Science.gov

Sample records for acid synthase genes

  1. The gene controlling marijuana psychoactivity: molecular cloning and heterologous expression of Delta1-tetrahydrocannabinolic acid synthase from Cannabis sativa L.

    PubMed

    Sirikantaramas, Supaart; Morimoto, Satoshi; Shoyama, Yoshinari; Ishikawa, Yu; Wada, Yoshiko; Shoyama, Yukihiro; Taura, Futoshi

    2004-09-17

    Delta(1)-tetrahydrocannabinolic acid (THCA) synthase is the enzyme that catalyzes oxidative cyclization of cannabigerolic acid into THCA, the precursor of Delta(1)-tetrahydrocannabinol. We cloned a novel cDNA (GenBank trade mark accession number AB057805) encoding THCA synthase by reverse transcription and polymerase chain reactions from rapidly expanding leaves of Cannabis sativa. This gene consists of a 1635-nucleotide open reading frame, encoding a 545-amino acid polypeptide of which the first 28 amino acid residues constitute the signal peptide. The predicted molecular weight of the 517-amino acid mature polypeptide is 58,597 Da. Interestingly, the deduced amino acid sequence exhibited high homology to berberine bridge enzyme from Eschscholtzia californica, which is involved in alkaloid biosynthesis. The liquid culture of transgenic tobacco hairy roots harboring the cDNA produced THCA upon feeding of cannabigerolic acid, demonstrating unequivocally that this gene encodes an active THCA synthase. Overexpression of the recombinant THCA synthase was achieved using a baculovirus-insect expression system. The purified recombinant enzyme contained covalently attached FAD cofactor at a molar ratio of FAD to protein of 1:1. The mutant enzyme constructed by changing His-114 of the wild-type enzyme to Ala-114 exhibited neither absorption characteristics of flavoproteins nor THCA synthase activity. Thus, we concluded that the FAD binding residue is His-114 and that the THCA synthase reaction is FAD-dependent. This is the first report on molecular characterization of an enzyme specific to cannabinoid biosynthesis.

  2. Differential expression of fatty acid synthase genes, Acl, Fat and Kas, in Capsicum fruit.

    PubMed

    Aluru, Maneesha R; Mazourek, Michael; Landry, Laurie G; Curry, Jeanne; Jahn, Molly; O'Connell, Mary A

    2003-07-01

    The biosynthesis of capsaicinoids in the placenta of chilli fruit is modelled to require components of the fatty acid synthase (FAS) complex. Three candidate genes for subunits in this complex, Kas, Acl, and Fat, isolated based on differential expression, were characterized. Transcription of these three genes was placental-specific and RNA abundance was positively correlated with degree of pungency. Kas and Acl were mapped to linkage group 1 and Fat to linkage group 6. None of the genes is linked to the pungency locus, C, on linkage group 2. KAS accumulation was positively correlated with pungency. Western blots of placental extracts and histological sections both demonstrated that the accumulation of this enzyme was correlated with fruit pungency and KAS was immunolocalized to the expected cell layer, the placental epidermis. Enzyme activity of the recombinant form of the placental-specific KAS was confirmed using crude cell extracts. These FAS components are fruit-specific members of their respective gene families. These genes are predicted to be associated with Capsicum fruit traits, for example, capsaicinoid biosynthesis or fatty acid biosynthesis necessary for placental development.

  3. Suppression of rat hepatic fatty acid synthase and S14 gene transcription by dietary polyunsaturated fat.

    PubMed

    Blake, W L; Clarke, S D

    1990-12-01

    The objective of this research was to determine whether dietary polyunsaturated fatty acids suppress hepatic fatty acid synthase (FAS) mRNA levels by altering FAS gene transcription. Male Sprague-Dawley rats were meal-fed for 10 d a high glucose diet supplemented with 20% digestible energy as menhaden oil or tripalmitin. The transcription rate for FAS was determined by nuclear run-on analysis in hepatic nuclei isolated from rats 2 h postmeal. The values for transcription rates of FAS and S14 (a putative lipogenic protein) in rats fed menhaden oil were only 6 and 21%, respectively, of the rates in rats fed the tripalmitin diet (p less than 0.02). Gene transcription for beta-actin and phosphoenolpyruvate carboxykinase did not differ between treatments. The reduction in hepatic FAS mRNA levels caused by dietary polyunsaturated fats appears to be caused primarily by an inhibition of FAS transcription. The control of transcription by polyunsaturated fats appears not to be mediated by cAMP because the transcription rate for phosphoenolpyruvate carboxykinase (whose gene is very sensitive to cAMP stimulation) was unaffected by the source of dietary fat.

  4. Evidence that the multifunctional polypeptides of vertebrate and fungal fatty acid synthases have arisen by independent gene fusion events.

    PubMed

    McCarthy, A D; Goldring, J P; Hardie, D G

    1983-10-17

    The enoyl reductase (NADPH binding site) of rabbit mammary fatty acid synthase has been radioactively labelled using pyridoxal phosphate and sodium [3H]borohydride. Using this method we have been able to add this site to the four sites whose location has already been mapped within the multifunctional polypeptide chain of the protein. The results show that the enoyl reductase lies between the 3-oxoacylsynthase and the acyl carrier. This confirms that the active sites occur in a different order on the single multifunctional polypeptide of vertebrate fatty acid synthase and the two multifunctional polypeptides of fungal fatty acid synthase, and suggests that these two systems have arisen by independent gene fusion events.

  5. Influence of Different Levels of Lipoic Acid Synthase Gene Expression on Diabetic Nephropathy

    PubMed Central

    Xu, Longquan; Hiller, Sylvia; Simington, Stephen; Nickeleit, Volker; Maeda, Nobuyo; James, Leighton R.; Yi, Xianwen

    2016-01-01

    Oxidative stress is implicated in the pathogenesis of diabetic nephropathy (DN) but outcomes of many clinical trials are controversial. To define the role of antioxidants in kidney protection during the development of diabetic nephropathy, we have generated a novel genetic antioxidant mouse model with over- or under-expression of lipoic acid synthase gene (Lias). These models have been mated with Ins2Akita/+ mice, a type I diabetic mouse model. We compare the major pathologic changes and oxidative stress status in two new strains of the mice with controls. Our results show that Ins2Akita/+ mice with under-expressed Lias gene, exhibit higher oxidative stress and more severe DN features (albuminuria, glomerular basement membrane thickening and mesangial matrix expansion). In contrast, Ins2Akita/+ mice with highly-expressed Lias gene display lower oxidative stress and less DN pathologic changes. Our study demonstrates that strengthening endogenous antioxidant capacity could be an effective strategy for prevention and treatment of DN. PMID:27706190

  6. Genetic diversity analysis of buffalo fatty acid synthase (FASN) gene and its differential expression among bovines.

    PubMed

    Niranjan, S K; Goyal, S; Dubey, P K; Kumari, N; Mishra, S K; Mukesh, M; Kataria, R S

    2016-01-10

    Fatty Acid Synthase (FASN) gene seems to be structurally and functionally different in bovines in view of their distinctive fatty acid synthesis process. Structural variation and differential expression of FASN gene is reported in buffalo (Bubalus bubalis), a bovine species close to cattle, in this study. Amino acid sequence and phylogenetic analysis of functionally important thioesterase (TE) domain of FASN revealed its conserved nature across mammals. Amino acid residues at TE domain, responsible for substrate binding and processing, were found to be invariant in all the mammalian species. A total of seven polymorphic nucleotide sites, including two in coding region of TE domain were identified across the 10 buffalo populations of riverine and swamp types. G and C alleles were found almost fixed at g18996 and g19056 loci, respectively in riverine buffaloes. Principal component analysis of three SNPs (g18433, g18996 and g19056) revealed distinct classification of riverine and swamp buffalo populations. Reverse Transcription-PCR amplification of mRNA corresponding to exon 8-10 region of buffalo FASN helped in identification of two transcript variants; one transcript of 565 nucleotides and another alternate transcript of 207 nucleotides, seems to have arisen through alternative splicing. Both the transcripts were found to be expressed in most of the vital tissues of buffalo with the highest expression in mammary gland. Semi-quantitative and real-time expression analysis across 13 different buffalo tissues revealed its highest expression in lactating mammary gland. When compared, expression of FASN was also found to be higher in liver, adipose and skeletal muscle of buffalo tissues, than cattle. However, the FASN expression was highest in adipose among the three tissues in both the species. Results indicate structural and functional distinctiveness of bovine FASN. Presence of alternate splicing in buffalo FASN also seems to be a unique phenomenon to the bovines

  7. DNA polymorphisms in the tetrahydrocannabinolic acid (THCA) synthase gene in "drug-type" and "fiber-type" Cannabis sativa L.

    PubMed

    Kojoma, Mareshige; Seki, Hikaru; Yoshida, Shigeo; Muranaka, Toshiya

    2006-06-02

    The cannabinoid content of 13 different strains of cannabis plant (Cannabis sativa L.) was analyzed. Six strains fell into the "drug-type" class, with high Delta-9-tetrahydrocannabinolic acid (THCA) content, and seven strains into the "fiber-type" class, with low THCA using HPLC analysis. Genomic DNA sequence polymorphisms in the THCA synthase gene from each strain were studied. A single PCR fragment of the THCA synthase gene was detected from six strains of "drug-type" plants. We could also detect the fragment from seven strains of "fiber-type" plants, although no or very low content of THCA were detected in these samples. These were 1638 bp from all 13 strains and no intron among the sequences obtained. There were two variants of the THCA synthase gene in the "drug-type" and "fiber-type" cannabis plants, respectively. Thirty-seven major substitutions were detected in the alignment of the deduced amino acid sequences from these variants. Furthermore, we identified a specific PCR marker for the THCA synthase gene for the "drug-type" strains. This PCR marker was not detected in the "fiber-type" strains.

  8. Enhanced citric acid biosynthesis in Pseudomonas fluorescens ATCC 13525 by overexpression of the Escherichia coli citrate synthase gene.

    PubMed

    Buch, Aditi D; Archana, G; Kumar, G Naresh

    2009-08-01

    Citric acid secretion by fluorescent pseudomonads has a distinct significance in microbial phosphate solubilization. The role of citrate synthase in citric acid biosynthesis and glucose catabolism in pseudomonads was investigated by overexpressing the Escherichia coli citrate synthase (gltA) gene in Pseudomonas fluorescens ATCC 13525. The resultant approximately 2-fold increase in citrate synthase activity in the gltA-overexpressing strain Pf(pAB7) enhanced the intracellular and extracellular citric acid yields during the stationary phase, by about 2- and 26-fold, respectively, as compared to the control, without affecting the growth rate, glucose depletion rate or biomass yield. Decreased glucose consumption was paralleled by increased gluconic acid production due to an increase in glucose dehydrogenase activity. While the extracellular acetic acid yield increased in Pf(pAB7), pyruvic acid secretion decreased, correlating with an increase in pyruvate carboxylase activity and suggesting an increased demand for the anabolic precursor oxaloacetate. Activities of two other key enzymes, glucose-6-phosphate dehydrogenase and isocitrate dehydrogenase, remained unaltered, and the contribution of phosphoenolpyruvate carboxylase and isocitrate lyase to glucose catabolism was negligible. Strain Pf(pAB7) demonstrated an enhanced phosphate-solubilizing ability compared to the control. Co-expression of the Synechococcus elongatus PCC 6301 phosphoenolpyruvate carboxylase and E. coli gltA genes in P. fluorescens ATCC 13525, so as to supplement oxaloacetate for citrate biosynthesis, neither significantly affected citrate biosynthesis nor caused any change in the other physiological and biochemical parameters measured, despite approximately 1.3- and 5-fold increases in citrate synthase and phosphoenolpyruvate carboxylase activities, respectively. Thus, our results demonstrate that citrate synthase is rate-limiting in enhancing citrate biosynthesis in P. fluorescens ATCC 13525

  9. Expression of the Rhodobacter sphaeroides hemA and hemT genes, encoding two 5-aminolevulinic acid synthase isozymes.

    PubMed Central

    Neidle, E L; Kaplan, S

    1993-01-01

    The nucleotide sequences of the Rhodobacter sphaeroides hemA and hemT genes, encoding 5-aminolevulinic acid (ALA) synthase isozymes, were determined. ALA synthase catalyzes the condensation of glycine and succinyl coenzyme A, the first and rate-limiting step in tetrapyrrole biosynthesis. The hemA and hemT structural gene sequences were 65% identical to each other, and the deduced HemA and HemT polypeptide sequences were 53% identical, with an additional 16% of aligned amino acids being similar. HemA and HemT were homologous to all characterized ALA synthases, including two human ALA synthase isozymes. In addition, they were evolutionarily related to 7-keto-8-aminopelargonic acid synthetase (BioF) and 2-amino-3-ketobutyrate coenzyme A ligase (Kbl), enzymes which catalyze similar reactions. Two hemA transcripts were identified, both expressed under photosynthetic conditions at levels approximately three times higher than those found under aerobic conditions. A single transcriptional start point was identified for both transcripts, and a consensus sequence at this location indicated that an Fnr-like protein may be involved in the transcriptional regulation of hemA. Transcription of hemT was not detected in wild-type cells under the physiological growth conditions tested. In a mutant strain in which the hemA gene had been inactivated, however, hemT was expressed. In this mutant, hemT transcripts were characterized by Northern (RNA) hybridization, primer extension, and ribonuclease protection techniques. A small open reading frame of unknown function was identified upstream of, and transcribed in the same direction as, hemA. Images PMID:8468290

  10. Cloning and Functional Analysis of a beta-amyrin synthase gene associated with oleanolic acid biosynthesis in Gentiana straminea MAXIM.

    PubMed

    Liu, Yanling; Cai, Yunfei; Zhao, Zhongjuan; Wang, Junfeng; Li, Jing; Xin, Wei; Xia, Guangmin; Xiang, Fengning

    2009-05-01

    Phytosterols and triterpenes are synthesized by oxidosqualene cyclases (OSCs) via the isoprenoid pathway. Here, GsAS1--a full-length beta-amyrin synthase cDNA isolated from Gentiana straminea MAXIM.--was characterized. Its open reading frame consists of 2268 bp, predicted to encode a 756 residue protein containing four QW and one Asp-Cys-Thr-Ala-Glu (DCTAE) motifs, which are both well conserved among known triterpene synthases. The deduced GsAS1 peptide sequence shares 76.2% homology with that of Panax ginseng beta-amyrin synthase. A phylogenetic analysis showed that GsAS1 is closely related to other plant OSCs, and particularly to the beta-amyrin synthases. When the GsAS1 sequence was heterologously expressed in Escherichia coli, an 88 kDa gene product was produced, and this reacted with the appropriate antibody. The sequence was also heterologously expressed in the Pichia pastoris yeast. GsAS1 is expressed in a tissue-specific manner, with its expression in the leaf being ca. 4.5-fold than that in the root, and nearly three-fold than that in the stem. GsAS1 expression was up-regulated by treatment with methyl jasmonate (MeJA) over a period from 6 h to 10 d post treatment. The accumulation oleanolic acid increased after induction by MeJA.

  11. Gene identification and functional analysis of methylcitrate synthase in citric acid-producing Aspergillus niger WU-2223L.

    PubMed

    Kobayashi, Keiichi; Hattori, Takasumi; Honda, Yuki; Kirimura, Kohtaro

    2013-01-01

    Methylcitrate synthase (EC 2.3.3.5; MCS) is a key enzyme of the methylcitric acid cycle localized in the mitochondria of eukaryotic cells and related to propionic acid metabolism. In this study, cloning of the gene mcsA encoding MCS and heterologous expression of it in Escherichia coli were performed for functional analysis of the MCS of citric acid-producing Aspergillus niger WU-2223L. Only one copy of mcsA (1,495 bp) exists in the A. niger WU-2223L chromosome. It encodes a 51-kDa polypeptide consisting of 465 amino acids containing mitochondrial targeting signal peptides. Purified recombinant MCS showed not only MCS activity (27.6 U/mg) but also citrate synthase (EC 2.3.3.1; CS) activity (26.8 U/mg). For functional analysis of MCS, mcsA disruptant strain DMCS-1, derived from A. niger WU-2223L, was constructed. Although A. niger WU-2223L showed growth on propionate as sole carbon source, DMCS-1 showed no growth. These results suggest that MCS is an essential enzyme in propionic acid metabolism, and that the methylcitric acid cycle operates functionally in A. niger WU-2223L. To determine whether MCS makes a contribution to citric acid production, citric acid production tests on DMCS-1 were performed. The amount of citric acid produced from glucose consumed by DMCS-1 in citric acid production medium over 12 d of cultivation was on the same level to that by WU-2223L. Thus it was found that MCS made no contribution to citric acid production from glucose in A. niger WU-2223L, although MCS showed CS activity.

  12. Mutation of L-2,3-diaminopropionic acid synthase genes blocks staphyloferrin B synthesis in Staphylococcus aureus

    PubMed Central

    2011-01-01

    Background Staphylococcus aureus synthesizes two siderophores, staphyloferrin A and staphyloferrin B, that promote iron-restricted growth. Previous work on the biosynthesis of staphyloferrin B has focused on the role of the synthetase enzymes, encoded from within the sbnA-I operon, which build the siderophore from the precursor molecules citrate, alpha-ketoglutarate and L-2,3-diaminopropionic acid. However, no information yet exists on several other enzymes, expressed from the biosynthetic cluster, that are thought to be involved in the synthesis of the precursors (or synthetase substrates) themselves. Results Using mutants carrying insertions in sbnA and sbnB, we show that these two genes are essential for the synthesis of staphyloferrin B, and that supplementation of the growth medium with L-2,3-diaminopropionic acid can bypass the block in staphyloferrin B synthesis displayed by the mutants. Several mechanisms are proposed for how the enzymes SbnA, with similarity to cysteine synthase enzymes, and SbnB, with similarity to amino acid dehydrogenases and ornithine cyclodeaminases, function together in the synthesis of this unusual nonproteinogenic amino acid L-2,3-diaminopropionic acid. Conclusions Mutation of either sbnA or sbnB result in abrogation of synthesis of staphyloferrin B, a siderophore that contributes to iron-restricted growth of S. aureus. The loss of staphyloferrin B synthesis is due to an inability to synthesize the unusual amino acid L-2,3-diaminopropionic acid which is an important, iron-liganding component of the siderophore structure. It is proposed that SbnA and SbnB function together as an L-Dap synthase in the S. aureus cell. PMID:21906287

  13. Phosphanilic Acid Inhibits Dihydropteroate Synthase

    DTIC Science & Technology

    1989-11-01

    dihydropteroate synthases of P. aeruginosa and E . coli were about equally susceptible to inhibition by PA. These results suggest that cells of P. aeruginosa...are more permeable to PA than cells of E . coli . Although a weak inhibitor, PA acted on dihydropteroate synthase in the same manner as the sulfonamides...with which PA is structurally related. Inhibition of E . coli by PA in a basal salts-glucose medium was prevented by p-aminobenzoic acid (pABA). However

  14. DNA Sequence and Expression Variation of Hop (Humulus lupulus) Valerophenone Synthase (VPS), a Key Gene in Bitter Acid Biosynthesis

    PubMed Central

    Castro, Consuelo B.; Whittock, Lucy D.; Whittock, Simon P.; Leggett, Grey; Koutoulis, Anthony

    2008-01-01

    Background The hop plant (Humulus lupulus) is a source of many secondary metabolites, with bitter acids essential in the beer brewing industry and others having potential applications for human health. This study investigated variation in DNA sequence and gene expression of valerophenone synthase (VPS), a key gene in the bitter acid biosynthesis pathway of hop. Methods Sequence variation was studied in 12 varieties, and expression was analysed in four of the 12 varieties in a series across the development of the hop cone. Results Nine single nucleotide polymorphisms (SNPs) were detected in VPS, seven of which were synonymous. The two non-synonymous polymorphisms did not appear to be related to typical bitter acid profiles of the varieties studied. However, real-time quantitative reverse-transcription polymerase chain reaction (qRT-PCR) analysis of VPS expression during hop cone development showed a clear link with the bitter acid content. The highest levels of VPS expression were observed in two triploid varieties, ‘Symphony’ and ‘Ember’, which typically have high bitter acid levels. Conclusions In all hop varieties studied, VPS expression was lowest in the leaves and an increase in expression was consistently observed during the early stages of cone development. PMID:18519445

  15. Molecular evolution and sequence divergence of plant chalcone synthase and chalcone synthase-Like genes.

    PubMed

    Han, Yingying; Zhao, Wenwen; Wang, Zhicui; Zhu, Jingying; Liu, Qisong

    2014-06-01

    Plant chalcone synthase (CHS) and CHS-Like (CHSL) proteins are polyketide synthases. In this study, we evaluated the molecular evolution of this gene family using representative types of CHSL genes, including stilbene synthase (STS), 2-pyrone synthase (2-PS), bibenzyl synthase (BBS), acridone synthase (ACS), biphenyl synthase (BIS), benzalacetone synthase, coumaroyl triacetic acid synthase (CTAS), and benzophenone synthase (BPS), along with their CHS homologs from the same species of both angiosperms and gymnosperms. A cDNA-based phylogeny indicated that CHSLs had diverse evolutionary patterns. STS, ACS, and 2-PS clustered with CHSs from the same species (late diverged pattern), while CTAS, BBS, BPS, and BIS were distant from their CHS homologs (early diverged pattern). The amino-acid phylogeny suggested that CHS and CHSL proteins formed clades according to enzyme function. The CHSs and CHSLs from Polygonaceae and Arachis had unique evolutionary histories. Synonymous mutation rates were lower in late diverged CHSLs than in early diverged ones, indicating that gene duplications occurred more recently in late diverged CHSLs than in early diverged ones. Relative rate tests proved that late diverged CHSLs had unequal rates to CHSs from the same species when using fatty acid synthase, which evolved from the common ancestor with the CHS superfamily, as the outgroup, while the early diverged lineages had equal rates. This indicated that late diverged CHSLs experienced more frequent mutation than early diverged CHSLs after gene duplication, allowing obtaining new functions in relatively short period of time.

  16. An Intronless β-amyrin Synthase Gene is More Efficient in Oleanolic Acid Accumulation than its Paralog in Gentiana straminea

    PubMed Central

    Liu, Yanling; Zhao, Zhongjuan; Xue, Zheyong; Wang, Long; Cai, Yunfei; Wang, Peng; Wei, Tiandi; Gong, Jing; Liu, Zhenhua; Li, Juan; Li, Shuo; Xiang, Fengning

    2016-01-01

    Paralogous members of the oxidosqualene cyclase (OSC) family encode a diversity of enzymes that are important in triterpenoid biosynthesis. This report describes the isolation of the Gentiana straminea gene GsAS2 that encodes a β-amyrin synthase (βAS) enzyme. Unlike its previously isolated paralog GsAS1, GsAS2 lacks introns. Its predicted protein product was is a 759 residue polypeptide that shares high homology with other known β-amyrin synthases (βASs). Heterologously expressed GsAS2 generates more β-amyrin in yeast than does GsAS1. Constitutive over-expression of GsAS2 resulted in a 5.7 fold increase in oleanolic acid accumulation, while over-expression of GsAS1 led to a 3 fold increase. Additionally, RNAi-directed suppression of GsAS2 and GsAS1 in G. straminea decreased oleonolic acid levels by 65.9% and 21% respectively, indicating that GsAS2 plays a more important role than GsAS1 in oleanolic acid biosynthesis in G. straminea. We uses a docking model to explore the catalytic mechanism of GsAS1/2 and predicted that GsAS2, with its Y560, have higher efficiency than GsAS1 and mutated versions of GsAS2 in β-amyrin produce. When the key residue in GsAS2 was mutagenized, it produced about 41.29% and 71.15% less β-amyrin than native, while the key residue in GsAS1 was mutagenized to that in GsAS2, the mutant produced 38.02% more β-amyrin than native GsAS1. PMID:27624821

  17. A real-time PCR assay for the relative quantification of the tetrahydrocannabinolic acid (THCA) synthase gene in herbal Cannabis samples.

    PubMed

    Cascini, Fidelia; Passerotti, Stella; Martello, Simona

    2012-04-10

    In this study, we wanted to investigate whether or not the tetrahydrocannabinolic acid (THCA) synthase gene, which codes for the enzyme involved in the biosynthesis of THCA, influences the production and storage of tetrahydrocannabinol (THC) in a dose-dependent manner. THCA is actually decarboxylated to produce THC, the main psychoactive component in the Cannabis plant. Assuming as the research hypothesis a correlation between the gene copy number and the production of THC, gene quantification could be useful in forensics in order to complement or replace chemical analysis for the identification and classification of seized Cannabis samples, thus distinguishing the drug-type from the fibre-type varieties. A real-time PCR assay for the relative quantification of the THCA synthase gene was then validated on Cannabis samples; some were seized from the illegal drug market and others were derived from experimental cultivation. In order to determine the gene copy number to compare high vs. low potency plants, we chose the ΔΔCt method for TaqMan reactions. The assay enabled single plants with zero, one, and two copies of the gene to be distinguished. As a result of this first part of the research on the THCA synthase gene (the second part will cover a study of gene expression), we found no correlation between THCA synthase gene copy number and the content of THC in the herbal Cannabis samples tested.

  18. Proto-oncogene FBI-1 (Pokemon) and SREBP-1 synergistically activate transcription of fatty-acid synthase gene (FASN).

    PubMed

    Choi, Won-Il; Jeon, Bu-Nam; Park, Hyejin; Yoo, Jung-Yoon; Kim, Yeon-Sook; Koh, Dong-In; Kim, Myung-Hwa; Kim, Yu-Ri; Lee, Choong-Eun; Kim, Kyung-Sup; Osborne, Timothy F; Hur, Man-Wook

    2008-10-24

    FBI-1 (Pokemon/ZBTB7A) is a proto-oncogenic transcription factor of the BTB/POZ (bric-à-brac, tramtrack, and broad complex and pox virus zinc finger) domain family. Recent evidence suggested that FBI-1 might be involved in adipogenic gene expression. Coincidentally, expression of FBI-1 and fatty-acid synthase (FASN) genes are often increased in cancer and immortalized cells. Both FBI-1 and FASN are important in cancer cell proliferation. SREBP-1 is a major regulator of many adipogenic genes, and FBI-1 and SREBP-1 (sterol-responsive element (SRE)-binding protein 1) interact with each other directly via their DNA binding domains. FBI-1 enhanced the transcriptional activation of SREBP-1 on responsive promoters, pGL2-6x(SRE)-Luc and FASN gene. FBI-1 and SREBP-1 synergistically activate transcription of the FASN gene by acting on the proximal GC-box and SRE/E-box. FBI-1, Sp1, and SREBP-1 can bind to all three SRE, GC-box, and SRE/E-box. Binding competition among the three transcription factors on the GC-box and SRE/E-box appears important in the transcription regulation. FBI-1 is apparently changing the binding pattern of Sp1 and SREBP-1 on the two elements in the presence of induced SREBP-1 and drives more Sp1 binding to the proximal promoter with less of an effect on SREBP-1 binding. The changes induced by FBI-1 appear critical in the synergistic transcription activation. The molecular mechanism revealed provides insight into how proto-oncogene FBI-1 may attack the cellular regulatory mechanism of FASN gene expression to provide more phospholipid membrane components needed for rapid cancer cell proliferation.

  19. Divinyl ether synthase gene, and protein and uses thereof

    DOEpatents

    Howe, Gregg A.; Itoh, Aya

    2006-12-26

    The present invention relates to divinyl ether synthase genes, proteins, and methods of their use. The present invention encompasses both native and recombinant wild-type forms of the synthase, as well as mutants and variant forms, some of which possess altered characteristics relative to the wild-type synthase. The present invention also relates to methods of using divinyl ether synthase genes and proteins, including in their expression in transgenic organisms and in the production of divinyl ether fatty acids, and to methods of suing divinyl ether fatty acids, including in the protection of plants from pathogens.

  20. Divinyl ether synthase gene and protein, and uses thereof

    DOEpatents

    Howe, Gregg A.; Itoh, Aya

    2011-09-13

    The present invention relates to divinyl ether synthase genes, proteins, and methods of their use. The present invention encompasses both native and recombinant wild-type forms of the synthase, as well as mutants and variant forms, some of which possess altered characteristics relative to the wild-type synthase. The present invention also relates to methods of using divinyl ether synthase genes and proteins, including in their expression in transgenic organisms and in the production of divinyl ether fatty acids, and to methods of suing divinyl ether fatty acids, including in the protection of plants from pathogens.

  1. Fatty acid synthase 2 contributes to diapause preparation in a beetle by regulating lipid accumulation and stress tolerance genes expression

    PubMed Central

    Tan, Qian-Qian; Liu, Wen; Zhu, Fen; Lei, Chao-Liang; Wang, Xiao-Ping

    2017-01-01

    Diapause, also known as dormancy, is a state of arrested development that allows insects to survive unfavorable environmental conditions. Diapause-destined insects store large amounts of fat when preparing for diapause. However, the extent to which these accumulated fat reserves influence diapause remains unclear. To address this question, we investigated the function of fatty acid synthase (FAS), which plays a central role in lipid synthesis, in stress tolerance, the duration of diapause preparation, and whether insects enter diapause or not. In diapause-destined adult female cabbage beetles, Colaphellus bowringi, FAS2 was more highly expressed than FAS1 at the peak stage of diapause preparation. FAS2 knockdown suppressed lipid accumulation and subsequently affected stress tolerance genes expression and water content. However, silencing FAS2 had no significant effects on the duration of diapause preparation or the incidence of diapause. FAS2 transcription was suppressed by juvenile hormone (JH) and the JH receptor methoprene-tolerant (Met). These results suggest that the absence of JH-Met induces FAS2 expression, thereby promoting lipid storage in diapause-destined female beetles. These results demonstrate that fat reserves regulate stress tolerance genes expression and water content, but have no significant effect on the duration of diapause preparation or the incidence of diapause. PMID:28071706

  2. Genes Specific for the Biosynthesis of Clavam Metabolites Antipodal to Clavulanic Acid Are Clustered with the Gene for Clavaminate Synthase 1 in Streptomyces clavuligerus

    PubMed Central

    Mosher, Roy H.; Paradkar, Ashish S.; Anders, Cecilia; Barton, Barry; Jensen, Susan E.

    1999-01-01

    Portions of the Streptomyces clavuligerus chromosome flanking cas1, which encodes the clavaminate synthase 1 isoenzyme (CAS1), have been cloned and sequenced. Mutants of S. clavuligerus disrupted in cvm1, the open reading frame located immediately upstream of cas1, were constructed by a gene replacement procedure. Similar techniques were used to generate S. clavuligerus mutants carrying a deletion that encompassed portions of the two open reading frames, cvm4 and cvm5, located directly downstream of cas1. Both classes of mutants still produced clavulanic acid and cephamycin C but lost the ability to synthesize the antipodal clavam metabolites clavam-2-carboxylate, 2-hydroxymethyl-clavam, and 2-alanylclavam. These results suggested that cas1 is clustered with genes essential and specific for clavam metabolite biosynthesis. When a cas1 mutant of S. clavuligerus was constructed by gene replacement, it produced lower levels of both clavulanic acid and most of the antipodal clavams except for 2-alanylclavam. However, a double mutant of S. clavuligerus disrupted in both cas1 and cas2 produced neither clavulanic acid nor any of the antipodal clavams, including 2-alanylclavam. This outcome was consistent with the contribution of both CAS1 and CAS2 to a common pool of clavaminic acid that is shunted toward clavulanic acid and clavam metabolite biosynthesis. PMID:10223939

  3. Induction of aminolevulinic acid synthase gene expression and enhancement of metabolite, protoporphyrin IX, excretion by organic germanium.

    PubMed

    Nakamura, Takashi; Saito, Miki; Shimada, Yasuhiro; Fukaya, Haruhiko; Shida, Yasuo; Tokuji, Yoshihiko

    2011-02-25

    Poly-trans-[(2-carboxyethyl) germasesquioxane], Ge-132 is a water-soluble organic germanium compound. Oral intake of dietary Ge-132 changes fecal color and we attempted to identify the fecal red pigment, which increased by the intake of dietary Ge-132. Sprague Dawley rats were given diets containing Ge-132 from 0 to 0.5% concentration. Fecal red pigment was extracted and purified for optical and structural studies. We examined the fecal red pigment content by high performance liquid chromatography (HPLC), and hepatic gene expressions relating to heme synthesis by reverse transcription polymerase chain reaction (RT-PCR). The purified red pigment had particular optical characteristics on the ultraviolet (UV)-visible spectrum (Soret band absorbance at 400 nm) and fluorescence emission at 600 nm by 400 nm excitation, and was identified as protoporphyrin IX by LC-MS analysis. Protoporphyrin IX significantly (P<0.05) increased 2.4-fold in the feces by the intake of a 0.5% Ge-132 diet. Gene expression analysis of the liver explained the increase of protoporphyrin IX by dietary Ge-132 as it enhanced (P<0.05) aminolevulinic acid synthase 1 (Alas1), a rate-limiting enzyme of heme synthesis, expression 1.8-fold, but decreased ferrochelatase (Fech) expression 0.6-fold (P<0.05). The results show that the intake of dietary Ge-132 is related to heme metabolism. Because protoporphyrin IX is used to treat chronic hepatitis, Ge-132 may be a beneficial substance to increase protoporphyrin IX in the liver.

  4. Expression and regulation of pear 1-aminocyclopropane-1-carboxylic acid synthase gene (PpACS1a) during fruit ripening, under salicylic acid and indole-3-acetic acid treatment, and in diseased fruit.

    PubMed

    Shi, Hai-Yan; Zhang, Yu-Xing

    2014-06-01

    In plants, the level of ethylene is determined by the activity of the key enzyme 1-aminocyclopropane-1-carboxylic acid (ACC) synthase (ACS). A gene encoding an ACC synthase protein was isolated from pear (Pyrus pyrifolia). This gene designated PpACS1a (GenBank accession no. KC632526) was 1488 bp in length with an open reading frame (ORF) encoding a protein of 495 amino acids that shared high similarity with other pear ACC synthase proteins. The PpACS1a was grouped into type-1 subfamily of plant ACS based on its conserved domain and phylogenetic status. Real-time quantitative PCR indicated that PpACS1a was differentially expressed in pear tissues and predominantly expressed in anthers. The expression signal of PpACS1a was also detected in fruit and leaves, but no signal was detected in shoots and petals. Furthermore, the PpACS1a expression was regulated during fruit ripening. In addition, the PpACS1a gene expression was regulated by salicylic acid (SA) and indole-3-acetic acid (IAA) in fruit. Moreover, the expression of the PpACS1a was up-regulated in diseased pear fruit. These results indicated that PpACS1a might be involved in fruit ripening and response to SA, IAA and disease.

  5. An apparent Bacillus subtilis folic acid biosynthetic operon containing pab, an amphibolic trpG gene, a third gene required for synthesis of para-aminobenzoic acid, and the dihydropteroate synthase gene.

    PubMed Central

    Slock, J; Stahly, D P; Han, C Y; Six, E W; Crawford, I P

    1990-01-01

    McDonald and Burke (J. Bacteriol. 149:391-394, 1982) previously cloned a sulfanilamide-resistance gene, sul, residing on a 4.9-kb segment of Bacillus subtilis chromosomal DNA, into plasmid pUB110. In this study we determined the nucleotide sequence of the entire 4.9-kb fragment. Genes identified on the fragment include pab, trpG, pabC, sul, one complete unidentified open reading frame, and one incomplete unidentified open reading frame. The first three of these genes, pab, trpG, and pabC, are required for synthesis of p-aminobenzoic acid. The trpG gene encodes an amphibolic glutamine amidotransferase required for synthesis of both p-aminobenzoate and anthranilate, the latter an intermediate in the tryptophan biosynthetic pathway. The pabC gene may encode a B. subtilis analog of enzyme X, an enzyme needed for p-aminobenzoate synthesis in Escherichia coli. The sul gene probably encodes dihydropteroate synthase, the enzyme responsible for formation of 7,8-dihydropteroate, the immediate precursor of folic acid. All six of the cloned genes are arranged in a single operon. Since all four of the identified genes are needed for folate biosynthesis, we refer to this operon as a folic acid operon. Expression of the trpG gene is known to be negatively controlled by tryptophan. We propose that this regulation is at the level of translation. This hypothesis is supported by the finding of an apparent Mtr-binding site which overlaps with the trpG ribosome-binding site. PMID:2123867

  6. Molecular characterization and expression analysis of GlHMGS, a gene encoding hydroxymethylglutaryl-CoA synthase from Ganoderma lucidum (Ling-zhi) in ganoderic acid biosynthesis pathway.

    PubMed

    Ren, Ang; Ouyang, Xiang; Shi, Liang; Jiang, Ai-Liang; Mu, Da-Shuai; Li, Meng-Jiao; Han, Qin; Zhao, Ming-Wen

    2013-03-01

    A hydroxymethylglutaryl-CoA synthase gene, designated as GlHMGS (GenBank accession No. JN391469) involved in ganoderic acid (GA) biosynthesis pathway was cloned from Ganoderma lucidum. The full-length cDNA of GlHMGS (GenBank accession No. JN391468) was found to contain an open reading frame of 1,413 bp encoding a polypeptide of 471 amino acid residues. The deduced amino acid sequence of GlHMGS shared high homology with other known hydroxymethylglutaryl-CoA synthase (HMGS) enzymes. In addition, functional complementation of GlHMGS in a mutant yeast strain YSC1021 lacking HMGS activity demonstrated that the cloned cDNA encodes a functional HMGS. A 1,561 bp promoter sequence was isolated and its putative regulatory elements and potential specific transcription factor binding sites were analyzed. GlHMGS expression profile analysis revealed that salicylic acid, abscisic acid and methyl jasmonate up-regulated GlHMGS transcript levels over the control. Further expression analysis revealed that the developmental stage and carbon source had significant effects on GlHMGS transcript levels. GlHMGS expression peaked on day 16 before decreasing with prolonged culture time. The highest mRNA level was observed when the carbon source was maltose. Overexpression of GlHMGS enhanced GA content in G. lucidum. This study provides useful information for further studying this gene and on its function in the ganoderic acid biosynthetic pathway in G. lucidum.

  7. Production of resveratrol from p-coumaric acid in recombinant Saccharomyces cerevisiae expressing 4-coumarate:coenzyme A ligase and stilbene synthase genes.

    PubMed

    Shin, So-Yeon; Han, Nam Soo; Park, Yong-Cheol; Kim, Myoung-Dong; Seo, Jin-Ho

    2011-01-05

    Resveratrol is a well-known polyphenol present in red wine and exerts antioxidative and anti-carcinogenic effects on the human body. To produce resveratrol in a food-grade yeast, the 4-coumarate:coenzyme A ligase gene (4CL1) from Arabidopsis thaliana and stilbene synthase gene (STS) from Arachis hypogaea were cloned and transformed into Saccharomyces cerevisiae W303-1A. The resveratrol produced was unglycosylated and secreted into the culture medium. A batch culture with 15.3mg/l p-coumaric acid used as precursor resulted in the production of 3.1mg/l resveratrol with 14.4 mol% yield. Deletion of the putative phenyl acrylic acid decarboxylase gene (PAD1) did not enhance resveratrol production.

  8. Biosynthesis of Akaeolide and Lorneic Acids and Annotation of Type I Polyketide Synthase Gene Clusters in the Genome of Streptomyces sp. NPS554

    PubMed Central

    Zhou, Tao; Komaki, Hisayuki; Ichikawa, Natsuko; Hosoyama, Akira; Sato, Seizo; Igarashi, Yasuhiro

    2015-01-01

    The incorporation pattern of biosynthetic precursors into two structurally unique polyketides, akaeolide and lorneic acid A, was elucidated by feeding experiments with 13C-labeled precursors. In addition, the draft genome sequence of the producer, Streptomyces sp. NPS554, was performed and the biosynthetic gene clusters for these polyketides were identified. The putative gene clusters contain all the polyketide synthase (PKS) domains necessary for assembly of the carbon skeletons. Combined with the 13C-labeling results, gene function prediction enabled us to propose biosynthetic pathways involving unusual carbon-carbon bond formation reactions. Genome analysis also indicated the presence of at least ten orphan type I PKS gene clusters that might be responsible for the production of new polyketides. PMID:25603349

  9. Nucleotide sequence of a Pseudomonas denitrificans 5.4-kilobase DNA fragment containing five cob genes and identification of structural genes encoding S-adenosyl-L-methionine: uroporphyrinogen III methyltransferase and cobyrinic acid a,c-diamide synthase.

    PubMed Central

    Crouzet, J; Cauchois, L; Blanche, F; Debussche, L; Thibaut, D; Rouyez, M C; Rigault, S; Mayaux, J F; Cameron, B

    1990-01-01

    A 5.4-kilobase DNA fragment carrying Pseudomonas denitrificans cob genes has been sequenced. The nucleotide sequence and genetic analysis revealed that this fragment carries five different cob genes (cobA to cobE). Four of these genes present the characteristics of translationally coupled genes. cobA has been identified as the structural gene of S-adenosyl-L-methionine:uroporphyrinogen III methyltransferase (SUMT) because the encoded protein has the same NH2 terminus and molecular weight as those determined for the purified SUMT. For the same reasons the cobB gene was shown to be the structural gene for cobyrinic acid a,c-diamide synthase. Genetic and biochemical data concerning cobC and cobD mutants suggest that the products of these genes are involved in the conversion of cobyric acid to cobinamide. PMID:2211520

  10. p-Aminobenzoic acid and chloramphenicol biosynthesis in Streptomyces venezuelae: gene sets for a key enzyme, 4-amino-4-deoxychorismate synthase.

    PubMed

    Chang, Z; Sun, Y; He, J; Vining, L C

    2001-08-01

    Amplification of sequences from Streptomyces venezuelae ISP5230 genomic DNA using PCR with primers based on conserved prokaryotic pabB sequences gave two main products. One matched pabAB, a locus previously identified in S. venezuelae. The second closely resembled the conserved pabB sequence consensus and hybridized with a 3.8 kb NcoI fragment of S. venezuelae ISP5230 genomic DNA. Cloning and sequence analysis of the 3.8 kb fragment detected three ORFs, and their deduced amino acid sequences were used in BLAST searches of the GenBank database. The ORF1 product was similar to PabB in other bacteria and to the PabB domain encoded by S. venezuelae pabAB. The ORF2 product resembled PabA of other bacteria. ORF3 was incomplete; its deduced partial amino acid sequence placed it in the MocR group of GntR-type transcriptional regulators. Introducing vectors containing the 3.8 kb NcoI fragment of S. venezuelae DNA into pabA and pabB mutants of Escherichia coli, or into the Streptomyces lividans pab mutant JG10, enhanced sulfanilamide resistance in the host strains. The increased resistance was attributed to expression of the pair of discrete translationally coupled p-aminobenzoic acid biosynthesis genes (designated pabB/pabA) cloned in the 3.8 kb fragment. These represent a second set of genes encoding 4-amino-4-deoxychorismate synthase in S. venezuelae ISP5230. In contrast to the fused pabAB set previously isolated from this species, they do not participate in chloramphenicol biosynthesis, but like pabAB they can be disrupted without affecting growth on minimal medium. The gene disruption results suggest that S. venezuelae may have a third set of genes encoding PABA synthase.

  11. Identification of two distinct Bacillus subtilis citrate synthase genes.

    PubMed

    Jin, S; Sonenshein, A L

    1994-08-01

    Two distinct Bacillus subtilis genes (citA and citZ) were found to encode citrate synthase isozymes that catalyze the first step of the Krebs cycle. The citA gene was cloned by genetic complementation of an Escherichia coli citrate synthase mutant strain (W620) and was in a monocistronic transcriptional unit. A divergently transcribed gene, citR, could encode a protein with strong similarity to the bacterial LysR family of regulatory proteins. A null mutation in citA had little effect on citrate synthase enzyme activity or sporulation. The residual citrate synthase activity was purified from a citA null mutant strain, and the partial amino acid sequence for the purified protein (CitZ) was determined. The citZ gene was cloned from B. subtilis chromosomal DNA by using a PCR-generated probe synthesized with oligonucleotide primers derived from the partial amino acid sequence of purified CitZ. The citZ gene proved to be the first gene in a tricistronic cluster that also included citC (coding for isocitrate dehydrogenase) and citH (coding for malate dehydrogenase). A mutation in citZ caused a substantial loss of citrate synthase enzyme activity, glutamate auxotrophy, and a defect in sporulation.

  12. Producing dicarboxylic acids using polyketide synthases

    DOEpatents

    Katz, Leonard; Fortman, Jeffrey L.; Keasling, Jay D.

    2015-05-26

    The present invention provides for a polyketide synthase (PKS) capable of synthesizing a dicarboxylic acid (diacid). Such diacids include diketide-diacids and triketide-diacids. The invention includes recombinant nucleic acid encoding the PKS, and host cells comprising the PKS. The invention also includes methods for producing the diacids.

  13. Producing dicarboxylic acids using polyketide synthases

    SciTech Connect

    Katz, Leonard; Fortman, Jeffrey L; Keasling, Jay D

    2013-10-29

    The present invention provides for a polyketide synthase (PKS) capable of synthesizing a dicarboxylic acid (diacid). Such diacids include diketide-diacids and triketide-diacids. The invention includes recombinant nucleic acid encoding the PKS, and host cells comprising the PKS. The invention also includes methods for producing the diacids.

  14. Associations of patella lead with polymorphisms in the vitamin D receptor, delta-aminolevulinic acid dehydratase and endothelial nitric oxide synthase genes.

    PubMed

    Theppeang, Keson; Schwartz, Brian S; Lee, Byung-Kook; Lustberg, Mark E; Silbergeld, Ellen K; Kelsey, Karl T; Parsons, Patrick J; Todd, Andrew C

    2004-06-01

    A cross-sectional analysis was performed to evaluate associations of polymorphisms in the vitamin D receptor (VDR), delta-aminolevulinic acid dehydratase (ALAD), and endothelial nitric oxide synthase (eNOS) genes with patella lead concentrations in 652 lead workers in the Republic of Korea. There was a wide range of patella lead (from below detection limit to 946 microg Pb/g bone mineral), with a mean (standard deviation) of 75.2 (101.0). There were no associations of ALAD or eNOS genotypes with patella lead, but workers with the VDR B allele had significantly (P value < 0.05) higher patella lead (on average, 25% or approximately 6.6 microg Pb/g bone mineral) than lead workers with the VDR bb genotype. There was evidence that the relation between age and patella lead was modified by both the VDR and eNOS genotypes.

  15. Associations of uric acid with polymorphisms in the delta-aminolevulinic acid dehydratase, vitamin D receptor, and nitric oxide synthase genes in Korean lead workers.

    PubMed

    Weaver, Virginia M; Schwartz, Brian S; Jaar, Bernard G; Ahn, Kyu-Dong; Todd, Andrew C; Lee, Sung-Soo; Kelsey, Karl T; Silbergeld, Ellen K; Lustberg, Mark E; Parsons, Patrick J; Wen, Jiayu; Lee, Byung-Kook

    2005-11-01

    Recent research suggests that uric acid may be nephrotoxic at lower levels than previously recognized and that it may be one mechanism for lead-related nephrotoxicity. Therefore, in understanding mechanisms for lead-related nephrotoxicity, it would be of value to determine whether genetic polymorphisms that are associated with renal outcomes in lead workers and/or modify associations between lead dose and renal function are also associated with uric acid and/or modify associations between lead dose and uric acid. We analyzed data on three such genetic polymorphisms: delta-aminolevulinic acid dehydratase (ALAD), endothelial nitric oxide synthase (eNOS), and the vitamin D receptor (VDR). Mean (+/- SD) tibia, blood, and dimercaptosuccinic acid-chelatable lead levels were 37.2 +/- 40.4 microg/g bone mineral, 32.0+/- 15.0 g/dL, and 0.77+/- 0.86 microg/mg creatinine, respectively, in 798 current and former lead workers. Participants with the eNOSAsp allele had lower mean serum uric acid compared with those with the Glu/Glu genotype. Among older workers (age > or = median of 40.6 years), ALAD genotype modified associations between lead dose and uric acid levels. Higher lead dose was significantly associated with higher uric acid in workers with the ALAD1-1 genotype; associations were in the opposite direction in participants with the variant ALAD1-2 genotype. In contrast, higher tibia lead was associated with higher uric acid in those with the variant VDRB allele; however, modification was dependent on participants with the bb genotype and high tibia lead levels. We conclude that genetic polymorphisms may modify uric acid mediation of lead-related adverse renal effects.

  16. The cellulose synthase 3 (CesA3) gene of oomycetes: structure, phylogeny and influence on sensitivity to carboxylic acid amide (CAA) fungicides.

    PubMed

    Blum, Mathias; Gamper, Hannes A; Waldner, Maya; Sierotzki, Helge; Gisi, Ulrich

    2012-04-01

    Proper disease control is very important to minimize yield losses caused by oomycetes in many crops. Today, oomycete control is partially achieved by breeding for resistance, but mainly by application of single-site mode of action fungicides including the carboxylic acid amides (CAAs). Despite having mostly specific targets, fungicidal activity can differ even in species belonging to the same phylum but the underlying mechanisms are often poorly understood. In an attempt to elucidate the phylogenetic basis and underlying molecular mechanism of sensitivity and tolerance to CAAs, the cellulose synthase 3 (CesA3) gene was isolated and characterized, encoding the target site of this fungicide class. The CesA3 gene was present in all 25 species included in this study representing the orders Albuginales, Leptomitales, Peronosporales, Pythiales, Rhipidiales and Saprolegniales, and based on phylogenetic analyses, enabled good resolution of all the different taxonomic orders. Sensitivity assays using the CAA fungicide mandipropamid (MPD) demonstrated that only species belonging to the Peronosporales were inhibited by the fungicide. Molecular data provided evidence, that the observed difference in sensitivity to CAAs between Peronosporales and CAA tolerant species is most likely caused by an inherent amino acid configuration at position 1109 in CesA3 possibly affecting fungicide binding. The present study not only succeeded in linking CAA sensitivity of various oomycetes to the inherent CesA3 target site configuration, but could also relate it to the broader phylogenetic context.

  17. Effects of bovine fatty acid synthase, stearoyl-coenzyme A desaturase, sterol regulatory element-binding protein 1, and growth hormone gene polymorphisms on fatty acid composition and carcass traits in Japanese Black cattle.

    PubMed

    Matsuhashi, T; Maruyama, S; Uemoto, Y; Kobayashi, N; Mannen, H; Abe, T; Sakaguchi, S; Kobayashi, E

    2011-01-01

    The quality of fat is an important factor in defining the quality of meat. Fat quality is determined by the composition of fatty acids. Among lipid metabolism-related genes, including fatty acid synthesis genes, several genetic variations have been reported in the bovine fatty acid synthase (FASN), stearoyl-CoA desaturase (SCD), sterol regulatory element-binding protein 1 (SREBP1), and GH genes. In the present study, we evaluated the single and epistatic effects of 5 genetic variations (4 SNP and 1 insertion/deletion) in 4 genes (FASN, SCD, SREBP1, and GH) on the fatty acid composition of the longissimus thoracis muscle and carcass and meat quality traits in 480 commercial Japanese Black cattle. Significant single effects of FASN, SCD, and GH(L127V) polymorphisms on the fatty acid composition of the longissimus thoracis muscle were detected. The A293V polymorphism of SCD had the largest effect on myristic acid (C14:0, P < 0.001), myristoleic acid (C14:1, P < 0.001), stearic acid (C18:0, P < 0.001), oleic acid (C18:1, P < 0.001), and MUFA (P < 0.001). Polymorphisms in the FASN, SCD, and SREBP1 genes showed no effect on any meat yield trait. There were no significant epistatic effects on fatty acid composition among pairs of the 3 genes (FASN, SCD, and SREBP1) involved in fatty acid synthesis. No epistatic interactions (P > 0.1) were detected between FASN and SCD for any carcass trait. When the genotypes of 3 markers (FASN, SCD, and GH(L127V)) were substituted from the lesser effect allele to the greater effect allele, the proportion of C18:1 increased by 4.46%. More than 20% of the genetic variance in the C18:1 level could be accounted for by these 3 genetic markers. The present results revealed that polymorphisms in 2 fatty acid synthesis genes (FASN and SCD) independently influenced fatty acid composition in the longissimus thoracis muscle. These results suggest that SNP in the FASN and SCD genes are useful markers for the improvement of fatty acid composition in

  18. Synergism in the effect of prior jasmonic acid application on herbivore-induced volatile emission by Lima bean plants: transcription of a monoterpene synthase gene and volatile emission

    PubMed Central

    Menzel, Tila R.; Weldegergis, Berhane T.; David, Anja; Boland, Wilhelm; Gols, Rieta; van Loon, Joop J. A.; Dicke, Marcel

    2014-01-01

    Jasmonic acid (JA) plays a central role in induced plant defence e.g. by regulating the biosynthesis of herbivore-induced plant volatiles that mediate the attraction of natural enemies of herbivores. Moreover, exogenous application of JA can be used to elicit plant defence responses similar to those induced by biting-chewing herbivores and mites that pierce cells and consume their contents. In the present study, we used Lima bean (Phaseolus lunatus) plants to explore how application of a low dose of JA followed by minor herbivory by spider mites (Tetranychus urticae) affects transcript levels of P. lunatus (E)-β-ocimene synthase (PlOS), emission of (E)-β-ocimene and nine other plant volatiles commonly associated with herbivory. Furthermore, we investigated the plant’s phytohormonal response. Application of a low dose of JA increased PlOS transcript levels in a synergistic manner when followed by minor herbivory for both simultaneous and sequential infestation. Emission of (E)-β-ocimene was also increased, and only JA, but not SA, levels were affected by treatments. Projection to latent structures-discriminant analysis (PLS-DA) of other volatiles showed overlap between treatments. Thus, a low-dose JA application results in a synergistic effect on gene transcription and an increased emission of a volatile compound involved in indirect defence after herbivore infestation. PMID:25318119

  19. Associations of renal function with polymorphisms in the delta-aminolevulinic acid dehydratase, vitamin D receptor, and nitric oxide synthase genes in Korean lead workers.

    PubMed

    Weaver, Virginia M; Schwartz, Brian S; Ahn, Kyu-Dong; Stewart, Walter F; Kelsey, Karl T; Todd, Andrew C; Wen, Jiayu; Simon, David J; Lustberg, Mark E; Parsons, Patrick J; Silbergeld, Ellen K; Lee, Byung-Kook

    2003-10-01

    We analyzed data from 798 lead workers to determine whether polymorphisms in the genes encoding delta-aminolevulinic acid dehydratase (ALAD), endothelial nitric oxide synthase (eNOS), and the vitamin D receptor (VDR) were associated with or modified relations of lead exposure and dose measures with renal outcomes. Lead exposure was assessed with job duration, blood lead, dimercaptosuccinic acid (DMSA)-chelatable lead, and tibia lead. Renal function was assessed with blood urea nitrogen (BUN), serum creatinine, measured creatinine clearance, calculated creatinine clearance and urinary N-acetyl-beta-D-glucosaminidase (NAG), and retinol-binding protein. Mean (+/- SD) tibia lead, blood lead, and DMSA-chelatable lead levels were 37.2 +/- 40.4 microg/g bone mineral, 32.0 +/- 15.0 microg/dL, and 767.8 +/- 862.1 microg/g creatinine, respectively. After adjustment, participants with the ALAD(2) allele had lower mean serum creatinine and higher calculated creatinine clearance. We observed effect modification by ALAD on associations between blood lead and/or DMSA-chelatable lead and three renal outcomes. Among those with the ALAD(1-2) genotype, higher lead measures were associated with lower BUN and serum creatinine and higher calculated creatinine clearance. Participants with the eNOS variant allele were found to have higher measured creatinine clearance and BUN. In participants with the Asp allele, longer duration working with lead was associated with higher serum creatinine and lower calculated creatinine clearance and NAG; all were significantly different from relations in those with the Glu/Glu genotype except NAG (p = 0.08). No significant differences were seen in renal outcomes by VDR genotype, nor was consistent effect modification observed. The ALAD findings could be explained by lead-induced hyperfiltration.

  20. Effect modification by delta-aminolevulinic acid dehydratase, vitamin D receptor, and nitric oxide synthase gene polymorphisms on associations between patella lead and renal function in lead workers.

    PubMed

    Weaver, Virginia M; Lee, Byung-Kook; Todd, Andrew C; Ahn, Kyu-Dong; Shi, Weiping; Jaar, Bernard G; Kelsey, Karl T; Lustberg, Mark E; Silbergeld, Ellen K; Parsons, Patrick J; Wen, Jiayu; Schwartz, Brian S

    2006-09-01

    Genetic polymorphisms that affect lead toxicokinetics or toxicodynamics may be important modifiers of risk for adverse outcomes in lead-exposed populations. We recently reported associations between higher patella lead, which is hypothesized to represent a lead pool that is both bioavailable and cumulative, and adverse renal outcomes in current and former Korean lead workers. In the present study, we assessed effect modification by polymorphisms in the genes encoding for delta-aminolevulinic acid dehydratase (ALAD), the vitamin D receptor (VDR), and endothelial nitric oxide synthase on those associations. Similar analyses were conducted with three other lead biomarkers. Renal function was assessed via blood urea nitrogen, serum creatinine, measured and calculated creatinine clearances, urinary N-acetyl-beta-D-glucosaminidase, and retinol-binding protein. Mean (SD) blood, patella, tibia, and dimercaptosuccinic acid-chelatable lead values were 30.9 (16.7) microg/dl, 75.1 (101.1)and 33.6 (43.4) microg Pb/g bone mineral, and 0.63 (0.75) microg Pb/mg creatinine, respectively, in 647 lead workers. Little evidence of effect modification by genotype on associations between patella lead and renal outcomes was observed. The VDR polymorphism did modify associations between the other lead biomarkers and the serum creatinine and calculated creatinine clearance. Higher lead dose was associated with worse renal function in participants with the variant B allele. Models in two groups, dichotomized by median age, showed that this effect was present in the younger half of the population. Limited evidence of effect modification by ALAD genotype was observed; higher blood lead levels were associated with higher calculated creatinine clearance among participants with the ALAD(1-2) genotype. In conclusion, VDR and/or ALAD genotypes modified associations between all the lead biomarkers, except patella lead, and the renal outcomes.

  1. Geranyl diphosphate synthase molecules, and nucleic acid molecules encoding same

    DOEpatents

    Croteau, Rodney Bruce; Burke, Charles Cullen

    2008-06-24

    In one aspect, the present invention provides isolated nucleic acid molecules that each encode a geranyl diphosphate synthase protein, wherein each isolated nucleic acid molecule hybridizes to a nucleic acid molecule consisting of the sequence set forth in SEQ ID NO:1 under conditions of 5.times.SSC at 45.degree. C. for one hour. The present invention also provides isolated geranyl diphosphate synthase proteins, and methods for altering the level of expression of geranyl diphosphate synthase protein in a host cell.

  2. Two branches of the lupeol synthase gene in the molecular evolution of plant oxidosqualene cyclases.

    PubMed

    Shibuya, M; Zhang, H; Endo, A; Shishikura, K; Kushiro, T; Ebizuka, Y

    1999-11-01

    Two new triterpene synthase cDNAs, named as OEW and TRW, were cloned from olive leaves (Olea europaea) and from dandelion roots (Taraxacum officinale), respectively, by the PCR method with primers designed from the conserved sequences found in the known oxidosqualene cyclases. Their ORFs consisted of 2274 bp nucleotides and coded for 758 amino acid long polypeptides. They shared high sequence identity (78%) to each other, while they showed only about 60% identities to the known triterpene synthases LUPI (lupeol synthase clone from Arabidopsis thaliana) and PNY (beta-amyrin synthase clone from Panax ginseng) at amino acid level. To determine the enzyme functions of the translates, they were expressed in an ERG7 deficient yeast mutant. Accumulation of lupeol in the cells of yeast transformants proved both of these clones code for lupeol synthase proteins. An EST (expression sequence tag) clone isolated from Medicago truncatula roots as a homologue of cycloartenol synthase gene, exhibits high sequence identity (75-77%) to these two lupeol synthase cDNAs, suggesting it to be another lupeol synthase clone. Comparatively low identity (approximately 57%) of LUP1 from Arabidopsis thaliana to either one of these clones leaves LUP1 as a distinct clone among lupeol synthases. From these sequence comparisons, now we propose that two branches of lupeol synthase gene have been generated in higher plants during the course of evolution.

  3. Chromosomal localization of the human and mouse hyaluronan synthase genes

    SciTech Connect

    Spicer, A.P.; McDonald, J.A.; Seldin, M.F.

    1997-05-01

    We have recently identified a new vertebrate gene family encoding putative hyaluronan (HA) synthases. Three highly conserved related genes have been identified, designated HAS1, HAS2, and HAS3 in humans and Has1, Has2, and Has3 in the mouse. All three genes encode predicted plasma membrane proteins with multiple transmembrane domains and approximately 25% amino acid sequence identity to the Streptococcus pyogenes HA synthase, HasA. Furthermore, expression of any one HAS gene in transfected mammalian cells leads to high levels of HA biosynthesis. We now report the chromosomal localization of the three HAS genes in human and in mouse. The genes localized to three different positions within both the human and the mouse genomes. HAS1 was localized to the human chromosome 19q13.3-q13.4 boundary and Has1 to mouse Chr 17. HAS2 was localized to human chromosome 8q24.12 and Has2 to mouse Chr 15. HAS3 was localized to human chromosome 16q22.1 and Has3 to mouse Chr 8. The map position for HAS1 reinforces the recently reported relationship between a small region of human chromosome 19q and proximal mouse chromosome 17. HAS2 mapped outside the predicted critical region delineated for the Langer-Giedion syndrome and can thus be excluded as a candidate gene for this genetic syndrome. 33 refs., 2 figs.

  4. Phytochelatin synthase genes from Arabidopsis and the yeast Schizosaccharomyces pombe.

    PubMed Central

    Ha, S B; Smith, A P; Howden, R; Dietrich, W M; Bugg, S; O'Connell, M J; Goldsbrough, P B; Cobbett, C S

    1999-01-01

    Phytochelatins (PCs), a family of heavy metal-inducible peptides important in the detoxification of heavy metals, have been identified in plants and some microorganisms, including Schizosaccharomyces pombe, but not in animals. PCs are synthesized enzymatically from glutathione (GSH) by PC synthase in the presence of heavy metal ions. In Arabidopsis, the CAD1 gene, identified by using Cd-sensitive, PC-deficient cad1 mutants, has been proposed to encode PC synthase. Using a positional cloning strategy, we have isolated the CAD1 gene. Database searches identified a homologous gene in S. pombe, and a mutant with a targeted deletion of this gene was also Cd sensitive and PC deficient. Extracts of Escherichia coli cells expressing a CAD1 cDNA or the S. pombe gene catalyzing GSH-dependent, heavy metal-activated synthesis of PCs in vitro demonstrated that both genes encode PC synthase activity. Both enzymes were activated by a range of metal ions. In contrast, reverse transcription-polymerase chain reaction experiments showed that expression of the CAD1 mRNA is not influenced by the presence of Cd. A comparison of the two predicted amino acid sequences revealed a highly conserved N-terminal region, which is presumed to be the catalytic domain, and a variable C-terminal region containing multiple Cys residues, which is proposed to be involved in activation of the enzyme by metal ions. Interestingly, a similar gene was identified in the nematode, Caenorhabditis elegans, suggesting that PCs may also be expressed in some animal species. PMID:10368185

  5. Generation of stable 'low phytic acid' transgenic rice through antisense repression of the 1D-myo-inositol 3-phosphate synthase gene (RINO1) using the 18-kDa oleosin promoter.

    PubMed

    Kuwano, Mio; Mimura, Tetsuro; Takaiwa, Fumio; Yoshida, Kaoru T

    2009-01-01

    Phytic acid acts as the major storage form of phosphorus in plant seeds and is poorly digested by monogastric animals. The degradation of phytic acid in animal diets is necessary to overcome both environmental and nutritional issues. The enzyme 1D-myo-inositol 3-phosphate [Ins(3)P(1)] synthase (EC 5.5.1.4) catalyses the first step of myo-inositol biosynthesis and directs phytic acid biosynthesis in seeds. The rice Ins(3)P(1) synthase gene (RINO1) is highly expressed in developing seed embryos and in the aleurone layer, where phytic acid is synthesized and stored. In rice seeds, 18-kDa oleosin (Ole18) is expressed in a seed-specific manner, and its transcripts are restricted to the embryo and the aleurone layer. Therefore, to effectively suppress phytic acid biosynthesis, antisense RINO1 cDNA was expressed under the control of the Ole18 promoter, directing the same spatial pattern in seeds as RINO1 in transgenic rice plants. The generated transgenic rice plants showed strong 'low phytic acid' (lpa) phenotypes, in which seed phytic acid was reduced by 68% and free available phosphate was concomitantly increased. No negative effects on seed weight, germination or plant growth were observed. The available phosphate levels of the stable transgenic plants surpassed those of currently available rice lpa mutants.

  6. Contribution of omega-3 fatty acid desaturase and 3-ketoacyl-ACP synthase II (KASII) genes in the modulation of glycerolipid fatty acid composition during cold acclimation in birch leaves.

    PubMed

    Martz, Françoise; Kiviniemi, Sari; Palva, Tapio E; Sutinen, Marja-Liisa

    2006-01-01

    Temperate and boreal tree species respond to low positive temperatures (LT) or a shortening of the photoperiod (SD) by inducing cold acclimation. One of the metabolic consequences of cold acclimation is an increase in fatty acid (FA) desaturation in membrane lipids, which allows functional membrane fluidity to be maintained at LT. The molecular mechanisms of FA desaturation were investigated in leaves of birch seedlings (Betula pendula) during cold acclimation. Four genes involved in FA biosynthesis were isolated: a 3-ketoacyl-ACP synthase II gene (BpKASII) involved in the elongation of palmitoyl-ACP to stearoyl-ACP, and three omega-3 FA desaturase genes (BpFAD3, BpFAD7, and BpFAD8) involved in the desaturation of linoleic acid (18:2) to alpha-linolenic acid (18:3). BpFAD7 was the main omega-3 FAD gene expressed in birch leaves, and it was down-regulated by LT under SD conditions. LT induced the expression of BpFAD3 and BpFAD8 and a synchronous increase in 18:3 occurred in glycerolipids. Changes in the photoperiod did not affect the LT-induced increase in 18:3 in chloroplast lipids (MGDG, DGDG, PG), but it modulated the LT response detected in extra-chloroplastic lipids (PC, PE, PI, PS). A decrease in the proportion of the 16-carbon FAs in lipids occurred at LT, possibly in relation to the regulation of BpKASII expression at LT. These results suggest that LT affects the whole FA biosynthesis pathway. They support a co-ordinated action of microsomal (BpFAD3) and chloroplast enzymes (BpFAD7, BpFAD8) in determining the level of 18:3 in extra-chloroplastic membranes, and they highlight the importance of dynamic lipid trafficking.

  7. Effects and mechanism of acid rain on plant chloroplast ATP synthase.

    PubMed

    Sun, Jingwen; Hu, Huiqing; Li, Yueli; Wang, Lihong; Zhou, Qing; Huang, Xiaohua

    2016-09-01

    Acid rain can directly or indirectly affect plant physiological functions, especially photosynthesis. The enzyme ATP synthase is the key in photosynthetic energy conversion, and thus, it affects plant photosynthesis. To clarify the mechanism by which acid rain affects photosynthesis, we studied the effects of acid rain on plant growth, photosynthesis, chloroplast ATP synthase activity and gene expression, chloroplast ultrastructure, intracellular H(+) level, and water content of rice seedlings. Acid rain at pH 4.5 remained the chloroplast structure unchanged but increased the expression of six chloroplast ATP synthase subunits, promoted chloroplast ATP synthase activity, and increased photosynthesis and plant growth. Acid rain at pH 4.0 or less decreased leaf water content, destroyed chloroplast structure, inhibited the expression of six chloroplast ATP synthase subunits, decreased chloroplast ATP synthase activity, and reduced photosynthesis and plant growth. In conclusion, acid rain affected the chloroplast ultrastructure, chloroplast ATPase transcription and activity, and P n by changing the acidity in the cells, and thus influencing the plant growth and development. Finally, the effects of simulated acid rain on the test indices were found to be dose-dependent.

  8. Investigation of a 6-MSA Synthase Gene Cluster in Aspergillus aculeatus Reveals 6-MSA-derived Aculinic Acid, Aculins A-B and Epi-Aculin A.

    PubMed

    Petersen, Lene M; Holm, Dorte K; Gotfredsen, Charlotte H; Mortensen, Uffe H; Larsen, Thomas O

    2015-10-12

    Aspergillus aculeatus, a filamentous fungus belonging to the Aspergillus clade Nigri, is an industrial workhorse in enzyme production. Recently we reported a number of secondary metabolites from this fungus; however, its genetic potential for the production of secondary metabolites is vast. In this study we identified a 6-methylsalicylic acid (6-MSA) synthase from A. aculeatus, and verified its functionality by episomal expression in A. aculeatus and heterologous expression in A. nidulans. Feeding studies with fully (13) C-labeled 6-MSA revealed that 6-MSA is incorporated into aculinic acid, which further incorporates into three compounds that we name aculins A and B, and epi-aculin A, described here for the first time. Based on NMR data and bioinformatic studies we propose the structures of the compounds as well as a biosynthetic pathway leading to formation of aculins from 6-MSA.

  9. Regulation of resin acid synthesis in Pinus densiflora by differential transcription of genes encoding multiple 1-deoxy-D-xylulose 5-phosphate synthase and 1-hydroxy-2-methyl-2-(E)-butenyl 4-diphosphate reductase genes.

    PubMed

    Kim, Yeon-Bok; Kim, Sang-Min; Kang, Min-Kyoung; Kuzuyama, Tomohisa; Lee, Jong Kyu; Park, Seung-Chan; Shin, Sang-Chul; Kim, Soo-Un

    2009-05-01

    Pinus densiflora Siebold et Zucc. is the major green canopy species in the mountainous area of Korea. To assess the response of resin acid biosynthetic genes to mechanical and chemical stimuli, we cloned cDNAs of genes encoding enzymes involved in the 2-C-methyl-d-erythritol 4-phosphate (MEP) pathway (1-deoxy-d-xylulose 5-phosphate synthase (PdDXS), 1-deoxy-d-xylulose 5-phosphate reductoisomerase (PdDXR) and 1-hydroxy-2-methyl-2-(E)-butenyl 4-diphosphate reductase (PdHDR)) by the rapid amplification of cDNA ends (RACE) technique. In addition, we cloned the gene encoding abietadiene synthase (PdABS) as a marker for the site of pine resin biosynthesis. PdHDR and PdDXS occurred as two gene families. In the phylogenetic trees, PdDXSs, PdDXR and PdHDRs each formed a separate clade from their respective angiosperm homologs. PdDXS2, PdHDR2 and PdDXR were most actively transcribed in stem wood, whereas PdABS was specifically transcribed. The abundance of PdDXS2 transcripts in wood in the resting state was generally 50-fold higher than the abundance of PdDXS1 transcripts, and PdHDR2 transcripts were more abundant by an order of magnitude in wood than in other tissues, with the ratio of PdHDR2 to PdHDR1 transcripts in wood being about 1. Application of 1 mM methyl jasmonate (MeJA) selectively enhanced the transcript levels of PdDXS2 and PdHDR2 in wood. The ratios of PdDXS2 to PdDXS1 and PdHDR2 to PdHDR1 reached 900 and 20, respectively, on the second day after MeJA treatment, whereas the transcript level of PdABS increased twofold by 3 days after MeJA treatment. Wounding of the stem differentially enhanced the transcript ratios of PdDXS2 to PdDXS1 and PdHDR2 to PdHDR1 to 300 and 70, respectively. The increase in the transcript levels of the MEP pathway genes in response to wounding was accompanied by two orders of magnitude increase in PdABS transcripts. These observations indicated that resin acid biosynthesis activity, represented by PdABS transcription, was correlated

  10. Structure and regulation of the omega-3 polyunsaturated fatty acid synthase genes from the deep-sea bacterium Photobacterium profundum strain SS9.

    PubMed

    Allen, Eric E; Bartlett, Douglas H

    2002-06-01

    Omega-3 polyunsaturated fatty acids (PUFAs) such as eicosapentaenoic acid (20:5n-3; EPA) and docosahexaenoic acid (22:6n-3; DHA) have been shown to be of major importance in the promotion of cardiovascular health, proper human development and the prevention of some cancers. A high proportion of bacterial isolates from low-temperature and high-pressure marine environments produce EPA or DHA. This paper presents the sequence of a 33 kbp locus from the deep-sea bacterium Photobacterium profundum strain SS9 which includes four of the five genes required for EPA biosynthesis. As with other bacterial pfa (polyunsaturated fatty acid) genes, the deduced amino acid sequences encoded by the SS9 genes reveal large multidomain proteins that are likely to catalyse EPA biosynthesis by a novel polyketide synthesis mechanism. RNase protection experiments separated the SS9 pfa genes into two transcriptional units, pfaA-C and pfaD. The pfaA transcriptional start site was identified. Cultivation at elevated hydrostatic pressure or reduced temperature did not increase pfa gene expression despite the resulting increase in percentage composition of EPA under these conditions. However, a regulatory mutant was characterized which showed both increased expression of pfaA-D and elevated EPA percentage composition. This result suggests that a regulatory factor exists which coordinates pfaA-D transcription. Additional consideration regarding the activities required for PUFA synthesis is provided together with comparative analyses of bacterial pfa genes and gene products.

  11. Modified cellulose synthase gene from 'Arabidopsis thaliana' confers herbicide resistance to plants

    SciTech Connect

    Somerville, Chris R.; Scieble, Wolf

    2000-10-11

    Cellulose synthase ('CS'), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl) phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  12. Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants

    DOEpatents

    Somerville, Chris R.; Scheible, Wolf

    2007-07-10

    Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  13. Altered expression of the caffeine synthase gene in a naturally caffeine-free mutant of Coffea arabica

    PubMed Central

    2009-01-01

    In this work, we studied the biosynthesis of caffeine by examining the expression of genes involved in this biosynthetic pathway in coffee fruits containing normal or low levels of this substance. The amplification of gene-specific transcripts during fruit development revealed that low-caffeine fruits had a lower expression of the theobromine synthase and caffeine synthase genes and also contained an extra transcript of the caffeine synthase gene. This extra transcript contained only part of exon 1 and all of exon 3. The sequence of the mutant caffeine synthase gene revealed the substitution of isoleucine for valine in the enzyme active site that probably interfered with enzymatic activity. These findings indicate that the absence of caffeine in these mutants probably resulted from a combination of transcriptional regulation and the presence of mutations in the caffeine synthase amino acid sequence. PMID:21637458

  14. Expression of a Flax Allene Oxide Synthase cDNA Leads to Increased Endogenous Jasmonic Acid (JA) Levels in Transgenic Potato Plants but Not to a Corresponding Activation of JA-Responding Genes.

    PubMed Central

    Harms, K.; Atzorn, R.; Brash, A.; Kuhn, H.; Wasternack, C.; Willmitzer, L.; Pena-Cortes, H.

    1995-01-01

    Both jasmonic acid (JA) and its methyl ester, methyl jasmonate (MeJA), are thought to be significant components of the signaling pathway regulating the expression of plant defense genes in response to various stresses. JA and MeJA are plant lipid derivatives synthesized from [alpha]-linolenic acid by a lipoxygenase-mediated oxygenation leading to 13-hydroperoxylinolenic acid, which is subsequently transformed by the action of allene oxide synthase (AOS) and additional modification steps. AOS converts lipoxygenase-derived fatty acid hydroperoxide to allene epoxide, which is the precursor for JA formation. Overexpression of flax AOS cDNA under the regulation of the cauliflower mosaic virus 35S promoter in transgenic potato plants led to an increase in the endogenous level of JA. Transgenic plants had six- to 12-fold higher levels of JA than the nontransformed plants. Increased levels of JA have been observed when potato and tomato plants are mechanically wounded. Under these conditions, the proteinase inhibitor II (pin2) genes are expressed in the leaves. Despite the fact that the transgenic plants had levels of JA similar to those found in nontransgenic wounded plants, pin2 genes were not constitutively expressed in the leaves of these plants. Transgenic plants with increased levels of JA did not show changes in water state or in the expression of water stress-responsive genes. Furthermore, the transgenic plants overexpressing the flax AOS gene, and containing elevated levels of JA, responded to wounding or water stress by a further increase in JA and by activating the expression of either wound- or water stress-inducible genes. Protein gel blot analysis demonstrated that the flax-derived AOS protein accumulated in the chloroplasts of the transgenic plants. PMID:12242357

  15. Citrate synthase encoded by the CIT2 gene of Saccharomyces cerevisiae is peroxisomal.

    PubMed Central

    Lewin, A S; Hines, V; Small, G M

    1990-01-01

    The product of the CIT2 gene has the tripeptide SKL at its carboxyl terminus. This amino acid sequence has been shown to act as a peroxisomal targeting signal in mammalian cells. We examined the subcellular site of this extramitochondrial citrate synthase. Cells of Saccharomyces cerevisiae were grown on oleate medium to induce peroxisome proliferation. A fraction containing membrane-enclosed vesicles and organelles was analyzed by sedimentation on density gradients. In wild-type cells, the major peak of citrate synthase activity was recovered in the mitochondrial fraction, but a second peak of activity cosedimented with peroxisomes. The peroxisomal activity, but not the mitochondrial activity, was inhibited by incubation at pH 8.1, a characteristic of the extramitochondrial citrate synthase encoded by the CIT2 gene. In a strain in which the CIT1 gene encoding mitochondrial citrate synthase had been disrupted, the major peak of citrate synthase activity was peroxisomal, and all of the activity was sensitive to incubation at pH 8.1. Yeast cells bearing a cit2 disruption were unable to mobilize stored lipids and did not form stable peroxisomes in oleate. We conclude that citrate synthase encoded by CIT2 is peroxisomal and participates in the glyoxylate cycle. Images PMID:2181273

  16. Producing a trimethylpentanoic acid using hybrid polyketide synthases

    DOEpatents

    Katz, Leonard; Fortman, Jeffrey L; Keasling, Jay D

    2014-10-07

    The present invention provides for a polyketide synthase (PKS) capable of synthesizing trimethylpentanoic acid. The present invention also provides for a host cell comprising the PKS and when cultured produces the trimethylpentanoic acid. The present invention also provides for a method of producing the trimethylpentanoic acid, comprising: providing a host cell of the present invention, and culturing said host cell in a suitable culture medium such that the trimethylpentanoic acid is produced, optionally isolating the trimethylpentanoic acid, and optionally, reducing the isolated trimethylpentanoic acid into a trimethylpentanol or an iso-octane.

