Science.gov

Sample records for acid synthase genes

  1. Isolation and partial characterization of the gene for goose fatty acid synthase.

    PubMed

    Kameda, K; Goodridge, A G

    1991-01-01

    Fatty acid synthase is regulated by diet and hormones, with regulation being primarily transcriptional. In chick embryo hepatocytes in culture, triiodothyronine stimulates accumulation of enzyme and transcription of the gene. Since the 5'-flanking region of this gene is likely involved in hormonal regulation of its expression, we have isolated and partially characterized an avian fatty acid synthase gene. A genomic DNA library was constructed in a cosmid vector and screened with cDNA clones that contained sequence complementary to the 3' end of goose fatty acid synthase mRNA. A genomic clone (approximately 35 kilobase pairs (kb] was isolated, and a 6.5-kb EcoRI fragment thereof contained DNA complementary to the 3' noncoding region of fatty acid synthase mRNA. Additional cosmid libraries were screened with 5' fragments of previously isolated genomic clones, resulting in the isolation of five overlapping cosmid DNAs. The entire region of cloned DNA spans approximately 105 kb. Exon-containing fragments were identified by hybridization with end-labeled poly(A)+ RNA and by hybridization of labeled exon-containing genomic DNA fragments to fatty acid synthase mRNA. A new set of cDNA clones spanning approximately 3.2 kb was isolated from a lambda-ZAP goose liver cDNA library using the 5'-most exon-containing fragment of the 5'-most genomic DNA clone. This region of mRNA contains a 5'-untranslated sequence and a continuous open reading frame which includes a region that codes for the essential cysteine of the beta-ketoacyl synthase domain. The entire fatty acid synthase gene spans about 50 kb. The 5' 15 kb of the gene contain 7 exons. S1 nuclease and primer extension analyses were used to identify a single site for initiation of transcription, 174 nucleotides upstream from the putative translation initiation codon. Putative "TATA" and "CCAAT" boxes are located 28 and 60 base pairs (bp), respectively, upstream of the site of initiation of transcription. The 5'-flanking 597

  2. Isolation and Molecular Characterization of 1-Aminocyclopropane-1-carboxylic Acid Synthase Genes in Hevea brasiliensis

    PubMed Central

    Zhu, Jia-Hong; Xu, Jing; Chang, Wen-Jun; Zhang, Zhi-Li

    2015-01-01

    Ethylene is an important factor that stimulates Hevea brasiliensis to produce natural rubber. 1-Aminocyclopropane-1-carboxylic acid synthase (ACS) is a rate-limiting enzyme in ethylene biosynthesis. However, knowledge of the ACS gene family of H. brasiliensis is limited. In this study, nine ACS-like genes were identified in H. brasiliensis. Sequence and phylogenetic analysis results confirmed that seven isozymes (HbACS1–7) of these nine ACS-like genes were similar to ACS isozymes with ACS activity in other plants. Expression analysis results showed that seven ACS genes were differentially expressed in roots, barks, flowers, and leaves of H. brasiliensis. However, no or low ACS gene expression was detected in the latex of H. brasiliensis. Moreover, seven genes were differentially up-regulated by ethylene treatment.These results provided relevant information to help determine the functions of the ACS gene in H. brasiliensis, particularly the functions in regulating ethylene stimulation of latex production. PMID:25690030

  3. Deletion of a Chitin Synthase Gene in a Citric Acid Producing Strain of Aspergillus niger

    SciTech Connect

    Rinker, Torri E.; Baker, Scott E.

    2007-01-29

    Citric acid production by the filamentous fungus Aspergillus niger is carried out in a process that causes the organism to drastically alter its morphology. This altered morphology includes hyphal swelling and highly limited polar growth resulting in clumps of swollen cells that eventually aggregate into pellets of approximately 100 microns in diameter. In this pelleted form, A. niger has increased citric acid production as compared to growth in filamentous form. Chitin is a crucial component of the cell wall of filamentous fungi. Alterations in the deposition or production of chitin may have profound effects on the morphology of the organism. In order to study the role of chitin synthesis in pellet formation we have deleted a chitin synthase gene (csmA) in Aspergillus niger strain ATCC 11414 using a PCR based deletion construct. This class of chitin synthases is only found in filamentous fungi and is not present in yeasts. The csmA genes contain a myosin motor domain at the N-terminus and a chitin synthesis domain at the C-terminus. They are believed to contribute to the specialized polar growth observed in filamentous fungi that is lacking in yeasts. The csmA deletion strain (csmAΔ) was subjected to minimal media with and without osmotic stabilizers as well as tested in citric acid production media. Without osmotic stabilizers, the mutant germlings were abnormally swollen, primarily in the subapical regions, and contained large vacuoles. However, this swelling is ultimately not inhibitory to growth as the germlings are able to recover and undergo polar growth. Colony formation was largely unaffected in the absence of osmotic stabilizers. In citric acid production media csmAΔ was observed to have a 2.5 fold increase in citric acid production. The controlled expression of this class of chitin synthases may be useful for improving production of organic acids in filamentous fungi.

  4. Intron-exon organization of the gene for the multifunctional animal fatty acid synthase.

    PubMed Central

    Amy, C M; Williams-Ahlf, B; Naggert, J; Smith, S

    1992-01-01

    The complete intron-exon organization of the gene encoding a multifunctional mammalian fatty acid synthase has been elucidated, and specific exons have been assigned to coding sequences for the component domains of the protein. The rat gene is interrupted by 42 introns and the sequences bordering the splice-site junctions universally follow the GT/AG rule. However, of the 41 introns that interrupt the coding region of the gene, 23 split the reading frame in phase I, 14 split the reading frame in phase 0, and only 4 split the reading frame in phase II. Remarkably, 46% of the introns interrupt codons for glycine. With only one exception, boundaries between the constituent enzymes of the multifunctional polypeptide coincide with the location of introns in the gene. The significance of the predominance of phase I introns, the almost uniformly short length of the 42 introns and the overall small size of the gene, is discussed in relation to the evolution of multifunctional proteins. Images PMID:1736293

  5. Influence of Different Levels of Lipoic Acid Synthase Gene Expression on Diabetic Nephropathy

    PubMed Central

    Xu, Longquan; Hiller, Sylvia; Simington, Stephen; Nickeleit, Volker; Maeda, Nobuyo; James, Leighton R.; Yi, Xianwen

    2016-01-01

    Oxidative stress is implicated in the pathogenesis of diabetic nephropathy (DN) but outcomes of many clinical trials are controversial. To define the role of antioxidants in kidney protection during the development of diabetic nephropathy, we have generated a novel genetic antioxidant mouse model with over- or under-expression of lipoic acid synthase gene (Lias). These models have been mated with Ins2Akita/+ mice, a type I diabetic mouse model. We compare the major pathologic changes and oxidative stress status in two new strains of the mice with controls. Our results show that Ins2Akita/+ mice with under-expressed Lias gene, exhibit higher oxidative stress and more severe DN features (albuminuria, glomerular basement membrane thickening and mesangial matrix expansion). In contrast, Ins2Akita/+ mice with highly-expressed Lias gene display lower oxidative stress and less DN pathologic changes. Our study demonstrates that strengthening endogenous antioxidant capacity could be an effective strategy for prevention and treatment of DN. PMID:27706190

  6. Genetic diversity analysis of buffalo fatty acid synthase (FASN) gene and its differential expression among bovines.

    PubMed

    Niranjan, S K; Goyal, S; Dubey, P K; Kumari, N; Mishra, S K; Mukesh, M; Kataria, R S

    2016-01-10

    Fatty Acid Synthase (FASN) gene seems to be structurally and functionally different in bovines in view of their distinctive fatty acid synthesis process. Structural variation and differential expression of FASN gene is reported in buffalo (Bubalus bubalis), a bovine species close to cattle, in this study. Amino acid sequence and phylogenetic analysis of functionally important thioesterase (TE) domain of FASN revealed its conserved nature across mammals. Amino acid residues at TE domain, responsible for substrate binding and processing, were found to be invariant in all the mammalian species. A total of seven polymorphic nucleotide sites, including two in coding region of TE domain were identified across the 10 buffalo populations of riverine and swamp types. G and C alleles were found almost fixed at g18996 and g19056 loci, respectively in riverine buffaloes. Principal component analysis of three SNPs (g18433, g18996 and g19056) revealed distinct classification of riverine and swamp buffalo populations. Reverse Transcription-PCR amplification of mRNA corresponding to exon 8-10 region of buffalo FASN helped in identification of two transcript variants; one transcript of 565 nucleotides and another alternate transcript of 207 nucleotides, seems to have arisen through alternative splicing. Both the transcripts were found to be expressed in most of the vital tissues of buffalo with the highest expression in mammary gland. Semi-quantitative and real-time expression analysis across 13 different buffalo tissues revealed its highest expression in lactating mammary gland. When compared, expression of FASN was also found to be higher in liver, adipose and skeletal muscle of buffalo tissues, than cattle. However, the FASN expression was highest in adipose among the three tissues in both the species. Results indicate structural and functional distinctiveness of bovine FASN. Presence of alternate splicing in buffalo FASN also seems to be a unique phenomenon to the bovines

  7. Cellulose production and cellulose synthase gene detection in acetic acid bacteria.

    PubMed

    Valera, Maria José; Torija, Maria Jesús; Mas, Albert; Mateo, Estibaliz

    2015-02-01

    The ability of acetic acid bacteria (AAB) to produce cellulose has gained much industrial interest due to the physical and chemical characteristics of bacterial cellulose. The production of cellulose occurs in the presence of oxygen and in a glucose-containing medium, but it can also occur during vinegar elaboration by the traditional method. The vinegar biofilm produced by AAB on the air-liquid interface is primarily composed of cellulose and maintains the cells in close contact with oxygen. In this study, we screened for the ability of AAB to produce cellulose using different carbon sources in the presence or absence of ethanol. The presence of cellulose in biofilms was confirmed using the fluorochrome Calcofluor by microscopy. Moreover, the process of biofilm formation was monitored under epifluorescence microscopy using the Live/Dead BacLight Kit. A total of 77 AAB strains belonging to 35 species of Acetobacter, Komagataeibacter, Gluconacetobacter, and Gluconobacter were analysed, and 30 strains were able to produce a cellulose biofilm in at least one condition. This cellulose production was correlated with the PCR amplification of the bcsA gene that encodes cellulose synthase. A total of eight degenerated primers were designed, resulting in one primer pair that was able to detect the presence of this gene in 27 AAB strains, 26 of which formed cellulose.

  8. Cloning and manipulation of the Escherichia coli cyclopropane fatty acid synthase gene: physiological aspects of enzyme overproduction.

    PubMed Central

    Grogan, D W; Cronan, J E

    1984-01-01

    Like many other eubacteria, cultures of Escherichia coli accumulate cyclopropane fatty acids (CFAs) at a well-defined stage of growth, due to the action of the cytoplasmic enzyme CFA synthase. We report the isolation of the putative structural gene, cfa, for this enzyme on an E. coli-ColE1 chimeric plasmid by the use of an autoradiographic colony screening technique. When introduced into a variety of E. coli strains, this plasmid, pLC18-11, induced corresponding increases in CFA content and CFA synthase activity. Subsequent manipulation of the cfa locus, facilitated by the insertion of pLC18-11 into a bacteriophage lambda vector, allowed genetic and physiological studies of CFA synthase in E. coli. Overproduction of this enzyme via multicopy cfa plasmids caused abnormally high levels of CFA in membrane phospholipid but no discernable growth perturbation. Infection with phage lambda derivatives bearing cfa caused transient overproduction of the enzyme, although pL-mediated expression of cfa could not be demonstrated in plasmids derived from such phages. CFA synthase specific activities could be raised to very high levels by using cfa runaway-replication plasmids. A variety of physiological factors were found to modulate the levels of CFA synthase in normal and gene-amplified cultures. These studies argue against several possible mechanisms for the temporal regulation of CFA formation. PMID:6325391

  9. Acid Sphingomyelinase Gene Knockout Ameliorates Hyperhomocysteinemic Glomerular Injury in Mice Lacking Cystathionine-β-Synthase

    PubMed Central

    Boini, Krishna M.; Xia, Min; Abais, Justine M.; Xu, Ming; Li, Cai-xia; Li, Pin-Lan

    2012-01-01

    Acid sphingomyelinase (ASM) has been implicated in the development of hyperhomocysteinemia (hHcys)-induced glomerular oxidative stress and injury. However, it remains unknown whether genetically engineering of ASM gene produces beneficial or detrimental action on hHcys-induced glomerular injury. The present study generated and characterized the mice lacking cystathionine β-synthase (Cbs) and Asm mouse gene by cross breeding Cbs+/− and Asm+/− mice. Given that the homozygotes of Cbs−/−/Asm−/− mice could not survive for 3 weeks. Cbs+/−/Asm+/+, Cbs+/−/Asm+/− and Cbs+/−/Asm−/− as well as their Cbs wild type littermates were used to study the role of Asm−/− under a background of Cbs+/− with hHcys. HPLC analysis revealed that plasma Hcys level was significantly elevated in Cbs heterozygous (Cbs+/−) mice with different copies of Asm gene compared to Cbs+/+ mice with different Asm gene copies. Cbs+/−/Asm+/+ mice had significantly increased renal Asm activity, ceramide production and O2.− level compared to Cbs+/+/Asm+/+, while Cbs+/−/Asm−/− mice showed significantly reduced renal Asm activity, ceramide production and O2.− level due to increased plasma Hcys levels. Confocal microscopy demonstrated that colocalization of podocin with ceramide was much lower in Cbs+/−/Asm−/− mice compared to Cbs+/−/Asm+/+ mice, which was accompanied by a reduced glomerular damage index, albuminuria and proteinuria in Cbs+/−/Asm−/− mice. Immunofluorescent analyses of the podocin, nephrin and desmin expression also illustrated less podocyte damages in the glomeruli from Cbs+/−/Asm−/− mice compared to Cbs+/−/Asm+/+ mice. In in vitro studies of podocytes, hHcys-enhanced O2.− production, desmin expression, and ceramide production as well as decreases in VEGF level and podocin expression in podocytes were substantially attenuated by prior treatment with amitriptyline, an Asm inhibitor. In conclusion, Asm gene knockout or

  10. Gene identification and functional analysis of methylcitrate synthase in citric acid-producing Aspergillus niger WU-2223L.

    PubMed

    Kobayashi, Keiichi; Hattori, Takasumi; Honda, Yuki; Kirimura, Kohtaro

    2013-01-01

    Methylcitrate synthase (EC 2.3.3.5; MCS) is a key enzyme of the methylcitric acid cycle localized in the mitochondria of eukaryotic cells and related to propionic acid metabolism. In this study, cloning of the gene mcsA encoding MCS and heterologous expression of it in Escherichia coli were performed for functional analysis of the MCS of citric acid-producing Aspergillus niger WU-2223L. Only one copy of mcsA (1,495 bp) exists in the A. niger WU-2223L chromosome. It encodes a 51-kDa polypeptide consisting of 465 amino acids containing mitochondrial targeting signal peptides. Purified recombinant MCS showed not only MCS activity (27.6 U/mg) but also citrate synthase (EC 2.3.3.1; CS) activity (26.8 U/mg). For functional analysis of MCS, mcsA disruptant strain DMCS-1, derived from A. niger WU-2223L, was constructed. Although A. niger WU-2223L showed growth on propionate as sole carbon source, DMCS-1 showed no growth. These results suggest that MCS is an essential enzyme in propionic acid metabolism, and that the methylcitric acid cycle operates functionally in A. niger WU-2223L. To determine whether MCS makes a contribution to citric acid production, citric acid production tests on DMCS-1 were performed. The amount of citric acid produced from glucose consumed by DMCS-1 in citric acid production medium over 12 d of cultivation was on the same level to that by WU-2223L. Thus it was found that MCS made no contribution to citric acid production from glucose in A. niger WU-2223L, although MCS showed CS activity.

  11. Gene identification and functional analysis of methylcitrate synthase in citric acid-producing Aspergillus niger WU-2223L.

    PubMed

    Kobayashi, Keiichi; Hattori, Takasumi; Honda, Yuki; Kirimura, Kohtaro

    2013-01-01

    Methylcitrate synthase (EC 2.3.3.5; MCS) is a key enzyme of the methylcitric acid cycle localized in the mitochondria of eukaryotic cells and related to propionic acid metabolism. In this study, cloning of the gene mcsA encoding MCS and heterologous expression of it in Escherichia coli were performed for functional analysis of the MCS of citric acid-producing Aspergillus niger WU-2223L. Only one copy of mcsA (1,495 bp) exists in the A. niger WU-2223L chromosome. It encodes a 51-kDa polypeptide consisting of 465 amino acids containing mitochondrial targeting signal peptides. Purified recombinant MCS showed not only MCS activity (27.6 U/mg) but also citrate synthase (EC 2.3.3.1; CS) activity (26.8 U/mg). For functional analysis of MCS, mcsA disruptant strain DMCS-1, derived from A. niger WU-2223L, was constructed. Although A. niger WU-2223L showed growth on propionate as sole carbon source, DMCS-1 showed no growth. These results suggest that MCS is an essential enzyme in propionic acid metabolism, and that the methylcitric acid cycle operates functionally in A. niger WU-2223L. To determine whether MCS makes a contribution to citric acid production, citric acid production tests on DMCS-1 were performed. The amount of citric acid produced from glucose consumed by DMCS-1 in citric acid production medium over 12 d of cultivation was on the same level to that by WU-2223L. Thus it was found that MCS made no contribution to citric acid production from glucose in A. niger WU-2223L, although MCS showed CS activity. PMID:23832368

  12. Gene-gene interactions of fatty acid synthase (FASN) using multifactor-dimensionality reduction method in Korean cattle.

    PubMed

    Lee, Jeayoung; Jin, Mehyun; Lee, Yoonseok; Ha, Jaejung; Yeo, Jungsou; Oh, Dongyep

    2014-01-01

    We examined the gene-gene interactions of five exonic single nucleotide polymorphisms (SNPs) in the gene encoding fatty acid synthase using 513 Korean cattle and using the model free and the non-parametrical multifactor dimensionality reduction method for the analysis. The five SNPs of g.12870 T>C, g.13126 T>C, g.15532 C>A, g.16907 T>C and g.17924 G>A associated with a variety of fatty acid compositions and marbling score were used in this study. The two-factor interaction between g.13126 T>C and g.15532 C>A had the highest training-balanced among the five-factor models and a testing-balanced accuracy at 70.18 % on C18:1 with a cross-validation consistency of 10 out of 10. Also, the two-factor interaction between g.13126 T>C and g.15532 C>A had the highest testing-balanced accuracy at 68.59 % with a 10 out of 10 cross-validation consistency, than any other models on MUFA. In MS, a single SNP g.15532 C>A had the best accuracy at 58.85 % and the two-factor interaction model g.12870 T>C and g.15532 C>A had the highest testing-balanced accuracy at 64.00 %. The three-factor interaction model g.12870 T>C, g.13126 T>C and g.15532 C>A was recorded as having a high testing-balanced accuracy of 63.24 %, but it was lower than the two-factor interaction model. We used likelihood ratio tests for interaction, and Chi square tests to validate our results, with all tests showing statistical significance. We also compared this with mean scores between the high-risk trait group and low-risk trait group. The genotypes of TTCA, TTAA and TCAA at g.15532 and g.13126 on C18:1, genotypes TTCC, TTCA, TTAA, TCAA CCAA at g.15532 and g.13126 on MUFA and genotypes CCCC, TCCA, CCCA, TTAA, TCAA and CCAA at g.15532 and g.12870 on MS were recommended for the genetic improvement of beef quality.

  13. DNA Sequence and Expression Variation of Hop (Humulus lupulus) Valerophenone Synthase (VPS), a Key Gene in Bitter Acid Biosynthesis

    PubMed Central

    Castro, Consuelo B.; Whittock, Lucy D.; Whittock, Simon P.; Leggett, Grey; Koutoulis, Anthony

    2008-01-01

    Background The hop plant (Humulus lupulus) is a source of many secondary metabolites, with bitter acids essential in the beer brewing industry and others having potential applications for human health. This study investigated variation in DNA sequence and gene expression of valerophenone synthase (VPS), a key gene in the bitter acid biosynthesis pathway of hop. Methods Sequence variation was studied in 12 varieties, and expression was analysed in four of the 12 varieties in a series across the development of the hop cone. Results Nine single nucleotide polymorphisms (SNPs) were detected in VPS, seven of which were synonymous. The two non-synonymous polymorphisms did not appear to be related to typical bitter acid profiles of the varieties studied. However, real-time quantitative reverse-transcription polymerase chain reaction (qRT-PCR) analysis of VPS expression during hop cone development showed a clear link with the bitter acid content. The highest levels of VPS expression were observed in two triploid varieties, ‘Symphony’ and ‘Ember’, which typically have high bitter acid levels. Conclusions In all hop varieties studied, VPS expression was lowest in the leaves and an increase in expression was consistently observed during the early stages of cone development. PMID:18519445

  14. Molecular evolution and sequence divergence of plant chalcone synthase and chalcone synthase-Like genes.

    PubMed

    Han, Yingying; Zhao, Wenwen; Wang, Zhicui; Zhu, Jingying; Liu, Qisong

    2014-06-01

    Plant chalcone synthase (CHS) and CHS-Like (CHSL) proteins are polyketide synthases. In this study, we evaluated the molecular evolution of this gene family using representative types of CHSL genes, including stilbene synthase (STS), 2-pyrone synthase (2-PS), bibenzyl synthase (BBS), acridone synthase (ACS), biphenyl synthase (BIS), benzalacetone synthase, coumaroyl triacetic acid synthase (CTAS), and benzophenone synthase (BPS), along with their CHS homologs from the same species of both angiosperms and gymnosperms. A cDNA-based phylogeny indicated that CHSLs had diverse evolutionary patterns. STS, ACS, and 2-PS clustered with CHSs from the same species (late diverged pattern), while CTAS, BBS, BPS, and BIS were distant from their CHS homologs (early diverged pattern). The amino-acid phylogeny suggested that CHS and CHSL proteins formed clades according to enzyme function. The CHSs and CHSLs from Polygonaceae and Arachis had unique evolutionary histories. Synonymous mutation rates were lower in late diverged CHSLs than in early diverged ones, indicating that gene duplications occurred more recently in late diverged CHSLs than in early diverged ones. Relative rate tests proved that late diverged CHSLs had unequal rates to CHSs from the same species when using fatty acid synthase, which evolved from the common ancestor with the CHS superfamily, as the outgroup, while the early diverged lineages had equal rates. This indicated that late diverged CHSLs experienced more frequent mutation than early diverged CHSLs after gene duplication, allowing obtaining new functions in relatively short period of time.

  15. Differential regulation of host genes including hepatic fatty acid synthase in HBV-transgenic mice.

    PubMed

    Zhang, Hongmin; Li, Hong; Yang, Yixuan; Li, Sanglin; Ren, Hong; Zhang, Dazhi; Hu, Huaidong

    2013-06-01

    Hepatitis B virus (HBV) is the most common of the hepatitis viruses that cause chronic liver infections in humans, and it is considered to be a major global health problem. To gain a better understanding of HBV pathogenesis, and identify novel putative targets for anti-HBV therapy, this study was designed to elucidate the differential expression of host proteins in liver tissue from HBV-transgenic mice. Liver samples from two groups, (1) HBV-transgenic (Tg) mice, (2) corresponding background normal mice, wild-type (WT) mice, were collected and subjected to iTRAQ and mass spectrometry analysis. In total, 1950 unique proteins were identified, and 68 proteins were found to be differentially expressed in HBV-Tg mice as compared with that in WT mice. Several differentially expressed proteins were further validated by real-time quantitative RT-PCR, Western blot and immunohistochemical analysis. Furthermore, the association of HBV replication with fatty acid synthase (FASN), one of the highly expressed proteins in HBV-Tg mice, was verified. Silencing of FASN expression in HepG2.2.15 cells suppressed viral replication through the IFN signaling pathway, and some downstream antiviral effectors. The implicated role of FASN in HBV replication provides an opportunity to test existing compounds against FASN for adjuvant therapy and/or treatment of HBV replication. PMID:23675653

  16. An Intronless β-amyrin Synthase Gene is More Efficient in Oleanolic Acid Accumulation than its Paralog in Gentiana straminea.

    PubMed

    Liu, Yanling; Zhao, Zhongjuan; Xue, Zheyong; Wang, Long; Cai, Yunfei; Wang, Peng; Wei, Tiandi; Gong, Jing; Liu, Zhenhua; Li, Juan; Li, Shuo; Xiang, Fengning

    2016-01-01

    Paralogous members of the oxidosqualene cyclase (OSC) family encode a diversity of enzymes that are important in triterpenoid biosynthesis. This report describes the isolation of the Gentiana straminea gene GsAS2 that encodes a β-amyrin synthase (βAS) enzyme. Unlike its previously isolated paralog GsAS1, GsAS2 lacks introns. Its predicted protein product was is a 759 residue polypeptide that shares high homology with other known β-amyrin synthases (βASs). Heterologously expressed GsAS2 generates more β-amyrin in yeast than does GsAS1. Constitutive over-expression of GsAS2 resulted in a 5.7 fold increase in oleanolic acid accumulation, while over-expression of GsAS1 led to a 3 fold increase. Additionally, RNAi-directed suppression of GsAS2 and GsAS1 in G. straminea decreased oleonolic acid levels by 65.9% and 21% respectively, indicating that GsAS2 plays a more important role than GsAS1 in oleanolic acid biosynthesis in G. straminea. We uses a docking model to explore the catalytic mechanism of GsAS1/2 and predicted that GsAS2, with its Y560, have higher efficiency than GsAS1 and mutated versions of GsAS2 in β-amyrin produce. When the key residue in GsAS2 was mutagenized, it produced about 41.29% and 71.15% less β-amyrin than native, while the key residue in GsAS1 was mutagenized to that in GsAS2, the mutant produced 38.02% more β-amyrin than native GsAS1. PMID:27624821

  17. An Intronless β-amyrin Synthase Gene is More Efficient in Oleanolic Acid Accumulation than its Paralog in Gentiana straminea

    PubMed Central

    Liu, Yanling; Zhao, Zhongjuan; Xue, Zheyong; Wang, Long; Cai, Yunfei; Wang, Peng; Wei, Tiandi; Gong, Jing; Liu, Zhenhua; Li, Juan; Li, Shuo; Xiang, Fengning

    2016-01-01

    Paralogous members of the oxidosqualene cyclase (OSC) family encode a diversity of enzymes that are important in triterpenoid biosynthesis. This report describes the isolation of the Gentiana straminea gene GsAS2 that encodes a β-amyrin synthase (βAS) enzyme. Unlike its previously isolated paralog GsAS1, GsAS2 lacks introns. Its predicted protein product was is a 759 residue polypeptide that shares high homology with other known β-amyrin synthases (βASs). Heterologously expressed GsAS2 generates more β-amyrin in yeast than does GsAS1. Constitutive over-expression of GsAS2 resulted in a 5.7 fold increase in oleanolic acid accumulation, while over-expression of GsAS1 led to a 3 fold increase. Additionally, RNAi-directed suppression of GsAS2 and GsAS1 in G. straminea decreased oleonolic acid levels by 65.9% and 21% respectively, indicating that GsAS2 plays a more important role than GsAS1 in oleanolic acid biosynthesis in G. straminea. We uses a docking model to explore the catalytic mechanism of GsAS1/2 and predicted that GsAS2, with its Y560, have higher efficiency than GsAS1 and mutated versions of GsAS2 in β-amyrin produce. When the key residue in GsAS2 was mutagenized, it produced about 41.29% and 71.15% less β-amyrin than native, while the key residue in GsAS1 was mutagenized to that in GsAS2, the mutant produced 38.02% more β-amyrin than native GsAS1. PMID:27624821

  18. Functional analysis of the gene encoding the clavaminate synthase 2 isoenzyme involved in clavulanic acid biosynthesis in Streptomyces clavuligerus.

    PubMed Central

    Paradkar, A S; Jensen, S E

    1995-01-01

    A Streptomyces clavuligerus mutant disrupted in cas2, encoding the clavaminate synthase (CAS2) isoenzyme, was constructed by a gene replacement procedure. The resulting cas2 mutant showed no clavulanic acid production when grown in starch-asparagine medium. However, in soy medium, the cas2 mutant did produce clavulanic acid, although in amounts less than those produced by wild-type cultures. This medium-dependent leaky phenotype correlated well with the presence of the cas1 transcript, encoding the CAS1 isoenzyme, in cultures grown in soy medium and with its absence from those grown in starch-asparagine medium. This suggested that CAS1 and CAS2 both contribute to clavulanic acid production but that their production is regulated differently. Under nutritional conditions in which cas1 expression is blocked, cas2 becomes essential for clavulanic acid production. Northern (RNA) analysis revealed that while cas1 is transcribed as a 1.4-kb monocistronic transcript only, cas2 is transcribed both as a 1.2-kb monocistronic transcript and as part of a 5.3-kb polycistronic transcript. High-resolution S1 nuclease analysis located the transcription start point of the monocistronic cas2 transcript at a C residue 103 nucleotides upstream from the cas2 start codon. PMID:7868606

  19. Association between single-nucleotide polymorphisms of fatty acid synthase gene and meat quality traits in Datong Yak (Bos grunniens).

    PubMed

    Chu, M; Wu, X Y; Guo, X; Pei, J; Jiao, F; Fang, H T; Liang, C N; Ding, X Z; Bao, P J; Yan, P

    2015-03-30

    Fatty acid synthase (FASN) is a key enzyme in fatty acid anabolism that plays an important role in the fat deposit of eukaryotic cells. Therefore, in this study, we detected 2 novel single-nucleotide polymorphisms (SNPs) in the FASN gene in 313 adult individuals of Datong yak using polymerase chain reaction-single strand conformation polymorphism and DNA sequencing techniques. SNP g.5477C>T is located in intron 3 of FASN, and 3 genotypes, HH, HG, and GG, were detected in this mutation site. SNP g.16930T>A is located in exon 37 of FASN, and 2 genotypes, EE and EF, were detected in this site. Association analysis of these 2 SNPs with meat quality traits showed that in SNP g.5477C>T, yaks with the HH genotype and HG genotype had significantly higher intramuscular fat content than individuals with the GG genotype (P < 0.01). In SNP g.16930T>A, yaks with the EE genotype also had significantly higher IMF content than individuals with the EF genotype (P < 0.01). The results indicate that FASN may be used as a candidate gene affecting intramuscular fat content in Datong yaks.

  20. (+)-Abscisic Acid Metabolism, 3-Ketoacyl-Coenzyme A Synthase Gene Expression, and Very-Long-Chain Monounsaturated Fatty Acid Biosynthesis in Brassica napus Embryos1

    PubMed Central

    Qi, Qungang; Rose, Patricia A.; Abrams, Garth D.; Taylor, David C.; Abrams, Suzanne R.; Cutler, Adrian J.

    1998-01-01

    Microspore-derived embryos of Brassica napus cv Reston were used to examine the effects of exogenous (+)-abscisic acid (ABA) and related compounds on the accumulation of very-long-chain monounsaturated fatty acids (VLCMFAs), VLCMFA elongase complex activity, and induction of the 3-ketoacyl-coenzyme A synthase (KCS) gene encoding the condensing enzyme of the VLCMFA elongation system. Of the concentrations tested, (+)-ABA at 10 μm showed the strongest effect. Maximum activity of the elongase complex, observed 6 h after 10 μm (+)-ABA treatment, was 60% higher than that of the untreated embryos at 24 h. The transcript of the KCS gene was induced by 10 μm (+)-ABA within 1 h and further increased up to 6 h. The VLCMFAs eicosenoic acid (20:1) and erucoic acid (22:1) increased by 1.5- to 2-fold in embryos treated with (+)-ABA for 72 h. Also, (+)-8′-methylene ABA, which is metabolized more slowly than ABA, had a stronger ABA-like effect on the KCS gene transcription, elongase complex activity (28% higher), and level of VLCMFAs (25–30% higher) than ABA. After 24 h approximately 60% of the added (+)-[3H]ABA (10 μm) was metabolized, yielding labeled phaseic and dihydrophaseic acid. This study demonstrates that (+)-ABA promotes VLCMFA biosynthesis via increased expression of the KCS gene and that reducing ABA catabolism would increase VLCMFAs in microspore-derived embryos. PMID:9662540

  1. Proto-oncogene FBI-1 (Pokemon) and SREBP-1 synergistically activate transcription of fatty-acid synthase gene (FASN).

    PubMed

    Choi, Won-Il; Jeon, Bu-Nam; Park, Hyejin; Yoo, Jung-Yoon; Kim, Yeon-Sook; Koh, Dong-In; Kim, Myung-Hwa; Kim, Yu-Ri; Lee, Choong-Eun; Kim, Kyung-Sup; Osborne, Timothy F; Hur, Man-Wook

    2008-10-24

    FBI-1 (Pokemon/ZBTB7A) is a proto-oncogenic transcription factor of the BTB/POZ (bric-à-brac, tramtrack, and broad complex and pox virus zinc finger) domain family. Recent evidence suggested that FBI-1 might be involved in adipogenic gene expression. Coincidentally, expression of FBI-1 and fatty-acid synthase (FASN) genes are often increased in cancer and immortalized cells. Both FBI-1 and FASN are important in cancer cell proliferation. SREBP-1 is a major regulator of many adipogenic genes, and FBI-1 and SREBP-1 (sterol-responsive element (SRE)-binding protein 1) interact with each other directly via their DNA binding domains. FBI-1 enhanced the transcriptional activation of SREBP-1 on responsive promoters, pGL2-6x(SRE)-Luc and FASN gene. FBI-1 and SREBP-1 synergistically activate transcription of the FASN gene by acting on the proximal GC-box and SRE/E-box. FBI-1, Sp1, and SREBP-1 can bind to all three SRE, GC-box, and SRE/E-box. Binding competition among the three transcription factors on the GC-box and SRE/E-box appears important in the transcription regulation. FBI-1 is apparently changing the binding pattern of Sp1 and SREBP-1 on the two elements in the presence of induced SREBP-1 and drives more Sp1 binding to the proximal promoter with less of an effect on SREBP-1 binding. The changes induced by FBI-1 appear critical in the synergistic transcription activation. The molecular mechanism revealed provides insight into how proto-oncogene FBI-1 may attack the cellular regulatory mechanism of FASN gene expression to provide more phospholipid membrane components needed for rapid cancer cell proliferation. PMID:18682402

  2. Proto-oncogene FBI-1 (Pokemon) and SREBP-1 synergistically activate transcription of fatty-acid synthase gene (FASN).

    PubMed

    Choi, Won-Il; Jeon, Bu-Nam; Park, Hyejin; Yoo, Jung-Yoon; Kim, Yeon-Sook; Koh, Dong-In; Kim, Myung-Hwa; Kim, Yu-Ri; Lee, Choong-Eun; Kim, Kyung-Sup; Osborne, Timothy F; Hur, Man-Wook

    2008-10-24

    FBI-1 (Pokemon/ZBTB7A) is a proto-oncogenic transcription factor of the BTB/POZ (bric-à-brac, tramtrack, and broad complex and pox virus zinc finger) domain family. Recent evidence suggested that FBI-1 might be involved in adipogenic gene expression. Coincidentally, expression of FBI-1 and fatty-acid synthase (FASN) genes are often increased in cancer and immortalized cells. Both FBI-1 and FASN are important in cancer cell proliferation. SREBP-1 is a major regulator of many adipogenic genes, and FBI-1 and SREBP-1 (sterol-responsive element (SRE)-binding protein 1) interact with each other directly via their DNA binding domains. FBI-1 enhanced the transcriptional activation of SREBP-1 on responsive promoters, pGL2-6x(SRE)-Luc and FASN gene. FBI-1 and SREBP-1 synergistically activate transcription of the FASN gene by acting on the proximal GC-box and SRE/E-box. FBI-1, Sp1, and SREBP-1 can bind to all three SRE, GC-box, and SRE/E-box. Binding competition among the three transcription factors on the GC-box and SRE/E-box appears important in the transcription regulation. FBI-1 is apparently changing the binding pattern of Sp1 and SREBP-1 on the two elements in the presence of induced SREBP-1 and drives more Sp1 binding to the proximal promoter with less of an effect on SREBP-1 binding. The changes induced by FBI-1 appear critical in the synergistic transcription activation. The molecular mechanism revealed provides insight into how proto-oncogene FBI-1 may attack the cellular regulatory mechanism of FASN gene expression to provide more phospholipid membrane components needed for rapid cancer cell proliferation.

  3. Divinyl ether synthase gene, and protein and uses thereof

    DOEpatents

    Howe, Gregg A.; Itoh, Aya

    2006-12-26

    The present invention relates to divinyl ether synthase genes, proteins, and methods of their use. The present invention encompasses both native and recombinant wild-type forms of the synthase, as well as mutants and variant forms, some of which possess altered characteristics relative to the wild-type synthase. The present invention also relates to methods of using divinyl ether synthase genes and proteins, including in their expression in transgenic organisms and in the production of divinyl ether fatty acids, and to methods of suing divinyl ether fatty acids, including in the protection of plants from pathogens.

  4. Divinyl ether synthase gene and protein, and uses thereof

    DOEpatents

    Howe, Gregg A.; Itoh, Aya

    2011-09-13

    The present invention relates to divinyl ether synthase genes, proteins, and methods of their use. The present invention encompasses both native and recombinant wild-type forms of the synthase, as well as mutants and variant forms, some of which possess altered characteristics relative to the wild-type synthase. The present invention also relates to methods of using divinyl ether synthase genes and proteins, including in their expression in transgenic organisms and in the production of divinyl ether fatty acids, and to methods of suing divinyl ether fatty acids, including in the protection of plants from pathogens.

  5. Genes Specific for the Biosynthesis of Clavam Metabolites Antipodal to Clavulanic Acid Are Clustered with the Gene for Clavaminate Synthase 1 in Streptomyces clavuligerus

    PubMed Central

    Mosher, Roy H.; Paradkar, Ashish S.; Anders, Cecilia; Barton, Barry; Jensen, Susan E.

    1999-01-01

    Portions of the Streptomyces clavuligerus chromosome flanking cas1, which encodes the clavaminate synthase 1 isoenzyme (CAS1), have been cloned and sequenced. Mutants of S. clavuligerus disrupted in cvm1, the open reading frame located immediately upstream of cas1, were constructed by a gene replacement procedure. Similar techniques were used to generate S. clavuligerus mutants carrying a deletion that encompassed portions of the two open reading frames, cvm4 and cvm5, located directly downstream of cas1. Both classes of mutants still produced clavulanic acid and cephamycin C but lost the ability to synthesize the antipodal clavam metabolites clavam-2-carboxylate, 2-hydroxymethyl-clavam, and 2-alanylclavam. These results suggested that cas1 is clustered with genes essential and specific for clavam metabolite biosynthesis. When a cas1 mutant of S. clavuligerus was constructed by gene replacement, it produced lower levels of both clavulanic acid and most of the antipodal clavams except for 2-alanylclavam. However, a double mutant of S. clavuligerus disrupted in both cas1 and cas2 produced neither clavulanic acid nor any of the antipodal clavams, including 2-alanylclavam. This outcome was consistent with the contribution of both CAS1 and CAS2 to a common pool of clavaminic acid that is shunted toward clavulanic acid and clavam metabolite biosynthesis. PMID:10223939

  6. Expression and regulation of pear 1-aminocyclopropane-1-carboxylic acid synthase gene (PpACS1a) during fruit ripening, under salicylic acid and indole-3-acetic acid treatment, and in diseased fruit.

    PubMed

    Shi, Hai-Yan; Zhang, Yu-Xing

    2014-06-01

    In plants, the level of ethylene is determined by the activity of the key enzyme 1-aminocyclopropane-1-carboxylic acid (ACC) synthase (ACS). A gene encoding an ACC synthase protein was isolated from pear (Pyrus pyrifolia). This gene designated PpACS1a (GenBank accession no. KC632526) was 1488 bp in length with an open reading frame (ORF) encoding a protein of 495 amino acids that shared high similarity with other pear ACC synthase proteins. The PpACS1a was grouped into type-1 subfamily of plant ACS based on its conserved domain and phylogenetic status. Real-time quantitative PCR indicated that PpACS1a was differentially expressed in pear tissues and predominantly expressed in anthers. The expression signal of PpACS1a was also detected in fruit and leaves, but no signal was detected in shoots and petals. Furthermore, the PpACS1a expression was regulated during fruit ripening. In addition, the PpACS1a gene expression was regulated by salicylic acid (SA) and indole-3-acetic acid (IAA) in fruit. Moreover, the expression of the PpACS1a was up-regulated in diseased pear fruit. These results indicated that PpACS1a might be involved in fruit ripening and response to SA, IAA and disease.

  7. A downstream regulatory element located within the coding sequence mediates autoregulated expression of the yeast fatty acid synthase gene FAS2 by the FAS1 gene product.

    PubMed

    Wenz, P; Schwank, S; Hoja, U; Schüller, H J

    2001-11-15

    The fatty acid synthase genes FAS1 and FAS2 of the yeast Saccharomyces cerevisiae are transcriptionally co-regulated by general transcription factors (such as Reb1, Rap1 and Abf1) and by the phospholipid-specific heterodimeric activator Ino2/Ino4, acting via their corresponding upstream binding sites. Here we provide evidence for a positive autoregulatory influence of FAS1 on FAS2 expression. Even with a constant FAS2 copy number, a 10-fold increase of FAS2 transcript amount was observed in the presence of FAS1 in multi-copy, compared to a fas1 null mutant. Surprisingly, the first 66 nt of the FAS2 coding region turned out as necessary and sufficient for FAS1-dependent gene expression. FAS2-lacZ fusion constructs deleted for this region showed high reporter gene expression even in the absence of FAS1, arguing for a negatively-acting downstream repression site (DRS) responsible for FAS1-dependent expression of FAS2. Our data suggest that the FAS1 gene product, in addition to its catalytic function, is also required for the coordinate biosynthetic control of the yeast FAS complex. An excess of uncomplexed Fas1 may be responsible for the deactivation of an FAS2-specific repressor, acting via the DRS. PMID:11713312

  8. MicroRNA-24 can control triacylglycerol synthesis in goat mammary epithelial cells by targeting the fatty acid synthase gene.

    PubMed

    Wang, H; Luo, J; Chen, Z; Cao, W T; Xu, H F; Gou, D M; Zhu, J J

    2015-12-01

    In nonruminants it has been demonstrated that microRNA-24 (miR-24) is involved in preadipocyte differentiation, hepatic lipid, and plasma triacylglycerol synthesis. However, its role in ruminant mammary gland remains unclear. In this study we measured miR-24 expression in goat mammary gland tissue at 4 different stages of lactation and observed that it had highest expression at peak lactation when compared with the dry period. Overexpression or downregulation of miR-24 in goat mammary epithelial cells (GMEC) strongly affected fatty acid profiles; in particular, miR-24 enhanced unsaturated fatty acid concentration. Additional effects of miR-24 included changes in triacylglycerol content and the expression of fatty acid synthase, sterol regulatory element binding transcription protein 1, stearoyl-CoA desaturase, glycerol-3-phosphate acyltransferase mitochondrial, and acetyl-CoA carboxylase. Luciferase reporter assay confirmed that fatty acid synthase is a target of miR-24. Taken together, these results not only highlight the physiological importance of miR-24 in fatty acid metabolism in GMEC, but also laid the foundation for further research on regulatory mechanisms among miR-24 and other microRNA expressed in GMEC. PMID:26476938

  9. Versatile enzyme expression and characterization system for Aspergillus nidulans, with the Penicillium brevicompactum polyketide synthase gene from the mycophenolic acid gene cluster as a test case.

    PubMed

    Hansen, Bjarne G; Salomonsen, Bo; Nielsen, Morten T; Nielsen, Jakob B; Hansen, Niels B; Nielsen, Kristian F; Regueira, Torsten B; Nielsen, Jens; Patil, Kiran R; Mortensen, Uffe H

    2011-05-01

    Assigning functions to newly discovered genes constitutes one of the major challenges en route to fully exploiting the data becoming available from the genome sequencing initiatives. Heterologous expression in an appropriate host is central in functional genomics studies. In this context, filamentous fungi offer many advantages over bacterial and yeast systems. To facilitate the use of filamentous fungi in functional genomics, we present a versatile cloning system that allows a gene of interest to be expressed from a defined genomic location of Aspergillus nidulans. By a single USER cloning step, genes are easily inserted into a combined targeting-expression cassette ready for rapid integration and analysis. The system comprises a vector set that allows genes to be expressed either from the constitutive PgpdA promoter or from the inducible PalcA promoter. Moreover, by using the vector set, protein variants can easily be made and expressed from the same locus, which is mandatory for proper comparative analyses. Lastly, all individual elements of the vectors can easily be substituted for other similar elements, ensuring the flexibility of the system. We have demonstrated the potential of the system by transferring the 7,745-bp large mpaC gene from Penicillium brevicompactum to A. nidulans. In parallel, we produced defined mutant derivatives of mpaC, and the combined analysis of A. nidulans strains expressing mpaC or mutated mpaC genes unequivocally demonstrated that mpaC indeed encodes a polyketide synthase that produces the first intermediate in the production of the medically important immunosuppressant mycophenolic acid. PMID:21398493

  10. Three-factor reciprocal cross mapping of a gene that causes expression of feedback-resistant acetohydroxy acid synthase in Escherichia coli K-12.

    PubMed

    Jackson, J H; Davis, E J; Madu, A C; Braxter, S E

    1981-01-01

    The ilv-662 allele was previously identified as a mutation that caused acetohydroxy acid synthase activity to be resistant to feedback inhibition by valine (Davis et al. 1977). This allele was mapped between thr and leu by cotransduction analysis and labeled ilvJ. This report describes the mapping of ilvJ relative to genes that lie between thr and leu (ara, carA and pdxA) by three factor reciprocal cross analyses. We find that the probable gene order is thr-carA-pdxA-ilvJ-ara-leu. Although the phenotypic properties of ilvJ662 appear to be quite distinct from brnS, a gene reported to involve branched chain amino acid transport (Guardiola et al. 1974), we do not rule out possible allelism because of the uncertainty of the map position of brnS.

  11. Biosynthesis of Akaeolide and Lorneic Acids and Annotation of Type I Polyketide Synthase Gene Clusters in the Genome of Streptomyces sp. NPS554

    PubMed Central

    Zhou, Tao; Komaki, Hisayuki; Ichikawa, Natsuko; Hosoyama, Akira; Sato, Seizo; Igarashi, Yasuhiro

    2015-01-01

    The incorporation pattern of biosynthetic precursors into two structurally unique polyketides, akaeolide and lorneic acid A, was elucidated by feeding experiments with 13C-labeled precursors. In addition, the draft genome sequence of the producer, Streptomyces sp. NPS554, was performed and the biosynthetic gene clusters for these polyketides were identified. The putative gene clusters contain all the polyketide synthase (PKS) domains necessary for assembly of the carbon skeletons. Combined with the 13C-labeling results, gene function prediction enabled us to propose biosynthetic pathways involving unusual carbon-carbon bond formation reactions. Genome analysis also indicated the presence of at least ten orphan type I PKS gene clusters that might be responsible for the production of new polyketides. PMID:25603349

  12. Mycocerosic acid synthase exemplifies the architecture of reducing polyketide synthases.

    PubMed

    Herbst, Dominik A; Jakob, Roman P; Zähringer, Franziska; Maier, Timm

    2016-03-24

    Polyketide synthases (PKSs) are biosynthetic factories that produce natural products with important biological and pharmacological activities. Their exceptional product diversity is encoded in a modular architecture. Modular PKSs (modPKSs) catalyse reactions colinear to the order of modules in an assembly line, whereas iterative PKSs (iPKSs) use a single module iteratively as exemplified by fungal iPKSs (fiPKSs). However, in some cases non-colinear iterative action is also observed for modPKSs modules and is controlled by the assembly line environment. PKSs feature a structural and functional separation into a condensing and a modifying region as observed for fatty acid synthases. Despite the outstanding relevance of PKSs, the detailed organization of PKSs with complete fully reducing modifying regions remains elusive. Here we report a hybrid crystal structure of Mycobacterium smegmatis mycocerosic acid synthase based on structures of its condensing and modifying regions. Mycocerosic acid synthase is a fully reducing iPKS, closely related to modPKSs, and the prototype of mycobacterial mycocerosic acid synthase-like PKSs. It is involved in the biosynthesis of C20-C28 branched-chain fatty acids, which are important virulence factors of mycobacteria. Our structural data reveal a dimeric linker-based organization of the modifying region and visualize dynamics and conformational coupling in PKSs. On the basis of comparative small-angle X-ray scattering, the observed modifying region architecture may be common also in modPKSs. The linker-based organization provides a rationale for the characteristic variability of PKS modules as a main contributor to product diversity. The comprehensive architectural model enables functional dissection and re-engineering of PKSs.

  13. Critical aspartic acid residues in pseudouridine synthases.

    PubMed

    Ramamurthy, V; Swann, S L; Paulson, J L; Spedaliere, C J; Mueller, E G

    1999-08-01

    The pseudouridine synthases catalyze the isomerization of uridine to pseudouridine at particular positions in certain RNA molecules. Genomic data base searches and sequence alignments using the first four identified pseudouridine synthases led Koonin (Koonin, E. V. (1996) Nucleic Acids Res. 24, 2411-2415) and, independently, Santi and co-workers (Gustafsson, C., Reid, R., Greene, P. J., and Santi, D. V. (1996) Nucleic Acids Res. 24, 3756-3762) to group this class of enzyme into four families, which display no statistically significant global sequence similarity to each other. Upon further scrutiny (Huang, H. L., Pookanjanatavip, M., Gu, X. G., and Santi, D. V. (1998) Biochemistry 37, 344-351), the Santi group discovered that a single aspartic acid residue is the only amino acid present in all of the aligned sequences; they then demonstrated that this aspartic acid residue is catalytically essential in one pseudouridine synthase. To test the functional significance of the sequence alignments in light of the global dissimilarity between the pseudouridine synthase families, we changed the aspartic acid residue in representatives of two additional families to both alanine and cysteine: the mutant enzymes are catalytically inactive but retain the ability to bind tRNA substrate. We have also verified that the mutant enzymes do not release uracil from the substrate at a rate significant relative to turnover by the wild-type pseudouridine synthases. Our results clearly show that the aligned aspartic acid residue is critical for the catalytic activity of pseudouridine synthases from two additional families of these enzymes, supporting the predictive power of the sequence alignments and suggesting that the sequence motif containing the aligned aspartic acid residue might be a prerequisite for pseudouridine synthase function.

  14. The female-specific Cs-ACS1G gene of cucumber. A case of gene duplication and recombination between the non-sex-specific 1-aminocyclopropane-1-carboxylate synthase gene and a branched-chain amino acid transaminase gene.

    PubMed

    Knopf, Ronit Rimon; Trebitsh, Tova

    2006-09-01

    Cucumber (Cucumis sativus L.) is a monoecious plant in which female sex expression (gynoecy) is controlled by the Female (F) locus that can be modified by other sex-determining genes as well as by environmental and hormonal factors. As in many other cucurbits, ethylene is the major plant hormone regulating female sex expression. Previously we isolated the Cs-ACS1 (ACS, 1-aminocyclopropane-1-carboxylate synthase) gene that encodes the rate-limiting enzyme in the ethylene biosynthetic pathway. We proposed that Cs-ACS1 is present in a single copy in monoecious (ffMM) plants whereas gynoecious plants (FFMM) contain an additional copy Cs-ACS1G that was mapped to the F locus. To study the origin of Cs-ACS1G, we cloned and analyzed both the gynoecious-specific Cs-ACS1G gene and the non-sex-specific Cs-ACS1 gene. Our results indicate that Cs-ACS1G is the result of a relatively recent gene duplication and recombination, between Cs-ACS1 and a branched-chain amino acid transaminase (BCAT) gene. Taking into consideration that the Cs-ACS1G gene was mapped to the F locus, we propose that this duplication event gave rise to the F locus and to gynoecious cucumber plants. Computer analysis of the 1 kb region upstream of the transcription initiation site revealed several putative cis-acting regulatory elements that can potentially confer the responsiveness of Cs-ACS1G to developmental and hormonal factors and thereby control female sex determination in cucumber. These findings lead us to a model explaining the action of Cs-ACS1 and Cs-ACS1G in cucumber floral sex determination. PMID:16887844

  15. Producing dicarboxylic acids using polyketide synthases

    SciTech Connect

    Katz, Leonard; Fortman, Jeffrey L; Keasling, Jay D

    2013-10-29

    The present invention provides for a polyketide synthase (PKS) capable of synthesizing a dicarboxylic acid (diacid). Such diacids include diketide-diacids and triketide-diacids. The invention includes recombinant nucleic acid encoding the PKS, and host cells comprising the PKS. The invention also includes methods for producing the diacids.

  16. Producing dicarboxylic acids using polyketide synthases

    SciTech Connect

    Katz, Leonard; Fortman, Jeffrey L.; Keasling, Jay D.

    2015-05-26

    The present invention provides for a polyketide synthase (PKS) capable of synthesizing a dicarboxylic acid (diacid). Such diacids include diketide-diacids and triketide-diacids. The invention includes recombinant nucleic acid encoding the PKS, and host cells comprising the PKS. The invention also includes methods for producing the diacids.

  17. Effects of a subconvulsive dose of kainic acid on the gene expressions of the arginine vasopressin, oxytocin and neuronal nitric oxide synthase in the rat hypothalamus.

    PubMed

    Yoshimura, Mitsuhiro; Ohkubo, Jun-ichi; Hashimoto, Hirofumi; Matsuura, Takanori; Maruyama, Takashi; Onaka, Tatsushi; Suzuki, Hideaki; Ueta, Yoichi

    2015-10-01

    Arginine vasopressin (AVP) synthesis in the hypothalamo-neurohypophysial system (HNS) is up-regulated by kainic acid (KA)-induced seizure in rats. However, it remains unknown whether a subconvulsive dose of KA affects the HNS. Here we examined the effects of subcutaneous (s.c.) administration of a low dose of KA (4 mg/kg) on the gene expressions of the AVP, oxytocin (OXT) and neuronal nitric oxide synthase (nNOS) in the supraoptic (SON) and paraventricular nuclei (PVN) of the rat hypothalamus, using in situ hybridization histochemistry. The expression of the AVP gene in the SON and PVN was judged to be up-regulated in KA-treated rats in comparison with saline-treated rats as controls. Next, the expression of the OXT gene was significantly increased in the SON at 6-24h and in the PVN at 6 and 12h after s.c. administration of KA. Finally, the expression of the nNOS gene was significantly increased in the SON and PVN at 3 and 6h after s.c. administration of KA. These results suggest that up-regulation of the gene expressions of the AVP, OXT and nNOS in the rat hypothalamus may be differentially affected by peripheral administration of a subconvulsive dose of KA.

  18. Retinoic acid activates human inducible nitric oxide synthase gene through binding of RAR{alpha}/RXR{alpha} heterodimer to a novel retinoic acid response element in the promoter

    SciTech Connect

    Zou Fang; Liu Yan; Liu Li; Wu Kailang; Wei Wei; Zhu Ying . E-mail: yingzhu@whu.edu.cn; Wu Jianguo . E-mail: wu9988@vip.sina.com

    2007-04-06

    Human inducible nitric oxide synthase (hiNOS) catalyzes nitric oxide (NO) which has a significant effect on tumor suppression and cancer therapy. Here we revealed the detailed molecular mechanism involved in the regulation of hiNOS expression induced by retinoic acid (RA). We showed that RAR{alpha}/RXR{alpha} heterodimer was important in hiNOS promoter activation, hiNOS protein expression, and NO production. Serial deletion and site-directed mutation analysis revealed two half-sites of retinoic acid response element (RARE) spaced by 5 bp located at -172 to -156 in the hiNOS promoter. EMSA and ChIP assays demonstrated that RAR{alpha}/RXR{alpha} directly bound to this RARE of hiNOS promoter. Our results suggested the identification of a novel RARE in the hiNOS promoter and the roles of the nuclear receptors (RAR{alpha}/RXR{alpha}) in the induction of hiNOS by RA.

  19. DNase I hypersensitivity sites and nuclear protein binding on the fatty acid synthase gene: identification of an element with properties similar to known glucose-responsive elements.

    PubMed Central

    Foufelle, F; Lepetit, N; Bosc, D; Delzenne, N; Morin, J; Raymondjean, M; Ferré, P

    1995-01-01

    We have shown previously that fatty acid synthase (FAS) gene expression is positively regulated by glucose in rat adipose tissue and liver. In the present study, we have identified in the first intron of the gene a sequence closely related to known glucose-responsive elements such as in the L-pyruvate kinase and S14 genes, including a putative upstream stimulatory factor/major late transcription factor (USF/MLTF) binding site (E-box) (+ 292 nt to + 297 nt). Location of this sequence corresponds to a site of hypersensitivity to DNase I which is present in the liver but not in the spleen. Moreover, using this information from a preliminary report of the present work, others have shown that a + 283 nt to + 303 nt sequence of the FAS gene can confer glucose responsiveness to a heterologous promoter. The protein binding to this region has been investigated in vitro by a combination of DNase I footprinting and gel-retardation experiments with synthetic oligonucleotides and known nuclear proteins. DNase I footprinting experiments using a + 161 nt to + 405 nt fragment of the FAS gene demonstrate that a region from + 290 nt to + 316 nt is protected by nuclear extracts from liver and spleen. This region binds two ubiquitous nuclear factors, USF/MLTF and the CAAT-binding transcription factor/nuclear factor 1 (CTF/NF1). Binding of these factors is similar in nuclear extracts from liver which does or does not express the FAS gene as observed for glucose-responsive elements in the L-pyruvate kinase and S14 genes. This suggests a posttranslational modification of a factor of the complex after glucose stimulation. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 PMID:7772036

  20. DNase I hypersensitivity sites and nuclear protein binding on the fatty acid synthase gene: identification of an element with properties similar to known glucose-responsive elements.

    PubMed

    Foufelle, F; Lepetit, N; Bosc, D; Delzenne, N; Morin, J; Raymondjean, M; Ferré, P

    1995-06-01

    We have shown previously that fatty acid synthase (FAS) gene expression is positively regulated by glucose in rat adipose tissue and liver. In the present study, we have identified in the first intron of the gene a sequence closely related to known glucose-responsive elements such as in the L-pyruvate kinase and S14 genes, including a putative upstream stimulatory factor/major late transcription factor (USF/MLTF) binding site (E-box) (+ 292 nt to + 297 nt). Location of this sequence corresponds to a site of hypersensitivity to DNase I which is present in the liver but not in the spleen. Moreover, using this information from a preliminary report of the present work, others have shown that a + 283 nt to + 303 nt sequence of the FAS gene can confer glucose responsiveness to a heterologous promoter. The protein binding to this region has been investigated in vitro by a combination of DNase I footprinting and gel-retardation experiments with synthetic oligonucleotides and known nuclear proteins. DNase I footprinting experiments using a + 161 nt to + 405 nt fragment of the FAS gene demonstrate that a region from + 290 nt to + 316 nt is protected by nuclear extracts from liver and spleen. This region binds two ubiquitous nuclear factors, USF/MLTF and the CAAT-binding transcription factor/nuclear factor 1 (CTF/NF1). Binding of these factors is similar in nuclear extracts from liver which does or does not express the FAS gene as observed for glucose-responsive elements in the L-pyruvate kinase and S14 genes. This suggests a posttranslational modification of a factor of the complex after glucose stimulation.

  1. Associations of Uric Acid with Polymorphisms in the δ-Aminolevulinic Acid Dehydratase, Vitamin D Receptor, and Nitric Oxide Synthase Genes in Korean Lead Workers

    PubMed Central

    Weaver, Virginia M.; Schwartz, Brian S.; Jaar, Bernard G.; Ahn, Kyu-Dong; Todd, Andrew C.; Lee, Sung-Soo; Kelsey, Karl T.; Silbergeld, Ellen K.; Lustberg, Mark E.; Parsons, Patrick J.; Wen, Jiayu; Lee, Byung-Kook

    2005-01-01

    Recent research suggests that uric acid may be nephrotoxic at lower levels than previously recognized and that it may be one mechanism for lead-related nephrotoxicity. Therefore, in understanding mechanisms for lead-related nephrotoxicity, it would be of value to determine whether genetic polymorphisms that are associated with renal outcomes in lead workers and/or modify associations between lead dose and renal function are also associated with uric acid and/or modify associations between lead dose and uric acid. We analyzed data on three such genetic polymorphisms: δ-aminolevulinic acid dehydratase (ALAD), endothelial nitric oxide synthase (eNOS), and the vitamin D receptor (VDR). Mean (± SD) tibia, blood, and dimercaptosuccinic acid–chelatable lead levels were 37.2 ± 40.4 μg/g bone mineral, 32.0± 15.0 g/dL, and 0.77± 0.86 μg/mg creatinine, respectively, in 798 current and former lead workers. Participants with the eNOS Asp allele had lower mean serum uric acid compared with those with the Glu/Glu genotype. Among older workers (age ≥ median of 40.6 years), ALAD genotype modified associations between lead dose and uric acid levels. Higher lead dose was significantly associated with higher uric acid in workers with the ALAD1-1 genotype; associations were in the opposite direction in participants with the variant ALAD1-2 genotype. In contrast, higher tibia lead was associated with higher uric acid in those with the variant VDR B allele; however, modification was dependent on participants with the bb genotype and high tibia lead levels. We conclude that genetic polymorphisms may modify uric acid mediation of lead-related adverse renal effects. PMID:16263504

  2. Increase in nervonic acid content in transformed yeast and transgenic plants by introduction of a Lunaria annua L. 3-ketoacyl-CoA synthase (KCS) gene.

    PubMed

    Guo, Yiming; Mietkiewska, Elzbieta; Francis, Tammy; Katavic, Vesna; Brost, Jennifer M; Giblin, Michael; Barton, Dennis L; Taylor, David C

    2009-03-01

    Nervonic acid is a Very Long-Chain Monounsaturated Fatty Acid (VLCMFA), 24:1 Delta15 (cis-tetracos-15-enoic acid) found in the seed oils of Lunaria annua, borage, hemp, Acer (Purpleblow maple) and Tropaeolum speciosum (Flame flower). However, of these, only the "money plant" (Lunaria annua L.) has been studied and grown sparingly for future development as a niche crop and the outlook has been disappointing. Therefore, our goal was to isolate and characterize strategic new genes for high nervonic acid production in Brassica oilseed crops. To this end, we have isolated a VLCMFA-utilizing 3-Keto-Acyl-CoA Synthase (KCS; fatty acid elongase; EC 2.3.1.86) gene from Lunaria annua and functionally expressed it in yeast, with the recombinant KCS protein able to catalyze the synthesis of several VLCMFAs, including nervonic acid. Seed-specific expression of the Lunaria KCS in Arabidopsis resulted in a 30-fold increase in nervonic acid proportions in seed oils, compared to the very low quantities found in the wild-type. Similar transgenic experiments using B. carinata as the host resulted in a 7-10 fold increase in seed oil nervonic acid proportions. KCS enzyme activity assays indicated that upon using (14)C-22:1-CoA as substrate, the KCS activity from developing seeds of transgenic B. carinata was 20-30-fold higher than the low erucoyl-elongation activity exhibited by wild type control plants. There was a very good correlation between the Lun KCS transcript intensity and the resultant 22:1-CoA KCS activity in developing seed. The highest nervonic acid level in transgenic B. carinata expressing the Lunaria KCS reached 30%, compared to 2.8% in wild type plant. In addition, the erucic acid proportions in these transgenic lines were considerably lower than that found in native Lunaria oil. These results show the functional utility of the Lunaria KCS in engineering new sources of high nervonate/reduced erucic oils in the Brassicaceae. PMID:19082744

  3. Proto-oncogene FBI-1 (Pokemon) and SREBP-1 Synergistically Activate Transcription of Fatty-acid Synthase Gene (FASN)*S⃞

    PubMed Central

    Choi, Won-Il; Jeon, Bu-Nam; Park, Hyejin; Yoo, Jung-Yoon; Kim, Yeon-Sook; Koh, Dong-In; Kim, Myung-Hwa; Kim, Yu-Ri; Lee, Choong-Eun; Kim, Kyung-Sup; Osborne, Timothy F.; Hur, Man-Wook

    2008-01-01

    FBI-1 (Pokemon/ZBTB7A) is a proto-oncogenic transcription factor of the BTB/POZ (bric-à-brac, tramtrack, and broad complex and pox virus zinc finger) domain family. Recent evidence suggested that FBI-1 might be involved in adipogenic gene expression. Coincidentally, expression of FBI-1 and fatty-acid synthase (FASN) genes are often increased in cancer and immortalized cells. Both FBI-1 and FASN are important in cancer cell proliferation. SREBP-1 is a major regulator of many adipogenic genes, and FBI-1 and SREBP-1 (sterol-responsive element (SRE)-binding protein 1) interact with each other directly via their DNA binding domains. FBI-1 enhanced the transcriptional activation of SREBP-1 on responsive promoters, pGL2-6x(SRE)-Luc and FASN gene. FBI-1 and SREBP-1 synergistically activate transcription of the FASN gene by acting on the proximal GC-box and SRE/E-box. FBI-1, Sp1, and SREBP-1 can bind to all three SRE, GC-box, and SRE/E-box. Binding competition among the three transcription factors on the GC-box and SRE/E-box appears important in the transcription regulation. FBI-1 is apparently changing the binding pattern of Sp1 and SREBP-1 on the two elements in the presence of induced SREBP-1 and drives more Sp1 binding to the proximal promoter with less of an effect on SREBP-1 binding. The changes induced by FBI-1 appear critical in the synergistic transcription activation. The molecular mechanism revealed provides insight into how proto-oncogene FBI-1 may attack the cellular regulatory mechanism of FASN gene expression to provide more phospholipid membrane components needed for rapid cancer cell proliferation. PMID:18682402

  4. Differential Expression of 1-Aminocyclopropane-1-Carboxylate Synthase Genes during Orchid Flower Senescence Induced by the Protein Phosphatase Inhibitor Okadaic Acid1

    PubMed Central

    Wang, Ning Ning; Yang, Shang Fa; Charng, Yee-yung

    2001-01-01

    Applying 10 pmol of okadaic acid (OA), a specific inhibitor of type 1 or type 2A serine/threonine protein phosphatases, to the orchid (Phalaenopsis species) stigma induced a dramatic increase in ethylene production and an accelerated senescence of the whole flower. Aminoethoxyvinylglycine or silver thiosulfate, inhibitors of ethylene biosynthesis or action, respectively, effectively inhibited the OA-induced ethylene production and retarded flower senescence, suggesting that the protein phosphatase inhibitor induced orchid flower senescence through an ethylene-mediated signaling pathway. OA treatment induced a differential expression pattern for the 1-aminocyclopropane-1-carboxylic acid synthase multigene family. Accumulation of Phal-ACS1 transcript in the stigma, labelum, and ovary induced by OA were higher than those induced by pollination as determined by “semiquantitative” reverse transcriptase-polymerase chain reaction. In contrast, the transcript levels of Phal-ACS2 and Phal-ACS3 induced by OA were much lower than those induced by pollination. Staurosporine, a protein kinase inhibitor, on the other hand, inhibited the OA-induced Phal-ACS1 expression in the stigma and delayed flower senescence. Our results suggest that a hyper-phosphorylation status of an unidentified protein(s) is involved in up-regulating the expression of Phal-ACS1 gene resulting in increased ethylene production and accelerated the senescence process of orchid flower. PMID:11351088

  5. Effects of bovine fatty acid synthase, stearoyl-coenzyme A desaturase, sterol regulatory element-binding protein 1, and growth hormone gene polymorphisms on fatty acid composition and carcass traits in Japanese Black cattle.

    PubMed

    Matsuhashi, T; Maruyama, S; Uemoto, Y; Kobayashi, N; Mannen, H; Abe, T; Sakaguchi, S; Kobayashi, E

    2011-01-01

    The quality of fat is an important factor in defining the quality of meat. Fat quality is determined by the composition of fatty acids. Among lipid metabolism-related genes, including fatty acid synthesis genes, several genetic variations have been reported in the bovine fatty acid synthase (FASN), stearoyl-CoA desaturase (SCD), sterol regulatory element-binding protein 1 (SREBP1), and GH genes. In the present study, we evaluated the single and epistatic effects of 5 genetic variations (4 SNP and 1 insertion/deletion) in 4 genes (FASN, SCD, SREBP1, and GH) on the fatty acid composition of the longissimus thoracis muscle and carcass and meat quality traits in 480 commercial Japanese Black cattle. Significant single effects of FASN, SCD, and GH(L127V) polymorphisms on the fatty acid composition of the longissimus thoracis muscle were detected. The A293V polymorphism of SCD had the largest effect on myristic acid (C14:0, P < 0.001), myristoleic acid (C14:1, P < 0.001), stearic acid (C18:0, P < 0.001), oleic acid (C18:1, P < 0.001), and MUFA (P < 0.001). Polymorphisms in the FASN, SCD, and SREBP1 genes showed no effect on any meat yield trait. There were no significant epistatic effects on fatty acid composition among pairs of the 3 genes (FASN, SCD, and SREBP1) involved in fatty acid synthesis. No epistatic interactions (P > 0.1) were detected between FASN and SCD for any carcass trait. When the genotypes of 3 markers (FASN, SCD, and GH(L127V)) were substituted from the lesser effect allele to the greater effect allele, the proportion of C18:1 increased by 4.46%. More than 20% of the genetic variance in the C18:1 level could be accounted for by these 3 genetic markers. The present results revealed that polymorphisms in 2 fatty acid synthesis genes (FASN and SCD) independently influenced fatty acid composition in the longissimus thoracis muscle. These results suggest that SNP in the FASN and SCD genes are useful markers for the improvement of fatty acid composition in

  6. Synergism in the effect of prior jasmonic acid application on herbivore-induced volatile emission by Lima bean plants: transcription of a monoterpene synthase gene and volatile emission.

    PubMed

    Menzel, Tila R; Weldegergis, Berhane T; David, Anja; Boland, Wilhelm; Gols, Rieta; van Loon, Joop J A; Dicke, Marcel

    2014-09-01

    Jasmonic acid (JA) plays a central role in induced plant defence e.g. by regulating the biosynthesis of herbivore-induced plant volatiles that mediate the attraction of natural enemies of herbivores. Moreover, exogenous application of JA can be used to elicit plant defence responses similar to those induced by biting-chewing herbivores and mites that pierce cells and consume their contents. In the present study, we used Lima bean (Phaseolus lunatus) plants to explore how application of a low dose of JA followed by minor herbivory by spider mites (Tetranychus urticae) affects transcript levels of P. lunatus (E)-β-ocimene synthase (PlOS), emission of (E)-β-ocimene and nine other plant volatiles commonly associated with herbivory. Furthermore, we investigated the plant's phytohormonal response. Application of a low dose of JA increased PlOS transcript levels in a synergistic manner when followed by minor herbivory for both simultaneous and sequential infestation. Emission of (E)-β-ocimene was also increased, and only JA, but not SA, levels were affected by treatments. Projection to latent structures-discriminant analysis (PLS-DA) of other volatiles showed overlap between treatments. Thus, a low-dose JA application results in a synergistic effect on gene transcription and an increased emission of a volatile compound involved in indirect defence after herbivore infestation.

  7. Synergism in the effect of prior jasmonic acid application on herbivore-induced volatile emission by Lima bean plants: transcription of a monoterpene synthase gene and volatile emission

    PubMed Central

    Menzel, Tila R.; Weldegergis, Berhane T.; David, Anja; Boland, Wilhelm; Gols, Rieta; van Loon, Joop J. A.; Dicke, Marcel

    2014-01-01

    Jasmonic acid (JA) plays a central role in induced plant defence e.g. by regulating the biosynthesis of herbivore-induced plant volatiles that mediate the attraction of natural enemies of herbivores. Moreover, exogenous application of JA can be used to elicit plant defence responses similar to those induced by biting-chewing herbivores and mites that pierce cells and consume their contents. In the present study, we used Lima bean (Phaseolus lunatus) plants to explore how application of a low dose of JA followed by minor herbivory by spider mites (Tetranychus urticae) affects transcript levels of P. lunatus (E)-β-ocimene synthase (PlOS), emission of (E)-β-ocimene and nine other plant volatiles commonly associated with herbivory. Furthermore, we investigated the plant’s phytohormonal response. Application of a low dose of JA increased PlOS transcript levels in a synergistic manner when followed by minor herbivory for both simultaneous and sequential infestation. Emission of (E)-β-ocimene was also increased, and only JA, but not SA, levels were affected by treatments. Projection to latent structures-discriminant analysis (PLS-DA) of other volatiles showed overlap between treatments. Thus, a low-dose JA application results in a synergistic effect on gene transcription and an increased emission of a volatile compound involved in indirect defence after herbivore infestation. PMID:25318119

  8. Geranyl diphosphate synthase molecules, and nucleic acid molecules encoding same

    DOEpatents

    Croteau, Rodney Bruce; Burke, Charles Cullen

    2008-06-24

    In one aspect, the present invention provides isolated nucleic acid molecules that each encode a geranyl diphosphate synthase protein, wherein each isolated nucleic acid molecule hybridizes to a nucleic acid molecule consisting of the sequence set forth in SEQ ID NO:1 under conditions of 5.times.SSC at 45.degree. C. for one hour. The present invention also provides isolated geranyl diphosphate synthase proteins, and methods for altering the level of expression of geranyl diphosphate synthase protein in a host cell.

  9. Chromosomal localization of the human and mouse hyaluronan synthase genes

    SciTech Connect

    Spicer, A.P.; McDonald, J.A.; Seldin, M.F.

