (roots, flag leaves, grains) and at three developmental stages during grain filling. NFP plants showed increased sensitivity to iron-deficiency conditions and changes in the expression of endogenous genes involved in nicotianamine (NA) metabolism, in comparison to their non-transgenic siblings (NTS). Elevated transcript levels were detected in NFP plants for several iron transporters. In contrast, expression of OsYSL2, which encodes a member of yellow stripe like protein family, and a transporter of the NA-Fe(II) complex was reduced in NFP plants under low iron conditions, indicating that expression of OsYSL2 is regulated by the endogenous iron status. Expression of the transgenes did not significantly affect overall iron homeostasis in NFP plants, which establishes the engineered push-pull mechanism as a suitable strategy to increase rice endosperm iron content. PMID:23755054

  7. Associations between Nitric Oxide Synthase Genes and Exhaled NO-Related Phenotypes according to Asthma Status

    PubMed Central

    Bouzigon, Emmanuelle; Monier, Florent; Boussaha, Mekki; Le Moual, Nicole; Huyvaert, Hélène; Matran, Régis; Letort, Sébastien; Bousquet, Jean; Pin, Isabelle; Lathrop, Mark; Kauffmann, Francine; Demenais, Florence; Nadif, Rachel

    2012-01-01

    Background The nitric oxide (NO) pathway is involved in asthma, and eosinophils participate in the regulation of the NO pool in pulmonary tissues. We investigated associations between single nucleotide polymorphisms (SNPs) of NO synthase genes (NOS) and biological NO-related phenotypes measured in two compartments (exhaled breath condensate and plasma) and blood eosinophil counts. Methodology SNPs (N = 121) belonging to NOS1, NOS2 and NOS3 genes were genotyped in 1277 adults from the French Epidemiological study on the Genetics and Environment of Asthma (EGEA). Association analyses were conducted on four quantitative phenotypes: the exhaled fraction of NO (FeNO), plasma and exhaled breath condensate (EBC) nitrite-nitrate levels (NO2–NO3) and blood eosinophils in asthmatics and non-asthmatics separately. Genetic heterogeneity of these phenotypes between asthmatics and non-asthmatics was also investigated. Principal Findings In non-asthmatics, after correction for multiple comparisons, we found significant associations of FeNO levels with three SNPs in NOS3 and NOS2 (P≤0.002), and of EBC NO2–NO3 level with NOS2 (P = 0.002). In asthmatics, a single significant association was detected between FeNO levels and one SNP in NOS3 (P = 0.004). Moreover, there was significant heterogeneity of NOS3 SNP effect on FeNO between asthmatics and non-asthmatics (P = 0.0002 to 0.005). No significant association was found between any SNP and NO2–NO3 plasma levels or blood eosinophil counts. Conclusions Variants in NO synthase genes influence FeNO and EBC NO2–NO3 levels in adults. These genetic determinants differ according to asthma status. Significant associations were only detected for exhaled phenotypes, highlighting the critical relevance to have access to specific phenotypes measured in relevant biological fluid. PMID:22590587

  8. Analysis of human hyaluronan synthase gene transcriptional regulation and downstream hyaluronan cell surface receptor mobility in myofibroblast differentiation.

    PubMed

    Midgley, Adam C; Bowen, Timothy

    2015-01-01

    The ubiquitous extracellular glycosaminoglycan hyaluronan (HA) is a polymer composed of repeated disaccharide units of alternating D-glucuronic acid and D-N-acetylglucosamine residues linked via alternating β-1,4 and β-1,3 glycosidic bonds. Emerging data continue to reveal functions attributable to HA in a variety of physiological and pathological contexts. Defining the mechanisms regulating expression of the human hyaluronan synthase (HAS) genes that encode the corresponding HA-synthesizing HAS enzymes is therefore important in the context of HA biology in health and disease. We describe here methods to analyze transcriptional regulation of the HAS and HAS2-antisense RNA 1 genes. Elucidation of mechanisms of HA interaction with receptors such as the cell surface molecule CD44 is also key to understanding HA function. To this end, we provide protocols for fluorescent recovery after photobleaching analysis of CD44 membrane dynamics in the process of fibroblast to myofibroblast differentiation, a phenotypic transition that is common to the pathology of fibrosis of large organs such as the liver and kidney. PMID:25325984

  9. Enrichment of carotenoids in flaxseed (Linum usitatissimum) by metabolic engineering with introduction of bacterial phytoene synthase gene crtB.

    PubMed

    Fujisawa, Masaki; Watanabe, Mio; Choi, Song-Kang; Teramoto, Maki; Ohyama, Kanji; Misawa, Norihiko

    2008-06-01

    Linseed flax (Linum usitatissimum L.) is an industrially important oil crop, which includes large amounts of alpha-linolenic acid (18:3) and lignan in its seed oil. We report here the metabolic engineering of flax plants to increase carotenoid amount in seeds. Agrobacterium-mediated transformation of flax was performed to express the phytoene synthase gene (crtB) derived from the soil bacterium Pantoea ananatis (formerly called Erwinia uredovora 20D3) under the control of the cauliflower mosaic virus (CaMV) 35S constitutive promoter or the Arabidopsis thaliana fatty acid elongase 1 gene (FAE1) seed-specific promoter. As a result, eight transgenic flax plants were generated. They formed orange seeds (embryos), in which phytoene, alpha-carotene, and beta-carotene were newly accumulated in addition to increased amounts of lutein, while untransformed flax plants formed light-yellow seeds, in which only lutein was detected. Interestingly, despite the control of the CaMV 35S promoter, the expression of crtB was not observed in the leaves but in the seeds in the transgenic flax plants. Total carotenoid amounts in these seeds were 65.4-156.3 microg/g fresh weight, which corresponded to 7.8- to 18.6-fold increase, compared with those of untransformed controls. These results suggest that the flux of phytoene synthesis from geranylgeranyl diphosphate was first promoted by the expressed crtB gene product (CrtB), and then phytoene was consecutively decomposed to the downstream metabolites alpha-carotene, beta-carotene, and lutein, as catalyzed by endogenous carotenoid biosynthetic enzymes in seeds. The transgenic flaxseeds enriched with the carotenoids could be valuable as nutritional sources for human health. PMID:18640603

  10. Crystal structure of the thioesterase domain of human fatty acid synthase inhibited by orlistat

    SciTech Connect

    Pemble,C.; Johnson, L.; Kridel, S.; Lowther, W.

    2007-01-01

    Human fatty acid synthase (FAS) is uniquely expressed at high levels in many tumor types. Pharmacological inhibition of FAS therefore represents an important therapeutic opportunity. The drug Orlistat, which has been approved by the US Food and Drug Administration, inhibits FAS, induces tumor cell-specific apoptosis and inhibits the growth of prostate tumor xenografts. We determined the 2.3-{angstrom}-resolution crystal structure of the thioesterase domain of FAS inhibited by Orlistat. Orlistat was captured in the active sites of two thioesterase molecules as a stable acyl-enzyme intermediate and as the hydrolyzed product. The details of these interactions reveal the molecular basis for inhibition and suggest a mechanism for acyl-chain length discrimination during the FAS catalytic cycle. Our findings provide a foundation for the development of new cancer drugs that target FAS.

  11. CT2108A and B: New fatty acid synthase inhibitors as antifungal agents.

    PubMed

    Laakso, Jodi A; Raulli, Robert; McElhaney-Feser, Gail E; Actor, Paul; Underiner, Ted L; Hotovec, Brian J; Mocek, Ursula; Cihlar, Ronald L; Broedel, Sheldon E

    2003-08-01

    A systematic screen for new natural products that displayed antifungal activity by inhibition of fungal fatty acid synthase (FAS) led to the discovery of two new fungal metabolites, designated CT2108A (1) and CT2108B (2). The metabolites were produced by Penicillium solitum (Westling) strain CT2108 and were classified as azaphilones. The structures of these new metabolites were determined using a variety of 1D and 2D NMR experiments, including COSY, HMQC, and HMBC. The chemical conversion of CT2108A to CT2108B was effected using WCl(6). The related metabolite, patulodin (3), was also isolated from the fermentation culture of this P. solitum isolate. Both new compounds inhibited fungal FAS, and neither was found to significantly inhibit human FAS activity. PMID:12932120

  12. Screen for mitochondrial DNA copy number maintenance genes reveals essential role for ATP synthase

    PubMed Central

    Fukuoh, Atsushi; Cannino, Giuseppe; Gerards, Mike; Buckley, Suzanne; Kazancioglu, Selena; Scialo, Filippo; Lihavainen, Eero; Ribeiro, Andre; Dufour, Eric; Jacobs, Howard T

    2014-01-01

    The machinery of mitochondrial DNA (mtDNA) maintenance is only partially characterized and is of wide interest due to its involvement in disease. To identify novel components of this machinery, plus other cellular pathways required for mtDNA viability, we implemented a genome-wide RNAi screen in Drosophila S2 cells, assaying for loss of fluorescence of mtDNA nucleoids stained with the DNA-intercalating agent PicoGreen. In addition to previously characterized components of the mtDNA replication and transcription machineries, positives included many proteins of the cytosolic proteasome and ribosome (but not the mitoribosome), three proteins involved in vesicle transport, some other factors involved in mitochondrial biogenesis or nuclear gene expression, > 30 mainly uncharacterized proteins and most subunits of ATP synthase (but no other OXPHOS complex). ATP synthase knockdown precipitated a burst of mitochondrial ROS production, followed by copy number depletion involving increased mitochondrial turnover, not dependent on the canonical autophagy machinery. Our findings will inform future studies of the apparatus and regulation of mtDNA maintenance, and the role of mitochondrial bioenergetics and signaling in modulating mtDNA copy number. PMID:24952591

  13. The diversity of polyketide synthase genes from sugarcane-derived fungi.

    PubMed

    Rojas, Juan Diego; Sette, Lara Durães; de Araujo, Welington L; Lopes, Mateus Schreiner Garcez; da Silva, Luiziana Ferreira; Furlan, Renata L A; Padilla, Gabriel

    2012-04-01

    The chemical ecology and biotechnological potential of metabolites from endophytic and rhizosphere fungi are receiving much attention. A collection of 17 sugarcane-derived fungi were identified and assessed by PCR for the presence of polyketide synthase (PKS) genes. The fungi were all various genera of ascomycetes, the genomes of which encoded 36 putative PKS sequences, 26 shared sequence homology with β-ketoacyl synthase domains, while 10 sequences showed homology to known fungal C-methyltransferase domains. A neighbour-joining phylogenetic analysis of the translated sequences could group the domains into previously established chemistry-based clades that represented non-reducing, partially reducing and highly reducing fungal PKSs. We observed that, in many cases, the membership of each clade also reflected the taxonomy of the fungal isolates. The functional assignment of the domains was further confirmed by in silico secondary and tertiary protein structure predictions. This genome mining study reveals, for the first time, the genetic potential of specific taxonomic groups of sugarcane-derived fungi to produce specific types of polyketides. Future work will focus on isolating these compounds with a view to understanding their chemical ecology and likely biotechnological potential. PMID:21938508

  14. Functional Analysis of a Predicted Flavonol Synthase Gene Family in Arabidopsis1[W][OA

    PubMed Central

    Owens, Daniel K.; Alerding, Anne B.; Crosby, Kevin C.; Bandara, Aloka B.; Westwood, James H.; Winkel, Brenda S.J.

    2008-01-01

    The genome of Arabidopsis (Arabidopsis thaliana) contains five sequences with high similarity to FLAVONOL SYNTHASE1 (AtFLS1), a previously characterized flavonol synthase gene that plays a central role in flavonoid metabolism. This apparent redundancy suggests the possibility that Arabidopsis uses multiple isoforms of FLS with different substrate specificities to mediate the production of the flavonols, quercetin and kaempferol, in a tissue-specific and inducible manner. However, biochemical and genetic analysis of the six AtFLS sequences indicates that, although several of the members are expressed, only AtFLS1 encodes a catalytically competent protein. AtFLS1 also appears to be the only member of this group that influences flavonoid levels and the root gravitropic response in seedlings under nonstressed conditions. This study showed that the other expressed AtFLS sequences have tissue- and cell type-specific promoter activities that overlap with those of AtFLS1 and encode proteins that interact with other flavonoid enzymes in yeast two-hybrid assays. Thus, it is possible that these “pseudogenes” have alternative, noncatalytic functions that have not yet been uncovered. PMID:18467451

  15. Molecular cloning of the human leukotriene C4 synthase gene and assignment to chromosome 5q35.

    PubMed Central

    Bigby, T. D.; Hodulik, C. R.; Arden, K. C.; Fu, L.

    1996-01-01

    BACKGROUND: Cysteinyl leukotrienes (LT) are mediators involved in inflammatory and allergic disorders LTC4 synthase catalyzes the first committed step in the synthesis of these inflammatory mediators, and its cellular distribution appears to be unique. MATERIALS AND METHODS: A human genomic library was screened by polymerase chain reaction (PCR) with primers that were designed based on the reported cDNA sequence for the LTC4 synthase gene. The gene was identified in one clone by Southern blotting of restriction enzyme digests, subcloning of fragments containing regions of interest, and DNA sequencing of these subclones. The transcription initiation site was determined by primer extension analysis. Chromosome location was determined by fluorescent in situ hybridization and screening of somatic cell hybrids by PCR. RESULTS: The LTC4 synthase gene is approximately 2.5 kb in length, consisting of five exons (136, 100, 71, 82, and 257 bp, respectively) and four introns (1,447, 102, 84, and 230 bp, respectively). Transcription initiation occurs at a single site 78 bp upstream of the coding region. The 5'-flanking region contains neither a TATA nor a CAAT box. The first 1 kb of the 5'-flanking region, however, contains putative DNA binding motifs for SP-1, AP-1, AP-2, ets factors, and CREB/ATF. A STAT binding motif is present in the first intron. The LTC4 synthase gene is located in the distal region of the long arm of chromosome 5 in 5q35. CONCLUSIONS: The LTC4 synthase gene does not contain elements of a typical regulated gene and may therefore contain novel regulatory elements. This gene is also located in a region on chromosome 5 that appears to play a role in allergic and inflammatory disorders, such as asthma. Images FIG. 1 FIG. 5 FIG. 4 FIG. 6 PMID:8898379

  16. Cloning and characterization of a flavonol synthase gene from Scutellaria baicalensis.

    PubMed

    Kim, Yeon Bok; Kim, KwangSoo; Kim, Yeji; Tuan, Pham Anh; Kim, Haeng Hoon; Cho, Jin Woong; Park, Sang Un

    2014-01-01

    Flavonols are the most abundant of all the flavonoids and play pivotal roles in a variety of plants. We isolated a cDNA clone encoding flavonol synthase from Scutellaria baicalensis (SbFLS). The SbFLS cDNA is 1011 bp long, encodes 336 amino acid residues, and belongs to a family of 2-oxoglutarate-dependent dioxygenases. The overall structure of SbFLS is very similar to that of Arabidopsis thaliana anthocyanidin synthase (AtANS), with a β jelly-roll fold surrounded by tens of short and long α-helices. SbFLS was constitutively expressed in the roots, stems, leaves, and flowers, with particularly high expression in the roots and flowers. SbFLS transcript levels in the roots were 376-, 70-, and 2.5-fold higher than in the leaves, stems, and flowers. The myricetin content was significantly higher than that of kaempferol and quercetin. Therefore, we suggest that SbFLS mediates flavonol formation in the different organs of S. baicalensis. Our study may contribute to the knowledge of the role of FLS in S. baicalensis. PMID:24672406

  17. Characterization of the lysyl adducts of prostaglandin H-synthases that are derived from oxygenation of arachidonic acid.

    PubMed

    Boutaud, O; Brame, C J; Chaurand, P; Li, J; Rowlinson, S W; Crews, B C; Ji, C; Marnett, L J; Caprioli, R M; Roberts, L J; Oates, J A

    2001-06-12

    These investigations characterize the covalent binding of reactive products of prostaglandin H-synthases (PGHSs) to the enzyme and to other molecules. The intermediate product of oxygenation of arachidonic acid by the PGHSs, prostaglandin (PG) H2, undergoes rearrangement to the highly reactive gamma-keto aldehydes, levuglandin (LG) E2 and D2. We previously have demonstrated that LGE2 reacts with the epsilon-amine of lysine to form both the lysyl-levuglandin Shiff base and the pyrrole-derived lysyl-levuglandin lactam adducts. We now demonstrate that these lysyl-levuglandin adducts are formed on the PGHSs following the oxygenation of arachidonic acid; after reduction of the putative Schiff base, proteolytic digestion of the enzyme, and isolation of the adducted amino acid residues, these adducts were identified by liquid chromatography-tandem mass spectrometry. The reactivity of the LGs is reflected by the finding that virtually all of the LG predicted to be formed from PGH2 can be accounted for as adducts of the PGH-synthase and that oxygenation of arachidonic acid by PGH-synthases also leads to the formation of adducts of other proteins present in the reaction solution. The reactivity of the PGH-synthase adducts themselves is demonstrated by the formation of intermolecular cross-links. PMID:11389610

  18. Low-temperature Storage of Cucumbers Induces Changes in the Organic Acid Content and in Citrate Synthase Activity

    Technology Transfer Automated Retrieval System (TEKTRAN)

    To elucidate the cause of reported pyruvate accumulation in chilled stored cucumbers (Cucumis sativus L.) cv. ‘Toppugurin’, we have examined differences in the extent of incorporation of acetate-1,2-14C into the tricarboxylic acid (TCA) cycle and the specific activity of the enzyme citrate synthase ...

  19. Studies on acetyl-CoA carboxylase and fatty acid synthase from rat mammary gland and mammary tumours.

    PubMed Central

    Ahmad, P M; Feltman, D S; Ahmad, F

    1982-01-01

    The activities of two lipogenic enzymes, acetyl-CoA carboxylase and fatty acid synthase, were determined in two transplantable mammary adenocarcinomas (13762 and R3230AC) carried by non-pregnant, pregnant and lactating rats, and in mammary tissue of control animals (non-tumour-carrying) of comparable physiological states. During mammary-gland differentiation of control or tumour-carrying animals, the activities of acetyl-CoA carboxylase and fatty acid synthase in the lactating gland increased by about 40--50-fold over the values found in non-pregnant animals. On the other hand, in tumours carried by lactating dams there were only modest increases (1.5--2-fold) in acetyl-CoA carboxylase and fatty acid synthase compared with the neoplasms carried by non-pregnant animals. On the basis of the Km values for different substrates and immunodiffusion and immunotitration data, the fatty acid synthase of neoplastic tissues appeared to be indistinguishable from the control mammary-gland enzyme. However, a comparison of the immunotitration and immunodiffusion experiments indicated that the mammary-gland acetyl-CoA carboxylase might differ from the enzyme present in mammary neoplasms. Images Fig. 1. Fig. 2. PMID:6130760

  20. Dietary Soy Protein Inhibits DNA Damage and Cell Survival of Colon Epithelial Cells through Attenuated Expression of Fatty Acid Synthase

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Dietary intake of soy protein decreases tumor incidence in rat models of chemically induced colon cancer. We hypothesized that decreased expression of Fatty Acid Synthase (FASN) underlies, in part, the tumor preventive effects of soy protein, since FASN over-expression characterizes early tumorigene...

  1. Differential Expression of Biphenyl Synthase Gene Family Members in Fire-Blight-Infected Apple ‘Holsteiner Cox’ 1[W][OA

    PubMed Central

    Chizzali, Cornelia; Gaid, Mariam M.; Belkheir, Asma K.; Hänsch, Robert; Richter, Klaus; Flachowsky, Henryk; Peil, Andreas; Hanke, Magda-Viola; Liu, Benye; Beerhues, Ludger

    2012-01-01

    Fire blight, caused by the bacterium Erwinia amylovora, is a devastating disease of apple (Malus × domestica). The phytoalexins of apple are biphenyls and dibenzofurans, whose carbon skeleton is formed by biphenyl synthase (BIS), a type III polyketide synthase. In the recently published genome sequence of apple ‘Golden Delicious’, nine BIS genes and four BIS gene fragments were detected. The nine genes fall into four subfamilies, referred to as MdBIS1 to MdBIS4. In a phylogenetic tree, the BIS amino acid sequences from apple and Sorbus aucuparia formed an individual cluster within the clade of the functionally diverse type III polyketide synthases. cDNAs encoding MdBIS1 to MdBIS4 were cloned from fire-blight-infected shoots of apple ‘Holsteiner Cox,’ heterologously expressed in Escherichia coli, and functionally analyzed. Benzoyl-coenzyme A and salicoyl-coenzyme A were the preferred starter substrates. In response to inoculation with E. amylovora, the BIS3 gene was expressed in stems of cv Holsteiner Cox, with highest transcript levels in the transition zone between necrotic and healthy tissues. The transition zone was the accumulation site of biphenyl and dibenzofuran phytoalexins. Leaves contained transcripts for BIS2 but failed to form immunodetectable amounts of BIS protein. In cell cultures of apple ‘Cox Orange,’ expression of the BIS1 to BIS3 genes was observed after the addition of an autoclaved E. amylovora suspension. Using immunofluorescence localization under a confocal laser-scanning microscope, the BIS3 protein in the transition zone of stems was detected in the parenchyma of the bark. Dot-shaped immunofluorescence was confined to the junctions between neighboring cortical parenchyma cells. PMID:22158676

  2. Lysophosphatidic acid induces vasodilation mediated by LPA1 receptors, phospholipase C, and endothelial nitric oxide synthase

    PubMed Central

    Ruisanchez, Éva; Dancs, Péter; Kerék, Margit; Németh, Tamás; Faragó, Bernadett; Balogh, Andrea; Patil, Renukadevi; Jennings, Brett L.; Liliom, Károly; Malik, Kafait U.; Smrcka, Alan V.; Tigyi, Gabor; Benyó, Zoltán

    2014-01-01

    Lysophosphatidic acid (LPA) has been implicated as a mediator of several cardiovascular functions, but its potential involvement in the control of vascular tone is obscure. Here, we show that both LPA (18:1) and VPC31143 (a synthetic agonist of LPA1–3 receptors) relax intact mouse thoracic aorta with similar Emax values (53.9 and 51.9% of phenylephrine-induced precontraction), although the EC50 of LPA- and VPC31143-induced vasorelaxations were different (400 vs. 15 nM, respectively). Mechanical removal of the endothelium or genetic deletion of endothelial nitric oxide synthase (eNOS) not only diminished vasorelaxation by LPA or VPC31143 but converted it to vasoconstriction. Freshly isolated mouse aortic endothelial cells expressed LPA1, LPA2, LPA4 and LPA5 transcripts. The LPA1,3 antagonist Ki16425, the LPA1 antagonist AM095, and the genetic deletion of LPA1, but not that of LPA2, abolished LPA-induced vasorelaxation. Inhibition of the phosphoinositide 3 kinase–protein kinase B/Akt pathway by wortmannin or MK-2206 failed to influence the effect of LPA. However, pharmacological inhibition of phospholipase C (PLC) by U73122 or edelfosine, but not genetic deletion of PLCε, abolished LPA-induced vasorelaxation and indicated that a PLC enzyme, other than PLCε, mediates the response. In summary, the present study identifies LPA as an endothelium-dependent vasodilator substance acting via LPA1, PLC, and eNOS.—Ruisanchez, É., Dancs, P., Kerék, M., Németh, T., Faragó, B., Balogh, A., Patil, R., Jennings, B. L., Liliom, K., Malik, K. U., Smrcka, A. V., Tigyi, G., Benyó, Z. Lysophosphatidic acid induces vasodilation mediated by LPA1 receptors, phospholipase C, and endothelial nitric oxide synthase. PMID:24249637

  3. Potential impact of a single nucleotide polymorphism in the hyaluronan synthase 1 gene in Waldenstrom's macroglobulinemia.

    PubMed

    Adamia, Sophia; Treon, Steven P; Reiman, Tony; Tournilhac, Olivier; McQuarrie, Carrie; Mant, Michael J; Belch, Andrew R; Pilarski, Linda M

    2005-03-01

    The hyaluronan synthase 1 (HAS1) gene encodes a plasma membrane protein that synthesizes hyaluronan, an extracellular matrix molecule. Previously, in patients with Waldenstrom's macroglobulinemia (WM), we detected upregulation of HAS1 transcripts and identified aberrant splice variants of this gene. Aberrant splicing of HAS1 results from activation of cryptic splice sites. In turn, activation of cryptic donor and acceptor splice sites can be promoted by mutations occurring upstream of these sites and/or at the branch point of slicing. We measured the frequency of the HAS1 833A/G polymorphism (ie, single-nucleotide polymorphism; SNP) in patients with WM and healthy donors. Additionally, HAS1 gene expression was evaluated in the same group of patients. Our observations so far suggest that HAS1 833A/G SNPs contribute to aberrant splicing of this gene; this idea is supported by the fact that 833A/G SNP is located on an exonic splicing enhancer motif. Based on the results obtained thus far, we speculate that individuals with HAS1 833G/G genotype are predisposed toward aberrant HAS1 splicing and expression of HAS1 variants, resulting in an enhanced risk of developing WM. Study of a larger group of patients and healthy donors is needed to confirm these speculations and to evaluate the prognostic significance of these findings. PMID:15794859

  4. Endothelial nitric oxide synthase gene transfer enhances dilation of newborn piglet pulmonary arteries.

    PubMed

    Aschner, J L; Kovacs, N; Perciaccante, J V; Figueroa, J P; Thrikawala, N; Robins, G S; Busija, D W

    1999-07-01

    We determined the expression and functional correlate of in vitro transfection with a recombinant adenoviral vector encoding the gene for bovine endothelial nitric oxide synthase (AdCMVeNOS) or Escherichia coli beta-galactosidase (AdCMVLacZ) in pulmonary endothelial cells (EC), vascular smooth muscle cells (VSMC), and pulmonary arteries (PA) from newborn piglets. AdCMVeNOS and AdCMVeLacZ vectors, grown in 293-cell monolayers, were purified by double-cesium gradient ultracentrifugation. Cell cultures and PA were incubated with increasing vector titers for 30 or 60 min, followed by incubation in fresh medium for 18 h at 37 degrees C. LacZ expression was assessed by histochemical staining; eNOS expression was evaluated by Western blot analysis. Functional eNOS expression was determined by measurement of cGMP and quantification of the relaxation response to bradykinin (BK). In PA, LacZ transgene expression was preferentially localized to the adventitia and endothelium. Increased eNOS protein expression was observed in EC and VSMC transfected with AdCMVeNOS. Functional studies revealed increased cGMP abundance in cultured cells and enhanced relaxation to BK in AdCMVeNOS-transfected PA. These studies demonstrate that gene transfer with AdCMVeNOS results in functional expression and altered vasoactive responses in the neonatal pulmonary vasculature. Gene transfer with replication-deficient adenovirus vectors is a useful tool for the study of targeted genes in vascular biology. PMID:10409217

  5. Isolation and expression of two polyketide synthase genes from Trichoderma harzianum 88 during mycoparasitism.

    PubMed

    Yao, Lin; Tan, Chong; Song, Jinzhu; Yang, Qian; Yu, Lijie; Li, Xinling

    2016-01-01

    Metabolites of mycoparasitic fungal species such as Trichoderma harzianum 88 have important biological roles. In this study, two new ketoacyl synthase (KS) fragments were isolated from cultured Trichoderma harzianum 88 mycelia using degenerate primers and analysed using a phylogenetic tree. The gene fragments were determined to be present as single copies in Trichoderma harzianum 88 through southern blot analysis using digoxigenin-labelled KS gene fragments as probes. The complete sequence analysis in formation of pksT-1 (5669bp) and pksT-2 (7901bp) suggests that pksT-1 exhibited features of a non-reducing type I fungal PKS, whereas pksT-2 exhibited features of a highly reducing type I fungal PKS. Reverse transcription polymerase chain reaction indicated that the isolated genes are differentially regulated in Trichoderma harzianum 88 during challenge with three fungal plant pathogens, which suggests that they participate in the response of Trichoderma harzianum 88 to fungal plant pathogens. Furthermore, disruption of the pksT-2 encoding ketosynthase-acyltransferase domains through Agrobacterium-mediated gene transformation indicated that pksT-2 is a key factor for conidial pigmentation in Trichoderma harzianum 88. PMID:26991299

  6. Chalcone synthase as a reporter in virus-induced gene silencing studies of flower senescence.

    PubMed

    Chen, Jen-Chih; Jiang, Cai-Zhong; Gookin, Timothy E; Hunter, Donald A; Clark, David G; Reid, Michael S

    2004-07-01

    Agrobacterium-mediated infection of petunia (Petunia hybrida) plants with tobacco rattle virus (TRV) bearing fragments of Petunia genes resulted in systemic infection and virus-induced gene silencing (VIGS) of the homologous host genes. Infection with TRV containing a phytoene desaturase (PDS) fragment resulted in reduced abundance of PDS transcripts and typical photobleaching of photosynthetic tissues. Infection with TRV containing a chalcone synthase (CHS) fragment resulted in silencing of anthocyanin production in infected flowers. The silencing phenotype ranged from scattered white spots on the normal purple background to entirely white flowers. Symptoms in the V26 cultivar were a diffuse mosaic, but infection of some purple-flowered commercial cultivars resulted in large white sectors and even entirely white flowers. Abundance of CHS transcripts in the white flowers was less than 4% of that in purple flowers on the same plant. Infection with TRV containing a tandem construct of PDS and CHS resulted in leaf photobleaching and white patterns on the flowers. Transcripts of CHS and PDS were reduced both in leaves and in flowers confirming simultaneous silencing of both genes by the tandem construct. We tested the effects of infection with TRV containing CHS and a fragment of a petunia gene encoding for 1-aminocyclopropane-1-carboxylate oxidase (ACO4) Abundance of transcripts encoding ACO4 and ACO1 were reduced (by 5% and 20%, respectively) in infected flowers. Whether the flowers were treated with ACC or pollinated, the white (silenced) flowers or flower sectors produced less ethylene and senesced later than purple (non-silenced) tissues. These results indicate the value of VIGS with tandem constructs containing CHS as reporter and a target gene as a tool for examining the function of floral-associated genes. PMID:15604697

  7. Crystal Structure and Substrate Specificity of Human Thioesterase 2: INSIGHTS INTO THE MOLECULAR BASIS FOR THE MODULATION OF FATTY ACID SYNTHASE.

    PubMed

    Ritchie, Melissa K; Johnson, Lynnette C; Clodfelter, Jill E; Pemble, Charles W; Fulp, Brian E; Furdui, Cristina M; Kridel, Steven J; Lowther, W Todd

    2016-02-12

    The type I fatty acid synthase (FASN) is responsible for the de novo synthesis of palmitate. Chain length selection and release is performed by the C-terminal thioesterase domain (TE1). FASN expression is up-regulated in cancer, and its activity levels are controlled by gene dosage and transcriptional and post-translational mechanisms. In addition, the chain length of fatty acids produced by FASN is controlled by a type II thioesterase called TE2 (E.C. 3.1.2.14). TE2 has been implicated in breast cancer and generates a broad lipid distribution within milk. The molecular basis for the ability of the TE2 to compete with TE1 for the acyl chain attached to the acyl carrier protein (ACP) domain of FASN is unknown. Herein, we show that human TE1 efficiently hydrolyzes acyl-CoA substrate mimetics. In contrast, TE2 prefers an engineered human acyl-ACP substrate and readily releases short chain fatty acids from full-length FASN during turnover. The 2.8 Å crystal structure of TE2 reveals a novel capping domain insert within the α/β hydrolase core. This domain is reminiscent of capping domains of type II thioesterases involved in polyketide synthesis. The structure also reveals that the capping domain had collapsed onto the active site containing the Ser-101-His-237-Asp-212 catalytic triad. This observation suggests that the capping domain opens to enable the ACP domain to dock and to place the acyl chain and 4'-phosphopantetheinyl-linker arm correctly for catalysis. Thus, the ability of TE2 to prematurely release fatty acids from FASN parallels the role of editing thioesterases involved in polyketide and non-ribosomal peptide synthase synthases. PMID:26663084

  8. Decarboxylation of malonyl-(acyl carrier protein) by 3-oxoacyl-(acyl carrier protein) synthases in plant fatty acid biosynthesis.