  17. Two anthranilate synthase genes in Arabidopsis: defense-related regulation of the tryptophan pathway.

    PubMed Central

    Niyogi, K K; Fink, G R

    1992-01-01

    Arabidopsis thaliana has two genes, ASA1 and ASA2, encoding the alpha subunit of anthranilate synthase, the enzyme catalyzing the first reaction in the tryptophan biosynthetic pathway. As a branchpoint enzyme in aromatic amino acid biosynthesis, anthranilate synthase has an important regulatory role. The sequences of the plant genes are homologous to their microbial counterparts. Both predicted proteins have putative chloroplast transit peptides at their amino termini and conserved amino acids involved in feedback inhibition by tryptophan. ASA1 and ASA2 cDNAs complement anthranilate synthase alpha subunit mutations in the yeast Saccharomyces cerevisiae and in Escherichia coli, confirming that both genes encode functional anthranilate synthase proteins. The distributions of ASA1 and ASA2 mRNAs in various parts of Arabidopsis plants are overlapping but nonidentical, and ASA1 mRNA is approximately 10 times more abundant in whole plants. Whereas ASA2 is expressed at a constitutive basal level, ASA1 is induced by wounding and bacterial pathogen infiltration, suggesting a novel role for ASA1 in the production of tryptophan pathway metabolites as part of an Arabidopsis defense response. Regulation of key steps in aromatic amino acid biosynthesis in Arabidopsis appears to involve differential expression of duplicated genes. PMID:1392592

  18. Polyunsaturated fatty acid inhibition of fatty acid synthase transcription is independent of PPAR activation.

    PubMed

    Clarke, S D; Turini, M; Jump, D B; Abraham, S; Reedy, M

    1998-01-01

    Polyunsaturated fatty acids (PUFA) of the (n-6) and (n-3) families inhibit the rate of gene transcription for a number of hepatic lipogenic and glycolytic genes, e.g., fatty acid synthase (FAS). In contrast, saturated and monounsaturated fatty acids have no inhibitory capability. The suppression of gene transcription resulting from the addition of PUFA to a high carbohydrate diet: occurs quickly (< 3 h) after its addition to a high glucose diet; can be recreated with hepatocytes cultured in a serum-free medium containing insulin and glucocorticoids; can be demonstrated in diabetic rats fed fructose; and is independent of glucagon. While the nature of the intracellular PUFA inhibitor is unclear, it appears that delta-6 desaturation is a required step in the process. Recently, the fatty acid activated nuclear factor, peroxisome-proliferator activated receptor (PPAR) was suggested to be the PUFA-response factor. However, the potent PPAR activators ETYA and Wy-14643 did not suppress hepatic expression of FAS, but did induce the PPAR-responsive gene, acyl-CoA oxidase (AOX). Similarly, treating rat hepatocytes with 20:4 (n-6) suppressed FAS expression but had no effect on AOX. Thus, it appears that the PUFA regulation of gene transcription involves a PUFA-response factor that is independent from PPAR.

  19. [Interspecific polymorphism of the glucosyltransferase domain of the sucrose synthase gene in the genus Malus and related species of Rosaceae].

    PubMed

    Boris, K V; Kochieva, E Z; Kudryavtsev, A M

    2014-12-01

    The sequences that encode the main functional glucosyltransferase domain of sucrose synthase genes have been identified for the first time in 14 species of the genus Malus and related species of the family Rosaceae, and their polymorphism was investigated. Single nucleotide substitutions leading to amino acid substitutions in the protein sequence, including the conservative transmembrane motif sequence common to all sucrose synthase genes of higher plants, were detected in the studied sequences.

  20. Mammalian fatty acid synthase: closure on a textbook mechanism?

    PubMed

    Leadlay, Peter; Baerga-Ortiz, Abel

    2003-02-01

    Mammalian fatty acid synthase is a classic example of a chain-building multienzyme. A cornerstone of its mechanism has been the obligatory collaboration of two identical subunits, with fatty acyl intermediates transferring between them. Now, fresh evidence has upset this view.

  1. Accumulation of wound-inducible ACC synthase transcript in tomato fruit is inhibited by salicylic acid and polyamines.

    PubMed

    Li, N; Parsons, B L; Liu, D R; Mattoo, A K

    1992-02-01

    Regulation of wound-inducible 1-aminocyclopropane-1-carboxylic acid (ACC) synthase expression was studied in tomato fruit (Lycopersicon esculentum cv. Pik-Red). A 70 base oligonucleotide probe homologous to published ACC synthase cDNA sequences was successfully used to identify and analyze regulation of a wound-inducible transcript. The 1.8 kb ACC synthase transcript increased upon wounding the fruit as well as during fruit ripening. Salicylic acid, an inhibitor of wound-responsive genes in tomato, inhibited the wound-induced accumulation of the ACC synthase transcript. Further, polyamines (putrescine, spermidine and spermine) that have anti-senescence properties and have been shown to inhibit the development of ACC synthase activity, inhibited the accumulation of the wound-inducible ACC synthase transcript. The inhibition by spermine was greater than that caused by putrescine or spermidine. The transcript level of a wound-repressible glycine-rich protein gene and that of the constitutively expressed rRNA were not affected as markedly by either salicylic acid or polyamines. These data suggest that salicylic acid and polyamines may specifically regulate ethylene biosynthesis at the level of ACC synthase transcript accumulation.

  2. Characterization of a sabinene synthase gene from rough lemon (Citrus jambhiri).

    PubMed

    Kohzaki, Keisuke; Gomi, Kenji; Yamasaki-Kokudo, Yumiko; Ozawa, Rika; Takabayashi, Junji; Akimitsu, Kazuya

    2009-10-15

    We previously isolated two putative monoterpene synthase genes, RlemTPS1 and RlemTPS2, from rough lemon (Citrus jambhiri) and showed that gene expression of RlemTPS2 was induced by microbial attack. The protein product of RlemTPS2 was obtained using a prokaryotic expression system, and GC and GC-MS of monoterpene synthesis by RlemTPS2 determined that RlemTPS2 encodes a sabinene synthase. Sabinene has antifungal activity toward Alternaria alternata. Furthermore, site-directed mutagenesis identified one amino acid, Ile, located at the front of the metal ion binding motif as an important residue for the product specificity of sabinene synthase.

  3. Cloning and analysis of valerophenone synthase gene expressed specifically in lupulin gland of hop (Humulus lupulus L.).

    PubMed

    Okada, Y; Ito, K

    2001-01-01

    Resin and essential oil derived from hop (Humulus lupulus L.) cones are very important compounds for beer brewing, and they specifically accumulate in the lupulin gland of hop cones. In order to identify the genes responsible for the biosynthetic pathway of these compounds and use the identified genes for hop breeding using Marker Assisted Selection and transformation techniques, genes expressed specifically in the lupulin gland were cloned and sequenced. One of them was suggested to be similar to the chalcone synthase gene from the DNA sequence. The translation product of the gene had the activity of valerophenone synthase, which catalyzes a part of the synthesis reaction of alpha-acid and beta-acid. Northern analysis showed that the valerophenone synthase gene seemed to be expressed specifically in the lupulin gland.

  4. Increased production of wax esters in transgenic tobacco plants by expression of a fatty acid reductase:wax synthase gene fusion.

    PubMed

    Aslan, Selcuk; Hofvander, Per; Dutta, Paresh; Sun, Chuanxin; Sitbon, Folke

    2015-12-01

    Wax esters are hydrophobic lipids consisting of a fatty acid moiety linked to a fatty alcohol with an ester bond. Plant-derived wax esters are today of particular concern for their potential as cost-effective and sustainable sources of lubricants. However, this aspect is hampered by the fact that the level of wax esters in plants generally is too low to allow commercial exploitation. To investigate whether wax ester biosynthesis can be increased in plants using transgenic approaches, we have here exploited a fusion between two bacterial genes together encoding a single wax ester-forming enzyme, and targeted the resulting protein to chloroplasts in stably transformed tobacco (Nicotiana benthamiana) plants. Compared to wild-type controls, transgenic plants showed both in leaves and stems a significant increase in the total level of wax esters, being eight-fold at the whole plant level. The profiles of fatty acid methyl ester and fatty alcohol in wax esters were related, and C16 and C18 molecules constituted predominant forms. Strong transformants displayed certain developmental aberrations, such as stunted growth and chlorotic leaves and stems. These negative effects were associated with an accumulation of fatty alcohols, suggesting that an adequate balance between formation and esterification of fatty alcohols is crucial for a high wax ester production. The results show that wax ester engineering in transgenic plants is feasible, and suggest that higher yields may become achieved in the near future.

  5. Characterization of three members of the ACC synthase gene family in Solanum tuberosum L.

    PubMed

    Destéfano-Beltrán, L J; van Caeneghem, W; Gielen, J; Richard, L; van Montagu, M; van der Straeten, D

    1995-02-20

    Two genomic clones corresponding to three members of the 1-aminocyclopropane-1-carboxylic acid (ACC) synthase gene family in potato (Solanum tuberosum L.) have been isolated and sequenced. Two highly homologous genes, ST-ACS1A and ST-ACS1B, transcribed in opposite directions were found in an 8.9 kb region. Their coding sequences are interrupted by two introns at identical positions. Their closest relative in tomato is the LE-ACS3 gene. The third gene in potato, ST-ACS2, was found in a 4 kb region and shows a gene structure similar to that of the tomato LE-ACS4 gene and to the mung bean VR-ACS4 and VR-ACS5 genes. Based on its lack of significant homology to the tomato gene family and its closeness to the VR-ACS4 and VR-ACS5 genes, we propose that LE-ACS7 represents an additional isoform in the tomato genome. Moreover, in a phylogenetic comparison of known ACC synthases, the ST-ACS2 isoform was grouped in a separate lineage together with the mung bean VR-ACS4 and VR-ACS5, and the moth orchid DS-ACS1A and DS-ACS1B gene products. Expression of the three potato genes was studied by reverse transcription-polymerase chain reaction on total RNA. The twin genes are positively regulated by indole-3-acetic acid in hypocotyls and expression is modulated by wounding in the leaves. The third gene is responsive to ethylene and wounding mainly in tubers. The roles of these three genes and of other members of the ACC synthase gene family in vegetative processes of potato such as tuberization, dormancy, and sprouting have yet to be determined.

  6. Molecular Cloning and Co-Expression of Phytoene Synthase Gene from Kocuria gwangalliensis in Escherichia coli.

    PubMed

    Seo, Yong Bae; Choi, Seong-Seok; Lee, Jong Kyu; Kim, Nan-Hee; Choi, Mi Jin; Kim, Jong-Myoung; Jeong, Tae Hyug; Nam, Soo-Wan; Lim, Han Kyu; Kim, Gun-Do

    2015-11-01

    A phytoene synthase gene, crtB, was isolated from Kocuria gwangalliensis. The crtB with 1,092 bp full-length has a coding sequence of 948 bp and encodes a 316-amino-acids protein. The deduced amino acid sequence showed a 70.9% identity with a putative phytoene synthase from K. rhizophila. An expression plasmid, pCcrtB, containing the crtB gene was constructed, and E. coli cells containing this plasmid produced the recombinant protein of approximately 34 kDa , corresponding to the molecular mass of phytoene synthase. Biosynthesis of lycopene was confirmed when the plasmid pCcrtB was co-transformed into E. coli containing pRScrtEI carrying the crtE and crtI genes encoding lycopene biosynthetic pathway enzymes. The results obtained from this study will provide a base of knowledge about the phytoene synthase of K. gwangalliensis and can be applied to the production of carotenoids in a non-carotenoidproducing host.

  7. Regulation of an anthranilate synthase gene in Streptomyces venezuelae by a trp attenuator.

    PubMed

    Lin, C; Paradkar, A S; Vining, L C

    1998-07-01

    The nucleotide sequence of a 2-4 kb BamHI-SalI fragment of Streptomyces venezuelae ISP5230 DNA that complements trpE and trpG mutations in Escherichia coli contains two ORFs. The larger of these (ORF2) encodes a 624 amino acid sequence similar to the overall sequence of the two subunits of anthranilate synthase. The two-thirds nearest the amino terminus resembles the aminase subunit; the remaining one-third resembles the glutamine amidotransferase subunit. Upstream of ORF2 is a small ORF encoding 18 amino acids that include three adjacent Trp residues; in addition the ORF contains inverted repeats with sequence and positional similarity to the products of attenuator (trpL) regions that regulate tryptophan biosynthesis in other bacteria. In cultures of a trpC mutant of S. venezuelae, increasing the concentration of exogenous tryptophan decreased the formation of anthranilate synthase; similar evidence of endproduct repression was obtained in a trpCER mutant of E. coli transformed with a vector containing the cloned DNA fragment from S. venezuelae. The anthranilate synthase activity in S. venezuelae cell extracts was inhibited by tryptophan, although only at high concentrations of the amino acid. A two-base deletion introduced into the cloned S. venezuelae DNA fragment prevented complementation of a trpE mutation in E. coli. However, S. venezuelae transformants in which the two-base deletion had been introduced by replacement of homologous chromosomal DNA did not exhibit a Trp- phenotype. The result implies that S. venezuelae has one or more additional genes for anthranilate synthase. In alignments with anthranilate synthase genes from other organisms, ORF2 from S. venezuelae most closely resembled genes for phenazine biosynthesis in Pseudomonas. The results bear on the function of the gene in S. venezuelae.

  8. Mechanistic studies of 3-deoxy-D-manno-octulosonic acid 8-phosphate synthase

    SciTech Connect

    Dotson, G.D.; Woodard, R.W.

    1994-12-01

    The enzyme 3-deOXY-D-manno-octulosonic acid 8-phosphate synthase (KDO 8-P synthase) catalyses the condensation of arabinose 5-phosphate (A 5-P) with phosphoenolpyruvate (PEP) to give the unique eight-carbon acidic sugar 3-deoxy-D-nianno-octulosonic acid 8-phosphate (KDO 8-P) found only in gram-negative bacteria and required for lipid A maturation and cellular growth. The E. coli gene kdsA that encodes KDO 8-P synthase has been amplified by standard PCR methodologies. The synthetic gene, subcloned into the expression vector pT7-7 was used to infect E. coli BL 21 (DE 3). Purification of crude supernatant from this transformant on Q Sepharose yields >200 mg of near-homogeneous KDO 8-P synthase per liter of cell culture. To explore the mechanism of KDO 8-P synthase, we prepared (E)- and (Z)-(3{sup 2}H)PEP, (2-{sup 13}C)PEP, and (2-{sup 13}C,{sup 18}O)PEP chemically from the appropriately labeled 3-bromopyruvates by reaction with trimethylphosphite under Perkow reaction conditions. Our {sup 1}H-NMR analysis of the stereochemistry at C3 of the KDO 8-Ps, obtained by separate incubation of (E)- and (Z)-(3-{sup 2}H)PEP with A 5-P in the presence of KDO 8-P synthase, demonstrated that the reaction is stereospecific with respect to both the C3 of PEP and the C1 carbonyl of A 5-P. (Z)-(3-{sup 2}H)PEP gave predominantly (3S)-(3{sup 2}H)KDO 8-P and (E)-(3-{sup 2}H)PEP gave predominantly (3R)-(3{sup 2}H)KDO-8P, which indicates condensation of the si face of PEP upon the re face of A 5-P-an orientation analogous to that seen with the similar aldehyde Iyase DAH 7-P synthase. The fate of the enolic oxygen of (2-{sup 13}C, {sup 18}O)PEP, during the course of the KDO 8-P synthase-catalyzed reaction as monitored by both {sup 13}C- and {sup 31}P-NMR spectroscopy demonstrated that the inorganic phosphate (Pi) and not the KDO 8-P contained the {sup 18}O.

  9. The Arabidopsis Trehalose-6-P Synthase AtTPS1 Gene Is a Regulator of Glucose, Abscisic Acid, and Stress Signaling1

    PubMed Central

    Avonce, Nelson; Leyman, Barbara; Mascorro-Gallardo, José O.; Van Dijck, Patrick; Thevelein, Johan M.; Iturriaga, Gabriel

    2004-01-01

    In Arabidopsis (Arabidopsis thaliana), trehalose is present at almost undetectable levels, excluding its role as an osmoprotectant. Here, we report that overexpression of AtTPS1 in Arabidopsis using the 35S promoter led to a small increase in trehalose and trehalose-6-P levels. In spite of this, transgenic plants displayed a dehydration tolerance phenotype without any visible morphological alterations, except for delayed flowering. Moreover, seedlings overexpressing AtTPS1 exhibited glucose (Glc)- and abscisic acid (ABA)-insensitive phenotypes. Transgenic seedlings germinated on Glc were visibly larger with green well-expanded cotyledonary leaves and fully developed roots, in contrast with wild-type seedlings showing growth retardation and absence of photosynthetic tissue. An ABA dose-response experiment revealed a higher germination rate for transgenic plants overexpressing AtTPS1 showing insensitive germination kinetics at 2.5 μm ABA. Interestingly, germination in the presence of Glc did not trigger an increase in ABA content in plants overexpressing AtTPS1. Expression analysis by quantitative reverse transcription-PCR in transgenic plants showed up-regulation of the ABI4 and CAB1 genes. In the presence of Glc, CAB1 expression remained high, whereas ABI4, HXK1, and ApL3 levels were down-regulated in the AtTPS1-overexpressing lines. Analysis of AtTPS1 expression in HXK1-antisense or HXK1-sense transgenic lines suggests the possible involvement of AtTPS1 in the hexokinase-dependent Glc-signaling pathway. These data strongly suggest that AtTPS1 has a pivotal role in the regulation of Glc and ABA signaling during vegetative development. PMID:15516499

  10. Modular synthase-encoding gene involved in α-olefin biosynthesis in Synechococcus sp. strain PCC 7002.

    PubMed

    Mendez-Perez, Daniel; Begemann, Matthew B; Pfleger, Brian F

    2011-06-01

    A gene involved in the production of medium-chain α-olefins was identified in the cyanobacterium Synechococcus sp. strain PCC 7002. The gene encodes a large multidomain protein with homology to type I polyketide synthases, suggesting a route for hydrocarbon biosynthesis from fatty acids via an elongation decarboxylation mechanism.

  11. Molecular cloning, expression pattern and comparative analysis of chitin synthase gene B in Spodoptera exigua.

    PubMed

    Kumar, N Senthil; Tang, Bin; Chen, Xiaofei; Tian, Honggang; Zhang, Wenqing

    2008-03-01

    The chitin synthase (CHS) gene B (4781 bp) of Spodoptera exigua (SeCHSB) was cloned by reverse-transcription PCR (RT-PCR) and 3'/5' RACE from the midgut. SeCHSB contains an open reading frame of 4572 nucleotides, encoding a protein of 1523 amino acids with a predicted molecular mass of approximately 174.6 kDa. Alignment of SeCHSB with class B CHSs of other insects showed a high degree of conservation in the putative catalytic domain region. The structure of the SeCHSB gene was analyzed and was found to be the same as that of Manduca sexta CHSB (MsCHSB), including 23 exons and 22 introns but without alternative exons. Southern blot analysis revealed that SeCHSB was a single copy gene and the presence of only two chitin synthase genes in S. exigua. Further investigation indicated that SeCHSB was specifically expressed in the midgut, and its transcript existed constitutively in the midgut from the 3rd instar larval stage to prepupae and reached highest expression on the 1st day of the fifth instar larval stage. These data suggest that SeCHSB is very important in midgut formation and development. Chitin synthase gene comparisons between different classes of insects using software tools revealed some interesting aspects of the similarity and divergence of the gene in the Class Insecta.

  12. The phytochelatin synthase gene in date palm (Phoenix dactylifera L.): Phylogeny, evolution and expression.

    PubMed

    Zayneb, Chaâbene; Imen, Rekik Hakim; Walid, Kriaa; Grubb, C Douglas; Bassem, Khemakhem; Franck, Vandenbulcke; Hafedh, Mejdoub; Amine, Elleuch

    2017-06-01

    We studied date palm phytochelatin synthase type I (PdPCS1), which catalyzes the cytosolic synthesis of phytochelatins (PCs), a heavy metal binding protein, in plant cells. The gene encoding PdPCS1 (Pdpcs) consists of 8 exons and 7 introns and encodes a protein of 528 amino acids. PCs gene history was studied using Notung phylogeny. During evolution, gene loss from several lineages was predicted including Proteobacteria, Bilateria and Brassicaceae. In addition, eleven gene duplication events appeared toward interior nodes of the reconciled tree and four gene duplication events appeared toward the external nodes. These latter sequences belong to species with a second copy of PCs suggesting that this gene evolved through subfunctionalization. Pdpcs1 gene expression was measured in seedling hypocotyls exposed to Cd, Cu and Cr using quantitative real-time polymerase chain reaction (qPCR). A Pdpcs1 overexpression was evidenced in P. dactylifera seedlings exposed to metals suggesting that 1-the Pdpcs1 gene is functional, 2-there is an implication of the enzyme in metal detoxification mechanisms. Additionally, the structure of PdPCS1 was predicted using its homologue from Nostoc (cyanobacterium, NsPCS) as a template in Discovery studio and PyMol software. These analyses allowed us to identify the phytochelatin synthase type I enzyme in date palm (PdPCS1) via recognition of key consensus amino acids involved in the catalytic mechanism, and to propose a hypothetical binding and catalytic site for an additional substrate binding cavity.

  13. Properties of Aspergillus niger citrate synthase and effects of citA overexpression on citric acid production.

    PubMed

    Ruijter, G J; Panneman, H; Xu, D; Visser, J

    2000-03-01

    Using a combination of dye adsorption and affinity elution we purified Aspergillus niger citrate synthase to homogeneity using a single column and characterised the enzyme. An A. niger citrate synthase cDNA was isolated by immunological screening and used to clone the corresponding citA gene. The deduced amino acid sequence showed high similarity to other fungal citrate synthases. After processing upon mitochondrial import, the calculated M(r) of A. niger citrate synthase is 48501, which agrees well with the estimated molecular mass of the purified protein (48 kDa). In addition to an N-terminal mitochondrial import signal, a peroxisomal target sequence (AKL) was found at the C-terminus of the protein. Whether both signals are functional in vivo is not clear. Strains overexpressing citA were made by transformation and cultured under citric acid-producing conditions. Up to 11-fold overproduction of citrate synthase did not increase the rate of citric acid production by the fungus, suggesting that citrate synthase contributes little to flux control in the pathway involved in citric acid biosynthesis by a non-commercial strain.

  14. Binding modes of zaragozic acid A to human squalene synthase and staphylococcal dehydrosqualene synthase.

    PubMed

    Liu, Chia-I; Jeng, Wen-Yih; Chang, Wei-Jung; Ko, Tzu-Ping; Wang, Andrew H-J

    2012-05-25

    Zaragozic acids (ZAs) belong to a family of fungal metabolites with nanomolar inhibitory activity toward squalene synthase (SQS). The enzyme catalyzes the committed step of sterol synthesis and has attracted attention as a potential target for antilipogenic and antiinfective therapies. Here, we have determined the structure of ZA-A complexed with human SQS. ZA-A binding induces a local conformational change in the substrate binding site, and its C-6 acyl group also extends over to the cofactor binding cavity. In addition, ZA-A effectively inhibits a homologous bacterial enzyme, dehydrosqualene synthase (CrtM), which synthesizes the precursor of staphyloxanthin in Staphylococcus aureus to cope with oxidative stress. Size reduction at Tyr(248) in CrtM further increases the ZA-A binding affinity, and it reveals a similar overall inhibitor binding mode to that of human SQS/ZA-A except for the C-6 acyl group. These structures pave the way for further improving selectivity and development of a new generation of anticholesterolemic and antimicrobial inhibitors.

  15. Eugenol synthase genes in floral scent variation in Gymnadenia species.

    PubMed

    Gupta, Alok K; Schauvinhold, Ines; Pichersky, Eran; Schiestl, Florian P

    2014-12-01

    Floral signaling, especially through floral scent, is often highly complex, and little is known about the molecular mechanisms and evolutionary causes of this complexity. In this study, we focused on the evolution of "floral scent genes" and the associated changes in their functions in three closely related orchid species of the genus Gymnadenia. We developed a benchmark repertoire of 2,571 expressed sequence tags (ESTs) in Gymnadenia odoratissima. For the functional characterization and evolutionary analysis, we focused on eugenol synthase, as eugenol is a widespread and important scent compound. We obtained complete coding complementary DNAs (cDNAs) of two copies of putative eugenol synthase genes in each of the three species. The proteins encoded by these cDNAs were characterized by expression and testing for activity in Escherichia coli. While G. odoratissima and Gymnadenia conopsea enzymes were found to catalyze the formation of eugenol only, the Gymnadenia densiflora proteins synthesize eugenol, as well as a smaller amount of isoeugenol. Finally, we showed that the eugenol and isoeugenol producing gene copies of G. densiflora are evolutionarily derived from the ancestral genes of the other species producing only eugenol. The evolutionary switch from production of one to two compounds evolved under relaxed purifying selection. In conclusion, our study shows the molecular bases of eugenol and isoeugenol production and suggests that an evolutionary transition in a single gene can lead to an increased complexity in floral scent emitted by plants.

  16. Transcriptional regulation of Bacillus subtilis citrate synthase genes.

    PubMed

    Jin, S; Sonenshein, A L

    1994-08-01

    The Bacillus subtilis citrate synthase genes citA and citZ were repressed during early exponential growth phase in nutrient broth medium and were induced as cells reached the end of exponential phase. Both genes were also induced by treatment of cells with the drug decoyinine. After induction, the steady-state level of citZ mRNA was about five times higher than that of citA mRNA. At least some of the citZ transcripts read through into the isocitrate dehydrogenase (citC) gene. Transcription from an apparent promoter site located near the 3' end of the citZ gene also contributed to expression of citC. In minimal medium, citA transcription was about 6-fold lower when glucose was the sole carbon source than it was when succinate was the carbon source. Expression of the citZ gene was repressed 2-fold by glucose and 10-fold when glucose and glutamate were present simultaneously. This latter synergistic repression is similar to the effect of glucose and glutamate on steady-state citrate synthase enzyme activity. CitR, a protein of the LysR family, appeared to be a repressor of citA but not of citZ.

  17. Inhibition of Fatty Acid Synthase in Prostate Cancer by Orlistat, a Novel Therapeutic

    DTIC Science & Technology

    2007-11-01

    C.W. Fatty acid synthase inhibitors: new directions for oncology. Expert Opinion on Investigational Drugs (2007) 16(11): 1817-29 (Invited Review...acid synthase inhibitors: new directions for oncology. Expert Opinion on Investigational Drugs (2007) 16(11): 1817-29 (Invited Review) Abstracts...Kuhajda FP: Fatty-acid synthase and human cancer: new perspectives on its role in tumor biology. Nutrition 2000, 16:202-208. 3. Smith S: The animal fatty

  18. Molecular cloning and expression profile analysis of three sunflower (Helianthus annuus) diterpene synthase genes.

    PubMed

    Pugliesi, Claudio; Fambrini, Marco; Salvini, Mariangela

    2011-02-01

    ent-Kaurene, a key precursor of gibberellins, is formed by the action of two diterpene synthases (diTPSs), ent-copalyl diphosphate synthase (CPS), and ent-kaurene synthase (KS). The full-length cDNAs of CPS- (HaCPS1L) and KS-like (HaKS2L and HaKS3L) genes were isolated from sunflower. The amino acid sequences of HaCPS1L, HaKS2L, and HaKS3L exhibit structural features and homology to diTPSs of several plant species involved in gibberellin biosynthesis. RT-PCR analysis indicates that the expression of all genes (HaCPS1L, HaKS2L, and HaKS3L) is highly regulated during growth and development. All three diTPSs are preferentially expressed in rapidly growing tissues. HaKS2L is expressed at a much lower level than the other two diTPS genes. During seed development, the high level of both HaCPS1L and HaKS3L transcripts correlated with the period of rapid growth of the embryo. The three diTPS genes are not subjected to feedback regulation by gibberellin activity.

  19. The human ATP synthase beta subunit gene: sequence analysis, chromosome assignment, and differential expression.

    PubMed

    Neckelmann, N; Warner, C K; Chung, A; Kudoh, J; Minoshima, S; Fukuyama, R; Maekawa, M; Shimizu, Y; Shimizu, N; Liu, J D

    1989-11-01

    In humans, the functional F0F1-ATP synthase beta subunit gene is located on chromosome 12 in the p13----qter region. Other partially homologous sequences have been detected on chromosomes 2 and 17. The bona fide beta subunit gene has 10 exons encoding a leader peptide of 49 amino acids and a mature protein of 480 amino acids. Thirteen Alu family DNA repeats are found upstream from the gene and in four introns. The gene has four "CCAAT" sequences upstream and in close proximity to the transcriptional initiation site. A 13-bp motif is found in the 5' nontranscribed region of both the beta subunit gene and an ADP/ATP translocator gene that is expressed in high levels in cardiac and skeletal muscle. Analysis of the beta subunit mRNA levels reveals marked differences among tissues. The highest levels are found in heart, lower levels in skeletal muscle, and the lowest levels in liver and kidney. These findings suggest that the tissue-specific levels of ATP synthase beta subunit mRNA may be generated through transcriptional control.

  20. Fine structure analysis of Salmonella typhimurium glutamate synthase genes.

    PubMed Central

    Madonna, M J; Fuchs, R L; Brenchley, J E

    1985-01-01

    Glutamate synthase activity is required for the growth of Salmonella typhimurium on media containing a growth-rate-limiting nitrogen source. Mutations that alter glutamate synthase activity had been identified in the gltB gene, but it was not known which of the two nonidentical subunits of the enzyme was altered. To examine the gene-protein relationship of the glt region, two nonsense mutations were identified and used to demonstrate that gltB encodes the large subunit of the enzyme. Six strains with independent Mu cts d1 (lac bla) insertions were isolated, from which a collection of deletion mutations was obtained. The deletions were transduced with the nonsense mutations and 38 other glt point mutations to construct a fine-structure genetic map. Chromosome mobilization studies, mediated by Hfr derivatives of Mu cts d1 lysogens, showed that gltB is transcribed in a clockwise direction, as shown in the S. typhimurium linkage map. Studies of the polar effects of three Mu cts d1 insertions indicated that the gene for the small subunit maps clockwise to gltB and that the two genes are cotranscribed to form a glt operon. Images PMID:3881392

  1. Methionine synthase and thymidylate synthase gene polymorphisms and colorectal adenoma risk: the self defense forces study.

    PubMed

    Yoshimitsu, Shinichiro; Morita, Makiko; Hamachi, Tadamichi; Tabata, Shinji; Abe, Hiroshi; Tajima, Osamu; Uezono, Kousaku; Ohnaka, Keizo; Kono, Suminori

    2012-10-01

    Folate-mediated one-carbon metabolism has been implicated in colorectal carcinogenesis. We investigated associations of functional genetic polymorphisms of methionine synthase (MTR), MTR reductase (MTRR), and thymidylate synthase (TS) with colorectal adenomas. The study subjects were 455 cases of colorectal adenomas and 1052 controls with no polyp at colonoscopy. Genotypes were determined for MTR A2756G, MTRR A66G and two polymorphisms in the TS gene, 28-bp tandem repeat polymorphism in the promoter enhancer region (TSER) and 6-bp deletion polymorphism at position 1494 in the 3' untranslated region (TS 1494del6). We also examined the alcohol-genotype and gene-gene interactions on adenoma risk. The GG genotype of MTR A2756G was associated with an increased risk of colorectal adenomas; odds ratios for AG and GG versus AA genotype were 0.99 (95% confidence interval 0.78-1.26) and 1.72 (1.04-2.82), respectively. The increase in the risk associated with MTR 2756GG genotype was evident in men with high alcohol consumption (≥30 mL/d), but not in those with low alcohol consumption (interaction P = 0.03). Men who were homozygous for the TSER double-repeat allele had a slightly decreased risk of colorectal adenomas as compared with those homozygous for the TSER triple-repeat allele. Neither MTRR A66G nor TS 1494del6 was associated with colorectal adenomas. There was no measurable interaction either between MTR A2756G and MTRR A66G or between TSER and TS 1494del6. MTR A2756G appears to be associated with colorectal adenoma risk differently according to alcohol consumption. The MTR-catalyzed reaction may play an important role in the development of colorectal adenomas.

  2. Evolutionary Dynamics of the Cellulose Synthase Gene Superfamily in Grasses1[OPEN

    PubMed Central

    Schwerdt, Julian G.; Wright, Frank; Oehme, Daniel; Wagner, John M.; Shirley, Neil J.; Burton, Rachel A.; Schreiber, Miriam; Zimmer, Jochen; Marshall, David F.; Waugh, Robbie; Fincher, Geoffrey B.

    2015-01-01

    Phylogenetic analyses of cellulose synthase (CesA) and cellulose synthase-like (Csl) families from the cellulose synthase gene superfamily were used to reconstruct their evolutionary origins and selection histories. Counterintuitively, genes encoding primary cell wall CesAs have undergone extensive expansion and diversification following an ancestral duplication from a secondary cell wall-associated CesA. Selection pressure across entire CesA and Csl clades appears to be low, but this conceals considerable variation within individual clades. Genes in the CslF clade are of particular interest because some mediate the synthesis of (1,3;1,4)-β-glucan, a polysaccharide characteristic of the evolutionarily successful grasses that is not widely distributed elsewhere in the plant kingdom. The phylogeny suggests that duplication of either CslF6 and/or CslF7 produced the ancestor of a highly conserved cluster of CslF genes that remain located in syntenic regions of all the grass genomes examined. A CslF6-specific insert encoding approximately 55 amino acid residues has subsequently been incorporated into the gene, or possibly lost from other CslFs, and the CslF7 clade has undergone a significant long-term shift in selection pressure. Homology modeling and molecular dynamics of the CslF6 protein were used to define the three-dimensional dispositions of individual amino acids that are subject to strong ongoing selection, together with the position of the conserved 55-amino acid insert that is known to influence the amounts and fine structures of (1,3;1,4)-β-glucans synthesized. These wall polysaccharides are attracting renewed interest because of their central roles as sources of dietary fiber in human health and for the generation of renewable liquid biofuels. PMID:25999407

  3. Primary structure of the Escherichia coli thyA gene and its thymidylate synthase product.

    PubMed Central

    Belfort, M; Maley, G; Pedersen-Lane, J; Maley, F

    1983-01-01

    The nucleotide sequence of a 1,163-base-pair fragment that encodes the entire thyA gene of Escherichia coli K-12 was determined. The strategy involved sequence determination of both DNA strands by using overlapping deletions that had been generated in vitro from the two ends of the fragment with BAL-31 nuclease. The amino-terminal sequence of thymidylate synthase (5,10-methylenetetrahydrofolate:dUMP C-methyltransferase, EC 2.1.1.45), the product of the thyA gene, located the 792-base-pair open reading frame, which codes for the 264 amino acid residues of this enzyme. The amino acid sequence deduced from the nucleotide data was confirmed to the extent of 40% by partial sequence analysis of the enzyme purified from extracts of the amplified cloned gene. Transcriptional and translational control areas were apparent in the regions flanking the structural gene. The 5-fluorodeoxyuridylate-binding residue of the active site was identified as cysteine-146. Comparison of the E. coli and Lactobacillus casei synthase sequences reveals consistent homology (62%) over extensive regions. This homology is particularly striking in a very hydrophobic region bordering cysteine-146. In the two enzymes, this region, which probably defines the active site, is 82% homologous. However, a dramatic difference between the two sequences is reflected by the surprising finding that a 51-amino-acid stretch, present midway through the L. casei sequence, is completely absent from the E. coli enzyme. PMID:6308660

  4. Nicotianamine synthase gene family as central components in heavy metal and phytohormone response in maize.

    PubMed

    Zhou, Mei-Liang; Qi, Lei-Peng; Pang, Jun-Feng; Zhang, Qian; Lei, Zhi; Tang, Yi-Xiong; Zhu, Xue-Mei; Shao, Ji-Rong; Wu, Yan-Min

    2013-06-01

    Nicotianamine (NA) is an important divalent metal chelator and the main precursor of phytosiderophores. NA is synthesized from S-adenosylmethionine in a process catalyzed by nicotianamine synthase (NAS). In this study, a set of structural and phylogenetic analyses have been applied to identify the maize NAS genes based on the maize genome sequence release. Ten maize NAS genes have been mapped; seven of them have not been reported to date. Phylogenetic analysis and expression pattern from microarray data led to their classification into two different orthologous groups. C-terminal fusion of ZmNAS3 with GFP was found in the cytoplasm of Arabidopsis leaf protoplast. Expression analysis by reverse transcription polymerase chain reaction revealed ZmNAS genes are responsive to heavy metal ions (Ni, Fe, Cu, Mn, Zn, and Cd), and all 10 ZmNAS genes were only observed in the root tissue except of ZmNAS6. The promoter of ZmNAS genes was analyzed for the presence of different cis-element response to all kinds of phytohormones and environment stresses. We found that the ZmNAS gene expression of maize seedlings was regulated by jasmonic acid, abscisic acid, and salicylic acid. Microarray data demonstrated that the ZmNAS genes show differential, organ-specific expression patterns in the maize developmental steps. The integrated comparative analysis can improve our current view of ZmNAS genes and facilitate the functional characterization of individual members.

  5. Dihydropteroate synthase gene mutations in Pneumocystis and sulfa resistance.

    PubMed

    Huang, Laurence; Crothers, Kristina; Atzori, Chiara; Benfield, Thomas; Miller, Robert; Rabodonirina, Meja; Helweg-Larsen, Jannik

    2004-10-01

    Pneumocystis pneumonia (PCP) remains a major cause of illness and death in HIV-infected persons. Sulfa drugs, trimethoprim-sulfamethoxazole (TMP-SMX) and dapsone are mainstays of PCP treatment and prophylaxis. While prophylaxis has reduced the incidence of PCP, its use has raised concerns about development of resistant organisms. The inability to culture human Pneumocystis, Pneumocystis jirovecii, in a standardized culture system prevents routine susceptibility testing and detection of drug resistance. In other microorganisms, sulfa drug resistance has resulted from specific point mutations in the dihydropteroate synthase (DHPS) gene. Similar mutations have been observed in P. jirovecii. Studies have consistently demonstrated a significant association between the use of sulfa drugs for PCP prophylaxis and DHPS gene mutations. Whether these mutations confer resistance to TMP-SMX or dapsone plus trimethoprim for PCP treatment remains unclear. We review studies of DHPS mutations in P. jirovecii and summarize the evidence for resistance to sulfamethoxazole and dapsone.

  6. Structure and function of eukaryotic fatty acid synthases.

    PubMed

    Maier, Timm; Leibundgut, Marc; Boehringer, Daniel; Ban, Nenad

    2010-08-01

    In all organisms, fatty acid synthesis is achieved in variations of a common cyclic reaction pathway by stepwise, iterative elongation of precursors with two-carbon extender units. In bacteria, all individual reaction steps are carried out by monofunctional dissociated enzymes, whereas in eukaryotes the fatty acid synthases (FASs) have evolved into large multifunctional enzymes that integrate the whole process of fatty acid synthesis. During the last few years, important advances in understanding the structural and functional organization of eukaryotic FASs have been made through a combination of biochemical, electron microscopic and X-ray crystallographic approaches. They have revealed the strikingly different architectures of the two distinct types of eukaryotic FASs, the fungal and the animal enzyme system. Fungal FAS is a 2·6 MDa α₆β₆ heterododecamer with a barrel shape enclosing two large chambers, each containing three sets of active sites separated by a central wheel-like structure. It represents a highly specialized micro-compartment strictly optimized for the production of saturated fatty acids. In contrast, the animal FAS is a 540 kDa X-shaped homodimer with two lateral reaction clefts characterized by a modular domain architecture and large extent of conformational flexibility that appears to contribute to catalytic efficiency.

  7. Rat mitochondrial and cytosolic 3-hydroxy-3-methylglutaryl-CoA synthases are encoded by two different genes.

    PubMed Central

    Ayté, J; Gil-Gómez, G; Haro, D; Marrero, P F; Hegardt, F G

    1990-01-01

    We report the isolation and characterization of a 1994-base-pair cDNA that encompasses the entire transcription unit of the mitochondrial 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) synthase (EC 4.1.3.5.) gene from rat. Analysis of the nucleotide sequence reveals that the cDNA encodes a polypeptide of 508 residues and 56,918-Da molecular mass. Identify of the cDNA clone isolated as mitochondrial HMG-CoA synthase was confirmed by the following criteria: (i) Amino acid residues are 65% homologous with hamster cytosolic HMG-CoA synthase. (ii) A 19-amino acid sequence probably corresponding to the catalytic site is highly homologous (90%) to that reported for chicken liver mitochondrial HMG-CoA synthase. (iii) The expression product of the cDNA in Escherichia coli has HMG-CoA synthase activity. (iv) The protein includes a sequence of 37 amino acid residues at the N terminus that is not present in the cytosolic enzyme. The predominantly basic, hydrophobic, and hydroxylated nature of the residues of this sequence suggests that it is a leader peptide to target HMG-CoA synthase inside mitochondria. These data plus the hybridization pattern in genomic Southern blot analysis, the different transcript size (2.0 kilobases versus 3.4 kilobases for the cytosolic enzyme), and the different expression pattern shown in RNA blot experiments suggest the presence of two HMG-CoA synthase genes, one for the cytosolic and another for the mitochondrial enzyme. Images PMID:1971108

  8. Homocysteine homeostasis in the rat is maintained by compensatory changes in cystathionine β-synthase, betaine-homocysteine methyltransferase, and phosphatidylethanolamine N-methyltransferase gene transcription occurring in response to maternal protein and folic acid intake during pregnancy and fat intake after weaning.

    PubMed

    Chmurzynska, Agata; Malinowska, Anna M

    2011-07-01

    The reactions of the methionine/homocysteine pathway are mediated by several enzymes, including phosphatidylethanolamine N-methyltransferase, cystathionine β-synthase, and betaine-homocysteine methyltransferase. Homocysteine homeostasis is regulated by these enzymes. We hypothesized here that the protein and folic acid content in the maternal diet affects methionine/homocysteine metabolism in the progeny. To test this hypothesis, pregnant rats were fed a diet with normal protein and normal folic acid levels (a modified casein-based AIN-93G diet), a protein-restricted and normal folic acid diet, a protein-restricted and folic acid-supplemented diet, or a normal protein and folic acid-supplemented diet. The progeny were fed either the modified AIN-93G diet or a high-fat lard-based diet. Progeny were analyzed for expression of the phosphatidylethanolamine N-methyltransferase, cystathionine β-synthase, and betaine-homocysteine methyltransferase genes in the liver and for serum homocysteine concentration. Interactions between prenatal and postnatal nutrition were also determined. The progeny of the dams fed the diets supplemented with folic acid showed decreased expression of all 3 genes (P < .001). An interaction effect between the protein and folic acid content in the maternal diet contributed to this down-regulation (P < .001), and the postweaning diet modified these effects. Serum homocysteine concentrations were approximately 15% higher in the male rats (P < .01), but neither prenatal nutrition nor the postweaning diet affected it significantly. We conclude that maternal diet during gestation has an important effect on the transcription level of these 3 genes, but changes in gene expression were not associated with significant changes in progeny homocysteine concentrations.

  9. Fatty Acid Synthase Impacts the Pathobiology of Candida parapsilosis In Vitro and during Mammalian Infection

    PubMed Central

    Nguyen, Long Nam; Trofa, David; Nosanchuk, Joshua D.

    2009-01-01

    Cytosolic fungal fatty acid synthase is composed of two subunits α and β, which are encoded by Fas1 and Fas2 genes. In this study, the Fas2 genes of the human pathogen Candida parapsilosis were deleted using a modified SAT1 flipper technique. CpFas2 was essential in media lacking exogenous fatty acids and the growth of Fas2 disruptants (Fas2 KO) was regulated by the supplementation of different long chain fatty acids, such as myristic acid (14∶0), palmitic acid (16∶0), and Tween 80, in a dose-specific manner. Lipidomic analysis revealed that Fas2 KO cells were severely restricted in production of unsaturated fatty acids. The Fas2 KO strains were unable to form normal biofilms and were more efficiently killed by murine-like macrophages, J774.16, than the wild type, heterozygous and reconstituted strains. Furthermore, Fas2 KO yeast were significantly less virulent in a systemic murine infection model. The Fas2 KO cells were also hypersensitive to human serum, and inhibition of CpFas2 in WT C. parapsilosis by cerulenin significantly decreased fungal growth in human serum. This study demonstrates that CpFas2 is essential for C. parapsilosis growth in the absence of exogenous fatty acids, is involved in unsaturated fatty acid production, influences fungal virulence, and represents a promising antifungal drug target. PMID:20027295

  10. A single amino acid change in acetolactate synthase confers resistance to valine in tobacco.

    PubMed

    Hervieu, F; Vaucheret, H

    1996-05-23

    The metabolic control of branches chain amino acid (BCAA) biosynthesis involves allosteric regulation of acetolactate synthase (ALS) by the end-products of the pathway, valine, leucine and isoleucine. We describe here the molecular basis of valine resistance. We cloned and sequenced an ALS gene from the tobacco mutant Valr-1 and found a single basepair substitution relative to the wild-type allele. This mutation causes a serine to leucine change in the amino acid sequence of ALS at position 214. We then mutagenized the wild-type allele of the ALS gene of Arabidopsis and found that it confers valine resistance when introduced into tobacco plants. Taken together, these results suggest that the serine to leucine change at position 214 of ALS is responsible for valine resistance in tobacco.

  11. Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis

    PubMed Central

    Noar, Roslyn D.; Daub, Margaret E.

    2016-01-01

    Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity) for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity) to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that they may encode

  12. Cloning and truncation modification of trehalose-6-phosphate synthase gene from Selaginella pulvinata.

    PubMed

    Zhao, Sheng-Mei; Fu, Feng-Ling; Gou, Lin; Wang, Han-Guang; He, Gang; Li, Wan-Chen

    2013-01-10

    A homologous sequence was amplified from resurrection plant Selaginella pulvinta by RACE technique, proved to be the full-length cDNA of trehalose-6-phosphate synthase gene by homologous alignment and yeast complementation assay, and nominated as SpTPS1 gene. The open reading frame of this gene was truncated 225bp at the 5'-end, resulting the N-terminal truncation modification of 75 amino acids for its encoding protein. The TPS1 deletion mutant strain YSH290 of the brewer's yeast transformed by the truncated gene SpTPS1Δ and its original full-length version restored growth on the medium with glucose as a sole carbon source and displayed growth curves with no significant difference, indicating their encoding proteins functioning as TPS enzyme. The TPS activity of the mutant strain transformed by the truncated gene SpTPS1Δ was about six fold higher than that transformed by its original version, reasoning that the extra N-terminal extension of the full-length amino acid sequence acts as an inhibitory domain to trehalose synthesis. However, the trehalose accumulation of the mutant strain transformed by the truncated gene SpTPS1Δ was only 8% higher than that transformed by its original version. This result is explained by the feedback balance of trehalose content coordinated by the comparative activities between trehalose synthase and trehalase. The truncated gene SpTPS1Δ is suggested to be used in transgenic operation, together with the inhibition of trehalase activity by the application of validamycin A or genetic deficiency of the endogenous trehalase gene, for the enhancement of trehalose accumulation and improvement of abiotic tolerance in transgenic plants.

  13. Cloning and characterization of the citA gene encoding the mitochondrial citrate synthase of Aspergillus nidulans.

    PubMed

    Park, B W; Han, K H; Lee, C Y; Lee, C H; Maeng, P J

    1997-04-30

    We isolated a citrate synthase gene (citA) from Aspergillus nidulans. By analysis of the protein coding region, citA was shown to encode a citrate synthase (CitA) of 52.2 kDa consisting of 474 amino acid residues that were interrupted by seven introns. Also, the precursor CitA protein was revealed to have an N-terminal mitochondrial targeting signal of 35 amino acid residues containing an R-3 cleavage motif, R(32)-C-Y decreases S(35), which supports the fact that citA encodes the mitochondrial form of citrate synthase of A. nidulans. Southern blot analysis showed that citA is present as a single copy in the genome.

  14. Phylogenetic analysis of uroporphyrinogen III synthase (UROS) gene.

    PubMed

    Shaik, Abjal Pasha; Alsaeed, Abbas H; Sultana, Asma

    2012-01-01

    The uroporphyrinogen III synthase (UROS) enzyme (also known as hydroxymethylbilane hydrolyase) catalyzes the cyclization of hydroxymethylbilane to uroporphyrinogen III during heme biosynthesis. A deficiency of this enzyme is associated with the very rare Gunther's disease or congenital erythropoietic porphyria, an autosomal recessive inborn error of metabolism. The current study investigated the possible role of UROS (Homo sapiens [EC: 4.2.1.75; 265 aa; 1371 bp mRNA; Entrez Pubmed ref NP_000366.1, NM_000375.2]) in evolution by studying the phylogenetic relationship and divergence of this gene using computational methods. The UROS protein sequences from various taxa were retrieved from GenBank database and were compared using Clustal-W (multiple sequence alignment) with defaults and a first-pass phylogenetic tree was built using neighbor-joining method as in DELTA BLAST 2.2.27+ version. A total of 163 BLAST hits were found for the uroporphyrinogen III synthase query sequence and these hits showed putative conserved domain, HemD superfamily (as on 14(th) Nov 2012). We then narrowed down the search by manually deleting the proteins which were not UROS sequences and sequences belonging to phyla other than Chordata were deleted. A repeat phylogenetic analysis of 39 taxa was performed using PhyML and TreeDyn software to confirm that UROS is a highly conserved protein with approximately 85% conserved sequences in almost all chordate taxons emphasizing its importance in heme synthesis.

  15. Quinic acids from Aster caucasicus and from transgenic callus expressing a beta-amyrin synthase.

    PubMed

    Pecchia, Paola; Cammareri, Maria; Malafronte, Nicola; Consiglio, M Federica; Gualtieri, Maria Josefina; Conicella, Clara

    2011-11-01

    Several different classes of secondary metabolites, including flavonoids, triterpenoid saponins and quinic acid derivatives, are found in Aster spp. (Fam. Asteraceae). Several Aster compounds revealed biological as well as pharmacological activities. In this work, a phytochemical investigation of A. caucasicus evidenced the presence of quinic acid derivatives, as well as the absence of triterpene saponins. To combine in one species the production of different phytochemicals, including triterpenes, an Agrobacterium-mediated transformation of A. caucasicus was set up to introduce A. sedifolius beta-amyrin synthase (AsOXA1)-encoding gene under the control of the constitutive promoter CaMV35S. The quali-quantitative analysis of transgenic calli with ectopic expression of AsOXA1 showed, in one sample, a negligible amount of triterpene saponins combined with higher amount of quinic acid derivatives as compared with the wild type callus.

  16. Transcriptional regulation of human thromboxane synthase gene expression

    SciTech Connect

    Lee, K.D.; Baek, S.J.; Fleischer, T

    1994-09-01

    The human thromboxane synthase (TS) gene encodes a microsomal enzyme catalyzing the conversion of prostaglandin endoperoxide into thromboxane A{sub 2}(TxA{sub 2}), a potent inducer of vasoconstriction and platelet aggregation. A deficiency in platelet TS activity results in bleeding disorders, but the underlying molecular mechanism remains to be elucidated. Increased TxA{sub 2} has been associated with many pathophysiological conditions such as cardiovascular disease, pulmonary hypertension, pre-eclampsia, and thrombosis in sickle cell patients. Since the formation of TxA{sub 2} is dependent upon TS, the regulation of TS gene expression may presumably play a crucial role in vivo. Abrogation of the regulatory mechanism in TS gene expression might contribute, in part, to the above clinical manifestations. To gain insight into TS gene regulation, a 1.7 kb promoter of the human TS gene was cloned and sequenced. RNase protection assay and 5{prime} RACE protocols were used to map the transcription initiation site to nucleotide A, 30 bp downstream from a canonical TATA box. Several transcription factor binding sites, including AP-1, PU.1, and PEA3, were identified within this sequence. Transient expression studies in HL-60 cells transfected with constructs containing various lengths (0.2 to 5.5 kb) of the TS promoter/luciferase fusion gene indicated the presence of multiple repressor elements within the 5.5 kb TS promoter. However, a lineage-specific up-regulation of TS gene expression was observed in HL-60 cells induced by TPA to differentiate along the macrophage lineage. The increase in TS transcription was not detectable until 36 hr after addition of the inducer. These results suggest that expression of the human TS gene may be regulated by a mechanism involving repression and derepression of the TS promoter.

  17. Novel Nuclear Localization of Fatty Acid Synthase Correlates with Prostate Cancer Aggressiveness

    PubMed Central

    Madigan, Allison A.; Rycyna, Kevin J.; Parwani, Anil V.; Datiri, Yeipyeng J.; Basudan, Ahmed M.; Sobek, Kathryn M.; Cummings, Jessica L.; Basse, Per H.; Bacich, Dean J.; O'Keefe, Denise S.

    2015-01-01

    Fatty acid synthase is up-regulated in a variety of cancers, including prostate cancer. Up-regulation of fatty acid synthase not only increases production of fatty acids in tumors but also contributes to the transformed phenotype by conferring growth and survival advantages. In addition, increased fatty acid synthase expression in prostate cancer correlates with poor prognosis, although the mechanism(s) by which this occurs are not completely understood. Because fatty acid synthase is expressed at low levels in normal cells, it is currently a major target for anticancer drug design. Fatty acid synthase is normally found in the cytosol; however, we have discovered that it also localizes to the nucleus in a subset of prostate cancer cells. Analysis of the fatty acid synthase protein sequence indicated the presence of a nuclear localization signal, and subcellular fractionation of LNCaP prostate cancer cells, as well as immunofluorescent confocal microscopy of patient prostate tumor tissue and LNCaPs confirmed nuclear localization of this protein. Finally, immunohistochemical analysis of prostate cancer tissue indicated that nuclear localization of fatty acid synthase correlates with Gleason grade, implicating a potentially novel role in prostate cancer progression. Possible clinical implications include improving the accuracy of prostate biopsies in the diagnosis of low- versus intermediate-risk prostate cancer and the uncovering of novel metabolic pathways for the therapeutic targeting of androgen-independent prostate cancer. PMID:24907642

  18. A trehalose-6-phosphate synthase gene from Saccharina japonica (Laminariales, Phaeophyceae).

    PubMed

    Deng, Yunyan; Wang, Xiuliang; Guo, Hui; Duan, Delin

    2014-01-01

    The full-length cDNA sequence of a trehalose-6-phosphate synthase gene from Saccharina japonica (designated as SjaTPS) (Accession: KC578568) was isolated based on homologous cloning and RACE-PCR. It was 4,127 bp, with 320 bp 5'-UTR, 21 bp 3'-UTR, and open reading frame (ORF) of 3,786 bp. The deduced 1,261 amino acids characterized with predicted molecular weight of 137.84 kDa and theoretical isoelectric point of 7.12. The SjaTPS had one N-terminal CBM20 (family 20 carbohydrate-binding module) domain, one TPS domain (trehalose-6-phosphate synthase) in the middle region and a single TPP (trehalose-6-phosphate phosphatase) domain near the C-terminus. Structural analysis suggested that the SjaTPS putatively functioned as trehalose-6-phosphate synthase, and might be related to laminaran metabolism in S. japonica. Homology analysis indicated that the SjaTPS shared 49-70 % similarities with the 13 known TPS sequences of other algae; only 55 % amino acid similarities were detected between SjaTPS and the previously reported TPS sequence of S. japonica (Accession: DQ666325). Phylogenetic analysis revealed close affinity between SjaTPS and TPS of brown alga Ectocarpus siliculosus (Accession: CBJ29609). Transcriptional analysis showed that desiccation greatly enhanced SjaTPS expression and the maximum appeared at 3 h, which was about 300-fold compared to that of the start, implied that SjaTPS was involved with drought adaption in kelp. In vitro expression of SjaTPS showed that one distinct band existed at ~115 kDa, and western blot detection proved that it was positive to the anti-His antibody with high specificity. Our results increased the knowledge of trehalose-6-phosphate synthase properties in S. japonica and also important for better understanding the role trehalose plays in kelp abiotic tolerance for adaption to the sublittoral habitats.

  19. Differential expression of acetohydroxyacid synthase genes in sunflower plantlets and its response to imazapyr herbicide.

    PubMed

    Breccia, Gabriela; Vega, Tatiana; Felitti, Silvina A; Picardi, Liliana; Nestares, Graciela

    2013-07-01

    Acetohydroxyacid synthase (AHAS) catalyzes the first reaction in branch chain amino acids biosynthesis. This enzyme is the target of several herbicides, including all members of the imidazolinone family. Little is known about the expression of the three acetohydroxyacid synthase genes (ahas1, ahas2 and ahas3) in sunflower. The aim of this work was to evaluate ahas gene expression and AHAS activity in different tissues of sunflower plantlets. Three genotypes differing in imidazolinone resistance were evaluated, two of which carry an herbicide resistant-endowing mutation known as Ahasl1-1 allele. In vivo and in vitro AHAS activity and transcript levels were higher in leaves than in roots. The ahas3 transcript was the less abundant in both tissues. No significant difference was observed between ahas1 and ahas2 transcript levels of the susceptible genotype but a higher ahas1 transcript level was observed in leaves of genotypes carrying Ahasl1-1 allele. Similar transcript levels were found for ahas1 and ahas2 in roots of genotypes carrying Ahasl1-1 allele whereas higher ahas2 abundance was found in the susceptible genotype. Herbicide treatment triggered tissue-specific, gene and genotype-dependent changes in ahas gene expression. AHAS activity was highly inhibited in the susceptible genotype. Differential responses were observed between in vitro and in vivo AHAS inhibition assays. These findings enhance our understanding of AHAS expression in sunflower genotypes differing for herbicide resistance and its response to herbicide treatment.

  20. Expression of fatty acid synthase in nonalcoholic fatty liver disease.

    PubMed

    Dorn, Christoph; Riener, Marc-Oliver; Kirovski, Georgi; Saugspier, Michael; Steib, Kathrin; Weiss, Thomas S; Gäbele, Erwin; Kristiansen, Glen; Hartmann, Arndt; Hellerbrand, Claus

    2010-03-25

    Nonalcoholic fatty liver disease (NAFLD) is characterized by hepatic lipid accumulation which starts with simple hepatic steatosis and may progress toward inflammation (nonalcoholic steatohepatitis [NASH]). Fatty acid synthase (FASN) catalyzes the last step in fatty acid biosynthesis, and thus, it is believed to be a major determinant of the maximal hepatic capacity to generate fatty acids by de novo lipogenesis. The aim of this study was to analyze the correlation between hepatic steatosis and inflammation with FASN expression. In vitro incubation of primary human hepatocytes with fatty acids dose-dependently induced cellular lipid-accumulation and FASN expression, while stimulation with TNF did not affect FASN levels. Further, hepatic FASN expression was significantly increased in vivo in a murine model of hepatic steatosis without significant inflammation but not in a murine NASH model as compared to control mice. Also, FASN expression was not increased in mice subjected to bile duct ligation, an experimental model characterized by severe hepatocellular damage and inflammation. Furthermore, FASN expression was analyzed in 102 human control or NAFLD livers applying tissue micro array technology and immunohistochemistry, and correlated significantly with the degree of hepatic steatosis, but not with inflammation or ballooning of hepatocytes. Quantification of FASN mRNA expression in human liver samples confirmed significantly higher FASN levels in hepatic steatosis but not in NASH, and expression of SREBP1, which is the main transcriptional regulator of FASN, paralleled FASN expression levels in human and experimental NAFLD. In conclusion, the transcriptional induction of FASN expression in hepatic steatosis is impaired in NASH, while hepatic inflammation in the absence of steatosis does not affect FASN expression, suggesting that FASN may serve as a new diagnostic marker or therapeutic target for the progression of NAFLD.

  1. Exploration of geosmin synthase from Streptomyces peucetius ATCC 27952 by deletion of doxorubicin biosynthetic gene cluster.

    PubMed

    Singh, Bijay; Oh, Tae-Jin; Sohng, Jae Kyung

    2009-10-01

    Thorough investigation of Streptomyces peucetius ATCC 27952 genome revealed a sesquiterpene synthase, named spterp13, which encodes a putative protein of 732 amino acids with significant similarity to S. avermitilis MA-4680 (SAV2163, GeoA) and S. coelicolor A3(2) (SCO6073). The proteins encoded by SAV2163 and SCO6073 produce geosmin in the respective strains. However, the spterp13 gene seemed to be silent in S. peucetius. Deletion of the doxorubicin gene cluster from S. peucetius resulted in increased cell growth rate along with detectable production of geosmin. When we over expressed the spterp13 gene in S. peucetius DM07 under the control of an ermE* promoter, 2.4 +/- 0.4-fold enhanced production of geosmin was observed.

  2. Identification of Unique Type II Polyketide Synthase Genes in Soil

    PubMed Central

    Wawrik, Boris; Kerkhof, Lee; Zylstra, Gerben J.; Kukor, Jerome J.

    2005-01-01

    Many bacteria, particularly actinomycetes, are known to produce secondary metabolites synthesized by polyketide synthases (PKS). Bacterial polyketides are a particularly rich source of bioactive molecules, many of which are of potential pharmaceutical relevance. To directly access PKS gene diversity from soil, we developed degenerate PCR primers for actinomycete type II KSα (ketosynthase) genes. Twenty-one soil samples were collected from diverse sources in New Jersey, and their bacterial communities were compared by terminal restriction fragment length polymorphism (TRFLP) analysis of PCR products generated using bacterial 16S rRNA gene primers (27F and 1525R) as well as an actinomycete-specific forward primer. The distribution of actinomycetes was highly variable but correlated with the overall bacterial species composition as determined by TRFLP. Two samples were identified to contain a particularly rich and unique actinomycete community based on their TRFLP patterns. The same samples also contained the greatest diversity of KSα genes as determined by TRFLP analysis of KSα PCR products. KSα PCR products from these and three additional samples with interesting TRFLP pattern were cloned, and seven novel clades of KSα genes were identified. Greatest sequence diversity was observed in a sample containing a moderate number of peaks in its KSα TRFLP. The nucleotide sequences were between 74 and 81% identical to known sequences in GenBank. One cluster of sequences was most similar to the KSα involved in ardacin (glycopeptide antibiotic) production by Kibdelosporangium aridum. The remaining sequences showed greatest similarity to the KSα genes in pathways producing the angucycline-derived antibiotics simocyclinone, pradimicin, and jasomycin. PMID:15870305

  3. Studies on 3-deoxy-D-manno-octulosonic acid 8-phosphate synthase using chorismate mutase inhibitors.

    PubMed

    Birck, M R; Husain, A; Sheflyan, G Y; Ganem, B; Woodard, R W

    2001-11-05

    The proposed cyclic mechanism of 3-deoxy-D-manno-octulosonic acid 8-phosphate synthase and the mechanism of chorismate mutase share certain structural and electronic similarities. In this report, we examine several inhibitors of chorismate mutase for their efficacy against KDO 8-P synthase.

  4. Cloning and characterization of squalene synthase gene from Poria cocos and its up-regulation by methyl jasmonate.

    PubMed

    Wang, Jian-Rong; Lin, Jun-Fang; Guo, Li-Qiong; You, Lin-Feng; Zeng, Xian-Lu; Wen, Jia-Ming

    2014-02-01

    Squalene synthase (SQS) catalyzes the condensation of two molecules of farnesyl diphosphate to give presqualene diphosphate and the subsequent rearrangement to form squalene. The gene encoding squalene synthase was cloned from Poria cocos by degenerate PCR and inverse PCR. The open reading frame of the gene is 1,497 bp, which encodes 499 amino acid residues. A phylogenetic analysis revealed that P. cocos SQS belonged to the fungus group, and was more closely related to the SQS of Ganoderma lucidum than other fungi. The treatment of P. cocos with methyl jasmonate (MeJA) significantly enhanced the transcriptional level of P. cocos sqs gene and the content of squalene in P. cocos. The transcriptional level of sqs gene was approximately fourfold higher than the control sample and the squalene content reached 128.62 μg/g, when the concentration of MeJA was 300 μM after 72 h induction.

  5. The biosynthetic origin of irregular monoterpenes in Lavandula: isolation and biochemical characterization of a novel cis-prenyl diphosphate synthase gene, lavandulyl diphosphate synthase.

    PubMed

    Demissie, Zerihun A; Erland, Lauren A E; Rheault, Mark R; Mahmoud, Soheil S

    2013-03-01

    Lavender essential oils are constituted predominantly of regular monoterpenes, for example linalool, 1,8-cineole, and camphor. However, they also contain irregular monoterpenes including lavandulol and lavandulyl acetate. Although the majority of genes responsible for the production of regular monoterpenes in lavenders are now known, enzymes (including lavandulyl diphosphate synthase (LPPS)) catalyzing the biosynthesis of irregular monoterpenes in these plants have not been described. Here, we report the isolation and functional characterization of a novel cis-prenyl diphosphate synthase cDNA, termed Lavandula x intermedia lavandulyl diphosphate synthase (LiLPPS), through a homology-based cloning strategy. The LiLPPS ORF, encoding for a 305-amino acid long protein, was expressed in Escherichia coli, and the recombinant protein was purified by nickel-nitrilotriacetic acid affinity chromatography. The approximately 34.5-kDa bacterially produced protein specifically catalyzed the head-to-middle condensation of two dimethylallyl diphosphate units to LPP in vitro with apparent Km and kcat values of 208 ± 12 μm and 0.1 s(-1), respectively. LiLPPS is a homodimeric enzyme with a sigmoidal saturation curve and Hill coefficient of 2.7, suggesting a positive co-operative interaction among its catalytic sites. LiLPPS could be used to modulate the production of lavandulol and its derivatives in plants through metabolic engineering.

  6. Human platelet/erythroleukemia cell prostaglandin G/H synthase: cDNA cloning, expression, and gene chromosomal assignment

    SciTech Connect

    Funk, C.D.; Funk, L.B.; Kennedy, M.E.; Pong, A.S.; Fitzgerald, G.A. )

    1991-06-01

    Platelets metabolize arachidonic acid to thromboxane A{sub 2}, a potent platelet aggregator and vasoconstrictor compound. The first step of this transformation is catalyzed by prostaglandin (PG) G/H synthase, a target site for nonsteroidal antiinflammatory drugs. We have isolated the cDNA for both human platelet and human erythroleukemia cell PGG/H synthase using the polymerase chain reaction and conventional screening procedures. The cDNA encoding the full-length protein was expressed in COS-M6 cells. Microsomal fractions from transfected cells produced prostaglandin endoperoxide derived products which were inhibited by indomethacin and aspirin. Mutagenesis of the serine residue at position 529, the putative aspirin acetylation site, to an asparagine reduced cyclooxygenase activity to barely detectable levels, an effect observed previously with the expressed sheep vesicular gland enzyme. Platelet-derived growth factor and phorbol ester differentially regulated the expression of PGG/H synthase mRNA levels in the megakaryocytic/platelet-like HEL cell line. The PGG/H synthase gene was assigned to chromosome 9 by analysis of a human-hamster somatic hybrid DNA panel. The availability of platelet PGG/H synthase cDNA should enhance our understanding of the important structure/function domains of this protein and it gene regulation.

  7. [An intron-free methyl jasmonate inducible geranylgeranyl diphosphate synthase gene from Taxus media and its functional identification in yeast].

    PubMed

    Liao, Zhihua; Gong, Yifu; Kai, Guoyin; Zuo, Kaijing; Chen, Min; Tan, Qiumin; Wei, Yamin; Guo, Liang; Tan, Feng; Sun, Xiaofen; Tang, Kexuan

    2005-01-01

    Geranylgeranyl diphosphate synthase (GGPPS, EC: 2.5.1.29) catalyzes the biosynthesis of geranylgeranyl diphosphate (GGPP), which is a key precursor for diterpenes including Taxol, one of the most potent antitumor drugs. In order to investigate the role of GGPP synthase in taxol biosynthesis, we cloned, characterized and functionally expressed the GGPP synthase gene from Taxus media. A 3743-bp genomic sequence of T. media was isolated by genome walking strategy which contained an 1182-bp open reading frame (ORF) encoding a 393-amino acid polypeptide that showed high similarity to other plant GGPPSs. Subsequently the full-length cDNA of the GGPPS gene of T. media (designated TmGGPPS) was amplified by RACE. Bioinformatic analysis showed that TmGGPPS was an intron-free gene and its deduced polypeptide contained all the five conserved domains and functional aspartate-rich motifs of the prenyltransferases. By constructing the phylogenetic tree of plant GGPPSs, it was found that plant-derived GGPPSs could be divided into two classes, angiosperm and gymnosperm classes, which might have evolved in parallel from the same ancestor. To our knowledge this was the first report that the geranylgeranyl diphosphate synthase genes were free of intron and evolved in parallel between angiosperms and gymnosperms. The coding sequence of TmGGPPS was expressed in yeast mutant (SFNY368) lacking of GGPP synthase activity through functional complementation, and the transgenic yeast showed to have activity of GGPP synthase. This was also the first time to use SFNY368 to identify the function of plant-derived GGPPSs. Furthermore, investigation of the impact of methyl jasmonate (MeJA) on the expression of TmGGPPS revealed that MeJA-treated T. media cultured cells had much higher expression of TmGGPPS than untreated cells.

  8. Biosynthesis of sulfur-containing amino acids in Streptomyces venezuelae ISP5230: roles for cystathionine beta-synthase and transsulfuration.

    PubMed

    Chang, Z; Vining, L C

    2002-07-01

    A 0.5 kb fragment of Streptomyces venezuelae ISP5230 genomic DNA was amplified by PCR using primers based on consensus sequences of cysteine synthase isozyme A from bacteria. The deduced amino acid sequence of the PCR product resembled not only cysteine synthase sequences from prokaryotes and eukaryotes but also eukaryotic cystathionine beta-synthase sequences. Probing an Str. venezuelae genomic library with the PCR product located a hybridizing colony from which pJV207 was isolated. Sequencing and analysis of the Str. venezuelae DNA insert in pJV207 detected two ORFs. The deduced amino acid sequence of ORF1 matched both cysteine synthase and cystathionine beta-synthase sequences in GenBank, but its size favoured assignment as a cystathionine beta-synthase. ORF2 in the pJV207 insert was unrelated in function to ORF1; in its sequence the deduced product resembled acetyl-CoA transferases, but disruption of the ORF did not cause a detectable phenotypic change. Disruption of ORF1 failed to elicit cysteine auxotrophy in wild-type Str. venezuelae, but in the cys-28 auxotroph VS263 it prevented restoration of prototrophy with homocysteine or methionine supplements. The change in phenotype implicated loss of the transsulfuration activity that in the wild-type converts these supplements to cysteine. This study concludes that disruption of ORF1 inactivates a cbs gene, the product of which participates in cysteine synthesis by transsulfuration. Enzyme assays of Str. venezuelae mycelial extracts confirmed the formation of cysteine by thiolation of O-acetylserine, providing the first unambiguous detection of this activity in a streptomycete. Enzyme assays also detected cystathionine gamma-synthase, cystathionine beta-lyase and cystathionine gamma-lyase activity in the extracts and showed that the substrate for cystathionine gamma-synthase was O-succinyl-homoserine. Based on assay results, the cys-28 mutation in Str. venezuelae VS263 does not inactivate the cysteine synthase

  9. Studies on tetrahydrocannabinolic acid synthase that produces the acidic precursor of tetrahydrocannabinol, the pharmacologically active cannabinoid in marijuana.

    PubMed

    Taura, F

    2009-06-01

    Tetrahydrocannabinol (THC), the psychoactive component of marijuana, is now regarded as a promising medicine because this cannabinoid has been shown to exert a variety of therapeutic activities. It has been demonstrated that THC is generated from the acidic precursor, tetrahydrocannabinolic acid (THCA) by nonenzymatic decarboxylation, and that THCA is biosynthesized by THCA synthase, which catalyzes a unique biosynthetic reaction, the stereospecific oxidative cyclization of the geranyl group of the substrate cannabigerolic acid. Molecular characterization of THCA synthase has revealed its structural characteristics and reaction mechanism. THCA synthase is the first cannabinoid synthase to be studied and is potentially attractive target for various biotechnological applications as it produces the direct precursor of THC. This review describes the research history of this enzyme, i.e., purification, molecular cloning, biochemical characterization, and possible biotechnological application of THCA synthase.

  10. A comparative analysis of the plant cellulose synthase (CesA) gene family.

    PubMed

    Holland, N; Holland, D; Helentjaris, T; Dhugga, K S; Xoconostle-Cazares, B; Delmer, D P

    2000-08-01

    CesA genes are believed to encode the catalytic subunit of cellulose synthase. Identification of nine distinct CesA cDNAs from maize (Zea mays) has allowed us to initiate comparative studies with homologs from Arabidopsis and other plant species. Mapping studies show that closely related CesA genes are not clustered but are found at different chromosomal locations in both Arabidopsis and maize. Furthermore, sequence comparisons among the CesA-deduced proteins show that these cluster in groups wherein orthologs are often more similar than paralogs, indicating that different subclasses evolved prior to the divergence of the monocot and dicot lineages. Studies using reverse transcriptase polymerase chain reaction with gene-specific primers for six of the nine maize genes indicate that all genes are expressed to at least some level in all of the organs examined. However, when expression patterns for a few selected genes from maize and Arabidopsis were analyzed in more detail, they were found to be expressed in unique cell types engaged in either primary or secondary wall synthesis. These studies also indicate that amino acid sequence comparisons, at least in some cases, may have value for prediction of such patterns of gene expression. Such analyses begin to provide insights useful for future genetic engineering of cellulose deposition, in that identification of close orthologs across species may prove useful for prediction of patterns of gene expression and may also aid in prediction of mutant combinations that may be necessary to generate severe phenotypes.

  11. A gene from the cellulose synthase-like C family encodes a β-1,4 glucan synthase

    PubMed Central

    Cocuron, Jean-Christophe; Lerouxel, Olivier; Drakakaki, Georgia; Alonso, Ana P.; Liepman, Aaron H.; Keegstra, Kenneth; Raikhel, Natasha; Wilkerson, Curtis G.

    2007-01-01

    Despite the central role of xyloglucan (XyG) in plant cell wall structure and function, important details of its biosynthesis are not understood. To identify the gene(s) responsible for synthesizing the β-1,4 glucan backbone of XyG, we exploited a property of nasturtium (Tropaeolum majus) seed development. During the last stages of nasturtium seed maturation, a large amount of XyG is deposited as a reserve polysaccharide. A cDNA library was produced from mRNA isolated during the deposition of XyG, and partial sequences of 10,000 cDNA clones were determined. A single member of the C subfamily from the large family of cellulose synthase-like (CSL) genes was found to be overrepresented in the cDNA library. Heterologous expression of this gene in the yeast Pichia pastoris resulted in the production of a β-1,4 glucan, confirming that the CSLC protein has glucan synthase activity. The Arabidopsis CSLC4 gene, which is the gene with the highest sequence similarity to the nasturtium CSL gene, is coordinately expressed with other genes involved in XyG biosynthesis. These and other observations provide a compelling case that the CSLC gene family encode proteins that synthesize the XyG backbone. PMID:17488821

  12. Characterization of a chitin synthase encoding gene and effect of diflubenzuron in soybean aphid, Aphis glycines

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Chitin synthases are critical enzymes for synthesis of chitin and thus for subsequent growth and development in insects. We have identified and characterized a chitin synthase gene (CHS) from cDNA of Aphis glycines, the soybean aphid, a serious pest of soybean. The full-length cDNA of CHS in A. glyc...

  13. The beta subunit of the Drosophila melanogaster ATP synthase: cDNA cloning, amino acid analysis and identification of the protein in adult flies.

    PubMed

    Peña, P; Garesse, R

    1993-09-15

    The cDNA encoding the Drosophila melanogaster beta subunit of H+ ATP synthase has been cloned and sequenced. The predicted mature protein is highly homologous to the equivalent beta subunits of other organisms and is preceded by a signal peptide of 31 amino acids, that although not conserved at primary sequence level has the characteristics of leader peptides present in other mitochondrial proteins. We have raised polyclonal antibodies that specifically recognize the beta H+ ATP synthase subunit present in Drosophila melanogaster protein extracts. This is the first time that a gene of the ATP synthase complex has been characterized in the invertebrate phyla.

  14. Identification and characterization of the alpha-acetolactate synthase gene from Lactococcus lactis subsp. lactis biovar diacetylactis.

    PubMed Central

    Marugg, J D; Goelling, D; Stahl, U; Ledeboer, A M; Toonen, M Y; Verhue, W M; Verrips, C T

    1994-01-01

    The conversion of 3-13C-labelled pyruvate in an acetoin-producing clone from a Lactococcus lactis subsp. lactis biovar diacetylactis strain DSM 20384 plasmid bank in Escherichia coli was studied by 13C nuclear magnetic resonance analysis. The results showed that alpha-acetolactate was the first metabolic product formed from pyruvate, whereas acetoin appeared at a much slower rate and reached only low concentrations. This alpha-acetolactate production shows that the cells express the gene for alpha-acetolactate synthase (als). Nucleotide sequence analysis identified an open reading frame encoding a protein of 554 amino acids. The deduced amino acid sequence exhibits extensive similarities to those of known alpha-acetolactate synthases from both prokaryotes and eukaryotes. The als gene is expressed on a monocistronic transcriptional unit, which is transcribed from a promoter located just upstream of the coding region. Images PMID:8017926

  15. The leaf extract of Siberian Crabapple (Malus baccata (Linn.) Borkh) contains potential fatty acid synthase inhibitors.

    PubMed

    Wei, Xiang; Zhao, Ran; Sun, Ying-Hui; Cong, Jian-Ping; Meng, Fan-Guo; Zhou, Hai-Meng

    2009-02-01

    The present work focused on the kinetics of the inhibitory effects of the leaf extract of Siberian Crabapple, named Shan jingzi in China, on chicken liver fatty acid synthase. The results showed that this extract had much stronger inhibitory ability on fatty acid synthase than that from green teas described in many previous reports. The inhibitory ability of this extract is closely related to the extracting solvent, and the time of extraction was also an important influencing factor. The inhibitory types of this extract on diffeerent substrates of chicken liver fatty acid synthase, acetyl-CoA, malonyl-CoA and NADPH, were found to be noncompetitive, uncompetitive and mixed, respectively. The studies here shed a new light on the exploration for inhibitors of fatty acid synthase.

  16. Only One of the Five Ralstonia solanacearum Long-Chain 3-Ketoacyl-Acyl Carrier Protein Synthase Homologues Functions in Fatty Acid Synthesis

    PubMed Central

    Cheng, Juanli; Ma, Jincheng; Lin, Jinshui; Fan, Zhen-Chuan; Cronan, John E.

    2012-01-01

    Ralstonia solanacearum, a major phytopathogenic bacterium, causes a bacterial wilt disease in diverse plants. Although fatty acid analyses of total membranes of R. solanacearum showed that they contain primarily palmitic (C16:0), palmitoleic (C16:1) and cis-vaccenic (C18:1) acids, little is known regarding R. solanacearum fatty acid synthesis. The R. solanacearum GMI1000 genome is unusual in that it contains four genes (fabF1, fabF2, fabF3, and fabF4) annotated as encoding 3-ketoacyl-acyl carrier protein synthase II homologues and one gene (fabB) annotated as encoding 3-ketoacyl-acyl carrier protein synthase I. We have analyzed this puzzling apparent redundancy and found that only one of these genes, fabF1, encoded a long-chain 3-ketoacyl-acyl carrier protein synthase, whereas the other homologues did not play roles in R. solanacearum fatty acid synthesis. Mutant strains lacking fabF1 are nonviable, and thus, FabF1 is essential for R. solanacearum fatty acid biosynthesis. Moreover, R. solanacearum FabF1 has the activities of both 3-ketoacyl-acyl carrier protein synthase II and 3-ketoacyl-acyl carrier protein synthase I. PMID:22194290

  17. Only one of the five Ralstonia solanacearum long-chain 3-ketoacyl-acyl carrier protein synthase homologues functions in fatty acid synthesis.