    1997-05-01

    We have recently identified a new vertebrate gene family encoding putative hyaluronan (HA) synthases. Three highly conserved related genes have been identified, designated HAS1, HAS2, and HAS3 in humans and Has1, Has2, and Has3 in the mouse. All three genes encode predicted plasma membrane proteins with multiple transmembrane domains and approximately 25% amino acid sequence identity to the Streptococcus pyogenes HA synthase, HasA. Furthermore, expression of any one HAS gene in transfected mammalian cells leads to high levels of HA biosynthesis. We now report the chromosomal localization of the three HAS genes in human and in mouse. The genes localized to three different positions within both the human and the mouse genomes. HAS1 was localized to the human chromosome 19q13.3-q13.4 boundary and Has1 to mouse Chr 17. HAS2 was localized to human chromosome 8q24.12 and Has2 to mouse Chr 15. HAS3 was localized to human chromosome 16q22.1 and Has3 to mouse Chr 8. The map position for HAS1 reinforces the recently reported relationship between a small region of human chromosome 19q and proximal mouse chromosome 17. HAS2 mapped outside the predicted critical region delineated for the Langer-Giedion syndrome and can thus be excluded as a candidate gene for this genetic syndrome. 33 refs., 2 figs.

  10. Surrogate splicing for functional analysis of sesquiterpene synthase genes.

    PubMed

    Wu, Shuiqin; Schoenbeck, Mark A; Greenhagen, Bryan T; Takahashi, Shunji; Lee, Sungbeom; Coates, Robert M; Chappell, Joseph

    2005-07-01

    A method for the recovery of full-length cDNAs from predicted terpene synthase genes containing introns is described. The approach utilizes Agrobacterium-mediated transient expression coupled with a reverse transcription-polydeoxyribonucleotide chain reaction assay to facilitate expression cloning of processed transcripts. Subsequent expression of intronless cDNAs in a suitable prokaryotic host provides for direct functional testing of the encoded gene product. The method was optimized by examining the expression of an intron-containing beta-glucuronidase gene agroinfiltrated into petunia (Petunia hybrida) leaves, and its utility was demonstrated by defining the function of two previously uncharacterized terpene synthases. A tobacco (Nicotiana tabacum) terpene synthase-like gene containing six predicted introns was characterized as having 5-epi-aristolochene synthase activity, while an Arabidopsis (Arabidopsis thaliana) gene previously annotated as a terpene synthase was shown to possess a novel sesquiterpene synthase activity for alpha-barbatene, thujopsene, and beta-chamigrene biosynthesis. PMID:15965019

  11. Polymorphism and expression of isoflavone synthase genes from soybean cultivars.

    PubMed

    Kim, Hyo-Kyoung; Jang, Yun-Hee; Baek, Il-Sun; Lee, Jeong-Hwan; Park, Min Joo; Chung, Young-Soo; Chung, Jong-Il; Kim, Jeong-Kook

    2005-02-28

    Isoflavones are synthesized by isoflavone synthases via the phenylpropanoid pathway in legumes. We have cloned two isoflavone synthase genes, IFS1 and IFS2, from a total of 18 soybean cultivars. The amino acid residues of the proteins that differed between cultivars were dispersed over the entire coding region. However, amino acid sequence variation did not occur in conserved domains such as the ERR triad region, except that one conserved amino acid was changed in the IFS2 protein of the GS12 cultivar (R374G) and the IFS1 proteins of the 99M06 and Soja99s65 cultivars (A109T, F105I). In three cultivars (99M06, 99M116, and Simheukpi), most of amino acid changes were such that the difference between the amino acid sequences of IFS1 and IFS2 was reduced. The expression profiles of three enzymes that convert naringenin to the isoflavone, genistein, chalcone isomerase (CHI), isoflavone synthase (IFS) and flavanone 3-hydroxylase (F3H) were examined. In general, IFS mRNA was more abundant in etiolated seedlings than mature plants whereas the levels of CHI and F3H mRNAs were similar in the two stages. During seed development, IFS was expressed a little later than CHI and F3H but expression of these three genes was barely detectable, if at all, during later seed hardening. In addition, we found that the levels of CHI, F3H, and IFS mRNAs were under circadian control. We also showed that IFS was induced by wounding and by application of methyl jasmonate to etiolated soybean seedlings. PMID:15750342

  12. Identification of a 1-aminocyclopropane-1-carboxylic acid synthase gene linked to the female (F) locus that enhances female sex expression in cucumber.

    PubMed Central

    Trebitsh, T; Staub, J E; O'Neill, S D

    1997-01-01

    Sex determination in cucumber (Cucumis sativus L.) is controlled largely by three genes: F, m, and a. The F and m loci interact to produce monoecious (M_f_) or gynoecious (M_f_) sex phenotypes. Ethylene and factors that induce ethylene biosynthesis, such as 1-aminocyclopropane-1-carboxylate (ACC) and auxin, also enhance female sex expression. A genomic sequence (CS-ACS1) encoding ACC synthase was amplified from genomic DNA by a polymerase chain reaction using degenerate oligonucleotide primers. Expression of CS-ACS1 is induced by auxin, but not by ACC, in wounded and intact shoot apices. Southern blo hybridization analysis of near-isogenic gynoecious (MMFF) and monoecious (MMff) lines derived from divers genetic backgrounds revealed the existence of an additional ACC synthase (CS-ACS1G) genomic sequence in the gynoecious lines. Sex phenotype analysis of a segregating F2 population detected a 100% correlation between the CS-ACS1G marker and the presence of the F locus. The CS-ACS1G gene is located in linkage group B coincident with the F locus, and in the population tested there was no recombination between the CS-ACS1G gene and the F locus. Collectively, these data suggest that CS-ACS1G is closely linked to the F locus and may play a pivotal role in the determination of sex in cucumber flowers. PMID:9085580

  13. Effects and mechanism of acid rain on plant chloroplast ATP synthase.

    PubMed

    Sun, Jingwen; Hu, Huiqing; Li, Yueli; Wang, Lihong; Zhou, Qing; Huang, Xiaohua

    2016-09-01

    Acid rain can directly or indirectly affect plant physiological functions, especially photosynthesis. The enzyme ATP synthase is the key in photosynthetic energy conversion, and thus, it affects plant photosynthesis. To clarify the mechanism by which acid rain affects photosynthesis, we studied the effects of acid rain on plant growth, photosynthesis, chloroplast ATP synthase activity and gene expression, chloroplast ultrastructure, intracellular H(+) level, and water content of rice seedlings. Acid rain at pH 4.5 remained the chloroplast structure unchanged but increased the expression of six chloroplast ATP synthase subunits, promoted chloroplast ATP synthase activity, and increased photosynthesis and plant growth. Acid rain at pH 4.0 or less decreased leaf water content, destroyed chloroplast structure, inhibited the expression of six chloroplast ATP synthase subunits, decreased chloroplast ATP synthase activity, and reduced photosynthesis and plant growth. In conclusion, acid rain affected the chloroplast ultrastructure, chloroplast ATPase transcription and activity, and P n by changing the acidity in the cells, and thus influencing the plant growth and development. Finally, the effects of simulated acid rain on the test indices were found to be dose-dependent. PMID:27278067

  14. Effects and mechanism of acid rain on plant chloroplast ATP synthase.

    PubMed

    Sun, Jingwen; Hu, Huiqing; Li, Yueli; Wang, Lihong; Zhou, Qing; Huang, Xiaohua

    2016-09-01

    Acid rain can directly or indirectly affect plant physiological functions, especially photosynthesis. The enzyme ATP synthase is the key in photosynthetic energy conversion, and thus, it affects plant photosynthesis. To clarify the mechanism by which acid rain affects photosynthesis, we studied the effects of acid rain on plant growth, photosynthesis, chloroplast ATP synthase activity and gene expression, chloroplast ultrastructure, intracellular H(+) level, and water content of rice seedlings. Acid rain at pH 4.5 remained the chloroplast structure unchanged but increased the expression of six chloroplast ATP synthase subunits, promoted chloroplast ATP synthase activity, and increased photosynthesis and plant growth. Acid rain at pH 4.0 or less decreased leaf water content, destroyed chloroplast structure, inhibited the expression of six chloroplast ATP synthase subunits, decreased chloroplast ATP synthase activity, and reduced photosynthesis and plant growth. In conclusion, acid rain affected the chloroplast ultrastructure, chloroplast ATPase transcription and activity, and P n by changing the acidity in the cells, and thus influencing the plant growth and development. Finally, the effects of simulated acid rain on the test indices were found to be dose-dependent.

  15. Identification and characterization of the Populus sucrose synthase gene family.

    PubMed

    An, Xinmin; Chen, Zhong; Wang, Jingcheng; Ye, Meixia; Ji, Lexiang; Wang, Jia; Liao, Weihua; Ma, Huandi

    2014-04-10

    In this study, we indentified 15 sucrose synthase (SS) genes in Populus and the results of RT-qPCR revealed that their expression patterns were constitutive and partially overlapping but diverse. The release of the most recent Populus genomic data in Phytozome v9.1 has revealed the largest SS gene family described to date, comprising 15 distinct members. This information will now enable the analysis of transcript expression profiles for those that have not been previously reported. Here, we performed a comprehensive analysis of SS genes in Populus by describing the gene structure, chromosomal location and phylogenetic relationship of each family member. A total of 15 putative SS gene members were identified in the Populus trichocarpa (Torr. & Gray) genome using the SS domain and amino acid sequences from Arabidopsis thaliana as a probe. A phylogenetic analysis indicated that the 15 members could be classified into four groups that fall into three major categories: dicots, monocots & dicots 1 (M & D 1), and monocots & dicots 2 (M & D 2). In addition, the 15 SS genes were found to be unevenly distributed on seven chromosomes. The two conserved domains (sucrose synthase and glycosyl transferase) were found in this family. Meanwhile, the expression profiles of all 15 gene members in seven different organs were investigated in Populus tomentosa (Carr.) by using RT-qPCR. Additional analysis indicated that the poplar SS gene family is also involved in response to water-deficit. The current study provides basic information that will assist in elucidating the functions of poplar SS family. PMID:24508272

  16. Modified cellulose synthase gene from 'Arabidopsis thaliana' confers herbicide resistance to plants

    SciTech Connect

    Somerville, Chris R.; Scieble, Wolf

    2000-10-11

    Cellulose synthase ('CS'), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl) phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  17. Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants

    DOEpatents

    Somerville, Chris R.; Scheible, Wolf

    2007-07-10

    Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  18. Tight linkage of genes that encode the two glutamate synthase subunits of Escherichia coli K-12.

    PubMed Central

    Lozoya, E; Sanchez-Pescador, R; Covarrubias, A; Vichido, I; Bolivar, F

    1980-01-01

    A hybrid deoxyribonucleic acid molecule, plasmid pRSP20, which was isolated from the Clarke and Carbon Escherichia coli gene bank, was shown to complement the gltB31 mutation, which affects the synthesis of glutamate synthase in E. coli strain PA340. We present evidence which demonstrates that plasmid pRSP20 carries an 8-megadalton E. coli chromosomal fragment, including the genes encoding the two unequal glutamate synthase subunits. Polypeptides with molecular weights of about 135,000 and 53,000, which comigrated with purified E. coli glutamate synthase subunit polypeptides and immunoprecipitated with antibodies to E. coli glutamate synthase, were synthesized by minicells carrying the pRSP20 plasmid. Images PMID:6107287

  19. Inhibition of de novo Palmitate Synthesis by Fatty Acid Synthase Induces Apoptosis in Tumor Cells by Remodeling Cell Membranes, Inhibiting Signaling Pathways, and Reprogramming Gene Expression

    PubMed Central

    Ventura, Richard; Mordec, Kasia; Waszczuk, Joanna; Wang, Zhaoti; Lai, Julie; Fridlib, Marina; Buckley, Douglas; Kemble, George; Heuer, Timothy S.

    2015-01-01

    Inhibition of de novo palmitate synthesis via fatty acid synthase (FASN) inhibition provides an unproven approach to cancer therapy with a strong biological rationale. FASN expression increases with tumor progression and associates with chemoresistance, tumor metastasis, and diminished patient survival in numerous tumor types. TVB-3166, an orally-available, reversible, potent, and selective FASN inhibitor induces apoptosis, inhibits anchorage-independent cell growth under lipid-rich conditions, and inhibits in-vivo xenograft tumor growth. Dose-dependent effects are observed between 20–200 nM TVB-3166, which agrees with the IC50 in biochemical FASN and cellular palmitate synthesis assays. Mechanistic studies show that FASN inhibition disrupts lipid raft architecture, inhibits biological pathways such as lipid biosynthesis, PI3K–AKT–mTOR and β-catenin signal transduction, and inhibits expression of oncogenic effectors such as c-Myc; effects that are tumor-cell specific. Our results demonstrate that FASN inhibition has anti-tumor activities in biologically diverse preclinical tumor models and provide mechanistic and pharmacologic evidence that FASN inhibition presents a promising therapeutic strategy for treating a variety of cancers, including those expressing mutant K-Ras, ErbB2, c-Met, and PTEN. The reported findings inform ongoing studies to link mechanisms of action with defined tumor types and advance the discovery of biomarkers supporting development of FASN inhibitors as cancer therapeutics. Research in context Fatty acid synthase (FASN) is a vital enzyme in tumor cell biology; the over-expression of FASN is associated with diminished patient prognosis and resistance to many cancer therapies. Our data demonstrate that selective and potent FASN inhibition with TVB-3166 leads to selective death of tumor cells, without significant effect on normal cells, and inhibits in vivo xenograft tumor growth at well-tolerated doses. Candidate biomarkers for

  20. Anthranilate synthase from Ruta graveolens. Duplicated AS alpha genes encode tryptophan-sensitive and tryptophan-insensitive isoenzymes specific to amino acid and alkaloid biosynthesis.

    PubMed Central

    Bohlmann, J; Lins, T; Martin, W; Eilert, U

    1996-01-01

    Anthranilate synthase (AS, EC 4.1.3.27) catalyzes the conversion of chorismate into anthranilate, the biosynthetic precursor of both tryptophan and numerous secondary metabolites, including inducible plant defense compounds. The higher plant Ruta graveolens produces tryptophan and elicitor-inducible, anthranilate-derived alkaloids by means of two differentially expressed nuclear genes for chloroplast-localized AS alpha subunits, AS alpha 1 and AS alpha 2. Mechanisms that partition chorismate between tryptophan and inducible alkaloids thus do not entail chloroplast/cytosol separation of AS isoenzymes and yet might involve differential feedback regulation of pathway-specific AS alpha subunits. The two AS alpha isoenzymes of R. graveolens were expressed as glutathione S-transferase fusion proteins in Escherichia coli deletion mutants defective in AS activity and were purified to homogeneity. Differential sensitivity of the transformed E. coli strains toward 5-methyltryptophan, a false-feedback inhibitor of AS, was demonstrated. Characterization of affinity-purified AS alpha isoenzymes revealed that the noninducible AS alpha 2 of R. graveolens is strongly feedback inhibited by 10 microns tryptophan. In contrast, the elicitor-inducible AS alpha 1 isoenzyme is only slightly affected even by tryptophan concentrations 10-fold higher than those observed in planta. These results are consistent with the hypothesis that chorismate flux into biosynthesis of tryptophan and defense-related alkaloid biosynthesis in R. graveolens is regulated at the site of AS alpha isoenzymes at both genetic and enzymatic levels. PMID:8787026

  1. Metabolic engineering of Pseudomonas putida for production of docosahexaenoic acid based on a myxobacterial PUFA synthase.

    PubMed

    Gemperlein, Katja; Zipf, Gregor; Bernauer, Hubert S; Müller, Rolf; Wenzel, Silke C

    2016-01-01

    Long-chain polyunsaturated fatty acids (LC-PUFAs) can be produced de novo via polyketide synthase-like enzymes known as PUFA synthases, which are encoded by pfa biosynthetic gene clusters originally discovered from marine microorganisms. Recently similar gene clusters were detected and characterized in terrestrial myxobacteria revealing several striking differences. As the identified myxobacterial producers are difficult to handle genetically and grow very slowly we aimed to establish heterologous expression platforms for myxobacterial PUFA synthases. Here we report the heterologous expression of the pfa gene cluster from Aetherobacter fasciculatus (SBSr002) in the phylogenetically distant model host bacteria Escherichia coli and Pseudomonas putida. The latter host turned out to be the more promising PUFA producer revealing higher production rates of n-6 docosapentaenoic acid (DPA) and docosahexaenoic acid (DHA). After several rounds of genetic engineering of expression plasmids combined with metabolic engineering of P. putida, DHA production yields were eventually increased more than threefold. Additionally, we applied synthetic biology approaches to redesign and construct artificial versions of the A. fasciculatus pfa gene cluster, which to the best of our knowledge represents the first example of a polyketide-like biosynthetic gene cluster modulated and synthesized for P. putida. Combination with the engineering efforts described above led to a further increase in LC-PUFA production yields. The established production platform based on synthetic DNA now sets the stage for flexible engineering of the complex PUFA synthase. PMID:26617065

  2. Structural and functional organization of the animal fatty acid synthase.

    PubMed

    Smith, Stuart; Witkowski, Andrzej; Joshi, Anil K

    2003-07-01

    The entire pathway of palmitate synthesis from malonyl-CoA in mammals is catalyzed by a single, homodimeric, multifunctional protein, the fatty acid synthase. Each subunit contains three N-terminal domains, the beta-ketoacyl synthase, malonyl/acetyl transferase and dehydrase separated by a structural core from four C-terminal domains, the enoyl reductase, beta-ketoacyl reductase, acyl carrier protein and thiosterase. The kinetics and specificities of the substrate loading reaction catalyzed by the malonyl/acetyl transferase, the condensation reaction catalyzed by beta-ketoacyl synthase and chain-terminating reaction catalyzed by the thioesterase ensure that intermediates do not leak off the enzyme, saturated chains exclusively are elongated and palmitate is released as the major product. Only in the fatty acid synthase dimer do the subunits adopt conformations that facilitate productive coupling of the individual reactions for fatty acid synthesis at the two acyl carrier protein centers. Introduction of a double tagging and dual affinity chromatographic procedure has permitted the engineering and isolation of heterodimeric fatty acid synthases carrying different mutations on each subunit. Characterization of these heterodimers, by activity assays and chemical cross-linking, has been exploited to map the functional topology of the protein. The results reveal that the two acyl carrier protein domains engage in substrate loading and condensation reactions catalyzed by the malonyl/acetyl transferase and beta-ketoacyl synthase domains of either subunit. In contrast, the reactions involved in processing of the beta-carbon atom, following each chain elongation step, together with the release of palmitate, are catalyzed by the cooperation of the acyl carrier protein with catalytic domains of the same subunit. These findings suggest a revised model for the fatty acid synthase in which the two polypeptides are oriented such that head-to-tail contacts are formed both between

  3. Plasticity and Evolution of (+)-3-Carene Synthase and (−)-Sabinene Synthase Functions of a Sitka Spruce Monoterpene Synthase Gene Family Associated with Weevil Resistance*

    PubMed Central

    Roach, Christopher R.; Hall, Dawn E.; Zerbe, Philipp; Bohlmann, Jörg

    2014-01-01

    The monoterpene (+)-3-carene is associated with resistance of Sitka spruce against white pine weevil, a major North American forest insect pest of pine and spruce. High and low levels of (+)-3-carene in, respectively, resistant and susceptible Sitka spruce genotypes are due to variation of (+)-3-carene synthase gene copy number, transcript and protein expression levels, enzyme product profiles, and enzyme catalytic efficiency. A family of multiproduct (+)-3-carene synthase-like genes of Sitka spruce include the three (+)-3-carene synthases, PsTPS-3car1, PsTPS-3car2, PsTPS-3car3, and the (−)-sabinene synthase PsTPS-sab. Of these, PsTPS-3car2 is responsible for the relatively higher levels of (+)-3-carene in weevil-resistant trees. Here, we identified features of the PsTPS-3car1, PsTPS-3car2, PsTPS-3car3, and PsTPS-sab proteins that determine different product profiles. A series of domain swap and site-directed mutations, supported by structural comparisons, identified the amino acid in position 596 as critical for product profiles dominated by (+)-3-carene in PsTPS-3car1, PsTPS-3car2, and PsTPS-3car3, or (−)-sabinene in PsTPS-sab. A leucine in this position promotes formation of (+)-3-carene, whereas phenylalanine promotes (−)-sabinene. Homology modeling predicts that position 596 directs product profiles through differential stabilization of the reaction intermediate. Kinetic analysis revealed position 596 also plays a role in catalytic efficiency. Mutations of position 596 with different side chain properties resulted in a series of enzymes with different product profiles, further highlighting the inherent plasticity and potential for evolution of alternative product profiles of these monoterpene synthases of conifer defense against insects. PMID:25016016

  4. [Intraspecific polymorphism of the sucrose synthase genes in Russian and Kazakhstan potato cultivars].

    PubMed

    Slugina, M A; Boris, K V; Kakimzhanova, A A; Kochieva, E Z

    2014-06-01

    In 12 different Russian and Kazakhstan potato cultivars, the polymorphism of the glycosyltransferase domain of the sucrose synthase gene was first examined, as well as the polymorphism of the sucrose synthase domain fragment of the same gene in the potato cultivars of Kazakhstan breed. It was demonstrated that the examined sequences contained point mutations, as well as insertions and deletions, including those not described earlier. Amino acid substitutions specific to heat- and drought-tolerant varieties were also identified and could be associated with the development of abiotic stress resistance. PMID:25715458

  5. Two anthranilate synthase genes in Arabidopsis: defense-related regulation of the tryptophan pathway.

    PubMed Central

    Niyogi, K K; Fink, G R

    1992-01-01

    Arabidopsis thaliana has two genes, ASA1 and ASA2, encoding the alpha subunit of anthranilate synthase, the enzyme catalyzing the first reaction in the tryptophan biosynthetic pathway. As a branchpoint enzyme in aromatic amino acid biosynthesis, anthranilate synthase has an important regulatory role. The sequences of the plant genes are homologous to their microbial counterparts. Both predicted proteins have putative chloroplast transit peptides at their amino termini and conserved amino acids involved in feedback inhibition by tryptophan. ASA1 and ASA2 cDNAs complement anthranilate synthase alpha subunit mutations in the yeast Saccharomyces cerevisiae and in Escherichia coli, confirming that both genes encode functional anthranilate synthase proteins. The distributions of ASA1 and ASA2 mRNAs in various parts of Arabidopsis plants are overlapping but nonidentical, and ASA1 mRNA is approximately 10 times more abundant in whole plants. Whereas ASA2 is expressed at a constitutive basal level, ASA1 is induced by wounding and bacterial pathogen infiltration, suggesting a novel role for ASA1 in the production of tryptophan pathway metabolites as part of an Arabidopsis defense response. Regulation of key steps in aromatic amino acid biosynthesis in Arabidopsis appears to involve differential expression of duplicated genes. PMID:1392592

  6. Producing a trimethylpentanoic acid using hybrid polyketide synthases

    DOEpatents

    Katz, Leonard; Fortman, Jeffrey L; Keasling, Jay D

    2014-10-07

    The present invention provides for a polyketide synthase (PKS) capable of synthesizing trimethylpentanoic acid. The present invention also provides for a host cell comprising the PKS and when cultured produces the trimethylpentanoic acid. The present invention also provides for a method of producing the trimethylpentanoic acid, comprising: providing a host cell of the present invention, and culturing said host cell in a suitable culture medium such that the trimethylpentanoic acid is produced, optionally isolating the trimethylpentanoic acid, and optionally, reducing the isolated trimethylpentanoic acid into a trimethylpentanol or an iso-octane.

  7. Differential expression of two genes for 1-aminocyclopropane-1-carboxylate synthase in tomato fruits

    SciTech Connect

    Olson, D.C.; White, J.A.; Edelman, L.; Kende, H. ); Harkins, R.N. )

    1991-06-15

    1-Aminocyclopropane-1-carboxylate synthase is the regulated enzyme in the biosynthetic pathway of the plant hormone ethylene. A full-length cDNA encoding this enzyme has been cloned from tomato fruits. The authors report here the complete nucleotide and derived amino acid sequences of a cDNA encoding a second isoform of ACC synthase from tomato fruits. The cDNAs coding for both isoforms contain highly conserved regions that are surrounded by regions of low homology, especially at the 5{prime} and 3{prime} ends. Gene-specific probes were constructed to examine the expression of transcripts encoding the two ACC synthase isoforms under two conditions of enhanced ethylene formation--namely, during fruit ripening and in response to mechanical stress (wounding). The level of mRNA encoding both isoforms, ACC synthase 1 and 2, increased during ripening. In contrast, wounding caused an increase in only the level of mRNA coding for ACC synthase 1. Blot analysis of genomic DNA digested with restriction enzymes confirmed that ACC synthase 1 and 2 are encoded by different genes.

  8. Cloning and nucleotide sequence of the gene coding for citrate synthase from a thermotolerant Bacillus sp.

    PubMed Central

    Schendel, F J; August, P R; Anderson, C R; Hanson, R S; Flickinger, M C

    1992-01-01

    The structural gene coding for citrate synthase from the gram-positive soil isolate Bacillus sp. strain C4 (ATCC 55182) capable of secreting acetic acid at pH 5.0 to 7.0 in the presence of dolime has been cloned from a genomic library by complementation of an Escherichia coli auxotrophic mutant lacking citrate synthase. The nucleotide sequence of the entire 3.1-kb HindIII fragment has been determined, and one major open reading frame was found coding for citrate synthase (ctsA). Citrate synthase from Bacillus sp. strain C4 was found to be a dimer (Mr, 84,500) with a subunit with an Mr of 42,000. The N-terminal sequence was found to be identical with that predicted from the gene sequence. The kinetics were best fit to a bisubstrate enzyme with an ordered mechanism. Bacillus sp. strain C4 citrate synthase was not activated by potassium chloride and was not inhibited by NADH, ATP, ADP, or AMP at levels up to 1 mM. The predicted amino acid sequence was compared with that of the E. coli, Acinetobacter anitratum, Pseudomonas aeruginosa, Rickettsia prowazekii, porcine heart, and Saccharomyces cerevisiae cytoplasmic and mitochondrial enzymes. PMID:1311544

  9. Characterization of a sabinene synthase gene from rough lemon (Citrus jambhiri).

    PubMed

    Kohzaki, Keisuke; Gomi, Kenji; Yamasaki-Kokudo, Yumiko; Ozawa, Rika; Takabayashi, Junji; Akimitsu, Kazuya

    2009-10-15

    We previously isolated two putative monoterpene synthase genes, RlemTPS1 and RlemTPS2, from rough lemon (Citrus jambhiri) and showed that gene expression of RlemTPS2 was induced by microbial attack. The protein product of RlemTPS2 was obtained using a prokaryotic expression system, and GC and GC-MS of monoterpene synthesis by RlemTPS2 determined that RlemTPS2 encodes a sabinene synthase. Sabinene has antifungal activity toward Alternaria alternata. Furthermore, site-directed mutagenesis identified one amino acid, Ile, located at the front of the metal ion binding motif as an important residue for the product specificity of sabinene synthase.

  10. Cloning and analysis of valerophenone synthase gene expressed specifically in lupulin gland of hop (Humulus lupulus L.).

    PubMed

    Okada, Y; Ito, K

    2001-01-01

    Resin and essential oil derived from hop (Humulus lupulus L.) cones are very important compounds for beer brewing, and they specifically accumulate in the lupulin gland of hop cones. In order to identify the genes responsible for the biosynthetic pathway of these compounds and use the identified genes for hop breeding using Marker Assisted Selection and transformation techniques, genes expressed specifically in the lupulin gland were cloned and sequenced. One of them was suggested to be similar to the chalcone synthase gene from the DNA sequence. The translation product of the gene had the activity of valerophenone synthase, which catalyzes a part of the synthesis reaction of alpha-acid and beta-acid. Northern analysis showed that the valerophenone synthase gene seemed to be expressed specifically in the lupulin gland.

  11. Cloning and analysis of valerophenone synthase gene expressed specifically in lupulin gland of hop (Humulus lupulus L.).

    PubMed

    Okada, Y; Ito, K

    2001-01-01

    Resin and essential oil derived from hop (Humulus lupulus L.) cones are very important compounds for beer brewing, and they specifically accumulate in the lupulin gland of hop cones. In order to identify the genes responsible for the biosynthetic pathway of these compounds and use the identified genes for hop breeding using Marker Assisted Selection and transformation techniques, genes expressed specifically in the lupulin gland were cloned and sequenced. One of them was suggested to be similar to the chalcone synthase gene from the DNA sequence. The translation product of the gene had the activity of valerophenone synthase, which catalyzes a part of the synthesis reaction of alpha-acid and beta-acid. Northern analysis showed that the valerophenone synthase gene seemed to be expressed specifically in the lupulin gland. PMID:11272819

  12. Nucleotide sequence variation of chitin synthase genes among ectomycorrhizal fungi and its potential use in taxonomy.

    PubMed Central

    Mehmann, B; Brunner, I; Braus, G H

    1994-01-01

    DNA sequences of single-copy genes coding for chitin synthases (UDP-N-acetyl-D-glucosamine:chitin 4-beta-N-acetylglucosaminyltransferase; EC 2.4.1.16) were used to characterize ectomycorrhizal fungi. Degenerate primers deduced from short, completely conserved amino acid stretches flanking a region of about 200 amino acids of zymogenic chitin synthases allowed the amplification of DNA fragments of several members of this gene family. Different DNA band patterns were obtained from basidiomycetes because of variation in the number and length of amplified fragments. Cloning and sequencing of the most prominent DNA fragments revealed that these differences were due to various introns at conserved positions. The presence of introns in basidiomycetous fungi therefore has a potential use in identification of genera by analyzing PCR-generated DNA fragment patterns. Analyses of the nucleotide sequences of cloned fragments revealed variations in nucleotide sequences from 4 to 45%. By comparison of the deduced amino acid sequences, the majority of the DNA fragments were identified as members of genes for chitin synthase class II. The deduced amino acid sequences from species of the same genus differed only in one amino acid residue, whereas identity between the amino acid sequences of ascomycetous and basidiomycetous fungi within the same taxonomic class was found to be approximately 43 to 66%. Phylogenetic analysis of the amino acid sequence of class II chitin synthase-encoding gene fragments by using parsimony confirmed the current taxonomic groupings. In addition, our data revealed a fourth class of putative zymogenic chitin synthesis. Images PMID:7944356

  13. Increased production of wax esters in transgenic tobacco plants by expression of a fatty acid reductase:wax synthase gene fusion.

    PubMed

    Aslan, Selcuk; Hofvander, Per; Dutta, Paresh; Sun, Chuanxin; Sitbon, Folke

    2015-12-01

    Wax esters are hydrophobic lipids consisting of a fatty acid moiety linked to a fatty alcohol with an ester bond. Plant-derived wax esters are today of particular concern for their potential as cost-effective and sustainable sources of lubricants. However, this aspect is hampered by the fact that the level of wax esters in plants generally is too low to allow commercial exploitation. To investigate whether wax ester biosynthesis can be increased in plants using transgenic approaches, we have here exploited a fusion between two bacterial genes together encoding a single wax ester-forming enzyme, and targeted the resulting protein to chloroplasts in stably transformed tobacco (Nicotiana benthamiana) plants. Compared to wild-type controls, transgenic plants showed both in leaves and stems a significant increase in the total level of wax esters, being eight-fold at the whole plant level. The profiles of fatty acid methyl ester and fatty alcohol in wax esters were related, and C16 and C18 molecules constituted predominant forms. Strong transformants displayed certain developmental aberrations, such as stunted growth and chlorotic leaves and stems. These negative effects were associated with an accumulation of fatty alcohols, suggesting that an adequate balance between formation and esterification of fatty alcohols is crucial for a high wax ester production. The results show that wax ester engineering in transgenic plants is feasible, and suggest that higher yields may become achieved in the near future.

  14. Identification of a novel gene coding for neoxanthin synthase from Solanum tuberosum.

    PubMed

    Al-Babili, S; Hugueney, P; Schledz, M; Welsch, R; Frohnmeyer, H; Laule, O; Beyer, P

    2000-11-24

    The polymerase chain reaction analysis of potato plants, transformed with capsanthin capsorubin synthase ccs, revealed the presence of a highly related gene. The cloned cDNA showed at the protein level 89.6% identity to CCS. This suggested that the novel enzyme catalyzes a mechanistically similar reaction. Such a reaction is represented by neoxanthin synthase (NXS), forming the xanthophyll neoxanthin, a direct substrate for abscisic acid formation. The function of the novel enzyme could be proven by transient expression in plant protoplasts and high performance liquid chromatography analysis. The cloned NXS was imported in vitro into plastids, the compartment of carotenoid biosynthesis.

  15. High diversity of polyketide synthase genes and the melanin biosynthesis gene cluster in Penicillium marneffei.

    PubMed

    Woo, Patrick C Y; Tam, Emily W T; Chong, Ken T K; Cai, James J; Tung, Edward T K; Ngan, Antonio H Y; Lau, Susanna K P; Yuen, Kwok-Yung

    2010-09-01

    Despite the unique phenotypic properties and clinical importance of Penicillium marneffei, the polyketide synthase genes in its genome have never been characterized. Twenty-three putative polyketide synthase genes and two putative polyketide synthase nonribosomal peptide-synthase hybrid genes were identified in the P. marneffei genome, a diversity much higher than found in other pathogenic thermal dimorphic fungi, such as Histoplasma capsulatum (one polyketide synthase gene) and Coccidioides immitis (10 polyketide synthase genes). These genes were evenly distributed on the phylogenetic tree with polyketide synthase genes of Aspergillus and other fungi, indicating that the high diversity was not a result of lineage-specific gene expansion through recent gene duplication. The melanin-biosynthesis gene cluster had gene order and orientations identical to those in the Talaromyces stipitatus (a teleomorph of Penicillium emmonsii) genome. Phylogenetically, all six genes of the melanin-biosynthesis gene cluster in P. marneffei were also most closely related to those in T. stipitatus, with high bootstrap supports. The polyketide synthase gene of the melanin-biosynthesis gene cluster (alb1) in P. marneffei was knocked down, which was accompanied by loss of melanin pigment production and reduced ornamentation in conidia. The survival of mice challenged with the alb1 knockdown mutant was significantly better than those challenged with wild-type P. marneffei (P < 0.005). The sterilizing doses of hydrogen peroxide, leading to a 50% reduction in survival of conidia, were 11 min for wild-type P. marneffei and 6 min for the alb1 knockdown mutant of P. marneffei, implying that the melanin-biosynthesis gene cluster contributed to virulence through decreased susceptibility to killing by hydrogen peroxide. PMID:20718860

  16. Cloning, sequencing, and expression of the gene for NADH-sensitive citrate synthase of Pseudomonas aeruginosa.

    PubMed Central

    Donald, L J; Molgat, G F; Duckworth, H W

    1989-01-01

    The structural gene for the allosteric citrate synthase of Pseudomonas aeruginosa has been cloned from a genomic library by using the Escherichia coli citrate synthase gene as a hybridization probe under conditions of reduced stringency. Subcloning of portions of the original 10-kilobase-pair (kbp) clone led to isolation of the structural gene, with its promoter, within a 2,083-bp length of DNA flanked by sites for KpnI and BamHI. The nucleotide sequence of this fragment is presented; the inferred amino acid sequence was 70 and 76% identical, respectively, with the citrate synthase sequences from E. coli and Acinetobacter anitratum, two other gram-negative bacteria. DEAE-cellulose chromatography of P. aeruginosa citrate synthase from an E. coli host harboring the cloned P. aeruginosa gene gave three peaks of activity. All three enzyme peaks had subunit molecular weights of 48,000; the proteins were identical by immunological criteria and very similar in kinetics of substrate saturation and NADH inhibition. Because the cloned gene contained only one open reading frame large enough to encode a polypeptide of such a size, the three peaks must represent different forms of the same protein. A portion of the cloned P. aeruginosa gene was used as a hybridization probe under stringent conditions to identify highly homologous sequences in genomic DNA of a second strain classified as P. aeruginosa and isolates of P. putida, P. stutzeri, and P. alcaligenes. When crude extracts of each of these four isolates were mixed with antiserum raised against purified P. aeruginosa citrate synthase, however, only the P. alcaligenes extract cross-reacted. Images PMID:2507528

  17. Mechanistic studies of 3-deoxy-D-manno-octulosonic acid 8-phosphate synthase

    SciTech Connect

    Dotson, G.D.; Woodard, R.W.

    1994-12-01

    The enzyme 3-deOXY-D-manno-octulosonic acid 8-phosphate synthase (KDO 8-P synthase) catalyses the condensation of arabinose 5-phosphate (A 5-P) with phosphoenolpyruvate (PEP) to give the unique eight-carbon acidic sugar 3-deoxy-D-nianno-octulosonic acid 8-phosphate (KDO 8-P) found only in gram-negative bacteria and required for lipid A maturation and cellular growth. The E. coli gene kdsA that encodes KDO 8-P synthase has been amplified by standard PCR methodologies. The synthetic gene, subcloned into the expression vector pT7-7 was used to infect E. coli BL 21 (DE 3). Purification of crude supernatant from this transformant on Q Sepharose yields >200 mg of near-homogeneous KDO 8-P synthase per liter of cell culture. To explore the mechanism of KDO 8-P synthase, we prepared (E)- and (Z)-(3{sup 2}H)PEP, (2-{sup 13}C)PEP, and (2-{sup 13}C,{sup 18}O)PEP chemically from the appropriately labeled 3-bromopyruvates by reaction with trimethylphosphite under Perkow reaction conditions. Our {sup 1}H-NMR analysis of the stereochemistry at C3 of the KDO 8-Ps, obtained by separate incubation of (E)- and (Z)-(3-{sup 2}H)PEP with A 5-P in the presence of KDO 8-P synthase, demonstrated that the reaction is stereospecific with respect to both the C3 of PEP and the C1 carbonyl of A 5-P. (Z)-(3-{sup 2}H)PEP gave predominantly (3S)-(3{sup 2}H)KDO 8-P and (E)-(3-{sup 2}H)PEP gave predominantly (3R)-(3{sup 2}H)KDO-8P, which indicates condensation of the si face of PEP upon the re face of A 5-P-an orientation analogous to that seen with the similar aldehyde Iyase DAH 7-P synthase. The fate of the enolic oxygen of (2-{sup 13}C, {sup 18}O)PEP, during the course of the KDO 8-P synthase-catalyzed reaction as monitored by both {sup 13}C- and {sup 31}P-NMR spectroscopy demonstrated that the inorganic phosphate (Pi) and not the KDO 8-P contained the {sup 18}O.

  18. Structural organization of the multifunctional animal fatty-acid synthase.

    PubMed

    Witkowski, A; Rangan, V S; Randhawa, Z I; Amy, C M; Smith, S

    1991-06-15

    The amino acid sequence of the multifunctional fatty-acid synthase has been examined to investigate the exact location of the seven functional domains. Good agreement in predicting the location of interdomain boundaries was obtained using three independent methods. First, the sites of limited proteolytic attack that give rise to relatively stable, large polypeptide fragments were identified; cryptic sites for protease attack at the subunit interface were unmasked by first dissociating the dimer into its component subunits. Second, polypeptide regions exhibiting higher-than-average rates of non-conservative mutation were identified. Third, the sizes of putative functional domains were compared with those of related monofunctional proteins that exhibit similar primary or secondary structure. Residues 1-406 were assigned to the oxoacyl synthase, residues 430-802 to the malonyl/acetyl transferase, residues 1630-1850 to the enoyl reductase, residues 1870-2100 to the oxyreductase, residues 2114-2190 to the acyl-carrier protein and residues 2200-2505 to the thioesterase. The 47-kDa transferase and 8-kDa acyl-carrier-protein domains, which are situated at opposite ends of the multifunctional subunit, were nevertheless isolated from tryptic digests as a non-covalently associated complex. Furthermore, a centrally located domain encompassing residues 1160-1545 was isolated as a nicked dimer. These findings, indicating that interactions between the head-to-tail juxtaposed subunits occur in both the polar and equatorial regions, are consistent with previously derived electron-micrograph images that show subunit contacts in these areas. The data permit refinement of the model for the fatty-acid synthase dimer and suggest that the malonyl/acetyl transferase and oxoacyl synthase of one subunit cooperate with the reductases, acyl carrier protein and thioesterase of the companion subunit in the formation of a center for fatty-acid synthesis.

  19. Evidence for a cyclic diguanylic acid-dependent cellulose synthase in plants.

    PubMed Central

    Amor, Y; Mayer, R; Benziman, M; Delmer, D

    1991-01-01

    Because numerous attempts to detect an activity for a cellulose synthase in plants have failed, we have taken a different approach toward detecting polypeptides involved in this process. The uniqueness of the structure and function of cyclic diguanylic acid (c-di-GMP) as an activator of the cellulose synthase of the bacterium Acetobacter xylinum makes it an attractive probe to use in a search for a c-di-GMP receptor that might be involved in the process in plants. Direct photolabeling with 32P-c-di-GMP has been used, therefore, to identify in plants two membrane polypeptides of 83 and 48 kD derived from cotton fibers that possess properties consistent with their being components of a c-di-GMP-dependent cellulose synthase. Based upon several criteria, the 48-kD species is proposed to be derived by proteolytic cleavage of the 83-kD polypeptide. Both polypeptides bind c-di-GMP with high affinity and specificity and show antigenic relatedness to the bacterial cellulose synthase, and the N-terminal sequence of the 48-kD polypeptide also indicates relatedness to the bacterial synthase. Ability to detect both cotton fiber polypeptides by photolabeling increases markedly in extracts derived from fibers entering the active phase of secondary wall cellulose synthesis. These results provide a basis for future work aimed at identifying and characterizing genes involved in cellulose synthesis in plants. PMID:1668373

  20. Virus-Induced Silencing of a Plant Cellulose Synthase Gene

    PubMed Central

    Burton, Rachel A.; Gibeaut, David M.; Bacic, Antony; Findlay, Kim; Roberts, Keith; Hamilton, Andrew; Baulcombe, David C.; Fincher, Geoffrey B.

    2000-01-01

    Specific cDNA fragments corresponding to putative cellulose synthase genes (CesA) were inserted into potato virus X vectors for functional analysis in Nicotiana benthamiana by using virus-induced gene silencing. Plants infected with one group of cDNAs had much shorter internode lengths, small leaves, and a “dwarf” phenotype. Consistent with a loss of cell wall cellulose, abnormally large and in many cases spherical cells ballooned from the undersurfaces of leaves, particularly in regions adjacent to vascular tissues. Linkage analyses of wall polysaccharides prepared from infected leaves revealed a 25% decrease in cellulose content. Transcript levels for at least one member of the CesA cellulose synthase gene family were lower in infected plants. The decrease in cellulose content in cell walls was offset by an increase in homogalacturonan, in which the degree of esterification of carboxyl groups decreased from ∼50 to ∼33%. The results suggest that feedback loops interconnect the cellular machinery controlling cellulose and pectin biosynthesis. On the basis of the phenotypic features of the infected plants, changes in wall composition, and the reduced abundance of CesA mRNA, we concluded that the cDNA fragments silenced one or more cellulose synthase genes. PMID:10810144

  1. Suppression of vascular smooth muscle cell responses induced by TNF-α in GM3 synthase gene transfected cells.

    PubMed

    Park, Sung-Suk; Kim, Wun-Jae; Moon, Sung-Kwon

    2011-01-01

    The natural accumulation of ganglioside GM3 (N-glycolylneuraminic acid) on atherosclerotic lesions is a common theory. The present study is the first to examine the effects of the GM3 synthase gene on the responses of vascular smooth muscle cells (VSMC) to tumor necrosis factor-α (TNF-α). We found that overexpression of the GM3 synthase gene inhibited DNA synthesis and ERK1/2 activity induced by TNF-α in VSMC, whereas the basal levels of DNA synthesis and ERK1/2 activity remained unchanged. In addition, GM3 synthase gene transfectants significantly reduced the migration and invasion of VSMC following TNF-α treatment, compared with empty vector transfectants. Furthermore, TNF-α-induced matrix metalloproteinase-9 (MMP-9) expression and promoter activity were also decreased in GM3 synthase gene transfectants. GM3 synthase gene expression markedly suppressed the TNF-α-stimulated transcriptional activity of activator protein-1 (AP-1) and nuclear factor-κB (NF-κB), which are the controlling factors of MMP-9 expression. Consistent with these results, the addition of anti-GM3 antibody into the GM3 synthase gene transfectants blocked inhibition of DNA synthesis, ERK1/2 activity, migration and invasion. Finally, GM3 synthase gene transfectants treated with anti-GM3 antibody reversed the suppression of MMP-9 expression by reducing AP-1 and NF-κB binding activity. These results suggest regulatory roles for the GM3 synthase gene in VSMC proliferation and migration during the formation of atherosclerotic lesions.

  2. [BIOINFORMATIC SEARCH AND PHYLOGENETIC ANALYSIS OF THE CELLULOSE SYNTHASE GENES OF FLAX (LINUM USITATISSIMUM)].

    PubMed

    Pydiura, N A; Bayer, G Ya; Galinousky, D V; Yemets, A I; Pirko, Ya V; Podvitski, T A; Anisimova, N V; Khotyleva, L V; Kilchevsky, A V; Blume, Ya B

    2015-01-01

    A bioinformatic search of sequences encoding cellulose synthase genes in the flax genome, and their comparison to dicots orthologs was carried out. The analysis revealed 32 cellulose synthase gene candidates, 16 of which are highly likely to encode cellulose synthases, and the remaining 16--cellulose synthase-like proteins (Csl). Phylogenetic analysis of gene products of cellulose synthase genes allowed distinguishing 6 groups of cellulose synthase genes of different classes: CesA1/10, CesA3, CesA4, CesA5/6/2/9, CesA7 and CesA8. Paralogous sequences within classes CesA1/10 and CesA5/6/2/9 which are associated with the primary cell wall formation are characterized by a greater similarity within these classes than orthologous sequences. Whereas the genes controlling the biosynthesis of secondary cell wall cellulose form distinct clades: CesA4, CesA7, and CesA8. The analysis of 16 identified flax cellulose synthase gene candidates shows the presence of at least 12 different cellulose synthase gene variants in flax genome which are represented in all six clades of cellulose synthase genes. Thus, at this point genes of all ten known cellulose synthase classes are identify in flax genome, but their correct classification requires additional research. PMID:26638491

  3. [BIOINFORMATIC SEARCH AND PHYLOGENETIC ANALYSIS OF THE CELLULOSE SYNTHASE GENES OF FLAX (LINUM USITATISSIMUM)].

    PubMed

    Pydiura, N A; Bayer, G Ya; Galinousky, D V; Yemets, A I; Pirko, Ya V; Podvitski, T A; Anisimova, N V; Khotyleva, L V; Kilchevsky, A V; Blume, Ya B

    2015-01-01

    A bioinformatic search of sequences encoding cellulose synthase genes in the flax genome, and their comparison to dicots orthologs was carried out. The analysis revealed 32 cellulose synthase gene candidates, 16 of which are highly likely to encode cellulose synthases, and the remaining 16--cellulose synthase-like proteins (Csl). Phylogenetic analysis of gene products of cellulose synthase genes allowed distinguishing 6 groups of cellulose synthase genes of different classes: CesA1/10, CesA3, CesA4, CesA5/6/2/9, CesA7 and CesA8. Paralogous sequences within classes CesA1/10 and CesA5/6/2/9 which are associated with the primary cell wall formation are characterized by a greater similarity within these classes than orthologous sequences. Whereas the genes controlling the biosynthesis of secondary cell wall cellulose form distinct clades: CesA4, CesA7, and CesA8. The analysis of 16 identified flax cellulose synthase gene candidates shows the presence of at least 12 different cellulose synthase gene variants in flax genome which are represented in all six clades of cellulose synthase genes. Thus, at this point genes of all ten known cellulose synthase classes are identify in flax genome, but their correct classification requires additional research.

  4. Eugenol synthase genes in floral scent variation in Gymnadenia species.

    PubMed

    Gupta, Alok K; Schauvinhold, Ines; Pichersky, Eran; Schiestl, Florian P

    2014-12-01

    Floral signaling, especially through floral scent, is often highly complex, and little is known about the molecular mechanisms and evolutionary causes of this complexity. In this study, we focused on the evolution of "floral scent genes" and the associated changes in their functions in three closely related orchid species of the genus Gymnadenia. We developed a benchmark repertoire of 2,571 expressed sequence tags (ESTs) in Gymnadenia odoratissima. For the functional characterization and evolutionary analysis, we focused on eugenol synthase, as eugenol is a widespread and important scent compound. We obtained complete coding complementary DNAs (cDNAs) of two copies of putative eugenol synthase genes in each of the three species. The proteins encoded by these cDNAs were characterized by expression and testing for activity in Escherichia coli. While G. odoratissima and Gymnadenia conopsea enzymes were found to catalyze the formation of eugenol only, the Gymnadenia densiflora proteins synthesize eugenol, as well as a smaller amount of isoeugenol. Finally, we showed that the eugenol and isoeugenol producing gene copies of G. densiflora are evolutionarily derived from the ancestral genes of the other species producing only eugenol. The evolutionary switch from production of one to two compounds evolved under relaxed purifying selection. In conclusion, our study shows the molecular bases of eugenol and isoeugenol production and suggests that an evolutionary transition in a single gene can lead to an increased complexity in floral scent emitted by plants.

  5. Cloning and nucleotide sequence of the gene coding for citrate synthase from a thermotolerant Bacillus sp

    SciTech Connect

    Schendel, F.J.; August, P.R.; Anderson, C.R.; Flickinger, M.C. ); Hanson, R.S. )

    1992-01-01

    Acetate salts are emerging as potentially attractive bulk chemicals for a variety of environmental applications, for example, as catalysts to facilitate combustion of high-sulfur coal by electrical utilities and as the biodegradable noncorrosive highway deicing salt calcium magnesium acetate. The structural gene coding for citrate synthase from the gram-positive soil isolate Bacillus sp. strain C4 (ATCC 55182) capable of secreting acetic acid at pH 5.0 to 7.0 in the presence of dolime has been cloned from a genomic library by complementation of an Escherichia coli auxotrophic mutant lacking citrate synthase. The nucleotide sequence of the entire 3.1-kb HindIII fragment has been determined, and one major open reading frame was found coding for citrate synthase (ctsA). Citrate synthase from Bacillus sp. strain C4 was found to be a dimer (M{sub r}, 84,500) with a sub unit with an M{sub r} of 42,000. The N-terminal sequence was found to be identical with that predicted from the gene sequence. The kinetics were best fit to a bisubstrate enzyme with an ordered mechanism. Bacillus sp. strain C4 citrate synthase was not activated by potassium chloride and was not inhibited by NADH, ATP, ADP, or AMP at levels up to 1 mM. The predicted amino acid sequence was compared with that of the E. coli, Acinetobacter anitratum, Pseudomonas aeruginosa, Rickettsia prowazekii, porcine heart, and Saccharomyces cerevisiae cytoplasmic and mitochondrial enzymes.

  6. Arabidopsis MYC2 Interacts with DELLA Proteins in Regulating Sesquiterpene Synthase Gene Expression[W][OA

    PubMed Central

    Hong, Gao-Jie; Xue, Xue-Yi; Mao, Ying-Bo; Wang, Ling-Jian; Chen, Xiao-Ya

    2012-01-01

    Arabidopsis thaliana flowers emit volatile terpenes, which may function in plant–insect interactions. Here, we report that Arabidopsis MYC2, a basic helix-loop-helix transcription factor, directly binds to promoters of the sesquiterpene synthase genes TPS21 and TPS11 and activates their expression. Expression of TPS21 and TPS11 can be induced by the phytohormones gibberellin (GA) and jasmonate (JA), and both inductions require MYC2. The induction of TPS21 and TPS11 results in increased emission of sesquiterpene, especially (E)-β-caryophyllene. DELLAs, the GA signaling repressors, negatively affect sesquiterpene biosynthesis, as the sesquiterpene synthase genes were repressed in plants overaccumulating REPRESSOR OF GA1-3 (RGA), one of the Arabidopsis DELLAs, and upregulated in a penta DELLA-deficient mutant. Yeast two-hybrid and coimmunoprecipitation assays demonstrated that DELLAs, represented by RGA, directly interact with MYC2. In yeast cells, the N terminus of MYC2 was responsible for binding to RGA. MYC2 has been proposed as a major mediator of JA signaling and crosstalk with abscisic acid, ethylene, and light signaling pathways. Our results demonstrate that MYC2 is also connected to GA signaling in regulating a subset of genes. In Arabidopsis inflorescences, it integrates both GA and JA signals into transcriptional regulation of sesquiterpene synthase genes and promotes sesquiterpene production. PMID:22669881

  7. 7-deoxyloganetic acid synthase catalyzes a key 3 step oxidation to form 7-deoxyloganetic acid in Catharanthus roseus iridoid biosynthesis.

    PubMed

    Salim, Vonny; Wiens, Brent; Masada-Atsumi, Sayaka; Yu, Fang; De Luca, Vincenzo

    2014-05-01

    Iridoids are key intermediates required for the biosynthesis of monoterpenoid indole alkaloids (MIAs), as well as quinoline alkaloids. Although most iridoid biosynthetic genes have been identified, one remaining three step oxidation required to form the carboxyl group of 7-deoxyloganetic acid has yet to be characterized. Here, it is reported that virus-induced gene silencing of 7-deoxyloganetic acid synthase (7DLS, CYP76A26) in Catharanthus roseus greatly decreased levels of secologanin and the major MIAs, catharanthine and vindoline in silenced leaves. Functional expression of this gene in Saccharomyces cerevisiae confirmed its function as an authentic 7DLS that catalyzes the 3 step oxidation of iridodial-nepetalactol to form 7-deoxyloganetic acid. The identification of CYP76A26 removes a key bottleneck for expression of iridoid and related MIA pathways in various biological backgrounds.

  8. 7-deoxyloganetic acid synthase catalyzes a key 3 step oxidation to form 7-deoxyloganetic acid in Catharanthus roseus iridoid biosynthesis.

    PubMed

    Salim, Vonny; Wiens, Brent; Masada-Atsumi, Sayaka; Yu, Fang; De Luca, Vincenzo

    2014-05-01

    Iridoids are key intermediates required for the biosynthesis of monoterpenoid indole alkaloids (MIAs), as well as quinoline alkaloids. Although most iridoid biosynthetic genes have been identified, one remaining three step oxidation required to form the carboxyl group of 7-deoxyloganetic acid has yet to be characterized. Here, it is reported that virus-induced gene silencing of 7-deoxyloganetic acid synthase (7DLS, CYP76A26) in Catharanthus roseus greatly decreased levels of secologanin and the major MIAs, catharanthine and vindoline in silenced leaves. Functional expression of this gene in Saccharomyces cerevisiae confirmed its function as an authentic 7DLS that catalyzes the 3 step oxidation of iridodial-nepetalactol to form 7-deoxyloganetic acid. The identification of CYP76A26 removes a key bottleneck for expression of iridoid and related MIA pathways in various biological backgrounds. PMID:24594312

  9. The type I fatty acid and polyketide synthases: a tale of two megasynthases

    PubMed Central

    Tsai, Shiou-Chuan

    2008-01-01

    This review chronicles the synergistic growth of the fields of fatty acid and polyketide synthesis over the last century. In both animal fatty acid synthases and modular polyketide synthases, similar catalytic elements are covalently linked in the same order in megasynthases. Whereas in fatty acid synthases the basic elements of the design remain immutable, guaranteeing the faithful production of saturated fatty acids, in the modular polyketide synthases, the potential of the basic design has been exploited to the full for the elaboration of a wide range of secondary metabolites of extraordinary structural diversity. PMID:17898897

  10. The type I fatty acid and polyketide synthases: a tale of two megasynthases.

    PubMed

    Smith, Stuart; Tsai, Shiou-Chuan

    2007-10-01

    This review chronicles the synergistic growth of the fields of fatty acid and polyketide synthesis over the last century. In both animal fatty acid synthases and modular polyketide synthases, similar catalytic elements are covalently linked in the same order in megasynthases. Whereas in fatty acid synthases the basic elements of the design remain immutable, guaranteeing the faithful production of saturated fatty acids, in the modular polyketide synthases, the potential of the basic design has been exploited to the full for the elaboration of a wide range of secondary metabolites of extraordinary structural diversity.

  11. Evolutionary Dynamics of the Cellulose Synthase Gene Superfamily in Grasses1[OPEN

    PubMed Central

    Schwerdt, Julian G.; Wright, Frank; Oehme, Daniel; Wagner, John M.; Shirley, Neil J.; Burton, Rachel A.; Schreiber, Miriam; Zimmer, Jochen; Marshall, David F.; Waugh, Robbie; Fincher, Geoffrey B.

    2015-01-01

    Phylogenetic analyses of cellulose synthase (CesA) and cellulose synthase-like (Csl) families from the cellulose synthase gene superfamily were used to reconstruct their evolutionary origins and selection histories. Counterintuitively, genes encoding primary cell wall CesAs have undergone extensive expansion and diversification following an ancestral duplication from a secondary cell wall-associated CesA. Selection pressure across entire CesA and Csl clades appears to be low, but this conceals considerable variation within individual clades. Genes in the CslF clade are of particular interest because some mediate the synthesis of (1,3;1,4)-β-glucan, a polysaccharide characteristic of the evolutionarily successful grasses that is not widely distributed elsewhere in the plant kingdom. The phylogeny suggests that duplication of either CslF6 and/or CslF7 produced the ancestor of a highly conserved cluster of CslF genes that remain located in syntenic regions of all the grass genomes examined. A CslF6-specific insert encoding approximately 55 amino acid residues has subsequently been incorporated into the gene, or possibly lost from other CslFs, and the CslF7 clade has undergone a significant long-term shift in selection pressure. Homology modeling and molecular dynamics of the CslF6 protein were used to define the three-dimensional dispositions of individual amino acids that are subject to strong ongoing selection, together with the position of the conserved 55-amino acid insert that is known to influence the amounts and fine structures of (1,3;1,4)-β-glucans synthesized. These wall polysaccharides are attracting renewed interest because of their central roles as sources of dietary fiber in human health and for the generation of renewable liquid biofuels. PMID:25999407

  12. A C. elegans Model for Mitochondrial Fatty Acid Synthase II: The Longevity-Associated Gene W09H1.5/mecr-1 Encodes a 2-trans-Enoyl-Thioester Reductase

    PubMed Central

    Gurvitz, Aner

    2009-01-01

    Our recognition of the mitochondria as being important sites of fatty acid biosynthesis is continuously unfolding, especially in light of new data becoming available on compromised fatty acid synthase type 2 (FASII) in mammals. For example, perturbed regulation of murine 17β-HSD8 encoding a component of the mitochondrial FASII enzyme 3-oxoacyl-thioester reductase is implicated in polycystic kidney disease. In addition, over-expression in mice of the Mecr gene coding for 2-trans-enoyl-thioester reductase, also of mitochondrial FASII, leads to impaired heart function. However, mouse knockouts for mitochondrial FASII have hitherto not been reported and, hence, there is a need to develop alternate metazoan models such as nematodes or fruit flies. Here, the identification of Caenorhabditis elegans W09H1.5/MECR-1 as a 2-trans-enoyl-thioester reductase of mitochondrial FASII is reported. To identify MECR-1, Saccharomyces cerevisiae etr1Δ mutant cells were employed that are devoid of mitochondrial 2-trans-enoyl-thioester reductase Etr1p. These yeast mutants fail to synthesize sufficient levels of lipoic acid or form cytochrome complexes, and cannot respire or grow on non-fermentable carbon sources. A mutant yeast strain ectopically expressing nematode mecr-1 was shown to contain reductase activity and resemble the self-complemented mutant strain for these phenotype characteristics. Since MECR-1 was not intentionally targeted for compartmentalization using a yeast mitochondrial leader sequence, this inferred that the protein represented a physiologically functional mitochondrial 2-trans-enoyl-thioester reductase. In accordance with published findings, RNAi-mediated knockdown of mecr-1 in C. elegans resulted in life span extension, presumably due to mitochondrial dysfunction. Moreover, old mecr-1(RNAi) worms had better internal organ appearance and were more mobile than control worms, indicating a reduced physiological age. This is the first report on RNAi work dedicated

  13. Isolation of the GFA1 gene encoding glucosamine-6-phosphate synthase of Sporothrix schenckii and its expression in Saccharomyces cerevisiae.

    PubMed

    Sánchez-López, Juan Francisco; González-Ibarra, Joaquín; Álvarez-Vargas, Aurelio; Milewski, Slawomir; Villagómez-Castro, Julio César; Cano-Canchola, Carmen; López-Romero, Everardo

    2015-06-01

    Glucosamine-6-phosphate synthase (GlcN-6-P synthase) is an essential enzyme involved in cell wall biogenesis that has been proposed as a strategic target for antifungal chemotherapy. Here we describe the cloning and functional characterization of Sporothrix schenckii GFA1 gene which was isolated from a genomic library of the fungus. The gene encodes a predicted protein of 708 amino acids that is homologous to GlcN-6-P synthases from other sources. The recombinant enzyme restored glucosamine prototrophy of the Saccharomyces cerevisiae gfa1 null mutant. Purification and biochemical analysis of the recombinant enzyme revealed some differences from the wild type enzyme, such as improved stability and less sensitivity to UDP-GlcNAc. The sensitivity of the recombinant enzyme to the selective inhibitor FMDP [N(3)-(4-methoxyfumaroyl)-l-2,3-diaminopropanoic acid] and other properties were similar to those previously reported for the wild type enzyme.

  14. Metabolic changes of Brassica rapa transformed with a bacterial isochorismate synthase gene.

    PubMed

    Simoh, Sanimah; Linthorst, Huub J M; Lefeber, Alfons W M; Erkelens, Cornelis; Kim, Hye Kyong; Choi, Young Hae; Verpoorte, Robert

    2010-12-15

    Metabolome analysis by 1-dimensional proton nuclear magnetic resonance (¹H NMR) coupled with multivariate data analysis was carried out in Brassica rapa plants transformed with a gene encoding bacterial isochorismate synthase (ICS). Partial least square-discrimination analysis (PLS-DA) on selected signals suggested that the resonances that were dominant in the transgenic plants corresponded to a glucosinolate (neoglucobrassicin), phenylpropanoids (sinapoyl malate, feruloyl malate, caffeoyl malate), organic acids (succinic acid and fumaric acid) and sugars (α- and β-glucose). In contrast, amino acids alanine threonine, valine, leucine were dominant in the untransformed controls. In addition, HPLC data showed that the transgenic plant accumulated salicylic acid (SA) at significantly higher levels than the control plants, whereas the phylloquinone levels were not affected. The results suggest that the expression of the bacterial isochorismate synthase gene in B. rapa does not affect fluxes into pathways to other groups of secondary metabolites through competition for the same precursor. On the contrary, the biosynthesis of isochorismate-derived products (SA) seems to induce the competitive pathways via phenylalanine (phenylpropanoids) and tryptophan (IAA and indole glucosinolates).

  15. Surrogate Splicing for Functional Analysis of Sesquiterpene Synthase Genes1[w

    PubMed Central

    Wu, Shuiqin; Schoenbeck, Mark A.; Greenhagen, Bryan T.; Takahashi, Shunji; Lee, Sungbeom; Coates, Robert M.; Chappell, Joseph

    2005-01-01

    A method for the recovery of full-length cDNAs from predicted terpene synthase genes containing introns is described. The approach utilizes Agrobacterium-mediated transient expression coupled with a reverse transcription-polydeoxyribonucleotide chain reaction assay to facilitate expression cloning of processed transcripts. Subsequent expression of intronless cDNAs in a suitable prokaryotic host provides for direct functional testing of the encoded gene product. The method was optimized by examining the expression of an intron-containing β-glucuronidase gene agroinfiltrated into petunia (Petunia hybrida) leaves, and its utility was demonstrated by defining the function of two previously uncharacterized terpene synthases. A tobacco (Nicotiana tabacum) terpene synthase-like gene containing six predicted introns was characterized as having 5-epi-aristolochene synthase activity, while an Arabidopsis (Arabidopsis thaliana) gene previously annotated as a terpene synthase was shown to possess a novel sesquiterpene synthase activity for α-barbatene, thujopsene, and β-chamigrene biosynthesis. PMID:15965019

  16. Dihydropteroate synthase gene mutations in Pneumocystis and sulfa resistance.

    PubMed

    Huang, Laurence; Crothers, Kristina; Atzori, Chiara; Benfield, Thomas; Miller, Robert; Rabodonirina, Meja; Helweg-Larsen, Jannik

    2004-10-01

    Pneumocystis pneumonia (PCP) remains a major cause of illness and death in HIV-infected persons. Sulfa drugs, trimethoprim-sulfamethoxazole (TMP-SMX) and dapsone are mainstays of PCP treatment and prophylaxis. While prophylaxis has reduced the incidence of PCP, its use has raised concerns about development of resistant organisms. The inability to culture human Pneumocystis, Pneumocystis jirovecii, in a standardized culture system prevents routine susceptibility testing and detection of drug resistance. In other microorganisms, sulfa drug resistance has resulted from specific point mutations in the dihydropteroate synthase (DHPS) gene. Similar mutations have been observed in P. jirovecii. Studies have consistently demonstrated a significant association between the use of sulfa drugs for PCP prophylaxis and DHPS gene mutations. Whether these mutations confer resistance to TMP-SMX or dapsone plus trimethoprim for PCP treatment remains unclear. We review studies of DHPS mutations in P. jirovecii and summarize the evidence for resistance to sulfamethoxazole and dapsone.

  17. Bacterial delta-aminolevulinic acid synthase activity is not essential for leghemoglobin formation in the soybean/Bradyrhizobium japonicum symbiosis

    SciTech Connect

    Guerinot, M.L.; Chelm, B.K.

    1986-03-01

    Previous studies of legume nodules have indicated that formation of the heme moiety of leghemoglobin is a function of the bacterial symbiont. The authors now show that a hemA mutant of Bradyrhizobium japonicum that cannot carry out the first step in heme biosynthesis forms fully effective nodules on soybeans. The bacterial mutant strain was constructed by first isolated the wild-type hemA gene encoding delta-aminolevulinic acid synthase (EC 2.3.1.37) from a cosmid library, using a fragment of the Rhizobium meliloti hemA gene as a hybridization probe. A deletion of the hemA gene region, generated in vitro, then was used to construct the analogous chromosomal mutation by gene-directed mutagenesis. The mutant strain had no delta-aminolevulinic acid synthase activity and was unable to grow in minimal medium unless delta-aminolevulinic acid was added. Despite its auxotrophy, the mutant strain incited nodules that appeared normal, contained heme, and were capable of high levels of acetylene reduction. These results rule out bacterial delta-aminolevulinic acid synthase activity as the exclusive source of delta-aminolevulinic acid for heme formation in soybean nodules.

  18. Homocysteine homeostasis in the rat is maintained by compensatory changes in cystathionine β-synthase, betaine-homocysteine methyltransferase, and phosphatidylethanolamine N-methyltransferase gene transcription occurring in response to maternal protein and folic acid intake during pregnancy and fat intake after weaning.

    PubMed

    Chmurzynska, Agata; Malinowska, Anna M

    2011-07-01

    The reactions of the methionine/homocysteine pathway are mediated by several enzymes, including phosphatidylethanolamine N-methyltransferase, cystathionine β-synthase, and betaine-homocysteine methyltransferase. Homocysteine homeostasis is regulated by these enzymes. We hypothesized here that the protein and folic acid content in the maternal diet affects methionine/homocysteine metabolism in the progeny. To test this hypothesis, pregnant rats were fed a diet with normal protein and normal folic acid levels (a modified casein-based AIN-93G diet), a protein-restricted and normal folic acid diet, a protein-restricted and folic acid-supplemented diet, or a normal protein and folic acid-supplemented diet. The progeny were fed either the modified AIN-93G diet or a high-fat lard-based diet. Progeny were analyzed for expression of the phosphatidylethanolamine N-methyltransferase, cystathionine β-synthase, and betaine-homocysteine methyltransferase genes in the liver and for serum homocysteine concentration. Interactions between prenatal and postnatal nutrition were also determined. The progeny of the dams fed the diets supplemented with folic acid showed decreased expression of all 3 genes (P < .001). An interaction effect between the protein and folic acid content in the maternal diet contributed to this down-regulation (P < .001), and the postweaning diet modified these effects. Serum homocysteine concentrations were approximately 15% higher in the male rats (P < .01), but neither prenatal nutrition nor the postweaning diet affected it significantly. We conclude that maternal diet during gestation has an important effect on the transcription level of these 3 genes, but changes in gene expression were not associated with significant changes in progeny homocysteine concentrations.

  19. Identification and characterization of two chitin synthase genes in African malaria mosquito, Anopheles gambiae

    PubMed Central

    Zhang, Xin; Zhang, Jianzhen; Park, Yoonseong; Zhu, Kun Yan

    2012-01-01

    Chitin synthase (CHS) represents an attractive target site for combating insect pests as insect growth and development are strictly dependent on precisely tuned chitin biosynthesis and this pathway is absent in humans and other vertebrates. Current knowledge on CHS in insects, especially their structures, functions, and regulations is still very limited. We report the identification and characterization of two chitin synthase genes, AgCHS1 and AgCHS2, in African malaria mosquito, Anopheles gambiae. AgCHS1 and AgCHS2 were predicted to encode proteins of 1,578 and 1,586 amino acid residues, respectively. Their deduced amino acid sequences show high similarities to other insect chitin synthases. Transcriptional analysis indicated that AgCHS1 was expressed in egg, larval, pupal and adult stages whereas AgCHS2 appeared to be expressed at relatively low levels, particularly during the larval stages as examined by reverse transcription (RT)-PCR and real-time quantitative PCR. Relatively high expression was detected in the carcass followed by the foregut and hindgut for AgCHS1, and the foregut (cardia included) followed by the midgut for AgCHS2. Fluorescence in situ hybridization (FISH) and immunohistochemical analysis revealed new information including the localization of the two enzymes in the ommatidia of the compound eyes, and AgCHS2 in the thoracic and abdominal inter-segmental regions of pupal integument. PMID:22683441

  20. Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

    PubMed

    Noar, Roslyn D; Daub, Margaret E

    2016-01-01

    Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity) for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity) to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that they may encode

  1. Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis

    PubMed Central

    Noar, Roslyn D.; Daub, Margaret E.

    2016-01-01

    Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity) for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity) to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that they may encode

  2. Cloning and characterisation of rosmarinic acid synthase from Melissa officinalis L.

    PubMed

    Weitzel, Corinna; Petersen, Maike

    2011-05-01

    Lemon balm (Melissa officinalis L.; Lamiaceae) is a well-known medicinal plant mainly due to two groups of compounds, the essential oil and the phenylpropanoid derivatives. The prominent phenolic compound is rosmarinic acid (RA), an ester of caffeic acid and 3,4-dihydroxyphenyllactic acid. RA shows a number of interesting biological activities. Rosmarinic acid synthase (RAS; 4-coumaroyl-CoA:hydroxyphenyllactic acid hydroxycinnamoyltransferase) catalyses the ester formation. Cell cultures of M. officinalis have been established in order to characterise the formation of RA in an important diploid medicinal plant. RAS activity as well as the expression of the RAS gene are closely correlated with the accumulation of RA in suspension cultures of M. officinalis. The RAS cDNA and gene (MoRAS) were isolated. The RAS gene was shown to be intron-free. MoRAS belongs to the BAHD superfamily of acyltransferases. Southern-blot analysis suggests the presence of only one RAS gene copy in the M. officinalis genome. The enzyme was characterised with respect to enzyme properties, substrate preferences and kinetic data in crude plant extracts and as heterologously synthesised protein from Escherichia coli. PMID:21354582

  3. Cloning and characterisation of rosmarinic acid synthase from Melissa officinalis L.

    PubMed

    Weitzel, Corinna; Petersen, Maike

    2011-05-01

    Lemon balm (Melissa officinalis L.; Lamiaceae) is a well-known medicinal plant mainly due to two groups of compounds, the essential oil and the phenylpropanoid derivatives. The prominent phenolic compound is rosmarinic acid (RA), an ester of caffeic acid and 3,4-dihydroxyphenyllactic acid. RA shows a number of interesting biological activities. Rosmarinic acid synthase (RAS; 4-coumaroyl-CoA:hydroxyphenyllactic acid hydroxycinnamoyltransferase) catalyses the ester formation. Cell cultures of M. officinalis have been established in order to characterise the formation of RA in an important diploid medicinal plant. RAS activity as well as the expression of the RAS gene are closely correlated with the accumulation of RA in suspension cultures of M. officinalis. The RAS cDNA and gene (MoRAS) were isolated. The RAS gene was shown to be intron-free. MoRAS belongs to the BAHD superfamily of acyltransferases. Southern-blot analysis suggests the presence of only one RAS gene copy in the M. officinalis genome. The enzyme was characterised with respect to enzyme properties, substrate preferences and kinetic data in crude plant extracts and as heterologously synthesised protein from Escherichia coli.

  4. Transcriptional regulation of human thromboxane synthase gene expression

    SciTech Connect

    Lee, K.D.; Baek, S.J.; Fleischer, T

    1994-09-01

    The human thromboxane synthase (TS) gene encodes a microsomal enzyme catalyzing the conversion of prostaglandin endoperoxide into thromboxane A{sub 2}(TxA{sub 2}), a potent inducer of vasoconstriction and platelet aggregation. A deficiency in platelet TS activity results in bleeding disorders, but the underlying molecular mechanism remains to be elucidated. Increased TxA{sub 2} has been associated with many pathophysiological conditions such as cardiovascular disease, pulmonary hypertension, pre-eclampsia, and thrombosis in sickle cell patients. Since the formation of TxA{sub 2} is dependent upon TS, the regulation of TS gene expression may presumably play a crucial role in vivo. Abrogation of the regulatory mechanism in TS gene expression might contribute, in part, to the above clinical manifestations. To gain insight into TS gene regulation, a 1.7 kb promoter of the human TS gene was cloned and sequenced. RNase protection assay and 5{prime} RACE protocols were used to map the transcription initiation site to nucleotide A, 30 bp downstream from a canonical TATA box. Several transcription factor binding sites, including AP-1, PU.1, and PEA3, were identified within this sequence. Transient expression studies in HL-60 cells transfected with constructs containing various lengths (0.2 to 5.5 kb) of the TS promoter/luciferase fusion gene indicated the presence of multiple repressor elements within the 5.5 kb TS promoter. However, a lineage-specific up-regulation of TS gene expression was observed in HL-60 cells induced by TPA to differentiate along the macrophage lineage. The increase in TS transcription was not detectable until 36 hr after addition of the inducer. These results suggest that expression of the human TS gene may be regulated by a mechanism involving repression and derepression of the TS promoter.