    PubMed Central

    Winter, E; Brummel, M; Schuch, R; Spener, F

    1997-01-01

    In order to identify regulatory steps in fatty acid biosynthesis, the influence of intermediate 3-oxoacyl-(acyl carrier proteins) (3-oxoacyl-ACPs) and end-product acyl-ACPs of the fatty acid synthase reaction on the condensation reaction was investigated in vitro, using total fatty acid synthase preparations and purified 3-oxoacyl-ACP synthases (KASs; EC 2.3.1.41) from Cuphea lanceolata seeds. KAS I and II in the fatty acid synthase preparations were assayed for the elongation of octanoyl- and hexadecanoyl-ACP respectively, and the accumulation of the corresponding condensation product 3-oxoacyl-ACP was studied by modulating the content of the reducing equivalentS NADH and NADPH. Complete omission of reducing equivalents resulted with either KAS in the abnormal synthesis of acetyl-ACP from malonyl-ACP by a decarboxylation reaction. Supplementation with NADPH or NADH, separately or in combination with recombinant 3-oxoacyl-ACP reductase (EC 1.1.1.100), led to a decrease in the amount of acetyl-ACP and a simultaneous increase in elongation products. This demonstrates that the accumulation of 3-oxoacyl-ACP inhibits the condensation reaction on the one hand, and induces the decarboxylation of malonyl-ACP on the other. By carrying out similar experiments with purified enzymes, this decarboxylation was attributed to the action of KAS. Our data point to a regulatory mechanism for the degradation of malonyl-ACP in plants which is activated by the accumulation of the fatty acid synthase intermediate 3-oxoacyl-ACP. PMID:9020860

  9. Mice with heterozygous deficiency of lipoic acid synthase have an increased sensitivity to lipopolysaccharide-induced tissue injury

    PubMed Central

    Yi, Xianwen; Kim, Kuikwon; Yuan, Weiping; Xu, Longquan; Kim, Hyung-Suk; Homeister, Jonathon W.; Key, Nigel S.; Maeda, Nobuyo

    2009-01-01

    α-Lipoic acid (1, 2-dithiolane-3-pentanoic acid; LA), synthesized in mitochondria by LA synthase (Lias), is a potent antioxidant and a cofactor for metabolic enzyme complexes. In this study, we examined the effect of genetic reduction of LA synthesis on its antioxidant and anti-inflammatory properties using a model of LPS-induced inflammation in Lias+/– mice. The increase of plasma proinflammatory cytokine, TNF-α, and NF-κB at an early phase following LPS injection was greater in Lias+/– mice compared with Lias+/+ mice. The circulating blood white blood cell (WBC) and platelet counts dropped continuously during the initial 4 h. The counts subsequently recovered partially in Lias+/+ mice, but the recovery was impaired totally in Lias+/– mice. Administration of exogenous LA normalized the recovery of WBC counts in Lias+/– mice but not platelets. Enhanced neutrophil sequestration in the livers of Lias+/– mice was associated with increased hepatocyte injury and increased gene expression of growth-related oncogene, E-selectin, and VCAM-1 in the liver and/or lung. Lias gene expression in tissues was 50% of normal expression in Lias+/– mice and reduced further by LPS treatment. Decreased Lias expression was associated with diminished hepatic LA and tissue oxidative stress. Finally, Lias+/– mice displayed enhanced mortality when exposed to LPS-induced sepsis. These data demonstrate the importance of endogenously produced LA for preventing leukocyte accumulation and tissue injury that result from LPS-induced inflammation. PMID:18845616

  10. Structure of Quinolinate Synthase from Pyrococcus horikoshii in the Presence of Its Product, Quinolinic Acid.

    PubMed

    Esakova, Olga A; Silakov, Alexey; Grove, Tyler L; Saunders, Allison H; McLaughlin, Martin I; Yennawar, Neela H; Booker, Squire J

    2016-06-15

    Quinolinic acid (QA) is a common intermediate in the biosynthesis of nicotinamide adenine dinucleotide (NAD(+)) and its derivatives in all organisms that synthesize the molecule de novo. In most prokaryotes, it is formed from the condensation of dihydroxyacetone phosphate (DHAP) and aspartate-enamine by the action of quinolinate synthase (NadA). NadA contains a [4Fe-4S] cluster cofactor with a unique, non-cysteinyl-ligated, iron ion (Fea), which is proposed to bind the hydroxyl group of a postulated intermediate in the last step of the reaction to facilitate a dehydration. However, direct evidence for this role in catalysis has yet to be provided. Herein, we present the structure of NadA in the presence of the product of its reaction, QA. We find that N1 and the C7 carboxylate group of QA ligate to Fea in a bidentate fashion, which is confirmed by Hyperfine Sublevel Correlation (HYSCORE) spectroscopy. This binding mode would place the C5 hydroxyl group of the postulated final intermediate distal to Fea and virtually incapable of coordinating to it. The structure shows that three strictly conserved amino acids, Glu198, Tyr109, and Tyr23, are in close proximity to the bound product. Substitution of these amino acids with Gln, Phe, and Phe, respectively, leads to complete loss of activity. PMID:27224840

  11. Δ(9)-Tetrahydrocannabinolic acid synthase production in Pichia pastoris enables chemical synthesis of cannabinoids.

    PubMed

    Lange, Kerstin; Schmid, Andreas; Julsing, Mattijs K

    2015-10-10

    Δ(9)-Tetrahydrocannabinol (THC) is of increasing interest as a pharmaceutical and bioactive compound. Chemical synthesis of THC uses a laborious procedure and does not satisfy the market demand. The implementation of biocatalysts for specific synthesis steps might be beneficial for making natural product availability independent from the plant. Δ(9)-Tetrahydrocannabinolic acid synthase (THCAS) from C. sativa L. catalyzes the cyclization of cannabigerolic acid (CBGA) to Δ(9)-tetrahydrocannabinolic acid (THCA), which is non-enzymatically decarboxylated to THC. We report the preparation of THCAS in amounts sufficient for the biocatalytic production of THC(A). Active THCAS was most efficiently obtained from Pichia pastoris. THCAS was produced on a 2L bioreactor scale and the enzyme was isolated by single-step chromatography with a specific activity of 73Ug(-1)total protein. An organic/aqueous two-liquid phase setup for continuous substrate delivery facilitated in situ product removal. In addition, THCAS activity in aqueous environments lasted for only 20min whereas the presence of hexane stabilized the activity over 3h. In conclusion, production of THCAS in P. pastoris Mut(S) KM71 KE1, subsequent isolation, and its application in a two-liquid phase setup enables the synthesis of THCA on a mg scale. PMID:26197418

  12. Using modern tools to probe the structure-function relationship of fatty acid synthases

    PubMed Central

    Burkart, Michael D.

    2015-01-01

    Fatty acid biosynthesis is essential to life and represents one of the most conserved pathways in Nature, preserving the same handful of chemical reactions over all species. Recent interest in the molecular details of the de novo fatty acid synthase (FAS) has been heightened by demand for renewable fuels and the emergence of multidrug resistant bacterial strains. Central to FAS is the acyl carrier protein (ACP), a protein chaperone that shuttles the growing acyl chain between catalytic enzymes within the FAS. Human efforts to alter fatty acid biosynthesis for oil production, chemical feedstock or antimicrobial purposes has been met with limited success in part due to a lack of detailed molecular information behind the ACP-partner protein interactions inherent to the pathway. This review will focus on recently developed tools for the modification of ACP and analysis of protein-protein interactions, such as mechanism-based crosslinking, and the studies exploiting them. Discussion specific to each enzymatic domain focuses first on mechanism and known inhibitors, followed by available structures and known interactions with ACP. While significant unknowns remain, new understandings into the intricacies of FAS point to future advances in manipulating this complex molecular factory. PMID:25676190

  13. Inhibition of Fatty Acid Synthase Decreases Expression of Stemness Markers in Glioma Stem Cells

    PubMed Central

    Yasumoto, Yuki; Miyazaki, Hirofumi; Vaidyan, Linda Koshy; Kagawa, Yoshiteru; Ebrahimi, Majid; Yamamoto, Yui; Ogata, Masaki; Katsuyama, Yu; Sadahiro, Hirokazu; Suzuki, Michiyasu; Owada, Yuji

    2016-01-01

    Cellular metabolic changes, especially to lipid metabolism, have recently been recognized as a hallmark of various cancer cells. However, little is known about the significance of cellular lipid metabolism in the regulation of biological activity of glioma stem cells (GSCs). In this study, we examined the expression and role of fatty acid synthase (FASN), a key lipogenic enzyme, in GSCs. In the de novo lipid synthesis assay, GSCs exhibited higher lipogenesis than differentiated non-GSCs. Western blot and immunocytochemical analyses revealed that FASN is strongly expressed in multiple lines of patient-derived GSCs (G144 and Y10), but its expression was markedly reduced upon differentiation. When GSCs were treated with 20 μM cerulenin, a pharmacological inhibitor of FASN, their proliferation and migration were significantly suppressed and de novo lipogenesis decreased. Furthermore, following cerulenin treatment, expression of the GSC markers nestin, Sox2 and fatty acid binding protein (FABP7), markers of GCSs, decreased while that of glial fibrillary acidic protein (GFAP) expression increased. Taken together, our results indicate that FASN plays a pivotal role in the maintenance of GSC stemness, and FASN-mediated de novo lipid biosynthesis is closely associated with tumor growth and invasion in glioblastoma. PMID:26808816

  14. Stable transformation of Toxoplasma gondii based on a pyrimethamine resistant trifunctional dihydrofolate reductase-cytosine deaminase-thymidylate synthase gene that confers sensitivity to 5-fluorocytosine.

    PubMed

    Fox, B A; Belperron, A A; Bzik, D J

    1999-01-01

    To improve genetic models available for the analysis of apicomplexan protozoan parasites, bacterial sequences encoding the 427 amino acid cytosine deaminase (CD) gene were fused, in-frame, to an engineered linker domain of the high level pyrimethamine resistant form of the parasite bifunctional dihydrofolate reductase-thymidylate synthase (DHFR-TS) gene. Toxoplasma gondii was transformed with the plasmid containing the fused pyrimethamine resistant dihydrofolate reductase-cytosine deaminase-thymidylate synthase (DHFRm2m3-CD-TS) gene and parasites were selected in a high level of pyrimethamine. Transfected parasites that acquired resistance to pyrimethamine were cloned and evaluated for expression of the CD genetic marker. CD transgenic parasites acquired a high sensitivity to 5-fluorocytosine due to the intraparasitic conversion of this non-toxic prodrug to the cytotoxic compound 5-fluorouracil. Exogenously supplied cytosine or uracil rescued the growth of CD transgenic T. gondii parasites that were cultured in the presence of cytotoxic concentrations of 5-fluorouracil or 5-fluorocytosine. Bacterial CD fused to the pyrimethamine resistant DHFR-TS marker provides a novel genetic tool for new positive and negative genetic selection strategies in several protozoan parasites. An advantage of the CD genetic marker is that it is derived from a bacterial gene and can therefore be used in nearly any parasite genetic background for negative selection. This novel system should facilitate new approaches for the development of improved model genetic systems for the biological investigation of apicomplexan parasites. PMID:10029312

  15. Enzymatic formation of a resorcylic acid by creating a structure-guided single-point mutation in stilbene synthase

    PubMed Central

    Bhan, Namita; Li, Lingyun; Cai, Chao; Xu, Peng; Linhardt, Robert J; Koffas, Mattheos A G

    2015-01-01

    A novel C17 resorcylic acid was synthesized by a structure-guided Vitis vinifera stilbene synthase (STS) mutant, in which threonine 197 was replaced with glycine (T197G). Altering the architecture of the coumaroyl binding and cyclization pocket of the enzyme led to the attachment of an extra acetyl unit, derived from malonyl-CoA, to p-coumaroyl-CoA. The resulting novel pentaketide can be produced strictly by STS-like enzymes and not by Chalcone synthase-like type III polyketide synthases; due to the unique thioesterase like activity of STS-like enzymes. We utilized a liquid chromatography mass spectrometry-based data analysis approach to directly compare the reaction products of the mutant and wild type STS. The findings suggest an easy to employ platform for precursor-directed biosynthesis and identification of unnatural polyketides by structure-guided mutation of STS-like enzymes. PMID:25402946

  16. Genome-wide identification, classification and expression profiling of nicotianamine synthase (NAS) gene family in maize

    PubMed Central

    2013-01-01

    Background Nicotianamine (NA), a ubiquitous molecule in plants, is an important metal ion chelator and the main precursor for phytosiderophores biosynthesis. Considerable progress has been achieved in cloning and characterizing the functions of nicotianamine synthase (NAS) in plants including barley, Arabidopsis and rice. Maize is not only an important cereal crop, but also a model plant for genetics and evolutionary study. The genome sequencing of maize was completed, and many gene families were identified. Although three NAS genes have been characterized in maize, there is still no systematic identification of maize NAS family by genomic mining. Results In this study, nine NAS genes in maize were identified and their expression patterns in different organs including developing seeds were determined. According to the evolutionary relationship and tissue specific expression profiles of ZmNAS genes, they can be subgrouped into two classes. Moreover, the expression patterns of ZmNAS genes in response to fluctuating metal status were analysed. The class I ZmNAS genes were induced under Fe deficiency and were suppressed under Fe excessive conditions, while the expression pattern of class II genes were opposite to class I. The complementary expression patterns of class I and class II ZmNAS genes confirmed the classification of this family. Furthermore, the histochemical localization of ZmNAS1;1/1;2 and ZmNAS3 were determined using in situ hybridization. It was revealed that ZmNAS1;1/1;2, representing the class I genes, mainly expressed in cortex and stele of roots with sufficient Fe, and its expression can expanded in epidermis, as well as shoot apices under Fe deficient conditions. On the contrary, ZmNAS3, one of the class II genes, was accumulated in axillary meristems, leaf primordia and mesophyll cells. These results suggest that the two classes of ZmNAS genes may be regulated on transcriptional level when responds to various demands for iron uptake, translocation

  17. Nitric oxide synthase polymorphisms, gene expression and lung function in chronic obstructive pulmonary disease

    PubMed Central

    2013-01-01

    Background Due to the pleiotropic effects of nitric oxide (NO) within the lungs, it is likely that NO is a significant factor in the pathogenesis of chronic obstructive pulmonary disease (COPD). The aim of this study was to test for association between single nucleotide polymorphisms (SNPs) in three NO synthase (NOS) genes and lung function, as well as to examine gene expression and protein levels in relation to the genetic variation. Methods One SNP in each NOS gene (neuronal NOS (NOS1), inducible NOS (NOS2), and endothelial NOS (NOS3)) was genotyped in the Lung Health Study (LHS) and correlated with lung function. One SNP (rs1800779) was also analyzed for association with COPD and lung function in four COPD case–control populations. Lung tissue expression of NOS3 mRNA and protein was tested in individuals of known genotype for rs1800779. Immunohistochemistry of lung tissue was used to localize NOS3 expression. Results For the NOS3 rs1800779 SNP, the baseline forced expiratory volume in one second in the LHS was significantly higher in the combined AG + GG genotypic groups compared with the AA genotypic group. Gene expression and protein levels in lung tissue were significantly lower in subjects with the AG + GG genotypes than in AA subjects. NOS3 protein was expressed in the airway epithelium and subjects with the AA genotype demonstrated higher NOS3 expression compared with AG and GG individuals. However, we were not able to replicate the associations with COPD or lung function in the other COPD study groups. Conclusions Variants in the NOS genes were not associated with lung function or COPD status. However, the G allele of rs1800779 resulted in a decrease of NOS3 gene expression and protein levels and this has implications for the numerous disease states that have been associated with this polymorphism. PMID:24192154

  18. An Arabidopsis callose synthase.

    PubMed

    Ostergaard, Lars; Petersen, Morten; Mattsson, Ole; Mundy, John

    2002-08-01

    Beta-1,3-glucan polymers are major structural components of fungal cell walls, while cellulosic beta-1,4-glucan is the predominant polysaccharide in plant cell walls. Plant beta-1,3-glucan, called callose, is produced in pollen and in response to pathogen attack and wounding, but it has been unclear whether callose synthases can also produce cellulose and whether plant cellulose synthases may also produce beta-1,3-glucans. We describe here an Arabidopsis gene, AtGsl5, encoding a plasma membrane-localized protein homologous to yeast beta-1,3-glucan synthase whose expression partially complements a yeast beta-1,3-glucan synthase mutant. AtGsl5 is developmentally expressed at highest levels in flowers, consistent with flowers having high beta-1,3-glucan synthase activities for deposition of callose in pollen. A role for AtGsl5 in callose synthesis is also indicated by AtGsl5 expression in the Arabidopsis mpk4 mutant which exhibits systemic acquired resistance (SAR), elevated beta-1,3-glucan synthase activity, and increased callose levels. In addition, AtGsl5 is a likely target of salicylic acid (SA)-dependent SAR, since AtGsl5 mRNA accumulation is induced by SA in wild-type plants, while expression of the nahG salicylate hydroxylase reduces AtGsl5 mRNA levels in the mpk4 mutant. These results indicate that AtGsl5 is likely involved in callose synthesis in flowering tissues and in the mpk4 mutant. PMID:12081364

  19. The promoter of LE-ACS7, an early flooding-induced 1-aminocyclopropane-1-carboxylate synthase gene of the tomato, is tagged by a Sol3 transposon

    PubMed Central

    Shiu, Oi Yin; Oetiker, Jürg H.; Yip, Wing Kin; Yang, Shang Fa

    1998-01-01

    Many terrestrial plants respond to flooding with enhanced ethylene production. The roots of flooded plants produce 1-aminocyclopropane-1-carboxylic acid (ACC), which is transported from the root to the shoot, where it is converted to ethylene. In the roots, ACC is synthesized by ACC synthase, which is encoded by a multigene family. Previously, we identified two ACC synthase genes of tomato that are involved in flooding-induced ethylene production. Here, we report the cloning of LE-ACS7, a new tomato ACC synthase with a role early during flooding but also in the early wound response of leaves. The promoter of LE-ACS7 is tagged by a Sol3 transposon. A Sol3 transposon is also present in the tomato polygalacturonase promoter to which it conferred regulatory elements. Thus, Sol3 transposons may affect the regulation of LE-ACS7 and may be involved in the communication between the root and the shoot of waterlogged tomato plants. PMID:9707648

  20. Acute intermittent porphyria: A single-base deletion and a nonsense mutation in the human hydroxymethylbilane synthase gene, predicting truncations of the enzyme polypeptide

    SciTech Connect

    Lee, G.L.; Astrin, K.H.; Desnick, R.J.

    1995-08-28

    Acute intermittent porphyria (AIP) is an autosomal-dominant inborn error of metabolism that results from the half-normal activity of the third enzyme in the heme biosynthetic pathway, hydroxymethylbilane synthase (HMB-synthase). AIP is an ecogenetic condition, since the life-threatening acute attacks are precipitated by various factors, including drugs, alcohol, fasting, and certain hormones. Biochemical diagnosis is problematic, and the identification of mutations in the HMB-synthase gene provides accurate detection of presymptomatic heterozygotes, permitting avoidance of the acute precipitating factors. By direct solid-phase sequencing, two mutations causing AIP were identified, an adenine deletion at position 629 in exon 11(629delA), which alters the reading frame and predicts premature truncation of the enzyme protein after amino acid 255, and a nonsense mutation in exon 12 (R225X). These mutations were confirmed by either restriction enzyme analysis or family studies of symptomatic patients, permitting accurate presymptomatic diagnosis of affected relatives. 29 refs., 2 figs.

  1. The Polyketide Synthase Gene pks4 of Trichoderma reesei Provides Pigmentation and Stress Resistance

    PubMed Central

    Atanasova, Lea; Knox, Benjamin P.; Kubicek, Christian P.; Baker, Scott E.

    2013-01-01

    Species of the fungal genus Trichoderma (Hypocreales, Ascomycota) are well-known for their production of various secondary metabolites. Nonribosomal peptides and polyketides represent a major portion of these products. In a recent phylogenomic investigation of Trichoderma polyketide synthase (PKS)-encoding genes, the pks4 from T. reesei was shown to be an orthologue of pigment-forming PKSs involved in synthesis of aurofusarin and bikaverin in Fusarium spp. In this study, we show that deletion of this gene in T. reesei results in loss of green conidial pigmentation and in pigmentation alteration of teleomorph structures. It also has an impact on conidial cell wall stability and the antagonistic abilities of T. reesei against other fungi, including formation of inhibitory metabolites. In addition, deletion of pks4 significantly influences the expression of other PKS-encoding genes of T. reesei. To our knowledge, this is the first indication that a low-molecular-weight pigment-forming PKS is involved in defense, mechanical stability, and stress resistance in fungi. PMID:24036343

  2. Callose Synthase Family Genes Involved in the Grapevine Defense Response to Downy Mildew Disease.

    PubMed

    Yu, Ying; Jiao, Li; Fu, Shufang; Yin, Ling; Zhang, Yali; Lu, Jiang

    2016-01-01

    The deposition of callose is a common plant defense response to intruding pathogens and part of the plant's innate immunity. In this study, eight grapevine callose synthase (CalS) genes were identified and characterized. To investigate biological function of CalS in grapevine against the infection of Plasmopara viticola, expression patterns of grapevine CalS family genes were analyzed among resistant/susceptible cultivars. After P. viticola infection, expression of CalS1, 3, 7, 8, 9, 10, and 11 were significantly modified among the grapevine cultivars. For example, the expression of CalS1 and CalS10 were greatly increased in downy mildew (DM)-immune Muscadinia rotundifolia 'Carlos' and 'Noble'. Transient expression assay with promoters of the CalS1 and CalS10 genes confirmed that they were regulated by the oomycete pathogen P. viticola. CalS1 promoter activity was also significantly up-regulated by ABA in DM-immune M. rotundifolia 'Noble', but down-regulated in DM-susceptible Vitis vinifera 'Chardonnay'. The CalS1 promoter, however, was also down-regulated by GA in 'Chardonnay', but not affected in 'Noble'. The promoter activity of CalS10 was significantly up-regulated by GA in 'Chardonnay', but not regulated by ABA at all. It is proposed that CalS1 and CalS10 were involved in grapevine defense against DM disease. PMID:26474330

  3. Two closely linked but separable promoters for human neuronal nitric oxide synthase gene transcription.

    PubMed Central

    Xie, J; Roddy, P; Rife, T K; Murad, F; Young, A P

    1995-01-01

    In this report we demonstrate that the human cerebellum contains neuronal nitric oxide synthase (nNOS) mRNAs with two distinct 5'-untranslated regions that are encoded through use of closely linked but separate promoters. nNOS cDNA clones were shown to contain different 5' terminal exons spliced to a common exon 2. Genomic cloning and sequence analysis demonstrate that the unique exons are positioned within 300 bp of each other but separated from exon 2 by an intron that is at least 20 kb in length. A CpG island engulfs the downstream 5'-terminal exon. In contrast, most of the upstream exon resides outside of this CpG island. Interestingly, the upstream exon includes a GT dinucleotide repeat. A fusion gene with a 414-bp nNOS genomic fragment that includes a portion of the upstream 5'-terminal exon and its immediate 5'-flanking DNA is expressed in transfected HeLa cells. Also expressed is a fusion gene that contains the luciferase reporter under transcriptional control by a 308-bp genomic fragment that includes the region separating both 5'-terminal exons. These results indicate that expression of these exons is subject to transcriptional control by separate promoters. However, the proximity of these promoters raise the possibility that complex interactions may be involved in regulating nNOS gene expression at these sites. Images Fig. 1 Fig. 4 PMID:7532307

  4. Molecular identity and gene expression of aldosterone synthase cytochrome P450

    SciTech Connect

    Okamoto, Mitsuhiro . E-mail: mokamoto@mr-mbio.med.osaka-u.ac.jp; Nonaka, Yasuki; Takemori, Hiroshi; Doi, Junko

    2005-12-09

    11{beta}-Hydroxylase (CYP11B1) of bovine adrenal cortex produced corticosterone as well as aldosterone from 11-deoxycorticosterone in the presence of the mitochondrial P450 electron transport system. CYP11B1s of pig, sheep, and bullfrog, when expressed in COS-7 cells, also performed corticosterone and aldosterone production. Since these CYP11B1s are present in the zonae fasciculata and reticularis as well as in the zona glomerulosa, the zonal differentiation of steroid production may occur by the action of still-unidentified factor(s) on the enzyme-catalyzed successive oxygenations at C11- and C18-positions of steroid. In contrast, two cDNAs, one encoding 11{beta}-hydroxylase and the other encoding aldosterone synthase (CYP11B2), were isolated from rat, mouse, hamster, guinea pig, and human adrenals. The expression of CYP11B1 gene was regulated by cyclic AMP (cAMP)-dependent signaling, whereas that of CYP11B2 gene by calcium ion-signaling as well as cAMP-signaling. Salt-inducible protein kinase, a cAMP-induced novel protein kinase, was one of the regulators of CYP11B2 gene expression.

  5. Identification of Genes Encoding Granule-Bound Starch Synthase Involved in Amylose Metabolism in Banana Fruit

    PubMed Central

    Liu, Weixin; Xu, Biyu; Jin, Zhiqiang

    2014-01-01

    Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage. PMID:24505384

  6. The Evolutionary Fate of the Horizontally Transferred Agrobacterial Mikimopine Synthase Gene in the Genera Nicotiana and Linaria

    PubMed Central

    Talianova, Martina; Vyskot, Boris

    2014-01-01

    Few cases of spontaneously horizontally transferred bacterial genes into plant genomes have been described to date. The occurrence of horizontally transferred genes from the T-DNA of Agrobacterium rhizogenes into the plant genome has been reported in the genus Nicotiana and in the species Linaria vulgaris. Here we compare patterns of evolution in one of these genes (a gene encoding mikimopine synthase, mis) following three different events of horizontal gene transfer (HGT). As this gene plays an important role in Agrobacterium, and there are known cases showing that genes from pathogens can acquire plant protection function, we hypothesised that in at least some of the studied species we will find signs of selective pressures influencing mis sequence. The mikimopine synthase (mis) gene evolved in a different manner in the branch leading to Nicotiana tabacum and N. tomentosiformis, in the branch leading to N. glauca and in the genus Linaria. Our analyses of the genus Linaria suggest that the mis gene began to degenerate soon after the HGT. In contrast, in the case of N. glauca, the mis gene evolved under significant selective pressures. This suggests a possible role of mikimopine synthase in current N. glauca and its ancestor(s). In N. tabacum and N. tomentosiformis, the mis gene has a common frameshift mutation that disrupted its open reading frame. Interestingly, our results suggest that in spite of the frameshift, the mis gene could evolve under selective pressures. This sequence may still have some regulatory role at the RNA level as suggested by coverage of this sequence by small RNAs in N. tabacum. PMID:25420106

  7. Fatty acid synthase inhibitors from plants: isolation, structure elucidation, and SAR studies.

    PubMed

    Li, Xing-Cong; Joshi, Alpana S; ElSohly, Hala N; Khan, Shabana I; Jacob, Melissa R; Zhang, Zhizheng; Khan, Ikhlas A; Ferreira, Daneel; Walker, Larry A; Broedel, Sheldon E; Raulli, Robert E; Cihlar, Ronald L

    2002-12-01

    Fatty acid synthase (FAS) has been identified as a potential antifungal target. FAS prepared from Saccharomyces cerevisiae was employed for bioactivity-guided fractionation of Chlorophora tinctoria,Paspalum conjugatum, Symphonia globulifera, Buchenavia parviflora, and Miconia pilgeriana. Thirteen compounds (1-13), including three new natural products (1, 4, 12), were isolated and their structures identified by spectroscopic interpretation. They represented five chemotypes, namely, isoflavones, flavones, biflavonoids, hydrolyzable tannin-related derivatives, and triterpenoids. 3'-Formylgenistein (1) and ellagic acid 4-O-alpha-l-rhamnopyranoside (9) were the most potent compounds against FAS, with IC(50) values of 2.3 and 7.5 microg/mL, respectively. Furthermore, 43 (14-56) analogues of the five chemotypes from our natural product repository and commercial sources were tested for their FAS inhibitory activity. Structure-activity relationships for some chemotypes were investigated. All these compounds were further evaluated for antifungal activity against Candida albicans and Cryptococcus neoformans. Although there were several antifungal compounds in the set, correlation between the FAS inhibitory activity and antifungal activity could not be defined. PMID:12502337

  8. Imperfect pseudo-merohedral twinning in crystals of fungal fatty acid synthase

    PubMed Central

    Jenni, Simon; Ban, Nenad

    2009-01-01

    The recent high-resolution structures of fungal fatty acid synthase (FAS) have provided new insights into the principles of fatty acid biosynthesis by large multifunctional enzymes. The crystallographic phase problem for the 2.6 MDa fungal FAS was initially solved to 5 Å resolution using two crystal forms from Thermomyces lanuginosus. Monoclinic crystals in space group P21 were obtained from orthorhombic crystals in space group P212121 by dehydration. Here, it is shown how this space-group transition induced imperfect pseudo-merohedral twinning in the monoclinic crystal, giving rise to a Moiré pattern-like interference of the two twin-related reciprocal lattices. The strategy for processing the twinned diffraction images and obtaining a quantitative analysis is presented. The twinning is also related to the packing of the molecules in the two crystal forms, which was derived from self-rotation function analysis and molecular-replacement solutions using a low-resolution electron microscopy map as a search model. PMID:19171964

  9. Engineering a Polyketide Synthase for In Vitro Production of Adipic Acid.

    PubMed

    Hagen, Andrew; Poust, Sean; Rond, Tristan de; Fortman, Jeffrey L; Katz, Leonard; Petzold, Christopher J; Keasling, Jay D

    2016-01-15

    Polyketides have enormous structural diversity, yet polyketide synthases (PKSs) have thus far been engineered to produce only drug candidates or derivatives thereof. Thousands of other molecules, including commodity and specialty chemicals, could be synthesized using PKSs if composing hybrid PKSs from well-characterized parts derived from natural PKSs was more efficient. Here, using modern mass spectrometry techniques as an essential part of the design-build-test cycle, we engineered a chimeric PKS to enable production one of the most widely used commodity chemicals, adipic acid. To accomplish this, we introduced heterologous reductive domains from various PKS clusters into the borrelidin PKS' first extension module, which we previously showed produces a 3-hydroxy-adipoyl intermediate when coincubated with the loading module and a succinyl-CoA starter unit. Acyl-ACP intermediate analysis revealed an unexpected bottleneck at the dehydration step, which was overcome by introduction of a carboxyacyl-processing dehydratase domain. Appending a thioesterase to the hybrid PKS enabled the production of free adipic acid. Using acyl-intermediate based techniques to "debug" PKSs as described here, it should one day be possible to engineer chimeric PKSs to produce a variety of existing commodity and specialty chemicals, as well as thousands of chemicals that are difficult to produce from petroleum feedstocks using traditional synthetic chemistry. PMID:26501439

  10. Mechanism of Orlistat Hydrolysis by the Thioesterase of Human Fatty Acid Synthase

    PubMed Central

    2015-01-01

    Fatty acid synthase (FASN), the sole protein capable of de novo synthesis of free fatty acids, is overexpressed in a wide variety of human cancers and is associated with poor prognosis and aggressiveness of these cancers. Orlistat, an FDA-approved drug for obesity treatment that inhibits pancreatic lipases in the GI tract, also inhibits the thioesterase (TE) of human FASN. The cocrystal structure of TE with orlistat shows a pseudo TE dimer containing two different forms of orlistat in the active site, an intermediate that is covalently bound to a serine residue (Ser2308) and a hydrolyzed and inactivated product. In this study, we attempted to understand the mechanism of TE-catalyzed orlistat hydrolysis by examining the role of the hexyl tail of the covalently bound orlistat in water activation for hydrolysis using molecular dynamics simulations. We found that the hexyl tail of the covalently bound orlistat undergoes a conformational transition, which is accompanied by destabilization of a hydrogen bond between a hydroxyl moiety of orlistat and the catalytic His2481 of TE that in turn leads to an increased hydrogen bonding between water molecules and His2481 and increased chance for water activation to hydrolyze the covalent bond between orlistat and Ser2308. Thus, the conformation of the hexyl tail of orlistat plays an important role in orlistat hydrolysis. Strategies that stabilize the hexyl tail may lead to the design of more potent irreversible inhibitors that target FASN and block TE activity with greater endurance. PMID:25309810

  11. Expression of dehydratase domains from a polyunsaturated fatty acid synthase increases the production of fatty acids in Escherichia coli.