    PubMed

    Cheng, Juanli; Ma, Jincheng; Lin, Jinshui; Fan, Zhen-Chuan; Cronan, John E; Wang, Haihong

    2012-03-01

    Ralstonia solanacearum, a major phytopathogenic bacterium, causes a bacterial wilt disease in diverse plants. Although fatty acid analyses of total membranes of R. solanacearum showed that they contain primarily palmitic (C(16:0)), palmitoleic (C(16:1)) and cis-vaccenic (C(18:1)) acids, little is known regarding R. solanacearum fatty acid synthesis. The R. solanacearum GMI1000 genome is unusual in that it contains four genes (fabF1, fabF2, fabF3, and fabF4) annotated as encoding 3-ketoacyl-acyl carrier protein synthase II homologues and one gene (fabB) annotated as encoding 3-ketoacyl-acyl carrier protein synthase I. We have analyzed this puzzling apparent redundancy and found that only one of these genes, fabF1, encoded a long-chain 3-ketoacyl-acyl carrier protein synthase, whereas the other homologues did not play roles in R. solanacearum fatty acid synthesis. Mutant strains lacking fabF1 are nonviable, and thus, FabF1 is essential for R. solanacearum fatty acid biosynthesis. Moreover, R. solanacearum FabF1 has the activities of both 3-ketoacyl-acyl carrier protein synthase II and 3-ketoacyl-acyl carrier protein synthase I.

  18. Fatty Acid Synthase Inhibitors Engage the Cell Death Program Through the Endoplasmic Reticulum

    DTIC Science & Technology

    2007-12-01

    any capacity. The goal of this proposal was two- fold. One was to determine the mechanism by which the ER might initiate death following FAS inhibition...acid synthase and human cancer: new perspectives on its role in tumor biology. Nutrition 2000;16:202–8. 8. Kuhajda FP, Jenner K, Wood FD, et al. Fatty...flexibility of the acyl carrier protein-thioesterase interdomain linker on functionality of the animal fatty acid synthase . Biochemistry 44, 4100–4107

  19. Evolution and Expression of Tandem Duplicated Maize Flavonol Synthase Genes

    PubMed Central

    Falcone Ferreyra, María Lorena; Casas, María Isabel; Questa, Julia Irene; Herrera, Andrea Lorena; DeBlasio, Stacy; Wang, Jing; Jackson, David; Grotewold, Erich; Casati, Paula

    2012-01-01

    Flavonoids are specialized compounds widely distributed and with diverse functions throughout the plant kingdom and with several benefits for human health. In particular, flavonols, synthesized by flavonol synthase (FLS), protect plants against UV-B radiation and are essential for male fertility in maize and other plants. We have recently characterized a UV-B inducible ZmFLS1, corresponding to the first to be described in monocot plants. Interestingly, the new assembly of the B73 maize genome revealed the presence of a second putative FLS gene (ZmFLS2), with very high identity with ZmFLS1. ZmFLSs expression was analyzed in different maize tissues, and by combining electrophoretic mobility shift assays and transient expression experiments, we show that both genes are direct targets of anthocyanin (C1/PL1 + R/B) and 3-deoxy flavonoid (P1) transcriptional regulators. ZmFLS expression analyses show higher levels of both transcripts in high altitude landraces than inbred lines, and both genes are regulated by UV-B radiation in all lines analyzed. Moreover, the high sequence conservation of the ZmFLS promoters between maize lines suggests that the differences observed in ZmFLS expression are due to allelic variations in the transcription factors that regulate their activities. Finally, we generated pFLS1::FLS1-RFP transgenic plants and analyzed ZmFLS1 expression in different maize tissues; we found that this enzyme is localized in the ER and the perinuclear region. PMID:22654889

  20. Cloning of galactinol synthase gene from Ammopiptanthus mongolicus and its expression in transgenic Photinia serrulata plants.

    PubMed

    Song, Jian; Liu, Jing; Weng, Manli; Huang, Yanyan; Luo, Lei; Cao, Pengxiu; Sun, Haiwei; Liu, Jie; Zhao, Jinhong; Feng, Dianqi; Wang, Bin

    2013-01-15

    A cold induced galactinol synthase gene (AmGS) and its promoter sequence were identified and cloned from the cold-tolerant tree Ammopiptanthus mongolicus by using cDNA-AFLP, RACE-PCR and TAIL-PCR strategies combined with its expression pattern analysis after cold inducing treatment. Accession number of the AmGS gene in GenBank is DQ519361. The open reading frame (ORF) region of the AmGS gene is 987 nucleotides encoding for 328 amino acid residues and a stop codon. The genomic DNA sequence of AmGS gene contains 3 exons and 2 introns. Moreover, a variety of temporal gene expression patterns of AmGS was detected, which revealed the up-regulation of AmGS gene in stresses of cold, ABA and others. Then the AmGS gene was transformed into Photinia serrulata tree by Agrobacterium-mediated transformation, and the transgenic plants exhibited higher cold-tolerance comparing with non-transformed plants.

  1. Characterization of the cDNA and gene coding for the biotin synthase of Arabidopsis thaliana.

    PubMed Central

    Weaver, L M; Yu, F; Wurtele, E S; Nikolau, B J

    1996-01-01

    Biotin, an essential cofactor, is synthesized de novo only by plants and some microbes. An Arabidopsis thaliana expressed sequence tag that shows sequence similarity to the carboxyl end of biotin synthase from Escherichia coli was used to isolate a near-full-length cDNA. This cDNA was shown to code for the Arabidopsis biotin synthase by its ability to complement a bioB mutant of E. coli. Site-specific mutagenesis indicates that residue threonine-173, which is highly conserved in biotin synthases, is important for catalytic competence of the enzyme. The primary sequence of the Arabidopsis biotin synthase is most similar to biotin synthases from E. coli, Serratia marcescens, and Saccharomyces cerevisiae (about 50% sequence identity) and more distantly related to the Bacillus sphaericus enzyme (33% sequence identity). The primary sequence of the amino terminus of the Arabidopsis biotin synthase may represent an organelle-targeting transit peptide. The single Arabidopsis gene coding for biotin synthase, BIO2, was isolated and sequenced. The biotin synthase coding sequence is interrupted by five introns. The gene sequence upstream of the translation start site has several unusual features, including imperfect palindromes and polypyrimidine sequences, which may function in the transcriptional regulation of the BIO2 gene. PMID:8819873

  2. Sequence of the indoleglycerol phosphate synthase (trpC) gene from Rhodobacter capsulatus.

    PubMed Central

    Becker-Rudzik, M; Young, D A; Marrs, B L

    1992-01-01

    We have isolated, cloned, and sequenced the indoleglycerol phosphate synthase gene (trpC) from Rhodobacter capsulatus. Normalized alignment scores comparing the trpC gene of R. capsulatus with the trpC genes of other bacterial species are reported. An unexpected degree of similarity to the trpC gene of Bacillus subtilis was found. PMID:1644778

  3. Cloning and Characterization of a Squalene Synthase Gene from the Chaga Medicinal Mushroom, Inonotus obliquus (Agaricomycetes).

    PubMed

    Zhang, Panpan; Cao, Xiaoying; Li, Changgen; Zheng, Zhujun; Yong, Sun; Jiang, Ji-Hong

    2016-01-01

    Squalene synthase catalyzes the condensation of 2 molecules of farnesyl diphosphate to produce squalene, the first committed precursor for sterol, brassinosteroid, and triterpene biosynthesis. A squalene synthase gene, designated IoSQS, was isolated from Inonotus obliquus, a medicinal mushroom that produces a plethora of bioactive triterpenes. IoSQS complementary DNA was found to contain an open reading frame of 1476 bp, encoding a protein of 491 amino acids with a calculated molecular mass of 55.85 kDa. The IoSQS genomic DNA sequence consisted of 1813 bp and contained 4 exons and 3 introns. The restriction fragment polymorphisms revealed by Southern blot analysis suggested that IoSQS was a single-copy gene. Promoter analysis indicated that the 5' upstream region of IoSQS possessed various potential elements associated with physiological and environmental factors. The expression pattern of IoSQS in different stages and under methyl jasmonate treatment correlated with the accumulation of total triterpenoids and was consistent with the predicted results of the IoSQS promoter region. The N-terminal 466 residues of the hydrophilic sequence were expressed as a His-tagged protein in Escherichia coli, and the resultant bacterial crude extract was incubated with farnesyl diphosphate and NADPH. Squalene was detected in vitro in reaction mixture by high-performance liquid chromatography analysis. These results suggest that the IoSQS enzyme is involved in squalene production in I. obliquus.

  4. Characterization of a pine multigene family containing elicitor-responsive stilbene synthase genes.

    PubMed

    Preisig-Müller, R; Schwekendiek, A; Brehm, I; Reif, H J; Kindl, H

    1999-01-01

    Young pine seedlings respond to environmental stress by induced synthesis of pinosylvin, a stilbene phytoalexin. Heartwood of pine trees is characterized by a high content of pinosylvin. The formation of pinosylvin from cinnamoyl-CoA and three molecules malonyl-CoA catalysed by pinosylvin synthase is typical of the genus Pinus. Its enzyme activity not detectable in unstressed seedlings is substantially increased upon application of stimuli like UV-light or infection with the phytopathogenic fungus Botrytis cinerea. A genomic DNA library was screened with pinosylvin synthase cDNA pSP-54 as a probe. Ten clones were isolated and grouped into five subclasses according to the size of their introns. After subcloning into plasmid T7T3, four different members of the five gene subclasses were characterized by sequencing. Emphasis was put on isolating various promoters and analyzing and comparing their responsiveness. The amino acid sequences deduced from genes PST-1, PST-2, PST-3 and PST-5 shared an overall identity of more than 95%. In gene PST-5, the putative translation start site ATG was replaced by CTG. While promoter regions near the TATAA box were almost identical PST-1, PST-2 and PST-3, further upstream sequences differed substantially. Differences in promoter strength were analysed both in transgenic tobacco plants and by transient expression in tobacco protoplasts. Constructs used contained the bacterial beta-glucuronidase under the control of the promoters of pine genes PST-1, PST-2 and PST-3. Upon treatment with UV light or fungal elicitor, the promoter of PST-1 showed highest responsiveness and led to tissue-specific expression in vascular bundles. The data suggest that in pine the gene product of PST-1 is responsible for both the stress response in seedlings and pinosylvin formation in the heartwood.

  5. A Single Amino Acid Substitution Converts Benzophenone Synthase into Phenylpyrone Synthase*

    PubMed Central

    Klundt, Tim; Bocola, Marco; Lütge, Maren; Beuerle, Till; Liu, Benye; Beerhues, Ludger

    2009-01-01

    Benzophenone metabolism provides a number of plant natural products with fascinating chemical structures and intriguing pharmacological activities. Formation of the carbon skeleton of benzophenone derivatives from benzoyl-CoA and three molecules of malonyl-CoA is catalyzed by benzophenone synthase (BPS), a member of the superfamily of type III polyketide synthases. A point mutation in the active site cavity (T135L) transformed BPS into a functional phenylpyrone synthase (PPS). The dramatic change in both substrate and product specificities of BPS was rationalized by homology modeling. The mutation may open a new pocket that accommodates the phenyl moiety of the triketide intermediate but limits polyketide elongation to two reactions, resulting in phenylpyrone formation. 3-Hydroxybenzoyl-CoA is the second best starter molecule for BPS but a poor substrate for PPS. The aryl moiety of the triketide intermediate may be trapped in the new pocket by hydrogen bond formation with the backbone, thereby acting as an inhibitor. PPS is a promising biotechnological tool for manipulating benzoate-primed biosynthetic pathways to produce novel compounds. PMID:19710020

  6. Fish Oil Supplementation and Fatty Acid Synthase Expression in the Prostate: A Randomized Controlled Trial

    DTIC Science & Technology

    2007-03-01

    14. ABSTRACT: See next page. 15. SUBJECT TERMS Prostate Cancer; Lipid Medtabolism, Clinical Trial; Omega -3 Fatty Acids 16. SECURITY...AD_________________ Award Number: W81XWH-04-1-0296 TITLE: Fish Oil Supplementation and Fatty Acid ...SUBTITLE Fish Oil Supplementation and Fatty Acid Synthase Expression in the Prostate: A 5a. CONTRACT NUMBER Randomized

  7. Acyl-carrier protein - Phosphopantetheinyltransferase partnerships in fungal fatty acid synthases

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The synthesis of fatty acids is an essential primary metabolic process for energy storage and cellular structural integrity. Assembly of saturated fatty acids is achieved by fatty acid synthases (FASs) that combine acetyl- and malonyl-CoAs by repetitive decarboxylative Claisen condensations with su...

  8. Identification and functional differentiation of two type I fatty acid synthases in Brevibacterium ammoniagenes.

    PubMed Central

    Stuible, H P; Wagner, C; Andreou, I; Huter, G; Haselmann, J; Schweizer, E

    1996-01-01

    The fatty acid synthase (FAS) from Brevibacterium ammoniagenes is a homohexameric multienzyme complex that catalyzes the synthesis of both saturated and unsaturated fatty acids. By immunological screening of a B. ammoniagenes expression library, an fas DNA fragment was isolated and subsequently used to clone the entire gene together with its flanking sequences. Within 10,525 bp of sequenced DNA, the 9,189-bp FAS coding region was identified, corresponding to a protein of 3,063 amino acids with a molecular mass of 324,910 Da. This gene (fasA) encodes, at its 5' end, the same amino acid sequence as is observed with purified B. ammoniagenes FAS. A second reading frame encoding another B. ammoniagenes FAS variant (FasB) had been identified previously. Both sequences are colinear and exhibit 61 and 47% identity at the DNA and protein levels, respectively. By using specific antibodies raised against a unique peptide sequence of FasB, this enzyme was shown to represent only 5 to 10% of the cellular FAS protein. Insertional inactivation of the FasB coding sequence causes no defective phenotype, while fasA disruptants require oleic acid for growth. Correspondingly, oleate-dependent B. ammoniagenes cells obtained by ethyl methanesulfonate mutagenesis were complemented by transformation with fasA DNA but not with fasB DNA. The data indicate that B. ammoniagenes contains two related though differently expressed type I FASs. FasA represents the bulk of cellular FAS protein and catalyzes the synthesis of both saturated and unsaturated fatty acids, while the minor variant, FasB, cannot catalyze the synthesis of oleic acid. PMID:8759839

  9. Biosynthesis of biphenyls and benzophenones--evolution of benzoic acid-specific type III polyketide synthases in plants.

    PubMed

    Beerhues, Ludger; Liu, Benye

    2009-01-01

    Type III polyketide synthases (PKSs) generate a diverse array of secondary metabolites by varying the starter substrate, the number of condensation reactions, and the mechanism of ring closure. Among the starter substrates used, benzoyl-CoA is a rare starter molecule. Biphenyl synthase (BIS) and benzophenone synthase (BPS) catalyze the formation of identical linear tetraketide intermediates from benzoyl-CoA and three molecules of malonyl-CoA but use alternative intramolecular cyclization reactions to form 3,5-dihydroxybiphenyl and 2,4,6-trihydroxybenzophenone, respectively. In a phylogenetic tree, BIS and BPS group together closely, indicating that they arise from a relatively recent functional diversification of a common ancestral gene. The functionally diverse PKSs, which include BIS and BPS, and the ubiquitously distributed chalcone synthases (CHSs) form separate clusters, which originate from a gene duplication event prior to the speciation of the angiosperms. BIS is the key enzyme of biphenyl metabolism. Biphenyls and the related dibenzofurans are the phytoalexins of the Maloideae. This subfamily of the Rosaceae includes a number of economically important fruit trees, such as apple and pear. When incubated with ortho-hydroxybenzoyl (salicoyl)-CoA, BIS catalyzes a single decarboxylative condensation with malonyl-CoA to form 4-hydroxycoumarin. A well-known anticoagulant derivative of this enzymatic product is dicoumarol. Elicitor-treated cell cultures of Sorbus aucuparia also formed 4-hydroxycoumarin when fed with the N-acetylcysteamine thioester of salicylic acid (salicoyl-NAC). BPS is the key enzyme of benzophenone metabolism. Polyprenylated benzophenone derivatives with bridged polycyclic skeletons are widely distributed in the Clusiaceae (Guttiferae). Xanthones are regioselectively cyclized benzophenone derivatives. BPS was converted into a functional phenylpyrone synthase (PPS) by a single amino acid substitution in the initiation/elongation cavity. The

  10. RNA Sequencing Revealed Numerous Polyketide Synthase Genes in the Harmful Dinoflagellate Karenia mikimotoi

    PubMed Central

    Kimura, Kei; Okuda, Shujiro; Nakayama, Kei; Shikata, Tomoyuki; Takahashi, Fumio; Yamaguchi, Haruo; Skamoto, Setsuko; Yamaguchi, Mineo; Tomaru, Yuji

    2015-01-01

    The dinoflagellate Karenia mikimotoi forms blooms in the coastal waters of temperate regions and occasionally causes massive fish and invertebrate mortality. This study aimed to elucidate the toxic effect of K. mikimotoi on marine organisms by using the genomics approach; RNA-sequence libraries were constructed, and data were analyzed to identify toxin-related genes. Next-generation sequencing produced 153,406 transcript contigs from the axenic culture of K. mikimotoi. BLASTX analysis against all assembled contigs revealed that 208 contigs were polyketide synthase (PKS) sequences. Thus, K. mikimotoi was thought to have several genes encoding PKS metabolites and to likely produce toxin-like polyketide molecules. Of all the sequences, approximately 30 encoded eight PKS genes, which were remarkably similar to those of Karenia brevis. Our phylogenetic analyses showed that these genes belonged to a new group of PKS type-I genes. Phylogenetic and active domain analyses showed that the amino acid sequence of four among eight Karenia PKS genes was not similar to any of the reported PKS genes. These PKS genes might possibly be associated with the synthesis of polyketide toxins produced by Karenia species. Further, a homology search revealed 10 contigs that were similar to a toxin gene responsible for the synthesis of saxitoxin (sxtA) in the toxic dinoflagellate Alexandrium fundyense. These contigs encoded A1–A3 domains of sxtA genes. Thus, this study identified some transcripts in K. mikimotoi that might be associated with several putative toxin-related genes. The findings of this study might help understand the mechanism of toxicity of K. mikimotoi and other dinoflagellates. PMID:26561394

  11. Effects of pyrazinamide on fatty acid synthesis by whole mycobacterial cells and purified fatty acid synthase I.

    PubMed

    Boshoff, Helena I; Mizrahi, Valerie; Barry, Clifton E

    2002-04-01

    The effects of low extracellular pH and intracellular accumulation of weak organic acids were compared with respect to fatty acid synthesis by whole cells of Mycobacterium tuberculosis and Mycobacterium smegmatis. The profile of fatty acids synthesized during exposure to benzoic, nicotinic, or pyrazinoic acids, as well as that observed during intracellular hydrolysis of the corresponding amides, was not a direct consequence of modulation of fatty acid synthesis by these compounds but reflected the response to inorganic acid stress. Analysis of fatty acid synthesis in crude mycobacterial cell extracts demonstrated that pyrazinoic acid failed to directly modulate the fatty acid synthase activity catalyzed by fatty acid synthase I (FAS-I). However, fatty acid synthesis was irreversibly inhibited by 5-chloro-pyrazinamide in a time-dependent fashion. Moreover, we demonstrate that pyrazinoic acid does not inhibit purified mycobacterial FAS-I, suggesting that this enzyme is not the immediate target of pyrazinamide.

  12. Para-aminobenzoic acid (PABA) synthase enhances thermotolerance of mushroom Agaricus bisporus.

    PubMed

    Lu, Zhonglei; Kong, Xiangxiang; Lu, Zhaoming; Xiao, Meixiang; Chen, Meiyuan; Zhu, Liang; Shen, Yuemao; Hu, Xiangyang; Song, Siyang

    2014-01-01

    Most mushrooms are thermo-sensitive to temperatures over 23°C, which greatly restricts their agricultural cultivation. Understanding mushroom's innate heat-tolerance mechanisms may facilitate genetic improvements of their thermotolerance. Agaricus bisporus strain 02 is a relatively thermotolerant mushroom strain, while strain 8213 is quite thermo-sensitive. Here, we compared their responses at proteomic level to heat treatment at 33°C. We identified 73 proteins that are differentially expressed between 02 and 8213 or induced upon heat stress in strain 02 itself, 48 of which with a known identity. Among them, 4 proteins are constitutively more highly expressed in 02 than 8213; and they can be further upregulated in response to heat stress in 02, but not in 8213. One protein is encoded by the para-aminobenzoic acid (PABA) synthase gene Pabs, which has been shown to scavenge the reactive oxygen species in vitro. Pabs mRNA and its chemical product PABA show similar heat stress induction pattern as PABA synthase protein and are more abundant in 02, indicating transcriptional level upregulation of Pabs upon heat stress. A specific inhibitor of PABA synthesis impaired thermotolerance of 02, while exogenous PABA or transgenic overexpression of 02 derived PABA synthase enhanced thermotolerance of 8213. Furthermore, compared to 8213, 02 accumulated less H2O2 but more defense-related proteins (e.g., HSPs and Chitinase) under heat stress. Together, these results demonstrate a role of PABA in enhancing mushroom thermotolerance by removing H2O2 and elevating defense-related proteins.

  13. In vitro isolation, elicitation of psoralen in callus cultures of Psoralea corylifolia and cloning of psoralen synthase gene.

    PubMed

    Parast, Behrooz M; Chetri, Siva K; Sharma, Kuldeep; Agrawal, Veena

    2011-10-01

    Psoralen, an important furanocoumarin occurring abundantly in seeds of Psoralea corylifolia is used as an anticancerous compound against leukemia and other cancer cell lines. Evaluation and isolation of psoralen from the calluses derived from different plant parts, viz. cotyledons, nodes, leaves and roots have been done in the present case for the first time. Amongst all, a maximum of 1934.75 μg/g f.w. of psoralen was recorded in callus derived from cotyledons, followed by 1875.50 and 1465.75 μg/g f.w. of psoralen in node and leaf derived calluses, respectively. Amount of psoralen enhanced further when cotyledonary calluses were exposed to different concentrations of organic elicitors (yeast extract, proline, inositol, casein hydrolyzate (CH), glycine, glutamine and sucrose) and precursors of psoralen (umbelliferone, cinnamic acid and NADPH). Isolation of psoralen was done using methanol as solvent through column chromatography and TLC. FT-IR and NMR further characterized and confirmed the structure of psoralen. In addition, the putative gene, psoralen synthase involved in psoralen synthesis pathway has been isolated, cloned and sequenced which comprised 1237 bp length. BLAST analysis of the gene sequence of psoralen synthase revealed that its nucleotide sequence showed 93% homology with psoralen synthase isolated from Ammi majus. This is the first report of isolation, cloning and characterization of psoralen synthase from Psoralea corylifolia.

  14. Molecular Evolution and Functional Divergence of Soluble Starch Synthase Genes in Cassava (Manihot Esculenta Crantz)

    PubMed Central

    Yang, Zefeng; Wang, Yifan; Xu, Shuhui; Xu, Chenwu; Yan, Changjie

    2013-01-01

    Soluble starch synthases (SSs) are major enzymes involved in starch biosynthesis in plants. Cassava starch has many remarkable characteristics, which should be influenced by the evolution of SS genes in this starchy root crop. In this work, we performed a comprehensive phylogenetic and evolutionary analysis of the soluble starch synthases in cassava. Genome-wide identification showed that there are 9 genes encoding soluble starch synthases in cassava. All of the soluble starch synthases encoded by these genes contain both Glyco_transf_5 and Glycos_transf_1 domains, and a correlation analysis showed evidence of coevolution between these 2 domains in cassava SS genes. The SS genes in land plants can be divided into 6 subfamilies that were formed before the origin of seed plants, and species-specific expansion has contributed to the evolution of this family in cassava. A functional divergence analysis for this family provided statistical evidence for shifted evolutionary rates between the subfamilies of land plant soluble starch synthases. Although the main selective pressure acting on land plant SS genes was purifying selection, our results also revealed that point mutation with positive selection contributed to the evolution of 2 SS genes in cassava. The remarkable cassava starch characteristics might be the result of both the duplication and adaptive selection of SS genes. PMID:23888108

  15. Hereditary sideroblastic anaemia due to a mutation in exon 10 of the erythroid 5-aminolaevulinate synthase gene.

    PubMed

    Edgar, A J; Wickramasinghe, S N

    1998-02-01

    DNA sequencing of the coding region of the erythroid 5-aminolaevulinate synthase (ALAS2) cDNA from a male with pyridoxine-responsive sideroblastic anaemia revealed a missense mutation C1622G and a closely linked polymorphism C1612A in exon 10 of the gene. Sequence analysis of the genomic DNA from other family members revealed that the proband's mother and daughter were heterozygous carriers of the mutation, consistent with the X-linked inheritance. The C1622G mutation results in a histidine to aspartic acid substitution at amino acid residue 524. The histidine residue is conserved in both the erythroid and housekeeping ALAS proteins in vertebrates, all other known ALAS proteins and other oxamine synthases that have pyridoxal 5'-phosphate as a co-factor. This histidine is located in a predicted loop, preceding a long alpha-helix region near the carboxy-terminus.

  16. Characterization and analysis of the cotton cyclopropane fatty acid synthase family and their contribution to cyclopropane fatty acid synthesis

    SciTech Connect

    Yu X. H.; Shanklin J.; Rawat, R.

    2011-05-01

    Cyclopropane fatty acids (CPA) have been found in certain gymnosperms, Malvales, Litchi and other Sapindales. The presence of their unique strained ring structures confers physical and chemical properties characteristic of unsaturated fatty acids with the oxidative stability displayed by saturated fatty acids making them of considerable industrial interest. While cyclopropenoid fatty acids (CPE) are well-known inhibitors of fatty acid desaturation in animals, CPE can also inhibit the stearoyl-CoA desaturase and interfere with the maturation and reproduction of some insect species suggesting that in addition to their traditional role as storage lipids, CPE can contribute to the protection of plants from herbivory. Three genes encoding cyclopropane synthase homologues GhCPS1, GhCPS2 and GhCPS3 were identified in cotton. Determination of gene transcript abundance revealed differences among the expression of GhCPS1, 2 and 3 showing high, intermediate and low levels, respectively, of transcripts in roots and stems; whereas GhCPS1 and 2 are both expressed at low levels in seeds. Analyses of fatty acid composition in different tissues indicate that the expression patterns of GhCPS1 and 2 correlate with cyclic fatty acid (CFA) distribution. Deletion of the N-terminal oxidase domain lowered GhCPS's ability to produce cyclopropane fatty acid by approximately 70%. GhCPS1 and 2, but not 3 resulted in the production of cyclopropane fatty acids upon heterologous expression in yeast, tobacco BY2 cell and Arabidopsis seed. In cotton GhCPS1 and 2 gene expression correlates with the total CFA content in roots, stems and seeds. That GhCPS1 and 2 are expressed at a similar level in seed suggests both of them can be considered potential targets for gene silencing to reduce undesirable seed CPE accumulation. Because GhCPS1 is more active in yeast than the published Sterculia CPS and shows similar activity when expressed in model plant systems, it represents a strong candidate gene for

  17. Molecular cloning of the human UMP synthase gene and characterization of point mutations in two hereditary orotic aciduria families.

    PubMed Central

    Suchi, M; Mizuno, H; Kawai, Y; Tsuboi, T; Sumi, S; Okajima, K; Hodgson, M E; Ogawa, H; Wada, Y

    1997-01-01

    Uridine monophosphate (UMP) synthase is a bifunctional enzyme catalyzing the last two steps of de novo pyrimidine biosynthesis, orotate phosphoribosyltransferase (OPRT) and orotidine-5'-monophosphate decarboxylase (ODC). Loss of either enzymatic activity results in hereditary orotic aciduria, a rare autosomal recessive disorder characterized by retarded growth, anemia, and excessive urinary excretion of orotic acid. We have isolated the UMP synthase chromosomal gene from a lambdaEMBL-3 human genomic library and report a single-copy gene spanning approximately 15 kb. The UMP synthase genomic structure encodes six exons ranging in size from 115 bp to 672 bp, and all splicing junctions adhere to the canonical GT/AG rule. Cognate promoter elements implicated in glucocorticoid- and cAMP-mediated regulation as well as in liver-, myeloid-, and lymphocyte-specific expression are located within the 5' flanking sequence. Molecular investigation of UMP synthase deficiency in a Japanese orotic aciduria patient revealed mutations R96G (A-to-G transition; nt 286) and G429R (G-to-C transversion; nt 1285) in one allele and V109G (T-to-G transversion; nt 326) in the other allele. Expression of human UMP synthase cDNAs containing these mutations in pyrimidine auxotrophic Escherichia coli and in recombinant baculovirus-infected Sf21 cells demonstrates impaired activity presumably associated with the urinary orotic acid substrate accumulations observed in vivo. We further establish the identity of two polymorphisms, G213A (v = .26) and 440Gpoly (v = .27) located in exons 3 and 6, respectively, which did not significantly compromise either OPRT or ODC function. Images Figure 1 Figure 4 Figure 5 PMID:9042911

  18. Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites*

    PubMed Central

    Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

    2012-01-01

    To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi’an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi’an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%–99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites. PMID:23024043

  19. Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites.

    PubMed

    Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

    2012-10-01

    To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi'an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi'an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%-99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites.

  20. Inhibitory effects of tannic acid on fatty acid synthase and 3T3-L1 preadipocyte.

    PubMed

    Fan, Huijin; Wu, Dan; Tian, Weixi; Ma, Xiaofeng

    2013-07-01

    Tannic acid is a hydrolyzable tannin that exists in many widespread edible plants with a variety of biological activities. In this study, we found that tannic acid potently inhibited the activity of fatty acid synthase (FAS) in a concentration-dependent manner with a half-inhibitory concentration value (IC50) of 0.14 microM. The inhibition kinetic results showed that the inhibition of FAS by tannic acid was mixed competitive and noncompetitive manner with respect to acetyl-CoA and malonyl-CoA, but uncompetitive to NADPH. Tannic acid prevented the differentiation of 3T3-L1 pre-adipocytes, and thus repressed intracellular lipid accumulation. In the meantime, tannic acid decreased the expression of FAS and down-regulated the mRNA level of FAS and PPARgamma during adipocyte differentiation. Further studies showed that the inhibitory effect of tannic acid did not relate to FAS non-specific sedimentation. Since FAS was believed to be a therapeutic target of obesity, these findings suggested that tannic acid was considered having potential in the prevention of obesity.

  1. Nonsense Mutation Inside Anthocyanidin Synthase Gene Controls Pigmentation in Yellow Raspberry (Rubus idaeus L.)

    PubMed Central

    Rafique, Muhammad Z.; Carvalho, Elisabete; Stracke, Ralf; Palmieri, Luisa; Herrera, Lorena; Feller, Antje; Malnoy, Mickael; Martens, Stefan

    2016-01-01

    Yellow raspberry fruits have reduced anthocyanin contents and offer unique possibility to study the genetics of pigment biosynthesis in this important soft fruit. Anthocyanidin synthase (Ans) catalyzes the conversion of leucoanthocyanidin to anthocyanidin, a key committed step in biosynthesis of anthocyanins. Molecular analysis of the Ans gene enabled to identify an inactive ans allele in a yellow fruit raspberry (“Anne”). A 5 bp insertion in the coding region was identified and designated as ans+5. The insertion creates a premature stop codon resulting in a truncated protein of 264 amino acids, compared to 414 amino acids wild-type ANS protein. This mutation leads to loss of function of the encoded protein that might also result in transcriptional downregulation of Ans gene as a secondary effect, i.e., nonsense-mediated mRNA decay. Further, this mutation results in loss of visible and detectable anthocyanin pigments. Functional characterization of raspberry Ans/ans alleles via complementation experiments in the Arabidopsis thaliana ldox mutant supports the inactivity of encoded protein through ans+5 and explains the proposed block in the anthocyanin biosynthetic pathway in raspberry. Taken together, our data shows that the mutation inside Ans gene in raspberry is responsible for yellow fruit phenotypes. PMID:28066458

  2. Overexpression of Citrus junos mitochondrial citrate synthase gene in Nicotiana benthamiana confers aluminum tolerance.

    PubMed

    Deng, Wei; Luo, Keming; Li, Zhengguo; Yang, Yingwu; Hu, Nan; Wu, Yu

    2009-07-01

    Aluminum (Al) toxicity is one of the major factors that limit plant growth in acid soils. Al-induced release of organic acids into rhizosphere from the root apex has been identified as a major Al-tolerance mechanism in many plant species. In this study, Al tolerance of Yuzu (Citrus Junos Sieb. ex Tanaka) was tested on the basis of root elongation and the results demonstrated that Yuzu was Al tolerant compared with other plant species. Exposure to Al triggered the exudation of citrate from the Yuzu root. Thus, the mechanism of Al tolerance in Yuzu involved an Al-inducible increase in citrate release. Aluminum also elicited an increase of citrate content and increased the expression level of mitochondrial citrate synthase (CjCS) gene and enzyme activity in Yuzu. The CjCS gene was cloned from Yuzu and overexpressed in Nicotiana benthamiana using Agrobacterium tumefaciens-mediated methods. Increased expression level of the CjCS gene and enhanced enzyme activity were observed in transgenic plants compared with the wild-type plants. Root growth experiments showed that transgenic plants have enhanced levels of Al tolerance. The transgenic Nicotiana plants showed increased levels of citrate in roots compared to wild-type plants. The exudation of citrate from roots of the transgenic plants significantly increased when exposed to Al. The results with transgenic plants suggest that overexpression of mitochondrial CS can be a useful tool to achieve Al tolerance.

  3. Cloning and Characterization of Farnesyl Diphosphate Synthase Gene Involved in Triterpenoids Biosynthesis from Poria cocos

    PubMed Central

    Wang, Jianrong; Li, Yangyuan; Liu, Danni

    2014-01-01

    Poria cocos (P. cocos) has long been used as traditional Chinese medicine and triterpenoids are the most important pharmacologically active constituents of this fungus. Farnesyl pyrophosphate synthase (FPS) is a key enzyme of triterpenoids biosynthesis. The gene encoding FPS was cloned from P. cocos by degenerate PCR, inverse PCR and cassette PCR. The open reading frame of the gene is 1086 bp in length, corresponding to a predicted polypeptide of 361 amino acid residues with a molecular weight of 41.2 kDa. Comparison of the P. cocos FPS deduced amino acid sequence with other species showed the highest identity with Ganoderma lucidum (74%). The predicted P. cocos FPS shares at least four conserved regions involved in the enzymatic activity with the FPSs of varied species. The recombinant protein was expressed in Pichia pastoris and purified. Gas chromatography analysis showed that the recombinant FPS could catalyze the formation of farnesyl diphosphate (FPP) from geranyl diphosphate (GPP) and isopentenyl diphosphate (IPP). Furthermore, the expression profile of the FPS gene and content of total triterpenoids under different stages of development and methyl jasmonate treatments were determined. The results indicated that there is a positive correlation between the activity of FPS and the amount of total triterpenoids produced in P. cocos. PMID:25474088

  4. Nonsense Mutation Inside Anthocyanidin Synthase Gene Controls Pigmentation in Yellow Raspberry (Rubus idaeus L.).

    PubMed

    Rafique, Muhammad Z; Carvalho, Elisabete; Stracke, Ralf; Palmieri, Luisa; Herrera, Lorena; Feller, Antje; Malnoy, Mickael; Martens, Stefan

    2016-01-01

    Yellow raspberry fruits have reduced anthocyanin contents and offer unique possibility to study the genetics of pigment biosynthesis in this important soft fruit. Anthocyanidin synthase (Ans) catalyzes the conversion of leucoanthocyanidin to anthocyanidin, a key committed step in biosynthesis of anthocyanins. Molecular analysis of the Ans gene enabled to identify an inactive ans allele in a yellow fruit raspberry ("Anne"). A 5 bp insertion in the coding region was identified and designated as ans(+5). The insertion creates a premature stop codon resulting in a truncated protein of 264 amino acids, compared to 414 amino acids wild-type ANS protein. This mutation leads to loss of function of the encoded protein that might also result in transcriptional downregulation of Ans gene as a secondary effect, i.e., nonsense-mediated mRNA decay. Further, this mutation results in loss of visible and detectable anthocyanin pigments. Functional characterization of raspberry Ans/ans alleles via complementation experiments in the Arabidopsis thaliana ldox mutant supports the inactivity of encoded protein through ans(+5) and explains the proposed block in the anthocyanin biosynthetic pathway in raspberry. Taken together, our data shows that the mutation inside Ans gene in raspberry is responsible for yellow fruit phenotypes.

  5. Molecular cloning and characterization of a glucan synthase gene from the human pathogenic fungus Paracoccidioides brasiliensis.

    PubMed

    Pereira, M; Felipe, M S; Brígido, M M; Soares, C M; Azevedo, M O

    2000-03-30

    1,3-beta-D-glucan is a fungal cell wall polymer synthesized by the multi-subunit enzyme 1,3-beta-D-glucan synthase. A subunit of this integral membrane protein was first described as the product of the FKS1 gene from Saccharomyces cerevisiae using echinocandin mutants. Other FKS1 genes were also reported for Candida albicans, Aspergillus nidulans and Cryptococcus neoformans. Here, we report the nucleotide sequence of the first homologous FKS gene cloned from the pathogenic fungus Paracoccidioides brasiliensis. An open reading frame of 5942 bp was identified in the complete sequence, interrupted by two putative introns, the first close to the 5' end and the second close to the 3' end of the gene. A promoter region is also described containing consensus sequences such as canonical TATA and CAAT boxes and, possibly, multiple sites for glucose regulation by creA protein. The deduced sequence of 1926 amino acid show more than 85% similarity to FksAp from A. nidulans, and 71% to Fks1p and Fks2p from S. cerevisiae. Computational analysis of P. brasiliensis Fks1p suggests a similar structure to transmembrane proteins, such as FksAp, with the presence of two domains composed by hydrophobic helices that limit the putative highly hydrophilic catalytic domain within the cytoplasm.

  6. Updating carbamoylphosphate synthase (CPS) phylogenies: occurrence and phylogenetic identity of archaeal CPS genes.

    PubMed

    Cammarano, Piero; Gribaldo, Simonetta; Johann, Andre

    2002-08-01

    Among Bacteria the carA and carB genes encoding the small (CarA) and large (CarB) subunits of carbamoylphosphate synthase (CPS) have been lost in certain symbionts (Haemophylus influenzae) and in most obligate intracellular parasites (Chlamydiae, Spirochaetes, Mycoplasmatales, Rickettsiae) having genome sizes in the 0.7- to 1.1-Mb range. Compared to Bacteria, Archaea exhibit a more varied pattern of CPS gene losses and an unusual propensity to incorporate CPS genes derived from both Bacteria and other Archaea. Schematically they fall into three groups. Group 1 taxa (the crenarchaeon Aeropyrum pernix and the euryarchaea Pyrococcus horikoshi and Pyrococcus abyssii) lack CPS genes altogether. Group 2 taxa (comprising Halobacteriales, Thermoplasmales, Methanococcales, Methanomicrobiales, Archaeoglobales) harbor CPS genes whose encoded CarB and CarA subunit proteins are ostensibly bacterial in origin; that is, they are intermixed with bacterial homologues on a phylogeny of concatenated CarA and CarB sequences and are not distinguishable from bacterial sequences after searching for domain-specific amino acid residue positions. Group 3 taxa (the crenarchaea Pyrobaculum aerophilum, Sulfolobus solfataricus, and Sulfolobus tokodaii and the euryarchaeon Pyrococcus furiosus) harbor CPS genes whose encoded proteins appear to be archaeal: consistent with an archaeal origin, the CarA and CarB sequences in this group possess both unique signatures and signatures affiliating them to Eukarya. Based on the topology of the clade comprising the four Group 3 taxa, we argue that CPS genes of P. furiosus (a euryarchaeon) and those of the crenarchaea P. aerophilum, S. solfataricus, and S. tokodaii are of a single type, resulting from the two genes being laterally transferred from a crenarchaeon to P. furiosus.

  7. 5,10-Methylenetetrahydrofolate reductase (MTHFR), methionine synthase (MTRR), and methionine synthase reductase (MTR) gene polymorphisms and adult meningioma risk.

    PubMed

    Zhang, Jun; Zhou, Yan-Wen; Shi, Hua-Ping; Wang, Yan-Zhong; Li, Gui-Ling; Yu, Hai-Tao; Xie, Xin-You

    2013-11-01

    The causes of meningiomas are not well understood. Folate metabolism gene polymorphisms have been shown to be associated with various human cancers. It is still controversial and ambiguous between the functional polymorphisms of folate metabolism genes 5,10-methylenetetrahydrofolate reductase (MTHFR), methionine synthase (MTRR), and methionine synthase reductase (MTR) and risk of adult meningioma. A population-based case–control study involving 600 meningioma patients (World Health Organization [WHO] Grade I, 391 cases; WHO Grade II, 167 cases; WHO Grade III, 42 cases) and 600 controls was done for the MTHFR C677T and A1298C, MTRR A66G, and MTR A2756G variants in Chinese Han population. The folate metabolism gene polymorphisms were determined by using a polymerase chain reaction–restriction fragment length polymorphism assay. Meningioma cases had a significantly lower frequency of MTHFR 677 TT genotype [odds ratio (OR) = 0.49, 95 % confidence interval (CI) 0.33–0.74; P = 0.001] and T allele (OR = 0.80, 95 % CI 0.67–0.95; P = 0.01) than controls. A significant association between risk of meningioma and MTRR 66 GG (OR = 1.41, 95 % CI 1.02–1.96; P = 0.04) was also observed. When stratifying by the WHO grade of meningioma, no association was found. Our study suggested that MTHFR C677T and MTRR A66G variants may affect the risk of adult meningioma in Chinese Han population.

  8. Leucine deprivation inhibits proliferation and induces apoptosis of human breast cancer cells via fatty acid synthase

    PubMed Central

    Xiao, Fei; Wang, Chunxia; Yin, Hongkun; Yu, Junjie; Chen, Shanghai; Fang, Jing; Guo, Feifan

    2016-01-01

    Substantial studies on fatty acid synthase (FASN) have focused on its role in regulating lipid metabolism and researchers have a great interest in treating cancer with dietary manipulation of amino acids. In the current study, we found that leucine deprivation caused the FASN-dependent anticancer effect. Here we showed that leucine deprivation inhibited cell proliferation and induced apoptosis of MDA-MB-231 and MCF-7 breast cancer cells. In an in vivo tumor xenograft model, the leucine-free diet suppressed the growth of human breast cancer tumors and triggered widespread apoptosis of the cancer cells. Further study indicated that leucine deprivation decreased expression of lipogenic gene FASN in vitro and in vivo. Over-expression of FASN or supplementation of palmitic acid (the product of FASN action) blocked the effects of leucine deprivation on cell proliferation and apoptosis in vitro and in vivo. Moreover, leucine deprivation suppressed the FASN expression via regulating general control non-derepressible (GCN)2 and sterol regulatory element-binding protein 1C (SREBP1C). Taken together, our study represents proof of principle that anticancer effects can be obtained with strategies to deprive tumors of leucine via suppressing FASN expression, which provides important insights in prevention of breast cancer via metabolic intervention. PMID:27579768

  9. Geranyl diphosphate synthase from mint

    DOEpatents

    Croteau, Rodney Bruce; Wildung, Mark Raymond; Burke, Charles Cullen; Gershenzon, Jonathan

    1999-01-01

    A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate.

  10. Geranyl diphosphate synthase from mint

    DOEpatents

    Croteau, R.B.; Wildung, M.R.; Burke, C.C.; Gershenzon, J.

    1999-03-02

    A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate. 5 figs.

  11. Purification, characterization and partial amino acid sequence of glycogen synthase from Saccharomyces cerevisiae.

    PubMed Central

    Carabaza, A; Arino, J; Fox, J W; Villar-Palasi, C; Guinovart, J J

    1990-01-01

    Glycogen synthase from Saccharomyces cerevisiae was purified to homogeneity. The enzyme showed a subunit molecular mass of 80 kDa. The holoenzyme appears to be a tetramer. Antibodies developed against purified yeast glycogen synthase inactivated the enzyme in yeast extracts and allowed the detection of the protein in Western blots. Amino acid analysis showed that the enzyme is very rich in glutamate and/or glutamine residues. The N-terminal sequence (11 amino acid residues) was determined. In addition, selected tryptic-digest peptides were purified by reverse-phase h.p.l.c. and submitted to gas-phase sequencing. Up to eight sequences (79 amino acid residues) could be aligned with the human muscle enzyme sequence. Levels of identity range between 37 and 100%, indicating that, although human and yeast glycogen synthases probably share some conserved regions, significant differences in their primary structure should be expected. Images Fig. 1. Fig. 2. Fig. 3. PMID:2114092

  12. Studies on the chalcone synthase gene of two higher plants: petroselinum hortense and matthiola incana

    SciTech Connect

    Hemleben, V.; Frey, M.; Rall, S.; Koch, M.; Kittel, M.; Kreuzaler, F.; Ragg, H.; Fautz, E.; Hahlbrock, K.

    1982-01-01

    Two higher plant systems are presented which allow to study coordinated gene expression of the light-induced metabolic pathway of flavonoid biosynthesis: tissue culture cells of Petroselinum hortense (Apiaceae) and different developmental stages of various genotypes of Matthiola incana (Brassicaceae). The gene structure of the chalcone synthase is mainly studied. A cDNA clone (pLF56) of parsley has been constructed and characterized conferring the chalcone synthase gene sequence. Strong cross hybridization between the parsley cDNA and Matthiola DNA allowed to identify a HindIII fragment (6000 bp) identical in size for parsley and different Matthiola wild type lines and a mutant line.

  13. Cloning and characterization of the nicotianamine synthase gene in Eruca vesicaria subsp sativa.

    PubMed

    Huang, B L; Cheng, C; Zhang, G Y; Su, J J; Zhi, Y; Xu, S S; Cai, D T; Zhang, X K; Huang, B Q

    2015-12-22

    Nicotianamine (NA) is a ubiquitous metabolite in plants that bind heavy metals, is crucial for metal homeostasis, and is also an important metal chelator that facilitates long-distance metal transport and sequestration. NA synthesis is catalyzed by the enzyme nicotianamine synthase (NAS). Eruca vesicaria subsp sativa is highly tolerant to Ni, Pb, and Zn. In this study, a gene encoding EvNAS was cloned and characterized in E. vesicaria subsp sativa. The full-length EvNAS cDNA sequence contained a 111-bp 5'-untranslated region (UTR), a 155-bp 3'-UTR, and a 966-bp open reading frame encoding 322-amino acid residues. The EvNAS genomic sequence contained no introns, which is similar to previously reported NAS genes. The deduced translation of EvNAS contained a well-conserved NAS domain (1-279 amino acids) and an LIKI-CGEAEG box identical to some Brassica NAS and to the LIRL-box in most plant NAS, which is essential for DNA binding. Phylogenetic analysis indicated that EvNAS was most closely related to Brassica rapa NAS3 within the Cruciferae, followed by Thlaspi NAS1, Camelina NAS3, and Arabidopsis NAS3. A reverse transcription-polymerase chain reaction indicated that EvNAS expression was greatest in the leaves, followed by the flower buds and hypocotyls. EvNAS was moderately expressed in the roots.

  14. Molecular cloning, characteristics and low temperature response of raffinose synthase gene in Cucumis sativus L.

    PubMed

    Sui, Xiao-lei; Meng, Fan-zhen; Wang, Hong-yun; Wei, Yu-xia; Li, Rui-fu; Wang, Zhen-yu; Hu, Li-ping; Wang, Shao-hui; Zhang, Zhen-xian

    2012-12-15

    Raffinose synthase (RS, EC2.4.1.82) is one of the key enzymes that channels sucrose into the raffinose family oligosaccharides (RFOs) biosynthetic pathway. However, the gene encoding RS is poorly characterized in cucumber (Cucumis sativus L.), which is a typical RFOs-translocating plant species. Here we isolated the gene encoding RS (CsRS) from the leaves of cucumber plants. The complete cDNA of CsRS consisted of 2552 nucleotides with an open reading frame encoding a polypeptide of 784 amino acid residues. Reverse transcription-polymerase chain reaction and RNA hybridization analysis revealed that expression of CsRS was the highest in leaves followed by roots, fruits, and stems. The RS activity was up-regulated and the raffinose content was high in the leaves of transgenic tobacco with over-expression of CsRS, while both the RS activity and the raffinose content decreased in the transgenic cucumber plants with anti-sense expression of CsRS. The expression of CsRS could be induced by low temperature and exogenous phytohormone abscisic acid (ABA). In cucumber growing under low temperature stress, CsRS expression, RS activity and raffinose content increased gradually in the leaves, the fruits, the stems and the roots. The most notable increase was observed in the leaves. Similarly, the expression of CsRS was induced in cucumber leaves and fruits with 200 μM and 150 μM ABA treatments, respectively.

  15. Analysis of THCA synthase gene expression in cannabis: a preliminary study by real-time quantitative PCR.

    PubMed

    Cascini, Fidelia; Passerotti, Stella; Boschi, Ilaria

    2013-09-10

    In this paper we describe analyses performed by Real-Time Reverse-Transcriptase Polymerase Chain Reaction (real-time RT-PCR) on RNA of 12 samples, carried out for forensic purposes to investigate a correlation between tetrahydrocannabinol (THC) concentration in Cannabis and the tetrahydrocannabinol acid synthase (THCAS) gene expression. Samples were obtained from an experimental cultivation of declared potency Cannabis variety seeds and from seizures. The Rubisco gene and the 26S ribosomal RNA gene were used as internal control genes for their constant expression and stability. As results we found minor gene expression in samples from leaves of young plants. Further, grouping results for cannabis samples with similar characteristics, we have found an increased relative expression in samples with the highest percentage of THC coming from seized sample and adult plants.

  16. Screening for latent acute intermittent porphyria: the value of measuring both leucocyte delta-aminolaevulinic acid synthase and erythrocyte uroporphyrinogen-1-synthase activities.

    PubMed Central

    McColl, K E; Moore, M R; Thompson, G G; Goldberg, A

    1982-01-01

    Acute intermittent porphyria (AIP) is an autosomal dominantly inherited disorder of haem biosynthesis characterised by reduced activity of the enzyme uroporphyrinogen-1-(URO) synthase and compensatory increased activity of the rate controlling enzyme delta-aminolaevulinic acid (ALA) synthase. Subjects with the disorder should be identified as they are at risk of developing severe porphyric attacks if exposed to a variety of drugs or chemicals. We have assessed the value of measuring the activities of ALA synthase and URO synthase in peripheral blood cells as a means of identifying latent cases in affected families. In AIP subjects, ALA synthase activity was increased and URO synthase decreased compared to controls, through there was considerable overlap between the two groups when either enzyme was examined alone. When both enzymes were examined together, all but one of the 19 AIP patients had both increased ALA synthase activity (greater than 250 nmol ALA/g protein/h) and reduced URO synthase activity (less than 25.1 nmol URO/l RBC/h), whereas none of the 62 controls showed this enzyme pattern. Examination of 35 asymptomatic first degree blood relatives of AIP patients showed that 17 (49%) had the porphyric enzyme pattern with no sex bias. The combined study of these two enzymes permits accurate detection of latent cases of AIP and confirms its autosomal dominant inheritance. PMID:7120315

  17. Homologous cloning, characterization and expression of a new halophyte phytochelatin synthase gene in Suaeda salsa

    NASA Astrophysics Data System (ADS)

    Cong, Ming; Zhao, Jianmin; Lü, Jiasen; Ren, Zhiming; Wu, Huifeng

    2016-09-01

    The halophyte Suaeda salsa can grow in heavy metal-polluted areas along intertidal zones having high salinity. Since phytochelatins can eff ectively chelate heavy metals, it was hypothesized that S. salsa possessed a phytochelatin synthase (PCS) gene. In the present study, the cDNA of PCS was obtained from S. salsa (designated as SsPCS) using homologous cloning and the rapid amplification of cDNA ends (RACE). A sequence analysis revealed that SsPCS consisted of 1 916 bp nucleotides, encoding a polypeptide of 492 amino acids with one phytochelatin domain and one phytochelatin C domain. A similarity analysis suggested that SsPCS shared up to a 58.6% identity with other PCS proteins and clustered with PCS proteins from eudicots. There was a new kind of metal ion sensor motif in its C-terminal domain. The SsPCS transcript was more highly expressed in elongated and fibered roots and stems ( P<0.05) than in leaves. Lead and mercury exposure significantly enhanced the mRNA expression of SsPCS ( P<0.05). To the best of our knowledge, SsPCS is the second PCS gene cloned from a halophyte, and it might contain a diff erent metal sensing capability than the first PCS from Thellungiella halophila. This study provided a new view of halophyte PCS genes in heavy metal tolerance.

  18. [Full-length cDNA cloning of flavonol synthase genes of Carthamus tinctorius and construction plant expression vector].

    PubMed

    Yang, Wen-ting; Liu, Xiu-ming; Wan, Qiu; Yao, Na; Wang, Nan; Zhang, Xue-meng; Jiao, Zhong-da; Li, Hai-yan; Li, Xiao-kun

    2015-02-01

    Flavonol synthase (FLS) is one of the key enzymes in flavonoids metabolic pathways. In this study, middle sequence was obtained from Carthamus tinctorius transcriptome sequencing results. Full-length cDNAs of FLS was cloned from petals of C. tinctorius to FLS by using RT-PCR and RACE technology. Its full-length cDNA was 1,201 bp, with an open reading frame of 1,101 bp and 336 encoded amino acids. The phylogenetic analysis showed that, FLS gene encoded amino acids in C. tinctorius were highly homologous with amino acids in congeneric Compositae species, especially Rudbeckia laciniata. The pBASTA-FLS plant expression vector was successfully built by the molecular biology method, which lays a foundation for further studying biology functions of the gene and biosynthesis mechanism of flavonoids.

  19. Expanding the product portfolio of fungal type I fatty acid synthases.

    PubMed

    Zhu, Zhiwei; Zhou, Yongjin J; Krivoruchko, Anastasia; Grininger, Martin; Zhao, Zongbao K; Nielsen, Jens

    2017-04-01

    Fungal type I fatty acid synthases (FASs) are mega-enzymes with two separated, identical compartments, in which the acyl carrier protein (ACP) domains shuttle substrates to catalytically active sites embedded in the chamber wall. We devised synthetic FASs by integrating heterologous enzymes into the reaction chambers and demonstrated their capability to convert acyl-ACP or acyl-CoA from canonical fatty acid biosynthesis to short/medium-chain fatty acids and methyl ketones.

  20. Phylogenomic analysis of polyketide synthase genes in actinomycetes: structural analysis of KS domains and modules of polyketide synthases.

    PubMed

    Sarwar, Samreen; Ahmed, Mehboob; Hasnain, Shahida

    2012-01-01

    Polyketides are complex and diverse secondary metabolites, synthesised by large multifunctional enzymes, Polyketide Synthases (PKS). The phylogenomic analysis of β-ketosynthase (KS) domains and PKSs within actinomycetes suggests the contribution of point mutations, gene duplications, horizontal gene transfer and homologous recombination in the evolution of PKSs. PKS genealogy suggested the ancestral module structure with KS-AT-ACP domain composition. KS domains showed similar core and highly variable loop regions at the dimer interface, which seems to affect the selectivity of the primer unit. In PKS modules, the linker regions comprise a significant fraction of the module. The reducing domains (ketoreductase and dehydrogenase) protrude out from the central axis of the module and also responsible for extreme variability in the final products. Thus, phylogenomic and structural analysis of PKSs can assist in the artificial reprogramming of PKSs.

  1. Assessing the allelotypic effect of two aminocyclopropane carboxylic acid synthase-encoding genes MdACS1 and MdACS3a on fruit ethylene production and softening in Malus

    PubMed Central

    Dougherty, Laura; Zhu, Yuandi; Xu, Kenong

    2016-01-01

    Phytohormone ethylene largely determines apple fruit shelf life and storability. Previous studies demonstrated that MdACS1 and MdACS3a, which encode 1-aminocyclopropane-1-carboxylic acid synthases (ACS), are crucial in apple fruit ethylene production. MdACS1 is well-known to be intimately involved in the climacteric ethylene burst in fruit ripening, while MdACS3a has been regarded a main regulator for ethylene production transition from system 1 (during fruit development) to system 2 (during fruit ripening). However, MdACS3a was also shown to have limited roles in initiating the ripening process lately. To better assess their roles, fruit ethylene production and softening were evaluated at five time points during a 20-day post-harvest period in 97 Malus accessions and in 34 progeny from 2 controlled crosses. Allelotyping was accomplished using an existing marker (ACS1) for MdACS1 and two markers (CAPS866 and CAPS870) developed here to specifically detect the two null alleles (ACS3a-G289V and Mdacs3a) of MdACS3a. In total, 952 Malus accessions were allelotyped with the three markers. The major findings included: The effect of MdACS1 was significant on fruit ethylene production and softening while that of MdACS3a was less detectable; allele MdACS1–2 was significantly associated with low ethylene and slow softening; under the same background of the MdACS1 allelotypes, null allele Mdacs3a (not ACS3a-G289V) could confer a significant delay of ethylene peak; alleles MdACS1–2 and Mdacs3a (excluding ACS3a-G289V) were highly enriched in M. domestica and M. hybrid when compared with those in M. sieversii. These findings are of practical implications in developing apples of low and delayed ethylene profiles by utilizing the beneficial alleles MdACS1-2 and Mdacs3a. PMID:27231553

  2. Purification and characterization of cannabidiolic-acid synthase from Cannabis sativa L.. Biochemical analysis of a novel enzyme that catalyzes the oxidocyclization of cannabigerolic acid to cannabidiolic acid.

    PubMed

    Taura, F; Morimoto, S; Shoyama, Y

    1996-07-19

    We identified a unique enzyme that catalyzes the oxidocyclization of cannabigerolic acid to cannabidiolic acid (CBDA) in Cannabis sativa L. (CBDA strain). The enzyme, named CBDA synthase, was purified to apparent homogeneity by a four-step procedure: ammonium sulfate precipitation followed by chromatography on DEAE-cellulose, phenyl-Sepharose CL-4B, and hydroxylapatite. The active enzyme consists of a single polypeptide with a molecular mass of 74 kDa and a pI of 6.1. The NH2-terminal amino acid sequence of CBDA synthase is similar to that of Delta1-tetrahydrocannabinolic-acid synthase. CBDA synthase does not require coenzymes, molecular oxygen, hydrogen peroxide, and metal ion cofactors for the oxidocyclization reaction. These results indicate that CBDA synthase is neither an oxygenase nor a peroxidase and that the enzymatic cyclization does not proceed via oxygenated intermediates. CBDA synthase catalyzes the formation of CBDA from cannabinerolic acid as well as cannabigerolic acid, although the kcat for the former (0.03 s-1) is lower than that for the latter (0.19 s-1). Therefore, we conclude that CBDA is predominantly biosynthesized from cannabigerolic acid rather than cannabinerolic acid.

  3. Functional analyses of cellulose synthase genes in flax (Linum usitatissimum) by virus-induced gene silencing.

    PubMed

    Chantreau, Maxime; Chabbert, Brigitte; Billiard, Sylvain; Hawkins, Simon; Neutelings, Godfrey

    2015-12-01

    Flax (Linum usitatissimum) bast fibres are located in the stem cortex where they play an important role in mechanical support. They contain high amounts of cellulose and so are used for linen textiles and in the composite industry. In this study, we screened the annotated flax genome and identified 14 distinct cellulose synthase (CESA) genes using orthologous sequences previously identified. Transcriptomics of 'primary cell wall' and 'secondary cell wall' flax CESA genes showed that some were preferentially expressed in different organs and stem tissues providing clues as to their biological role(s) in planta. The development for the first time in flax of a virus-induced gene silencing (VIGS) approach was used to functionally evaluate the biological role of different CESA genes in stem tissues. Quantification of transcript accumulation showed that in many cases, silencing not only affected targeted CESA clades, but also had an impact on other CESA genes. Whatever the targeted clade, inactivation by VIGS affected plant growth. In contrast, only clade 1- and clade 6-targeted plants showed modifications in outer-stem tissue organization and secondary cell wall formation. In these plants, bast fibre number and structure were severely impacted, suggesting that the targeted genes may play an important role in the establishment of the fibre cell wall. Our results provide new fundamental information about cellulose biosynthesis in flax that should facilitate future plant improvement/engineering.

  4. Gene Therapy Inhibiting Neointimal Vascular Lesion: In vivo Transfer of Endothelial Cell Nitric Oxide Synthase Gene

    NASA Astrophysics Data System (ADS)

    von der Leyen, Heiko E.; Gibbons, Gary H.; Morishita, Ryuichi; Lewis, Neil P.; Zhang, Lunan; Nakajima, Masatoshi; Kaneda, Yasufumi; Cooke, John P.; Dzau, Victor J.

    1995-02-01

    It is postulated that vascular disease involves a disturbance in the homeostatic balance of factors regulating vascular tone and structure. Recent developments in gene transfer techniques have emerged as an exciting therapeutic option to treat vascular disease. Several studies have established the feasibility of direct in vivo gene transfer into the vasculature by using reporter genes such as β-galactosidase or luciferase. To date no study has documented therapeutic effects with in vivo gene transfer of a cDNA encoding a functional enzyme. This study tests the hypothesis that endothelium-derived nitric oxide is an endogenous inhibitor of vascular lesion formation. After denudation by balloon injury of the endothelium of rat carotid arteries, we restored endothelial cell nitric oxide synthase (ec-NOS) expression in the vessel wall by using the highly efficient Sendai virus/liposome in vivo gene transfer technique. ec-NOS gene transfection not only restored NO production to levels seen in normal untreated vessels but also increased vascular reactivity of the injured vessel. Neointima formation at day 14 after balloon injury was inhibited by 70%. These findings provide direct evidence that NO is an endogenous inhibitor of vascular lesion formation in vivo (by inhibiting smooth muscle cell proliferation and migration) and suggest the possibility of ec-NOS transfection as a potential therapeutic approach to treat neointimal hyperplasia.

  5. Deletion of the carboxyl-terminal region of 1-aminocyclopropane-1-carboxylic acid synthase, a key protein in the biosynthesis of ethylene, results in catalytically hyperactive, monomeric enzyme.

    PubMed

    Li, N; Mattoo, A K

    1994-03-04

    1-Aminocyclopropane-1-carboxylic acid (ACC) synthase is a key enzyme regulating biosynthesis of the plant hormone ethylene. The expression of an enzymatically active, wound-inducible tomato (Lycopersicon esculentum L. cv Pik-Red) ACC synthase (485 amino acids long) in a heterologous Escherichia coli system allowed us to study the importance of hypervariable COOH terminus in enzymatic activity and protein conformation. We constructed several deletion mutants of the gene, expressed these in E. coli, purified the protein products to apparent homogeneity, and analyzed both conformation and enzyme kinetic parameters of the wild-type and truncated ACC syntheses. Deletion of the COOH terminus through Arg429 results in complete inactivation of the enzyme. Deletion of 46-52 amino acids from the COOH terminus results in an enzyme that has nine times higher affinity for the substrate S-adenosylmethionine than the wild-type enzyme. The highly efficient, truncated ACC synthase was found to be a monomer of 52 +/- 1.8 kDa as determined by gel filtration, whereas the wild-type ACC synthase, analyzed under similar conditions, is a dimer. These results demonstrate that the non-conserved COOH terminus of ACC synthase affects its enzymatic function as well as dimerization.

  6. Pyrazinoic acid and its n-propyl ester inhibit fatty acid synthase type I in replicating tubercle bacilli.

    PubMed

    Zimhony, Oren; Vilchèze, Catherine; Arai, Masayoshi; Welch, John T; Jacobs, William R

    2007-02-01

    The activity of different analogs of pyrazinamide on Mycobacterium tuberculosis fatty acid synthase type I (FASI) in replicating bacilli was studied. Palmitic acid biosynthesis was diminished by 96% in bacilli treated with n-propyl pyrazinoate, 94% in bacilli treated with 5-chloro-pyrazinamide, and 97% in bacilli treated with pyrazinoic acid, the pharmacologically active agent of pyrazinamide. We conclude that the minimal structure of pyrazine ring with an acyl group is sufficient for FASI inhibition and antimycobacterial activity.

  7. The missing piece of the type II fatty acid synthase system from Mycobacterium tuberculosis

    PubMed Central

    Sacco, Emmanuelle; Covarrubias, Adrian Suarez; O'Hare, Helen M.; Carroll, Paul; Eynard, Nathalie; Jones, T. Alwyn; Parish, Tanya; Daffé, Mamadou; Bäckbro, Kristina; Quémard, Annaïk

    2007-01-01

    The Mycobacterium tuberculosis fatty acid synthase type II (FAS-II) system has the unique property of producing unusually long-chain fatty acids involved in the biosynthesis of mycolic acids, key molecules of the tubercle bacillus. The enzyme(s) responsible for dehydration of (3R)-hydroxyacyl-ACP during the elongation cycles of the mycobacterial FAS-II remained unknown. This step is classically catalyzed by FabZ- and FabA-type enzymes in bacteria, but no such proteins are present in mycobacteria. Bioinformatic analyses and an essentiality study allowed the identification of a candidate protein cluster, Rv0635-Rv0636-Rv0637. Its expression in recombinant Escherichia coli strains leads to the formation of two heterodimers, Rv0635-Rv0636 (HadAB) and Rv0636-Rv0637 (HadBC), which also occurs in Mycobacterium smegmatis, as shown by split-Trp assays. Both heterodimers exhibit the enzymatic properties expected for mycobacterial FAS-II dehydratases: a marked specificity for both long-chain (≥C12) and ACP-linked substrates. Furthermore, they function as 3-hydroxyacyl dehydratases when coupled with MabA and InhA enzymes from the M. tuberculosis FAS-II system. HadAB and HadBC are the long-sought (3R)-hydroxyacyl-ACP dehydratases. The correlation between the substrate specificities of these enzymes, the organization of the orthologous gene cluster in different Corynebacterineae, and the structure of their mycolic acids suggests distinct roles for both heterodimers during the elongation process. This work describes bacterial monofunctional (3R)-hydroxyacyl-ACP dehydratases belonging to the hydratase 2 family. Their original structure and the fact that they are essential for M. tuberculosis survival make these enzymes very good candidates for the development of antimycobacterial drugs. PMID:17804795

  8. The role of 1-deoxy-d-xylulose-5-phosphate synthase and phytoene synthase gene family in citrus carotenoid accumulation.

    PubMed

    Peng, Gang; Wang, Chunyan; Song, Song; Fu, Xiumin; Azam, Muhammad; Grierson, Don; Xu, Changjie

    2013-10-01

    Three 1-deoxy-D-xylulose-5-phosphate synthases (DXS) and three phytoene synthases (PSY) were identified in citrus, from Affymetrix GeneChip Citrus Genome Array, GenBank and public orange genome databases. Tissue-specific expression analysis of these genes was carried out on fruit peel and flesh, flower and leaf of Satsuma mandarin (Citrus unshiu Marc.) in order to determine their roles in carotenoid accumulation in different tissues. Expression of CitDXS1 and CitPSY1 was highest in all test tissues, while that of CitDXS2 and CitPSY2 was lower, and that of CitDXS3 and CitPSY3 undetectable. The transcript profiles of CitDXS1 and CitPSY1 paralleled carotenoid accumulation in flesh of Satsuma mandarin and orange (Citrus sinensis Osbeck) during fruit development, and CitPSY1 expression was also associated with carotenoid accumulation in peel, while the CitDXS1 transcript level was only weakly correlated with carotenoid accumulation in peel. Similar results were obtained following correlation analysis between expression of CitDXS1 and CitPSY1 and carotenoid accumulation in peel and flesh of 16 citrus cultivars. These findings identify CitPSY1 and CitDXS1 as the main gene members controlling carotenoid biosynthesis in citrus fruit. Furthermore, chromoplasts were extracted from flesh tissue of these citrus, and chromoplasts of different shape (spindle or globular), different size, and color depth were observed in different cultivars, indicating chromoplast abundance, number per gram tissue, size and color depth were closely correlated with carotenoid content in most cultivars. The relationship between carotenoid biosynthesis and chromoplast development was discussed.

  9. Differential in radiosensitizing potency of enantiomers of the fatty acid synthase inhibitor C75.

    PubMed

    Rae, Colin; Babich, John W; Mairs, Robert J

    2017-01-01

    The elevated activity of fatty acid synthase has been reported in a number of cancer types. Inhibition of this enzyme has been demonstrated to induce cancer cell death and reduce tumor growth. In addition, the fatty acid synthase inhibitor drug C75 has been reported to synergistically enhance the cancer-killing ability of ionizing radiation. However, clinical use of C75 has been limited due to its producing weight loss, believed to be caused by alterations in the activity of carnitine palmitoyltransferase-1. C75 is administered in the form of a racemic mixture of (-) and (+) enantiomers that may differ in their regulation of fatty acid synthase and carnitine palmitoyltransferase-1. Therefore, we assessed the relative cancer-killing potency of different enantiomeric forms of C75 in prostate cancer cells. These results suggest that (-)-C75 is the more cytotoxic enantiomer and has greater radiosensitizing capacity than (+)-C75. These observations will stimulate the development of fatty acid synthase inhibitors that are selective for cancer cells and enhance the tumor-killing activity of ionizing radiation, while minimizing weight loss in cancer patients.

  10. Differential in radiosensitizing potency of enantiomers of the fatty acid synthase inhibitor C75

    PubMed Central

    Babich, John W.; Mairs, Robert J.

    2016-01-01

    Abstract The elevated activity of fatty acid synthase has been reported in a number of cancer types. Inhibition of this enzyme has been demonstrated to induce cancer cell death and reduce tumor growth. In addition, the fatty acid synthase inhibitor drug C75 has been reported to synergistically enhance the cancer‐killing ability of ionizing radiation. However, clinical use of C75 has been limited due to its producing weight loss, believed to be caused by alterations in the activity of carnitine palmitoyltransferase‐1. C75 is administered in the form of a racemic mixture of (−) and (+) enantiomers that may differ in their regulation of fatty acid synthase and carnitine palmitoyltransferase‐1. Therefore, we assessed the relative cancer‐killing potency of different enantiomeric forms of C75 in prostate cancer cells. These results suggest that (−)‐C75 is the more cytotoxic enantiomer and has greater radiosensitizing capacity than (+)‐C75. These observations will stimulate the development of fatty acid synthase inhibitors that are selective for cancer cells and enhance the tumor‐killing activity of ionizing radiation, while minimizing weight loss in cancer patients. PMID:27901292

  11. Parallel evolution of the glycogen synthase 1 (muscle) gene Gys1 between Old World and New World fruit bats (Order: Chiroptera).

    PubMed

    Fang, Lu; Shen, Bin; Irwin, David M; Zhang, Shuyi

    2014-10-01

    Glycogen synthase, which catalyzes the synthesis of glycogen, is especially important for Old World (Pteropodidae) and New World (Phyllostomidae) fruit bats that ingest high-carbohydrate diets. Glycogen synthase 1, encoded by the Gys1 gene, is the glycogen synthase isozyme that functions in muscles. To determine whether Gys1 has undergone adaptive evolution in bats with carbohydrate-rich diets, in comparison to insect-eating sister bat taxa, we sequenced the coding region of the Gys1 gene from 10 species of bats, including two Old World fruit bats (Pteropodidae) and a New World fruit bat (Phyllostomidae). Our results show no evidence for positive selection in the Gys1 coding sequence on the ancestral Old World and the New World Artibeus lituratus branches. Tests for convergent evolution indicated convergence of the sequences and one parallel amino acid substitution (T395A) was detected on these branches, which was likely driven by natural selection.

  12. Identification and characterization of a novel trehalose synthase gene derived from saline-alkali soil metagenomes.

    PubMed

    Jiang, Ling; Lin, Ming; Zhang, Yang; Li, Yanping; Xu, Xian; Li, Shuang; He Huang

    2013-01-01

    A novel trehalose synthase (TreS) gene was identified from a metagenomic library of saline-alkali soil by a simple activity-based screening system. Sequence analysis revealed that TreS encodes a protein of 552 amino acids, with a deduced molecular weight of 63.3 kDa. After being overexpressed in Escherichia coli and purified, the enzymatic properties of TreS were investigated. The recombinant TreS displayed its optimal activity at pH 9.0 and 45 °C, and the addition of most common metal ions (1 or 30 mM) had no inhibition effect on the enzymatic activity evidently, except for the divalent metal ions Zn(2+) and Hg(2+). Kinetic analysis showed that the recombinant TreS had a 4.1-fold higher catalytic efficiency (Kcat/K m ) for maltose than for trehalose. The maximum conversion rate of maltose into trehalose by the TreS was reached more than 78% at a relatively high maltose concentration (30%), making it a good candidate in the large-scale production of trehalsoe after further study. In addition, five amino acid residues, His172, Asp201, Glu251, His318 and Asp319, were shown to be conserved in the TreS, which were also important for glycosyl hydrolase family 13 enzyme catalysis.

  13. Isomaltulose synthase from Klebsiella sp. strain LX3: gene cloning and characterization and engineering of thermostability.

    PubMed

    Zhang, Daohai; Li, Xianzhen; Zhang, Lian-Hui

    2002-06-01

    The gene (palI) encoding isomaltulose synthase (PalI) from a soil bacterial isolate, Klebsiella sp. strain LX3, was cloned and characterized. PalI converts sucrose into isomaltulose, trehalulose, and trace amounts of glucose and fructose. Sequence domain analysis showed that PalI contains an alpha-amylase domain and (beta/alpha)(8)-barrel structures, suggesting that it belongs to the alpha-amylase family. Sequence alignment indicated that the five amino acid residues of catalytic importance in alpha-amylases and glucosyltransferases (Asp(241), Glu(295), Asp(369), His(145), and His(368)) are conserved in PalI. Purified recombinant PalI displayed high catalytic efficiency, with a Km of 54.6 +/- 1.7 mM for sucrose, and maximum activity (approximately 328.0 +/- 2.5 U/mg) at pH 6.0 and 35 degrees C. PalI activity was strongly inhibited by Fe3+ and Hg2+ and was enhanced by Mn2+ and Mg2+. The half-life of PalI was 1.8 min at 50 degrees C. Replacement of selected amino acid residues by proline significantly increased the thermostability of PalI. Simultaneous replacement of Glu(498) and Arg(310) with proline resulted in an 11-fold increase in the half-life of PalI at 50 degrees C.

  14. [Cloning and bioinformatics analysis of ent-kaurene oxidase synthase gene in Salvia miltiorrhiza].

    PubMed

    Hu, Ya-ting; Gao, Wei; Liu, Yu-jia; Cheng, Qi-qing; Su, Ping; Liu, Yu-zhong; Chen, Min

    2014-11-01

    Based on the transcriptome database of Salvia miltiorrhiza, specific primers were designed to clone a full-length cDNA of ent-kaurene oxidase synthase (SmKOL) using the RACE strategy. ORF Finder was used to find the open reading frame of SmKOL cDNA, and ClustalW has been performed to analysis the multiple amino acid sequence alignment. Phylogenetic tree has been constructed using MEGA 5.1. The transcription level of SmKOL from the hairy roots induced by elicitor methyl jasmonate (MeJA) was qualifiedby real-time quantitative PCR. The full length of SmKOL cDNA was of 1 884 bp nucleotides encoding 519 amino acids. The molecular weight of the SmKOL protein was about 58.88 kDa with isoelectric point (pI) of 7.62. Results of real-time quantitative PCR analyses indicated that the level of SmKOL mRNA expression in hairy roots was increased by elicitor oMeJA, and reached maximum in 36 h. The full-length cDNA of SmKOL was cloned from S. miltiorrhiza hairy root, which provides a target gene for further studies of its function, gibberellin biosynthesis and regulation of secondary metabolites.

  15. Novel terpenes generated by heterologous expression of bacterial terpene synthase genes in an engineered Streptomyces host.

    PubMed

    Yamada, Yuuki; Arima, Shiho; Nagamitsu, Tohru; Johmoto, Kohei; Uekusa, Hidehiro; Eguchi, Tadashi; Shin-ya, Kazuo; Cane, David E; Ikeda, Haruo

    2015-06-01

    Mining of bacterial genome data has revealed numerous presumptive terpene synthases. Heterologous expression of several putative terpene synthase genes in an engineered Streptomyces host has revealed 13 newly discovered terpenes whose GC-MS and NMR data did not match with any known compounds in spectroscopic databases. Each of the genes encoding the corresponding terpene synthases were silent in their parent microorganisms. Heterologous expression and detailed NMR spectroscopic analysis allowed assignment of the structures of 13 new cyclic terpenes. Among these newly identified compounds, two were found to be linear triquinane sesquiterpenes that have never previously been isolated from bacteria or any other source. The remaining 11 new compounds were shown to be diterpene hydrocarbons and alcohol, including hydropyrene (1), hydropyrenol (2), tsukubadiene (11) and odyverdienes A (12) and B (13) each displaying a novel diterpene skeleton that had not previously been reported.

  16. Genes encoding norcoclaurine synthase occur as tandem fusions in the Papaveraceae

    PubMed Central

    Li, Jing; Lee, Eun-Jeong; Chang, Limei; Facchini, Peter J.

    2016-01-01

    Norcoclaurine synthase (NCS) catalyzes the enantioselective Pictet-Spengler condensation of dopamine and 4-hydroxyphenylacetaldehyde as the first step in benzylisoquinoline alkaloid (BIA) biosynthesis. NCS orthologs in available transcriptome databases were screened for variants that might improve the low yield of BIAs in engineered microorganisms. Databases for 21 BIA-producing species from four plant families yielded 33 assembled contigs with homology to characterized NCS genes. Predicted translation products generated from nine contigs consisted of two to five sequential repeats, each containing most of the sequence found in single-domain enzymes. Assembled contigs containing tandem domain repeats were detected only in members of the Papaveraceae family, including opium poppy (Papaver somniferum). Fourteen cDNAs were generated from 10 species, five of which encoded NCS orthologs with repeated domains. Functional analysis of corresponding recombinant proteins yielded six active NCS enzymes, including four containing either two, three or four repeated catalytic domains. Truncation of the first 25 N-terminal amino acids from the remaining polypeptides revealed two additional enzymes. Multiple catalytic domains correlated with a proportional increase in catalytic efficiency. Expression of NCS genes in Saccharomyces cereviseae also produced active enzymes. The metabolic conversion capacity of engineered yeast positively correlated with the number of repeated domains. PMID:27991536

  17. Genes encoding norcoclaurine synthase occur as tandem fusions in the Papaveraceae.

    PubMed

    Li, Jing; Lee, Eun-Jeong; Chang, Limei; Facchini, Peter J

    2016-12-19

    Norcoclaurine synthase (NCS) catalyzes the enantioselective Pictet-Spengler condensation of dopamine and 4-hydroxyphenylacetaldehyde as the first step in benzylisoquinoline alkaloid (BIA) biosynthesis. NCS orthologs in available transcriptome databases were screened for variants that might improve the low yield of BIAs in engineered microorganisms. Databases for 21 BIA-producing species from four plant families yielded 33 assembled contigs with homology to characterized NCS genes. Predicted translation products generated from nine contigs consisted of two to five sequential repeats, each containing most of the sequence found in single-domain enzymes. Assembled contigs containing tandem domain repeats were detected only in members of the Papaveraceae family, including opium poppy (Papaver somniferum). Fourteen cDNAs were generated from 10 species, five of which encoded NCS orthologs with repeated domains. Functional analysis of corresponding recombinant proteins yielded six active NCS enzymes, including four containing either two, three or four repeated catalytic domains. Truncation of the first 25 N-terminal amino acids from the remaining polypeptides revealed two additional enzymes. Multiple catalytic domains correlated with a proportional increase in catalytic efficiency. Expression of NCS genes in Saccharomyces cereviseae also produced active enzymes. The metabolic conversion capacity of engineered yeast positively correlated with the number of repeated domains.