  5. Quinic acids from Aster caucasicus and from transgenic callus expressing a beta-amyrin synthase.

    PubMed

    Pecchia, Paola; Cammareri, Maria; Malafronte, Nicola; Consiglio, M Federica; Gualtieri, Maria Josefina; Conicella, Clara

    2011-11-01

    Several different classes of secondary metabolites, including flavonoids, triterpenoid saponins and quinic acid derivatives, are found in Aster spp. (Fam. Asteraceae). Several Aster compounds revealed biological as well as pharmacological activities. In this work, a phytochemical investigation of A. caucasicus evidenced the presence of quinic acid derivatives, as well as the absence of triterpene saponins. To combine in one species the production of different phytochemicals, including triterpenes, an Agrobacterium-mediated transformation of A. caucasicus was set up to introduce A. sedifolius beta-amyrin synthase (AsOXA1)-encoding gene under the control of the constitutive promoter CaMV35S. The quali-quantitative analysis of transgenic calli with ectopic expression of AsOXA1 showed, in one sample, a negligible amount of triterpene saponins combined with higher amount of quinic acid derivatives as compared with the wild type callus.

  6. Mechanism of the beta-ketoacyl synthase reaction catalyzed by the animal fatty acid synthase.

    PubMed

    Witkowski, Andrzej; Joshi, Anil K; Smith, Stuart

    2002-09-01

    The catalytic mechanism of the beta-ketoacyl synthase domain of the multifunctional fatty acid synthase has been investigated by a combination of mutagenesis, active-site titration, product analysis, and product inhibition. Neither the reactivity of the active-site Cys161 residue toward iodoacetamide nor the rate of unidirectional transfer of acyl moieties to Cys161 was significantly decreased by replacement of any of the conserved residues, His293, His331, or Lys326, with Ala. Decarboxylation of malonyl moieties in the fully-active Cys161Gln background generated equimolar amounts of acetyl-CoA and bicarbonate, rather than carbon dioxide, and was seriously compromised by replacement of any of the conserved basic residues. The ability of bicarbonate to inhibit decarboxylation of malonyl moieties in the Cys161Gln background was significantly reduced by replacement of His293 but less so by replacement of His331. The data are consistent with a reaction mechanism, in which the initial primer transfer reaction is promoted largely through a lowering of the pKa of the Cys161 thiol by a helix dipole effect and activation of the substrate thioester carbon atom by binding of the keto group in an oxyanion hole. The data also indicate that an activated water molecule is present at the active site that is required either for the rapid hydration of carbon dioxide, prior its release as bicarbonate or, alternatively, for an initial attack on the malonyl C3. In the alternative mechanism, a negatively-charged tetrahedral transition state could be generated, stabilized in part by interaction of His293 with the negatively charged oxygen at C3 and interaction of His331 with the negatively charged thioester carbonyl oxygen, that breaks down to generate bicarbonate directly. Finally, the carbanion at C2, attacks the electrophilic C1 of the primer, generating a second tetrahedral transition state, also stabilized through contacts with the oxyanion hole and His331, that breaks down to form

  7. Coexpressing Escherichia coli cyclopropane synthase with Sterculia foetida Lysophosphatidic acid acyltransferase enhances cyclopropane fatty acid accumulation.

    PubMed

    Yu, Xiao-Hong; Prakash, Richa Rawat; Sweet, Marie; Shanklin, John

    2014-01-01

    Cyclopropane fatty acids (CPAs) are desirable as renewable chemical feedstocks for the production of paints, plastics, and lubricants. Toward our goal of creating a CPA-accumulating crop, we expressed nine higher plant cyclopropane synthase (CPS) enzymes in the seeds of fad2fae1 Arabidopsis (Arabidopsis thaliana) and observed accumulation of less than 1% CPA. Surprisingly, expression of the Escherichia coli CPS gene resulted in the accumulation of up to 9.1% CPA in the seed. Coexpression of a Sterculia foetida lysophosphatidic acid acyltransferase (SfLPAT) increases CPA accumulation up to 35% in individual T1 seeds. However, seeds with more than 9% CPA exhibit wrinkled seed morphology and reduced size and oil accumulation. Seeds with more than 11% CPA exhibit strongly decreased seed germination and establishment, and no seeds with CPA more than 15% germinated. That previous reports suggest that plant CPS prefers the stereospecific numbering (sn)-1 position whereas E. coli CPS acts on sn-2 of phospholipids prompted us to investigate the preferred positions of CPS on phosphatidylcholine (PC) and triacylglycerol. Unexpectedly, in planta, E. coli CPS acts primarily on the sn-1 position of PC; coexpression of SfLPAT results in the incorporation of CPA at the sn-2 position of lysophosphatidic acid. This enables a cycle that enriches CPA at both sn-1 and sn-2 positions of PC and results in increased accumulation of CPA. These data provide proof of principle that CPA can accumulate to high levels in transgenic seeds and sets the stage for the identification of factors that will facilitate the movement of CPA from PC into triacylglycerol to produce viable seeds with additional CPA accumulation. PMID:24204024

  8. Differential expression of acetohydroxyacid synthase genes in sunflower plantlets and its response to imazapyr herbicide.

    PubMed

    Breccia, Gabriela; Vega, Tatiana; Felitti, Silvina A; Picardi, Liliana; Nestares, Graciela

    2013-07-01

    Acetohydroxyacid synthase (AHAS) catalyzes the first reaction in branch chain amino acids biosynthesis. This enzyme is the target of several herbicides, including all members of the imidazolinone family. Little is known about the expression of the three acetohydroxyacid synthase genes (ahas1, ahas2 and ahas3) in sunflower. The aim of this work was to evaluate ahas gene expression and AHAS activity in different tissues of sunflower plantlets. Three genotypes differing in imidazolinone resistance were evaluated, two of which carry an herbicide resistant-endowing mutation known as Ahasl1-1 allele. In vivo and in vitro AHAS activity and transcript levels were higher in leaves than in roots. The ahas3 transcript was the less abundant in both tissues. No significant difference was observed between ahas1 and ahas2 transcript levels of the susceptible genotype but a higher ahas1 transcript level was observed in leaves of genotypes carrying Ahasl1-1 allele. Similar transcript levels were found for ahas1 and ahas2 in roots of genotypes carrying Ahasl1-1 allele whereas higher ahas2 abundance was found in the susceptible genotype. Herbicide treatment triggered tissue-specific, gene and genotype-dependent changes in ahas gene expression. AHAS activity was highly inhibited in the susceptible genotype. Differential responses were observed between in vitro and in vivo AHAS inhibition assays. These findings enhance our understanding of AHAS expression in sunflower genotypes differing for herbicide resistance and its response to herbicide treatment.

  9. [Chitin Synthase 2 (CHS2) gene of Malassezia species].

    PubMed

    Kano, Rui

    2005-01-01

    Malassezia species have been recognized as members of the microbiological flora of human and animal skin; they are also considered to play an important role in the pathogenesis of folliculitis, atopic dermatitis and otitis externa. Therefore, the molecular characteristics were investigated to clarify the epidemiology and the pathogenesis of diseases associated with Malassezia species in human and animals. Molecular investigation was made of 105 clinical isolates of M. pachydermatis from dogs and cats by random amplification of polymorphic DNA (RAPD) and chitin synthase 2 (CHS2) gene sequence analyses. The RAPD analysis and CHS2 gene analysis indicated that clinical isolates of M. pachydermatis were divided into four distinct genetic types (A, B, C and D). Type A was isolated from lesions of atopic dermatitis, flea allergic dermatitis, otitis externa, pyoderma and seborrheic (dermatitidis) in dogs and cats, and might be predominant on this. The phylogenetic analysis of the nucleotide sequences of CHS2 gene fragments of standard strains of 11 Malassezia species showed 11 distinct clusters of this species. PMID:16094288

  10. Transcriptional regulation of the Arabidopsis thaliana chalcone synthase gene

    SciTech Connect

    Feinbaum, R.L.; Ausubel, F.M.

    1988-05-01

    The authors cloned an Arabiodpsis thaliana chalcone synthase (CHS) gene on the basis of cross-hybridization with a Petroselinum hortense CHS cDNA clone. The protein sequence deduced from the A. thaliana CHS DNA sequence is at least 85% homologous to the CHS sequences from P. hortense, Antirrhinum majus, and Petunia hybrida. Southern blot analysis indicated that CHS is a single-copy gene in A. thaliana. High-intensity light treatment of A. thaliana plants for 24 h caused a 50-fold increase in CHS enzyme activity and an accumulation of visibly detectable levels of anthocyanin pigments in the vegetative structures of these plants. A corresponding increase in the steady-state level of CHS mRNA was detected after high-intensity light treatment for the same period of time. The accumulation of CHS mRNA in response to high-intensity light was due, at least in part, to an increased rate of transcription of the CHS gene as demonstrated by nuclear runoff experiment.

  11. Three New Non-reducing Polyketide Synthase Genes from the Lichen-Forming Fungus Usnea longissima

    PubMed Central

    Wang, Yi; Wang, Juan; Cheong, Yong Hwa

    2014-01-01

    Usnea longissima has a long history of use as a traditional medicine. Several bioactive compounds, primarily belonging to the polyketide family, have been isolated from U. longissima. However, the genes for the biosynthesis of these compounds are yet to be identified. In the present study, three different types of non-reducing polyketide synthases (UlPKS2, UlPKS4, and UlPKS6) were identified from a cultured lichen-forming fungus of U. longissima. Phylogenetic analysis of product template domains showed that UlPKS2 and UlPKS4 belong to group IV, which includes the non-reducing polyketide synthases with an methyltransferase (MeT) domain that are involved in methylorcinol-based compound synthesis; UlPKS6 was found to belong to group I, which includes the non-reducing polyketide synthases that synthesize single aromatic ring polyketides, such as orsellinic acid. Reverse transcriptase-PCR analysis demonstrated that UlPKS2 and UlPKS4 were upregulated by sucrose; UlPKS6 was downregulated by asparagine, glycine, and alanine. PMID:24808732

  12. Amino acid sequence of a new mitochondrially synthesized proteolipid of the ATP synthase of Saccharomyces cerevisiae.

    PubMed Central

    Velours, J; Esparza, M; Hoppe, J; Sebald, W; Guerin, B

    1984-01-01

    The purification and the amino acid sequence of a proteolipid translated on ribosomes in yeast mitochondria is reported. This protein, which is a subunit of the ATP synthase, was purified by extraction with chloroform/methanol (2/1) and subsequent chromatography on phosphocellulose and reverse phase h.p.l.c. A mol. wt. of 5500 was estimated by chromatography on Bio-Gel P-30 in 80% formic acid. The complete amino acid sequence of this protein was determined by automated solid phase Edman degradation of the whole protein and of fragments obtained after cleavage with cyanogen bromide. The sequence analysis indicates a length of 48 amino acid residues. The calculated mol. wt. of 5870 corresponds to the value found by gel chromatography. This polypeptide contains three basic residues and no negatively charged side chain. The three basic residues are clustered at the C terminus. The primary structure of this protein is in full agreement with the predicted amino acid sequence of the putative polypeptide encoded by the mitochondrial aap1 gene recently discovered in Saccharomyces cerevisiae. Moreover, this protein shows 50% homology with the amino acid sequence of a putative polypeptide encoded by an unidentified reading frame also discovered near the mitochondrial ATPase subunit 6 gene in Aspergillus nidulans. Images Fig. 2. PMID:6323165

  13. Expression of fatty acid synthase in nonalcoholic fatty liver disease.

    PubMed

    Dorn, Christoph; Riener, Marc-Oliver; Kirovski, Georgi; Saugspier, Michael; Steib, Kathrin; Weiss, Thomas S; Gäbele, Erwin; Kristiansen, Glen; Hartmann, Arndt; Hellerbrand, Claus

    2010-01-01

    Nonalcoholic fatty liver disease (NAFLD) is characterized by hepatic lipid accumulation which starts with simple hepatic steatosis and may progress toward inflammation (nonalcoholic steatohepatitis [NASH]). Fatty acid synthase (FASN) catalyzes the last step in fatty acid biosynthesis, and thus, it is believed to be a major determinant of the maximal hepatic capacity to generate fatty acids by de novo lipogenesis. The aim of this study was to analyze the correlation between hepatic steatosis and inflammation with FASN expression. In vitro incubation of primary human hepatocytes with fatty acids dose-dependently induced cellular lipid-accumulation and FASN expression, while stimulation with TNF did not affect FASN levels. Further, hepatic FASN expression was significantly increased in vivo in a murine model of hepatic steatosis without significant inflammation but not in a murine NASH model as compared to control mice. Also, FASN expression was not increased in mice subjected to bile duct ligation, an experimental model characterized by severe hepatocellular damage and inflammation. Furthermore, FASN expression was analyzed in 102 human control or NAFLD livers applying tissue micro array technology and immunohistochemistry, and correlated significantly with the degree of hepatic steatosis, but not with inflammation or ballooning of hepatocytes. Quantification of FASN mRNA expression in human liver samples confirmed significantly higher FASN levels in hepatic steatosis but not in NASH, and expression of SREBP1, which is the main transcriptional regulator of FASN, paralleled FASN expression levels in human and experimental NAFLD. In conclusion, the transcriptional induction of FASN expression in hepatic steatosis is impaired in NASH, while hepatic inflammation in the absence of steatosis does not affect FASN expression, suggesting that FASN may serve as a new diagnostic marker or therapeutic target for the progression of NAFLD. PMID:20606731

  14. Primary structure of the dihydrofolate reductase-thymidylate synthase gene from Toxoplasma gondii.

    PubMed

    Roos, D S

    1993-03-25

    We have determined the primary genomic and cDNA sequences encoding the bifunctional dihydrofolate reductase-thymidylate synthase (DHFR-TS) enzyme of the protozoan parasite Toxoplasma gondii (dihydrofolate reductase, EC 1.5.1.3; thymidylate synthase EC 2.1.1.45). The DHFR-TS gene of T. gondii (strain RH) spans more than 6 kilobases of genomic DNA. Unlike the DHFR-TS genes of other protists, sequences encoding the Toxoplasma protein are interrupted by numerous intervening sequences. Analysis of processed T. gondii DHFR-TS cDNAs reveals a single open reading frame of 1830 nucleotides, predicting a 610-amino acid protein of molecular mass of 69 kilodaltons. Because its nucleotide composition and codon usage are roughly comparable to those observed in "higher" eukaryotes, the Toxoplasma DHFR-TS sequence is particularly useful for assessing evolutionary relationships between eukaryotic species. The predicted amino acid sequence for the DHFR-TS protein shows conservation of the major structural features identified in other DHFR and TS enzymes, while revealing certain differences which may be exploited for the design of novel antifolates for treatment of toxoplasmosis associated with AIDS.

  15. Human platelet/erythroleukemia cell prostaglandin G/H synthase: cDNA cloning, expression, and gene chromosomal assignment

    SciTech Connect

    Funk, C.D.; Funk, L.B.; Kennedy, M.E.; Pong, A.S.; Fitzgerald, G.A. )

    1991-06-01

    Platelets metabolize arachidonic acid to thromboxane A{sub 2}, a potent platelet aggregator and vasoconstrictor compound. The first step of this transformation is catalyzed by prostaglandin (PG) G/H synthase, a target site for nonsteroidal antiinflammatory drugs. We have isolated the cDNA for both human platelet and human erythroleukemia cell PGG/H synthase using the polymerase chain reaction and conventional screening procedures. The cDNA encoding the full-length protein was expressed in COS-M6 cells. Microsomal fractions from transfected cells produced prostaglandin endoperoxide derived products which were inhibited by indomethacin and aspirin. Mutagenesis of the serine residue at position 529, the putative aspirin acetylation site, to an asparagine reduced cyclooxygenase activity to barely detectable levels, an effect observed previously with the expressed sheep vesicular gland enzyme. Platelet-derived growth factor and phorbol ester differentially regulated the expression of PGG/H synthase mRNA levels in the megakaryocytic/platelet-like HEL cell line. The PGG/H synthase gene was assigned to chromosome 9 by analysis of a human-hamster somatic hybrid DNA panel. The availability of platelet PGG/H synthase cDNA should enhance our understanding of the important structure/function domains of this protein and it gene regulation.

  16. RNA interference-based gene silencing of phytoene synthase impairs growth, carotenoids, and plastid phenotype in Oncidium hybrid orchid.

    PubMed

    Liu, Jian-Xin; Chiou, Chung-Yi; Shen, Chin-Hui; Chen, Peng-Jen; Liu, Yao-Chung; Jian, Chin-Der; Shen, Xiao-Lan; Shen, Fu-Quan; Yeh, Kai-Wun

    2014-01-01

    Phytoene synthase (PSY) is the first rate-limiting regulatory enzyme in the carotenoid biosynthesis pathway. In order to modify the floral color pattern by reducing carotenoid contents, a phytoene synthase-RNAi construct was delivered into protocorm-like body (PLB) of Oncidium hybrid orchid. The transgenic orchids show down-regulated level of PSY and geranyl synthase gene. They displayed semi-dwarf phenotype and brilliant green leaves. The microscopic anatomy revealed development-arrested plastids with rare grana. The total carotenoid content was decreased and the efficiency of the photosynthetic electron transport was declined. The chlorophyll level and the expression of chlorophyll biosynthetic genes, such as OgGLUTR and OgCS were dramatically reduced. HPLC analysis showed that the endogenous level of gibberellic acid and abscisic acid in the dwarf transformants are 4-fold lower than in wild type plants. In addition, chilling tolerance of the transgenic Oncidium plants was reduced. The data showed that down-regulation of PSY resulted in alterations of gene expression in enzymes involved in many metabolic pathways, such as carotenoid, gibberellic acid, abscisic acid and chlorophyll biosynthetic pathway as well as causes predominant defects in plant growth and development. PMID:25221736

  17. The y1 gene of maize codes for phytoene synthase.

    PubMed

    Buckner, B; Miguel, P S; Janick-Buckner, D; Bennetzen, J L

    1996-05-01

    The cloned y1 locus of maize was sequenced and found to encode phytoene synthase. Different "wild-type" alleles of the locus were found to differ by the insertion of transposable elements in their promoter and polyA addition regions, and by the length of a CCA tandem repeat series, without any obvious effect on function of the gene. A dominant Y1 ("wild-type") allele was observed to be expressed at highest levels in the seedling but also in the embryo and endosperm. The Mu3 transposable element insertion responsible for a pastel allele of y1, which gives lowered levels of carotenoids in the endosperm of kernels and seedlings grown at high temperatures, was located in the 5' end of the gene. Although the size of the transcript from this y1 mutation suggests that the Mu3 element provides the promoter for this allele, leaf tissue in this mutant line contained approximately normal amounts of y1 mRNA. A recessive allele of y1, which conditions normal levels of carotenoids in the embryo and seedling, but almost no carotenoids in the endosperm, was found to accumulate normal amounts of y1 mRNA in the seedling and embryo, while y1 transcripts were not detected in the endosperm.

  18. Studies on tetrahydrocannabinolic acid synthase that produces the acidic precursor of tetrahydrocannabinol, the pharmacologically active cannabinoid in marijuana.

    PubMed

    Taura, F

    2009-06-01

    Tetrahydrocannabinol (THC), the psychoactive component of marijuana, is now regarded as a promising medicine because this cannabinoid has been shown to exert a variety of therapeutic activities. It has been demonstrated that THC is generated from the acidic precursor, tetrahydrocannabinolic acid (THCA) by nonenzymatic decarboxylation, and that THCA is biosynthesized by THCA synthase, which catalyzes a unique biosynthetic reaction, the stereospecific oxidative cyclization of the geranyl group of the substrate cannabigerolic acid. Molecular characterization of THCA synthase has revealed its structural characteristics and reaction mechanism. THCA synthase is the first cannabinoid synthase to be studied and is potentially attractive target for various biotechnological applications as it produces the direct precursor of THC. This review describes the research history of this enzyme, i.e., purification, molecular cloning, biochemical characterization, and possible biotechnological application of THCA synthase. PMID:22495534

  19. A gene from the cellulose synthase-like C family encodes a β-1,4 glucan synthase

    PubMed Central

    Cocuron, Jean-Christophe; Lerouxel, Olivier; Drakakaki, Georgia; Alonso, Ana P.; Liepman, Aaron H.; Keegstra, Kenneth; Raikhel, Natasha; Wilkerson, Curtis G.

    2007-01-01

    Despite the central role of xyloglucan (XyG) in plant cell wall structure and function, important details of its biosynthesis are not understood. To identify the gene(s) responsible for synthesizing the β-1,4 glucan backbone of XyG, we exploited a property of nasturtium (Tropaeolum majus) seed development. During the last stages of nasturtium seed maturation, a large amount of XyG is deposited as a reserve polysaccharide. A cDNA library was produced from mRNA isolated during the deposition of XyG, and partial sequences of 10,000 cDNA clones were determined. A single member of the C subfamily from the large family of cellulose synthase-like (CSL) genes was found to be overrepresented in the cDNA library. Heterologous expression of this gene in the yeast Pichia pastoris resulted in the production of a β-1,4 glucan, confirming that the CSLC protein has glucan synthase activity. The Arabidopsis CSLC4 gene, which is the gene with the highest sequence similarity to the nasturtium CSL gene, is coordinately expressed with other genes involved in XyG biosynthesis. These and other observations provide a compelling case that the CSLC gene family encode proteins that synthesize the XyG backbone. PMID:17488821

  20. Isolation of developing secondary xylem specific cellulose synthase genes and their expression profiles during hormone signalling in Eucalyptus tereticornis.

    PubMed

    Sundari, Balachandran Karpaga Raja; Dasgupta, Modhumita Ghosh

    2014-08-01

    Cellulose synthases (CesA) represent a group of β-1, 4 glycosyl transferases involved in cellulose biosynthesis. Recent reports in higher plants have revealed that two groups of CesA gene families exist, which are associated with either primary or secondary cell wall deposition. The present study aimed at identifying developing secondary xylem specific cellulose synthase genes from Eucalyptus tereticornis, a species predominantly used in paper and pulp industries in the tropics. The differential expression analysis of the three EtCesA genes using qRT-PCR revealed 49 to 87 fold relative expression in developing secondary xylem tissues. Three full length gene sequences of EtCesA1, EtCesA2 and EtCesA3 were isolated with the size of 2940, 3114 and 3123 bp, respectively. Phytohormone regulation of all three EtCesA genes were studied by exogenous application of gibberellic acid, naphthalene acetic acid, indole acetic acid and 2, 4-epibrassinolide in internode tissues derived from three-month-old rooted cuttings. All three EtCesA transcripts were upregulated by indole acetic acid and gibberellic acid. This study demonstrates that the increased cellulose deposition in the secondary wood induced by hormones can be attributed to the upregulation of xylem specific CesAs.

  1. Isolation of the Inositol Phosphoceramide Synthase Gene (AUR1) from Stress-Tolerant Yeast Pichia kudriavzevii.

    PubMed

    Yoo, Boung-Hyuk; Kim, Myoung-Dong

    2015-11-01

    This study is the first report of the entire nucleotide sequence of an inositol phosphoceramide synthase gene from the stress-tolerant yeast Pichia kudriavzevii (PkAUR1). Sequence analysis revealed an open reading frame that spans 1,443 bp and encodes a 480-amino-acid-residue protein with the highest sequence similarity (41.7%) to Aur1 from Spathaspora passalidarum. A phenotypic assay with transformed S. cerevisiae and P. kudriavzevii indicated that two amino acid residues, Phe166 and Gly249, play crucial roles in the resistance to aureobasidin A, which is consistent with previous reports for other fungal Aur1s. The GenBank Accession No. for PkAUR1 is KP729614. PMID:26323269

  2. All members in the sphingomyelin synthase gene family have ceramide phosphoethanolamine synthase activity[S

    PubMed Central

    Ding, Tingbo; Kabir, Inamul; Li, Yue; Lou, Caixia; Yazdanyar, Amirfarbod; Xu, Jiachen; Dong, Jibin; Zhou, Hongwen; Park, Taesik; Boutjdir, Mohamed; Li, Zhiqiang; Jiang, Xian-Cheng

    2015-01-01

    Sphingomyelin synthase-related protein (SMSr) synthesizes the sphingomyelin analog ceramide phosphoethanolamine (CPE) in cells. Previous cell studies indicated that SMSr is involved in ceramide homeostasis and is crucial for cell function. To further examine SMSr function in vivo, we generated Smsr KO mice that were fertile and had no obvious phenotypic alterations. Quantitative MS analyses of plasma, liver, and macrophages from the KO mice revealed only marginal changes in CPE and ceramide as well as other sphingolipid levels. Because SMS2 also has CPE synthase activity, we prepared Smsr/Sms2 double KO mice. We found that CPE levels were not significantly changed in macrophages, suggesting that CPE levels are not exclusively dependent on SMSr and SMS2 activities. We then measured CPE levels in Sms1 KO mice and found that Sms1 deficiency also reduced plasma CPE levels. Importantly, we found that expression of Sms1 or Sms2 in SF9 insect cells significantly increased not only SM but also CPE formation, indicating that SMS1 also has CPE synthase activity. Moreover, we measured CPE synthase Km and Vmax for SMS1, SMS2, and SMSr using different NBD ceramides. Our study reveals that all mouse SMS family members (SMSr, SMS1, and SMS2) have CPE synthase activity. However, neither CPE nor SMSr appears to be a critical regulator of ceramide levels in vivo. PMID:25605874

  3. The action of exogenous abscisic acid on malate-synthase synthesis in germinating castor-bean seeds.

    PubMed

    Dommes, J; Northcote, D H

    1985-12-01

    The presence of 30 μM abscisic acid inhibited development of malate-synthase activity in the endosperm of germinating castor-bean seeds. Malate synthase was purified from castor-bean endosperms and an antibody to it was prepared from rabbit serum. This antibody was used to measure the amounts of malate-synthase mRNA using an in-vitro translation system. The effect of abscisic acid appeared to be greater on malate-synthase mRNA than on the bulk of mRNA, indicating some specificity of abscisic-acid action. The extent of the inhibition of malate-synthase activity and of malate-synthase mRNA accumulation were similar. This indicates that abscisic acid inhibits malate-synthase activity by lowering levels of translatable malate-synthase mRNA rather than by affecting the translation rate of this mRNA.

  4. Cloning of galactinol synthase gene from Ammopiptanthus mongolicus and its expression in transgenic Photinia serrulata plants.

    PubMed

    Song, Jian; Liu, Jing; Weng, Manli; Huang, Yanyan; Luo, Lei; Cao, Pengxiu; Sun, Haiwei; Liu, Jie; Zhao, Jinhong; Feng, Dianqi; Wang, Bin

    2013-01-15

    A cold induced galactinol synthase gene (AmGS) and its promoter sequence were identified and cloned from the cold-tolerant tree Ammopiptanthus mongolicus by using cDNA-AFLP, RACE-PCR and TAIL-PCR strategies combined with its expression pattern analysis after cold inducing treatment. Accession number of the AmGS gene in GenBank is DQ519361. The open reading frame (ORF) region of the AmGS gene is 987 nucleotides encoding for 328 amino acid residues and a stop codon. The genomic DNA sequence of AmGS gene contains 3 exons and 2 introns. Moreover, a variety of temporal gene expression patterns of AmGS was detected, which revealed the up-regulation of AmGS gene in stresses of cold, ABA and others. Then the AmGS gene was transformed into Photinia serrulata tree by Agrobacterium-mediated transformation, and the transgenic plants exhibited higher cold-tolerance comparing with non-transformed plants.

  5. SUI-family genes encode phosphatidylserine synthases and regulate stem development in rice.

    PubMed

    Yin, Hengfu; Gao, Peng; Liu, Chengwu; Yang, Jun; Liu, Zhongchi; Luo, Da

    2013-01-01

    In vascular plants, the regulation of stem cell niche determines development of aerial shoot which consists of stems and lateral organs. Intercalary meristem (IM) controls internode elongation in rice and other grasses, however little attention has been paid to the underlying mechanism of stem cell maintenance. Here, we investigated the stem development in rice and showed that the Shortened Uppermost Internode 1 (SUI1) family of genes are pivotal for development of rice stems. We demonstrated that SUI-family genes regulate the development of IM for internode elongation and also the cell expansion of the panicle stem rachis in rice. The SUI-family genes encoded base-exchange types of phosphatidylserine synthases (PSSs), which possessed enzymatic activity in a yeast complementary assay. Overexpression of SUI1 and SUI2 caused outgrowths of internodes during vegetative development, and we showed that expression patterns of Oryza Sativa Homeobox 15 (OSH15) and Histone4 were impaired. Furthermore, genome-wide gene expression analysis revealed that overexpression and RNA knockdown of SUI-family genes affected downstream gene expression related to phospholipid metabolic pathways. Moreover, using Ultra-performance liquid chromatography-quadrupole time of flight-mass spectrometry, we analyzed PS contents in different genetic backgrounds of rice and showed that the quantity of very long chain fatty acids PS is affected by transgene of SUI-family genes. Our study reveals a new mechanism conveyed by the SUI1 pathway and provides evidence to link lipid metabolism with plant stem cell maintenance.

  6. Cloning and Characterization of a Squalene Synthase Gene from the Chaga Medicinal Mushroom, Inonotus obliquus (Agaricomycetes).

    PubMed

    Zhang, Panpan; Cao, Xiaoying; Li, Changgen; Zheng, Zhujun; Yong, Sun; Jiang, Ji-Hong

    2016-01-01

    Squalene synthase catalyzes the condensation of 2 molecules of farnesyl diphosphate to produce squalene, the first committed precursor for sterol, brassinosteroid, and triterpene biosynthesis. A squalene synthase gene, designated IoSQS, was isolated from Inonotus obliquus, a medicinal mushroom that produces a plethora of bioactive triterpenes. IoSQS complementary DNA was found to contain an open reading frame of 1476 bp, encoding a protein of 491 amino acids with a calculated molecular mass of 55.85 kDa. The IoSQS genomic DNA sequence consisted of 1813 bp and contained 4 exons and 3 introns. The restriction fragment polymorphisms revealed by Southern blot analysis suggested that IoSQS was a single-copy gene. Promoter analysis indicated that the 5' upstream region of IoSQS possessed various potential elements associated with physiological and environmental factors. The expression pattern of IoSQS in different stages and under methyl jasmonate treatment correlated with the accumulation of total triterpenoids and was consistent with the predicted results of the IoSQS promoter region. The N-terminal 466 residues of the hydrophilic sequence were expressed as a His-tagged protein in Escherichia coli, and the resultant bacterial crude extract was incubated with farnesyl diphosphate and NADPH. Squalene was detected in vitro in reaction mixture by high-performance liquid chromatography analysis. These results suggest that the IoSQS enzyme is involved in squalene production in I. obliquus. PMID:27649606

  7. Characterization of a non-reducing polyketide synthase gene from lichen Dirinaria applanata.

    PubMed

    Valarmathi, R; Hariharan, G N; Venkataraman, Gayatri; Parida, Ajay

    2009-04-01

    Lichens are known to produce a variety of secondary metabolites including polyketides that have diverse biological role(s). The biosynthesis of fungal polyketides is governed by type I polyketide synthases (PKS), enzymes with a multidomain structure, including the beta-ketoacyl synthase (KS), acyl transferase (AT), ketoreductase (KR), dehydratase (DH), enoyl reductase (ER) and acyl carrier protein (ACP) domains. Established soredial cultures of Dirinaria applanata (Fée) producing atranorin and divaricatic acid were used to characterize a polyketide synthase gene (DnPKS). A 743bp fragment corresponding to the ketosynthase domain (KS) was isolated using degenerate primers. Complete sequence information for DnPKS (8162bp) was obtained by walking in the 5'and 3' directions of the isolated KS domain using TAIL PCR. A translation of the DnPKS sequence identified the presence of KS, AT, two ACP and TE domains with eight intervening introns. TBLASTX analysis and comparison with other PKS sequences suggest that the coding region of DnPKS sequence is complete with the identification of putative start and stop codons and a stretch of 1226 upstream of the start codon corresponding to the putative promoter. This sequence shows the presence of putative binding sites for fungal transcription factors such as AflR, AreA and PacC. Southern blot analysis suggests that additional DnPKS-like genes may be present in the D. applanata genome. Additionally, expression of a DnPKS-like transcript was examined under different culture conditions and found to be down-regulated by sucrose and up-regulated by mannitol, UV and neutral pH. PMID:19427006

  8. Deletion of the trichodiene synthase gene of Fusarium venenatum: two systems for repeated gene deletions.

    PubMed

    Royer, J C; Christianson, L M; Yoder, W T; Gambetta, G A; Klotz, A V; Morris, C L; Brody, H; Otani, S

    1999-10-01

    The trichodiene synthase (tri5) gene of Fusarium venenatum was cloned from a genomic library. Vectors were created in which the tri5 coding sequence was replaced with the Neurospora crassa nitrate reductase (nit3) gene and with the Aspergillus nidulans acetamidase (amdS) gene flanked by direct repeats. The first vector was utilized to transform a nitrate reductase (niaD) mutant of F. venenatum to prototrophy, and the second vector was utilized to confer acetamide utilization to the wild-type strain. Several of the transformants lost the capacity to produce the trichothecene diacetoxyscirpenol and were shown by hybridization analysis to have gene replacements at the tri5 locus. The nit3 gene was removed by retransformation with a tri5 deletion fragment and selection on chlorate. The amdS gene was shown to excise spontaneously via the flanking direct repeats when spores were plated onto fluoroacetamide. PMID:10512673

  9. RNA Sequencing Revealed Numerous Polyketide Synthase Genes in the Harmful Dinoflagellate Karenia mikimotoi

    PubMed Central

    Kimura, Kei; Okuda, Shujiro; Nakayama, Kei; Shikata, Tomoyuki; Takahashi, Fumio; Yamaguchi, Haruo; Skamoto, Setsuko; Yamaguchi, Mineo; Tomaru, Yuji

    2015-01-01

    The dinoflagellate Karenia mikimotoi forms blooms in the coastal waters of temperate regions and occasionally causes massive fish and invertebrate mortality. This study aimed to elucidate the toxic effect of K. mikimotoi on marine organisms by using the genomics approach; RNA-sequence libraries were constructed, and data were analyzed to identify toxin-related genes. Next-generation sequencing produced 153,406 transcript contigs from the axenic culture of K. mikimotoi. BLASTX analysis against all assembled contigs revealed that 208 contigs were polyketide synthase (PKS) sequences. Thus, K. mikimotoi was thought to have several genes encoding PKS metabolites and to likely produce toxin-like polyketide molecules. Of all the sequences, approximately 30 encoded eight PKS genes, which were remarkably similar to those of Karenia brevis. Our phylogenetic analyses showed that these genes belonged to a new group of PKS type-I genes. Phylogenetic and active domain analyses showed that the amino acid sequence of four among eight Karenia PKS genes was not similar to any of the reported PKS genes. These PKS genes might possibly be associated with the synthesis of polyketide toxins produced by Karenia species. Further, a homology search revealed 10 contigs that were similar to a toxin gene responsible for the synthesis of saxitoxin (sxtA) in the toxic dinoflagellate Alexandrium fundyense. These contigs encoded A1–A3 domains of sxtA genes. Thus, this study identified some transcripts in K. mikimotoi that might be associated with several putative toxin-related genes. The findings of this study might help understand the mechanism of toxicity of K. mikimotoi and other dinoflagellates. PMID:26561394

  10. RNA Sequencing Revealed Numerous Polyketide Synthase Genes in the Harmful Dinoflagellate Karenia mikimotoi.

    PubMed

    Kimura, Kei; Okuda, Shujiro; Nakayama, Kei; Shikata, Tomoyuki; Takahashi, Fumio; Yamaguchi, Haruo; Skamoto, Setsuko; Yamaguchi, Mineo; Tomaru, Yuji

    2015-01-01

    The dinoflagellate Karenia mikimotoi forms blooms in the coastal waters of temperate regions and occasionally causes massive fish and invertebrate mortality. This study aimed to elucidate the toxic effect of K. mikimotoi on marine organisms by using the genomics approach; RNA-sequence libraries were constructed, and data were analyzed to identify toxin-related genes. Next-generation sequencing produced 153,406 transcript contigs from the axenic culture of K. mikimotoi. BLASTX analysis against all assembled contigs revealed that 208 contigs were polyketide synthase (PKS) sequences. Thus, K. mikimotoi was thought to have several genes encoding PKS metabolites and to likely produce toxin-like polyketide molecules. Of all the sequences, approximately 30 encoded eight PKS genes, which were remarkably similar to those of Karenia brevis. Our phylogenetic analyses showed that these genes belonged to a new group of PKS type-I genes. Phylogenetic and active domain analyses showed that the amino acid sequence of four among eight Karenia PKS genes was not similar to any of the reported PKS genes. These PKS genes might possibly be associated with the synthesis of polyketide toxins produced by Karenia species. Further, a homology search revealed 10 contigs that were similar to a toxin gene responsible for the synthesis of saxitoxin (sxtA) in the toxic dinoflagellate Alexandrium fundyense. These contigs encoded A1-A3 domains of sxtA genes. Thus, this study identified some transcripts in K. mikimotoi that might be associated with several putative toxin-related genes. The findings of this study might help understand the mechanism of toxicity of K. mikimotoi and other dinoflagellates. PMID:26561394

  11. The Cellulose Synthase Gene Superfamily and Biochemical Functions of Xylem-Specific Cellulose Synthase-Like Genes in Populus trichocarpa1[W][OA

    PubMed Central

    Suzuki, Shiro; Li, Laigeng; Sun, Ying-Hsuan; Chiang, Vincent L.

    2006-01-01

    Wood from forest trees modified for more cellulose or hemicelluloses could be a major feedstock for fuel ethanol. Xylan and glucomannan are the two major hemicelluloses in wood of angiosperms. However, little is known about the genes and gene products involved in the synthesis of these wood polysaccharides. Using Populus trichocarpa as a model angiosperm tree, we report here a systematic analysis in various tissues of the absolute transcript copy numbers of cellulose synthase superfamily genes, the cellulose synthase (CesA) and the hemicellulose-related cellulose synthase-like (Csl) genes. Candidate Csl genes were characterized for biochemical functions in Drosophila Schneider 2 (S2) cells. Of the 48 identified members, 37 were found expressed in various tissues. Seven CesA genes are xylem specific, suggesting gene networks for the synthesis of wood cellulose. Four Csl genes are xylem specific, three of which belong to the CslA subfamily. The more xylem-specific CslA subfamily is represented by three types of members: PtCslA1, PtCslA3, and PtCslA5. They share high sequence homology, but their recombinant proteins produced by the S2 cells exhibited distinct substrate specificity. PtCslA5 had no catalytic activity with the substrates for xylan or glucomannan. PtCslA1 and PtCslA3 encoded mannan synthases, but PtCslA1 further encoded a glucomannan synthase for the synthesis of (1→4)-β-d-glucomannan. The expression of PtCslA1 is most highly xylem specific, suggesting a key role for it in the synthesis of wood glucomannan. The results may help guide further studies to learn about the regulation of cellulose and hemicellulose synthesis in wood. PMID:16950861

  12. Chalcone synthase genes from milk thistle (Silybum marianum): isolation and expression analysis.

    PubMed

    Sanjari, Sepideh; Shobbar, Zahra Sadat; Ebrahimi, Mohsen; Hasanloo, Tahereh; Sadat-Noori, Seyed-Ahmad; Tirnaz, Soodeh

    2015-12-01

    Silymarin is a flavonoid compound derived from milk thistle (Silybum marianum) seeds which has several pharmacological applications. Chalcone synthase (CHS) is a key enzyme in the biosynthesis of flavonoids; thereby, the identification of CHS encoding genes in milk thistle plant can be of great importance. In the current research, fragments of CHS genes were amplified using degenerate primers based on the conserved parts of Asteraceae CHS genes, and then cloned and sequenced. Analysis of the resultant nucleotide and deduced amino acid sequences led to the identification of two different members of CHS gene family,SmCHS1 and SmCHS2. Third member, full-length cDNA (SmCHS3) was isolated by rapid amplification of cDNA ends (RACE), whose open reading frame contained 1239 bp including exon 1 (190 bp) and exon 2 (1049 bp), encoding 63 and 349 amino acids, respectively. In silico analysis of SmCHS3 sequence contains all the conserved CHS sites and shares high homology with CHS proteins from other plants.Real-time PCR analysis indicated that SmCHS1 and SmCHS3 had the highest transcript level in petals in the early flowering stage and in the stem of five upper leaves, followed by five upper leaves in the mid-flowering stage which are most probably involved in anthocyanin and silymarin biosynthesis.

  13. Acyl-carrier protein - Phosphopantetheinyltransferase partnerships in fungal fatty acid synthases

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The synthesis of fatty acids is an essential primary metabolic process for energy storage and cellular structural integrity. Assembly of saturated fatty acids is achieved by fatty acid synthases (FASs) that combine acetyl- and malonyl-CoAs by repetitive decarboxylative Claisen condensations with su...

  14. Para-aminobenzoic acid (PABA) synthase enhances thermotolerance of mushroom Agaricus bisporus.

    PubMed

    Lu, Zhonglei; Kong, Xiangxiang; Lu, Zhaoming; Xiao, Meixiang; Chen, Meiyuan; Zhu, Liang; Shen, Yuemao; Hu, Xiangyang; Song, Siyang

    2014-01-01

    Most mushrooms are thermo-sensitive to temperatures over 23°C, which greatly restricts their agricultural cultivation. Understanding mushroom's innate heat-tolerance mechanisms may facilitate genetic improvements of their thermotolerance. Agaricus bisporus strain 02 is a relatively thermotolerant mushroom strain, while strain 8213 is quite thermo-sensitive. Here, we compared their responses at proteomic level to heat treatment at 33°C. We identified 73 proteins that are differentially expressed between 02 and 8213 or induced upon heat stress in strain 02 itself, 48 of which with a known identity. Among them, 4 proteins are constitutively more highly expressed in 02 than 8213; and they can be further upregulated in response to heat stress in 02, but not in 8213. One protein is encoded by the para-aminobenzoic acid (PABA) synthase gene Pabs, which has been shown to scavenge the reactive oxygen species in vitro. Pabs mRNA and its chemical product PABA show similar heat stress induction pattern as PABA synthase protein and are more abundant in 02, indicating transcriptional level upregulation of Pabs upon heat stress. A specific inhibitor of PABA synthesis impaired thermotolerance of 02, while exogenous PABA or transgenic overexpression of 02 derived PABA synthase enhanced thermotolerance of 8213. Furthermore, compared to 8213, 02 accumulated less H2O2 but more defense-related proteins (e.g., HSPs and Chitinase) under heat stress. Together, these results demonstrate a role of PABA in enhancing mushroom thermotolerance by removing H2O2 and elevating defense-related proteins. PMID:24614118

  15. Para-aminobenzoic acid (PABA) synthase enhances thermotolerance of mushroom Agaricus bisporus.

    PubMed

    Lu, Zhonglei; Kong, Xiangxiang; Lu, Zhaoming; Xiao, Meixiang; Chen, Meiyuan; Zhu, Liang; Shen, Yuemao; Hu, Xiangyang; Song, Siyang

    2014-01-01

    Most mushrooms are thermo-sensitive to temperatures over 23°C, which greatly restricts their agricultural cultivation. Understanding mushroom's innate heat-tolerance mechanisms may facilitate genetic improvements of their thermotolerance. Agaricus bisporus strain 02 is a relatively thermotolerant mushroom strain, while strain 8213 is quite thermo-sensitive. Here, we compared their responses at proteomic level to heat treatment at 33°C. We identified 73 proteins that are differentially expressed between 02 and 8213 or induced upon heat stress in strain 02 itself, 48 of which with a known identity. Among them, 4 proteins are constitutively more highly expressed in 02 than 8213; and they can be further upregulated in response to heat stress in 02, but not in 8213. One protein is encoded by the para-aminobenzoic acid (PABA) synthase gene Pabs, which has been shown to scavenge the reactive oxygen species in vitro. Pabs mRNA and its chemical product PABA show similar heat stress induction pattern as PABA synthase protein and are more abundant in 02, indicating transcriptional level upregulation of Pabs upon heat stress. A specific inhibitor of PABA synthesis impaired thermotolerance of 02, while exogenous PABA or transgenic overexpression of 02 derived PABA synthase enhanced thermotolerance of 8213. Furthermore, compared to 8213, 02 accumulated less H2O2 but more defense-related proteins (e.g., HSPs and Chitinase) under heat stress. Together, these results demonstrate a role of PABA in enhancing mushroom thermotolerance by removing H2O2 and elevating defense-related proteins.

  16. Ethylene-Enhanced 1-Aminocyclopropane-1-carboxylic Acid Synthase Activity in Ripening Apples 1

    PubMed Central

    Bufler, Gebhard

    1984-01-01

    Apples (Malus sylvestris Mill, cv Golden Delicious) were treated before harvest with aminoethoxyvinylglycine (AVG). AVG is presumed to reversibly inhibit 1-aminocyclopropane-1-carboxylic acid (ACC) activity, but not the formation of ACC synthase. AVG treatment effectively blocked initiation of autocatalytic ethylene production and ripening of harvested apples. Exogenous ethylene induced extractable ACC synthase activity and ripening in AVG-treated apples. Removal of exogenous ethylene caused a rapid decline in ACC synthase activity and in CO2 production. The results with ripened, AVG-treated apples indicate (a) a dose-response relationship between ethylene and enhancement of ACC synthase activity with a half-maximal response at approximately 0.8 μl/l ethylene; (b) reversal of ethylene-enhanced ACC synthase activity by CO2; (c) enhancement of ACC synthase activity by the ethylene-activity analog propylene. Induction of ACC synthase activity, autocatalytic ethylene production, and ripening of preclimacteric apples not treated with AVG were delayed by 6 and 10% CO2, but not by 1.25% CO2. However, each of these CO2 concentrations reduced the rate of increase of ACC synthase activity. PMID:16663569

  17. Direct transfer of starter substrates from type I fatty acid synthase to type III polyketide synthases in phenolic lipid synthesis

    PubMed Central

    Miyanaga, Akimasa; Funa, Nobutaka; Awakawa, Takayoshi; Horinouchi, Sueharu

    2008-01-01

    Alkylresorcinols and alkylpyrones, which have a polar aromatic ring and a hydrophobic alkyl chain, are phenolic lipids found in plants, fungi, and bacteria. In the Gram-negative bacterium Azotobacter vinelandii, phenolic lipids in the membrane of dormant cysts are essential for encystment. The aromatic moieties of the phenolic lipids in A. vinelandii are synthesized by two type III polyketide synthases (PKSs), ArsB and ArsC, which are encoded by the ars operon. However, details of the synthesis of hydrophobic acyl chains, which might serve as starter substrates for the type III polyketide synthases (PKSs), were unknown. Here, we show that two type I fatty acid synthases (FASs), ArsA and ArsD, which are members of the ars operon, are responsible for the biosynthesis of C22–C26 fatty acids from malonyl-CoA. In vivo and in vitro reconstitution of phenolic lipid synthesis systems with the Ars enzymes suggested that the C22–C26 fatty acids produced by ArsA and ArsD remained attached to the ACP domain of ArsA and were transferred hand-to-hand to the active-site cysteine residues of ArsB and ArsC. The type III PKSs then used the fatty acids as starter substrates and carried out two or three extensions with malonyl-CoA to yield the phenolic lipids. The phenolic lipids in A. vinelandii were thus found to be synthesized solely from malonyl-CoA by the four members of the ars operon. This is the first demonstration that a type I FAS interacts directly with a type III PKS through substrate transfer. PMID:18199837

  18. Direct transfer of starter substrates from type I fatty acid synthase to type III polyketide synthases in phenolic lipid synthesis.

    PubMed

    Miyanaga, Akimasa; Funa, Nobutaka; Awakawa, Takayoshi; Horinouchi, Sueharu

    2008-01-22

    Alkylresorcinols and alkylpyrones, which have a polar aromatic ring and a hydrophobic alkyl chain, are phenolic lipids found in plants, fungi, and bacteria. In the Gram-negative bacterium Azotobacter vinelandii, phenolic lipids in the membrane of dormant cysts are essential for encystment. The aromatic moieties of the phenolic lipids in A. vinelandii are synthesized by two type III polyketide synthases (PKSs), ArsB and ArsC, which are encoded by the ars operon. However, details of the synthesis of hydrophobic acyl chains, which might serve as starter substrates for the type III polyketide synthases (PKSs), were unknown. Here, we show that two type I fatty acid synthases (FASs), ArsA and ArsD, which are members of the ars operon, are responsible for the biosynthesis of C(22)-C(26) fatty acids from malonyl-CoA. In vivo and in vitro reconstitution of phenolic lipid synthesis systems with the Ars enzymes suggested that the C(22)-C(26) fatty acids produced by ArsA and ArsD remained attached to the ACP domain of ArsA and were transferred hand-to-hand to the active-site cysteine residues of ArsB and ArsC. The type III PKSs then used the fatty acids as starter substrates and carried out two or three extensions with malonyl-CoA to yield the phenolic lipids. The phenolic lipids in A. vinelandii were thus found to be synthesized solely from malonyl-CoA by the four members of the ars operon. This is the first demonstration that a type I FAS interacts directly with a type III PKS through substrate transfer.

  19. Molecular evolution and functional divergence of soluble starch synthase genes in cassava (manihot esculenta crantz).

    PubMed

    Yang, Zefeng; Wang, Yifan; Xu, Shuhui; Xu, Chenwu; Yan, Changjie

    2013-01-01

    Soluble starch synthases (SSs) are major enzymes involved in starch biosynthesis in plants. Cassava starch has many remarkable characteristics, which should be influenced by the evolution of SS genes in this starchy root crop. In this work, we performed a comprehensive phylogenetic and evolutionary analysis of the soluble starch synthases in cassava. Genome-wide identification showed that there are 9 genes encoding soluble starch synthases in cassava. All of the soluble starch synthases encoded by these genes contain both Glyco_transf_5 and Glycos_transf_1 domains, and a correlation analysis showed evidence of coevolution between these 2 domains in cassava SS genes. The SS genes in land plants can be divided into 6 subfamilies that were formed before the origin of seed plants, and species-specific expansion has contributed to the evolution of this family in cassava. A functional divergence analysis for this family provided statistical evidence for shifted evolutionary rates between the subfamilies of land plant soluble starch synthases. Although the main selective pressure acting on land plant SS genes was purifying selection, our results also revealed that point mutation with positive selection contributed to the evolution of 2 SS genes in cassava. The remarkable cassava starch characteristics might be the result of both the duplication and adaptive selection of SS genes.

  20. Acetohydroxyacid synthase activity and transcripts profiling reveal tissue-specific regulation of ahas genes in sunflower.

    PubMed

    Ochogavía, Ana C; Breccia, Gabriela; Vega, Tatiana; Felitti, Silvina A; Picardi, Liliana A; Nestares, Graciela

    2014-07-01

    Acetohydroxyacid synthase (AHAS) is the target site of several herbicides and catalyses the first step in the biosynthesis of branched chain amino acid. Three genes coding for AHAS catalytic subunit (ahas1, ahas2 and ahas3) have been reported for sunflower. The aim of this work was to study the expression pattern of ahas genes family and AHAS activity in sunflower (Helianthus annuus L.). Different organs (leaves, hypocotyls, roots, flowers and embryos) were evaluated at several developmental stages. The transcriptional profile was studied through RT-qPCR. The highest expression for ahas1 was shown in leaves, where all the induced and natural gene mutations conferring herbicide resistance were found. The maximal expression of ahas2 and ahas3 occurred in immature flowers and embryos. The highest AHAS activity was found in leaves and immature embryos. Correlation analysis among ahas gene expression and AHAS activity was discussed. Our results show that differences in ahas genes expression are tissue-specific and temporally regulated. Moreover, the conservation of multiple AHAS isoforms in sunflower seems to result from different expression requirements controlled by tissue-specific regulatory mechanisms at different developmental stages. PMID:24908515

  1. Characterization and analysis of the cotton cyclopropane fatty acid synthase family and their contribution to cyclopropane fatty acid synthesis

    SciTech Connect

    Yu X. H.; Shanklin J.; Rawat, R.

    2011-05-01

    Cyclopropane fatty acids (CPA) have been found in certain gymnosperms, Malvales, Litchi and other Sapindales. The presence of their unique strained ring structures confers physical and chemical properties characteristic of unsaturated fatty acids with the oxidative stability displayed by saturated fatty acids making them of considerable industrial interest. While cyclopropenoid fatty acids (CPE) are well-known inhibitors of fatty acid desaturation in animals, CPE can also inhibit the stearoyl-CoA desaturase and interfere with the maturation and reproduction of some insect species suggesting that in addition to their traditional role as storage lipids, CPE can contribute to the protection of plants from herbivory. Three genes encoding cyclopropane synthase homologues GhCPS1, GhCPS2 and GhCPS3 were identified in cotton. Determination of gene transcript abundance revealed differences among the expression of GhCPS1, 2 and 3 showing high, intermediate and low levels, respectively, of transcripts in roots and stems; whereas GhCPS1 and 2 are both expressed at low levels in seeds. Analyses of fatty acid composition in different tissues indicate that the expression patterns of GhCPS1 and 2 correlate with cyclic fatty acid (CFA) distribution. Deletion of the N-terminal oxidase domain lowered GhCPS's ability to produce cyclopropane fatty acid by approximately 70%. GhCPS1 and 2, but not 3 resulted in the production of cyclopropane fatty acids upon heterologous expression in yeast, tobacco BY2 cell and Arabidopsis seed. In cotton GhCPS1 and 2 gene expression correlates with the total CFA content in roots, stems and seeds. That GhCPS1 and 2 are expressed at a similar level in seed suggests both of them can be considered potential targets for gene silencing to reduce undesirable seed CPE accumulation. Because GhCPS1 is more active in yeast than the published Sterculia CPS and shows similar activity when expressed in model plant systems, it represents a strong candidate gene for

  2. Functional Inducible Nitric Oxide Synthase Gene Variants Associate With Hypertension

    PubMed Central

    Nikkari, Seppo T.; Määttä, Kirsi M.; Kunnas, Tarja A.

    2015-01-01

    Abstract Increased inducible nitric oxide synthase (iNOS) activity and expression has been associated with hypertension, but less is known whether the 2 known functional polymorphic sites in the iNOS gene (g.–1026 C/A (rs2779249), g.2087 G/A (rs2297518)) affect susceptibility to hypertension. The objective of this study was to investigate the association between the genetic variants of iNOS and diagnosed hypertension in a Finnish cohort. This study included 320 hypertensive cases and 439 healthy controls. All participants were 50-year-old men and women and the data were collected from the Tampere adult population cardiovascular risk study (TAMRISK). DNA was extracted from buccal swabs and iNOS single nucleotide polymorphisms (SNPs) were analyzed using KASP genotyping PCR. Data analysis was done by logistic regression. At the age of 50 years, the SNP rs2779249 (C/A) associated significantly with hypertension (P = 0.009); specifically, subjects carrying the A-allele had higher risk of hypertension compared to those carrying the CC genotype (OR = 1.47; CI = 1.08–2.01; P = 0.015). In addition, a 15-year follow-up period (35, 40, and 45 years) of the same individuals showed that carriers of the A-allele had more often hypertension in all of the studied age-groups. The highest risk for developing hypertension was obtained among 35-year-old subjects (odds ratio [OR] 3.83; confidence interval [CI] = 1.20–12.27; P = 0.024). Those carrying variant A had also significantly higher readings of both systolic (P = 0.047) and diastolic (P = 0.048) blood pressure during the follow-up. No significant associations between rs2297518 (G/A) variants alone and hypertension were found. However, haplotype analysis of rs2779249 and rs2297518 revealed that individuals having haplotype H3 which combines both A alleles (CA–GA, 19.7% of individuals) was more commonly found in the hypertensive group than in the normotensive group (OR = 2.01; CI = 1

  3. Expression of the trichodiene synthase gene of Fusarium sporotrichioides in Escherichia coli results in sesquiterpene production.

    PubMed

    Hohn, T M; Plattner, R D

    1989-11-15

    Trichodiene synthase is a sesquiterpene cyclase involved in the biosynthesis of trichothecene mycotoxins. We report that insertion of the unaltered trichodiene synthase gene of Fusarium sporotrichioides into the Escherichia coli expression vector pDR540 produced an inactive polypeptide with a molecular weight approximately 2000 greater than that of trichodiene synthase. This result is consistent with the presence of an intron in the trichodiene synthase gene, and prompted us to specifically delete a putative 60-nucleotide intron sequence. Insertion of the intron-deleted open reading frame into pDR540 resulted in the production of active enzyme. Trichodiene synthase activity in crude extracts from induced cultures was 0.07 nmol/min/mg of protein and represented 0.05-0.10% of the total cell protein. A cross-reactive protein was present with the same apparent molecular weight as the subunit of native trichodiene synthase. The recombinant enzyme was partially purified and shown to have properties closely resembling those of the native enzyme. Trichodiene was detected in ethyl acetate extracts from induced cultures at a concentration of 60 micrograms/liter after 4.5 h. These findings support the primary structure recently reported for trichodiene synthase and demonstrate that the expression of a sesquiterpene cyclase in E. coli results in sesquiterpene production. PMID:2817906

  4. Homology analyses of the protein sequences of fatty acid synthases from chicken liver, rat mammary gland, and yeast

    SciTech Connect

    Chang, Soo-Ik ); Hammes, G.G. )

    1989-11-01

    Homology analyses of the protein sequences of chicken liver and rat mammary gland fatty acid synthases were carried out. The amino acid sequences of the chicken and rat enzymes are 67% identical. If conservative substitutions are allowed, 78% of the amino acids are matched. A region of low homologies exists between the functional domains, in particular around amino acid residues 1059-1264 of the chicken enzyme. Homologies between the active sites of chicken and rat and of chicken and yeast enzymes have been analyzed by an alignment method. A high degree of homology exists between the active sites of the chicken and rat enzymes. However, the chicken and yeast enzymes show a lower degree of homology. The DADPH-binding dinucleotide folds of the {beta}-ketoacyl reductase and the enoyl reductase sites were identified by comparison with a known consensus sequence for the DADP- and FAD-binding dinucleotide folds. The active sites of all of the enzymes are primarily in hydrophobic regions of the protein. This study suggests that the genes for the functional domains of fatty acid synthase were originally separated, and these genes were connected to each other by using different connecting nucleotide sequences in different species. An alternative explanation for the differences in rat and chicken is a common ancestry and mutations in the joining regions during evolution.

  5. Production of geranylgeraniol on overexpression of a prenyl diphosphate synthase fusion gene in Saccharomyces cerevisiae.

    PubMed

    Ohto, Chikara; Muramatsu, Masayoshi; Obata, Shusei; Sakuradani, Eiji; Shimizu, Sakayu

    2010-07-01

    An acyclic diterpene alcohol, (E,E,E)-geranylgeraniol (GGOH), is one of the important compounds used as perfume and pharmacological agents. A deficiency of squalene (SQ) synthase activity allows yeasts to accumulate an acyclic sesquiterpene alcohol, (E,E)-farnesol, in their cells. Since sterols are essential for the growth of yeasts, a deficiency of SQ synthase activity makes the addition of supplemental sterols to the culture media necessary. To develop a GGOH production method not requiring any supplemental sterols, we overexpressed HMG1 encoding hydroxymethylglutaryl-CoA reductase and the genes of two prenyl diphosphate synthases, ERG20 and BTS1, in Saccharomyces cerevisiae. A prototrophic diploid coexpressing HMG1 and the ERG20-BTS1 fusion accumulated GGOH with neither disruption of the SQ synthase gene nor the addition of any supplemental sterols. The GGOH content on the diploid cultivation in a 5-l jar fermenter reached 138.8 mg/l under optimal conditions.

  6. Cloning and sequence analysis of the Blumea balsamifera DC farnesyl diphosphate synthase gene.

    PubMed

    Pang, Y X; Guan, L L; Wu, L F; Chen, Z X; Wang, K; Xie, X L; Yu, F L; Chen, X L; Zhang, Y B; Jiang, Q

    2014-01-01

    Blumea balsamifera DC is a member of the Compositae family and is frequently used as traditional Chinese medicine. Blumea balsamifera is rich in monoterpenes, which possess a variety of pharmacological activities, such as antioxidant, anti-bacteria, and anti-viral activities. Farnesyl diphosphate synthase (FPS) is a key enzyme in the biosynthetic pathway of terpenes, playing an important regulatory role in plant growth, such as resistance and secondary metabolism. Based on the conserved oligo amino acid residues of published FPS genes from other higher plant species, a cDNA sequence, designated BbFPS, was isolated from B. balsamifera DC using polymerase chain reaction. The clones were an average of 1.6 kb and contained an open reading frame that predicted a polypeptide of 342 amino acids with 89.07% identity to FPS from other plants. The deduced amino acid sequence was dominated by hydrophobic regions and contained 2 highly conserved DDxxD motifs that are essential for proper functioning of FPS. Phylogenetic analysis indicated that FPS grouped with other composite families. Prediction of secondary structure and subcellular localization suggested that alpha helices made up 70% of the amino acids of the sequence. PMID:25501197

  7. Isolation and gene disruption of the Tox5 gene encoding trichodiene synthase in Gibberella pulicaris.

    PubMed

    Hohn, T M; Desjardins, A E

    1992-01-01

    The trichodiene synthase gene (Tox5) was isolated from Gibberella pulicaris, and its nucleotide sequence was determined. Tox5 was disrupted through transformation with a plasmid carrying a doubly truncated copy of the coding region and a selectable marker for resistance to hygromycin B (Hygr). Analysis of 82 transformants for their ability to produce the trichothecene, 4,15-diacetoxyscirpenol (DAS), resulted in the identification of five DAS- strains. Southern hybridization analysis of DAS- Hygr transformants indicated that the plasmid integrated at the Tox5 locus. The disrupted Tox5 gene was shown to be mitotically stable. Analysis of nine tetrads revealed either the cosegregation of the disrupter plasmid and the DAS- phenotype or the loss of the disrupter plasmid. These results demonstrate the feasibility of using gene disruption in G. pulicaris and suggest a general method for obtaining Tox5- mutants in other trichothecene-producing fungi. PMID:1421511

  8. Geranyl diphosphate synthase from mint

    DOEpatents

    Croteau, Rodney Bruce; Wildung, Mark Raymond; Burke, Charles Cullen; Gershenzon, Jonathan

    1999-01-01

    A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate.

  9. Geranyl diphosphate synthase from mint

    DOEpatents

    Croteau, R.B.; Wildung, M.R.; Burke, C.C.; Gershenzon, J.

    1999-03-02

    A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate. 5 figs.

  10. Studies on the chalcone synthase gene of two higher plants: petroselinum hortense and matthiola incana

    SciTech Connect

    Hemleben, V.; Frey, M.; Rall, S.; Koch, M.; Kittel, M.; Kreuzaler, F.; Ragg, H.; Fautz, E.; Hahlbrock, K.

    1982-01-01

    Two higher plant systems are presented which allow to study coordinated gene expression of the light-induced metabolic pathway of flavonoid biosynthesis: tissue culture cells of Petroselinum hortense (Apiaceae) and different developmental stages of various genotypes of Matthiola incana (Brassicaceae). The gene structure of the chalcone synthase is mainly studied. A cDNA clone (pLF56) of parsley has been constructed and characterized conferring the chalcone synthase gene sequence. Strong cross hybridization between the parsley cDNA and Matthiola DNA allowed to identify a HindIII fragment (6000 bp) identical in size for parsley and different Matthiola wild type lines and a mutant line.

  11. Human fatty acid synthase: Structure and substrate selectivity of the thioesterase domain

    PubMed Central

    Chakravarty, Bornali; Gu, Ziwei; Chirala, Subrahmanyam S.; Wakil, Salih J.; Quiocho, Florante A.

    2004-01-01

    Human fatty acid synthase is a large homodimeric multifunctional enzyme that synthesizes palmitic acid. The unique carboxyl terminal thioesterase domain of fatty acid synthase hydrolyzes the growing fatty acid chain and plays a critical role in regulating the chain length of fatty acid released. Also, the up-regulation of human fatty acid synthase in a variety of cancer makes the thioesterase a candidate target for therapeutic treatment. The 2.6-Å resolution structure of human fatty acid synthase thioesterase domain reported here is comprised of two dissimilar subdomains, A and B. The smaller subdomain B is composed entirely of α-helices arranged in an atypical fold, whereas the A subdomain is a variation of the α/β hydrolase fold. The structure revealed the presence of a hydrophobic groove with a distal pocket at the interface of the two subdomains, which constitutes the candidate substrate binding site. The length and largely hydrophobic nature of the groove and pocket are consistent with the high selectivity of the thioesterase for palmitoyl acyl substrate. The structure also set the identity of the Asp residue of the catalytic triad of Ser, His, and Asp located in subdomain A at the proximal end of the groove. PMID:15507492

  12. Analysis of THCA synthase gene expression in cannabis: a preliminary study by real-time quantitative PCR.

    PubMed

    Cascini, Fidelia; Passerotti, Stella; Boschi, Ilaria

    2013-09-10

    In this paper we describe analyses performed by Real-Time Reverse-Transcriptase Polymerase Chain Reaction (real-time RT-PCR) on RNA of 12 samples, carried out for forensic purposes to investigate a correlation between tetrahydrocannabinol (THC) concentration in Cannabis and the tetrahydrocannabinol acid synthase (THCAS) gene expression. Samples were obtained from an experimental cultivation of declared potency Cannabis variety seeds and from seizures. The Rubisco gene and the 26S ribosomal RNA gene were used as internal control genes for their constant expression and stability. As results we found minor gene expression in samples from leaves of young plants. Further, grouping results for cannabis samples with similar characteristics, we have found an increased relative expression in samples with the highest percentage of THC coming from seized sample and adult plants.

  13. Cloning and characterization of the nicotianamine synthase gene in Eruca vesicaria subsp sativa.

    PubMed

    Huang, B L; Cheng, C; Zhang, G Y; Su, J J; Zhi, Y; Xu, S S; Cai, D T; Zhang, X K; Huang, B Q

    2015-12-22

    Nicotianamine (NA) is a ubiquitous metabolite in plants that bind heavy metals, is crucial for metal homeostasis, and is also an important metal chelator that facilitates long-distance metal transport and sequestration. NA synthesis is catalyzed by the enzyme nicotianamine synthase (NAS). Eruca vesicaria subsp sativa is highly tolerant to Ni, Pb, and Zn. In this study, a gene encoding EvNAS was cloned and characterized in E. vesicaria subsp sativa. The full-length EvNAS cDNA sequence contained a 111-bp 5'-untranslated region (UTR), a 155-bp 3'-UTR, and a 966-bp open reading frame encoding 322-amino acid residues. The EvNAS genomic sequence contained no introns, which is similar to previously reported NAS genes. The deduced translation of EvNAS contained a well-conserved NAS domain (1-279 amino acids) and an LIKI-CGEAEG box identical to some Brassica NAS and to the LIRL-box in most plant NAS, which is essential for DNA binding. Phylogenetic analysis indicated that EvNAS was most closely related to Brassica rapa NAS3 within the Cruciferae, followed by Thlaspi NAS1, Camelina NAS3, and Arabidopsis NAS3. A reverse transcription-polymerase chain reaction indicated that EvNAS expression was greatest in the leaves, followed by the flower buds and hypocotyls. EvNAS was moderately expressed in the roots.

  14. Molecular cloning, characteristics and low temperature response of raffinose synthase gene in Cucumis sativus L.

    PubMed

    Sui, Xiao-lei; Meng, Fan-zhen; Wang, Hong-yun; Wei, Yu-xia; Li, Rui-fu; Wang, Zhen-yu; Hu, Li-ping; Wang, Shao-hui; Zhang, Zhen-xian

    2012-12-15

    Raffinose synthase (RS, EC2.4.1.82) is one of the key enzymes that channels sucrose into the raffinose family oligosaccharides (RFOs) biosynthetic pathway. However, the gene encoding RS is poorly characterized in cucumber (Cucumis sativus L.), which is a typical RFOs-translocating plant species. Here we isolated the gene encoding RS (CsRS) from the leaves of cucumber plants. The complete cDNA of CsRS consisted of 2552 nucleotides with an open reading frame encoding a polypeptide of 784 amino acid residues. Reverse transcription-polymerase chain reaction and RNA hybridization analysis revealed that expression of CsRS was the highest in leaves followed by roots, fruits, and stems. The RS activity was up-regulated and the raffinose content was high in the leaves of transgenic tobacco with over-expression of CsRS, while both the RS activity and the raffinose content decreased in the transgenic cucumber plants with anti-sense expression of CsRS. The expression of CsRS could be induced by low temperature and exogenous phytohormone abscisic acid (ABA). In cucumber growing under low temperature stress, CsRS expression, RS activity and raffinose content increased gradually in the leaves, the fruits, the stems and the roots. The most notable increase was observed in the leaves. Similarly, the expression of CsRS was induced in cucumber leaves and fruits with 200 μM and 150 μM ABA treatments, respectively.

  15. Cloning and characterization of the nicotianamine synthase gene in Eruca vesicaria subsp sativa.

    PubMed

    Huang, B L; Cheng, C; Zhang, G Y; Su, J J; Zhi, Y; Xu, S S; Cai, D T; Zhang, X K; Huang, B Q

    2015-01-01

    Nicotianamine (NA) is a ubiquitous metabolite in plants that bind heavy metals, is crucial for metal homeostasis, and is also an important metal chelator that facilitates long-distance metal transport and sequestration. NA synthesis is catalyzed by the enzyme nicotianamine synthase (NAS). Eruca vesicaria subsp sativa is highly tolerant to Ni, Pb, and Zn. In this study, a gene encoding EvNAS was cloned and characterized in E. vesicaria subsp sativa. The full-length EvNAS cDNA sequence contained a 111-bp 5'-untranslated region (UTR), a 155-bp 3'-UTR, and a 966-bp open reading frame encoding 322-amino acid residues. The EvNAS genomic sequence contained no introns, which is similar to previously reported NAS genes. The deduced translation of EvNAS contained a well-conserved NAS domain (1-279 amino acids) and an LIKI-CGEAEG box identical to some Brassica NAS and to the LIRL-box in most plant NAS, which is essential for DNA binding. Phylogenetic analysis indicated that EvNAS was most closely related to Brassica rapa NAS3 within the Cruciferae, followed by Thlaspi NAS1, Camelina NAS3, and Arabidopsis NAS3. A reverse transcription-polymerase chain reaction indicated that EvNAS expression was greatest in the leaves, followed by the flower buds and hypocotyls. EvNAS was moderately expressed in the roots. PMID:26782459

  16. Polypeptide composition of bacterial cyclic diguanylic acid-dependent cellulose synthase and the occurrence of immunologically crossreacting proteins in higher plants

    SciTech Connect

    Mayer, R.; Ross, P.; Weinhouse, H.; Amikam, D.; Volman, G.; Ohana, P.; Benziman, M. ); Calhoon, R.D.; Wong, Hing C.; Emerick, A.W. )

    1991-06-15

    To comprehend the catalytic and regulatory mechanism of the cyclic diguanylic acid (c-di-GMP)-dependent cellulose synthase of Acetobacter xylinum and its relatedness to similar enzymes in other organisms, the structure of this enzyme was analyzed at the polypeptide level. The enzyme, purified 350-fold by enzyme-product entrapment, contains three major peptides (90, 67, and 54 kDa), which, based on direct photoaffinity and immunochemical labeling and amino acid sequence analysis, are constituents of the native cellulose synthase. Labeling of purified synthase with either ({sup 32}P)c-di-GMP or ({alpha}-{sup 32}P)UDP-glucose indicates that activator- and substrate-specific binding sites are most closely associated with the 67- and 54-kDa peptides, respectively, whereas marginal photolabeling is detected in the 90-k-Da peptide. However, antibodies raised against a protein derived from the cellulose synthase structural gene (bcsB) specifically label all three peptides. The authors suggest that the structurally related 67- and 54-kDa peptides are fragments proteolytically derived from the 90-kDa peptide encoded by bcsB. The anti-cellulose synthase antibodies crossreact with a similar set of peptides derived from other cellulose-producing microorganisms and plants such as Agrobacterium tumefaciens, Rhizobium leguminosarum, mung bean, peas, barley, and cotton. The occurrence of such cellulose synthase-like structures in plant species suggests that a common enzymatic mechanism for cellulose biogenesis is employed throughout nature.