    PubMed

    Oyola-Robles, Delise; Rullán-Lind, Carlos; Carballeira, Néstor M; Baerga-Ortiz, Abel

    2014-02-01

    Increasing the production of fatty acids by microbial fermentation remains an important step toward the generation of biodiesel and other portable liquid fuels. In this work, we report an Escherichia coli strain engineered to overexpress a fragment consisting of four dehydratase domains from the polyunsaturated fatty acid (PUFA) synthase enzyme complex from the deep-sea bacterium, Photobacterium profundum. The DH1-DH2-UMA enzyme fragment was excised from its natural context within a multi-enzyme PKS and expressed as a stand-alone protein. Fatty acids were extracted from the cell pellet, esterified with methanol and quantified by GC-MS analysis. Results show that the E. coli strain expressing the DH tetradomain fragment was capable of producing up to a 5-fold increase (80.31 mg total FA/L culture) in total fatty acids over the negative control strain lacking the recombinant enzyme. The enhancement in production was observed across the board for all the fatty acids that are typically made by E. coli. The overexpression of the DH tetradomain did not affect E. coli cell growth, thus showing that the observed enhancement in fatty acid production was not a result of effects associated with cell density. The observed enhancement was more pronounced at lower temperatures (3.8-fold at 16 °C, 3.5-fold at 22 °C and 1.5-fold at 30 °C) and supplementation of the media with 0.4% glycerol did not result in an increase in fatty acid production. All these results taken together suggest that either the dehydration of fatty acid intermediates are a limiting step in the E. coli fatty acid biosynthesis machinery, or that the recombinant dehydratase domains used in this study are also capable of catalyzing thioester hydrolysis of the final products. The enzyme in this report is a new tool which could be incorporated into other existing strategies aimed at improving fatty acid production in bacterial fermentations toward accessible biodiesel precursors. PMID:24411456

  12. Expression of dehydratase domains from a polyunsaturated fatty acid synthase increases the production of fatty acids in Escherichia coli

    PubMed Central

    Oyola-Robles, Delise; Rullán-Lind, Carlos; Carballeira, Néstor M.; Baerga-Ortiz, Abel

    2014-01-01

    Increasing the production of fatty acids by microbial fermentation remains an important step towards the generation of biodiesel and other portable liquid fuels. In this work, we report an Escherichia coli strain engineered to overexpress a fragment consisting of four dehydratase domains from the polyunsaturated fatty acid (PUFA) synthase enzyme complex from the deep-sea bacterium, Photobacterium profundum. The DH1-DH2-UMA enzyme fragment was excised from its natural context within a multi-enzyme PKS and expressed as a stand-alone protein. Fatty acids were extracted from the cell pellet, esterified with methanol and quantified by GC-MS analysis. Results show that the E. coli strain expressing the DH tetradomain fragment was capable of producing up to a 5-fold increase (80.31 mg total FA/L culture) in total fatty acids over the negative control strain lacking the recombinant enzyme. The enhancement in production was observed across the board for all the fatty acids that are typically made by E. coli. The overexpression of the DH tetradomain did not affect E. coli cell growth, thus showing that the observed enhancement in fatty acid production was not a result of effects associated with cell density. The observed enhancement was more pronounced at lower temperatures (3.8-fold at 16 °C, 3.5-fold at 22 °C and 1.5-fold at 30 °C) and supplementation of the media with 0.4% glycerol did not result in an increase in fatty acid production. All these results taken together suggest that either the dehydration of fatty acid intermediates are a limiting step in the E. coli fatty acid biosynthesis machinery, or that the recombinant dehydratase domains used in this study are also capable of catalyzing thioester hydrolysis of the final products. The enzyme in this report is a new tool which could be incorporated into other existing strategies aimed at improving fatty acid production in bacterial fermentations towards accessible biodiesel precursors. PMID:24411456

  13. Disrupted short chain specific β-oxidation and improved synthase expression increase synthesis of short chain fatty acids in Saccharomyces cerevisiae.

    PubMed

    Leber, Christopher; Choi, Jin Wook; Polson, Brian; Da Silva, Nancy A

    2016-04-01

    Biologically derived fatty acids have gained tremendous interest as an alternative to petroleum-derived fuels and chemical precursors. We previously demonstrated the synthesis of short chain fatty acids in Saccharomyces cerevisiae by introduction of the Homo sapiens fatty acid synthase (hFAS) with heterologous phosphopantetheine transferases and heterologous thioesterases. In this study, short chain fatty acid production was improved by combining a variety of novel enzyme and metabolic engineering strategies. The use of a H. sapiens-derived thioesterase and phosphopantetheine transferase were evaluated. In addition, strains were engineered to disrupt either the full β-oxidation (by deleting FAA2, PXA1, and POX1) or short chain-specific β-oxidation (by deleting FAA2, ANT1, and PEX11) pathways. Prohibiting full β-oxidation increased hexanoic and octanoic acid levels by 8- and 79-fold relative to the parent strain expressing hFAS. However, by targeting only short chain β-oxidation, hexanoic and octanoic acid levels increased further to 31- and 140-fold over the parent. In addition, an optimized hFAS gene increased hexanoic, octanoic, decanoic and total short chain fatty acid levels by 2.9-, 2.0-, 2.3-, and 2.2-fold, respectively, relative to the non-optimized counterpart. By combining these unique enzyme and metabolic engineering strategies, octanoic acid was increased more than 181-fold over the parent strain expressing hFAS. PMID:26388428

  14. Endothelial nitric oxide synthase gene polymorphism is associated with sickle cell disease patients in India.

    PubMed

    Nishank, Sudhansu Sekhar; Singh, Mendi Prema Shyam Sunder; Yadav, Rajiv; Gupta, Rasik Bihari; Gadge, Vijay Sadashiv; Gwal, Anil

    2013-12-01

    Patients with sickle cell disease (SCD) produce significantly low levels of plasma nitric oxide (NO) during acute vaso-occlusive crisis. In transgenic sickle cell mice, NO synthesized by endothelial nitric oxide synthase (eNOS) enzyme of vascular endothelial cells has been found to protect the mice from vaso-occlusive events. Therefore, the present study aims to explore possible association of eNOS gene polymorphism as a potential genetic modifier in SCD patients. A case control study involving 150 SCD patients and age- and ethnicity-matched 150 healthy controls were genotyped by PCR-restriction fragment length polymorphism techniques for three important eNOS gene polymorphisms-eNOS 4a/b, eNOS 894G>T and eNOS -786T>C. It was observed that SCD patients had significantly higher frequencies of mutant alleles besides heterozygous and homozygous mutant genotypes of these three eNOS gene polymorphisms and low levels of plasma nitrite (NO2) as compared with control groups. The SCD severe group had significantly lower levels of plasma NO2 and higher frequencies of mutant alleles of these three SNPs of eNOS gene in contrast to the SCD mild group of patients. Haplotype analysis revealed that frequencies of one mutant haplotype '4a-T-C' (alleles in order of eNOS 4a/b, eNOS 894G>T and eNOS -786T>C) were significantly high in the severe SCD patients (P<0.0001), whereas the frequency of a wild haplotype '4b-G-T' was found to be significantly high (P<0.0001) in the SCD mild patients, which indicates that eNOS gene polymorphisms are associated with SCD patients in India and may act as a genetic modifier of the phenotypic variation of SCD patients. PMID:24088668

  15. UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6

    SciTech Connect

    Miyata, Maiko; Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko; Sugiura, Kazumitsu; Furukawa, Koichi; Furukawa, Keiko

    2014-03-07

    Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes.

  16. High Polyhydroxybutyrate Production in Pseudomonas extremaustralis Is Associated with Differential Expression of Horizontally Acquired and Core Genome Polyhydroxyalkanoate Synthase Genes

    PubMed Central

    Catone, Mariela V.; Ruiz, Jimena A.; Castellanos, Mildred; Segura, Daniel; Espin, Guadalupe; López, Nancy I.

    2014-01-01

    Pseudomonas extremaustralis produces mainly polyhydroxybutyrate (PHB), a short chain length polyhydroxyalkanoate (sclPHA) infrequently found in Pseudomonas species. Previous studies with this strain demonstrated that PHB genes are located in a genomic island. In this work, the analysis of the genome of P. extremaustralis revealed the presence of another PHB cluster phbFPX, with high similarity to genes belonging to Burkholderiales, and also a cluster, phaC1ZC2D, coding for medium chain length PHA production (mclPHA). All mclPHA genes showed high similarity to genes from Pseudomonas species and interestingly, this cluster also showed a natural insertion of seven ORFs not related to mclPHA metabolism. Besides PHB, P. extremaustralis is able to produce mclPHA although in minor amounts. Complementation analysis demonstrated that both mclPHA synthases, PhaC1 and PhaC2, were functional. RT-qPCR analysis showed different levels of expression for the PHB synthase, phbC, and the mclPHA synthases. The expression level of phbC, was significantly higher than the obtained for phaC1 and phaC2, in late exponential phase cultures. The analysis of the proteins bound to the PHA granules showed the presence of PhbC and PhaC1, whilst PhaC2 could not be detected. In addition, two phasin like proteins (PhbP and PhaI) associated with the production of scl and mcl PHAs, respectively, were detected. The results of this work show the high efficiency of a foreign gene (phbC) in comparison with the mclPHA core genome genes (phaC1 and phaC2) indicating that the ability of P. extremaustralis to produce high amounts of PHB could be explained by the different expression levels of the genes encoding the scl and mcl PHA synthases. PMID:24887088

  17. High polyhydroxybutyrate production in Pseudomonas extremaustralis is associated with differential expression of horizontally acquired and core genome polyhydroxyalkanoate synthase genes.

    PubMed

    Catone, Mariela V; Ruiz, Jimena A; Castellanos, Mildred; Segura, Daniel; Espin, Guadalupe; López, Nancy I

    2014-01-01

    Pseudomonas extremaustralis produces mainly polyhydroxybutyrate (PHB), a short chain length polyhydroxyalkanoate (sclPHA) infrequently found in Pseudomonas species. Previous studies with this strain demonstrated that PHB genes are located in a genomic island. In this work, the analysis of the genome of P. extremaustralis revealed the presence of another PHB cluster phbFPX, with high similarity to genes belonging to Burkholderiales, and also a cluster, phaC1ZC2D, coding for medium chain length PHA production (mclPHA). All mclPHA genes showed high similarity to genes from Pseudomonas species and interestingly, this cluster also showed a natural insertion of seven ORFs not related to mclPHA metabolism. Besides PHB, P. extremaustralis is able to produce mclPHA although in minor amounts. Complementation analysis demonstrated that both mclPHA synthases, PhaC1 and PhaC2, were functional. RT-qPCR analysis showed different levels of expression for the PHB synthase, phbC, and the mclPHA synthases. The expression level of phbC, was significantly higher than the obtained for phaC1 and phaC2, in late exponential phase cultures. The analysis of the proteins bound to the PHA granules showed the presence of PhbC and PhaC1, whilst PhaC2 could not be detected. In addition, two phasin like proteins (PhbP and PhaI) associated with the production of scl and mcl PHAs, respectively, were detected. The results of this work show the high efficiency of a foreign gene (phbC) in comparison with the mclPHA core genome genes (phaC1 and phaC2) indicating that the ability of P. extremaustralis to produce high amounts of PHB could be explained by the different expression levels of the genes encoding the scl and mcl PHA synthases. PMID:24887088

  18. The Variability of Sesquiterpenes Emitted from Two Zea mays Cultivars Is Controlled by Allelic Variation of Two Terpene Synthase Genes Encoding Stereoselective Multiple Product Enzymes

    PubMed Central

    Köllner, Tobias G.; Schnee, Christiane; Gershenzon, Jonathan; Degenhardt, Jörg

    2004-01-01

    The mature leaves and husks of Zea mays release a complex blend of terpene volatiles after anthesis consisting predominantly of bisabolane-, sesquithujane-, and bergamotane-type sesquiterpenes. The varieties B73 and Delprim release the same volatile constituents but in significantly different proportions. To study the molecular genetic and biochemical mechanisms controlling terpene diversity and distribution in these varieties, we isolated the closely related terpene synthase genes terpene synthase4 (tps4) and tps5 from both varieties. The encoded enzymes, TPS4 and TPS5, each formed the same complex mixture of sesquiterpenes from the precursor farnesyl diphosphate but with different proportions of products. These mixtures correspond to the sesquiterpene blends observed in the varieties B73 and Delprim, respectively. The differences in the stereoselectivity of TPS4 and TPS5 are determined by four amino acid substitutions with the most important being a Gly instead of an Ala residue at position 409 at the catalytic site of the enzyme. Although both varieties contain tps4 and tps5 alleles, their differences in terpene composition result from the fact that B73 has only a single functional allele of tps4 and no functional alleles of tps5, whereas Delprim has only a functional allele of tps5 and no functional alleles of tps4. Lack of functionality was shown to be attributable to frame-shift mutations or amino acid substitutions that greatly reduce the activity of their encoded proteins. Therefore, the diversity of sesquiterpenes in these two maize cultivars is strongly influenced by single nucleotide changes in the alleles of two terpene synthase genes. PMID:15075399

  19. Provitamin A accumulation in cassava (Manihot esculenta) roots driven by a single nucleotide polymorphism in a phytoene synthase gene.

    PubMed

    Welsch, Ralf; Arango, Jacobo; Bär, Cornelia; Salazar, Bertha; Al-Babili, Salim; Beltrán, Jesús; Chavarriaga, Paul; Ceballos, Hernan; Tohme, Joe; Beyer, Peter

    2010-10-01

    Cassava (Manihot esculenta) is an important staple crop, especially in the arid tropics. Because roots of commercial cassava cultivars contain a limited amount of provitamin A carotenoids, both conventional breeding and genetic modification are being applied to increase their production and accumulation to fight vitamin A deficiency disorders. We show here that an allelic polymorphism in one of the two expressed phytoene synthase (PSY) genes is capable of enhancing the flux of carbon through carotenogenesis, thus leading to the accumulation of colored provitamin A carotenoids in storage roots. A single nucleotide polymorphism present only in yellow-rooted cultivars cosegregates with colored roots in a breeding pedigree. The resulting amino acid exchange in a highly conserved region of PSY provides increased catalytic activity in vitro and is able to increase carotenoid production in recombinant yeast and Escherichia coli cells. Consequently, cassava plants overexpressing a PSY transgene produce yellow-fleshed, high-carotenoid roots. This newly characterized PSY allele provides means to improve cassava provitamin A content in cassava roots through both breeding and genetic modification. PMID:20889914

  20. RNA interference of a trehalose-6-phosphate synthase gene reveals its roles during larval-pupal metamorphosis in Bactrocera minax (Diptera: Tephritidae).

    PubMed

    Xiong, Ke-Cai; Wang, Jia; Li, Jia-Hao; Deng, Yu-Qing; Pu, Po; Fan, Huan; Liu, Ying-Hong

    2016-01-01

    Trehalose is the major blood sugar in insects, which plays a crucial role as an instant source of energy and the starting substrate for chitin biosynthesis. In insects, trehalose is synthesized by catalysis of an important enzyme, trehalose-6-phosphate synthase (TPS). In the present study, a trehalose-6-phosphate synthase gene from Bactrocera minax (BmTPS) was cloned and characterized. BmTPS contained an open reading frame of 2445 nucleotides encoding a protein of 814 amino acids with a predicted molecular weight of 92.05kDa. BmTPS was detectable in all developmental stages of Bactrocera minax and expressed higher in the final- (third-) instar larvae. Tissue-specific expression patterns of BmTPS showed that it was mainly expressed in the fat body. The 20-hydroxyecdysone (20E) induced the expression of BmTPS and three genes in the chitin biosynthesis pathway. Moreover, injection of double-stranded RNA into third-instar larvae successfully silenced the transcription of BmTPS in B. minax, and thereby decreased the activity of TPS and trehalose content. Additionally, silencing of BmTPS inhibited the expression of three key genes in the chitin biosynthesis pathway and exhibited 52% death and abnormal phenotypes. The findings demonstrate that BmTPS is indispensable for larval-pupal metamorphosis. Besides, the establishment of RNAi experimental system in B. minax would lay a solid foundation for further investigation of molecular biology and physiology of this pest. PMID:27405007

  1. Loss of the gene for the alpha subunit of ATP synthase (ATP5A1) from the W chromosome in the African grey parrot (Psittacus erithacus).

    PubMed

    de Kloet, S R

    2001-08-01

    This study describes the results of an analysis using Southern blotting, the polymerase chain reaction, and sequencing which shows that the African grey parrot (Psittacus erithacus) lacks the W-chromosomal gene for the alpha subunit of mitochondrial ATP synthase (ATP5A1W). Additional evidence shows that in other psittacines a fragment of the ATP5A1W gene contains five times as many nonsynonymous nucleotide replacements as the homologous fragment of the Z gene. Therefore, whereas in these other psittacines the corresponding ATP5A1Z protein fragment is highly conserved and varies by only a few, moderately conservative amino acid substitutions, the homologous ATP5A1W fragments contain a considerable number of, sometimes highly nonconservative, amino acid replacements. In one of these species, the ringneck parakeet (Psittacula krameri), the ATP5A1W gene is present in an inactive form because of the presence of a nonsense codon. Other changes, possibly leading to an inactive ATP5A1W gene product, involve the substitution of arginine residues by cysteine in the ATP5A1W protein of the mitred conure (Aratinga mitrata) and the blue and gold macaw (Ara ararauna). The data suggest also that although the divergence of the psittacine ATP5A1W and ATP5A1Z genes preceded the origin of the psittacidae, this divergence occurred independently of a similar process in the myna (Gracula religiosa), the outgroup used in this study. PMID:11479684

  2. Molecular characterization of a cellulose synthase gene (AaxmCesA1) isolated from an Acacia auriculiformis x Acacia mangium hybrid.

    PubMed

    Yong, Seok Yien Christina; Wickneswari, Ratnam

    2013-01-01

    Cellulose is the major component of plant cell walls, providing mechanical strength to the structural framework of plants. In association with lignin, hemicellulose, protein and pectin, cellulose forms the strong yet flexible bio-composite tissue of wood. Wood formation is an essential biological process and is of significant importance to the cellulosic private sector industry. Cellulose synthase genes encode the catalytic subunits of a large protein complex responsible for the biogenesis of cellulose in higher plants. The hybrid Acacia auriculiformis x Acacia mangium represents an important source of tree cellulose for forest-based product manufacturing, with enormous economic potential. In this work, we isolate the first cellulose synthase gene, designated AaxmCesA1, from this species. The isolated full-length AaxmCesA1 cDNA encodes a polypeptide of 1,064 amino acids. Sequence analyses revealed that AaxmCesA1 cDNA possesses the key motif characteristics of a CesA protein. AaxmCesA1 shares more than 75 % amino acid sequence identity with CesA proteins from other plant species. Subsequently, the full-length AaxmCesA1 gene of 7,389 bp with partial regulatory and 13 intron regions was also isolated. Relative gene expression analysis by quantitative PCR in different tissues of the Acacia hybrid, suggests the involvement of the AaxmCesA1 gene in primary cell wall synthesis of rapidly dividing young root cells. Similarity analyses using Blast algorithms also suggests a role in primary cell wall deposition in the Acacia hybrid. Southern analysis predicts that AaxmCesA1 is a member of a multigene family with at least two isoforms in the genome of the Acacia hybrid. PMID:24415841

  3. The fatty acid synthase fasn-1 acts upstream of WNK and Ste20/GCK-VI kinases to modulate antimicrobial peptide expression in C. elegans epidermis

    PubMed Central

    Lee, Kwang-Zin; Kniazeva, Marina; Han, Min; Pujol, Nathalie

    2010-01-01

    An important part of the innate immune response of the nematode C. elegans to fungal infection is the rapid induction of antimicrobial peptide gene expression. One of these genes, nlp-29, is expressed at a low level in adults under normal conditions. Its expression is upregulated in the epidermis by infection with Drechmeria coniospora, but also by physical injury and by osmotic stress. For infection and wounding, the induction is dependent on a p38 MAP kinase cascade, but for osmotic stress, this pathway is not required. To characterize further the pathways that control the expression of nlp-29, we carried out a genetic screen for negative regulatory genes. We isolated a number of Peni (peptide expression no infection) mutants and cloned one. It corresponds to fasn-1, the nematode ortholog of vertebrate fatty acid synthase. We show here that a pathway involving fatty acid synthesis and the evolutionary conserved wnk-1 and gck-3/Ste20/GCK-VI kinases modulates nlp-29 expression in the C. elegans epidermis, independently of p38 MAPK signaling. The control of the antimicrobial peptide gene nlp-29 thus links different physiological processes, including fatty acid metabolism, osmoregulation, maintenance of epidermal integrity and the innate immune response to infection. PMID:21178429

  4. Structural, Functional, and Evolutionary Analysis of the Unusually Large Stilbene Synthase Gene Family in Grapevine1[W

    PubMed Central

    Parage, Claire; Tavares, Raquel; Réty, Stéphane; Baltenweck-Guyot, Raymonde; Poutaraud, Anne; Renault, Lauriane; Heintz, Dimitri; Lugan, Raphaël; Marais, Gabriel A.B.; Aubourg, Sébastien; Hugueney, Philippe

    2012-01-01

    Stilbenes are a small family of phenylpropanoids produced in a number of unrelated plant species, including grapevine (Vitis vinifera). In addition to their participation in defense mechanisms in plants, stilbenes, such as resveratrol, display important pharmacological properties and are postulated to be involved in the health benefits associated with a moderate consumption of red wine. Stilbene synthases (STSs), which catalyze the biosynthesis of the stilbene backbone, seem to have evolved from chalcone synthases (CHSs) several times independently in stilbene-producing plants. STS genes usually form small families of two to five closely related paralogs. By contrast, the sequence of grapevine reference genome (cv PN40024) has revealed an unusually large STS gene family. Here, we combine molecular evolution and structural and functional analyses to investigate further the high number of STS genes in grapevine. Our reannotation of the STS and CHS gene families yielded 48 STS genes, including at least 32 potentially functional ones. Functional characterization of nine genes representing most of the STS gene family diversity clearly indicated that these genes do encode for proteins with STS activity. Evolutionary analysis of the STS gene family revealed that both STS and CHS evolution are dominated by purifying selection, with no evidence for strong selection for new functions among STS genes. However, we found a few sites under different selection pressures in CHS and STS sequences, whose potential functional consequences are discussed using a structural model of a typical STS from grapevine that we developed. PMID:22961129

  5. Association of Thymidylate Synthase Gene Polymorphisms with Stavudine Triphosphate Intracellular Levels and Lipodystrophy▿

    PubMed Central

    Domingo, Pere; Cabeza, M. Carmen; Pruvost, Alain; Torres, Ferran; Salazar, Juliana; del Mar Gutierrez, M.; Mateo, M. Gracia; Fontanet, Angels; Fernandez, Irene; Domingo, Joan C.; Villarroya, Francesc; Vidal, Francesc; Baiget, Montserrat

    2011-01-01

    The antiviral activity and toxicity of stavudine (d4T) depend on its triphosphate metabolite, stavudine triphosphate (d4T-TP). Therefore, modifications in intracellular levels of d4T-TP may change the toxicity profile of stavudine. d4T-TP intracellular levels in peripheral blood mononuclear cells were determined with a prominence liquid chromatograph connected to a triple-quadruple mass spectrometer. Polymorphisms in the thymidylate synthase (TS), methylenetetrahydrofolate reductase (MTHFR), dihydrofolate reductase (DHFR), reduced folate carrier 1 (RFC1; SLC19A1), and cyclin D1 (CCND1) genes were determined by direct sequencing using an ABI Prism 3100 genetic analyzer or Fluidigm's Biomark system. The Mann-Whitney test, rank analysis of variance (with Bonferroni's adjusted post hoc comparisons), and logistic regression were used for the inferential analyses. Thirty-three stavudine-treated patients were enrolled in this cross-sectional study. d4T-TP intracellular levels were 11.50 fmol/106 cells (interquartile range [IQR] = 8.12 to 13.87 fmol/106 cells) in patients with a high-expression TS genotype (2/3G, 3C/3G, and 3G/3G), whereas in those with a low-expression TS genotype (2/2, 2/3C, and 3C/3C), they were 21.40 fmol/106 cells (IQR = 18.90 to 27.0 fmol/106 cells) (P < 0.0001). Polymorphisms in the MTHFR, DHFR, RFC1, and CCND1 genes did not influence the intracellular concentration of d4T-TP. d4T-TP levels were independently associated with the TS genotype (low versus high expression; odds ratio [OR] = 86.22; 95% confidence interval [CI] = 8.48 to nonestimable; P = 0.0023). The low-expression TS genotype was associated with the development of HIV/highly active antiretroviral therapy-associated lypodystrophy syndrome (HALS) (OR = 14.0; 95% CI = 2.09 to 108.0; P = 0.0032). Our preliminary data show that polymorphisms in the thymidylate synthase gene are strongly associated with d4T-TP intracellular levels and with development of HALS. PMID:21282454

  6. Association of thymidylate synthase gene polymorphisms with stavudine triphosphate intracellular levels and lipodystrophy.

    PubMed

    Domingo, Pere; Cabeza, M Carmen; Pruvost, Alain; Torres, Ferran; Salazar, Juliana; del Mar Gutierrez, M; Mateo, M Gracia; Fontanet, Angels; Fernandez, Irene; Domingo, Joan C; Villarroya, Francesc; Vidal, Francesc; Baiget, Montserrat

    2011-04-01

    The antiviral activity and toxicity of stavudine (d4T) depend on its triphosphate metabolite, stavudine triphosphate (d4T-TP). Therefore, modifications in intracellular levels of d4T-TP may change the toxicity profile of stavudine. d4T-TP intracellular levels in peripheral blood mononuclear cells were determined with a prominence liquid chromatograph connected to a triple-quadruple mass spectrometer. Polymorphisms in the thymidylate synthase (TS), methylenetetrahydrofolate reductase (MTHFR), dihydrofolate reductase (DHFR), reduced folate carrier 1 (RFC1; SLC19A1), and cyclin D1 (CCND1) genes were determined by direct sequencing using an ABI Prism 3100 genetic analyzer or Fluidigm's Biomark system. The Mann-Whitney test, rank analysis of variance (with Bonferroni's adjusted post hoc comparisons), and logistic regression were used for the inferential analyses. Thirty-three stavudine-treated patients were enrolled in this cross-sectional study. d4T-TP intracellular levels were 11.50 fmol/10(6) cells (interquartile range [IQR] = 8.12 to 13.87 fmol/10(6) cells) in patients with a high-expression TS genotype (2/3G, 3C/3G, and 3G/3G), whereas in those with a low-expression TS genotype (2/2, 2/3C, and 3C/3C), they were 21.40 fmol/10(6) cells (IQR = 18.90 to 27.0 fmol/10(6) cells) (P < 0.0001). Polymorphisms in the MTHFR, DHFR, RFC1, and CCND1 genes did not influence the intracellular concentration of d4T-TP. d4T-TP levels were independently associated with the TS genotype (low versus high expression; odds ratio [OR] = 86.22; 95% confidence interval [CI] = 8.48 to nonestimable; P = 0.0023). The low-expression TS genotype was associated with the development of HIV/highly active antiretroviral therapy-associated lypodystrophy syndrome (HALS) (OR = 14.0; 95% CI = 2.09 to 108.0; P = 0.0032). Our preliminary data show that polymorphisms in the thymidylate synthase gene are strongly associated with d4T-TP intracellular levels and with development of HALS. PMID:21282454

  7. Volatile emissions of scented Alstroemeria genotypes are dominated by terpenes, and a myrcene synthase gene is highly expressed in scented Alstroemeria flowers

    PubMed Central

    Aros, Danilo; Gonzalez, Veronica; Allemann, Rudolf K.; Müller, Carsten T.; Rosati, Carlo; Rogers, Hilary J.

    2012-01-01

    Native to South America, Alstroemeria flowers are known for their colourful tepals, and Alstroemeria hybrids are an important cut flower. However, in common with many commercial cut flowers, virtually all the commercial Alstroemeria hybrids are not scented. The cultivar ‘Sweet Laura’ is one of very few scented commercial Alstroemeria hybrids. Characterization of the volatile emission profile of these cut flowers revealed three major terpene compounds: (E)-caryophyllene, humulene (also known as α-caryophyllene), an ocimene-like compound, and several minor peaks, one of which was identified as myrcene. The profile is completely different from that of the parental scented species A. caryophyllaea. Volatile emission peaked at anthesis in both scented genotypes, coincident in cv. ‘Sweet Laura’ with the maximal expression of a putative terpene synthase gene AlstroTPS. This gene was preferentially expressed in floral tissues of both cv. ‘Sweet Laura’ and A. caryophyllaea. Characterization of the AlstroTPS gene structure from cv. ‘Sweet Laura’ placed it as a member of the class III terpene synthases, and the predicted 567 amino acid sequence placed it into the subfamily TPS-b. The conserved sequences R28(R)X8W and D321DXXD are the putative Mg2+-binding sites, and in vitro assay of AlstroTPS expressed in Escherichia coli revealed that the encoded enzyme possesses myrcene synthase activity, consistent with a role for AlstroTPS in scent production in Alstroemeria cv. ‘Sweet Laura’ flowers. PMID:22268153

  8. Nonribosomal peptide synthase gene clusters for lipopeptide biosynthesis in Bacillus subtilis 916 and their phenotypic functions.

    PubMed

    Luo, Chuping; Liu, Xuehui; Zhou, Huafei; Wang, Xiaoyu; Chen, Zhiyi

    2015-01-01

    Bacillus cyclic lipopeptides (LPs) have been well studied for their phytopathogen-antagonistic activities. Recently, research has shown that these LPs also contribute to the phenotypic features of Bacillus strains, such as hemolytic activity, swarming motility, biofilm formation, and colony morphology. Bacillus subtilis 916 not only coproduces the three families of well-known LPs, i.e., surfactins, bacillomycin Ls (iturin family), and fengycins, but also produces a new family of LP called locillomycins. The genome of B. subtilis 916 contains four nonribosomal peptide synthase (NRPS) gene clusters, srf, bmy, fen, and loc, which are responsible for the biosynthesis of surfactins, bacillomycin Ls, fengycins, and locillomycins, respectively. By studying B. subtilis 916 mutants lacking production of one, two, or three LPs, we attempted to unveil the connections between LPs and phenotypic features. We demonstrated that bacillomycin Ls and fengycins contribute mainly to antifungal activity. Although surfactins have weak antifungal activity in vitro, the strain mutated in srfAA had significantly decreased antifungal activity. This may be due to the impaired productions of fengycins and bacillomycin Ls. We also found that the disruption of any LP gene cluster other than fen resulted in a change in colony morphology. While surfactins and bacillomycin Ls play very important roles in hemolytic activity, swarming motility, and biofilm formation, the fengycins and locillomycins had little influence on these phenotypic features. In conclusion, B. subtilis 916 coproduces four families of LPs which contribute to the phenotypic features of B. subtilis 916 in an intricate way. PMID:25362061

  9. Nonribosomal Peptide Synthase Gene Clusters for Lipopeptide Biosynthesis in Bacillus subtilis 916 and Their Phenotypic Functions

    PubMed Central

    Liu, Xuehui; Zhou, Huafei; Wang, Xiaoyu

    2014-01-01

    Bacillus cyclic lipopeptides (LPs) have been well studied for their phytopathogen-antagonistic activities. Recently, research has shown that these LPs also contribute to the phenotypic features of Bacillus strains, such as hemolytic activity, swarming motility, biofilm formation, and colony morphology. Bacillus subtilis 916 not only coproduces the three families of well-known LPs, i.e., surfactins, bacillomycin Ls (iturin family), and fengycins, but also produces a new family of LP called locillomycins. The genome of B. subtilis 916 contains four nonribosomal peptide synthase (NRPS) gene clusters, srf, bmy, fen, and loc, which are responsible for the biosynthesis of surfactins, bacillomycin Ls, fengycins, and locillomycins, respectively. By studying B. subtilis 916 mutants lacking production of one, two, or three LPs, we attempted to unveil the connections between LPs and phenotypic features. We demonstrated that bacillomycin Ls and fengycins contribute mainly to antifungal activity. Although surfactins have weak antifungal activity in vitro, the strain mutated in srfAA had significantly decreased antifungal activity. This may be due to the impaired productions of fengycins and bacillomycin Ls. We also found that the disruption of any LP gene cluster other than fen resulted in a change in colony morphology. While surfactins and bacillomycin Ls play very important roles in hemolytic activity, swarming motility, and biofilm formation, the fengycins and locillomycins had little influence on these phenotypic features. In conclusion, B. subtilis 916 coproduces four families of LPs which contribute to the phenotypic features of B. subtilis 916 in an intricate way. PMID:25362061

  10. Chromosomal organization of the inducible and constitutive prostaglandin synthase/cyclooxygenase genes in mouse

    SciTech Connect

    Ping Zi Wen; Warden C.; Fletcher, B.S.; Kujubu, D.A.; Herschman, H.R.; Lusis, A.J. )

    1993-02-01

    Two distinct prostaglandin synthase/cyclooxygenase (PGS/COS) enzymes have recently been recognized. One (EC 1.14.00.1) is largely constitutive and has been characterized in a variety of species, whereas the other (also known as TIS10) is inducible by mitogens and inhibitable by glucocorticoids. Along with activation of phospholipase A2, the latter PGS/COS is likely to mediate ligand-induced prostaglandin production in a variety of cell types. The two enzymes have similar gene structures and activities. There is accumulating evidence that PGS/COX activity may play a role in inflammatory diseases. For example, PGS/COX expression is upregulated in inflammatory joint diseases and is genetically controlled. As part of an effort to examine genetic factors regulating PGS/COX expression and the possible involvement of the enzymes in mouse models of inflammatory disorders, we report here the chromosomal mapping of the genes for the constitutive and regulated PGS/COX enzymes. We will refer to the constitutive enzyme as Pgs-1 and the inducible enzyme as Pgs-2. 14 refs., 1 tab.