  18. A Sorangium cellulosum (myxobacterium) gene cluster for the biosynthesis of the macrolide antibiotic soraphen A: cloning, characterization, and homology to polyketide synthase genes from actinomycetes.

    PubMed Central

    Schupp, T; Toupet, C; Cluzel, B; Neff, S; Hill, S; Beck, J J; Ligon, J M

    1995-01-01

    A 40-kb region of DNA from Sorangium cellulosum So ce26, which contains polyketide synthase (PKS) genes for synthesis of the antifungal macrolide antibiotic soraphen A, was cloned. These genes were detected by homology to Streptomyces violaceoruber genes encoding components of granaticin PKS, thus extending this powerful technique for the identification of bacterial PKS genes, which has so far been applied only to actinomycetes, to the gram-negative myxobacteria. Functional analysis by gene disruption has indicated that about 32 kb of contiguous DNA of the cloned region contains genes involved in soraphen A biosynthesis. The nucleotide sequence of a 6.4-kb DNA fragment, derived from the region with homology to granaticin PKS genes, was determined. Analysis of this sequence has revealed the presence of a single large open reading frame beginning and ending outside the 6.4-kb fragment. The deduced amino acid sequence indicates the presence of a domain with a high level of similarity to beta-ketoacyl synthases that are involved in polyketide synthesis. Other domains with high levels of similarity to regions of known polyketide biosynthetic functions were identified, including those for acyl transferase, acyl carrier protein, ketoreductase, and dehydratase. We present data which indicate that soraphen A biosynthesis is catalyzed by large, multifunctional enzymes analogous to other bacterial PKSs of type I. PMID:7601830

  19. Inhibition of spermidine synthase gene expression by transforming growth factor-beta 1 in hepatoma cells.

    PubMed Central

    Nishikawa, Y; Kar, S; Wiest, L; Pegg, A E; Carr, B I

    1997-01-01

    We screened genes responsive to transforming growth factor-beta (TGF-beta 1) protein in a human hepatoma cell line (Hep3B) using a PCR-mediated differential display technique, in order to investigate the mechanisms involved in TGF-beta-induced growth suppression. We found a gene that was down-regulated by TGF-beta 1 to be completely identical in an approx. 620 bp segment to the gene for the enzyme spermidine synthase, which mediates the conversion of putrescine into spermidine. Both spermidine synthase mRNA expression and its enzyme activity were decreased after TGF-beta 1 treatment of Hep3B cells. The inhibition of spermidine synthase gene expression by TGF-beta 1 protein was also observed in other hepatoma cell lines. The expression of genes for other biosynthetic enzymes in polyamine metabolism (ornithine decarboxylase and S-adenosylmethionine decarboxylase) was also inhibited to the same extent as for spermidine synthase, while the gene expression of spermidine/spermine N1-acetyltransferase, a catabolic enzyme, was relatively resistant to TGF-beta 1. Spermine levels in Hep3B cells were decreased by TGF-beta 1 treatment, although the levels of spermidine and putrescine were unchanged, probably due to compensation by remaining spermidine/spermine N1-acetyltransferase activity. Exogenously added spermidine or spermine, but not putrescine, partially antagonized the growth-inhibitor effects of TGF-beta 1 on Hep3B cells. Our data suggest that down-regulation of gene expression of the enzymes involved in polyamine metabolism, including spermidine synthase, may be associated with the mechanism of TGF-beta-induced growth suppression. PMID:9020892

  20. [Identification and characterization of intraspecific variability of the sucrose synthase gene Sus4 of potato (Solanum tuberosum)].

    PubMed

    Boris, K V; Ryzhova, N N; Kochieva, E Z

    2011-02-01

    Nucleotide and amino acid variability of fragments of the Sus4 gene encoding the sucrose synthase enzyme was studied in 24 potato cultivars selected in Russia and other countries and differing in starch content in tubers. Both SNPs and indels were detected in a chosen Sus4 gene fragment including the sequence from exon 3 to exon 6 and corresponding to the main part of the sucrose synthase domain. Four types of Sus4 sequences were revealed depending on the presence of an insertion in introns 4 and 5 and of the mononucleotide octamer (T)8 in intron 5. Differentiation of these sequences was confirmed by statistical methods. Sixteen amino acid substitutions were identified in the translated sequence, of which eleven were nonsynonymous. Specific varietal nucleotide and amino acid substitutions were also revealed, which can be used in future for marking potato cultivars/genotypes. No direct associations between the mutational changes and the starch content were found in the potato cultivars studied by us.

  1. Oncogene KRAS activates fatty acid synthase, resulting in specific ERK and lipid signatures associated with lung adenocarcinoma.

    PubMed

    Gouw, Arvin M; Eberlin, Livia S; Margulis, Katherine; Sullivan, Delaney K; Toal, Georgia G; Tong, Ling; Zare, Richard N; Felsher, Dean W

    2017-04-11

    KRAS gene mutation causes lung adenocarcinoma. KRAS activation has been associated with altered glucose and glutamine metabolism. Here, we show that KRAS activates lipogenesis, and this activation results in distinct proteomic and lipid signatures. By gene expression analysis, KRAS is shown to be associated with a lipogenesis gene signature and specific induction of fatty acid synthase (FASN). Through desorption electrospray ionization MS imaging (DESI-MSI), specific changes in lipogenesis and specific lipids are identified. By the nanoimmunoassay (NIA), KRAS is found to activate the protein ERK2, whereas ERK1 activation is found in non-KRAS-associated human lung tumors. The inhibition of FASN by cerulenin, a small molecule antibiotic, blocked cellular proliferation of KRAS-associated lung cancer cells. Hence, KRAS is associated with activation of ERK2, induction of FASN, and promotion of lipogenesis. FASN may be a unique target for KRAS-associated lung adenocarcinoma remediation.

  2. Tissue Localization of a Submergence-Induced 1-Aminocyclopropane-1-Carboxylic Acid Synthase in Rice1

    PubMed Central

    Zhou, Zhongyi; de Almeida Engler, Janice; Rouan, Dominique; Michiels, Frank; Van Montagu, Marc; Van Der Straeten, Dominique

    2002-01-01

    At least two 1-aminocyclopropane-1-carboxylic acid synthase genes (ACS) are implicated in the submergence response of rice (Oryza sativa). Previously, the OS-ACS5 gene has been shown to be induced during short- as well as long-term complete submergence of seedlings and to be controlled by a balance of gibberellin and abscisic acid in both lowland and deepwater rice. This study demonstrates that OS-ACS5 mRNA is localized in specific tissues and cells both during normal development and in response to complete submergence. The temporal and spatial regulation of OS-ACS5 expression is presented by in situ hybridization and histochemical analysis of β-glucuronidase (GUS) activity in transgenic rice carrying an OS-ACS5-gus fusion. Whole-mount in situ hybridization revealed that in air-grown rice seedlings, OS-ACS5 was expressed at a low level in the shoot apex, meristems, leaf, and adventitious root primordia, and in vascular tissues of nonelongated stems and leaf sheaths. In response to complete submergence, the expression in vascular bundles of young stems and leaf sheaths was strongly induced. The results of histochemical GUS assays were consistent with those found by whole-mount in situ hybridization. Our findings suggest that OS-ACS5 plays a role in vegetative growth of rice under normal conditions and is also recruited for enhanced growth upon complete submergence. The possible implication of OS-ACS5 in root-shoot communication during submergence stress and its putative role in aerenchyma formation upon low-oxygen stress are discussed. PMID:12011339

  3. Gene Deletion of 7,8-Linoleate Diol Synthase of the Rice Blast Fungus

    PubMed Central

    Jernerén, Fredrik; Sesma, Ane; Francheschetti, Marina; Hamberg, Mats; Oliw, Ernst H.

    2010-01-01

    Linoleate diol synthases (LDS) are heme enzymes, which oxygenate 18:2n-6 sequentially to (8R)-hydroperoxylinoleic acid ((8R)-HPODE) and to (5S,8R)-dihydroxy-, (7S,8S)-dihydroxy-, or (8R,11S)-dihydroxylinoleic acids (DiHODE). The genome of the rice blast fungus, Magnaporthe oryzae, contains two genes with homology to LDS. M. oryzae oxidized 18:2n-6 to (8R)-HPODE and to (7S,8S)-DiHODE, (6S,8R)-DiHODE, and (8R,11S)-HODE. Small amounts of 10-hydroxy-(8E,12Z)-octadecadienoic acid and traces of 5,8-DiHODE were also detected by liquid chromatography-mass spectrometry. The contribution of the 7,8-LDS gene to M. oryzae pathogenicity was evaluated by replacement of the catalytic domain with hygromycin and green fluorescent protein variant (SGFP) cassettes. This genetically modified strain Δ7,8-LDS infected rice leaves and roots and formed appressoria and conidia as the native fungus. The Δ7,8-LDS mutant had lost the capacity to biosynthesize all the metabolites except small amounts of 8-hydroxylinoleic acid. Studies with stereospecifically deuterated linoleic acids showed that (8R)-HPODE was formed by abstraction of the pro-S hydrogen at C-8 and antarafacial oxygenation, whereas (7S,8S)-DiHODE and (8R,11S)-DiHODE were formed from (8R)-HPODE by suprafacial hydrogen abstraction and oxygenation at C-7 and C-11, respectively. A mac1 suppressor mutant (Δmac1 sum1–99) of M. oryzae, which shows cAMP-independent protein kinase A activity, oxygenated 18:2n-6 to increased amounts of (10R)-HPODE and (5S,8R)-DiHODE. Expression of the 7,8-LDS gene but not of the second homologue was detected in the suppressor mutant. This suggests that PKA-mediated signaling pathway regulates the dioxygenase and hydroperoxide isomerase activities of M. oryzae. PMID:20023302

  4. Recent Progress on the Construction and Testing of a Fusion Poly(hydroxyalkanoate) Synthase Gene

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Poly(hydroxyalkanoates) (PHAs) are biodegradable polyesters produced by some bacteria. Two genes in Allochromatium vinosum, phaE and phaC, respectively code for the two subunits of the enzyme complex, PHA synthase, which catalyzes the polymerization of precursors into PHA. We hypothesized that by ...

  5. Molecular and phylogenetic characterization of the homoeologous EPSP Synthase genes of allohexaploid wheat, Triticum aestivum (L.)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: 5-Enolpyruvylshikimate-3-phosphate synthase (EPSPS) is the sixth and penultimate enzyme in the shikimate biosynthesis pathway. The EPSPS genes of allohexaploid wheat (Triticum aestivum, AABBDD) have not been well characterized. Herein, the three homoeologous copies of the wheat EPSPS gen...

  6. Strengthening Triterpene Saponins Biosynthesis by Over-Expression of Farnesyl Pyrophosphate Synthase Gene and RNA Interference of Cycloartenol Synthase Gene in Panax notoginseng Cells.

    PubMed

    Yang, Yan; Ge, Feng; Sun, Ying; Liu, Diqiu; Chen, Chaoyin

    2017-04-05

    To conform to the multiple regulations of triterpene biosynthesis, the gene encoding farnesyl pyrophosphate synthase (FPS) was transformed into Panax notoginseng (P. notoginseng) cells in which RNA interference (RNAi) of the cycloartenol synthase (CAS) gene had been accomplished. Transgenic cell lines showed both higher expression levels of FPS and lower expression levels of CAS compared to the wild-type (WT) cells. In the triterpene and phytosterol analysis, transgenic cell lines provided a higher accumulation of total triterpene saponins, and a lower amount of phytosterols in comparison with the WT cells. Compared with the cells in which RNAi of the CAS gene was achieved, the cells with simultaneously over-expressed FPS and silenced CAS showed higher triterpene contents. These results demonstrate that over-expression of FPS can break the rate-limiting reaction catalyzed by FPS in the triterpene saponins biosynthetic pathway; and inhibition of CAS expression can decrease the synthesis metabolic flux of the phytosterol branch. Thus, more precursors flow in the direction of triterpene synthesis, and ultimately promote the accumulation of P. notoginseng saponins. Meanwhile, silencing and over-expressing key enzyme genes simultaneously is more effective than just manipulating one gene in the regulation of saponin biosynthesis.

  7. Apoptotic effect of tannic acid on fatty acid synthase over-expressed human breast cancer cells.

    PubMed

    Nie, Fangyuan; Liang, Yan; Jiang, Bing; Li, Xiabing; Xun, Hang; He, Wei; Lau, Hay Tong; Ma, Xiaofeng

    2016-02-01

    Breast cancer is one of the most common cancers and is the second leading cause of cancer mortality in women worldwide. Novel therapies and chemo-therapeutic drugs are urgently needed to be developed for the treatment of breast cancer. Increasing evidence suggests that fatty acid synthase (FAS) plays an important role in breast cancer, for the expression of FAS is significantly higher in human breast cancer cells than in normal cells. Tannic acid (TA), a natural polyphenol, possesses significant biological functions, including bacteriostasis, hemostasis, and anti-oxidant. Our previous studies demonstrated that TA is a natural FAS inhibitor whose inhibitory activity is stronger than that of classical FAS inhibitors, such as C75 and cerulenin. This study further assessed the effect and therapeutic potential of TA on FAS over-expressed breast cancer cells, and as a result, TA had been proven to possess the functions of inhibiting intracellular FAS activity, down-regulating FAS expression in human breast cancer MDA-MB-231 and MCF-7 cells, and inducing cancer cell apoptosis. Since high-expressed FAS is recognized as a molecular marker for breast cancer and plays an important role in cancer prognosis, these findings suggest that TA is a potential drug candidate for treatment of breast cancer.

  8. {alpha}-Lipoic acid prevents lipotoxic cardiomyopathy in acyl CoA-synthase transgenic mice

    SciTech Connect

    Lee, Young; Naseem, R. Haris; Park, Byung-Hyun; Garry, Daniel J.; Richardson, James A.; Schaffer, Jean E.; Unger, Roger H. . E-mail: roger.unger@utsouthwestern.edu

    2006-05-26

    {alpha}-Lipoic acid ({alpha}-LA) mimics the hypothalamic actions of leptin on food intake, energy expenditure, and activation of AMP-activated protein kinase (AMPK). To determine if, like leptin, {alpha}-LA protects against cardiac lipotoxicity, {alpha}-LA was fed to transgenic mice with cardiomyocyte-specific overexpression of the acyl CoA synthase (ACS) gene. Untreated ACS-transgenic mice died prematurely with increased triacylglycerol content and dilated cardiomyopathy, impaired systolic function and myofiber disorganization, apoptosis, and interstitial fibrosis on microscopy. In {alpha}-LA-treated ACS-transgenic mice heart size, echocardiogram and TG content were normal. Plasma TG fell 50%, hepatic-activated phospho-AMPK rose 6-fold, sterol regulatory element-binding protein-1c declined 50%, and peroxisome proliferator-activated receptor-{gamma} cofactor-1{alpha} mRNA rose 4-fold. Since food restriction did not prevent lipotoxicity, we conclude that {alpha}-LA treatment, like hyperleptinemia, protects the heart of ACS-transgenic mice from lipotoxicity.

  9. Biphasic modulation of fatty acid synthase by hydrogen peroxide in Saccharomyces cerevisiae.

    PubMed

    Matias, Ana C; Marinho, H Susana; Cyrne, Luísa; Herrero, Enrique; Antunes, Fernando

    2011-11-01

    Taking into account published contradictory results concerning the regulation of fatty acid synthase (Fas) by H(2)O(2), we carried out a systematic study where two methods of H(2)O(2) delivery (steady-state and bolus addition) and the effect of a wide range of H(2)O(2) concentrations were investigated. A decrease in Fas activity was observed for cells exposed to 100 and 150μM H(2)O(2) in a steady-state, while a bolus addition of the same H(2)O(2) concentrations did not alter Fas activity. Similar results were observed for the mRNA levels of FAS1, the gene that encodes Fas subunit β. However, the exposure to a steady-state 50μM H(2)O(2) dose lead to an increase in FAS1 mRNA levels, showing a biphasic modulation of Fas by H(2)O(2). The results obtained emphasize that cellular effects of H(2)O(2) can vary over a narrow range of concentrations. Therefore, a tight control of H(2)O(2) exposure, which can be achieved by exposing H(2)O(2) in a steady-state, is important for cellular studies of H(2)O(2)-dependent redox regulation.

  10. Induction of isoprenyl diphosphate synthases, plant hormones and defense signalling genes correlates with traumatic resin duct formation in Norway spruce (Picea abies).

    PubMed

    Schmidt, Axel; Nagel, Raimund; Krekling, Trygve; Christiansen, Erik; Gershenzon, Jonathan; Krokene, Paal

    2011-12-01

    Norway spruce (Picea abies) defends itself against herbivores and pathogens by formation of traumatic resin ducts filled with terpenoid-based oleoresin. An important group of enzymes in terpenoid biosynthesis are the short-chain isoprenyl diphosphate synthases which produce geranyl diphosphate (C(10)), farnesyl diphosphate (C(15)), and geranylgeranyl diphosphate (C(20)) as precursors of monoterpenes, sesquiterpenes, and diterpene resin acids, respectively. After treatment with methyl jasmonate (MJ) we investigated the expression of all isoprenyl diphosphate synthase genes characterized to date from Norway spruce and correlated this with formation of traumatic resin ducts and terpene accumulation. Formation of traumatic resin ducts correlated with higher amounts of monoterpenes, sesquiterpenes and diterpene resin acids and an upregulation of isoprenyl diphosphate synthase genes producing geranyl diphosphate or geranylgeranyl diphosphate. Among defense hormones, jasmonate and jasmonate-isoleucine conjugate accumulated to higher levels in trees with extensive traumatic resin duct formation, whereas salicylate did not. Jasmonate and ethylene are likely to both be involved in formation of traumatic resin ducts based on elevated transcripts of genes encoding lipoxygenase and 1-aminocyclopropane-1-carboxylic acid oxidase associated with resin duct formation. Other genes involved in defense signalling in other systems, mitogen-activated protein kinase3 and nonexpressor of pathogenesis-related gene1, were also associated with traumatic resin duct formation. These responses were detected not only at the site of MJ treatment, but also systemically up to 60 cm above the site of treatment on the trunk.

  11. Inhibitors of Fatty Acid Synthase for Prostate Cancer

    DTIC Science & Technology

    2010-05-31

    targeting. Ursolic acid, a pentacyclic triterpenoid acid, as well as the tea polyphenols, epigallocatechin gallate (EGCG) and epicatechin gallate...glucose  utilization:  theory,  procedure,  and  normal  values  in  the  conscious  and  anesthetized  albino  rat. J Neurochem, 1977,  28(5), 897‐916

  12. The CTB1 gene encoding a fungal polyketide synthase is required for cercosporin biosynthesis and fungal virulence of Cercospora nicotianae.

    PubMed

    Choquer, Mathias; Dekkers, Katherine L; Chen, Hui-Qin; Cao, Lihua; Ueng, Peter P; Daub, Margaret E; Chung, Kuang-Ren

    2005-05-01

    Cercosporin is a light-activated, non-host-selective toxin produced by many Cercospora fungal species. In this study, a polyketide synthase gene (CTB1) was functionally identified and molecularly characterized to play a key role in cercosporin biosynthesis by Cercospora nicotianae. We also provide conclusive evidence to confirm the crucial role of cercosporin in fungal pathogenesis. CTB1 encoded a polypeptide with a deduced length of 2,196 amino acids containing a keto synthase (KS), an acyltransferase (AT), a thioesterase/claisen cyclase (TE/CYC), and two acyl carrier protein (ACP) domains, and had high levels of similarity to many fungal type I polyketide synthases. Expression of a 6.8-kb CTB1 transcript was highly regulated by light and medium composition, consistent with the conditions required for cercosporin biosynthesis in cultures. Targeted disruption of CTB1 resulted in the loss of both CTB1 transcript and cercosporin biosynthesis in C. nicotianae. The ctb1-null mutants incited fewer necrotic lesions on inoculated tobacco leaves compared with the wild type. Complementation of ctb1-null mutants with a full-length CTB1 clone restored wild-type levels of cercosporin production as well as the ability to induce lesions on tobacco. Thus, we have demonstrated conclusively that cercosporin is synthesized via a polyketide pathway, and cercosporin is an important virulence factor in C. nicotianae. The results also suggest that strategies that avoid the toxicity of cercosporin will be useful in reduction of disease incidence caused by Cercospora spp.

  13. Paradoxical performance of tryptophan synthase gene trp1 (+) in transformations of the basidiomycete Coprinopsis cinerea.

    PubMed

    Dörnte, Bastian; Kües, Ursula

    2016-10-01

    Several transformation strains of Coprinopsis cinerea carry the defective tryptophan synthase allele trp1-1,1-6 which can be complemented by introduction of the trp1 (+) wild-type gene. Regularly in C. cinerea, single-trp1 (+)-vector transformations yield about half the numbers of clones than cotransformations with a non-trp1 (+)-plasmid done in parallel. The effect is also observed with the orthologous Schizophyllum commune trpB (+) gene shown here to function as a selection marker in C. cinerea. Parts of single-trp1 (+) - or single-trpB (+) -vector transformants are apparently lost. This paradoxical phenomenon relates to de-regulation of aromatic amino acid biosynthesis pathways. Adding tryptophan precursors to protoplast regeneration agar or feeding with other aromatic amino acids increases loss of single-trp1 (+)-vector transformants and also sets off loss of clones in cotransformation with a non-trp1 (+)-plasmid. Feedback control by tryptophan and cross-pathway control by tyrosine and phenylalanine are both active in the process. We deduce from the observations that more cotransformants than single-vector transformants are obtained by in average less disturbance of the tryptophan biosynthesis pathway. DNA in C. cinerea transformation usually integrates into the genome at multiple ectopic places. Integration events for a single vector per nucleus should statistically be 2-fold higher in single-vector transformations than in cotransformations in which the two different molecules compete for the same potential integration sites. Integration of more trp1 (+) copies into the genome might more likely lead to sudden tryptophan overproduction with subsequent rigid shut-down of the pathway. Blocking ectopic DNA integration in a Δku70 mutant abolished the effect of doubling clone numbers in cotransformations due to preferred single trp1 (+) integration by homologous recombination at its native genomic site.

  14. Crystallization of Δ{sup 1}-tetrahydrocannabinolic acid (THCA) synthase from Cannabis sativa

    SciTech Connect

    Shoyama, Yoshinari; Takeuchi, Ayako; Taura, Futoshi; Tamada, Taro; Adachi, Motoyasu; Kuroki, Ryota; Shoyama, Yukihiro; Morimoto, Satoshi

    2005-08-01

    Δ{sup 1}-Tetrahydrocannabinolic acid (THCA) synthase from C. sativa was crystallized. The crystal diffracted to 2.7 Å resolution with sufficient quality for further structure determination. Δ{sup 1}-Tetrahydrocannabinolic acid (THCA) synthase is a novel oxidoreductase that catalyzes the biosynthesis of the psychoactive compound THCA in Cannabis sativa (Mexican strain). In order to investigate the structure–function relationship of THCA synthase, this enzyme was overproduced in insect cells, purified and finally crystallized in 0.1 M HEPES buffer pH 7.5 containing 1.4 M sodium citrate. A single crystal suitable for X-ray diffraction measurement was obtained in 0.09 M HEPES buffer pH 7.5 containing 1.26 M sodium citrate. The crystal diffracted to 2.7 Å resolution at beamline BL41XU, SPring-8. The crystal belonged to the primitive cubic space group P432, with unit-cell parameters a = b = c = 178.2 Å. The calculated Matthews coefficient was approximately 4.1 or 2.0 Å{sup 3} Da{sup −1} assuming the presence of one or two molecules of THCA synthase in the asymmetric unit, respectively.

  15. Morphology engineering of Penicillium chrysogenum by RNA silencing of chitin synthase gene.

    PubMed

    Liu, Hui; Wang, Peng; Gong, Guohong; Wang, Li; Zhao, Genhai; Zheng, Zhiming

    2013-03-01

    Chitin synthases, that catalyze the formation of chitin the major component of cell walls in most filamentous fungi, play crucial roles in the growth and morphogenesis. To investigate the roles of chitin synthase in Penicillium chrysogenum, we developed an RNAi system to silence the class III chitin synthase gene chs4. After transformation, mutants had a slow growth rate and shorter but highly branched hyphae. All transformants either were unable to form conidia or could form only a few. Changes in chs4 expression could lead to a completely different morphology and eventually cause distinct penicillin yields. In particular, the yield of one transformant was 41 % higher than that of the original strain.

  16. EXPRESSION OF THE GEOSMIN SYNTHASE GENE IN THE CYANOBACTERIUM ANABAENA CIRCINALIS AWQC318(1).

    PubMed

    Giglio, Steven; Saint, Christopher P; Monis, Paul T

    2011-12-01

    The occurrence of taste and odor episodes attributed to geosmin continues to trouble water utilities worldwide, and only recently have advances been made in our fundamental understanding of the biochemical and genetic mechanisms responsible for the production of geosmin in microorganisms. For the first time, we have examined the expression of the geosmin synthase gene and corresponding geosmin production by Anabaena circinalis Rabenh. ex Bornet et Flahault AWQC318 under conditions of continuous light illumination and the removal of light as a stimulus and demonstrate that the expression of geosmin synthase appears to be constitutive under these conditions. The decrease in geosmin synthase transcription post maximum cell numbers and stationary phase suggests that a decrease in isoprenoid synthesis may occur before a decrease in the transcription of ribosomal units as the process of cell death is initiated.

  17. Molecular cloning and functional expression analysis of a new gene encoding geranylgeranyl diphosphate synthase from hazel (Corylus avellana L. Gasaway).

    PubMed

    Wang, Yechun; Miao, Zhiqi; Tang, Kexuan

    2010-10-01

    Geranylgeranyl diphosphate synthase (GGPPS) [EC 2.5.1.29] catalyzes the biosynthesis of geranylgeranyl diphosphate (GGPP), which is a key precursor for diterpenes such as taxol. Herein, a full-length cDNA encoding GGPPS (designated as CgGGPPS) was cloned and characterized from hazel (Corylus avellana L. Gasaway), a taxol-producing angiosperms. The full-length cDNA of CgGGPPS was 1515 bp with a 1122 bp open reading frame (ORF) encoding a 373 amino acid polypeptide. The CgGGPPS genomic DNA sequence was also obtained, revealing CgGGPPS gene was not interrupted by an intron. Southern blot analysis indicated that CgGGPPS belonged to a small gene family. Tissue expression pattern analysis indicated that CgGGPPS expressed the highest in leaves. RT-PCR analysis indicated that CgGGPPS expression could be induced by exogenous methyl jasmonate acid. Furthermore, carotenoid accumulation was observed in Escherichia coli carrying pACCAR25ΔcrtE plasmid carrying CgGGPPS. The result revealed that cDNA encoded a functional GGPP synthase.

  18. Coexpressing Escherichia coli Cyclopropane Synthase with Sterculia foetida Lysophosphatidic Acid Acyltransferase Enhances Cyclopropane Fatty Acid Accumulation1[W][OPEN

    PubMed Central

    Yu, Xiao-Hong; Prakash, Richa Rawat; Sweet, Marie; Shanklin, John

    2014-01-01

    Cyclopropane fatty acids (CPAs) are desirable as renewable chemical feedstocks for the production of paints, plastics, and lubricants. Toward our goal of creating a CPA-accumulating crop, we expressed nine higher plant cyclopropane synthase (CPS) enzymes in the seeds of fad2fae1 Arabidopsis (Arabidopsis thaliana) and observed accumulation of less than 1% CPA. Surprisingly, expression of the Escherichia coli CPS gene resulted in the accumulation of up to 9.1% CPA in the seed. Coexpression of a Sterculia foetida lysophosphatidic acid acyltransferase (SfLPAT) increases CPA accumulation up to 35% in individual T1 seeds. However, seeds with more than 9% CPA exhibit wrinkled seed morphology and reduced size and oil accumulation. Seeds with more than 11% CPA exhibit strongly decreased seed germination and establishment, and no seeds with CPA more than 15% germinated. That previous reports suggest that plant CPS prefers the stereospecific numbering (sn)-1 position whereas E. coli CPS acts on sn-2 of phospholipids prompted us to investigate the preferred positions of CPS on phosphatidylcholine (PC) and triacylglycerol. Unexpectedly, in planta, E. coli CPS acts primarily on the sn-1 position of PC; coexpression of SfLPAT results in the incorporation of CPA at the sn-2 position of lysophosphatidic acid. This enables a cycle that enriches CPA at both sn-1 and sn-2 positions of PC and results in increased accumulation of CPA. These data provide proof of principle that CPA can accumulate to high levels in transgenic seeds and sets the stage for the identification of factors that will facilitate the movement of CPA from PC into triacylglycerol to produce viable seeds with additional CPA accumulation. PMID:24204024

  19. Tolerance to toxic metals by a gene family of phytochelatin synthases from plants and yeast.

    PubMed Central

    Clemens, S; Kim, E J; Neumann, D; Schroeder, J I

    1999-01-01

    Phytochelatins play major roles in metal detoxification in plants and fungi. However, genes encoding phytochelatin synthases have not yet been identified. By screening for plant genes mediating metal tolerance we identified a wheat cDNA, TaPCS1, whose expression in Saccharomyces cerevisiae results in a dramatic increase in cadmium tolerance. TaPCS1 encodes a protein of approximately 55 kDa with no similarity to proteins of known function. We identified homologs of this new gene family from Arabidopsis thaliana, Schizosaccharomyces pombe, and interestingly also Caenorhabditis elegans. The Arabidopsis and S.pombe genes were also demonstrated to confer substantial increases in metal tolerance in yeast. PCS-expressing cells accumulate more Cd2+ than controls. PCS expression mediates Cd2+ tolerance even in yeast mutants that are either deficient in vacuolar acidification or impaired in vacuolar biogenesis. PCS-induced metal resistance is lost upon exposure to an inhibitor of glutathione biosynthesis, a process necessary for phytochelatin formation. Schizosaccharomyces pombe cells disrupted in the PCS gene exhibit hypersensitivity to Cd2+ and Cu2+ and are unable to synthesize phytochelatins upon Cd2+ exposure as determined by HPLC analysis. Saccharomyces cerevisiae cells expressing PCS produce phytochelatins. Moreover, the recombinant purified S.pombe PCS protein displays phytochelatin synthase activity. These data demonstrate that PCS genes encode phytochelatin synthases and mediate metal detoxification in eukaryotes. PMID:10369673

  20. Alternative splicing and gene duplication differentially shaped the regulation of isochorismate synthase in Populus and Arabidopsis

    PubMed Central

    Yuan, Yinan; Chung, Jeng-Der; Fu, Xueyan; Johnson, Virgil E.; Ranjan, Priya; Booth, Sarah L.; Harding, Scott A.; Tsai, Chung-Jui

    2009-01-01

    Isochorismate synthase (ICS) converts chorismate to isochorismate for the biosynthesis of phylloquinone, an essential cofactor for photosynthetic electron transport. ICS is also required for salicylic acid (SA) synthesis during Arabidopsis defense. In several other species, including Populus, SA is derived primarily from the phenylpropanoid pathway. We therefore sought to investigate ICS regulation in Populus to learn the extent of ICS involvement in SA synthesis and defense. Arabidopsis harbors duplicated AtICS genes that differ in their exon-intron structure, basal expression, and stress inducibility. In contrast, we found a single ICS gene in Populus and six other sequenced plant genomes, pointing to the AtICS duplication as a lineage-specific event. The Populus ICS encodes a functional plastidic enzyme, and was not responsive to stresses that stimulated phenylpropanoid accumulation. Populus ICS underwent extensive alternative splicing that was rare for the duplicated AtICSs. Sequencing of 184 RT-PCR Populus clones revealed 37 alternative splice variants, with normal transcripts representing ≈50% of the population. When expressed in Arabidopsis, Populus ICS again underwent alternative splicing, but did not produce normal transcripts to complement AtICS1 function. The splice-site sequences of Populus ICS are unusual, suggesting a causal link between junction sequence, alternative splicing, and ICS function. We propose that gene duplication and alternative splicing of ICS evolved independently in Arabidopsis and Populus in accordance with their distinct defense strategies. AtICS1 represents a divergent isoform for inducible SA synthesis during defense. Populus ICS primarily functions in phylloquinone biosynthesis, a process that can be sustained at low ICS transcript levels. PMID:19996170

  1. Identification and characterization of the Arabidopsis gene encoding the tetrapyrrole biosynthesis enzyme uroporphyrinogen III synthase.

    PubMed

    Tan, Fui-Ching; Cheng, Qi; Saha, Kaushik; Heinemann, Ilka U; Jahn, Martina; Jahn, Dieter; Smith, Alison G

    2008-03-01

    UROS (uroporphyrinogen III synthase; EC 4.2.1.75) is the enzyme responsible for the formation of uroporphyrinogen III, the precursor of all cellular tetrapyrroles including haem, chlorophyll and bilins. Although UROS genes have been cloned from many organisms, the level of sequence conservation between them is low, making sequence similarity searches difficult. As an alternative approach to identify the UROS gene from plants, we used functional complementation, since this does not require conservation of primary sequence. A mutant of Saccharomyces cerevisiae was constructed in which the HEM4 gene encoding UROS was deleted. This mutant was transformed with an Arabidopsis thaliana cDNA library in a yeast expression vector and two colonies were obtained that could grow in the absence of haem. The rescuing plasmids encoded an ORF (open reading frame) of 321 amino acids which, when subcloned into an Escherichia coli expression vector, was able to complement an E. coli hemD mutant defective in UROS. Final proof that the ORF encoded UROS came from the fact that the recombinant protein expressed with an N-terminal histidine-tag was found to have UROS activity. Comparison of the sequence of AtUROS (A. thaliana UROS) with the human enzyme found that the seven invariant residues previously identified were conserved, including three shown to be important for enzyme activity. Furthermore, a structure-based homology search of the protein database with AtUROS identified the human crystal structure. AtUROS has an N-terminal extension compared with orthologues from other organisms, suggesting that this might act as a targeting sequence. The precursor protein of 34 kDa translated in vitro was imported into isolated chloroplasts and processed to the mature size of 29 kDa. Confocal microscopy of plant cells transiently expressing a fusion protein of AtUROS with GFP (green fluorescent protein) confirmed that AtUROS was targeted exclusively to chloroplasts in vivo.

  2. Cloning of the Nocardia corallina polyhydroxyalkanoate synthase gene and production of poly-(3-hydroxybutyrate-co-3-hydroxyhexanoate) and poly-(3-hydroxyvalerate-co-3-hydroxyheptanoate).

    PubMed

    Hall, B; Baldwin, J; Rhie, H G; Dennis, D

    1998-07-01

    The polyhydroxyalkanoate (PHA) synthase gene (phaCNc) from Nocardia corallina was identified in a lambda library on a 6-kb BamHI fragment. A 2.8-kb XhoII subfragment was found to contain the intact PHA synthase. This 2.8-kb fragment was subjected to DNA sequencing and was found to contain the coding region for the PHA synthase and a small downstream open reading frame of unknown function. On the basis of DNA sequence, phaCNc is closest in homology to the PHA synthases (phaCPaI and phaCPaII) of Pseudomonas aeruginosa (approximately 41% identity and 55% similarity). The 2.8-kb XhoII fragment containing phaCNc was subcloned into broad host range mobilizable plasmids and transferred into Escherichia coli, Klebsiella aerogenes (both containing a plasmid bearing phaA and phaB from Ralstonia eutropha), and PHA-negative strains of R. eutropha and Pseudomonas putida. The recombinant strains were grown on various carbon sources and the resulting polymers were analyzed. In these strains, the PHA synthase from N. corallina was able to mediate the production of poly(3-hydroxybutyrate-co-3-hydroxyhexanoate) containing high levels of 3-hydroxyhexanoate when grown on hexanoate and larger even-chain fatty acids and poly(3-hydroxyvalerate-co-3-hydroxyheptanoate) containing high levels of 3-hydroxyheptanoate when grown on heptanoate or larger odd-chain fatty acids.

  3. Identification and expression of mutations in the hydroxymethylbilane synthase gene causing acute intermittent porphyria (AIP).

    PubMed Central

    Solis, C.; Lopez-Echaniz, I.; Sefarty-Graneda, D.; Astrin, K. H.; Desnick, R. J.

    1999-01-01

    BACKGROUND: Acute intermittent porphyria (AIP), an autosomal dominant inborn error, results from the half-normal activity of the heme biosynthetic enzyme hydroxymethylbilane synthase (EC 4.3.1.8; HMB-synthase). This disease is characterized by acute, life-threatening neurologic attacks that are precipitated by various drugs, hormones, and other factors. The enzymatic and/or biochemical diagnosis of AIP heterozygotes is problematic; therefore, efforts have focused on the identification of HMB-synthase mutations so that heterozygotes can be identified and educated to avoid the precipitating factors. In Spain, the occurrence of AIP has been reported, but the nature of the HMB-synthase mutations causing AIP in Spanish families has not been investigated. Molecular analysis was therefore undertaken in nine unrelated Spanish AIP patients. MATERIALS AND METHODS: Genomic DNA was isolated from affected probands and family members of nine unrelated Spanish families with AIP. The HMB-synthase gene was amplified by long-range PCR and the nucleotide sequence of each exon was determined by cycle sequencing. RESULTS: Three new mutations, a missense, M212V; a single base insertion, g4715insT; and a deletion/insertion, g7902ACT-->G, as well as five previously reported mutations (G111R, R116W, R149X R167W, and R173W) were detected in the Spanish probands. Expression of the novel missense mutation M212V in E. coli revealed that the mutation was causative, having <2% residual activity. CONCLUSIONS: These studies identified the first mutations in the HMB-synthase gene causing AIP in Spanish patients. Three of the mutations were novel, while five previously reported lesions were found in six Spanish families. These findings enable accurate identification and counseling of presymptomatic carriers in these nine unrelated Spanish AIP families and further demonstrate the genetic heterogeneity of mutations causing AIP. Images Fig. 1 PMID:10602775

  4. Analysis of genetic variability and relationships among Mentha L. using the limonene synthase gene, LS.

    PubMed

    Wang, Hai Tang; Yu, Xu; Liu, Yan; Liang, Cheng-Yuan; Li, Wei-Lin

    2013-07-25

    The genus Mentha comprises a group of aromatic plants with worldwide distribution. Because of frequent interspecific hybridization, the genetic relationships within the genus are not clearly understood. Limonene synthase, which catalyses the first committed step in the essential oil monoterpene biosynthetic pathway, is considered to be a possible rate limiting enzyme. With the homology-based cloning method, primers were designed according to cDNA sequence to amplify full-length DNA sequences in 13 Mentha samples from five species, using Perilla as an outgroup. Analyses of gene structure, length variation, GC-content, Ts/Tv ratio and evolutionary diversity were carried out. Consensus phylogenetic trees were obtained using maximum likelihood, neighbor-joining, and maximum parsimony, respectively, based on the full-length genomic DNA sequences, complete ORF coding sequences and predicted amino acid sequences. The results presented here based on the sequence of MhLS provide the first credibly supported genetic relationships for Mentha, which enables a basis for further mint taxonomy, cultivation and breeding.

  5. Molecular characterization and expression analyses of an anthocyanin synthase gene from Magnolia sprengeri Pamp.

    PubMed

    Shi, Shou-Guo; Li, Shan-Ju; Kang, Yong-Xiang; Liu, Jian-Jun

    2015-01-01

    Anthocyanin synthase (ANS), which catalyzes the conversion of colorless leucoanthocyanins into colored anthocyanins, is a key enzyme in the anthocyanin biosynthetic pathway. It plays important roles in plant development and defense. An ANS gene designated as MsANS was cloned from Magnolia sprengeri using rapid amplification of complementary DNA (cDNA) ends technology. The full-length MsANS is 1171-bp long and contains a 1080-bp open reading frame encoding a 360 amino acid polypeptide. In a sequence alignment analysis, the deduced MsANS protein showed high identity to ANS proteins from other plants: Prunus salicina var. cordata (74 % identity), Ampelopsis grossedentata (74 % identity), Pyrus communis (73 % identity), and Prunus avium (73 % identity). A structural analysis showed that MsANS belongs to 2-oxoglutarate (2OG)- and ferrous iron-dependent oxygenase family because it contains three binding sites for 2OG. Real-time quantitative polymerase chain reaction analyses showed that the transcript level of MsANS was 26-fold higher in red petals than in white petals. The accumulation of anthocyanins in petals of white, pink, and red M. sprengeri flowers was analyzed by HPLC. The main anthocyanin was cyanidin-3-o-glucoside chloride, and the red petals contained the highest concentration of this pigment.

  6. Inhibition of Mycobacterium tuberculosis dihydrodipicolinate synthase by alpha-ketopimelic acid and its other structural analogues

    PubMed Central

    Shrivastava, Priyanka; Navratna, Vikas; Silla, Yumnam; Dewangan, Rikeshwer P.; Pramanik, Atreyi; Chaudhary, Sarika; Rayasam, GeethaVani; Kumar, Anuradha; Gopal, Balasubramanian; Ramachandran, Srinivasan

    2016-01-01

    The Mycobacterium tuberculosis dihydrodipicolinate synthase (Mtb-dapA) is an essential gene. Mtb-DapA catalyzes the aldol condensation between pyruvate and L-aspartate-beta-semialdehyde (ASA) to yield dihydrodipicolinate. In this work we tested the inhibitory effects of structural analogues of pyruvate on recombinant Mtb-DapA (Mtb-rDapA) using a coupled assay with recombinant dihydrodipicolinate reductase (Mtb-rDapB). Alpha-ketopimelic acid (α-KPA) showed maximum inhibition of 88% and IC50 of 21 μM in the presence of pyruvate (500 μM) and ASA (400 μM). Competition experiments with pyruvate and ASA revealed competition of α-KPA with pyruvate. Liquid chromatography-mass spectrometry (LC-MS) data with multiple reaction monitoring (MRM) showed that the relative abundance peak of final product, 2,3,4,5-tetrahydrodipicolinate, was decreased by 50%. Thermal shift assays showed 1 °C Tm shift of Mtb-rDapA upon binding α-KPA. The 2.4 Å crystal structure of Mtb-rDapA-α-KPA complex showed the interaction of critical residues at the active site with α-KPA. Molecular dynamics simulations over 500 ns of pyruvate docked to Mtb-DapA and of α-KPA-bound Mtb-rDapA revealed formation of hydrogen bonds with pyruvate throughout in contrast to α-KPA. Molecular descriptors analysis showed that ligands with polar surface area of 91.7 Å2 are likely inhibitors. In summary, α-hydroxypimelic acid and other analogues could be explored further as inhibitors of Mtb-DapA. PMID:27501775

  7. The 3-hydroxyacyl-ACP dehydratase component of the plant mitochondrial fatty acid synthase system.

    PubMed

    Guan, Xin; Okazaki, Yozo; Lithio, Andrew; Li, Ling; Zhao, Xuefeng; Jin, Huanan; Nettleton, Dan; Saito, Kazuki; Nikolau, Basil J

    2017-02-15

    We report the characterization of the Arabidopsis 3-hydroxyacyl-acyl carrier protein (ACP) dehydratase (mtHD) component of the mitochondrial fatty acid synthase (mtFAS) system, encoded by AT5G60335. The mitochondrial localization and catalytic capability of mtHD were demonstrated with a green fluorescent protein (GFP) transgenesis experiment, and by in vivo complementation and in vitro enzymatic assays. RNAi knockdown lines with reduced mtHD expression exhibit traits typically associated with mtFAS mutants, namely a miniaturized morphological appearance, reduced lipoylation of lipoylated proteins, and altered metabolomes consistent with the reduced catalytic activity of lipoylated enzymes. These alterations are reversed when mthd-rnai mutant plants are grown in a 1% CO2 atmosphere, indicating the link between mtFAS and photorespiratory deficiency due to the reduced lipoylation of glycine decarboxylase. In vivo biochemical feeding experiments illustrate that sucrose and glycolate are the metabolic modulators that mediate the alterations in morphology and lipid accumulation. In addition, both mthd-rnai and mtkas mutants exhibit reduced accumulation of 3-hydroxytetradecanoic acid (i.e. a hallmark of lipid A-like molecules) and abnormal chloroplastic starch granules; these changes are not reversible by the 1% CO2 atmosphere, demonstrating two novel mtFAS functions that are independent of photorespiration. Finally, RNA-Seq analysis revealed that mthd-rnai and mtkas mutants are near equivalent to each other in altering transcriptome, and these analyses further identified genes whose expression is affected by a functional mtFAS system, but independent of photorespiratory deficiency. These data demonstrate the non-redundant nature of the mtFAS system, which contributes unique lipid components needed to support plant cell structure and metabolism.

  8. Mining for Nonribosomal Peptide Synthetase and Polyketide Synthase Genes Revealed a High Level of Diversity in the Sphagnum Bog Metagenome

    PubMed Central

    Müller, Christina A.; Oberauner-Wappis, Lisa; Peyman, Armin; Amos, Gregory C. A.; Wellington, Elizabeth M. H.

    2015-01-01

    Sphagnum bog ecosystems are among the oldest vegetation forms harboring a specific microbial community and are known to produce an exceptionally wide variety of bioactive substances. Although the Sphagnum metagenome shows a rich secondary metabolism, the genes have not yet been explored. To analyze nonribosomal peptide synthetases (NRPSs) and polyketide synthases (PKSs), the diversity of NRPS and PKS genes in Sphagnum-associated metagenomes was investigated by in silico data mining and sequence-based screening (PCR amplification of 9,500 fosmid clones). The in silico Illumina-based metagenomic approach resulted in the identification of 279 NRPSs and 346 PKSs, as well as 40 PKS-NRPS hybrid gene sequences. The occurrence of NRPS sequences was strongly dominated by the members of the Protebacteria phylum, especially by species of the Burkholderia genus, while PKS sequences were mainly affiliated with Actinobacteria. Thirteen novel NRPS-related sequences were identified by PCR amplification screening, displaying amino acid identities of 48% to 91% to annotated sequences of members of the phyla Proteobacteria, Actinobacteria, and Cyanobacteria. Some of the identified metagenomic clones showed the closest similarity to peptide synthases from Burkholderia or Lysobacter, which are emerging bacterial sources of as-yet-undescribed bioactive metabolites. This report highlights the role of the extreme natural ecosystems as a promising source for detection of secondary compounds and enzymes, serving as a source for biotechnological applications. PMID:26002894

  9. Mining for Nonribosomal Peptide Synthetase and Polyketide Synthase Genes Revealed a High Level of Diversity in the Sphagnum Bog Metagenome.

    PubMed

    Müller, Christina A; Oberauner-Wappis, Lisa; Peyman, Armin; Amos, Gregory C A; Wellington, Elizabeth M H; Berg, Gabriele

    2015-08-01

    Sphagnum bog ecosystems are among the oldest vegetation forms harboring a specific microbial community and are known to produce an exceptionally wide variety of bioactive substances. Although the Sphagnum metagenome shows a rich secondary metabolism, the genes have not yet been explored. To analyze nonribosomal peptide synthetases (NRPSs) and polyketide synthases (PKSs), the diversity of NRPS and PKS genes in Sphagnum-associated metagenomes was investigated by in silico data mining and sequence-based screening (PCR amplification of 9,500 fosmid clones). The in silico Illumina-based metagenomic approach resulted in the identification of 279 NRPSs and 346 PKSs, as well as 40 PKS-NRPS hybrid gene sequences. The occurrence of NRPS sequences was strongly dominated by the members of the Protebacteria phylum, especially by species of the Burkholderia genus, while PKS sequences were mainly affiliated with Actinobacteria. Thirteen novel NRPS-related sequences were identified by PCR amplification screening, displaying amino acid identities of 48% to 91% to annotated sequences of members of the phyla Proteobacteria, Actinobacteria, and Cyanobacteria. Some of the identified metagenomic clones showed the closest similarity to peptide synthases from Burkholderia or Lysobacter, which are emerging bacterial sources of as-yet-undescribed bioactive metabolites. This report highlights the role of the extreme natural ecosystems as a promising source for detection of secondary compounds and enzymes, serving as a source for biotechnological applications.

  10. Differential induction of 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase genes in Arabidopsis thaliana by wounding and pathogenic attack.

    PubMed Central

    Keith, B; Dong, X N; Ausubel, F M; Fink, G R

    1991-01-01

    We have isolated cDNAs from two distinct genes encoding 3-deoxy-D-arabino-heptulosonate 7-phosphate (DAHP) synthase (EC 4.1.2.15) in Arabidopsis thaliana. Predicted protein sequences from both genes, DHS1 and DHS2, and a potato DAHP synthase gene are highly related, but none shows significant sequence similarity to conserved microbial DAHP synthase proteins. Despite this structural difference, the DHS1 cDNA complements mutations in a yeast strain lacking DAHP synthase activity. DHS1 RNA levels increase in Arabidopsis leaves subjected either to physical wounding or to infiltration with pathogenic Pseudomonas syringae strains. DHS2 RNA levels are not increased by these treatments, suggesting that the DHS1 and DHS2 proteins fulfill different physiological functions. Other enzymes in the Arabidopsis aromatic pathway are also encoded by duplicated genes, an arrangement that may allow independent regulation of aromatic amino acid biosynthesis by distinct physiological requirements such as protein synthesis and secondary metabolism. The presence of amino-terminal extensions characteristic of chloroplast transit peptides on DHS1 and DHS2 suggests that both proteins may be targeted to the chloroplast. Images PMID:1681544

  11. Structural, functional, and evolutionary analysis of the unusually large stilbene synthase gene family in grapevine.

    PubMed

    Parage, Claire; Tavares, Raquel; Réty, Stéphane; Baltenweck-Guyot, Raymonde; Poutaraud, Anne; Renault, Lauriane; Heintz, Dimitri; Lugan, Raphaël; Marais, Gabriel A B; Aubourg, Sébastien; Hugueney, Philippe

    2012-11-01

    Stilbenes are a small family of phenylpropanoids produced in a number of unrelated plant species, including grapevine (Vitis vinifera). In addition to their participation in defense mechanisms in plants, stilbenes, such as resveratrol, display important pharmacological properties and are postulated to be involved in the health benefits associated with a moderate consumption of red wine. Stilbene synthases (STSs), which catalyze the biosynthesis of the stilbene backbone, seem to have evolved from chalcone synthases (CHSs) several times independently in stilbene-producing plants. STS genes usually form small families of two to five closely related paralogs. By contrast, the sequence of grapevine reference genome (cv PN40024) has revealed an unusually large STS gene family. Here, we combine molecular evolution and structural and functional analyses to investigate further the high number of STS genes in grapevine. Our reannotation of the STS and CHS gene families yielded 48 STS genes, including at least 32 potentially functional ones. Functional characterization of nine genes representing most of the STS gene family diversity clearly indicated that these genes do encode for proteins with STS activity. Evolutionary analysis of the STS gene family revealed that both STS and CHS evolution are dominated by purifying selection, with no evidence for strong selection for new functions among STS genes. However, we found a few sites under different selection pressures in CHS and STS sequences, whose potential functional consequences are discussed using a structural model of a typical STS from grapevine that we developed.

  12. Likelihood analysis of the chalcone synthase genes suggests the role of positive selection in morning glories (Ipomoea).

    PubMed

    Yang, Ji; Gu, Hongya; Yang, Ziheng

    2004-01-01

    Chalcone synthase (CHS) is a key enzyme in the biosynthesis of flavonoides, which are important for the pigmentation of flowers and act as attractants to pollinators. Genes encoding CHS constitute a multigene family in which the copy number varies among plant species and functional divergence appears to have occurred repeatedly. In morning glories (Ipomoea), five functional CHS genes (A-E) have been described. Phylogenetic analysis of the Ipomoea CHS gene family revealed that CHS A, B, and C experienced accelerated rates of amino acid substitution relative to CHS D and E. To examine whether the CHS genes of the morning glories underwent adaptive evolution, maximum-likelihood models of codon substitution were used to analyze the functional sequences in the Ipomoea CHS gene family. These models used the nonsynonymous/synonymous rate ratio (omega = d(N)/ d(S)) as an indicator of selective pressure and allowed the ratio to vary among lineages or sites. Likelihood ratio test suggested significant variation in selection pressure among amino acid sites, with a small proportion of them detected to be under positive selection along the branches ancestral to CHS A, B, and C. Positive Darwinian selection appears to have promoted the divergence of subfamily ABC and subfamily DE and is at least partially responsible for a rate increase following gene duplication.

  13. Production of taxadiene from cultured ginseng roots transformed with taxadiene synthase gene.

    PubMed

    Cha, Mijeong; Shim, Sang Hee; Kim, Sung Hong; Kim, Ok Tae; Lee, Se-Weon; Kwon, Suk-Yoon; Baek, Kwang-Hyun

    2012-10-01

    Paclitaxel is produced by various species of yew trees and has been extensively used to treat tumors. In our research, a taxadiene synthase (TS) gene from Taxus brevifolia was used to transform the roots of cultured ginseng (Panax ginseng C.A. Meyer) to produce taxadiene, the unique skeletal precursor to taxol. The TS gene was successfully introduced into the ginseng genome, and the de novo formation of taxadiene was identified by mass spectroscopy profiling. Without any change in phenotypes or growth difference in a TS-transgenic ginseng line, the transgenic TSS3-2 line accumulated 9.1 μg taxadiene per gram of dry weight. In response to the treatment of methyl jasmonate for 3 or 6 days, the accumulation was 14.6 and 15.9 μg per g of dry weight, respectively. This is the first report of the production of taxadiene by engineering ginseng roots with a taxadiene synthase gene.

  14. Assignment of the gene encoding glycogen synthase (GYS) to human chromosome 19, band q13,3

    SciTech Connect

    Lehto, M. Helsinki Univ. ); Stoffel, M.; Espinosa, R. III; Beau, M.M. le; Bell, G.I. ); Groop, L. )

    1993-02-01

    The enzyme glycogen synthase (UDP glocose:glycogen 4-[alpha]-D-glucosyltransferase, EC 2.4.1.11) catalyzes the formation of glycogen from uridine diphosphate glucose (UPDG). Impaired activation of muscle glycogen synthase by insulin has been noted in patients with genetic risk of developing non-insulin-dependent diabets mellitus (NIDDM) and this may represent an early defect in the pathogenesis of this disorder. As such, glycogen synthase represents a candidate gene for contributing to genetic susceptibility. As a first step in studying the role of glycogen synthase in the genetics of NIDDM, we have isolated a cosmid encoding the human glycogen synthase gene (gene symbol GYS) and determined its chromosomal localization by fluorescence in situ hybridization. 4 refs., 1 fig.

  15. Metabolic and developmental effects resulting from deletion of the citA gene encoding citrate synthase in Aspergillus nidulans.

    PubMed

    Murray, Sandra L; Hynes, Michael J

    2010-04-01

    Citrate synthase is a central activity in carbon metabolism. It is required for the tricarboxylic acid (TCA) cycle, respiration, and the glyoxylate cycle. In Saccharomyces cerevisiae and Arabidopsis thaliana, there are mitochondrial and peroxisomal isoforms encoded by separate genes, while in Aspergillus nidulans, a single gene, citA, encodes a protein with predicted mitochondrial and peroxisomal targeting sequences (PTS). Deletion of citA results in poor growth on glucose but not on derepressing carbon sources, including those requiring the glyoxylate cycle. Growth on glucose is restored by a mutation in the creA carbon catabolite repressor gene. Methylcitrate synthase, required for propionyl-coenzyme A (CoA) metabolism, has previously been shown to have citrate synthase activity. We have been unable to construct the mcsADelta citADelta double mutant, and the expression of mcsA is subject to CreA-mediated carbon repression. Therefore, McsA can substitute for the loss of CitA activity. Deletion of citA does not affect conidiation or sexual development but results in delayed conidial germination as well as a complete loss of ascospores in fruiting bodies, which can be attributed to loss of meiosis. These defects are suppressed by the creA204 mutation, indicating that McsA activity can substitute for the loss of CitA. A mutation of the putative PTS1-encoding sequence in citA had no effect on carbon source utilization or development but did result in slower colony extension arising from single conidia or ascospores. CitA-green fluorescent protein (GFP) studies showed mitochondrial localization in conidia, ascospores, and hyphae. Peroxisomal localization was not detected. However, a very low and variable detection of punctate GFP fluorescence was sometimes observed in conidia germinated for 5 h when the mitochondrial targeting sequence was deleted.

  16. chsZ, a gene for a novel class of chitin synthase from Aspergillus oryzae.

    PubMed

    Chigira, Yuko; Abe, Keietsu; Gomi, Katsuya; Nakajima, Tasuku

    2002-07-01

    We cloned and characterized a novel Aspergillus oryzae chitin synthase gene, chsZ, encoding a polypeptide containing a new myosin motor-like domain in its N-terminal half. Alignment analysis revealed that ChsZ was less homologous to known class V enzymes, except for its probable chitin synthase conserved region in the C-terminal half. We also found a chsY gene and found that ChsY showed higher similarity to the class V enzymes than did ChsZ. Phylogenetic analysis clearly demonstrated that the A. oryzae ChsZ, together with Chs4 of Paracoccidioides brasiliensis and Chs6 of Ustilago maydis, formed a new subclass distinct from A. oryzae ChsY and known class V chitin synthases, including A. nidulans CsmA (ChsD) and A. fumigatus ChsE. In conclusion, we propose a new class, class VI chitin synthases, represented by A. oryzae ChsZ, P. brasiliensis Chs4 and U. maydis Chs6. Expression analysis suggested that the regulation of chsZ expression is distinct from that of chsY expression.

  17. Enrichment and identification of Δ(9)-Tetrahydrocannabinolic acid synthase from Pichia pastoris culture supernatants.

    PubMed

    Lange, Kerstin; Poetsch, Ansgar; Schmid, Andreas; Julsing, Mattijs K

    2015-09-01

    This data article refers to the report Δ(9)-Tetrahydrocannabinolic acid synthase (THCAS) production in Pichia pastoris enables chemical synthesis of cannabinoids (Lange et. al. 2015) [2]. THCAS was produced on a 2 L lab scale using recombinant P. pastoris KM71 KE1. Enrichment of THCAS as a technically pure enzyme was realized using dialysis and cationic exchange chromatography. nLC-ESI-MS/MS analysis identified THCAS in different fractions obtained by cationic exchange chromatography.

  18. Inhibition of Fatty Acid Synthase in Prostate Cancer by Olristat, a Novel Therapeutic

    DTIC Science & Technology

    2006-11-01

    and other FAS inhibitors in prostate cancer through a multi-disciplinary approach combining cell biology, biochemistry and crystallography. 15... Devlin , C. M., Zhang, D., Harding, H. P., Sweeney, M., Rong, J. X., Kuriakose, G., Fisher, E. A., Marks, A. R., Ron, D., and Tabas, I. The... Biochemistry 1989;28:4523-30. 2. Asturias FJ, Chadick JZ, Cheung IK, et al. Structure and molecular organization of mammalian fatty acid synthase. Nat Struct

  19. Characterization of capsaicin synthase and identification of its gene (csy1) for pungency factor capsaicin in pepper (Capsicum sp.).

    PubMed

    Prasad, B C Narasimha; Kumar, Vinod; Gururaj, H B; Parimalan, R; Giridhar, P; Ravishankar, G A

    2006-09-05

    Capsaicin is a unique alkaloid of the plant kingdom restricted to the genus Capsicum. Capsaicin is the pungency factor, a bioactive molecule of food and of medicinal importance. Capsaicin is useful as a counterirritant, antiarthritic, analgesic, antioxidant, and anticancer agent. Capsaicin biosynthesis involves condensation of vanillylamine and 8-methyl nonenoic acid, brought about by capsaicin synthase (CS). We found that CS activity correlated with genotype-specific capsaicin levels. We purified and characterized CS ( approximately 35 kDa). Immunolocalization studies confirmed that CS is specifically localized to the placental tissues of Capsicum fruits. Western blot analysis revealed concomitant enhancement of CS levels and capsaicin accumulation during fruit development. We determined the N-terminal amino acid sequence of purified CS, cloned the CS gene (csy1) and sequenced full-length cDNA (981 bp). The deduced amino acid sequence of CS from full-length cDNA was 38 kDa. Functionality of csy1 through heterologous expression in recombinant Escherichia coli was also demonstrated. Here we report the gene responsible for capsaicin biosynthesis, which is unique to Capsicum spp. With this information on the CS gene, speculation on the gene for pungency is unequivocally resolved. Our findings have implications in the regulation of capsaicin levels in Capsicum genotypes.

  20. myo-Inositol 1-Phosphate Synthase Inhibition and Control of Uridine Diphosphate-d-glucuronic Acid Biosynthesis in Plants 12

    PubMed Central

    Loewus, Mary W.; Loewus, Frank

    1974-01-01

    Of the eight intermediates associated with the two pathways of UDP-d-glucuronic acid biosynthesis found in plants, only d-glucuronic acid inhibited myo-inositol 1-phosphate synthase (EC 5.5.1.4), formerly referred to as d-glucose 6-phosphate cycloaldolase. Inhibition was competitive. An attempt to demonstrate over-all reversibility of the synthase indicated that it was less than 5% reversible, if at all. PMID:16658890

  1. Detection and molecular cloning of CYP74Q1 gene: identification of Ranunculus acris leaf divinyl ether synthase.

    PubMed

    Gorina, Svetlana S; Toporkova, Yana Y; Mukhtarova, Lucia S; Chechetkin, Ivan R; Khairutdinov, Bulat I; Gogolev, Yuri V; Grechkin, Alexander N

    2014-09-01

    Enzymes of the CYP74 family, including the divinyl ether synthase (DES), play important roles in plant cell signalling and defence. The potent DES activities have been detected before in the leaves of the meadow buttercup (Ranunculus acris L.) and few other Ranunculaceae species. The nature of these DESs and their genes remained unrevealed. The PCR with degenerate primers enabled to detect the transcript of unknown P450 gene assigned as CYP74Q1. Besides, two more CYP74Q1 isoforms with minimal sequence variations have been found. The full length recombinant CYP74Q1 protein was expressed in Escherichia coli. The preferred substrates of this enzyme are the 13-hydroperoxides of α-linolenic and linoleic acids, which are converted to the divinyl ether oxylipins (ω5Z)-etherolenic acid, (9Z,11E)-12-[(1'Z,3'Z)-hexadienyloxy]-9,11-dodecadienoic acid, and (ω5Z)-etheroleic acid, (9Z,11E)-12-[(1'Z)-hexenyloxy]-9,11-dodecadienoic acid, respectively, as revealed by the data of mass spectrometry, NMR and UV spectroscopy. Thus, CYP74Q1 protein was identified as the R. acris DES (RaDES), a novel DES type and the opening member of new CYP74Q subfamily.

  2. Characterization of Stilbene Synthase Genes in Mulberry (Morus atropurpurea) and Metabolic Engineering for the Production of Resveratrol in Escherichia coli.

    PubMed

    Wang, Chuanhong; Zhi, Shuang; Liu, Changying; Xu, Fengxiang; Zhao, Aichun; Wang, Xiling; Ren, Yanhong; Li, Zhengang; Yu, Maode

    2017-03-01

    Stilbenes have been recognized for their beneficial physiological effects on human health. Stilbene synthase (STS) is the key enzyme of resveratrol biosynthesis and has been studied in numerous plants. Here, four MaSTS genes were isolated and identified in mulberry (Morus atropurpurea Roxb.). The expression levels of MaSTS genes and the accumulation of trans-resveratrol, trans-oxyresveratrol, and trans-mulberroside A were investigated in different plant organs. A novel coexpression system that harbored 4-coumarate:CoA ligase gene (Ma4CL) and MaSTS was established. Stress tests suggested that MaSTS genes participate in responses to salicylic acid, abscisic acid, wounding, and NaCl stresses. Additionally, overexpressed MaSTS in transgenic tobacco elevated the trans-resveratrol level and increased tolerance to drought and salinity stresses. These results revealed the major MaSTS gene, and we evaluated its function in mulberry, laying the foundation for future research on stilbene metabolic pathways in mulberry.

  3. Horizontal Gene Transfer of Phytochelatin Synthases from Bacteria to Extremophilic Green Algae.

    PubMed

    Olsson, Sanna; Penacho, Vanessa; Puente-Sánchez, Fernando; Díaz, Silvia; Gonzalez-Pastor, José Eduardo; Aguilera, Angeles

    2017-01-01

    Transcriptomic sequencing together with bioinformatic analyses and an automated annotation process led us to identify novel phytochelatin synthase (PCS) genes from two extremophilic green algae (Chlamydomonas acidophila and Dunaliella acidophila). These genes are of intermediate length compared to known PCS genes from eukaryotes and PCS-like genes from prokaryotes. A detailed phylogenetic analysis gives new insight into the complicated evolutionary history of PCS genes and provides evidence for multiple horizontal gene transfer events from bacteria to eukaryotes within the gene family. A separate subgroup containing PCS-like genes within the PCS gene family is not supported since the PCS genes are monophyletic only when the PCS-like genes are included. The presence and functionality of the novel genes in the organisms were verified by genomic sequencing and qRT-PCR. Furthermore, the novel PCS gene in Chlamydomonas acidophila showed very strong induction by cadmium. Cloning and expression of the gene in Escherichia coli clearly improves its cadmium resistance. The gene in Dunaliella was not induced, most likely due to gene duplication.

  4. Molecular cloning and expression profile of ß-ketoacyl-acp synthase gene from tung tree (Vernicia fordii Hemsl.)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Tung tree (Vernicia fordii) is an important woody oil tree. Tung tree seeds contain 50-60% oil with approximately 80 mole a-eleostearic acid (9cis, 11trans, 13trans octadecatrienoic acid). Fatty acid synthesis is catalyzed by the concerted action of acetyl-CoA carboxylase and fatty acid synthase, a ...

  5. Construction of gene expression system in hop (Humulus lupulus) lupulin gland using valerophenone synthase promoter.

    PubMed

    Okada, Yukio; Saeki, Kazuo; Inaba, Akira; Suda, Narushi; Kaneko, Takafumi; Ito, Kazutoshi

    2003-09-01

    The promoter region of the valerophenone synthase (VPS) gene was isolated from hop (Humulus lupulus). VPS, a member of the chalcone synthase (CHS) super-family, catalyzes the biosynthesis reaction of the hop resin that significantly accumulates in the cone's secretory gland called the "lupulin gland". The typical H-box and G-box sequences, which exist in many plants' CHS promoters and act as cis-elements for tissue specificity, UV-light induction, etc., were not found in the isolated VPS promoter, although the H-box-like sequence (CCTTACC, CCTAACC) and the core sequence (ACGT) of the G-box were observed. The transformation experiment using the VPS promoter-UIDA gene fusion revealed that the promoter acts not only in the lupulin gland but also in the glands of leaf and stem. On the other hand, the VPS promoter activity was not induced by UV-irradiation.

  6. Fatty Acid Synthase Polymorphisms, Tumor Expression, Body Mass Index, Prostate Cancer Risk, and Survival

    PubMed Central

    Nguyen, Paul L.; Ma, Jing; Chavarro, Jorge E.; Freedman, Matthew L.; Lis, Rosina; Fedele, Giuseppe; Fiore, Christopher; Qiu, Weiliang; Fiorentino, Michelangelo; Finn, Stephen; Penney, Kathryn L.; Eisenstein, Anna; Schumacher, Fredrick R.; Mucci, Lorelei A.; Stampfer, Meir J.; Giovannucci, Edward; Loda, Massimo

    2010-01-01

    Purpose Fatty acid synthase (FASN) regulates de novo lipogenesis, body weight, and tumor growth. We examined whether common germline single nucleotide polymorphisms (SNPs) in the FASN gene affect prostate cancer (PCa) risk or PCa-specific mortality and whether these effects vary by body mass index (BMI). Methods In a prospective nested case-control study of 1,331 white patients with PCa and 1,267 age-matched controls, we examined associations of five common SNPs within FASN (and 5 kb upstream/downstream, R2 > 0.8) with PCa incidence and, among patients, PCa-specific death and tested for an interaction with BMI. Survival analyses were repeated for tumor FASN expression (n = 909). Results Four of the five SNPs were associated with lethal PCa. SNP rs1127678 was significantly related to higher BMI and interacted with BMI for both PCa risk (Pinteraction = .004) and PCa mortality (Pinteraction = .056). Among overweight men (BMI ≥ 25 kg/m2), but not leaner men, the homozygous variant allele carried a relative risk of advanced PCa of 2.49 (95% CI, 1.00 to 6.23) compared with lean men with the wild type. Overweight patients carrying the variant allele had a 2.04 (95% CI, 1.31 to 3.17) times higher risk of PCa mortality. Similarly, overweight patients with elevated tumor FASN expression had a 2.73 (95% CI, 1.05 to 7.08) times higher risk of lethal PCa (Pinteraction = .02). Conclusion FASN germline polymorphisms were significantly associated with risk of lethal PCa. Significant interactions of BMI with FASN polymorphisms and FASN tumor expression suggest FASN as a potential link between obesity and poor PCa outcome and raise the possibility that FASN inhibition could reduce PCa-specific mortality, particularly in overweight men. PMID:20679621

  7. Inactivation of fatty acid synthase impairs hepatocarcinogenesis driven by AKT in mice and humans

    PubMed Central

    Li, Lei; Pilo, Giulia M.; Li, Xiaolei; Cigliano, Antonio; Latte, Gavinella; Che, Li; Joseph, Christy; Mela, Marta; Wang, Chunmei; Jiang, Lijie; Ribback, Silvia; Simile, Maria M.; Pascale, Rosa M.; Dombrowski, Frank; Evert, Matthias; Semenkovich, Clay F.; Chen, Xin; Calvisi, Diego F.

    2015-01-01

    Background & Aims Cumulating evidence underlines the crucial role of aberrant lipogenesis in human hepatocellular carcinoma (HCC). Here, we investigated the oncogenic potential of fatty acid synthase (FASN), the master regulator of de novo lipogenesis, in the mouse liver. Methods FASN was overexpressed in the mouse liver, either alone or in combination with activated N-Ras, c-Met, or SCD1, via hydrodynamic injection. Activated AKT was overexpressed via hydrodynamic injection in livers of conditional FASN or Rictor knockout mice. FASN was suppressed in human hepatoma cell lines via specific small interfering RNA. Results Overexpression of FASN, either alone or in combination with other genes associated with hepatocarcinogenesis, did not induce histological liver alterations. In contrast, genetic ablation of FASN resulted in the complete inhibition of hepatocarcinogenesis in AKT-overexpressing mice. In human HCC cell lines, FASN inactivation led to a decline in cell proliferation and a rise in apoptosis, which were paralleled by a decrease in the levels of phosphorylated/activated AKT, an event controlled by the mammalian target of rapamycin complex 2 (mTORC2). Downregulation of AKT phosphorylation/activation following FASN inactivation was associated with strong inhibition of rapamycin-insensitive companion of mTOR (Rictor), the major component of mTORC2, at post-transcriptional level. Finally, genetic ablation of Rictor impaired AKT-driven hepatocarcinogenesis in mice. Conclusions FASN is not oncogenic per se in the mouse liver, but is necessary for AKT-driven hepatocarcinogenesis. Pharmacological blockade of FASN might be highly useful in the treatment of human HCC characterized by activation of the AKT pathway. PMID:26476289

  8. The very-long-chain fatty acid synthase is inhibited by chloroacetamides.

    PubMed

    Götz, Thomas; Böger, Peter

    2004-01-01

    The first elongation step to form very-long-chain fatty acids (VLCFAs) is catalyzed by the VLCFA-synthase. CoA-activated fatty acids react with malonyl-CoA to condense a C2-unit. As shown with recombinant enzyme this reaction is specifically inhibited by chloroacetamide herbicides. The inhibition is alleviated when the inhibitor (e.g. metazachlor) is incubated together with adequate concentrations of the substrate (e.g. oleoyl-CoA). Malonyl-CoA has no influence. However, once a chloroacetamide has been tightly bound to the synthase after an appropriate time it cannot be displaced anymore by the substrate. In contrast, oleoyl-CoA, is easily removed from the synthase by metazachlor. The irreversible binding of the chloroacetamides and their competition with the substrate explains the very low half-inhibition values of 10(-8) M and below. Chiral chloroacetamides like metolachlor or dimethenamid give identical results. However, only the (S)-enantiomers are active.

  9. Genome-wide identification of galactinol synthase (GolS) genes in Solanum lycopersicum and Brachypodium distachyon.

    PubMed

    Filiz, Ertugrul; Ozyigit, Ibrahim Ilker; Vatansever, Recep

    2015-10-01

    GolS genes stand as potential candidate genes for molecular breeding and/or engineering programs in order for improving abiotic stress tolerance in plant species. In this study, a total of six galactinol synthase (GolS) genes/proteins were retrieved for Solanum lycopersicum and Brachypodium distachyon. GolS protein sequences were identified to include glyco_transf_8 (PF01501) domain structure, and to have a close molecular weight (36.40-39.59kDa) and amino acid length (318-347 aa) with a slightly acidic pI (5.35-6.40). The sub-cellular location was mainly predicted as cytoplasmic. S. lycopersicum genes located on chr 1 and 2, and included one segmental duplication while genes of B. distachyon were only on chr 1 with one tandem duplication. GolS sequences were found to have well conserved motif structures. Cis-acting analysis was performed for three abiotic stress responsive elements, including ABA responsive element (ABRE), dehydration and cold responsive elements (DRE/CRT) and low-temperature responsive element (LTRE). ABRE elements were found in all GolS genes, except for SlGolS4; DRE/CRT was not detected in any GolS genes and LTRE element found in SlGolS1 and BdGolS1 genes. AU analysis in UTR and ORF regions indicated that SlGolS and BdGolS mRNAs may have a short half-life. SlGolS3 and SlGolS4 genes may generate more stable transcripts since they included AATTAAA motif for polyadenylation signal POLASIG2. Seconder structures of SlGolS proteins were well conserved than that of BdGolS. Some structural divergences were detected in 3D structures and predicted binding sites exhibited various patterns in GolS proteins.

  10. A conserved amino acid residue critical for product and substrate specificity in plant triterpene synthases

    PubMed Central

    Salmon, Melissa; Thimmappa, Ramesha B.; Minto, Robert E.; Melton, Rachel E.; O’Maille, Paul E.; Hemmings, Andrew M.; Osbourn, Anne

    2016-01-01

    Triterpenes are structurally complex plant natural products with numerous medicinal applications. They are synthesized through an origami-like process that involves cyclization of the linear 30 carbon precursor 2,3-oxidosqualene into different triterpene scaffolds. Here, through a forward genetic screen in planta, we identify a conserved amino acid residue that determines product specificity in triterpene synthases from diverse plant species. Mutation of this residue results in a major change in triterpene cyclization, with production of tetracyclic rather than pentacyclic products. The mutated enzymes also use the more highly oxygenated substrate dioxidosqualene in preference to 2,3-oxidosqualene when expressed in yeast. Our discoveries provide new insights into triterpene cyclization, revealing hidden functional diversity within triterpene synthases. They further open up opportunities to engineer novel oxygenated triterpene scaffolds by manipulating the precursor supply. PMID:27412861

  11. Molecular cloning and expression of squalene synthase and 2,3-oxidosqualene cyclase genes in persimmon (Diospyros kaki L.) fruits.

    PubMed

    Zhou, Chunhua; Zhao, Daqiu; Sheng, Yanle; Liang, Guohua; Tao, Jun

    2012-02-01

    Oleanolic acid (OA) and ursolic acid (UA) are the main triterpene acids in persimmon fruit, and squalene synthase and 2,3-oxidosqualene cyclases are important enzymes in pentacyclic triterpene biosynthesis. In order to study their relationship, DkSQS and DkOSC were cloned from persimmon fruits in the present study. The full-length cDNA of DkSQS was 1647 bp, containing an open reading frame (ORF) of 1245 bp that encoded a peptide of 415 amino acids (AA). The 3'-end of DkOSC cDNA fragment contained 522 bp, including a partial ORF of 298 bp, a full poly A tail that encoded 98 AA. Two cultivars of persimmon, i.e. cv. Nishimurawase and cv. Niuxinshi, were used to study the content of OA and UA and the related gene expression. Results showed that OA and UA contents changed in both cultivars during fruit development, the difference in cv. Nishimurawase was greater than that in cv. Niuxinshi. The expression of DkSQS and DkOSC had no obvious correlation with the biosynthesis of OA and UA in the flesh. There may be two main reasons. Firstly, different enzymes involved in the biosynthesis of triterpenes and mutual adjustment were existed in different gene expressions. Secondly, it was not clear that the DkOSC cloned in this research belonged to which subfamily. Therefore, the real relationship between triterpenes and DkSQS and DkOSC in persimmon fruits is still to be revealed.

  12. Hydroxymethylbilane synthase: Complete genomic sequence and amplifiable polymorphisms in the human gene

    SciTech Connect

    Yoo, Hanwook; Warner, C.A.; Chen, Chiahsiang; Desnick, R.J. )

    1993-01-01

    Acute intermittent porphyria (AIP), an autosomal dominant inborn error of heme biosynthesis, results from the half-normal activity of the heme biosynthetic enzyme hydroxymethylbilane synthase (HMB-synthase). Heterozygous individuals are prone to life-threatening acute neurologic attacks, which are precipitated by certain drugs and other metabolic, hormonal, and nutritional factors. Since the biochemical diagnosis of heterozygous individuals has been problematic, recent efforts have focused on the identification of mutations and diagnostically useful restriction fragment length polymorphisms (RFLPS) in the HMB-synthase gene. To facilitate these endeavors, the human HMB-synthase gene, including 1.1 kb of the 5[prime] flanking region, was isolated and completely sequenced in both orientations. The 10,024-bp gene contained 15 exons ranging in size from 39 to 438 bp and 14 introns ranging from 87 to 2913 bp. All intron/exon boundaries conformed to the GT/AG consensus rule. There were six Alu repetitive elements, one of the J and five of the Sa subfamilies. Analysis of the 1. I -kb 5[prime]flanking region revealed putative regulatory elements for the housekeeping promoter including AP1, AP4, SP1, TRE, ENH, and CAC. This region contained 10 HpaII sites and had an overall GC content of 54%. Three new polymorphic sites were identified by the single-strand conformation polymorphism (SSCP) technique, a common BsmAI site in intron 3 (3581 A/G), a common HinfI RFLP in intron 10 (7064 C/A), and a rare MnlI site in intron 14 (7998G/A). The allele frequencies of five previously known and the new polymorphic sites in a normal Caucasian population indicated that the intron 1 and intron 3 RFLPs were in linkage disequilibrium; however, the Hint I site segregated independently. 54 refs., 6 figs., 3 tabs.

  13. SNP in Chalcone Synthase gene is associated with variation of 6-gingerol content in contrasting landraces of Zingiber officinale.Roscoe.