  17. Analysis of acetohydroxyacid synthase1 gene in chickpea conferring resistance to imazamox herbicide.

    PubMed

    Jain, Parul; Tar'an, Bunyamin

    2014-11-01

    Chickpea (Cicer arietinum L.) production in the Canadian prairies is challenging due to a lack of effective weed management mainly because of poor competition ability of the crop and limited registered herbicide options. Chickpea genotype with resistance to imidazolinone (IMI) herbicides has been identified. A point mutation in the acetohydroxyacid synthase1 (AHAS1) gene at C581 to T581, resulting in an amino acid substitution from Ala194 to Val194 (position 205, standardized to arabidopsis), confers the resistance to imazamox in chickpea. However, the molecular mechanism leading to the resistance is not fully understood. In many plant species, contrasting transcription levels of AHAS gene has been implicated in the resistant and susceptible genotypes in response to IMI. The objectives of this research were to compare the AHAS gene expression and AHAS enzyme activity in resistant and susceptible chickpea cultivars in response to imazamox herbicide treatment. Results from RT-qPCR indicated that there is no significant change in the transcript levels of AHAS1 between the susceptible and the resistant genotypes in response to imazamox treatment. Protein hydrophobic cluster analysis, protein-ligand docking analysis, and AHAS enzyme activity assay all indicated that the resistance to imazamox in chickpea is due to the alteration of interaction of the AHAS1 enzyme with the imazamox herbicide.

  18. Homologous cloning, characterization and expression of a new halophyte phytochelatin synthase gene in Suaeda salsa

    NASA Astrophysics Data System (ADS)

    Cong, Ming; Zhao, Jianmin; Lü, Jiasen; Ren, Zhiming; Wu, Huifeng

    2016-09-01

    The halophyte Suaeda salsa can grow in heavy metal-polluted areas along intertidal zones having high salinity. Since phytochelatins can eff ectively chelate heavy metals, it was hypothesized that S. salsa possessed a phytochelatin synthase (PCS) gene. In the present study, the cDNA of PCS was obtained from S. salsa (designated as SsPCS) using homologous cloning and the rapid amplification of cDNA ends (RACE). A sequence analysis revealed that SsPCS consisted of 1 916 bp nucleotides, encoding a polypeptide of 492 amino acids with one phytochelatin domain and one phytochelatin C domain. A similarity analysis suggested that SsPCS shared up to a 58.6% identity with other PCS proteins and clustered with PCS proteins from eudicots. There was a new kind of metal ion sensor motif in its C-terminal domain. The SsPCS transcript was more highly expressed in elongated and fibered roots and stems ( P<0.05) than in leaves. Lead and mercury exposure significantly enhanced the mRNA expression of SsPCS ( P<0.05). To the best of our knowledge, SsPCS is the second PCS gene cloned from a halophyte, and it might contain a diff erent metal sensing capability than the first PCS from Thellungiella halophila. This study provided a new view of halophyte PCS genes in heavy metal tolerance.

  19. [Full-length cDNA cloning of flavonol synthase genes of Carthamus tinctorius and construction plant expression vector].

    PubMed

    Yang, Wen-ting; Liu, Xiu-ming; Wan, Qiu; Yao, Na; Wang, Nan; Zhang, Xue-meng; Jiao, Zhong-da; Li, Hai-yan; Li, Xiao-kun

    2015-02-01

    Flavonol synthase (FLS) is one of the key enzymes in flavonoids metabolic pathways. In this study, middle sequence was obtained from Carthamus tinctorius transcriptome sequencing results. Full-length cDNAs of FLS was cloned from petals of C. tinctorius to FLS by using RT-PCR and RACE technology. Its full-length cDNA was 1,201 bp, with an open reading frame of 1,101 bp and 336 encoded amino acids. The phylogenetic analysis showed that, FLS gene encoded amino acids in C. tinctorius were highly homologous with amino acids in congeneric Compositae species, especially Rudbeckia laciniata. The pBASTA-FLS plant expression vector was successfully built by the molecular biology method, which lays a foundation for further studying biology functions of the gene and biosynthesis mechanism of flavonoids.

  20. The human liver glycogen synthase isozyme gene is located on the short arm of chromosome 12

    SciTech Connect

    Nuttall, F.Q.; Gannon, M.C. ); Kubic, V.L.; Hoyt, K.J. )

    1994-01-15

    Glycogen synthase catalyzes the rate-limiting step in glycogen synthesis. Its activity is regulated by a complex phosphorylation-dephosphorylation mechanism and by allosteric stimulators and inhibitors. Two isozymes of synthase, a skeletal muscle type and liver type, have been identified in rabbit and rat tissues using specific polyclonal antibodies. The skeletal muscle type isozyme is present in several organs in addition to skeletal muscle; the liver isozyme has been identified only in liver. Recently, we have purified and characterized the human liver synthase isozyme. We also have cloned and sequenced the gene from a human liver cDNA library. Using the entire cDNA coding sequence as a probe, we report here the localization of the liver synthase isozyme gene to the short arm of chromosome 12. These studies revealed a centromeric signal on chromosome 12 together with signal to glycogen synthase on the short arm of this chromosome in the p11.2-p12.2 region. Measurements of the relative distance from the midpoint of the centromere to the signal corresponding to glycogen synthase suggests that the locus is in the p12.2 band rather than in the more centromeric location.

  1. Assessing the allelotypic effect of two aminocyclopropane carboxylic acid synthase-encoding genes MdACS1 and MdACS3a on fruit ethylene production and softening in Malus.

    PubMed

    Dougherty, Laura; Zhu, Yuandi; Xu, Kenong

    2016-01-01

    Phytohormone ethylene largely determines apple fruit shelf life and storability. Previous studies demonstrated that MdACS1 and MdACS3a, which encode 1-aminocyclopropane-1-carboxylic acid synthases (ACS), are crucial in apple fruit ethylene production. MdACS1 is well-known to be intimately involved in the climacteric ethylene burst in fruit ripening, while MdACS3a has been regarded a main regulator for ethylene production transition from system 1 (during fruit development) to system 2 (during fruit ripening). However, MdACS3a was also shown to have limited roles in initiating the ripening process lately. To better assess their roles, fruit ethylene production and softening were evaluated at five time points during a 20-day post-harvest period in 97 Malus accessions and in 34 progeny from 2 controlled crosses. Allelotyping was accomplished using an existing marker (ACS1) for MdACS1 and two markers (CAPS866 and CAPS870) developed here to specifically detect the two null alleles (ACS3a-G289V and Mdacs3a) of MdACS3a. In total, 952 Malus accessions were allelotyped with the three markers. The major findings included: The effect of MdACS1 was significant on fruit ethylene production and softening while that of MdACS3a was less detectable; allele MdACS1-2 was significantly associated with low ethylene and slow softening; under the same background of the MdACS1 allelotypes, null allele Mdacs3a (not ACS3a-G289V) could confer a significant delay of ethylene peak; alleles MdACS1-2 and Mdacs3a (excluding ACS3a-G289V) were highly enriched in M. domestica and M. hybrid when compared with those in M. sieversii. These findings are of practical implications in developing apples of low and delayed ethylene profiles by utilizing the beneficial alleles MdACS1-2 and Mdacs3a. PMID:27231553

  2. Assessing the allelotypic effect of two aminocyclopropane carboxylic acid synthase-encoding genes MdACS1 and MdACS3a on fruit ethylene production and softening in Malus

    PubMed Central

    Dougherty, Laura; Zhu, Yuandi; Xu, Kenong

    2016-01-01

    Phytohormone ethylene largely determines apple fruit shelf life and storability. Previous studies demonstrated that MdACS1 and MdACS3a, which encode 1-aminocyclopropane-1-carboxylic acid synthases (ACS), are crucial in apple fruit ethylene production. MdACS1 is well-known to be intimately involved in the climacteric ethylene burst in fruit ripening, while MdACS3a has been regarded a main regulator for ethylene production transition from system 1 (during fruit development) to system 2 (during fruit ripening). However, MdACS3a was also shown to have limited roles in initiating the ripening process lately. To better assess their roles, fruit ethylene production and softening were evaluated at five time points during a 20-day post-harvest period in 97 Malus accessions and in 34 progeny from 2 controlled crosses. Allelotyping was accomplished using an existing marker (ACS1) for MdACS1 and two markers (CAPS866 and CAPS870) developed here to specifically detect the two null alleles (ACS3a-G289V and Mdacs3a) of MdACS3a. In total, 952 Malus accessions were allelotyped with the three markers. The major findings included: The effect of MdACS1 was significant on fruit ethylene production and softening while that of MdACS3a was less detectable; allele MdACS1–2 was significantly associated with low ethylene and slow softening; under the same background of the MdACS1 allelotypes, null allele Mdacs3a (not ACS3a-G289V) could confer a significant delay of ethylene peak; alleles MdACS1–2 and Mdacs3a (excluding ACS3a-G289V) were highly enriched in M. domestica and M. hybrid when compared with those in M. sieversii. These findings are of practical implications in developing apples of low and delayed ethylene profiles by utilizing the beneficial alleles MdACS1-2 and Mdacs3a. PMID:27231553

  3. Gene therapy inhibiting neointimal vascular lesion: in vivo transfer of endothelial cell nitric oxide synthase gene.

    PubMed Central

    von der Leyen, H E; Gibbons, G H; Morishita, R; Lewis, N P; Zhang, L; Nakajima, M; Kaneda, Y; Cooke, J P; Dzau, V J

    1995-01-01

    It is postulated that vascular disease involves a disturbance in the homeostatic balance of factors regulating vascular tone and structure. Recent developments in gene transfer techniques have emerged as an exciting therapeutic option to treat vascular disease. Several studies have established the feasibility of direct in vivo gene transfer into the vasculature by using reporter genes such as beta-galactosidase or luciferase. To date no study has documented therapeutic effects with in vivo gene transfer of a cDNA encoding a functional enzyme. This study tests the hypothesis that endothelium-derived nitric oxide is an endogenous inhibitor of vascular lesion formation. After denudation by balloon injury of the endothelium of rat carotid arteries, we restored endothelial cell nitric oxide synthase (ec-NOS) expression in the vessel wall by using the highly efficient Sendai virus/liposome in vivo gene transfer technique. ec-NOS gene transfection not only restored NO production to levels seen in normal untreated vessels but also increased vascular reactivity of the injured vessels. Neointima formation at day 14 after balloon injury was inhibited by 70%. These findings provide direct evidence that NO is an endogenous inhibitor of vascular lesion formation in vivo (by inhibiting smooth muscle cell proliferation and migration) and suggest the possibility of ec-NOS transfection as a potential therapeutic approach to treat neointimal hyperplasia. Images Fig. 1 Fig. 2 Fig. 5 PMID:7532305

  4. Gene Therapy Inhibiting Neointimal Vascular Lesion: In vivo Transfer of Endothelial Cell Nitric Oxide Synthase Gene

    NASA Astrophysics Data System (ADS)

    von der Leyen, Heiko E.; Gibbons, Gary H.; Morishita, Ryuichi; Lewis, Neil P.; Zhang, Lunan; Nakajima, Masatoshi; Kaneda, Yasufumi; Cooke, John P.; Dzau, Victor J.

    1995-02-01

    It is postulated that vascular disease involves a disturbance in the homeostatic balance of factors regulating vascular tone and structure. Recent developments in gene transfer techniques have emerged as an exciting therapeutic option to treat vascular disease. Several studies have established the feasibility of direct in vivo gene transfer into the vasculature by using reporter genes such as β-galactosidase or luciferase. To date no study has documented therapeutic effects with in vivo gene transfer of a cDNA encoding a functional enzyme. This study tests the hypothesis that endothelium-derived nitric oxide is an endogenous inhibitor of vascular lesion formation. After denudation by balloon injury of the endothelium of rat carotid arteries, we restored endothelial cell nitric oxide synthase (ec-NOS) expression in the vessel wall by using the highly efficient Sendai virus/liposome in vivo gene transfer technique. ec-NOS gene transfection not only restored NO production to levels seen in normal untreated vessels but also increased vascular reactivity of the injured vessel. Neointima formation at day 14 after balloon injury was inhibited by 70%. These findings provide direct evidence that NO is an endogenous inhibitor of vascular lesion formation in vivo (by inhibiting smooth muscle cell proliferation and migration) and suggest the possibility of ec-NOS transfection as a potential therapeutic approach to treat neointimal hyperplasia.

  5. Functional analyses of cellulose synthase genes in flax (Linum usitatissimum) by virus-induced gene silencing.

    PubMed

    Chantreau, Maxime; Chabbert, Brigitte; Billiard, Sylvain; Hawkins, Simon; Neutelings, Godfrey

    2015-12-01

    Flax (Linum usitatissimum) bast fibres are located in the stem cortex where they play an important role in mechanical support. They contain high amounts of cellulose and so are used for linen textiles and in the composite industry. In this study, we screened the annotated flax genome and identified 14 distinct cellulose synthase (CESA) genes using orthologous sequences previously identified. Transcriptomics of 'primary cell wall' and 'secondary cell wall' flax CESA genes showed that some were preferentially expressed in different organs and stem tissues providing clues as to their biological role(s) in planta. The development for the first time in flax of a virus-induced gene silencing (VIGS) approach was used to functionally evaluate the biological role of different CESA genes in stem tissues. Quantification of transcript accumulation showed that in many cases, silencing not only affected targeted CESA clades, but also had an impact on other CESA genes. Whatever the targeted clade, inactivation by VIGS affected plant growth. In contrast, only clade 1- and clade 6-targeted plants showed modifications in outer-stem tissue organization and secondary cell wall formation. In these plants, bast fibre number and structure were severely impacted, suggesting that the targeted genes may play an important role in the establishment of the fibre cell wall. Our results provide new fundamental information about cellulose biosynthesis in flax that should facilitate future plant improvement/engineering.

  6. Fatty acid synthase-positive hepatocytes and subsequent steatosis in rat livers by irinotecan

    PubMed Central

    SAWANO, TAKEYUKI; SHIMIZU, TAKESHI; YAMADA, TOSHIYUKI; NANASHIMA, NAOKI; MIURA, TAKUYA; MOROHASHI, SATOKO; KUDO, DAISUKE; HUI, FENG MAO; KIJIMA, HIROSHI; HAKAMADA, KENICHI; TSUCHIDA, SHIGEKI

    2015-01-01

    Using a rat model, we investigated factors contributing to the pathogenesis of irinotecan-associated fatty liver disease. Male Sprague-Dawley rats were administered 200 mg/kg irinotecan by intraperitoneal injection on days 1–4, but not on days 5–7. This schedule was repeated 3 times. Rats were sacrificed 4, 18 and 25 days after the last injection, and liver steatosis was evaluated by hematoxylin and eosin (H&E) staining, microarray analysis and immunohistochemistry. Panacinar intrahepatocyte vacuoles were absent on days 4 and 25, but present on day 18, and this alteration was more prominent around the bile ducts than the central veins. Microarray analysis showed that the expression of genes involved in the synthesis of cholesterol and fatty acids was upregulated on day 4. Immunohistochemistry detected fatty acid synthase (Fasn)-strongly positive hepatocytes as well as the activation of liver progenitor cells on day 4, whereas intracellular vacuoles were evident in carbonic anhydrase 3 (CA3)-positive hepatocytes on day 18. Thus, irinotecan-induced liver steatosis was preceded by Fasn-strongly-positive hepatocytes and liver progenitor cell activation. The magnitude of the decrease in the number of Fasn-strongly positive hepatocytes between days 4 and 18 was similar to that of the increase in the number of CA3-positive hepatocytes accompanying vacuoles. PMID:25708528

  7. P300 acetyltransferase regulates fatty acid synthase expression, lipid metabolism and prostate cancer growth.

    PubMed

    Gang, Xiaokun; Yang, Yinhui; Zhong, Jian; Jiang, Kui; Pan, Yunqian; Karnes, R Jeffrey; Zhang, Jun; Xu, Wanhai; Wang, Guixia; Huang, Haojie

    2016-03-22

    De novo fatty acid (FA) synthesis is required for prostate cancer (PCa) survival and progression. As a key enzyme for FA synthesis fatty acid synthase (FASN) is often overexpressed in human prostate cancers and its expression correlates with worse prognosis and poor survival. P300 is an acetyltransferase that acts as a transcription co-activator. Increasing evidence suggests that P300 is a major PCa promoter, although the underlying mechanism remains poorly understood. Here, we demonstrated that P300 binds to and increases histone H3 lysine 27 acetylation (H3K27Ac) in the FASN gene promoter. We provided evidence that P300 transcriptionally upregulates FASN expression and promotes lipid accumulation in human PCa cells in culture and Pten knockout prostate tumors in mice. Pharmacological inhibition of P300 decreased FASN expression and lipid droplet accumulation in PCa cells. Immunohistochemistry analysis revealed that expression of P300 protein positively correlates with FASN protein levels in a cohort of human PCa specimens. We further showed that FASN is a key mediator of P300-induced growth of PCa cells in culture and in mice. Together, our findings demonstrate P300 as a key factor that regulates FASN expression, lipid accumulation and cell growth in PCa. They also suggest that this regulatory pathway can serve as a new therapeutic target for PCa treatment. PMID:26934656

  8. P300 acetyltransferase regulates fatty acid synthase expression, lipid metabolism and prostate cancer growth.

    PubMed

    Gang, Xiaokun; Yang, Yinhui; Zhong, Jian; Jiang, Kui; Pan, Yunqian; Karnes, R Jeffrey; Zhang, Jun; Xu, Wanhai; Wang, Guixia; Huang, Haojie

    2016-03-22

    De novo fatty acid (FA) synthesis is required for prostate cancer (PCa) survival and progression. As a key enzyme for FA synthesis fatty acid synthase (FASN) is often overexpressed in human prostate cancers and its expression correlates with worse prognosis and poor survival. P300 is an acetyltransferase that acts as a transcription co-activator. Increasing evidence suggests that P300 is a major PCa promoter, although the underlying mechanism remains poorly understood. Here, we demonstrated that P300 binds to and increases histone H3 lysine 27 acetylation (H3K27Ac) in the FASN gene promoter. We provided evidence that P300 transcriptionally upregulates FASN expression and promotes lipid accumulation in human PCa cells in culture and Pten knockout prostate tumors in mice. Pharmacological inhibition of P300 decreased FASN expression and lipid droplet accumulation in PCa cells. Immunohistochemistry analysis revealed that expression of P300 protein positively correlates with FASN protein levels in a cohort of human PCa specimens. We further showed that FASN is a key mediator of P300-induced growth of PCa cells in culture and in mice. Together, our findings demonstrate P300 as a key factor that regulates FASN expression, lipid accumulation and cell growth in PCa. They also suggest that this regulatory pathway can serve as a new therapeutic target for PCa treatment.

  9. P300 acetyltransferase regulates fatty acid synthase expression, lipid metabolism and prostate cancer growth

    PubMed Central

    Zhong, Jian; Jiang, Kui; Pan, Yunqian; Karnes, R. Jeffrey; Zhang, Jun; Xu, Wanhai; Wang, Guixia; Huang, Haojie

    2016-01-01

    De novo fatty acid (FA) synthesis is required for prostate cancer (PCa) survival and progression. As a key enzyme for FA synthesis fatty acid synthase (FASN) is often overexpressed in human prostate cancers and its expression correlates with worse prognosis and poor survival. P300 is an acetyltransferase that acts as a transcription co-activator. Increasing evidence suggests that P300 is a major PCa promoter, although the underlying mechanism remains poorly understood. Here, we demonstrated that P300 binds to and increases histone H3 lysine 27 acetylation (H3K27Ac) in the FASN gene promoter. We provided evidence that P300 transcriptionally upregulates FASN expression and promotes lipid accumulation in human PCa cells in culture and Pten knockout prostate tumors in mice. Pharmacological inhibition of P300 decreased FASN expression and lipid droplet accumulation in PCa cells. Immunohistochemistry analysis revealed that expression of P300 protein positively correlates with FASN protein levels in a cohort of human PCa specimens. We further showed that FASN is a key mediator of P300-induced growth of PCa cells in culture and in mice. Together, our findings demonstrate P300 as a key factor that regulates FASN expression, lipid accumulation and cell growth in PCa. They also suggest that this regulatory pathway can serve as a new therapeutic target for PCa treatment. PMID:26934656

  10. Cloning and characterization of a novel gene that encodes (S)-beta-bisabolene synthase from ginger, Zingiber officinale.

    PubMed

    Fujisawa, Masaki; Harada, Hisashi; Kenmoku, Hiromichi; Mizutani, Satoru; Misawa, Norihiko

    2010-06-01

    Ginger, Zingiber officinale Roscoe, contains a fragrant oil mainly composed of sesquiterpenes and monoterpenes. We isolated a cDNA that codes for a sesquiterpene synthase from young rhizomes of ginger, Z. officinale Roscoe, Japanese cultivar "Kintoki". The cDNA, designated ZoTps1, potentially encoded a protein that comprised 550 amino acid residues and exhibited 49-53% identity with those of the sesquiterpene synthases already isolated from the genus Zingiber. Recombinant Escherichia coli cells, in which ZoTps1 was coexpressed along with genes for D-mevalonate utilization, resulted in the production of a sesquiterpene (S)-beta-bisabolene exclusively with a D-mevalonolactone supplement. This result indicated that ZoTps1 was the (S)-beta-bisabolene synthase gene in ginger. ZoTPS1 was suggested to catalyze (S)-beta-bisabolene formation with the conversion of farnesyl diphosphate to nerolidyl diphosphate followed by the cyclization between position 1 and 6 carbons. The ZoTps1 transcript was detected in young rhizomes, but not in leaves, roots and mature rhizomes of the ginger "Kintoki". PMID:20229191

  11. The maize An2 gene is induced by Fusarium attack and encodes an ent-copalyl diphosphate synthase.

    PubMed

    Harris, L J; Saparno, A; Johnston, A; Prisic, S; Xu, M; Allard, S; Kathiresan, A; Ouellet, T; Peters, R J

    2005-12-01

    Using the technique of differential display, a maize transcript was identified whose silk tissue expression is induced in the presence of the ear rot pathogen Fusarium graminearum. The 3445 nt transcript includes a 727 nt 5' untranslated leader with the potential for extensive secondary structure and represents the maize gene An2. An2 encodes a copalyl diphosphate synthase (CPS)-like protein with 60% amino acid sequence identity with the maize An1 gene product involved in gibberellin (GA) biosynthesis. Recombinant expression and functional analysis demonstrated that both AN1 and AN2 are ent-copalyl diphosphate (ent-CPP) synthases (ent-CPS). Notably, the presence of an additional ent-CPS gene is consistent with previous reports that maize GA biosynthesis can proceed in the absence of An1. In addition, northern blot analysis showed that An2 transcript levels were strongly up-regulated by Fusarium attack, with an increase in silk, husk and ear tip tissues as early as 6 h after inoculation of silk channels with spore suspensions of various Fusarium sp. Gene expression of a third maize CPS-like gene, Cpsl1, is not affected by Fusarium infection. The Fusarium-inducible nature of An2 is also consistent with a previous report that cell-free extracts from maize seedlings produce ent-CPP derived diterpenes in response to Fusarium infection. However, it is not known whether An2 is involved in defense-related secondary metabolism in addition to GA synthesis.

  12. The role of 1-deoxy-d-xylulose-5-phosphate synthase and phytoene synthase gene family in citrus carotenoid accumulation.

    PubMed

    Peng, Gang; Wang, Chunyan; Song, Song; Fu, Xiumin; Azam, Muhammad; Grierson, Don; Xu, Changjie

    2013-10-01

    Three 1-deoxy-D-xylulose-5-phosphate synthases (DXS) and three phytoene synthases (PSY) were identified in citrus, from Affymetrix GeneChip Citrus Genome Array, GenBank and public orange genome databases. Tissue-specific expression analysis of these genes was carried out on fruit peel and flesh, flower and leaf of Satsuma mandarin (Citrus unshiu Marc.) in order to determine their roles in carotenoid accumulation in different tissues. Expression of CitDXS1 and CitPSY1 was highest in all test tissues, while that of CitDXS2 and CitPSY2 was lower, and that of CitDXS3 and CitPSY3 undetectable. The transcript profiles of CitDXS1 and CitPSY1 paralleled carotenoid accumulation in flesh of Satsuma mandarin and orange (Citrus sinensis Osbeck) during fruit development, and CitPSY1 expression was also associated with carotenoid accumulation in peel, while the CitDXS1 transcript level was only weakly correlated with carotenoid accumulation in peel. Similar results were obtained following correlation analysis between expression of CitDXS1 and CitPSY1 and carotenoid accumulation in peel and flesh of 16 citrus cultivars. These findings identify CitPSY1 and CitDXS1 as the main gene members controlling carotenoid biosynthesis in citrus fruit. Furthermore, chromoplasts were extracted from flesh tissue of these citrus, and chromoplasts of different shape (spindle or globular), different size, and color depth were observed in different cultivars, indicating chromoplast abundance, number per gram tissue, size and color depth were closely correlated with carotenoid content in most cultivars. The relationship between carotenoid biosynthesis and chromoplast development was discussed.

  13. Parallel evolution of the glycogen synthase 1 (muscle) gene Gys1 between Old World and New World fruit bats (Order: Chiroptera).

    PubMed

    Fang, Lu; Shen, Bin; Irwin, David M; Zhang, Shuyi

    2014-10-01

    Glycogen synthase, which catalyzes the synthesis of glycogen, is especially important for Old World (Pteropodidae) and New World (Phyllostomidae) fruit bats that ingest high-carbohydrate diets. Glycogen synthase 1, encoded by the Gys1 gene, is the glycogen synthase isozyme that functions in muscles. To determine whether Gys1 has undergone adaptive evolution in bats with carbohydrate-rich diets, in comparison to insect-eating sister bat taxa, we sequenced the coding region of the Gys1 gene from 10 species of bats, including two Old World fruit bats (Pteropodidae) and a New World fruit bat (Phyllostomidae). Our results show no evidence for positive selection in the Gys1 coding sequence on the ancestral Old World and the New World Artibeus lituratus branches. Tests for convergent evolution indicated convergence of the sequences and one parallel amino acid substitution (T395A) was detected on these branches, which was likely driven by natural selection.

  14. Small-Interfering RNAs from Natural Antisense Transcripts Derived from a Cellulose Synthase Gene Modulate Cell Wall Biosynthesis in Barley

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Viral-induced gene silencing of members of the cellulose synthase/cellulose synthase-like (CesA/Csl) gene superfamily in barley (Hordeum vulgare cv. Blackhulless) using the Barley Stripe Mosaic Virus reduced theincorporation of D-14C-Glc into cellulose and into mixed-linkage (1'3),(1'4)-'-D-glucans ...

  15. Identification and Characterization of a Novel Trehalose Synthase Gene Derived from Saline-Alkali Soil Metagenomes

    PubMed Central

    Zhang, Yang; Li, Yanping; Xu, Xian; Li, Shuang; He Huang

    2013-01-01

    A novel trehalose synthase (TreS) gene was identified from a metagenomic library of saline-alkali soil by a simple activity-based screening system. Sequence analysis revealed that TreS encodes a protein of 552 amino acids, with a deduced molecular weight of 63.3 kDa. After being overexpressed in Escherichia coli and purified, the enzymatic properties of TreS were investigated. The recombinant TreS displayed its optimal activity at pH 9.0 and 45 °C, and the addition of most common metal ions (1 or 30 mM) had no inhibition effect on the enzymatic activity evidently, except for the divalent metal ions Zn2+ and Hg2+. Kinetic analysis showed that the recombinant TreS had a 4.1-fold higher catalytic efficientcy (Kcat/Km) for maltose than for trehalose. The maximum conversion rate of maltose into trehalose by the TreS was reached more than 78% at a relatively high maltose concentration (30%), making it a good candidate in the large-scale production of trehalsoe after further study. In addition, five amino acid residues, His172, Asp201, Glu251, His318 and Asp319, were shown to be conserved in the TreS, which were also important for glycosyl hydrolase family 13 enzyme catalysis. PMID:24146994

  16. Human molybdopterin synthase gene: genomic structure and mutations in molybdenum cofactor deficiency type B.

    PubMed Central

    Reiss, J; Dorche, C; Stallmeyer, B; Mendel, R R; Cohen, N; Zabot, M T

    1999-01-01

    Biosynthesis of the molybdenum cofactor (MoCo) can be divided into (1) the formation of a precursor and (2) the latter's subsequent conversion, by molybdopterin synthase, into the organic moiety of MoCo. These two steps are reflected by the complementation groups A and B and the two formally distinguished types of MoCo deficiency that have an identical phenotype. Both types of MoCo deficiency result in a pleiotropic loss of all molybdoenzyme activities and cause severe neurological damage. MOCS1 is defective in patients with group A deficiency and has been shown to encode two enzymes for early synthesis via a bicistronic transcript with two consecutive open reading frames (ORFs). MOCS2 encodes the small and large subunits of molybdopterin synthase via a single transcript with two overlapping reading frames. This gene was mapped to 5q and comprises seven exons. The coding sequence and all splice site-junction sequences were screened for mutations, in MoCo-deficient patients in whom a previous search for MOCS1 mutations had been negative. In seven of the eight patients whom we investigated, we identified MOCS2 mutations that, by their nature, are most likely responsible for the deficiency. Three different frameshift mutations were observed, with one of them found on 7 of 14 identified alleles. Furthermore, a start-codon mutation and a missense mutation of a highly conserved amino acid residue were found. The locations of the mutations confirm the functional role of both ORFs. One of the patients with identified MOCS2 mutations had been classified as type B, in complementation studies. These findings support the hypothetical mechanism, for both forms of MoCo deficiency, that formerly had been established by cell-culture experiments. PMID:10053004

  17. Inhibition of spermidine synthase gene expression by transforming growth factor-beta 1 in hepatoma cells.

    PubMed Central

    Nishikawa, Y; Kar, S; Wiest, L; Pegg, A E; Carr, B I

    1997-01-01

    We screened genes responsive to transforming growth factor-beta (TGF-beta 1) protein in a human hepatoma cell line (Hep3B) using a PCR-mediated differential display technique, in order to investigate the mechanisms involved in TGF-beta-induced growth suppression. We found a gene that was down-regulated by TGF-beta 1 to be completely identical in an approx. 620 bp segment to the gene for the enzyme spermidine synthase, which mediates the conversion of putrescine into spermidine. Both spermidine synthase mRNA expression and its enzyme activity were decreased after TGF-beta 1 treatment of Hep3B cells. The inhibition of spermidine synthase gene expression by TGF-beta 1 protein was also observed in other hepatoma cell lines. The expression of genes for other biosynthetic enzymes in polyamine metabolism (ornithine decarboxylase and S-adenosylmethionine decarboxylase) was also inhibited to the same extent as for spermidine synthase, while the gene expression of spermidine/spermine N1-acetyltransferase, a catabolic enzyme, was relatively resistant to TGF-beta 1. Spermine levels in Hep3B cells were decreased by TGF-beta 1 treatment, although the levels of spermidine and putrescine were unchanged, probably due to compensation by remaining spermidine/spermine N1-acetyltransferase activity. Exogenously added spermidine or spermine, but not putrescine, partially antagonized the growth-inhibitor effects of TGF-beta 1 on Hep3B cells. Our data suggest that down-regulation of gene expression of the enzymes involved in polyamine metabolism, including spermidine synthase, may be associated with the mechanism of TGF-beta-induced growth suppression. PMID:9020892

  18. The human TruB family of pseudouridine synthase genes, including the Dyskeratosis Congenita 1 gene and the novel member TRUB1.

    PubMed

    Zucchini, Cinzia; Strippoli, Pierluigi; Biolchi, Alessia; Solmi, Rossella; Lenzi, Luca; D'Addabbo, Pietro; Carinci, Paolo; Valvassori, Luisa

    2003-06-01

    A novel human gene denominated TruB pseudouridine (psi) synthase homolog 1 (E. coli) (approved symbol, TRUB1) has been identified and characterized. Spanning approximately 40 kb on chromosome 10 and including 8 exons, TRUB1 is the first described human ortholog of bacterial TruB/psi55, a gene involved in tRNA pseudouridinilation. TRUB1 gene encodes a 349-amino acid product, with a VFAVHKPKGPTSA box in positions 71-83 corresponding to motif I of the TruB family (probably involved in conserving protein structure). The TruB domain of TRUB1 lies between W104 and I255, and contains another short motif, GGTLDS AARGVLVV, including the highly conserved D residue that characterizes motif II (involved in uridine recognition and in catalytic function of psi synthases). Northern blot analysis revealed that TRUB1 mRNA is widely expressed in various human tissues (especially heart, skeletal muscle and liver). Phylogenetic analysis of the TruB domain revealed another human gene (approved symbol TRUB2) encoding a conserved TruB domain, located on human chromosome 9. Thus, the human TruB family includes at least three members: i.e. DKC1 (previously identified), TRUB1 and TRUB2. The TRUB1 and TRUB2 products could be the hitherto unidentified human tRNA psi synthases. Although TRUB1 is not highly similar to DKC1/dyskerin (whose mutations cause X-linked dyskeratosis congenita) and putatively affects tRNA rather than rRNA modification, it is the most similar human protein to dyskerin. Study of TRUB1 (and TRUB2) should facilitate understanding of the molecular mechanisms of RNA modification and the involvement of psi synthases in human pathology, including dyskeratosis-like diseases.

  19. Mapping the functional topology of the animal fatty acid synthase by mutant complementation in vitro.

    PubMed

    Rangan, V S; Joshi, A K; Smith, S

    2001-09-11

    An in vitro mutant complementation approach has been used to map the functional topology of the animal fatty acid synthase. A series of knockout mutants was engineered, each mutant compromised in one of the seven functional domains, and heterodimers generated by hybridizing all possible combinations of the mutated subunits were isolated and characterized. Heterodimers comprised of a subunit containing either a beta-ketoacyl synthase or malonyl/acetyltransferase mutant, paired with a subunit containing mutations in any one of the other five domains, are active in fatty acid synthesis. Heterodimers in which both subunits carry a knockout mutation in either the dehydrase, enoyl reductase, keto reductase, or acyl carrier protein are inactive. Heterodimers comprised of a subunit containing a thioesterase mutation paired with a subunit containing a mutation in either the dehydrase, enoyl reductase, beta-ketoacyl reductase, or acyl carrier protein domains exhibit very low fatty acid synthetic ability. The results are consistent with a model for the fatty acid synthase in which the substrate loading and condensation reactions are catalyzed by cooperation of an acyl carrier protein domain of one subunit with the malonyl/acetyltransferase or beta-ketoacyl synthase domains, respectively, of either subunit. The beta-carbon-processing reactions, responsible for the complete reduction of the beta-ketoacyl moiety following each condensation step, are catalyzed by cooperation of an acyl carrier protein domain with the beta-ketoacyl reductase, dehydrase, and enoyl reductase domains associated exclusively with the same subunit. The chain-terminating reaction is carried out most efficiently by cooperation of an acyl carrier protein domain with the thioesterase domain of the same subunit. These results are discussed in the context of a revised model for the fatty acid synthase.

  20. Lysophosphatidic acid-mediated signal-transduction pathways involved in the induction of the early-response genes prostaglandin G/H synthase-2 and Egr-1: a critical role for the mitogen-activated protein kinase p38 and for Rho proteins.

    PubMed Central

    Reiser, C O; Lanz, T; Hofmann, F; Hofer, G; Rupprecht, H D; Goppelt-Struebe, M

    1998-01-01

    During inflammatory processes of the kidney, lesions of the glomerulus lead to aggregation of thrombocytes and infiltration of macrophages, which can release bioactive mediators. One of these important signalling molecules is lysophosphatidic acid (LPA). Incubation of rat mesangial cells with LPA induced mRNA and protein expression of the early-response genes pghs-2 (for prostaglandin G/H synthase-2/cyclo-oxygenase-2) and egr-1. As shown by antisense experiments, induction of egr-1 was related to the strong mitogenic effect of LPA. LPA-mediated gene expression was inhibited by pertussis toxin, indicating coupling to G-proteins of the Gi family. Specific inhibition of proteins of the small G-protein subfamily Rho with toxin B from Clostridium difficile led to changes in mesangial cell morphology without induction of apoptosis. LPA-mediated expression of pghs-2 and egr-1 was reduced to base-line levels by toxin B, indicating a role for Rho proteins in LPA-mediated gene induction. Of the two mitogen-activated protein kinase (MAPK) pathways investigated, the MAPK kinase-extracellular signal-regulated kinase pathway was involved in the induction of both pghs-2 and egr-1 mRNA expression, as shown by the inhibitory effect of PD98059. Activation of the MAPK p38, however, was only related to pghs-2 expression, whereas egr-1 expression was not affected by treatment of mesangial cells with the specific inhibitor SB203580. Taken together our data provide evidence that LPA-mediated activation of MAPK kinase and Rho proteins leads to the induction of the functionally distinct early-response genes pghs-2 and egr-1, whereas activation of MAPK p38 revealed considerable differences between the regulation of these two genes. PMID:9494074

  1. Molecular and phylogenetic characterization of the homoeologous EPSP Synthase genes of allohexaploid wheat, Triticum aestivum (L.)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: 5-Enolpyruvylshikimate-3-phosphate synthase (EPSPS) is the sixth and penultimate enzyme in the shikimate biosynthesis pathway. The EPSPS genes of allohexaploid wheat (Triticum aestivum, AABBDD) have not been well characterized. Herein, the three homoeologous copies of the wheat EPSPS gen...

  2. A case of primary selective hypoaldosteronism carrying three mutations in the aldosterone synthase (Cyp11b2) gene.

    PubMed

    Taranta, Anna; Bizzarri, Carla; Masotti, Andrea; Sciré, Giuseppe; Pampanini, Valentina; Cappa, Marco

    2012-05-25

    An infant with a clinical phenotype of early onset hypoaldosteronism has been screened for mutation analysis of the Cyp11b2 gene encoding aldosterone synthase enzyme. We have described a novel nonsense mutation in exon 3 (c.508C>T) that gave rise to a shorter protein (Q170X) and two known concurrent missense mutations (c.594A>C in exon 3 and c.1157T>C in exon 7) that led to substitution of glutamic acid for aspartic acid at amino acid position 198 (E198D) and of valine for alanine at amino acid position 386 (V386A). The father, who carried E198D plus V386A mutations, showed a fractional sodium excretion of 1.25% that was unmodified by dietary salt restriction, suggesting a mild haploinsufficiency. We examined by in silico analysis the effect of the mutations on the secondary and tertiary structures of aldosterone synthase to explain the inefficient enzymatic activity. The Q170X mutation produced a truncated protein, which was consequently associated with a loss of catalytic activity. As predicted by JPred web system and Dock 6.3 software, the concurrent expression of E198D and V386A mutations induced a significant secondary structure rearrangement and a shift of the heme group and the 18-hydroxycorticosterone substrate from their optimal placement.

  3. Induction of isoprenyl diphosphate synthases, plant hormones and defense signalling genes correlates with traumatic resin duct formation in Norway spruce (Picea abies).

    PubMed

    Schmidt, Axel; Nagel, Raimund; Krekling, Trygve; Christiansen, Erik; Gershenzon, Jonathan; Krokene, Paal

    2011-12-01

    Norway spruce (Picea abies) defends itself against herbivores and pathogens by formation of traumatic resin ducts filled with terpenoid-based oleoresin. An important group of enzymes in terpenoid biosynthesis are the short-chain isoprenyl diphosphate synthases which produce geranyl diphosphate (C(10)), farnesyl diphosphate (C(15)), and geranylgeranyl diphosphate (C(20)) as precursors of monoterpenes, sesquiterpenes, and diterpene resin acids, respectively. After treatment with methyl jasmonate (MJ) we investigated the expression of all isoprenyl diphosphate synthase genes characterized to date from Norway spruce and correlated this with formation of traumatic resin ducts and terpene accumulation. Formation of traumatic resin ducts correlated with higher amounts of monoterpenes, sesquiterpenes and diterpene resin acids and an upregulation of isoprenyl diphosphate synthase genes producing geranyl diphosphate or geranylgeranyl diphosphate. Among defense hormones, jasmonate and jasmonate-isoleucine conjugate accumulated to higher levels in trees with extensive traumatic resin duct formation, whereas salicylate did not. Jasmonate and ethylene are likely to both be involved in formation of traumatic resin ducts based on elevated transcripts of genes encoding lipoxygenase and 1-aminocyclopropane-1-carboxylic acid oxidase associated with resin duct formation. Other genes involved in defense signalling in other systems, mitogen-activated protein kinase3 and nonexpressor of pathogenesis-related gene1, were also associated with traumatic resin duct formation. These responses were detected not only at the site of MJ treatment, but also systemically up to 60 cm above the site of treatment on the trunk.

  4. {alpha}-Lipoic acid prevents lipotoxic cardiomyopathy in acyl CoA-synthase transgenic mice

    SciTech Connect

    Lee, Young; Naseem, R. Haris; Park, Byung-Hyun; Garry, Daniel J.; Richardson, James A.; Schaffer, Jean E.; Unger, Roger H. . E-mail: roger.unger@utsouthwestern.edu

    2006-05-26

    {alpha}-Lipoic acid ({alpha}-LA) mimics the hypothalamic actions of leptin on food intake, energy expenditure, and activation of AMP-activated protein kinase (AMPK). To determine if, like leptin, {alpha}-LA protects against cardiac lipotoxicity, {alpha}-LA was fed to transgenic mice with cardiomyocyte-specific overexpression of the acyl CoA synthase (ACS) gene. Untreated ACS-transgenic mice died prematurely with increased triacylglycerol content and dilated cardiomyopathy, impaired systolic function and myofiber disorganization, apoptosis, and interstitial fibrosis on microscopy. In {alpha}-LA-treated ACS-transgenic mice heart size, echocardiogram and TG content were normal. Plasma TG fell 50%, hepatic-activated phospho-AMPK rose 6-fold, sterol regulatory element-binding protein-1c declined 50%, and peroxisome proliferator-activated receptor-{gamma} cofactor-1{alpha} mRNA rose 4-fold. Since food restriction did not prevent lipotoxicity, we conclude that {alpha}-LA treatment, like hyperleptinemia, protects the heart of ACS-transgenic mice from lipotoxicity.

  5. Engineering of an active animal fatty acid synthase dimer with only one competent subunit.

    PubMed

    Joshi, Anil K; Rangan, Vangipuram S; Witkowski, Andrzej; Smith, Stuart

    2003-02-01

    Animal fatty acid synthases are large polypeptides containing seven functional domains that are active only in the dimeric form. Inactivity of the monomeric form has long been attributed to the obligatory participation of domains from both subunits in catalysis of substrate loading and condensation reactions. However, we have engineered a fatty acid synthase containing one wild-type subunit and one subunit compromised by mutations in all seven functional domains that is active in fatty acid synthesis. This finding indicates that a single subunit, in the context of a dimer, is able to catalyze the entire biosynthetic pathway and suggests that, in the natural complex, each of the two subunits forms a scaffold that optimizes the conformation of the companion subunit.

  6. Disruption of homocitrate synthase genes in Candida albicans affects growth but not virulence.

    PubMed

    Kur, Krzysztof; Gabriel, Iwona; Morschhäuser, Joachim; Barchiesi, Francesco; Spreghini, Elisabetta; Milewski, Sławomir

    2010-12-01

    Two genes, LYS21 and LYS22, encoding isoforms of homocitrate synthase, an enzyme catalysing the first committed step in the lysine biosynthetic pathway, were disrupted in Candida albicans using the SAT1 flipper strategy. The double null lys21Δ/lys22Δ mutant lacked homocitrate synthase activity and exhibited lysine auxotrophy in minimal media that could be fully rescued by the addition of 0.5-0.6 mM L: -lysine. On the other hand, its virulence in vivo in the model of disseminated murine candidiasis appeared identical to that of the mother, wild-type strain. These findings strongly question a possibility of exploitation of homocitrate synthase and possibly also other enzymes of the lysine biosynthetic pathway as targets in chemotherapy of disseminated fungal infections.

  7. EXPRESSION OF THE GEOSMIN SYNTHASE GENE IN THE CYANOBACTERIUM ANABAENA CIRCINALIS AWQC318(1).

    PubMed

    Giglio, Steven; Saint, Christopher P; Monis, Paul T

    2011-12-01

    The occurrence of taste and odor episodes attributed to geosmin continues to trouble water utilities worldwide, and only recently have advances been made in our fundamental understanding of the biochemical and genetic mechanisms responsible for the production of geosmin in microorganisms. For the first time, we have examined the expression of the geosmin synthase gene and corresponding geosmin production by Anabaena circinalis Rabenh. ex Bornet et Flahault AWQC318 under conditions of continuous light illumination and the removal of light as a stimulus and demonstrate that the expression of geosmin synthase appears to be constitutive under these conditions. The decrease in geosmin synthase transcription post maximum cell numbers and stationary phase suggests that a decrease in isoprenoid synthesis may occur before a decrease in the transcription of ribosomal units as the process of cell death is initiated.

  8. Tolerance to toxic metals by a gene family of phytochelatin synthases from plants and yeast.

    PubMed

    Clemens, S; Kim, E J; Neumann, D; Schroeder, J I

    1999-06-15

    Phytochelatins play major roles in metal detoxification in plants and fungi. However, genes encoding phytochelatin synthases have not yet been identified. By screening for plant genes mediating metal tolerance we identified a wheat cDNA, TaPCS1, whose expression in Saccharomyces cerevisiae results in a dramatic increase in cadmium tolerance. TaPCS1 encodes a protein of approximately 55 kDa with no similarity to proteins of known function. We identified homologs of this new gene family from Arabidopsis thaliana, Schizosaccharomyces pombe, and interestingly also Caenorhabditis elegans. The Arabidopsis and S.pombe genes were also demonstrated to confer substantial increases in metal tolerance in yeast. PCS-expressing cells accumulate more Cd2+ than controls. PCS expression mediates Cd2+ tolerance even in yeast mutants that are either deficient in vacuolar acidification or impaired in vacuolar biogenesis. PCS-induced metal resistance is lost upon exposure to an inhibitor of glutathione biosynthesis, a process necessary for phytochelatin formation. Schizosaccharomyces pombe cells disrupted in the PCS gene exhibit hypersensitivity to Cd2+ and Cu2+ and are unable to synthesize phytochelatins upon Cd2+ exposure as determined by HPLC analysis. Saccharomyces cerevisiae cells expressing PCS produce phytochelatins. Moreover, the recombinant purified S.pombe PCS protein displays phytochelatin synthase activity. These data demonstrate that PCS genes encode phytochelatin synthases and mediate metal detoxification in eukaryotes.

  9. Tolerance to toxic metals by a gene family of phytochelatin synthases from plants and yeast.

    PubMed

    Clemens, S; Kim, E J; Neumann, D; Schroeder, J I

    1999-06-15

    Phytochelatins play major roles in metal detoxification in plants and fungi. However, genes encoding phytochelatin synthases have not yet been identified. By screening for plant genes mediating metal tolerance we identified a wheat cDNA, TaPCS1, whose expression in Saccharomyces cerevisiae results in a dramatic increase in cadmium tolerance. TaPCS1 encodes a protein of approximately 55 kDa with no similarity to proteins of known function. We identified homologs of this new gene family from Arabidopsis thaliana, Schizosaccharomyces pombe, and interestingly also Caenorhabditis elegans. The Arabidopsis and S.pombe genes were also demonstrated to confer substantial increases in metal tolerance in yeast. PCS-expressing cells accumulate more Cd2+ than controls. PCS expression mediates Cd2+ tolerance even in yeast mutants that are either deficient in vacuolar acidification or impaired in vacuolar biogenesis. PCS-induced metal resistance is lost upon exposure to an inhibitor of glutathione biosynthesis, a process necessary for phytochelatin formation. Schizosaccharomyces pombe cells disrupted in the PCS gene exhibit hypersensitivity to Cd2+ and Cu2+ and are unable to synthesize phytochelatins upon Cd2+ exposure as determined by HPLC analysis. Saccharomyces cerevisiae cells expressing PCS produce phytochelatins. Moreover, the recombinant purified S.pombe PCS protein displays phytochelatin synthase activity. These data demonstrate that PCS genes encode phytochelatin synthases and mediate metal detoxification in eukaryotes. PMID:10369673

  10. An active site mutant of Escherichia coli cyclopropane fatty acid synthase forms new non-natural fatty acids providing insights on the mechanism of the enzymatic reaction.

    PubMed

    E, Guangqi; Drujon, Thierry; Correia, Isabelle; Ploux, Olivier; Guianvarc'h, Dominique

    2013-12-01

    We have produced and purified an active site mutant of the Escherichia coli cyclopropane fatty acid synthase (CFAS) by replacing the strictly conserved G236 within cyclopropane synthases, by a glutamate residue, which corresponds to E146 of the homologous mycolic acid methyltransferase, Hma, producing hydroxymethyl mycolic acids. The G236E CFAS mutant had less than 1% of the in vitro activity of the wild type enzyme. We expressed the G236E CFAS mutant in an E. coli (DE3) strain in which the chromosomal cfa gene had been deleted. After extraction of phospholipids and conversion into the corresponding fatty acid methyl esters (FAMEs), we observed the formation of cyclopropanated FAMEs suggesting that the mutant retained some of the normal activity in vivo. However, we also observed the formation of new C17 methyl-branched unsaturated FAMEs whose structures were determined using GC/MS and NMR analyses. The double bond was located at different positions 8, 9 or 10, and the methyl group at position 10 or 9. Thus, this new FAMEs are likely arising from a 16:1 acyl chain of a phospholipid that had been transformed by the G236E CFAS mutant in vivo. The reaction catalyzed by this G236E CFAS mutant thus starts by the methylation of the unsaturated acyl chain at position 10 or 9 yielding a carbocation at position 9 or 10 respectively. It follows then two competing steps, a normal cyclopropanation or hydride shift/elimination events giving different combinations of alkenes. This study not only provides further evidence that cyclopropane synthases (CSs) form a carbocationic intermediate but also opens the way to CSs engineering for the synthesis of non-natural fatty acids.

  11. Bacterial lipopolysaccharide induction of the prostaglandin G/H synthase 2 gene causes thromboxane-dependent pulmonary hypertension in rabbits.

    PubMed

    Delong, P; O'Sullivan, M G; Huggins, E; Hubbard, C L; McCall, C

    1999-03-01

    Two genes encode proteins with prostaglandin G/H synthase (PGHS) activity. PGHS-1 is primarily a constitutively expressed gene, whereas inflammatory agents such as bacterial lipopolysaccharide (LPS) endotoxin rapidly induce the PGHS-2 gene in leukocytes. Both PGHS-1 and PGHS-2 are rate-limiting enzymes for the production of prostaglandins and thromboxane following release of arachidonic acid by phospholipases. We previously reported that LPS perfusion into the circulation of isolated perfused rabbit lung (IPL) results in thromboxane-dependent pulmonary hypertension and lung edema when the LPS-primed lung is subsequently stimulated with platelet activating factor (PAF) (J. Clin. Invest. 1990;85:1135). In this study, we showed that the mechanism by which LPS primes IPL for enhanced production of thromboxane and pulmonary hypertension in response to PAF depends on specific upregulation of the PGHS-2 gene in the rabbit lung. LPS perfusion of IPL induced PGHS-2 gene expression, which correlated with the conversion of free arachidonic acid to thromboxane-B2 (TXB2) and the onset of pulmonary hypertension. LPS-induced PGHS-2 expression, TXB2 release, and pulmonary hypertension were inhibited by actinomycin D (an inhibitor of transcription) and cycloheximide (an inhibitor of protein synthesis). The constitutively expressed PGHS-1 remained unchanged with LPS perfusion, and did not convert free arachidonic acid to TXB2, suggesting that PGHS-1 does not contribute to the induction of pulmonary hypertension by LPS. These studies reveal a pathogenic role for induction of PGHS-2 in lung injury.

  12. Identification of an insulin response element in the fatty acid synthase promoter.

    PubMed

    Moustaïd, N; Beyer, R S; Sul, H S

    1994-02-25

    We have previously reported that insulin increases fatty acid synthase (FAS) gene transcription, and that sequences responsible for positive regulation are located within the first 332 base pairs of the FAS promoter. To define minimal sequences required for insulin regulation within this region, chimeric constructs containing serial 5' deletions starting at -318 and extending through position +67 of the rat FAS gene ligated to the luciferase reporter gene were transfected into 3T3-L1 adipocytes. Insulin treatment at 10 nM increased luciferase activity 2-3-fold in 3T3-L1 adipocytes transfected with constructs containing progressive deletions from -318 to -67. This stimulation of the FAS promoter activity by insulin was dose-dependent. However, no effect of insulin was observed when fusion constructs containing FAS promoter sequences spanning from -25 or from -19 to +67 were transfected into adipocytes. These results suggest that the insulin response sequences of the FAS gene may be located in the region from -67 to -25. DNase I footprinting using liver nuclear extracts revealed a protected region spanning -71 and -50 in addition to a region near the putative TATA box. Gel mobility shift assays using the sequence from -71 to -50 as a probe revealed nuclear factor(s) from mouse liver and 3T3-L1 adipocytes that specifically complexed with this sequence. Mutational analysis of this region showed that sequences between -68 and -60 are essential for recognition and interaction with a trans-acting factor(s). Moreover, when three tandem repeats of the sequences spanning -68 to -52 were linked to the SV40 promoter and used for transfection, luciferase activity increased 3.6-fold in response to insulin treatment. Thus, we have identified novel cis-acting DNA sequences responsible for insulin regulation of the FAS gene, which interact with nuclear protein(s) from liver and adipocytes and which are found to share limited homology to insulin response sequences present in other

  13. Citrate synthase mutants of Agrobacterium are attenuated in virulence and display reduced vir gene induction.

    PubMed

    Suksomtip, Maneewan; Liu, Pu; Anderson, Tamara; Tungpradabkul, Sumalee; Wood, Derek W; Nester, Eugene W

    2005-07-01

    A citrate synthase (CS) deletion mutant of Agrobacterium tumefaciens C58 is highly attenuated in virulence. The identity of the mutant was initially determined from its amino acid sequence, which is 68% identical to Escherichia coli and 77% identical to Brucella melitensis. The mutant lost all CS enzymatic activity, and a cloned CS gene complemented a CS mutation in Sinorhizobium. The CS mutation resulted in a 10-fold reduction in vir gene expression, which likely accounts for the attenuated virulence. When a plasmid containing a constitutive virG [virG(Con)] locus was introduced into this mutant, the level of vir gene induction was restored to nearly wild-type level. Further, the virG(Con)-complemented CS mutant strain induced tumors that were similar in size and number to those induced by the parental strain. The CS mutation resulted in only a minor reduction in growth rate in a glucose-salts medium. Both the CS mutant and the virG(Con)-complemented CS strain displayed similar growth deficiencies in a glucose-salts medium, indicating that the reduced growth rate of the CS mutant could not be responsible for the attenuated virulence. A search of the genome of A. tumefaciens C58 revealed four proteins, encoded on different replicons, with conserved CS motifs. However, only the locus that when mutated resulted in an attenuated phenotype has CS activity. Mutations in the other three loci did not result in attenuated virulence and any loss of CS activity, and none were able to complement the CS mutation in Sinorhizobium. The function of these loci remains unknown. PMID:15995199

  14. Cloning of the Nocardia corallina polyhydroxyalkanoate synthase gene and production of poly-(3-hydroxybutyrate-co-3-hydroxyhexanoate) and poly-(3-hydroxyvalerate-co-3-hydroxyheptanoate).

    PubMed

    Hall, B; Baldwin, J; Rhie, H G; Dennis, D

    1998-07-01

    The polyhydroxyalkanoate (PHA) synthase gene (phaCNc) from Nocardia corallina was identified in a lambda library on a 6-kb BamHI fragment. A 2.8-kb XhoII subfragment was found to contain the intact PHA synthase. This 2.8-kb fragment was subjected to DNA sequencing and was found to contain the coding region for the PHA synthase and a small downstream open reading frame of unknown function. On the basis of DNA sequence, phaCNc is closest in homology to the PHA synthases (phaCPaI and phaCPaII) of Pseudomonas aeruginosa (approximately 41% identity and 55% similarity). The 2.8-kb XhoII fragment containing phaCNc was subcloned into broad host range mobilizable plasmids and transferred into Escherichia coli, Klebsiella aerogenes (both containing a plasmid bearing phaA and phaB from Ralstonia eutropha), and PHA-negative strains of R. eutropha and Pseudomonas putida. The recombinant strains were grown on various carbon sources and the resulting polymers were analyzed. In these strains, the PHA synthase from N. corallina was able to mediate the production of poly(3-hydroxybutyrate-co-3-hydroxyhexanoate) containing high levels of 3-hydroxyhexanoate when grown on hexanoate and larger even-chain fatty acids and poly(3-hydroxyvalerate-co-3-hydroxyheptanoate) containing high levels of 3-hydroxyheptanoate when grown on heptanoate or larger odd-chain fatty acids.

  15. mRNA expressions of inducible nitric oxide synthase, endothelial nitric oxide synthase, and neuronal nitric oxide synthase genes in meningitis patients.

    PubMed

    Oztuzcu, Serdar; Igci, Yusuf Ziya; Arslan, Ahmet; Sivasli, Ercan; Ozkara, Esma; Igci, Mehri; Demiryürek, Seniz; Cengiz, Beyhan; Gogebakan, Bulent; Namiduru, Mustafa; Coskun, Mehmet Yavuz; Cakmak, Ecir Ali

    2011-03-01

    Meningitis is an inflammation of the protective membranes covering the brain and spinal cord caused by bacteria, fungi, or viruses with various clinical symptoms. Although meningitis is not so prevalent, it remains the most serious contagious disease. The aim of our study was to investigate the effect of gene expressions of nitric oxide synthases (NOS) on meningitis patients. Using samples taken from 61 meningitis patients, inducible NOS, endothelial NOS (eNOS), and neuronal NOS mRNA levels were assessed in both blood and cerebrospinal fluid (CSF). A control group was constructed of 64 healthy persons. The gene expression analysis was made using real-time polymerase chain reaction method. There was no neuronal NOS expression in either group, whereas inducible NOS expression was detected in 40 blood samples and 12 CSF samples from meningitis patients. However, there were no marked differences between groups (p=0.5104). eNOS expression was detected in all blood and CSF samples, which was markedly higher in patients (p=0.0367). Because the increase in eNOS expression increases NO production, eNOS expression in meningitis patients is of great importance. This increase of eNOS in meningitis patients compared with healthy subjects may lead to novel treatments for reducing the severity of the disease.

  16. Crystallization of Δ{sup 1}-tetrahydrocannabinolic acid (THCA) synthase from Cannabis sativa

    SciTech Connect

    Shoyama, Yoshinari; Takeuchi, Ayako; Taura, Futoshi; Tamada, Taro; Adachi, Motoyasu; Kuroki, Ryota; Shoyama, Yukihiro; Morimoto, Satoshi

    2005-08-01

    Δ{sup 1}-Tetrahydrocannabinolic acid (THCA) synthase from C. sativa was crystallized. The crystal diffracted to 2.7 Å resolution with sufficient quality for further structure determination. Δ{sup 1}-Tetrahydrocannabinolic acid (THCA) synthase is a novel oxidoreductase that catalyzes the biosynthesis of the psychoactive compound THCA in Cannabis sativa (Mexican strain). In order to investigate the structure–function relationship of THCA synthase, this enzyme was overproduced in insect cells, purified and finally crystallized in 0.1 M HEPES buffer pH 7.5 containing 1.4 M sodium citrate. A single crystal suitable for X-ray diffraction measurement was obtained in 0.09 M HEPES buffer pH 7.5 containing 1.26 M sodium citrate. The crystal diffracted to 2.7 Å resolution at beamline BL41XU, SPring-8. The crystal belonged to the primitive cubic space group P432, with unit-cell parameters a = b = c = 178.2 Å. The calculated Matthews coefficient was approximately 4.1 or 2.0 Å{sup 3} Da{sup −1} assuming the presence of one or two molecules of THCA synthase in the asymmetric unit, respectively.

  17. Coexpressing Escherichia coli Cyclopropane Synthase with Sterculia foetida Lysophosphatidic Acid Acyltransferase Enhances Cyclopropane Fatty Acid Accumulation1[W][OPEN

    PubMed Central

    Yu, Xiao-Hong; Prakash, Richa Rawat; Sweet, Marie; Shanklin, John

    2014-01-01

    Cyclopropane fatty acids (CPAs) are desirable as renewable chemical feedstocks for the production of paints, plastics, and lubricants. Toward our goal of creating a CPA-accumulating crop, we expressed nine higher plant cyclopropane synthase (CPS) enzymes in the seeds of fad2fae1 Arabidopsis (Arabidopsis thaliana) and observed accumulation of less than 1% CPA. Surprisingly, expression of the Escherichia coli CPS gene resulted in the accumulation of up to 9.1% CPA in the seed. Coexpression of a Sterculia foetida lysophosphatidic acid acyltransferase (SfLPAT) increases CPA accumulation up to 35% in individual T1 seeds. However, seeds with more than 9% CPA exhibit wrinkled seed morphology and reduced size and oil accumulation. Seeds with more than 11% CPA exhibit strongly decreased seed germination and establishment, and no seeds with CPA more than 15% germinated. That previous reports suggest that plant CPS prefers the stereospecific numbering (sn)-1 position whereas E. coli CPS acts on sn-2 of phospholipids prompted us to investigate the preferred positions of CPS on phosphatidylcholine (PC) and triacylglycerol. Unexpectedly, in planta, E. coli CPS acts primarily on the sn-1 position of PC; coexpression of SfLPAT results in the incorporation of CPA at the sn-2 position of lysophosphatidic acid. This enables a cycle that enriches CPA at both sn-1 and sn-2 positions of PC and results in increased accumulation of CPA. These data provide proof of principle that CPA can accumulate to high levels in transgenic seeds and sets the stage for the identification of factors that will facilitate the movement of CPA from PC into triacylglycerol to produce viable seeds with additional CPA accumulation. PMID:24204024

  18. [Advances of resveratrol synthase gene in the application of genetic engineering and biofunctional investigation].

    PubMed

    Zheng, Shigang; Li, Zhen; Zhao, Shancang; Wang, Qingguo; Liu, Wei

    2014-03-01

    Resveratrol synthase (RS) plays a key role in resveratrol (Res) biosynthesis. RS gene has been formerly reported to be transformed into many plant species and microorganisms, and to play certain roles in metabolic and regulation processes. In this paper, the transformations of RS gene in plants, and the related changes of biological properties, such as metabolites, anti-pathogen activities, anti-radical properties, and developmental characters in transgenic plants, as well as the production of resveratrol in microbes by utilizing RS gene were summarized. Moreover, the application prospects of RS gene in bioengineering were also addressed.

  19. Molecular characterization and expression analyses of an anthocyanin synthase gene from Magnolia sprengeri Pamp.

    PubMed

    Shi, Shou-Guo; Li, Shan-Ju; Kang, Yong-Xiang; Liu, Jian-Jun

    2015-01-01

    Anthocyanin synthase (ANS), which catalyzes the conversion of colorless leucoanthocyanins into colored anthocyanins, is a key enzyme in the anthocyanin biosynthetic pathway. It plays important roles in plant development and defense. An ANS gene designated as MsANS was cloned from Magnolia sprengeri using rapid amplification of complementary DNA (cDNA) ends technology. The full-length MsANS is 1171-bp long and contains a 1080-bp open reading frame encoding a 360 amino acid polypeptide. In a sequence alignment analysis, the deduced MsANS protein showed high identity to ANS proteins from other plants: Prunus salicina var. cordata (74 % identity), Ampelopsis grossedentata (74 % identity), Pyrus communis (73 % identity), and Prunus avium (73 % identity). A structural analysis showed that MsANS belongs to 2-oxoglutarate (2OG)- and ferrous iron-dependent oxygenase family because it contains three binding sites for 2OG. Real-time quantitative polymerase chain reaction analyses showed that the transcript level of MsANS was 26-fold higher in red petals than in white petals. The accumulation of anthocyanins in petals of white, pink, and red M. sprengeri flowers was analyzed by HPLC. The main anthocyanin was cyanidin-3-o-glucoside chloride, and the red petals contained the highest concentration of this pigment. PMID:25315387

  20. Cloning and expression analysis of chalcone synthase gene from Coleus forskohlii.

    PubMed

    Awasthi, Praveen; Mahajan, Vidushi; Jamwal, Vijay Lakshmi; Kapoor, Nitika; Rasool, Shafaq; Bedi, Yashbir S; Gandhi, Sumit G

    2016-09-01

    Flavonoids are an important class of secondary metabolites that play various roles in plants such as mediating defense, floral pigmentation and plant-microbe interaction. Flavonoids are also known to possess antioxidant and antimicrobial activities. Coleus forskohlii (Willd.) Briq. (Lamiaceae) is an important medicinal herb with a diverse metabolic profile, including production of a flavonoid, genkwanin. However, components of the flavonoid pathway have not yet been studied in this plant. Chalcone synthase (CHS) catalyses the first committed step of flavonoid biosynthetic pathway. Full-length cDNA, showing homology with plant CHS gene was isolated from leaves of C. forskohlii and named CfCHS (GenBank accession no. KF643243). Theoretical translation of CfCHS nucleotide sequence shows that it encodes a protein of 391 amino acids with a molecular weight of 42.75 kDa and pI 6.57. Expression analysis of CfCHS in different tissues and elicitor treatments showed that methyl jasmonate (MeJA) strongly induced its expression. Total flavonoids content and antioxidant activity of C. forskohlii also got enhanced in response to MeJA, which correlated with increased CfCHS expression. Induction of CfCHS by MeJA suggest its involvement in production of flavonoids, providing protection from microbes during herbivory or mechanical wounding. Further, our in silico predictions and experimental data suggested that CfCHS may be posttranscriptionally regulated by miR34. PMID:27659336

  1. Analysis of genetic variability and relationships among Mentha L. using the limonene synthase gene, LS.

    PubMed

    Wang, Hai Tang; Yu, Xu; Liu, Yan; Liang, Cheng-Yuan; Li, Wei-Lin

    2013-07-25

    The genus Mentha comprises a group of aromatic plants with worldwide distribution. Because of frequent interspecific hybridization, the genetic relationships within the genus are not clearly understood. Limonene synthase, which catalyses the first committed step in the essential oil monoterpene biosynthetic pathway, is considered to be a possible rate limiting enzyme. With the homology-based cloning method, primers were designed according to cDNA sequence to amplify full-length DNA sequences in 13 Mentha samples from five species, using Perilla as an outgroup. Analyses of gene structure, length variation, GC-content, Ts/Tv ratio and evolutionary diversity were carried out. Consensus phylogenetic trees were obtained using maximum likelihood, neighbor-joining, and maximum parsimony, respectively, based on the full-length genomic DNA sequences, complete ORF coding sequences and predicted amino acid sequences. The results presented here based on the sequence of MhLS provide the first credibly supported genetic relationships for Mentha, which enables a basis for further mint taxonomy, cultivation and breeding.

  2. Mining for Nonribosomal Peptide Synthetase and Polyketide Synthase Genes Revealed a High Level of Diversity in the Sphagnum Bog Metagenome

    PubMed Central

    Müller, Christina A.; Oberauner-Wappis, Lisa; Peyman, Armin; Amos, Gregory C. A.; Wellington, Elizabeth M. H.

    2015-01-01

    Sphagnum bog ecosystems are among the oldest vegetation forms harboring a specific microbial community and are known to produce an exceptionally wide variety of bioactive substances. Although the Sphagnum metagenome shows a rich secondary metabolism, the genes have not yet been explored. To analyze nonribosomal peptide synthetases (NRPSs) and polyketide synthases (PKSs), the diversity of NRPS and PKS genes in Sphagnum-associated metagenomes was investigated by in silico data mining and sequence-based screening (PCR amplification of 9,500 fosmid clones). The in silico Illumina-based metagenomic approach resulted in the identification of 279 NRPSs and 346 PKSs, as well as 40 PKS-NRPS hybrid gene sequences. The occurrence of NRPS sequences was strongly dominated by the members of the Protebacteria phylum, especially by species of the Burkholderia genus, while PKS sequences were mainly affiliated with Actinobacteria. Thirteen novel NRPS-related sequences were identified by PCR amplification screening, displaying amino acid identities of 48% to 91% to annotated sequences of members of the phyla Proteobacteria, Actinobacteria, and Cyanobacteria. Some of the identified metagenomic clones showed the closest similarity to peptide synthases from Burkholderia or Lysobacter, which are emerging bacterial sources of as-yet-undescribed bioactive metabolites. This report highlights the role of the extreme natural ecosystems as a promising source for detection of secondary compounds and enzymes, serving as a source for biotechnological applications. PMID:26002894

  3. Enhancement of carotenoids biosynthesis in Chlamydomonas reinhardtii by nuclear transformation using a phytoene synthase gene isolated from Chlorella zofingiensis.

    PubMed

    Cordero, Baldo F; Couso, Inmaculada; León, Rosa; Rodríguez, Herminia; Vargas, M Angeles

    2011-07-01

    The isolation and characterization of the phytoene synthase gene from the green microalga Chlorella zofingiensis (CzPSY), involved in the first step of the carotenoids biosynthetic pathway, have been performed. CzPSY gene encodes a polypeptide of 420 amino acids. A single copy of CzPSY has been found in C. zofingiensis by Southern blot analysis. Heterologous genetic complementation in Escherichia coli showed the ability of the predicted protein to catalyze the condensation of two molecules of geranylgeranyl pyrophosphate (GGPP) to form phytoene. Phylogenetic analysis has shown that the deduced protein forms a cluster with the rest of the phytoene synthases (PSY) of the chlorophycean microalgae studied, being very closely related to PSY of plants. This new isolated gene has been adequately inserted in a vector and expressed in Chlamydomonas reinhardtii. The overexpression of CzPSY in C. reinhardtii, by nuclear transformation, has led to an increase in the corresponding CzPSY transcript level as well as in the content of the carotenoids violaxanthin and lutein which were 2.0- and 2.2-fold higher than in untransformed cells. This is an example of manipulation of the carotenogenic pathway in eukaryotic microalgae, which can open up the possibility of enhancing the productivity of commercial carotenoids by molecular engineering. PMID:21519934

  4. Biosynthesis of riboflavin: cloning, sequencing, and expression of the gene coding for 3,4-dihydroxy-2-butanone 4-phosphate synthase of Escherichia coli.

    PubMed Central

    Richter, G; Volk, R; Krieger, C; Lahm, H W; Röthlisberger, U; Bacher, A

    1992-01-01

    3,4-Dihydroxy-2-butanone 4-phosphate is biosynthesized from ribulose 5-phosphate and serves as the biosynthetic precursor for the xylene ring of riboflavin. The gene coding for 3,4-dihydroxy-2-butanone 4-phosphate synthase of Escherichia coli has been cloned and sequenced. The gene codes for a protein of 217 amino acid residues with a calculated molecular mass of 23,349.6 Da. The enzyme was purified to near homogeneity from a recombinant E. coli strain and had a specific activity of 1,700 nmol mg-1 h-1. The N-terminal amino acid sequence and the amino acid composition of the protein were in agreement with the deduced sequence. The molecular mass as determined by ion spray mass spectrometry was 23,351 +/- 2 Da, which is in agreement with the predicted mass. The previously reported loci htrP, "luxH-like," and ribB at 66 min of the E. coli chromosome are all identical to the gene coding for 3,4-dihydroxy-2-butanone 4-phosphate synthase, but their role had not been hitherto determined. Sequence homology indicates that gene luxH of Vibrio harveyi and the central open reading frame of the Bacillus subtilis riboflavin operon code for 3,4-dihydroxy-2-butanone 4-phosphate synthase. Images PMID:1597419

  5. Assignment of the gene encoding glycogen synthase (GYS) to human chromosome 19, band q13,3

    SciTech Connect

    Lehto, M. Helsinki Univ. ); Stoffel, M.; Espinosa, R. III; Beau, M.M. le; Bell, G.I. ); Groop, L. )

    1993-02-01

    The enzyme glycogen synthase (UDP glocose:glycogen 4-[alpha]-D-glucosyltransferase, EC 2.4.1.11) catalyzes the formation of glycogen from uridine diphosphate glucose (UPDG). Impaired activation of muscle glycogen synthase by insulin has been noted in patients with genetic risk of developing non-insulin-dependent diabets mellitus (NIDDM) and this may represent an early defect in the pathogenesis of this disorder. As such, glycogen synthase represents a candidate gene for contributing to genetic susceptibility. As a first step in studying the role of glycogen synthase in the genetics of NIDDM, we have isolated a cosmid encoding the human glycogen synthase gene (gene symbol GYS) and determined its chromosomal localization by fluorescence in situ hybridization. 4 refs., 1 fig.

  6. Over-expression of a grape stilbene synthase gene in tomato induces parthenocarpy and causes abnormal pollen development.