  11. Gene transfer of the neuronal NO synthase isoform to cirrhotic rat liver ameliorates portal hypertension

    PubMed Central

    Yu, Qing; Shao, Rong; Qian, Hu Sheng; George, Samuel E.; Rockey, Don C.

    2000-01-01

    Reduced production of nitric oxide (NO) in the cirrhotic liver results from a defect in hepatic endothelial cell nitric oxide synthase (ecNOS) and appears to contribute to the high intrahepatic resistance and portal hypertension typical of cirrhosis. Therefore, we postulated that targeting a heterologous NOS isoform to sinusoidal endothelial cells or other perisinusoidal cells, such as hepatic stellate cells, would counter the defect in NO production and reduce resistance to blood flow. Recombinant adenovirus (Ad) carrying the neuronal NOS gene (nNOS) targeted liver sinusoidal endothelial cells, stellate cells, and hepatocytes more efficiently than the corresponding cells in cirrhotic livers, but transduction rates were substantial even in cirrhotic animals. Expression of nNOS in each liver cell type, whether from normal or injured liver, caused increased NO production and inhibited endothelin-1–induced contractility of perisinusoidal stellate cells. Finally, in 2 different in vivo models of cirrhosis and portal hypertension, transduction of livers with recombinant Ad.nNOS significantly reduced intrahepatic resistance and portal pressure. The data highlight the feasibility of gene transfer to diseased liver and hepatic cells and demonstrate the potential of a novel therapy for portal hypertension caused by cirrhosis. PMID:10727442

  12. Evolution of mustard (Brassica juncea Coss) subspecies in China: evidence from the chalcone synthase gene.

    PubMed

    Chen, F B; Liu, H F; Yao, Q L; Fang, P

    2016-01-01

    To explore the phylogenetic relationship, genome donor, and evolutionary history of the polyploid mustard (Brassica juncea) from China, eighty-one sequences of the chalcone synthase gene (Chs) were analyzed in 43 individuals, including 34 B. juncea, 2 B. rapa, 1 B. nigra, 2 B. oleracea, 1 B. napus, 1 B. carinata, and 2 Raphanus sativus. A maximum likelihood analysis showed that sequences from B. juncea were separated into two well-supported groups in accordance with the A and B genomes, whereas the traditional phenotypic classification of B. juncea was not wholly supported by the molecular results. The SplitsTree analysis recognized four distinct groups of Brassicaceae, and the median-joining network analysis recognized four distinct haplotypes of Chs. The estimates of Tajima's D, Fu and Li's D, and Fu and Li's F statistic for the Chs gene in the B genome were negative, while those in the A genome were significant. The results indicated that 1) the Chs sequences revealed a high level of sequence variation in Chinese mustard, 2) both tree and reticulate evolutions existed, and artificial selection played an important role in the evolution of Chinese mustard, 3) the original parental species of Chinese mustard are B. rapa var. sinapis arvensis and B. nigra (derived from China), 4) nucleotide variation in the B genome was higher than that in the A genome, and 5) cultivated mustard evolved from wild mustard, and China is one of the primary origins of B. juncea. PMID:27173323

  13. IDENTIFICATION AND HORMONE INDUCTION OF PUTATIVE CHITIN SYNTHASE GENES AND SPLICE VARIANTS IN Leptinotarsa decemlineata (SAY).

    PubMed

    Shi, Ji-Feng; Mu, Li-Li; Guo, Wen-Chao; Li, Guo-Qing

    2016-08-01

    Chitin synthase (ChS) plays a critical role in chitin synthesis and excretion. In this study, two ChS genes (LdChSA and LdChSB) were identified in Leptinotarsa decemlineata. LdChSA contains two splicing variants, LdChSAa and LdChSAb. Within the first, second, and third larval instars, the mRNA levels of LdChSAa, LdChSAb, and LdChSB coincide with the peaks of circulating 20-hydroxyecdysone (20E) and juvenile hormone (JH). In vitro culture of midguts and an in vivo bioassay revealed that 20E and an ecdysteroid agonist halofenozide stimulated the expression of the three LdChSs. Conversely, a reduction of 20E by RNA interference (RNAi) of an ecdysteroidogenesis gene LdSHD repressed the expression of these LdChSs, and ingestion of halofenozide by LdSHD RNAi larvae rescued the repression. Moreover, disruption of 20E signaling by RNAi of LdEcR, LdE75, LdHR3, and LdFTZ-F1 reduced the expression levels of these genes. Similarly, in vitro culture and an in vivo bioassay showed that exogenous JH and a JH analog methoprene activated the expression of the three LdChSs, whereas a decrease in JH by RNAi of a JH biosynthesis gene LdJHAMT downregulated these LdChSs. It seems that JH upregulates LdChSs at the early stage of each instar, whereas a 20E pulse triggers the transcription of LdChSs during molting in L. decemlineata. PMID:27030662

  14. Characterization of two trpE genes encoding anthranilate synthase {alpha}-subunit in Azospirillum brasilense

    SciTech Connect

    Ge Shimei; Xie Baoen; Chen Sanfeng . E-mail: chensf@cau.edu.cn

    2006-03-10

    The previous report from our laboratory has recently identified a new trpE gene (termed trpE {sub 2}) which exists independently in Azospirillum brasilense Yu62. In this study, amplification of trpE(G) (termed trpE {sub 1}(G) here) confirmed that there are two copies of trpE gene, one trpE being fused into trpG while the other trpE existed independently. This is First report to suggest that two copies of the trpE gene exist in this bacterium. Comparison of the nucleotide sequence demonstrated that putative leader peptide, terminator, and anti-terminator were found upstream of trpE {sub 1}(G) while these sequence features did not exist in front of trpE {sub 2}. The {beta}-galactosidase activity of an A. brasilense strain carrying a trpE {sub 2}-lacZ fusion remained constant at different tryptophan concentrations, but the {beta}-galactosidase activity of the same strain carrying a trpE {sub 1}(G)-lacZ fusion decreased as the tryptophan concentration increased. These data suggest that the expression of trpE {sub 1}(G) is regulated at the transcriptional level by attenuation while trpE {sub 2} is constantly expressed. The anthranilate synthase assays with trpE {sub 1}(G){sup -} and trpE {sub 2} {sup -} mutants demonstrated that TrpE{sub 1}(G) fusion protein is feedback inhibited by tryptophan while TrpE{sub 2} protein is not. We also found that both trpE {sub 1}(G) and trpE {sub 2} gene products were involved in IAA synthesis.

  15. Macrophage nitric oxide synthase gene: two upstream regions mediate induction by interferon gamma and lipopolysaccharide.

    PubMed Central

    Lowenstein, C J; Alley, E W; Raval, P; Snowman, A M; Snyder, S H; Russell, S W; Murphy, W J

    1993-01-01

    The promoter region of the mouse gene for macrophage-inducible nitric oxide synthase (mac-NOS; EC 1.14.13.39) has been characterized. A putative TATA box is 30 base pairs upstream of the transcription start site. Computer analysis reveals numerous potential binding sites for transcription factors, many of them associated with stimuli that induce mac-NOS expression. To localize functionally important portions of the regulatory region, we constructed deletion mutants of the mac-NOS 5' flanking region and placed them upstream of a luciferase reporter gene. The macrophage cell line RAW 264.7, when transfected with a minimal promoter construct, expresses little luciferase activity when stimulated by lipopolysaccharide (LPS), interferon gamma (IFN-gamma), or both. Maximal expression depends on two discrete regulatory regions upstream of the putative TATA box. Region I (position -48 to -209) increases luciferase activity approximately 75-fold over the minimal promoter construct. Region I contains LPS-related responsive elements, including a binding site for nuclear factor interleukin 6 (NF-IL6) and the kappa B binding site for NF-kappa B, suggesting that this region regulates LPS-induced expression of the mac-NOS gene. Region II (position -913 to -1029) alone does not increase luciferase expression, but together with region I it causes an additional 10-fold increase in expression. Together the two regions increase expression 750-fold over activity obtained from a minimal promoter construct. Region II contains motifs for binding IFN-related transcription factors and thus probably is responsible for IFN-mediated regulation of LPS-induced mac-NOS. Delineation of these two cooperative regions explains at the level of transcription how IFN-gamma and LPS act in concert to induce maximally the mac-NOS gene and, furthermore, how IFN-gamma augments the inflammatory response to LPS. Images Fig. 2 PMID:7692452

  16. Effects of starch synthase IIa gene dosage on grain, protein and starch in endosperm of wheat.

    PubMed

    Konik-Rose, Christine; Thistleton, Jenny; Chanvrier, Helene; Tan, Ihwa; Halley, Peter; Gidley, Michael; Kosar-Hashemi, Behjat; Wang, Hong; Larroque, Oscar; Ikea, Joseph; McMaugh, Steve; Regina, Ahmed; Rahman, Sadequr; Morell, Matthew; Li, Zhongyi

    2007-11-01

    Starch synthases (SS) are responsible for elongating the alpha-1,4 glucan chains of starch. A doubled haploid population was generated by crossing a line of wheat, which lacks functional ssIIa genes on each genome (abd), and an Australian wheat cultivar, Sunco, with wild type ssIIa alleles on each genome (ABD). Evidence has been presented previously indicating that the SGP-1 (starch granule protein-1) proteins present in the starch granule in wheat are products of the ssIIa genes. Analysis of 100 progeny lines demonstrated co-segregation of the ssIIa alleles from the three genomes with the SGP-1 proteins, providing further evidence that the SGP-1 proteins are the products of the ssIIa genes. From the progeny lines, 40 doubled haploid lines representing the eight possible genotypes for SSIIa (ABD, aBD, AbD, ABd, abD, aBd, Abd, abd) were characterized for their grain weight, protein content, total starch content and starch properties. For some properties (chain length distribution, pasting properties, swelling power, and gelatinization properties), a progressive change was observed across the four classes of genotypes (wild type, single nulls, double nulls and triple nulls). However, for other grain properties (seed weight and protein content) and starch properties (total starch content, granule morphology and crystallinity, granule size distribution, amylose content, amylose-lipid dissociation properties), a statistically significant change only occurred for the triple nulls, indicating that all three genes had to be missing or inactive for a change to occur. These results illustrate the importance of SSIIa in controlling grain and starch properties and the importance of amylopectin fine structure in controlling starch granule properties in wheat. PMID:17721773

  17. Expression of Ceramide Synthase 6 Transcriptionally Activates Acid Ceramidase in a c-Jun N-terminal Kinase (JNK)-dependent Manner.

    PubMed

    Tirodkar, Tejas S; Lu, Ping; Bai, Aiping; Scheffel, Matthew J; Gencer, Salih; Garrett-Mayer, Elizabeth; Bielawska, Alicja; Ogretmen, Besim; Voelkel-Johnson, Christina

    2015-05-22

    A family of six ceramide synthases with distinct but overlapping substrate specificities is responsible for generation of ceramides with acyl chains ranging from ∼14-26 carbons. Ceramide synthase 6 (CerS6) preferentially generates C14- and C16-ceramides, and we have previously shown that down-regulation of this enzyme decreases apoptotic susceptibility. In this study, we further evaluated how increased CerS6 expression impacts sphingolipid composition and metabolism. Overexpression of CerS6 in HT29 colon cancer cells resulted in increased apoptotic susceptibility and preferential generation of C16-ceramide, which occurred at the expense of very long chain, saturated ceramides. These changes were also reflected in sphingomyelin composition. HT-CerS6 cells had increased intracellular levels of sphingosine, which is generated by ceramidases upon hydrolysis of ceramide. qRT-PCR analysis revealed that only expression of acid ceramidase (ASAH1) was increased. The increase in acid ceramidase was confirmed by expression and activity analyses. Pharmacological inhibition of JNK (SP600125) or curcumin reduced transcriptional up-regulation of acid ceramidase. Using an acid ceramidase promoter driven luciferase reporter plasmid, we demonstrated that CerS1 has no effect on transcriptional activation of acid ceramidase and that CerS2 slightly but significantly decreased the luciferase signal. Similar to CerS6, overexpression of CerS3-5 resulted in an ∼2-fold increase in luciferase reporter gene activity. Exogenous ceramide failed to induce reporter activity, while a CerS inhibitor and a catalytically inactive mutant of CerS6 failed to reduce it. Taken together, these results suggest that increased expression of CerS6 can mediate transcriptional activation of acid ceramidase in a JNK-dependent manner that is independent of CerS6 activity. PMID:25839235

  18. In vitro reconstitution and steady-state analysis of the fatty acid synthase from Escherichia coli

    PubMed Central

    Yu, Xingye; Liu, Tiangang; Zhu, Fayin; Khosla, Chaitan

    2011-01-01

    Microbial fatty acid derivatives are emerging as promising alternatives to fossil fuel derived transportation fuels. Among bacterial fatty acid synthases (FAS), the Escherichia coli FAS is perhaps the most well studied, but little is known about its steady-state kinetic behavior. Here we describe the reconstitution of E. coli FAS using purified protein components and report detailed kinetic analysis of this reconstituted system. When all ketosynthases are present at 1 μM, the maximum rate of free fatty acid synthesis of the FAS exceeded 100 μM/ min. The steady-state turnover frequency was not significantly inhibited at high concentrations of any substrate or cofactor. FAS activity was saturated with respect to most individual protein components when their concentrations exceeded 1 μM. The exceptions were FabI and FabZ, which increased FAS activity up to concentrations of 10 μM; FabH and FabF, which decreased FAS activity at concentrations higher than 1 μM; and holo-ACP and TesA, which gave maximum FAS activity at 30 μM concentrations. Analysis of the S36T mutant of the ACP revealed that the unusual dependence of FAS activity on holo-ACP concentration was due, at least in part, to the acyl-phosphopantetheine moiety. MALDI-TOF mass spectrometry analysis of the reaction mixture further revealed medium and long chain fatty acyl-ACP intermediates as predominant ACP species. We speculate that one or more of such intermediates are key allosteric regulators of FAS turnover. Our findings provide a new basis for assessing the scope and limitations of using E. coli as a biocatalyst for the production of diesel-like fuels. PMID:22042840

  19. Stilbene synthase gene transfer caused alterations in the phenylpropanoid metabolism of transgenic strawberry (Fragaria×ananassa)

    PubMed Central

    Hanhineva, Kati; Kokko, Harri; Siljanen, Henri; Rogachev, Ilana; Aharoni, Asaph; Kärenlampi, Sirpa O.

    2009-01-01

    The gene encoding stilbene synthase is frequently used to modify plant secondary metabolism with the aim of producing the self-defence phytoalexin resveratrol. In this study, strawberry (Fragaria×ananassa) was transformed with the NS-Vitis3 gene encoding stilbene synthase from frost grape (Vitis riparia) under the control of the cauliflower mosaic virus 35S and the floral filament-specific fil1 promoters. Changes in leaf metabolites were investigated with UPLC-qTOF-MS (ultra performance liquid chromatography-quadrupole time of flight mass spectrometry) profiling, and increased accumulation of cinnamate, coumarate, and ferulate derivatives concomitantly with a decrease in the levels of flavonols was observed, while the anticipated resveratrol or its derivatives were not detected. The changed metabolite profile suggested that chalcone synthase was down-regulated by the genetic modification; this was verified by decreased chalcone synthase transcript levels. Changes in the levels of phenolic compounds led to increased susceptibility of the transgenic strawberry to grey mould fungus. PMID:19443619

  20. Siro(haem)amide in Allochromatium vinosum and relevance of DsrL and DsrN, a homolog of cobyrinic acid a,c-diamide synthase, for sulphur oxidation.

    PubMed

    Lübbe, Yvonne J; Youn, Hyung-Sun; Timkovich, Russell; Dahl, Christiane

    2006-08-01

    In the purple sulphur bacterium Allochromatium vinosum, the prosthetic group of dissimilatory sulphite reductase (DsrAB) was identified as siroamide, an amidated form of the classical sirohaem. The genes dsrAB are the first two of a large cluster of genes necessary for the oxidation of sulphur globules stored intracellularly during growth on sulphide and thiosulphate. DsrN is homologous to cobyrinic acid a,c diamide synthase and may therefore catalyze glutamine-dependent amidation of sirohaem. Indeed, an A. vinosumDeltadsrN in frame deletion mutant showed a significantly reduced sulphur oxidation rate that was fully restored upon complementation with dsrN in trans. Sulphite reductase was still present in the DeltadsrN mutant. DsrL is a homolog of the small subunits of bacterial glutamate synthases and was proposed to deliver glutamine for sirohaem amidation. However, recombinant DsrL does not exhibit glutamate synthase activity nor does the gene complement a glutamate synthase-deficient Escherichia coli strain. Deletion of dsrL showed that the encoded protein is absolutely essential for sulphur oxidation in A. vinosum. PMID:16907720

  1. Overexpression of fatty acid synthase predicts a poor prognosis for human gastric cancer

    PubMed Central

    DUAN, JIANGMAN; SUN, LI; HUANG, HONGXIANG; WU, ZHENZHEN; WANG, LIN; LIAO, WANGJUN

    2016-01-01

    Fatty acid synthase (FASN), a lipogenic multi-enzyme complex, is reported to be overexpressed in various types of of tumor tissues and serves an important role in tumor development and progression. However, the expression of FASN and its possible role in gastric cancer (GC) remains to be defined. In the present study, FASN expression in a group sample of 167 GC tissues was detected by immunohistochemistry and its correlation with clinicopathological features was analyzed. By clinical analysis, it was identified that FASN overexpression was positively correlated with the overall survival [P=0.008; hazard ratio (HR), 4.412; 95% confidence interval (CI), 1.463–13.305] and recurrence rate (P=0.014; HR, 1.705; 95% CI, 1.116–2.606) in patients with GC. In addition, expression of the FASN protein in GC tissues was correlated with age (P=0.032), clinical stage (P<0.001), gastric wall invasion (P=0.014), lymph node metastasis (P<0.001) and distant metastasis (P<0.001), however not with gender (P>0.05). In addition, FASN was observed to be overexpressed in GC tissues at an mRNA and protein level, compared with the adjacent non-cancerous tissues (P<0.05). Taken together, it was suggested that FASN was closely associated with GC metastasis and survival, which further provided evidence that FASN may be a promising prognostic biomarker for patients with GC. PMID:26936091

  2. Circulating Fatty Acid Synthase in pregnant women: Relationship to blood pressure, maternal metabolism and newborn parameters

    PubMed Central

    Carreras-Badosa, Gemma; Prats-Puig, Anna; Puig, Teresa; Vázquez-Ruíz, Montserrat; Bruel, Monserrat; Mendoza, Ericka; de Zegher, Francis; Ibáñez, Lourdes; López-Bermejo, Abel; Bassols, Judit

    2016-01-01

    The enzyme FASN (fatty acid synthase) is potentially related with hypertension and metabolic dysfunction. FASN is highly expressed in the human placenta. We aimed to investigate the relationship circulating FASN has with blood pressure, maternal metabolism and newborn parameters in healthy pregnant women. Circulating FASN was assessed in 115 asymptomatic pregnant women in the second trimester of gestation along with C-peptide, fasting glucose and insulin, post-load glucose lipids, HMW-adiponectin and blood pressure (the latter was assessed in each trimester of gestation). At birth, newborns and placentas were weighed. FASN expression was also able to be assessed in 80 placentas. Higher circulating FASN was associated with lower systolic blood pressure (SBP), with a more favourable metabolic phenotype (lower fasting glucose and insulin, post load glucose, HbAc1, HOMA-IR and C-peptide), and with lower placental and birth weight (all p < 0.05 to p < 0.001). Placental FASN expression related positively to circulating FASN (p < 0.005) and negatively to placental weight (p < 0.05). Our observations suggest a physiological role of placental FASN in human pregnancy. Future studies will clarify whether circulating FASN of placental origin does actually regulate placental and fetal growth, and (thereby) has a favourable influence on the pregnant mother’s insulin sensitivity and blood pressure. PMID:27090298

  3. Synthesis of novel beta-lactone inhibitors of fatty acid synthase.

    PubMed

    Richardson, Robyn D; Ma, Gil; Oyola, Yatsandra; Zancanella, Manuel; Knowles, Lynn M; Cieplak, Piotr; Romo, Daniel; Smith, Jeffrey W

    2008-09-11

    Fatty acid synthase (FAS) is necessary for growth and survival of tumor cells and is a promising drug target for oncology. Here, we report on the syntheses and activity of novel inhibitors of the thioesterase domain of FAS. Using the structure of orlistat as a starting point, which contains a beta-lactone as the central pharmacophore, 28 novel congeners were synthesized and examined. Structural features such as the length of the alpha- and beta-alkyl chains, their chemical composition, and amino ester substitutions were altered and the resulting compounds explored for inhibitory activity toward the thioesterase domain of FAS. Nineteen congeners show improved potency for FAS in biochemical assays relative to orlistat. Three of that subset, including the natural product valilactone, also display an increased potency in inducing tumor cell death and improved solubility compared to orlistat. These findings support the idea that an orlistat congener can be optimized for use in a preclinical drug design and for clinical drug development. PMID:18710210

  4. Synthesis of Novel β-Lactone Inhibitors of Fatty Acid Synthase

    PubMed Central

    Richardson, Robyn D.; Ma, Gil; Oyola, Yatsandra; Zancanella, Manuel; Knowles, Lynn M.; Cieplak, Piotr; Romo, Daniel; Smith, Jeffrey W.

    2011-01-01

    Fatty acid synthase (FAS) is necessary for growth and survival of tumor cells and is a promising drug target for oncology. Here, we report on the syntheses and activity of novel inhibitors of the thioesterase domain of FAS. Using the structure of orlistat as a starting point, which contains a β-lactone as the central pharmacophore, 28 novel congeners were synthesized and examined. Structural features such as the length of the α- and β-alkyl chains, their chemical composition, and amino ester substitutions were altered and the resulting compounds explored for inhibitory activity toward the thioesterase domain of FAS. Nineteen congeners show improved potency for FAS in biochemical assays relative to orlistat. Three of that subset, including the natural product valilactone, also display an increased potency in inducing tumor cell death and improved solubility compared to orlistat. These findings support the idea that an orlistat congener can be optimized for use in a preclinical drug design and for clinical drug development. PMID:18710210

  5. TSH/TSHR Signaling Suppresses Fatty Acid Synthase (FASN) Expression in Adipocytes.

    PubMed

    Chen, Jicui; Ren, Jianmin; Jing, Qingping; Lu, Sumei; Zhang, Yuchao; Liu, Yuantao; Yu, Cong; Gao, Peng; Zong, Chen; Li, Xia; Wang, Xiangdong

    2015-09-01

    TSH/TSHR signaling plays a role in the regulation of lipid metabolism in adipocytes. However, the precise mechanisms are not known. In the present study, we determined the effect of TSH on fatty acid synthase (FASN) expression, and explored the underlying mechanisms. In vitro, TSH reduced FASN expression in both mRNA and protein levels in mature adipocytes and was accompanied by protein kinase A (PKA) activation, cAMP-response element binding protein (CREB) phosphorylation, as well as extracellular signal-regulated kinase 1/2 (ERK1/2) and c-Jun NH2 -terminal kinase (JNK) activation. TSH-induced downregulation of FASN was partially abolished by inhibition of PKA and ERK, but not JNK. TSHR and FASN expression in visceral tissue was significantly increased in C57BL/6 mice with diet-induced obesity compared with control animals, whereas thyroid TSHR expression was normal. These findings suggest that activation of TSHR directly inhibits FASN expression in mature adipocytes, possibly mediated by PKA and ERK. In obese animals, this function of TSHR seems to be counteracted. The precise mechanisms need further investigation. PMID:25655684

  6. Fatty acid synthase is a novel therapeutic target in multiple myeloma.

    PubMed

    Okawa, Yutaka; Hideshima, Teru; Ikeda, Hiroshi; Raje, Noopur; Vallet, Sonia; Kiziltepe, Tanyel; Yasui, Hiroshi; Enatsu, Sotaro; Pozzi, Samantha; Breitkreutz, Iris; Cirstea, Diana; Santo, Loredana; Richardson, Paul; Anderson, Kenneth C

    2008-05-01

    This study investigated the biological significance of the inhibition of fatty acid synthase (FAS) in multiple myeloma (MM) using the small molecule inhibitor Cerulenin. Cerulenin triggered growth inhibition in both MM cell lines and MM patient cells, and overcame the survival and growth advantages conferred by interleukin-6, insulin-like growth factor-1, and bone marrow stromal cells. It induced apoptosis in MM cell lines with only modest activation of caspase -8, -9, -3 and PARP; moreover, the pan-caspase inhibitor Z-VAD-FMK did not inhibit Cerulenin-induced apoptosis and cell death. In addition, treatment of MM cells with Cerulenin primarily up-regulated apoptosis-inducing factor/endonuclease G, mediators of caspase-independent apoptosis. Importantly, Cerulenin induced endoplasmic reticulum stress response via up-regulation of the Grp78/IRE1alpha/JNK pathway. Although the C-Jun-NH(2)-terminal kinase (JNK) inhibitor SP600215 blocked Cerulenin-induced cytotoxicity, it did not inhibit apoptosis and caspase cleavage. Furthermore, Cerulenin showed synergistic cytotoxic effects with various agents including Bortezomib, Melphalan and Doxorubicin. Our results therefore indicate that inhibition of FAS by Cerulenin primarily triggered caspase-independent apoptosis and JNK-dependent cytotoxicity in MM cells. This report demonstrated that inhibition of FAS has anti-tumour activity against MM cells, suggesting that it represents a novel therapeutic target in MM. PMID:18410446

  7. Retraction: Fatty acid synthase is a novel therapeutic target in multiple myeloma

    PubMed Central

    Okawa, Yutaka; Hideshima, Teru; Ikeda, Hiroshi; Raje, Noopur; Vallet, Sonia; Kiziltepe, Tanyel; Yasui, Hiroshi; Enatsu, Sotaro; Pozzi, Samantha; Breitkreutz, Iris; Cirstea, Diana; Santo, Loredana; Richardson, Paul; Anderson, Kenneth C

    2008-01-01

    This study investigated the biological significance of the inhibition of fatty acid synthase (FAS) in multiple myeloma (MM) using the small molecule inhibitor Cerulenin. Cerulenin triggered growth inhibition in both MM cell lines and MM patient cells, and overcame the survival and growth advantages conferred by interleukin-6, insulin-like growth factor-1, and bone marrow stromal cells. It induced apoptosis in MM cell lines with only modest activation of caspase -8, -9, -3 and PARP; moreover, the pan-caspase inhibitor Z-VAD-FMK did not inhibit Cerulenin-induced apoptosis and cell death. In addition, treatment of MM cells with Cerulenin primarily up-regulated apoptosis-inducing factor/endonuclease G, mediators of caspase-independent apoptosis. Importantly, Cerulenin induced endoplasmic reticulum stress response via up-regulation of the Grp78/IRE1α/JNK pathway. Although the C-Jun-NH2-terminal kinase (JNK) inhibitor SP600215 blocked Cerulenin-induced cytotoxicity, it did not inhibit apoptosis and caspase cleavage. Furthermore, Cerulenin showed synergistic cytotoxic effects with various agents including Bortezomib, Melphalan and Doxorubicin. Our results therefore indicate that inhibition of FAS by Cerulenin primarily triggered caspase-independent apoptosis and JNK-dependent cytotoxicity in MM cells. This report demonstrated that inhibition of FAS has anti-tumour activity against MM cells, suggesting that it represents a novel therapeutic target in MM. PMID:18410446

  8. Virus-induced gene silencing of Withania somnifera squalene synthase negatively regulates sterol and defence-related genes resulting in reduced withanolides and biotic stress tolerance.

    PubMed

    Singh, Anup Kumar; Dwivedi, Varun; Rai, Avanish; Pal, Shaifali; Reddy, Sajjalavarahalli Gangireddy Eswara; Rao, Dodaghatta Krishnarao Venkata; Shasany, Ajit Kumar; Nagegowda, Dinesh A

    2015-12-01

    Withania somnifera (L.) Dunal is an important Indian medicinal plant that produces withanolides, which are triterpenoid steroidal lactones having diverse biological activities. To enable fast and efficient functional characterization of genes in this slow-growing and difficult-to-transform plant, a virus-induced gene silencing (VIGS) was established by silencing phytoene desaturase (PDS) and squalene synthase (SQS). VIGS of the gene encoding SQS, which provides precursors for triterpenoids, resulted in significant reduction of squalene and withanolides, demonstrating its application in studying withanolides biosynthesis in W. somnifera leaves. A comprehensive analysis of gene expression and sterol pathway intermediates in WsSQS-vigs plants revealed transcriptional modulation with positive feedback regulation of mevalonate pathway genes, and negative feed-forward regulation of downstream sterol pathway genes including DWF1 (delta-24-sterol reductase) and CYP710A1 (C-22-sterol desaturase), resulting in significant reduction of sitosterol, campesterol and stigmasterol. However, there was little effect of SQS silencing on cholesterol, indicating the contribution of sitosterol, campesterol and stigmasterol, but not of cholesterol, towards withanolides formation. Branch-point oxidosqualene synthases in WsSQS-vigs plants exhibited differential regulation with reduced CAS (cycloartenol synthase) and cycloartenol, and induced BAS (β-amyrin synthase) and β-amyrin. Moreover, SQS silencing also led to the down-regulation of brassinosteroid-6-oxidase-2 (BR6OX2), pathogenesis-related (PR) and nonexpressor of PR (NPR) genes, resulting in reduced tolerance to bacterial and fungal infection as well as to insect feeding. Taken together, SQS silencing negatively regulated sterol and defence-related genes leading to reduced phytosterols, withanolides and biotic stress tolerance, thus implicating the application of VIGS for functional analysis of genes related to withanolides

  9. Fatty Acid Biosynthesis in Pseudomonas aeruginosa Is Initiated by the FabY Class of β-Ketoacyl Acyl Carrier Protein Synthases

    PubMed Central

    Yuan, Yanqiu; Sachdeva, Meena; Leeds, Jennifer A.