    PubMed

    Ghosh, Subhabrata; Mandi, Swati Sen

    2015-07-25

    Zingiber officinale, medicinally the most important species within Zingiber genus, contains 6-gingerol as the active principle. This compound obtained from rhizomes of Z.officinale, has immense medicinal importance and is used in various herbal drug formulations. Our record of variation in content of this active principle, viz. 6-gingerol, in land races of this drug plant collected from different locations correlated with our Gene expression studies exhibiting high Chalcone Synthase gene (Chalcone Synthase is the rate limiting enzyme of 6-gingerol biosynthesis pathway) expression in high 6-gingerol containing landraces than in the low 6-gingerol containing landraces. Sequencing of Chalcone Synthase cDNA and subsequent multiple sequence alignment revealed seven SNPs between these contrasting genotypes. Converting this nucleotide sequence to amino acid sequence, alteration of two amino acids becomes evident; one amino acid change (asparagine to serine at position 336) is associated with base change (A→G) and another change (serine to leucine at position 142) is associated with the base change (C→T). Since asparagine at position 336 is one of the critical amino acids of the catalytic triad of Chalcone Synthase enzyme, responsible for substrate binding, our study suggests that landraces with a specific amino acid change viz. Asparagine (found in high 6-gingerol containing landraces) to serine causes low 6-gingerol content. This is probably due to a weak enzyme substrate association caused by the absence of asparagine in the catalytic triad. Detailed study of this finding could also help to understand molecular mechanism associated with variation in 6-gingerol content in Z.officinale genotypes and thereby strategies for developing elite genotypes containing high 6-gingerol content.

  14. Identification and characterization of the niddamycin polyketide synthase genes from Streptomyces caelestis.

    PubMed Central

    Kakavas, S J; Katz, L; Stassi, D

    1997-01-01

    The genes encoding the polyketide synthase (PKS) portion of the niddamycin biosynthetic pathway were isolated from a library of Streptomyces caelestis NRRL-2821 chromosomal DNA. Analysis of 40 kb of DNA revealed the presence of five large open reading frames (ORFs) encoding the seven modular sets of enzymatic activities required for the synthesis of a 16-membered lactone ring. The enzymatic motifs identified within each module were consistent with those predicted from the structure of niddamycin. Disruption of the second ORF of the PKS coding region eliminated niddamycin production, demonstrating that the cloned genes are involved in the biosynthesis of this compound. PMID:9393718

  15. Three nicotianamine synthase genes isolated from maize are differentially regulated by iron nutritional status.

    PubMed

    Mizuno, Daichi; Higuchi, Kyoko; Sakamoto, Tatsuya; Nakanishi, Hiromi; Mori, Satoshi; Nishizawa, Naoko K

    2003-08-01

    Nicotianamine synthase (NAS) is an enzyme that is critical for the biosynthesis of the mugineic acid family of phytosiderophores in graminaceous plants, and for the homeostasis of metal ions in nongraminaceous plants. We isolated one genomic NAS clone, ZmNAS3, and two cDNA NAS clones, ZmNAS1 and ZmNAS2, from maize (Zea mays cv Alice). In agreement with the increased secretion of phytosiderophores with Fe deficiency, ZmNAS1 and ZmNAS2 were positively expressed only in Fe-deficient roots. In contrast, ZmNAS3 was expressed under Fe-sufficient conditions, and was negatively regulated by Fe deficiency. This is the first report describing down-regulation of NAS gene expression in response to Fe deficiency in plants, shedding light on the role of nicotianamine in graminaceous plants, other than as a precursor in phytosiderophore production. ZmNAS1-green fluorescent protein (sGFP) and ZmNAS2-sGFP were localized at spots in the cytoplasm of onion (Allium cepa) epidermal cells, whereas ZmNAS3-sGFP was distributed throughout the cytoplasm of these cells. ZmNAS1 and ZmNAS3 showed NAS activity in vitro, whereas ZmNAS2 showed none. Due to its duplicated structure, ZmNAS2 was much larger (65.8 kD) than ZmNAS1, ZmNAS3, and previously characterized NAS proteins (30-38 kD) from other plant species. We reveal that maize has two types of NAS proteins based on their expression pattern and subcellular localization.

  16. REACTION MECHANISMS OF 15-HYDROPEROXYEICOSATETRAENOIC ACID CATALYZED BY HUMAN PROSTACYCLIN AND THROMBOXANE SYNTHASES

    PubMed Central

    Yeh, Hui-Chun; Tsai, Ah-Lim; Wang, Lee-Ho

    2007-01-01

    Prostacyclin synthase (PGIS) and thromboxane synthase (TXAS) are atypical cytochrome P450s. They do not require NADPH or dioxygen for isomerization of prostaglandin H2 (PGH2) to produce prostacyclin (PGI2) and thromboxane A2 (TXA2). PGI2 and TXA2 have opposing actions on platelet aggregation and blood vessel tone. In this report, we use a lipid hydroperoxide, 15-hydroperoxyeicosatetraenoic acid (15-HPETE), to explore the active site characteristics of PGIS and TXAS. The two enzymes transformed 15-HPETE not only into 13-hydroxy-14,15-epoxy-5,8,11-eicosatrienoic acid (13-OH-14,15-EET), like many microsomal P450s, but also to 15-ketoeicosatetraenoic acid (15-KETE) and 15-hydroxyeicosatetraenoic acid (15-HETE). 13-OH-14,15-EET and 15-KETE result from homolytic cleavage of the O–O bond, whereas 15-HETE results from heterolytic cleavage, a common peroxidase pathway. About 80% of 15-HPETE was homolytically cleaved by PGIS and 60% was homolytically cleaved by TXAS. The Vmax of homolytic cleavage is 3.5-fold faster than heterolytic cleavage for PGIS-catalyzed reactions (1100 min−1 vs. 320 min−1) and 1.4-fold faster for TXAS (170 min−1 vs. 120 min−1). Similar KM values for homolytic and heterolytic cleavages were found for PGIS (∼60 μM 15-HPETE) and TXAS (∼80 μM 15-HPETE), making PGIS a more efficient catalyst for the 15-HPETE reaction. PMID:17459323

  17. [Cloning, expression and functional identification of a type III polyketide synthase gene from Huperzia serrata].

    PubMed

    Ye, Jin-cui; Zhang, Ping; Sun, Jie-yin; Guo, Chao-tan; Chen, Guo-shen; Abe, Ikuro; Noguchi, Hiroshi

    2011-10-01

    A cDNA encoding novel type III polyketide synthase (PKS) was cloned and sequenced from young leaves of Chinese club moss Huperzia serrata (Thunb.) Trev. by RT-PCR using degenerated primers based on the conserved sequences of known CHSs, and named as H. serrata PKS2. The terminal sequences of cDNA were obtained by the 3'- and 5'-RACE method. The full-length cDNA of H. serrata PKS2 contained a 1212 bp open reading frame encoding a 46.4 kDa protein with 404 amino acids. The deduced amino acid sequence of H. serrata PKS2 showed 50%-66% identities to those of other chalcone synthase super family enzymes of plant origin. The recombinant H. serrata PKS2 was functionally expressed in Escherichia coli with an additional hexahistidine tag at the N-terminus and showed unusually versatile catalytic potency to produce various aromatic tetraketides, including chalcones, benzophenones, phloroglucinols, and acridones. In particular, the enzyme accepted bulky starter substrates N-methylanthraniloyl-CoA, and carried out three condensations with malonyl-CoA to produce 1, 3-dihydroxy-N-methylacridone. Interestingly, H. serrata PKS2 lacks most of the consensus active site sequences with acridone synthase from Ruta graveolens (Rutaceae).

  18. Cloning and functional characterization of a gene for capsanthin-capsorubin synthase from tiger lily (Lilium lancifolium Thunb. 'Splendens').

    PubMed

    Jeknić, Zoran; Morré, Jeffrey T; Jeknić, Stevan; Jevremović, Sladana; Subotić, Angelina; Chen, Tony H H

    2012-11-01

    The orange color of tiger lily (Lolium lancifolium 'Splendens') flowers is due, primarily, to the accumulation of two κ-xanthophylls, capsanthin and capsorubin. An enzyme, known as capsanthin-capsorubin synthase (CCS), catalyzes the conversion of antheraxanthin and violaxanthin into capsanthin and capsorubin, respectively. We cloned the gene for capsanthin-capsorubin synthase (Llccs) from flower tepals of L. lancifolium by the rapid amplification of cDNA ends (RACE) with a heterologous non-degenerate primer that was based on the sequence of a gene for lycopene β-cyclase (lcyB). The full-length cDNA of Llccs was 1,785 bp long and contained an open reading frame of 1,425 bp that encoded a polypeptide of 474 amino acids with a predicted N-terminal plastid-targeting sequence. Analysis by reverse transcription-PCR (RT-PCR) revealed that expression of Llccs was spatially and temporally regulated, with expression in flower buds and flowers of L. lancifolium but not in vegetative tissues. Stable overexpression of the Llccs gene in callus tissue of Iris germanica, which accumulates several xanthophylls including violaxanthin, the precursor of capsorubin, resulted in transgenic callus whose color had changed from its normal yellow to red-orange. This novel red-orange coloration was due to the accumulation of two non-native κ-xanthophylls, capsanthin and capsorubin, as confirmed by HPLC and ultraperformance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS) analysis with authentic standards. Cloning of the Llccs gene should advance our understanding of the molecular and genetic mechanisms of the biosynthesis of κ-carotenoids in general and in the genus Lilium in particular, and will facilitate transgenic alterations of the colors of flowers and fruits of many plant species.

  19. Truncating mutation in the nitric oxide synthase 1 gene is associated with infantile achalasia.

    PubMed

    Shteyer, Eyal; Edvardson, Simon; Wynia-Smith, Sarah L; Pierri, Ciro Leonardo; Zangen, Tzili; Hashavya, Saar; Begin, Michal; Yaacov, Barak; Cinamon, Yuval; Koplewitz, Benjamin Z; Vromen, Amos; Elpeleg, Orly; Smith, Brian C

    2015-03-01

    Nitric oxide is thought to have a role in the pathogenesis of achalasia. We performed a genetic analysis of 2 siblings with infant-onset achalasia. Exome analysis revealed that they were homozygous for a premature stop codon in the gene encoding nitric oxide synthase 1. Kinetic analyses and molecular modeling showed that the truncated protein product has defects in folding, nitric oxide production, and binding of cofactors. Heller myotomy had no effect in these patients, but sildenafil therapy increased their ability to drink. The finding recapitulates the previously reported phenotype of nitric oxide synthase 1-deficient mice, which have achalasia. Nitric oxide signaling appears to be involved in the pathogenesis of achalasia in humans.

  20. Identification and molecular characterization of nitric oxide synthase (NOS) gene in the intertidal copepod Tigriopus japonicus.

    PubMed

    Jeong, Chang-Bum; Kang, Hye-Min; Seo, Jung Soo; Park, Heum Gi; Rhee, Jae-Sung; Lee, Jae-Seong

    2016-02-10

    In copepods, no information has been reported on the structure or molecular characterization of the nitric oxide synthase (NOS) gene. In the intertidal copepod Tigriopus japonicus, we identified a NOS gene that is involved in immune responses of vertebrates and invertebrates. In silico analyses revealed that nitric oxide (NO) synthase domains, such as the oxygenase and reductase domains, are highly conserved in the T. japonicus NOS gene. The T. japonicus NOS gene was highly transcribed in the nauplii stages, implying that it plays a role in protecting the host during the early developmental stages. To examine the involvement of the T. japonicus NOS gene in the innate immune response, the copepods were exposed to lipopolysaccharide (LPS) and two Vibrio sp. After exposure to different concentrations of LPS and Vibrio sp., T. japonicus NOS transcription was significantly increased over time in a dose-dependent manner, and the NO/nitrite concentration increased as well. Taken together, our findings suggest that T. japonicus NOS transcription is induced in response to an immune challenge as part of the conserved innate immunity.

  1. Crystallization of Delta1-tetrahydrocannabinolic acid (THCA) synthase from Cannabis sativa.

    PubMed

    Shoyama, Yoshinari; Takeuchi, Ayako; Taura, Futoshi; Tamada, Taro; Adachi, Motoyasu; Kuroki, Ryota; Shoyama, Yukihiro; Morimoto, Satoshi

    2005-08-01

    Delta1-Tetrahydrocannabinolic acid (THCA) synthase is a novel oxidoreductase that catalyzes the biosynthesis of the psychoactive compound THCA in Cannabis sativa (Mexican strain). In order to investigate the structure-function relationship of THCA synthase, this enzyme was overproduced in insect cells, purified and finally crystallized in 0.1 M HEPES buffer pH 7.5 containing 1.4 M sodium citrate. A single crystal suitable for X-ray diffraction measurement was obtained in 0.09 M HEPES buffer pH 7.5 containing 1.26 M sodium citrate. The crystal diffracted to 2.7 A resolution at beamline BL41XU, SPring-8. The crystal belonged to the primitive cubic space group P432, with unit-cell parameters a = b = c = 178.2 A. The calculated Matthews coefficient was approximately 4.1 or 2.0 A3 Da(-1) assuming the presence of one or two molecules of THCA synthase in the asymmetric unit, respectively.

  2. Carnosol and carnosic acids from Salvia officinalis inhibit microsomal prostaglandin E2 synthase-1.

    PubMed

    Bauer, Julia; Kuehnl, Susanne; Rollinger, Judith M; Scherer, Olga; Northoff, Hinnak; Stuppner, Hermann; Werz, Oliver; Koeberle, Andreas

    2012-07-01

    Prostaglandin E(2) (PGE(2)), the most relevant eicosanoid promoting inflammation and tumorigenesis, is formed by cyclooxygenases (COXs) and PGE(2) synthases from free arachidonic acid. Preparations of the leaves of Salvia officinalis are commonly used in folk medicine as an effective antiseptic and anti-inflammatory remedy and possess anticancer activity. Here, we demonstrate that a standard ethyl acetate extract of S. officinalis efficiently suppresses the formation of PGE(2) in a cell-free assay by direct interference with microsomal PGE(2) synthase (mPGES)-1. Bioactivity-guided fractionation of the extract yielded closely related fractions that potently suppressed mPGES-1 with IC(50) values between 1.9 and 3.5 μg/ml. Component analysis of these fractions revealed the diterpenes carnosol and carnosic acid as potential bioactive principles inhibiting mPGES-1 activity with IC(50) values of 5.0 μM. Using a human whole-blood assay as a robust cell-based model, carnosic acid, but not carnosol, blocked PGE(2) generation upon stimulation with lipopolysaccharide (IC(50) = 9.3 μM). Carnosic acid neither inhibited the concomitant biosynthesis of other prostanoids [6-keto PGF(1α), 12(S)-hydroxy-5-cis-8,10-trans-heptadecatrienoic acid, and thromboxane B(2)] in human whole blood nor affected the activities of COX-1/2 in a cell-free assay. Together, S. officinalis extracts and its ingredients carnosol and carnosic acid inhibit PGE(2) formation by selectively targeting mPGES-1. We conclude that the inhibitory effect of carnosic acid on PGE(2) formation, observed in the physiologically relevant whole-blood model, may critically contribute to the anti-inflammatory and anticarcinogenic properties of S. officinalis.

  3. Automating gene library synthesis by structure-based combinatorial protein engineering: examples from plant sesquiterpene synthases.

    PubMed

    Dokarry, Melissa; Laurendon, Caroline; O'Maille, Paul E

    2012-01-01

    Structure-based combinatorial protein engineering (SCOPE) is a homology-independent recombination method to create multiple crossover gene libraries by assembling defined combinations of structural elements ranging from single mutations to domains of protein structure. SCOPE was originally inspired by DNA shuffling, which mimics recombination during meiosis, where mutations from parental genes are "shuffled" to create novel combinations in the resulting progeny. DNA shuffling utilizes sequence identity between parental genes to mediate template-switching events (the annealing and extension of one parental gene fragment on another) in PCR reassembly reactions to generate crossovers and hence recombination between parental genes. In light of the conservation of protein structure and degeneracy of sequence, SCOPE was developed to enable the "shuffling" of distantly related genes with no requirement for sequence identity. The central principle involves the use of oligonucleotides to encode for crossover regions to choreograph template-switching events during PCR assembly of gene fragments to create chimeric genes. This approach was initially developed to create libraries of hybrid DNA polymerases from distantly related parents, and later developed to create a combinatorial mutant library of sesquiterpene synthases to explore the catalytic landscapes underlying the functional divergence of related enzymes. This chapter presents a simplified protocol of SCOPE that can be integrated with different mutagenesis techniques and is suitable for automation by liquid-handling robots. Two examples are presented to illustrate the application of SCOPE to create gene libraries using plant sesquiterpene synthases as the model system. In the first example, we outline how to create an active-site library as a series of complex mixtures of diverse mutants. In the second example, we outline how to create a focused library as an array of individual clones to distil minimal combinations of

  4. Bioengineering of the Plant Culture of Capsicum frutescens with Vanillin Synthase Gene for the Production of Vanillin.

    PubMed

    Chee, Marcus Jenn Yang; Lycett, Grantley W; Khoo, Teng-Jin; Chin, Chiew Foan

    2017-01-01

    Production of vanillin by bioengineering has gained popularity due to consumer demand toward vanillin produced by biological systems. Natural vanillin from vanilla beans is very expensive to produce compared to its synthetic counterpart. Current bioengineering works mainly involve microbial biotechnology. Therefore, alternative means to the current approaches are constantly being explored. This work describes the use of vanillin synthase (VpVAN), to bioconvert ferulic acid to vanillin in a plant system. The VpVAN enzyme had been shown to directly convert ferulic acid and its glucoside into vanillin and its glucoside, respectively. As the ferulic acid precursor and vanillin were found to be the intermediates in the phenylpropanoid biosynthetic pathway of Capsicum species, this work serves as a proof-of-concept for vanillin production using Capsicum frutescens (C. frutescens or hot chili pepper). The cells of C. frutescens were genetically transformed with a codon optimized VpVAN gene via biolistics. Transformed explants were selected and regenerated into callus. Successful integration of the gene cassette into the plant genome was confirmed by polymerase chain reaction. High-performance liquid chromatography was used to quantify the phenolic compounds detected in the callus tissues. The vanillin content of transformed calli was 0.057% compared to 0.0003% in untransformed calli.

  5. Natural fatty acid synthase inhibitors as potent therapeutic agents for cancers: A review.

    PubMed

    Zhang, Jia-Sui; Lei, Jie-Ping; Wei, Guo-Qing; Chen, Hui; Ma, Chao-Ying; Jiang, He-Zhong

    2016-09-01

    Context Fatty acid synthase (FAS) is the only mammalian enzyme to catalyse the synthesis of fatty acid. The expression level of FAS is related to cancer progression, aggressiveness and metastasis. In recent years, research on natural FAS inhibitors with significant bioactivities and low side effects has increasingly become a new trend. Herein, we present recent research progress on natural fatty acid synthase inhibitors as potent therapeutic agents. Objective This paper is a mini overview of the typical natural FAS inhibitors and their possible mechanism of action in the past 10 years (2004-2014). Method The information was collected and compiled through major databases including Web of Science, PubMed, and CNKI. Results Many natural products induce cancer cells apoptosis by inhibiting FAS expression, with fewer side effects than synthetic inhibitors. Conclusion Natural FAS inhibitors are widely distributed in plants (especially in herbs and foods). Some natural products (mainly phenolics) possessing potent biological activities and stable structures are available as lead compounds to synthesise promising FAS inhibitors.

  6. Type III polyketide synthase is involved in the biosynthesis of protocatechuic acid in Aspergillus niger.

    PubMed

    Lv, Yangyong; Xiao, Jing; Pan, Li

    2014-11-01

    Genomic studies have shown that not only plants but also filamentous fungi contain type III polyketide synthases. To study the function of type III polyketide synthase (AnPKSIII) in Aspergillus niger, a deletion strain (delAnPKSIII) and an overexpression strain (oeAnPKSIII) were constructed in A. niger MA169.4, a derivative of the wild-type (WT) A. niger ATCC 9029 that produces large quantities of gluconic acid. Alterations in the metabolites were analyzed by HPLC when the extract of the overexpression strain was compared with extracts of the WT and deletion strains. Protocatechuic acid (PCA; 3,4-dihydroxybenzoic acid, 3.2 mg/l) was isolated and identified as the main product of AnPKSIII when inductively expressed in A. niger MA169.4. The molecular weight of PCA was 154.1 (m/z 153.1 [M-H](-)), was detected by ESI-MS in the negative ionization mode, and (1)H and (13)C NMR data confirmed its structure.

  7. Analysis of the mitochondrial ATP synthase beta-subunit gene in Drosophilidae: structure, transcriptional regulatory features and developmental pattern of expression in Drosophila melanogaster.

    PubMed Central

    Peña, P; Ugalde, C; Calleja, M; Garesse, R

    1995-01-01

    We have cloned and determined the structure of the gene encoding the H(+)-ATP synthase beta subunit in two distantly related Drosophila species, D. melanogaster and D. virilis. The gene contains three exons that are extremely well conserved at the amino acid level, not only in the region encoding the mature protein but also in that encoding the leader peptide. Primer extension analysis indicates that the 5' untranslated region is extremely short, and reveals the presence of multiple initiation sites of transcription in both Drosophila species. The promoters of D. melanogaster and D. virilis H(+)-ATP synthase beta-subunit genes contain a conserved region surrounding the initiation transcription sites. Nucleotide sequence analysis has revealed the absence of canonical TATA and CCAAT boxes and the presence of several putative regulatory elements in both promoter regions, including GAGA, GATA and Ets binding sites. We have analysed the pattern of gene expression during D. melanogaster development. The mRNA is stored in oocytes, and activation of transcription takes place after 10 h of development. The expression of the nuclear-encoded H(+)-ATP synthase beta subunit is strictly coordinated with the expression of subunits 6 and 8 of the same complex that are encoded in the mitochondrial genome. Images Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 8 PMID:8554535

  8. β-Ketoacyl-acyl Carrier Protein Synthase I (KASI) Plays Crucial Roles in the Plant Growth and Fatty Acids Synthesis in Tobacco

    PubMed Central

    Yang, Tianquan; Xu, Ronghua; Chen, Jianghua; Liu, Aizhong

    2016-01-01

    Fatty acids serve many functions in plants, but the effects of some key genes involved in fatty acids biosynthesis on plants growth and development are not well understood yet. To understand the functions of 3-ketoacyl-acyl-carrier protein synthase I (KASI) in tobacco, we isolated two KASI homologs, which we have designated NtKASI-1 and NtKASI-2. Expression analysis showed that these two KASI genes were transcribed constitutively in all tissues examined. Over-expression of NtKASI-1 in tobacco changed the fatty acid content in leaves, whereas over-expressed lines of NtKASI-2 exhibited distinct phenotypic features such as slightly variegated leaves and reduction of the fatty acid content in leaves, similar to the silencing plants of NtKASI-1 gene. Interestingly, the silencing of NtKASI-2 gene had no discernibly altered phenotypes compared to wild type. The double silencing plants of these two genes enhanced the phenotypic changes during vegetative and reproductive growth compared to wild type. These results uncovered that these two KASI genes had the partially functional redundancy, and that the KASI genes played a key role in regulating fatty acids synthesis and in mediating plant growth and development in tobacco. PMID:27509494

  9. Human gene encoding prostacyclin synthase (PTGIS): Genomic organization, chromosomal localization, and promoter activity

    SciTech Connect

    Yokoyama, Chieko; Yabuki, Tomoko; Inoue, Hiroyasu

    1996-09-01

    The prostacyclin synthase gene isolated from human genomic libraries (PTGIS) consists of 10 exons spanning approximately 60 kb. All the splice donor and acceptor sites conform to the GT/AG rule. Genomic Southern blot and fluorescence in situ hybridization analyses revealed that the human prostacyclin synthase gene is present as a single copy per haploid genome and is localized on chromosome 20q13.11-q13.13. The 1.5-kb sequence of the 5{prime} of the translational initiation site contained both GC-rich and pyrimidine-rich regions and consensus sequences of the transcription factor recognition sites such as Sp1, AP-2, the interferon-{gamma} response element, GATA, NF-{kappa}B, the CACCC box, and the glucocorticoid response element. The core binding sequence (GAGACC) of the shear stress responsive element was also found in the 5{prime}-flanking region of the gene. The major product of the primer extension analysis suggested that the transcription of the gene started from the positions around 49 bp upstream of the translational initiation codon. Transient transfection experiments using human aortic and bovine arterial endothelial cells demonstrated that the GC-rich region (positions -145 to -10) possessed a significant promoter activity. The 6-kb downstream sequence of the translational termination codon contained multiple polyadenylation signals, Alu repeat sequences, and the consensus sequence of the primate-repetitive DNA element, MER1. Two sizes of the prostacyclin synthase mRNAs (approximately 6 and 3.3 kb) were detected with the human aorta and lung. RNA blot hybridization analysis using the 3{prime}-untranslated region as probe indicated that the sizes of the 3{prime}-flanking regions were different in the major 6-kb and minor 3.3-kb mRNAs. 54 refs., 7 figs.

  10. Detection of polyketide synthase and nonribosomal peptide synthetase biosynthetic genes from antimicrobial coral-associated actinomycetes.

    PubMed

    Li, Jie; Dong, Jun-De; Yang, Jian; Luo, Xiong-Ming; Zhang, Si

    2014-10-01

    The diversity and properties of actinobacteria, predominant residents in coral holobionts, have been rarely documented. In this study, we aimed to explore the species diversity, antimicrobial activities and biosynthetic potential of culturable actinomycetes within the tissues of the scleractinian corals Porites lutea, Galaxea fascicularis and Acropora millepora from the South China Sea. A total of 70 strains representing 13 families and 15 genera of actinobacteria were isolated. The antimicrobial activity and biosynthetic potential of fifteen representative filamentous actinomycetes were estimated. Crude fermentation extracts of 6 strains exhibited comparable or greater activities against Vibrio alginolyticus than ciprofloxacin. Seven of the 15 actinomycetes strains possess type I polyketide synthases (PKS-I) and/or nonribosomal peptide synthetases (NRPS) genes. Nine tested strains possess type II polyketide synthases (PKS-II). Phylogenetic analysis based on 16S rRNA gene sequences indicated that these PKS and NRPS gene screening positive strains belong to genera Nocardiopsis, Pseudonocardia, Streptomyces, Micromonospora, Amycolatopsis and Prauserella. One PKS-I and four NRPS fragments showed <70% similarity to their closest relatives, which suggested the novelty of these genes. This study helps uncover the genetic capacity of stony coral-associated actinomycetes to produce bioactive molecules.

  11. Phylogenomic analysis of type I polyketide synthase genes in pathogenic and saprobic ascomycetes.

    PubMed

    Kroken, Scott; Glass, N Louise; Taylor, John W; Yoder, O C; Turgeon, B Gillian

    2003-12-23

    Fungal type I polyketides (PKs) are synthesized by PK synthases (PKSs) and include well known secondary metabolites such as the anticholesterol drug lovastatin and the potent natural carcinogen aflatoxin. Other type I PKs are known to be virulence factors for some plant pathogens and pigments such as melanin. In this study, a phylogenomic approach was used to investigate the origin and diversity of fungal genes encoding putative PKSs that are predicted to synthesize type I PKs. The resulting genealogy, constructed by using the highly conserved PKS ketosynthase (KS) domain, indicated that: (i). Species within subphylum Pezizomycotina (phylum Ascomycota) but not early diverging ascomycetes, like Saccharomyces cerevisiae (Saccharomycotina) or Schizosaccharomyces pombe (Taphrinomycotina), had large numbers (7-25) of PKS genes. (ii). Bacteria and fungi had separate groups of PKS genes; the few exceptions are the likely result of horizontal gene transfer from bacteria to various sublineages of fungi. (iii). The bulk of genes encoding fungal PKSs fell into eight groups. Four groups were predicted to synthesize variously reduced PKs, and four groups were predicted to make unreduced PKs. (iv). Species within different classes of Pezizomycotina shared the same groups of PKS genes. (v). Different fungal genomes shared few putative orthologous PKS genes, even between closely related genomes in the same class or genus. (vi) The discontinuous distributions of orthologous PKSs among fungal species can be explained by gene duplication, divergence, and gene loss; horizontal gene transfer among fungi does not need to be invoked.

  12. Identification and characterization of granule bound starch synthase I (GBSSI) gene of tartary buckwheat (Fagopyrum tataricum Gaertn.).

    PubMed

    Wang, Xun; Feng, Bo; Xu, Zhibin; Sestili, Francesco; Zhao, Guojun; Xiang, Chao; Lafiandra, Domenico; Wang, Tao

    2014-01-25

    Tartary buckwheat (Fagopyrum tataricum Gaertn.) is increasingly considered as an important functional food material because of its rich nutraceutical compounds. Reserve starch is the major component of tartary buckwheat seed. However, the gene sequences and the molecular mechanism of tartary buckwheat starch synthesis are unknown so far. In this study, the complete genomic sequence and full-size cDNA coding tartary buckwheat granule-bound starch synthase I (FtGBSSI), which is responsible for amylose synthesis, were isolated and analyzed. The genomic sequence of the FtGBSSI contained 3947 nucleotides and was composed of 14 exons and 13 introns. The cDNA coding sequence of FtGBSSI shared 63.3%-75.1% identities with those of dicots and 56.6%-57.5% identities with monocots (Poaceae). In deduced amino acid sequence of FtGBSSI, eight motifs conserved among plant starch synthases were identified. A cleavage at the site IVC↓G of FtGBSSI protein produces the chloroplast transit sequence of 78 amino acids and the mature protein of 527 amino acids. The FtGBSSI mature protein showed an identity of 73.4%-77.8% with dicot plants, and 67.6%-70.4% with monocot plants (Poaceae). The mature protein was composed of 20 α-helixes and 16 β-strands, and folds into two main domains, N- and C-terminal domains. The critical residues which are involved in ADP and sugar binding were predicted. These results will be useful to modulate starch composition of buckwheat kernels with the aim to produce novel improved varieties in future breeding programs.

  13. Molecular cloning and differential expression analysis of a squalene synthase gene from Dioscorea zingiberensis, an important pharmaceutical plant.

    PubMed

    Ye, Yun; Wang, Runfa; Jin, Liang; Shen, Junhao; Li, Xiaotong; Yang, Ting; Zhou, Mengzhuo; Yang, Zhifan; Chen, Yongqin

    2014-09-01

    Diosgenin is a steroid derived from cholesterol in plants and used as a typical initial intermediate for synthesis of numerous steroidal drugs in the world. Commercially, this compound is extracted mainly from the rhizomes or tubers of some Dioscorea species. Squalene synthase (SQS: EC 2.5.1.21) catalyzes the condensation of two molecules of farnesyl diphosphate to form squalene, the first committed step for biosynthesis of plant sterols including cholesterol, and is thought to play an important role in diosgenin biosynthesis. A full-length cDNA of a putative squalene synthase gene was cloned from D. zingiberensis and designated as DzSQS (Genbank Accession Number KC960673). DzSQS was contained an open reading frame of 1,230 bp encoding a polypeptide of 409 amino acids with a predicted molecular weight of 46 kDa and an isoelectric point of 6.2. The deduced amino acid sequence of DzSQS shared over 70 % sequence identity with those of SQSs from other plants. The truncated DzSQS in which 24 amino acids were deleted from the carboxy terminus was expressed in Escherichia coli, and the resultant bacterial crude extract was incubated with farnesyl diphosphate and NADPH. GC-MS analysis showed that squalene was detected in the in vitro reaction mixture. Quantitative real-time PCR analysis revealed that DzSQS was expressed from highest to lowest order in mature leaves, newly-formed rhizomes, young leaves, young stems, and two-year-old rhizomes of D. zingiberensis.

  14. Molecular evolution of the hyaluronan synthase 2 gene in mammals: implications for adaptations to the subterranean niche and cancer resistance

    PubMed Central

    Faulkes, Christopher G.; Davies, Kalina T. J.; Rossiter, Stephen J.; Bennett, Nigel C.

    2015-01-01

    The naked mole-rat (NMR) Heterocephalus glaber is a unique and fascinating mammal exhibiting many unusual adaptations to a subterranean lifestyle. The recent discovery of their resistance to cancer and exceptional longevity has opened up new and important avenues of research. Part of this resistance to cancer has been attributed to the fact that NMRs produce a modified form of hyaluronan—a key constituent of the extracellular matrix—that is thought to confer increased elasticity of the skin as an adaptation for living in narrow tunnels. This so-called high molecular mass hyaluronan (HMM-HA) stems from two apparently unique substitutions in the hyaluronan synthase 2 enzyme (HAS2). To test whether other subterranean mammals with similar selection pressures also show molecular adaptation in their HAS2 gene, we sequenced the HAS2 gene for 11 subterranean mammals and closely related species, and combined these with data from 57 other mammals. Comparative screening revealed that one of the two putatively important HAS2 substitutions in the NMR predicted to have a significant effect on hyaluronan synthase function was uniquely shared by all African mole-rats. Interestingly, we also identified multiple other amino acid substitutions in key domains of the HAS2 molecule, although the biological consequences of these for hyaluronan synthesis remain to be determined. Despite these results, we found evidence of strong purifying selection acting on the HAS2 gene across all mammals, and the NMR remains unique in its particular HAS2 sequence. Our results indicate that more work is needed to determine whether the apparent cancer resistance seen in NMR is shared by other members of the African mole-rat clade. PMID:25948568

  15. Enhanced freeze tolerance of baker's yeast by overexpressed trehalose-6-phosphate synthase gene (TPS1) and deleted trehalase genes in frozen dough.

    PubMed

    Tan, Haigang; Dong, Jian; Wang, Guanglu; Xu, Haiyan; Zhang, Cuiying; Xiao, Dongguang

    2014-08-01

    Several recombinant strains with overexpressed trehalose-6-phosphate synthase gene (TPS1) and/or deleted trehalase genes were obtained to elucidate the relationships between TPS1, trehalase genes, content of intracellular trehalose and freeze tolerance of baker's yeast, as well as improve the fermentation properties of lean dough after freezing. In this study, strain TL301(TPS1) overexpressing TPS1 showed 62.92 % higher trehalose-6-phosphate synthase (Tps1) activity and enhanced the content of intracellular trehalose than the parental strain. Deleting ATH1 exerted a significant effect on trehalase activities and the degradation amount of intracellular trehalose during the first 30 min of prefermentation. This finding indicates that acid trehalase (Ath1) plays a role in intracellular trehalose degradation. NTH2 encodes a functional neutral trehalase (Nth2) that was significantly involved in intracellular trehalose degradation in the absence of the NTH1 and/or ATH1 gene. The survival ratio, freeze-tolerance ratio and relative fermentation ability of strain TL301(TPS1) were approximately twice as high as those of the parental strain (BY6-9α). The increase in freeze tolerance of strain TL301(TPS1) was accompanied by relatively low trehalase activity, high Tps1 activity and high residual content of intracellular trehalose. Our results suggest that overexpressing TPS1 and deleting trehalase genes are sufficient to improve the freeze tolerance of baker's yeast in frozen dough. The present study provides guidance for the commercial baking industry as well as the research on the intracellular trehalose mobilization and freeze tolerance of baker's yeast.

  16. Coordinated responses of phytochelatin synthase and metallothionein genes in black mangrove, Avicennia germinans, exposed to cadmium and copper.

    PubMed

    Gonzalez-Mendoza, Daniel; Moreno, Adriana Quiroz; Zapata-Perez, Omar

    2007-08-01

    To evaluate the role of phytochelatins and metallothioneins in heavy metal tolerance of black mangrove Avicennia germinans, 3-month-old seedlings were exposed to cadmium or copper for 30 h, under hydroponic conditions. Degenerate Mt2 and PCS primers were synthesized based on amino acid and nucleotide alignment sequences reported for Mt2 and PCS in other plant species found in GenBank. Total RNA was isolated from A. germinans leaves and two partial fragments of metallothionein and phytochelatin synthase genes were isolated. Gene expression was evaluated with reverse transcripatase-polymerase chain reaction (RT-PCR) amplification technique. Temporal analysis showed that low Cd2+ and Cu2+ concentrations caused a slight (but not significant) increase in AvMt2 expression after a 16 h exposure time, while AvPCS expression showed a significant increase under the same conditions but only after 4h. Results strongly suggest that the rapid increase in AvPCS expression may contribute to Cd2+ and Cu2+ detoxification. Moreover, we found that A. germinans has the capacity to over-express both genes (AvMt2 and AvPCS), which may constitute a coordinated detoxification response mechanism targeting non-essential metals. Nonetheless, our results confirm that AvPCS was the most active gene involved in the regulation of essential metals (e.g., Cu2+) in A. germinans leaves.

  17. Evolution and Function of the Sucrose-Phosphate Synthase Gene Families in Wheat and Other Grasses[w

    PubMed Central

    Castleden, C. Kate; Aoki, Naohiro; Gillespie, Vanessa J.; MacRae, Elspeth A.; Quick, W. Paul; Buchner, Peter; Foyer, Christine H.; Furbank, Robert T.; Lunn, John E.

    2004-01-01

    Suc-phosphate synthase (SPS) is a key regulatory enzyme in the pathway of Suc biosynthesis and has been linked to quantitative trait loci controlling plant growth and yield. In dicotyledonous plants there are three SPS gene families: A, B, and C. Here we report the finding of five families of SPS genes in wheat (Triticum aestivum) and other monocotyledonous plants from the family Poaceae (grasses). Three of these form separate subfamilies within the previously described A, B, and C gene families, but the other two form a novel and distinctive D family, which on present evidence is only found in the Poaceae. The D-type SPS proteins lack the phosphorylation sites associated with 14-3-3 protein binding and osmotic stress activation, and the linker region between the N-terminal catalytic glucosyltransferase domain and the C-terminal Suc-phosphatase-like domain is 80 to 90 amino acid residues shorter than in the A, B, or C types. The D family appears to have arisen after the divergence of mono- and dicotyledonous plants, with a later duplication event resulting in the two D-type subfamilies. Each of the SPS gene families in wheat showed different, but overlapping, spatial and temporal expression patterns, and in most organs at least two different SPS genes are expressed. Analysis of expressed sequence tags indicated similar expression patterns to wheat for each SPS gene family in barley (Hordeum vulgare) but not in more distantly related grasses. We identified an expressed sequence tag from rice (Oryza sativa) that appears to be derived from an endogenous antisense SPS gene, and this might account for the apparently low level of expression of the related OsSPS11 sense gene, adding to the already extensive list of mechanisms for regulating the activity of SPS in plants. PMID:15247374

  18. Polyester synthases: natural catalysts for plastics.

    PubMed Central

    Rehm, Bernd H A

    2003-01-01

    Polyhydroxyalkanoates (PHAs) are biopolyesters composed of hydroxy fatty acids, which represent a complex class of storage polyesters. They are synthesized by a wide range of different Gram-positive and Gram-negative bacteria, as well as by some Archaea, and are deposited as insoluble cytoplasmic inclusions. Polyester synthases are the key enzymes of polyester biosynthesis and catalyse the conversion of (R)-hydroxyacyl-CoA thioesters to polyesters with the concomitant release of CoA. These soluble enzymes turn into amphipathic enzymes upon covalent catalysis of polyester-chain formation. A self-assembly process is initiated resulting in the formation of insoluble cytoplasmic inclusions with a phospholipid monolayer and covalently attached polyester synthases at the surface. Surface-attached polyester synthases show a marked increase in enzyme activity. These polyester synthases have only recently been biochemically characterized. An overview of these recent findings is provided. At present, 59 polyester synthase structural genes from 45 different bacteria have been cloned and the nucleotide sequences have been obtained. The multiple alignment of the primary structures of these polyester synthases show an overall identity of 8-96% with only eight strictly conserved amino acid residues. Polyester synthases can been assigned to four classes based on their substrate specificity and subunit composition. The current knowledge on the organization of the polyester synthase genes, and other genes encoding proteins related to PHA metabolism, is compiled. In addition, the primary structures of the 59 PHA synthases are aligned and analysed with respect to highly conserved amino acids, and biochemical features of polyester synthases are described. The proposed catalytic mechanism based on similarities to alpha/beta-hydrolases and mutational analysis is discussed. Different threading algorithms suggest that polyester synthases belong to the alpha/beta-hydrolase superfamily, with

  19. Increased Production of Fatty Acids and Triglycerides in Aspergillus oryzae by Enhancing Expressions of Fatty Acid Synthesis-Related Genes

    SciTech Connect

    Tamano, Koichi; Bruno, Kenneth S.; Karagiosis, Sue A.; Culley, David E.; Deng, Shuang; Collett, James R.; Umemura, Myco; Koike, Hideaki; Baker, Scott E.; Machida, Masa

    2013-01-01

    Microbial production of fats and oils is being developedas a means of converting biomass to biofuels. Here we investigate enhancing expression of enzymes involved in the production of fatty acids and triglycerides as a means to increase production of these compounds in Aspergillusoryzae. Examination of the A.oryzaegenome demonstrates that it contains twofatty acid synthases and several other genes that are predicted to be part of this biosynthetic pathway. We enhancedthe expressionof fatty acid synthesis-related genes by replacing their promoters with thepromoter fromthe constitutively highly expressedgene tef1. We demonstrate that by simply increasing the expression of the fatty acid synthasegenes we successfullyincreasedtheproduction of fatty acids and triglyceridesby more than two fold. Enhancement of expression of the fatty acid pathway genes ATP-citrate lyase and palmitoyl-ACP thioesteraseincreasedproductivity to a lesser extent.Increasing expression ofacetyl-CoA carboxylase caused no detectable change in fatty acid levels. Increases in message level for each gene were monitored usingquantitative real-time RT-PCR. Our data demonstrates that a simple increase in the abundance of fatty acid synthase genes can increase the detectable amount of fatty acids.

  20. Characterization and functional analysis of the human inducible nitric oxide synthase gene promoter.

    PubMed Central

    Spitsin, S. V.; Koprowski, H.; Michaels, F. H.

    1996-01-01

    BACKGROUND: Nitric oxide has a wide variety of homeostatic and pathological effects. Control of the production of nitric oxide by the inducible form of the enzyme resides in the 5' promoter region of the gene. Although control of the murine isoform has been investigated, little is known about the functional aspects of the human analog. MATERIALS AND METHODS: A 3.9-kb 5' nontranslated region of the human gene was cloned, sequenced, and several reporter constructs prepared. The promoter-reporter constructs were transfected into human or murine monocytoid cells and reporter expression quantified following cytokine activation of the cells. The production of nitric oxide was also monitored. RESULTS: Although a murine promoter-reporter functioned efficiently in both human and mouse cells, the human constructs functioned only in human cells. The activity of the mouse construct increased progressively with the addition of activating cytokines, but the human promoter-reporter did not. Although interleukin 1 beta drove expression of the human inducible nitric oxide synthase reporter, actual expression of nitric oxide required both interleukin 1 beta and interferon-gamma. CONCLUSIONS: The data indicate that despite the significant homology between the human and mouse inducible nitric oxide synthase promoter sequence, control of the two genes is quite different. In addition to being more efficient in promoter activity, the murine promoter responds increasingly to cytokines that are not effective for the human analog. It is also apparent that human inducible nitric oxide synthase is controlled at both the level of transcription and post-translationally. PMID:8726465

  1. Functional characterization of the rice kaurene synthase-like gene family.

    PubMed

    Xu, Meimei; Wilderman, P Ross; Morrone, Dana; Xu, Jianjun; Roy, Arnab; Margis-Pinheiro, Marcia; Upadhyaya, Narayana M; Coates, Robert M; Peters, Reuben J

    2007-02-01

    The rice (Oryza sativa) genome contains a family of kaurene synthase-like genes (OsKSL) presumably involved in diterpenoid biosynthesis. While a number of OsKSL enzymes have been functionally characterized, several have not been previously investigated, and the gene family has not been broadly analyzed. Here we report cloning of several OsKSL genes and functional characterization of the encoded enzymes. In particular, we have verified the expected production of ent-kaur-16-ene by the gibberellin phytohormone biosynthesis associated OsKS1 and demonstrated that OsKSL3 is a pseudo-gene, while OsKSL5 and OsKSL6 produce ent-(iso)kaur-15-ene. Similar to previous reports, we found that our sub-species variant of OsKSL7 produces ent-cassa-12,15-diene, OsKSL10 produces ent-(sandaraco)pimar-8(14),15-diene, and OsKSL8 largely syn-stemar-13-ene, although we also identified syn-stemod-12-ene as an alternative product formed in approximately 20% of the reactions catalyzed by OsKSL8. Along with our previous reports identifying OsKSL4 as a syn-pimara-7,15-diene synthase and OsKSL11 as a syn-stemod-13(17)-ene synthase, this essentially completes biochemical characterization of the OsKSL gene family, enabling broader analyses. For example, because several OsKSL enzymes are involved in phytoalexin biosynthesis and their gene transcription is inducible, promoter analysis was used to identify a pair of specifically conserved motifs that may be involved in transcriptional up-regulation during the rice plant defense response. Also examined is the continuing process of gene evolution in the OsKSL gene family, which is particularly interesting in the context of very recently reported data indicating that a japonica sub-species variant of OsKSL5 produces ent-pimara-8(14),15-diene, rather than the ent-(iso)kaur-15-ene produced by the indica sub-species variant analyzed here.

  2. Fatty Acid Synthase: A Metabolic Enzyme and Candidate Oncogene in Prostate Cancer

    PubMed Central

    Migita, Toshiro; Ruiz, Stacey; Fornari, Alessandro; Fiorentino, Michelangelo; Priolo, Carmen; Zadra, Giorgia; Inazuka, Fumika; Grisanzio, Chiara; Palescandolo, Emanuele; Shin, Eyoung; Fiore, Christopher; Xie, Wanling; Kung, Andrew L.; Febbo, Phillip G.; Subramanian, Aravind; Mucci, Lorelei; Ma, Jing; Signoretti, Sabina; Stampfer, Meir; Hahn, William C.; Finn, Stephen

    2009-01-01

    Background Overexpression of the fatty acid synthase (FASN) gene has been implicated in prostate carcinogenesis. We sought to directly assess the oncogenic potential of FASN. Methods We used immortalized human prostate epithelial cells (iPrECs), androgen receptor–overexpressing iPrECs (AR-iPrEC), and human prostate adenocarcinoma LNCaP cells that stably overexpressed FASN for cell proliferation assays, soft agar assays, and tests of tumor formation in immunodeficient mice. Transgenic mice expressing FASN in the prostate were generated to assess the effects of FASN on prostate histology. Apoptosis was evaluated by Hoechst 33342 staining and by fluorescence-activated cell sorting in iPrEC-FASN cells treated with stimulators of the intrinsic and extrinsic pathways of apoptosis (ie, camptothecin and anti-Fas antibody, respectively) or with a small interfering RNA (siRNA) targeting FASN. FASN expression was compared with the apoptotic index assessed by the terminal deoxynucleotidyltransferase-mediated UTP end-labeling method in 745 human prostate cancer samples by using the least squares means procedure. All statistical tests were two-sided. Results Forced expression of FASN in iPrECs, AR-iPrECs, and LNCaP cells increased cell proliferation and soft agar growth. iPrECs that expressed both FASN and androgen receptor (AR) formed invasive adenocarcinomas in immunodeficient mice (12 of 14 mice injected formed tumors vs 0 of 14 mice injected with AR-iPrEC expressing empty vector (P < .001, Fisher exact test); however, iPrECs that expressed only FASN did not. Transgenic expression of FASN in mice resulted in prostate intraepithelial neoplasia, the incidence of which increased from 10% in 8- to 16-week-old mice to 44% in mice aged 7 months or more (P  = .0028, Fisher exact test), but not in invasive tumors. In LNCaP cells, siRNA-mediated silencing of FASN resulted in apoptosis. FASN overexpression protected iPrECs from apoptosis induced by camptothecin but did not

  3. siRNA-based spherical nucleic acids reverse impaired wound healing in diabetic mice by ganglioside GM3 synthase knockdown.

    PubMed

    Randeria, Pratik S; Seeger, Mark A; Wang, Xiao-Qi; Wilson, Heather; Shipp, Desmond; Mirkin, Chad A; Paller, Amy S

    2015-05-05

    Spherical nucleic acid (SNA) gold nanoparticle conjugates (13-nm-diameter gold cores functionalized with densely packed and highly oriented nucleic acids) dispersed in Aquaphor have been shown to penetrate the epidermal barrier of both intact mouse and human skin, enter keratinocytes, and efficiently down-regulate gene targets. ganglioside-monosialic acid 3 synthase (GM3S) is a known target that is overexpressed in diabetic mice and responsible for causing insulin resistance and impeding wound healing. GM3S SNAs increase keratinocyte migration and proliferation as well as insulin and insulin-like growth factor-1 (IGF1) receptor activation under both normo- and hyperglycemic conditions. The topical application of GM3S SNAs (50 nM) to splinted 6-mm-diameter full-thickness wounds in diet-induced obese diabetic mice decreases local GM3S expression by >80% at the wound edge through an siRNA pathway and fully heals wounds clinically and histologically within 12 d, whereas control-treated wounds are only 50% closed. Granulation tissue area, vascularity, and IGF1 and EGF receptor phosphorylation are increased in GM3S SNA-treated wounds. These data capitalize on the unique ability of SNAs to naturally penetrate the skin and enter keratinocytes without the need for transfection agents. Moreover, the data further validate GM3 as a mediator of the delayed wound healing in type 2 diabetes and support regional GM3 depletion as a promising therapeutic direction.

  4. 3-Ketoacyl-acyl carrier protein synthase III from spinach (Spinacia oleracea) is not similar to other condensing enzymes of fatty acid synthase.

    PubMed Central

    Tai, H; Jaworski, J G

    1993-01-01

    A cDNA clone encoding spinach (Spinacia oleracea) 3-ketoacyl-acyl carrier protein synthase III (KAS III), which catalyzes the initial condensing reaction in fatty acid biosynthesis, was isolated. Based on the amino acid sequence of tryptic digests of purified spinach KAS III, degenerate polymerase chain reaction (PCR) primers were designed and used to amplify a 612-bp fragment from first-strand cDNA of spinach leaf RNA. A root cDNA library was probed with the PCR fragment, and a 1920-bp clone was isolated. Its deduced amino acid sequence matched the sequences of the tryptic digests obtained from the purified KAS III. Northern analysis confirmed that it was expressed in both leaf and root. The clone contained a 1218-bp open reading frame coding for 405 amino acids. The identity of the clone was confirmed by expression in Escherichia coli BL 21 as a glutathione S-transferase fusion protein. The deduced amino acid sequence was 48 and 45% identical with the putative KAS III of Porphyra umbilicalis and KAS III of E. coli, respectively. It also had a strong local homology to the plant chalcone synthases but had little homology with other KAS isoforms from plants, bacteria, or animals. PMID:8290632

  5. A polyketide synthase-peptide synthetase gene cluster from an uncultured bacterial symbiont of Paederus beetles.

    PubMed

    Piel, Jörn

    2002-10-29

    Many drug candidates from marine and terrestrial invertebrates are suspected metabolites of uncultured bacterial symbionts. The antitumor polyketides of the pederin family, isolated from beetles and sponges, are an example. Drug development from such sources is commonly hampered by low yields and the difficulty of sustaining invertebrate cultures. To obtain insight into the true producer and find alternative supplies of these rare drug candidates, the putative pederin biosynthesis genes were cloned from total DNA of Paederus fuscipes beetles, which use this compound for chemical defense. Sequence analysis of the gene cluster and adjacent regions revealed the presence of ORFs with typical bacterial architecture and homologies. The ped cluster, which is present only in beetle specimens with high pederin content, is located on a 54-kb region bordered by transposase pseudogenes and encodes a mixed modular polyketide synthase/nonribosomal peptide synthetase. Notably, none of the modules contains regions with homology to acyltransferase domains, but two copies of isolated monodomain acyltransferase genes were found at the upstream end of the cluster. In line with an involvement in pederin biosynthesis, the upstream cluster region perfectly mirrors pederin structure. The unexpected presence of additional polyketide synthase/nonribosomal peptide synthetase modules reveals surprising insights into the evolutionary relationship between pederin-type pathways in beetles and sponges.

  6. Prospects for Lentiviral Vector Mediated Prostaglandin F Synthase Gene Delivery in Monkey Eyes In vivo

    PubMed Central

    Lee, Eun Suk; Rasmussen, Carol A.; Filla, Mark S.; Slauson, Sarah R.; Kolb, Aaron W.; Peters, Donna M.; Kaufman, Paul L.; Gabelt, B’Ann True; Brandt, Curtis R.

    2014-01-01

    Currently, the most effective outflow drugs approved for clinical use are prostaglandin F2α analogues, but these require daily topical self-dosing and have various intraocular, ocular surface and extraocular side effects. Lentiviral vector-mediated delivery of the prostaglandin F synthase (PGFS) gene, resulting in long-term reduction of IOP, may eliminate off-target tissue effects and the need for daily topical PGF2α self-administration. Lentiviral vector-mediated delivery of the PGFS gene to the anterior segment has been achieved in cats and non-human primates. Although these results are encouraging, our studies have identified a number of challenges that need to be overcome for prostaglandin gene therapy to be translated into the clinic. Using examples from our work in non-human primates, where we were able to achieve a significant reduction in IOP (2 mm Hg) for 5 months after delivery of the cDNA for bovine PGF synthase, we identify and discuss these issues and consider several possible solutions. PMID:24559478

  7. Tetrahydrocannabinolic acid synthase, the enzyme controlling marijuana psychoactivity, is secreted into the storage cavity of the glandular trichomes.

    PubMed

    Sirikantaramas, Supaart; Taura, Futoshi; Tanaka, Yumi; Ishikawa, Yu; Morimoto, Satoshi; Shoyama, Yukihiro

    2005-09-01

    Tetrahydrocannabinolic acid (THCA) synthase is the enzyme responsible for the production of tetrahydrocannabinol (THC), the psychoactive component of marijuana (Cannabis sativa L.). We suggest herein that THCA is biosynthesized in the storage cavity of the glandular trichomes based on the following observations. (i) The exclusive expression of THCA synthase was confirmed in the secretory cells of glandular trichomes by reverse transcription-PCR (RT-PCR) analysis. (ii) THCA synthase activity was detected in the storage cavity content. (iii) Transgenic tobacco expressing THCA synthase fused to green fluorescent protein showed fluorescence in the trichome head corresponding to the storage cavity. These results also showed that secretory cells of the glandular trichomes secrete not only metabolites but also biosynthetic enzyme.

  8. Efficient transformation of wheat by using a mutated rice acetolactate synthase gene as a selectable marker.

    PubMed

    Ogawa, Taiichi; Kawahigashi, Hiroyuki; Toki, Seiichi; Handa, Hirokazu

    2008-08-01

    Acetolactate synthase (ALS) is a target enzyme for many herbicides, including sulfonylurea and imidazolinone. We investigated the usefulness of a mutated ALS gene of rice, which had double point mutations and encoded an herbicide-resistant form of the enzyme, as a selectable marker for wheat transformation. After the genomic DNA fragment from rice containing the mutated ALS gene was introduced into immature embryos by means of particle bombardment, transgenic plants were efficiently selected with the herbicide bispyribac sodium (BS). Southern blot analysis confirmed that transgenic plants had one to more than ten copies of the transgene in their chromosomes. Adjustment of the BS concentration combined with repeated selection effectively prevented nontransgenic plants from escaping herbicide selection. Measurement of ALS activity indicated that transgenic plants produced an herbicide-resistant form of ALS and therefore had acquired the resistance to BS. This report is the first to describe a selection system for wheat transformation that uses a selectable marker gene of plant origin.

  9. Transcriptional modulation of squalene synthase genes in barley treated with PGPR

    PubMed Central

    Yousaf, Anam; Qadir, Abdul; Anjum, Tehmina; Ahmad, Aqeel

    2015-01-01

    Phytosterol contents and food quality of plant produce is directly associated with transcription of gene squalene synthase (SS). In current study, barley plants were treated with different rhizobacterial strains under semi controlled (27 ± 3°C) greenhouse conditions in order to modulate expression of SS gene. Plant samples were analyzed through semi-quantitative PCR to evaluate effect of rhizobacterial application on transcriptional status of SS. Results revealed that among four SS genes (i.e., SSA, SS1, SS2, and SS3), the most expressive gene was SSA; while, SS2 was screened out as the second best induced gene due to Acetobacter aceti. The most efficient bacterial strain which recorded maximum gene expression was A. aceti AC8. Moreover, AC7 was reported as the least efficient bacterial species for inducing SS gene expression. AC8 enhanced the share of SSA and SS2 up to 43 and 31%, respectively. The study also described ribosomal sequence of the most efficient bacterial strain AC8, which was used to determine its phylogenetic relationships with other microbial strains. The study would be helpful to improve quality of plant produce by modulating transcription of SS genes. PMID:26388880

  10. The maize brown midrib4 (bm4) gene encodes a functional folylpolyglutamate synthase

    PubMed Central

    Li, Li; Hill-Skinner, Sarah; Liu, Sanzhen; Beuchle, Danielle; Tang, Ho Man; Yeh, Cheng-Ting; Nettleton, Dan; Schnable, Patrick S

    2015-01-01

    Mutations in the brown midrib4 (bm4) gene affect the accumulation and composition of lignin in maize. Fine-mapping analysis of bm4 narrowed the candidate region to an approximately 105 kb interval on chromosome 9 containing six genes. Only one of these six genes, GRMZM2G393334, showed decreased expression in mutants. At least four of 10 Mu-induced bm4 mutant alleles contain a Mu insertion in the GRMZM2G393334 gene. Based on these results, we concluded that GRMZM2G393334 is the bm4 gene. GRMZM2G393334 encodes a putative folylpolyglutamate synthase (FPGS), which functions in one-carbon (C1) metabolism to polyglutamylate substrates of folate-dependent enzymes. Yeast complementation experiments demonstrated that expression of the maize bm4 gene in FPGS-deficient met7 yeast is able to rescue the yeast mutant phenotype, thus demonstrating that bm4 encodes a functional FPGS. Consistent with earlier studies, bm4 mutants exhibit a modest decrease in lignin concentration and an overall increase in the S:G lignin ratio relative to wild-type. Orthologs of bm4 include at least one paralogous gene in maize and various homologs in other grasses and dicots. Discovery of the gene underlying the bm4 maize phenotype illustrates a role for FPGS in lignin biosynthesis. PMID:25495051

  11. Volatile emissions of scented Alstroemeria genotypes are dominated by terpenes, and a myrcene synthase gene is highly expressed in scented Alstroemeria flowers.

    PubMed

    Aros, Danilo; Gonzalez, Veronica; Allemann, Rudolf K; Müller, Carsten T; Rosati, Carlo; Rogers, Hilary J

    2012-04-01

    Native to South America, Alstroemeria flowers are known for their colourful tepals, and Alstroemeria hybrids are an important cut flower. However, in common with many commercial cut flowers, virtually all the commercial Alstroemeria hybrids are not scented. The cultivar 'Sweet Laura' is one of very few scented commercial Alstroemeria hybrids. Characterization of the volatile emission profile of these cut flowers revealed three major terpene compounds: (E)-caryophyllene, humulene (also known as α-caryophyllene), an ocimene-like compound, and several minor peaks, one of which was identified as myrcene. The profile is completely different from that of the parental scented species A. caryophyllaea. Volatile emission peaked at anthesis in both scented genotypes, coincident in cv. 'Sweet Laura' with the maximal expression of a putative terpene synthase gene AlstroTPS. This gene was preferentially expressed in floral tissues of both cv. 'Sweet Laura' and A. caryophyllaea. Characterization of the AlstroTPS gene structure from cv. 'Sweet Laura' placed it as a member of the class III terpene synthases, and the predicted 567 amino acid sequence placed it into the subfamily TPS-b. The conserved sequences R(28)(R)X(8)W and D(321)DXXD are the putative Mg(2+)-binding sites, and in vitro assay of AlstroTPS expressed in Escherichia coli revealed that the encoded enzyme possesses myrcene synthase activity, consistent with a role for AlstroTPS in scent production in Alstroemeria cv. 'Sweet Laura' flowers.

  12. Functional Analysis of the Brassica napus L. Phytoene Synthase (PSY) Gene Family

    PubMed Central

    López-Emparán, Ada; Quezada-Martinez, Daniela; Zúñiga-Bustos, Matías; Cifuentes, Víctor; Iñiguez-Luy, Federico; Federico, María Laura

    2014-01-01

    Phytoene synthase (PSY) has been shown to catalyze the first committed and rate-limiting step of carotenogenesis in several crop species, including Brassica napus L. Due to its pivotal role, PSY has been a prime target for breeding and metabolic engineering the carotenoid content of seeds, tubers, fruits and flowers. In Arabidopsis thaliana, PSY is encoded by a single copy gene but small PSY gene families have been described in monocot and dicotyledonous species. We have recently shown that PSY genes have been retained in a triplicated state in the A- and C-Brassica genomes, with each paralogue mapping to syntenic locations in each of the three “Arabidopsis-like” subgenomes. Most importantly, we have shown that in B. napus all six members are expressed, exhibiting overlapping redundancy and signs of subfunctionalization among photosynthetic and non photosynthetic tissues. The question of whether this large PSY family actually encodes six functional enzymes remained to be answered. Therefore, the objectives of this study were to: (i) isolate, characterize and compare the complete protein coding sequences (CDS) of the six B. napus PSY genes; (ii) model their predicted tridimensional enzyme structures; (iii) test their phytoene synthase activity in a heterologous complementation system and (iv) evaluate their individual expression patterns during seed development. This study further confirmed that the six B. napus PSY genes encode proteins with high sequence identity, which have evolved under functional constraint. Structural modeling demonstrated that they share similar tridimensional protein structures with a putative PSY active site. Significantly, all six B. napus PSY enzymes were found to be functional. Taking into account the specific patterns of expression exhibited by these PSY genes during seed development and recent knowledge of PSY suborganellar localization, the selection of transgene candidates for metabolic engineering the carotenoid content of

  13. Functional analysis of the Brassica napus L. phytoene synthase (PSY) gene family.

    PubMed

    López-Emparán, Ada; Quezada-Martinez, Daniela; Zúñiga-Bustos, Matías; Cifuentes, Víctor; Iñiguez-Luy, Federico; Federico, María Laura

    2014-01-01

    Phytoene synthase (PSY) has been shown to catalyze the first committed and rate-limiting step of carotenogenesis in several crop species, including Brassica napus L. Due to its pivotal role, PSY has been a prime target for breeding and metabolic engineering the carotenoid content of seeds, tubers, fruits and flowers. In Arabidopsis thaliana, PSY is encoded by a single copy gene but small PSY gene families have been described in monocot and dicotyledonous species. We have recently shown that PSY genes have been retained in a triplicated state in the A- and C-Brassica genomes, with each paralogue mapping to syntenic locations in each of the three "Arabidopsis-like" subgenomes. Most importantly, we have shown that in B. napus all six members are expressed, exhibiting overlapping redundancy and signs of subfunctionalization among photosynthetic and non photosynthetic tissues. The question of whether this large PSY family actually encodes six functional enzymes remained to be answered. Therefore, the objectives of this study were to: (i) isolate, characterize and compare the complete protein coding sequences (CDS) of the six B. napus PSY genes; (ii) model their predicted tridimensional enzyme structures; (iii) test their phytoene synthase activity in a heterologous complementation system and (iv) evaluate their individual expression patterns during seed development. This study further confirmed that the six B. napus PSY genes encode proteins with high sequence identity, which have evolved under functional constraint. Structural modeling demonstrated that they share similar tridimensional protein structures with a putative PSY active site. Significantly, all six B. napus PSY enzymes were found to be functional. Taking into account the specific patterns of expression exhibited by these PSY genes during seed development and recent knowledge of PSY suborganellar localization, the selection of transgene candidates for metabolic engineering the carotenoid content of oilseeds

  14. Essential amino acids of starch synthase IIa differentiate amylopectin structure and starch quality between japonica and indica rice varieties.

    PubMed

    Nakamura, Yasunori; Francisco, Perigio B; Hosaka, Yuko; Sato, Aya; Sawada, Takayuki; Kubo, Akiko; Fujita, Naoko

    2005-05-01

    Four amino acids were variable between the 'active' indica-type and 'inactive' japonica-type soluble starch synthase IIa (SSIIa) of rice plants; Glu-88 and Gly-604 in SSIIa of indica-cultivars IR36 and Kasalath were replaced by Asp-88 and Ser-604, respectively, in both japonica cultivars Nipponbare and Kinmaze SSIIa, whereas Val-737 and Leu-781 in indica SSIIa were replaced by Met-737 in cv. Nipponbare and Phe-781 in cv. Kinmaze SSIIa, respectively. The SSIIa gene fragments shuffling experiments revealed that Val-737 and Leu-781 are essential not only for the optimal SSIIa activity, but also for the capacity to synthesize indica-type amylopectin. Surprisingly, however, a combination of Phe-781 and Gly-604 could restore about 44% of the SSIIa activity provided that Val-737 was conserved. The introduction of the 'active' indica-type SSIIa gene enabled the japonica-type cv. Kinmaze to synthesize indica-type amylopectin. The starch in the transformed japonica rice plants exhibited gelatinization-resistant properties that are characteristic of indica-rice starch. Transformed lines expressing different levels of the IR36 SSIIa protein produced a variety of starches with amylopectin chain-length distribution patterns that correlated well with their onset temperatures of gelatinization. The present study confirmed that the SSIIa activity determines the type of amylopectin structure of rice starch to be either the typical indica-type or japonica-type, by playing a specific role in the synthesis of the long B(1) chains by elongating short A and B(1) chains, notwithstanding the presence of functional two additional SSII genes, a single SSI gene, two SSIII genes, and two SSIV genes in rice plants.

  15. 2C-Methyl- D- erythritol 2,4-cyclodiphosphate synthase from Stevia rebaudiana Bertoni is a functional gene.

    PubMed

    Kumar, Hitesh; Singh, Kashmir; Kumar, Sanjay

    2012-12-01

    Stevia [Stevia rebaudiana (Bertoni)] is a perennial herb which accumulates sweet diterpenoid steviol glycosides (SGs) in its leaf tissue. SGs are synthesized by 2C-methyl-D-erythritol 4-phosphate (MEP) pathway. Of the various enzymes of the MEP pathway, 2C-methyl-D-erythritol 2,4-cyclodiphosphate synthase (MDS) (encoded by MDS) catalyzes the cyclization of 4-(cytidine 5' diphospho)-2C-methyl-D-erythritol 2-phosphate into 2C-methyl-D-erythritol 2,4-cyclodiphosphate. Complementation of the MDS knockout mutant strain of Escherichia coli, EB370 with putative MDS of stevia (SrMDS) rescued the lethal mutant, suggesting SrMDS to be a functional gene. Experiments conducted in plant growth chamber and in the field suggested SrMDS to be a light regulated gene. Indole 3-acetic acid (IAA; 50, 100 μM) down-regulated the expression of SrMDS at 4 h of the treatment, whereas, abscisic acid did not modulate its expression. A high expression of SrMDS was observed during the light hours of the day as compared to the dark hours. The present work established functionality of SrMDS and showed the role of light and IAA in regulating expression of SrMDS.

  16. DHA Production in Escherichia coli by Expressing Reconstituted Key Genes of Polyketide Synthase Pathway from Marine Bacteria

    PubMed Central

    Xiao, Kang; Xu, Lin; Wang, Lian; Wan, Xia

    2016-01-01

    The gene encoding phosphopantetheinyl transferase (PPTase), pfaE, a component of the polyketide synthase (PKS) pathway, is crucial for the production of docosahexaenoic acid (DHA, 22:6ω3), along with the other pfa cluster members pfaA, pfaB, pfaC and pfaD. DHA was produced in Escherichia coli by co-expressing pfaABCD from DHA-producing Colwellia psychrerythraea 34H with one of four pfaE genes from bacteria producing arachidonic acid (ARA, 20:4ω6), eicosapentaenoic acid (EPA, 20:5ω3) or DHA, respectively. Substitution of the pfaE gene from different strain source in E. coli did not influence the function of the PKS pathway producing DHA, although they led to different DHA yields and fatty acid profiles. This result suggested that the pfaE gene could be switchable between these strains for the production of DHA. The DHA production by expressing the reconstituted PKS pathway was also investigated in different E. coli strains, at different temperatures, or with the treatment of cerulenin. The highest DHA production, 2.2 mg of DHA per gram of dry cell weight or 4.1% of total fatty acids, was obtained by co-expressing pfaE(EPA) from the EPA-producing strain Shewanella baltica with pfaABCD in DH5α. Incubation at low temperature (10–15°C) resulted in higher accumulation of DHA compared to higher temperatures. The addition of cerulenin to the medium increased the proportion of DHA and saturated fatty acids, including C12:0, C14:0 and C16:0, at the expense of monounsaturated fatty acids, including C16:1 and C18:1. Supplementation with 1 mg/L cerulenin resulted in the highest DHA yield of 2.4 mg/L upon co-expression of pfaE(DHA) from C. psychrerythraea. PMID:27649078

  17. Development of intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase for discriminating Curcuma species.

    PubMed

    Kita, Tomoko; Komatsu, Katsuko; Zhu, Shu; Iida, Osamu; Sugimura, Koji; Kawahara, Nobuo; Taguchi, Hiromu; Masamura, Noriya; Cai, Shao-Qing

    2016-03-01

    Various Curcuma rhizomes have been used as medicines or spices in Asia since ancient times. It is very difficult to distinguish them morphologically, especially when they are boiled and dried, which causes misidentification leading to a loss of efficacy. We developed a method for discriminating Curcuma species by intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase. This method could apply to identification of not only fresh plants but also samples of crude drugs or edible spices. By applying this method to Curcuma specimens and samples, and constructing a dendrogram based on these markers, seven Curcuma species were clearly distinguishable. Moreover, Curcuma longa specimens were geographically distinguishable. On the other hand, Curcuma kwangsiensis (gl type) specimens also showed intraspecies polymorphism, which may have occurred as a result of hybridization with other Curcuma species. The molecular method we developed is a potential tool for global classification of the genus Curcuma.

  18. Evolution of the chitin synthase gene family correlates with fungal morphogenesis and adaption to ecological niches

    PubMed Central

    Liu, Ran; Xu, Chuan; Zhang, Qiangqiang; Wang, Shiyi; Fang, Weiguo

    2017-01-01

    The fungal kingdom potentially has the most complex chitin synthase (CHS) gene family, but evolution of the fungal CHS gene family and its diversification to fulfill multiple functions remain to be elucidated. Here, we identified the full complement of CHSs from 231 fungal species. Using the largest dataset to date, we characterized the evolution of the fungal CHS gene family using phylogenetic and domain structure analysis. Gene duplication, domain recombination and accretion are major mechanisms underlying the diversification of the fungal CHS gene family, producing at least 7 CHS classes. Contraction of the CHS gene family is morphology-specific, with significant loss in unicellular fungi, whereas family expansion is lineage-specific with obvious expansion in early-diverging fungi. ClassV and ClassVII CHSs with the same domain structure were produced by the recruitment of domains PF00063 and PF08766 and subsequent duplications. Comparative analysis of their functions in multiple fungal species shows that the emergence of ClassV and ClassVII CHSs is important for the morphogenesis of filamentous fungi, development of pathogenicity in pathogenic fungi, and heat stress tolerance in Pezizomycotina fungi. This work reveals the evolution of the fungal CHS gene family, and its correlation with fungal morphogenesis and adaptation to ecological niches. PMID:28300148

  19. Gene structure, phylogeny and expression profile of the sucrose synthase gene family in cacao (Theobroma cacao L.).

    PubMed

    Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui

    2015-09-01

    In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.

  20. A conditional mutant of the fatty acid synthase unveils unexpected cross talks in mycobacterial lipid metabolism.

    PubMed

    Cabruja, Matías; Mondino, Sonia; Tsai, Yi Ting; Lara, Julia; Gramajo, Hugo; Gago, Gabriela

    2017-02-01

    Unlike most bacteria, mycobacteria rely on the multi-domain enzyme eukaryote-like fatty acid synthase I (FAS I) to make fatty acids de novo. These metabolites are precursors of the biosynthesis of most of the lipids present both in the complex mycobacteria cell wall and in the storage lipids inside the cell. In order to study the role of the type I FAS system in Mycobacterium lipid metabolism in vivo, we constructed a conditional mutant in the fas-acpS operon of Mycobacterium smegmatis and analysed in detail the impact of reduced de novo fatty acid biosynthesis on the global architecture of the cell envelope. As expected, the mutant exhibited growth defect in the non-permissive condition that correlated well with the lower expression of fas-acpS and the concomitant reduction of FAS I, confirming that FAS I is essential for survival. The reduction observed in FAS I provoked an accumulation of its substrates, acetyl-CoA and malonyl-CoA, and a strong reduction of C12 to C18 acyl-CoAs, but not of long-chain acyl-CoAs (C19 to C24). The most intriguing result was the ability of the mutant to keep synthesizing mycolic acids when fatty acid biosynthesis was impaired. A detailed comparative lipidomic analysis showed that although reduced FAS I levels had a strong impact on fatty acid and phospholipid biosynthesis, mycolic acids were still being synthesized in the mutant, although with a different relative species distribution. However, when triacylglycerol degradation was inhibited, mycolic acid biosynthesis was significantly reduced, suggesting that storage lipids could be an intracellular reservoir of fatty acids for the biosynthesis of complex lipids in mycobacteria. Understanding the interaction between FAS I and the metabolic pathways that rely on FAS I products is a key step to better understand how lipid homeostasis is regulated in this microorganism and how this regulation could play a role during infection in pathogenic mycobacteria.

  1. Tissue-specific gene silencing mediated by a naturally occurring chalcone synthase gene cluster in Glycine max.

    PubMed

    Tuteja, Jigyasa H; Clough, Steven J; Chan, Wan-Ching; Vodkin, Lila O

    2004-04-01

    Chalcone synthase, a key regulatory enzyme in the flavonoid pathway, constitutes an eight-member gene family in Glycine max (soybean). Three of the chalcone synthase (CHS) gene family members are arranged as inverted repeats in a 10-kb region, corresponding to the I locus (inhibitor). Spontaneous mutations of a dominant allele (I or i(i)) to a recessive allele (i) have been shown to delete promoter sequences, paradoxically increasing total CHS transcript levels and resulting in black seed coats. However, it is not known which of the gene family members contribute toward pigmentation and how this locus affects CHS expression in other tissues. We investigated the unusual nature of the I locus using four pairs of isogenic lines differing with respect to alleles of the I locus. RNA gel blots using a generic open reading frame CHS probe detected similar CHS transcript levels in stems, roots, leaves, young pods, and cotyledons of the yellow and black isolines but not in the seed coats, which is consistent with the dominant I and i(i) alleles mediating CHS gene silencing in a tissue-specific manner. Using real-time RT-PCR, a variable pattern of expression of CHS genes in different tissues was demonstrated. However, increase in pigmentation in the black seed coats was associated with release of the silencing effect specifically on CHS7/CHS8, which occurred at all stages of seed coat development. These expression changes were linked to structural changes taking place at the I locus, shown to encompass a much wider region of at least 27 kb, comprising two identical 10.91-kb stretches of CHS gene duplications. The suppressive effect of this 27-kb I locus in a specific tissue of the G. max plant represents a unique endogenous gene silencing mechanism.

  2. Tissue-Specific Gene Silencing Mediated by a Naturally Occurring Chalcone Synthase Gene Cluster in Glycine maxW⃞

    PubMed Central

    Tuteja, Jigyasa H.; Clough, Steven J.; Chan, Wan-Ching; Vodkin, Lila O.

    2004-01-01

    Chalcone synthase, a key regulatory enzyme in the flavonoid pathway, constitutes an eight-member gene family in Glycine max (soybean). Three of the chalcone synthase (CHS) gene family members are arranged as inverted repeats in a 10-kb region, corresponding to the I locus (inhibitor). Spontaneous mutations of a dominant allele (I or ii) to a recessive allele (i) have been shown to delete promoter sequences, paradoxically increasing total CHS transcript levels and resulting in black seed coats. However, it is not known which of the gene family members contribute toward pigmentation and how this locus affects CHS expression in other tissues. We investigated the unusual nature of the I locus using four pairs of isogenic lines differing with respect to alleles of the I locus. RNA gel blots using a generic open reading frame CHS probe detected similar CHS transcript levels in stems, roots, leaves, young pods, and cotyledons of the yellow and black isolines but not in the seed coats, which is consistent with the dominant I and ii alleles mediating CHS gene silencing in a tissue-specific manner. Using real-time RT-PCR, a variable pattern of expression of CHS genes in different tissues was demonstrated. However, increase in pigmentation in the black seed coats was associated with release of the silencing effect specifically on CHS7/CHS8, which occurred at all stages of seed coat development. These expression changes were linked to structural changes taking place at the I locus, shown to encompass a much wider region of at least 27 kb, comprising two identical 10.91-kb stretches of CHS gene duplications. The suppressive effect of this 27-kb I locus in a specific tissue of the G. max plant represents a unique endogenous gene silencing mechanism. PMID:15064367

  3. Tissue-specific expression and dietary regulation of chimeric mitochondrial 3-hydroxy-3-methylglutaryl coenzyme A synthase/human growth hormone gene in transgenic mice.

    PubMed

    Serra, D; Fillat, C; Matas, R; Bosch, F; Hegardt, F G

    1996-03-29

    We have studied the role of the mitochondrial 3-hydroxy-3-methylglutaryl CoA (HMG-CoA) synthase gene in regulating ketogenesis. The gene exhibits expression in various tissues and it is regulated in a tissue-specific manner. To investigate the underlying mechanisms of this expression, we linked a 1148-base-pair portion of the mitochondrial HMG-CoA synthase promoter to the human growth hormone (hGH) gene and analyzed the expression of the hGH reporter gene in transgenic mice. mRNA levels of hGH were observed in liver, testis, ovary, stomach, colon, cecum, brown adipose tissue, spleen, adrenal glands, and mammary glands from adult mice, and also in liver and stomach, duodenum, jejunum, brown adipose tissue, and heart of suckling mice. There was no expression either in kidney or in any other nonketogenic tissue. The comparison between these data and those of the endogenous mitochondrial HMG-CoA synthase gene suggests that the 1148 base pairs of the promoter contain the elements necessary for expression in liver and testis, but an enhancer is necessary for full expression in intestine of suckling animals and that a silencer prevents expression in stomach, brown adipose tissue, spleen, adrenal glands, and mammary glands in wild type adult mice. In starvation, transgenic mice showed higher expression in liver than did wild type. Both refeeding and insulin injection reduced the expression. Fat diets, composed in each case of different fatty acids, produced similar expression levels, respectively, to those found in wild type animals, suggesting that long-, medium-, and short-chain fatty acids may exert a positive influence on the transcription rate in this 1148-base-pair portion of the promoter. The ketogenic capacity of liver and the blood ketone body levels were equal in transgenic mice and in nontransgenic mice.

  4. Cloning of a cDNA that encodes farnesyl diphosphate synthase and the blue-light-induced expression of the corresponding gene in the leaves of rice plants.