    PubMed

    Ingrosso, Ilaria; Bonsegna, Stefania; De Domenico, Stefania; Laddomada, Barbara; Blando, Federica; Santino, Angelo; Giovinazzo, Giovanna

    2011-10-01

    A novel strategy to induce parthenocarpy in tomato fruits by the induction of resveratrol biosynthesis in flower tissues was exploited. Two transgenic tomato lines were considered: a higher resveratrol-producing (35SS) line, constitutively expressing a grape stilbene synthase cDNA, and a lower resveratrol-producing (LoxS) line, expressing stilbene synthase under a fruit-specific promoter. The expression of the stilbene synthase gene affected flavonoid metabolism in a different manner in the transgenic lines, and in one of these, the 35SS line, resulted in complete male sterility. Resveratrol was synthesised either in 35SS or LoxS tomato flowers, at an even higher extent (about 8-10 times) in the former line. We further investigated whether stilbene synthase expression may have resulted in impaired naringenin accumulation during flower development. In the 35SS flowers, naringenin was significantly impaired by about 50%, probably due to metabolic competition. Conversely, the amount of glycosylated flavonols increased in transgenic flowers, thereby excluding the diminished production of flavonols as a reason for parthenocarpy in tomato. We further investigated whether resveratrol synthesis may have resulted changes to pollen structure. Microscopic observations revealed the presence of few and abnormal flake-like pollen grains in 35SS flowers with no germination capability. Finally, the analysis of coumaric and ferulic acids, the precursors of lignin and sporopollenin biosynthesis, revealed significant depletion of these compounds, therefore suggesting an impairment in structural compounds as a reason for pollen ablation. These overall outcomes, to the best of our knowledge, reveal for the first time the major role displayed by resveratrol synthesis on parthenocarpy in tomato fruits. PMID:21843947

  7. Inhibition of Mycobacterium tuberculosis dihydrodipicolinate synthase by alpha-ketopimelic acid and its other structural analogues

    PubMed Central

    Shrivastava, Priyanka; Navratna, Vikas; Silla, Yumnam; Dewangan, Rikeshwer P.; Pramanik, Atreyi; Chaudhary, Sarika; Rayasam, GeethaVani; Kumar, Anuradha; Gopal, Balasubramanian; Ramachandran, Srinivasan

    2016-01-01

    The Mycobacterium tuberculosis dihydrodipicolinate synthase (Mtb-dapA) is an essential gene. Mtb-DapA catalyzes the aldol condensation between pyruvate and L-aspartate-beta-semialdehyde (ASA) to yield dihydrodipicolinate. In this work we tested the inhibitory effects of structural analogues of pyruvate on recombinant Mtb-DapA (Mtb-rDapA) using a coupled assay with recombinant dihydrodipicolinate reductase (Mtb-rDapB). Alpha-ketopimelic acid (α-KPA) showed maximum inhibition of 88% and IC50 of 21 μM in the presence of pyruvate (500 μM) and ASA (400 μM). Competition experiments with pyruvate and ASA revealed competition of α-KPA with pyruvate. Liquid chromatography-mass spectrometry (LC-MS) data with multiple reaction monitoring (MRM) showed that the relative abundance peak of final product, 2,3,4,5-tetrahydrodipicolinate, was decreased by 50%. Thermal shift assays showed 1 °C Tm shift of Mtb-rDapA upon binding α-KPA. The 2.4 Å crystal structure of Mtb-rDapA-α-KPA complex showed the interaction of critical residues at the active site with α-KPA. Molecular dynamics simulations over 500 ns of pyruvate docked to Mtb-DapA and of α-KPA-bound Mtb-rDapA revealed formation of hydrogen bonds with pyruvate throughout in contrast to α-KPA. Molecular descriptors analysis showed that ligands with polar surface area of 91.7 Å2 are likely inhibitors. In summary, α-hydroxypimelic acid and other analogues could be explored further as inhibitors of Mtb-DapA. PMID:27501775

  8. Regulation of Expression of Citrate Synthase by the Retinoic Acid Receptor-Related Orphan Receptor α (RORα)

    PubMed Central

    Crumbley, Christine; Wang, Yongjun; Banerjee, Subhashis; Burris, Thomas P.

    2012-01-01

    The retinoic acid receptor-related orphan receptor α (RORα) is a member of the nuclear receptor superfamily of transcription factors that plays an important role in regulation of the circadian rhythm and metabolism. Mice lacking a functional RORα display a range of metabolic abnormalities including decreased serum cholesterol and plasma triglycerides. Citrate synthase (CS) is a key enzyme of the citric acid cycle that provides energy for cellular function. Additionally, CS plays a critical role in providing citrate derived acetyl-CoA for lipogenesis and cholesterologenesis. Here, we identified a functional RORα response element (RORE) in the promoter of the CS gene. ChIP analysis demonstrates RORα occupancy of the CS promoter and a putative RORE binds to RORα effectively in an electrophoretic mobility shift assay and confers RORα responsiveness to a reporter gene in a cotransfection assay. We also observed a decrease in CS gene expression and CS enzymatic activity in the staggerer mouse, which has a mutation of in the Rora gene resulting in nonfunctional RORα protein. Furthermore, we found that SR1001 a RORα inverse agonist eliminated the circadian pattern of expression of CS mRNA in mice. These data suggest that CS is a direct RORα target gene and one mechanism by which RORα regulates lipid metabolism is via regulation of CS expression. PMID:22485150

  9. Stilbene synthase gene transfer caused alterations in the phenylpropanoid metabolism of transgenic strawberry (Fragaria x ananassa).

    PubMed

    Hanhineva, Kati; Kokko, Harri; Siljanen, Henri; Rogachev, Ilana; Aharoni, Asaph; Kärenlampi, Sirpa O

    2009-01-01

    The gene encoding stilbene synthase is frequently used to modify plant secondary metabolism with the aim of producing the self-defence phytoalexin resveratrol. In this study, strawberry (Fragaria x ananassa) was transformed with the NS-Vitis3 gene encoding stilbene synthase from frost grape (Vitis riparia) under the control of the cauliflower mosaic virus 35S and the floral filament-specific fil1 promoters. Changes in leaf metabolites were investigated with UPLC-qTOF-MS (ultra performance liquid chromatography-quadrupole time of flight mass spectrometry) profiling, and increased accumulation of cinnamate, coumarate, and ferulate derivatives concomitantly with a decrease in the levels of flavonols was observed, while the anticipated resveratrol or its derivatives were not detected. The changed metabolite profile suggested that chalcone synthase was down-regulated by the genetic modification; this was verified by decreased chalcone synthase transcript levels. Changes in the levels of phenolic compounds led to increased susceptibility of the transgenic strawberry to grey mould fungus.

  10. Expression of Sucrose Synthase Genes Involved in Enhanced Elongation of Pondweed (Potamogeton distinctus) Turions under Anoxia

    PubMed Central

    HARADA, TARO; SATOH, SHIGERU; YOSHIOKA, TOSHIHITO; ISHIZAWA, KIMIHARU

    2005-01-01

    • Background and Aims Overwintering buds (turions) of the monocot aquatic pondweed species (Potamogeton distinctus) are highly tolerant to anoxic stress. Sucrose metabolism accompanied by enhanced activity of sucrose synthase (SuSy) operates actively during anaerobic elongation of pondweed turions. The aim of this study is to isolate SuSy genes from the turions and to investigate their transcriptional changes in response to anoxia and other stimuli. • Methods SuSy genes were isolated from pondweed turions by PCR methods and transcript levels of SuSy genes were examined in response to anoxia, sugars and plant hormones. In addition, the effects of anoxia on SuSy activity were examined both in the soluble fraction and in the microsomal fraction. • Key Results cDNAs of two SuSy genes (PdSUS1 and PdSUS2) were cloned from pondweed turions. The levels of PdSUS1 transcripts increased under anoxia but did not with sugar treatments. Anoxia-stimulated elongation of turions was further enhanced by 2,4-dichlorophenoxyacetic acid (2,4-D) and suppressed by treatments with sorbitol, 2-deoxyglucose (2-dGlc) and abscisic acid (ABA). The levels of PdSUS1 transcripts were increased by 2,4-D and decreased by sorbitol under anoxia. The levels of PdSUS2 transcripts were not significantly affected by anoxia and any other treatments. SuSy activity of turions under anoxia was enhanced in the soluble fraction, but not in the microsomal fraction. • Conclusions Up-regulation of PdSUS1 transcription under anoxia may not be attributed to sugar starvation under anoxia. A positive correlation between stem elongation and the level of PdSUS1 transcripts was observed in turions treated with anoxic conditions, 2,4-D and sorbitol. The increase in SuSy activity in the cytosol may contribute to sugar metabolism and sustain stem elongation under anoxia. PMID:16033779

  11. Effect of abscisic and gibberellic acids on malate synthase transcripts in germinating castor bean seeds.

    PubMed

    Rodriguez, D; Dommes, J; Northcote, D H

    1987-05-01

    Several clones complementary to malate synthase mRNA have been identified in a complementary-DNA library to mRNA from castor bean endosperm. One of these clones has been used as a probe to measure levels of transcripts during seed germination and the effects of gibberellic acid and abscisic acid on these levels have been examined.Malate synthase transcripts increased during germination and GA3 advanced their appearance in the endosperm. Exogenously applied ABA inhibited the accumulation of transcripts over a time course of germination but the addition of GA3 counteracted its inhibitory effects. The data confirmed previous reports which indicated that the action of both growth regulators was on transcript accumulation and that there is a coordinated induction of the enzymes involved in the lipid metabolism in oil seeds.

  12. [Cellulose synthase genes that control the fiber formation of flax (Linum usitatissimum L.)].

    PubMed

    Galinovskiĭ, D V; Anisimova, N V; Raĭskiĭ, A P; Leont'ev, V N; Titok, V V; Hotyleva, L V

    2014-01-01

    Four cellulose synthase genes were identified by analysis of their class-specific regions (CSRII) in plants of fiber flax during the "rapid growth" stage. These genes were designated as LusCesA1, LusCesA4, LusCesA7 and LusCesA9. LusCesA4, LusCesA7, and LusCesA9 genes were expressed in the stem; LusCesA1 and LusCesA4 genes were expressed in the apex part of plants, and the LusCesA4 gene was expressed in the leaves of fiber flax. The expression of the LusCesA7 and LusCesA9 genes was specific to the stems of fiber flax. These genes may influence the quality of the flax fiber.

  13. Molecular cloning and expression profile of ß-ketoacyl-acp synthase gene from tung tree (Vernicia fordii Hemsl.)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Tung tree (Vernicia fordii) is an important woody oil tree. Tung tree seeds contain 50-60% oil with approximately 80 mole a-eleostearic acid (9cis, 11trans, 13trans octadecatrienoic acid). Fatty acid synthesis is catalyzed by the concerted action of acetyl-CoA carboxylase and fatty acid synthase, a ...

  14. Identification and Characterization of the Sucrose Synthase 2 Gene (Sus2) in Durum Wheat

    PubMed Central

    Volpicella, Mariateresa; Fanizza, Immacolata; Leoni, Claudia; Gadaleta, Agata; Nigro, Domenica; Gattulli, Bruno; Mangini, Giacomo; Blanco, Antonio; Ceci, Luigi R.

    2016-01-01

    Sucrose transport is the central system for the allocation of carbon resources in vascular plants. Sucrose synthase (SUS), which reversibly catalyzes sucrose synthesis and cleavage, represents a key enzyme in the control of the flow of carbon into starch biosynthesis. In the present study the genomic identification and characterization of the Sus2-2A and Sus2-2B genes coding for SUS in durum wheat (cultivars Ciccio and Svevo) is reported. The genes were analyzed for their expression in different tissues and at different seed maturation stages, in four tetraploid wheat genotypes (Svevo, Ciccio, Primadur, and 5-BIL42). The activity of the encoded proteins was evaluated by specific activity assays on endosperm extracts and their structure established by modeling approaches. The combined results of sucrose synthase 2 expression and activity levels were then considered in the light of their possible involvement in starch yield. PMID:27014292

  15. Cloning of an anthocyanidin synthase gene homolog from blackcurrant (Ribes nigrum L.) and its expression at different fruit stages.

    PubMed

    Li, X-G; Wang, J; Yu, Z-Y

    2015-01-01

    Anthocyanidin synthase (ANS), a 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase, catalyzes the penultimate step in anthocyanin biosynthesis, from leucoanthocyanidins to anthocyanidins, the first colored compound in the anthocyanin pathway. In this study, a full-length, 1427-bp long cDNA named RnANS1, which is homologous to the anthocyanidin synthase gene, was cloned from blackcurrant using a homologous cloning strategy. RnANS1 is highly homologous to other plant ANS genes at both the nucleotide and amino acid sequence levels. The deduced protein contains domains conserved in the 2OG and Fe(II)-dependent oxygenase, and is phylogenetically closely related to Paeonia suffruticosa and Paeonia lactiflora. The expression of RnANS1 was upregulated during fruit maturation, and correlated with the accumulation of anthocyanins and soluble carbohydrates in the fruit. Further characterization of the structure and expression patterns of RnANS1 will clarify our understanding of anthocyanin biosynthesis in blackcurrant, and support the development of molecular approaches to manipulate anthocyanin production in this plant. PMID:25867421

  16. Molecular cloning and expression analysis of an 1-aminocyclopropane-1-carboxylate synthase gene from Oncidium Gower Ramsey.

    PubMed

    Shi, Le-Song; Liu, Jin-Ping

    2016-01-01

    1-aminocyclopropane-1-carboxylic acid (ACC) synthase (ACS) is a rate-limiting enzyme in the biosynthesis of ethylene which regulates many aspects of the plant development and responses to biotic and abiotic stresses. In this study, a full-length cDNA of ACC synthase, OnACS2, was cloned from the senescing flower of Oncidium Gower Ramsey by RACE. The full-length cDNA of OnACS2 (GenBank accession no. JQ822087) was 1557 bp in length with an open reading frame (ORF) of 1308 bp encoding for a protein of 435 amino acid residues. The predicted OnACS2 protein had a molecular mass of 49.1 kDa with pI value of 7.51. Phylogenetic analysis indicated its evolutionary relationships with corresponding orthologous sequences in orchids, Hosta ventricosa and monocots. Real-time PCR assay demonstrated that OnACS2 was constitutively expressed in all tested organs with the highest transcript level in the gynandria. Differential expression pattern of OnACS2 gene correlated to the ethylene production and the subsequent occurrence of senescent symptoms in flower suggested that OnACS2 probably played an important role in the initiation of flower senescence. PMID:26631967

  17. Expression pattern of the coparyl diphosphate synthase gene in developing rice anthers.

    PubMed

    Fukuda, Ari; Nemoto, Keisuke; Chono, Makiko; Yamaguchi, Shinjiro; Nakajima, Masatoshi; Yamagishi, Junko; Maekawa, Masahiko; Yamaguchi, Isomaro

    2004-08-01

    Rice anthers contain high concentrations of gibberellins A(4) and A(7). To understand their physiological roles, we examined the site of their biosynthesis by analyzing the expression pattern of a gene (OsCPS) encoding coparyl diphosphate synthase in developing rice flowers. Expression was apparent in the anthers 1-2 days before flowering, and CPS mRNA accumulated in the maturing pollen.

  18. Genome-wide identification of galactinol synthase (GolS) genes in Solanum lycopersicum and Brachypodium distachyon.

    PubMed

    Filiz, Ertugrul; Ozyigit, Ibrahim Ilker; Vatansever, Recep

    2015-10-01

    GolS genes stand as potential candidate genes for molecular breeding and/or engineering programs in order for improving abiotic stress tolerance in plant species. In this study, a total of six galactinol synthase (GolS) genes/proteins were retrieved for Solanum lycopersicum and Brachypodium distachyon. GolS protein sequences were identified to include glyco_transf_8 (PF01501) domain structure, and to have a close molecular weight (36.40-39.59kDa) and amino acid length (318-347 aa) with a slightly acidic pI (5.35-6.40). The sub-cellular location was mainly predicted as cytoplasmic. S. lycopersicum genes located on chr 1 and 2, and included one segmental duplication while genes of B. distachyon were only on chr 1 with one tandem duplication. GolS sequences were found to have well conserved motif structures. Cis-acting analysis was performed for three abiotic stress responsive elements, including ABA responsive element (ABRE), dehydration and cold responsive elements (DRE/CRT) and low-temperature responsive element (LTRE). ABRE elements were found in all GolS genes, except for SlGolS4; DRE/CRT was not detected in any GolS genes and LTRE element found in SlGolS1 and BdGolS1 genes. AU analysis in UTR and ORF regions indicated that SlGolS and BdGolS mRNAs may have a short half-life. SlGolS3 and SlGolS4 genes may generate more stable transcripts since they included AATTAAA motif for polyadenylation signal POLASIG2. Seconder structures of SlGolS proteins were well conserved than that of BdGolS. Some structural divergences were detected in 3D structures and predicted binding sites exhibited various patterns in GolS proteins. PMID:26232767

  19. In vitro selection of transgenic sugarcane callus utilizing a plant gene encoding a mutant form of acetolactate synthase.

    PubMed

    van der Vyver, Christell; Conradie, Tobie; Kossmann, Jens; Lloyd, James

    2013-04-01

    Selection genes are routinely used in plant genetic transformation protocols to ensure the survival of transformed cells by limiting the regeneration of non-transgenic cells. In order to find alternatives to the use of antibiotics as selection agents, we followed a targeted approach utilizing a plant gene, encoding a mutant form of the enzyme acetolactate synthase, to convey resistance to herbicides. The sensitivity of sugarcane callus (Saccharum spp. hybrids, cv. NCo310) to a number of herbicides from the sulfonylurea and imidazolinone classes was tested. Callus growth was most affected by sulfonylurea herbicides, particularly 3.6 μg/l chlorsulfuron. Herbicide-resistant transgenic sugarcane plants containing mutant forms of a tobacco acetolactate synthase (als) gene were obtained following biolistic transformation. Post-bombardment, putative transgenic callus was selectively proliferated on MS medium containing 3 mg/l 2,4-dichlorophenoxyacetic acid (2,4-D), 20 g/l sucrose, 0.5 g/l casein, and 3.6 μg/l chlorsulfuron. Plant regeneration and rooting was done on MS medium lacking 2,4-D under similar selection conditions. Thirty vigorously growing putative transgenic plants were successfully ex vitro-acclimatized and established under glasshouse conditions. Glasshouse spraying of putative transgenic plants with 100 mg/l chlorsulfuron dramatically decreased the amount of non-transgenic plants that had escaped the in vitro selection regime. PCR analysis showed that six surviving plants were als-positive and that five of these expressed the mutant als gene. This report is the first to describe a selection system for sugarcane transformation that uses a selectable marker gene of plant origin targeted by a sulfonylurea herbicide. PMID:23543883

  20. Root parasitic plant Orobanche aegyptiaca and shoot parasitic plant Cuscuta australis obtained Brassicaceae-specific strictosidine synthase-like genes by horizontal gene transfer

    PubMed Central

    2014-01-01

    Background Besides gene duplication and de novo gene generation, horizontal gene transfer (HGT) is another important way of acquiring new genes. HGT may endow the recipients with novel phenotypic traits that are important for species evolution and adaption to new ecological niches. Parasitic systems expectedly allow the occurrence of HGT at relatively high frequencies due to their long-term physical contact. In plants, a number of HGT events have been reported between the organelles of parasites and the hosts, but HGT between host and parasite nuclear genomes has rarely been found. Results A thorough transcriptome screening revealed that a strictosidine synthase-like (SSL) gene in the root parasitic plant Orobanche aegyptiaca and the shoot parasitic plant Cuscuta australis showed much higher sequence similarities with those in Brassicaceae than with those in their close relatives, suggesting independent gene horizontal transfer events from Brassicaceae to these parasites. These findings were strongly supported by phylogenetic analysis and their identical unique amino acid residues and deletions. Intriguingly, the nucleus-located SSL genes in Brassicaceae belonged to a new member of SSL gene family, which were originated from gene duplication. The presence of introns indicated that the transfer occurred directly by DNA integration in both parasites. Furthermore, positive selection was detected in the foreign SSL gene in O. aegyptiaca but not in C. australis. The expression of the foreign SSL genes in these two parasitic plants was detected in multiple development stages and tissues, and the foreign SSL gene was induced after wounding treatment in C. australis stems. These data imply that the foreign genes may still retain certain functions in the recipient species. Conclusions Our study strongly supports that parasitic plants can gain novel nuclear genes from distantly related host species by HGT and the foreign genes may execute certain functions in the new hosts

  1. Molecular cloning and expression of squalene synthase and 2,3-oxidosqualene cyclase genes in persimmon (Diospyros kaki L.) fruits.

    PubMed

    Zhou, Chunhua; Zhao, Daqiu; Sheng, Yanle; Liang, Guohua; Tao, Jun

    2012-02-01

    Oleanolic acid (OA) and ursolic acid (UA) are the main triterpene acids in persimmon fruit, and squalene synthase and 2,3-oxidosqualene cyclases are important enzymes in pentacyclic triterpene biosynthesis. In order to study their relationship, DkSQS and DkOSC were cloned from persimmon fruits in the present study. The full-length cDNA of DkSQS was 1647 bp, containing an open reading frame (ORF) of 1245 bp that encoded a peptide of 415 amino acids (AA). The 3'-end of DkOSC cDNA fragment contained 522 bp, including a partial ORF of 298 bp, a full poly A tail that encoded 98 AA. Two cultivars of persimmon, i.e. cv. Nishimurawase and cv. Niuxinshi, were used to study the content of OA and UA and the related gene expression. Results showed that OA and UA contents changed in both cultivars during fruit development, the difference in cv. Nishimurawase was greater than that in cv. Niuxinshi. The expression of DkSQS and DkOSC had no obvious correlation with the biosynthesis of OA and UA in the flesh. There may be two main reasons. Firstly, different enzymes involved in the biosynthesis of triterpenes and mutual adjustment were existed in different gene expressions. Secondly, it was not clear that the DkOSC cloned in this research belonged to which subfamily. Therefore, the real relationship between triterpenes and DkSQS and DkOSC in persimmon fruits is still to be revealed.

  2. Phylogenetically diverse cultivable fungal community and polyketide synthase (PKS), non-ribosomal peptide synthase (NRPS) genes associated with the South China Sea sponges.

    PubMed

    Zhou, Kang; Zhang, Xia; Zhang, Fengli; Li, Zhiyong

    2011-10-01

    Compared with sponge-associated bacteria, the phylogenetic diversity of fungi in sponge and the association of sponge fungi remain largely unknown. Meanwhile, no detection of polyketide synthase (PKS) or non-ribosomal peptide synthase (NRPS) genes in sponge-associated fungi has been attempted. In this study, diverse and novel cultivable fungi including 10 genera (Aspergillus, Ascomycete, Fusarium, Isaria, Penicillium, Plectosphaerella, Pseudonectria, Simplicillium, Trichoderma, and Volutella) in four orders (Eurotiales, Hypocreales, Microascales, and Phyllachorales) of phylum Ascomycota were isolated from 10 species marine sponges in the South China Sea. Eurotiales and Hypocreales fungi were suggested as sponge generalists. The predominant isolates were Penicillium and Aspergillus in Eurotiales followed by Volutella in Hypocreales. Based on the conserved Beta-ketosynthase of PKS and A domain of NRPS, 15 polyketide synthases, and four non-ribosomal peptides synthesis genes, including non-reducing and reducing PKSs and hybrid PKS-NRPS, were detected in these fungal isolates. A lateral gene transfer event was indicated in the comparison between the phylogenetic diversity of 18S rRNA genes and β-ketoacyl synthase domain sequences. Some fungi, especially those with PKS or NRPS genes, showed antimicrobial activity against P. fluorescens, S. aureus and B. subtilis. It was the first time to investigate PKS and NRPS genes in sponge-associated fungi. Based on the detected antibiotics biosynthesis-related PKS and NRPS genes and antimicrobial activity, the potential ecological role of sponge-associated fungi in the chemical defense for sponge host was suggested. This study extended our knowledge of sponge-associated fungal phylogenetic diversity and their potential roles in the chemical defense.

  3. A conserved amino acid residue critical for product and substrate specificity in plant triterpene synthases.

    PubMed

    Salmon, Melissa; Thimmappa, Ramesha B; Minto, Robert E; Melton, Rachel E; Hughes, Richard K; O'Maille, Paul E; Hemmings, Andrew M; Osbourn, Anne

    2016-07-26

    Triterpenes are structurally complex plant natural products with numerous medicinal applications. They are synthesized through an origami-like process that involves cyclization of the linear 30 carbon precursor 2,3-oxidosqualene into different triterpene scaffolds. Here, through a forward genetic screen in planta, we identify a conserved amino acid residue that determines product specificity in triterpene synthases from diverse plant species. Mutation of this residue results in a major change in triterpene cyclization, with production of tetracyclic rather than pentacyclic products. The mutated enzymes also use the more highly oxygenated substrate dioxidosqualene in preference to 2,3-oxidosqualene when expressed in yeast. Our discoveries provide new insights into triterpene cyclization, revealing hidden functional diversity within triterpene synthases. They further open up opportunities to engineer novel oxygenated triterpene scaffolds by manipulating the precursor supply. PMID:27412861

  4. A conserved amino acid residue critical for product and substrate specificity in plant triterpene synthases

    PubMed Central

    Salmon, Melissa; Thimmappa, Ramesha B.; Minto, Robert E.; Melton, Rachel E.; O’Maille, Paul E.; Hemmings, Andrew M.; Osbourn, Anne

    2016-01-01

    Triterpenes are structurally complex plant natural products with numerous medicinal applications. They are synthesized through an origami-like process that involves cyclization of the linear 30 carbon precursor 2,3-oxidosqualene into different triterpene scaffolds. Here, through a forward genetic screen in planta, we identify a conserved amino acid residue that determines product specificity in triterpene synthases from diverse plant species. Mutation of this residue results in a major change in triterpene cyclization, with production of tetracyclic rather than pentacyclic products. The mutated enzymes also use the more highly oxygenated substrate dioxidosqualene in preference to 2,3-oxidosqualene when expressed in yeast. Our discoveries provide new insights into triterpene cyclization, revealing hidden functional diversity within triterpene synthases. They further open up opportunities to engineer novel oxygenated triterpene scaffolds by manipulating the precursor supply. PMID:27412861

  5. Detecting adaptive evolution and functional divergence in aminocyclopropane-1-carboxylate synthase (ACS) gene family.

    PubMed

    Zhang, Ti-Cao; Qiao, Qin; Zhong, Yang

    2012-06-01

    Ethylene is an essential plant gaseous hormone that controls many aspects of plant growth and development, especially the fruit ripening. It is important to know how this hormone is synthesized and how its production is regulated to understand the roles of ethylene in plant development. The aminocyclopropane-1-carboxylate synthase (ACS) gene is a rate-limiting enzyme in the ethylene biosynthesis pathway, which is encoded by a highly divergent multi-gene family in plant species. Although many ACS genes have been cloned from a wide variety of plant species previously, their origin and evolutionary process are still not clear. In this study, we conducted a phylogenetic analysis based on an updated dataset including 107 members of plant ACS genes and eight ACS-like genes from animal as well as six AATase genes. The motifs were identified and the positive selection and functional divergence in the ACS gene family were detected. The results obtained from these analyses are consistent with previous division of the ACS gene family in angiosperm, i.e., three distinct clades, and show that the duplications of three subclades (I, II and III) ACS genes have occurred after the divergence of gymnosperm and angiosperm. We conclude that the ACS genes could have experienced three times significant positive selection as they underwent expansion in land plants and gain the full-scale ethylene biosynthesis and regulatory functions, and all plant ACS genes originated from plant-ACS-like genes which come from AATase genes.

  6. Evolutionary analyses of the small subunit of glutamate synthase: gene order conservation, gene fusions, and prokaryote-to-eukaryote lateral gene transfers.

    PubMed

    Andersson, Jan O; Roger, Andrew J

    2002-04-01

    Lateral gene transfer has been identified as an important mode of genome evolution within prokaryotes. Except for the special case of gene transfer from organelle genomes to the eukaryotic nucleus, only a few cases of lateral gene transfer involving eukaryotes have been described. Here we present phylogenetic and gene order analyses on the small subunit of glutamate synthase (encoded by gltD) and its homologues, including the large subunit of sulfide dehydrogenase (encoded by sudA). The scattered distribution of the sudA and sudB gene pair and the phylogenetic analysis strongly suggest that lateral gene transfer was involved in the propagation of the genes in the three domains of life. One of these transfers most likely occurred between a prokaryote and an ancestor of diplomonad protists. Furthermore, phylogenetic analyses indicate that the gene for the small subunit of glutamate synthase was transferred from a low-GC gram-positive bacterium to a common ancestor of animals, fungi, and plants. Interestingly, in both examples, the eukaryotes encode a single gene that corresponds to a conserved operon structure in prokaryotes. Our analyses, together with several recent publications, show that lateral gene transfers from prokaryotes to unicellular eukaryotes occur with appreciable frequency. In the case of the genes for sulfide dehydrogenase, the transfer affected only a limited group of eukaryotes--the diplomonads--while the transfer of the glutamate synthase gene probably happened earlier in evolution and affected a wider range of eukaryotes.

  7. Hydroxymethylbilane synthase: Complete genomic sequence and amplifiable polymorphisms in the human gene

    SciTech Connect

    Yoo, Hanwook; Warner, C.A.; Chen, Chiahsiang; Desnick, R.J. )

    1993-01-01

    Acute intermittent porphyria (AIP), an autosomal dominant inborn error of heme biosynthesis, results from the half-normal activity of the heme biosynthetic enzyme hydroxymethylbilane synthase (HMB-synthase). Heterozygous individuals are prone to life-threatening acute neurologic attacks, which are precipitated by certain drugs and other metabolic, hormonal, and nutritional factors. Since the biochemical diagnosis of heterozygous individuals has been problematic, recent efforts have focused on the identification of mutations and diagnostically useful restriction fragment length polymorphisms (RFLPS) in the HMB-synthase gene. To facilitate these endeavors, the human HMB-synthase gene, including 1.1 kb of the 5[prime] flanking region, was isolated and completely sequenced in both orientations. The 10,024-bp gene contained 15 exons ranging in size from 39 to 438 bp and 14 introns ranging from 87 to 2913 bp. All intron/exon boundaries conformed to the GT/AG consensus rule. There were six Alu repetitive elements, one of the J and five of the Sa subfamilies. Analysis of the 1. I -kb 5[prime]flanking region revealed putative regulatory elements for the housekeeping promoter including AP1, AP4, SP1, TRE, ENH, and CAC. This region contained 10 HpaII sites and had an overall GC content of 54%. Three new polymorphic sites were identified by the single-strand conformation polymorphism (SSCP) technique, a common BsmAI site in intron 3 (3581 A/G), a common HinfI RFLP in intron 10 (7064 C/A), and a rare MnlI site in intron 14 (7998G/A). The allele frequencies of five previously known and the new polymorphic sites in a normal Caucasian population indicated that the intron 1 and intron 3 RFLPs were in linkage disequilibrium; however, the Hint I site segregated independently. 54 refs., 6 figs., 3 tabs.

  8. SNP in Chalcone Synthase gene is associated with variation of 6-gingerol content in contrasting landraces of Zingiber officinale.Roscoe.

    PubMed

    Ghosh, Subhabrata; Mandi, Swati Sen

    2015-07-25

    Zingiber officinale, medicinally the most important species within Zingiber genus, contains 6-gingerol as the active principle. This compound obtained from rhizomes of Z.officinale, has immense medicinal importance and is used in various herbal drug formulations. Our record of variation in content of this active principle, viz. 6-gingerol, in land races of this drug plant collected from different locations correlated with our Gene expression studies exhibiting high Chalcone Synthase gene (Chalcone Synthase is the rate limiting enzyme of 6-gingerol biosynthesis pathway) expression in high 6-gingerol containing landraces than in the low 6-gingerol containing landraces. Sequencing of Chalcone Synthase cDNA and subsequent multiple sequence alignment revealed seven SNPs between these contrasting genotypes. Converting this nucleotide sequence to amino acid sequence, alteration of two amino acids becomes evident; one amino acid change (asparagine to serine at position 336) is associated with base change (A→G) and another change (serine to leucine at position 142) is associated with the base change (C→T). Since asparagine at position 336 is one of the critical amino acids of the catalytic triad of Chalcone Synthase enzyme, responsible for substrate binding, our study suggests that landraces with a specific amino acid change viz. Asparagine (found in high 6-gingerol containing landraces) to serine causes low 6-gingerol content. This is probably due to a weak enzyme substrate association caused by the absence of asparagine in the catalytic triad. Detailed study of this finding could also help to understand molecular mechanism associated with variation in 6-gingerol content in Z.officinale genotypes and thereby strategies for developing elite genotypes containing high 6-gingerol content.

  9. SNP in Chalcone Synthase gene is associated with variation of 6-gingerol content in contrasting landraces of Zingiber officinale.Roscoe.

    PubMed

    Ghosh, Subhabrata; Mandi, Swati Sen

    2015-07-25

    Zingiber officinale, medicinally the most important species within Zingiber genus, contains 6-gingerol as the active principle. This compound obtained from rhizomes of Z.officinale, has immense medicinal importance and is used in various herbal drug formulations. Our record of variation in content of this active principle, viz. 6-gingerol, in land races of this drug plant collected from different locations correlated with our Gene expression studies exhibiting high Chalcone Synthase gene (Chalcone Synthase is the rate limiting enzyme of 6-gingerol biosynthesis pathway) expression in high 6-gingerol containing landraces than in the low 6-gingerol containing landraces. Sequencing of Chalcone Synthase cDNA and subsequent multiple sequence alignment revealed seven SNPs between these contrasting genotypes. Converting this nucleotide sequence to amino acid sequence, alteration of two amino acids becomes evident; one amino acid change (asparagine to serine at position 336) is associated with base change (A→G) and another change (serine to leucine at position 142) is associated with the base change (C→T). Since asparagine at position 336 is one of the critical amino acids of the catalytic triad of Chalcone Synthase enzyme, responsible for substrate binding, our study suggests that landraces with a specific amino acid change viz. Asparagine (found in high 6-gingerol containing landraces) to serine causes low 6-gingerol content. This is probably due to a weak enzyme substrate association caused by the absence of asparagine in the catalytic triad. Detailed study of this finding could also help to understand molecular mechanism associated with variation in 6-gingerol content in Z.officinale genotypes and thereby strategies for developing elite genotypes containing high 6-gingerol content. PMID:25895474

  10. Cloning and sequence characterization of a non-reducing polyketide synthase gene from the lichen Xanthoparmelia semiviridis.

    PubMed

    Chooi, Yit-Heng; Stalker, David M; Davis, Meryl A; Fujii, Isao; Elix, John A; Louwhoff, Simone H J J; Lawrie, Ann C

    2008-02-01

    Lichens produce a diverse array of secondary metabolites that have shown various biological activities. Of particular interest are the coupled phenolics that originate from polyketide pathways, such as depsides, depsidones and usnic acids, which are produced almost solely by lichens. Based on the presumed catalytic domains required for the synthesis of the key intermediates beta-orsellinic acid and methylphloroacetophenone, two pairs of degenerate primers were designed to target specifically the beta-ketoacylsynthase (KS) and C-methyltransferase (CMeT) domains of fungal non-reducing polyketide synthase (NR-PKS) genes with CMeT domains. These primers were used to explore the genome of the lichen Xanthoparmelia semiviridis, which produces beta-orcinol depsidones and usnic acid. One of the two KS domains amplified from genomic DNA of field-collected X. semiviridis was used as a probe to recover the candidate PKS gene. A 13 kb fragment containing an intact putative PKS gene (xsepks1) of 6555 bp was recovered from a partial genomic library. The inferred amino acid sequence indicated that xsepks1 encodes a protein of 2164 amino acids and contains KS, acyltransferase (AT), acyl carrier protein (ACP) and CMeT domains as expected. This demonstrated a successful strategy for targeting non-reducing PKS genes with CMeT domains. Integration of the 5' fragment of xsepks1, including the native promoter, into Aspergillus nidulans by cotransformation resulted in the transcription of the 5'xsepks1 and the splicing of a 63 bp intron, suggesting that A. nidulans could be a suitable heterologous host for xsepks1 expression.

  11. Lycopene cyclase and phytoene synthase activities in the marine yeast Rhodosporidium diobovatum are encoded by a single gene crtYB.

    PubMed

    Guo, Wenjing; Tang, Hui; Zhang, Liping

    2014-10-01

    crtYB, encoding lycopene cyclase and phytoene synthase was cloned from Rhodosporidium diobovatum ATCC 2527 by rapid amplification of cDNA ends method. The full-length cDNA of crtYB is 2, 330 bp and contains eight introns. The gene products is a 594 amino acids, with a predicted molecular mass of 65.63 kDa and a pI of 6.73. The N-terminus of the protein contains six transmembrane regions, which has been characterized as a lycopene beta-cyclase. The C-terminal half has squalene and phytoene synthase signatures that identified as phytoene synthetase. By heterologous complementary detection of this gene in E. coli and HPLC analysis, the regions responsible for phytoene synthesis and lycopene cyclization were localized within the protein.

  12. Identification and molecular characterization of nitric oxide synthase (NOS) gene in the intertidal copepod Tigriopus japonicus.

    PubMed

    Jeong, Chang-Bum; Kang, Hye-Min; Seo, Jung Soo; Park, Heum Gi; Rhee, Jae-Sung; Lee, Jae-Seong

    2016-02-10

    In copepods, no information has been reported on the structure or molecular characterization of the nitric oxide synthase (NOS) gene. In the intertidal copepod Tigriopus japonicus, we identified a NOS gene that is involved in immune responses of vertebrates and invertebrates. In silico analyses revealed that nitric oxide (NO) synthase domains, such as the oxygenase and reductase domains, are highly conserved in the T. japonicus NOS gene. The T. japonicus NOS gene was highly transcribed in the nauplii stages, implying that it plays a role in protecting the host during the early developmental stages. To examine the involvement of the T. japonicus NOS gene in the innate immune response, the copepods were exposed to lipopolysaccharide (LPS) and two Vibrio sp. After exposure to different concentrations of LPS and Vibrio sp., T. japonicus NOS transcription was significantly increased over time in a dose-dependent manner, and the NO/nitrite concentration increased as well. Taken together, our findings suggest that T. japonicus NOS transcription is induced in response to an immune challenge as part of the conserved innate immunity.

  13. Adaptive evolution of the chrysanthemyl diphosphate synthase gene involved in irregular monoterpene metabolism

    PubMed Central

    2012-01-01

    Background Chrysanthemyl diphosphate synthase (CDS) is a key enzyme in biosynthetic pathways producing pyrethrins and irregular monoterpenes. These compounds are confined to plants of the tribe Anthemideae of the Asteraceae, and play an important role in defending the plants against herbivorous insects. It has been proposed that the CDS genes arose from duplication of the farnesyl diphosphate synthase (FDS) gene and have different function from FDSs. However, the duplication time toward the origin of CDS and the evolutionary force behind the functional divergence of the CDS gene are still unknown. Results Two duplication events were detected in the evolutionary history of the FDS gene family in the Asteraceae, and the second duplication led to the origin of CDS. CDS occurred after the divergence of the tribe Mutisieae from other tribes of Asteraceae but before the birth of the Anthemideae tribe. After its origin, CDS accumulated four mutations in sites homologous to the substrate-binding and catalysis sites of FDS. Of these, two sites were involved in the binding of the nucleophilic substrate isopentenyl diphosphate in FDS. Maximum likelihood analyses showed that some sites in CDS were under positive selection and were scattered throughout primary sequences, whereas in the three-dimensional structure model they clustered in the large central cavity. Conclusion Positive selection associated with gene duplication played a major role in the evolution of CDS. PMID:23137178

  14. Retinoic acid-mediated gene expression in transgenic reporter zebrafish.

    PubMed

    Perz-Edwards, A; Hardison, N L; Linney, E

    2001-01-01

    Retinoic acid-mediated gene activation is important for normal vertebrate development. The size and nature of retinoic acid make it difficult to identify the precise cellular location of this signaling molecule throughout an embryo. Additionally, retinoic acid (RA) signaling is regulated by a complex combination of receptors, coactivators, and antagonizing proteins. Thus, in order to integrate these signals and identify regions within a whole developing embryo where cells can respond transcriptionally to retinoic acid, we have used a reporter transgenic approach. We have generated several stable lines of transgenic zebrafish which use retinoic acid response elements to drive fluorescent protein expression. In these zebrafish lines, transgene expression is localized to regions of the neural tube, retina, notochord, somites, heart, pronephric ducts, branchial arches, and jaw muscles in embryos and larvae. Transgene expression can be induced in additional regions of the neural tube and retina as well as the immature notochord, hatching gland, enveloping cell layer, and fin by exposing embryos to retinoic acid. Treatment with retinoic acid synthase inhibitors, citral and diethylaminobenzaldehyde (DEAB), during neurulation, greatly reduces transgene expression. DEAB treatment of embryos at gastrulation phenocopies the embryonic effects of vitamin A deprivation or targeted disruption of the RA synthase retinaldehyde dehydrogenase-2 in other vertebrates. Together these data suggest that the reporter expression we see in zebrafish is dependent upon conserved vertebrate pathways of RA synthesis.

  15. Canola engineered with a microalgal polyketide synthase-like system produces oil enriched in docosahexaenoic acid.

    PubMed

    Walsh, Terence A; Bevan, Scott A; Gachotte, Daniel J; Larsen, Cory M; Moskal, William A; Merlo, P A Owens; Sidorenko, Lyudmila V; Hampton, Ronnie E; Stoltz, Virginia; Pareddy, Dayakar; Anthony, Geny I; Bhaskar, Pudota B; Marri, Pradeep R; Clark, Lauren M; Chen, Wei; Adu-Peasah, Patrick S; Wensing, Steven T; Zirkle, Ross; Metz, James G

    2016-08-01

    Dietary omega-3 long-chain polyunsaturated fatty acids (LC-PUFAs), docosahexaenoic acid (DHA, C22:6) and eicosapentaenoic acid (EPA, C20:5) are usually derived from marine fish. Although production of both EPA and DHA has been engineered into land plants, including Arabidopsis, Camelina sativa and Brassica juncea, neither has been produced in commercially relevant amounts in a widely grown crop. We report expression of a microalgal polyketide synthase-like PUFA synthase system, comprising three multidomain polypeptides and an accessory enzyme, in canola (Brassica napus) seeds. This transgenic enzyme system is expressed in the cytoplasm, and synthesizes DHA and EPA de novo from malonyl-CoA without substantially altering plastidial fatty acid production. Furthermore, there is no significant impact of DHA and EPA production on seed yield in either the greenhouse or the field. Canola oil processed from field-grown grain contains 3.7% DHA and 0.7% EPA, and can provide more than 600 mg of omega-3 LC-PUFAs in a 14 g serving. PMID:27398790

  16. Automating gene library synthesis by structure-based combinatorial protein engineering: examples from plant sesquiterpene synthases.

    PubMed

    Dokarry, Melissa; Laurendon, Caroline; O'Maille, Paul E

    2012-01-01

    Structure-based combinatorial protein engineering (SCOPE) is a homology-independent recombination method to create multiple crossover gene libraries by assembling defined combinations of structural elements ranging from single mutations to domains of protein structure. SCOPE was originally inspired by DNA shuffling, which mimics recombination during meiosis, where mutations from parental genes are "shuffled" to create novel combinations in the resulting progeny. DNA shuffling utilizes sequence identity between parental genes to mediate template-switching events (the annealing and extension of one parental gene fragment on another) in PCR reassembly reactions to generate crossovers and hence recombination between parental genes. In light of the conservation of protein structure and degeneracy of sequence, SCOPE was developed to enable the "shuffling" of distantly related genes with no requirement for sequence identity. The central principle involves the use of oligonucleotides to encode for crossover regions to choreograph template-switching events during PCR assembly of gene fragments to create chimeric genes. This approach was initially developed to create libraries of hybrid DNA polymerases from distantly related parents, and later developed to create a combinatorial mutant library of sesquiterpene synthases to explore the catalytic landscapes underlying the functional divergence of related enzymes. This chapter presents a simplified protocol of SCOPE that can be integrated with different mutagenesis techniques and is suitable for automation by liquid-handling robots. Two examples are presented to illustrate the application of SCOPE to create gene libraries using plant sesquiterpene synthases as the model system. In the first example, we outline how to create an active-site library as a series of complex mixtures of diverse mutants. In the second example, we outline how to create a focused library as an array of individual clones to distil minimal combinations of

  17. Catalytic residues are shared between two pseudosubunits of the dehydratase domain of the animal fatty acid synthase.

    PubMed

    Pasta, Saloni; Witkowski, Andrzej; Joshi, Anil K; Smith, Stuart

    2007-12-01

    Expression, characterization, and mutagenesis of a series of N-terminal fragments of an animal fatty acid synthase, containing the beta-ketoacyl synthase, acyl transferase, and dehydratase domains, demonstrate that the dehydratase domain consists of two pseudosubunits, derived from contiguous regions of the same polypeptide, in which a single active site is formed by the cooperation of the catalytic histidine 878 residue of the first pseudosubunit with aspartate 1032 of the second pseudosubunit. Mutagenesis and modeling studies revealed an essential role for glutamine 1036 in anchoring the position of the catalytic aspartate. These findings establish that sequence elements previously assigned to a central structural core region of the type I fatty acid synthases and some modular polyketide synthase counterparts play an essential catalytic role as part of the dehydratase domain.

  18. Carnosol and carnosic acids from Salvia officinalis inhibit microsomal prostaglandin E2 synthase-1.

    PubMed

    Bauer, Julia; Kuehnl, Susanne; Rollinger, Judith M; Scherer, Olga; Northoff, Hinnak; Stuppner, Hermann; Werz, Oliver; Koeberle, Andreas

    2012-07-01

    Prostaglandin E(2) (PGE(2)), the most relevant eicosanoid promoting inflammation and tumorigenesis, is formed by cyclooxygenases (COXs) and PGE(2) synthases from free arachidonic acid. Preparations of the leaves of Salvia officinalis are commonly used in folk medicine as an effective antiseptic and anti-inflammatory remedy and possess anticancer activity. Here, we demonstrate that a standard ethyl acetate extract of S. officinalis efficiently suppresses the formation of PGE(2) in a cell-free assay by direct interference with microsomal PGE(2) synthase (mPGES)-1. Bioactivity-guided fractionation of the extract yielded closely related fractions that potently suppressed mPGES-1 with IC(50) values between 1.9 and 3.5 μg/ml. Component analysis of these fractions revealed the diterpenes carnosol and carnosic acid as potential bioactive principles inhibiting mPGES-1 activity with IC(50) values of 5.0 μM. Using a human whole-blood assay as a robust cell-based model, carnosic acid, but not carnosol, blocked PGE(2) generation upon stimulation with lipopolysaccharide (IC(50) = 9.3 μM). Carnosic acid neither inhibited the concomitant biosynthesis of other prostanoids [6-keto PGF(1α), 12(S)-hydroxy-5-cis-8,10-trans-heptadecatrienoic acid, and thromboxane B(2)] in human whole blood nor affected the activities of COX-1/2 in a cell-free assay. Together, S. officinalis extracts and its ingredients carnosol and carnosic acid inhibit PGE(2) formation by selectively targeting mPGES-1. We conclude that the inhibitory effect of carnosic acid on PGE(2) formation, observed in the physiologically relevant whole-blood model, may critically contribute to the anti-inflammatory and anticarcinogenic properties of S. officinalis.

  19. Carnosol and Carnosic Acids from Salvia officinalis Inhibit Microsomal Prostaglandin E2 Synthase-1

    PubMed Central

    Bauer, Julia; Kuehnl, Susanne; Rollinger, Judith M.; Scherer, Olga; Northoff, Hinnak; Stuppner, Hermann; Werz, Oliver; Koeberle, Andreas

    2012-01-01

    Prostaglandin E2 (PGE2), the most relevant eicosanoid promoting inflammation and tumorigenesis, is formed by cyclooxygenases (COXs) and PGE2 synthases from free arachidonic acid. Preparations of the leaves of Salvia officinalis are commonly used in folk medicine as an effective antiseptic and anti-inflammatory remedy and possess anticancer activity. Here, we demonstrate that a standard ethyl acetate extract of S. officinalis efficiently suppresses the formation of PGE2 in a cell-free assay by direct interference with microsomal PGE2 synthase (mPGES)-1. Bioactivity-guided fractionation of the extract yielded closely related fractions that potently suppressed mPGES-1 with IC50 values between 1.9 and 3.5 μg/ml. Component analysis of these fractions revealed the diterpenes carnosol and carnosic acid as potential bioactive principles inhibiting mPGES-1 activity with IC50 values of 5.0 μM. Using a human whole-blood assay as a robust cell-based model, carnosic acid, but not carnosol, blocked PGE2 generation upon stimulation with lipopolysaccharide (IC50 = 9.3 μM). Carnosic acid neither inhibited the concomitant biosynthesis of other prostanoids [6-keto PGF1α, 12(S)-hydroxy-5-cis-8,10-trans-heptadecatrienoic acid, and thromboxane B2] in human whole blood nor affected the activities of COX-1/2 in a cell-free assay. Together, S. officinalis extracts and its ingredients carnosol and carnosic acid inhibit PGE2 formation by selectively targeting mPGES-1. We conclude that the inhibitory effect of carnosic acid on PGE2 formation, observed in the physiologically relevant whole-blood model, may critically contribute to the anti-inflammatory and anticarcinogenic properties of S. officinalis. PMID:22511203

  20. Chalcone synthase gene lineage diversification confirms allopolyploid evolutionary relationships of European rostrate violets.

    PubMed

    van den Hof, Kevin; van den Berg, Ronald G; Gravendeel, Barbara

    2008-10-01

    Phylogenetic relationships among and within the subsections of the genus Viola are still far from resolved. We present the first organismal phylogeny of predominantly western European species of subsection Rostratae based on the plastid trnS-trnG intron and intergenic spacer and the nuclear low-copy gene chalcone synthase (CHS) sequences. CHS is a key enzyme in the synthesis of flavonoids, which are important for flower pigmentation. Genes encoding for CHS are members of a multigene family. In Viola, 3 different CHS copies are present. CHS gene lineages obtained confirmed earlier hypotheses about reticulate relationships between species of Viola subsection Rostratae based on karyotype data. Comparison of the CHS gene lineage tree and the plastid species phylogeny of Viola reconstructed in this study indicates that the different CHS copies present in Viola are the products of both recent and more ancient duplications.

  1. Harvesting of novel polyhydroxyalkanaote (PHA) synthase encoding genes from a soil metagenome library using phenotypic screening.

    PubMed

    Schallmey, Marcus; Ly, Anh; Wang, Chunxia; Meglei, Gabriela; Voget, Sonja; Streit, Wolfgang R; Driscoll, Brian T; Charles, Trevor C

    2011-08-01

    We previously reported the construction of metagenomic libraries in the IncP cosmid vector pRK7813, enabling heterologous expression of these broad-host-range libraries in multiple bacterial hosts. Expressing these libraries in Sinorhizobium meliloti, we have successfully complemented associated phenotypes of polyhydroxyalkanoate synthesis mutants. DNA sequence analysis of three clones indicates that the complementing genes are homologous to, but substantially different from, known polyhydroxyalkanaote synthase-encoding genes. Thus we have demonstrated the ability to isolate diverse genes for polyhydroxyalkanaote synthesis by functional complementation of defined mutants. Such genes might be of use in the engineering of more efficient systems for the industrial production of bioplastics. The use of functional complementation will also provide a vehicle to probe the genetics of polyhydroxyalkanaote metabolism and its relation to carbon availability in complex microbial assemblages. PMID:21631577

  2. β-Ketoacyl-acyl Carrier Protein Synthase I (KASI) Plays Crucial Roles in the Plant Growth and Fatty Acids Synthesis in Tobacco

    PubMed Central

    Yang, Tianquan; Xu, Ronghua; Chen, Jianghua; Liu, Aizhong

    2016-01-01

    Fatty acids serve many functions in plants, but the effects of some key genes involved in fatty acids biosynthesis on plants growth and development are not well understood yet. To understand the functions of 3-ketoacyl-acyl-carrier protein synthase I (KASI) in tobacco, we isolated two KASI homologs, which we have designated NtKASI-1 and NtKASI-2. Expression analysis showed that these two KASI genes were transcribed constitutively in all tissues examined. Over-expression of NtKASI-1 in tobacco changed the fatty acid content in leaves, whereas over-expressed lines of NtKASI-2 exhibited distinct phenotypic features such as slightly variegated leaves and reduction of the fatty acid content in leaves, similar to the silencing plants of NtKASI-1 gene. Interestingly, the silencing of NtKASI-2 gene had no discernibly altered phenotypes compared to wild type. The double silencing plants of these two genes enhanced the phenotypic changes during vegetative and reproductive growth compared to wild type. These results uncovered that these two KASI genes had the partially functional redundancy, and that the KASI genes played a key role in regulating fatty acids synthesis and in mediating plant growth and development in tobacco. PMID:27509494

  3. β-Ketoacyl-acyl Carrier Protein Synthase I (KASI) Plays Crucial Roles in the Plant Growth and Fatty Acids Synthesis in Tobacco.

    PubMed

    Yang, Tianquan; Xu, Ronghua; Chen, Jianghua; Liu, Aizhong

    2016-01-01

    Fatty acids serve many functions in plants, but the effects of some key genes involved in fatty acids biosynthesis on plants growth and development are not well understood yet. To understand the functions of 3-ketoacyl-acyl-carrier protein synthase I (KASI) in tobacco, we isolated two KASI homologs, which we have designated NtKASI-1 and NtKASI-2. Expression analysis showed that these two KASI genes were transcribed constitutively in all tissues examined. Over-expression of NtKASI-1 in tobacco changed the fatty acid content in leaves, whereas over-expressed lines of NtKASI-2 exhibited distinct phenotypic features such as slightly variegated leaves and reduction of the fatty acid content in leaves, similar to the silencing plants of NtKASI-1 gene. Interestingly, the silencing of NtKASI-2 gene had no discernibly altered phenotypes compared to wild type. The double silencing plants of these two genes enhanced the phenotypic changes during vegetative and reproductive growth compared to wild type. These results uncovered that these two KASI genes had the partially functional redundancy, and that the KASI genes played a key role in regulating fatty acids synthesis and in mediating plant growth and development in tobacco. PMID:27509494

  4. Congenital hyperreninemic hypoaldosteronism unlinked to the aldosterone synthase (CYP11B2) gene.

    PubMed

    Kayes-Wandover, K M; Tannin, G M; Shulman, D; Peled, D; Jones, K L; Karaviti, L; White, P C

    2001-11-01

    Isolated hyperreninemic hypoaldosteronism presenting in infancy is usually caused by mutations in the CYP11B2 gene encoding aldosterone synthase. We studied five patients in four unrelated kindreds with hyperreninemic hypoaldosteronism, in whom we were unable to find such mutations. All presented in infancy with failure to thrive, hyponatremia, hyperkalemia, markedly elevated plasma renin activity, and low or inappropriately normal aldosterone levels. All had normal cortisol levels and no signs or symptoms of congenital adrenal hyperplasia. All responded to fludrocortisone treatment. There were no mutations detected in exons or splice junctions of CYP11B2. Linkage of the disorder to CYP11B2 was studied in two unrelated consanguineous patients and in an affected sib pair. The consanguineous patients were each heterozygous for at least one of three polymorphic microsatellite markers near CYP11B2, excluding linkage to CYP11B2. However, linkage of the disease to CYP11B2 could not be excluded in the affected sib pair. Genes involved in the regulation of aldosterone biosynthesis, including those encoding angiotensinogen, angiotensin-converting enzyme, and the AT1 angiotensin II receptor were similarly excluded from linkage. These results demonstrate the existence of an inherited form of hyperreninemic hypoaldosteronism distinct from aldosterone synthase deficiency. The affected gene(s) remain to be determined.

  5. Promoter regulatory domain identification of cassava starch synthase IIb gene in transgenic tobacco.

    PubMed

    Guan, Zhihui; Chen, Xin; Xie, Hairong; Wang, Wenquan

    2016-05-01

    Soluble starch synthase is a key enzyme in the starch biosynthesis pathway, and its enzyme activity significantly influences starch components in cassava storage root. However, studies on the regulation mechanism of soluble starch synthase gene are rare. In this study, we cloned the 5' flanking sequence of the MeSSIIb gene and predicted the distribution of cis-elements. The region from -453 to -1 was considered the primary core promoter by the quantitative detection of GUS activity in transgenic tobacco plants containing 5' truncated promoters fused with the GUS gene. Analysis results clarified that the region from -531 to -454 significantly repressed promoter activity. The region from -453 to -388 was a repressive domain of ethylene, and some unknown drought responsive cis-elements were located in the region from -387 to -1. These findings will provide useful information on the functional assay and transcriptional regulation mechanisms of the MeSSIIb gene. PMID:26919397

  6. Detection of polyketide synthase and nonribosomal peptide synthetase biosynthetic genes from antimicrobial coral-associated actinomycetes.

    PubMed

    Li, Jie; Dong, Jun-De; Yang, Jian; Luo, Xiong-Ming; Zhang, Si

    2014-10-01

    The diversity and properties of actinobacteria, predominant residents in coral holobionts, have been rarely documented. In this study, we aimed to explore the species diversity, antimicrobial activities and biosynthetic potential of culturable actinomycetes within the tissues of the scleractinian corals Porites lutea, Galaxea fascicularis and Acropora millepora from the South China Sea. A total of 70 strains representing 13 families and 15 genera of actinobacteria were isolated. The antimicrobial activity and biosynthetic potential of fifteen representative filamentous actinomycetes were estimated. Crude fermentation extracts of 6 strains exhibited comparable or greater activities against Vibrio alginolyticus than ciprofloxacin. Seven of the 15 actinomycetes strains possess type I polyketide synthases (PKS-I) and/or nonribosomal peptide synthetases (NRPS) genes. Nine tested strains possess type II polyketide synthases (PKS-II). Phylogenetic analysis based on 16S rRNA gene sequences indicated that these PKS and NRPS gene screening positive strains belong to genera Nocardiopsis, Pseudonocardia, Streptomyces, Micromonospora, Amycolatopsis and Prauserella. One PKS-I and four NRPS fragments showed <70% similarity to their closest relatives, which suggested the novelty of these genes. This study helps uncover the genetic capacity of stony coral-associated actinomycetes to produce bioactive molecules.

  7. Natural fatty acid synthase inhibitors as potent therapeutic agents for cancers: A review.

    PubMed

    Zhang, Jia-Sui; Lei, Jie-Ping; Wei, Guo-Qing; Chen, Hui; Ma, Chao-Ying; Jiang, He-Zhong

    2016-09-01

    Context Fatty acid synthase (FAS) is the only mammalian enzyme to catalyse the synthesis of fatty acid. The expression level of FAS is related to cancer progression, aggressiveness and metastasis. In recent years, research on natural FAS inhibitors with significant bioactivities and low side effects has increasingly become a new trend. Herein, we present recent research progress on natural fatty acid synthase inhibitors as potent therapeutic agents. Objective This paper is a mini overview of the typical natural FAS inhibitors and their possible mechanism of action in the past 10 years (2004-2014). Method The information was collected and compiled through major databases including Web of Science, PubMed, and CNKI. Results Many natural products induce cancer cells apoptosis by inhibiting FAS expression, with fewer side effects than synthetic inhibitors. Conclusion Natural FAS inhibitors are widely distributed in plants (especially in herbs and foods). Some natural products (mainly phenolics) possessing potent biological activities and stable structures are available as lead compounds to synthesise promising FAS inhibitors.

  8. Molecular evolution of the hyaluronan synthase 2 gene in mammals: implications for adaptations to the subterranean niche and cancer resistance

    PubMed Central

    Faulkes, Christopher G.; Davies, Kalina T. J.; Rossiter, Stephen J.; Bennett, Nigel C.

    2015-01-01

    The naked mole-rat (NMR) Heterocephalus glaber is a unique and fascinating mammal exhibiting many unusual adaptations to a subterranean lifestyle. The recent discovery of their resistance to cancer and exceptional longevity has opened up new and important avenues of research. Part of this resistance to cancer has been attributed to the fact that NMRs produce a modified form of hyaluronan—a key constituent of the extracellular matrix—that is thought to confer increased elasticity of the skin as an adaptation for living in narrow tunnels. This so-called high molecular mass hyaluronan (HMM-HA) stems from two apparently unique substitutions in the hyaluronan synthase 2 enzyme (HAS2). To test whether other subterranean mammals with similar selection pressures also show molecular adaptation in their HAS2 gene, we sequenced the HAS2 gene for 11 subterranean mammals and closely related species, and combined these with data from 57 other mammals. Comparative screening revealed that one of the two putatively important HAS2 substitutions in the NMR predicted to have a significant effect on hyaluronan synthase function was uniquely shared by all African mole-rats. Interestingly, we also identified multiple other amino acid substitutions in key domains of the HAS2 molecule, although the biological consequences of these for hyaluronan synthesis remain to be determined. Despite these results, we found evidence of strong purifying selection acting on the HAS2 gene across all mammals, and the NMR remains unique in its particular HAS2 sequence. Our results indicate that more work is needed to determine whether the apparent cancer resistance seen in NMR is shared by other members of the African mole-rat clade. PMID:25948568

  9. Molecular evolution of the hyaluronan synthase 2 gene in mammals: implications for adaptations to the subterranean niche and cancer resistance.

    PubMed

    Faulkes, Christopher G; Davies, Kalina T J; Rossiter, Stephen J; Bennett, Nigel C

    2015-05-01

    The naked mole-rat (NMR) Heterocephalus glaber is a unique and fascinating mammal exhibiting many unusual adaptations to a subterranean lifestyle. The recent discovery of their resistance to cancer and exceptional longevity has opened up new and important avenues of research. Part of this resistance to cancer has been attributed to the fact that NMRs produce a modified form of hyaluronan--a key constituent of the extracellular matrix--that is thought to confer increased elasticity of the skin as an adaptation for living in narrow tunnels. This so-called high molecular mass hyaluronan (HMM-HA) stems from two apparently unique substitutions in the hyaluronan synthase 2 enzyme (HAS2). To test whether other subterranean mammals with similar selection pressures also show molecular adaptation in their HAS2 gene, we sequenced the HAS2 gene for 11 subterranean mammals and closely related species, and combined these with data from 57 other mammals. Comparative screening revealed that one of the two putatively important HAS2 substitutions in the NMR predicted to have a significant effect on hyaluronan synthase function was uniquely shared by all African mole-rats. Interestingly, we also identified multiple other amino acid substitutions in key domains of the HAS2 molecule, although the biological consequences of these for hyaluronan synthesis remain to be determined. Despite these results, we found evidence of strong purifying selection acting on the HAS2 gene across all mammals, and the NMR remains unique in its particular HAS2 sequence. Our results indicate that more work is needed to determine whether the apparent cancer resistance seen in NMR is shared by other members of the African mole-rat clade.

  10. Molecular cloning and differential expression analysis of a squalene synthase gene from Dioscorea zingiberensis, an important pharmaceutical plant.

    PubMed

    Ye, Yun; Wang, Runfa; Jin, Liang; Shen, Junhao; Li, Xiaotong; Yang, Ting; Zhou, Mengzhuo; Yang, Zhifan; Chen, Yongqin

    2014-09-01

    Diosgenin is a steroid derived from cholesterol in plants and used as a typical initial intermediate for synthesis of numerous steroidal drugs in the world. Commercially, this compound is extracted mainly from the rhizomes or tubers of some Dioscorea species. Squalene synthase (SQS: EC 2.5.1.21) catalyzes the condensation of two molecules of farnesyl diphosphate to form squalene, the first committed step for biosynthesis of plant sterols including cholesterol, and is thought to play an important role in diosgenin biosynthesis. A full-length cDNA of a putative squalene synthase gene was cloned from D. zingiberensis and designated as DzSQS (Genbank Accession Number KC960673). DzSQS was contained an open reading frame of 1,230 bp encoding a polypeptide of 409 amino acids with a predicted molecular weight of 46 kDa and an isoelectric point of 6.2. The deduced amino acid sequence of DzSQS shared over 70 % sequence identity with those of SQSs from other plants. The truncated DzSQS in which 24 amino acids were deleted from the carboxy terminus was expressed in Escherichia coli, and the resultant bacterial crude extract was incubated with farnesyl diphosphate and NADPH. GC-MS analysis showed that squalene was detected in the in vitro reaction mixture. Quantitative real-time PCR analysis revealed that DzSQS was expressed from highest to lowest order in mature leaves, newly-formed rhizomes, young leaves, young stems, and two-year-old rhizomes of D. zingiberensis.

  11. Identification and characterization of granule bound starch synthase I (GBSSI) gene of tartary buckwheat (Fagopyrum tataricum Gaertn.).

    PubMed

    Wang, Xun; Feng, Bo; Xu, Zhibin; Sestili, Francesco; Zhao, Guojun; Xiang, Chao; Lafiandra, Domenico; Wang, Tao

    2014-01-25

    Tartary buckwheat (Fagopyrum tataricum Gaertn.) is increasingly considered as an important functional food material because of its rich nutraceutical compounds. Reserve starch is the major component of tartary buckwheat seed. However, the gene sequences and the molecular mechanism of tartary buckwheat starch synthesis are unknown so far. In this study, the complete genomic sequence and full-size cDNA coding tartary buckwheat granule-bound starch synthase I (FtGBSSI), which is responsible for amylose synthesis, were isolated and analyzed. The genomic sequence of the FtGBSSI contained 3947 nucleotides and was composed of 14 exons and 13 introns. The cDNA coding sequence of FtGBSSI shared 63.3%-75.1% identities with those of dicots and 56.6%-57.5% identities with monocots (Poaceae). In deduced amino acid sequence of FtGBSSI, eight motifs conserved among plant starch synthases were identified. A cleavage at the site IVC↓G of FtGBSSI protein produces the chloroplast transit sequence of 78 amino acids and the mature protein of 527 amino acids. The FtGBSSI mature protein showed an identity of 73.4%-77.8% with dicot plants, and 67.6%-70.4% with monocot plants (Poaceae). The mature protein was composed of 20 α-helixes and 16 β-strands, and folds into two main domains, N- and C-terminal domains. The critical residues which are involved in ADP and sugar binding were predicted. These results will be useful to modulate starch composition of buckwheat kernels with the aim to produce novel improved varieties in future breeding programs.

  12. Cytosylglucuronic acid synthase (cytosine: UDP-glucuronosyltransferase) from Streptomyces griseochromogenes, the first prokaryotic UDP-glucuronosyltransferase.

    PubMed Central

    Gould, S J; Guo, J

    1994-01-01

    Cytosylglucuronic acid synthase (cytosine: UDP-glucuronosyltransferase), the first prokaryotic UDP-GT and a key enzyme in the biosynthesis of the antibiotic blasticidin S, was purified 870-fold. It has optimum activity at a pH of 8.4 to 8.6, Kms of 6.0 (UDP-glucuronic acid) and 243 (cytosine) microM, and a maximum rate of metabolism of 14.6 mumol/min/mg. The apparent M(r) is 43,000. Activity was slightly enhanced by Mg2+ or Ca2+ but was not inhibited by EDTA. Activity was strongly inhibited by UDP. Cytosylglucuronic acid differs from eukaryotic UDP-glucuronosyltransferases in being a soluble protein with no apparent phospholipid requirement. Images PMID:8113166

  13. Increased Production of Fatty Acids and Triglycerides in Aspergillus oryzae by Enhancing Expressions of Fatty Acid Synthesis-Related Genes

    SciTech Connect

    Tamano, Koichi; Bruno, Kenneth S.; Karagiosis, Sue A.; Culley, David E.; Deng, Shuang; Collett, James R.; Umemura, Myco; Koike, Hideaki; Baker, Scott E.; Machida, Masa

    2013-01-01

    Microbial production of fats and oils is being developedas a means of converting biomass to biofuels. Here we investigate enhancing expression of enzymes involved in the production of fatty acids and triglycerides as a means to increase production of these compounds in Aspergillusoryzae. Examination of the A.oryzaegenome demonstrates that it contains twofatty acid synthases and several other genes that are predicted to be part of this biosynthetic pathway. We enhancedthe expressionof fatty acid synthesis-related genes by replacing their promoters with thepromoter fromthe constitutively highly expressedgene tef1. We demonstrate that by simply increasing the expression of the fatty acid synthasegenes we successfullyincreasedtheproduction of fatty acids and triglyceridesby more than two fold. Enhancement of expression of the fatty acid pathway genes ATP-citrate lyase and palmitoyl-ACP thioesteraseincreasedproductivity to a lesser extent.Increasing expression ofacetyl-CoA carboxylase caused no detectable change in fatty acid levels. Increases in message level for each gene were monitored usingquantitative real-time RT-PCR. Our data demonstrates that a simple increase in the abundance of fatty acid synthase genes can increase the detectable amount of fatty acids.

  14. Enhanced freeze tolerance of baker's yeast by overexpressed trehalose-6-phosphate synthase gene (TPS1) and deleted trehalase genes in frozen dough.

    PubMed

    Tan, Haigang; Dong, Jian; Wang, Guanglu; Xu, Haiyan; Zhang, Cuiying; Xiao, Dongguang

    2014-08-01

    Several recombinant strains with overexpressed trehalose-6-phosphate synthase gene (TPS1) and/or deleted trehalase genes were obtained to elucidate the relationships between TPS1, trehalase genes, content of intracellular trehalose and freeze tolerance of baker's yeast, as well as improve the fermentation properties of lean dough after freezing. In this study, strain TL301(TPS1) overexpressing TPS1 showed 62.92 % higher trehalose-6-phosphate synthase (Tps1) activity and enhanced the content of intracellular trehalose than the parental strain. Deleting ATH1 exerted a significant effect on trehalase activities and the degradation amount of intracellular trehalose during the first 30 min of prefermentation. This finding indicates that acid trehalase (Ath1) plays a role in intracellular trehalose degradation. NTH2 encodes a functional neutral trehalase (Nth2) that was significantly involved in intracellular trehalose degradation in the absence of the NTH1 and/or ATH1 gene. The survival ratio, freeze-tolerance ratio and relative fermentation ability of strain TL301(TPS1) were approximately twice as high as those of the parental strain (BY6-9α). The increase in freeze tolerance of strain TL301(TPS1) was accompanied by relatively low trehalase activity, high Tps1 activity and high residual content of intracellular trehalose. Our results suggest that overexpressing TPS1 and deleting trehalase genes are sufficient to improve the freeze tolerance of baker's yeast in frozen dough. The present study provides guidance for the commercial baking industry as well as the research on the intracellular trehalose mobilization and freeze tolerance of baker's yeast. PMID:24951963

  15. Sequence variation of chalcone synthase gene in a spontaneous white-flower mutant of Chinese cabbage-pak-choi.

    PubMed

    Jiang, Ming; Cao, Jiashu

    2008-12-01

    A spontaneous white-flower mutant of Chinese cabbage-pak-choi (Brassica campestris ssp. chinenesis, syn. B. rapa ssp. chinenesis) was found in our test fields, and all the plant characters except flower color were identical with wild type ones. We hypothesized that a mutational event had occurred in the gene coding for chalcone synthase (CHS), the key enzyme of flavonoid biosynthesis pathway. Two genes, later designated BcCHS and BcCHS-wf, were isolated from wild type and mutant Chinese cabbage-pak-choi, respectively, using gene-specific primer pairs. Comparison of the genomic sequences revealed two mutations in BcCHS-wf, both with A to G transitions, one at position +37 bp and the other at +970 bp. Both nucleotide substitutions occurred in AGA codes for arginine into GGA for glycin at residue +13 and into AGC coding for serine at residue +229, respectively. Homologous genes of BcCHS were isolated from another four cruciferous plants, though there were some differences among the genomic and deduced amino acid sequences, the mutation locus of the mutant, as we called it, were identical to the wild type Chinese cabbage-pak-choi.

  16. Codon usage bias analysis for the spermidine synthase gene from Camellia sinensis (L.) O. Kuntze.

    PubMed

    You, E; Wang, Y; Ding, Z T; Zhang, X F; Pan, L L; Zheng, C

    2015-07-03

    The spermidine synthase (SPDS) gene exists widely in all types of plants. In this paper, the codon usage of the SPDS gene from Camellia sinensis (CsSPDS) was analyzed. The results showed that the codon usage of the CsSPDS gene is biased towards the T-ended or A-ended codons, which is similar to that observed in 73 genes selected from the C. sinensis genome. An ENC-plot for 15 SPDS genes from various plant species suggested that mutational bias was the major factor in shaping codon usage in these genes. Codon usage frequency analysis indicated that there was little difference between the CsSPDS gene and dicot genomes, such as Arabidopsis thaliana and Nicotiana tabacum, but significant differences in codon usage were observed between the CsSPDS gene and monocot genomes, such as Triticum aestivum and Zea mays. Therefore, A. thaliana and N. tabacum expression systems may be more suitable for the expression of the CsSPDS gene.

  17. Noncholinergic penile erection in mice lacking the gene for endothelial nitric oxide synthase.

    PubMed

    Burnett, Arthur L; Chang, Alex G; Crone, Julie K; Huang, Paul L; Sezen, Sena E

    2002-01-01

    With the current understanding that nitric oxide (NO) mediates penile erection, the endothelial isoform of NO synthase (eNOS) has been implicated in this function. We undertook this study applying transgenic mice with targeted deletion of the eNOS gene (eNOS-/- mice) as an experimental approach to evaluate the importance of eNOS in cholinergically stimulated erectile function in vivo. Combined pharmacostimulation with intracavernosal carbachol (3 ng) administration and submaximal cavernous nerve (CN) electrical stimulation (16 Hz, 5 millisecond, 1 V) simultaneous with intracavernosal pressure (ICP) monitoring, and both biochemical assay of NO synthase activity and Western blot analysis of eNOS protein content in penile tissue, were performed on eNOS-/- mice and wild-type controls. Combined intracavernosal carbachol administration and submaximal CN electrical stimulation raised the recorded ICP, elicited by CN electrical stimulation alone in wild-type mice (from 35.7 +/- 2.7 to 48.1 +/- 5.5 mm Hg, P < .05) but not in eNOS-/ - mice (from 54.9 +/- 6.3 to 51.0 +/- 9.5 mm Hg, not significant [NS]). Pretreatment with the nonselective nitric oxide synthase inhibitor nitro-L-arginine methyl ester (L-NAME; 100 mg intracavernosally) blocked electrically stimulated ICP responses in eNOS-/- mice to baseline levels (37.8 +/- 4.4 vs 12.7 +/- 4.0 mm Hg, P < .05). In penes of eNOS-/- mice, approximately 60% NO synthase activity of wild-type penis levels was retained (NS), and eNOS protein was absent. We concluded that eNOS-/- mice preserve erectile function on the basis of a noncholinergic but NO-dependent mechanism and that eNOS physiologically mediates penile erection under cholinergic stimulation. PMID:11780929

  18. Mutations in the dihydropteroate synthase gene of Pneumocystis jiroveci isolates from Portuguese patients with Pneumocystis pneumonia.