    2012-01-01

    The prototypical type II fatty acid synthesis (FAS) pathway in bacteria utilizes two distinct classes of β-ketoacyl synthase (KAS) domains to assemble long-chain fatty acids, the KASIII domain for initiation and the KASI/II domain for elongation. The central role of FAS in bacterial viability and virulence has stimulated significant effort toward developing KAS inhibitors, particularly against the KASIII domain of the β-acetoacetyl-acyl carrier protein (ACP) synthase FabH. Herein, we show that the opportunistic pathogen Pseudomonas aeruginosa does not utilize a FabH ortholog but rather a new class of divergent KAS I/II enzymes to initiate the FAS pathway. When a P. aeruginosa cosmid library was used to rescue growth in a fabH downregulated strain of Escherichia coli, a single unannotated open reading frame, PA5174, complemented fabH depletion. While deletion of all four KASIII domain-encoding genes in the same P. aeruginosa strain resulted in a wild-type growth phenotype, deletion of PA5174 alone specifically attenuated growth due to a defect in de novo FAS. Siderophore secretion and quorum-sensing signaling, particularly in the rhl and Pseudomonas quinolone signal (PQS) systems, was significantly muted in the absence of PA5174. The defect could be repaired by intergeneric complementation with E. coli fabH. Characterization of recombinant PA5174 confirmed a preference for short-chain acyl coenzyme A (acyl-CoA) substrates, supporting the identification of PA5174 as the predominant enzyme catalyzing the condensation of acetyl coenzyme A with malonyl-ACP in P. aeruginosa. The identification of the functional role for PA5174 in FAS defines the new FabY class of β-ketoacyl synthase KASI/II domain condensation enzymes. PMID:22753059

  10. Endothelial nitric oxide synthase gene polymorphism is associated with Legg-Calvé-Perthes disease

    PubMed Central

    ZHAO, YULONG; LIAO, SHIJIE; LU, RONGBIN; DANG, HAO; ZHAO, JINMIN; DING, XIAOFEI

    2016-01-01

    The aim of this study was to assess the association of 27-bp variable number tandem repeat (VNTR) polymorphism in intron 4 and G894T polymorphism in exon 7 of the endothelial nitric oxide synthase (eNOS) gene with Legg-Calvé-Perthes disease (LCPD), and to provide a scientific basis for further research into the pathogenic mechanism. A total of 80 patients with LCPD and 100 healthy subjects were recruited in this case-control study. The 27-bp VNTR and G894T polymorphisms of the eNOS gene were genotyped using polymerase chain reaction (PCR) and PCR-restriction fragment length polymorphism, respectively, followed by agarose gel electrophoresis and DNA sequencing. Allelic and genotypic frequencies were computed in the two groups and subjected to statistical analysis. For the 27-bp VNTR polymorphism, individuals with LCPD showed a higher frequency of the ab genotype [27.5 vs. 14%; odds ratio (OR), 2.33; 95% confidence interval (CI), 1.10–4.92; P=0.024]. For the G894T polymorphism, the LCPD case group showed a higher frequency of the heterozygous genotype GT than the healthy control group (35 vs. 17%; OR, 2.67; 95% CI, 1.33–5.36; P=0.005). The results indicate that these eNOS gene polymorphisms may be a risk factor for LCPD. The 27-bp VNTR polymorphism in intron 4 and G894T polymorphism in exon 7 may be involved in the etiology of LCPD. PMID:27168827

  11. Thymidylate synthase gene amplification in human colon cancer cell lines resistant to 5-fluorouracil.

    PubMed

    Copur, S; Aiba, K; Drake, J C; Allegra, C J; Chu, E

    1995-05-17

    A series of 5-fluorouracil (5-FU)-resistant human colon H630 cancer cell lines were established by continuous exposure of cells to 5-FU. The concentration of 5-FU required to inhibit cell proliferation by 50% (IC50) in the parent colon line (H630) was 5.5 microM. The 5-FU IC50 values for the resistant H630-R1, H630-R10, and H630-R cell lines were 11-, 29-, and 27-fold higher than that for the parent H630 cell line. Using both the radioenzymatic 5-fluoro-2'-deoxyuridine-5'-monophosphate (FdUMP) binding and catalytic assays for measurement of thymidylate synthase (TS) enzyme activity, there was significantly increased TS activity in resistant H630-R1 (13- and 23-fold), H630-R10 (37- and 40-fold), and H630-R (24- and 34-fold) lines, for binding and catalytic assays, respectively, compared with the parent H630 line. The level of TS protein, as determined by western immunoblot analysis, was increased markedly in resistant H630-R1 (23-fold), H630-R10 (33-fold), and H630-R (26-fold) cells. Northern analysis revealed elevations in TS mRNA levels in H630-R1 (18-fold), H630-R10 (39-fold), and H630-R (36-fold) cells relative to parent H630 cells. Although no major rearrangements of the TS gene were noted by Southern analysis, there was significant amplification of the TS gene in 5-FU-resistant cells, which was confirmed by DNA slot blot analysis. These studies demonstrate that continuous exposure of human colon cancer cells to 5-FU leads to TS gene amplification and overexpression of TS protein with resultant development of fluoropyrimidine resistance. PMID:7763285

  12. Endothelial nitric oxide synthase G894T gene polymorphism and response to skin reactive hyperemia.

    PubMed

    Rasool, Aida Hanum Ghulam; Ghazali, Dzuzaini Mohd; Abdullah, Haswati; Halim, Ahmad Sukari; Wong, Abd Rahim

    2009-09-01

    Post occlusive skin reactive hyperemia (PORH) is a tool used to assess microcirculation. Endothelial nitric oxide synthase (eNOS) mediates nitric oxide (NO) production; polymorphism of the eNOS gene may affect response to the PORH process. This study aims to determine whether eNOS G894T gene polymorphism affects response to skin PORH. 230 normotensive male and females between 18 and 40 years participated in this cross-sectional study. 170 subjects were of the homozygous GG genotype, whereas 60 were of the GT genotype. Skin PORH was performed by occlusion of the upper arm at 200 mm Hg for 3 min. Skin perfusion and temperature were monitored before, during and after occlusion release using the laser Doppler fluximetry. There were no significant differences between genotypes in their baseline blood pressure, serum cholesterol, BMI and age. Maximum change in perfusion after occlusion release (PORHmax) for the GG and GT genotypes were not significantly different at 50.15+/-1.29 vs. 47.92+/-2.17 AU; ANCOVA, p=0.351. Peak perfusion (PORHpeak) were also not significantly different between the two genotypes (61.23+/-1.36 vs. 57.72+/-2.32 AU; p=0.169). Minimum baseline perfusion were however higher in the GG compared to the GT genotype (10.83+/-0.29 vs. 9.61+/-0.50, p=0.029). We conclude that microvascular reactivity, assessed by change in perfusion after temporary ischemia was not significantly different between the GG and GT genotypes of the eNOS G894T gene. eNOS 894T allele carriers however, have lower baseline perfusion compared to the homozygous G894 allele carrier. PMID:19481100

  13. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    NASA Astrophysics Data System (ADS)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  14. Angelica Sinensis Polysaccharides Stimulated UDP-Sugar Synthase Genes through Promoting Gene Expression of IGF-1 and IGF1R in Chondrocytes: Promoting Anti-Osteoarthritic Activity

    PubMed Central

    Wen, Yinxian; Li, Jing; Tan, Yang; Qin, Jun; Xie, Xianfei; Wang, Linlong; Mei, Qibing; Wang, Hui; Magdalou, Jacques; Chen, Liaobin

    2014-01-01

    Background Osteoarthritis (OA) is a chronic joints disease characterized by progressive degeneration of articular cartilage due to the loss of cartilage matrix. Previously, we found, for the first time, that an acidic glycan from Angelica Sinensis Polysaccharides (APSs), namely the APS-3c, could protect rat cartilage from OA due to promoting glycosaminoglycan (GAG) synthesis in chondrocytes. In the present work, we tried to further the understanding of ASP-3c’s anti-OA activity. Methodology/Principal Findings Human primary chondrocytes were treated with APS-3c or/and recombinant human interleukin 1β (IL-1β). It turned out that APS-3c promoted synthesis of UDP-xylose and GAG, as well as the gene expression of UDP-sugar synthases (USSs), insulin like growth factor 1 (IGF1) and IGF1 receptor (IGF1R), and attenuated the degenerative phenotypes, suppressed biosynthesis of UDP-sugars and GAG, and inhibited the gene expression of USSs, IGF1 and IGF1R induced by IL-1β. Then, we induced a rat OA model with papain, and found that APS-3c also stimulated GAG synthesis and gene expression of USSs, IGF1 and IGF1R in vivo. Additionally, recombinant human IGF1 and IGF1R inhibitor NP-AEW541 were applied to figure out the correlation between stimulated gene expression of USSs, IGF1 and IGF1R induced by APS-3c. It tuned out that the promoted GAG synthesis and USSs gene expression induced by APS-3c was mediated by the stimulated IGF1 and IGF1R gene expression, but not through directly activation of IGF1R signaling pathway. Conclusions/Significances We demonstrated for the first time that APS-3c presented anti-OA activity through stimulating IGF-1 and IGF1R gene expression, but not directly activating the IGF1R signaling pathway, which consequently promoted UDP-sugars and GAG synthesis due to up-regulating gene expression of USSs. Our findings presented a better understanding of APS-3c’s anti-OA activity and suggested that APS-3c could potentially be a novel therapeutic agent

  15. Directed tagging of the Arabidopsis FATTY ACID ELONGATION1 (FAE1) gene with the maize transposon activator.

    PubMed Central

    James, D W; Lim, E; Keller, J; Plooy, I; Ralston, E; Dooner, H K

    1995-01-01

    The FATTY ACID ELONGATION1 (FAE1) gene of Arabidopsis is required for the synthesis of very long chain fatty acids in the seed. The product of the FAE1 gene is presumed to be a condensing enzyme that extends the chain length of fatty acids from C18 to C20 and C22. We report here the cloning of FAE1 by directed transposon tagging with the maize element Activator (Ac). An unstable fae1 mutant was isolated in a line carrying Ac linked to the FAE1 locus on chromosome 4. Cosegregation and reversion analyses established that the new mutant was tagged by Ac. A DNA fragment flanking Ac was cloned by inverse polymerase chain reaction and used to isolate FAE1 genomic clones and a cDNA clone from a library made from immature siliques. The predicted amino acid sequence of the FAE1 protein shares homology with those of other condensing enzymes (chalcone synthase, stilbene synthases, and beta-ketoacyl-acyl carrier protein synthase III), supporting the notion that FAE1 is the structural gene for a synthase or condensing enzyme. FAE1 is expressed in developing seed, but not in leaves, as expected from the effect of the fae1 mutation on the fatty acid compositions of those tissues. PMID:7734965

  16. Amino acid regulation of gene expression.

    PubMed Central

    Fafournoux, P; Bruhat, A; Jousse, C

    2000-01-01

    The impact of nutrients on gene expression in mammals has become an important area of research. Nevertheless, the current understanding of the amino acid-dependent control of gene expression is limited. Because amino acids have multiple and important functions, their homoeostasis has to be finely maintained. However, amino-acidaemia can be affected by certain nutritional conditions or various forms of stress. It follows that mammals have to adjust several of their physiological functions involved in the adaptation to amino acid availability by regulating the expression of numerous genes. The aim of the present review is to examine the role of amino acids in regulating mammalian gene expression and protein turnover. It has been reported that some genes involved in the control of growth or amino acid metabolism are regulated by amino acid availability. For instance, limitation of several amino acids greatly increases the expression of the genes encoding insulin-like growth factor binding protein-1, CHOP (C/EBP homologous protein, where C/EBP is CCAAT/enhancer binding protein) and asparagine synthetase. Elevated mRNA levels result from both an increase in the rate of transcription and an increase in mRNA stability. Several observations suggest that the amino acid regulation of gene expression observed in mammalian cells and the general control process described in yeast share common features. Moreover, amino acid response elements have been characterized in the promoters of the CHOP and asparagine synthetase genes. Taken together, the results discussed in the present review demonstrate that amino acids, by themselves, can, in concert with hormones, play an important role in the control of gene expression. PMID:10998343

  17. The smoking-associated oxidant hypothiocyanous acid induces endothelial nitric oxide synthase dysfunction.

    PubMed

    Talib, Jihan; Kwan, Jair; Suryo Rahmanto, Aldwin; Witting, Paul K; Davies, Michael J

    2014-01-01

    Smokers have an elevated risk of cardiovascular disease but the origin(s) of this increased risk are incompletely defined. Considerable evidence supports an accumulation of the oxidant-generating enzyme MPO (myeloperoxidase) in the inflamed artery wall, and smokers have high levels of SCN(-), a preferred MPO substrate, with this resulting in HOSCN (hypothiocyanous acid) formation. We hypothesized that this thiol-specific oxidant may target the Zn(2+)-thiol cluster of eNOS (endothelial nitric oxide synthase), resulting in enzyme dysfunction and reduced formation of the critical signalling molecule NO•. Decreased NO• bioavailability is an early and critical event in atherogenesis, and HOSCN-mediated damage to eNOS may contribute to smoking-associated disease. In the present study it is shown that exposure of isolated eNOS to HOSCN or MPO/H2O2/SCN(-) decreased active dimeric eNOS levels, and increased inactive monomer and Zn(2+) release, compared with controls, HOCl (hypochlorous acid)- or MPO/H2O2/Cl(-)-treated samples. eNOS activity was increasingly compromised by MPO/H2O2/Cl(-) with increasing SCN(-) concentrations. Exposure of HCAEC (human coronary artery endothelial cell) lysates to pre-formed HOSCN, or MPO/H2O2/Cl(-) with increasing SCN(-), increased eNOS monomerization and Zn(2+) release, and decreased activity. Intact HCAECs exposed to HOCl and HOSCN had decreased eNOS activity and NO2(-)/NO3(-) formation (products of NO• decomposition), and increased free Zn(2+). Exposure of isolated rat aortic rings to HOSCN resulted in thiol loss, and decreased eNOS activity and cGMP levels. Overall these data indicate that high SCN(-) levels, as seen in smokers, can increase HOSCN formation and enhance eNOS dysfunction in human endothelial cells, with this potentially contributing to increased atherogenesis in smokers. PMID:24112082

  18. Polyketide genes in the marine sponge Plakortis simplex: a new group of mono-modular type I polyketide synthases from sponge symbionts

    PubMed Central

    Della Sala, Gerardo; Hochmuth, Thomas; Costantino, Valeria; Teta, Roberta; Gerwick, William; Gerwick, Lena; Piel, Jörn; Mangoni, Alfonso

    2013-01-01

    Summary Sponge symbionts are a largely unexplored source of new and unusual metabolic pathways. Insights into the distribution and function of metabolic genes of sponge symbionts are crucial to dissect and exploit their biotechnological potential. Screening of the metagenome of the marine sponge Plakortis simplex led to the discovery of the swf family, a new group of mono-modular type I polyketide synthase/fatty acid synthase (PKS/FAS) specifically associated with sponge symbionts. Two different examples of the swf cluster were present in the metagenome of P. simplex. A third example of the cluster is present in the previously sequenced genome of a poribacterium from the sponge Aplysina aerophoba but was formerly considered orthologous to the wcb/rkp cluster. The swf cluster was also found in six additional species of sponges. Therefore, the swf cluster represents the second group of mono-modular PKS, after the supA family, to be widespread in marine sponges. The putative swf operon consists of swfA (type I PKS/FAS), swfB (reductase and sulphotransferase domains) and swfC (radical S-adenosylmethionine, or radical SAM). Activation of the acyl carrier protein (ACP) domain of the SwfA protein to its holo-form by co-expression with Svp is the first functional proof of swf type genes in marine sponges. However, the precise biosynthetic role of the swf clusters remains unknown. PMID:24249289

  19. Polyketide genes in the marine sponge Plakortis simplex: a new group of mono-modular type I polyketide synthases from sponge symbionts.

    PubMed

    Della Sala, Gerardo; Hochmuth, Thomas; Costantino, Valeria; Teta, Roberta; Gerwick, William; Gerwick, Lena; Piel, Jörn; Mangoni, Alfonso

    2013-12-01

    Sponge symbionts are a largely unexplored source of new and unusual metabolic pathways. Insights into the distribution and function of metabolic genes of sponge symbionts are crucial to dissect and exploit their biotechnological potential. Screening of the metagenome of the marine sponge Plakortis simplex led to the discovery of the swf family, a new group of mono-modular type I polyketide synthase/fatty acid synthase (PKS/FAS) specifically associated with sponge symbionts. Two different examples of the swf cluster were present in the metagenome of P. simplex. A third example of the cluster is present in the previously sequenced genome of a poribacterium from the sponge Aplysina aerophoba but was formerly considered orthologous to the wcb/rkp cluster. The swf cluster was also found in six additional species of sponges. Therefore, the swf cluster represents the second group of mono-modular PKS, after the supA family, to be widespread in marine sponges. The putative swf operon consists of swfA (type I PKS/FAS), swfB (reductase and sulphotransferase domains) and swfC (radical S-adenosylmethionine, or radical SAM). Activation of the acyl carrier protein (ACP) domain of the SwfA protein to its holo-form by co-expression with Svp is the first functional proof of swf type genes in marine sponges. However, the precise biosynthetic role of the swf clusters remains unknown. PMID:24249289

  20. RNAi and Homologous Over-Expression Based Functional Approaches Reveal Triterpenoid Synthase Gene-Cycloartenol Synthase Is Involved in Downstream Withanolide Biosynthesis in Withania somnifera.

    PubMed

    Mishra, Smrati; Bansal, Shilpi; Mishra, Bhawana; Sangwan, Rajender Singh; Asha; Jadaun, Jyoti Singh; Sangwan, Neelam S

    2016-01-01

    Withania somnifera Dunal, is one of the most commonly used medicinal plant in Ayurvedic and indigenous medicine traditionally owing to its therapeutic potential, because of major chemical constituents, withanolides. Withanolide biosynthesis requires the activities of several enzymes in vivo. Cycloartenol synthase (CAS) is an important enzyme in the withanolide biosynthetic pathway, catalyzing cyclization of 2, 3 oxidosqualene into cycloartenol. In the present study, we have cloned full-length WsCAS from Withania somnifera by homology-based PCR method. For gene function investigation, we constructed three RNAi gene-silencing constructs in backbone of RNAi vector pGSA and a full-length over-expression construct. These constructs were transformed in Agrobacterium strain GV3101 for plant transformation in W. somnifera. Molecular and metabolite analysis was performed in putative Withania transformants. The PCR and Southern blot results showed the genomic integration of these RNAi and overexpression construct(s) in Withania genome. The qRT-PCR analysis showed that the expression of WsCAS gene was considerably downregulated in stable transgenic silenced Withania lines compared with the non-transformed control and HPLC analysis showed that withanolide content was greatly reduced in silenced lines. Transgenic plants over expressing CAS gene displayed enhanced level of CAS transcript and withanolide content compared to non-transformed controls. This work is the first full proof report of functional validation of any metabolic pathway gene in W. somnifera at whole plant level as per our knowledge and it will be further useful to understand the regulatory role of different genes involved in the biosynthesis of withanolides. PMID:26919744

  1. RNAi and Homologous Over-Expression Based Functional Approaches Reveal Triterpenoid Synthase Gene-Cycloartenol Synthase Is Involved in Downstream Withanolide Biosynthesis in Withania somnifera

    PubMed Central

    Mishra, Bhawana; Sangwan, Rajender Singh; Asha; Jadaun, Jyoti Singh; Sangwan, Neelam S.

    2016-01-01

    Withania somnifera Dunal, is one of the most commonly used medicinal plant in Ayurvedic and indigenous medicine traditionally owing to its therapeutic potential, because of major chemical constituents, withanolides. Withanolide biosynthesis requires the activities of several enzymes in vivo. Cycloartenol synthase (CAS) is an important enzyme in the withanolide biosynthetic pathway, catalyzing cyclization of 2, 3 oxidosqualene into cycloartenol. In the present study, we have cloned full-length WsCAS from Withania somnifera by homology-based PCR method. For gene function investigation, we constructed three RNAi gene-silencing constructs in backbone of RNAi vector pGSA and a full-length over-expression construct. These constructs were transformed in Agrobacterium strain GV3101 for plant transformation in W. somnifera. Molecular and metabolite analysis was performed in putative Withania transformants. The PCR and Southern blot results showed the genomic integration of these RNAi and overexpression construct(s) in Withania genome. The qRT-PCR analysis showed that the expression of WsCAS gene was considerably downregulated in stable transgenic silenced Withania lines compared with the non-transformed control and HPLC analysis showed that withanolide content was greatly reduced in silenced lines. Transgenic plants over expressing CAS gene displayed enhanced level of CAS transcript and withanolide content compared to non-transformed controls. This work is the first full proof report of functional validation of any metabolic pathway gene in W. somnifera at whole plant level as per our knowledge and it will be further useful to understand the regulatory role of different genes involved in the biosynthesis of withanolides. PMID:26919744

  2. Polyhydroxyalkanoate production by a novel bacterium Massilia sp. UMI-21 isolated from seaweed, and molecular cloning of its polyhydroxyalkanoate synthase gene.

    PubMed

    Han, Xuerong; Satoh, Yasuharu; Kuriki, Yumi; Seino, Teruyuki; Fujita, Shinji; Suda, Takanori; Kobayashi, Takanori; Tajima, Kenji

    2014-11-01

    We successfully isolated one microorganism (UMI-21) from Ulva, a green algae that contains starch. The strain UMI-21 can produce polyhydroxyalkanoate (PHA) from starch, maltotriose, or maltose as a sole carbon source. Taxonomic studies and 16S rDNA sequence analysis revealed that strain UMI-21 was phylogenetically related to species of the genus Massilia. The PHA content under the cultivation condition using a 10-L jar fermentor was 45.5% (w/w). This value was higher than that obtained after cultivation in a flask, suggesting the possibility of large-scale PHA production by UMI-21 from starch. A major issue for the industrial production of microbial PHAs is the very high production cost. Starch is a relatively inexpensive substrate that is also found in abundant seaweeds such as Ulva. Therefore, the strain isolated in this study may be very useful for producing PHA from seaweeds containing polysaccharides such as starch. In addition, a 3.7-kbp DNA fragment containing the whole PHA synthase gene (phaC) was obtained from the strain UMI-21. The results of open reading frame (ORF) analysis suggested that the DNA fragment contained two ORFs, which were composed of 1740 (phaC) and 564 bp (phaR). The deduced amino acid sequence of PhaC from strain UMI-21 shared high similarity with PhaC from Ralstonia eutropha, which is a representative PHA-producing bacterium with a class I PHA synthase. This is the first report for the cloning of the PHA synthase gene from Massilia species. PMID:24932969

  3. Modulation of medium-chain fatty acid synthesis in Synechococcus sp. PCC 7002 by replacing FabH with a Chaetoceros Ketoacyl-ACP synthase

    DOE PAGESBeta

    Gu, Huiya; Jinkerson, Robert E.; Davies, Fiona K.; Sisson, Lyle A.; Schneider, Philip E.; Posewitz, Matthew C.

    2016-05-26

    The isolation or engineering of algal cells synthesizing high levels of medium-chain fatty acids (MCFAs) is attractive to mitigate the high clouding point of longer chain fatty acids in algal based biodiesel. To develop a more informed understanding of MCFA synthesis in photosynthetic microorganisms, we isolated several algae from Great Salt Lake and screened this collection for MCFA accumulation to identify strains naturally accumulating high levels of MCFA. A diatom, Chaetoceros sp. GSL56, accumulated particularly high levels of C14 (up to 40%), with the majority of C14 fatty acids allocated in triacylglycerols. Using whole cell transcriptome sequencing and de novomore » assembly, putative genes encoding fatty acid synthesis enzymes were identified. Enzymes from this Chaetoceros sp. were expressed in the cyanobacterium Synechococcus sp. PCC 7002 to validate gene function and to determine whether eukaryotic enzymes putatively lacking bacterial evolutionary control mechanisms could be used to improve MCFA production in this promising production strain. Replacement of the Synechococcus 7002 native FabH with a Chaetoceros ketoacyl-ACP synthase Ill increased MCFA synthesis up to fivefold. In conclusion, the level of increase is dependent on promoter strength and culturing conditions.« less

  4. Modulation of Medium-Chain Fatty Acid Synthesis in Synechococcus sp. PCC 7002 by Replacing FabH with a Chaetoceros Ketoacyl-ACP Synthase

    PubMed Central

    Gu, Huiya; Jinkerson, Robert E.; Davies, Fiona K.; Sisson, Lyle A.; Schneider, Philip E.; Posewitz, Matthew C.

    2016-01-01

    The isolation or engineering of algal cells synthesizing high levels of medium-chain fatty acids (MCFAs) is attractive to mitigate the high clouding point of longer chain fatty acids in algal based biodiesel. To develop a more informed understanding of MCFA synthesis in photosynthetic microorganisms, we isolated several algae from Great Salt Lake and screened this collection for MCFA accumulation to identify strains naturally accumulating high levels of MCFA. A diatom, Chaetoceros sp. GSL56, accumulated particularly high levels of C14 (up to 40%), with the majority of C14 fatty acids allocated in triacylglycerols. Using whole cell transcriptome sequencing and de novo assembly, putative genes encoding fatty acid synthesis enzymes were identified. Enzymes from this Chaetoceros sp. were expressed in the cyanobacterium Synechococcus sp. PCC 7002 to validate gene function and to determine whether eukaryotic enzymes putatively lacking bacterial evolutionary control mechanisms could be used to improve MCFA production in this promising production strain. Replacement of the Synechococcus 7002 native FabH with a Chaetoceros ketoacyl-ACP synthase III increased MCFA synthesis up to fivefold. The level of increase is dependent on promoter strength and culturing conditions. PMID:27303412

  5. Modulation of Medium-Chain Fatty Acid Synthesis in Synechococcus sp. PCC 7002 by Replacing FabH with a Chaetoceros Ketoacyl-ACP Synthase.

    PubMed

    Gu, Huiya; Jinkerson, Robert E; Davies, Fiona K; Sisson, Lyle A; Schneider, Philip E; Posewitz, Matthew C

    2016-01-01

    The isolation or engineering of algal cells synthesizing high levels of medium-chain fatty acids (MCFAs) is attractive to mitigate the high clouding point of longer chain fatty acids in algal based biodiesel. To develop a more informed understanding of MCFA synthesis in photosynthetic microorganisms, we isolated several algae from Great Salt Lake and screened this collection for MCFA accumulation to identify strains naturally accumulating high levels of MCFA. A diatom, Chaetoceros sp. GSL56, accumulated particularly high levels of C14 (up to 40%), with the majority of C14 fatty acids allocated in triacylglycerols. Using whole cell transcriptome sequencing and de novo assembly, putative genes encoding fatty acid synthesis enzymes were identified. Enzymes from this Chaetoceros sp. were expressed in the cyanobacterium Synechococcus sp. PCC 7002 to validate gene function and to determine whether eukaryotic enzymes putatively lacking bacterial evolutionary control mechanisms could be used to improve MCFA production in this promising production strain. Replacement of the Synechococcus 7002 native FabH with a Chaetoceros ketoacyl-ACP synthase III increased MCFA synthesis up to fivefold. The level of increase is dependent on promoter strength and culturing conditions. PMID:27303412

  6. Congenital erythropoietic porphyria: identification and expression of 10 mutations in the uroporphyrinogen III synthase gene.

    PubMed Central

    Xu, W; Warner, C A; Desnick, R J

    1995-01-01

    To investigate the molecular basis of the phenotypic heterogeneity in congenital erythropoietic porphyria, the mutations in the uroporphyrinogen III synthase gene from unrelated patients were determined. Six missense (L4F, Y19C, V82F, V99A, A104V, and G225S), a nonsense (Q249X), a frameshift (633insA), and two splicing mutations (IVS2+1 and IVS9 delta A + 4) were identified. When L4F, Y19C, V82F, V99A, A104V, 633insA, G225S, and Q249X were expressed in Escherichia coli, only the V82F, V99A, and A104V alleles expressed residual enzymatic activity. Of note, the V82F mutation, which occurs adjacent to the 5' donor site of intron 4, resulted in approximately 54% aberrantly spliced transcripts with exon 4 deleted. Thus, this novel exonic single-base substitution caused two lesions, a missense mutation and an aberrantly spliced transcript. Of the splicing mutations, the IVS2+1 allele produced a single transcript with exon 2 deleted, whereas the IVS9 delta A+4 allele was alternatively spliced, approximately 26% being normal transcripts and the remainder with exon 9 deleted. The amount of residual activity expressed by each allele provided a basis to correlate genotype with disease severity, thereby permitting genotype/phenotype predictions in this clinically heterogeneous disease. Images PMID:7860775

  7. An update to polyketide synthase and non-ribosomal synthetase genes and nomenclature in Fusarium.

    PubMed

    Hansen, Frederik T; Gardiner, Donald M; Lysøe, Erik; Fuertes, Patricia Romans; Tudzynski, Bettina; Wiemann, Philipp; Sondergaard, Teis Esben; Giese, Henriette; Brodersen, Ditlev E; Sørensen, Jens Laurids

    2015-02-01

    Members of the genus Fusarium produce a plethora of bioactive secondary metabolites, which can be harmful to humans and animals or have potential in drug development. In this study we have performed comparative analyses of polyketide synthases (PKSs) and non-ribosomal peptide synthetases (NRPSs) from ten different Fusarium species including F. graminearum (two strains), F. verticillioides, F. solani, F. culmorum, F. pseudograminearum, F. fujikuroi, F. acuminatum, F. avenaceum, F. equiseti, and F. oxysporum (12 strains). This led to identification of 52 NRPS and 52 PKSs orthology groups, respectively, and although not all PKSs and NRPSs are assumed to be intact or functional, the analyses illustrate the huge secondary metabolite potential in Fusarium. In our analyses we identified a core collection of eight NRPSs (NRPS2-4, 6, 10-13) and two PKSs (PKS3 and PKS7) that are conserved in all strains analyzed in this study. The identified PKSs and NRPSs were named based on a previously developed classification system (www.FusariumNRPSPKS.dk). We suggest this system be used when PKSs and NRPSs have to be classified in future sequenced Fusarium strains. This system will facilitate identification of orthologous and non-orthologous NRPSs and PKSs from newly sequenced Fusarium genomes and will aid the scientific community by providing a common nomenclature for these two groups of genes/enzymes. PMID:25543026

  8. Genes encoding chavicol/eugenol synthase from the creosote bush Larrea tridentata

    SciTech Connect

    Lewis, Norman G.; Davin, Laurence B.; Kim, Sung -Jin; Vassao, Daniel Giddings; Patten, Ann M.; Eichinger, Dietmar

    2015-09-15

    Particular aspects provide novel methods for redirecting carbon allocation in plants or cell culture from lignification to inherently more useful and tractable materials, and to facilitate the generation of, e.g., biofuels from the remaining plant ro culture biomass. Particular aspects provided novel methods for converting monolignols into allyl/propenyl phenols, and for chavicol/eugenol formation or production. Additional aspects relate to the discovery of novel chavicol/eugenol synthases that convert p-coumaryl/coniferyl alcohol esters into chavicol/eugenol, and to novel compositions (e.g., novel proteins and nucleic acids encoding same), and novel methods using same for producing or forming chavicol/eugenol and other derivatives in cell culture and/or genetically modified plants, and for re-engineering the composition of plant biomass. Particular aspects provide novel methods for generation in culture or in planta of liquid/combustible allyl/propenyl phenols, and these phenolic products are utilized for (non-ethanol) biofuel/bioenergy purposes, while the remaining plant biomass facilitates the generation of other biofuels.