    PubMed

    Sanmiya, K; Iwasaki, T; Matsuoka, M; Miyao, M; Yamamoto, N

    1997-02-28

    A cDNA encoding farnesyl diphosphate synthase (FPPS), a key enzyme in isoprenoid biosynthesis, was isolated from a cDNA library constructed from mRNA that had been prepared from etiolated rice (Oriza sativa L. variety Nipponbare) seedlings after three hours of illumination by a subtraction method. The putative polypeptide deduced from the 1289 bp nucleotide sequence consisted of 353 amino acids and had a molecular mass of 40 676 Da. The predicted amino acid sequence exhibited high homology to those of FPPS from Arabidopsis (73% to type 1, 72% to type 2) and white lupin (74%). Southern blot analysis showed that the rice genome might contain only one gene for FPPS. The highest level of expression of the gene was demonstrated in leaves by RNA blot analysis. Moreover, light, in particular blue light, effectively enhanced expression of the gene.

  5. Tracking sesamin synthase gene expression through seed maturity in wild and cultivated sesame species--a domestication footprint.

    PubMed

    Pathak, N; Bhaduri, A; Bhat, K V; Rai, A K

    2015-09-01

    Sesamin and sesamolin are the major oil-soluble lignans present in sesame seed, having a wide range of biological functions beneficial to human health. Understanding sesame domestication history using sesamin synthase gene expression could enable delineation of the sesame putative progenitor. This report examined the functional expression of sesamin synthase (CYP81Q1) during capsule maturation (0-40 days after flowering) in three wild Sesamum species and four sesame cultivars. Among the cultivated accessions, only S. indicum (CO-1) exhibited transcript abundance of sesamin synthase along with high sesamin content similar to S. malabaricum, while the other cultivated sesame showed low expression. The sesamin synthase expression analysis, coupled with quantification of sesamin level, indicates that sesamin synthase was not positively favoured during domestication. The sesamin synthase expression pattern and lignan content, along with phylogenetic analysis suggested a close relationship of cultivated sesame and the wild species S. malabaricum. The high genetic identity between the two species S. indicum and S. malabaricum points towards the role of the putative progenitor S. malabaricum in sesame breeding programmes to broaden the genetic base of sesame cultivars. This study emphasises the need to investigate intraspecific and interspecific variation in the primary, secondary and tertiary gene pools to develop superior sesame genotypes.

  6. Insect attack and wounding induce traumatic resin duct development and gene expression of (-)-pinene synthase in Sitka spruce.

    PubMed

    McKay, S Ashley Byun; Hunter, William L; Godard, Kimberley-Ann; Wang, Shawn X; Martin, Diane M; Bohlmann, Jörg; Plant, Aine L

    2003-09-01

    Conifers possess inducible terpenoid defense systems. These systems are associated with the formation of traumatic resin ducts (TRD) and are underpinned by enhanced gene expression and activity of terpene synthases (TPS), enzymes responsible for oleoresin formation. We first determined that Sitka spruce (Picea sitchensis [Bong.] Carriere) had the capacity for TRD formation by mechanically wounding representative trees. We then proceeded to investigate whether the white pine weevil (Pissodes strobi Peck.), a stem-boring insect, can influence the expression of genes encoding monoterpene synthases (mono-tps) in Sitka spruce. We went on to compare this response with the effects of a simulated insect attack by drill wounding. A significant increase in mono-tps transcript level was observed in the leaders of lateral branches of weevil-attacked and mechanically wounded trees. In this study, weevils induced a more rapid enhancement of mono-tps gene expression. A full-length Sitka spruce mono-tps cDNA (PsTPS2) was isolated, expressed in Escherichia coli, and functionally identified as (-)-pinene synthase. The recombinant (-)-pinene synthase catalyzes the formation of (-)-alpha-pinene and (-)-beta-pinene, both of which are known constituents of stem oleoresin in Sitka spruce and increase in abundance after weevil attack. These data suggest that increased (-)-pinene synthase gene expression is an important element of the direct defense system deployed in Sitka spruce after insect attack.

  7. Structure and conformational variability of the mycobacterium tuberculosis fatty acid synthase multienzyme complex.

    PubMed

    Ciccarelli, Luciano; Connell, Sean R; Enderle, Mathias; Mills, Deryck J; Vonck, Janet; Grininger, Martin

    2013-07-02

    Antibiotic therapy in response to Mycobacterium tuberculosis infections targets de novo fatty acid biosynthesis, which is orchestrated by a 1.9 MDa type I fatty acid synthase (FAS). Here, we characterize M. tuberculosis FAS by single-particle cryo-electron microscopy and interpret the data by docking the molecular models of yeast and Mycobacterium smegmatis FAS. Our analysis reveals a porous barrel-like structure of considerable conformational variability that is illustrated by the identification of several conformational states with altered topology in the multienzymatic assembly. This demonstrates that the barrel-like structure of M. tuberculosis FAS is not just a static scaffold for the catalytic domains, but may play an active role in coordinating fatty acid synthesis. The conception of M. tuberculosis FAS as a highly dynamic assembly of domains revises the view on bacterial type I fatty acid synthesis and might inspire new strategies for inhibition of de novo fatty acid synthesis in M. tuberculosis.

  8. (E)-β-farnesene synthase genes affect aphid (Myzus persicae) infestation in tobacco (Nicotiana tabacum).

    PubMed

    Yu, Xiudao; Jones, Huw D; Ma, Youzhi; Wang, Genping; Xu, Zhaoshi; Zhang, Baoming; Zhang, Yongjun; Ren, Guangwei; Pickett, John A; Xia, Lanqin

    2012-03-01

    Aphids are major agricultural pests which cause significant yield losses of the crop plants each year. (E)-β-farnesene (EβF) is the alarm pheromone involved in the chemical communication between aphids and particularly in the avoidance of predation. In the present study, two EβF synthase genes were isolated from sweet wormwood and designated as AaβFS1 and AaβFS2, respectively. Overexpression of AaβFS1 or AaβFS2 in tobacco plants resulted in the emission of EβF ranging from 1.55 to 4.65 ng/day/g fresh tissues. Tritrophic interactions involving the peach aphids (Myzus persicae), predatory lacewings (Chrysopa septempunctata) demonstrated that the transgenic tobacco expressing AaβFS1 and AaβFS2 could repel peach aphids, but not as strongly as expected. However, AaβFS1 and AaβFS2 lines exhibited strong and statistically significant attraction to lacewings. Further experiments combining aphids and lacewing larvae in an octagon arrangement showed transgenic tobacco plants could repel aphids and attract lacewing larvae, thus minimizing aphid infestation. Therefore, we demonstrated a potentially valuable strategy of using EβF synthase genes from sweet wormwood for aphid control in tobacco or other economic important crops in an environmentally benign way.

  9. Altered ceramide acyl chain length and ceramide synthase gene expression in Parkinson’s disease.

    PubMed

    Abbott, Sarah K; Li, Hongyun; Muñoz, Sonia Sanz; Knoch, Bianca; Batterham, Marijka; Murphy, Karen E; Halliday, Glenda M; Garner, Brett

    2014-04-01

    Genetic studies have provided increasing evidence that ceramide homeostasis plays a role in neurodegenerative diseases including Parkinson’s disease (PD). It is known that the relative amounts of different ceramide molecular species, as defined by their fatty acyl chain length, regulate ceramide function in lipid membranes and in signaling pathways. In the present study we used a comprehensive sphingolipidomic case-control approach to determine the effects of PD on ceramide composition in postmortem brain tissue from the anterior cingulate cortex (a region with significant PD pathology) and the occipital cortex (spared in PD), also assessing mRNA expression of the major ceramide synthase genes that regulate ceramide acyl chain composition in the same tissue using quantitative PCR. In PD anterior cingulate cortex but not occipital cortex, total ceramide and sphingomyelin levels were reduced from control levels by 53% (P < 0.001) and 42% (P < 0.001), respectively. Of the 13 ceramide and 15 sphingomyelin molecular lipid species identified and quantified, there was a significant shift in the ceramide acyl chain composition toward shorter acyl chain length in the PD anterior cingulate cortex. This PD-associated change in ceramide acyl chain composition was accompanied by an upregulation of ceramide synthase-1 gene expression, which we consider may represent a response to reduced ceramide levels. These data suggest a significant shift in ceramide function in lipid membranes and signaling pathways occurs in regions with PD pathology. Identifying the regulatory mechanisms precipitating this change may provide novel targets for future therapeutics.

  10. Morphological changes induced by class III chitin synthase gene silencing could enhance penicillin production of Penicillium chrysogenum.

    PubMed

    Liu, Hui; Zheng, Zhiming; Wang, Peng; Gong, Guohong; Wang, Li; Zhao, Genhai

    2013-04-01

    Chitin synthases catalyze the formation of β-(1,4)-glycosidic bonds between N-acetylglucosamine residues to form the unbranched polysaccharide chitin, which is the major component of cell walls in most filamentous fungi. Several studies have shown that chitin synthases are structurally and functionally divergent and play crucial roles in the growth and morphogenesis of the genus Aspergillus although little research on this topic has been done in Penicillium chrysogenum. We used BLAST to find the genes encoding chitin synthases in P. chrysogenum related to chitin synthase genes in Aspergillus nidulans. Three homologous sequences coding for a class III chitin synthase CHS4 and two hypothetical proteins in P. chrysogenum were found. The gene which product showed the highest identity and encoded the class III chitin synthase CHS4 was studied in detail. To investigate the role of CHS4 in P. chrysogenum morphogenesis, we developed an RNA interference system to silence the class III chitin synthase gene chs4. After transformation, mutants exhibited a slow growth rate and shorter and more branched hyphae, which were distinct from those of the original strain. The results also showed that the conidiation efficiency of all transformants was reduced sharply and indicated that chs4 is essential in conidia development. The morphologies of all transformants and the original strain in penicillin production were investigated by light microscopy, which showed that changes in chs4 expression led to a completely different morphology during fermentation and eventually caused distinct penicillin yields, especially in the transformants PcRNAi1-17 and PcRNAi2-1 where penicillin production rose by 27 % and 41 %, respectively.

  11. Characterization of 1-hydroxy-2-methyl-2-(E)-butenyl-4-diphosphate synthase (HDS) gene from Ginkgo biloba.

    PubMed

    Kim, Sang-Min; Kim, Soo-Un

    2010-02-01

    Diterpene trilactone ginkgolides, one of the major constituents of Ginkgo biloba extract, have shown interesting bioactivities including platelet-activating factor antagonistic activity. 1-Hydroxy-2-methyl-2-(E)-butenyl-4-diphosphate synthase (HDS), converting 2-C-methyl-d-erythritol-2,4-cyclodiphosphate into 1-hydroxy-2-methyl-2-(E)-butenyl-4-diphosphate, is the penultimate enzyme of the seven-step 2-C-methyl-d-erythritol 4-phosphate pathway that supplies building blocks for plant isoprenoids of plastid origin such as ginkgolides and carotenoids. Here, we report on the isolation and characterization of the full-length cDNA encoding HDS (GbHDS, GenBank accession number: DQ251630) from G. biloba. Full-length cDNA of GbHDS, 2,763 bp long, contained an ORF of 2,226 bp encoding a protein composed of 741 amino acids. The theoretical molecular weight and pI of the deduced mature GbHDS of 679 amino acid residues are 75.6 kDa and 5.5, respectively. From 2 weeks after initiation of the culture onward, transcription level of this gene in the ginkgo embryo roots increased to about two times higher than that in the leaves. GbHDS was predicted to possess chloroplast transit peptide of 62 amino acid residues, suggesting its putative localization in the plastids. The transient gene expression in Arabidopsis protoplasts confirmed that the transit peptide was capable of delivering the GbHDS protein from the cytosol into the chloroplasts. The isolation and characterization of GbHDS gene enabled us to further understand the role of GbHDS in the terpenoid biosynthesis in G. biloba.

  12. Copy Number Variation in Acetolactate Synthase Genes of Thifensulfuron-Methyl Resistant Alopecurus aequalis (Shortawn Foxtail) Accessions in Japan

    PubMed Central

    Iwakami, Satoshi; Shimono, Yoshiko; Manabe, Yohei; Endo, Masaki; Shibaike, Hiroyuki; Uchino, Akira; Tominaga, Tohru

    2017-01-01

    Severe infestations of Alopecurus aequalis (shortawn foxtail), a noxious weed in wheat and barley cropping systems in Japan, can occur even after application of thifensulfuron-methyl, a sulfonylurea (SU) herbicide. In the present study, nine accessions of A. aequalis growing in a single wheat field were tested for sensitivity to thifensulfuron-methyl. Seven of the nine accessions survived application of standard field rates of thifensulfuron-methyl, indicating that severe infestations likely result from herbicide resistance. Acetolactate synthase (ALS) is the target enzyme of SU herbicides. Full-length genes encoding ALS were therefore isolated to determine the mechanism of SU resistance. As a result, differences in ALS gene copy numbers among accessions were revealed. Two copies, ALS1 and ALS2, were conserved in all accessions, while some carried two additional copies, ALS3 and ALS4. A single-base deletion in ALS3 and ALS4 further indicated that they represent pseudogenes. No differences in ploidy level were observed between accessions with two or four copies of the ALS gene, suggesting that copy number varies. Resistant plants were found to carry a mutation in either the ALS1 or ALS2 gene, with all mutations causing an amino acid substitution at the Pro197 residue, which is known to confer SU resistance. Transcription of each ALS gene copy was confirmed by reverse transcription PCR, supporting involvement of these mutations in SU resistance. The information on the copy number and full-length sequences of ALS genes in A. aequalis will aid future analysis of the mechanism of resistance. PMID:28303143

  13. Pyrazinamide, but not pyrazinoic acid, is a competitive inhibitor of NADPH binding to Mycobacterium tuberculosis fatty acid synthase I.

    PubMed

    Sayahi, Halimah; Zimhony, Oren; Jacobs, William R; Shekhtman, Alexander; Welch, John T

    2011-08-15

    Pyrazinamide (PZA), an essential component of short-course anti-tuberculosis chemotherapy, was shown by Saturation Transfer Difference (STD) NMR methods to act as a competitive inhibitor of NADPH binding to purified Mycobacterium tuberculosis fatty acid synthase I (FAS I). Both PZA and pyrazinoic acid (POA) reversibly bind to FAS I but at different binding sites. The competitive binding of PZA and NADPH suggests potential FAS I binding sites. POA was not previously known to have any specific binding interactions. The STD NMR of NADPH bound to the mycobacterial FAS I was consistent with the orientation reported in published single crystal X-ray diffraction studies of fungal FAS I. Overall the differences in binding between PZA and POA are consistent with previous recognition of the importance of intracellular accumulation of POA for anti-mycobacterial activity.

  14. [Mechanism of genuineness of Glycyrrhiza uralensis based on SNP of β-Amyrin synthase gene].

    PubMed

    Zang, Yi-mei; Li, Yan-peng; Qiao, Jing; Chen, Hong-hao; Liu, Chun-sheng

    2015-07-01

    β-Amyrin synthase (β-AS) genes of Glycyrrhiza uralensis from 6 different regions were analyzed by PCR-SSCP and sequenced, then the correlationship between β-AS SNP and regions of Glycyrrhiza uralensis were determined. According to the 1 coding single nucleotide polymorphism on the first exon of β-AS gene at 94 bp site, Glycyrrhiza uralensis could be divided into 3 genotypes. In these genotypes, the percentage of 94A type in genuine regions was much higher, and it had significant differences with the percentage in non-genuine regions (P < 0.001). The results of the experiment proved that different β-AS genotypes at 94 bp site from different regions may be one of the important reasons to result in the genuineness of Glycyrrhiza uralensis.

  15. Identification and characterization of chitin synthase genes in the postharvest citrus fruit pathogen Penicillium digitatum.

    PubMed

    Gandía, Mónica; Harries, Eleonora; Marcos, Jose F

    2012-06-01

    In this study, we carried out the isolation and characterization of chitin synthase genes (CHS) of the main citrus fruit postharvest pathogen Penicillium digitatum. Using distinct sets of degenerate primers designed from conserved regions of CHS genes of yeast and filamentous fungi, PCR methods, and a DNA genomic library, five putative CHS genes (PdigCHSI, PdigCHSII, PdigCHSIII, PdigCHSV, and PdigCHSVII) were identified, isolated, sequenced, and characterized. Phylogenetic analyses, sequence identity, and domain conservation support the annotation as CHS. A very high sequence identity and strong synteny were found with corresponding regions from the genome of Penicillium chrysogenum. Gene expression of P. digitatum CHS genes during mycelium axenic growth, under oxidative and osmotic stress conditions, and during infection of citrus fruits was confirmed and quantified using quantitative RT-PCR (qRT-PCR). PdigCHSIII had the highest expression among the five genes by one order of magnitude, while PdigCHSII had the lowest. However, PdigCHSII was strongly induced coincident with conidial production, suggesting a role in conidiogenesis. The expression of PdigCHSI, PdigCHSIII, PdigCHSV, and PdigCHSVII was upregulated during infection of citrus fruit. PdigCHSV and PdigCHSVII coexpressed in most of the experiments carried out, and they are separated by a 1.77 kb intergenic region and arranged in opposite directions.

  16. ACTIVATION OF VASCULAR ENDOTHELIAL NITRIC OXIDE SYNTHASE AND HEME OXYGENASE-1 EXPRESSION BY ELECTROPHILIC NITRO-FATTY ACIDS

    PubMed Central

    Khoo, Nicholas K.H.; Rudolph, Volker; Cole, Marsha P.; Golin-Bisello, Franca; Schopfer, Francisco J.; Woodcock, Steven R.; Batthyany, Carlos; Freeman, Bruce A.

    2010-01-01

    Reactive oxygen species mediate a decrease in nitric oxide (NO) bioavailability and endothelial dysfunction, with secondary oxidized and nitrated byproducts of these reactions contributing to the pathogenesis of numerous vascular diseases. While oxidized lipids and lipoproteins exacerbate inflammatory reactions in the vasculature, in stark contrast the nitration of polyunsaturated fatty acids and complex lipids yield electrophilic products that exhibit pluripotent anti-inflammatory signaling capabilities acting via both cGMP-dependent and -independent mechanisms. Herein we report that nitro-oleic acid (OA-NO2) treatment increases expression of endothelial nitric oxide synthase (eNOS) and heme oxygenase 1 (HO-1) in the vasculature, thus transducing vascular protective effects associated with enhanced NO production. Administration of OA-NO2 via osmotic pump results in a significant increase in eNOS and HO-1 mRNA in mouse aortas. Moreover, HPLC-MS/MS analysis showed that NO2-FAs are rapidly metabolized in cultured endothelial cells (ECs) and treatment with NO2-FAs stimulated the phosphorylation of eNOS at Ser1179. These post-translational modifications of eNOS, in concert with elevated eNOS gene expression, contributed to an increase in endothelial NO production. In aggregate, OA-NO2-induced eNOS and HO-1 expression by vascular cells can induce beneficial effects on endothelial function and provide a new strategy for treating various vascular inflammatory and hypertensive disorders. PMID:19857569

  17. Transcriptional regulation of pig GYS1 gene by glycogen synthase kinase 3β (GSK3β).

    PubMed

    Wang, Yilin; Wang, Yan; Zhong, Tao; Guo, Jiazhong; Li, Li; Zhang, Hongping; Wang, Linjie

    2017-01-01

    Glycogen synthase kinase 3β (GSK3β) is a ubiquitous serine/threonine kinase and has important roles in glycogen metabolism biosynthesis. Studies have revealed that GSK3β can directly regulate the glycogen synthase activity, yet little is known about the regulation of GSK3β on GYS1 gene transcription. Here, we show that overexpression of GSK3β decreased the mRNA expression level of GYS1. Then we cloned approximately 1.5 kb of pig GYS1 gene promoter region, generated sequential deletion constructs, and evaluated their activity. A gradual increase of the promoter activity was seen with increasing length of the promoter sequence, reaching its highest activity to the sequence corresponding to nt -350 to +224, and then decreased. However, the activities of constructed promoter fragments show different responses to GSK3β co-transfection. By analyzing a series of GYS1 promoter reporter constructs, we have defined two crucial regions (-1488 to -539, -350 to -147) that are responsible for GSK3β-induced transcriptional repression. Furthermore, the ChIP results revealed that only the first and second NF-κB sites of GYS1 promoter could bind to p65, and overexpression of GSK3β induced a significant decrease in p65 binding to the second NF-κB binding site, suggesting that GSK3β may regulate expression of GYS1 gene through binding to the second rather than the first NF-κB site. These data suggest that the NF-κB plays important roles in the transcriptional activity of pig GYS1 gene regulated by GSK3β.

  18. UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6.

    PubMed

    Miyata, Maiko; Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko; Sugiura, Kazumitsu; Furukawa, Koichi; Furukawa, Keiko

    2014-03-07

    Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes.

  19. Evolution of Homospermidine Synthase in the Convolvulaceae: A Story of Gene Duplication, Gene Loss, and Periods of Various Selection Pressures[C][W][OA

    PubMed Central

    Kaltenegger, Elisabeth; Eich, Eckart; Ober, Dietrich

    2013-01-01

    Homospermidine synthase (HSS), the first pathway-specific enzyme of pyrrolizidine alkaloid biosynthesis, is known to have its origin in the duplication of a gene encoding deoxyhypusine synthase. To study the processes that followed this gene duplication event and gave rise to HSS, we identified sequences encoding HSS and deoxyhypusine synthase from various species of the Convolvulaceae. We show that HSS evolved only once in this lineage. This duplication event was followed by several losses of a functional gene copy attributable to gene loss or pseudogenization. Statistical analyses of sequence data suggest that, in those lineages in which the gene copy was successfully recruited as HSS, the gene duplication event was followed by phases of various selection pressures, including purifying selection, relaxed functional constraints, and possibly positive Darwinian selection. Site-specific mutagenesis experiments have confirmed that the substitution of sites predicted to be under positive Darwinian selection is sufficient to convert a deoxyhypusine synthase into a HSS. In addition, analyses of transcript levels have shown that HSS and deoxyhypusine synthase have also diverged with respect to their regulation. The impact of protein–protein interaction on the evolution of HSS is discussed with respect to current models of enzyme evolution. PMID:23572540

  20. Structure and function of ∆1-tetrahydrocannabinolic acid (THCA) synthase, the enzyme controlling the psychoactivity of Cannabis sativa.

    PubMed

    Shoyama, Yoshinari; Tamada, Taro; Kurihara, Kazuo; Takeuchi, Ayako; Taura, Futoshi; Arai, Shigeki; Blaber, Michael; Shoyama, Yukihiro; Morimoto, Satoshi; Kuroki, Ryota

    2012-10-12

    ∆1-Tetrahydrocannabinolic acid (THCA) synthase catalyzes the oxidative cyclization of cannabigerolic acid (CBGA) into THCA, the precursor of the primary psychoactive agent ∆1-tetrahydrocannabinol in Cannabis sativa. The enzyme was overproduced in insect cells, purified, and crystallized in order to investigate the structure-function relationship of THCA synthase, and the tertiary structure was determined to 2.75Å resolution by X-ray crystallography (R(cryst)=19.9%). The THCA synthase enzyme is a member of the p-cresol methyl-hydroxylase superfamily, and the tertiary structure is divided into two domains (domains I and II), with a flavin adenine dinucleotide coenzyme positioned between each domain and covalently bound to His114 and Cys176 (located in domain I). The catalysis of THCA synthesis involves a hydride transfer from C3 of CBGA to N5 of flavin adenine dinucleotide and the deprotonation of O6' of CBGA. The ionized residues in the active site of THCA synthase were investigated by mutational analysis and X-ray structure. Mutational analysis indicates that the reaction does not involve the carboxyl group of Glu442 that was identified as the catalytic base in the related berberine bridge enzyme but instead involves the hydroxyl group of Tyr484. Mutations at the active-site residues His292 and Tyr417 resulted in a decrease in, but not elimination of, the enzymatic activity of THCA synthase, suggesting a key role for these residues in substrate binding and not direct catalysis.

  1. Crystal structure of the thioesterase domain of human fatty acid synthase inhibited by orlistat

    SciTech Connect

    Pemble,C.; Johnson, L.; Kridel, S.; Lowther, W.

    2007-01-01

    Human fatty acid synthase (FAS) is uniquely expressed at high levels in many tumor types. Pharmacological inhibition of FAS therefore represents an important therapeutic opportunity. The drug Orlistat, which has been approved by the US Food and Drug Administration, inhibits FAS, induces tumor cell-specific apoptosis and inhibits the growth of prostate tumor xenografts. We determined the 2.3-{angstrom}-resolution crystal structure of the thioesterase domain of FAS inhibited by Orlistat. Orlistat was captured in the active sites of two thioesterase molecules as a stable acyl-enzyme intermediate and as the hydrolyzed product. The details of these interactions reveal the molecular basis for inhibition and suggest a mechanism for acyl-chain length discrimination during the FAS catalytic cycle. Our findings provide a foundation for the development of new cancer drugs that target FAS.

  2. Presence of fatty acid synthase inhibitors in the rhizome of Alpinia officinarum hance.

    PubMed

    Li, Bing-Hui; Tian, Wei-Xi

    2003-08-01

    The galangal (the rhizome of Alpinia officinarum, Hance) is popular in Asia as a traditional herbal medicine. The present study reports that the galangal extract (GE) can potently inhibit fatty-acid synthase (FAS, E.C.2.3.1.85). The inhibition consists of both reversible inhibition with an IC50 value of 1.73 microg dried GE/ml, and biphasic slow-binding inactivation. Subsequently the reversible inhibition and slow-binding inactivation to FAS were further studied. The inhibition of FAS by galangin, quercetin and kaempferol, which are the main flavonoids existing in the galangal, showed that quercetin and kaempferol had potent reversible inhibitory activity, but all three flavonoids had no obvious slow-binding inactivation. Analysis of the kinetic results led to the conclusion that the inhibitory mechanism of GE is totally different from that of some other previously reported inhibitors of FAS, such as cerulenin, EGCG (epigallocatechin gallate) and C75.

  3. Lysophosphatidic acid induces vasodilation mediated by LPA1 receptors, phospholipase C, and endothelial nitric oxide synthase

    PubMed Central

    Ruisanchez, Éva; Dancs, Péter; Kerék, Margit; Németh, Tamás; Faragó, Bernadett; Balogh, Andrea; Patil, Renukadevi; Jennings, Brett L.; Liliom, Károly; Malik, Kafait U.; Smrcka, Alan V.; Tigyi, Gabor; Benyó, Zoltán

    2014-01-01

    Lysophosphatidic acid (LPA) has been implicated as a mediator of several cardiovascular functions, but its potential involvement in the control of vascular tone is obscure. Here, we show that both LPA (18:1) and VPC31143 (a synthetic agonist of LPA1–3 receptors) relax intact mouse thoracic aorta with similar Emax values (53.9 and 51.9% of phenylephrine-induced precontraction), although the EC50 of LPA- and VPC31143-induced vasorelaxations were different (400 vs. 15 nM, respectively). Mechanical removal of the endothelium or genetic deletion of endothelial nitric oxide synthase (eNOS) not only diminished vasorelaxation by LPA or VPC31143 but converted it to vasoconstriction. Freshly isolated mouse aortic endothelial cells expressed LPA1, LPA2, LPA4 and LPA5 transcripts. The LPA1,3 antagonist Ki16425, the LPA1 antagonist AM095, and the genetic deletion of LPA1, but not that of LPA2, abolished LPA-induced vasorelaxation. Inhibition of the phosphoinositide 3 kinase–protein kinase B/Akt pathway by wortmannin or MK-2206 failed to influence the effect of LPA. However, pharmacological inhibition of phospholipase C (PLC) by U73122 or edelfosine, but not genetic deletion of PLCε, abolished LPA-induced vasorelaxation and indicated that a PLC enzyme, other than PLCε, mediates the response. In summary, the present study identifies LPA as an endothelium-dependent vasodilator substance acting via LPA1, PLC, and eNOS.—Ruisanchez, É., Dancs, P., Kerék, M., Németh, T., Faragó, B., Balogh, A., Patil, R., Jennings, B. L., Liliom, K., Malik, K. U., Smrcka, A. V., Tigyi, G., Benyó, Z. Lysophosphatidic acid induces vasodilation mediated by LPA1 receptors, phospholipase C, and endothelial nitric oxide synthase. PMID:24249637

  4. [Diversity of polyketide synthase genes (PKS) in metagenomic community of the freshwater sponge].

    PubMed

    Kaliuzhnaia, O V; Kulakova, N V; Itskovich, B V

    2012-01-01

    Screening of metagenomic DNA of microbial community, associated with Baikalian sponge Lubomirskia baicalensis, was made to show the presence of polyketide synthase genes (PKS). PKS enzymatic systems take part in synthesis of a great number of biologically-active substances. Cloning and sequencing of amplified products of the ketosynthase domain section of PKS gene cluster has revealed 15 fragments of PKS genes differing from each other's on 35-65% by aminoacid sequences. BLASTX analysis has shown that all these sequences belong to the KS-domains identified in various groups of microorganisms: alpha-, beta-, delta-Proteobacteria, Verrucomicrobia, Cyanobacteria, Chlorophyta. Some sequences were related to the genes which are taking part in biosynthesis of curacin A (CurI, CurJ), stigmatellin (StiC, StiG), nostophycin (NpnB), and cryptophycins (CrpB). The homology of the found sequences with those of the EMBL database varies within 50-82% confirming the presence in fresh-water sponge community the genes for synthesis of the new, yet not studied polyketide substances, possessing the biotechnological potential.

  5. Identification of regulatory sequences in the gene for 5-aminolevulinate synthase from rat.

    PubMed

    Braidotti, G; Borthwick, I A; May, B K

    1993-01-15

    The housekeeping enzyme 5-aminolevulinate synthase (ALAS) regulates the supply of heme for respiratory cytochromes. Here we report on the isolation of a genomic clone for the rat ALAS gene. The 5'-flanking region was fused to the chloramphenicol acetyltransferase gene and transient expression analysis revealed the presence of both positive and negative cis-acting sequences. Expression was substantially increased by the inclusion of the first intron located in the 5'-untranslated region. Sequence analysis of the promoter identified two elements at positions -59 and -88 bp with strong similarity to the binding site for nuclear respiratory factor 1 (NRF-1). Gel shift analysis revealed that both NRF-1 elements formed nucleoprotein complexes which could be abolished by an authentic NRF-1 oligomer. Mutagenesis of each NRF-1 motif in the ALAS promoter gave substantially lowered levels of chloramphenicol acetyltransferase expression, whereas mutagenesis of both NRF-1 motifs resulted in the almost complete loss of expression. These results establish that the NRF-1 motifs in the ALAS promoter are critical for promoter activity. NRF-1 binding sites have been identified in the promoters of several nuclear genes encoding mitochondrial proteins concerned with oxidative phosphorylation. The present studies suggest that NRF-1 may co-ordinate the supply of mitochondrial heme with the synthesis of respiratory cytochromes by regulating expression of ALAS. In erythroid cells, NRF-1 may be less important for controlling heme levels since an erythroid ALAS gene is strongly expressed and the promoter for this gene apparently lacks NRF-1 binding sites.

  6. Plastid-expressed 5-enolpyruvylshikimate-3-phosphate synthase genes provide high level glyphosate tolerance in tobacco.

    PubMed

    Ye, G N; Hajdukiewicz, P T; Broyles, D; Rodriguez, D; Xu, C W; Nehra, N; Staub, J M

    2001-02-01

    Plastid transformation (transplastomic) technology has several potential advantages for biotechnological applications including the use of unmodified prokaryotic genes for engineering, potential high-level gene expression and gene containment due to maternal inheritance in most crop plants. However, the efficacy of a plastid-encoded trait may change depending on plastid number and tissue type. We report a feasibility study in tobacco plastids to achieve high-level herbicide resistance in both vegetative tissues and reproductive organs. We chose to test glyphosate resistance via over-expression in plastids of tolerant forms of 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). Immunological, enzymatic and whole-plant assays were used to prove the efficacy of three different prokaryotic (Achromobacter, Agrobacterium and Bacillus) EPSPS genes. Using the Agrobacterium strain CP4 EPSPS as a model we identified translational control sequences that direct a 10,000-fold range of protein accumulation (to >10% total soluble protein in leaves). Plastid-expressed EPSPS could provide very high levels of glyphosate resistance, although levels of resistance in vegetative and reproductive tissues differed depending on EPSPS accumulation levels, and correlated to the plastid abundance in these tissues. Paradoxically, higher levels of plastid-expressed EPSPS protein accumulation were apparently required for efficacy than from a similar nuclear-encoded gene. Nevertheless, the demonstration of high-level glyphosate tolerance in vegetative and reproductive organs using transplastomic technology provides a necessary step for transfer of this technology to other crop species.

  7. Chromosomal Organization and Sequence Diversity of Genes Encoding Lachrymatory Factor Synthase in Allium cepa L.

    PubMed

    Masamura, Noriya; McCallum, John; Khrustaleva, Ludmila; Kenel, Fernand; Pither-Joyce, Meegham; Shono, Jinji; Suzuki, Go; Mukai, Yasuhiko; Yamauchi, Naoki; Shigyo, Masayoshi

    2012-06-01

    Lachrymatory factor synthase (LFS) catalyzes the formation of lachrymatory factor, one of the most distinctive traits of bulb onion (Allium cepa L.). Therefore, we used LFS as a model for a functional gene in a huge genome, and we examined the chromosomal organization of LFS in A. cepa by multiple approaches. The first-level analysis completed the chromosomal assignment of LFS gene to chromosome 5 of A. cepa via the use of a complete set of A. fistulosum-shallot (A. cepa L. Aggregatum group) monosomic addition lines. Subsequent use of an F(2) mapping population from the interspecific cross A. cepa × A. roylei confirmed the assignment of an LFS locus to this chromosome. Sequence comparison of two BAC clones bearing LFS genes, LFS amplicons from diverse germplasm, and expressed sequences from a doubled haploid line revealed variation consistent with duplicated LFS genes. Furthermore, the BAC-FISH study using the two BAC clones as a probe showed that LFS genes are localized in the proximal region of the long arm of the chromosome. These results suggested that LFS in A. cepa is transcribed from at least two loci and that they are localized on chromosome 5.

  8. The ketogenic diet component decanoic acid increases mitochondrial citrate synthase and complex I activity in neuronal cells.

    PubMed

    Hughes, Sean David; Kanabus, Marta; Anderson, Glenn; Hargreaves, Iain P; Rutherford, Tricia; O'Donnell, Maura; Cross, J Helen; Rahman, Shamima; Eaton, Simon; Heales, Simon J R

    2014-05-01

    The Ketogenic diet (KD) is an effective treatment with regards to treating pharmaco-resistant epilepsy. However, there are difficulties around compliance and tolerability. Consequently, there is a need for refined/simpler formulations that could replicate the efficacy of the KD. One of the proposed hypotheses is that the KD increases cellular mitochondrial content which results in elevation of the seizure threshold. Here, we have focussed on the medium-chain triglyceride form of the diet and the observation that plasma octanoic acid (C8) and decanoic acid (C10) levels are elevated in patients on the medium-chain triglyceride KD. Using a neuronal cell line (SH-SY5Y), we demonstrated that 250-μM C10, but not C8, caused, over a 6-day period, a marked increase in the mitochondrial enzyme, citrate synthase along with complex I activity and catalase activity. Increased mitochondrial number was also indicated by electron microscopy. C10 is a reported peroxisome proliferator activator receptor γ agonist, and the use of a peroxisome proliferator activator receptor γ antagonist was shown to prevent the C10-mediated increase in mitochondrial content and catalase. C10 may mimic the mitochondrial proliferation associated with the KD and raises the possibility that formulations based on this fatty acid could replace a more complex diet. We propose that decanoic acid (C10) results in increased mitochondrial number. Our data suggest that this may occur via the activation of the PPARγ receptor and its target genes involved in mitochondrial biogenesis. This finding could be of significant benefit to epilepsy patients who are currently on a strict ketogenic diet. Evidence that C10 on its own can modulate mitochondrial number raises the possibility that a simplified and less stringent C10-based diet could be developed.

  9. Imidazopyridine-Based Fatty Acid Synthase Inhibitors That Show Anti-HCV Activity and in Vivo Target Modulation

    PubMed Central

    2012-01-01

    Potent imidazopyridine-based inhibitors of fatty acid synthase (FASN) are described. The compounds are shown to have antiviral (HCV replicon) activities that track with their biochemical activities. The most potent analogue (compound 19) also inhibits rat FASN and inhibits de novo palmitate synthesis in vitro (cell-based) as well as in vivo. PMID:24900571

  10. Low-temperature Storage of Cucumbers Induces Changes in the Organic Acid Content and in Citrate Synthase Activity

    Technology Transfer Automated Retrieval System (TEKTRAN)

    To elucidate the cause of reported pyruvate accumulation in chilled stored cucumbers (Cucumis sativus L.) cv. ‘Toppugurin’, we have examined differences in the extent of incorporation of acetate-1,2-14C into the tricarboxylic acid (TCA) cycle and the specific activity of the enzyme citrate synthase ...

  11. Nicotianamine synthase overexpression positively modulates iron homeostasis-related genes in high iron rice

    PubMed Central

    Wang, Meng; Gruissem, Wilhelm; Bhullar, Navreet K.

    2013-01-01

    Nearly one-third of the world population, mostly women and children, suffer from iron malnutrition and its consequences, such as anemia or impaired mental development. Biofortification of rice, which is a staple crop for nearly half of the world's population, can significantly contribute in alleviating iron deficiency. NFP rice (transgenic rice expressing nicotianamine synthase, ferritin and phytase genes) has a more than six-fold increase in iron content in polished rice grains, resulting from the synergistic action of nicotianamine synthase (NAS) and ferritin transgenes. We investigated iron homeostasis in NFP plants by analyzing the expression of 28 endogenous rice genes known to be involved in the homeostasis of iron and other metals, in iron-deficient and iron-sufficient conditions. RNA was collected from different tissues (roots, flag leaves, grains) and at three developmental stages during grain filling. NFP plants showed increased sensitivity to iron-deficiency conditions and changes in the expression of endogenous genes involved in nicotianamine (NA) metabolism, in comparison to their non-transgenic siblings (NTS). Elevated transcript levels were detected in NFP plants for several iron transporters. In contrast, expression of OsYSL2, which encodes a member of yellow stripe like protein family, and a transporter of the NA-Fe(II) complex was reduced in NFP plants under low iron conditions, indicating that expression of OsYSL2 is regulated by the endogenous iron status. Expression of the transgenes did not significantly affect overall iron homeostasis in NFP plants, which establishes the engineered push-pull mechanism as a suitable strategy to increase rice endosperm iron content. PMID:23755054

  12. Nicotianamine synthase overexpression positively modulates iron homeostasis-related genes in high iron rice.

    PubMed

    Wang, Meng; Gruissem, Wilhelm; Bhullar, Navreet K

    2013-01-01

    Nearly one-third of the world population, mostly women and children, suffer from iron malnutrition and its consequences, such as anemia or impaired mental development. Biofortification of rice, which is a staple crop for nearly half of the world's population, can significantly contribute in alleviating iron deficiency. NFP rice (transgenic rice expressing nicotianamine synthase, ferritin and phytase genes) has a more than six-fold increase in iron content in polished rice grains, resulting from the synergistic action of nicotianamine synthase (NAS) and ferritin transgenes. We investigated iron homeostasis in NFP plants by analyzing the expression of 28 endogenous rice genes known to be involved in the homeostasis of iron and other metals, in iron-deficient and iron-sufficient conditions. RNA was collected from different tissues (roots, flag leaves, grains) and at three developmental stages during grain filling. NFP plants showed increased sensitivity to iron-deficiency conditions and changes in the expression of endogenous genes involved in nicotianamine (NA) metabolism, in comparison to their non-transgenic siblings (NTS). Elevated transcript levels were detected in NFP plants for several iron transporters. In contrast, expression of OsYSL2, which encodes a member of yellow stripe like protein family, and a transporter of the NA-Fe(II) complex was reduced in NFP plants under low iron conditions, indicating that expression of OsYSL2 is regulated by the endogenous iron status. Expression of the transgenes did not significantly affect overall iron homeostasis in NFP plants, which establishes the engineered push-pull mechanism as a suitable strategy to increase rice endosperm iron content.

  13. Evaluating the Effect of Expressing a Peanut Resveratrol Synthase Gene in Rice

    PubMed Central

    Li, Zhen; Wang, Qingguo; Yao, Fangyin; Yang, Lianqun; Pan, Jiaowen; Liu, Wei

    2015-01-01

    Resveratrol (Res) is a type of natural plant stilbenes and phytoalexins that only exists in a few plant species. Studies have shown that the Res could be biosynthesized and accumulated within plants, once the complete metabolic pathway and related enzymes, such as the key enzyme resveratrol synthase (RS), existed. In this study, a RS gene named PNRS1 was cloned from the peanut, and the activity was confirmed in E. coli. Using transgenic approach, the PNRS1 transgenic rice was obtained. In T3 generation, the Res production and accumulation were further detected by HPLC. Our data revealed that compared to the wild type rice which trans-resveratrol was undetectable, in transgenic rice, the trans-resveratrol could be synthesized and achieved up to 0.697 μg/g FW in seedlings and 3.053 μg/g DW in seeds. Furthermore, the concentration of trans-resveratrol in transgenic rice seedlings could be induced up to eight or four-fold higher by ultraviolet (UV-C) or dark, respectively. Simultaneously, the endogenous increased of Res also showed the advantages in protecting the host plant from UV-C caused damage or dark-induced senescence. Our data indicated that Res was involved in host-defense responses against environmental stresses in transgenic rice. Here the results describes the processes of a peanut resveratrol synthase gene transformed into rice, and the detection of trans-resveratrol in transgenic rice, and the role of trans-resveratrol as a phytoalexin in transgenic rice when treated by UV-C and dark. These findings present new outcomes of transgenic approaches for functional genes and their corresponding physiological functions, and shed some light on broadening available resources of Res, nutritional improvement of crops, and new variety cultivation by genetic engineering. PMID:26302213

  14. Cloning and Characterization of a Flavonol Synthase Gene from Scutellaria baicalensis

    PubMed Central

    Kim, Yeon Bok; Kim, KwangSoo; Kim, YeJi; Tuan, Pham Anh; Kim, Haeng Hoon; Cho, Jin Woong; Park, Sang Un

    2014-01-01

    Flavonols are the most abundant of all the flavonoids and play pivotal roles in a variety of plants. We isolated a cDNA clone encoding flavonol synthase from Scutellaria baicalensis (SbFLS). The SbFLS cDNA is 1011 bp long, encodes 336 amino acid residues, and belongs to a family of 2-oxoglutarate-dependent dioxygenases. The overall structure of SbFLS is very similar to that of Arabidopsis thaliana anthocyanidin synthase (AtANS), with a β jelly-roll fold surrounded by tens of short and long α-helices. SbFLS was constitutively expressed in the roots, stems, leaves, and flowers, with particularly high expression in the roots and flowers. SbFLS transcript levels in the roots were 376-, 70-, and 2.5-fold higher than in the leaves, stems, and flowers. The myricetin content was significantly higher than that of kaempferol and quercetin. Therefore, we suggest that SbFLS mediates flavonol formation in the different organs of S. baicalensis. Our study may contribute to the knowledge of the role of FLS in S. baicalensis. PMID:24672406

  15. Nitric oxide production and NO synthase gene expression contribute to vascular regulation during exercise.

    PubMed

    Shen, W; Zhang, X; Zhao, G; Wolin, M S; Sessa, W; Hintze, T H

    1995-08-01

    Nitric oxide (NO) is a vasodilator produced under normal physiologic conditions primarily by the vascular endothelium lining all blood vessels. The primary stimulus for the production of nitric oxide by the constitutive endothelial nitric oxide synthase (ECNOS, Type II) found in blood vessels is most likely the shear stress, the frictional force, caused by blood flowing through blood vessels. During exercise there is an increase in cardiac output and redistribution of blood flow to increase blood flow in skeletal muscle and in the coronary circulation. These adjustments provide increased oxygen delivery to support aerobic energy production and to sustain the exercise response. NO may be involved in the regulation of vascular tone in exercising skeletal and cardiac muscle by promoting, enhancing the metabolic vasodilation. In addition, the production of NO by capillary endothelium may regulate oxygen consumption by mitochondria through chemical interactions between NO and the iron-sulfur center of these enzymes. Finally, brief exercise training may alter the gene expression for the enzyme, the constitutive endothelial NO synthase, which forms NO and may be part of the vascular adaptation seen after aerobic exercise training. Furthermore, if there is a genetic predisposition to produce NO, as in world class athletes or animals bred to race, NO may contribute to spectacular exercise performance. These three potential roles of NO will be discussed and data presented to support each of these in our review.

  16. Functional Analysis of a Predicted Flavonol Synthase Gene Family in Arabidopsis1[W][OA

    PubMed Central

    Owens, Daniel K.; Alerding, Anne B.; Crosby, Kevin C.; Bandara, Aloka B.; Westwood, James H.; Winkel, Brenda S.J.

    2008-01-01

    The genome of Arabidopsis (Arabidopsis thaliana) contains five sequences with high similarity to FLAVONOL SYNTHASE1 (AtFLS1), a previously characterized flavonol synthase gene that plays a central role in flavonoid metabolism. This apparent redundancy suggests the possibility that Arabidopsis uses multiple isoforms of FLS with different substrate specificities to mediate the production of the flavonols, quercetin and kaempferol, in a tissue-specific and inducible manner. However, biochemical and genetic analysis of the six AtFLS sequences indicates that, although several of the members are expressed, only AtFLS1 encodes a catalytically competent protein. AtFLS1 also appears to be the only member of this group that influences flavonoid levels and the root gravitropic response in seedlings under nonstressed conditions. This study showed that the other expressed AtFLS sequences have tissue- and cell type-specific promoter activities that overlap with those of AtFLS1 and encode proteins that interact with other flavonoid enzymes in yeast two-hybrid assays. Thus, it is possible that these “pseudogenes” have alternative, noncatalytic functions that have not yet been uncovered. PMID:18467451

  17. Characterization and functional analysis of a chitin synthase gene (HcCS1) identified from the freshwater pearlmussel Hyriopsis cumingii.

    PubMed

    Zheng, H F; Bai, Z Y; Lin, J Y; Wang, G L; Li, J L

    2015-12-29

    The triangle sail mussel, Hyriopsis cumingii, is the most important freshwater pearl mussel in China. However, the mechanisms underlying its chitin-mediated shell and nacre formation remain largely unknown. Here, we characterized a chitin synthase (CS) gene (HcCS1) in H. cumingii, and analyzed its possible physiological function. The complete ORF sequence of HcCS1 contained 6903 bp, encoding a 2300-amino acid protein (theoretical molecular mass = 264 kDa; isoelectric point = 6.22), and no putative signal peptide was predicted. A myosin motor head domain, a CS domain, and 12 transmembrane domains were found. The predicted spatial structures of the myosin head and CS domains were similar to the electron microscopic structure of the heavy meromyosin subfragment of chicken smooth muscle myosin and the crystal structure of bacterial cellulose synthase, respectively. This structural similarity indicates that the functions of these two domains might be conserved. Quantitative reverse transcription PCR results showed that HcCS1 was present in all detected tissues, with the highest expression levels detected in the mantle. The HcCS1 transcripts in the mantle were upregulated following shell damage from 12 to 24 h post-damage, and they peaked (approximately 1.5-fold increase) at 12 h after shell damage. These findings suggest that HcCS1 was involved in shell regeneration, and that it might participate in shell and nacre formation in this species via chitin synthesis. HcCS1 might also dynamically regulate chitin deposition during the process of shell and nacre formation with the help of its conserved myosin head domain.

  18. Cloning and functional analysis of farnesyl diphosphate synthase (FPPS) gene from Mylabris cichorii Cloning, functional analysis of McFPPS.

    PubMed

    Zha, Shenfang; Yin, Youping; Wang, Yu; Huang, Yi; Li, Yan; Wang, Zhongkang

    2016-03-14

    Cantharidin, a defensive terpene compound synthesized by the meloid beetle (Coleoptera, Meloidae), is an important anti-cancer agent. However, there has been little study done on how this compound synthesized by the beetle. In this paper, a farnesyl-diphosphate synthase gene, designated McFPPS, was isolated from Mylabris cichorii by RT-PCR based on conserved domains in other organisms. Multiple alignment analysis showed that the deduced amino acids shared >70% homology with FPPSs from other species and contained typically seven conservative regions. Expression profile analysis revealed that McFPPS was expressed throughout the tested growth stages of M. cichorii adults; whereas the transcripts accumulated to the highest level at 20 d male adults while the highest expression level appeared at 15 d females. Tissue expression pattern analysis showed McFPPS was expressed constitutively in all tested tissues and a relatively higher expression level in the alimentary canal of males, but no significant tissue difference in the females. For the first time, a RNA interference strategy was employed to induce a greater suppression of McFPPS mRNA, and thus, a sharp decrease in the expression levels of downstream genes and the concentration of product. All these results indicated McFPPS may be directly involved or play an essential role in the biosynthesis of cantharidin. This article is protected by copyright. All rights reserved.

  19. Crosstalk between osteoprotegerin (OPG), fatty acid synthase (FASN) and, cycloxygenase-2 (COX-2) in breast cancer: implications in carcinogenesis

    PubMed Central

    Goswami, Sudeshna; Sharma-Walia, Neelam

    2016-01-01

    The crosstalk between malignant and nonmalignant cells in the tumor microenvironment, as maneuvered by cytokines/chemokines, drives breast cancer progression. In our previous study, we discovered Osteoprotegerin (OPG) as one of the cytokines heavily secreted by breast cancer cells. We demonstrated that OPG is expressed and secreted at very high levels from the highly invasive breast cancer cell lines SUM149PT and SUM1315MO2 as compared to normal human mammary epithelial HMEC cells. OPG was involved in modulating aneuploidy, cell proliferation, and angiogenesis in breast cancer. Mass spectrometry analysis performed in this study revealed OPG interacts with fatty acid synthase (FASN), which is a key enzyme of the fatty acid biosynthetic pathway in breast cancer cells. Further, electron microscopy, immunofluorescence, and fluorescence quantitation assays highlighted the presence of a large number of lipid bodies (lipid droplets) in SUM149PT and SUM1315MO2 cells in comparison to HMEC. We recently showed upregulation of the COX-2 inflammatory pathway and its metabolite PGE2 secretion in SUM149PT and SUM1315MO2 breast cancer cells. Interestingly, human breast cancer tissue samples displayed high expression of OPG, PGE2 and fatty acid synthase (FASN). FASN is a multifunctional enzyme involved in lipid biosynthesis. Immunofluorescence staining revealed the co-existence of COX-2 and FASN in the lipid bodies of breast cancer cells. We reasoned that there might be crosstalk between OPG, FASN, and COX-2 that sustains the inflammatory pathways in breast cancer. Interestingly, knocking down OPG by CRISPR/Cas9 gene editing in breast cancer cells decreased FASN expression at the protein level. Here, we identified cis-acting elements involved in the transcriptional regulation of COX-2 and FASN by recombinant human OPG (rhOPG). Treatment with FASN inhibitor C75 and COX-2 inhibitor celecoxib individually decreased the number of lipid bodies/cell, downregulated phosphorylation of ERK

  20. Quality control of a cytoplasmic protein complex: chaperone motors and the ubiquitin-proteasome system govern the fate of orphan fatty acid synthase subunit Fas2 of yeast.

    PubMed

    Scazzari, Mario; Amm, Ingo; Wolf, Dieter H

    2015-02-20

    For the assembly of protein complexes in the cell, the presence of stoichiometric amounts of the respective protein subunits is of utmost importance. A surplus of any of the subunits may trigger unspecific and harmful protein interactions and has to be avoided. A stoichiometric amount of subunits must finally be reached via transcriptional, translational, and/or post-translational regulation. Synthesis of saturated 16 and 18 carbon fatty acids is carried out by fatty acid synthase: in yeast Saccharomyces cerevisiae, a 2.6-MDa molecular mass assembly containing six protomers each of two different subunits, Fas1 (β) and Fas2 (α). The (α)6(β)6 complex carries six copies of all eight enzymatic activities required for fatty acid synthesis. The FAS1 and FAS2 genes in yeast are unlinked and map on two different chromosomes. Here we study the fate of the α-subunit of the complex, Fas2, when its partner, the β-subunit Fas1, is absent. Individual subunits of fatty acid synthase are proteolytically degraded when the respective partner is missing. Elimination of Fas2 is achieved by the proteasome. Here we show that a ubiquitin transfer machinery is required for Fas2 elimination. The major ubiquitin ligase targeting the superfluous Fas2 subunit to the proteasome is Ubr1. The ubiquitin-conjugating enzymes Ubc2 and Ubc4 assist the degradation process. The AAA-ATPase Cdc48 and the Hsp70 chaperone Ssa1 are crucially involved in the elimination of Fas2.

  1. Differential stress-response expression of two flavonol synthase genes and accumulation of flavonols in tartary buckwheat.

    PubMed

    Li, Xiaohua; Kim, Yeon Bok; Kim, Yeji; Zhao, Shicheng; Kim, Haeng Hoon; Chung, Eunsook; Lee, Jai-Heon; Park, Sang Un

    2013-12-15

    Flavonoids are ubiquitously present in plants and play important roles in these organisms as well as in the human diet. Flavonol synthase (FLS) is a key enzyme of the flavonoid biosynthetic pathway, acting at the diverging point into the flavonol subclass branch. We isolated and characterized a FLS isoform gene, FtFLS2, from tartary buckwheat (Fagopyrum tataricum). FtFLS2 shares 48% identity and 67% similarity with the previously reported FtFLS1, whereas both genes share 47-65% identity and 65-69% similarity with FLSs from other plant species. Using quantitative real-time PCR and high-performance liquid chromatography (HPLC), the expression of FtFLS1/2 and the production of 3 main flavonols (kaempferol, myricetin and quercetin) was detected in roots, leaves, stems, flowers and different stages of developing seeds. The relationship between the expression of the 2 FLS genes and the accumulation of the 3 basic flavonols was analyzed in 2 tartary buckwheat cultivars. FtFLS1 and FtFLS2 exhibited differential transcriptional levels between the tartary buckwheat cultivars 'Hokkai T10' and 'Hokkai T8'. Generally, higher transcript levels of FtFLS1 and FtFLS2 and a higher amount of flavonols were observed in the 'Hokkai T10' cultivar than 'Hokkai T8'. The content of flavonols showed tissue-specific accumulation between the 2 cultivars. The transcription of FtFLS1 was inhibited by the exogenous application of abscisic acid (ABA), salicylic acid (SA) and sodium chloride (NaCl), while FtFLS2 was not affected by ABA but up-regulated by SA and NaCl. These data indicate that the 2 FtFLS isoforms of buckwheat have different functions in the response of buckwheat to environmental stress.

  2. Molecular cloning and characterization of a phytochelatin synthase gene, PvPCS1, from Pteris vittata L.

    PubMed

    Dong, Ruibin; Formentin, Elide; Losseso, Carmen; Carimi, Francesco; Benedetti, Piero; Terzi, Mario; Schiavo, Fiorella Lo

    2005-12-01

    Pteris vittata L. is a staggeringly efficient arsenic hyperaccumulator that has been shown to be capable of accumulating up to 23,000 microg arsenic g(-1), and thus represents a species that may fully exploit the adaptive potential of plants to toxic metals. However, the molecular mechanisms of adaptation to toxic metal tolerance and hyperaccumulation remain unknown, and P. vittata genes related to metal detoxification have not yet been identified. Here, we report the isolation of a full-length cDNA sequence encoding a phytochelatin synthase (PCS) from P. vittata. The cDNA, designated PvPCS1, predicts a protein of 512 amino acids with a molecular weight of 56.9 kDa. Homology analysis of the PvPCS1 nucleotide sequence revealed that it has low identity with most known plant PCS genes except AyPCS1, and the homology is largely confined to two highly conserved regions near the 5'-end, where the similarity is as high as 85-95%. The amino acid sequence of PvPCS1 contains two Cys-Cys motifs and 12 single Cys, only 4 of which (Cys-56, Cys-90/91, and Cys-109) in the N-terminal half of the protein are conserved in other known PCS polypeptides. When expressed in Saccharomyces cerevisae, PvPCS1 mediated increased Cd tolerance. Cloning of the PCS gene from an arsenic hyperaccumulator may provide information that will help further our understanding of the genetic basis underlying toxic metal tolerance and hyperaccumulation.

  3. Endothelial Nitric Oxide Synthase and Angiotensin Converting Enzyme Gene Polymorphisms in Migraine Patients

    PubMed Central

    SİPAHİ, Tammam; GÜLDİKEN, Babürhan; KABAYEL, Levent; PALABIYIK, Orkide; ÖZKAN, Hülya; KILIÇ, Tülay Okman; SÜT, Necdet; TURGUT, Nilda

    2013-01-01

    Introduction In this study, we investigated the association of migraine with the Variable Number of Tandem Repeats (VNTR), repeated as 27 base pair, gene polymorphism in intron 4 of the endothelial nitric oxide synthase (eNOS) and the insertion/deletion of angiotensin converting enzyme (ACE) gene polymorphisms. Methods One hundred and five migraine and ninety seven healthy female control subjects were enrolled in the study. The patients were subdivided as migraine with aura and without aura, and the frequency and severity of migraine headaches were recorded. The eNOS VNTR (eNOS 4 a/b) and ACE insertion/deletion gene polymorphisms (ACE I/D) were assessed by polymerase chain reactions. Result The allele and genotype frequencies of eNOS 4 a/b gene polymorphism showed no difference between the migraine and control groups. The genotypic distribution of the ACE I/D gene polymorphism in the migraine group significantly differed from that in the control group. The DD and ID genotype increased the risk of migraine as much as 2.571 (95% CI-1.138–5.811) and 4.453 (95% CI-2.006–9.883) compared to the II genotype. The same increased risk sustained for both genotypes in the migraine with aura subgroup, but only the ID genotype remained as the risk factor in the migraine without aura subgroup (OR-3.750, 95% CI-1.493–9.420). No association of gene polymorphisms with migraine frequency and severity was observed. Conclusion Our findings support the relationship between migraine and the ACE I/D gene polymorphism. However, no association was found between migraine and the eNOS 4 a/b gene polymorphism.

  4. Effects of methionine synthase and methylenetetrahydrofolate reductase gene polymorphisms on markers of one-carbon metabolism.

    PubMed

    Ho, Vikki; Massey, Thomas E; King, Will D

    2013-11-01

    Genetic and nutritional factors play a role in determining the functionality of the one-carbon (1C) metabolism cycle, a network of biochemical reactions critical to intracellular processes. Genes encoding enzymes for methylenetetrahydrofolate reductase (MTHFR) and methionine synthase (MTR) may determine biomarkers of the cycle including homocysteine (HCY), S-adenosylmethionine (SAM) and S-adenosylhomocysteine (SAH). MTHFR C677T is an established genetic determinant of HCY but less is known of its effect on SAM and SAH. Conversely, the relationship between MTR A2756G and HCY remains inconclusive, and its effect on SAM and SAH has only been previously investigated in a female-specific population. Folate and vitamin B12 are essential substrate and cofactor of 1C metabolism; thus, consideration of gene-nutrient interactions may clarify the role of genetic determinants of HCY, SAM and SAH. This cross-sectional study included 570 healthy volunteers from Kingston, Ontario, Ottawa, Ontario and Halifax, Nova Scotia, Canada. Least squares regression was used to examine the effects of MTR and MTHFR polymorphisms on plasma HCY, SAM and SAH concentrations; gene-gene and gene-nutrient interactions were considered with the inclusion of cross-products in the model. Main effects of MTR and MTHFR polymorphisms on HCY concentrations were observed; however, no gene-gene or gene-nutrient interactions were found. No association was observed for SAM. For SAH, interactions between MTR and MTHFR polymorphisms, and MTHFR polymorphism and serum folate were found. The findings of this research provide evidence that HCY and SAH, biomarkers of 1C metabolism, are influenced by genetic and nutritional factors and their interactions.

  5. Inhibition of Fatty Acid Synthase Reduces Blastocyst Hatching through Regulation of the AKT Pathway in Pigs

    PubMed Central

    Guo, Jing; Kim, Nam-Hyung; Cui, Xiang-Shun

    2017-01-01

    Fatty acid synthase (FASN) is an enzyme responsible for the de novo synthesis of long-chain fatty acids. During oncogenesis, FASN plays a role in growth and survival rather than acting within the energy storage pathways. Here, the function of FASN during early embryonic development was studied using its specific inhibitor, C75. We found that the presence of the inhibitor reduced blastocyst hatching. FASN inhibition decreased Cpt1 expression, leading to a reduction in mitochondria numbers and ATP content. This inhibition of FASN resulted in the down-regulation of the AKT pathway, thereby triggering apoptosis through the activation of the p53 pathway. Activation of the apoptotic pathway also leads to increased accumulation of reactive oxygen species and autophagy. In addition, the FASN inhibitor impaired cell proliferation, a parameter of blastocyst quality for outgrowth. The level of OCT4, an important factor in embryonic development, decreased after treatment with the FASN inhibitor. These results show that FASN exerts an effect on early embryonic development by regulating both fatty acid oxidation and the AKT pathway in pigs. PMID:28107461

  6. Using modern tools to probe the structure-function relationship of fatty acid synthases

    PubMed Central

    Burkart, Michael D.

    2015-01-01

    Fatty acid biosynthesis is essential to life and represents one of the most conserved pathways in Nature, preserving the same handful of chemical reactions over all species. Recent interest in the molecular details of the de novo fatty acid synthase (FAS) has been heightened by demand for renewable fuels and the emergence of multidrug resistant bacterial strains. Central to FAS is the acyl carrier protein (ACP), a protein chaperone that shuttles the growing acyl chain between catalytic enzymes within the FAS. Human efforts to alter fatty acid biosynthesis for oil production, chemical feedstock or antimicrobial purposes has been met with limited success in part due to a lack of detailed molecular information behind the ACP-partner protein interactions inherent to the pathway. This review will focus on recently developed tools for the modification of ACP and analysis of protein-protein interactions, such as mechanism-based crosslinking, and the studies exploiting them. Discussion specific to each enzymatic domain focuses first on mechanism and known inhibitors, followed by available structures and known interactions with ACP. While significant unknowns remain, new understandings into the intricacies of FAS point to future advances in manipulating this complex molecular factory. PMID:25676190

  7. Δ(9)-Tetrahydrocannabinolic acid synthase production in Pichia pastoris enables chemical synthesis of cannabinoids.

    PubMed

    Lange, Kerstin; Schmid, Andreas; Julsing, Mattijs K

    2015-10-10

    Δ(9)-Tetrahydrocannabinol (THC) is of increasing interest as a pharmaceutical and bioactive compound. Chemical synthesis of THC uses a laborious procedure and does not satisfy the market demand. The implementation of biocatalysts for specific synthesis steps might be beneficial for making natural product availability independent from the plant. Δ(9)-Tetrahydrocannabinolic acid synthase (THCAS) from C. sativa L. catalyzes the cyclization of cannabigerolic acid (CBGA) to Δ(9)-tetrahydrocannabinolic acid (THCA), which is non-enzymatically decarboxylated to THC. We report the preparation of THCAS in amounts sufficient for the biocatalytic production of THC(A). Active THCAS was most efficiently obtained from Pichia pastoris. THCAS was produced on a 2L bioreactor scale and the enzyme was isolated by single-step chromatography with a specific activity of 73Ug(-1)total protein. An organic/aqueous two-liquid phase setup for continuous substrate delivery facilitated in situ product removal. In addition, THCAS activity in aqueous environments lasted for only 20min whereas the presence of hexane stabilized the activity over 3h. In conclusion, production of THCAS in P. pastoris Mut(S) KM71 KE1, subsequent isolation, and its application in a two-liquid phase setup enables the synthesis of THCA on a mg scale.

  8. A Novel Class of Plant Type III Polyketide Synthase Involved in Orsellinic Acid Biosynthesis from Rhododendron dauricum

    PubMed Central

    Taura, Futoshi; Iijima, Miu; Yamanaka, Eriko; Takahashi, Hironobu; Kenmoku, Hiromichi; Saeki, Haruna; Morimoto, Satoshi; Asakawa, Yoshinori; Kurosaki, Fumiya; Morita, Hiroyuki

    2016-01-01

    Rhododendron dauricum L. produces daurichromenic acid, the anti-HIV meroterpenoid consisting of sesquiterpene and orsellinic acid (OSA) moieties. To characterize the enzyme responsible for OSA biosynthesis, a cDNA encoding a novel polyketide synthase (PKS), orcinol synthase (ORS), was cloned from young leaves of R. dauricum. The primary structure of ORS shared relatively low identities to those of PKSs from other plants, and the active site of ORS had a unique amino acid composition. The bacterially expressed, recombinant ORS accepted acetyl-CoA as the preferable starter substrate, and produced orcinol as the major reaction product, along with four minor products including OSA. The ORS identified in this study is the first plant PKS that generates acetate-derived aromatic tetraketides, such as orcinol and OSA. Interestingly, OSA production was clearly enhanced in the presence of Cannabis sativa olivetolic acid cyclase, suggesting that the ORS is involved in OSA biosynthesis together with an unidentified cyclase in R. dauricum. PMID:27729920

  9. Analysis of carbon source-regulated gene expression by the upstream region of the Candida tropicalis malate synthase gene in Saccharomyces cerevisiae.

    PubMed

    Umemura, K; Atomi, H; Izuta, M; Kanai, T; Takeshita, S; Ueda, M; Tanaka, A

    1997-01-03

    We investigated the regulation of expression of a gene encoding malate synthase (MS) of an n-alkane-utilizable yeast Candida tropicalis in the yeast Saccharomyces cerevisiae, where its expression is highly induced by acetate. By comparing levels of gene expression in cells grown on glucose, acetate, lactate, and oleic acid, we found that the increase in gene expression was due to a glucose repression-derepression mechanism. In order to obtain information concerning the regulation of the gene expression, a fusion gene which consists of the 5'-upstream region of MS-2 (UPR-MS-2) and the lacZ gene (encoding Escherichia coli beta-galactosidase), was introduced into S. cerevisiae, and beta-galactosidase activities were measured with cells grown on glucose or acetate. Deletion analysis of UPR-MS-2 revealed that the region between -777 and -448 (against the translation initiation codon) enhanced the level of gene expression in both glucose- and acetate-grown cells. In this region, sequences which resemble binding sites of Rap1p/Grf1p/Tufp, a global transcription activator, were found at seven locations and one was found for another pleiotropic activator Abf1p. The result also suggested the presence of multiple upstream repression sequences (URSs), which function specifically in glucose-grown cells, in the region between -368 and -126. In the repressing region, there were three tandem C(A/T)CTCCC sequences and also a putative binding site of Mig1p, a transcriptional repressor which mediates glucose repression of several other genes. When MIG1 gene of S. cerevisiae was disrupted, the expression of the UPR-MS-2-lacZ gene in glucose-grown cells increased approx. 10-fold. Furthermore, the effect of deletion of a putative Mig1p binding site was abolished in the MIG1-disrupted strain, suggesting Mig1p binds to this site and brings about glucose repression. When the SNF1 gene was disrupted, the high level gene expression observed in acetate-grown cells bearing UPR-MS-2 was

  10. Enhanced thermotolerance for ethanol fermentation of Saccharomyces cerevisiae strain by overexpression of the gene coding for trehalose-6-phosphate synthase.

    PubMed

    An, Ming-Zhe; Tang, Yue-Qin; Mitsumasu, Kanako; Liu, Ze-Shen; Shigeru, Morimura; Kenji, Kida

    2011-07-01

    The effect of overexpression of the trehalose-6-phosphate (T6P) synthase gene (TPS1) on ethanol fermentation of Saccharomyces cerevisiae has been studied at 30 and 38°C. The activity of T6P synthase and the accumulation of trehalose during ethanol fermentation were significantly improved by overexpression of TPS1, and especially at 38°C. Ethanol produced by transformants with and without TPS1 gene overexpression at 38°C was approx. 60 and 37 g/l, respectively. The fermentation efficiency of transformants with TPS1 gene overexpression at 38°C was similar to that at 30°C. The critical growth temperature was increased from 36 to 42°C by TPS1 gene overexpression. These results indicated that overexpression of the TPS1 gene had a beneficial effect on the fermentation capacity of the title yeast strain at high temperatures.

  11. Decarboxylation of malonyl-(acyl carrier protein) by 3-oxoacyl-(acyl carrier protein) synthases in plant fatty acid biosynthesis.

    PubMed Central

    Winter, E; Brummel, M; Schuch, R; Spener, F

    1997-01-01

    In order to identify regulatory steps in fatty acid biosynthesis, the influence of intermediate 3-oxoacyl-(acyl carrier proteins) (3-oxoacyl-ACPs) and end-product acyl-ACPs of the fatty acid synthase reaction on the condensation reaction was investigated in vitro, using total fatty acid synthase preparations and purified 3-oxoacyl-ACP synthases (KASs; EC 2.3.1.41) from Cuphea lanceolata seeds. KAS I and II in the fatty acid synthase preparations were assayed for the elongation of octanoyl- and hexadecanoyl-ACP respectively, and the accumulation of the corresponding condensation product 3-oxoacyl-ACP was studied by modulating the content of the reducing equivalentS NADH and NADPH. Complete omission of reducing equivalents resulted with either KAS in the abnormal synthesis of acetyl-ACP from malonyl-ACP by a decarboxylation reaction. Supplementation with NADPH or NADH, separately or in combination with recombinant 3-oxoacyl-ACP reductase (EC 1.1.1.100), led to a decrease in the amount of acetyl-ACP and a simultaneous increase in elongation products. This demonstrates that the accumulation of 3-oxoacyl-ACP inhibits the condensation reaction on the one hand, and induces the decarboxylation of malonyl-ACP on the other. By carrying out similar experiments with purified enzymes, this decarboxylation was attributed to the action of KAS. Our data point to a regulatory mechanism for the degradation of malonyl-ACP in plants which is activated by the accumulation of the fatty acid synthase intermediate 3-oxoacyl-ACP. PMID:9020860

  12. Differential Expression of Biphenyl Synthase Gene Family Members in Fire-Blight-Infected Apple ‘Holsteiner Cox’ 1[W][OA

    PubMed Central

    Chizzali, Cornelia; Gaid, Mariam M.; Belkheir, Asma K.; Hänsch, Robert; Richter, Klaus; Flachowsky, Henryk; Peil, Andreas; Hanke, Magda-Viola; Liu, Benye; Beerhues, Ludger

    2012-01-01

    Fire blight, caused by the bacterium Erwinia amylovora, is a devastating disease of apple (Malus × domestica). The phytoalexins of apple are biphenyls and dibenzofurans, whose carbon skeleton is formed by biphenyl synthase (BIS), a type III polyketide synthase. In the recently published genome sequence of apple ‘Golden Delicious’, nine BIS genes and four BIS gene fragments were detected. The nine genes fall into four subfamilies, referred to as MdBIS1 to MdBIS4. In a phylogenetic tree, the BIS amino acid sequences from apple and Sorbus aucuparia formed an individual cluster within the clade of the functionally diverse type III polyketide synthases. cDNAs encoding MdBIS1 to MdBIS4 were cloned from fire-blight-infected shoots of apple ‘Holsteiner Cox,’ heterologously expressed in Escherichia coli, and functionally analyzed. Benzoyl-coenzyme A and salicoyl-coenzyme A were the preferred starter substrates. In response to inoculation with E. amylovora, the BIS3 gene was expressed in stems of cv Holsteiner Cox, with highest transcript levels in the transition zone between necrotic and healthy tissues. The transition zone was the accumulation site of biphenyl and dibenzofuran phytoalexins. Leaves contained transcripts for BIS2 but failed to form immunodetectable amounts of BIS protein. In cell cultures of apple ‘Cox Orange,’ expression of the BIS1 to BIS3 genes was observed after the addition of an autoclaved E. amylovora suspension. Using immunofluorescence localization under a confocal laser-scanning microscope, the BIS3 protein in the transition zone of stems was detected in the parenchyma of the bark. Dot-shaped immunofluorescence was confined to the junctions between neighboring cortical parenchyma cells. PMID:22158676

  13. Silybin content and overexpression of chalcone synthase genes in Silybum marianum L. plants under abiotic elicitation.

    PubMed

    El-Garhy, Hoda A S; Khattab, Salah; Moustafa, Mahmoud M A; Abou Ali, Rania; Abdel Azeiz, Ahmed Z; Elhalwagi, Abeer; El Sherif, Fadia

    2016-11-01

    Silymarin, a Silybum marianum seed extract containing a mixture of flavonolignans including silybin, is being used as an antihepatotoxic therapy for liver diseases. In this study, the enhancing effect of gamma irradiation on plant growth parameters of S. marianum under salt stress was investigated. The effect of gamma irradiation, either as a single elicitor or coupled with salinity, on chalcone synthase (CHS) gene expression and silybin A + B yield was also evaluated. The silybin A + B content in S. marianum fruits was estimated by liquid chromatography-mass spectrometry (LC-MS/MS). An increase in silybin content was accompanied by up-regulation of the CHS1, CHS2 and CHS3 genes, which are involved in the silybin biosynthetic pathway. The highest silybin A + B production (0.77 g/100 g plant DW) and transcript levels of the three studied genes (100.2-, 91.9-, and 24.3-fold increase, respectively) were obtained with 100GY gamma irradiation and 4000 ppm salty water. The CHS2 and CHS3 genes were partially sequenced and submitted to the NCBI database under the accession numbers KT252908.1 and KT252909.1, respectively. Developing new approaches to stimulate silybin biosynthetic pathways could be a useful tool to potentiate the use of plants as renewable resources of medicinal compounds.

  14. Isolation and expression of two polyketide synthase genes from Trichoderma harzianum 88 during mycoparasitism.

    PubMed

    Yao, Lin; Tan, Chong; Song, Jinzhu; Yang, Qian; Yu, Lijie; Li, Xinling

    2016-01-01

    Metabolites of mycoparasitic fungal species such as Trichoderma harzianum 88 have important biological roles. In this study, two new ketoacyl synthase (KS) fragments were isolated from cultured Trichoderma harzianum 88 mycelia using degenerate primers and analysed using a phylogenetic tree. The gene fragments were determined to be present as single copies in Trichoderma harzianum 88 through southern blot analysis using digoxigenin-labelled KS gene fragments as probes. The complete sequence analysis in formation of pksT-1 (5669bp) and pksT-2 (7901bp) suggests that pksT-1 exhibited features of a non-reducing type I fungal PKS, whereas pksT-2 exhibited features of a highly reducing type I fungal PKS. Reverse transcription polymerase chain reaction indicated that the isolated genes are differentially regulated in Trichoderma harzianum 88 during challenge with three fungal plant pathogens, which suggests that they participate in the response of Trichoderma harzianum 88 to fungal plant pathogens. Furthermore, disruption of the pksT-2 encoding ketosynthase-acyltransferase domains through Agrobacterium-mediated gene transformation indicated that pksT-2 is a key factor for conidial pigmentation in Trichoderma harzianum 88.

  15. Potential impact of a single nucleotide polymorphism in the hyaluronan synthase 1 gene in Waldenstrom's macroglobulinemia.

    PubMed

    Adamia, Sophia; Treon, Steven P; Reiman, Tony; Tournilhac, Olivier; McQuarrie, Carrie; Mant, Michael J; Belch, Andrew R; Pilarski, Linda M

    2005-03-01

    The hyaluronan synthase 1 (HAS1) gene encodes a plasma membrane protein that synthesizes hyaluronan, an extracellular matrix molecule. Previously, in patients with Waldenstrom's macroglobulinemia (WM), we detected upregulation of HAS1 transcripts and identified aberrant splice variants of this gene. Aberrant splicing of HAS1 results from activation of cryptic splice sites. In turn, activation of cryptic donor and acceptor splice sites can be promoted by mutations occurring upstream of these sites and/or at the branch point of slicing. We measured the frequency of the HAS1 833A/G polymorphism (ie, single-nucleotide polymorphism; SNP) in patients with WM and healthy donors. Additionally, HAS1 gene expression was evaluated in the same group of patients. Our observations so far suggest that HAS1 833A/G SNPs contribute to aberrant splicing of this gene; this idea is supported by the fact that 833A/G SNP is located on an exonic splicing enhancer motif. Based on the results obtained thus far, we speculate that individuals with HAS1 833G/G genotype are predisposed toward aberrant HAS1 splicing and expression of HAS1 variants, resulting in an enhanced risk of developing WM. Study of a larger group of patients and healthy donors is needed to confirm these speculations and to evaluate the prognostic significance of these findings.

  16. Mice with heterozygous deficiency of lipoic acid synthase have an increased sensitivity to lipopolysaccharide-induced tissue injury

    PubMed Central

    Yi, Xianwen; Kim, Kuikwon; Yuan, Weiping; Xu, Longquan; Kim, Hyung-Suk; Homeister, Jonathon W.; Key, Nigel S.; Maeda, Nobuyo

    2009-01-01

    α-Lipoic acid (1, 2-dithiolane-3-pentanoic acid; LA), synthesized in mitochondria by LA synthase (Lias), is a potent antioxidant and a cofactor for metabolic enzyme complexes. In this study, we examined the effect of genetic reduction of LA synthesis on its antioxidant and anti-inflammatory properties using a model of LPS-induced inflammation in Lias+/– mice. The increase of plasma proinflammatory cytokine, TNF-α, and NF-κB at an early phase following LPS injection was greater in Lias+/– mice compared with Lias+/+ mice. The circulating blood white blood cell (WBC) and platelet counts dropped continuously during the initial 4 h. The counts subsequently recovered partially in Lias+/+ mice, but the recovery was impaired totally in Lias+/– mice. Administration of exogenous LA normalized the recovery of WBC counts in Lias+/– mice but not platelets. Enhanced neutrophil sequestration in the livers of Lias+/– mice was associated with increased hepatocyte injury and increased gene expression of growth-related oncogene, E-selectin, and VCAM-1 in the liver and/or lung. Lias gene expression in tissues was 50% of normal expression in Lias+/– mice and reduced further by LPS treatment. Decreased Lias expression was associated with diminished hepatic LA and tissue oxidative stress. Finally, Lias+/– mice displayed enhanced mortality when exposed to LPS-induced sepsis. These data demonstrate the importance of endogenously produced LA for preventing leukocyte accumulation and tissue injury that result from LPS-induced inflammation. PMID:18845616

  17. Effects of homoeologous wheat starch synthase IIa genes on starch properties.

    PubMed

    Shimbata, Tomoya; Ai, Yongfeng; Fujita, Masaya; Inokuma, Takayuki; Vrinten, Patricia; Sunohara, Ai; Saito, Mika; Takiya, Toshiyuki; Jane, Jay-lin; Nakamura, Toshiki

    2012-12-05

    Near-isogenic lines (NILs) of the eight haplotypes of starch synthase IIa (SSIIa) were used to analyze the effects of SSIIa gene dosage on branch chain length, gelatinization, pasting, retrogradation, and enzymatic hydrolysis of starches. Compared to wild-type, the amylopectin of lines missing one or more active SSIIa enzymes had increases in the proportion of short branch chains (DP6-10) and decreases in midlength chains (DP11-24), and the size of these differences depended on the dosage of active SSIIa enzymes. Of the three loci, SSIIa-A1 had the smallest contribution to amylopectin structure and SSIIa-B1 the largest. The different effects of the three SSIIa enzymes on starch properties were also seen in gelatinization, retrogradation, pasting, and enzymatic hydrolysis properties. Such differences in starch properties might be useful in influencing the texture and shelf life of food products.