    PubMed

    Costa, M C; Helweg-Larsen, J; Lundgren, Bettina; Antunes, F; Matos, O

    2003-11-01

    The aim of this study was to evaluate the frequency of mutations of the P. jiroveci dihydropteroate synthase (DHPS) gene in an immunocompromised Portuguese population and to investigate the possible association between DHPS mutations and sulpha exposure. In the studied population, DHPS gene mutations were not significantly more frequent in patients exposed to sulpha drugs compared with patients not exposed (P=0.390). The results of this study suggest that DHPS gene mutations are frequent in the Portuguese immunocompromised population but do not seem associated with previous sulpha exposure. These results are consistent with the possibility of an incidental acquisition and transmission of P. jiroveci mutant types, either by person to person transmission or from an environmental source.

  19. Molecular cloning and in vitro expression of a silent phenoxazinone synthase gene from Streptomyces lividans.

    PubMed

    Madu, A C; Jones, G H

    1989-12-14

    Phenoxazinone synthase (PHS) catalyzes a step in actinomycin D biosynthesis in Streptomyces antibioticus. Two sequences from Streptomyces lividans that hybridize to the phs gene of S. antibioticus have been cloned in Escherichia coli K-12 using the plasmid pBR322. Although there was some similarity in the restriction maps of the two cloned fragments, neither insert appeared to be a direct subset of the other nor of the S. antibioticus phs gene. In vitro expression studies, in a streptomycete coupled transcription-translation system, showed that a 3.98-kb SphI fragment encoded a PHS-related protein. These observations provide additional support for the existence of silent genes for antibiotic production in streptomycetes.

  20. Transcriptional modulation of squalene synthase genes in barley treated with PGPR

    PubMed Central

    Yousaf, Anam; Qadir, Abdul; Anjum, Tehmina; Ahmad, Aqeel

    2015-01-01

    Phytosterol contents and food quality of plant produce is directly associated with transcription of gene squalene synthase (SS). In current study, barley plants were treated with different rhizobacterial strains under semi controlled (27 ± 3°C) greenhouse conditions in order to modulate expression of SS gene. Plant samples were analyzed through semi-quantitative PCR to evaluate effect of rhizobacterial application on transcriptional status of SS. Results revealed that among four SS genes (i.e., SSA, SS1, SS2, and SS3), the most expressive gene was SSA; while, SS2 was screened out as the second best induced gene due to Acetobacter aceti. The most efficient bacterial strain which recorded maximum gene expression was A. aceti AC8. Moreover, AC7 was reported as the least efficient bacterial species for inducing SS gene expression. AC8 enhanced the share of SSA and SS2 up to 43 and 31%, respectively. The study also described ribosomal sequence of the most efficient bacterial strain AC8, which was used to determine its phylogenetic relationships with other microbial strains. The study would be helpful to improve quality of plant produce by modulating transcription of SS genes. PMID:26388880

  1. Transcriptional modulation of squalene synthase genes in barley treated with PGPR.

    PubMed

    Yousaf, Anam; Qadir, Abdul; Anjum, Tehmina; Ahmad, Aqeel

    2015-01-01

    Phytosterol contents and food quality of plant produce is directly associated with transcription of gene squalene synthase (SS). In current study, barley plants were treated with different rhizobacterial strains under semi controlled (27 ± 3°C) greenhouse conditions in order to modulate expression of SS gene. Plant samples were analyzed through semi-quantitative PCR to evaluate effect of rhizobacterial application on transcriptional status of SS. Results revealed that among four SS genes (i.e., SSA, SS1, SS2, and SS3), the most expressive gene was SSA; while, SS2 was screened out as the second best induced gene due to Acetobacter aceti. The most efficient bacterial strain which recorded maximum gene expression was A. aceti AC8. Moreover, AC7 was reported as the least efficient bacterial species for inducing SS gene expression. AC8 enhanced the share of SSA and SS2 up to 43 and 31%, respectively. The study also described ribosomal sequence of the most efficient bacterial strain AC8, which was used to determine its phylogenetic relationships with other microbial strains. The study would be helpful to improve quality of plant produce by modulating transcription of SS genes.

  2. Transcriptional modulation of squalene synthase genes in barley treated with PGPR.

    PubMed

    Yousaf, Anam; Qadir, Abdul; Anjum, Tehmina; Ahmad, Aqeel

    2015-01-01

    Phytosterol contents and food quality of plant produce is directly associated with transcription of gene squalene synthase (SS). In current study, barley plants were treated with different rhizobacterial strains under semi controlled (27 ± 3°C) greenhouse conditions in order to modulate expression of SS gene. Plant samples were analyzed through semi-quantitative PCR to evaluate effect of rhizobacterial application on transcriptional status of SS. Results revealed that among four SS genes (i.e., SSA, SS1, SS2, and SS3), the most expressive gene was SSA; while, SS2 was screened out as the second best induced gene due to Acetobacter aceti. The most efficient bacterial strain which recorded maximum gene expression was A. aceti AC8. Moreover, AC7 was reported as the least efficient bacterial species for inducing SS gene expression. AC8 enhanced the share of SSA and SS2 up to 43 and 31%, respectively. The study also described ribosomal sequence of the most efficient bacterial strain AC8, which was used to determine its phylogenetic relationships with other microbial strains. The study would be helpful to improve quality of plant produce by modulating transcription of SS genes. PMID:26388880

  3. Localization of polyketide synthase encoding genes to the toxic dinoflagellate Karenia brevis

    PubMed Central

    Snyder, Richard V.; Guerrero, Maria A.; Sinigalliano, Christopher D.; Winshell, Jamie; Perez, Roberto; Lopez, Jose V.; Rein, Kathleen S.

    2008-01-01

    Karenia brevis is a toxic marine dinoflagellate endemic to the Gulf of Mexico. Blooms of this harmful alga cause fish kills, marine mammal mortalities and neurotoxic shellfish poisonings. These harmful effects are attributed to a suite of polyketide secondary metabolites known as the brevetoxins. The carbon framework of all polyketides is assembled by a polyketide synthase (PKS). Previously, PKS encoding genes were amplified from K. brevis culture and their similarity to a PKS gene from the closely related protist, Cryptosporidium parvum, suggested that these genes originate from the dinoflagellate. However, K. brevis has not been grown axenically. The associated bacteria might be the source of the toxins or the PKS genes. Herein we report the localization of PKS encoding genes by a combination of flow cytometry/PCR and fluorescence in situ hybridization (FISH). Two genes localized exclusively to K. brevis cells while a third localized to both K. brevis and associated bacteria. While these genes have not yet been linked to toxin production, the work describes the first definitive evidence of resident PKS genes in any dinoflagellate. PMID:16051286

  4. Volatile emissions of scented Alstroemeria genotypes are dominated by terpenes, and a myrcene synthase gene is highly expressed in scented Alstroemeria flowers.

    PubMed

    Aros, Danilo; Gonzalez, Veronica; Allemann, Rudolf K; Müller, Carsten T; Rosati, Carlo; Rogers, Hilary J

    2012-04-01

    Native to South America, Alstroemeria flowers are known for their colourful tepals, and Alstroemeria hybrids are an important cut flower. However, in common with many commercial cut flowers, virtually all the commercial Alstroemeria hybrids are not scented. The cultivar 'Sweet Laura' is one of very few scented commercial Alstroemeria hybrids. Characterization of the volatile emission profile of these cut flowers revealed three major terpene compounds: (E)-caryophyllene, humulene (also known as α-caryophyllene), an ocimene-like compound, and several minor peaks, one of which was identified as myrcene. The profile is completely different from that of the parental scented species A. caryophyllaea. Volatile emission peaked at anthesis in both scented genotypes, coincident in cv. 'Sweet Laura' with the maximal expression of a putative terpene synthase gene AlstroTPS. This gene was preferentially expressed in floral tissues of both cv. 'Sweet Laura' and A. caryophyllaea. Characterization of the AlstroTPS gene structure from cv. 'Sweet Laura' placed it as a member of the class III terpene synthases, and the predicted 567 amino acid sequence placed it into the subfamily TPS-b. The conserved sequences R(28)(R)X(8)W and D(321)DXXD are the putative Mg(2+)-binding sites, and in vitro assay of AlstroTPS expressed in Escherichia coli revealed that the encoded enzyme possesses myrcene synthase activity, consistent with a role for AlstroTPS in scent production in Alstroemeria cv. 'Sweet Laura' flowers.

  5. Functional Analysis of the Brassica napus L. Phytoene Synthase (PSY) Gene Family

    PubMed Central

    López-Emparán, Ada; Quezada-Martinez, Daniela; Zúñiga-Bustos, Matías; Cifuentes, Víctor; Iñiguez-Luy, Federico; Federico, María Laura

    2014-01-01

    Phytoene synthase (PSY) has been shown to catalyze the first committed and rate-limiting step of carotenogenesis in several crop species, including Brassica napus L. Due to its pivotal role, PSY has been a prime target for breeding and metabolic engineering the carotenoid content of seeds, tubers, fruits and flowers. In Arabidopsis thaliana, PSY is encoded by a single copy gene but small PSY gene families have been described in monocot and dicotyledonous species. We have recently shown that PSY genes have been retained in a triplicated state in the A- and C-Brassica genomes, with each paralogue mapping to syntenic locations in each of the three “Arabidopsis-like” subgenomes. Most importantly, we have shown that in B. napus all six members are expressed, exhibiting overlapping redundancy and signs of subfunctionalization among photosynthetic and non photosynthetic tissues. The question of whether this large PSY family actually encodes six functional enzymes remained to be answered. Therefore, the objectives of this study were to: (i) isolate, characterize and compare the complete protein coding sequences (CDS) of the six B. napus PSY genes; (ii) model their predicted tridimensional enzyme structures; (iii) test their phytoene synthase activity in a heterologous complementation system and (iv) evaluate their individual expression patterns during seed development. This study further confirmed that the six B. napus PSY genes encode proteins with high sequence identity, which have evolved under functional constraint. Structural modeling demonstrated that they share similar tridimensional protein structures with a putative PSY active site. Significantly, all six B. napus PSY enzymes were found to be functional. Taking into account the specific patterns of expression exhibited by these PSY genes during seed development and recent knowledge of PSY suborganellar localization, the selection of transgene candidates for metabolic engineering the carotenoid content of

  6. Functional analysis of the Brassica napus L. phytoene synthase (PSY) gene family.

    PubMed

    López-Emparán, Ada; Quezada-Martinez, Daniela; Zúñiga-Bustos, Matías; Cifuentes, Víctor; Iñiguez-Luy, Federico; Federico, María Laura

    2014-01-01

    Phytoene synthase (PSY) has been shown to catalyze the first committed and rate-limiting step of carotenogenesis in several crop species, including Brassica napus L. Due to its pivotal role, PSY has been a prime target for breeding and metabolic engineering the carotenoid content of seeds, tubers, fruits and flowers. In Arabidopsis thaliana, PSY is encoded by a single copy gene but small PSY gene families have been described in monocot and dicotyledonous species. We have recently shown that PSY genes have been retained in a triplicated state in the A- and C-Brassica genomes, with each paralogue mapping to syntenic locations in each of the three "Arabidopsis-like" subgenomes. Most importantly, we have shown that in B. napus all six members are expressed, exhibiting overlapping redundancy and signs of subfunctionalization among photosynthetic and non photosynthetic tissues. The question of whether this large PSY family actually encodes six functional enzymes remained to be answered. Therefore, the objectives of this study were to: (i) isolate, characterize and compare the complete protein coding sequences (CDS) of the six B. napus PSY genes; (ii) model their predicted tridimensional enzyme structures; (iii) test their phytoene synthase activity in a heterologous complementation system and (iv) evaluate their individual expression patterns during seed development. This study further confirmed that the six B. napus PSY genes encode proteins with high sequence identity, which have evolved under functional constraint. Structural modeling demonstrated that they share similar tridimensional protein structures with a putative PSY active site. Significantly, all six B. napus PSY enzymes were found to be functional. Taking into account the specific patterns of expression exhibited by these PSY genes during seed development and recent knowledge of PSY suborganellar localization, the selection of transgene candidates for metabolic engineering the carotenoid content of oilseeds

  7. Homology study of two polyhydroxyalkanoate (PHA) synthases from Pseudomonas aureofaciens.

    PubMed

    Umeda, F; Nishikawa, T; Miyasaka, H; Maeda, I; Kawase, M; Yagi, K

    2001-11-01

    Recently, we have cloned and analyzed two polyhydroxyalkanoate (PHA) synthase genes (phaC1 and phaC2 in the pha cluster) from Pseudomonas aureofaciens. In this report, the deduced amino acid (AA) sequences of PHA synthase 1 and PHA synthase 2 from P. aureofaciens are compared with those from three other bacterial strains (Pseudomonas sp. 61-3, P. oleovorans and P. aeruginosa) containing the homologous pha cluster. The level of homology of either PHA synthase 1 or PHA synthase 2 was high with each enzyme from these three bacterial strains. Furthermore, multialignment of PHA synthase AA sequences implied that both enzymes of PHA synthase 1 and PHA synthase 2 were highly conserved in the four strains including P. aureofaciens. PMID:11916262

  8. Association between allelic variation at the Phytoene synthase 1 gene and yellow pigment content in the wheat grain.

    PubMed

    Zhang, W; Dubcovsky, J

    2008-03-01

    A better understanding of the genetic factors controlling grain yellow pigment content (GYPC) is important for both pasta (high GYPC) and bread wheat (low GYPC) quality improvement. Quantitative trait loci (QTL) for GYPC have been mapped repeatedly on the distal regions of chromosome arms 7AL and 7BL in wheat, and the Phytoene synthase 1 (PSY-1) gene located in this region has been proposed as a candidate gene. We show here that PSY-E1, the tall wheatgrass orthologue, is completely linked to differences in GYPC, and that selection for white endosperm mutants in recombinant lines carrying this gene resulted in the identification of a mutation in a conserved amino acid of PSY-E1. These results, together with the association between GYPC and allelic differences in PSY-1 in hexaploid wheat, suggest that this gene plays an important role in the determination of GYPC. However, a second white endosperm mutant previously mapped to chromosome arm 7EL showed no mutations in PSY-E1 suggesting the existence of additional gene(s) affecting GYPC in this chromosome region. This hypothesis was further supported by the mapping of QTL for GYPC on 7AL proximal to PSY-1 in a cross between pasta wheat varieties UC1113 and Kofa. Interestingly, the Kofa PSY-B1 allele showed unusually high levels of polymorphisms as a result of a conversion event involving the PSY-A1 allele. In summary, our results support the hypothesis that allelic differences in PSY-1 and at least one additional gene in the distal region of the long arm of homoeologous group 7L are associated with differences in GYPC. PMID:18193186

  9. Functional Characterization of New Polyketide Synthase Genes Involved in Ochratoxin A Biosynthesis in Aspergillus Ochraceus fc-1

    PubMed Central

    Wang, Liuqing; Wang, Yan; Wang, Qi; Liu, Fei; Selvaraj, Jonathan Nimal; Liu, Lingna; Xing, Fuguo; Zhao, Yueju; Zhou, Lu; Liu, Yang

    2015-01-01

    Ochratoxin A (OTA), a potentially carcinogenic mycotoxin which contaminates grains, is produced by several Aspergillus species. A comparative sequence analysis of the OTA-producing Aspergillus ochraceus fc-1 strain and other Aspergillus species was performed. Two new OTA-related polyketide synthase (PKS) (AoOTApks) genes were identified. The predicted amino acid sequence of AoOTApks-1 displayed high similarity to previously identified PKSs from OTA-producing A. carbonarius ITEM 5010 (67%; [PI] No. 173482) and A. niger CBS 513.88 (62%; XP_001397313). However, the predicted amino acid sequence of AoOTApks-2 displayed lower homology with A. niger CBS 513.88 (38%) and A. carbonarius ITEM 5010 (28%). A phylogenetic analysis of the β-ketosynthase and acyl-transferase domains of the AoOTApks proteins indicated that they shared a common origin with other OTA-producing species, such as A. carbonarius, A. niger, and A. westerdijkiae. A real-time reverse-transcription PCR analysis showed that the expression of AoOTApks-1 and -2 was positively correlated with the OTA concentration. The pks gene deleted mutants ∆AoOTApks-1 and ∆AoOTApks-2 produced nil and lesser OTA than the wild-type strain, respectively. Our study suggests that AoOTApks-1 could be involved in OTA biosynthesis, while AoOTApks-2 might be indirectly involved in OTA production. PMID:26213966

  10. 2C-Methyl- D- erythritol 2,4-cyclodiphosphate synthase from Stevia rebaudiana Bertoni is a functional gene.

    PubMed

    Kumar, Hitesh; Singh, Kashmir; Kumar, Sanjay

    2012-12-01

    Stevia [Stevia rebaudiana (Bertoni)] is a perennial herb which accumulates sweet diterpenoid steviol glycosides (SGs) in its leaf tissue. SGs are synthesized by 2C-methyl-D-erythritol 4-phosphate (MEP) pathway. Of the various enzymes of the MEP pathway, 2C-methyl-D-erythritol 2,4-cyclodiphosphate synthase (MDS) (encoded by MDS) catalyzes the cyclization of 4-(cytidine 5' diphospho)-2C-methyl-D-erythritol 2-phosphate into 2C-methyl-D-erythritol 2,4-cyclodiphosphate. Complementation of the MDS knockout mutant strain of Escherichia coli, EB370 with putative MDS of stevia (SrMDS) rescued the lethal mutant, suggesting SrMDS to be a functional gene. Experiments conducted in plant growth chamber and in the field suggested SrMDS to be a light regulated gene. Indole 3-acetic acid (IAA; 50, 100 μM) down-regulated the expression of SrMDS at 4 h of the treatment, whereas, abscisic acid did not modulate its expression. A high expression of SrMDS was observed during the light hours of the day as compared to the dark hours. The present work established functionality of SrMDS and showed the role of light and IAA in regulating expression of SrMDS.

  11. Function of heterologous Mycobacterium tuberculosis InhA, a type 2 fatty acid synthase enzyme involved in extending C20 fatty acids to C60-to-C90 mycolic acids, during de novo lipoic acid synthesis in Saccharomyces cerevisiae.

    PubMed

    Gurvitz, Aner; Hiltunen, J Kalervo; Kastaniotis, Alexander J

    2008-08-01

    We describe the physiological function of heterologously expressed Mycobacterium tuberculosis InhA during de novo lipoic acid synthesis in yeast (Saccharomyces cerevisiae) mitochondria. InhA, representing 2-trans-enoyl-acyl carrier protein reductase and the target for the front-line antituberculous drug isoniazid, is involved in the activity of dissociative type 2 fatty acid synthase (FASII) that extends associative type 1 fatty acid synthase (FASI)-derived C(20) fatty acids to form C(60)-to-C(90) mycolic acids. Mycolic acids are major constituents of the protective layer around the pathogen that contribute to virulence and resistance to certain antimicrobials. Unlike FASI, FASII is thought to be incapable of de novo biosynthesis of fatty acids. Here, the genes for InhA (Rv1484) and four similar proteins (Rv0927c, Rv3485c, Rv3530c, and Rv3559c) were expressed in S. cerevisiae etr1Delta cells lacking mitochondrial 2-trans-enoyl-thioester reductase activity. The phenotype of the yeast mutants includes the inability to produce sufficient levels of lipoic acid, form mitochondrial cytochromes, respire, or grow on nonfermentable carbon sources. Yeast etr1Delta cells expressing mitochondrial InhA were able to respire, grow on glycerol, and produce lipoic acid. Commensurate with a role in mitochondrial de novo fatty acid biosynthesis, InhA could accept in vivo much shorter acyl-thioesters (C(4) to C(8)) than was previously thought (>C(12)). Moreover, InhA functioned in the absence of AcpM or protein-protein interactions with its native FASII partners KasA, KasB, FabD, and FabH. None of the four proteins similar to InhA complemented the yeast mutant phenotype. We discuss the implications of our findings with reference to lipoic acid synthesis in M. tuberculosis and the potential use of yeast FASII mutants for investigating the physiological function of drug-targeted pathogen enzymes involved in fatty acid biosynthesis. PMID:18552191

  12. DHA Production in Escherichia coli by Expressing Reconstituted Key Genes of Polyketide Synthase Pathway from Marine Bacteria

    PubMed Central

    Xiao, Kang; Xu, Lin; Wang, Lian; Wan, Xia

    2016-01-01

    The gene encoding phosphopantetheinyl transferase (PPTase), pfaE, a component of the polyketide synthase (PKS) pathway, is crucial for the production of docosahexaenoic acid (DHA, 22:6ω3), along with the other pfa cluster members pfaA, pfaB, pfaC and pfaD. DHA was produced in Escherichia coli by co-expressing pfaABCD from DHA-producing Colwellia psychrerythraea 34H with one of four pfaE genes from bacteria producing arachidonic acid (ARA, 20:4ω6), eicosapentaenoic acid (EPA, 20:5ω3) or DHA, respectively. Substitution of the pfaE gene from different strain source in E. coli did not influence the function of the PKS pathway producing DHA, although they led to different DHA yields and fatty acid profiles. This result suggested that the pfaE gene could be switchable between these strains for the production of DHA. The DHA production by expressing the reconstituted PKS pathway was also investigated in different E. coli strains, at different temperatures, or with the treatment of cerulenin. The highest DHA production, 2.2 mg of DHA per gram of dry cell weight or 4.1% of total fatty acids, was obtained by co-expressing pfaE(EPA) from the EPA-producing strain Shewanella baltica with pfaABCD in DH5α. Incubation at low temperature (10–15°C) resulted in higher accumulation of DHA compared to higher temperatures. The addition of cerulenin to the medium increased the proportion of DHA and saturated fatty acids, including C12:0, C14:0 and C16:0, at the expense of monounsaturated fatty acids, including C16:1 and C18:1. Supplementation with 1 mg/L cerulenin resulted in the highest DHA yield of 2.4 mg/L upon co-expression of pfaE(DHA) from C. psychrerythraea. PMID:27649078

  13. DHA Production in Escherichia coli by Expressing Reconstituted Key Genes of Polyketide Synthase Pathway from Marine Bacteria.

    PubMed

    Peng, Yun-Feng; Chen, Wen-Chao; Xiao, Kang; Xu, Lin; Wang, Lian; Wan, Xia

    2016-01-01

    The gene encoding phosphopantetheinyl transferase (PPTase), pfaE, a component of the polyketide synthase (PKS) pathway, is crucial for the production of docosahexaenoic acid (DHA, 22:6ω3), along with the other pfa cluster members pfaA, pfaB, pfaC and pfaD. DHA was produced in Escherichia coli by co-expressing pfaABCD from DHA-producing Colwellia psychrerythraea 34H with one of four pfaE genes from bacteria producing arachidonic acid (ARA, 20:4ω6), eicosapentaenoic acid (EPA, 20:5ω3) or DHA, respectively. Substitution of the pfaE gene from different strain source in E. coli did not influence the function of the PKS pathway producing DHA, although they led to different DHA yields and fatty acid profiles. This result suggested that the pfaE gene could be switchable between these strains for the production of DHA. The DHA production by expressing the reconstituted PKS pathway was also investigated in different E. coli strains, at different temperatures, or with the treatment of cerulenin. The highest DHA production, 2.2 mg of DHA per gram of dry cell weight or 4.1% of total fatty acids, was obtained by co-expressing pfaE(EPA) from the EPA-producing strain Shewanella baltica with pfaABCD in DH5α. Incubation at low temperature (10-15°C) resulted in higher accumulation of DHA compared to higher temperatures. The addition of cerulenin to the medium increased the proportion of DHA and saturated fatty acids, including C12:0, C14:0 and C16:0, at the expense of monounsaturated fatty acids, including C16:1 and C18:1. Supplementation with 1 mg/L cerulenin resulted in the highest DHA yield of 2.4 mg/L upon co-expression of pfaE(DHA) from C. psychrerythraea. PMID:27649078

  14. Fatty acid synthase is preferentially degraded by autophagy upon nitrogen starvation in yeast

    PubMed Central

    Shpilka, Tomer; Welter, Evelyn; Borovsky, Noam; Amar, Nira; Shimron, Frida; Peleg, Yoav; Elazar, Zvulun

    2015-01-01

    Autophagy, an evolutionarily conserved intracellular catabolic process, leads to the degradation of cytosolic proteins and organelles in the vacuole/lysosome. Different forms of selective autophagy have recently been described. Starvation-induced protein degradation, however, is considered to be nonselective. Here we describe a novel interaction between autophagy-related protein 8 (Atg8) and fatty acid synthase (FAS), a pivotal enzymatic complex responsible for the entire synthesis of C16- and C18-fatty acids in yeast. We show that although FAS possesses housekeeping functions, under starvation conditions it is delivered to the vacuole for degradation by autophagy in a Vac8- and Atg24-dependent manner. We also provide evidence that FAS degradation is essential for survival under nitrogen deprivation. Our results imply that during nitrogen starvation specific proteins are preferentially recruited into autophagosomes PMID:25605918

  15. Gene structure, phylogeny and expression profile of the sucrose synthase gene family in cacao (Theobroma cacao L.).

    PubMed

    Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui

    2015-09-01

    In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.

  16. Gene structure, phylogeny and expression profile of the sucrose synthase gene family in cacao (Theobroma cacao L.).

    PubMed

    Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui

    2015-09-01

    In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family. PMID:26440085

  17. Characterization of a Soil Metagenome-Derived Gene Encoding Wax Ester Synthase.

    PubMed

    Kim, Nam Hee; Park, Ji-Hye; Chung, Eunsook; So, Hyun-Ah; Lee, Myung Hwan; Kim, Jin-Cheol; Hwang, Eul Chul; Lee, Seon-Woo

    2016-02-01

    A soil metagenome contains the genomes of all microbes included in a soil sample, including those that cannot be cultured. In this study, soil metagenome libraries were searched for microbial genes exhibiting lipolytic activity and those involved in potential lipid metabolism that could yield valuable products in microorganisms. One of the subclones derived from the original fosmid clone, pELP120, was selected for further analysis. A subclone spanning a 3.3 kb DNA fragment was found to encode for lipase/esterase and contained an additional partial open reading frame encoding a wax ester synthase (WES) motif. Consequently, both pELP120 and the full length of the gene potentially encoding WES were sequenced. To determine if the wes gene encoded a functioning WES protein that produced wax esters, gas chromatography-mass spectroscopy was conducted using ethyl acetate extract from an Escherichia coli strain that expressed the wes gene and was grown with hexadecanol. The ethyl acetate extract from this E. coli strain did indeed produce wax ester compounds of various carbon-chain lengths. DNA sequence analysis of the full-length gene revealed that the gene cluster may be derived from a member of Proteobacteria, whereas the clone does not contain any clear phylogenetic markers. These results suggest that the wes gene discovered in this study encodes a functional protein in E. coli and produces wax esters through a heterologous expression system.

  18. Isoniazid affects multiple components of the type II fatty acid synthase system of Mycobacterium tuberculosis.

    PubMed

    Slayden, R A; Lee, R E; Barry, C E

    2000-11-01

    Genetic and biochemical evidence has implicated two different target enzymes for isoniazid (INH) within the unique type II fatty acid synthase (FAS) system involved in the production of mycolic acids. These two components are an enoyl acyl carrier protein (ACP) reductase, InhA, and a beta-ketoacyl-ACP synthase, KasA. We compared the consequences of INH treatment of Mycobacterium tuberculosis (MTB) with two inhibitors having well-defined targets: triclosan (TRC), which inhibits InhA; and thiolactomycin (TLM), which inhibits KasA. INH and TLM, but not TRC, upregulate the expression of an operon containing five FAS II components, including kasA and acpM. Although all three compounds inhibit mycolic acid synthesis, treatment with INH and TLM, but not with TRC, results in the accumulation of ACP-bound lipid precursors to mycolic acids that were 26 carbons long and fully saturated. TLM-resistant mutants of MTB were more cross-resistant to INH than TRC-resistant mutants. Overexpression of KasA conferred more resistance to TLM and INH than to TRC. Overexpression of InhA conferred more resistance to TRC than to INH and TLM. Co-overexpression of both InhA and KasA resulted in strongly enhanced levels of INH resistance, in addition to cross-resistance to both TLM and TRC. These results suggest that these components of the FAS II complex are not independently regulated and that alterations in the expression level of InhA affect expression levels of KasA. Nonetheless, INH appeared to resemble TLM more closely in overall mode of action, and KasA levels appeared to be tightly correlated with INH sensitivity. PMID:11069675

  19. Development of intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase for discriminating Curcuma species.

    PubMed

    Kita, Tomoko; Komatsu, Katsuko; Zhu, Shu; Iida, Osamu; Sugimura, Koji; Kawahara, Nobuo; Taguchi, Hiromu; Masamura, Noriya; Cai, Shao-Qing

    2016-03-01

    Various Curcuma rhizomes have been used as medicines or spices in Asia since ancient times. It is very difficult to distinguish them morphologically, especially when they are boiled and dried, which causes misidentification leading to a loss of efficacy. We developed a method for discriminating Curcuma species by intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase. This method could apply to identification of not only fresh plants but also samples of crude drugs or edible spices. By applying this method to Curcuma specimens and samples, and constructing a dendrogram based on these markers, seven Curcuma species were clearly distinguishable. Moreover, Curcuma longa specimens were geographically distinguishable. On the other hand, Curcuma kwangsiensis (gl type) specimens also showed intraspecies polymorphism, which may have occurred as a result of hybridization with other Curcuma species. The molecular method we developed is a potential tool for global classification of the genus Curcuma.

  20. Transcriptional regulation of the genes encoding chitin and β-1,3-glucan synthases from Ustilago maydis.

    PubMed

    Robledo-Briones, Mariana; Ruiz-Herrera, José

    2012-07-01

    Transcriptional regulation of genes encoding chitin synthases (CHS) and β-1,3-glucan synthase (GLS) from Ustilago maydis was studied. Transcript levels were measured during the growth curve of yeast and mycelial forms, in response to ionic and osmotic stress, and during infection of maize plants. Expression of the single GLS gene was constitutive. In contrast, CHS genes expression showed differences depending on environmental conditions. Transcript levels were slightly higher in the mycelial forms, the highest levels occurring at the log phase. Ionic and osmotic stress induced alterations in the expression of CHS genes, but not following a defined pattern, some genes were induced and others repressed by the tested compounds. Changes in transcripts were more apparent during the pathogenic process. At early infection stages, only CHS6 gene showed significant transcript levels, whereas at the period of tumor formation CHS7 and CHS8 genes were also were induced.

  1. Tracking sesamin synthase gene expression through seed maturity in wild and cultivated sesame species--a domestication footprint.

    PubMed

    Pathak, N; Bhaduri, A; Bhat, K V; Rai, A K

    2015-09-01

    Sesamin and sesamolin are the major oil-soluble lignans present in sesame seed, having a wide range of biological functions beneficial to human health. Understanding sesame domestication history using sesamin synthase gene expression could enable delineation of the sesame putative progenitor. This report examined the functional expression of sesamin synthase (CYP81Q1) during capsule maturation (0-40 days after flowering) in three wild Sesamum species and four sesame cultivars. Among the cultivated accessions, only S. indicum (CO-1) exhibited transcript abundance of sesamin synthase along with high sesamin content similar to S. malabaricum, while the other cultivated sesame showed low expression. The sesamin synthase expression analysis, coupled with quantification of sesamin level, indicates that sesamin synthase was not positively favoured during domestication. The sesamin synthase expression pattern and lignan content, along with phylogenetic analysis suggested a close relationship of cultivated sesame and the wild species S. malabaricum. The high genetic identity between the two species S. indicum and S. malabaricum points towards the role of the putative progenitor S. malabaricum in sesame breeding programmes to broaden the genetic base of sesame cultivars. This study emphasises the need to investigate intraspecific and interspecific variation in the primary, secondary and tertiary gene pools to develop superior sesame genotypes.

  2. Insect attack and wounding induce traumatic resin duct development and gene expression of (-)-pinene synthase in Sitka spruce.

    PubMed

    McKay, S Ashley Byun; Hunter, William L; Godard, Kimberley-Ann; Wang, Shawn X; Martin, Diane M; Bohlmann, Jörg; Plant, Aine L

    2003-09-01

    Conifers possess inducible terpenoid defense systems. These systems are associated with the formation of traumatic resin ducts (TRD) and are underpinned by enhanced gene expression and activity of terpene synthases (TPS), enzymes responsible for oleoresin formation. We first determined that Sitka spruce (Picea sitchensis [Bong.] Carriere) had the capacity for TRD formation by mechanically wounding representative trees. We then proceeded to investigate whether the white pine weevil (Pissodes strobi Peck.), a stem-boring insect, can influence the expression of genes encoding monoterpene synthases (mono-tps) in Sitka spruce. We went on to compare this response with the effects of a simulated insect attack by drill wounding. A significant increase in mono-tps transcript level was observed in the leaders of lateral branches of weevil-attacked and mechanically wounded trees. In this study, weevils induced a more rapid enhancement of mono-tps gene expression. A full-length Sitka spruce mono-tps cDNA (PsTPS2) was isolated, expressed in Escherichia coli, and functionally identified as (-)-pinene synthase. The recombinant (-)-pinene synthase catalyzes the formation of (-)-alpha-pinene and (-)-beta-pinene, both of which are known constituents of stem oleoresin in Sitka spruce and increase in abundance after weevil attack. These data suggest that increased (-)-pinene synthase gene expression is an important element of the direct defense system deployed in Sitka spruce after insect attack.

  3. [Mechanism of genuineness of Glycyrrhiza uralensis based on SNP of β-Amyrin synthase gene].

    PubMed

    Zang, Yi-mei; Li, Yan-peng; Qiao, Jing; Chen, Hong-hao; Liu, Chun-sheng

    2015-07-01

    β-Amyrin synthase (β-AS) genes of Glycyrrhiza uralensis from 6 different regions were analyzed by PCR-SSCP and sequenced, then the correlationship between β-AS SNP and regions of Glycyrrhiza uralensis were determined. According to the 1 coding single nucleotide polymorphism on the first exon of β-AS gene at 94 bp site, Glycyrrhiza uralensis could be divided into 3 genotypes. In these genotypes, the percentage of 94A type in genuine regions was much higher, and it had significant differences with the percentage in non-genuine regions (P < 0.001). The results of the experiment proved that different β-AS genotypes at 94 bp site from different regions may be one of the important reasons to result in the genuineness of Glycyrrhiza uralensis. PMID:26552155

  4. Point mutations in dihydrofolate reductase and dihydropteroate synthase genes of Plasmodium falciparum isolates from Venezuela.

    PubMed

    Urdaneta, L; Plowe, C; Goldman, I; Lal, A A

    1999-09-01

    The present study was designed to characterize mutations in dihydrofolate reductase (DHFR) and dihydropteroate synthase (DHPS) genes of Plasmodium falciparum in the Bolivar region of Venezuela, where high levels of clinical resistance to sulfadoxine-pyrimethamine (SP, Fansidar; F. Hoffman-La Roche, Basel, Switzerland) has been documented. We used a nested mutation-specific polymerase chain reaction and restriction digestion methods to measure 1) the prevalence of DHFR mutations at 16, 50, 51, 59, 108, and 164 codon positions, and 2) the prevalence of mutations in the 436, 437, 581, and 613 codon sites in DHPS gene. In the case of the DHFR gene, of the 54 parasite isolates analyzed, we detected the presence of Asn-108 and Ile-51 in 96% of the isolates and Arg-50 mutation in 64% of the isolates. Each of these mutations has been associated with high level of resistance to pyrimethamine. Only 2 samples (4%) showed the wild type Ser-108 mutation and none showed Thr-108 and Val-16 mutations that are specific for resistance to cycloguanil. In the case of DHPS gene, we found a mutation at position 437 (Gly) in 100% of the isolates and Gly-581 in 96% of the isolates. The simultaneous presence of mutations Asn-108 and Ile-51 in the DHFR gene and Gly-437 and Gly-581 in the DHPS gene in 96% of the samples tested suggested that a cumulative effect of mutations could be the major mechanism conferring high SP resistance in this area. PMID:10497990

  5. Glyphosate selected amplification of the 5-enolpyruvylshikimate-3-phosphate synthase gene in cultured carrot cells.

    PubMed

    Shyr, Y Y; Hepburn, A G; Widholm, J M

    1992-04-01

    CAR and C1, two carrot (Daucus carota L.) suspension cultures of different genotypes, were subjected to stepwise selection for tolerance to the herbicide glyphosate [(N-phosphonomethyl)glycine]. The specific activity of the target enzyme, 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS), as well as the mRNA level and copy number of the structural gene increased with each glyphosate selection step. Therefore, the tolerance to glyphosate is due to stepwise amplification of the EPSPS genes. During the amplification process, DNA rearrangement did not occur within the EPSPS gene of the CAR cell line but did occur during the selection step from 28 to 35 mM glyphosate for the C1 cell line, as determined by Southern hybridization of selected cell DNA following EcoRI restriction endonuclease digestion. Two cell lines derived from a previously selected glyphosate-tolerant cell line (PR), which also had undergone EPSPS gene amplification but have been maintained in glyphosate-free medium for 2 and 5 years, have lost 36 and 100% of the increased EPSPS activity, respectively. Southern blot analysis of these lines confirms that the amplified DNA is relatively stable in the absence of selection. These studies demonstrate that stepwise selection for glyphosate resistance reproducibly produces stepwise amplification of the EPSPS genes. The relative stability of this amplification indicates that the amplified genes are not extrachromosomal.

  6. Transcriptome analysis of potato leaves expressing the trehalose-6-phosphate synthase 1 gene of yeast.

    PubMed

    Kondrák, Mihály; Marincs, Ferenc; Kalapos, Balázs; Juhász, Zsófia; Bánfalvi, Zsófia

    2011-01-01

    Transgenic lines of the potato cultivar White Lady expressing the trehalose-6-phosphate synthase (TPS1) gene of yeast exhibit improved drought tolerance, but grow slower and have a lower carbon fixation rate and stomatal density than the wild-type. To understand the molecular basis of this phenomenon, we have compared the transcriptomes of wild-type and TPS1-transgenic plants using the POCI microarray containing 42,034 potato unigene probes. We show that 74 and 25 genes were up-, and down-regulated, respectively, in the mature source leaves of TPS1-transgenic plants when compared with the wild-type. The differentially regulated genes were assigned into 16 functional groups. All of the seven genes, which were assigned into carbon fixation and metabolism group, were up-regulated, while about 42% of the assigned genes are involved in transcriptional and post-transcriptional regulation. Expression of genes encoding a 14-3-3 regulatory protein, and four transcription factors were down-regulated in the TPS1-transgenic leaves. To verify the microarray results, we used RNA gel blot analysis to examine the expression of eight genes and found that the RNA gel blot and microarray data correlated in each case. Using the putative Arabidopsis orthologs of the assigned potato sequences we have identified putative transcription binding sites in the promoter region of the differentially regulated genes, and putative protein-protein interactions involving some of the up- and down-regulated genes. We have also demonstrated that starch content is lower, while malate, inositol and maltose contents are higher in the TPS1-transgenic than in the wild-type leaves. Our results suggest that a complex regulatory network, involving transcription factors and other regulatory proteins, underpins the phenotypic alterations we have observed previously in potato when expressing the TPS1 gene of yeast.

  7. Structural characterization of 15-hydroxytrichodiene, a sesquiterpenoid produced by transformed tobacco cell suspension cultures expressing a trichodiene synthase gene from Fusarium sporotrichioides.

    PubMed

    Zook, M; Johnson, K; Hohn, T; Hammerschmidt, R

    1996-12-01

    Tobacco (Nicotiana tabaccum) cell suspension cultures transformed with a gene encoding trichodiene synthase, a sesquiterpene synthase from the fungus Fusarium sporotrichioides, produced a novel sesquiterpenoid derived from the in vivo production of trichodiene. Mass and nuclear magnetic resonance spectroscopic analyses identified the new compound as 15-hydroxytrichodiene. The in vivo hydroxylation of trichodiene by transformant tobacco cell suspension cultures demonstrates that the introduction of a foreign sesquiterpene synthase gene can result in the production of novel sesquiterpenoid metabolites. PMID:8987907

  8. UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6.

    PubMed

    Miyata, Maiko; Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko; Sugiura, Kazumitsu; Furukawa, Koichi; Furukawa, Keiko

    2014-03-01

    Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes. PMID:24548412

  9. UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6.

    PubMed

    Miyata, Maiko; Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko; Sugiura, Kazumitsu; Furukawa, Koichi; Furukawa, Keiko

    2014-03-01

    Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes.

  10. ACTIVATION OF VASCULAR ENDOTHELIAL NITRIC OXIDE SYNTHASE AND HEME OXYGENASE-1 EXPRESSION BY ELECTROPHILIC NITRO-FATTY ACIDS

    PubMed Central

    Khoo, Nicholas K.H.; Rudolph, Volker; Cole, Marsha P.; Golin-Bisello, Franca; Schopfer, Francisco J.; Woodcock, Steven R.; Batthyany, Carlos; Freeman, Bruce A.

    2010-01-01

    Reactive oxygen species mediate a decrease in nitric oxide (NO) bioavailability and endothelial dysfunction, with secondary oxidized and nitrated byproducts of these reactions contributing to the pathogenesis of numerous vascular diseases. While oxidized lipids and lipoproteins exacerbate inflammatory reactions in the vasculature, in stark contrast the nitration of polyunsaturated fatty acids and complex lipids yield electrophilic products that exhibit pluripotent anti-inflammatory signaling capabilities acting via both cGMP-dependent and -independent mechanisms. Herein we report that nitro-oleic acid (OA-NO2) treatment increases expression of endothelial nitric oxide synthase (eNOS) and heme oxygenase 1 (HO-1) in the vasculature, thus transducing vascular protective effects associated with enhanced NO production. Administration of OA-NO2 via osmotic pump results in a significant increase in eNOS and HO-1 mRNA in mouse aortas. Moreover, HPLC-MS/MS analysis showed that NO2-FAs are rapidly metabolized in cultured endothelial cells (ECs) and treatment with NO2-FAs stimulated the phosphorylation of eNOS at Ser1179. These post-translational modifications of eNOS, in concert with elevated eNOS gene expression, contributed to an increase in endothelial NO production. In aggregate, OA-NO2-induced eNOS and HO-1 expression by vascular cells can induce beneficial effects on endothelial function and provide a new strategy for treating various vascular inflammatory and hypertensive disorders. PMID:19857569

  11. Protection of rabbit lungs from endotoxin injury by in vivo hyperexpression of the prostaglandin G/H synthase gene.

    PubMed Central

    Conary, J T; Parker, R E; Christman, B W; Faulks, R D; King, G A; Meyrick, B O; Brigham, K L

    1994-01-01

    A recombinant prostaglandin G/H (PGH) synthase gene has been expressed in vitro in bovine pulmonary artery endothelial cells and in vivo in rabbits by transfection with a plasmid using cationic liposomes. Transfection of bovine pulmonary artery endothelial cells with the PGH synthase cDNA resulted in increased intracellular PGH synthase protein (determined by Western blot analysis) and increased release of prostacyclin. Rabbits intravenously transfected with the PGH synthase gene had increased plasma levels of prostacyclin and PGE2, and their lungs produced increased amounts of the same eicosanoids. In an in situ, perfused preparation of PGH synthase transfected rabbit lungs, the pressor response to endotoxin was markedly attenuated. In addition, pulmonary edema and release of thromboxane B2 into the perfusate after endotoxin infusion were markedly decreased in transfected lungs compared to controls (animals transfected with a pCMV4 construct that did not contain a cDNA insert). The data suggest that augmented endogenous production of prostacyclin and PGE2, achieved by liposome-mediated gene transfer, protects the lungs from endotoxin. This may be caused in part by suppression of endotoxin-stimulated thromboxane B2 production. Modification of lipid mediator responses by in vivo transfection is a potential approach to the therapy of acute lung injury. Images PMID:8163682

  12. Association of thymidylate synthase gene with endometrial cancer risk in a Chinese population

    PubMed Central

    Xu, Wang-Hong; Long, Ji-Rong; Zheng, Wei; Ruan, Zhi-Xian; Cai, Qiuyin; Cheng, Jia-Rong; Zhao, Gen-Ming; Xiang, Yong-Bing; Shu, Xiao-Ou

    2009-01-01

    We comprehensively evaluated genetic variants in the thymidylate synthase (TYMS) gene in association with endometrial cancer risk in a population-based case-control study of 1,199 incident endometrial cancer cases and 1,212 age frequency-matched population controls. Exposure information was obtained via in-person interview and DNA samples (blood or buccal cell) were collected. Genotyping of 11 haplotype-tagging SNPs (htSNPs) for the TYMS gene plus the 5kb flanking regions was performed for 1,028 cases and 1,003 controls by using the Affymetrix MegAllele Targeted Genotyping System. Of eleven htSNPs identified, seven that are located in flanking regions of the TYMS gene are also in the ENOSF1 (rTS) gene. The SNP rs3819102, located in the 3′ flanking region of the TYMS gene and in an intron of the ENOSF1 gene, was associated with risk of endometrial cancer. The odds ratio (OR) for the CC genotype was 1.5 (95% confidence interval (CI) =1.0–2.2) compared to the TT genotype. Haplotype TTG in block 2 of the TYMS gene, which includes SNPs rs10502289, rs2298583, and rs2298581 (located in introns of the ENOSF1 gene), was associated with a marginally significant decrease in risk of endometrial cancer under the dominant model (OR=0.8, 95%CI=0.6–1.0). This study suggests that genetic polymorphisms in the TYMS or ENOSF1 genes may play a role in the development of endometrial cancer among Chinese women. PMID:19190136

  13. Analyses of the sucrose synthase gene family in cotton: structure, phylogeny and expression patterns

    PubMed Central

    2012-01-01

    Background In plants, sucrose synthase (Sus) is widely considered as a key enzyme involved in sucrose metabolism. Several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, while limited information of Sus genes is available to date for cotton. Results Here, we report the molecular cloning, structural organization, phylogenetic evolution and expression profiles of seven Sus genes (GaSus1 to 7) identified from diploid fiber cotton (Gossypium arboreum). Comparisons between cDNA and genomic sequences revealed that the cotton GaSus genes were interrupted by multiple introns. Comparative screening of introns in homologous genes demonstrated that the number and position of Sus introns are highly conserved among Sus genes in cotton and other more distantly related plant species. Phylogenetic analysis showed that GaSus1, GaSus2, GaSus3, GaSus4 and GaSus5 could be clustered together into a dicot Sus group, while GaSus6 and GaSus7 were separated evenly into other two groups, with members from both dicot and monocot species. Expression profiles analyses of the seven Sus genes indicated that except GaSus2, of which the transcripts was undetectable in all tissues examined, and GaSus7, which was only expressed in stem and petal, the other five paralogues were differentially expressed in a wide ranges of tissues, and showed development-dependent expression profiles in cotton fiber cells. Conclusions This is a comprehensive study of the Sus gene family in cotton plant. The results presented in this work provide new insights into the evolutionary conservation and sub-functional divergence of the cotton Sus gene family in response to cotton fiber growth and development. PMID:22694895

  14. Plastid-expressed 5-enolpyruvylshikimate-3-phosphate synthase genes provide high level glyphosate tolerance in tobacco.

    PubMed

    Ye, G N; Hajdukiewicz, P T; Broyles, D; Rodriguez, D; Xu, C W; Nehra, N; Staub, J M

    2001-02-01

    Plastid transformation (transplastomic) technology has several potential advantages for biotechnological applications including the use of unmodified prokaryotic genes for engineering, potential high-level gene expression and gene containment due to maternal inheritance in most crop plants. However, the efficacy of a plastid-encoded trait may change depending on plastid number and tissue type. We report a feasibility study in tobacco plastids to achieve high-level herbicide resistance in both vegetative tissues and reproductive organs. We chose to test glyphosate resistance via over-expression in plastids of tolerant forms of 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). Immunological, enzymatic and whole-plant assays were used to prove the efficacy of three different prokaryotic (Achromobacter, Agrobacterium and Bacillus) EPSPS genes. Using the Agrobacterium strain CP4 EPSPS as a model we identified translational control sequences that direct a 10,000-fold range of protein accumulation (to >10% total soluble protein in leaves). Plastid-expressed EPSPS could provide very high levels of glyphosate resistance, although levels of resistance in vegetative and reproductive tissues differed depending on EPSPS accumulation levels, and correlated to the plastid abundance in these tissues. Paradoxically, higher levels of plastid-expressed EPSPS protein accumulation were apparently required for efficacy than from a similar nuclear-encoded gene. Nevertheless, the demonstration of high-level glyphosate tolerance in vegetative and reproductive organs using transplastomic technology provides a necessary step for transfer of this technology to other crop species.

  15. Chromosomal Organization and Sequence Diversity of Genes Encoding Lachrymatory Factor Synthase in Allium cepa L.

    PubMed

    Masamura, Noriya; McCallum, John; Khrustaleva, Ludmila; Kenel, Fernand; Pither-Joyce, Meegham; Shono, Jinji; Suzuki, Go; Mukai, Yasuhiko; Yamauchi, Naoki; Shigyo, Masayoshi

    2012-06-01

    Lachrymatory factor synthase (LFS) catalyzes the formation of lachrymatory factor, one of the most distinctive traits of bulb onion (Allium cepa L.). Therefore, we used LFS as a model for a functional gene in a huge genome, and we examined the chromosomal organization of LFS in A. cepa by multiple approaches. The first-level analysis completed the chromosomal assignment of LFS gene to chromosome 5 of A. cepa via the use of a complete set of A. fistulosum-shallot (A. cepa L. Aggregatum group) monosomic addition lines. Subsequent use of an F(2) mapping population from the interspecific cross A. cepa × A. roylei confirmed the assignment of an LFS locus to this chromosome. Sequence comparison of two BAC clones bearing LFS genes, LFS amplicons from diverse germplasm, and expressed sequences from a doubled haploid line revealed variation consistent with duplicated LFS genes. Furthermore, the BAC-FISH study using the two BAC clones as a probe showed that LFS genes are localized in the proximal region of the long arm of the chromosome. These results suggested that LFS in A. cepa is transcribed from at least two loci and that they are localized on chromosome 5. PMID:22690373

  16. Structure and function of ∆1-tetrahydrocannabinolic acid (THCA) synthase, the enzyme controlling the psychoactivity of Cannabis sativa.

    PubMed

    Shoyama, Yoshinari; Tamada, Taro; Kurihara, Kazuo; Takeuchi, Ayako; Taura, Futoshi; Arai, Shigeki; Blaber, Michael; Shoyama, Yukihiro; Morimoto, Satoshi; Kuroki, Ryota

    2012-10-12

    ∆1-Tetrahydrocannabinolic acid (THCA) synthase catalyzes the oxidative cyclization of cannabigerolic acid (CBGA) into THCA, the precursor of the primary psychoactive agent ∆1-tetrahydrocannabinol in Cannabis sativa. The enzyme was overproduced in insect cells, purified, and crystallized in order to investigate the structure-function relationship of THCA synthase, and the tertiary structure was determined to 2.75Å resolution by X-ray crystallography (R(cryst)=19.9%). The THCA synthase enzyme is a member of the p-cresol methyl-hydroxylase superfamily, and the tertiary structure is divided into two domains (domains I and II), with a flavin adenine dinucleotide coenzyme positioned between each domain and covalently bound to His114 and Cys176 (located in domain I). The catalysis of THCA synthesis involves a hydride transfer from C3 of CBGA to N5 of flavin adenine dinucleotide and the deprotonation of O6' of CBGA. The ionized residues in the active site of THCA synthase were investigated by mutational analysis and X-ray structure. Mutational analysis indicates that the reaction does not involve the carboxyl group of Glu442 that was identified as the catalytic base in the related berberine bridge enzyme but instead involves the hydroxyl group of Tyr484. Mutations at the active-site residues His292 and Tyr417 resulted in a decrease in, but not elimination of, the enzymatic activity of THCA synthase, suggesting a key role for these residues in substrate binding and not direct catalysis.

  17. Crystal structure of the thioesterase domain of human fatty acid synthase inhibited by orlistat

    SciTech Connect

    Pemble,C.; Johnson, L.; Kridel, S.; Lowther, W.

    2007-01-01

    Human fatty acid synthase (FAS) is uniquely expressed at high levels in many tumor types. Pharmacological inhibition of FAS therefore represents an important therapeutic opportunity. The drug Orlistat, which has been approved by the US Food and Drug Administration, inhibits FAS, induces tumor cell-specific apoptosis and inhibits the growth of prostate tumor xenografts. We determined the 2.3-{angstrom}-resolution crystal structure of the thioesterase domain of FAS inhibited by Orlistat. Orlistat was captured in the active sites of two thioesterase molecules as a stable acyl-enzyme intermediate and as the hydrolyzed product. The details of these interactions reveal the molecular basis for inhibition and suggest a mechanism for acyl-chain length discrimination during the FAS catalytic cycle. Our findings provide a foundation for the development of new cancer drugs that target FAS.

  18. Fatty acid synthase inhibitors of phenolic constituents isolated from Garcinia mangostana.

    PubMed

    Jiang, He Zhong; Quan, Xiao Fang; Tian, Wei Xi; Hu, Jiang Miao; Wang, Peng Cheng; Huang, Sheng Zhuo; Cheng, Zhong Quan; Liang, Wen Juan; Zhou, Jun; Ma, Xiao Feng; Zhao, You Xing

    2010-10-15

    Natural inhibitors of fatty acid synthase (FAS) are emerging as potential therapeutic agents to treat cancer and obesity. The bioassay-guided chemical investigation of the hulls of Garcinia mangostana led to the isolation of 13 phenolic compounds (1-13) mainly including xanthone and benzophenone, in which compounds 7, 8, 9, 10, and 11 were isolated from this plant for the first time and compound 9 was a new natural product. These isolates possess strong inhibitory activity of FAS with the IC(50) values ranging from 1.24 to 91.07 μM. The study indicates that two types of natural products, xanthones and benzophenones, could be considered as promising FAS inhibitors.

  19. Evaluating the Effect of Expressing a Peanut Resveratrol Synthase Gene in Rice

    PubMed Central

    Li, Zhen; Wang, Qingguo; Yao, Fangyin; Yang, Lianqun; Pan, Jiaowen; Liu, Wei

    2015-01-01

    Resveratrol (Res) is a type of natural plant stilbenes and phytoalexins that only exists in a few plant species. Studies have shown that the Res could be biosynthesized and accumulated within plants, once the complete metabolic pathway and related enzymes, such as the key enzyme resveratrol synthase (RS), existed. In this study, a RS gene named PNRS1 was cloned from the peanut, and the activity was confirmed in E. coli. Using transgenic approach, the PNRS1 transgenic rice was obtained. In T3 generation, the Res production and accumulation were further detected by HPLC. Our data revealed that compared to the wild type rice which trans-resveratrol was undetectable, in transgenic rice, the trans-resveratrol could be synthesized and achieved up to 0.697 μg/g FW in seedlings and 3.053 μg/g DW in seeds. Furthermore, the concentration of trans-resveratrol in transgenic rice seedlings could be induced up to eight or four-fold higher by ultraviolet (UV-C) or dark, respectively. Simultaneously, the endogenous increased of Res also showed the advantages in protecting the host plant from UV-C caused damage or dark-induced senescence. Our data indicated that Res was involved in host-defense responses against environmental stresses in transgenic rice. Here the results describes the processes of a peanut resveratrol synthase gene transformed into rice, and the detection of trans-resveratrol in transgenic rice, and the role of trans-resveratrol as a phytoalexin in transgenic rice when treated by UV-C and dark. These findings present new outcomes of transgenic approaches for functional genes and their corresponding physiological functions, and shed some light on broadening available resources of Res, nutritional improvement of crops, and new variety cultivation by genetic engineering. PMID:26302213

  20. Nicotianamine synthase overexpression positively modulates iron homeostasis-related genes in high iron rice.

    PubMed

    Wang, Meng; Gruissem, Wilhelm; Bhullar, Navreet K

    2013-01-01

    Nearly one-third of the world population, mostly women and children, suffer from iron malnutrition and its consequences, such as anemia or impaired mental development. Biofortification of rice, which is a staple crop for nearly half of the world's population, can significantly contribute in alleviating iron deficiency. NFP rice (transgenic rice expressing nicotianamine synthase, ferritin and phytase genes) has a more than six-fold increase in iron content in polished rice grains, resulting from the synergistic action of nicotianamine synthase (NAS) and ferritin transgenes. We investigated iron homeostasis in NFP plants by analyzing the expression of 28 endogenous rice genes known to be involved in the homeostasis of iron and other metals, in iron-deficient and iron-sufficient conditions. RNA was collected from different tissues (roots, flag leaves, grains) and at three developmental stages during grain filling. NFP plants showed increased sensitivity to iron-deficiency conditions and changes in the expression of endogenous genes involved in nicotianamine (NA) metabolism, in comparison to their non-transgenic siblings (NTS). Elevated transcript levels were detected in NFP plants for several iron transporters. In contrast, expression of OsYSL2, which encodes a member of yellow stripe like protein family, and a transporter of the NA-Fe(II) complex was reduced in NFP plants under low iron conditions, indicating that expression of OsYSL2 is regulated by the endogenous iron status. Expression of the transgenes did not significantly affect overall iron homeostasis in NFP plants, which establishes the engineered push-pull mechanism as a suitable strategy to increase rice endosperm iron content.

  1. Molecular cloning, characterization, and overexpression of ERG7, the Saccharomyces cerevisiae gene encoding lanosterol synthase.

    PubMed Central

    Corey, E J; Matsuda, S P; Bartel, B

    1994-01-01

    We report the cloning, characterization, and overexpression of Saccharomyces cerevisiae ERG7, which encodes lanosterol synthase [(S)-2,3-epoxysqualene mutase (cyclizing, lanosterol forming), EC 5.4.99.7], the enzyme responsible for the complex cyclization/rearrangement step in sterol biosynthesis. Oligonucleotide primers were designed corresponding to protein sequences conserved between Candida albicans ERG7 and the related Arabidopsis thaliana cycloartenol synthase [(S)-2,3-epoxysqualene mutase (cyclizing, cycloartenol forming), EC 5.4.99.8]. A PCR product was amplified from yeast genomic DNA using these primers and was used to probe yeast libraries by hybridization. Partial-length clones homologous to the two known epoxysqualene mutases were isolated, but a full-length sequence was found neither in cDNA nor genomic libraries, whether in phage or plasmids. Two overlapping clones were assembled to make a functional reconstruction of the gene, which contains a 2196-bp open reading frame capable of encoding an 83-kDa protein. The reconstruction complemented the erg7 mutation when driven from either its native promoter or the strong ADH1 promoter. Images PMID:8134375

  2. Functional Analysis of a Predicted Flavonol Synthase Gene Family in Arabidopsis1[W][OA

    PubMed Central

    Owens, Daniel K.; Alerding, Anne B.; Crosby, Kevin C.; Bandara, Aloka B.; Westwood, James H.; Winkel, Brenda S.J.

    2008-01-01

    The genome of Arabidopsis (Arabidopsis thaliana) contains five sequences with high similarity to FLAVONOL SYNTHASE1 (AtFLS1), a previously characterized flavonol synthase gene that plays a central role in flavonoid metabolism. This apparent redundancy suggests the possibility that Arabidopsis uses multiple isoforms of FLS with different substrate specificities to mediate the production of the flavonols, quercetin and kaempferol, in a tissue-specific and inducible manner. However, biochemical and genetic analysis of the six AtFLS sequences indicates that, although several of the members are expressed, only AtFLS1 encodes a catalytically competent protein. AtFLS1 also appears to be the only member of this group that influences flavonoid levels and the root gravitropic response in seedlings under nonstressed conditions. This study showed that the other expressed AtFLS sequences have tissue- and cell type-specific promoter activities that overlap with those of AtFLS1 and encode proteins that interact with other flavonoid enzymes in yeast two-hybrid assays. Thus, it is possible that these “pseudogenes” have alternative, noncatalytic functions that have not yet been uncovered. PMID:18467451

  3. Characterization and functional analysis of a chitin synthase gene (HcCS1) identified from the freshwater pearlmussel Hyriopsis cumingii.

    PubMed

    Zheng, H F; Bai, Z Y; Lin, J Y; Wang, G L; Li, J L

    2015-01-01

    The triangle sail mussel, Hyriopsis cumingii, is the most important freshwater pearl mussel in China. However, the mechanisms underlying its chitin-mediated shell and nacre formation remain largely unknown. Here, we characterized a chitin synthase (CS) gene (HcCS1) in H. cumingii, and analyzed its possible physiological function. The complete ORF sequence of HcCS1 contained 6903 bp, encoding a 2300-amino acid protein (theoretical molecular mass = 264 kDa; isoelectric point = 6.22), and no putative signal peptide was predicted. A myosin motor head domain, a CS domain, and 12 transmembrane domains were found. The predicted spatial structures of the myosin head and CS domains were similar to the electron microscopic structure of the heavy meromyosin subfragment of chicken smooth muscle myosin and the crystal structure of bacterial cellulose synthase, respectively. This structural similarity indicates that the functions of these two domains might be conserved. Quantitative reverse transcription PCR results showed that HcCS1 was present in all detected tissues, with the highest expression levels detected in the mantle. The HcCS1 transcripts in the mantle were upregulated following shell damage from 12 to 24 h post-damage, and they peaked (approximately 1.5-fold increase) at 12 h after shell damage. These findings suggest that HcCS1 was involved in shell regeneration, and that it might participate in shell and nacre formation in this species via chitin synthesis. HcCS1 might also dynamically regulate chitin deposition during the process of shell and nacre formation with the help of its conserved myosin head domain. PMID:26782579

  4. Cloning and Characterization of a Flavonol Synthase Gene from Scutellaria baicalensis

    PubMed Central

    Kim, Yeon Bok; Kim, KwangSoo; Kim, YeJi; Tuan, Pham Anh; Kim, Haeng Hoon; Cho, Jin Woong; Park, Sang Un

    2014-01-01

    Flavonols are the most abundant of all the flavonoids and play pivotal roles in a variety of plants. We isolated a cDNA clone encoding flavonol synthase from Scutellaria baicalensis (SbFLS). The SbFLS cDNA is 1011 bp long, encodes 336 amino acid residues, and belongs to a family of 2-oxoglutarate-dependent dioxygenases. The overall structure of SbFLS is very similar to that of Arabidopsis thaliana anthocyanidin synthase (AtANS), with a β jelly-roll fold surrounded by tens of short and long α-helices. SbFLS was constitutively expressed in the roots, stems, leaves, and flowers, with particularly high expression in the roots and flowers. SbFLS transcript levels in the roots were 376-, 70-, and 2.5-fold higher than in the leaves, stems, and flowers. The myricetin content was significantly higher than that of kaempferol and quercetin. Therefore, we suggest that SbFLS mediates flavonol formation in the different organs of S. baicalensis. Our study may contribute to the knowledge of the role of FLS in S. baicalensis. PMID:24672406

  5. Cloning and characterization of a flavonol synthase gene from Scutellaria baicalensis.

    PubMed

    Kim, Yeon Bok; Kim, KwangSoo; Kim, Yeji; Tuan, Pham Anh; Kim, Haeng Hoon; Cho, Jin Woong; Park, Sang Un

    2014-01-01

    Flavonols are the most abundant of all the flavonoids and play pivotal roles in a variety of plants. We isolated a cDNA clone encoding flavonol synthase from Scutellaria baicalensis (SbFLS). The SbFLS cDNA is 1011 bp long, encodes 336 amino acid residues, and belongs to a family of 2-oxoglutarate-dependent dioxygenases. The overall structure of SbFLS is very similar to that of Arabidopsis thaliana anthocyanidin synthase (AtANS), with a β jelly-roll fold surrounded by tens of short and long α-helices. SbFLS was constitutively expressed in the roots, stems, leaves, and flowers, with particularly high expression in the roots and flowers. SbFLS transcript levels in the roots were 376-, 70-, and 2.5-fold higher than in the leaves, stems, and flowers. The myricetin content was significantly higher than that of kaempferol and quercetin. Therefore, we suggest that SbFLS mediates flavonol formation in the different organs of S. baicalensis. Our study may contribute to the knowledge of the role of FLS in S. baicalensis. PMID:24672406

  6. Differential stress-response expression of two flavonol synthase genes and accumulation of flavonols in tartary buckwheat.

    PubMed

    Li, Xiaohua; Kim, Yeon Bok; Kim, Yeji; Zhao, Shicheng; Kim, Haeng Hoon; Chung, Eunsook; Lee, Jai-Heon; Park, Sang Un

    2013-12-15

    Flavonoids are ubiquitously present in plants and play important roles in these organisms as well as in the human diet. Flavonol synthase (FLS) is a key enzyme of the flavonoid biosynthetic pathway, acting at the diverging point into the flavonol subclass branch. We isolated and characterized a FLS isoform gene, FtFLS2, from tartary buckwheat (Fagopyrum tataricum). FtFLS2 shares 48% identity and 67% similarity with the previously reported FtFLS1, whereas both genes share 47-65% identity and 65-69% similarity with FLSs from other plant species. Using quantitative real-time PCR and high-performance liquid chromatography (HPLC), the expression of FtFLS1/2 and the production of 3 main flavonols (kaempferol, myricetin and quercetin) was detected in roots, leaves, stems, flowers and different stages of developing seeds. The relationship between the expression of the 2 FLS genes and the accumulation of the 3 basic flavonols was analyzed in 2 tartary buckwheat cultivars. FtFLS1 and FtFLS2 exhibited differential transcriptional levels between the tartary buckwheat cultivars 'Hokkai T10' and 'Hokkai T8'. Generally, higher transcript levels of FtFLS1 and FtFLS2 and a higher amount of flavonols were observed in the 'Hokkai T10' cultivar than 'Hokkai T8'. The content of flavonols showed tissue-specific accumulation between the 2 cultivars. The transcription of FtFLS1 was inhibited by the exogenous application of abscisic acid (ABA), salicylic acid (SA) and sodium chloride (NaCl), while FtFLS2 was not affected by ABA but up-regulated by SA and NaCl. These data indicate that the 2 FtFLS isoforms of buckwheat have different functions in the response of buckwheat to environmental stress.

  7. Molecular cloning and characterization of a phytochelatin synthase gene, PvPCS1, from Pteris vittata L.

    PubMed

    Dong, Ruibin; Formentin, Elide; Losseso, Carmen; Carimi, Francesco; Benedetti, Piero; Terzi, Mario; Schiavo, Fiorella Lo

    2005-12-01

    Pteris vittata L. is a staggeringly efficient arsenic hyperaccumulator that has been shown to be capable of accumulating up to 23,000 microg arsenic g(-1), and thus represents a species that may fully exploit the adaptive potential of plants to toxic metals. However, the molecular mechanisms of adaptation to toxic metal tolerance and hyperaccumulation remain unknown, and P. vittata genes related to metal detoxification have not yet been identified. Here, we report the isolation of a full-length cDNA sequence encoding a phytochelatin synthase (PCS) from P. vittata. The cDNA, designated PvPCS1, predicts a protein of 512 amino acids with a molecular weight of 56.9 kDa. Homology analysis of the PvPCS1 nucleotide sequence revealed that it has low identity with most known plant PCS genes except AyPCS1, and the homology is largely confined to two highly conserved regions near the 5'-end, where the similarity is as high as 85-95%. The amino acid sequence of PvPCS1 contains two Cys-Cys motifs and 12 single Cys, only 4 of which (Cys-56, Cys-90/91, and Cys-109) in the N-terminal half of the protein are conserved in other known PCS polypeptides. When expressed in Saccharomyces cerevisae, PvPCS1 mediated increased Cd tolerance. Cloning of the PCS gene from an arsenic hyperaccumulator may provide information that will help further our understanding of the genetic basis underlying toxic metal tolerance and hyperaccumulation.

  8. Molecular cloning of the human leukotriene C4 synthase gene and assignment to chromosome 5q35.

    PubMed Central

    Bigby, T. D.; Hodulik, C. R.; Arden, K. C.; Fu, L.

    1996-01-01

    BACKGROUND: Cysteinyl leukotrienes (LT) are mediators involved in inflammatory and allergic disorders LTC4 synthase catalyzes the first committed step in the synthesis of these inflammatory mediators, and its cellular distribution appears to be unique. MATERIALS AND METHODS: A human genomic library was screened by polymerase chain reaction (PCR) with primers that were designed based on the reported cDNA sequence for the LTC4 synthase gene. The gene was identified in one clone by Southern blotting of restriction enzyme digests, subcloning of fragments containing regions of interest, and DNA sequencing of these subclones. The transcription initiation site was determined by primer extension analysis. Chromosome location was determined by fluorescent in situ hybridization and screening of somatic cell hybrids by PCR. RESULTS: The LTC4 synthase gene is approximately 2.5 kb in length, consisting of five exons (136, 100, 71, 82, and 257 bp, respectively) and four introns (1,447, 102, 84, and 230 bp, respectively). Transcription initiation occurs at a single site 78 bp upstream of the coding region. The 5'-flanking region contains neither a TATA nor a CAAT box. The first 1 kb of the 5'-flanking region, however, contains putative DNA binding motifs for SP-1, AP-1, AP-2, ets factors, and CREB/ATF. A STAT binding motif is present in the first intron. The LTC4 synthase gene is located in the distal region of the long arm of chromosome 5 in 5q35. CONCLUSIONS: The LTC4 synthase gene does not contain elements of a typical regulated gene and may therefore contain novel regulatory elements. This gene is also located in a region on chromosome 5 that appears to play a role in allergic and inflammatory disorders, such as asthma. Images FIG. 1 FIG. 5 FIG. 4 FIG. 6 PMID:8898379

  9. Differential Expression of Biphenyl Synthase Gene Family Members in Fire-Blight-Infected Apple ‘Holsteiner Cox’ 1[W][OA

    PubMed Central

    Chizzali, Cornelia; Gaid, Mariam M.; Belkheir, Asma K.; Hänsch, Robert; Richter, Klaus; Flachowsky, Henryk; Peil, Andreas; Hanke, Magda-Viola; Liu, Benye; Beerhues, Ludger

    2012-01-01

    Fire blight, caused by the bacterium Erwinia amylovora, is a devastating disease of apple (Malus × domestica). The phytoalexins of apple are biphenyls and dibenzofurans, whose carbon skeleton is formed by biphenyl synthase (BIS), a type III polyketide synthase. In the recently published genome sequence of apple ‘Golden Delicious’, nine BIS genes and four BIS gene fragments were detected. The nine genes fall into four subfamilies, referred to as MdBIS1 to MdBIS4. In a phylogenetic tree, the BIS amino acid sequences from apple and Sorbus aucuparia formed an individual cluster within the clade of the functionally diverse type III polyketide synthases. cDNAs encoding MdBIS1 to MdBIS4 were cloned from fire-blight-infected shoots of apple ‘Holsteiner Cox,’ heterologously expressed in Escherichia coli, and functionally analyzed. Benzoyl-coenzyme A and salicoyl-coenzyme A were the preferred starter substrates. In response to inoculation with E. amylovora, the BIS3 gene was expressed in stems of cv Holsteiner Cox, with highest transcript levels in the transition zone between necrotic and healthy tissues. The transition zone was the accumulation site of biphenyl and dibenzofuran phytoalexins. Leaves contained transcripts for BIS2 but failed to form immunodetectable amounts of BIS protein. In cell cultures of apple ‘Cox Orange,’ expression of the BIS1 to BIS3 genes was observed after the addition of an autoclaved E. amylovora suspension. Using immunofluorescence localization under a confocal laser-scanning microscope, the BIS3 protein in the transition zone of stems was detected in the parenchyma of the bark. Dot-shaped immunofluorescence was confined to the junctions between neighboring cortical parenchyma cells. PMID:22158676

  10. A multi-gene phylogeny for Stachybotrys evidences lack of trichodiene synthase (tri5) gene for isolates of one of three intrageneric lineages.

    PubMed

    Koster, Brenda; Wong, Bess; Straus, Neil; Malloch, David

    2009-08-01

    Members of the mitosporic fungal form-genus Stachybotrys, including common indoor contaminants Stachybotrys chartarum, Stachybotrys echinata and Stachybotrys chlorohalonata, are capable of producing potent, protein synthesis-inhibiting, trichothecene mycotoxins. A combined multi-gene approach was used to investigate relationships among species of Stachybotrys against which the presence/absence of the trichothecene biosynthetic pathway gene, trichodiene synthase (tri5), was evaluated. Phylogenetic analyses partitioned species of Stachybotrys into three strongly supported lineages, two of which contained common indoor taxa. No tri5 PCR product was amplified from members of the third clade, which included the only member of the group with a known sexual state, Stachybotrys albipes. Isolates grouped with S. albipes also tested negative for tri5 in Southern analyses. The phylogenetic distribution of tri5 was consistent with known toxin production for the group. For isolates with tri5 product, Bayesian analysis suggested that signal from amino acid determining sites conflicted with the combined phylogeny. Incongruence however, was not supported by either SH-test results or maximum likelihood analyses. Moreover, sites rates analysis showed that tri5 was highly conserved at the amino acid level suggesting that identity at variable sites, among otherwise divergent taxa, might be the result of chance events. PMID:19422915

  11. Disruption of Spodoptera exigua larval development by silencing chitin synthase gene A with RNA interference.

    PubMed

    Chen, X; Tian, H; Zou, L; Tang, B; Hu, J; Zhang, W

    2008-12-01

    RNA interference (RNAi) is a powerful tool for rapidly analyzing gene functions. However, little is known about the possible use of dsRNA/siRNA as a pest control method. Here, we demonstrate that dsRNA/siRNA can induce the silence of chitin synthase gene A (CHSA), which is an important gene for the growth and development of cuticles and trachea in beet armyworm, Spodoptera exigua. Based on the in vitro RNAi experiments in an insect cell line (Trichoplusia ni High 5), in vivo RNAi was performed by injecting synthesized dsRNA/siRNA into the 4th instar larvae of S. exigua. Significantly lower levels of CHSA transcripts were detected. In addition, the cuticle of these insects was disordered and the epithelial walls of larval trachea did not expand uniformly in injected individuals. Moreover, Injections significantly increased abnormalities relative to control larvae. These results highlighted the possibility of dsRNA/siRNA for gene function studies in lepidopteran insects and future pest control. PMID:18662430

  12. Isolation and expression of two polyketide synthase genes from Trichoderma harzianum 88 during mycoparasitism.

    PubMed

    Yao, Lin; Tan, Chong; Song, Jinzhu; Yang, Qian; Yu, Lijie; Li, Xinling

    2016-01-01

    Metabolites of mycoparasitic fungal species such as Trichoderma harzianum 88 have important biological roles. In this study, two new ketoacyl synthase (KS) fragments were isolated from cultured Trichoderma harzianum 88 mycelia using degenerate primers and analysed using a phylogenetic tree. The gene fragments were determined to be present as single copies in Trichoderma harzianum 88 through southern blot analysis using digoxigenin-labelled KS gene fragments as probes. The complete sequence analysis in formation of pksT-1 (5669bp) and pksT-2 (7901bp) suggests that pksT-1 exhibited features of a non-reducing type I fungal PKS, whereas pksT-2 exhibited features of a highly reducing type I fungal PKS. Reverse transcription polymerase chain reaction indicated that the isolated genes are differentially regulated in Trichoderma harzianum 88 during challenge with three fungal plant pathogens, which suggests that they participate in the response of Trichoderma harzianum 88 to fungal plant pathogens. Furthermore, disruption of the pksT-2 encoding ketosynthase-acyltransferase domains through Agrobacterium-mediated gene transformation indicated that pksT-2 is a key factor for conidial pigmentation in Trichoderma harzianum 88. PMID:26991299

  13. Molecular analysis of the poly(3-hydroxyalkanoate) synthase gene from a methylotrophic bacterium, Paracoccus denitrificans.