  9. Classification of fungal chitin synthases.

    PubMed Central

    Bowen, A R; Chen-Wu, J L; Momany, M; Young, R; Szaniszlo, P J; Robbins, P W

    1992-01-01

    Comparison of the chitin synthase genes of Saccharomyces cerevisiae CHS1 and CHS2 with the Candida albicans CHS1 gene (UDP-N-acetyl-D-glucosamine:chitin 4-beta-N-acetylglucosaminyltransferase, EC 2.4.1.16) revealed two small regions of complete amino acid sequence conservation that were used to design PCR primers. Fragments homologous to chitin synthase (approximately 600 base pairs) were amplified from the genomic DNA of 14 fungal species. These fragments were sequenced, and their deduced amino acid sequences were aligned. With the exception of S. cerevisiae CHS1, the sequences fell into three distinct classes, which could represent separate functional groups. Within each class phylogenetic analysis was performed. Although not the major purpose of the investigation, this analysis tends to confirm some relationships consistent with current taxonomic groupings. Images PMID:1731323

  10. Chitin synthase 3 from yeast has zymogenic properties that depend on both the CAL1 and the CAL3 genes.

    PubMed Central

    Choi, W J; Sburlati, A; Cabib, E

    1994-01-01

    In previous studies, chitin synthase 3 (Chs3), the enzyme responsible for synthesis of most of the chitin present in the yeast cell, was found to be inactivated by incubation with trypsin, in contrast to other yeast chitin synthases (Chs1 and Chs2), which are stimulated by this treatment (chitin synthase; UDP-N-acetyl-D-glucosamine:chitin 4-beta-N-acetylglucosaminyl-transferase, EC 2.4.1.16). It has now been found that the substrate UDPGlcNAc protects Chs3 against proteolytic inactivation. Treatment of Chs3-containing membranes with detergents drastically reduced the enzymatic activity. Activity could, however, be restored by subsequent incubation with trypsin or other proteases in the presence of UDPGlcNAc. Under such conditions, protease treatment stimulated activity as much as 10-fold. A change in divalent cation specificity after trypsin treatment suggests that the protease directly affects the enzyme molecule. Experiments with mutants in the three genes involved in Chs3 activity--CAL1, CAL2, and CAL3--showed that only CAL1 and CAL3 are required for the protease-elicited (zymogenic) activity. It is concluded that Chs3 is a zymogen and that the CAL2 product functions as its activator. The differences and possible similarities between Chs3 and the other chitin synthases are discussed. PMID:8197125

  11. Functional Analysis of the Phycomyces carRA Gene Encoding the Enzymes Phytoene Synthase and Lycopene Cyclase

    PubMed Central

    Sanz, Catalina; Velayos, Antonio; Álvarez, María Isabel; Benito, Ernesto P.; Eslava, Arturo P.

    2011-01-01

    Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism. PMID:21858003

  12. Identification of amino acid networks governing catalysis in the closed complex of class I terpene synthases

    PubMed Central

    Buettner, Alexander; Goerner, Christian; Hertel, Michael; van Rijn, Jeaphianne; Wallrapp, Frank; Eisenreich, Wolfgang; Sieber, Volker; Kourist, Robert; Brück, Thomas

    2016-01-01

    Class I terpene synthases generate the structural core of bioactive terpenoids. Deciphering structure–function relationships in the reactive closed complex and targeted engineering is hampered by highly dynamic carbocation rearrangements during catalysis. Available crystal structures, however, represent the open, catalytically inactive form or harbor nonproductive substrate analogs. Here, we present a catalytically relevant, closed conformation of taxadiene synthase (TXS), the model class I terpene synthase, which simulates the initial catalytic time point. In silico modeling of subsequent catalytic steps allowed unprecedented insights into the dynamic reaction cascades and promiscuity mechanisms of class I terpene synthases. This generally applicable methodology enables the active-site localization of carbocations and demonstrates the presence of an active-site base motif and its dominating role during catalysis. It additionally allowed in silico-designed targeted protein engineering that unlocked the path to alternate monocyclic and bicyclic synthons representing the basis of a myriad of bioactive terpenoids. PMID:26842837

  13. Identification of amino acid networks governing catalysis in the closed complex of class I terpene synthases.

    PubMed

    Schrepfer, Patrick; Buettner, Alexander; Goerner, Christian; Hertel, Michael; van Rijn, Jeaphianne; Wallrapp, Frank; Eisenreich, Wolfgang; Sieber, Volker; Kourist, Robert; Brück, Thomas

    2016-02-23

    Class I terpene synthases generate the structural core of bioactive terpenoids. Deciphering structure-function relationships in the reactive closed complex and targeted engineering is hampered by highly dynamic carbocation rearrangements during catalysis. Available crystal structures, however, represent the open, catalytically inactive form or harbor nonproductive substrate analogs. Here, we present a catalytically relevant, closed conformation of taxadiene synthase (TXS), the model class I terpene synthase, which simulates the initial catalytic time point. In silico modeling of subsequent catalytic steps allowed unprecedented insights into the dynamic reaction cascades and promiscuity mechanisms of class I terpene synthases. This generally applicable methodology enables the active-site localization of carbocations and demonstrates the presence of an active-site base motif and its dominating role during catalysis. It additionally allowed in silico-designed targeted protein engineering that unlocked the path to alternate monocyclic and bicyclic synthons representing the basis of a myriad of bioactive terpenoids. PMID:26842837

  14. Evolution of Conifer Diterpene Synthases: Diterpene Resin Acid Biosynthesis in Lodgepole Pine and Jack Pine Involves Monofunctional and Bifunctional Diterpene Synthases1[W][OA

    PubMed Central

    Hall, Dawn E.; Zerbe, Philipp; Jancsik, Sharon; Quesada, Alfonso Lara; Dullat, Harpreet; Madilao, Lina L.; Yuen, Macaire; Bohlmann, Jörg

    2013-01-01

    Diterpene resin acids (DRAs) are major components of pine (Pinus spp.) oleoresin. They play critical roles in conifer defense against insects and pathogens and as a renewable resource for industrial bioproducts. The core structures of DRAs are formed in secondary (i.e. specialized) metabolism via cycloisomerization of geranylgeranyl diphosphate (GGPP) by diterpene synthases (diTPSs). Previously described gymnosperm diTPSs of DRA biosynthesis are bifunctional enzymes that catalyze the initial bicyclization of GGPP followed by rearrangement of a (+)-copalyl diphosphate intermediate at two discrete class II and class I active sites. In contrast, similar diterpenes of gibberellin primary (i.e. general) metabolism are produced by the consecutive activity of two monofunctional class II and class I diTPSs. Using high-throughput transcriptome sequencing, we discovered 11 diTPS from jack pine (Pinus banksiana) and lodgepole pine (Pinus contorta). Three of these were orthologous to known conifer bifunctional levopimaradiene/abietadiene synthases. Surprisingly, two sets of orthologous PbdiTPSs and PcdiTPSs were monofunctional class I enzymes that lacked functional class II active sites and converted (+)-copalyl diphosphate, but not GGPP, into isopimaradiene and pimaradiene as major products. Diterpene profiles and transcriptome sequences of lodgepole pine and jack pine are consistent with roles for these diTPSs in DRA biosynthesis. The monofunctional class I diTPSs of DRA biosynthesis form a new clade within the gymnosperm-specific TPS-d3 subfamily that evolved from bifunctional diTPS rather than monofunctional enzymes (TPS-c and TPS-e) of gibberellin metabolism. Homology modeling suggested alterations in the class I active site that may have contributed to their functional specialization relative to other conifer diTPSs. PMID:23370714

  15. Insulin inhibits delta-aminolevulinate synthase gene expression in rat hepatocytes and human hepatoma cells.

    PubMed

    Scassa, M E; Varone, C L; Montero, L; Cánepa, E T

    1998-11-01

    Insulin has been known to regulate intracellular metabolism by modifying the activity or location of many enzymes but it is only in the past few years that the regulation of gene expression is recognized to be a major action of this hormone. The present work provides evidences that insulin inhibits delta-aminolevulinate synthase (ALA-S) gene expression, the enzyme which governs the rate-limiting step in heme biosynthesis. The addition of 5 nM insulin to hepatocytes culture led to a significant decrease of both basal and phenobarbital-induced ALA-S mRNA in a dose-dependent manner, as measured by Northern and slot-blot analysis. Several clues as to how insulin regulates ALA-S transcription were determined. The inhibitory effect is achieved at physiological concentrations but much higher proinsulin doses are needed. Insulin's effect is rapid, quite specific, and protein synthesis is not required. Moreover, ALA-S mRNA half-life is not modified by the presence of the peptidic hormone. Our results demonstrate that the insulin effect is dominant; it overrides 8-CPT-cAMP plus phenobarbital-mediated induction. Also, insulin requires the activation of protein kinase C to exert its full effect. On the other hand, a 870-bp fragment of the ALA-S promoter region is able to sustain the inhibition of CAT expression in plasmid-transfected HepG2 cells. Thus, these results indicate that insulin plays an important role in regulating ALA-S expression by inhibiting its transcription. PMID:9806796

  16. A Malus Crabapple Chalcone Synthase Gene, McCHS, Regulates Red Petal Color and Flavonoid Biosynthesis

    PubMed Central

    Song, Tingting; Yao, Yuncong

    2014-01-01

    Chalcone synthase is a key and often rate-limiting enzyme in the biosynthesis of anthocyanin pigments that accumulate in plant organs such as flowers and fruits, but the relationship between CHS expression and the petal coloration level in different cultivars is still unclear. In this study, three typical crabapple cultivars were chosen based on different petal colors and coloration patterns. The two extreme color cultivars, ‘Royalty’ and ‘Flame’, have dark red and white petals respectively, while the intermediate cultivar ‘Radiant’ has pink petals. We detected the flavoniods accumulation and the expression levels of McCHS during petals expansion process in different cultivars. The results showed McCHS have their special expression patterns in each tested cultivars, and is responsible for the red coloration and color variation in crabapple petals, especially for color fade process in ‘Radiant’. Furthermore, tobacco plants constitutively expressing McCHS displayed a higher anthocyanins accumulation and a deeper red petal color compared with control untransformed lines. Moreover, the expression levels of several anthocyanin biosynthetic genes were higher in the transgenic McCHS overexpressing tobacco lines than in the control plants. A close relationship was observed between the expression of McCHS and the transcription factors McMYB4 and McMYB5 during petals development in different crabapple cultivars, suggesting that the expression of McCHS was regulated by these transcription factors. We conclude that the endogenous McCHS gene is a critical factor in the regulation of anthocyanin biosynthesis during petal coloration in Malus crabapple. PMID:25357207

  17. Biological activities of novel zaragozic acids, the potent inhibitors of squalene synthase, produced by the fungus, Mollisia sp. SANK 10294.

    PubMed

    Tanimoto, T; Hamano, K; Onodera, K; Hosoya, T; Kakusaka, M; Hirayama, T; Shimada, Y; Koga, T; Tsujita, Y

    1997-05-01

    Four novel zaragozic acids, F-10863A, B, C and D, were isolated from a culture broth of the fungus Mollisia sp. SANK 10294. F-10863 compounds contain a 4,6,7-trihydroxy-2,8-dioxyobicyclo-[3.2.1]octane-3,4,5-tricarboxyl ic acid core like previously reported zaragozic acids, but the structures of the side chains are different. Recently, it was found that F-10863A is identical to zaragozic acid D3, while the other three are novel compounds. F-10863 compounds are potent inhibitors of squalene synthase like previously reported zaragozic acids, and, furthermore, they exhibit serum cholesterol-lowering activity in vivo. PMID:9207908

  18. Transcripts of two ent-copalyl diphosphate synthase genes differentially localize in rice plants according to their distinct biological roles

    PubMed Central

    Toyomasu, Tomonobu; Usui, Masami; Sugawara, Chizu; Kanno, Yuri; Sakai, Arisa; Takahashi, Hirokazu; Nakazono, Mikio; Kuroda, Masaharu; Miyamoto, Koji; Morimoto, Yu; Mitsuhashi, Wataru; Okada, Kazunori; Yamaguchi, Shinjiro; Yamane, Hisakazu

    2015-01-01

    Gibberellins (GAs) are diterpenoid phytohormones that regulate various aspects of plant growth. Tetracyclic hydrocarbon ent-kaurene is a biosynthetic intermediate of GAs, and is converted from geranylgeranyl diphosphate, a common precursor of diterpenoids, via ent-copalyl diphosphate (ent-CDP) through successive cyclization reactions catalysed by two distinct diterpene synthases, ent-CDP synthase and ent-kaurene synthase. Rice (Oryza sativa L.) has two ent-CDP synthase genes, OsCPS1 and OsCPS2. It has been thought that OsCPS1 participates in GA biosynthesis, while OsCPS2 participates in the biosynthesis of phytoalexins, phytocassanes A–E, and oryzalexins A–F. It has been shown previously that loss-of-function OsCPS1 mutants display a severe dwarf phenotype caused by GA deficiency despite possessing another ent-CDP synthase gene, OsCPS2. Here, experiments were performed to account for the non-redundant biological function of OsCPS1 and OsCPS2. Quantitative reverse transcription–PCR (qRT–PCR) analysis showed that OsCPS2 transcript levels were drastically lower than those of OsCPS1 in the basal parts, including the meristem of the second-leaf sheaths of rice seedlings. qRT–PCR results using tissue samples prepared by laser microdissection suggested that OsCPS1 transcripts mainly localized in vascular bundle tissues, similar to Arabidopsis CPS, which is responsible for GA biosynthesis, whereas OsCPS2 transcripts mainly localized in epidermal cells that address environmental stressors such as pathogen attack. Furthermore, the OsCPS2 transgene under regulation of the OsCPS1 promoter complemented the dwarf phenotype of an OsCPS1 mutant, oscps1-1. The results indicate that transcripts of the two ent-CDP synthase genes differentially localize in rice plants according to their distinct biological roles, OsCPS1 for growth and OsCPS2 for defence. PMID:25336684

  19. Localization of the squalene synthase gene (FDFT1) to human chromosome 8p22-p23. 1

    SciTech Connect

    Shechter, I.; Conrad, D.G.; Hart, I.; Berger, R.C.; McKenzie, T.L.; Bleskan, J.; Patterson, D. )

    1994-03-01

    Recently, the authors reported the isolation of a cDNA encoding the human enzyme squalene synthase, the first step of sterol biosynthesis uniquely committed to synthesis of cholesterol. As such, it is likely that this enzyme occupies a critical regulatory position in the synthesis of cholesterol. As part of continuing studies of the role of this gene in cellular metabolism, they undertook the mapping of this gene on the human chromosomes. To localize the gene, they first isolated a yeast artificial chromosome (YAC) containing the squalene synthase gene. They then used fluorescence in situ hybridization (FISH) with yeast DNA containing the YAC to localize the gene to chromosome 8. Assignment to human chromosome 8 was confirmed by polymerase chain reaction analysis of a somatic cell hybrid containing human chromosome 8. Use of a somatic cell hybrid regional mapping panel dividing chromosome 8 into several fragments localized the gene to 8p21-pter. Fractional length analysis of the FISH mapping placed the signal generated with this YAC at 8p22-p23.1. 13 refs., 2 figs.

  20. Biosynthesis of riboflavin: an unusual riboflavin synthase of Methanobacterium thermoautotrophicum.

    PubMed Central

    Eberhardt, S; Korn, S; Lottspeich, F; Bacher, A

    1997-01-01

    Riboflavin synthase was purified by a factor of about 1,500 from cell extract of Methanobacterium thermoautotrophicum. The enzyme had a specific activity of about 2,700 nmol mg(-1) h(-1) at 65 degrees C, which is relatively low compared to those of riboflavin synthases of eubacteria and yeast. Amino acid sequences obtained after proteolytic cleavage had no similarity with known riboflavin synthases. The gene coding for riboflavin synthase (designated ribC) was subsequently cloned by marker rescue with a ribC mutant of Escherichia coli. The ribC gene of M. thermoautotrophicum specifies a protein of 153 amino acid residues. The predicted amino acid sequence agrees with the information gleaned from Edman degradation of the isolated protein and shows 67% identity with the sequence predicted for the unannotated reading frame MJ1184 of Methanococcus jannaschii. The ribC gene is adjacent to a cluster of four genes with similarity to the genes cbiMNQO of Salmonella typhimurium, which form part of the cob operon (this operon contains most of the genes involved in the biosynthesis of vitamin B12). The amino acid sequence predicted by the ribC gene of M. thermoautotrophicum shows no similarity whatsoever to the sequences of riboflavin synthases of eubacteria and yeast. Most notably, the M. thermoautotrophicum protein does not show the internal sequence homology characteristic of eubacterial and yeast riboflavin synthases. The protein of M. thermoautotrophicum can be expressed efficiently in a recombinant E. coli strain. The specific activity of the purified, recombinant protein is 1,900 nmol mg(-1) h(-1) at 65 degrees C. In contrast to riboflavin synthases from eubacteria and fungi, the methanobacterial enzyme has an absolute requirement for magnesium ions. The 5' phosphate of 6,7-dimethyl-8-ribityllumazine does not act as a substrate. The findings suggest that riboflavin synthase has evolved independently in eubacteria and methanobacteria. PMID:9139911

  1. Proteomic Upregulation of Fatty Acid Synthase and Fatty Acid Binding Protein 5 and Identification of Cancer- and Race-Specific Pathway Associations in Human Prostate Cancer Tissues

    PubMed Central

    Myers, Jennifer S.; von Lersner, Ariana K.; Sang, Qing-Xiang Amy

    2016-01-01

    Protein profiling studies of prostate cancer have been widely used to characterize molecular differences between diseased and non-diseased tissues. When combined with pathway analysis, profiling approaches are able to identify molecular mechanisms of prostate cancer, group patients by cancer subtype, and predict prognosis. This strategy can also be implemented to study prostate cancer in very specific populations, such as African Americans who have higher rates of prostate cancer incidence and mortality than other racial groups in the United States. In this study, age-, stage-, and Gleason score-matched prostate tumor specimen from African American and Caucasian American men, along with non-malignant adjacent prostate tissue from these same patients, were compared. Protein expression changes and altered pathway associations were identified in prostate cancer generally and in African American prostate cancer specifically. In comparing tumor to non-malignant samples, 45 proteins were significantly cancer-associated and 3 proteins were significantly downregulated in tumor samples. Notably, fatty acid synthase (FASN) and epidermal fatty acid-binding protein (FABP5) were upregulated in human prostate cancer tissues, consistent with their known functions in prostate cancer progression. Aldehyde dehydrogenase family 1 member A3 (ALDH1A3) was also upregulated in tumor samples. The Metastasis Associated Protein 3 (MTA3) pathway was significantly enriched in tumor samples compared to non-malignant samples. While the current experiment was unable to detect statistically significant differences in protein expression between African American and Caucasian American samples, differences in overrepresentation and pathway enrichment were found. Structural components (Cytoskeletal Proteins and Extracellular Matrix Protein protein classes, and Biological Adhesion Gene Ontology (GO) annotation) were overrepresented in African American but not Caucasian American tumors. Additionally, 5

  2. Cancer cell-associated fatty acid synthase activates endothelial cells and promotes angiogenesis in colorectal cancer.

    PubMed

    Zaytseva, Yekaterina Y; Elliott, Victoria A; Rychahou, Piotr; Mustain, W Conan; Kim, Ji Tae; Valentino, Joseph; Gao, Tianyan; O'Connor, Kathleen L; Neltner, Janna M; Lee, Eun Y; Weiss, Heidi L; Evers, B Mark

    2014-06-01

    Upregulation of fatty acid synthase (FASN), a key enzyme of de novo lipogenesis, is associated with metastasis in colorectal cancer (CRC). However, the mechanisms of regulation are unknown. Since angiogenesis is crucial for metastasis, we investigated the role of FASN in the neovascularization of CRC. The effect of FASN on tumor vasculature was studied in orthotopic CRCs, the chick embryo chorioallantoic membrane (CAM) and Matrigel plug models using immunohistochemistry, immunofluorescent staining and confocal microscopy. Cell secretion was evaluated by ELISA and antibody arrays. Proliferation, migration and tubulogenesis of endothelial cells (ECs) were assessed in CRC-EC coculture models. In this study, we found that stable knockdown of FASN decreased microvessel density in HT29 and HCT116 orthotopic CRCs and resulted in 'normalization' of tumor vasculature in both orthotopic and CAM models. Furthermore, FASN regulated secretion of pro- and antiangiogenic factors, including vascular endothelial growth factor-A (VEGF-A). Mechanisms associated with the antiangiogenic activity noted with knockdown of FASN included: downregulation of VEGF(189), upregulation of antiangiogenic isoform VEGF(165b) and a decrease in expression and activity of matrix metalloproteinase-9. Furthermore, conditioned medium from FASN knockdown CRC cells inhibited activation of vascular endothelial growth factor receptor-2 and its downstream signaling and decreased proliferation, migration and tubulogenesis of ECs as compared with control medium. Together, these results suggest that cancer cell-associated FASN regulates tumor vasculature through alteration of the profile of secreted angiogenic factors and regulation of their bioavailability. Inhibition of FASN upstream of VEGF-A and other angiogenic pathways can be a novel therapeutic strategy to prevent or inhibit metastasis in CRC. PMID:24510238

  3. Cancer cell-associated fatty acid synthase activates endothelial cells and promotes angiogenesis in colorectal cancer

    PubMed Central

    Evers, B.Mark

    2014-01-01

    Upregulation of fatty acid synthase (FASN), a key enzyme of de novo lipogenesis, is associated with metastasis in colorectal cancer (CRC). However, the mechanisms of regulation are unknown. Since angiogenesis is crucial for metastasis, we investigated the role of FASN in the neovascularization of CRC. The effect of FASN on tumor vasculature was studied in orthotopic CRCs, the chick embryo chorioallantoic membrane (CAM) and Matrigel plug models using immunohistochemistry, immunofluorescent staining and confocal microscopy. Cell secretion was evaluated by ELISA and antibody arrays. Proliferation, migration and tubulogenesis of endothelial cells (ECs) were assessed in CRC–EC coculture models. In this study, we found that stable knockdown of FASN decreased microvessel density in HT29 and HCT116 orthotopic CRCs and resulted in ‘normalization’ of tumor vasculature in both orthotopic and CAM models. Furthermore, FASN regulated secretion of pro- and antiangiogenic factors, including vascular endothelial growth factor-A (VEGF-A). Mechanisms associated with the antiangiogenic activity noted with knockdown of FASN included: downregulation of VEGF189, upregulation of antiangiogenic isoform VEGF165b and a decrease in expression and activity of matrix metalloproteinase-9. Furthermore, conditioned medium from FASN knockdown CRC cells inhibited activation of vascular endothelial growth factor receptor-2 and its downstream signaling and decreased proliferation, migration and tubulogenesis of ECs as compared with control medium. Together, these results suggest that cancer cell-associated FASN regulates tumor vasculature through alteration of the profile of secreted angiogenic factors and regulation of their bioavailability. Inhibition of FASN upstream of VEGF-A and other angiogenic pathways can be a novel therapeutic strategy to prevent or inhibit metastasis in CRC. PMID:24510238

  4. Sequence of the bchG gene from Chloroflexus aurantiacus: relationship between chlorophyll synthase and other polyprenyltransferases

    NASA Technical Reports Server (NTRS)

    Lopez, J. C.; Ryan, S.; Blankenship, R. E.

    1996-01-01

    The sequence of the Chloroflexus aurantiacus open reading frame thought to be the C. aurantiacus homolog of the Rhodobacter capsulatus bchG gene is reported. The BchG gene product catalyzes esterification of bacteriochlorophyllide a by geranylgeraniol-PPi during bacteriochlorophyll a biosynthesis. Homologs from Arabidopsis thaliana, Synechocystis sp. strain PCC6803, and C. aurantiacus were identified in database searches. Profile analysis identified three related polyprenyltransferase enzymes which attach an aliphatic alcohol PPi to an aromatic substrate. This suggests a broader relationship between chlorophyll synthases and other polyprenyltransferases.

  5. Multiple resistance to sulfonylureas and imidazolinones conferred by an acetohydroxyacid synthase gene with separate mutations for selective resistance.

    PubMed

    Hattori, J; Rutledge, R; Labbé, H; Brown, D; Sunohara, G; Miki, B

    1992-03-01

    The acetohydroxyacid synthase (AHAS) gene from the Arabidopsis thaliana mutant line GH90 carrying the imidazolinone resistance allele imr1 was cloned. Expression of the AHAS gene under the control of the CaMV 35S promoter in transgenic tobacco resulted in selective imidazolinone resistance, confirming that the single base-pair change found near the 3' end of the coding region of this gene is responsible for imidazolinone resistance. A chimeric AHAS gene containing both the imr1 mutation and the csr1 mutation, responsible for selective resistance to sulfonylurea herbicides, was constructed. It conferred on transgenic tobacco plants resistance to both sulfonylurea and imidazolinone herbicides. The data illustrate that a multiple-resistance phenotype can be achieved in an AHAS gene through combinations of separate mutations, each of which individually confers resistance to only one class of herbicides. PMID:1557022

  6. The Sesquiterpene Synthase from the Botrydial Biosynthetic Gene Cluster of the Phytopathogen Botrytis cinerea

    PubMed Central

    Pinedo, Cristina; Wang, Chieh-Mei; Pradier, Jean-Marc; Dalmais, Bérengère; Choquer, Mathias; Pêcheur, Pascal Le; Morgant, Guillaume; Collado, Isidro G.; Cane, David E.; Viaud, Muriel

    2009-01-01

    The fungus Botrytis cinerea is the causal agent of the economically important gray mold disease that affects more than 200 ornamental and agriculturally important plant species. B. cinerea is a necrotrophic plant pathogen that secretes nonspecific phytotoxins, including the sesquiterpene botrydial and the polyketide botcinic acid. The region surrounding the previously characterized BcBOT1 gene has now been identified as the botrydial biosynthetic gene cluster. Five genes including BcBOT1 and BcBOT2 were shown by quantitative Reverse Transcription-PCR to be co-regulated through the calcineurin signaling pathway. Inactivation of the BcBOT2 gene, encoding a putative sesquiterpene cyclase, abolished botrydial biosynthesis, which could be restored by in trans complementation. Inactivation of BcBOT2 also resulted in over-production of botcinic acid that was observed to be strain-dependent. Recombinant BcBOT2 protein converted farnesyl diphosphate to the parent sesquiterpene of the botrydial biosynthetic pathway, the tricyclic alcohol presilphiperfolan-8β-ol. PMID:19035644

  7. Physiological implications of the specificity of acetohydroxy acid synthase isozymes of enteric bacteria.

    PubMed Central

    Barak, Z; Chipman, D M; Gollop, N

    1987-01-01

    The rates of formation of the two alternative products of acetohydroxy acid synthase (AHAS) have been determined by a new analytical method (N. Gollop, Z. Barak, and D. M. Chipman, Anal. Biochem., 160:323-331, 1987). For each of the three distinct isozymes of AHAS in Escherichia coli and Salmonella typhimurium, a specificity ratio, R, was defined: Formula: see text, which is constant over a wide range of substrate concentrations. This is consistent with competition between pyruvate and 2-ketobutyrate for an active acetaldehyde intermediate formed irreversibly after addition of the first pyruvate moiety to the enzyme. Isozyme I showed no product preference (R = 1), whereas isozymes II and III form acetohydroxybutyrate (AHB) at approximately 180- and 60-fold faster rates, respectively, than acetolactate (AL) at equal pyruvate and 2-ketobutyrate concentrations. R values higher than 60 represent remarkably high specificity in favor of the substrate with one extra methylene group. In exponentially growing E. coli cells (under aerobic growth on glucose), which contain about 300 microM pyruvate and only 3 microM 2-ketobutyrate, AHAS I would produce almost entirely AL and only 1 to 2% AHB. However, isozymes II and III would synthesize AHB (on the pathway to Ile) and AL (on the pathway to valine-leucine) in essentially the ratio required for protein synthesis. The specificity ratio R of any AHAS isozyme was affected neither by the natural feedback inhibitors (Val, Ile) nor by the pH. On the basis of the specificities of the isozymes, the known regulation of AHAS I expression by the catabolite repression system, and the reported behavior of bacterial mutants containing single AHAS isozymes, we suggest that AHAS I enables a bacterium to cope with poor carbon sources, which lead to low endogenous pyruvate concentrations. Although AHAS II and III are well suited to producing the branched-chain amino acid precursors during growth on glucose, they would fail to provide

  8. Fatty Acid Synthase Cooperates with Glyoxalase 1 to Protect against Sugar Toxicity

    PubMed Central

    Garrido, Damien; Rubin, Thomas; Poidevin, Mickael; Maroni, Brigitte; Le Rouzic, Arnaud; Parvy, Jean-Philippe; Montagne, Jacques

    2015-01-01

    Fatty acid (FA) metabolism is deregulated in several human diseases including metabolic syndrome, type 2 diabetes and cancers. Therefore, FA-metabolic enzymes are potential targets for drug therapy, although the consequence of these treatments must be precisely evaluated at the organismal and cellular levels. In healthy organism, synthesis of triacylglycerols (TAGs)—composed of three FA units esterified to a glycerol backbone—is increased in response to dietary sugar. Saturation in the storage and synthesis capacity of TAGs is associated with type 2 diabetes progression. Sugar toxicity likely depends on advanced-glycation-end-products (AGEs) that form through covalent bounding between amine groups and carbonyl groups of sugar or their derivatives α-oxoaldehydes. Methylglyoxal (MG) is a highly reactive α-oxoaldehyde that is derived from glycolysis through a non-enzymatic reaction. Glyoxalase 1 (Glo1) works to neutralize MG, reducing its deleterious effects. Here, we have used the power of Drosophila genetics to generate Fatty acid synthase (FASN) mutants, allowing us to investigate the consequence of this deficiency upon sugar-supplemented diets. We found that FASN mutants are lethal but can be rescued by an appropriate lipid diet. Rescued animals do not exhibit insulin resistance, are dramatically sensitive to dietary sugar and accumulate AGEs. We show that FASN and Glo1 cooperate at systemic and cell-autonomous levels to protect against sugar toxicity. We observed that the size of FASN mutant cells decreases as dietary sucrose increases. Genetic interactions at the cell-autonomous level, where glycolytic enzymes or Glo1 were manipulated in FASN mutant cells, revealed that this sugar-dependent size reduction is a direct consequence of MG-derived-AGE accumulation. In summary, our findings indicate that FASN is dispensable for cell growth if extracellular lipids are available. In contrast, FA-synthesis appears to be required to limit a cell

  9. Physiological implications of the specificity of acetohydroxy acid synthase isozymes of enteric bacteria.

    PubMed

    Barak, Z; Chipman, D M; Gollop, N

    1987-08-01

    The rates of formation of the two alternative products of acetohydroxy acid synthase (AHAS) have been determined by a new analytical method (N. Gollop, Z. Barak, and D. M. Chipman, Anal. Biochem., 160:323-331, 1987). For each of the three distinct isozymes of AHAS in Escherichia coli and Salmonella typhimurium, a specificity ratio, R, was defined: Formula: see text, which is constant over a wide range of substrate concentrations. This is consistent with competition between pyruvate and 2-ketobutyrate for an active acetaldehyde intermediate formed irreversibly after addition of the first pyruvate moiety to the enzyme. Isozyme I showed no product preference (R = 1), whereas isozymes II and III form acetohydroxybutyrate (AHB) at approximately 180- and 60-fold faster rates, respectively, than acetolactate (AL) at equal pyruvate and 2-ketobutyrate concentrations. R values higher than 60 represent remarkably high specificity in favor of the substrate with one extra methylene group. In exponentially growing E. coli cells (under aerobic growth on glucose), which contain about 300 microM pyruvate and only 3 microM 2-ketobutyrate, AHAS I would produce almost entirely AL and only 1 to 2% AHB. However, isozymes II and III would synthesize AHB (on the pathway to Ile) and AL (on the pathway to valine-leucine) in essentially the ratio required for protein synthesis. The specificity ratio R of any AHAS isozyme was affected neither by the natural feedback inhibitors (Val, Ile) nor by the pH. On the basis of the specificities of the isozymes, the known regulation of AHAS I expression by the catabolite repression system, and the reported behavior of bacterial mutants containing single AHAS isozymes, we suggest that AHAS I enables a bacterium to cope with poor carbon sources, which lead to low endogenous pyruvate concentrations. Although AHAS II and III are well suited to producing the branched-chain amino acid precursors during growth on glucose, they would fail to provide

  10. Polyunsaturated fatty acids and gene expression

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Purpose of review. This review focuses on the effect(s) of n-3 polyunsaturated fatty acids (PUFA) on gene transcription as determined from data generated using cDNA microarrays. Introduced within the past decade, this methodology allows detection of the expression of thousands of genes simultaneo...