  18. A cluster of three genes (dapA, orf2, and dapB) of Brevibacterium lactofermentum encodes dihydrodipicolinate synthase, dihydrodipicolinate reductase, and a third polypeptide of unknown function.

    PubMed Central

    Pisabarro, A; Malumbres, M; Mateos, L M; Oguiza, J A; Martín, J F

    1993-01-01

    The dapA and dapB genes, encoding, respectively, dihydrodipicolinate synthase and dihydrodipicolinate reductase, the two first enzymes of the lysine branch of the aspartic amino acid family, were cloned from the DNA of the amino acid-producing bacterium Brevibacterium lactofermentum. The two genes were clustered in a 3.5-kb Sau3AI-BamHI fragment but were separated by an open reading frame of 750 nucleotides. The protein encoded by this open reading frame had little similarity to any protein in the data banks, and its function remains unknown. The three genes were translated in Escherichia coli, giving the corresponding polypeptides. Images PMID:8478336

  19. Enzymatic formation of a resorcylic acid by creating a structure-guided single-point mutation in stilbene synthase.

    PubMed

    Bhan, Namita; Li, Lingyun; Cai, Chao; Xu, Peng; Linhardt, Robert J; Koffas, Mattheos A G

    2015-02-01

    A novel C17 resorcylic acid was synthesized by a structure-guided Vitis vinifera stilbene synthase (STS) mutant, in which threonine 197 was replaced with glycine (T197G). Altering the architecture of the coumaroyl binding and cyclization pocket of the enzyme led to the attachment of an extra acetyl unit, derived from malonyl-CoA, to p-coumaroyl-CoA. The resulting novel pentaketide can be produced strictly by STS-like enzymes and not by Chalcone synthase-like type III polyketide synthases; due to the unique thioesterase like activity of STS-like enzymes. We utilized a liquid chromatography mass spectrometry-based data analysis approach to directly compare the reaction products of the mutant and wild type STS. The findings suggest an easy to employ platform for precursor-directed biosynthesis and identification of unnatural polyketides by structure-guided mutation of STS-like enzymes.

  20. Cystathionine beta synthase gene dose dependent vascular remodeling in murine model of hyperhomocysteinemia.

    PubMed

    Tyagi, Neetu; Qipshidze, Natia; Sen, Utpal; Rodriguez, Walter; Ovechkin, Alexander; Tyagi, Suresh C

    2011-09-30

    Although children born with severe homocystinurea (i.e. cystathionine beta synthase homozygote knockout, CBS-/-) develop deleterious vascular complications with structural malformation and do not live past teenage, the heterozygote (CBS-/+) lives with apparently normal phenotype. Interestingly, this differential role of CBS expression in vascular remodeling is unclear. Peroxisome proliferator activated receptor gamma (PPARγ) is nuclear transcription factor that mitigates vascular complications. The hypothesis was that homocysteine (Hcy) decreased thioredoxin (Trx), peroxiredoxin (Prx), increased NADPH oxidase (NOX1), mitochondrial nitric oxide synthase (mtNOS) activity and reactive oxygen species (ROS) in mitochondria in a CBS gene dose-dependent manner. ROS transduced matrix metalloproteinase (MMP) activation causing thickening (fibrosis) of the basement membrane, rendering ineffective endothelial nitric oxide synthase (eNOS) and promoted endothelial-smooth muscle disconnection/uncoupling by antagonizing PPARγ. Wild type (WT-CBS+/+), CBS-/+ and CBS -/- mice were treated with or without ciglitazone (CZ, a PPARγ agonist) in food at birth. Aortic nuclear PPARγ expression was measured by EMSA. Aortic mtNOS activity and ROS production was measured using NO- and H(2)O(2)-electrodes, respectively. Aorta was analyzed for Trx, Prx, by Western blot, and PCR. MMP activity was by in situ zymography. Aortic function was measured in tissue myobath. The results suggested 90% morbidity in CBS-/- allele at 12 wks. However, treatment with the PPARγ agonist, CZ significantly reduced the morbidity to 20%. In addition, CZ restored the PPARγ activity in CBS-/+ and -/- mice to normal levels. The oxidative stress was alleviated by CZ treatment. In situ labeling with mito-tracker suggests co-localization of ROS with mitochondrial mitophagy. The mtNOS activity was increased in HHcy compared to WT. The data support the notion that Hcy decreases redoxins, increases mtNOS activity and

  1. A conditional mutant of the fatty acid synthase unveils unexpected cross talks in mycobacterial lipid metabolism

    PubMed Central

    Cabruja, Matías; Mondino, Sonia; Tsai, Yi Ting; Lara, Julia; Gramajo, Hugo

    2017-01-01

    Unlike most bacteria, mycobacteria rely on the multi-domain enzyme eukaryote-like fatty acid synthase I (FAS I) to make fatty acids de novo. These metabolites are precursors of the biosynthesis of most of the lipids present both in the complex mycobacteria cell wall and in the storage lipids inside the cell. In order to study the role of the type I FAS system in Mycobacterium lipid metabolism in vivo, we constructed a conditional mutant in the fas-acpS operon of Mycobacterium smegmatis and analysed in detail the impact of reduced de novo fatty acid biosynthesis on the global architecture of the cell envelope. As expected, the mutant exhibited growth defect in the non-permissive condition that correlated well with the lower expression of fas-acpS and the concomitant reduction of FAS I, confirming that FAS I is essential for survival. The reduction observed in FAS I provoked an accumulation of its substrates, acetyl-CoA and malonyl-CoA, and a strong reduction of C12 to C18 acyl-CoAs, but not of long-chain acyl-CoAs (C19 to C24). The most intriguing result was the ability of the mutant to keep synthesizing mycolic acids when fatty acid biosynthesis was impaired. A detailed comparative lipidomic analysis showed that although reduced FAS I levels had a strong impact on fatty acid and phospholipid biosynthesis, mycolic acids were still being synthesized in the mutant, although with a different relative species distribution. However, when triacylglycerol degradation was inhibited, mycolic acid biosynthesis was significantly reduced, suggesting that storage lipids could be an intracellular reservoir of fatty acids for the biosynthesis of complex lipids in mycobacteria. Understanding the interaction between FAS I and the metabolic pathways that rely on FAS I products is a key step to better understand how lipid homeostasis is regulated in this microorganism and how this regulation could play a role during infection in pathogenic mycobacteria. PMID:28228470

  2. Promoters of Human Cosmc and T-synthase Genes Are Similar in Structure, Yet Different in Epigenetic Regulation*

    PubMed Central

    Zeng, Junwei; Mi, Rongjuan; Wang, Yingchun; Li, Yujing; Lin, Li; Yao, Bing; Song, Lina; van Die, Irma; Chapman, Arlene B.; Cummings, Richard D.; Jin, Peng; Ju, Tongzhong

    2015-01-01

    The T-synthase (core 1 β3-galactosyltransferase) and its molecular chaperone Cosmc regulate the biosynthesis of mucin type O-glycans on glycoproteins, and evidence suggests that both T-synthase and Cosmc are transcriptionally suppressed in several human diseases, although the transcriptional regulation of these two genes is not understood. Here, we characterized the promoters essential for human Cosmc and T-synthase transcription. The upstream regions of the genes lack a conventional TATA box but contain CpG islands, cCpG-I and cCpG-II for Cosmc and tCpG for T-synthase. Using luciferase reporter assays, site-directed mutagenesis, ChIP assays, and mithramycin A treatment, we identified the core promoters within cCpG-II and tCpG, which contain two binding sites for Krüppel-like transcription factors, including SP1/SP3, respectively. Methylome analysis of Tn4 B cells, which harbor a silenced Cosmc, confirmed the hypermethylation of the Cosmc core promoter but not for T-synthase. These results demonstrate that Cosmc and T-synthase are transcriptionally regulated at a basal level by the specificity protein/Krüppel-like transcription factor family of members, which explains their ubiquitous and coordinated expression, and also indicate that they are differentially epigenetically regulated beyond X chromosome imprinting. These results are important in understanding the regulation of these genes that have roles in human diseases, such as IgA nephropathy and cancer. PMID:26063800

  3. Promoters of Human Cosmc and T-synthase Genes Are Similar in Structure, Yet Different in Epigenetic Regulation.

    PubMed

    Zeng, Junwei; Mi, Rongjuan; Wang, Yingchun; Li, Yujing; Lin, Li; Yao, Bing; Song, Lina; van Die, Irma; Chapman, Arlene B; Cummings, Richard D; Jin, Peng; Ju, Tongzhong

    2015-07-31

    The T-synthase (core 1 β3-galactosyltransferase) and its molecular chaperone Cosmc regulate the biosynthesis of mucin type O-glycans on glycoproteins, and evidence suggests that both T-synthase and Cosmc are transcriptionally suppressed in several human diseases, although the transcriptional regulation of these two genes is not understood. Here, we characterized the promoters essential for human Cosmc and T-synthase transcription. The upstream regions of the genes lack a conventional TATA box but contain CpG islands, cCpG-I and cCpG-II for Cosmc and tCpG for T-synthase. Using luciferase reporter assays, site-directed mutagenesis, ChIP assays, and mithramycin A treatment, we identified the core promoters within cCpG-II and tCpG, which contain two binding sites for Krüppel-like transcription factors, including SP1/SP3, respectively. Methylome analysis of Tn4 B cells, which harbor a silenced Cosmc, confirmed the hypermethylation of the Cosmc core promoter but not for T-synthase. These results demonstrate that Cosmc and T-synthase are transcriptionally regulated at a basal level by the specificity protein/Krüppel-like transcription factor family of members, which explains their ubiquitous and coordinated expression, and also indicate that they are differentially epigenetically regulated beyond X chromosome imprinting. These results are important in understanding the regulation of these genes that have roles in human diseases, such as IgA nephropathy and cancer.

  4. Partial deletion of both the spermine synthase gene and the Pex gene in the X-linked hypophosphatemic, gyro (Gy) mouse.

    PubMed

    Meyer, R A; Henley, C M; Meyer, M H; Morgan, P L; McDonald, A G; Mills, C; Price, D K

    1998-03-15

    Gy, along with Hyp, is a dominant mutation of the normal gene Pex causing X-linked hypophosphatemia in the mouse. Hemizygous Gy male mice, however, have greater defects in survival, bodily growth, skeletal mineralization, and neurological function than those found in heterozygous Gy females or in Hyp mice. Since the gene for spermine synthase is immediately upstream of the homologous human gene PEX, we compared the effects of the Gy and Hyp mutations on both the spermine synthase gene and the Pex gene. Barely detectable levels of spermine (< 5% of normal) with elevated levels of its precursor, spermidine, were found in organs of Gy male mice compared to normal male littermates. Neither Gy females nor Hyp male mice were significantly affected. Four missing introns of the spermine synthase gene were identified in Gy male mice, suggesting extensive gene disruption. A pseudogene for spermine synthase was also identified in the mouse genome. Pex mRNA was found in several but not all tissues studied in adult normal mice. Pex mRNA was altered in both Gy and Hyp mice. All male Hyp mice were lacking the 3' end of the Pex message, whereas all male Gy mice were deficient at the 5' end. In summary, the Gy mutation is associated with a recessively expressed mutation of the spermine synthase gene, leading to spermine deficiency, and a dominantly expressed mutation of the Pex gene, leading to hypophosphatemia. Alterations in two contiguous genes in Gy may explain the additional phenotypic abnormalities present in the Gy male mouse.

  5. Divergence of cuticular hydrocarbons in two sympatric grasshopper species and the evolution of fatty acid synthases and elongases across insects

    PubMed Central

    Finck, Jonas; Berdan, Emma L.; Mayer, Frieder; Ronacher, Bernhard; Geiselhardt, Sven

    2016-01-01

    Cuticular hydrocarbons (CHCs) play a major role in the evolution of reproductive isolation between insect species. The CHC profiles of two closely related sympatric grasshopper species, Chorthippus biguttulus and C. mollis, differ mainly in the position of the first methyl group in major methyl-branched CHCs. The position of methyl branches is determined either by a fatty acid synthase (FAS) or by elongases. Both protein families showed an expansion in insects. Interestingly, the FAS family showed several lineage-specific expansions, especially in insect orders with highly diverse methyl-branched CHC profiles. We found five putative FASs and 12 putative elongases in the reference transcriptomes for both species. A dN/dS test showed no evidence for positive selection acting on FASs and elongases in these grasshoppers. However, one candidate FAS showed species-specific transcriptional differences and may contribute to the shift of the methyl-branch position between the species. In addition, transcript levels of four elongases were expressed differentially between the sexes. Our study indicates that complex methyl-branched CHC profiles are linked to an expansion of FASs genes, but that species differences can also mediated at the transcriptional level. PMID:27677406

  6. Functional specialization of cellulose synthase genes of prokaryotic origin in chordate larvaceans.

    PubMed

    Sagane, Yoshimasa; Zech, Karin; Bouquet, Jean-Marie; Schmid, Martina; Bal, Ugur; Thompson, Eric M

    2010-05-01

    Extracellular matrices play important, but poorly investigated, roles in morphogenesis. Extracellular cellulose is central to regulation of pattern formation in plants, but among metazoans only tunicates are capable of cellulose biosynthesis. Cellulose synthase (CesA) gene products are present in filter-feeding structures of all tunicates and also regulate metamorphosis in the ascidian Ciona. Ciona CesA is proposed to have been acquired by lateral gene transfer from a prokaryote. We identified two CesA genes in the sister-class larvacean Oikopleura dioica. Each has a mosaic structure of a glycoslyltransferase 2 domain upstream of a glycosyl hydrolase family 6 cellulase-like domain, a signature thus far unique to tunicates. Spatial-temporal expression analysis revealed that Od-CesA1 produces long cellulose fibrils along the larval tail, whereas Od-CesA2 is responsible for the cellulose scaffold of the post-metamorphic filter-feeding house. Knockdown of Od-CesA1 inhibited cellulose production in the extracellular matrix of the larval tail. Notochord cells either failed to align or were misaligned, the tail did not elongate properly and tailbud embryos also exhibited a failure to hatch. Knockdown of Od-CesA2 did not elicit any of these phenotypes and instead caused a mild delay in pre-house formation. Phylogenetic analyses including Od-CesAs indicate that a single lateral gene transfer event from a prokaryote at the base of the lineage conferred biosynthetic capacity in all tunicates. Ascidians possess one CesA gene, whereas duplicated larvacean genes have evolved distinct temporal and functional specializations. Extracellular cellulose microfibrils produced by the pre-metamorphic Od-CesA1 duplicate have a role in notochord and tail morphogenesis.

  7. Genetic association analyses of nitric oxide synthase genes and neural tube defects vary by phenotype.

    PubMed

    Soldano, Karen L; Garrett, Melanie E; Cope, Heidi L; Rusnak, J Michael; Ellis, Nathen J; Dunlap, Kaitlyn L; Speer, Marcy C; Gregory, Simon G; Ashley-Koch, Allison E

    2013-10-01

    Neural tube defects (NTDs) are caused by improper neural tube closure during the early stages of embryonic development. NTDs are hypothesized to have a complex genetic origin and numerous candidate genes have been proposed. The nitric oxide synthase 3 (NOS3) G594T polymorphism has been implicated in risk for spina bifida, and interactions between that single nucleotide polymorphism (SNP) and the methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism have also been observed. To evaluate other genetic variation in the NO pathway in the development of NTDs, we examined all three NOS genes: NOS1, NOS2, and NOS3. Using 3109 Caucasian samples in 745 families, we evaluated association in the overall dataset and within specific phenotypic subsets. Haplotype tagging SNPs in the NOS genes were tested for genetic association with NTD subtypes, both for main effects as well as for the presence of interactions with the MTHFR C677T polymorphism. Nominal main effect associations were found with all subtypes, across all three NOS genes, and interactions were observed between SNPs in all three NOS genes and MTHFR C677T. Unlike the previous report, the most significant associations in our dataset were with cranial subtypes and the AG genotype of rs4795067 in NOS2 (p = 0.0014) and the interaction between the rs9658490 G allele in NOS1 and MTHFR 677TT genotype (p = 0.0014). Our data extend the previous findings by implicating a role for all three NOS genes, independently and through interactions with MTHFR, in risk not only for spina bifida, but all NTD subtypes.

  8. In silico identification and analysis of phytoene synthase genes in plants.

    PubMed

    Han, Y; Zheng, Q S; Wei, Y P; Chen, J; Liu, R; Wan, H J

    2015-08-14

    In this study, we examined phytoene synthetase (PSY), the first key limiting enzyme in the synthesis of carotenoids and catalyzing the formation of geranylgeranyl pyrophosphate in terpenoid biosynthesis. We used known amino acid sequences of the PSY gene in tomato plants to conduct a genome-wide search and identify putative candidates in 34 sequenced plants. A total of 101 homologous genes were identified. Phylogenetic analysis revealed that PSY evolved independently in algae as well as monocotyledonous and dicotyledonous plants. Our results showed that the amino acid structures exhibited 5 motifs (motifs 1 to 5) in algae and those in higher plants were highly conserved. The PSY gene structures showed that the number of intron in algae varied widely, while the number of introns in higher plants was 4 to 5. Identification of PSY genes in plants and the analysis of the gene structure may provide a theoretical basis for studying evolutionary relationships in future analyses.

  9. Engineering a Polyketide Synthase for In Vitro Production of Adipic Acid.

    PubMed

    Hagen, Andrew; Poust, Sean; Rond, Tristan de; Fortman, Jeffrey L; Katz, Leonard; Petzold, Christopher J; Keasling, Jay D

    2016-01-15

    Polyketides have enormous structural diversity, yet polyketide synthases (PKSs) have thus far been engineered to produce only drug candidates or derivatives thereof. Thousands of other molecules, including commodity and specialty chemicals, could be synthesized using PKSs if composing hybrid PKSs from well-characterized parts derived from natural PKSs was more efficient. Here, using modern mass spectrometry techniques as an essential part of the design-build-test cycle, we engineered a chimeric PKS to enable production one of the most widely used commodity chemicals, adipic acid. To accomplish this, we introduced heterologous reductive domains from various PKS clusters into the borrelidin PKS' first extension module, which we previously showed produces a 3-hydroxy-adipoyl intermediate when coincubated with the loading module and a succinyl-CoA starter unit. Acyl-ACP intermediate analysis revealed an unexpected bottleneck at the dehydration step, which was overcome by introduction of a carboxyacyl-processing dehydratase domain. Appending a thioesterase to the hybrid PKS enabled the production of free adipic acid. Using acyl-intermediate based techniques to "debug" PKSs as described here, it should one day be possible to engineer chimeric PKSs to produce a variety of existing commodity and specialty chemicals, as well as thousands of chemicals that are difficult to produce from petroleum feedstocks using traditional synthetic chemistry.

  10. Homology modeling of Homo sapiens Lipoic acid Synthase: substrate docking and insights on its binding mode.

    PubMed

    Krishnamoorthy, Ezhilarasi; Hassan, Sameer; Hanna, Luke Elizabeth; Padmalayam, Indira; Rajaram, Rama; Viswanathan, Vijay

    2016-10-04

    Lipoic acid synthase (LIAS) is an iron-sulfur cluster mitochondrial enzyme which catalyzes the final step in the de novo pathway for the biosynthesis of lipoic acid, a potent antioxidant. Recently there has been significant interest in its role in metabolic diseases and its deficiency in LIAS expression has been linked to conditions such as diabetes, atherosclerosis and neonatal-onset epilepsy, suggesting a strong inverse correlation between LIAS reduction and disease status. In this study we use a bioinformatics approach to predict its structure, which would be helpful to understanding its role. A homology model for LIAS protein was generated using X - ray crystallographic structure of Thermosynechococcus elongatus BP-1 (PDB ID: 4U0P). The predicted structure has 93% of the residues in the most favour region of Ramachandran plot. The active site of LIAS protein was mapped and docked with S-Adenosyl Methionine (SAM) using GOLD software. The LIAS - SAM complex was further refined using molecular dynamics simulation within the subsite 1 and subsite 3 of the active site. To the best of our knowledge, this is the first study to report a reliable homology model of LIAS protein. This study will facilitate a better understanding mode of action of the enzyme-substrate complex for future studies in designing drugs that can target LIAS protein.

  11. Fatty acid synthase - Modern tumor cell biology insights into a classical oncology target.

    PubMed

    Buckley, Douglas; Duke, Gregory; Heuer, Timothy S; O'Farrell, Marie; Wagman, Allan S; McCulloch, William; Kemble, George

    2017-02-12

    Decades of preclinical and natural history studies have highlighted the potential of fatty acid synthase (FASN) as a bona fide drug target for oncology. This review will highlight the foundational concepts upon which this perspective is built. Published studies have shown that high levels of FASN in patient tumor tissues are present at later stages of disease and this overexpression predicts poor prognosis. Preclinical studies have shown that experimental overexpression of FASN in previously normal cells leads to changes that are critical for establishing a tumor phenotype. Once the tumor phenotype is established, FASN elicits several changes to the tumor cell and becomes intertwined with its survival. The product of FASN, palmitate, changes the biophysical nature of the tumor cell membrane; membrane microdomains enable the efficient assembly of signaling complexes required for continued tumor cell proliferation and survival. Membranes densely packed with phospholipids containing saturated fatty acids become resistant to the action of other chemotherapeutic agents. Inhibiting FASN leads to tumor cell death while sparing normal cells, which do not have the dependence of this enzyme for normal functions, and restores membrane architecture to more normal properties thereby resensitizing tumors to killing by chemotherapies. One compound has recently reached clinical studies in solid tumor patients and highlights the need for continued evaluation of the role of FASN in tumor cell biology. Significant advances have been made and much remains to be done to optimally apply this class of pharmacological agents for the treatment of specific cancers.

  12. Gibberellic acid, synthetic auxins, and ethylene differentially modulate alpha-L-Arabinofuranosidase activities in antisense 1-aminocyclopropane-1-carboxylic acid synthase tomato pericarp discs.

    PubMed

    Sozzi, Gabriel O; Greve, L Carl; Prody, Gerry A; Labavitch, John M

    2002-07-01

    Alpha-L-Arabinofuranosidases (alpha-Afs) are plant enzymes capable of releasing terminal arabinofuranosyl residues from cell wall matrix polymers, as well as from different glycoconjugates. Three different alpha-Af isoforms were distinguished by size exclusion chromatography of protein extracts from control tomatoes (Lycopersicon esculentum) and an ethylene synthesis-suppressed (ESS) line expressing an antisense 1-aminocyclopropane-1-carboxylic synthase transgene. alpha-Af I and II are active throughout fruit ontogeny. alpha-Af I is the first Zn-dependent cell wall enzyme isolated from tomato pericarp tissues, thus suggesting the involvement of zinc in fruit cell wall metabolism. This isoform is inhibited by 1,10-phenanthroline, but remains stable in the presence of NaCl and sucrose. alpha-Af II activity accounts for over 80% of the total alpha-Af activity in 10-d-old fruit, but activity drops during ripening. In contrast, alpha-Af III is ethylene dependent and specifically active during ripening. alpha-Af I released monosaccharide arabinose from KOH-soluble polysaccharides from tomato cell walls, whereas alpha-Af II and III acted on Na(2)CO(3)-soluble pectins. Different alpha-Af isoform responses to gibberellic acid, synthetic auxins, and ethylene were followed by using a novel ESS mature-green tomato pericarp disc system. alpha-Af I and II activity increased when gibberellic acid or 2,4-dichlorophenoxyacetic acid was applied, whereas ethylene treatment enhanced only alpha-Af III activity. Results suggest that tomato alpha-Afs are encoded by a gene family under differential hormonal controls, and probably have different in vivo functions. The ESS pericarp explant system allows comprehensive studies involving effects of physiological levels of different growth regulators on gene expression and enzyme activity with negligible wound-induced ethylene production.

  13. Gibberellic Acid, Synthetic Auxins, and Ethylene Differentially Modulate α-l-Arabinofuranosidase Activities in Antisense 1-Aminocyclopropane-1-Carboxylic Acid Synthase Tomato Pericarp Discs1

    PubMed Central

    Sozzi, Gabriel O.; Greve, L. Carl; Prody, Gerry A.; Labavitch, John M.

    2002-01-01

    α-l-Arabinofuranosidases (α-Afs) are plant enzymes capable of releasing terminal arabinofuranosyl residues from cell wall matrix polymers, as well as from different glycoconjugates. Three different α-Af isoforms were distinguished by size exclusion chromatography of protein extracts from control tomatoes (Lycopersicon esculentum) and an ethylene synthesis-suppressed (ESS) line expressing an antisense 1-aminocyclopropane-1-carboxylic synthase transgene. α-Af I and II are active throughout fruit ontogeny. α-Af I is the first Zn-dependent cell wall enzyme isolated from tomato pericarp tissues, thus suggesting the involvement of zinc in fruit cell wall metabolism. This isoform is inhibited by 1,10-phenanthroline, but remains stable in the presence of NaCl and sucrose. α-Af II activity accounts for over 80% of the total α-Af activity in 10-d-old fruit, but activity drops during ripening. In contrast, α-Af III is ethylene dependent and specifically active during ripening. α-Af I released monosaccharide arabinose from KOH-soluble polysaccharides from tomato cell walls, whereas α-Af II and III acted on Na2CO3-soluble pectins. Different α-Af isoform responses to gibberellic acid, synthetic auxins, and ethylene were followed by using a novel ESS mature-green tomato pericarp disc system. α-Af I and II activity increased when gibberellic acid or 2,4-dichlorophenoxyacetic acid was applied, whereas ethylene treatment enhanced only α-Af III activity. Results suggest that tomato α-Afs are encoded by a gene family under differential hormonal controls, and probably have different in vivo functions. The ESS pericarp explant system allows comprehensive studies involving effects of physiological levels of different growth regulators on gene expression and enzyme activity with negligible wound-induced ethylene production. PMID:12114586

  14. The Polyketide Synthase Gene pks4 of Trichoderma reesei Provides Pigmentation and Stress Resistance

    PubMed Central

    Atanasova, Lea; Knox, Benjamin P.; Kubicek, Christian P.; Baker, Scott E.

    2013-01-01

    Species of the fungal genus Trichoderma (Hypocreales, Ascomycota) are well-known for their production of various secondary metabolites. Nonribosomal peptides and polyketides represent a major portion of these products. In a recent phylogenomic investigation of Trichoderma polyketide synthase (PKS)-encoding genes, the pks4 from T. reesei was shown to be an orthologue of pigment-forming PKSs involved in synthesis of aurofusarin and bikaverin in Fusarium spp. In this study, we show that deletion of this gene in T. reesei results in loss of green conidial pigmentation and in pigmentation alteration of teleomorph structures. It also has an impact on conidial cell wall stability and the antagonistic abilities of T. reesei against other fungi, including formation of inhibitory metabolites. In addition, deletion of pks4 significantly influences the expression of other PKS-encoding genes of T. reesei. To our knowledge, this is the first indication that a low-molecular-weight pigment-forming PKS is involved in defense, mechanical stability, and stress resistance in fungi. PMID:24036343

  15. A Single Arabidopsis Gene Encodes Two Differentially Targeted Geranylgeranyl Diphosphate Synthase Isoforms1[OPEN

    PubMed Central

    Schipper, Bert; Beekwilder, Jules

    2016-01-01

    A wide diversity of isoprenoids is produced in different plant compartments. Most groups of isoprenoids synthesized in plastids, and some produced elsewhere in the plant cell derive from geranylgeranyl diphosphate (GGPP) synthesized by GGPP synthase (GGPPS) enzymes. In Arabidopsis (Arabidopsis thaliana), five genes appear to encode GGPPS isoforms localized in plastids (two), the endoplasmic reticulum (two), and mitochondria (one). However, the loss of function of the plastid-targeted GGPPS11 isoform (referred to as G11) is sufficient to cause lethality. Here, we show that the absence of a strong transcription initiation site in the G11 gene results in the production of transcripts of different lengths. The longer transcripts encode an isoform with a functional plastid import sequence that produces GGPP for the major groups of photosynthesis-related plastidial isoprenoids. However, shorter transcripts are also produced that lack the first translation initiation codon and rely on a second in-frame ATG codon to produce an enzymatically active isoform lacking this N-terminal domain. This short enzyme localizes in the cytosol and is essential for embryo development. Our results confirm that the production of differentially targeted enzyme isoforms from the same gene is a central mechanism to control the biosynthesis of isoprenoid precursors in different plant cell compartments. PMID:27707890

  16. Molecular identity and gene expression of aldosterone synthase cytochrome P450

    SciTech Connect

    Okamoto, Mitsuhiro . E-mail: mokamoto@mr-mbio.med.osaka-u.ac.jp; Nonaka, Yasuki; Takemori, Hiroshi; Doi, Junko

    2005-12-09

    11{beta}-Hydroxylase (CYP11B1) of bovine adrenal cortex produced corticosterone as well as aldosterone from 11-deoxycorticosterone in the presence of the mitochondrial P450 electron transport system. CYP11B1s of pig, sheep, and bullfrog, when expressed in COS-7 cells, also performed corticosterone and aldosterone production. Since these CYP11B1s are present in the zonae fasciculata and reticularis as well as in the zona glomerulosa, the zonal differentiation of steroid production may occur by the action of still-unidentified factor(s) on the enzyme-catalyzed successive oxygenations at C11- and C18-positions of steroid. In contrast, two cDNAs, one encoding 11{beta}-hydroxylase and the other encoding aldosterone synthase (CYP11B2), were isolated from rat, mouse, hamster, guinea pig, and human adrenals. The expression of CYP11B1 gene was regulated by cyclic AMP (cAMP)-dependent signaling, whereas that of CYP11B2 gene by calcium ion-signaling as well as cAMP-signaling. Salt-inducible protein kinase, a cAMP-induced novel protein kinase, was one of the regulators of CYP11B2 gene expression.

  17. Molecular cloning, structure, and chromosomal localization of the human inducible nitric oxide synthase gene.

    PubMed

    Chartrain, N A; Geller, D A; Koty, P P; Sitrin, N F; Nussler, A K; Hoffman, E P; Billiar, T R; Hutchinson, N I; Mudgett, J S

    1994-03-04

    Nitric oxide, a multifunctional effector molecule synthesized by nitric oxide synthase (NOS) from L-arginine, conveys signals for vasorelaxation, neurotransmission, and cytotoxicity. Three different NOS isoforms have been identified which fall into two distinct types, constitutive and inducible. The inducible NOS (iNOS) isoform is expressed in a variety of cell types and tissues in response to inflammatory agents and cytokines. The human iNOS (NOS2) gene was isolated on overlapping cosmid clones from a human genomic library using both the murine macrophage and the human hepatocyte iNOS cDNAs as probes. All isolated cosmids were part of a single genomic locus and no other genomic loci were identified or isolated. Analysis of this locus indicated that the human iNOS gene is approximately 37 kilobases in length and consists of 26 exons and 25 introns. Primer extension analysis of lipopolysaccharide and cytokine-stimulated human hepatocyte RNA mapped the transcriptional initiation site 30 base pairs downstream of a TATA sequence, and a 400-base pair 5'-flanking region was found to be structurally similar to the recently described murine iNOS promoter. Polymerase chain reaction analysis of a human/rodent genomic DNA somatic cell hybrid panel and fluorescent in situ hybridization indicated that the human iNOS gene is located on chromosome 17 at position 17cen-q11.2.

  18. The polyketide synthase gene pks4 of Trichoderma reesei provides pigmentation and stress resistance.

    PubMed

    Atanasova, Lea; Knox, Benjamin P; Kubicek, Christian P; Druzhinina, Irina S; Baker, Scott E

    2013-11-01

    Species of the fungal genus Trichoderma (Hypocreales, Ascomycota) are well-known for their production of various secondary metabolites. Nonribosomal peptides and polyketides represent a major portion of these products. In a recent phylogenomic investigation of Trichoderma polyketide synthase (PKS)-encoding genes, the pks4 from T. reesei was shown to be an orthologue of pigment-forming PKSs involved in synthesis of aurofusarin and bikaverin in Fusarium spp. In this study, we show that deletion of this gene in T. reesei results in loss of green conidial pigmentation and in pigmentation alteration of teleomorph structures. It also has an impact on conidial cell wall stability and the antagonistic abilities of T. reesei against other fungi, including formation of inhibitory metabolites. In addition, deletion of pks4 significantly influences the expression of other PKS-encoding genes of T. reesei. To our knowledge, this is the first indication that a low-molecular-weight pigment-forming PKS is involved in defense, mechanical stability, and stress resistance in fungi.

  19. Two closely linked but separable promoters for human neuronal nitric oxide synthase gene transcription.

    PubMed Central

    Xie, J; Roddy, P; Rife, T K; Murad, F; Young, A P

    1995-01-01

    In this report we demonstrate that the human cerebellum contains neuronal nitric oxide synthase (nNOS) mRNAs with two distinct 5'-untranslated regions that are encoded through use of closely linked but separate promoters. nNOS cDNA clones were shown to contain different 5' terminal exons spliced to a common exon 2. Genomic cloning and sequence analysis demonstrate that the unique exons are positioned within 300 bp of each other but separated from exon 2 by an intron that is at least 20 kb in length. A CpG island engulfs the downstream 5'-terminal exon. In contrast, most of the upstream exon resides outside of this CpG island. Interestingly, the upstream exon includes a GT dinucleotide repeat. A fusion gene with a 414-bp nNOS genomic fragment that includes a portion of the upstream 5'-terminal exon and its immediate 5'-flanking DNA is expressed in transfected HeLa cells. Also expressed is a fusion gene that contains the luciferase reporter under transcriptional control by a 308-bp genomic fragment that includes the region separating both 5'-terminal exons. These results indicate that expression of these exons is subject to transcriptional control by separate promoters. However, the proximity of these promoters raise the possibility that complex interactions may be involved in regulating nNOS gene expression at these sites. Images Fig. 1 Fig. 4 PMID:7532307

  20. Acute intermittent porphyria: A single-base deletion and a nonsense mutation in the human hydroxymethylbilane synthase gene, predicting truncations of the enzyme polypeptide

    SciTech Connect

    Lee, G.L.; Astrin, K.H.; Desnick, R.J.

    1995-08-28

    Acute intermittent porphyria (AIP) is an autosomal-dominant inborn error of metabolism that results from the half-normal activity of the third enzyme in the heme biosynthetic pathway, hydroxymethylbilane synthase (HMB-synthase). AIP is an ecogenetic condition, since the life-threatening acute attacks are precipitated by various factors, including drugs, alcohol, fasting, and certain hormones. Biochemical diagnosis is problematic, and the identification of mutations in the HMB-synthase gene provides accurate detection of presymptomatic heterozygotes, permitting avoidance of the acute precipitating factors. By direct solid-phase sequencing, two mutations causing AIP were identified, an adenine deletion at position 629 in exon 11(629delA), which alters the reading frame and predicts premature truncation of the enzyme protein after amino acid 255, and a nonsense mutation in exon 12 (R225X). These mutations were confirmed by either restriction enzyme analysis or family studies of symptomatic patients, permitting accurate presymptomatic diagnosis of affected relatives. 29 refs., 2 figs.

  1. Expression of dehydratase domains from a polyunsaturated fatty acid synthase increases the production of fatty acids in Escherichia coli

    PubMed Central

    Oyola-Robles, Delise; Rullán-Lind, Carlos; Carballeira, Néstor M.; Baerga-Ortiz, Abel

    2014-01-01

    Increasing the production of fatty acids by microbial fermentation remains an important step towards the generation of biodiesel and other portable liquid fuels. In this work, we report an Escherichia coli strain engineered to overexpress a fragment consisting of four dehydratase domains from the polyunsaturated fatty acid (PUFA) synthase enzyme complex from the deep-sea bacterium, Photobacterium profundum. The DH1-DH2-UMA enzyme fragment was excised from its natural context within a multi-enzyme PKS and expressed as a stand-alone protein. Fatty acids were extracted from the cell pellet, esterified with methanol and quantified by GC-MS analysis. Results show that the E. coli strain expressing the DH tetradomain fragment was capable of producing up to a 5-fold increase (80.31 mg total FA/L culture) in total fatty acids over the negative control strain lacking the recombinant enzyme. The enhancement in production was observed across the board for all the fatty acids that are typically made by E. coli. The overexpression of the DH tetradomain did not affect E. coli cell growth, thus showing that the observed enhancement in fatty acid production was not a result of effects associated with cell density. The observed enhancement was more pronounced at lower temperatures (3.8-fold at 16 °C, 3.5-fold at 22 °C and 1.5-fold at 30 °C) and supplementation of the media with 0.4% glycerol did not result in an increase in fatty acid production. All these results taken together suggest that either the dehydration of fatty acid intermediates are a limiting step in the E. coli fatty acid biosynthesis machinery, or that the recombinant dehydratase domains used in this study are also capable of catalyzing thioester hydrolysis of the final products. The enzyme in this report is a new tool which could be incorporated into other existing strategies aimed at improving fatty acid production in bacterial fermentations towards accessible biodiesel precursors. PMID:24411456

  2. Expression of dehydratase domains from a polyunsaturated fatty acid synthase increases the production of fatty acids in Escherichia coli.

    PubMed

    Oyola-Robles, Delise; Rullán-Lind, Carlos; Carballeira, Néstor M; Baerga-Ortiz, Abel

    2014-02-05

    Increasing the production of fatty acids by microbial fermentation remains an important step toward the generation of biodiesel and other portable liquid fuels. In this work, we report an Escherichia coli strain engineered to overexpress a fragment consisting of four dehydratase domains from the polyunsaturated fatty acid (PUFA) synthase enzyme complex from the deep-sea bacterium, Photobacterium profundum. The DH1-DH2-UMA enzyme fragment was excised from its natural context within a multi-enzyme PKS and expressed as a stand-alone protein. Fatty acids were extracted from the cell pellet, esterified with methanol and quantified by GC-MS analysis. Results show that the E. coli strain expressing the DH tetradomain fragment was capable of producing up to a 5-fold increase (80.31 mg total FA/L culture) in total fatty acids over the negative control strain lacking the recombinant enzyme. The enhancement in production was observed across the board for all the fatty acids that are typically made by E. coli. The overexpression of the DH tetradomain did not affect E. coli cell growth, thus showing that the observed enhancement in fatty acid production was not a result of effects associated with cell density. The observed enhancement was more pronounced at lower temperatures (3.8-fold at 16 °C, 3.5-fold at 22 °C and 1.5-fold at 30 °C) and supplementation of the media with 0.4% glycerol did not result in an increase in fatty acid production. All these results taken together suggest that either the dehydration of fatty acid intermediates are a limiting step in the E. coli fatty acid biosynthesis machinery, or that the recombinant dehydratase domains used in this study are also capable of catalyzing thioester hydrolysis of the final products. The enzyme in this report is a new tool which could be incorporated into other existing strategies aimed at improving fatty acid production in bacterial fermentations toward accessible biodiesel precursors.

  3. Association of methionine synthase gene polymorphisms with wool production and quality traits in Chinese Merino population.

    PubMed

    Rong, E G; Yang, H; Zhang, Z W; Wang, Z P; Yan, X H; Li, H; Wang, N

    2015-10-01

    Methionine synthase (MTR) plays a crucial role in maintaining homeostasis of intracellular methionine, folate, and homocysteine, and its activity correlates with DNA methylation in many mammalian tissues. Our previous genomewide association study identified that 1 SNP located in the gene was associated with several wool production and quality traits in Chinese Merino. To confirm the potential involvement of the gene in sheep wool production and quality traits, we performed sheep tissue expression profiling, SNP detection, and association analysis with sheep wool production and quality traits. The semiquantitative reverse transcription PCR analysis showed that the gene was differentially expressed in skin from Merino and Kazak sheep. The sequencing analysis identified a total of 13 SNP in the gene from Chinese Merino sheep. Comparison of the allele frequencies revealed that these 13 identified SNP were significantly different among the 6 tested Chinese Merino strains ( < 0.001). Linkage disequilibrium analysis showed that SNP 3 to 11 were strongly linked in a single haplotype block in the tested population. Association analysis showed that SNP 2 to 11 were significantly associated with the average wool fiber diameter and the fineness SD and that SNP 4 to 11 were significantly associated with the CV of fiber diameter trait ( < 0.05). Single nucleotide polymorphism 2 and SNP 5 to 12 were weakly associated with wool crimp. Similarly, the haplotypes derived from these 13 identified SNP were also significantly associated with the average wool fiber diameter, fineness SD, and the CV of fiber diameter ( < 0.05). Our results suggest that is a candidate gene for sheep wool production and quality traits, and the identified SNP might be used in sheep breeding.

  4. Endothelial nitric oxide synthase gene polymorphism is associated with sickle cell disease patients in India.

    PubMed

    Nishank, Sudhansu Sekhar; Singh, Mendi Prema Shyam Sunder; Yadav, Rajiv; Gupta, Rasik Bihari; Gadge, Vijay Sadashiv; Gwal, Anil

    2013-12-01

    Patients with sickle cell disease (SCD) produce significantly low levels of plasma nitric oxide (NO) during acute vaso-occlusive crisis. In transgenic sickle cell mice, NO synthesized by endothelial nitric oxide synthase (eNOS) enzyme of vascular endothelial cells has been found to protect the mice from vaso-occlusive events. Therefore, the present study aims to explore possible association of eNOS gene polymorphism as a potential genetic modifier in SCD patients. A case control study involving 150 SCD patients and age- and ethnicity-matched 150 healthy controls were genotyped by PCR-restriction fragment length polymorphism techniques for three important eNOS gene polymorphisms-eNOS 4a/b, eNOS 894G>T and eNOS -786T>C. It was observed that SCD patients had significantly higher frequencies of mutant alleles besides heterozygous and homozygous mutant genotypes of these three eNOS gene polymorphisms and low levels of plasma nitrite (NO2) as compared with control groups. The SCD severe group had significantly lower levels of plasma NO2 and higher frequencies of mutant alleles of these three SNPs of eNOS gene in contrast to the SCD mild group of patients. Haplotype analysis revealed that frequencies of one mutant haplotype '4a-T-C' (alleles in order of eNOS 4a/b, eNOS 894G>T and eNOS -786T>C) were significantly high in the severe SCD patients (P<0.0001), whereas the frequency of a wild haplotype '4b-G-T' was found to be significantly high (P<0.0001) in the SCD mild patients, which indicates that eNOS gene polymorphisms are associated with SCD patients in India and may act as a genetic modifier of the phenotypic variation of SCD patients.

  5. The Evolutionary Fate of the Horizontally Transferred Agrobacterial Mikimopine Synthase Gene in the Genera Nicotiana and Linaria

    PubMed Central

    Talianova, Martina; Vyskot, Boris

    2014-01-01

    Few cases of spontaneously horizontally transferred bacterial genes into plant genomes have been described to date. The occurrence of horizontally transferred genes from the T-DNA of Agrobacterium rhizogenes into the plant genome has been reported in the genus Nicotiana and in the species Linaria vulgaris. Here we compare patterns of evolution in one of these genes (a gene encoding mikimopine synthase, mis) following three different events of horizontal gene transfer (HGT). As this gene plays an important role in Agrobacterium, and there are known cases showing that genes from pathogens can acquire plant protection function, we hypothesised that in at least some of the studied species we will find signs of selective pressures influencing mis sequence. The mikimopine synthase (mis) gene evolved in a different manner in the branch leading to Nicotiana tabacum and N. tomentosiformis, in the branch leading to N. glauca and in the genus Linaria. Our analyses of the genus Linaria suggest that the mis gene began to degenerate soon after the HGT. In contrast, in the case of N. glauca, the mis gene evolved under significant selective pressures. This suggests a possible role of mikimopine synthase in current N. glauca and its ancestor(s). In N. tabacum and N. tomentosiformis, the mis gene has a common frameshift mutation that disrupted its open reading frame. Interestingly, our results suggest that in spite of the frameshift, the mis gene could evolve under selective pressures. This sequence may still have some regulatory role at the RNA level as suggested by coverage of this sequence by small RNAs in N. tabacum. PMID:25420106

  6. Over-expression of the apple spermidine synthase gene in pear confers multiple abiotic stress tolerance by altering polyamine titers.

    PubMed

    Wen, Xiao-Peng; Pang, Xiao-Ming; Matsuda, Narumi; Kita, Masayuki; Inoue, Hiromichi; Hao, Yu-Jin; Honda, Chikako; Moriguchi, Takaya

    2008-04-01

    An apple spermidine synthase (SPDS) gene (MdSPDS1) was verified to encode a functional protein by the complementation of the spe3 yeast mutant, which lacks the SPDS gene. To justify our hypothesis that apple SPDS is involved in abiotic stress responses and to obtain transgenic fruit trees tolerant to abiotic stresses as well, MdSPDS1-over-expressing transgenic European pear (Pyrus communis L. 'Ballad') plants were created by Agrobacterium-mediated transformation. A total of 21 transgenic lines showing various spermidine (Spd) titers and MdSPDS1 expression levels were obtained. Selected lines were exposed to salt (150 mM NaCl), osmosis (300 mM mannitol), and heavy metal (500 microM CuSO4) stresses for evaluating their stress tolerances. Transgenic line no. 32, which was revealed to have the highest Spd accumulation and expression level of MdSPDS1, showed the strongest tolerance to these stresses. When growth increments, electrolyte leakage (EL), and values of thiobarbituric acid reactive substances (TBARS) were monitored, line no. 32 showed the lowest growth inhibition and the least increase in EL or TBARS under stress conditions. Spd titers in wild-type and transgenic lines showed diverse changes upon stresses, and these changes were not consistent with the changes in MdSPDS1 expressions. Moreover, there were no differences in the sodium concentration in the shoots between the wild type and line no. 32, whereas the copper concentration was higher in the wild type than in line no. 32. Although the mechanism(s) underlying the involvement of polyamines in stress responses is not known, these results suggest that the over-expression of the SPDS gene substantially increased the tolerance to multiple stresses by altering the polyamine titers in pear. Thus, MdSPDS1-over-expressing transgenic pear plants could be used to improve desert land and/or to repair polluted environments.

  7. UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6

    SciTech Connect

    Miyata, Maiko; Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko; Sugiura, Kazumitsu; Furukawa, Koichi; Furukawa, Keiko

    2014-03-07

    Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes.

  8. High Polyhydroxybutyrate Production in Pseudomonas extremaustralis Is Associated with Differential Expression of Horizontally Acquired and Core Genome Polyhydroxyalkanoate Synthase Genes

    PubMed Central

    Catone, Mariela V.; Ruiz, Jimena A.; Castellanos, Mildred; Segura, Daniel; Espin, Guadalupe; López, Nancy I.

    2014-01-01

    Pseudomonas extremaustralis produces mainly polyhydroxybutyrate (PHB), a short chain length polyhydroxyalkanoate (sclPHA) infrequently found in Pseudomonas species. Previous studies with this strain demonstrated that PHB genes are located in a genomic island. In this work, the analysis of the genome of P. extremaustralis revealed the presence of another PHB cluster phbFPX, with high similarity to genes belonging to Burkholderiales, and also a cluster, phaC1ZC2D, coding for medium chain length PHA production (mclPHA). All mclPHA genes showed high similarity to genes from Pseudomonas species and interestingly, this cluster also showed a natural insertion of seven ORFs not related to mclPHA metabolism. Besides PHB, P. extremaustralis is able to produce mclPHA although in minor amounts. Complementation analysis demonstrated that both mclPHA synthases, PhaC1 and PhaC2, were functional. RT-qPCR analysis showed different levels of expression for the PHB synthase, phbC, and the mclPHA synthases. The expression level of phbC, was significantly higher than the obtained for phaC1 and phaC2, in late exponential phase cultures. The analysis of the proteins bound to the PHA granules showed the presence of PhbC and PhaC1, whilst PhaC2 could not be detected. In addition, two phasin like proteins (PhbP and PhaI) associated with the production of scl and mcl PHAs, respectively, were detected. The results of this work show the high efficiency of a foreign gene (phbC) in comparison with the mclPHA core genome genes (phaC1 and phaC2) indicating that the ability of P. extremaustralis to produce high amounts of PHB could be explained by the different expression levels of the genes encoding the scl and mcl PHA synthases. PMID:24887088

  9. [Cloning, prokaryotic expression, and functional identification of a sesquiterpene synthase gene (AsSS4) from Aquilaria sinensis].

    PubMed

    Liang, Liang; Guo, Qing-Mei; Zhang, Zheng; Xu, Yan-Hong; Han, Xiao-Min; Liu, Juan

    2014-12-01

    A sesquiterpene synthase (AsSS4) full-length open reading frame (ORF) cDNA was cloned from wounded stems of Aquilaria sinensis by RT-PCR method. The result showed that the ORF of AsSS4 was 1,698 bp encoding 565 amino acids. Prokaryotic expression vector pET28a-AsSS4 was constructed and transformed into E. coli BL21 (DE3) pLysS. Recombinant AsSS4 protein was obtained after induction by IPTG and SDS-PAGE analysis with a MW of 64 kD. Enzymatic reactions using farnesyl pyrophosphate showed that recombinant AsSS4 protein purified by Ni-agarose gel yielded five sesquiterpene compounds, cyclohexane, 1-ethenyl-1-methyl-2, 4-bis(1-methylethenyl)-, β-elemene, α-guaiene, α-caryophyllene and δ-guaiene. This paper reported the first cloning and functional characterization of AsSS4 gene from A. sinensis, which will establish a foundation for future studies on the molecular mechanisms of wound-induce agarwood formation in A. sinensis

  10. Overexpression of the trichodiene synthase gene tri5 increases trichodermin production and antimicrobial activity in Trichoderma brevicompactum.

    PubMed

    Tijerino, Anamariela; Cardoza, R Elena; Moraga, Javier; Malmierca, Mónica G; Vicente, Francisca; Aleu, Josefina; Collado, Isidro G; Gutiérrez, Santiago; Monte, Enrique; Hermosa, Rosa

    2011-03-01

    Trichoderma brevicompactum produces trichodermin, a simple trichothecene-type toxin that shares the first steps of the sesquiterpene biosynthetic pathway with other phytotoxic trichothecenes from Fusarium spp. Trichodiene synthase catalyses the conversion of farnesyl pyrophosphate to trichodiene and it is encoded by the tri5 gene that was cloned and analysed functionally by homologous overexpression in T. brevicompactum. tri5 expression was up-regulated in media with glucose, H(2)O(2) or glycerol. tri5 repression was observed in cultures supplemented with the antioxidants ferulic acid and tyrosol. Acetone extracts of tri5-overexpressing transformants displayed higher antifungal activity than those from the wild-type. Chromatographic and spectroscopic analyses revealed that tri5 overexpression led to an increased production of trichodermin and tyrosol. Agar diffusion assays with these two purified metabolites from the tri5-overexpressing transformant T. brevicompactum Tb41tri5 showed that only trichodermin had antifungal activity against Saccharomyces cerevisiae, Kluyveromyces marxianus, Candida albicans, Candida glabrata, Candida tropicalis and Aspergillus fumigatus, in most cases such activity being higher than that observed for amphotericin B and hygromycin. Our results point to the significant role of tri5 in the production of trichodermin and in the antifungal activity of T. brevicompactum.

  11. Provitamin A accumulation in cassava (Manihot esculenta) roots driven by a single nucleotide polymorphism in a phytoene synthase gene.

    PubMed

    Welsch, Ralf; Arango, Jacobo; Bär, Cornelia; Salazar, Bertha; Al-Babili, Salim; Beltrán, Jesús; Chavarriaga, Paul; Ceballos, Hernan; Tohme, Joe; Beyer, Peter

    2010-10-01

    Cassava (Manihot esculenta) is an important staple crop, especially in the arid tropics. Because roots of commercial cassava cultivars contain a limited amount of provitamin A carotenoids, both conventional breeding and genetic modification are being applied to increase their production and accumulation to fight vitamin A deficiency disorders. We show here that an allelic polymorphism in one of the two expressed phytoene synthase (PSY) genes is capable of enhancing the flux of carbon through carotenogenesis, thus leading to the accumulation of colored provitamin A carotenoids in storage roots. A single nucleotide polymorphism present only in yellow-rooted cultivars cosegregates with colored roots in a breeding pedigree. The resulting amino acid exchange in a highly conserved region of PSY provides increased catalytic activity in vitro and is able to increase carotenoid production in recombinant yeast and Escherichia coli cells. Consequently, cassava plants overexpressing a PSY transgene produce yellow-fleshed, high-carotenoid roots. This newly characterized PSY allele provides means to improve cassava provitamin A content in cassava roots through both breeding and genetic modification.

  12. The Variability of Sesquiterpenes Emitted from Two Zea mays Cultivars Is Controlled by Allelic Variation of Two Terpene Synthase Genes Encoding Stereoselective Multiple Product Enzymes

    PubMed Central

    Köllner, Tobias G.; Schnee, Christiane; Gershenzon, Jonathan; Degenhardt, Jörg

    2004-01-01

    The mature leaves and husks of Zea mays release a complex blend of terpene volatiles after anthesis consisting predominantly of bisabolane-, sesquithujane-, and bergamotane-type sesquiterpenes. The varieties B73 and Delprim release the same volatile constituents but in significantly different proportions. To study the molecular genetic and biochemical mechanisms controlling terpene diversity and distribution in these varieties, we isolated the closely related terpene synthase genes terpene synthase4 (tps4) and tps5 from both varieties. The encoded enzymes, TPS4 and TPS5, each formed the same complex mixture of sesquiterpenes from the precursor farnesyl diphosphate but with different proportions of products. These mixtures correspond to the sesquiterpene blends observed in the varieties B73 and Delprim, respectively. The differences in the stereoselectivity of TPS4 and TPS5 are determined by four amino acid substitutions with the most important being a Gly instead of an Ala residue at position 409 at the catalytic site of the enzyme. Although both varieties contain tps4 and tps5 alleles, their differences in terpene composition result from the fact that B73 has only a single functional allele of tps4 and no functional alleles of tps5, whereas Delprim has only a functional allele of tps5 and no functional alleles of tps4. Lack of functionality was shown to be attributable to frame-shift mutations or amino acid substitutions that greatly reduce the activity of their encoded proteins. Therefore, the diversity of sesquiterpenes in these two maize cultivars is strongly influenced by single nucleotide changes in the alleles of two terpene synthase genes. PMID:15075399

  13. In vitro reconstitution and steady-state analysis of the fatty acid synthase from Escherichia coli.

    PubMed

    Yu, Xingye; Liu, Tiangang; Zhu, Fayin; Khosla, Chaitan

    2011-11-15

    Microbial fatty acid derivatives are emerging as promising alternatives to fossil fuel derived transportation fuels. Among bacterial fatty acid synthases (FAS), the Escherichia coli FAS is perhaps the most well studied, but little is known about its steady-state kinetic behavior. Here we describe the reconstitution of E. coli FAS using purified protein components and report detailed kinetic analysis of this reconstituted system. When all ketosynthases are present at 1 μM, the maximum rate of free fatty acid synthesis of the FAS exceeded 100 μM/ min. The steady-state turnover frequency was not significantly inhibited at high concentrations of any substrate or cofactor. FAS activity was saturated with respect to most individual protein components when their concentrations exceeded 1 μM. The exceptions were FabI and FabZ, which increased FAS activity up to concentrations of 10 μM; FabH and FabF, which decreased FAS activity at concentrations higher than 1 μM; and holo-ACP and TesA, which gave maximum FAS activity at 30 μM concentrations. Analysis of the S36T mutant of the ACP revealed that the unusual dependence of FAS activity on holo-ACP concentration was due, at least in part, to the acyl-phosphopantetheine moiety. MALDI-TOF mass spectrometry analysis of the reaction mixture further revealed medium and long chain fatty acyl-ACP intermediates as predominant ACP species. We speculate that one or more of such intermediates are key allosteric regulators of FAS turnover. Our findings provide a new basis for assessing the scope and limitations of using E. coli as a biocatalyst for the production of diesel-like fuels.

  14. Association of Thymidylate Synthase Gene Polymorphisms with Stavudine Triphosphate Intracellular Levels and Lipodystrophy▿

    PubMed Central

    Domingo, Pere; Cabeza, M. Carmen; Pruvost, Alain; Torres, Ferran; Salazar, Juliana; del Mar Gutierrez, M.; Mateo, M. Gracia; Fontanet, Angels; Fernandez, Irene; Domingo, Joan C.; Villarroya, Francesc; Vidal, Francesc; Baiget, Montserrat

    2011-01-01

    The antiviral activity and toxicity of stavudine (d4T) depend on its triphosphate metabolite, stavudine triphosphate (d4T-TP). Therefore, modifications in intracellular levels of d4T-TP may change the toxicity profile of stavudine. d4T-TP intracellular levels in peripheral blood mononuclear cells were determined with a prominence liquid chromatograph connected to a triple-quadruple mass spectrometer. Polymorphisms in the thymidylate synthase (TS), methylenetetrahydrofolate reductase (MTHFR), dihydrofolate reductase (DHFR), reduced folate carrier 1 (RFC1; SLC19A1), and cyclin D1 (CCND1) genes were determined by direct sequencing using an ABI Prism 3100 genetic analyzer or Fluidigm's Biomark system. The Mann-Whitney test, rank analysis of variance (with Bonferroni's adjusted post hoc comparisons), and logistic regression were used for the inferential analyses. Thirty-three stavudine-treated patients were enrolled in this cross-sectional study. d4T-TP intracellular levels were 11.50 fmol/106 cells (interquartile range [IQR] = 8.12 to 13.87 fmol/106 cells) in patients with a high-expression TS genotype (2/3G, 3C/3G, and 3G/3G), whereas in those with a low-expression TS genotype (2/2, 2/3C, and 3C/3C), they were 21.40 fmol/106 cells (IQR = 18.90 to 27.0 fmol/106 cells) (P < 0.0001). Polymorphisms in the MTHFR, DHFR, RFC1, and CCND1 genes did not influence the intracellular concentration of d4T-TP. d4T-TP levels were independently associated with the TS genotype (low versus high expression; odds ratio [OR] = 86.22; 95% confidence interval [CI] = 8.48 to nonestimable; P = 0.0023). The low-expression TS genotype was associated with the development of HIV/highly active antiretroviral therapy-associated lypodystrophy syndrome (HALS) (OR = 14.0; 95% CI = 2.09 to 108.0; P = 0.0032). Our preliminary data show that polymorphisms in the thymidylate synthase gene are strongly associated with d4T-TP intracellular levels and with development of HALS. PMID:21282454

  15. Structural, Functional, and Evolutionary Analysis of the Unusually Large Stilbene Synthase Gene Family in Grapevine1[W

    PubMed Central

    Parage, Claire; Tavares, Raquel; Réty, Stéphane; Baltenweck-Guyot, Raymonde; Poutaraud, Anne; Renault, Lauriane; Heintz, Dimitri; Lugan, Raphaël; Marais, Gabriel A.B.; Aubourg, Sébastien; Hugueney, Philippe

    2012-01-01

    Stilbenes are a small family of phenylpropanoids produced in a number of unrelated plant species, including grapevine (Vitis vinifera). In addition to their participation in defense mechanisms in plants, stilbenes, such as resveratrol, display important pharmacological properties and are postulated to be involved in the health benefits associated with a moderate consumption of red wine. Stilbene synthases (STSs), which catalyze the biosynthesis of the stilbene backbone, seem to have evolved from chalcone synthases (CHSs) several times independently in stilbene-producing plants. STS genes usually form small families of two to five closely related paralogs. By contrast, the sequence of grapevine reference genome (cv PN40024) has revealed an unusually large STS gene family. Here, we combine molecular evolution and structural and functional analyses to investigate further the high number of STS genes in grapevine. Our reannotation of the STS and CHS gene families yielded 48 STS genes, including at least 32 potentially functional ones. Functional characterization of nine genes representing most of the STS gene family diversity clearly indicated that these genes do encode for proteins with STS activity. Evolutionary analysis of the STS gene family revealed that both STS and CHS evolution are dominated by purifying selection, with no evidence for strong selection for new functions among STS genes. However, we found a few sites under different selection pressures in CHS and STS sequences, whose potential functional consequences are discussed using a structural model of a typical STS from grapevine that we developed. PMID:22961129

  16. Expression of Ceramide Synthase 6 Transcriptionally Activates Acid Ceramidase in a c-Jun N-terminal Kinase (JNK)-dependent Manner*

    PubMed Central

    Tirodkar, Tejas S.; Lu, Ping; Bai, Aiping; Scheffel, Matthew J.; Gencer, Salih; Garrett-Mayer, Elizabeth; Bielawska, Alicja; Ogretmen, Besim; Voelkel-Johnson, Christina

    2015-01-01

    A family of six ceramide synthases with distinct but overlapping substrate specificities is responsible for generation of ceramides with acyl chains ranging from ∼14–26 carbons. Ceramide synthase 6 (CerS6) preferentially generates C14- and C16-ceramides, and we have previously shown that down-regulation of this enzyme decreases apoptotic susceptibility. In this study, we further evaluated how increased CerS6 expression impacts sphingolipid composition and metabolism. Overexpression of CerS6 in HT29 colon cancer cells resulted in increased apoptotic susceptibility and preferential generation of C16-ceramide, which occurred at the expense of very long chain, saturated ceramides. These changes were also reflected in sphingomyelin composition. HT-CerS6 cells had increased intracellular levels of sphingosine, which is generated by ceramidases upon hydrolysis of ceramide. qRT-PCR analysis revealed that only expression of acid ceramidase (ASAH1) was increased. The increase in acid ceramidase was confirmed by expression and activity analyses. Pharmacological inhibition of JNK (SP600125) or curcumin reduced transcriptional up-regulation of acid ceramidase. Using an acid ceramidase promoter driven luciferase reporter plasmid, we demonstrated that CerS1 has no effect on transcriptional activation of acid ceramidase and that CerS2 slightly but significantly decreased the luciferase signal. Similar to CerS6, overexpression of CerS3–5 resulted in an ∼2-fold increase in luciferase reporter gene activity. Exogenous ceramide failed to induce reporter activity, while a CerS inhibitor and a catalytically inactive mutant of CerS6 failed to reduce it. Taken together, these results suggest that increased expression of CerS6 can mediate transcriptional activation of acid ceramidase in a JNK-dependent manner that is independent of CerS6 activity. PMID:25839235

  17. Expression of Ceramide Synthase 6 Transcriptionally Activates Acid Ceramidase in a c-Jun N-terminal Kinase (JNK)-dependent Manner.

    PubMed

    Tirodkar, Tejas S; Lu, Ping; Bai, Aiping; Scheffel, Matthew J; Gencer, Salih; Garrett-Mayer, Elizabeth; Bielawska, Alicja; Ogretmen, Besim; Voelkel-Johnson, Christina

    2015-05-22

    A family of six ceramide synthases with distinct but overlapping substrate specificities is responsible for generation of ceramides with acyl chains ranging from ∼14-26 carbons. Ceramide synthase 6 (CerS6) preferentially generates C14- and C16-ceramides, and we have previously shown that down-regulation of this enzyme decreases apoptotic susceptibility. In this study, we further evaluated how increased CerS6 expression impacts sphingolipid composition and metabolism. Overexpression of CerS6 in HT29 colon cancer cells resulted in increased apoptotic susceptibility and preferential generation of C16-ceramide, which occurred at the expense of very long chain, saturated ceramides. These changes were also reflected in sphingomyelin composition. HT-CerS6 cells had increased intracellular levels of sphingosine, which is generated by ceramidases upon hydrolysis of ceramide. qRT-PCR analysis revealed that only expression of acid ceramidase (ASAH1) was increased. The increase in acid ceramidase was confirmed by expression and activity analyses. Pharmacological inhibition of JNK (SP600125) or curcumin reduced transcriptional up-regulation of acid ceramidase. Using an acid ceramidase promoter driven luciferase reporter plasmid, we demonstrated that CerS1 has no effect on transcriptional activation of acid ceramidase and that CerS2 slightly but significantly decreased the luciferase signal. Similar to CerS6, overexpression of CerS3-5 resulted in an ∼2-fold increase in luciferase reporter gene activity. Exogenous ceramide failed to induce reporter activity, while a CerS inhibitor and a catalytically inactive mutant of CerS6 failed to reduce it. Taken together, these results suggest that increased expression of CerS6 can mediate transcriptional activation of acid ceramidase in a JNK-dependent manner that is independent of CerS6 activity.

  18. Genome mining unearths a hybrid nonribosomal peptide synthetase-like-pteridine synthase biosynthetic gene cluster

    PubMed Central

    Park, Hyun Bong; Perez, Corey E; Barber, Karl W; Rinehart, Jesse; Crawford, Jason M

    2017-01-01

    Nonribosomal peptides represent a large class of metabolites with pharmaceutical relevance. Pteridines, such as pterins, folates, and flavins, are heterocyclic metabolites that often serve as redox-active cofactors. The biosynthetic machineries for construction of these distinct classes of small molecules operate independently in the cell. Here, we discovered an unprecedented nonribosomal peptide synthetase-like-pteridine synthase hybrid biosynthetic gene cluster in Photorhabdus luminescens using genome synteny analysis. P. luminescens is a Gammaproteobacterium that undergoes phenotypic variation and can have both pathogenic and mutualistic roles. Through extensive gene deletion, pathway-targeted molecular networking, quantitative proteomic analysis, and NMR, we show that the genetic locus affects the regulation of quorum sensing and secondary metabolic enzymes and encodes new pteridine metabolites functionalized with cis-amide acyl-side chains, termed pepteridine A (1) and B (2). The pepteridines are produced in the pathogenic phenotypic variant and represent the first reported metabolites to be synthesized by a hybrid NRPS-pteridine pathway. These studies expand our view of the combinatorial biosynthetic potential available in bacteria. DOI: http://dx.doi.org/10.7554/eLife.25229.001

  19. Spermine deficiency in Gy mice caused by deletion of the spermine synthase gene.

    PubMed

    Lorenz, B; Francis, F; Gempel, K; Böddrich, A; Josten, M; Schmahl, W; Schmidt, J; Lehrach, H; Meitinger, T; Strom, T M

    1998-03-01

    Two mouse mutations gyro (Gy) and hypophosphatemia (Hyp) are mouse models for X-linked hypophosphatemic rickets and have been shown to be deleted for the 5' and 3' end of the mouse homolog of PHEX (phosphate regulating gene with homologies to endopeptidases on the X chromosome; formerly called PEX), respectively. In addition to the metabolic disorder observed in Hyp mice, male Gy mice are sterile and show circling behavior and reduced viability. The human SMS (spermine synthase) gene maps approximately 39 kb upstream of PHEX and is transcribed in the same direction. To elucidate the complex phenotype of Gy mice, we characterized the genomic region upstream of Phex. By establishing the genomic structure of mouse Sms, a 160-190 kb deletion was shown in Gy mice, which includes both Phex and Sms. There are several pseudogenes of SMS / Sms in man and mouse. Northern analysis revealed three different Sms transcripts which are absent in Gy mice. Measurement of polyamine levels revealed a marked decrease in spermine in liver and pancreas of affected male Gy mice. Analysis of brain tissue revealed no gross or histological abnormalities. Gy provides a mouse model for a defect in the polyamine pathway, which is known to play a key role in cell proliferation.

  20. Endothelial Nitric Oxide Synthase Gene Single Nucleotide Polymorphism Predicts Cerebral Vasospasm following Aneurysmal Subarachnoid Hemorrhage

    PubMed Central

    Starke, Robert M.; Kim, Grace H.; Komotar, Ricardo J.; Hickman, Zachary L.; Black, Eric M.; Rosales, Maritza B.; Kellner, Christopher P.; Hahn, David K.; Otten, Marc L.; Edwards, John; Wang, Tao; Russo, James J.; Mayer, Stephan A.; Connolly, E. Sander

    2009-01-01

    Summary Vasospasm is a major cause of morbidity and mortality following aneurysmal subarachnoid hemorrhage (aSAH). Studies have demonstrated a link between single nucleotide polymorphisms (SNP) in the endothelial nitric oxide synthase (eNOS) gene and the incidence of coronary spasm and aneurysms. Alterations in the eNOS T-786 SNP may lead to an increased risk of post-aSAH cerebral vasospasm. In this prospective clinical study, 77 aSAH patients provided genetic material and were followed for the occurrence of vasospasm. In multivariate logistic regression analysis, genotype was the only factor predictive of vasospasm. The odds ratio for symptomatic vasospasm in patients with one T allele was 3.3 (95% CI 1.1–10.0, p=0.034) and 10.9 for TT. Patients with angiographic spasm were 3.6 times more likely to have a T allele (95% CI 1.3–9.6, p=0.013, TT OR 12.6). Patients with severe vasospasm requiring endovascular therapy were more likely to have a T allele (OR 3.5, 95% CI 1.3–9.5, p=0.016, TT OR 12.0). Patients with the T allele of the eNOS gene are more likely have severe vasospasm. Presence of this genotype may allow the identification of individuals at high risk for post-aSAH vasospasm and lead to early treatment and improved outcome. PMID:18319732

  1. Nitric Oxide Synthase Type III Overexpression By Gene Therapy Exerts Antitumoral Activity In Mouse Hepatocellular Carcinoma.

    PubMed

    González, Raúl; De la Rosa, Ángel J; Romero-Brufau, Santiago; Barrera-Pulido, Lydia; Gallardo-Chamizo, Francisco; Pereira, Sheila; Marín, Luís M; Álamo, José M; Rodríguez-Hernández, Ángeles; Padillo, Francisco J; Muntané, Jordi

    2015-08-01

    Hepatocellular carcinoma develops in cirrhotic liver. The nitric oxide (NO) synthase type III (NOS-3) overexpression induces cell death in hepatoma cells. The study developed gene therapy designed to specifically overexpress NOS-3 in cultured hepatoma cells, and in tumors derived from orthotopically implanted tumor cells in fibrotic livers. Liver fibrosis was induced by CCl4 administration in mice. Hepa 1-6 cells were used for in vitro and in vivo experiments. The first generation adenovirus was designed to overexpress NOS-3 (or GFP) and luciferase cDNA under the regulation of murine alpha-fetoprotein (AFP) and Rous Sarcoma Virus (RSV) promoters, respectively. Both adenoviruses were administered through the tail vein two weeks after orthotopic tumor cell implantation. AFP-NOS-3/RSV-Luciferase increased oxidative-related DNA damage, p53, CD95/CD95L expression and caspase-8 activity in cultured Hepa 1-6 cells. The increased expression of CD95/CD95L and caspase-8 activity was abolished by l-NAME or p53 siRNA. The tail vein infusion of AFP-NOS- 3/RSV-Luciferase adenovirus increased cell death markers, and reduced cell proliferation of established tumors in fibrotic livers. The increase of oxidative/nitrosative stress induced by NOS-3 overexpression induced DNA damage, p53, CD95/CD95L expression and cell death in hepatocellular carcinoma cells. The effectiveness of the gene therapy has been demonstrated in vitro and in vivo.

  2. Cis-regulatory analysis of the sea urchin pigment cell gene polyketide synthase.

    PubMed

    Calestani, Cristina; Rogers, David J

    2010-04-15

    The Strongylocentrotus purpuratus polyketide synthase gene (SpPks) encodes an enzyme required for the biosynthesis of the larval pigment echinochrome. SpPks is expressed exclusively in pigment cells and their precursors starting at blastula stage. The 7th-9th cleavage Delta-Notch signaling, required for pigment cell development, positively regulates SpPks. In previous studies, the transcription factors glial cell missing (SpGcm), SpGatae and kruppel-like (SpKrl/z13) have been shown to positively regulate SpPks. To uncover the structure of the Gene Regulatory Network (GRN) regulating the specification and differentiation processes of pigment cells, we experimentally analyzed the putative SpPks cis-regulatory region. We established that the -1.5kb region is sufficient to recapitulate the correct spatial and temporal expression of SpPks. Predicted DNA-binding sites for SpGcm, SpGataE and SpKrl are located within this region. The mutagenesis of these DNA-binding sites indicated that SpGcm, SpGataE and SpKrl are direct positive regulators of SpPks. These results demonstrate that the sea urchin GRN for pigment cell development is quite shallow, which is typical of type I embryo development.

  3. An Evolutionary Analysis of Lateral Gene Transfer in Thymidylate Synthase Enzymes

    PubMed Central

    Stern, Adi; Mayrose, Itay; Penn, Osnat; Shaul, Shaul; Gophna, Uri; Pupko, Tal

    2010-01-01

    Thymidylate synthases (Thy) are key enzymes in the synthesis of deoxythymidylate, 1 of the 4 building blocks of DNA. As such, they are essential for all DNA-based forms of life and therefore implicated in the hypothesized transition from RNA genomes to DNA genomes. Two evolutionally unrelated Thy enzymes, ThyA and ThyX, are known to catalyze the same biochemical reaction. Both enzymes are sporadically distributed within each of the 3 domains of life in a pattern that suggests multiple nonhomologous lateral gene transfer (LGT) events. We present a phylogenetic analysis of the evolution of the 2 enzymes, aimed at unraveling their entangled evolutionary history and tracing their origin back to early life. A novel probabilistic evolutionary model was developed, which allowed us to compute the posterior probabilities and the posterior expectation of the number of LGT events. Simulation studies were performed to validate the model's ability to accurately detect LGT events, which have occurred throughout a large phylogeny. Applying the model to the Thy data revealed widespread nonhomologous LGT between and within all 3 domains of life. By reconstructing the ThyA and ThyX gene trees, the most likely donor of each LGT event was inferred. The role of viruses in LGT of Thy is finally discussed. PMID:20525631

  4. Amelioration of osteoarthritis by intra-articular hyaluronan synthase 2 gene therapy.

    PubMed

    Zhang, Da-Wei; Yang, Quan-Sheng; Zhu, Jin-Yu; Cao, Xiao-Rui; Li, Li-Wen; Zhu, Qing-Sheng

    2007-01-01

    Osteoarthritis (OA) is a chronic, degenerative disorder of multifactorial aetiology, characterized by loss of articular cartilage and periarticular bone remodelling. Goals of managing OA include controlling pain, maintaining and improving function and health-related quality of life, and limiting functional impairment. Although several managements had been proved to ameliorate the symptoms of osteoarthritis, no methods could cure it thoroughly. High-molecular-weight hyaluronan (HMW-HA) is a major component of synovial joint fluids which physically acts as a viscous lubricant for slow joint movements and as an elastic shock absorber during rapid movements. It also has a variety of biologic effects in vivo, such as inhibiting the release of inflammatory factors and suppressing the degradation of cartilage matrix. Intra-articular injection of synthetic HMW-HA has been used as viscosupplement for knee OA and its therapeutic efficacy has been verified. However, repeated injections of HMW-HA which is needed to control symptoms increase the probability of infection and sometimes there will have acute joint pain with effusion, which requires aspiration to exclude sepsis. In order to overcome the disadvantages of repeated injections of HMW-HA, novel strategies should be developed. As HMW-HA is synthesized by hyaluronan synthase-2 (HAS2), we postulate that HAS2 gene could be delivered into intra-articular cells by methods of gene therapy to achieve long-lasting synthesis of HMW-HA. In our opinion, this strategy seems to hold interesting future prospects for the treatment of OA.

  5. Nonribosomal peptide synthase gene clusters for lipopeptide biosynthesis in Bacillus subtilis 916 and their phenotypic functions.

    PubMed

    Luo, Chuping; Liu, Xuehui; Zhou, Huafei; Wang, Xiaoyu; Chen, Zhiyi

    2015-01-01

    Bacillus cyclic lipopeptides (LPs) have been well studied for their phytopathogen-antagonistic activities. Recently, research has shown that these LPs also contribute to the phenotypic features of Bacillus strains, such as hemolytic activity, swarming motility, biofilm formation, and colony morphology. Bacillus subtilis 916 not only coproduces the three families of well-known LPs, i.e., surfactins, bacillomycin Ls (iturin family), and fengycins, but also produces a new family of LP called locillomycins. The genome of B. subtilis 916 contains four nonribosomal peptide synthase (NRPS) gene clusters, srf, bmy, fen, and loc, which are responsible for the biosynthesis of surfactins, bacillomycin Ls, fengycins, and locillomycins, respectively. By studying B. subtilis 916 mutants lacking production of one, two, or three LPs, we attempted to unveil the connections between LPs and phenotypic features. We demonstrated that bacillomycin Ls and fengycins contribute mainly to antifungal activity. Although surfactins have weak antifungal activity in vitro, the strain mutated in srfAA had significantly decreased antifungal activity. This may be due to the impaired productions of fengycins and bacillomycin Ls. We also found that the disruption of any LP gene cluster other than fen resulted in a change in colony morphology. While surfactins and bacillomycin Ls play very important roles in hemolytic activity, swarming motility, and biofilm formation, the fengycins and locillomycins had little influence on these phenotypic features. In conclusion, B. subtilis 916 coproduces four families of LPs which contribute to the phenotypic features of B. subtilis 916 in an intricate way.

  6. Cloning and Characterization of the Autoinducer Synthase Gene from Lipid-Degrading Bacterium Cedecea neteri

    PubMed Central

    Tan, Kian-Hin; How, Kah-Yan; Tan, Jia-Yi; Yin, Wai-Fong; Chan, Kok-Gan

    2017-01-01

    The process of intercellular communication among bacteria, termed quorum sensing (QS), is mediated by small diffusible molecules known as the autoinducers. QS allows the population to react to the change of cell density in unison, in processes such as biofilm formation, plasmid conjugation, virulence, motility and root nodulation. In Gram-negative proteobacteria, N-acyl homoserine lactone (AHL) is the common “language” to coordinate gene expression. This signaling molecule is usually synthesized by LuxI-type proteins. We have previously discovered that a rare bacterium, Cedecea neteri, exhibits AHL-type QS activity. With information generated from genome sequencing, we have identified the luxIR gene pair responsible for AHL-type QS and named it cneIR. In this study, we have cloned and expressed the 636 bp luxI homolog in an Escherichia coli host for further characterization. Our findings show that E. coli harboring cneI produced the same AHL profile as the wild type C. neteri, with the synthesis of AHL known as N-butyryl-homoserine lactone. This 25 kDa LuxI homolog shares high similarity with other AHL synthases from closely related species. This work is the first documentation of molecular cloning and characterization of luxI homolog from C. neteri. PMID:28197135

  7. Macrophage nitric oxide synthase gene: two upstream regions mediate induction by interferon gamma and lipopolysaccharide.

    PubMed

    Lowenstein, C J; Alley, E W; Raval, P; Snowman, A M; Snyder, S H; Russell, S W; Murphy, W J

    1993-10-15

    The promoter region of the mouse gene for macrophage-inducible nitric oxide synthase (mac-NOS; EC 1.14.13.39) has been characterized. A putative TATA box is 30 base pairs upstream of the transcription start site. Computer analysis reveals numerous potential binding sites for transcription factors, many of them associated with stimuli that induce mac-NOS expression. To localize functionally important portions of the regulatory region, we constructed deletion mutants of the mac-NOS 5' flanking region and placed them upstream of a luciferase reporter gene. The macrophage cell line RAW 264.7, when transfected with a minimal promoter construct, expresses little luciferase activity when stimulated by lipopolysaccharide (LPS), interferon gamma (IFN-gamma), or both. Maximal expression depends on two discrete regulatory regions upstream of the putative TATA box. Region I (position -48 to -209) increases luciferase activity approximately 75-fold over the minimal promoter construct. Region I contains LPS-related responsive elements, including a binding site for nuclear factor interleukin 6 (NF-IL6) and the kappa B binding site for NF-kappa B, suggesting that this region regulates LPS-induced expression of the mac-NOS gene. Region II (position -913 to -1029) alone does not increase luciferase expression, but together with region I it causes an additional 10-fold increase in expression. Together the two regions increase expression 750-fold over activity obtained from a minimal promoter construct. Region II contains motifs for binding IFN-related transcription factors and thus probably is responsible for IFN-mediated regulation of LPS-induced mac-NOS. Delineation of these two cooperative regions explains at the level of transcription how IFN-gamma and LPS act in concert to induce maximally the mac-NOS gene and, furthermore, how IFN-gamma augments the inflammatory response to LPS.