    PubMed Central

    Ueda, S; Yabutani, T; Maehara, A; Yamane, T

    1996-01-01

    A 3.6-kb EcoRI-SalI fragment of Paracoccus denitrificans DNA hybridized with a DNA probe carrying the poly(3-hydroxyalkanoate) (PHA) synthase gene (phaC) of Alcaligenes eutrophus. Nucleotide sequence analysis of this region showed the presence of a 1,872-bp open reading frame (ORF), which corresponded to a polypeptide with a molecular weight of 69,537. Upstream of the ORF, a promoter-like sequence was found. Escherichia coli carrying the fusion gene between lacZ and the ORF accumulated a level of poly(3-hydroxybutyrate) that was as much as 20 wt% of the cell dry weight in the presence of beta-ketothiolase and acetoacetylcoenzyme A reductase genes of A. eutrophus. The ORF was designated phaCPd. A plasmid vector carrying the phaCPd'-'lacZ fusion gene downstream of the promoter-like sequence expressed beta-galactosidase activity in P. denitrificans. When a multicopy and broad-host-range vector carrying the ORF along with the promoter-like sequence was introduced into P. denitrificans, the PHA content in the cells increased by twofold compared with cells carrying only a vector sequence. PMID:8550512

  14. Molecular analysis of the poly(3-hydroxyalkanoate) synthase gene from a methylotrophic bacterium, Paracoccus denitrificans.

    PubMed

    Ueda, S; Yabutani, T; Maehara, A; Yamane, T

    1996-02-01

    A 3.6-kb EcoRI-SalI fragment of Paracoccus denitrificans DNA hybridized with a DNA probe carrying the poly(3-hydroxyalkanoate) (PHA) synthase gene (phaC) of Alcaligenes eutrophus. Nucleotide sequence analysis of this region showed the presence of a 1,872-bp open reading frame (ORF), which corresponded to a polypeptide with a molecular weight of 69,537. Upstream of the ORF, a promoter-like sequence was found. Escherichia coli carrying the fusion gene between lacZ and the ORF accumulated a level of poly(3-hydroxybutyrate) that was as much as 20 wt% of the cell dry weight in the presence of beta-ketothiolase and acetoacetylcoenzyme A reductase genes of A. eutrophus. The ORF was designated phaCPd. A plasmid vector carrying the phaCPd'-'lacZ fusion gene downstream of the promoter-like sequence expressed beta-galactosidase activity in P. denitrificans. When a multicopy and broad-host-range vector carrying the ORF along with the promoter-like sequence was introduced into P. denitrificans, the PHA content in the cells increased by twofold compared with cells carrying only a vector sequence.

  15. A Novel Class of Plant Type III Polyketide Synthase Involved in Orsellinic Acid Biosynthesis from Rhododendron dauricum

    PubMed Central

    Taura, Futoshi; Iijima, Miu; Yamanaka, Eriko; Takahashi, Hironobu; Kenmoku, Hiromichi; Saeki, Haruna; Morimoto, Satoshi; Asakawa, Yoshinori; Kurosaki, Fumiya; Morita, Hiroyuki

    2016-01-01

    Rhododendron dauricum L. produces daurichromenic acid, the anti-HIV meroterpenoid consisting of sesquiterpene and orsellinic acid (OSA) moieties. To characterize the enzyme responsible for OSA biosynthesis, a cDNA encoding a novel polyketide synthase (PKS), orcinol synthase (ORS), was cloned from young leaves of R. dauricum. The primary structure of ORS shared relatively low identities to those of PKSs from other plants, and the active site of ORS had a unique amino acid composition. The bacterially expressed, recombinant ORS accepted acetyl-CoA as the preferable starter substrate, and produced orcinol as the major reaction product, along with four minor products including OSA. The ORS identified in this study is the first plant PKS that generates acetate-derived aromatic tetraketides, such as orcinol and OSA. Interestingly, OSA production was clearly enhanced in the presence of Cannabis sativa olivetolic acid cyclase, suggesting that the ORS is involved in OSA biosynthesis together with an unidentified cyclase in R. dauricum. PMID:27729920

  16. Using modern tools to probe the structure-function relationship of fatty acid synthases

    PubMed Central

    Burkart, Michael D.

    2015-01-01

    Fatty acid biosynthesis is essential to life and represents one of the most conserved pathways in Nature, preserving the same handful of chemical reactions over all species. Recent interest in the molecular details of the de novo fatty acid synthase (FAS) has been heightened by demand for renewable fuels and the emergence of multidrug resistant bacterial strains. Central to FAS is the acyl carrier protein (ACP), a protein chaperone that shuttles the growing acyl chain between catalytic enzymes within the FAS. Human efforts to alter fatty acid biosynthesis for oil production, chemical feedstock or antimicrobial purposes has been met with limited success in part due to a lack of detailed molecular information behind the ACP-partner protein interactions inherent to the pathway. This review will focus on recently developed tools for the modification of ACP and analysis of protein-protein interactions, such as mechanism-based crosslinking, and the studies exploiting them. Discussion specific to each enzymatic domain focuses first on mechanism and known inhibitors, followed by available structures and known interactions with ACP. While significant unknowns remain, new understandings into the intricacies of FAS point to future advances in manipulating this complex molecular factory. PMID:25676190

  17. Inhibition of Fatty Acid Synthase Decreases Expression of Stemness Markers in Glioma Stem Cells

    PubMed Central

    Yasumoto, Yuki; Miyazaki, Hirofumi; Vaidyan, Linda Koshy; Kagawa, Yoshiteru; Ebrahimi, Majid; Yamamoto, Yui; Ogata, Masaki; Katsuyama, Yu; Sadahiro, Hirokazu; Suzuki, Michiyasu; Owada, Yuji

    2016-01-01

    Cellular metabolic changes, especially to lipid metabolism, have recently been recognized as a hallmark of various cancer cells. However, little is known about the significance of cellular lipid metabolism in the regulation of biological activity of glioma stem cells (GSCs). In this study, we examined the expression and role of fatty acid synthase (FASN), a key lipogenic enzyme, in GSCs. In the de novo lipid synthesis assay, GSCs exhibited higher lipogenesis than differentiated non-GSCs. Western blot and immunocytochemical analyses revealed that FASN is strongly expressed in multiple lines of patient-derived GSCs (G144 and Y10), but its expression was markedly reduced upon differentiation. When GSCs were treated with 20 μM cerulenin, a pharmacological inhibitor of FASN, their proliferation and migration were significantly suppressed and de novo lipogenesis decreased. Furthermore, following cerulenin treatment, expression of the GSC markers nestin, Sox2 and fatty acid binding protein (FABP7), markers of GCSs, decreased while that of glial fibrillary acidic protein (GFAP) expression increased. Taken together, our results indicate that FASN plays a pivotal role in the maintenance of GSC stemness, and FASN-mediated de novo lipid biosynthesis is closely associated with tumor growth and invasion in glioblastoma. PMID:26808816

  18. Structure of Quinolinate Synthase from Pyrococcus horikoshii in the Presence of Its Product, Quinolinic Acid.

    PubMed

    Esakova, Olga A; Silakov, Alexey; Grove, Tyler L; Saunders, Allison H; McLaughlin, Martin I; Yennawar, Neela H; Booker, Squire J

    2016-06-15

    Quinolinic acid (QA) is a common intermediate in the biosynthesis of nicotinamide adenine dinucleotide (NAD(+)) and its derivatives in all organisms that synthesize the molecule de novo. In most prokaryotes, it is formed from the condensation of dihydroxyacetone phosphate (DHAP) and aspartate-enamine by the action of quinolinate synthase (NadA). NadA contains a [4Fe-4S] cluster cofactor with a unique, non-cysteinyl-ligated, iron ion (Fea), which is proposed to bind the hydroxyl group of a postulated intermediate in the last step of the reaction to facilitate a dehydration. However, direct evidence for this role in catalysis has yet to be provided. Herein, we present the structure of NadA in the presence of the product of its reaction, QA. We find that N1 and the C7 carboxylate group of QA ligate to Fea in a bidentate fashion, which is confirmed by Hyperfine Sublevel Correlation (HYSCORE) spectroscopy. This binding mode would place the C5 hydroxyl group of the postulated final intermediate distal to Fea and virtually incapable of coordinating to it. The structure shows that three strictly conserved amino acids, Glu198, Tyr109, and Tyr23, are in close proximity to the bound product. Substitution of these amino acids with Gln, Phe, and Phe, respectively, leads to complete loss of activity. PMID:27224840

  19. Two Arabidopsis Genes (IPMS1 and IPMS2) Encode Isopropylmalate Synthase, the Branchpoint Step in the Biosynthesis of Leucine1[W][OA

    PubMed Central

    de Kraker, Jan-Willem; Luck, Katrin; Textor, Susanne; Tokuhisa, James G.; Gershenzon, Jonathan

    2007-01-01

    Heterologous expression of the Arabidopsis (Arabidopsis thaliana) IPMS1 (At1g18500) and IPMS2 (At1g74040) cDNAs in Escherichia coli yields isopropylmalate synthases (IPMSs; EC 2.3.3.13). These enzymes catalyze the first dedicated step in leucine (Leu) biosynthesis, an aldol-type condensation of acetyl-coenzyme A (CoA) and 2-oxoisovalerate yielding isopropylmalate. Most biochemical properties of IPMS1 and IPMS2 are similar: broad pH optimum around pH 8.5, Mg2+ as cofactor, feedback inhibition by Leu, Km for 2-oxoisovalerate of approximately 300 μm, and a Vmax of approximately 2 × 103 μmol min−1 g−1. However, IPMS1 and IPMS2 differ in their Km for acetyl-CoA (45 μm and 16 μm, respectively) and apparent quaternary structure (dimer and tetramer, respectively). A knockout insertion mutant for IPMS1 showed an increase in valine content but no changes in Leu content; two insertion mutants for IPMS2 did not show any changes in soluble amino acid content. Apparently, in planta each gene can adequately compensate for the absence of the other, consistent with available microarray and reverse transcription-polymerase chain reaction data that show that both genes are expressed in all organs at all developmental stages. Both encoded proteins accept 2-oxo acid substrates in vitro ranging in length from glyoxylate to 2-oxohexanoate, and catalyze at a low rate the condensation of acetyl-CoA and 4-methylthio-2-oxobutyrate, i.e. a reaction involved in glucosinolate chain elongation normally catalyzed by methylthioalkylmalate synthases. The evolutionary relationship between IPMS and methylthioalkylmalate synthase enzymes is discussed in view of their amino acid sequence identity (60%) and overlap in substrate specificity. PMID:17189332

  20. Cloning and heterologous expression of Plasmodium ovale dihydrofolate reductase-thymidylate synthase gene

    PubMed Central

    Tirakarn, Srisuda; Riangrungroj, Pinpunya; Kongsaeree, Palangpon; Imwong, Mallika; Yuthavong, Yongyuth; Leartsakulpanich, Ubolsree

    2012-01-01

    Plasmodial bifunctional dihydrofolate reductase-thymidylate synthase (DHFR-TS) is a validated antimalarial drug target. In this study, expression of the putative dhfr-ts of Plasmodium ovale rescued the DHFR chemical knockout and a TS null bacterial strain, demonstrating its DHFR and TS catalytic functions. PoDHFR-TS was expressed in Escherichia coli BL21 (DE3) and affinity purified by Methotrexate Sepharose column. Biochemical and enzyme kinetics characterizations indicated that PoDHFR-TS is similar to other plasmodial enzymes, albeit with lower catalytic activity but better tolerance of acidic pH. Importantly, the PoDHFR from Thai isolate EU266602 remains sensitive to the antimalarials pyrimethamine and cycloguanil, in contrast to P. falciparum and P. vivax isolates where resistance to these drugs is widespread. PMID:22234170

  1. Suppressors of trp1 fluorescence identify a new arabidopsis gene, TRP4, encoding the anthranilate synthase beta subunit.

    PubMed Central

    Niyogi, K K; Last, R L; Fink, G R; Keith, B

    1993-01-01

    Suppressors of the blue fluorescence phenotype of the Arabidopsis trp1-100 mutant can be used to identify mutations in genes involved in plant tryptophan biosynthesis. Two recessive suppressor mutations define a new gene, TRP4. The trp4 mutant and the trp1-100 mutant are morphologically normal and grow without tryptophan, whereas the trp4; trp1-100 double mutant requires tryptophan for growth. The trp4; trp1-100 double mutant does not segregate at expected frequencies in genetic crosses because of a female-specific defect in transmission of the double mutant genotype, suggesting a role for the tryptophan pathway in female gametophyte development. Genetic and biochemical evidence shows that trp4 mutants are defective in a gene encoding the beta subunit of anthranilate synthase (AS). Arabidopsis AS beta subunit genes were isolated by complementation of an Escherichia coli anthranilate synthase mutation. The trp4 mutation cosegregates with one of the genes, ASB1, located on chromosome 1. Sequence analysis of the ASB1 gene from trp4-1 and trp4-2 plants revealed different single base pair substitutions relative to the wild type. Anthranilate synthase alpha and beta subunit genes are regulated coordinately in response to bacterial pathogen infiltration. PMID:8400875

  2. Functional specialization of cellulose synthase genes of prokaryotic origin in chordate larvaceans.

    PubMed

    Sagane, Yoshimasa; Zech, Karin; Bouquet, Jean-Marie; Schmid, Martina; Bal, Ugur; Thompson, Eric M

    2010-05-01

    Extracellular matrices play important, but poorly investigated, roles in morphogenesis. Extracellular cellulose is central to regulation of pattern formation in plants, but among metazoans only tunicates are capable of cellulose biosynthesis. Cellulose synthase (CesA) gene products are present in filter-feeding structures of all tunicates and also regulate metamorphosis in the ascidian Ciona. Ciona CesA is proposed to have been acquired by lateral gene transfer from a prokaryote. We identified two CesA genes in the sister-class larvacean Oikopleura dioica. Each has a mosaic structure of a glycoslyltransferase 2 domain upstream of a glycosyl hydrolase family 6 cellulase-like domain, a signature thus far unique to tunicates. Spatial-temporal expression analysis revealed that Od-CesA1 produces long cellulose fibrils along the larval tail, whereas Od-CesA2 is responsible for the cellulose scaffold of the post-metamorphic filter-feeding house. Knockdown of Od-CesA1 inhibited cellulose production in the extracellular matrix of the larval tail. Notochord cells either failed to align or were misaligned, the tail did not elongate properly and tailbud embryos also exhibited a failure to hatch. Knockdown of Od-CesA2 did not elicit any of these phenotypes and instead caused a mild delay in pre-house formation. Phylogenetic analyses including Od-CesAs indicate that a single lateral gene transfer event from a prokaryote at the base of the lineage conferred biosynthetic capacity in all tunicates. Ascidians possess one CesA gene, whereas duplicated larvacean genes have evolved distinct temporal and functional specializations. Extracellular cellulose microfibrils produced by the pre-metamorphic Od-CesA1 duplicate have a role in notochord and tail morphogenesis.

  3. Nitric oxide synthase polymorphisms, gene expression and lung function in chronic obstructive pulmonary disease

    PubMed Central

    2013-01-01

    Background Due to the pleiotropic effects of nitric oxide (NO) within the lungs, it is likely that NO is a significant factor in the pathogenesis of chronic obstructive pulmonary disease (COPD). The aim of this study was to test for association between single nucleotide polymorphisms (SNPs) in three NO synthase (NOS) genes and lung function, as well as to examine gene expression and protein levels in relation to the genetic variation. Methods One SNP in each NOS gene (neuronal NOS (NOS1), inducible NOS (NOS2), and endothelial NOS (NOS3)) was genotyped in the Lung Health Study (LHS) and correlated with lung function. One SNP (rs1800779) was also analyzed for association with COPD and lung function in four COPD case–control populations. Lung tissue expression of NOS3 mRNA and protein was tested in individuals of known genotype for rs1800779. Immunohistochemistry of lung tissue was used to localize NOS3 expression. Results For the NOS3 rs1800779 SNP, the baseline forced expiratory volume in one second in the LHS was significantly higher in the combined AG + GG genotypic groups compared with the AA genotypic group. Gene expression and protein levels in lung tissue were significantly lower in subjects with the AG + GG genotypes than in AA subjects. NOS3 protein was expressed in the airway epithelium and subjects with the AA genotype demonstrated higher NOS3 expression compared with AG and GG individuals. However, we were not able to replicate the associations with COPD or lung function in the other COPD study groups. Conclusions Variants in the NOS genes were not associated with lung function or COPD status. However, the G allele of rs1800779 resulted in a decrease of NOS3 gene expression and protein levels and this has implications for the numerous disease states that have been associated with this polymorphism. PMID:24192154

  4. Endothelin-1 gene and endothelial nitric oxide synthase gene polymorphisms in adolescents with juvenile and obesity-associated hypertension.

    PubMed

    Baráth, A; Endreffy, E; Bereczki, Cs; Gellén, B; Szücs, B; Németh, I; Túri, S

    2007-03-01

    Hypertension is an increasing public health problem all over the world. Essential hypertension accounts for more than 90% of cases of hypertension. It is a complex genetic, environmental and demographic trait. New method in molecular biology has been proposed a number of candidate genes, but the linkage or association with hypertension has been problematic (lack of gene-gene and gene-environment interaction). It is well known that genetic influences are more important in younger hypertensives, because children are relatively free from the common environmental factors contributing to essential hypertension. The association studies compare genotype ferquencies of the candidate gene between patient groups and the controls, in pathways known to be involved in blood pressure regulation. This study examined three polymorphisms of these factors encoding genes (ET-1 G+5665T (Lys198Asn), endothelial nitric oxide synthase (eNOS) T-786C promoter polymorphism and 27-bp repeat polymorphism in intron 4) in adolescents with juvenile essential and obesity-associated hypertension. Significant differences were found in the G/T genotype of the ET-1 polymorphism in the hypertensive and obese+hypertensive patients (body mass index (BMI) > 30). A strong association was detected between the BMI and the polymorphism of the ET-1 gene. It seems that ET-1 gene polymorphism plays a role in the development of juvenile hypertension associated with obesity. Although no significant differences were seen in the case of the eNOS promoter polymorphism and the eNOS 4th intron 27-bp repeat polymorphism. It seems that eNOS may play a role, but this is not the main factor in the control of blood pressure; it is rather a fine regulator in this process. This study with adolescents facilitates an understanding of the genetic factors promoting juvenile hypertension and obesity. PMID:17444275

  5. In silico identification and analysis of phytoene synthase genes in plants.

    PubMed

    Han, Y; Zheng, Q S; Wei, Y P; Chen, J; Liu, R; Wan, H J

    2015-08-14

    In this study, we examined phytoene synthetase (PSY), the first key limiting enzyme in the synthesis of carotenoids and catalyzing the formation of geranylgeranyl pyrophosphate in terpenoid biosynthesis. We used known amino acid sequences of the PSY gene in tomato plants to conduct a genome-wide search and identify putative candidates in 34 sequenced plants. A total of 101 homologous genes were identified. Phylogenetic analysis revealed that PSY evolved independently in algae as well as monocotyledonous and dicotyledonous plants. Our results showed that the amino acid structures exhibited 5 motifs (motifs 1 to 5) in algae and those in higher plants were highly conserved. The PSY gene structures showed that the number of intron in algae varied widely, while the number of introns in higher plants was 4 to 5. Identification of PSY genes in plants and the analysis of the gene structure may provide a theoretical basis for studying evolutionary relationships in future analyses.

  6. Expression of terpene synthase genes associated with the formation of volatiles in different organs of Vitis vinifera.

    PubMed

    Matarese, Fabiola; Cuzzola, Angela; Scalabrelli, Giancarlo; D'Onofrio, Claudio

    2014-09-01

    Plants produce a plethora of volatile organic compounds (VOCs) which are important in determining the quality and nutraceutical properties of horticultural food products, including the taste and aroma of wine. Given that some of the most prevalent grape aroma constituents are terpenoids, we investigated the possible variations in the relative expression of terpene synthase (TPS) genes that depend on the organ. We thus analysed mature leaves, young leaves, stems, young stems, roots, rachis, tendrils, peduncles, bud flowers, flowers and berries of cv Moscato bianco in terms of their VOC content and the expression of 23 TPS genes. In terms of the volatile characterization of the organs by SPME/GC-MS analysis, flower buds and open flowers appeared to be clearly distinct from all the other organs analysed in terms of their high VOC concentration. Qualitatively detected VOCs clearly separated all the vegetative organs from flowers and berries, then the roots and rachis from other vegetative organs and flowers from berries, which confirms the specialization in volatile production among different organs. Our real-time RT-PCR results revealed that the majority of TPS genes analysed exhibited detectable transcripts in all the organs investigated, while only some were found to be expressed specifically in one or just a few organs. In most cases, we found that the known products of the in vitro assay of VvTPS enzymes corresponded well to the terpenes found in the organs in which the encoding gene was expressed, as in the case of (E)-β-caryophyllene synthases, α-terpineol synthase and α-farnesene synthase. In addition, we found groups of homologous TPS genes, such as (E)-β-caryophyllene and β-ocimene synthases, expressed distinctively in the various tissues. This thus confirmed the subfunctionalization events and a specialization on the basis of the organs in which they are mostly expressed.

  7. Expression of terpene synthase genes associated with the formation of volatiles in different organs of Vitis vinifera.

    PubMed

    Matarese, Fabiola; Cuzzola, Angela; Scalabrelli, Giancarlo; D'Onofrio, Claudio

    2014-09-01

    Plants produce a plethora of volatile organic compounds (VOCs) which are important in determining the quality and nutraceutical properties of horticultural food products, including the taste and aroma of wine. Given that some of the most prevalent grape aroma constituents are terpenoids, we investigated the possible variations in the relative expression of terpene synthase (TPS) genes that depend on the organ. We thus analysed mature leaves, young leaves, stems, young stems, roots, rachis, tendrils, peduncles, bud flowers, flowers and berries of cv Moscato bianco in terms of their VOC content and the expression of 23 TPS genes. In terms of the volatile characterization of the organs by SPME/GC-MS analysis, flower buds and open flowers appeared to be clearly distinct from all the other organs analysed in terms of their high VOC concentration. Qualitatively detected VOCs clearly separated all the vegetative organs from flowers and berries, then the roots and rachis from other vegetative organs and flowers from berries, which confirms the specialization in volatile production among different organs. Our real-time RT-PCR results revealed that the majority of TPS genes analysed exhibited detectable transcripts in all the organs investigated, while only some were found to be expressed specifically in one or just a few organs. In most cases, we found that the known products of the in vitro assay of VvTPS enzymes corresponded well to the terpenes found in the organs in which the encoding gene was expressed, as in the case of (E)-β-caryophyllene synthases, α-terpineol synthase and α-farnesene synthase. In addition, we found groups of homologous TPS genes, such as (E)-β-caryophyllene and β-ocimene synthases, expressed distinctively in the various tissues. This thus confirmed the subfunctionalization events and a specialization on the basis of the organs in which they are mostly expressed. PMID:25014656

  8. Characterization of the beta-carbon processing reactions of the mammalian cytosolic fatty acid synthase: role of the central core.

    PubMed

    Witkowski, Andrzej; Joshi, Anil K; Smith, Stuart

    2004-08-17

    The properties of the beta-ketoacyl reductase, dehydrase, and enoyl reductase components of the animal fatty acid synthase responsible for the reduction of the beta-ketoacyl moiety formed at each round of chain elongation have been studied by engineering and characterizing mutants defective in each of these three catalytic domains. These "beta-carbon processing" mutants leak the stalled four-carbon intermediates by direct transfer to CoA. However, enoyl reductase mutants leak beta-ketobutyryl, beta-hydroxybutyryl, and crotonyl moieties, a finding explained, at least in part, by the observation that the equilibrium and rate constant for the dehydrase reaction favor the formation of beta-hydroxy rather than enoyl moieties. In this regard, the type I animal fatty acid synthase resembles its type II counterpart in Escherichia coli in that both systems rely on the enoyl reductase to pull the beta-carbon processing reactions to completion. Kinetic and nucleotide binding measurements on fatty acid synthases mutated in either of the two nucleotide binding domains revealed that the NADPH binding sites are nonidentical, the enoyl reductase exhibiting higher affinity. Surprisingly, NADPH binding is also completely compromised by certain deletions and mutations in the central core region distant from the nucleotide binding sites. Comparable central core sequences are present in the structurally related modular polyketide synthases, except in those modules that lack all three beta-carbon processing enzymes. These findings suggest that the central core region of fatty acid and polyketide synthases plays an important role in facilitating the beta-carbon processing reactions.

  9. Divergence of cuticular hydrocarbons in two sympatric grasshopper species and the evolution of fatty acid synthases and elongases across insects

    PubMed Central

    Finck, Jonas; Berdan, Emma L.; Mayer, Frieder; Ronacher, Bernhard; Geiselhardt, Sven

    2016-01-01

    Cuticular hydrocarbons (CHCs) play a major role in the evolution of reproductive isolation between insect species. The CHC profiles of two closely related sympatric grasshopper species, Chorthippus biguttulus and C. mollis, differ mainly in the position of the first methyl group in major methyl-branched CHCs. The position of methyl branches is determined either by a fatty acid synthase (FAS) or by elongases. Both protein families showed an expansion in insects. Interestingly, the FAS family showed several lineage-specific expansions, especially in insect orders with highly diverse methyl-branched CHC profiles. We found five putative FASs and 12 putative elongases in the reference transcriptomes for both species. A dN/dS test showed no evidence for positive selection acting on FASs and elongases in these grasshoppers. However, one candidate FAS showed species-specific transcriptional differences and may contribute to the shift of the methyl-branch position between the species. In addition, transcript levels of four elongases were expressed differentially between the sexes. Our study indicates that complex methyl-branched CHC profiles are linked to an expansion of FASs genes, but that species differences can also mediated at the transcriptional level. PMID:27677406

  10. Primary structure of the gene encoding the bifunctional dihydrofolate reductase-thymidylate synthase of Leishmania major.

    PubMed Central

    Beverley, S M; Ellenberger, T E; Cordingley, J S

    1986-01-01

    We have determined the nucleotide sequence of the dihydrofolate reductase-thymidylate synthetase (DHFR-TS) gene of the protozoan parasite Leishmania major (dihydrofolate reductase, EC 1.5.1.3 and thymidylate synthase, EC 2.1.1.45). The DHFR-TS protein is encoded by a single 1560-base-pair open reading frame within genomic DNA, in contrast to vertebrate DHFRs or mouse and phage T4 TSs, which contain intervening sequences. Comparisons of the DHFR-TS sequence with DHFR and TS sequences of other organisms indicate that the order of enzymatic activities within the bifunctional polypeptide chain is DHFR followed by TS, the Leishmania bifunctional DHFR-TS evolved independently and not through a phage T4-related intermediate, and the rate of evolution of both the DHFR and TS domains has not detectably changed despite the acquisition of new functional properties by the bifunctional enzyme. The Leishmania gene is 86% G+C in the third codon position, in contrast to genes of the parasite Plasmodium falciparum, which exhibit an opposite bias toward A+T. The DHFR-TS locus is encoded within a region of DNA amplified in methotrexate-resistant lines, as previously proposed. PMID:3458220

  11. Molecular identity and gene expression of aldosterone synthase cytochrome P450

    SciTech Connect

    Okamoto, Mitsuhiro . E-mail: mokamoto@mr-mbio.med.osaka-u.ac.jp; Nonaka, Yasuki; Takemori, Hiroshi; Doi, Junko

    2005-12-09

    11{beta}-Hydroxylase (CYP11B1) of bovine adrenal cortex produced corticosterone as well as aldosterone from 11-deoxycorticosterone in the presence of the mitochondrial P450 electron transport system. CYP11B1s of pig, sheep, and bullfrog, when expressed in COS-7 cells, also performed corticosterone and aldosterone production. Since these CYP11B1s are present in the zonae fasciculata and reticularis as well as in the zona glomerulosa, the zonal differentiation of steroid production may occur by the action of still-unidentified factor(s) on the enzyme-catalyzed successive oxygenations at C11- and C18-positions of steroid. In contrast, two cDNAs, one encoding 11{beta}-hydroxylase and the other encoding aldosterone synthase (CYP11B2), were isolated from rat, mouse, hamster, guinea pig, and human adrenals. The expression of CYP11B1 gene was regulated by cyclic AMP (cAMP)-dependent signaling, whereas that of CYP11B2 gene by calcium ion-signaling as well as cAMP-signaling. Salt-inducible protein kinase, a cAMP-induced novel protein kinase, was one of the regulators of CYP11B2 gene expression.

  12. Acute intermittent porphyria: A single-base deletion and a nonsense mutation in the human hydroxymethylbilane synthase gene, predicting truncations of the enzyme polypeptide

    SciTech Connect

    Lee, G.L.; Astrin, K.H.; Desnick, R.J.

    1995-08-28

    Acute intermittent porphyria (AIP) is an autosomal-dominant inborn error of metabolism that results from the half-normal activity of the third enzyme in the heme biosynthetic pathway, hydroxymethylbilane synthase (HMB-synthase). AIP is an ecogenetic condition, since the life-threatening acute attacks are precipitated by various factors, including drugs, alcohol, fasting, and certain hormones. Biochemical diagnosis is problematic, and the identification of mutations in the HMB-synthase gene provides accurate detection of presymptomatic heterozygotes, permitting avoidance of the acute precipitating factors. By direct solid-phase sequencing, two mutations causing AIP were identified, an adenine deletion at position 629 in exon 11(629delA), which alters the reading frame and predicts premature truncation of the enzyme protein after amino acid 255, and a nonsense mutation in exon 12 (R225X). These mutations were confirmed by either restriction enzyme analysis or family studies of symptomatic patients, permitting accurate presymptomatic diagnosis of affected relatives. 29 refs., 2 figs.

  13. Gibberellic Acid, Synthetic Auxins, and Ethylene Differentially Modulate α-l-Arabinofuranosidase Activities in Antisense 1-Aminocyclopropane-1-Carboxylic Acid Synthase Tomato Pericarp Discs1

    PubMed Central

    Sozzi, Gabriel O.; Greve, L. Carl; Prody, Gerry A.; Labavitch, John M.

    2002-01-01

    α-l-Arabinofuranosidases (α-Afs) are plant enzymes capable of releasing terminal arabinofuranosyl residues from cell wall matrix polymers, as well as from different glycoconjugates. Three different α-Af isoforms were distinguished by size exclusion chromatography of protein extracts from control tomatoes (Lycopersicon esculentum) and an ethylene synthesis-suppressed (ESS) line expressing an antisense 1-aminocyclopropane-1-carboxylic synthase transgene. α-Af I and II are active throughout fruit ontogeny. α-Af I is the first Zn-dependent cell wall enzyme isolated from tomato pericarp tissues, thus suggesting the involvement of zinc in fruit cell wall metabolism. This isoform is inhibited by 1,10-phenanthroline, but remains stable in the presence of NaCl and sucrose. α-Af II activity accounts for over 80% of the total α-Af activity in 10-d-old fruit, but activity drops during ripening. In contrast, α-Af III is ethylene dependent and specifically active during ripening. α-Af I released monosaccharide arabinose from KOH-soluble polysaccharides from tomato cell walls, whereas α-Af II and III acted on Na2CO3-soluble pectins. Different α-Af isoform responses to gibberellic acid, synthetic auxins, and ethylene were followed by using a novel ESS mature-green tomato pericarp disc system. α-Af I and II activity increased when gibberellic acid or 2,4-dichlorophenoxyacetic acid was applied, whereas ethylene treatment enhanced only α-Af III activity. Results suggest that tomato α-Afs are encoded by a gene family under differential hormonal controls, and probably have different in vivo functions. The ESS pericarp explant system allows comprehensive studies involving effects of physiological levels of different growth regulators on gene expression and enzyme activity with negligible wound-induced ethylene production. PMID:12114586

  14. Gibberellic acid, synthetic auxins, and ethylene differentially modulate alpha-L-Arabinofuranosidase activities in antisense 1-aminocyclopropane-1-carboxylic acid synthase tomato pericarp discs.

    PubMed

    Sozzi, Gabriel O; Greve, L Carl; Prody, Gerry A; Labavitch, John M

    2002-07-01

    Alpha-L-Arabinofuranosidases (alpha-Afs) are plant enzymes capable of releasing terminal arabinofuranosyl residues from cell wall matrix polymers, as well as from different glycoconjugates. Three different alpha-Af isoforms were distinguished by size exclusion chromatography of protein extracts from control tomatoes (Lycopersicon esculentum) and an ethylene synthesis-suppressed (ESS) line expressing an antisense 1-aminocyclopropane-1-carboxylic synthase transgene. alpha-Af I and II are active throughout fruit ontogeny. alpha-Af I is the first Zn-dependent cell wall enzyme isolated from tomato pericarp tissues, thus suggesting the involvement of zinc in fruit cell wall metabolism. This isoform is inhibited by 1,10-phenanthroline, but remains stable in the presence of NaCl and sucrose. alpha-Af II activity accounts for over 80% of the total alpha-Af activity in 10-d-old fruit, but activity drops during ripening. In contrast, alpha-Af III is ethylene dependent and specifically active during ripening. alpha-Af I released monosaccharide arabinose from KOH-soluble polysaccharides from tomato cell walls, whereas alpha-Af II and III acted on Na(2)CO(3)-soluble pectins. Different alpha-Af isoform responses to gibberellic acid, synthetic auxins, and ethylene were followed by using a novel ESS mature-green tomato pericarp disc system. alpha-Af I and II activity increased when gibberellic acid or 2,4-dichlorophenoxyacetic acid was applied, whereas ethylene treatment enhanced only alpha-Af III activity. Results suggest that tomato alpha-Afs are encoded by a gene family under differential hormonal controls, and probably have different in vivo functions. The ESS pericarp explant system allows comprehensive studies involving effects of physiological levels of different growth regulators on gene expression and enzyme activity with negligible wound-induced ethylene production.

  15. Evolutionary origins of the multienzyme architecture of giant fungal fatty acid synthase.

    PubMed

    Bukhari, Habib S T; Jakob, Roman P; Maier, Timm

    2014-12-01

    Fungal fatty acid synthase (fFAS) is a key paradigm for the evolution of complex multienzymes. Its 48 functional domains are embedded in a matrix of scaffolding elements, which comprises almost 50% of the total sequence and determines the emergent multienzymes properties of fFAS. Catalytic domains of fFAS are derived from monofunctional bacterial enzymes, but the evolutionary origin of the scaffolding elements remains enigmatic. Here, we identify two bacterial protein families of noncanonical fatty acid biosynthesis starter enzymes and trans-acting polyketide enoyl reductases (ERs) as potential ancestors of scaffolding regions in fFAS. The architectures of both protein families are revealed by representative crystal structures of the starter enzyme FabY and DfnA-ER. In both families, a striking structural conservation of insertions to scaffolding elements in fFAS is observed, despite marginal sequence identity. The combined phylogenetic and structural data provide insights into the evolutionary origins of the complex multienzyme architecture of fFAS.

  16. Engineering a Polyketide Synthase for In Vitro Production of Adipic Acid.

    PubMed

    Hagen, Andrew; Poust, Sean; Rond, Tristan de; Fortman, Jeffrey L; Katz, Leonard; Petzold, Christopher J; Keasling, Jay D

    2016-01-15

    Polyketides have enormous structural diversity, yet polyketide synthases (PKSs) have thus far been engineered to produce only drug candidates or derivatives thereof. Thousands of other molecules, including commodity and specialty chemicals, could be synthesized using PKSs if composing hybrid PKSs from well-characterized parts derived from natural PKSs was more efficient. Here, using modern mass spectrometry techniques as an essential part of the design-build-test cycle, we engineered a chimeric PKS to enable production one of the most widely used commodity chemicals, adipic acid. To accomplish this, we introduced heterologous reductive domains from various PKS clusters into the borrelidin PKS' first extension module, which we previously showed produces a 3-hydroxy-adipoyl intermediate when coincubated with the loading module and a succinyl-CoA starter unit. Acyl-ACP intermediate analysis revealed an unexpected bottleneck at the dehydration step, which was overcome by introduction of a carboxyacyl-processing dehydratase domain. Appending a thioesterase to the hybrid PKS enabled the production of free adipic acid. Using acyl-intermediate based techniques to "debug" PKSs as described here, it should one day be possible to engineer chimeric PKSs to produce a variety of existing commodity and specialty chemicals, as well as thousands of chemicals that are difficult to produce from petroleum feedstocks using traditional synthetic chemistry.

  17. Engineering a Polyketide Synthase for In Vitro Production of Adipic Acid.

    PubMed

    Hagen, Andrew; Poust, Sean; Rond, Tristan de; Fortman, Jeffrey L; Katz, Leonard; Petzold, Christopher J; Keasling, Jay D

    2016-01-15

    Polyketides have enormous structural diversity, yet polyketide synthases (PKSs) have thus far been engineered to produce only drug candidates or derivatives thereof. Thousands of other molecules, including commodity and specialty chemicals, could be synthesized using PKSs if composing hybrid PKSs from well-characterized parts derived from natural PKSs was more efficient. Here, using modern mass spectrometry techniques as an essential part of the design-build-test cycle, we engineered a chimeric PKS to enable production one of the most widely used commodity chemicals, adipic acid. To accomplish this, we introduced heterologous reductive domains from various PKS clusters into the borrelidin PKS' first extension module, which we previously showed produces a 3-hydroxy-adipoyl intermediate when coincubated with the loading module and a succinyl-CoA starter unit. Acyl-ACP intermediate analysis revealed an unexpected bottleneck at the dehydration step, which was overcome by introduction of a carboxyacyl-processing dehydratase domain. Appending a thioesterase to the hybrid PKS enabled the production of free adipic acid. Using acyl-intermediate based techniques to "debug" PKSs as described here, it should one day be possible to engineer chimeric PKSs to produce a variety of existing commodity and specialty chemicals, as well as thousands of chemicals that are difficult to produce from petroleum feedstocks using traditional synthetic chemistry. PMID:26501439

  18. Expression of dehydratase domains from a polyunsaturated fatty acid synthase increases the production of fatty acids in Escherichia coli

    PubMed Central

    Oyola-Robles, Delise; Rullán-Lind, Carlos; Carballeira, Néstor M.; Baerga-Ortiz, Abel

    2014-01-01

    Increasing the production of fatty acids by microbial fermentation remains an important step towards the generation of biodiesel and other portable liquid fuels. In this work, we report an Escherichia coli strain engineered to overexpress a fragment consisting of four dehydratase domains from the polyunsaturated fatty acid (PUFA) synthase enzyme complex from the deep-sea bacterium, Photobacterium profundum. The DH1-DH2-UMA enzyme fragment was excised from its natural context within a multi-enzyme PKS and expressed as a stand-alone protein. Fatty acids were extracted from the cell pellet, esterified with methanol and quantified by GC-MS analysis. Results show that the E. coli strain expressing the DH tetradomain fragment was capable of producing up to a 5-fold increase (80.31 mg total FA/L culture) in total fatty acids over the negative control strain lacking the recombinant enzyme. The enhancement in production was observed across the board for all the fatty acids that are typically made by E. coli. The overexpression of the DH tetradomain did not affect E. coli cell growth, thus showing that the observed enhancement in fatty acid production was not a result of effects associated with cell density. The observed enhancement was more pronounced at lower temperatures (3.8-fold at 16 °C, 3.5-fold at 22 °C and 1.5-fold at 30 °C) and supplementation of the media with 0.4% glycerol did not result in an increase in fatty acid production. All these results taken together suggest that either the dehydration of fatty acid intermediates are a limiting step in the E. coli fatty acid biosynthesis machinery, or that the recombinant dehydratase domains used in this study are also capable of catalyzing thioester hydrolysis of the final products. The enzyme in this report is a new tool which could be incorporated into other existing strategies aimed at improving fatty acid production in bacterial fermentations towards accessible biodiesel precursors. PMID:24411456

  19. Feeding-based RNA interference of a trehalose phosphate synthase gene in the brown planthopper, Nilaparvata lugens.

    PubMed

    Chen, J; Zhang, D; Yao, Q; Zhang, J; Dong, X; Tian, H; Chen, J; Zhang, W

    2010-12-01

    The brown planthopper, Nilaparvata lugens, is the most devastating rice insect pest to have given rise to an outbreak in recent years. RNA interference (RNAi) is a technological breakthrough that has been developed as a powerful tool for studying gene function and for the highly targeted control of insect pests. Here, we examined the effects of using a feeding-based RNAi technique to target the gene trehalose phosphate synthase (TPS) in N. lugens. The full-length cDNA of N. lugens TPS (NlTPS) is 3235 bp and has an open reading frame of 2424 bp, encoding a protein of 807 amino acids. NlTPS was expressed in the fat body, midgut and ovary. Quantitative real-time PCR (qRT-PCR) analysis revealed that NlTPS mRNA is expressed continuously with little change during the life of the insect. Efficient silencing of the TPS gene through double-stranded RNA (dsRNA) feeding led to rapid and significant reduction levels of TPS mRNA and enzymatic activity. Additionally, the development of N. lugens larvae that had been fed with the dsRNA was disturbed, resulting in lethality, and the cumulative survival rates dropped to 75.56, 64.44, 55.56 and 40.00% after continuous ingestion of 0.5 µg/µl dsRNA for 2, 4, 7 and 10 days, respectively. These values were significantly lower than those of the insects in the control group, suggesting that NlTPS dsRNA may be useful as a means of insect pest control. PMID:20726907

  20. Disrupted short chain specific β-oxidation and improved synthase expression increase synthesis of short chain fatty acids in Saccharomyces cerevisiae.

    PubMed

    Leber, Christopher; Choi, Jin Wook; Polson, Brian; Da Silva, Nancy A

    2016-04-01

    Biologically derived fatty acids have gained tremendous interest as an alternative to petroleum-derived fuels and chemical precursors. We previously demonstrated the synthesis of short chain fatty acids in Saccharomyces cerevisiae by introduction of the Homo sapiens fatty acid synthase (hFAS) with heterologous phosphopantetheine transferases and heterologous thioesterases. In this study, short chain fatty acid production was improved by combining a variety of novel enzyme and metabolic engineering strategies. The use of a H. sapiens-derived thioesterase and phosphopantetheine transferase were evaluated. In addition, strains were engineered to disrupt either the full β-oxidation (by deleting FAA2, PXA1, and POX1) or short chain-specific β-oxidation (by deleting FAA2, ANT1, and PEX11) pathways. Prohibiting full β-oxidation increased hexanoic and octanoic acid levels by 8- and 79-fold relative to the parent strain expressing hFAS. However, by targeting only short chain β-oxidation, hexanoic and octanoic acid levels increased further to 31- and 140-fold over the parent. In addition, an optimized hFAS gene increased hexanoic, octanoic, decanoic and total short chain fatty acid levels by 2.9-, 2.0-, 2.3-, and 2.2-fold, respectively, relative to the non-optimized counterpart. By combining these unique enzyme and metabolic engineering strategies, octanoic acid was increased more than 181-fold over the parent strain expressing hFAS.

  1. A jojoba beta-Ketoacyl-CoA synthase cDNA complements the canola fatty acid elongation mutation in transgenic plants.

    PubMed

    Lassner, M W; Lardizabal, K; Metz, J G

    1996-02-01

    beta-Ketoacyl-coenzyme A (CoA) synthase (KCS) catalyzes the condensation of malonyl-CoA with long-chain acyl-CoA. This reaction is the initial step of the microsomal fatty acyl-CoA elongation pathway responsible for formation of very long chain fatty acids (VLCFAs, or fatty acids with chain lengths > 18 carbons). Manipulation of this pathway is significant for agriculture, because it is the basis of conversion of high erucic acid rapeseed into canola. High erucic acid rapeseed oil, used as an industrial feedstock, is rich in VLCFAs, whereas the edible oil extracted from canola is essentially devoid of VLCFAs. Here, we report the cloning of a cDNA from developing jojoba embryos involved in microsomal fatty acid elongation. The jojoba cDNA is homologous to the recently cloned Arabidopsis FATTY ACID ELONGATION1 (FAE1) gene that has been suggested to encode KCS. We characterize the jojoba enzyme and present biochemical data indicating that the jojoba cDNA does indeed encode KCS. Transformation of low erucic acid rapeseed with the jojoba cDNA restored KCS activity to developing embryos and altered the transgenic seed oil composition to contain high levels of VLCFAs. The data reveal the key role KCS plays in determining the chain lengths of fatty acids found in seed oils.

  2. UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6

    SciTech Connect

    Miyata, Maiko; Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko; Sugiura, Kazumitsu; Furukawa, Koichi; Furukawa, Keiko

    2014-03-07

    Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes.

  3. The Variability of Sesquiterpenes Emitted from Two Zea mays Cultivars Is Controlled by Allelic Variation of Two Terpene Synthase Genes Encoding Stereoselective Multiple Product Enzymes

    PubMed Central

    Köllner, Tobias G.; Schnee, Christiane; Gershenzon, Jonathan; Degenhardt, Jörg

    2004-01-01

    The mature leaves and husks of Zea mays release a complex blend of terpene volatiles after anthesis consisting predominantly of bisabolane-, sesquithujane-, and bergamotane-type sesquiterpenes. The varieties B73 and Delprim release the same volatile constituents but in significantly different proportions. To study the molecular genetic and biochemical mechanisms controlling terpene diversity and distribution in these varieties, we isolated the closely related terpene synthase genes terpene synthase4 (tps4) and tps5 from both varieties. The encoded enzymes, TPS4 and TPS5, each formed the same complex mixture of sesquiterpenes from the precursor farnesyl diphosphate but with different proportions of products. These mixtures correspond to the sesquiterpene blends observed in the varieties B73 and Delprim, respectively. The differences in the stereoselectivity of TPS4 and TPS5 are determined by four amino acid substitutions with the most important being a Gly instead of an Ala residue at position 409 at the catalytic site of the enzyme. Although both varieties contain tps4 and tps5 alleles, their differences in terpene composition result from the fact that B73 has only a single functional allele of tps4 and no functional alleles of tps5, whereas Delprim has only a functional allele of tps5 and no functional alleles of tps4. Lack of functionality was shown to be attributable to frame-shift mutations or amino acid substitutions that greatly reduce the activity of their encoded proteins. Therefore, the diversity of sesquiterpenes in these two maize cultivars is strongly influenced by single nucleotide changes in the alleles of two terpene synthase genes. PMID:15075399

  4. Provitamin A accumulation in cassava (Manihot esculenta) roots driven by a single nucleotide polymorphism in a phytoene synthase gene.

    PubMed

    Welsch, Ralf; Arango, Jacobo; Bär, Cornelia; Salazar, Bertha; Al-Babili, Salim; Beltrán, Jesús; Chavarriaga, Paul; Ceballos, Hernan; Tohme, Joe; Beyer, Peter

    2010-10-01

    Cassava (Manihot esculenta) is an important staple crop, especially in the arid tropics. Because roots of commercial cassava cultivars contain a limited amount of provitamin A carotenoids, both conventional breeding and genetic modification are being applied to increase their production and accumulation to fight vitamin A deficiency disorders. We show here that an allelic polymorphism in one of the two expressed phytoene synthase (PSY) genes is capable of enhancing the flux of carbon through carotenogenesis, thus leading to the accumulation of colored provitamin A carotenoids in storage roots. A single nucleotide polymorphism present only in yellow-rooted cultivars cosegregates with colored roots in a breeding pedigree. The resulting amino acid exchange in a highly conserved region of PSY provides increased catalytic activity in vitro and is able to increase carotenoid production in recombinant yeast and Escherichia coli cells. Consequently, cassava plants overexpressing a PSY transgene produce yellow-fleshed, high-carotenoid roots. This newly characterized PSY allele provides means to improve cassava provitamin A content in cassava roots through both breeding and genetic modification.

  5. Overexpression of the trichodiene synthase gene tri5 increases trichodermin production and antimicrobial activity in Trichoderma brevicompactum.

    PubMed

    Tijerino, Anamariela; Cardoza, R Elena; Moraga, Javier; Malmierca, Mónica G; Vicente, Francisca; Aleu, Josefina; Collado, Isidro G; Gutiérrez, Santiago; Monte, Enrique; Hermosa, Rosa

    2011-03-01

    Trichoderma brevicompactum produces trichodermin, a simple trichothecene-type toxin that shares the first steps of the sesquiterpene biosynthetic pathway with other phytotoxic trichothecenes from Fusarium spp. Trichodiene synthase catalyses the conversion of farnesyl pyrophosphate to trichodiene and it is encoded by the tri5 gene that was cloned and analysed functionally by homologous overexpression in T. brevicompactum. tri5 expression was up-regulated in media with glucose, H(2)O(2) or glycerol. tri5 repression was observed in cultures supplemented with the antioxidants ferulic acid and tyrosol. Acetone extracts of tri5-overexpressing transformants displayed higher antifungal activity than those from the wild-type. Chromatographic and spectroscopic analyses revealed that tri5 overexpression led to an increased production of trichodermin and tyrosol. Agar diffusion assays with these two purified metabolites from the tri5-overexpressing transformant T. brevicompactum Tb41tri5 showed that only trichodermin had antifungal activity against Saccharomyces cerevisiae, Kluyveromyces marxianus, Candida albicans, Candida glabrata, Candida tropicalis and Aspergillus fumigatus, in most cases such activity being higher than that observed for amphotericin B and hygromycin. Our results point to the significant role of tri5 in the production of trichodermin and in the antifungal activity of T. brevicompactum. PMID:21145409

  6. RNA interference of a trehalose-6-phosphate synthase gene reveals its roles during larval-pupal metamorphosis in Bactrocera minax (Diptera: Tephritidae).

    PubMed

    Xiong, Ke-Cai; Wang, Jia; Li, Jia-Hao; Deng, Yu-Qing; Pu, Po; Fan, Huan; Liu, Ying-Hong

    2016-01-01

    Trehalose is the major blood sugar in insects, which plays a crucial role as an instant source of energy and the starting substrate for chitin biosynthesis. In insects, trehalose is synthesized by catalysis of an important enzyme, trehalose-6-phosphate synthase (TPS). In the present study, a trehalose-6-phosphate synthase gene from Bactrocera minax (BmTPS) was cloned and characterized. BmTPS contained an open reading frame of 2445 nucleotides encoding a protein of 814 amino acids with a predicted molecular weight of 92.05kDa. BmTPS was detectable in all developmental stages of Bactrocera minax and expressed higher in the final- (third-) instar larvae. Tissue-specific expression patterns of BmTPS showed that it was mainly expressed in the fat body. The 20-hydroxyecdysone (20E) induced the expression of BmTPS and three genes in the chitin biosynthesis pathway. Moreover, injection of double-stranded RNA into third-instar larvae successfully silenced the transcription of BmTPS in B. minax, and thereby decreased the activity of TPS and trehalose content. Additionally, silencing of BmTPS inhibited the expression of three key genes in the chitin biosynthesis pathway and exhibited 52% death and abnormal phenotypes. The findings demonstrate that BmTPS is indispensable for larval-pupal metamorphosis. Besides, the establishment of RNAi experimental system in B. minax would lay a solid foundation for further investigation of molecular biology and physiology of this pest. PMID:27405007

  7. Evolution of mustard (Brassica juncea Coss) subspecies in China: evidence from the chalcone synthase gene.

    PubMed

    Chen, F B; Liu, H F; Yao, Q L; Fang, P

    2016-01-01

    To explore the phylogenetic relationship, genome donor, and evolutionary history of the polyploid mustard (Brassica juncea) from China, eighty-one sequences of the chalcone synthase gene (Chs) were analyzed in 43 individuals, including 34 B. juncea, 2 B. rapa, 1 B. nigra, 2 B. oleracea, 1 B. napus, 1 B. carinata, and 2 Raphanus sativus. A maximum likelihood analysis showed that sequences from B. juncea were separated into two well-supported groups in accordance with the A and B genomes, whereas the traditional phenotypic classification of B. juncea was not wholly supported by the molecular results. The SplitsTree analysis recognized four distinct groups of Brassicaceae, and the median-joining network analysis recognized four distinct haplotypes of Chs. The estimates of Tajima's D, Fu and Li's D, and Fu and Li's F statistic for the Chs gene in the B genome were negative, while those in the A genome were significant. The results indicated that 1) the Chs sequences revealed a high level of sequence variation in Chinese mustard, 2) both tree and reticulate evolutions existed, and artificial selection played an important role in the evolution of Chinese mustard, 3) the original parental species of Chinese mustard are B. rapa var. sinapis arvensis and B. nigra (derived from China), 4) nucleotide variation in the B genome was higher than that in the A genome, and 5) cultivated mustard evolved from wild mustard, and China is one of the primary origins of B. juncea.

  8. Nonribosomal Peptide Synthase Gene Clusters for Lipopeptide Biosynthesis in Bacillus subtilis 916 and Their Phenotypic Functions

    PubMed Central

    Liu, Xuehui; Zhou, Huafei; Wang, Xiaoyu

    2014-01-01

    Bacillus cyclic lipopeptides (LPs) have been well studied for their phytopathogen-antagonistic activities. Recently, research has shown that these LPs also contribute to the phenotypic features of Bacillus strains, such as hemolytic activity, swarming motility, biofilm formation, and colony morphology. Bacillus subtilis 916 not only coproduces the three families of well-known LPs, i.e., surfactins, bacillomycin Ls (iturin family), and fengycins, but also produces a new family of LP called locillomycins. The genome of B. subtilis 916 contains four nonribosomal peptide synthase (NRPS) gene clusters, srf, bmy, fen, and loc, which are responsible for the biosynthesis of surfactins, bacillomycin Ls, fengycins, and locillomycins, respectively. By studying B. subtilis 916 mutants lacking production of one, two, or three LPs, we attempted to unveil the connections between LPs and phenotypic features. We demonstrated that bacillomycin Ls and fengycins contribute mainly to antifungal activity. Although surfactins have weak antifungal activity in vitro, the strain mutated in srfAA had significantly decreased antifungal activity. This may be due to the impaired productions of fengycins and bacillomycin Ls. We also found that the disruption of any LP gene cluster other than fen resulted in a change in colony morphology. While surfactins and bacillomycin Ls play very important roles in hemolytic activity, swarming motility, and biofilm formation, the fengycins and locillomycins had little influence on these phenotypic features. In conclusion, B. subtilis 916 coproduces four families of LPs which contribute to the phenotypic features of B. subtilis 916 in an intricate way. PMID:25362061

  9. Evolution of mustard (Brassica juncea Coss) subspecies in China: evidence from the chalcone synthase gene.

    PubMed

    Chen, F B; Liu, H F; Yao, Q L; Fang, P

    2016-01-01

    To explore the phylogenetic relationship, genome donor, and evolutionary history of the polyploid mustard (Brassica juncea) from China, eighty-one sequences of the chalcone synthase gene (Chs) were analyzed in 43 individuals, including 34 B. juncea, 2 B. rapa, 1 B. nigra, 2 B. oleracea, 1 B. napus, 1 B. carinata, and 2 Raphanus sativus. A maximum likelihood analysis showed that sequences from B. juncea were separated into two well-supported groups in accordance with the A and B genomes, whereas the traditional phenotypic classification of B. juncea was not wholly supported by the molecular results. The SplitsTree analysis recognized four distinct groups of Brassicaceae, and the median-joining network analysis recognized four distinct haplotypes of Chs. The estimates of Tajima's D, Fu and Li's D, and Fu and Li's F statistic for the Chs gene in the B genome were negative, while those in the A genome were significant. The results indicated that 1) the Chs sequences revealed a high level of sequence variation in Chinese mustard, 2) both tree and reticulate evolutions existed, and artificial selection played an important role in the evolution of Chinese mustard, 3) the original parental species of Chinese mustard are B. rapa var. sinapis arvensis and B. nigra (derived from China), 4) nucleotide variation in the B genome was higher than that in the A genome, and 5) cultivated mustard evolved from wild mustard, and China is one of the primary origins of B. juncea. PMID:27173323

  10. Ventilation and oxygenation induce endothelial nitric oxide synthase gene expression in the lungs of fetal lambs.

    PubMed Central

    Black, S M; Johengen, M J; Ma, Z D; Bristow, J; Soifer, S J

    1997-01-01

    At birth, ventilation and oxygenation immediately decrease pulmonary vascular resistance (PVR) and increase pulmonary blood flow (PBF); more gradual changes occur over the next several hours. Nitric oxide, produced by endothelial nitric oxide synthase (eNOS), mediates these gradual changes. To determine how ventilation and oxygenation affect eNOS gene expression, 12 fetal lambs were ventilated for 8 h without changing fetal descending aortic blood gases or pH (rhythmic distension) or with 100% oxygen (O2 ventilation). Vascular pressures and PBF were measured. Total RNA, protein, and tissue sections were prepared from lung tissue for RNase protection assays, Western blotting, and in situ hybridization. O2 ventilation increased PBF and decreased PVR more than rhythmic distension (P < 0.05). Rhythmic distension increased eNOS mRNA expression; O2 ventilation increased eNOS mRNA expression more and increased eNOS protein expression (P < 0.05). To define the mechanisms responsible for these changes, ovine fetal pulmonary arterial endothelial cells were exposed to 1, 21, or 95% O2 or to shear stress. 95% O2 increased eNOS mRNA and protein expression (P < 0.05). Shear stress increased eNOS mRNA and protein expression (P < 0.05). Increased oxygenation but more importantly increased PBF with increased shear stress induce eNOS gene expression and contribute to pulmonary vasodilation after birth. PMID:9294110

  11. Volatile emissions of scented Alstroemeria genotypes are dominated by terpenes, and a myrcene synthase gene is highly expressed in scented Alstroemeria flowers

    PubMed Central

    Aros, Danilo; Gonzalez, Veronica; Allemann, Rudolf K.; Müller, Carsten T.; Rosati, Carlo; Rogers, Hilary J.

    2012-01-01

    Native to South America, Alstroemeria flowers are known for their colourful tepals, and Alstroemeria hybrids are an important cut flower. However, in common with many commercial cut flowers, virtually all the commercial Alstroemeria hybrids are not scented. The cultivar ‘Sweet Laura’ is one of very few scented commercial Alstroemeria hybrids. Characterization of the volatile emission profile of these cut flowers revealed three major terpene compounds: (E)-caryophyllene, humulene (also known as α-caryophyllene), an ocimene-like compound, and several minor peaks, one of which was identified as myrcene. The profile is completely different from that of the parental scented species A. caryophyllaea. Volatile emission peaked at anthesis in both scented genotypes, coincident in cv. ‘Sweet Laura’ with the maximal expression of a putative terpene synthase gene AlstroTPS. This gene was preferentially expressed in floral tissues of both cv. ‘Sweet Laura’ and A. caryophyllaea. Characterization of the AlstroTPS gene structure from cv. ‘Sweet Laura’ placed it as a member of the class III terpene synthases, and the predicted 567 amino acid sequence placed it into the subfamily TPS-b. The conserved sequences R28(R)X8W and D321DXXD are the putative Mg2+-binding sites, and in vitro assay of AlstroTPS expressed in Escherichia coli revealed that the encoded enzyme possesses myrcene synthase activity, consistent with a role for AlstroTPS in scent production in Alstroemeria cv. ‘Sweet Laura’ flowers. PMID:22268153

  12. In vitro reconstitution and steady-state analysis of the fatty acid synthase from Escherichia coli.

    PubMed

    Yu, Xingye; Liu, Tiangang; Zhu, Fayin; Khosla, Chaitan

    2011-11-15

    Microbial fatty acid derivatives are emerging as promising alternatives to fossil fuel derived transportation fuels. Among bacterial fatty acid synthases (FAS), the Escherichia coli FAS is perhaps the most well studied, but little is known about its steady-state kinetic behavior. Here we describe the reconstitution of E. coli FAS using purified protein components and report detailed kinetic analysis of this reconstituted system. When all ketosynthases are present at 1 μM, the maximum rate of free fatty acid synthesis of the FAS exceeded 100 μM/ min. The steady-state turnover frequency was not significantly inhibited at high concentrations of any substrate or cofactor. FAS activity was saturated with respect to most individual protein components when their concentrations exceeded 1 μM. The exceptions were FabI and FabZ, which increased FAS activity up to concentrations of 10 μM; FabH and FabF, which decreased FAS activity at concentrations higher than 1 μM; and holo-ACP and TesA, which gave maximum FAS activity at 30 μM concentrations. Analysis of the S36T mutant of the ACP revealed that the unusual dependence of FAS activity on holo-ACP concentration was due, at least in part, to the acyl-phosphopantetheine moiety. MALDI-TOF mass spectrometry analysis of the reaction mixture further revealed medium and long chain fatty acyl-ACP intermediates as predominant ACP species. We speculate that one or more of such intermediates are key allosteric regulators of FAS turnover. Our findings provide a new basis for assessing the scope and limitations of using E. coli as a biocatalyst for the production of diesel-like fuels.

  13. In vitro reconstitution and steady-state analysis of the fatty acid synthase from Escherichia coli

    PubMed Central

    Yu, Xingye; Liu, Tiangang; Zhu, Fayin; Khosla, Chaitan

    2011-01-01

    Microbial fatty acid derivatives are emerging as promising alternatives to fossil fuel derived transportation fuels. Among bacterial fatty acid synthases (FAS), the Escherichia coli FAS is perhaps the most well studied, but little is known about its steady-state kinetic behavior. Here we describe the reconstitution of E. coli FAS using purified protein components and report detailed kinetic analysis of this reconstituted system. When all ketosynthases are present at 1 μM, the maximum rate of free fatty acid synthesis of the FAS exceeded 100 μM/ min. The steady-state turnover frequency was not significantly inhibited at high concentrations of any substrate or cofactor. FAS activity was saturated with respect to most individual protein components when their concentrations exceeded 1 μM. The exceptions were FabI and FabZ, which increased FAS activity up to concentrations of 10 μM; FabH and FabF, which decreased FAS activity at concentrations higher than 1 μM; and holo-ACP and TesA, which gave maximum FAS activity at 30 μM concentrations. Analysis of the S36T mutant of the ACP revealed that the unusual dependence of FAS activity on holo-ACP concentration was due, at least in part, to the acyl-phosphopantetheine moiety. MALDI-TOF mass spectrometry analysis of the reaction mixture further revealed medium and long chain fatty acyl-ACP intermediates as predominant ACP species. We speculate that one or more of such intermediates are key allosteric regulators of FAS turnover. Our findings provide a new basis for assessing the scope and limitations of using E. coli as a biocatalyst for the production of diesel-like fuels. PMID:22042840

  14. An ancient repeat sequence in the ATP synthase beta-subunit gene of forcipulate sea stars.

    PubMed

    Foltz, David W

    2007-11-01

    A novel repeat sequence with a conserved secondary structure is described from two nonadjacent introns of the ATP synthase beta-subunit gene in sea stars of the order Forcipulatida (Echinodermata: Asteroidea). The repeat is present in both introns of all forcipulate sea stars examined, which suggests that it is an ancient feature of this gene (with an approximate age of 200 Mya). Both stem and loop regions show high levels of sequence constraint when compared to flanking nonrepetitive intronic regions. The repeat was also detected in (1) the family Pterasteridae, order Velatida and (2) the family Korethrasteridae, order Velatida. The repeat was not detected in (1) the family Echinasteridae, order Spinulosida, (2) the family Astropectinidae, order Paxillosida, (3) the family Solasteridae, order Velatida, or (4) the family Goniasteridae, order Valvatida. The repeat lacks similarity to published sequences in unrestricted GenBank searches, and there are no significant open reading frames in the repeat or in the flanking intron sequences. Comparison via parametric bootstrapping to a published phylogeny based on 4.2 kb of nuclear and mitochondrial sequence for a subset of these species allowed the null hypothesis of a congruent phylogeny to be rejected for each repeat, when compared separately to the published phylogeny. In contrast, the flanking nonrepetitive sequences in each intron yielded separate phylogenies that were each congruent with the published phylogeny. In four species, the repeat in one or both introns has apparently experienced gene conversion. The two introns also show a correlated pattern of nucleotide substitutions, even after excluding the putative cases of gene conversion.

  15. IDENTIFICATION AND HORMONE INDUCTION OF PUTATIVE CHITIN SYNTHASE GENES AND SPLICE VARIANTS IN Leptinotarsa decemlineata (SAY).

    PubMed

    Shi, Ji-Feng; Mu, Li-Li; Guo, Wen-Chao; Li, Guo-Qing

    2016-08-01

    Chitin synthase (ChS) plays a critical role in chitin synthesis and excretion. In this study, two ChS genes (LdChSA and LdChSB) were identified in Leptinotarsa decemlineata. LdChSA contains two splicing variants, LdChSAa and LdChSAb. Within the first, second, and third larval instars, the mRNA levels of LdChSAa, LdChSAb, and LdChSB coincide with the peaks of circulating 20-hydroxyecdysone (20E) and juvenile hormone (JH). In vitro culture of midguts and an in vivo bioassay revealed that 20E and an ecdysteroid agonist halofenozide stimulated the expression of the three LdChSs. Conversely, a reduction of 20E by RNA interference (RNAi) of an ecdysteroidogenesis gene LdSHD repressed the expression of these LdChSs, and ingestion of halofenozide by LdSHD RNAi larvae rescued the repression. Moreover, disruption of 20E signaling by RNAi of LdEcR, LdE75, LdHR3, and LdFTZ-F1 reduced the expression levels of these genes. Similarly, in vitro culture and an in vivo bioassay showed that exogenous JH and a JH analog methoprene activated the expression of the three LdChSs, whereas a decrease in JH by RNAi of a JH biosynthesis gene LdJHAMT downregulated these LdChSs. It seems that JH upregulates LdChSs at the early stage of each instar, whereas a 20E pulse triggers the transcription of LdChSs during molting in L. decemlineata. PMID:27030662

  16. Characterization of two trpE genes encoding anthranilate synthase {alpha}-subunit in Azospirillum brasilense

    SciTech Connect

    Ge Shimei; Xie Baoen; Chen Sanfeng . E-mail: chensf@cau.edu.cn

    2006-03-10

    The previous report from our laboratory has recently identified a new trpE gene (termed trpE {sub 2}) which exists independently in Azospirillum brasilense Yu62. In this study, amplification of trpE(G) (termed trpE {sub 1}(G) here) confirmed that there are two copies of trpE gene, one trpE being fused into trpG while the other trpE existed independently. This is First report to suggest that two copies of the trpE gene exist in this bacterium. Comparison of the nucleotide sequence demonstrated that putative leader peptide, terminator, and anti-terminator were found upstream of trpE {sub 1}(G) while these sequence features did not exist in front of trpE {sub 2}. The {beta}-galactosidase activity of an A. brasilense strain carrying a trpE {sub 2}-lacZ fusion remained constant at different tryptophan concentrations, but the {beta}-galactosidase activity of the same strain carrying a trpE {sub 1}(G)-lacZ fusion decreased as the tryptophan concentration increased. These data suggest that the expression of trpE {sub 1}(G) is regulated at the transcriptional level by attenuation while trpE {sub 2} is constantly expressed. The anthranilate synthase assays with trpE {sub 1}(G){sup -} and trpE {sub 2} {sup -} mutants demonstrated that TrpE{sub 1}(G) fusion protein is feedback inhibited by tryptophan while TrpE{sub 2} protein is not. We also found that both trpE {sub 1}(G) and trpE {sub 2} gene products were involved in IAA synthesis.

  17. Macrophage nitric oxide synthase gene: two upstream regions mediate induction by interferon gamma and lipopolysaccharide.

    PubMed Central

    Lowenstein, C J; Alley, E W; Raval, P; Snowman, A M; Snyder, S H; Russell, S W; Murphy, W J

    1993-01-01

    The promoter region of the mouse gene for macrophage-inducible nitric oxide synthase (mac-NOS; EC 1.14.13.39) has been characterized. A putative TATA box is 30 base pairs upstream of the transcription start site. Computer analysis reveals numerous potential binding sites for transcription factors, many of them associated with stimuli that induce mac-NOS expression. To localize functionally important portions of the regulatory region, we constructed deletion mutants of the mac-NOS 5' flanking region and placed them upstream of a luciferase reporter gene. The macrophage cell line RAW 264.7, when transfected with a minimal promoter construct, expresses little luciferase activity when stimulated by lipopolysaccharide (LPS), interferon gamma (IFN-gamma), or both. Maximal expression depends on two discrete regulatory regions upstream of the putative TATA box. Region I (position -48 to -209) increases luciferase activity approximately 75-fold over the minimal promoter construct. Region I contains LPS-related responsive elements, including a binding site for nuclear factor interleukin 6 (NF-IL6) and the kappa B binding site for NF-kappa B, suggesting that this region regulates LPS-induced expression of the mac-NOS gene. Region II (position -913 to -1029) alone does not increase luciferase expression, but together with region I it causes an additional 10-fold increase in expression. Together the two regions increase expression 750-fold over activity obtained from a minimal promoter construct. Region II contains motifs for binding IFN-related transcription factors and thus probably is responsible for IFN-mediated regulation of LPS-induced mac-NOS. Delineation of these two cooperative regions explains at the level of transcription how IFN-gamma and LPS act in concert to induce maximally the mac-NOS gene and, furthermore, how IFN-gamma augments the inflammatory response to LPS. Images Fig. 2 PMID:7692452

  18. Endothelial nitric oxide synthase (eNOS) gene polymorphism in early term chronic allograft nephropathy.

    PubMed

    Yilmaz, E; Mir, S; Berdeli, A

    2009-12-01

    Chronic allograft nephropathy (CAN) is a complex phenomenon caused by underlying kidney disease with superimposed enviromental and genetic factors. CAN development begins with progressive renal microvascular injury. Endothelial cells play key roles in the regulation of vascular tone, permeability, and remodeling. A reduction in basal nitric oxide (NO) release as a result of genetic variation in endothelial NO synthase (eNOS) function may predispose to hypertension, thrombosis, vasospasm, and atherosclerosis, all contributing to the development of CAN. We analyzed the G894T mutation at exon 7 of the eNOS gene in relationship to CAN among 81 children with renal transplantations. The 20 patients who developed CAN underwent renal biopsies for histological confirmation. Proteinuria and hypertension were observed in CAN. We selected 173 healthy reference subjects. The G894T polymorphism of the eNOS gene was determined by PCR-restriction fragment-length polymorphism analysis. The group included 33 male and 48 female subjects who received 32 living-related grafts and 49 from deceased donors (DD) donors. Donor age (y) was 32.7 +/- 13.7 and the HLA A,B,DR mismatch number of the cadaveric cases was 3.5 +/- 0.79. The distribution of the genotypes were ENOS GG/GT/TT 48%, 33%, 19%, respectively. G-alleles frequency was 64.8%; T-allele frequency was 35.2%. ENOS G894T gene polymorphism did not seem to influence long-term renal allograft outcome. Recipient ENOS G894T gene polymorphism did not alter the risk of chronic allograft failure. Even if NO synthesis and bioactivity are influenced by this polymorphism, many vasoactive factors may have roles to suppress the advantageous effects of NO. PMID:20005399

  19. Stilbene synthase gene transfer caused alterations in the phenylpropanoid metabolism of transgenic strawberry (Fragaria×ananassa)

    PubMed Central

    Hanhineva, Kati; Kokko, Harri; Siljanen, Henri; Rogachev, Ilana; Aharoni, Asaph; Kärenlampi, Sirpa O.