  11. Amino acid determinants of substrate selectivity in the Trypanosoma brucei sphingolipid synthase family.

    PubMed

    Goren, Michael A; Fox, Brian G; Bangs, James D

    2011-10-18

    The substrate selectivity of four Trypanosoma brucei sphingolipid synthases was examined. TbSLS1, an inositol phosphorylceramide (IPC) synthase, and TbSLS4, a bifunctional sphingomyelin (SM)/ethanolamine phosphorylceramide (EPC) synthase, were inactivated by Ala substitutions of a conserved triad of residues His210, His253, and Asp257 thought to form part of the active site. TbSLS4 also catalyzed the reverse reaction, production of ceramide from sphingomyelin, but none of the Ala substitutions of the catalytic triad in TbSLS4 were able to do so. Site-directed mutagenesis identified residues proximal to the conserved triad that were responsible for the discrimination between charge and size of the different head groups. For discrimination between anionic (phosphoinositol) and zwitterionic (phosphocholine, phosphoethanolamine) head groups, doubly mutated V172D/S252F TbSLS1 and D172V/F252S TbSLS3 showed reciprocal conversion between IPC and bifunctional SM/EPC synthases. For differentiation of zwitterionic headgroup size, N170A TbSLS1 and A170N/N187D TbSLS4 showed reciprocal conversion between EPC and bifunctional SM/EPC synthases. These studies provide a mapping of the SLS active site and demonstrate that differences in catalytic specificity of the T. brucei enzyme family are controlled by natural variations in as few as three residue positions. PMID:21899277

  12. A human fatty acid synthase inhibitor binds β-ketoacyl reductase in the keto-substrate site.

    PubMed

    Hardwicke, Mary Ann; Rendina, Alan R; Williams, Shawn P; Moore, Michael L; Wang, Liping; Krueger, Julie A; Plant, Ramona N; Totoritis, Rachel D; Zhang, Guofeng; Briand, Jacques; Burkhart, William A; Brown, Kristin K; Parrish, Cynthia A

    2014-09-01

    Human fatty acid synthase (hFAS) is a complex, multifunctional enzyme that is solely responsible for the de novo synthesis of long chain fatty acids. hFAS is highly expressed in a number of cancers, with low expression observed in most normal tissues. Although normal tissues tend to obtain fatty acids from the diet, tumor tissues rely on de novo fatty acid synthesis, making hFAS an attractive metabolic target for the treatment of cancer. We describe here the identification of GSK2194069, a potent and specific inhibitor of the β-ketoacyl reductase (KR) activity of hFAS; the characterization of its enzymatic and cellular mechanism of action; and its inhibition of human tumor cell growth. We also present the design of a new protein construct suitable for crystallography, which resulted in what is to our knowledge the first co-crystal structure of the human KR domain and includes a bound inhibitor. PMID:25086508

  13. Citrus nobiletin suppresses inducible nitric oxide synthase gene expression in interleukin-1β-treated hepatocytes

    SciTech Connect

    Yoshigai, Emi; Machida, Toru; Okuyama, Tetsuya; Mori, Masatoshi; Murase, Hiromitsu; Yamanishi, Ryota; Okumura, Tadayoshi; Ikeya, Yukinobu; Nishino, Hoyoku; Nishizawa, Mikio

    2013-09-13

    Highlights: •Nobiletin is a polymethoxylated flavone that is abundant in citrus peels. •Nobiletin is a major constituent of the Citrus unshiu peel extract. •Nobiletin suppresses induction of NO and reduces iNOS expression in hepatocytes. •Nobiletin reduces the iNOS promoter activity and the DNA-binding activity of NF-κB. -- Abstract: Background: Nobiletin is a polymethoxylated flavone that is abundant in the peels of citrus fruits, such as Citrus unshiu (Satsuma mandarin) and Citrus sinensis. The dried peels of C. unshiu (chinpi) have been included in several formulae of Japanese Kampo medicines. Nobiletin may suppress the induction of inducible nitric oxide synthase (iNOS), which synthesizes the inflammatory mediator nitric oxide (NO) in hepatocytes. Methods: A C. unshiu peel (CUP) extract was prepared. Primary cultured rat hepatocytes were treated with the CUP extract or nobiletin in the presence of interleukin 1β (IL-1β), which induces iNOS expression. NO production and iNOS gene expression were analyzed. Results: High-performance liquid chromatography analyses revealed that the nobiletin content in the CUP extract was 0.14%. Nobiletin dose-dependently reduced the NO levels and decreased iNOS expression at the protein, mRNA and antisense transcript levels. Flavone, which does not contain any methoxy groups, also suppressed iNOS induction. Nobiletin reduced the transcriptional activity of iNOS promoter-luciferase constructs and the DNA-binding activity of nuclear factor κB (NF-κB) in the nuclei. Conclusions: The suppression of iNOS induction by nobiletin suggests that nobiletin may be responsible for the anti-inflammatory effects of citrus peels and have a therapeutic potential for liver diseases.

  14. Polymorphisms of cystathionine beta-synthase gene are associated with susceptibility to sepsis.

    PubMed

    Sponholz, Christoph; Kramer, Marcel; Schöneweck, Franziska; Menzel, Uwe; Inanloo Rahatloo, Kolsoum; Giamarellos-Bourboulis, Evangelos J; Papavassileiou, Vassileios; Lymberopoulou, Korina; Pavlaki, Maria; Koutelidakis, Ioannis; Perdios, Ioannis; Scherag, André; Bauer, Michael; Platzer, Matthias; Huse, Klaus

    2016-07-01

    Sepsis is the systemic inflammatory host response to infection. Cystathionine beta-synthase (CBS)-dependent homocysteine (Hcy) pathway was demonstrated to affect disease severity and mortality in patients with severe sepsis/septic shock. Independent studies identified a single-nucleotide polymorphism (SNP, rs6586282, hg19 chr21:g.44478497C>T) in intron 14 of the CBS-coding gene (CBS) associated with Hcy plasma levels. We aimed to describe the association of this SNP and variants of a splice donor-affecting variable-number tandem repeat (VNTR, NG_008938.1:g.22763_22793[16_22]) 243 bp downstream of rs6586282 with severe human sepsis. We analyzed the VNTR structure and genotyped variants of rs6586282 and a neighboring SNP (rs34758144, hg19 chr21:g.44478582G>A) in two case-control studies including patients with severe sepsis/septic shock from Germany (n=168) and Greece (n=237). In both studies, we consistently observed an association of CBS VNTR alleles with sepsis susceptibility. Risk linearly increased with number of tandem repeats (per allele odds ratio in the adjusted analysis 1.34; 95% confidence interval (CI)=1.17-1.55; P<0.001). Association had also been shown for rs34758144 whose risk allele is in linkage disequilibrium with one long VNTR allele (19 repeat). In contrast, we observed no evidence for an effect on 28-day survival in patients with severe sepsis/septic shock (per allele hazard ratio in the adjusted analysis for VNTR 1.10; 95% CI=0.95-1.28; P=0.20). In a minigene approach, we demonstrated alternative splicing in distinct VNTR alleles, which, however, was independent of the number of tandem units. In conclusion, there is no ordinary conjunction between human CBS and severe sepsis/septic shock, but CBS genotypes are involved in disease susceptibility. PMID:26508567

  15. From Amino Acid to Glucosinolate Biosynthesis: Protein Sequence Changes in the Evolution of Methylthioalkylmalate Synthase in Arabidopsis[W][OA

    PubMed Central

    de Kraker, Jan-Willem; Gershenzon, Jonathan

    2011-01-01

    Methylthioalkylmalate synthase (MAM) catalyzes the committed step in the side chain elongation of Met, yielding important precursors for glucosinolate biosynthesis in Arabidopsis thaliana and other Brassicaceae species. MAM is believed to have evolved from isopropylmalate synthase (IPMS), an enzyme involved in Leu biosynthesis, based on phylogenetic analyses and an overlap of catalytic abilities. Here, we investigated the changes in protein structure that have occurred during the recruitment of IPMS from amino acid to glucosinolate metabolism. The major sequence difference between IPMS and MAM is the absence of 120 amino acids at the C-terminal end of MAM that constitute a regulatory domain for Leu-mediated feedback inhibition. Truncation of this domain in Arabidopsis IPMS2 results in loss of Leu feedback inhibition and quaternary structure, two features common to MAM enzymes, plus an 8.4-fold increase in the kcat/Km for a MAM substrate. Additional exchange of two amino acids in the active site resulted in a MAM-like enzyme that had little residual IPMS activity. Hence, combination of the loss of the regulatory domain and a few additional amino acid exchanges can explain the evolution of MAM from IPMS during its recruitment from primary to secondary metabolism. PMID:21205930

  16. Chitin synthase homologs in three ectomycorrhizal truffles.

    PubMed

    Lanfranco, L; Garnero, L; Delpero, M; Bonfante, P

    1995-12-01

    Degenerate PCR primers were used to amplify a conserved gene portion coding chitin synthase from genomic DNA of six species of ectomycorrhizal truffles. DNA was extracted from both hypogeous fruitbodies and in vitro growing mycelium of Tuber borchii. A single fragment of about 600 bp was amplified for each species. The amplification products from Tuber magnatum, T. borchii and T. ferrugineum were cloned and sequenced, revealing a high degree of identity (91.5%) at the nucleotide level. On the basis of the deduced amino acid sequences these clones were assigned to class II chitin synthase. Southern blot experiments performed on genomic DNA showed that the amplification products derive from a single copy gene. Phylogenetic analysis of the nucleotide sequences of class II chitin synthase genes confirmed the current taxonomic position of the genus Tuber, and suggested a close relationship between T. magnatum and T. uncinatum. PMID:8593947

  17. Molecular Cloning, Characterization and mRNA Expression of a Chitin Synthase 2 Gene from the Oriental Fruit Fly, Bactrocera dorsalis (Diptera: Tephritidae)

    PubMed Central

    Chen, Li; Yang, Wen-Jia; Cong, Lin; Xu, Kang-Kang; Wang, Jin-Jun

    2013-01-01

    Chitin synthase (CHS), a potential target for eco-friendly insecticides, plays an essential role in chitin formation in insects. In this study, a full-length cDNA encoding chitin synthase 2 (BdCHS2) was cloned and characterized in the oriental fruit fly, Bactrocera dorsalis. The BdCHS2 cDNA had 4417 nucleotides, containing an open reading frame of 4122 nucleotides, which encoded 1373 amino acid residues with a predicted molecular weight of 158.5 kDa. Phylogenetic analysis with other insect CHSs suggested that BdCHS2 belongs to insect CHS2. The BdCHS2 transcript was predominately found in midgut but was detected at low levels in fat body, Malpighian tubules, integument, and trachea. Moreover, BdCHS2 was expressed in all developmental stages, and highly expressed in the feeding stages. There was a positive relationship between BdCHS2 expression and total chitin content during development. Furthermore, both the gene expression and chitin content in midgut decreased when the insect was fed for 24 h, then starved for 24 h, while they increased dramatically and rapidly under the condition of starvation for 24 h then feeding for 24 h. These results suggest that BdCHS2 may play an important role in regulating chitin content of the midgut, and subsequently affect the growth and development of B. dorsalis. PMID:23965972

  18. Exposure to Diflubenzuron Results in an Up-Regulation of a Chitin Synthase 1 Gene in Citrus Red Mite, Panonychus citri (Acari: Tetranychidae)

    PubMed Central

    Xia, Wen-Kai; Ding, Tian-Bo; Niu, Jin-Zhi; Liao, Chong-Yu; Zhong, Rui; Yang, Wen-Jia; Liu, Bin; Dou, Wei; Wang, Jin-Jun

    2014-01-01

    Chitin synthase synthesizes chitin, which is critical for the arthropod exoskeleton. In this study, we cloned the cDNA sequences of a chitin synthase 1 gene, PcCHS1, in the citrus red mite, Panonychus citri (McGregor), which is one of the most economically important pests of citrus worldwide. The full-length cDNA of PcCHS1 contains an open reading frame of 4605 bp of nucleotides, which encodes a protein of 1535 amino acid residues with a predicted molecular mass of 175.0 kDa. A phylogenetic analysis showed that PcCHS1 was most closely related to CHS1 from Tetranychus urticae. During P. citri development, PcCHS1 was constantly expressed in all stages but highly expressed in the egg stage (114.8-fold higher than in the adult). When larvae were exposed to diflubenzuron (DFB) for 6 h, the mite had a significantly high mortality rate, and the mRNA expression levels of PcCHS1 were significantly enhanced. These results indicate a promising use of DFB to control P. citri, by possibly acting as an inhibitor in chitin synthesis as indicated by the up-regulation of PcCHS1 after exposure to DFB. PMID:24590130

  19. Exposure to diflubenzuron results in an up-regulation of a chitin synthase 1 gene in citrus red mite, Panonychus citri (Acari: Tetranychidae).

    PubMed

    Xia, Wen-Kai; Ding, Tian-Bo; Niu, Jin-Zhi; Liao, Chong-Yu; Zhong, Rui; Yang, Wen-Jia; Liu, Bin; Dou, Wei; Wang, Jin-Jun

    2014-01-01

    Chitin synthase synthesizes chitin, which is critical for the arthropod exoskeleton. In this study, we cloned the cDNA sequences of a chitin synthase 1 gene, PcCHS1, in the citrus red mite, Panonychus citri (McGregor), which is one of the most economically important pests of citrus worldwide. The full-length cDNA of PcCHS1 contains an open reading frame of 4605 bp of nucleotides, which encodes a protein of 1535 amino acid residues with a predicted molecular mass of 175.0 kDa. A phylogenetic analysis showed that PcCHS1 was most closely related to CHS1 from Tetranychus urticae. During P. citri development, PcCHS1 was constantly expressed in all stages but highly expressed in the egg stage (114.8-fold higher than in the adult). When larvae were exposed to diflubenzuron (DFB) for 6 h, the mite had a significantly high mortality rate, and the mRNA expression levels of PcCHS1 were significantly enhanced. These results indicate a promising use of DFB to control P. citri, by possibly acting as an inhibitor in chitin synthesis as indicated by the up-regulation of PcCHS1 after exposure to DFB. PMID:24590130

  20. [Cloning of flavone synthase (FNSII) gene and expression in three cell lines of Saussurea medusa].

    PubMed

    Wang, Bingjie; Li, Houhua; Wang, Yajie; Gaol, Yan; Fu, Wany; Weil, Xincui

    2015-12-01

    Saussurea medusa is a rare traditional Chinese medicinal herb, of which luteolin is the niain active medicinal compound for cancer prevention and treatment. A full-length FNSII gene, namely SmFNSII (GenBank Accession No. KF170286), was obtained from green cell line of Saussurea medusa by RT-PCR and RACE-PCR. Sequence analysis indicated that SmFNSII is 1 710 bp in full length, containing a 34 bp 5'-untranslated region (5'-UTR), a 125 bp 3'-UTR, and a 1 551 bp open reading frame (ORF) encoding 516 amino acid residues. Amino acid sequence analysis indicated that SmFNSII belonged to subfamily CYP93B of plant cytochrome P450. Sequence alignment and phylogenetic analysis revealed that amino acid sequences of SmFNSII shared 87% homology with the protein in Hieracium pilosella. Quantitative real-time PCR analysis indicated that SmFNSII expression is the highest in red cell line and the lowest in white cell line, corresponding to quantitative analysis of luteolin concentration. pET-SmFNSII, a prokaryotic expression recombinant plasmid, was constructed and transferred into Escherichia coli, and the expressed protein band was the same size with predicted protein. Saussurea medusa cultivars with high anti-inflammatory, anti-cancer activities and health care function would be cultivated through filtering cell lines and plants with high expression level of FNSII gene and luteolin accumulation. PMID:27093835

  1. Overexpression of fatty acid synthase in human urinary bladder cancer and combined expression of the synthase and Ki-67 as a predictor of prognosis of cancer patients.

    PubMed

    Sugino, Takashi; Baba, Keiichi; Hoshi, Nobuo; Aikawa, Ken; Yamaguchi, Osamu; Suzuki, Toshimitsu

    2011-09-01

    To investigate the status of fatty acid synthase (FAS) in bladder tumors and evaluate its prognostic significance, we immunohistochemically examined the expression of FAS in normal urothelium, carcinoma in situ (CIS), and urothelial carcinoma (UC) in cystectomized bladder. In normal urothelium, only the surface layer expressed FAS, whereas the protein was detected in the basal layer or whole layer of CIS and UC in every specimen. Of the clinicopathological factors in UC, pathological tumor (pT) stage and histological grade were significantly correlated to FAS expression (P = 0.002, P < 0.0001, respectively). Univariate analysis for disease-specific survival indicated that the combination scores of FAS and Ki-67 expression, which were not associated with each other, was a more predictive variable than the individual score of each protein expression. Kaplan-Meier analysis showed that high combination scores of both proteins were significantly associated with poor prognosis (P = 0.04). In conclusion, FAS expression can be a biomarker for tumor aggressiveness and loss of differentiation of bladder cancer, and the evaluation of its expression level in combination with Ki-67 labeling index may be a precise predictor for poor prognosis of cancer patients. PMID:21922386

  2. [Distinctive Features of the Microbial Diversity and the Polyketide Synthase GenesSpectrum in the Community of the Endemic Baikal Sponge Swartschewskia papyracea].

    PubMed

    Kaluzhnaya, O V; Itskovich, V B

    2016-01-01

    The diversity of the symbiotic community of the endemic Baikal sponge Swartschewskia papyracea was studied, and an analysis of the polyketide synthases genes spectrum in sponge-associated microorganisms was carried out. Six bacterial phyla were detected in the S. papyracea microbiome, namely, Verrucomicrobia, Cyanobacteria, Actinobacteria, Bacteroidetes, Proteobacteria, and Planctomycetes. Unlike the microbial associations of other freshwater sponges, the community under study was dominated by the Verrucomicrobia (42.1%) and Cyanobacteria (17.5%) phyla, while the proportion of the Proteobacteria was unusually low (9.7%). In the S. papyracea community metagenome, there were identified 18 polyketide synthases genes fragments, the closest homologs of which included the polyketide synthases of the microorganisms belonging to the bacterial phyla Cyanobacteria, Proteobacteria (Betaproteobacteria, Deltaproteobacteria, and Gammaproteobacteria classes), and Acidobacteria and to the eukaryotic algae of the Heterokonta phylum (Eustigmatophyceae class). Polyketide synthase sequences from S. papyracea formed three groups on the phylogenetic tree: a group of hybrid NRPS/PKS complexes, a group of cyanobacterial polyketide synthases, and a group of homologs of the eukaryotic alga Nannochloropsis galiana. Notably, the identified polyketide synthase genes fragments showed only a 57-88% similarity to the sequences in the databases, which implies the presence of genes controlling the synthesis of the novel, still unstudied, polyketide compounds in the S. papyracea community. It was proposed that the habitation conditions of S. papyracea affect the taxonomic composition of the microorganisms associated with the sponge, including the diversity of the producers of secondary metabolites. PMID:27183792

  3. pks63787, a Polyketide Synthase Gene Responsible for the Biosynthesis of Benzenoids in the Medicinal Mushroom Antrodia cinnamomea.

    PubMed

    Yu, Po-Wei; Chang, Ya-Chih; Liou, Ruey-Fen; Lee, Tzong-Huei; Tzean, Shean-Shong

    2016-06-24

    Antrodia cinnamomea, a unique resupinate basidiomycete endemic to Taiwan, has potent medicinal activities. The reddish basidiocarps and mycelia generally exhibit abundant metabolites and higher biological activity. To investigate the pigments of A. cinnamomea, polyketide synthase (PKS) genes were characterized based on its partially deciphered genome and the construction of a fosmid library. Furthermore, a gene disruption platform was established via protoplast transformation and homologous recombination. Of four putative polyketide synthase genes, pks63787 was selected and disrupted in the monokaryotic wild-type (wt) strain f101. Transformant Δpks63787 was deficient in the synthesis of several aromatic metabolites, including five benzenoids and two benzoquinone derivatives. Based on these results, a biosynthetic pathway for benzenoid derivatives was proposed. The pks63787 deletion mutant not only displayed a reduced red phenotype compared to the wt strain but also displayed less 1,1-biphenyl-2-picrylhydrazyl free radical scavenging activity. This finding suggests that PKS63787 is responsible for the biosynthesis of pigments and metabolites related to the antioxidant activity of A. cinnamomea. The present study focuses on the functional characterization of the PKS gene, the fluctuations of its profile of secondary metabolites, and interpretation of the biosynthesis of benzenoids. PMID:27227778

  4. Expression of fatty acid synthesis genes and fatty acid accumulation in haematococcus pluvialis under different stressors

    PubMed Central

    2012-01-01

    Background Biofuel has been the focus of intensive global research over the past few years. The development of 4th generation biofuel production (algae-to-biofuels) based on metabolic engineering of algae is still in its infancy, one of the main barriers is our lacking of understanding of microalgal growth, metabolism and biofuel production. Although fatty acid (FA) biosynthesis pathway genes have been all cloned and biosynthesis pathway was built up in some higher plants, the molecular mechanism for its regulation in microalgae is far away from elucidation. Results We cloned main key genes for FA biosynthesis in Haematococcus pluvialis, a green microalga as a potential biodiesel feedstock, and investigated the correlations between their expression alternation and FA composition and content detected by GC-MS under different stress treatments, such as nitrogen depletion, salinity, high or low temperature. Our results showed that high temperature, high salinity, and nitrogen depletion treatments played significant roles in promoting microalgal FA synthesis, while FA qualities were not changed much. Correlation analysis showed that acyl carrier protein (ACP), 3-ketoacyl-ACP-synthase (KAS), and acyl-ACP thioesterase (FATA) gene expression had significant correlations with monounsaturated FA (MUFA) synthesis and polyunsaturated FA (PUFA) synthesis. Conclusions We proposed that ACP, KAS, and FATA in H. pluvialis may play an important role in FA synthesis and may be rate limiting genes, which probably could be modified for the further study of metabolic engineering to improve microalgal biofuel quality and production. PMID:22448811

  5. The Maize Gene terpene synthase 1 Encodes a Sesquiterpene Synthase Catalyzing the Formation of (E)-β-Farnesene, (E)-Nerolidol, and (E,E)-Farnesol after Herbivore Damage1

    PubMed Central

    Schnee, Christiane; Köllner, Tobias G.; Gershenzon, Jonathan; Degenhardt, Jörg

    2002-01-01

    Maize (Zea mays) emits a mixture of volatile compounds upon attack by the Egyptian cotton leafworm (Spodoptera littoralis). These substances, primarily mono- and sesquiterpenes, are used by parasitic wasps to locate the lepidopteran larvae, which are their natural hosts. This interaction among plant, lepidopteran larvae, and hymenopteran parasitoids benefits the plant and has been termed indirect defense. The committed step in the biosynthesis of the different skeletal types of mono- and sesquiterpenes is catalyzed by terpene synthases, a class of enzymes that forms a large variety of mono- and sesquiterpene products from prenyl diphosphate precursors. We isolated a terpene synthase gene, terpene synthase 1 (tps1), from maize that exhibits only a low degree of sequence identity to previously identified terpene synthases. Upon expression in a bacterial system, the encoded enzyme produced the acyclic sesquiterpenes, (E)-β-farnesene, (E,E)-farnesol, and (3R)-(E)-nerolidol, the last an intermediate in the formation of (3E)-4,8-dimethyl-1,3,7-nonatriene. Both (E)-β-farnesene and (3E)-4,8-dimethyl-1,3,7-nonatriene are prominent compounds of the maize volatile blend that is emitted after herbivore damage. The biochemical characteristics of the encoded enzyme are similar to those of terpene synthases from both gymnosperms and dicotyledonous angiosperms, suggesting that catalysis involves a similar electrophilic reaction mechanism. The transcript level of tps1 in the maize cv B73 was elevated after herbivory, mechanical damage, and treatment with elicitors. In contrast, the increase in the transcript level of the tps1 gene or gene homolog in the maize cv Delprim after herbivory was less pronounced, suggesting that the regulation of terpene synthase expression may vary among maize varieties. PMID:12481088

  6. Ketide Synthase (KS) Domain Prediction and Analysis of Iterative Type II PKS Gene in Marine Sponge-Associated Actinobacteria Producing Biosurfactants and Antimicrobial Agents

    PubMed Central

    Selvin, Joseph; Sathiyanarayanan, Ganesan; Lipton, Anuj N.; Al-Dhabi, Naif Abdullah; Valan Arasu, Mariadhas; Kiran, George S.

    2016-01-01

    The important biological macromolecules, such as lipopeptide and glycolipid biosurfactant producing marine actinobacteria were analyzed and their potential linkage between type II polyketide synthase (PKS) genes was explored. A unique feature of type II PKS genes is their high amino acid (AA) sequence homology and conserved gene organization. These enzymes mediate the biosynthesis of polyketide natural products with enormous structural complexity and chemical nature by combinatorial use of various domains. Therefore, deciphering the order of AA sequence encoded by PKS domains tailored the chemical structure of polyketide analogs still remains a great challenge. The present work deals with an in vitro and in silico analysis of PKS type II genes from five actinobacterial species to correlate KS domain architecture and structural features. Our present analysis reveals the unique protein domain organization of iterative type II PKS and KS domain of marine actinobacteria. The findings of this study would have implications in metabolic pathway reconstruction and design of semi-synthetic genomes to achieve rational design of novel natural products. PMID:26903957

  7. Biosynthesis of Dictyostelium discoideum differentiation-inducing factor by a hybrid type I fatty acid-type III polyketide synthase.

    PubMed

    Austin, Michael B; Saito, Tamao; Bowman, Marianne E; Haydock, Stephen; Kato, Atsushi; Moore, Bradley S; Kay, Robert R; Noel, Joseph P

    2006-09-01

    Differentiation-inducing factors (DIFs) are well known to modulate formation of distinct communal cell types from identical Dictyostelium discoideum amoebas, but DIF biosynthesis remains obscure. We report complimentary in vivo and in vitro experiments identifying one of two approximately 3,000-residue D. discoideum proteins, termed 'steely', as responsible for biosynthesis of the DIF acylphloroglucinol scaffold. Steely proteins possess six catalytic domains homologous to metazoan type I fatty acid synthases (FASs) but feature an iterative type III polyketide synthase (PKS) in place of the expected FAS C-terminal thioesterase used to off load fatty acid products. This new domain arrangement likely facilitates covalent transfer of steely N-terminal acyl products directly to the C-terminal type III PKS active sites, which catalyze both iterative polyketide extension and cyclization. The crystal structure of a steely C-terminal domain confirms conservation of the homodimeric type III PKS fold. These findings suggest new bioengineering strategies for expanding the scope of fatty acid and polyketide biosynthesis. PMID:16906151

  8. The condensing activities of the Mycobacterium tuberculosis type II fatty acid synthase are differentially regulated by phosphorylation.

    PubMed

    Molle, Virginie; Brown, Alistair K; Besra, Gurdyal S; Cozzone, Alain J; Kremer, Laurent

    2006-10-01

    Phosphorylation of proteins by Ser/Thr protein kinases (STPKs) has recently become of major physiological importance because of its possible involvement in virulence of bacterial pathogens. Although Mycobacterium tuberculosis has eleven STPKs, the nature and function of the substrates of these enzymes remain largely unknown. In this work, we have identified for the first time STPK substrates in M. tuberculosis forming part of the type II fatty acid synthase (FAS-II) system involved in mycolic acid biosynthesis: the malonyl-CoA::AcpM transacylase mtFabD, and the beta-ketoacyl AcpM synthases KasA and KasB. All three enzymes were phosphorylated in vitro by different kinases, suggesting a complex network of interactions between STPKs and these substrates. In addition, both KasA and KasB were efficiently phosphorylated in M. bovis BCG each at different sites and could be dephosphorylated by the M. tuberculosis Ser/Thr phosphatase PstP. Enzymatic studies revealed that, whereas phosphorylation decreases the activity of KasA in the elongation process of long chain fatty acids synthesis, this modification enhances that of KasB. Such a differential effect of phosphorylation may represent an unusual mechanism of FAS-II system regulation, allowing pathogenic mycobacteria to produce full-length mycolates, which are required for adaptation and intracellular survival in macrophages. PMID:16873379

  9. Mycolic acid biosynthesis and enzymic characterization of the beta-ketoacyl-ACP synthase A-condensing enzyme from Mycobacterium tuberculosis.

    PubMed

    Kremer, Laurent; Dover, Lynn G; Carrère, Séverine; Nampoothiri, K Madhavan; Lesjean, Sarah; Brown, Alistair K; Brennan, Patrick J; Minnikin, David E; Locht, Camille; Besra, Gurdyal S

    2002-06-01

    Mycolic acids consist of long-chain alpha-alkyl-beta-hydroxy fatty acids that are produced by successive rounds of elongation catalysed by a type II fatty acid synthase (FAS-II). A key feature in the elongation process is the condensation of a two-carbon unit from malonyl-acyl-carrier protein (ACP) to a growing acyl-ACP chain catalysed by a beta-ketoacyl-ACP synthase (Kas). In the present study, we provide evidence that kasA from Mycobacterium tuberculosis encodes an enzyme that elongates in vivo the meromycolate chain, in both Mycobacterium smegmatis and Mycobacterium chelonae. We demonstrate that KasA belongs to the FAS-II system, which utilizes primarily palmitoyl-ACP rather than short-chain acyl-ACP primers. Furthermore, in an in vitro condensing assay using purified recombinant KasA, palmitoyl-AcpM and malonyl-AcpM, KasA was found to express Kas activity. Also, mutated KasA proteins, with mutation of Cys(171), His(311), Lys(340) and His(345) to Ala abrogated the condensation activity of KasA in vitro completely. Finally, purified KasA was highly sensitive to cerulenin, a well-known inhibitor of Kas, which may lead to the development of novel anti-mycobacterial drugs targeting KasA. PMID:12023885

  10. Identification of the trehalose-6-phosphate synthase gene family in winter wheat and expression analysis under conditions of freezing stress.

    PubMed

    Xie, D W; Wang, X N; Fu, L S; Sun, J; Zheng, W; Li, Z F

    2015-03-01

    Trehalose plays an important role in metabolic regulation and abiotic stress tolerance in plants. Trehalose contents are potentially modulated by trehalose-6-phosphate synthase (TPS), which is a key enzyme in the trehalose biosynthetic pathway. Using available wheat expressed sequence tag sequence information from NCBI and two wheat genome databases, we identified 12 wheat TPS genes and performed a comprehensive study on their structural, evolutionary and functional properties. The estimated divergence time of wheat TPS gene pairs and wheat-rice orthologues suggested that wheat and rice have a common ancestor. The number of TPS genes in the wheat genome was estimated to be at least 12, which is close to the number found in rice, Arabidopsis and soybean. Moreover, it has been reported earlier in other plants that TPS genes respond to abiotic stress, however, our study mainly analysed the TPS gene family under freezing conditions in winter wheat, and determined that most of the TPS gene expression in winter wheat was induced by freezing conditions, which further suggested that wheat TPS genes were involved in winter wheat freeze-resistance signal transduction pathways. Taken together, the current study represents the first comprehensive study of TPS genes in winter wheat and provides a foundation for future functional studies of this important gene family in Triticeae. PMID:25846877

  11. The Saccharomyces cerevisiae FKS1 (ETG1) gene encodes an integral membrane protein which is a subunit of 1,3-beta-D-glucan synthase.