  8. A Novel Transcriptional Regulator Related to Thiamine Phosphate Synthase Controls Thiamine Metabolism Genes in Archaea.

    PubMed

    Rodionov, Dmitry A; Leyn, Semen A; Li, Xiaoqing; Rodionova, Irina A

    2017-02-15

    Thiamine (vitamin B1) is a precursor of thiamine pyrophosphate (TPP), an essential coenzyme in the central metabolism of all living organisms. Bacterial thiamine biosynthesis and salvage genes are controlled at the RNA level by TPP-responsive riboswitches. In Archaea, TPP riboswitches are restricted to the Thermoplasmatales order. Mechanisms of transcriptional control of thiamine genes in other archaeal lineages remain unknown. Using the comparative genomics approach, we identified a novel family of transcriptional regulators (named ThiR) controlling thiamine biosynthesis and transport genes in diverse lineages in the Crenarchaeota phylum as well as in the Halobacteria and Thermococci classes of the Euryarchaeota ThiR regulators are composed of an N-terminal DNA-binding domain and a C-terminal ligand-binding domain, which is similar to the archaeal thiamine phosphate synthase ThiN. By using comparative genomics, we predicted ThiR-binding DNA motifs and reconstructed ThiR regulons in 67 genomes representing all above-mentioned lineages. The predicted ThiR-binding motifs are characterized by palindromic symmetry with several distinct lineage-specific consensus sequences. In addition to thiamine biosynthesis genes, the reconstructed ThiR regulons include various transporters for thiamine and its precursors. Bioinformatics predictions were experimentally validated by in vitro DNA-binding assays with the recombinant ThiR protein from the hyperthermophilic archaeon Metallosphaera yellowstonensis MK1. Thiamine phosphate and, to some extent, TPP and hydroxyethylthiazole phosphate were required for the binding of ThiR to its DNA targets, suggesting that ThiR is derepressed by limitation of thiamine phosphates. The thiamine phosphate-binding residues previously identified in ThiN are highly conserved in ThiR regulators, suggesting a conserved mechanism for effector recognition.

  9. IDENTIFICATION AND HORMONE INDUCTION OF PUTATIVE CHITIN SYNTHASE GENES AND SPLICE VARIANTS IN Leptinotarsa decemlineata (SAY).

    PubMed

    Shi, Ji-Feng; Mu, Li-Li; Guo, Wen-Chao; Li, Guo-Qing

    2016-08-01

    Chitin synthase (ChS) plays a critical role in chitin synthesis and excretion. In this study, two ChS genes (LdChSA and LdChSB) were identified in Leptinotarsa decemlineata. LdChSA contains two splicing variants, LdChSAa and LdChSAb. Within the first, second, and third larval instars, the mRNA levels of LdChSAa, LdChSAb, and LdChSB coincide with the peaks of circulating 20-hydroxyecdysone (20E) and juvenile hormone (JH). In vitro culture of midguts and an in vivo bioassay revealed that 20E and an ecdysteroid agonist halofenozide stimulated the expression of the three LdChSs. Conversely, a reduction of 20E by RNA interference (RNAi) of an ecdysteroidogenesis gene LdSHD repressed the expression of these LdChSs, and ingestion of halofenozide by LdSHD RNAi larvae rescued the repression. Moreover, disruption of 20E signaling by RNAi of LdEcR, LdE75, LdHR3, and LdFTZ-F1 reduced the expression levels of these genes. Similarly, in vitro culture and an in vivo bioassay showed that exogenous JH and a JH analog methoprene activated the expression of the three LdChSs, whereas a decrease in JH by RNAi of a JH biosynthesis gene LdJHAMT downregulated these LdChSs. It seems that JH upregulates LdChSs at the early stage of each instar, whereas a 20E pulse triggers the transcription of LdChSs during molting in L. decemlineata.

  10. Volatile emissions of scented Alstroemeria genotypes are dominated by terpenes, and a myrcene synthase gene is highly expressed in scented Alstroemeria flowers

    PubMed Central

    Aros, Danilo; Gonzalez, Veronica; Allemann, Rudolf K.; Müller, Carsten T.; Rosati, Carlo; Rogers, Hilary J.

    2012-01-01

    Native to South America, Alstroemeria flowers are known for their colourful tepals, and Alstroemeria hybrids are an important cut flower. However, in common with many commercial cut flowers, virtually all the commercial Alstroemeria hybrids are not scented. The cultivar ‘Sweet Laura’ is one of very few scented commercial Alstroemeria hybrids. Characterization of the volatile emission profile of these cut flowers revealed three major terpene compounds: (E)-caryophyllene, humulene (also known as α-caryophyllene), an ocimene-like compound, and several minor peaks, one of which was identified as myrcene. The profile is completely different from that of the parental scented species A. caryophyllaea. Volatile emission peaked at anthesis in both scented genotypes, coincident in cv. ‘Sweet Laura’ with the maximal expression of a putative terpene synthase gene AlstroTPS. This gene was preferentially expressed in floral tissues of both cv. ‘Sweet Laura’ and A. caryophyllaea. Characterization of the AlstroTPS gene structure from cv. ‘Sweet Laura’ placed it as a member of the class III terpene synthases, and the predicted 567 amino acid sequence placed it into the subfamily TPS-b. The conserved sequences R28(R)X8W and D321DXXD are the putative Mg2+-binding sites, and in vitro assay of AlstroTPS expressed in Escherichia coli revealed that the encoded enzyme possesses myrcene synthase activity, consistent with a role for AlstroTPS in scent production in Alstroemeria cv. ‘Sweet Laura’ flowers. PMID:22268153

  11. Identification of the single amino acid involved in quenching the ent-kauranyl cation by a water molecule in ent-kaurene synthase of Physcomitrella patens.

    PubMed

    Kawaide, Hiroshi; Hayashi, Ken-ichiro; Kawanabe, Ryo; Sakigi, Yuka; Matsuo, Akihiko; Natsume, Masahiro; Nozaki, Hiroshi

    2011-01-01

    ent-Kaurene is a tetracyclic diterpene hydrocarbon and a biosynthetic intermediate of the plant hormone gibberellins. In flowering plants, ent-kaurene is biosynthesized from geranylgeranyl diphosphate (GGDP) by two distinct cyclases, ent-copalyl diphosphate synthase (CPS) and ent-kaurene synthase (KS). Recently, the moss Physcomitrella patens ent-kaurene biosynthetic gene was cloned and functionally characterized. The bifunctional ent-kaurene synthase [P. patens CPS/KS (PpCPS/KS)] produces both ent-kaurene and 16α-hydroxy-ent-kaurane from GGDP via ent-copalyl diphosphate. Here, we cloned and analyzed the function of a cDNA encoding bifunctional ent-kaurene synthase from the liverwort Jungermannia subulata [J. subulata CPS/KS (JsCPS/KS)]. JsCPS/KS catalyzes the cyclization reaction of GGDP to produce ent-kaurene but not 16α-hydroxy-ent-kaurane, even though the PpCPS/KS (881 amino acids) and JsCPS/KS (886 amino acids) sequences share 60% identity. To determine the regions and amino acids involved in 16α-hydroxy-ent-kaurane formation, we analyzed the enzymic functions of JsCPS/KS and PpCPS/KS chimeric proteins. When the C-terminal region of PpCPS/KS was exchanged with the JsCPS/KS C-terminal region, the chimeric cyclases produced only ent-kaurene. The replacement of PpCPS/KS Ala710 with Met or Phe produced a JsCPS/KS-type cyclase that converted GGDP to ent-kaurene as the sole product. In contrast, replacing Ala710 with Gly, Cys or Ser did not affect the PpCPS/KS product profile as much as replacement of Cys of JsCPS/KS by Ala. Thus, the hydrophobicity and size of the side chain residue at the PpCPS/KS amino acid 710 is responsible for quenching the ent-kauranyl cation by the addition of a water molecule.

  12. Circulating Fatty Acid Synthase in pregnant women: Relationship to blood pressure, maternal metabolism and newborn parameters

    PubMed Central

    Carreras-Badosa, Gemma; Prats-Puig, Anna; Puig, Teresa; Vázquez-Ruíz, Montserrat; Bruel, Monserrat; Mendoza, Ericka; de Zegher, Francis; Ibáñez, Lourdes; López-Bermejo, Abel; Bassols, Judit

    2016-01-01

    The enzyme FASN (fatty acid synthase) is potentially related with hypertension and metabolic dysfunction. FASN is highly expressed in the human placenta. We aimed to investigate the relationship circulating FASN has with blood pressure, maternal metabolism and newborn parameters in healthy pregnant women. Circulating FASN was assessed in 115 asymptomatic pregnant women in the second trimester of gestation along with C-peptide, fasting glucose and insulin, post-load glucose lipids, HMW-adiponectin and blood pressure (the latter was assessed in each trimester of gestation). At birth, newborns and placentas were weighed. FASN expression was also able to be assessed in 80 placentas. Higher circulating FASN was associated with lower systolic blood pressure (SBP), with a more favourable metabolic phenotype (lower fasting glucose and insulin, post load glucose, HbAc1, HOMA-IR and C-peptide), and with lower placental and birth weight (all p < 0.05 to p < 0.001). Placental FASN expression related positively to circulating FASN (p < 0.005) and negatively to placental weight (p < 0.05). Our observations suggest a physiological role of placental FASN in human pregnancy. Future studies will clarify whether circulating FASN of placental origin does actually regulate placental and fetal growth, and (thereby) has a favourable influence on the pregnant mother’s insulin sensitivity and blood pressure. PMID:27090298

  13. Circulating Fatty Acid Synthase in pregnant women: Relationship to blood pressure, maternal metabolism and newborn parameters.

    PubMed

    Carreras-Badosa, Gemma; Prats-Puig, Anna; Puig, Teresa; Vázquez-Ruíz, Montserrat; Bruel, Monserrat; Mendoza, Ericka; de Zegher, Francis; Ibáñez, Lourdes; López-Bermejo, Abel; Bassols, Judit

    2016-04-19

    The enzyme FASN (fatty acid synthase) is potentially related with hypertension and metabolic dysfunction. FASN is highly expressed in the human placenta. We aimed to investigate the relationship circulating FASN has with blood pressure, maternal metabolism and newborn parameters in healthy pregnant women. Circulating FASN was assessed in 115 asymptomatic pregnant women in the second trimester of gestation along with C-peptide, fasting glucose and insulin, post-load glucose lipids, HMW-adiponectin and blood pressure (the latter was assessed in each trimester of gestation). At birth, newborns and placentas were weighed. FASN expression was also able to be assessed in 80 placentas. Higher circulating FASN was associated with lower systolic blood pressure (SBP), with a more favourable metabolic phenotype (lower fasting glucose and insulin, post load glucose, HbAc1, HOMA-IR and C-peptide), and with lower placental and birth weight (all p < 0.05 to p < 0.001). Placental FASN expression related positively to circulating FASN (p < 0.005) and negatively to placental weight (p < 0.05). Our observations suggest a physiological role of placental FASN in human pregnancy. Future studies will clarify whether circulating FASN of placental origin does actually regulate placental and fetal growth, and (thereby) has a favourable influence on the pregnant mother's insulin sensitivity and blood pressure.

  14. Inhibitory effects of sea buckthorn procyanidins on fatty acid synthase and MDA-MB-231 cells.

    PubMed

    Wang, Yi; Nie, Fangyuan; Ouyang, Jian; Wang, Xiaoyan; Ma, Xiaofeng

    2014-10-01

    Fatty acid synthase (FAS) is overexpressed in many human cancers including breast cancer and is considered to be a promising target for therapy. Sea buckthorn has long been used to treat a variety of maladies. Here, we investigated the inhibitory effect of sea buckthorn procyanidins (SBPs) isolated from the seeds of sea buckthorn on FAS and FAS overexpressed human breast cancer MDA-MB-231 cells. The FAS activity and FAS inhibition were measured by a spectrophotometer at 340 nm of nicotinamide adenine dinucleotide phosphate (NADPH) absorption. We found that SBP potently inhibited the activity of FAS with a half-inhibitory concentration (IC50) value of 0.087 μg/ml. 3-4,5-Dimethylthiazol-2-yl-2,3-diphenyl tetrazolium bromide (MTT) assay was used to test the cell viability. SBP reduced MDA-MB-231 cell viability with an IC50 value of 37.5 μg/ml. Hoechst 33258/propidium iodide dual staining and flow cytometric analysis showed that SBP induced MDA-MB-231 cell apoptosis. SBP inhibited intracellular FAS activity with a dose-dependent manner. In addition, sodium palmitate could rescue the cell apoptosis induced by SBP. These results showed that SBP was a promising FAS inhibitor which could induce the apoptosis of MDA-MB-231 cells via inhibiting FAS. These findings suggested that SBP might be useful for preventing or treating breast cancer.

  15. Extracellular Fatty Acid Synthase: A Possible Surrogate Biomarker of Insulin Resistance

    PubMed Central

    Fernandez-Real, Jose Manuel; Menendez, Javier A.; Moreno-Navarrete, Jose Maria; Blüher, Matthias; Vazquez-Martin, Alejandro; Vázquez, María Jesús; Ortega, Francisco; Diéguez, Carlos; Frühbeck, Gema; Ricart, Wifredo; Vidal-Puig, Antonio

    2010-01-01

    CONTEXT Circulating fatty acid synthase (FASN) is a biomarker of metabolically demanding human diseases. The aim of this study was to determine whether circulating FASN could be a biomarker of overnutrition-induced metabolic stress and insulin resistance in common metabolic disorders. RESEARCH DESIGN AND METHODS Circulating FASN was evaluated in two cross-sectional studies in association with insulin sensitivity and in four longitudinal studies investigating the effect of diet- and surgery-induced weight loss, physical training, and adipose tissue expansion using peroxisome proliferator–activated receptor agonist rosiglitazone on circulating FASN. RESULTS Age- and BMI-adjusted FASN concentrations were significantly increased in association with obesity-induced insulin resistance in two independent cohorts. Both visceral and subcutaneous FASN expression and protein levels correlated inversely with extracellular circulating FASN (P = −0.63; P < 0.0001), suggesting that circulating FASN is linked to depletion of intracellular FASN. Improved insulin sensitivity induced by therapeutic strategies that decreased fat mass (diet induced, surgery induced, or physical training) all led to decreased FASN levels in blood (P values between 0.02 and 0.04). To discriminate whether this was an effect related to insulin sensitization, we also investigated the effects of rosiglitazone. Rosiglitazone did not lead to significant changes in circulating FASN concentration. CONCLUSIONS Our results suggest that circulating FASN is a biomarker of overnutrition-induced insulin resistance that could provide diagnostic and prognostic advantages by providing insights on the individualized metabolic stress. PMID:20299470

  16. (-)-UB006: A new fatty acid synthase inhibitor and cytotoxic agent without anorexic side effects.

    PubMed

    Makowski, Kamil; Mir, Joan Francesc; Mera, Paula; Ariza, Xavier; Asins, Guillermina; Hegardt, Fausto G; Herrero, Laura; García, Jordi; Serra, Dolors

    2017-05-05

    C75 is a synthetic anticancer drug that inhibits fatty acid synthase (FAS) and shows a potent anorexigenic side effect. In order to find new cytotoxic compounds that do not impact food intake, we synthesized a new family of C75 derivatives. The most promising anticancer compound among them was UB006 ((4SR,5SR)-4-(hydroxymethyl)-3-methylene-5-octyldihydrofuran-2(3H)-one). The effects of this compound on cytotoxicity, food intake and body weight were studied in UB006 racemic mixture and in both its enantiomers separately. The results showed that both enantiomers inhibit FAS activity and have potent cytotoxic effects in several tumour cell lines, such as the ovarian cell cancer line OVCAR-3. The (-)-UB006 enantiomer's cytotoxic effect on OVCAR-3 was 40-fold higher than that of racemic C75, and 2- and 38-fold higher than that of the racemic mixture and its opposite enantiomer, respectively. This cytotoxic effect on the OVCAR-3 cell line involves mechanisms that reduce mitochondrial respiratory capacity and ATP production, DDIT4/REDD1 upregulation, mTOR activity inhibition, and caspase-3 activation, resulting in apoptosis. In addition, central and peripheral administration of (+)-UB006 or (-)-UB006 into rats and mice did not affect food intake or body weight. Altogether, our data support the discovery of a new potential anticancer compound (-)-UB006 that has no anorexigenic side effects.

  17. Inhibition of fatty acid synthase by amentoflavone reduces coxsackievirus B3 replication.

    PubMed

    Wilsky, Steffi; Sobotta, Katharina; Wiesener, Nadine; Pilas, Johanna; Althof, Nadine; Munder, Thomas; Wutzler, Peter; Henke, Andreas

    2012-02-01

    Coxsackievirus B3 (CVB3) is a human pathogen that causes acute and chronic infections, but an antiviral drug to treat these diseases has not yet been developed for clinical use. Several intracellular pathways are altered to assist viral transcription, RNA replication, and progeny release. Among these, fatty acid synthase (FAS) expression is increased. In order to test the potential of FAS inhibition as an anti-CVB3 strategy, several experiments were performed, including studies on the correlation of CVB3 replication and FAS expression in human Raji cells and an analysis of the time and dose dependence of the antiviral effect of FAS inhibition due to treatment with amentoflavone. The results demonstrate that CVB3 infection induces an up-regulation of FAS expression already at 1 h postinfection (p.i.). Incubation with increasing concentrations of amentoflavone inhibited CVB3 replication significantly up to 8 h p.i. In addition, suppression of p38 MAP kinase activity by treatment with SB239063 decreased FAS expression as well as viral replication. These data provide evidence that FAS inhibition via amentoflavone administration might present a target for anti-CVB3 therapy.

  18. Retinoic acid inhibits inducible nitric oxide synthase expression in 3T3-L1 adipocytes.

    PubMed

    Yang, Jeong-Yeh; Koo, Bon-Sun; Kang, Mi-Kyung; Rho, Hye-Won; Sohn, Hee-Sook; Jhee, Eun-Chung; Park, Jin-Woo

    2002-11-30

    The present study was undertaken to explore whether retinoids, which are known to have immunomodulatory actions, could attenuate tumor necrosis factor-alpha (TNF)-stimulated inducible nitric oxide synthase (iNOS) expression in 3T3-L1 adipocytes. Adipocytes incubated with TNF induced dose- and time-dependent accumulation of nitrite in the culture medium through the iNOS induction as confirmed by Western blotting. Treatment of cells with TNF in the presence of all-trans-retinoic acid (RA) significantly decreased their ability to produce nitrite and iNOS induction. Both 13-cis- and all- trans-RA-induced suppression was dose-dependent, and all-trans-RA was somewhat potent than 13-cis-RA. The inhibitory effect of RA on TNF-induced iNOS induction was reversible, completely recovered after 2 days, and was exerted through the inhibition of NF-kappaB activation. TNF also suppressed the lipoprotein lipase (LPL) activity of 3T3-L1 adipocytes. RA could not reverse the TNF- induced LPL suppression at RA levels causing near complete inhibition of the TNF-induced NO production. These results indicate that RAs attenuate iNOS expression reversibly in TNF-stimulated 3T3-L1 adipocytes, and that the TNF-induced LPL suppression is not the result of NO overproduction.

  19. Potent Inhibitory Effect of Chinese Dietary Spices on Fatty Acid Synthase.

    PubMed

    Jiang, Bing; Liang, Yan; Sun, Xuebing; Liu, Xiaoxin; Tian, Weixi; Ma, Xiaofeng

    2015-09-01

    Dietary spices have been adopted in cooking since ancient times to enhance flavor and also as food preservatives and disease remedies. In China, the use of spices and other aromatic plants as food flavoring is an integral part of dietary behavior, but relatively little is known about their functions. Fatty acid synthase (FAS) has been recognized as a remedy target, and its inhibitors might be applied in disease treatment. The present work was designed to assess the inhibitory activities on FAS of spices extracts in Chinese menu. The in vitro inhibitory activities on FAS of 22 extracts of spices were assessed by spectrophotometrically monitoring oxidation of NADPH at 340 nm. Results showed that 20 spices extracts (90.9 %) exhibited inhibitory activities on FAS, with half inhibition concentration (IC(50)) values ranging from 1.72 to 810.7 μg/ml. Among them, seven spices showed strong inhibitory effect with IC(50) values lower than 10 μg/ml. These findings suggest that a large proportion of the dietary spices studied possess promising inhibitory activities on FAS, and subsequently might be applied in the treatment of obesity and obesity-related human diseases.

  20. Stilbene synthase gene transfer caused alterations in the phenylpropanoid metabolism of transgenic strawberry (Fragaria×ananassa)

    PubMed Central

    Hanhineva, Kati; Kokko, Harri; Siljanen, Henri; Rogachev, Ilana; Aharoni, Asaph; Kärenlampi, Sirpa O.

    2009-01-01

    The gene encoding stilbene synthase is frequently used to modify plant secondary metabolism with the aim of producing the self-defence phytoalexin resveratrol. In this study, strawberry (Fragaria×ananassa) was transformed with the NS-Vitis3 gene encoding stilbene synthase from frost grape (Vitis riparia) under the control of the cauliflower mosaic virus 35S and the floral filament-specific fil1 promoters. Changes in leaf metabolites were investigated with UPLC-qTOF-MS (ultra performance liquid chromatography-quadrupole time of flight mass spectrometry) profiling, and increased accumulation of cinnamate, coumarate, and ferulate derivatives concomitantly with a decrease in the levels of flavonols was observed, while the anticipated resveratrol or its derivatives were not detected. The changed metabolite profile suggested that chalcone synthase was down-regulated by the genetic modification; this was verified by decreased chalcone synthase transcript levels. Changes in the levels of phenolic compounds led to increased susceptibility of the transgenic strawberry to grey mould fungus. PMID:19443619

  1. Siro(haem)amide in Allochromatium vinosum and relevance of DsrL and DsrN, a homolog of cobyrinic acid a,c-diamide synthase, for sulphur oxidation.

    PubMed

    Lübbe, Yvonne J; Youn, Hyung-Sun; Timkovich, Russell; Dahl, Christiane

    2006-08-01

    In the purple sulphur bacterium Allochromatium vinosum, the prosthetic group of dissimilatory sulphite reductase (DsrAB) was identified as siroamide, an amidated form of the classical sirohaem. The genes dsrAB are the first two of a large cluster of genes necessary for the oxidation of sulphur globules stored intracellularly during growth on sulphide and thiosulphate. DsrN is homologous to cobyrinic acid a,c diamide synthase and may therefore catalyze glutamine-dependent amidation of sirohaem. Indeed, an A. vinosumDeltadsrN in frame deletion mutant showed a significantly reduced sulphur oxidation rate that was fully restored upon complementation with dsrN in trans. Sulphite reductase was still present in the DeltadsrN mutant. DsrL is a homolog of the small subunits of bacterial glutamate synthases and was proposed to deliver glutamine for sirohaem amidation. However, recombinant DsrL does not exhibit glutamate synthase activity nor does the gene complement a glutamate synthase-deficient Escherichia coli strain. Deletion of dsrL showed that the encoded protein is absolutely essential for sulphur oxidation in A. vinosum.

  2. Fatty Acid Biosynthesis in Pseudomonas aeruginosa Is Initiated by the FabY Class of β-Ketoacyl Acyl Carrier Protein Synthases

    PubMed Central

    Yuan, Yanqiu; Sachdeva, Meena; Leeds, Jennifer A.

    2012-01-01

    The prototypical type II fatty acid synthesis (FAS) pathway in bacteria utilizes two distinct classes of β-ketoacyl synthase (KAS) domains to assemble long-chain fatty acids, the KASIII domain for initiation and the KASI/II domain for elongation. The central role of FAS in bacterial viability and virulence has stimulated significant effort toward developing KAS inhibitors, particularly against the KASIII domain of the β-acetoacetyl-acyl carrier protein (ACP) synthase FabH. Herein, we show that the opportunistic pathogen Pseudomonas aeruginosa does not utilize a FabH ortholog but rather a new class of divergent KAS I/II enzymes to initiate the FAS pathway. When a P. aeruginosa cosmid library was used to rescue growth in a fabH downregulated strain of Escherichia coli, a single unannotated open reading frame, PA5174, complemented fabH depletion. While deletion of all four KASIII domain-encoding genes in the same P. aeruginosa strain resulted in a wild-type growth phenotype, deletion of PA5174 alone specifically attenuated growth due to a defect in de novo FAS. Siderophore secretion and quorum-sensing signaling, particularly in the rhl and Pseudomonas quinolone signal (PQS) systems, was significantly muted in the absence of PA5174. The defect could be repaired by intergeneric complementation with E. coli fabH. Characterization of recombinant PA5174 confirmed a preference for short-chain acyl coenzyme A (acyl-CoA) substrates, supporting the identification of PA5174 as the predominant enzyme catalyzing the condensation of acetyl coenzyme A with malonyl-ACP in P. aeruginosa. The identification of the functional role for PA5174 in FAS defines the new FabY class of β-ketoacyl synthase KASI/II domain condensation enzymes. PMID:22753059

  3. Fatty acid synthase regulates estrogen receptor-α signaling in breast cancer cells

    PubMed Central

    Menendez, J A; Lupu, R

    2017-01-01

    Fatty acid synthase (FASN), the key enzyme for endogenous synthesis of fatty acids, is overexpressed and hyperactivated in a biologically aggressive subset of sex steroid-related tumors, including breast carcinomas. Using pharmacological and genetic approaches, we assessed the molecular relationship between FASN signaling and estrogen receptor alpha (ERα) signaling in breast cancer. The small compound C75, a synthetic slow-binding inhibitor of FASN activity, induced a dramatic augmentation of estradiol (E2)-stimulated, ERα-driven transcription. FASN and ERα were both necessary for the synergistic activation of ERα transcriptional activity that occurred following co-exposure to C75 and E2: first, knockdown of FASN expression using RNAi (RNA interference) drastically lowered (>100 fold) the amount of E2 required for optimal activation of ERα-mediated transcriptional activity; second, FASN blockade synergistically increased E2-stimulated ERα-mediated transcriptional activity in ERα-negative breast cancer cells stably transfected with ERα, but not in ERα-negative parental cells. Non-genomic, E2-regulated cross-talk between the ERα and MAPK pathways participated in these phenomena. Thus, treatment with the pure antiestrogen ICI 182 780 or the potent and specific inhibitor of MEK/ERK, U0126, was sufficient to abolish the synergistic nature of the interaction between FASN blockade and E2-stimulated ERα transactivation. FASN inhibition suppressed E2-stimulated breast cancer cell proliferation and anchorage-independent colony formation while promoting the reduction of ERα protein. FASN blockade resulted in the increased expression and nuclear accumulation of the cyclin-dependent kinase inhibitors p21WAF1/CIP1 and p27Kip1, two critical mediators of the therapeutic effects of antiestrogen in breast cancer, while inactivating AKT, a key mediator of E2-promoted anchorage-independent growth. The ability of FASN to regulate E2/ERα signaling may represent a

  4. Fatty acid synthase inhibits the O-GlcNAcase during oxidative stress.

    PubMed

    Groves, Jennifer A; Maduka, Austin O; O'Meally, Robert N; Cole, Robert N; Zachara, Natasha E

    2017-02-23

    The dynamic post-translational modification O-linked-β-N-acetylglucosamine (O-GlcNAc) regulates thousands of nuclear, cytoplasmic, and mitochondrial proteins. Cellular stress, including oxidative stress, results in increased O-GlcNAcylation of numerous proteins and this increase is thought to promote cell survival. The mechanisms by which the O-GlcNAc transferase (OGT) and the O-GlcNAcase (OGA), the enzymes that add and remove O-GlcNAc respectively, are regulated during oxidative stress to alter O-GlcNAcylation are not fully characterized. Here, we demonstrate that oxidative stress leads to elevated O-GlcNAc levels in U2OS cells, but has little impact on the activity of OGT. In contrast, the expression and activity of OGA are enhanced. We hypothesized that this seeming paradox could be explained by proteins that bind to and control the local activity or substrate targeting of OGA, thereby resulting in the observed stress-induced elevations of O-GlcNAc. To identify potential protein partners, we utilized BioID proximity biotinylation in combination with Stable Isotope Labeling of Amino Acids in Cell culture (SILAC). This analysis revealed 90 OGA-interacting partners, many of which exhibited increased binding to OGA upon stress. The associations of OGA with fatty acid synthase (FAS), filamin-A, heat shock cognate 70 kDa protein, and OGT were confirmed by co-immunoprecipitation. The pool of OGA bound to FAS demonstrated a substantial (≈85%) reduction in specific activity, suggesting that FAS inhibits OGA. Consistent with this observation, FAS overexpression augmented stress-induced O-GlcNAcylation. While the mechanism by which FAS sequesters OGA remains unknown, these data suggest that FAS fine-tunes the cell's response to stress and injury by remodeling cellular O-GlcNAcylation.

  5. Diet-induced alteration of fatty acid synthase in prostate cancer progression

    PubMed Central

    Huang, M; Koizumi, A; Narita, S; Inoue, T; Tsuchiya, N; Nakanishi, H; Numakura, K; Tsuruta, H; Saito, M; Satoh, S; Nanjo, H; Sasaki, T; Habuchi, T

    2016-01-01

    Fatty acid synthase (FASN) is a cytosolic metabolic enzyme that catalyzes de novo fatty acid synthesis. A high-fat diet (HFD) is attributed to prostate cancer (PCa) progression, but the role FASN on HFD-mediated PCa progression remains unclear. We investigated the role of FASN on PCa progression in LNCaP xenograft mice fed with HFD or low-fat diet (LFD), in PCa cells, and in clinical PCa. The HFD promoted tumour growth and FASN expression in the LNCaP xenograft mice. HFD resulted in AKT and extracellular signal-regulated kinase (ERK) activation and 5' adenosine monophosphate-activated protein kinase (AMPK) inactivation. Serum FASN levels were significantly lower in the HFD group (P=0.026) and correlated inversely with tumour volume (P=0.022). Extracellular FASN release was enhanced in the PCa cells with phosphatidylinositol 3-kinase (PI3K)/mitogen-activated protein kinase (MAPK) inhibition and AMPK signalling activation. FASN inhibition resulted in decrease of PCa cell proliferation through PI3K/MAPK downregulation and AMPK activation. Furthermore, AMPK activation was associated with FASN downregulation and PI3K/MAPK inactivation. Clinically, high FASN expression was significantly associated with high Gleason scores and advanced pathological T stage. Moreover, FASN expression was markedly decreased in the PCa response to androgen deprivation therapy and chemotherapy. HFD modulates FASN expression, which may be an important mechanism in HFD-associated PCa progression. Furthermore, a critical stimulatory loop exists between FASN and the PI3K/MAPK system, whereas AMPK signalling was associated with suppression. These may offer appropriate targets for chemoprevention and cancer therapy in HFD-induced PCa. PMID:26878389

  6. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    NASA Astrophysics Data System (ADS)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  7. Analysis of methionine synthase (rs1805087) gene polymorphism in autism patients in Northern Iran.

    PubMed

    Haghiri, Rosa; Mashayekhi, Farhad; Bidabadi, Elham; Salehi, Zivar

    2016-01-01

    Autism is characterized by impairment in reciprocal communication and speech, repetitive behaviors, and social communication. The genetic and environmental factors play roles in the pathogenesis of autism. It was recently shown that the genes involved in the folate/homocysteine pathway may be risk factors for autistic children. One of the genes that may be the risk factor for autism is Methionine synthase (MTR). MTR is responsible for the regeneration of methionine from homocysteine. The aim of this study was to analyze the association of MTR A2756G gene polymorphism (rs1805087) and the risk of autism in a population in northern Iran. The prevalence of MTR A2756G polymorphism was determined in 108 children with autism and 130 controls in northern Iran. Genotypes and allele frequencies were determined in patients and controls by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). The prevalence of genotype frequencies of AA, AG and GG in autistic children were 57.41%, 22.22% and 20.37%, respectively, while in controls were 61.54%, 32.31% and 6.15%, respectively. There was significant difference between the MTR polymorphism distribution in control and patient groups. The prevalence of allele frequencies of A and G in autistic children were 0.69 and 0.31, respectively and in controls were 0.78 and 0.22, respectively (P=0.03). The MTR G allele conferred a 1.6-fold increased risk to autism relative to the A allele (95% CI=1.06-2.41, P=0.02). The present study suggests that the G allele of MTR A2756G polymorphism is associated with an increased risk of autism.

  8. Virus-induced gene silencing of Withania somnifera squalene synthase negatively regulates sterol and defence-related genes resulting in reduced withanolides and biotic stress tolerance.

    PubMed

    Singh, Anup Kumar; Dwivedi, Varun; Rai, Avanish; Pal, Shaifali; Reddy, Sajjalavarahalli Gangireddy Eswara; Rao, Dodaghatta Krishnarao Venkata; Shasany, Ajit Kumar; Nagegowda, Dinesh A

    2015-12-01

    Withania somnifera (L.) Dunal is an important Indian medicinal plant that produces withanolides, which are triterpenoid steroidal lactones having diverse biological activities. To enable fast and efficient functional characterization of genes in this slow-growing and difficult-to-transform plant, a virus-induced gene silencing (VIGS) was established by silencing phytoene desaturase (PDS) and squalene synthase (SQS). VIGS of the gene encoding SQS, which provides precursors for triterpenoids, resulted in significant reduction of squalene and withanolides, demonstrating its application in studying withanolides biosynthesis in W. somnifera leaves. A comprehensive analysis of gene expression and sterol pathway intermediates in WsSQS-vigs plants revealed transcriptional modulation with positive feedback regulation of mevalonate pathway genes, and negative feed-forward regulation of downstream sterol pathway genes including DWF1 (delta-24-sterol reductase) and CYP710A1 (C-22-sterol desaturase), resulting in significant reduction of sitosterol, campesterol and stigmasterol. However, there was little effect of SQS silencing on cholesterol, indicating the contribution of sitosterol, campesterol and stigmasterol, but not of cholesterol, towards withanolides formation. Branch-point oxidosqualene synthases in WsSQS-vigs plants exhibited differential regulation with reduced CAS (cycloartenol synthase) and cycloartenol, and induced BAS (β-amyrin synthase) and β-amyrin. Moreover, SQS silencing also led to the down-regulation of brassinosteroid-6-oxidase-2 (BR6OX2), pathogenesis-related (PR) and nonexpressor of PR (NPR) genes, resulting in reduced tolerance to bacterial and fungal infection as well as to insect feeding. Taken together, SQS silencing negatively regulated sterol and defence-related genes leading to reduced phytosterols, withanolides and biotic stress tolerance, thus implicating the application of VIGS for functional analysis of genes related to withanolides

  9. Methionine synthase: high-resolution mapping of the human gene and evaluation as a candidate locus for neural tube defects.

    PubMed

    Brody, L C; Baker, P J; Chines, P S; Musick, A; Molloy, A M; Swanson, D A; Kirke, P N; Ghosh, S; Scott, J M; Mills, J L

    1999-08-01

    Periconceptual folate supplementation has been found to prevent the occurrence of many neural tube defects (NTDs). Consequently, genetic variation in folate metabolism genes is expected to contribute to the risk for neural tube defects. Methionine synthase catalyzes the vitamin B(12)-dependent conversion of homocysteine and 5-methyltetrahydrofolate to methionine and tetrahydrofolate. The observation that homocysteine and vitamin B(12) levels are independent predictors of NTD risk suggested that methionine synthase could be a candidate gene for NTDs. To assess the role of the MS gene in NTDs, we performed high-resolution physical mapping of the MS locus, isolated highly polymorphic markers linked to the MS gene, and tested for an association between specific MS alleles and NTDs. We mapped the MS gene to a position between 909 and 913 cR(10000) on chromosome 1 by radiation hybrid mapping. Polymorphic markers D1S1567 and D1S1568 map to locations no more than 900 and 194 kb from the MS gene, respectively. The segregation of these polymorphic markers was measured in 85 Irish NTD families. No allele of either marker showed a significant association with NTDs using the transmission disequilibrium test. A lack of association was also observed for the D1919G missense mutation within the gene. Our results suggest that inherited variation in the MS gene does not contribute to NTD risk in this population.

  10. RNAi and Homologous Over-Expression Based Functional Approaches Reveal Triterpenoid Synthase Gene-Cycloartenol Synthase Is Involved in Downstream Withanolide Biosynthesis in Withania somnifera

    PubMed Central

    Mishra, Bhawana; Sangwan, Rajender Singh; Asha; Jadaun, Jyoti Singh; Sangwan, Neelam S.

    2016-01-01

    Withania somnifera Dunal, is one of the most commonly used medicinal plant in Ayurvedic and indigenous medicine traditionally owing to its therapeutic potential, because of major chemical constituents, withanolides. Withanolide biosynthesis requires the activities of several enzymes in vivo. Cycloartenol synthase (CAS) is an important enzyme in the withanolide biosynthetic pathway, catalyzing cyclization of 2, 3 oxidosqualene into cycloartenol. In the present study, we have cloned full-length WsCAS from Withania somnifera by homology-based PCR method. For gene function investigation, we constructed three RNAi gene-silencing constructs in backbone of RNAi vector pGSA and a full-length over-expression construct. These constructs were transformed in Agrobacterium strain GV3101 for plant transformation in W. somnifera. Molecular and metabolite analysis was performed in putative Withania transformants. The PCR and Southern blot results showed the genomic integration of these RNAi and overexpression construct(s) in Withania genome. The qRT-PCR analysis showed that the expression of WsCAS gene was considerably downregulated in stable transgenic silenced Withania lines compared with the non-transformed control and HPLC analysis showed that withanolide content was greatly reduced in silenced lines. Transgenic plants over expressing CAS gene displayed enhanced level of CAS transcript and withanolide content compared to non-transformed controls. This work is the first full proof report of functional validation of any metabolic pathway gene in W. somnifera at whole plant level as per our knowledge and it will be further useful to understand the regulatory role of different genes involved in the biosynthesis of withanolides. PMID:26919744

  11. Angelica Sinensis Polysaccharides Stimulated UDP-Sugar Synthase Genes through Promoting Gene Expression of IGF-1 and IGF1R in Chondrocytes: Promoting Anti-Osteoarthritic Activity

    PubMed Central

    Wen, Yinxian; Li, Jing; Tan, Yang; Qin, Jun; Xie, Xianfei; Wang, Linlong; Mei, Qibing; Wang, Hui; Magdalou, Jacques; Chen, Liaobin

    2014-01-01

    Background Osteoarthritis (OA) is a chronic joints disease characterized by progressive degeneration of articular cartilage due to the loss of cartilage matrix. Previously, we found, for the first time, that an acidic glycan from Angelica Sinensis Polysaccharides (APSs), namely the APS-3c, could protect rat cartilage from OA due to promoting glycosaminoglycan (GAG) synthesis in chondrocytes. In the present work, we tried to further the understanding of ASP-3c’s anti-OA activity. Methodology/Principal Findings Human primary chondrocytes were treated with APS-3c or/and recombinant human interleukin 1β (IL-1β). It turned out that APS-3c promoted synthesis of UDP-xylose and GAG, as well as the gene expression of UDP-sugar synthases (USSs), insulin like growth factor 1 (IGF1) and IGF1 receptor (IGF1R), and attenuated the degenerative phenotypes, suppressed biosynthesis of UDP-sugars and GAG, and inhibited the gene expression of USSs, IGF1 and IGF1R induced by IL-1β. Then, we induced a rat OA model with papain, and found that APS-3c also stimulated GAG synthesis and gene expression of USSs, IGF1 and IGF1R in vivo. Additionally, recombinant human IGF1 and IGF1R inhibitor NP-AEW541 were applied to figure out the correlation between stimulated gene expression of USSs, IGF1 and IGF1R induced by APS-3c. It tuned out that the promoted GAG synthesis and USSs gene expression induced by APS-3c was mediated by the stimulated IGF1 and IGF1R gene expression, but not through directly activation of IGF1R signaling pathway. Conclusions/Significances We demonstrated for the first time that APS-3c presented anti-OA activity through stimulating IGF-1 and IGF1R gene expression, but not directly activating the IGF1R signaling pathway, which consequently promoted UDP-sugars and GAG synthesis due to up-regulating gene expression of USSs. Our findings presented a better understanding of APS-3c’s anti-OA activity and suggested that APS-3c could potentially be a novel therapeutic agent

  12. Development of an analysis program of type I polyketide synthase gene clusters using homology search and profile hidden Markov model.

    PubMed

    Tae, Hongseok; Sohng, Jae Kyung; Park, Kiejung

    2009-02-01

    MAPSI (Management and Analysis for Polyketide Synthase Type I) has been developed to offer computational analysis methods to detect type I PKS (polyketide synthase) gene clusters in genome sequences. MAPSI provides a genome analysis component, which detects PKS gene clusters by identifying domains in proteins of a genome. MAPSI also contains databases on polyketides and genome annotation data, as well as analytic components such as new PKS assembly and domain analysis. The polyketide data and analysis component are accessible through Web interfaces and are displayed with diverse information. MAPSI, which was developed to aid researchers studying type I polyketides, provides diverse components to access and analyze polyketide information and should become a very powerful computational tool for polyketide research. The system can be extended through further studies of factors related to the biological activities of polyketides.

  13. Characterization and evolutionary analysis of ent-kaurene synthase like genes from the wild rice species Oryza rufipogon.

    PubMed

    Toyomasu, Tomonobu; Miyamoto, Koji; Shenton, Matthew R; Sakai, Arisa; Sugawara, Chizu; Horie, Kiyotaka; Kawaide, Hiroshi; Hasegawa, Morifumi; Chuba, Masaru; Mitsuhashi, Wataru; Yamane, Hisakazu; Kurata, Nori; Okada, Kazunori

    2016-11-18

    Cultivated rice (Oryza sativa) possesses various labdane-related diterpene synthase genes, homologs of ent-copalyl diphosphate synthase (CPS) and ent-kaurene synthase (KS) that are responsible for the biosynthesis of phytohormone gibberellins. The CPS homologs and KS like (KSL) homologs successively converted geranylgeranyl diphosphate to cyclic diterpene hydrocarbons via ent-copalyl diphosphate or syn-copalyl diphosphate in O. sativa. Consequently, a variety of labdane-related diterpenoids, including phytoalexin phytocassanes, momilactones and oryzalexins, have been identified from cultivated rice. Our previous report indicated that the biosynthesis of phytocassanes and momilactones is conserved in Oryza rufipogon, the progenitor of Asian cultivated rice. Moreover, their biosynthetic gene clusters, containing OsCPS2 and OsKSL7 for phytocassane biosynthesis and OsCPS4 and OsKSL4 for momilactone biosynthesis, are also present in the O. rufipogon genome. We herein characterized O. rufipogon homologs of OsKSL5, OsKSL6, OsKSL8 responsible for oryzalexin S biosynthesis, and OsKSL10 responsible for oryzalexins A-F biosynthesis, to obtain more evolutionary insight into diterpenoid biosynthesis in O. sativa. Our phytoalexin analyses showed that no accumulation of oryzalexins was detected in extracts from O. rufipogon leaf blades. In vitro functional analyses indicated that unlike OsKSL10, O. rufipogon KSL10 functions as an ent-miltiradiene synthase, which explains the lack of accumulation of oryzalexins A-F in O. rufipogon. The different functions of KSL5 and KSL8 in O. sativa japonica to those in indica are conserved in each type of O. rufipogon, while KSL6 functions (ent-isokaurene synthases) are well conserved. Our study suggests that O. sativa japonica has evolved distinct specialized diterpenoid metabolism, including the biosynthesis of oryzalexins.

  14. Transformation of apple ( Malus domestica Borkh.) with the stilbene synthase gene from grapevine ( Vitis vinifera L.) and a PGIP gene from kiwi ( Actinidia deliciosa).

    PubMed

    Szankowski, I; Briviba, K; Fleschhut, J; Schönherr, J; Jacobsen, H-J; Kiesecker, H

    2003-09-01

    The objective of the present research was to introduce genes with antifungal potential into the commercially important apple cvs. Elstar and Holsteiner Cox in order to establish resistance against fungal diseases. The gene encoding the stilbene synthase (Vst1) from Vitis vinifera L., responsible for the synthesis of the phytoalexin resveratrol in grapevine, and the gene for a polygalacturonase-inhibiting protein (PGIP) from kiwi ( Actinidia deliciosa) were transferred into Holsteiner Cox and Elstar via Agrobacterium tumefaciens-mediated transformation. A total of nine transgenic Holsteiner Cox clones and one transgenic E clone carrying the stilbene-synthase gene as well as three transgenic Holsteiner Cox lines harbouring the polygalacturonase-inhibiting protein from Kiwi were identified via polymerase chain reaction and Southern blot analysis. High performance liquid chromatography analysis revealed the accumulation of a resveratrol-derivate, a glycoside, in transgenic Vst1 plants.

  15. Identification of amino acid networks governing catalysis in the closed complex of class I terpene synthases.

    PubMed

    Schrepfer, Patrick; Buettner, Alexander; Goerner, Christian; Hertel, Michael; van Rijn, Jeaphianne; Wallrapp, Frank; Eisenreich, Wolfgang; Sieber, Volker; Kourist, Robert; Brück, Thomas

    2016-02-23

    Class I terpene synthases generate the structural core of bioactive terpenoids. Deciphering structure-function relationships in the reactive closed complex and targeted engineering is hampered by highly dynamic carbocation rearrangements during catalysis. Available crystal structures, however, represent the open, catalytically inactive form or harbor nonproductive substrate analogs. Here, we present a catalytically relevant, closed conformation of taxadiene synthase (TXS), the model class I terpene synthase, which simulates the initial catalytic time point. In silico modeling of subsequent catalytic steps allowed unprecedented insights into the dynamic reaction cascades and promiscuity mechanisms of class I terpene synthases. This generally applicable methodology enables the active-site localization of carbocations and demonstrates the presence of an active-site base motif and its dominating role during catalysis. It additionally allowed in silico-designed targeted protein engineering that unlocked the path to alternate monocyclic and bicyclic synthons representing the basis of a myriad of bioactive terpenoids.

  16. Modulation of Medium-Chain Fatty Acid Synthesis in Synechococcus sp. PCC 7002 by Replacing FabH with a Chaetoceros Ketoacyl-ACP Synthase

    PubMed Central

    Gu, Huiya; Jinkerson, Robert E.; Davies, Fiona K.; Sisson, Lyle A.; Schneider, Philip E.; Posewitz, Matthew C.

    2016-01-01

    The isolation or engineering of algal cells synthesizing high levels of medium-chain fatty acids (MCFAs) is attractive to mitigate the high clouding point of longer chain fatty acids in algal based biodiesel. To develop a more informed understanding of MCFA synthesis in photosynthetic microorganisms, we isolated several algae from Great Salt Lake and screened this collection for MCFA accumulation to identify strains naturally accumulating high levels of MCFA. A diatom, Chaetoceros sp. GSL56, accumulated particularly high levels of C14 (up to 40%), with the majority of C14 fatty acids allocated in triacylglycerols. Using whole cell transcriptome sequencing and de novo assembly, putative genes encoding fatty acid synthesis enzymes were identified. Enzymes from this Chaetoceros sp. were expressed in the cyanobacterium Synechococcus sp. PCC 7002 to validate gene function and to determine whether eukaryotic enzymes putatively lacking bacterial evolutionary control mechanisms could be used to improve MCFA production in this promising production strain. Replacement of the Synechococcus 7002 native FabH with a Chaetoceros ketoacyl-ACP synthase III increased MCFA synthesis up to fivefold. The level of increase is dependent on promoter strength and culturing conditions. PMID:27303412

  17. Modulation of medium-chain fatty acid synthesis in Synechococcus sp. PCC 7002 by replacing FabH with a Chaetoceros Ketoacyl-ACP synthase

    DOE PAGES

    Gu, Huiya; Jinkerson, Robert E.; Davies, Fiona K.; ...

    2016-05-26

    The isolation or engineering of algal cells synthesizing high levels of medium-chain fatty acids (MCFAs) is attractive to mitigate the high clouding point of longer chain fatty acids in algal based biodiesel. To develop a more informed understanding of MCFA synthesis in photosynthetic microorganisms, we isolated several algae from Great Salt Lake and screened this collection for MCFA accumulation to identify strains naturally accumulating high levels of MCFA. A diatom, Chaetoceros sp. GSL56, accumulated particularly high levels of C14 (up to 40%), with the majority of C14 fatty acids allocated in triacylglycerols. Using whole cell transcriptome sequencing and de novomore » assembly, putative genes encoding fatty acid synthesis enzymes were identified. Enzymes from this Chaetoceros sp. were expressed in the cyanobacterium Synechococcus sp. PCC 7002 to validate gene function and to determine whether eukaryotic enzymes putatively lacking bacterial evolutionary control mechanisms could be used to improve MCFA production in this promising production strain. Replacement of the Synechococcus 7002 native FabH with a Chaetoceros ketoacyl-ACP synthase Ill increased MCFA synthesis up to fivefold. In conclusion, the level of increase is dependent on promoter strength and culturing conditions.« less

  18. Genes encoding chavicol/eugenol synthase from the creosote bush Larrea tridentata

    DOEpatents

    Lewis, Norman G.; Davin, Laurence B.; Kim, Sung -Jin; Vassao, Daniel Giddings; Patten, Ann M.; Eichinger, Dietmar

    2015-09-15

    Particular aspects provide novel methods for redirecting carbon allocation in plants or cell culture from lignification to inherently more useful and tractable materials, and to facilitate the generation of, e.g., biofuels from the remaining plant ro culture biomass. Particular aspects provided novel methods for converting monolignols into allyl/propenyl phenols, and for chavicol/eugenol formation or production. Additional aspects relate to the discovery of novel chavicol/eugenol synthases that convert p-coumaryl/coniferyl alcohol esters into chavicol/eugenol, and to novel compositions (e.g., novel proteins and nucleic acids encoding same), and novel methods using same for producing or forming chavicol/eugenol and other derivatives in cell culture and/or genetically modified plants, and for re-engineering the composition of plant biomass. Particular aspects provide novel methods for generation in culture or in planta of liquid/combustible allyl/propenyl phenols, and these phenolic products are utilized for (non-ethanol) biofuel/bioenergy purposes, while the remaining plant biomass facilitates the generation of other biofuels.

  19. Polyketide genes in the marine sponge Plakortis simplex: a new group of mono-modular type I polyketide synthases from sponge symbionts

    PubMed Central

    Della Sala, Gerardo; Hochmuth, Thomas; Costantino, Valeria; Teta, Roberta; Gerwick, William; Gerwick, Lena; Piel, Jörn; Mangoni, Alfonso

    2013-01-01

    Summary Sponge symbionts are a largely unexplored source of new and unusual metabolic pathways. Insights into the distribution and function of metabolic genes of sponge symbionts are crucial to dissect and exploit their biotechnological potential. Screening of the metagenome of the marine sponge Plakortis simplex led to the discovery of the swf family, a new group of mono-modular type I polyketide synthase/fatty acid synthase (PKS/FAS) specifically associated with sponge symbionts. Two different examples of the swf cluster were present in the metagenome of P. simplex. A third example of the cluster is present in the previously sequenced genome of a poribacterium from the sponge Aplysina aerophoba but was formerly considered orthologous to the wcb/rkp cluster. The swf cluster was also found in six additional species of sponges. Therefore, the swf cluster represents the second group of mono-modular PKS, after the supA family, to be widespread in marine sponges. The putative swf operon consists of swfA (type I PKS/FAS), swfB (reductase and sulphotransferase domains) and swfC (radical S-adenosylmethionine, or radical SAM). Activation of the acyl carrier protein (ACP) domain of the SwfA protein to its holo-form by co-expression with Svp is the first functional proof of swf type genes in marine sponges. However, the precise biosynthetic role of the swf clusters remains unknown. PMID:24249289

  20. An update to polyketide synthase and non-ribosomal synthetase genes and nomenclature in Fusarium.

    PubMed

    Hansen, Frederik T; Gardiner, Donald M; Lysøe, Erik; Fuertes, Patricia Romans; Tudzynski, Bettina; Wiemann, Philipp; Sondergaard, Teis Esben; Giese, Henriette; Brodersen, Ditlev E; Sørensen, Jens Laurids

    2015-02-01

    Members of the genus Fusarium produce a plethora of bioactive secondary metabolites, which can be harmful to humans and animals or have potential in drug development. In this study we have performed comparative analyses of polyketide synthases (PKSs) and non-ribosomal peptide synthetases (NRPSs) from ten different Fusarium species including F. graminearum (two strains), F. verticillioides, F. solani, F. culmorum, F. pseudograminearum, F. fujikuroi, F. acuminatum, F. avenaceum, F. equiseti, and F. oxysporum (12 strains). This led to identification of 52 NRPS and 52 PKSs orthology groups, respectively, and although not all PKSs and NRPSs are assumed to be intact or functional, the analyses illustrate the huge secondary metabolite potential in Fusarium. In our analyses we identified a core collection of eight NRPSs (NRPS2-4, 6, 10-13) and two PKSs (PKS3 and PKS7) that are conserved in all strains analyzed in this study. The identified PKSs and NRPSs were named based on a previously developed classification system (www.FusariumNRPSPKS.dk). We suggest this system be used when PKSs and NRPSs have to be classified in future sequenced Fusarium strains. This system will facilitate identification of orthologous and non-orthologous NRPSs and PKSs from newly sequenced Fusarium genomes and will aid the scientific community by providing a common nomenclature for these two groups of genes/enzymes.

  1. A CELLULOSE SYNTHASE (CESA) gene essential for gametophore morphogenesis in the moss Physcomitrella patens.

    PubMed

    Goss, Chessa A; Brockmann, Derek J; Bushoven, John T; Roberts, Alison W

    2012-06-01

    In seed plants, different groups of orthologous genes encode the CELLULOSE SYNTHASE (CESA) proteins that are responsible for cellulose biosynthesis in primary and secondary cell walls. The seven CESA sequences of the moss Physcomitrella patens (Hedw.) B. S. G. form a monophyletic sister group to seed plant CESAs, consistent with independent CESA diversification and specialization in moss and seed plant lines. The role of PpCESA5 in the development of P. patens was investigated by targeted mutagenesis. The cesa5 knockout lines were tested for cellulose deficiency using carbohydrate-binding module affinity cytochemistry and the morphology of the leafy gametophores was analyzed by 3D reconstruction of confocal images. No defects were identified in the development of the filamentous protonema or in production of bud initials that normally give rise to the leafy gametophores. However, the gametophore buds were cellulose deficient and defects in subsequent cell expansion, cytokinesis, and leaf initiation resulted in the formation of irregular cell clumps instead of leafy shoots. Analysis of the cesa5 knockout phenotype indicates that a biophysical model of organogenesis can be extended to the moss gametophore shoot apical meristem.

  2. Endothelial nitric oxide synthase gene polymorphism and elite endurance athlete status: the Genathlete study.

    PubMed

    Wolfarth, B; Rankinen, T; Mühlbauer, S; Ducke, M; Rauramaa, R; Boulay, M R; Pérusse, L; Bouchard, C

    2008-08-01

    In the Genathlete study, we examined the contribution of three polymorphisms in the endothelial nitric oxide synthase (NOS3) gene to discriminate elite endurance athletes (EEA) from sedentary controls (SC). The EEA group included a total of 316 Caucasian males with a VO2max >75 mL/kg. The SC group comprised 299 unrelated sedentary Caucasian males who had VO2max values below 50 mL/kg. The polymerase chain reaction technique was used to amplify a microsatellite (CA)(n) repeat in intron 13, a 27 bp repeat in intron 4 and a third fragment in exon 7 containing the Glu298Asp SNP. No difference was found between the EEA and SC groups for the 27 bp repeat and the Glu298Asp polymorphism. Chi-square analysis of the overall allelic distribution of the (CA)(n) repeat revealed no significant difference between the two groups (P=0.135). However, comparing carriers and non-carriers for the most common (CA)(n) repeat alleles, we found significant differences between SC and EEA, with more EEA subjects carrying the 164 bp allele (P=0.007). In summary, we found suggestive evidence that the 164 bp allele of the (CA)(n) repeat in intron 13 is associated with EEA status and may account for some of the differences between EEA and SC.

  3. Expression of Monoamine Transporters, Nitric Oxide Synthase 3, and Neurotrophin Genes in Antidepressant-Stimulated Astrocytes

    PubMed Central

    Kittel-Schneider, Sarah; Kenis, Gunter; Schek, Julia; van den Hove, Daniel; Prickaerts, Jos; Lesch, Klaus-Peter; Steinbusch, Harry; Reif, Andreas

    2012-01-01

    Background: There is increasing evidence that glial cells play a role in the pathomechanisms of mood disorders and the mode of action of antidepressant drugs. Methods: To examine whether there is a direct effect on the expression of different genes encoding proteins that have been implicated in the pathophysiology of affective disorders, primary astrocyte cell cultures from rats were treated with two different antidepressant drugs, imipramine and escitalopram, and the RNA expression of brain-derived neurotrophic factor (Bdnf), serotonin transporter (5Htt), dopamine transporter (Dat), and endothelial nitric oxide synthase (Nos3) was examined. Results: Stimulation of astroglial cell culture with imipramine, a tricyclic antidepressant, led to a significant increase of the Bdnf RNA level whereas treatment with escitalopram did not. In contrast, 5Htt was not differentially expressed after antidepressant treatment. Finally, neither Dat nor Nos3 RNA expression was detected in cultured astrocytes. Conclusion: These data provide further evidence for a role of astroglial cells in the molecular mechanisms of action of antidepressants. PMID:22529824

  4. Endothelial nitric oxide synthase: From biochemistry and gene structure to clinical implications of NOS3 polymorphisms.

    PubMed

    Oliveira-Paula, Gustavo H; Lacchini, Riccardo; Tanus-Santos, Jose E

    2016-01-10

    Nitric oxide (NO) is an important vasodilator with a well-established role in cardiovascular homeostasis. While mediator is synthesized from L-arginine by neuronal, endothelial, and inducible nitric oxide synthases (NOS1,NOS3 and NOS2 respectively), NOS3 is the most important isoform for NO formation in the cardiovascular system. NOS3 is a dimeric enzyme whose expression and activity are regulated at transcriptional, posttranscriptional,and posttranslational levels. The NOS3 gene, which encodes NOS3, exhibits a number of polymorphic sites including single nucleotide polymorphisms (SNPs), variable number of tandem repeats (VNTRs), microsatellites, and insertions/deletions. Some NOS3 polymorphisms show functional effects on NOS3 expression or activity, thereby affecting NO formation. Interestingly, many studies have evaluated the effects of functional NOS3 polymorphisms on disease susceptibility and drug responses. Moreover, some studies have investigated how NOS3 haplotypes may impact endogenous NO formation and disease susceptibility. In this article,we carried out a comprehensive review to provide a basic understanding of biochemical mechanisms involved in NOS3 regulation and how genetic variations in NOS3 may translate into relevant clinical and pharmacogenetic implications.

  5. Congenital erythropoietic porphyria: identification and expression of 10 mutations in the uroporphyrinogen III synthase gene.

    PubMed Central

    Xu, W; Warner, C A; Desnick, R J

    1995-01-01

    To investigate the molecular basis of the phenotypic heterogeneity in congenital erythropoietic porphyria, the mutations in the uroporphyrinogen III synthase gene from unrelated patients were determined. Six missense (L4F, Y19C, V82F, V99A, A104V, and G225S), a nonsense (Q249X), a frameshift (633insA), and two splicing mutations (IVS2+1 and IVS9 delta A + 4) were identified. When L4F, Y19C, V82F, V99A, A104V, 633insA, G225S, and Q249X were expressed in Escherichia coli, only the V82F, V99A, and A104V alleles expressed residual enzymatic activity. Of note, the V82F mutation, which occurs adjacent to the 5' donor site of intron 4, resulted in approximately 54% aberrantly spliced transcripts with exon 4 deleted. Thus, this novel exonic single-base substitution caused two lesions, a missense mutation and an aberrantly spliced transcript. Of the splicing mutations, the IVS2+1 allele produced a single transcript with exon 2 deleted, whereas the IVS9 delta A+4 allele was alternatively spliced, approximately 26% being normal transcripts and the remainder with exon 9 deleted. The amount of residual activity expressed by each allele provided a basis to correlate genotype with disease severity, thereby permitting genotype/phenotype predictions in this clinically heterogeneous disease. Images PMID:7860775

  6. Nucleotide variability in the 5-enolpyruvylshikimate-3-phosphate synthase gene from Eleusine indica (L.) Gaertn.

    PubMed

    Chong, J L; Wickneswari, R; Ismail, B S; Salmijah, S

    2008-02-01

    This study reports the results of the partial DNA sequence analysis of the 5-enolpyruvyl-shikimate-3-phosphate synthase (EPSPS) gene in glyphosate-resistant (R) and glyphosate-susceptible (S) biotypes of Eleusine indica (L.) Gaertn from Peninsular Malaysia. Sequencing results revealed point mutation at nucleotide position 875 in the R biotypes of Bidor, Chaah and Temerloh. In the Chaah R population, substitution of cytosine (C) to adenine (A) resulted in the change of threonine (Thr106) to proline (Pro106) and from C to thymidine (T) in the Bidor R population, leading to serine (Ser106) from Pro106. As for the Temerloh R, C was substituted by T resulting in the change of Pro106 to Ser106. A new mutation previously undetected in the Temerloh R was revealed with C being substituted with A, resulting in the change of Pro106 to Thr106 indicating multiple founding events rather than to the spread of a single resistant allele. There was no point mutation recorded at nucleotide position 875 previously demonstrated to play a pivotal role in conferring glyphosate resistance to E. indica for the Lenggeng, Kuala Selangor, Melaka R populations. Thus, there may be another resistance mechanism yet undiscovered in the resistant Lenggeng, Kuala Selangor and Melaka populations.

  7. Polyhydroxyalkanoate production by a novel bacterium Massilia sp. UMI-21 isolated from seaweed, and molecular cloning of its polyhydroxyalkanoate synthase gene.

    PubMed

    Han, Xuerong; Satoh, Yasuharu; Kuriki, Yumi; Seino, Teruyuki; Fujita, Shinji; Suda, Takanori; Kobayashi, Takanori; Tajima, Kenji

    2014-11-01

    We successfully isolated one microorganism (UMI-21) from Ulva, a green algae that contains starch. The strain UMI-21 can produce polyhydroxyalkanoate (PHA) from starch, maltotriose, or maltose as a sole carbon source. Taxonomic studies and 16S rDNA sequence analysis revealed that strain UMI-21 was phylogenetically related to species of the genus Massilia. The PHA content under the cultivation condition using a 10-L jar fermentor was 45.5% (w/w). This value was higher than that obtained after cultivation in a flask, suggesting the possibility of large-scale PHA production by UMI-21 from starch. A major issue for the industrial production of microbial PHAs is the very high production cost. Starch is a relatively inexpensive substrate that is also found in abundant seaweeds such as Ulva. Therefore, the strain isolated in this study may be very useful for producing PHA from seaweeds containing polysaccharides such as starch. In addition, a 3.7-kbp DNA fragment containing the whole PHA synthase gene (phaC) was obtained from the strain UMI-21. The results of open reading frame (ORF) analysis suggested that the DNA fragment contained two ORFs, which were composed of 1740 (phaC) and 564 bp (phaR). The deduced amino acid sequence of PhaC from strain UMI-21 shared high similarity with PhaC from Ralstonia eutropha, which is a representative PHA-producing bacterium with a class I PHA synthase. This is the first report for the cloning of the PHA synthase gene from Massilia species.

  8. Rapid screening of an ordered fosmid library to clone multiple polyketide synthase genes of the phytopathogenic fungus Cladosporium phlei.

    PubMed

    So, Kum-Kang; Kim, Jung-Mi; Nguyen, Ngoc-Luong; Park, Jin-Ah; Kim, Beom-Tae; Park, Seung-Moon; Hwang, Ki-Jun; Kim, Dae-Hyuk

    2012-12-01

    In previous studies, the biological characteristics of the fungus Cladosporium phlei and its genetic manipulation by transformation were assessed to improve production of the fungal pigment, phleichrome, which is a fungal perylenequinone that plays an important role in the production of a photodynamic therapeutic agent. However, the low production of this metabolite by the wild-type strain has limited its application. Thus, we attempted to clone and characterize the genes that encode polyketide synthases (PKS), which are responsible for the synthesis of fungal pigments such as perylenequinones including phleichrome, elsinochrome and cercosporin. Thus, we performed genomic DNA PCR using 11 different combinations of degenerate primers targeting conserved domains including β-ketoacyl synthase and acyltransferase domains. Sequence comparison of the PCR amplicons revealed a high homology to known PKSs, and four different PKS genes showing a high similarity to three representative types of PKS genes were amplified. To obtain full-length PKS genes, an ordered gene library of a phleichrome-producing C. phlei strain (ATCC 36193) was constructed in a fosmid vector and 4800 clones were analyzed using a simple pyramidal arrangement system. This hierarchical clustering method combines the efficiency of PCR with enhanced specificity. Among the three representative types of PKSs, two reducing, one partially reducing, and one non-reducing PKS were identified. These genes were subsequently cloned, sequenced, and characterized. Biological characterization of these genes to determine their roles in phleichrome production is underway, with the ultimate aim of engineering this pathway to overproduce the desired substance.

  9. Malate synthase gene expression during fruit ripening of Cavendish banana (Musa acuminata cv. Williams).

    PubMed

    Pua, Eng-Chong; Chandramouli, Sumana; Han, Ping; Liu, Pei

    2003-01-01

    Malate synthase (MS) is a key enzyme responsible for malic acid synthesis in the glyoxylate cycle, which functions to convert stored lipids to carbohydrates, by catalysing the glyoxylate condensation reaction with acetyl-CoA in the peroxisome. In this study, the cloning of an MS cDNA, designated MaMS-1, from the banana fruit is reported. MaMS-1 was 1801 bp in length encoding a single polypeptide of 556 amino acid residues. Sequence analysis revealed that MaMS-1 possessed the conserved catalytic domain and a putative peroxisomal targeting signal SK(I/L) at the carboxyl terminal. MaMS-1 also shared an extensive sequence homology (79-81.3%) with other plant MS homologues. Southern analysis indicated that MS might be present as multiple members in the banana genome. In Northern analysis, MaMS-1 was expressed specifically in ripening fruit tissue and transcripts were not detected in other organs such as roots, pseudostem, leaves, ovary, male flower, and in fruit at different stages of development. However, the transcript abundance in fruit was affected by stage of ripening, during which transcript was barely detectable at the early stage of ripening (FG and TY), but the level increased markedly in MG and in other fruits at advanced ripening stages. Furthermore, MaMS-1 expression in FG fruit could be stimulated by treatment with 1 microl l(-1) exogenous ethylene, but the stimulatory effect was abolished by the application of an ethylene inhibitor, norbornadiene. Results of this study clearly show that MS expression in banana fruit is temporally regulated during ripening and is ethylene-inducible.

  10. Directed tagging of the Arabidopsis FATTY ACID ELONGATION1 (FAE1) gene with the maize transposon activator.

    PubMed Central

    James, D W; Lim, E; Keller, J; Plooy, I; Ralston, E; Dooner, H K

    1995-01-01

    The FATTY ACID ELONGATION1 (FAE1) gene of Arabidopsis is required for the synthesis of very long chain fatty acids in the seed. The product of the FAE1 gene is presumed to be a condensing enzyme that extends the chain length of fatty acids from C18 to C20 and C22. We report here the cloning of FAE1 by directed transposon tagging with the maize element Activator (Ac). An unstable fae1 mutant was isolated in a line carrying Ac linked to the FAE1 locus on chromosome 4. Cosegregation and reversion analyses established that the new mutant was tagged by Ac. A DNA fragment flanking Ac was cloned by inverse polymerase chain reaction and used to isolate FAE1 genomic clones and a cDNA clone from a library made from immature siliques. The predicted amino acid sequence of the FAE1 protein shares homology with those of other condensing enzymes (chalcone synthase, stilbene synthases, and beta-ketoacyl-acyl carrier protein synthase III), supporting the notion that FAE1 is the structural gene for a synthase or condensing enzyme. FAE1 is expressed in developing seed, but not in leaves, as expected from the effect of the fae1 mutation on the fatty acid compositions of those tissues. PMID:7734965

  11. A Malus crabapple chalcone synthase gene, McCHS, regulates red petal color and flavonoid biosynthesis.

    PubMed

    Tai, Deqiang; Tian, Ji; Zhang, Jie; Song, Tingting; Yao, Yuncong

    2014-01-01

    Chalcone synthase is a key and often rate-limiting enzyme in the biosynthesis of anthocyanin pigments that accumulate in plant organs such as flowers and fruits, but the relationship between CHS expression and the petal coloration level in different cultivars is still unclear. In this study, three typical crabapple cultivars were chosen based on different petal colors and coloration patterns. The two extreme color cultivars, 'Royalty' and 'Flame', have dark red and white petals respectively, while the intermediate cultivar 'Radiant' has pink petals. We detected the flavoniods accumulation and the expression levels of McCHS during petals expansion process in different cultivars. The results showed McCHS have their special expression patterns in each tested cultivars, and is responsible for the red coloration and color variation in crabapple petals, especially for color fade process in 'Radiant'. Furthermore, tobacco plants constitutively expressing McCHS displayed a higher anthocyanins accumulation and a deeper red petal color compared with control untransformed lines. Moreover, the expression levels of several anthocyanin biosynthetic genes were higher in the transgenic McCHS overexpressing tobacco lines than in the control plants. A close relationship was observed between the expression of McCHS and the transcription factors McMYB4 and McMYB5 during petals development in different crabapple cultivars, suggesting that the expression of McCHS was regulated by these transcription factors. We conclude that the endogenous McCHS gene is a critical factor in the regulation of anthocyanin biosynthesis during petal coloration in Malus crabapple.

  12. A Malus Crabapple Chalcone Synthase Gene, McCHS, Regulates Red Petal Color and Flavonoid Biosynthesis

    PubMed Central

    Song, Tingting; Yao, Yuncong

    2014-01-01

    Chalcone synthase is a key and often rate-limiting enzyme in the biosynthesis of anthocyanin pigments that accumulate in plant organs such as flowers and fruits, but the relationship between CHS expression and the petal coloration level in different cultivars is still unclear. In this study, three typical crabapple cultivars were chosen based on different petal colors and coloration patterns. The two extreme color cultivars, ‘Royalty’ and ‘Flame’, have dark red and white petals respectively, while the intermediate cultivar ‘Radiant’ has pink petals. We detected the flavoniods accumulation and the expression levels of McCHS during petals expansion process in different cultivars. The results showed McCHS have their special expression patterns in each tested cultivars, and is responsible for the red coloration and color variation in crabapple petals, especially for color fade process in ‘Radiant’. Furthermore, tobacco plants constitutively expressing McCHS displayed a higher anthocyanins accumulation and a deeper red petal color compared with control untransformed lines. Moreover, the expression levels of several anthocyanin biosynthetic genes were higher in the transgenic McCHS overexpressing tobacco lines than in the control plants. A close relationship was observed between the expression of McCHS and the transcription factors McMYB4 and McMYB5 during petals development in different crabapple cultivars, suggesting that the expression of McCHS was regulated by these transcription factors. We conclude that the endogenous McCHS gene is a critical factor in the regulation of anthocyanin biosynthesis during petal coloration in Malus crabapple. PMID:25357207

  13. Late-onset cutaneous porphyria in a patient heterozygous for a uroporphyrinogen III synthase gene mutation.

    PubMed

    Aguilera, P; Badenas, C; Whatley, S D; To-Figueras, J

    2016-12-01

    Deficiency of uroporphyrinogen III synthase (UROS) causes congenital erythropoietic porphyria (CEP). The disease, originating from the inheritance of mutations within the UROS gene, presents a recessive form of transmission. In a few patients, a late-onset CEP-like phenotype without UROS mutations appears to be associated with a myelodysplastic syndrome. We report a 60-year-old man with late-onset signs of cutaneous porphyria and accumulation in urine, plasma and faeces of type I porphyrin isomers characteristic of CEP. Analysis of DNA from peripheral leucocytes, skin and bone marrow aspirate showed that he was a heterozygous carrier of a Cys73Arg (c.217 T>C) mutation within UROS. Sequencing of cDNA from peripheral blood confirmed heterozygosity and expression of the normal allele. Measurement of UROS enzymatic activity in erythrocytes showed values ~70% of normal, indirectly indicating expression of the normal allele. Differently from other cases of late-onset uroporphyria, the patient did not present thrombocytopenia or any evidence of a myelodysplastic syndrome. Five years of clinical follow-up showed persistence of skin signs and increased excretion of porphyrins, independently of lifestyle factors or changes in medication regimes. We hypothesize acquired mosaicism (in the bone marrow) affecting the UROS gene. Thus, unstable cellular clones initiated overproduction of isomer I porphyrins leading to a CEP phenotype. This could be explained either by a clonal expansion of the porphyric (Cys73Arg) allele or by loss of function of the normal allele. Cellular turnover would facilitate release of uroporphyrins into circulation and subsequent skin lesions. This is the first case of a CEP heterozygous carrier presenting clinical manifestations.

  14. Chitin synthase genes in Manduca sexta: characterization of a gut-specific transcript and differential tissue expression of alternately spliced mRNAs during development.

    PubMed

    Hogenkamp, David G; Arakane, Yasuyuki; Zimoch, Lars; Merzendorfer, Hans; Kramer, Karl J; Beeman, Richard W; Kanost, Michael R; Specht, Charles A; Muthukrishnan, Subbaratnam

    2005-06-01

    Chitin, the linear homopolymer of beta-1,4-linked N-acetylglucosamine, is produced by the enzyme chitin synthase (CHS). In general, this insoluble polysaccharide is found in two major extracellular structures in insects, the cuticle that overlays the epidermis and the peritrophic membrane (PM) that lines the midgut. Based on amino acid sequence similarities, insect CHSs are divided into two classes, A and B, and to date no more than two CHS genes have been identified in any single insect species. In species where both CHSs have been identified, one class A CHS and one class B CHS are always present. This finding suggests that these two genes may encode enzymes that synthesize chitin in different epithelial tissues. In our laboratory, we previously characterized transcripts for a class A CHS gene (MsCHS1) from the tobacco hornworm, Manduca sexta. We observed the expression of this gene in the larval epidermis, suggesting that the encoded enzyme functions to synthesize cuticular chitin. In this paper, we characterize a second chitin synthase gene (MsCHS2) belonging to class B and its cDNA from Manduca and show that it is expressed only in the midgut. This cDNA contains an open reading frame of 4575 nucleotides, which encodes a conceptual protein that is 1524 amino acids in length and is predicted to contain 16 transmembrane spans. Northern blot analysis of RNA isolated from anterior, medial, and posterior sections of the midgut from feeding larvae indicate that MsCHS2 is primarily expressed in the anterior midgut, with transcript levels tapering off in the medial and posterior midgut. Analysis of the MsCHS2 gene sequence indicates the absence of an alternate exon in contrast to the MsCHS1 gene, which yields two transcripts, MsCHS1a and MsCHS1b. RT-PCR analysis of the differential expression of these alternately spliced transcripts reveals that both splice variants are present in the epidermis. However, the ratio of the two alternately spliced transcripts varies

  15. Peroxidative oxidation of leuco-dichlorofluorescein by prostaglandin H synthase in prostaglandin biosynthesis from polyunsaturated fatty acids.

    PubMed

    Larsen, L N; Dahl, E; Bremer, J

    1996-01-05

    Prostaglandin H synthase can oxidize arachidonic acid with leuco-dichlorofluorescein as reducing cosubstrate. Addition of 0.5 mM phenol increases the oxidation of leuco-dichlorofluorescein to dichlorofluorescein 5-fold, probably by acting as a cyclic intermediate in the oxidation. Tetramethyl-p-phenylenediamine is also oxidized as cosubstrate. Its oxidation is not influenced by phenol. A stoichiometry of close to one mole of tetramethyl-p-phenylenediamine or leuco-dichlorofluorescein consumed per mole of arachidonic acid was found in the initial phase of the reaction. In the presence of phenol + leuco-dichlorofluorescein, the oxidation rate of arachidonic acid is about 40% lower than with phenol alone as cosubstrate. Since dichlorofluorescein has a molar extinction coefficient of 91 . 10(3) at 502 nm, the oxidation of less than 1 microM leuco-dichlorofluorescein can be detected spectrophotometrically. The rate of extinction change with leuco-dichlorofluorescein (at 502 nm) is about 4-fold more rapid than with tetramethyl-p-phenylenediamine (at 611 nm). With this spectrophotometric assay we have confirmed that arachidonic acid, linolenic acid, adrenic acid, gamma-linolenic acid, eicosapentaenoic acid, are substrates for prostaglandin H synthase with decreasing reaction rates in the mentioned order. The same order of reaction rates were found when oxygen consumption was measured. The assay also shows that docosahexaenoic acid is substrate for the enzyme. The reaction rate of the enzyme evidently is decreased both by a n-3 double bond and by deviation from a 20 carbon chain length of the fatty acid substrate.

  16. Proteomic Upregulation of Fatty Acid Synthase and Fatty Acid Binding Protein 5 and Identification of Cancer- and Race-Specific Pathway Associations in Human Prostate Cancer Tissues

    PubMed Central

    Myers, Jennifer S.; von Lersner, Ariana K.; Sang, Qing-Xiang Amy

    2016-01-01

    Protein profiling studies of prostate cancer have been widely used to characterize molecular differences between diseased and non-diseased tissues. When combined with pathway analysis, profiling approaches are able to identify molecular mechanisms of prostate cancer, group patients by cancer subtype, and predict prognosis. This strategy can also be implemented to study prostate cancer in very specific populations, such as African Americans who have higher rates of prostate cancer incidence and mortality than other racial groups in the United States. In this study, age-, stage-, and Gleason score-matched prostate tumor specimen from African American and Caucasian American men, along with non-malignant adjacent prostate tissue from these same patients, were compared. Protein expression changes and altered pathway associations were identified in prostate cancer generally and in African American prostate cancer specifically. In comparing tumor to non-malignant samples, 45 proteins were significantly cancer-associated and 3 proteins were significantly downregulated in tumor samples. Notably, fatty acid synthase (FASN) and epidermal fatty acid-binding protein (FABP5) were upregulated in human prostate cancer tissues, consistent with their known functions in prostate cancer progression. Aldehyde dehydrogenase family 1 member A3 (ALDH1A3) was also upregulated in tumor samples. The Metastasis Associated Protein 3 (MTA3) pathway was significantly enriched in tumor samples compared to non-malignant samples. While the current experiment was unable to detect statistically significant differences in protein expression between African American and Caucasian American samples, differences in overrepresentation and pathway enrichment were found. Structural components (Cytoskeletal Proteins and Extracellular Matrix Protein protein classes, and Biological Adhesion Gene Ontology (GO) annotation) were overrepresented in African American but not Caucasian American tumors. Additionally, 5

  17. Amino acid regulation of gene expression.