    PubMed Central

    Douglas, C M; Foor, F; Marrinan, J A; Morin, N; Nielsen, J B; Dahl, A M; Mazur, P; Baginsky, W; Li, W; el-Sherbeini, M

    1994-01-01

    In Saccharomyces cerevisiae, mutations in FKS1 confer hypersensitivity to the immunosuppressants FK506 and cyclosporin A, while mutations in ETG1 confer resistance to the cell-wall-active echinocandins (inhibitors of 1,3-beta-D-glucan synthase) and, in some cases, concomitant hypersensitivity to the chitin synthase inhibitor nikkomycin Z. The FKS1 and ETG1 genes were cloned by complementation of these phenotypes and were found to be identical. Disruption of the gene results in (i) a pronounced slow-growth phenotype, (ii) hypersensitivity to FK506 and cyclosporin A, (iii) a slight increase in sensitivity to echinocandin, and (iv) a significant reduction in 1,3-beta-D-glucan synthase activity in vitro. The nucleotide sequence encodes a 215-kDa polypeptide predicted to be an integral membrane protein with 16 transmembrane helices, consistent with previous observations that the etg1-1 mutation results in echinocandin-resistant glucan synthase activity associated with the nonextractable membrane fraction of the enzyme. These results suggest that FKS1 encodes a subunit of 1,3-beta-D-glucan synthase. The residual activity present in the disruption mutant, the nonessential nature of the gene, and results of Southern blot hybridization analysis point to the existence of a glucan synthase isozyme. Images Fig. 1 Fig. 3 Fig. 5 PMID:7528927

  12. Association of Polymorphism of Neuronal Nitric Oxide Synthase Gene with Risk to Parkinson's Disease.

    PubMed

    Gupta, Satya Prakash; Kamal, Ritul; Mishra, Sarad Kumar; Singh, Maneesh Kumar; Shukla, Rakesh; Singh, Mahendra Pratap

    2016-07-01

    Environmental factors are implicated in aging as well as genetic predisposition-induced Parkinson's disease (PD) pathogenesis. Wrongdoers increase oxidative stress and nitrosative burden, which eventually degenerate the nigrostriatal dopaminergic neurons. Inhibition of the expression of nitric oxide synthase (NOS), an enzyme responsible for nitric oxide (NO) biosynthesis, prevents the demise of the nigrostriatal dopaminergic neurons. Polymorphism of NOS is thus expected to alter PD susceptibility. The study therefore aimed to examine an association of neuronal NOS (nNOS) gene polymorphism with nitrite, an indicator of nitrosative load; lipid peroxidation, an index of oxidative stress and PD susceptibility. An age-matched case-control study was performed in the north Indian residents enrolled at the Neurology Department of the King George's Medical University, Lucknow, India. While nNOS exon 29 TT variant genotype [odds ratio (OR) = 2.20, 95 % CI = 1.08-5.34, P = 0.040], combined TT and CT variants [OR = 1.68, 95 % CI = 1.05-2.69, P = 0.031] and T allele [OR = 1.58, 95 % CI = 1.10-2.28, P = 0.014] were found to be significantly associated with PD susceptibility, no association between nNOS exon 18 [OR for TT carriers = 1.97, 95 % CI = 0.89-4.20, P = 0.09 and OR for T allele = 1.35, 95 % CI = 0.94-1.93, P = 0.098] and PD risk was observed. Lipid peroxidation was augmented in all patients irrespective of their genotype. While genotype independent increase in nitrite content was observed in PD patients of exon 29 polymorphic groups, only heterozygous variant genotype of exon 18 was associated with augmentation in nitrite level as compared with respective control. The results obtained thus demonstrate that selected nNOS polymorphisms do not significantly contribute to PD risk in north Indian population. PMID:26081147

  13. Discovery of bacterial polyhydroxyalkanoate synthase (PhaC)-encoding genes from seasonal Baltic Sea ice and cold estuarine waters.

    PubMed

    Pärnänen, Katariina; Karkman, Antti; Virta, Marko; Eronen-Rasimus, Eeva; Kaartokallio, Hermanni

    2015-01-01

    Polyhydroxyalkanoates (PHAs) are macromolecules produced by bacteria as means for storing carbon and energy in intracellular granules. PHAs have physical properties similar to those of plastics and have become of interest to industry as materials for environmentally friendly bioplastic production. There is an ongoing search for new PHA-producing bacterial strains and PHA-synthesizing enzymes tolerating extreme conditions to find ways of producing PHAs at cold temperatures and high solute concentrations. Moreover, the study of PHA producers in the sea-ice biome can aid in understanding the microbial ecology of carbon cycling in ice-associated ecosystems. In this study, PHA producers and PHA synthase genes were examined under the extreme environmental conditions of sea ice and cold seawater to find evidence of PHA production in an environment requiring adaptation to high salinity and cold temperatures. Sea ice and cold estuarine water samples were collected from the northern Baltic Sea and evidence of PHA production was gathered, using microscopy with Nile Blue A staining of PHA-granules and PCR assays detecting PHA-synthesis genes. The PHA granules and PHA synthases were found at all sampling locations, in both sea ice and water, and throughout the sampling period spanning over 10 years. Our study shows, for the first time, that PHA synthesis occurs in Baltic Sea cold-adapted bacteria in their natural environment, which makes the Baltic Sea and its cold environments an interesting choice in the quest for PHA-synthesizing bacteria and synthesis genes. PMID:25280551

  14. Roles of ceramide synthase and ceramide clearence genes in nilotinib-induced cell death in chronic myeloid leukemia cells.

    PubMed

    Camgoz, Aylin; Gencer, Emel Basak; Ural, Ali Ugur; Avcu, Ferit; Baran, Yusuf

    2011-08-01

    In this study, we aimed to increase the sensitivity of human K562 and Meg-01 chronic myeloid leukemia (CML) cells to nilotinib by targeting bioactive sphingolipids, in addition to investigating the roles of ceramide metabolizing genes in nilotinib induced apoptosis. Cytotoxic effects of nilotinib, C8:ceramide, glucosyle ceramide synthase (GCS) and sphingosine kinase-1 (SK-1) inhibitors were determined by XTT cell proliferation assay and synergism between the agents was determined by isobologram analysis. Also, quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) results demonstrated that expression levels of longevity assurance (LASS) genes in response to nilotinib were correlated with sensitivity to nilotinib. For the first time, The results of this study showed for the first time that nilotinib induces apoptosis through upregulating ceramide synthase genes and downregulating SK-1 in CML cells in addition to inhibition of BCR/ABL. On the other hand, manipulating bioactive sphingolipids toward generation/accumulation of ceramides increased the apoptotic effects of nilotinib in CML cells. PMID:21756066

  15. Agrobacterium mediated transfer of a mutant Arabidopsis acetolactate synthase gene confers resistance to chlorsulfuron in chicory (Cichorium intybus L.).

    PubMed

    Vermeulen, A; Vaucheret, H; Pautot, V; Chupeau, Y

    1992-06-01

    Leaf discs of C. intybus were inoculated with an Agrobacterium tumefaciens strain harboring a neomycin phosphotransferase (neo) gene for kanamycin resistance and a mutant acetolactate synthase gene (csr1-1) from Arabidopsis thaliana conferring resistance to sulfonylurea herbicides. A regeneration medium was optimized which permitted an efficient shoot regeneration from leaf discs. Transgenic shoots were selected on rooting medium containing 100 mg/l kanamycin sulfate. Integration of the csr1-1 gene into genomic DNA of kanamycin resistant chicory plants was confirmed by Southern blot hybridizations. Analysis of the selfed progenies (S1 and S2) of two independent transformed clones showed that kanamycin and chlorsulfuron resistances were inherited as dominant Mendelian traits. The method described here for producing transformed plants will allow new opportunities for chicory breeding. PMID:24203132

  16. Analysis of the endothelial nitric oxide synthase gene as a modifier of the cerebral response to ischemia.

    PubMed

    Dutra, Ana Virginia; Lin, Hsiu-Fen; Juo, Suh-Hang Hank; Boyadjis, Melanie; Moussouttas, Michael; Reddy, P Leema; Grewal, Raji Paul

    2006-01-01

    We studied the endothelial nitric oxide synthase (eNOS or NOS-3) gene as a potential modifier of the cerebral response to ischemia by investigating the association of two common polymorphisms with ischemic stroke volume. We genotyped an intronic variable number tandem repeat and a single nucleotide polymorphism, G894T, in 132 patients with nonlacunar ischemic strokes in whom clinical data and stroke lesion volume were recorded. Our results show that all genotypes are in Hardy-Weinberg equilibrium. After adjustment of covariates, neither of the NOS-3 polymorphisms showed significant differences comparing the genotypes and mean stroke volume (analysis of variance). Our results do not suggest a major gene effect of the NOS-3 gene as a modifier of the cerebral response to ischemia. PMID:17904064

  17. Transcriptional Profiling of Canker-Resistant Transgenic Sweet Orange (Citrus sinensis Osbeck) Constitutively Overexpressing a Spermidine Synthase Gene

    PubMed Central

    Fu, Xing-Zheng; Liu, Ji-Hong

    2013-01-01

    Citrus canker disease caused by Xanthomonas citri subsp. citri (Xcc) is one of the most devastating diseases affecting the citrus industry worldwide. In our previous study, the canker-resistant transgenic sweet orange (Citrus sinensis Osbeck) plants were produced via constitutively overexpressing a spermidine synthase. To unravel the molecular mechanisms underlying Xcc resistance of the transgenic plants, in the present study global transcriptional profiling was compared between untransformed line (WT) and the transgenic line (TG9) by hybridizing with Affymetrix Citrus GeneChip. In total, 666 differentially expressed genes (DEGs) were identified, 448 upregulated, and 218 downregulated. The DEGs were classified into 33 categories after Gene ontology (GO) annotation, in which 68 genes are in response to stimulus and involved in immune system process, 12 genes are related to cell wall, and 13 genes belong to transcription factors. These genes and those related to starch and sucrose metabolism, glutathione metabolism, biosynthesis of phenylpropanoids, and plant hormones were hypothesized to play major roles in the canker resistance of TG9. Semiquantitative RT-PCR analysis showed that the transcript levels of several candidate genes in TG9 were significantly higher than in WT both before and after Xcc inoculation, indicating their potential association with canker disease. PMID:23509803

  18. Saponin Biosynthesis in Saponaria vaccaria. cDNAs Encoding β-Amyrin Synthase and a Triterpene Carboxylic Acid Glucosyltransferase1[OA

    PubMed Central

    Meesapyodsuk, Dauenpen; Balsevich, John; Reed, Darwin W.; Covello, Patrick S.

    2007-01-01

    Saponaria vaccaria (Caryophyllaceae), a soapwort, known in western Canada as cowcockle, contains bioactive oleanane-type saponins similar to those found in soapbark tree (Quillaja saponaria; Rosaceae). To improve our understanding of the biosynthesis of these saponins, a combined polymerase chain reaction and expressed sequence tag approach was taken to identify the genes involved. A cDNA encoding a β-amyrin synthase (SvBS) was isolated by reverse transcription-polymerase chain reaction and characterized by expression in yeast (Saccharomyces cerevisiae). The SvBS gene is predominantly expressed in leaves. A S. vaccaria developing seed expressed sequence tag collection was developed and used for the isolation of a full-length cDNA bearing sequence similarity to ester-forming glycosyltransferases. The gene product of the cDNA, classified as UGT74M1, was expressed in Escherichia coli, purified, and identified as a triterpene carboxylic acid glucosyltransferase. UGT74M1 is expressed in roots and leaves and appears to be involved in monodesmoside biosynthesis in S. vaccaria. PMID:17172290

  19. Inhibition of G-protein-coupled Receptor Kinase 2 Prevents the Dysfunctional Cardiac Substrate Metabolism in Fatty Acid Synthase Transgenic Mice.

    PubMed

    Abd Alla, Joshua; Graemer, Muriel; Fu, Xuebin; Quitterer, Ursula

    2016-02-01

    Impairment of myocardial fatty acid substrate metabolism is characteristic of late-stage heart failure and has limited treatment options. Here, we investigated whether inhibition of G-protein-coupled receptor kinase 2 (GRK2) could counteract the disturbed substrate metabolism of late-stage heart failure. The heart failure-like substrate metabolism was reproduced in a novel transgenic model of myocardium-specific expression of fatty acid synthase (FASN), the major palmitate-synthesizing enzyme. The increased fatty acid utilization of FASN transgenic neonatal cardiomyocytes rapidly switched to a heart failure phenotype in an adult-like lipogenic milieu. Similarly, adult FASN transgenic mice developed signs of heart failure. The development of disturbed substrate utilization of FASN transgenic cardiomyocytes and signs of heart failure were retarded by the transgenic expression of GRKInh, a peptide inhibitor of GRK2. Cardioprotective GRK2 inhibition required an intact ERK axis, which blunted the induction of cardiotoxic transcripts, in part by enhanced serine 273 phosphorylation of Pparg (peroxisome proliferator-activated receptor γ). Conversely, the dual-specific GRK2 and ERK cascade inhibitor, RKIP (Raf kinase inhibitor protein), triggered dysfunctional cardiomyocyte energetics and the expression of heart failure-promoting Pparg-regulated genes. Thus, GRK2 inhibition is a novel approach that targets the dysfunctional substrate metabolism of the failing heart. PMID:26670611

  20. Genetic Diversity of Polyketide Synthase/Nonribosomal Peptide Synthetase Genes in Isolates of the Barley Net Blotch Fungus Pyrenophora teres f. teres

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyketide synthases (PKSs) and nonribosomal peptide synthetases (NRPSs) are multifunctional enzymes responsible for biosynthesis of diverse small molecules (e.g., mycotoxins and phytotoxins) in filamentous ascomycetes. Both PKS and NRPS genes are present in fungal genomes as large gene families but...

  1. Crystallization and X-ray diffraction studies of a complete bacterial fatty-acid synthase type I

    SciTech Connect

    Enderle, Mathias; McCarthy, Andrew; Paithankar, Karthik Shivaji; Grininger, Martin

    2015-10-23

    Bacterial and fungal type I fatty-acid synthases (FAS I) are evolutionarily connected, as bacterial FAS I is considered to be the ancestor of fungal FAS I. In this work, the production, crystallization and X-ray diffraction data analysis of a bacterial FAS I are reported. While a deep understanding of the fungal and mammalian multi-enzyme type I fatty-acid synthases (FAS I) has been achieved in recent years, the bacterial FAS I family, which is narrowly distributed within the Actinomycetales genera Mycobacterium, Corynebacterium and Nocardia, is still poorly understood. This is of particular relevance for two reasons: (i) although homologous to fungal FAS I, cryo-electron microscopic studies have shown that bacterial FAS I has unique structural and functional properties, and (ii) M. tuberculosis FAS I is a drug target for the therapeutic treatment of tuberculosis (TB) and therefore is of extraordinary importance as a drug target. Crystals of FAS I from C. efficiens, a homologue of M. tuberculosis FAS I, were produced and diffracted X-rays to about 4.5 Å resolution.

  2. Host-induced gene silencing of an essential chitin synthase gene confers durable resistance to Fusarium head blight and seedling blight in wheat.

    PubMed

    Cheng, Wei; Song, Xiu-Shi; Li, He-Ping; Cao, Le-Hui; Sun, Ke; Qiu, Xiao-Li; Xu, Yu-Bin; Yang, Peng; Huang, Tao; Zhang, Jing-Bo; Qu, Bo; Liao, Yu-Cai

    2015-12-01

    Fusarium head blight (FHB) and Fusarium seedling blight (FSB) of wheat, caused by Fusarium pathogens, are devastating diseases worldwide. We report the expression of RNA interference (RNAi) sequences derived from an essential Fusarium graminearum (Fg) virulence gene, chitin synthase (Chs) 3b, as a method to enhance resistance of wheat plants to fungal pathogens. Deletion of Chs3b was lethal to Fg; disruption of the other Chs gene family members generated knockout mutants with diverse impacts on Fg. Comparative expression analyses revealed that among the Chs gene family members, Chs3b had the highest expression levels during Fg colonization of wheat. Three hairpin RNAi constructs corresponding to the different regions of Chs3b were found to silence Chs3b in transgenic Fg strains. Co-expression of these three RNAi constructs in two independent elite wheat cultivar transgenic lines conferred high levels of stable, consistent resistance (combined type I and II resistance) to both FHB and FSB throughout the T3 to T5 generations. Confocal microscopy revealed profoundly restricted mycelia in Fg-infected transgenic wheat plants. Presence of the three specific short interfering RNAs in transgenic wheat plants was confirmed by Northern blotting, and these RNAs efficiently down-regulated Chs3b in the colonizing Fusarium pathogens on wheat seedlings and spikes. Our results demonstrate that host-induced gene silencing of an essential fungal chitin synthase gene is an effective strategy for enhancing resistance in crop plants under field test conditions. PMID:25735638

  3. Reduced expression of intestinal N-acetylglutamate synthase in suckling piglets: a novel molecular mechanism for arginine as a nutritionally essential amino acid for neonates.

    PubMed

    Geng, Meimei; Li, Tiejun; Kong, Xiangfeng; Song, Xiaoyan; Chu, Wuying; Huang, Ruilin; Yin, Yulong; Wu, Guoyao

    2011-05-01

    The objective of this study was to determine developmental changes in mRNA and protein levels for N-acetylglutamate synthase (NAGS; a key enzyme in synthesis of citrulline and arginine from glutamine/glutamate and proline) in the small intestine of suckling piglets. The porcine NAGS gene was cloned using the real-time polymerase-chain reaction (RT-PCR) method. The porcine NAGS gene encoded 368 amino acid residues and had a high degree of sequence similarity to the "conserved domain" of human and mouse NAGS genes. The porcine NAGS gene was expressed in E. coli BL21 and a polyclonal antibody against the porcine NAGS protein was developed. Real-time RT-PCR and western-blot analyses were performed to quantify NAGS mRNA and protein, respectively, in the jejunum and ileum of 1- to 28-day-old pigs. Results indicated that intestinal NAGS mRNA levels were lower in 7- to 28-day-old than in 1-day-old pigs. Immunochemical analysis revealed that NAGS protein was localized in enterocytes of the gut. Notably, intestinal NAGS protein abundance declined progressively during the 28-day suckling period. The postnatal decrease in NAGS protein levels was consistent with the previous report of reduced NAGS enzymatic activity as well as reduced synthesis of citrulline and arginine in the small intestine of 7- to 28-day-old pigs. Collectively, these results suggest that intestinal NAGS expression is regulated primarily at the post-transcriptional level. The findings also provide a new molecular basis to explain that endogenous synthesis of arginine is impaired in sow-reared piglets and arginine is a nutritionally essential amino acid for the neonates. PMID:20931344

  4. Characterization of the Saccharomyces cerevisiae ARG7 gene encoding ornithine acetyltransferase, an enzyme also endowed with acetylglutamate synthase activity.

    PubMed

    Crabeel, M; Abadjieva, A; Hilven, P; Desimpelaere, J; Soetens, O

    1997-12-01

    We have cloned by functional complementation and characterized the yeast ARG7 gene encoding mitochondrial ornithine acetyltransferase, the enzyme catalyzing the fifth step in arginine biosynthesis. While forming ornithine, this enzyme regenerates acetylglutamate, also produced in the first step by the ARG2-encoded acetylglutamate synthase. Interestingly, total deletion of the genomic ARG7 ORF resulted in an arginine-leaky phenotype, indicating that yeast cells possess an alternative route for generating ornithine from acetylornithine. Yeast ornithine acetyltransferase has been purified and characterized previously as a heterodimer of two subunits proposed to derive from a single precursor protein [Liu, Y-S., Van Heeswijck R., Hoj, P. & Hoogenraad, N. (1995) Eur. J. Biochem. 228, 291-296]; those authors further suggested that the internal processing of Arg7p, which is a mitochondrial enzyme, might occur in the matrix, while the leader peptide would be of the non-cleavable-type. The characterization of the gene (a) establishes that Arg7p is indeed encoded by a single gene, (b) demonstrates the existence of a cleaved mitochondrial prepeptide of eight residues, and (c) shows that the predicted internal processing site is unlike the mitochondrial proteolytic peptidase target sequence. Yeast Arg7p shares between 32-43% identity in pairwise comparisons with the ten analogous bacterial ArgJ enzymes characterized. Among these evolutionarily related enzymes, some but not all appear bifunctional, being able to produce acetylglutamate not only from acetylornithine but also from acetyl-CoA, thus catalyzing the same reaction as the apparently unrelated acetylglutamate synthase. We have addressed the question of the bifunctionality of the eucaryotic enzyme, showing that overexpressed ARG7 can complement yeast arg2 and Escherichia coli argA mutations (affecting acetylglutamate synthase). Furthermore, Arg7p-linked acetylglutamate synthase activity was measurable in an assay. The

  5. Evolutionary origin of the NCSI gene subfamily encoding norcoclaurine synthase is associated with the biosynthesis of benzylisoquinoline alkaloids in plants

    PubMed Central

    Vimolmangkang, Sornkanok; Deng, Xianbao; Owiti, Albert; Meelaph, Thitirat; Ogutu, Collins; Han, Yuepeng

    2016-01-01

    Sacred lotus is rich in biologically active compounds, particularly benzylisoquinoline alkaloids (BIAs). Here, we report on isolation of genes encoding (S)-norcoclaurine synthase (NCS) in sacred lotus, which is a key entry-enzyme in BIA biosynthesis. Seven NCS genes, designated NnNCS1 through NnNCS7, were identified in the sacred lotus genome, and five are located next to each other within a 83 kb region on scaffold 8. The NCS genes are divided into two subfamilies, designated NCSI and NCSII. The NCSII genes are universal in plants, while the NCSI genes are only identified in a limited number of dicotyledonous taxa that produce BIAs. In sacred lotus, only NnNCS4 belongs to the NCSII subfamily, whilst the rest NCS genes within the NCSI subfamily. Overall, the NnNCS7 gene was predominantly expressed in all tested tissues, and its expression is significantly correlated with alkaloid content in leaf. In contrast, the NnNCS4 expression shows no significant correlation with alkaloid accumulation in leaf, and its lack of expression cannot inhibit alkaloid accumulation. Taken together, these results suggest that the NCSI subfamily is crucial for BIA biosynthesis, and its origin may represent an important evolutionary event that allows certain plant taxa to produce BIAs. PMID:27189519

  6. Evolutionary origin of the NCSI gene subfamily encoding norcoclaurine synthase is associated with the biosynthesis of benzylisoquinoline alkaloids in plants.

    PubMed

    Vimolmangkang, Sornkanok; Deng, Xianbao; Owiti, Albert; Meelaph, Thitirat; Ogutu, Collins; Han, Yuepeng

    2016-01-01

    Sacred lotus is rich in biologically active compounds, particularly benzylisoquinoline alkaloids (BIAs). Here, we report on isolation of genes encoding (S)-norcoclaurine synthase (NCS) in sacred lotus, which is a key entry-enzyme in BIA biosynthesis. Seven NCS genes, designated NnNCS1 through NnNCS7, were identified in the sacred lotus genome, and five are located next to each other within a 83 kb region on scaffold 8. The NCS genes are divided into two subfamilies, designated NCSI and NCSII. The NCSII genes are universal in plants, while the NCSI genes are only identified in a limited number of dicotyledonous taxa that produce BIAs. In sacred lotus, only NnNCS4 belongs to the NCSII subfamily, whilst the rest NCS genes within the NCSI subfamily. Overall, the NnNCS7 gene was predominantly expressed in all tested tissues, and its expression is significantly correlated with alkaloid content in leaf. In contrast, the NnNCS4 expression shows no significant correlation with alkaloid accumulation in leaf, and its lack of expression cannot inhibit alkaloid accumulation. Taken together, these results suggest that the NCSI subfamily is crucial for BIA biosynthesis, and its origin may represent an important evolutionary event that allows certain plant taxa to produce BIAs. PMID:27189519

  7. A WDR Gene Is a Conserved Member of a Chitin Synthase Gene Cluster and Influences the Cell Wall in Aspergillus nidulans

    PubMed Central

    Guerriero, Gea; Silvestrini, Lucia; Obersriebnig, Michael; Hausman, Jean-Francois; Strauss, Joseph; Ezcurra, Inés

    2016-01-01

    WD40 repeat (WDR) proteins are pleiotropic molecular hubs. We identify a WDR gene that is a conserved genomic neighbor of a chitin synthase gene in Ascomycetes. The WDR gene is unique to fungi and plants, and was called Fungal Plant WD (FPWD). FPWD is within a cell wall metabolism gene cluster in the Ascomycetes (Pezizomycotina) comprising chsD, a Chs activator and a GH17 glucanase. The FPWD, AN1556.2 locus was deleted in Aspergillus nidulans strain SAA.111 by gene replacement and only heterokaryon transformants were obtained. The re-annotation of Aspergilli genomes shows that AN1556.2 consists of two tightly linked separate genes, i.e., the WDR gene and a putative beta-flanking gene of unknown function. The WDR and the beta-flanking genes are conserved genomic neighbors localized within a recently identified metabolic cell wall gene cluster in genomes of Aspergilli. The heterokaryons displayed increased susceptibility to drugs affecting the cell wall, and their phenotypes, observed by optical, confocal, scanning electron and atomic force microscopy, suggest cell wall alterations. Quantitative real-time PCR shows altered expression of some cell wall-related genes. The possible implications on cell wall biosynthesis are discussed. PMID:27367684

  8. High Trap Formation and Low Metabolite Production by Disruption of the Polyketide Synthase Gene Involved in the Biosynthesis of Arthrosporols from Nematode-Trapping Fungus Arthrobotrys oligospora.

    PubMed

    Xu, Zi-Fei; Wang, Bai-Le; Sun, Hong-Kai; Yan, Ni; Zeng, Zhi-Jun; Zhang, Ke-Qin; Niu, Xue-Mei

    2015-10-21

    A group of morphology regulatory arthrosporol metabolites have been recently characterized from carnivorous fungus Arthrobotrys oligospora that can develop trapping networks to capture their prey. A combination of genetic manipulation and chemical analyses was applied to characterize the function of one polyketide synthase (PKS) gene AOL_s00215g283 in A. oligospora, which was putatively involved in the production of 6-methylsalicylic acid. High-performance liquid chromatography analysis showed that the disruption of the PKS gene not only led to the total loss of the arthrosporol A but also resulted in significant reduction in the production of secondary metabolites in the cultural broth of the mutant ΔAOL_s00215g283 strain. Interestingly, the mutant strain displayed significant increases in the trap formation and the nematicidal activity by 10 and 2 times, respectively, higher than the wild-type strain. These findings revealed a pathogenicity-related biosynthetic gene of this agriculturally important biological agent and have implications for establishment of efficient fungal biocontrol agents. PMID:26422178

  9. Ambient pH Controls Glycogen Levels by Regulating Glycogen Synthase Gene Expression in Neurospora crassa. New Insights into the pH Signaling Pathway

    PubMed Central

    Cupertino, Fernanda Barbosa; Freitas, Fernanda Zanolli; de Paula, Renato Magalhães; Bertolini, Maria Célia

    2012-01-01

    Glycogen is a polysaccharide widely distributed in microorganisms and animal cells and its metabolism is under intricate regulation. Its accumulation in a specific situation results from the balance between glycogen synthase and glycogen phosphorylase activities that control synthesis and degradation, respectively. These enzymes are highly regulated at transcriptional and post-translational levels. The existence of a DNA motif for the Aspergillus nidulans pH responsive transcription factor PacC in the promoter of the gene encoding glycogen synthase (gsn) in Neurospora crassa prompted us to investigate whether this transcription factor regulates glycogen accumulation. Transcription factors such as PacC in A. nidulans and Rim101p in Saccharomyces cerevisiae play a role in the signaling pathway that mediates adaptation to ambient pH by inducing the expression of alkaline genes and repressing acidic genes. We showed here that at pH 7.8 pacC was over-expressed and gsn was down-regulated in wild-type N. crassa coinciding with low glycogen accumulation. In the pacCKO strain the glycogen levels and gsn expression at alkaline pH were, respectively, similar to and higher than the wild-type strain at normal pH (5.8). These results characterize gsn as an acidic gene and suggest a regulatory role for PACC in gsn expression. The truncated recombinant protein, containing the DNA-binding domain specifically bound to a gsn DNA fragment containing the PacC motif. DNA-protein complexes were observed with extracts from cells grown at normal and alkaline pH and confirmed by ChIP-PCR analysis. The PACC present in these extracts showed equal molecular mass, indicating that the protein is already processed at normal pH, in contrast to A. nidulans. Together, these results show that the pH signaling pathway controls glycogen accumulation by regulating gsn expression and suggest the existence of a different mechanism for PACC activation in N. crassa. PMID:22952943

  10. Campylobacter jejuni fatty acid synthase II: Structural and functional analysis of [beta]-hydroxyacyl-ACP dehydratase (FabZ)

    SciTech Connect

    Kirkpatrick, Andrew S.; Yokoyama, Takeshi; Choi, Kyoung-Jae; Yeo, Hye-Jeong

    2009-08-14

    Fatty acid biosynthesis is crucial for all living cells. In contrast to higher organisms, bacteria use a type II fatty acid synthase (FAS II) composed of a series of individual proteins, making FAS II enzymes excellent targets for antibiotics discovery. The {beta}-hydroxyacyl-ACP dehydratase (FabZ) catalyzes an essential step in the FAS II pathway. Here, we report the structure of Campylobacter jejuni FabZ (CjFabZ), showing a hexamer both in crystals and solution, with each protomer adopting the characteristic hot dog fold. Together with biochemical analysis of CjFabZ, we define the first functional FAS II enzyme from this pathogen, and provide a framework for investigation on roles of FAS II in C. jejuni virulence

  11. Structure-guided Discovery of Phenyl diketo-acids as Potent Inhibitors of M. tuberculosis Malate Synthase

    PubMed Central

    Krieger, Inna V.; Freundlich, Joel S.; Gawandi, Vijay B.; Roberts, Justin P.; Gawandi, Vidyadhar B.; Sun, Qingan; Owen, Joshua L.; Fraile, Maria T.; Huss, Sofia I.; Lavandera, Jose-Luis; Ioerger, Thomas R.; Sacchettini, James C.

    2012-01-01

    Summary The glyoxylate shunt plays an important role in fatty-acid metabolism, and has been shown to be critical to survival of several pathogens involved in chronic infections. For Mycobacterium tuberculosis (Mtb), a strain with a defective glyoxylate shunt was previously shown to be unable to establish infection in a mouse model. We report the development of novel phenyl-diketo acid (PDKA) inhibitors of malate synthase (GlcB), one of two glyoxylate shunt enzymes, using structure-based methods. PDKA inhibitors were active against Mtb grown on acetate, and over-expression of GlcB ameliorated this inhibition. Crystal structures of complexes of GlcB with PDKA inhibitors were used to guide optimization of potency. A selected PDKA compound demonstrated efficacy in a mouse model of tuberculosis. The discovery of these PDKA derivatives provides chemical validation of GlcB as an attractive target for tuberculosis therapeutics. PMID:23261599

  12. Analogs of the antituberculous agent pyrazinamide are competitive inhibitors of NADPH binding to M. tuberculosis fatty acid synthase I.

    PubMed

    Sayahi, Halimah; Pugliese, Kaitlin M; Zimhony, Oren; Jacobs, William R; Shekhtman, Alexander; Welch, John T

    2012-11-01

    Analogs of pyrazinamide (=pyrazine-2-carboxamide; PZA), an essential component of short-course antituberculous chemotherapy, such as 5-chloropyrazinamide (5-Cl-PZA) act as competitive inhibitors of NADPH binding to purified mycobacterial fatty acid synthase I (FAS I) as shown by Saturation Transfer Difference (STD) NMR studies. In addition, pyrazinoic acid esters (POE) and 5-Cl-POE reversibly bind to FAS I with the relatively greater affinity of longer-chain esters for FAS I, clear from the STD amplification factors. The competitive binding of PZA and 5-Cl-PZA clearly illustrates that both agents bind FAS. In contrast to PZA, at low NADPH concentrations 5-Cl-PZA is a cooperative inhibitor of NADPH binding. PMID:23161636

  13. A novel mechanism of dasatinib-induced apoptosis in chronic myeloid leukemia; ceramide synthase and ceramide clearance genes.

    PubMed

    Gencer, Emel B; Ural, Ali U; Avcu, Ferit; Baran, Yusuf

    2011-11-01

    Sphingolipids are bioeffector molecules that control various aspects of cell growth, proliferation, apoptosis, and drug resistance. Ceramides, the central molecule of sphingolipid metabolism, are inducer of apoptosis and inhibitors of proliferation. Sphingosine-1-phosphate (S1P) and glucosyleceramide, converted from ceramides by sphingosine kinase-1 (SK-1) and glucosyleceramide synthase (GCS) enzymes, respectively, inhibit apoptosis and develop resistance to chemotherapeutic drugs. In this study, we examined the therapeutic potentials of bioactive sphingolipids in chronic myeloid leukemia (CML) alone and in combination with dasatinib in addition to invest