    2009-01-01

    The gene encoding stilbene synthase is frequently used to modify plant secondary metabolism with the aim of producing the self-defence phytoalexin resveratrol. In this study, strawberry (Fragaria×ananassa) was transformed with the NS-Vitis3 gene encoding stilbene synthase from frost grape (Vitis riparia) under the control of the cauliflower mosaic virus 35S and the floral filament-specific fil1 promoters. Changes in leaf metabolites were investigated with UPLC-qTOF-MS (ultra performance liquid chromatography-quadrupole time of flight mass spectrometry) profiling, and increased accumulation of cinnamate, coumarate, and ferulate derivatives concomitantly with a decrease in the levels of flavonols was observed, while the anticipated resveratrol or its derivatives were not detected. The changed metabolite profile suggested that chalcone synthase was down-regulated by the genetic modification; this was verified by decreased chalcone synthase transcript levels. Changes in the levels of phenolic compounds led to increased susceptibility of the transgenic strawberry to grey mould fungus. PMID:19443619

  20. Circulating Fatty Acid Synthase in pregnant women: Relationship to blood pressure, maternal metabolism and newborn parameters

    PubMed Central

    Carreras-Badosa, Gemma; Prats-Puig, Anna; Puig, Teresa; Vázquez-Ruíz, Montserrat; Bruel, Monserrat; Mendoza, Ericka; de Zegher, Francis; Ibáñez, Lourdes; López-Bermejo, Abel; Bassols, Judit

    2016-01-01

    The enzyme FASN (fatty acid synthase) is potentially related with hypertension and metabolic dysfunction. FASN is highly expressed in the human placenta. We aimed to investigate the relationship circulating FASN has with blood pressure, maternal metabolism and newborn parameters in healthy pregnant women. Circulating FASN was assessed in 115 asymptomatic pregnant women in the second trimester of gestation along with C-peptide, fasting glucose and insulin, post-load glucose lipids, HMW-adiponectin and blood pressure (the latter was assessed in each trimester of gestation). At birth, newborns and placentas were weighed. FASN expression was also able to be assessed in 80 placentas. Higher circulating FASN was associated with lower systolic blood pressure (SBP), with a more favourable metabolic phenotype (lower fasting glucose and insulin, post load glucose, HbAc1, HOMA-IR and C-peptide), and with lower placental and birth weight (all p < 0.05 to p < 0.001). Placental FASN expression related positively to circulating FASN (p < 0.005) and negatively to placental weight (p < 0.05). Our observations suggest a physiological role of placental FASN in human pregnancy. Future studies will clarify whether circulating FASN of placental origin does actually regulate placental and fetal growth, and (thereby) has a favourable influence on the pregnant mother’s insulin sensitivity and blood pressure. PMID:27090298

  1. Potent Inhibitory Effect of Chinese Dietary Spices on Fatty Acid Synthase.

    PubMed

    Jiang, Bing; Liang, Yan; Sun, Xuebing; Liu, Xiaoxin; Tian, Weixi; Ma, Xiaofeng

    2015-09-01

    Dietary spices have been adopted in cooking since ancient times to enhance flavor and also as food preservatives and disease remedies. In China, the use of spices and other aromatic plants as food flavoring is an integral part of dietary behavior, but relatively little is known about their functions. Fatty acid synthase (FAS) has been recognized as a remedy target, and its inhibitors might be applied in disease treatment. The present work was designed to assess the inhibitory activities on FAS of spices extracts in Chinese menu. The in vitro inhibitory activities on FAS of 22 extracts of spices were assessed by spectrophotometrically monitoring oxidation of NADPH at 340 nm. Results showed that 20 spices extracts (90.9 %) exhibited inhibitory activities on FAS, with half inhibition concentration (IC(50)) values ranging from 1.72 to 810.7 μg/ml. Among them, seven spices showed strong inhibitory effect with IC(50) values lower than 10 μg/ml. These findings suggest that a large proportion of the dietary spices studied possess promising inhibitory activities on FAS, and subsequently might be applied in the treatment of obesity and obesity-related human diseases.

  2. Inhibition of fatty acid synthase by amentoflavone reduces coxsackievirus B3 replication.

    PubMed

    Wilsky, Steffi; Sobotta, Katharina; Wiesener, Nadine; Pilas, Johanna; Althof, Nadine; Munder, Thomas; Wutzler, Peter; Henke, Andreas

    2012-02-01

    Coxsackievirus B3 (CVB3) is a human pathogen that causes acute and chronic infections, but an antiviral drug to treat these diseases has not yet been developed for clinical use. Several intracellular pathways are altered to assist viral transcription, RNA replication, and progeny release. Among these, fatty acid synthase (FAS) expression is increased. In order to test the potential of FAS inhibition as an anti-CVB3 strategy, several experiments were performed, including studies on the correlation of CVB3 replication and FAS expression in human Raji cells and an analysis of the time and dose dependence of the antiviral effect of FAS inhibition due to treatment with amentoflavone. The results demonstrate that CVB3 infection induces an up-regulation of FAS expression already at 1 h postinfection (p.i.). Incubation with increasing concentrations of amentoflavone inhibited CVB3 replication significantly up to 8 h p.i. In addition, suppression of p38 MAP kinase activity by treatment with SB239063 decreased FAS expression as well as viral replication. These data provide evidence that FAS inhibition via amentoflavone administration might present a target for anti-CVB3 therapy. PMID:22075919

  3. Effect of modification of the length and flexibility of the acyl carrier protein-thioesterase interdomain linker on functionality of the animal fatty acid synthase.

    PubMed

    Joshi, Anil K; Witkowski, Andrzej; Berman, Harvey A; Zhang, Lei; Smith, Stuart

    2005-03-15

    A natural linker of approximately 20 residues connects the acyl carrier protein with the carboxy-terminal thioesterase domain of the animal fatty acid synthase. This study examines the effects of changes in the length and amino acid composition of this linker on catalytic activity, product composition, and segmental motion of the thioesterase domain. Deletion of 10 residues, almost half of the interdomain linker, had no effect on either mobility of the thioesterase domain, estimated from fluorescence polarization of a pyrenebutyl methylphosphono moiety bound covalently to the active site serine residue, or functionality of the fatty acid synthase; further shortening of the linker limited mobility of the thioesterase domain and resulted in reduced fatty acid synthase activity and an increase in product chain length from 16 to 18 and 20 carbon atoms. Surprisingly, however, even when the entire linker region was deleted, the fatty acid synthase retained 28% activity. Lengthening of the linker, by insertion of an unusually long acyl carrier protein-thioesterase linker from a modular polyketide synthase, increased mobility of the thioesterase domain without having any significant effect on catalytic properties of the complex. Interdomain linkers could also be used to tether, to the acyl carrier protein domain of the fatty acid synthase, a thioesterase active toward shorter chain length acyl thioesters generating novel short-chain fatty acid synthases. These studies reveal that although truncation of the interdomain linker partially impacts the ability of the thioesterase domain to terminate growth of the acyl chain, the overall integrity of the fatty acid synthase is quite tolerant to moderate changes in linker length and flexibility. The retention of fatty acid synthesizing activity on deletion of the entire linker region implies that the inherent flexibility of the phosphopantetheine "swinging arm" also contributes significantly to the successful docking of the long

  4. Physiological roles of trehalose in Leptinotarsa larvae revealed by RNA interference of trehalose-6-phosphate synthase and trehalase genes.

    PubMed

    Shi, Ji-Feng; Xu, Qing-Yu; Sun, Qiang-Kun; Meng, Qing-Wei; Mu, Li-Li; Guo, Wen-Chao; Li, Guo-Qing

    2016-10-01

    Trehalose is proposed to serve multiple physiological roles in insects. However, its importance remains largely unconfirmed. In the present paper, we knocked down either a trehalose biosynthesis gene (trehalose-6-phosphate synthase, LdTPS) or each of three degradation genes (soluble trehalases LdTRE1a, LdTRE1b or membrane-bound LdTRE2) in Leptinotarsa decemlineata by RNA interference (RNAi). Knockdown of LdTPS decreased trehalose content and caused larval and pupal lethality. The LdTPS RNAi survivors consumed a greater amount of foliage, obtained a heavier body mass, accumulated more glycogen, lipid and proline, and had a smaller amount of chitin compared with the controls. Ingestion of trehalose but not glucose rescued the food consumption increase and larval mass rise, increased survivorship, and recovered glycogen, lipid and chitin to the normal levels. In contrast, silencing of LdTRE1a increased trehalose content and resulted in larval and pupal lethality. The surviving LdTRE1a RNAi hypomorphs fed a smaller quantity of food, had a lighter body weight, depleted lipid and several glucogenic amino acids, and contained a smaller amount of chitin. Neither trehalose nor glucose ingestion rescued these LdTRE1a RNAi defects. Silencing of LdTRE1b caused little effects. Knockdown of LdTRE2 caused larval death, increased trehalose contents in several tissues and diminished glycogen in the brain-corpora cardiaca-corpora allata complex (BCC). Feeding glucose but not trehalose partially rescued the high mortality rate and recovered glycogen content in the BCC. It seems that trehalose is involved in feeding regulation, sugar absorption, brain energy supply and chitin biosynthesis in L. decemlineata larvae. PMID:27524277

  5. Fatty acid biosynthesis in Pseudomonas aeruginosa is initiated by the FabY class of β-ketoacyl acyl carrier protein synthases.

    PubMed

    Yuan, Yanqiu; Sachdeva, Meena; Leeds, Jennifer A; Meredith, Timothy C

    2012-10-01

    The prototypical type II fatty acid synthesis (FAS) pathway in bacteria utilizes two distinct classes of β-ketoacyl synthase (KAS) domains to assemble long-chain fatty acids, the KASIII domain for initiation and the KASI/II domain for elongation. The central role of FAS in bacterial viability and virulence has stimulated significant effort toward developing KAS inhibitors, particularly against the KASIII domain of the β-acetoacetyl-acyl carrier protein (ACP) synthase FabH. Herein, we show that the opportunistic pathogen Pseudomonas aeruginosa does not utilize a FabH ortholog but rather a new class of divergent KAS I/II enzymes to initiate the FAS pathway. When a P. aeruginosa cosmid library was used to rescue growth in a fabH downregulated strain of Escherichia coli, a single unannotated open reading frame, PA5174, complemented fabH depletion. While deletion of all four KASIII domain-encoding genes in the same P. aeruginosa strain resulted in a wild-type growth phenotype, deletion of PA5174 alone specifically attenuated growth due to a defect in de novo FAS. Siderophore secretion and quorum-sensing signaling, particularly in the rhl and Pseudomonas quinolone signal (PQS) systems, was significantly muted in the absence of PA5174. The defect could be repaired by intergeneric complementation with E. coli fabH. Characterization of recombinant PA5174 confirmed a preference for short-chain acyl coenzyme A (acyl-CoA) substrates, supporting the identification of PA5174 as the predominant enzyme catalyzing the condensation of acetyl coenzyme A with malonyl-ACP in P. aeruginosa. The identification of the functional role for PA5174 in FAS defines the new FabY class of β-ketoacyl synthase KASI/II domain condensation enzymes.

  6. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    NASA Astrophysics Data System (ADS)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  7. Endothelial nitric oxide synthase gene polymorphism is associated with Legg-Calvé-Perthes disease

    PubMed Central

    ZHAO, YULONG; LIAO, SHIJIE; LU, RONGBIN; DANG, HAO; ZHAO, JINMIN; DING, XIAOFEI

    2016-01-01

    The aim of this study was to assess the association of 27-bp variable number tandem repeat (VNTR) polymorphism in intron 4 and G894T polymorphism in exon 7 of the endothelial nitric oxide synthase (eNOS) gene with Legg-Calvé-Perthes disease (LCPD), and to provide a scientific basis for further research into the pathogenic mechanism. A total of 80 patients with LCPD and 100 healthy subjects were recruited in this case-control study. The 27-bp VNTR and G894T polymorphisms of the eNOS gene were genotyped using polymerase chain reaction (PCR) and PCR-restriction fragment length polymorphism, respectively, followed by agarose gel electrophoresis and DNA sequencing. Allelic and genotypic frequencies were computed in the two groups and subjected to statistical analysis. For the 27-bp VNTR polymorphism, individuals with LCPD showed a higher frequency of the ab genotype [27.5 vs. 14%; odds ratio (OR), 2.33; 95% confidence interval (CI), 1.10–4.92; P=0.024]. For the G894T polymorphism, the LCPD case group showed a higher frequency of the heterozygous genotype GT than the healthy control group (35 vs. 17%; OR, 2.67; 95% CI, 1.33–5.36; P=0.005). The results indicate that these eNOS gene polymorphisms may be a risk factor for LCPD. The 27-bp VNTR polymorphism in intron 4 and G894T polymorphism in exon 7 may be involved in the etiology of LCPD. PMID:27168827

  8. The smoking-associated oxidant hypothiocyanous acid induces endothelial nitric oxide synthase dysfunction.

    PubMed

    Talib, Jihan; Kwan, Jair; Suryo Rahmanto, Aldwin; Witting, Paul K; Davies, Michael J

    2014-01-01

    Smokers have an elevated risk of cardiovascular disease but the origin(s) of this increased risk are incompletely defined. Considerable evidence supports an accumulation of the oxidant-generating enzyme MPO (myeloperoxidase) in the inflamed artery wall, and smokers have high levels of SCN(-), a preferred MPO substrate, with this resulting in HOSCN (hypothiocyanous acid) formation. We hypothesized that this thiol-specific oxidant may target the Zn(2+)-thiol cluster of eNOS (endothelial nitric oxide synthase), resulting in enzyme dysfunction and reduced formation of the critical signalling molecule NO•. Decreased NO• bioavailability is an early and critical event in atherogenesis, and HOSCN-mediated damage to eNOS may contribute to smoking-associated disease. In the present study it is shown that exposure of isolated eNOS to HOSCN or MPO/H2O2/SCN(-) decreased active dimeric eNOS levels, and increased inactive monomer and Zn(2+) release, compared with controls, HOCl (hypochlorous acid)- or MPO/H2O2/Cl(-)-treated samples. eNOS activity was increasingly compromised by MPO/H2O2/Cl(-) with increasing SCN(-) concentrations. Exposure of HCAEC (human coronary artery endothelial cell) lysates to pre-formed HOSCN, or MPO/H2O2/Cl(-) with increasing SCN(-), increased eNOS monomerization and Zn(2+) release, and decreased activity. Intact HCAECs exposed to HOCl and HOSCN had decreased eNOS activity and NO2(-)/NO3(-) formation (products of NO• decomposition), and increased free Zn(2+). Exposure of isolated rat aortic rings to HOSCN resulted in thiol loss, and decreased eNOS activity and cGMP levels. Overall these data indicate that high SCN(-) levels, as seen in smokers, can increase HOSCN formation and enhance eNOS dysfunction in human endothelial cells, with this potentially contributing to increased atherogenesis in smokers. PMID:24112082

  9. Angelica Sinensis Polysaccharides Stimulated UDP-Sugar Synthase Genes through Promoting Gene Expression of IGF-1 and IGF1R in Chondrocytes: Promoting Anti-Osteoarthritic Activity

    PubMed Central

    Wen, Yinxian; Li, Jing; Tan, Yang; Qin, Jun; Xie, Xianfei; Wang, Linlong; Mei, Qibing; Wang, Hui; Magdalou, Jacques; Chen, Liaobin

    2014-01-01

    Background Osteoarthritis (OA) is a chronic joints disease characterized by progressive degeneration of articular cartilage due to the loss of cartilage matrix. Previously, we found, for the first time, that an acidic glycan from Angelica Sinensis Polysaccharides (APSs), namely the APS-3c, could protect rat cartilage from OA due to promoting glycosaminoglycan (GAG) synthesis in chondrocytes. In the present work, we tried to further the understanding of ASP-3c’s anti-OA activity. Methodology/Principal Findings Human primary chondrocytes were treated with APS-3c or/and recombinant human interleukin 1β (IL-1β). It turned out that APS-3c promoted synthesis of UDP-xylose and GAG, as well as the gene expression of UDP-sugar synthases (USSs), insulin like growth factor 1 (IGF1) and IGF1 receptor (IGF1R), and attenuated the degenerative phenotypes, suppressed biosynthesis of UDP-sugars and GAG, and inhibited the gene expression of USSs, IGF1 and IGF1R induced by IL-1β. Then, we induced a rat OA model with papain, and found that APS-3c also stimulated GAG synthesis and gene expression of USSs, IGF1 and IGF1R in vivo. Additionally, recombinant human IGF1 and IGF1R inhibitor NP-AEW541 were applied to figure out the correlation between stimulated gene expression of USSs, IGF1 and IGF1R induced by APS-3c. It tuned out that the promoted GAG synthesis and USSs gene expression induced by APS-3c was mediated by the stimulated IGF1 and IGF1R gene expression, but not through directly activation of IGF1R signaling pathway. Conclusions/Significances We demonstrated for the first time that APS-3c presented anti-OA activity through stimulating IGF-1 and IGF1R gene expression, but not directly activating the IGF1R signaling pathway, which consequently promoted UDP-sugars and GAG synthesis due to up-regulating gene expression of USSs. Our findings presented a better understanding of APS-3c’s anti-OA activity and suggested that APS-3c could potentially be a novel therapeutic agent

  10. RNAi and Homologous Over-Expression Based Functional Approaches Reveal Triterpenoid Synthase Gene-Cycloartenol Synthase Is Involved in Downstream Withanolide Biosynthesis in Withania somnifera.

    PubMed

    Mishra, Smrati; Bansal, Shilpi; Mishra, Bhawana; Sangwan, Rajender Singh; Asha; Jadaun, Jyoti Singh; Sangwan, Neelam S

    2016-01-01

    Withania somnifera Dunal, is one of the most commonly used medicinal plant in Ayurvedic and indigenous medicine traditionally owing to its therapeutic potential, because of major chemical constituents, withanolides. Withanolide biosynthesis requires the activities of several enzymes in vivo. Cycloartenol synthase (CAS) is an important enzyme in the withanolide biosynthetic pathway, catalyzing cyclization of 2, 3 oxidosqualene into cycloartenol. In the present study, we have cloned full-length WsCAS from Withania somnifera by homology-based PCR method. For gene function investigation, we constructed three RNAi gene-silencing constructs in backbone of RNAi vector pGSA and a full-length over-expression construct. These constructs were transformed in Agrobacterium strain GV3101 for plant transformation in W. somnifera. Molecular and metabolite analysis was performed in putative Withania transformants. The PCR and Southern blot results showed the genomic integration of these RNAi and overexpression construct(s) in Withania genome. The qRT-PCR analysis showed that the expression of WsCAS gene was considerably downregulated in stable transgenic silenced Withania lines compared with the non-transformed control and HPLC analysis showed that withanolide content was greatly reduced in silenced lines. Transgenic plants over expressing CAS gene displayed enhanced level of CAS transcript and withanolide content compared to non-transformed controls. This work is the first full proof report of functional validation of any metabolic pathway gene in W. somnifera at whole plant level as per our knowledge and it will be further useful to understand the regulatory role of different genes involved in the biosynthesis of withanolides.

  11. RNAi and Homologous Over-Expression Based Functional Approaches Reveal Triterpenoid Synthase Gene-Cycloartenol Synthase Is Involved in Downstream Withanolide Biosynthesis in Withania somnifera

    PubMed Central

    Mishra, Bhawana; Sangwan, Rajender Singh; Asha; Jadaun, Jyoti Singh; Sangwan, Neelam S.

    2016-01-01

    Withania somnifera Dunal, is one of the most commonly used medicinal plant in Ayurvedic and indigenous medicine traditionally owing to its therapeutic potential, because of major chemical constituents, withanolides. Withanolide biosynthesis requires the activities of several enzymes in vivo. Cycloartenol synthase (CAS) is an important enzyme in the withanolide biosynthetic pathway, catalyzing cyclization of 2, 3 oxidosqualene into cycloartenol. In the present study, we have cloned full-length WsCAS from Withania somnifera by homology-based PCR method. For gene function investigation, we constructed three RNAi gene-silencing constructs in backbone of RNAi vector pGSA and a full-length over-expression construct. These constructs were transformed in Agrobacterium strain GV3101 for plant transformation in W. somnifera. Molecular and metabolite analysis was performed in putative Withania transformants. The PCR and Southern blot results showed the genomic integration of these RNAi and overexpression construct(s) in Withania genome. The qRT-PCR analysis showed that the expression of WsCAS gene was considerably downregulated in stable transgenic silenced Withania lines compared with the non-transformed control and HPLC analysis showed that withanolide content was greatly reduced in silenced lines. Transgenic plants over expressing CAS gene displayed enhanced level of CAS transcript and withanolide content compared to non-transformed controls. This work is the first full proof report of functional validation of any metabolic pathway gene in W. somnifera at whole plant level as per our knowledge and it will be further useful to understand the regulatory role of different genes involved in the biosynthesis of withanolides. PMID:26919744

  12. RNAi and Homologous Over-Expression Based Functional Approaches Reveal Triterpenoid Synthase Gene-Cycloartenol Synthase Is Involved in Downstream Withanolide Biosynthesis in Withania somnifera.

    PubMed

    Mishra, Smrati; Bansal, Shilpi; Mishra, Bhawana; Sangwan, Rajender Singh; Asha; Jadaun, Jyoti Singh; Sangwan, Neelam S

    2016-01-01

    Withania somnifera Dunal, is one of the most commonly used medicinal plant in Ayurvedic and indigenous medicine traditionally owing to its therapeutic potential, because of major chemical constituents, withanolides. Withanolide biosynthesis requires the activities of several enzymes in vivo. Cycloartenol synthase (CAS) is an important enzyme in the withanolide biosynthetic pathway, catalyzing cyclization of 2, 3 oxidosqualene into cycloartenol. In the present study, we have cloned full-length WsCAS from Withania somnifera by homology-based PCR method. For gene function investigation, we constructed three RNAi gene-silencing constructs in backbone of RNAi vector pGSA and a full-length over-expression construct. These constructs were transformed in Agrobacterium strain GV3101 for plant transformation in W. somnifera. Molecular and metabolite analysis was performed in putative Withania transformants. The PCR and Southern blot results showed the genomic integration of these RNAi and overexpression construct(s) in Withania genome. The qRT-PCR analysis showed that the expression of WsCAS gene was considerably downregulated in stable transgenic silenced Withania lines compared with the non-transformed control and HPLC analysis showed that withanolide content was greatly reduced in silenced lines. Transgenic plants over expressing CAS gene displayed enhanced level of CAS transcript and withanolide content compared to non-transformed controls. This work is the first full proof report of functional validation of any metabolic pathway gene in W. somnifera at whole plant level as per our knowledge and it will be further useful to understand the regulatory role of different genes involved in the biosynthesis of withanolides. PMID:26919744

  13. Polyketide genes in the marine sponge Plakortis simplex: a new group of mono-modular type I polyketide synthases from sponge symbionts

    PubMed Central

    Della Sala, Gerardo; Hochmuth, Thomas; Costantino, Valeria; Teta, Roberta; Gerwick, William; Gerwick, Lena; Piel, Jörn; Mangoni, Alfonso

    2013-01-01

    Summary Sponge symbionts are a largely unexplored source of new and unusual metabolic pathways. Insights into the distribution and function of metabolic genes of sponge symbionts are crucial to dissect and exploit their biotechnological potential. Screening of the metagenome of the marine sponge Plakortis simplex led to the discovery of the swf family, a new group of mono-modular type I polyketide synthase/fatty acid synthase (PKS/FAS) specifically associated with sponge symbionts. Two different examples of the swf cluster were present in the metagenome of P. simplex. A third example of the cluster is present in the previously sequenced genome of a poribacterium from the sponge Aplysina aerophoba but was formerly considered orthologous to the wcb/rkp cluster. The swf cluster was also found in six additional species of sponges. Therefore, the swf cluster represents the second group of mono-modular PKS, after the supA family, to be widespread in marine sponges. The putative swf operon consists of swfA (type I PKS/FAS), swfB (reductase and sulphotransferase domains) and swfC (radical S-adenosylmethionine, or radical SAM). Activation of the acyl carrier protein (ACP) domain of the SwfA protein to its holo-form by co-expression with Svp is the first functional proof of swf type genes in marine sponges. However, the precise biosynthetic role of the swf clusters remains unknown. PMID:24249289

  14. Directed tagging of the Arabidopsis FATTY ACID ELONGATION1 (FAE1) gene with the maize transposon activator.

    PubMed Central

    James, D W; Lim, E; Keller, J; Plooy, I; Ralston, E; Dooner, H K

    1995-01-01

    The FATTY ACID ELONGATION1 (FAE1) gene of Arabidopsis is required for the synthesis of very long chain fatty acids in the seed. The product of the FAE1 gene is presumed to be a condensing enzyme that extends the chain length of fatty acids from C18 to C20 and C22. We report here the cloning of FAE1 by directed transposon tagging with the maize element Activator (Ac). An unstable fae1 mutant was isolated in a line carrying Ac linked to the FAE1 locus on chromosome 4. Cosegregation and reversion analyses established that the new mutant was tagged by Ac. A DNA fragment flanking Ac was cloned by inverse polymerase chain reaction and used to isolate FAE1 genomic clones and a cDNA clone from a library made from immature siliques. The predicted amino acid sequence of the FAE1 protein shares homology with those of other condensing enzymes (chalcone synthase, stilbene synthases, and beta-ketoacyl-acyl carrier protein synthase III), supporting the notion that FAE1 is the structural gene for a synthase or condensing enzyme. FAE1 is expressed in developing seed, but not in leaves, as expected from the effect of the fae1 mutation on the fatty acid compositions of those tissues. PMID:7734965

  15. Endothelial nitric oxide synthase: From biochemistry and gene structure to clinical implications of NOS3 polymorphisms.

    PubMed

    Oliveira-Paula, Gustavo H; Lacchini, Riccardo; Tanus-Santos, Jose E

    2016-01-10

    Nitric oxide (NO) is an important vasodilator with a well-established role in cardiovascular homeostasis. While mediator is synthesized from L-arginine by neuronal, endothelial, and inducible nitric oxide synthases (NOS1,NOS3 and NOS2 respectively), NOS3 is the most important isoform for NO formation in the cardiovascular system. NOS3 is a dimeric enzyme whose expression and activity are regulated at transcriptional, posttranscriptional,and posttranslational levels. The NOS3 gene, which encodes NOS3, exhibits a number of polymorphic sites including single nucleotide polymorphisms (SNPs), variable number of tandem repeats (VNTRs), microsatellites, and insertions/deletions. Some NOS3 polymorphisms show functional effects on NOS3 expression or activity, thereby affecting NO formation. Interestingly, many studies have evaluated the effects of functional NOS3 polymorphisms on disease susceptibility and drug responses. Moreover, some studies have investigated how NOS3 haplotypes may impact endogenous NO formation and disease susceptibility. In this article,we carried out a comprehensive review to provide a basic understanding of biochemical mechanisms involved in NOS3 regulation and how genetic variations in NOS3 may translate into relevant clinical and pharmacogenetic implications. PMID:26428312

  16. Endothelial nitric oxide synthase: From biochemistry and gene structure to clinical implications of NOS3 polymorphisms.

    PubMed

    Oliveira-Paula, Gustavo H; Lacchini, Riccardo; Tanus-Santos, Jose E

    2016-01-10

    Nitric oxide (NO) is an important vasodilator with a well-established role in cardiovascular homeostasis. While mediator is synthesized from L-arginine by neuronal, endothelial, and inducible nitric oxide synthases (NOS1,NOS3 and NOS2 respectively), NOS3 is the most important isoform for NO formation in the cardiovascular system. NOS3 is a dimeric enzyme whose expression and activity are regulated at transcriptional, posttranscriptional,and posttranslational levels. The NOS3 gene, which encodes NOS3, exhibits a number of polymorphic sites including single nucleotide polymorphisms (SNPs), variable number of tandem repeats (VNTRs), microsatellites, and insertions/deletions. Some NOS3 polymorphisms show functional effects on NOS3 expression or activity, thereby affecting NO formation. Interestingly, many studies have evaluated the effects of functional NOS3 polymorphisms on disease susceptibility and drug responses. Moreover, some studies have investigated how NOS3 haplotypes may impact endogenous NO formation and disease susceptibility. In this article,we carried out a comprehensive review to provide a basic understanding of biochemical mechanisms involved in NOS3 regulation and how genetic variations in NOS3 may translate into relevant clinical and pharmacogenetic implications.

  17. An update to polyketide synthase and non-ribosomal synthetase genes and nomenclature in Fusarium.

    PubMed

    Hansen, Frederik T; Gardiner, Donald M; Lysøe, Erik; Fuertes, Patricia Romans; Tudzynski, Bettina; Wiemann, Philipp; Sondergaard, Teis Esben; Giese, Henriette; Brodersen, Ditlev E; Sørensen, Jens Laurids

    2015-02-01

    Members of the genus Fusarium produce a plethora of bioactive secondary metabolites, which can be harmful to humans and animals or have potential in drug development. In this study we have performed comparative analyses of polyketide synthases (PKSs) and non-ribosomal peptide synthetases (NRPSs) from ten different Fusarium species including F. graminearum (two strains), F. verticillioides, F. solani, F. culmorum, F. pseudograminearum, F. fujikuroi, F. acuminatum, F. avenaceum, F. equiseti, and F. oxysporum (12 strains). This led to identification of 52 NRPS and 52 PKSs orthology groups, respectively, and although not all PKSs and NRPSs are assumed to be intact or functional, the analyses illustrate the huge secondary metabolite potential in Fusarium. In our analyses we identified a core collection of eight NRPSs (NRPS2-4, 6, 10-13) and two PKSs (PKS3 and PKS7) that are conserved in all strains analyzed in this study. The identified PKSs and NRPSs were named based on a previously developed classification system (www.FusariumNRPSPKS.dk). We suggest this system be used when PKSs and NRPSs have to be classified in future sequenced Fusarium strains. This system will facilitate identification of orthologous and non-orthologous NRPSs and PKSs from newly sequenced Fusarium genomes and will aid the scientific community by providing a common nomenclature for these two groups of genes/enzymes.

  18. Epidemiology and clinical relevance of Pneumocystis jirovecii Frenkel, 1976 dihydropteroate synthase gene mutations.

    PubMed

    Matos, O; Esteves, F

    2010-09-01

    A review was conducted to examine the published works that studied the prevalence of Pneumocystis jirovecii dihydropteroate synthase (DHPS) mutations in patients with P. jirovecii pneumonia (PcP), in develop and developing countries, and that focused the problem of the possible association of these mutations with exposure to sulpha or sulphone drugs and their influence in the PcP outcome. Studies conducted in United States of America presented higher P. jirovecii mutations rates, in comparison with European countries, and in developing countries, lower rates of DHPS mutations were reported, due to limited use of sulpha drugs. A significant association was reported between the use of sulpha or sulphone agents for PcP prophylaxis in HIV-infected patients and the presence of DHPS mutations. However these mutations were also detected in PcP patients who were not currently receiving sulpha or sulphone agents. The outcome and mortality of HIV-infected patients with PcP harbouring DHPS gene mutations were related primarily to the underlying severity of illness and the initial severity of PcP, more than to the presence of mutations.

  19. Genes encoding chavicol/eugenol synthase from the creosote bush Larrea tridentata

    SciTech Connect

    Lewis, Norman G.; Davin, Laurence B.; Kim, Sung -Jin; Vassao, Daniel Giddings; Patten, Ann M.; Eichinger, Dietmar

    2015-09-15

    Particular aspects provide novel methods for redirecting carbon allocation in plants or cell culture from lignification to inherently more useful and tractable materials, and to facilitate the generation of, e.g., biofuels from the remaining plant ro culture biomass. Particular aspects provided novel methods for converting monolignols into allyl/propenyl phenols, and for chavicol/eugenol formation or production. Additional aspects relate to the discovery of novel chavicol/eugenol synthases that convert p-coumaryl/coniferyl alcohol esters into chavicol/eugenol, and to novel compositions (e.g., novel proteins and nucleic acids encoding same), and novel methods using same for producing or forming chavicol/eugenol and other derivatives in cell culture and/or genetically modified plants, and for re-engineering the composition of plant biomass. Particular aspects provide novel methods for generation in culture or in planta of liquid/combustible allyl/propenyl phenols, and these phenolic products are utilized for (non-ethanol) biofuel/bioenergy purposes, while the remaining plant biomass facilitates the generation of other biofuels.

  20. Modulation of medium-chain fatty acid synthesis in Synechococcus sp. PCC 7002 by replacing FabH with a Chaetoceros Ketoacyl-ACP synthase

    DOE PAGES

    Gu, Huiya; Jinkerson, Robert E.; Davies, Fiona K.; Sisson, Lyle A.; Schneider, Philip E.; Posewitz, Matthew C.

    2016-05-26

    The isolation or engineering of algal cells synthesizing high levels of medium-chain fatty acids (MCFAs) is attractive to mitigate the high clouding point of longer chain fatty acids in algal based biodiesel. To develop a more informed understanding of MCFA synthesis in photosynthetic microorganisms, we isolated several algae from Great Salt Lake and screened this collection for MCFA accumulation to identify strains naturally accumulating high levels of MCFA. A diatom, Chaetoceros sp. GSL56, accumulated particularly high levels of C14 (up to 40%), with the majority of C14 fatty acids allocated in triacylglycerols. Using whole cell transcriptome sequencing and de novomore » assembly, putative genes encoding fatty acid synthesis enzymes were identified. Enzymes from this Chaetoceros sp. were expressed in the cyanobacterium Synechococcus sp. PCC 7002 to validate gene function and to determine whether eukaryotic enzymes putatively lacking bacterial evolutionary control mechanisms could be used to improve MCFA production in this promising production strain. Replacement of the Synechococcus 7002 native FabH with a Chaetoceros ketoacyl-ACP synthase Ill increased MCFA synthesis up to fivefold. In conclusion, the level of increase is dependent on promoter strength and culturing conditions.« less

  1. Modulation of Medium-Chain Fatty Acid Synthesis in Synechococcus sp. PCC 7002 by Replacing FabH with a Chaetoceros Ketoacyl-ACP Synthase

    PubMed Central

    Gu, Huiya; Jinkerson, Robert E.; Davies, Fiona K.; Sisson, Lyle A.; Schneider, Philip E.; Posewitz, Matthew C.

    2016-01-01

    The isolation or engineering of algal cells synthesizing high levels of medium-chain fatty acids (MCFAs) is attractive to mitigate the high clouding point of longer chain fatty acids in algal based biodiesel. To develop a more informed understanding of MCFA synthesis in photosynthetic microorganisms, we isolated several algae from Great Salt Lake and screened this collection for MCFA accumulation to identify strains naturally accumulating high levels of MCFA. A diatom, Chaetoceros sp. GSL56, accumulated particularly high levels of C14 (up to 40%), with the majority of C14 fatty acids allocated in triacylglycerols. Using whole cell transcriptome sequencing and de novo assembly, putative genes encoding fatty acid synthesis enzymes were identified. Enzymes from this Chaetoceros sp. were expressed in the cyanobacterium Synechococcus sp. PCC 7002 to validate gene function and to determine whether eukaryotic enzymes putatively lacking bacterial evolutionary control mechanisms could be used to improve MCFA production in this promising production strain. Replacement of the Synechococcus 7002 native FabH with a Chaetoceros ketoacyl-ACP synthase III increased MCFA synthesis up to fivefold. The level of increase is dependent on promoter strength and culturing conditions. PMID:27303412

  2. Modulation of Medium-Chain Fatty Acid Synthesis in Synechococcus sp. PCC 7002 by Replacing FabH with a Chaetoceros Ketoacyl-ACP Synthase.

    PubMed

    Gu, Huiya; Jinkerson, Robert E; Davies, Fiona K; Sisson, Lyle A; Schneider, Philip E; Posewitz, Matthew C

    2016-01-01

    The isolation or engineering of algal cells synthesizing high levels of medium-chain fatty acids (MCFAs) is attractive to mitigate the high clouding point of longer chain fatty acids in algal based biodiesel. To develop a more informed understanding of MCFA synthesis in photosynthetic microorganisms, we isolated several algae from Great Salt Lake and screened this collection for MCFA accumulation to identify strains naturally accumulating high levels of MCFA. A diatom, Chaetoceros sp. GSL56, accumulated particularly high levels of C14 (up to 40%), with the majority of C14 fatty acids allocated in triacylglycerols. Using whole cell transcriptome sequencing and de novo assembly, putative genes encoding fatty acid synthesis enzymes were identified. Enzymes from this Chaetoceros sp. were expressed in the cyanobacterium Synechococcus sp. PCC 7002 to validate gene function and to determine whether eukaryotic enzymes putatively lacking bacterial evolutionary control mechanisms could be used to improve MCFA production in this promising production strain. Replacement of the Synechococcus 7002 native FabH with a Chaetoceros ketoacyl-ACP synthase III increased MCFA synthesis up to fivefold. The level of increase is dependent on promoter strength and culturing conditions. PMID:27303412

  3. Rapid screening of an ordered fosmid library to clone multiple polyketide synthase genes of the phytopathogenic fungus Cladosporium phlei.

    PubMed

    So, Kum-Kang; Kim, Jung-Mi; Nguyen, Ngoc-Luong; Park, Jin-Ah; Kim, Beom-Tae; Park, Seung-Moon; Hwang, Ki-Jun; Kim, Dae-Hyuk

    2012-12-01

    In previous studies, the biological characteristics of the fungus Cladosporium phlei and its genetic manipulation by transformation were assessed to improve production of the fungal pigment, phleichrome, which is a fungal perylenequinone that plays an important role in the production of a photodynamic therapeutic agent. However, the low production of this metabolite by the wild-type strain has limited its application. Thus, we attempted to clone and characterize the genes that encode polyketide synthases (PKS), which are responsible for the synthesis of fungal pigments such as perylenequinones including phleichrome, elsinochrome and cercosporin. Thus, we performed genomic DNA PCR using 11 different combinations of degenerate primers targeting conserved domains including β-ketoacyl synthase and acyltransferase domains. Sequence comparison of the PCR amplicons revealed a high homology to known PKSs, and four different PKS genes showing a high similarity to three representative types of PKS genes were amplified. To obtain full-length PKS genes, an ordered gene library of a phleichrome-producing C. phlei strain (ATCC 36193) was constructed in a fosmid vector and 4800 clones were analyzed using a simple pyramidal arrangement system. This hierarchical clustering method combines the efficiency of PCR with enhanced specificity. Among the three representative types of PKSs, two reducing, one partially reducing, and one non-reducing PKS were identified. These genes were subsequently cloned, sequenced, and characterized. Biological characterization of these genes to determine their roles in phleichrome production is underway, with the ultimate aim of engineering this pathway to overproduce the desired substance.

  4. Evolution of conifer diterpene synthases: diterpene resin acid biosynthesis in lodgepole pine and jack pine involves monofunctional and bifunctional diterpene synthases.

    PubMed

    Hall, Dawn E; Zerbe, Philipp; Jancsik, Sharon; Quesada, Alfonso Lara; Dullat, Harpreet; Madilao, Lina L; Yuen, Macaire; Bohlmann, Jörg

    2013-02-01

    Diterpene resin acids (DRAs) are major components of pine (Pinus spp.) oleoresin. They play critical roles in conifer defense against insects and pathogens and as a renewable resource for industrial bioproducts. The core structures of DRAs are formed in secondary (i.e. specialized) metabolism via cycloisomerization of geranylgeranyl diphosphate (GGPP) by diterpene synthases (diTPSs). Previously described gymnosperm diTPSs of DRA biosynthesis are bifunctional enzymes that catalyze the initial bicyclization of GGPP followed by rearrangement of a (+)-copalyl diphosphate intermediate at two discrete class II and class I active sites. In contrast, similar diterpenes of gibberellin primary (i.e. general) metabolism are produced by the consecutive activity of two monofunctional class II and class I diTPSs. Using high-throughput transcriptome sequencing, we discovered 11 diTPS from jack pine (Pinus banksiana) and lodgepole pine (Pinus contorta). Three of these were orthologous to known conifer bifunctional levopimaradiene/abietadiene synthases. Surprisingly, two sets of orthologous PbdiTPSs and PcdiTPSs were monofunctional class I enzymes that lacked functional class II active sites and converted (+)-copalyl diphosphate, but not GGPP, into isopimaradiene and pimaradiene as major products. Diterpene profiles and transcriptome sequences of lodgepole pine and jack pine are consistent with roles for these diTPSs in DRA biosynthesis. The monofunctional class I diTPSs of DRA biosynthesis form a new clade within the gymnosperm-specific TPS-d3 subfamily that evolved from bifunctional diTPS rather than monofunctional enzymes (TPS-c and TPS-e) of gibberellin metabolism. Homology modeling suggested alterations in the class I active site that may have contributed to their functional specialization relative to other conifer diTPSs. PMID:23370714

  5. Evolution of Conifer Diterpene Synthases: Diterpene Resin Acid Biosynthesis in Lodgepole Pine and Jack Pine Involves Monofunctional and Bifunctional Diterpene Synthases1[W][OA

    PubMed Central

    Hall, Dawn E.; Zerbe, Philipp; Jancsik, Sharon; Quesada, Alfonso Lara; Dullat, Harpreet; Madilao, Lina L.; Yuen, Macaire; Bohlmann, Jörg

    2013-01-01

    Diterpene resin acids (DRAs) are major components of pine (Pinus spp.) oleoresin. They play critical roles in conifer defense against insects and pathogens and as a renewable resource for industrial bioproducts. The core structures of DRAs are formed in secondary (i.e. specialized) metabolism via cycloisomerization of geranylgeranyl diphosphate (GGPP) by diterpene synthases (diTPSs). Previously described gymnosperm diTPSs of DRA biosynthesis are bifunctional enzymes that catalyze the initial bicyclization of GGPP followed by rearrangement of a (+)-copalyl diphosphate intermediate at two discrete class II and class I active sites. In contrast, similar diterpenes of gibberellin primary (i.e. general) metabolism are produced by the consecutive activity of two monofunctional class II and class I diTPSs. Using high-throughput transcriptome sequencing, we discovered 11 diTPS from jack pine (Pinus banksiana) and lodgepole pine (Pinus contorta). Three of these were orthologous to known conifer bifunctional levopimaradiene/abietadiene synthases. Surprisingly, two sets of orthologous PbdiTPSs and PcdiTPSs were monofunctional class I enzymes that lacked functional class II active sites and converted (+)-copalyl diphosphate, but not GGPP, into isopimaradiene and pimaradiene as major products. Diterpene profiles and transcriptome sequences of lodgepole pine and jack pine are consistent with roles for these diTPSs in DRA biosynthesis. The monofunctional class I diTPSs of DRA biosynthesis form a new clade within the gymnosperm-specific TPS-d3 subfamily that evolved from bifunctional diTPS rather than monofunctional enzymes (TPS-c and TPS-e) of gibberellin metabolism. Homology modeling suggested alterations in the class I active site that may have contributed to their functional specialization relative to other conifer diTPSs. PMID:23370714

  6. Identification of amino acid networks governing catalysis in the closed complex of class I terpene synthases

    PubMed Central

    Buettner, Alexander; Goerner, Christian; Hertel, Michael; van Rijn, Jeaphianne; Wallrapp, Frank; Eisenreich, Wolfgang; Sieber, Volker; Kourist, Robert; Brück, Thomas

    2016-01-01

    Class I terpene synthases generate the structural core of bioactive terpenoids. Deciphering structure–function relationships in the reactive closed complex and targeted engineering is hampered by highly dynamic carbocation rearrangements during catalysis. Available crystal structures, however, represent the open, catalytically inactive form or harbor nonproductive substrate analogs. Here, we present a catalytically relevant, closed conformation of taxadiene synthase (TXS), the model class I terpene synthase, which simulates the initial catalytic time point. In silico modeling of subsequent catalytic steps allowed unprecedented insights into the dynamic reaction cascades and promiscuity mechanisms of class I terpene synthases. This generally applicable methodology enables the active-site localization of carbocations and demonstrates the presence of an active-site base motif and its dominating role during catalysis. It additionally allowed in silico-designed targeted protein engineering that unlocked the path to alternate monocyclic and bicyclic synthons representing the basis of a myriad of bioactive terpenoids. PMID:26842837

  7. Head-to-head coiled arrangement of the subunits of the animal fatty acid synthase.

    PubMed

    Witkowski, Andrzej; Ghosal, Alokesh; Joshi, Anil K; Witkowska, H Ewa; Asturias, Francisco J; Smith, Stuart

    2004-12-01

    The role of the beta-ketoacyl synthase domains in dimerization of the 2505 residue subunits of the multifunctional animal FAS has been evaluated by a combination of crosslinking and characterization of several truncated forms of the protein. Polypeptides containing only the N-terminal 971 residues can form dimers, but polypeptides lacking only the N-terminal 422 residue beta-ketoacyl synthase domain cannot. FAS subunits can be crosslinked with spacer lengths as short as 6 A, via cysteine residues engineered near the N terminus of the full-length polypeptides. The proximity of the N-terminal beta-ketoacyl synthase domains and their essential role in dimerization is consistent with a revised model for the FAS in which a head-to-head arrangement of two coiled subunits facilitates functional interactions between the dimeric beta-ketoacyl synthase and the acyl carrier protein domains of either subunit.

  8. Identification of amino acid networks governing catalysis in the closed complex of class I terpene synthases.

    PubMed

    Schrepfer, Patrick; Buettner, Alexander; Goerner, Christian; Hertel, Michael; van Rijn, Jeaphianne; Wallrapp, Frank; Eisenreich, Wolfgang; Sieber, Volker; Kourist, Robert; Brück, Thomas

    2016-02-23

    Class I terpene synthases generate the structural core of bioactive terpenoids. Deciphering structure-function relationships in the reactive closed complex and targeted engineering is hampered by highly dynamic carbocation rearrangements during catalysis. Available crystal structures, however, represent the open, catalytically inactive form or harbor nonproductive substrate analogs. Here, we present a catalytically relevant, closed conformation of taxadiene synthase (TXS), the model class I terpene synthase, which simulates the initial catalytic time point. In silico modeling of subsequent catalytic steps allowed unprecedented insights into the dynamic reaction cascades and promiscuity mechanisms of class I terpene synthases. This generally applicable methodology enables the active-site localization of carbocations and demonstrates the presence of an active-site base motif and its dominating role during catalysis. It additionally allowed in silico-designed targeted protein engineering that unlocked the path to alternate monocyclic and bicyclic synthons representing the basis of a myriad of bioactive terpenoids.

  9. Functional Analysis of the Phycomyces carRA Gene Encoding the Enzymes Phytoene Synthase and Lycopene Cyclase

    PubMed Central

    Sanz, Catalina; Velayos, Antonio; Álvarez, María Isabel; Benito, Ernesto P.; Eslava, Arturo P.

    2011-01-01

    Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism. PMID:21858003

  10. A Malus crabapple chalcone synthase gene, McCHS, regulates red petal color and flavonoid biosynthesis.

    PubMed

    Tai, Deqiang; Tian, Ji; Zhang, Jie; Song, Tingting; Yao, Yuncong

    2014-01-01

    Chalcone synthase is a key and often rate-limiting enzyme in the biosynthesis of anthocyanin pigments that accumulate in plant organs such as flowers and fruits, but the relationship between CHS expression and the petal coloration level in different cultivars is still unclear. In this study, three typical crabapple cultivars were chosen based on different petal colors and coloration patterns. The two extreme color cultivars, 'Royalty' and 'Flame', have dark red and white petals respectively, while the intermediate cultivar 'Radiant' has pink petals. We detected the flavoniods accumulation and the expression levels of McCHS during petals expansion process in different cultivars. The results showed McCHS have their special expression patterns in each tested cultivars, and is responsible for the red coloration and color variation in crabapple petals, especially for color fade process in 'Radiant'. Furthermore, tobacco plants constitutively expressing McCHS displayed a higher anthocyanins accumulation and a deeper red petal color compared with control untransformed lines. Moreover, the expression levels of several anthocyanin biosynthetic genes were higher in the transgenic McCHS overexpressing tobacco lines than in the control plants. A close relationship was observed between the expression of McCHS and the transcription factors McMYB4 and McMYB5 during petals development in different crabapple cultivars, suggesting that the expression of McCHS was regulated by these transcription factors. We conclude that the endogenous McCHS gene is a critical factor in the regulation of anthocyanin biosynthesis during petal coloration in Malus crabapple. PMID:25357207

  11. A Malus Crabapple Chalcone Synthase Gene, McCHS, Regulates Red Petal Color and Flavonoid Biosynthesis

    PubMed Central

    Song, Tingting; Yao, Yuncong

    2014-01-01

    Chalcone synthase is a key and often rate-limiting enzyme in the biosynthesis of anthocyanin pigments that accumulate in plant organs such as flowers and fruits, but the relationship between CHS expression and the petal coloration level in different cultivars is still unclear. In this study, three typical crabapple cultivars were chosen based on different petal colors and coloration patterns. The two extreme color cultivars, ‘Royalty’ and ‘Flame’, have dark red and white petals respectively, while the intermediate cultivar ‘Radiant’ has pink petals. We detected the flavoniods accumulation and the expression levels of McCHS during petals expansion process in different cultivars. The results showed McCHS have their special expression patterns in each tested cultivars, and is responsible for the red coloration and color variation in crabapple petals, especially for color fade process in ‘Radiant’. Furthermore, tobacco plants constitutively expressing McCHS displayed a higher anthocyanins accumulation and a deeper red petal color compared with control untransformed lines. Moreover, the expression levels of several anthocyanin biosynthetic genes were higher in the transgenic McCHS overexpressing tobacco lines than in the control plants. A close relationship was observed between the expression of McCHS and the transcription factors McMYB4 and McMYB5 during petals development in different crabapple cultivars, suggesting that the expression of McCHS was regulated by these transcription factors. We conclude that the endogenous McCHS gene is a critical factor in the regulation of anthocyanin biosynthesis during petal coloration in Malus crabapple. PMID:25357207

  12. The effects of putative lipase and wax ester synthase/acyl-CoA:diacylglycerol acyltransferase gene knockouts on triacylglycerol accumulation in Gordonia sp. KTR9.

    PubMed

    Indest, Karl J; Eberly, Jed O; Ringelberg, David B; Hancock, Dawn E

    2015-02-01

    Previously, we demonstrated triacylglycerol (TAG) accumulation and the in vivo ability to catalyze esters from exogenous short chain alcohol sources in Gordonia sp. strain KTR9. In this study, we investigated the effects that putative lipase (KTR9_0186) and wax ester synthase/acyl-CoA:diacylglycerol acyltransferase (WS/DGAT; KTR9_3844) gene knockouts had on TAG accumulation. Gene disruption of KTR9_0186 resulted in a twofold increase in TAG content in nitrogen starved cells. Lipase mutants subjected to carbon starvation, following nitrogen starvation, retained 75 % more TAGs and retained pigmentation. Transcriptome expression data confirmed the deletion of KTR9_0186 and identified the up-regulation of key genes involved in fatty acid degradation, a likely compensatory mechanism for reduced TAG mobilization. In vitro assays with purified KTR9_3844 demonstrated WS/DGAT activity with short chain alcohols and C16 and C18 fatty acid Co-As. Collectively, these results indicate that Gordonia sp. KTR9 has a suitable tractable genetic background for TAG production as well as the enzymatic capacity to catalyze fatty acid esters from short chain alcohols.

  13. Cytochrome P450-dependent metabolism of oxylipins in tomato. Cloning and expression of allene oxide synthase and fatty acid hydroperoxide lyase.

    PubMed

    Howe, G A; Lee, G I; Itoh, A; Li, L; DeRocher, A E

    2000-06-01

    Allene oxide synthase (AOS) and fatty acid hydroperoxide lyase (HPL) are plant-specific cytochrome P450s that commit fatty acid hydroperoxides to different branches of oxylipin metabolism. Here we report the cloning and characterization of AOS (LeAOS) and HPL (LeHPL) cDNAs from tomato (Lycopersicon esculentum). Functional expression of the cDNAs in Escherichia coli showed that LeAOS and LeHPL encode enzymes that metabolize 13- but not 9-hydroperoxide derivatives of C(18) fatty acids. LeAOS was active against both 13S-hydroperoxy-9(Z),11(E),15(Z)-octadecatrienoic acid (13-HPOT) and 13S-hydroperoxy-9(Z),11(E)-octadecadienoic acid, whereas LeHPL showed a strong preference for 13-HPOT. These results suggest a role for LeAOS and LeHPL in the metabolism of 13-HPOT to jasmonic acid and hexenal/traumatin, respectively. LeAOS expression was detected in all organs of the plant. In contrast, LeHPL expression was predominant in leaves and flowers. Damage inflicted to leaves by chewing insect larvae led to an increase in the local and systemic expression of both genes, with LeAOS showing the strongest induction. Wound-induced expression of LeAOS also occurred in the def-1 mutant that is deficient in octadecanoid-based signaling of defensive proteinase inhibitor genes. These results demonstrate that tomato uses genetically distinct signaling pathways for the regulation of different classes of wound responsive genes.

  14. Circular RNA of the human sphingomyelin synthase 1 gene: Multiple splice variants, evolutionary conservatism and expression in different tissues

    PubMed Central

    Filippenkov, Ivan B; Sudarkina, Olga Yu; Limborska, Svetlana A; Dergunova, Lyudmila V

    2015-01-01

    The human sphingomyelin synthase 1 gene (SGMS1) encodes an essential enzyme that is involved in the synthesis of sphingomyelin and diacylglycerol from phosphatidylcholine and ceramide. Among the products of SGMS1, we found new transcripts, circular RNAs (circRNAs), that contain sequences of the gene's 5′ untranslated region (5′UTR). Some of them include the gene's coding region and fragments of introns. An analysis of the abundance of circRNAs in human tissues showed that the largest transcripts were predominantly found in different parts of the brain. circRNAs of rat and mouse sphingomyelin synthase 1 orthologous genes were detected and are highly similar to the human SGMS1 gene transcripts. A quantitative analysis of the abundance of such transcripts also revealed their elevated amount in the brain. A computational analysis of sequences of human circRNAs showed their high potential of binding microRNAs (miRNAs), including the miRNAs that form complexes with Ago proteins and the mRNA of SGMS1. We assume that the circRNAs identified here participate in the regulation of the function of the SGMS1 gene in the brain. PMID:26274505

  15. Sucrose Phosphate Synthase and Acid Invertase as Determinants of Sucrose Concentration in Developing Muskmelon (Cucumis melo L.) Fruits 1

    PubMed Central

    Hubbard, Natalie L.; Huber, Steven C.; Pharr, D. Mason

    1989-01-01

    Fruits of orange-fleshed and green-fleshed muskmelon (Cucumis melo L.) were harvested at different times throughout development to evaluate changes in metabolism which lead to sucrose accumulation, and to determine the basis of differences in fruit sucrose accumulation among genotypes. Concentrations of sucrose, raffinose saccharides, hexoses and starch, as well as activities of the sucrose metabolizing enzymes sucrose phosphate synthase (SPS) (EC 2.4.1.14), sucrose synthase (EC 2.4.1.13), and acid and neutral invertases (EC 3.2.1.26) were measured. Sucrose synthase and neutral invertase activities were relatively low (1.7 ± 0.3 micromole per hour per gram fresh weight and 2.2 ± 0.2, respectively) and changed little throughout fruit development. Acid invertase activity decreased during fruit development, (from as high as 40 micromoles per hour per gram fresh weight) in unripe fruit, to undetectable activity in mature, ripened fruits, while SPS activity in the fruit increased (from 7 micromoles per hour per gram fresh weight) to as high as 32 micromoles per hour per gram fresh weight. Genotypes which accumulated different amounts of sucrose had similar acid invertase activity but differed in SPS activity. Our results indicate that both acid invertase and SPS are determinants of sucrose accumulation in melon fruit. However, the decline in acid invertase appears to be a normal function of fruit maturation, and is not the primary factor which determines sucrose accumulation. Rather, the capacity for sucrose synthesis, reflected in the activity of SPS, appears to determine sucrose accumulation, which is an important component of fruit quality. PMID:16667212

  16. Proteomic Upregulation of Fatty Acid Synthase and Fatty Acid Binding Protein 5 and Identification of Cancer- and Race-Specific Pathway Associations in Human Prostate Cancer Tissues

    PubMed Central

    Myers, Jennifer S.; von Lersner, Ariana K.; Sang, Qing-Xiang Amy

    2016-01-01

    Protein profiling studies of prostate cancer have been widely used to characterize molecular differences between diseased and non-diseased tissues. When combined with pathway analysis, profiling approaches are able to identify molecular mechanisms of prostate cancer, group patients by cancer subtype, and predict prognosis. This strategy can also be implemented to study prostate cancer in very specific populations, such as African Americans who have higher rates of prostate cancer incidence and mortality than other racial groups in the United States. In this study, age-, stage-, and Gleason score-matched prostate tumor specimen from African American and Caucasian American men, along with non-malignant adjacent prostate tissue from these same patients, were compared. Protein expression changes and altered pathway associations were identified in prostate cancer generally and in African American prostate cancer specifically. In comparing tumor to non-malignant samples, 45 proteins were significantly cancer-associated and 3 proteins were significantly downregulated in tumor samples. Notably, fatty acid synthase (FASN) and epidermal fatty acid-binding protein (FABP5) were upregulated in human prostate cancer tissues, consistent with their known functions in prostate cancer progression. Aldehyde dehydrogenase family 1 member A3 (ALDH1A3) was also upregulated in tumor samples. The Metastasis Associated Protein 3 (MTA3) pathway was significantly enriched in tumor samples compared to non-malignant samples. While the current experiment was unable to detect statistically significant differences in protein expression between African American and Caucasian American samples, differences in overrepresentation and pathway enrichment were found. Structural components (Cytoskeletal Proteins and Extracellular Matrix Protein protein classes, and Biological Adhesion Gene Ontology (GO) annotation) were overrepresented in African American but not Caucasian American tumors. Additionally, 5

  17. Proteomic Upregulation of Fatty Acid Synthase and Fatty Acid Binding Protein 5 and Identification of Cancer- and Race-Specific Pathway Associations in Human Prostate Cancer Tissues.

    PubMed

    Myers, Jennifer S; von Lersner, Ariana K; Sang, Qing-Xiang Amy

    2016-01-01

    Protein profiling studies of prostate cancer have been widely used to characterize molecular differences between diseased and non-diseased tissues. When combined with pathway analysis, profiling approaches are able to identify molecular mechanisms of prostate cancer, group patients by cancer subtype, and predict prognosis. This strategy can also be implemented to study prostate cancer in very specific populations, such as African Americans who have higher rates of prostate cancer incidence and mortality than other racial groups in the United States. In this study, age-, stage-, and Gleason score-matched prostate tumor specimen from African American and Caucasian American men, along with non-malignant adjacent prostate tissue from these same patients, were compared. Protein expression changes and altered pathway associations were identified in prostate cancer generally and in African American prostate cancer specifically. In comparing tumor to non-malignant samples, 45 proteins were significantly cancer-associated and 3 proteins were significantly downregulated in tumor samples. Notably, fatty acid synthase (FASN) and epidermal fatty acid-binding protein (FABP5) were upregulated in human prostate cancer tissues, consistent with their known functions in prostate cancer progression. Aldehyde dehydrogenase family 1 member A3 (ALDH1A3) was also upregulated in tumor samples. The Metastasis Associated Protein 3 (MTA3) pathway was significantly enriched in tumor samples compared to non-malignant samples. While the current experiment was unable to detect statistically significant differences in protein expression between African American and Caucasian American samples, differences in overrepresentation and pathway enrichment were found. Structural components (Cytoskeletal Proteins and Extracellular Matrix Protein protein classes, and Biological Adhesion Gene Ontology (GO) annotation) were overrepresented in African American but not Caucasian American tumors. Additionally, 5

  18. Proteomic Upregulation of Fatty Acid Synthase and Fatty Acid Binding Protein 5 and Identification of Cancer- and Race-Specific Pathway Associations in Human Prostate Cancer Tissues.

    PubMed

    Myers, Jennifer S; von Lersner, Ariana K; Sang, Qing-Xiang Amy

    2016-01-01

    Protein profiling studies of prostate cancer have been widely used to characterize molecular differences between diseased and non-diseased tissues. When combined with pathway analysis, profiling approaches are able to identify molecular mechanisms of prostate cancer, group patients by cancer subtype, and predict prognosis. This strategy can also be implemented to study prostate cancer in very specific populations, such as African Americans who have higher rates of prostate cancer incidence and mortality than other racial groups in the United States. In this study, age-, stage-, and Gleason score-matched prostate tumor specimen from African American and Caucasian American men, along with non-malignant adjacent prostate tissue from these same patients, were compared. Protein expression changes and altered pathway associations were identified in prostate cancer generally and in African American prostate cancer specifically. In comparing tumor to non-malignant samples, 45 proteins were significantly cancer-associated and 3 proteins were significantly downregulated in tumor samples. Notably, fatty acid synthase (FASN) and epidermal fatty acid-binding protein (FABP5) were upregulated in human prostate cancer tissues, consistent with their known functions in prostate cancer progression. Aldehyde dehydrogenase family 1 member A3 (ALDH1A3) was also upregulated in tumor samples. The Metastasis Associated Protein 3 (MTA3) pathway was significantly enriched in tumor samples compared to non-malignant samples. While the current experiment was unable to detect statistically significant differences in protein expression between African American and Caucasian American samples, differences in overrepresentation and pathway enrichment were found. Structural components (Cytoskeletal Proteins and Extracellular Matrix Protein protein classes, and Biological Adhesion Gene Ontology (GO) annotation) were overrepresented in African American but not Caucasian American tumors. Additionally, 5

  19. Biosynthesis of riboflavin: an unusual riboflavin synthase of Methanobacterium thermoautotrophicum.

    PubMed Central

    Eberhardt, S; Korn, S; Lottspeich, F; Bacher, A

    1997-01-01

    Riboflavin synthase was purified by a factor of about 1,500 from cell extract of Methanobacterium thermoautotrophicum. The enzyme had a specific activity of about 2,700 nmol mg(-1) h(-1) at 65 degrees C, which is relatively low compared to those of riboflavin synthases of eubacteria and yeast. Amino acid sequences obtained after proteolytic cleavage had no similarity with known riboflavin synthases. The gene coding for riboflavin synthase (designated ribC) was subsequently cloned by marker rescue with a ribC mutant of Escherichia coli. The ribC gene of M. thermoautotrophicum specifies a protein of 153 amino acid residues. The predicted amino acid sequence agrees with the information gleaned from Edman degradation of the isolated protein and shows 67% identity with the sequence predicted for the unannotated reading frame MJ1184 of Methanococcus jannaschii. The ribC gene is adjacent to a cluster of four genes with similarity to the genes cbiMNQO of Salmonella typhimurium, which form part of the cob operon (this operon contains most of the genes involved in the biosynthesis of vitamin B12). The amino acid sequence predicted by the ribC gene of M. thermoautotrophicum shows no similarity whatsoever to the sequences of riboflavin synthases of eubacteria and yeast. Most notably, the M. thermoautotrophicum protein does not show the internal sequence homology characteristic of eubacterial and yeast riboflavin synthases. The protein of M. thermoautotrophicum can be expressed efficiently in a recombinant E. coli strain. The specific activity of the purified, recombinant protein is 1,900 nmol mg(-1) h(-1) at 65 degrees C. In contrast to riboflavin synthases from eubacteria and fungi, the methanobacterial enzyme has an absolute requirement for magnesium ions. The 5' phosphate of 6,7-dimethyl-8-ribityllumazine does not act as a substrate. The findings suggest that riboflavin synthase has evolved independently in eubacteria and methanobacteria. PMID:9139911

  20. Sequence of the bchG gene from Chloroflexus aurantiacus: relationship between chlorophyll synthase and other polyprenyltransferases

    NASA Technical Reports Server (NTRS)

    Lopez, J. C.; Ryan, S.; Blankenship, R. E.

    1996-01-01

    The sequence of the Chloroflexus aurantiacus open reading frame thought to be the C. aurantiacus homolog of the Rhodobacter capsulatus bchG gene is reported. The BchG gene product catalyzes esterification of bacteriochlorophyllide a by geranylgeraniol-PPi during bacteriochlorophyll a biosynthesis. Homologs from Arabidopsis thaliana, Synechocystis sp. strain PCC6803, and C. aurantiacus were identified in database searches. Profile analysis identified three related polyprenyltransferase enzymes which attach an aliphatic alcohol PPi to an aromatic substrate. This suggests a broader relationship between chlorophyll synthases and other polyprenyltransferases.

  1. Absence of mutations associated with sulfa resistance in Pneumocystis carinii dihydropteroate synthase gene from non-human primates.

    PubMed

    Demanche, C; Guillot, J; Berthelemy, M; Petitt, T; Roux, P; Wakefield, A E

    2002-06-01

    The dihydropteroate synthase (DHPS) gene from Pneumocystis carinii isolated from non-human primates was amplified using a polymerase chain reaction (PCR) and sequenced to analyse point mutations associated with sulfa resistance. P. carinii DHPS gene amplification was obtained from eight lung samples from five New World primate species and one Old World primate species. None of the animals had been exposed to sulfa drugs and only the wild-type P. carinii DHPS sequence at codons 55 and 57 was observed. These data support the hypothesis that high rates of DHPS mutants in P. carinii f. sp. hominis have arisen with increased use of sulfa drugs for P. carinii pneumonia prophylaxis.

  2. Sequence of the bchG gene from Chloroflexus aurantiacus: relationship between chlorophyll synthase and other polyprenyltransferases.

    PubMed

    Lopez, J C; Ryan, S; Blankenship, R E

    1996-06-01

    The sequence of the Chloroflexus aurantiacus open reading frame thought to be the C. aurantiacus homolog of the Rhodobacter capsulatus bchG gene is reported. The BchG gene product catalyzes esterification of bacteriochlorophyllide a by geranylgeraniol-PPi during bacteriochlorophyll a biosynthesis. Homologs from Arabidopsis thaliana, Synechocystis sp. strain PCC6803, and C. aurantiacus were identified in database searches. Profile analysis identified three related polyprenyltransferase enzymes which attach an aliphatic alcohol PPi to an aromatic substrate. This suggests a broader relationship between chlorophyll synthases and other polyprenyltransferases.

  3. Seasonal influence on gene expression of monoterpene synthases in Salvia officinalis (Lamiaceae).

    PubMed

    Grausgruber-Gröger, Sabine; Schmiderer, Corinna; Steinborn, Ralf; Novak, Johannes

    2012-03-01

    Garden sage (Salvia officinalis L., Lamiaceae) is one of the most important medicinal and aromatic plants and possesses antioxidant, antimicrobial, spasmolytic, astringent, antihidrotic and specific sensorial properties. The essential oil of the plant, formed mainly in very young leaves, is in part responsible for these activities. It is mainly composed of the monoterpenes 1,8-cineole, α- and β-thujone and camphor synthesized by the 1,8-cineole synthase, the (+)-sabinene synthase and the (+)-bornyl diphosphate synthase, respectively, and is produced and stored in epidermal glands. In this study, the seasonal influence on the formation of the main monoterpenes in young, still expanding leaves of field-grown sage plants was studied in two cultivars at the level of mRNA expression, analyzed by qRT-PCR, and at the level of end-products, analyzed by gas chromatography. All monoterpene synthases and monoterpenes were significantly influenced by cultivar and season. 1,8-Cineole synthase and its end product 1,8-cineole remained constant until August and then decreased slightly. The thujones increased steadily during the vegetative period. The transcript level of their corresponding terpene synthase, however, showed its maximum in the middle of the vegetative period and declined afterwards. Camphor remained constant until August and then declined, exactly correlated with the mRNA level of the corresponding terpene synthase. In summary, terpene synthase mRNA expression and respective end product levels were concordant in the case of 1,8-cineole (r=0.51 and 0.67 for the two cultivars, respectively; p<0.05) and camphor (r=0.75 and 0.82; p<0.05) indicating basically transcriptional control, but discordant for α-/β-thujone (r=-0.05 and 0.42; p=0.87 and 0.13, respectively).

  4. Characterization of GaWRKY1, a cotton transcription factor that regulates the sesquiterpene synthase gene (+)-delta-cadinene synthase-A.

    PubMed

    Xu, Yan-Hua; Wang, Jia-Wei; Wang, Shui; Wang, Jian-Ying; Chen, Xiao-Ya

    2004-05-01

    The cotton (+)-delta-cadinene synthase (CAD1), a sesquiterpene cyclase, catalyzes a branch-point step leading to biosynthesis of sesquiterpene phytoalexins, including gossypol. CAD1-A is a member of CAD1 gene family, and its promoter contains a W-box palindrome with two reversely oriented TGAC repeats, which are the proposed binding sites of WRKY transcription factors. We isolated several WRKY cDNAs from Gossypium arboreum. One of them, GaWRKY1, encodes a protein containing a single WRKY domain and a putative N-terminal Leu zipper. Similar to genes encoding enzymes of cotton sesquiterpene pathway, GaWRKY1 was down-regulated in a glandless cotton cultivar that contained much less gossypol. GaWRKY1 showed a temporal and spatial pattern of expression comparable to that of CAD1-A in various aerial organs examined, including sepal, stigma, anther, and developing seeds. In suspension cells, expression of both GaWRKY1 and CAD1-A genes and biosynthesis of sesquiterpene aldehydes were strongly induced by a fungal elicitor preparation and methyl jasmonate. GaWRKY1 interacted with the 3x W-box derived from CAD1-A promoter in yeast (Saccharomyces cerevisiae) one-hybrid system and in vitro. Furthermore, in transgenic Arabidopsis plants, overexpression of GaWRKY1 highly activated the CAD1-A promoter, and transient assay in tobacco (Nicotiana tabacum) leaves demonstrated that W-box was required for this activation. These results suggest that GaWRKY1 participates in regulation of sesquiterpene biosynthesis in cotton, and CAD1-A is a target gene of this transcription factor. PMID:15133151

  5. Impact of obesity and nitric oxide synthase gene G894T polymorphism on essential hypertension.

    PubMed

    Wrzosek, M; Sokal, M; Sawicka, A; Wlodarczyk, M; Glowala, M; Wrzosek, M; Kosior, M; Talalaj, M; Biecek, P; Nowicka, G

    2015-10-01

    Hypertension is a multifactorial disease caused by environmental, metabolic and genetic factors, but little is currently known on the complex interplay between these factors and blood pressure. The aim of the present study was to assess the potential impact of obesity, and angiotensin-converting enzyme (ACE) I/D polymorphism and endothelial nitric oxide synthase gene (NOS3) 4a/4b, G894T and -T786C variants on the essential hypertension. The study group consisted of 1,027 Caucasian adults of Polish nationality (45.5 ± 13.6 years old), of which 401 met the criteria for hypertension. Body weight, height and blood pressure were measured and data on self-reported smoking status were collected. Fasting blood glucose, total cholesterol, LDL-cholesterol, HDL-cholesterol, triglycerides were determined by standard procedures. The ACE I/D polymorphism and three polymorphisms in NOS3 gene (4a/4b, G894T, -T786C) were detected by the PCR method. Multivariable logistic regression demonstrated that age above 45 years, diabetes, dyslipidemia, smoking and male sex are important risk factors for hypertension and no significant influence of variants in ACE and NOS3 genes on this risk was recognized. Obese subjects had a 3.27-times higher risk (OR = 3.27, 95% CI: 2.37 - 4.52) of hypertension than non-obese, and in obese the NOS3 894T allele was associated with 1.37 fold higher risk of hypertension (P = 0.031). The distribution of NOS3 G894T genotypes supported the co-dominant (OR = 1.35, P = 0.034, Pfit = 0.435) or recessive (OR = 2.00, P = 0.046, Pfit = 0.286), but not dominant model of inheritance (P = 0.100). The study indicates that in obese NOS3 G894T polymorphism may enhance hypertension risk. However, in the presence of such strong risk factors as age, diabetes and smoking, the impact of this genetic variant seems to be attenuated. Further studies are needed to reveal the usefulness of G894T polymorphism in hypertension risk assessment in obese. PMID:26579574

  6. Impact of obesity and nitric oxide synthase gene G894T polymorphism on essential hypertension.

    PubMed

    Wrzosek, M; Sokal, M; Sawicka, A; Wlodarczyk, M; Glowala, M; Wrzosek, M; Kosior, M; Talalaj, M; Biecek, P; Nowicka, G

    2015-10-01

    Hypertension is a multifactorial disease caused by environmental, metabolic and genetic factors, but little is currently known on the complex interplay between these factors and blood pressure. The aim of the present study was to assess the potential impact of obesity, and angiotensin-converting enzyme (ACE) I/D polymorphism and endothelial nitric oxide synthase gene (NOS3) 4a/4b, G894T and -T786C variants on the essential hypertension. The study group consisted of 1,027 Caucasian adults of Polish nationality (45.5 ± 13.6 years old), of which 401 met the criteria for hypertension. Body weight, height and blood pressure were measured and data on self-reported smoking status were collected. Fasting blood glucose, total cholesterol, LDL-cholesterol, HDL-cholesterol, triglycerides were determined by standard procedures. The ACE I/D polymorphism and three polymorphisms in NOS3 gene (4a/4b, G894T, -T786C) were detected by the PCR method. Multivariable logistic regression demonstrated that age above 45 years, diabetes, dyslipidemia, smoking and male sex are important risk factors for hypertension and no significant influence of variants in ACE and NOS3 genes on this risk was recognized. Obese subjects had a 3.27-times higher risk (OR = 3.27, 95% CI: 2.37 - 4.52) of hypertension than non-obese, and in obese the NOS3 894T allele was associated with 1.37 fold higher risk of hypertension (P = 0.031). The distribution of NOS3 G894T genotypes supported the co-dominant (OR = 1.35, P = 0.034, Pfit = 0.435) or recessive (OR = 2.00, P = 0.046, Pfit = 0.286), but not dominant model of inheritance (P = 0.100). The study indicates that in obese NOS3 G894T polymorphism may enhance hypertension risk. However, in the presence of such strong risk factors as age, diabetes and smoking, the impact of this genetic variant seems to be attenuated. Further studies are needed to reveal the usefulness of G894T polymorphism in hypertension risk assessment in obese.

  7. Endothelial nitric oxide synthase gene intron4 VNTR polymorphism in patients with chronic kidney disease.

    PubMed

    Elshamaa, Manal F; Sabry, Samar; Badr, Ahmed; El-Ahmady, Mostafa; Elghoroury, Eman A; Thabet, Eman H; Kandil, Dina; Kamel, Solaf

    2011-09-01

    Nitric oxide production is reduced in renal disease, partially due to decreased endothelial nitric oxide production. Evidence indicates that nitric oxide deficiency contributes to cardiovascular events and progression of kidney damage. A polymorphism in intron 4 of the endothelial constitutive nitric oxide synthase (ecNOS) gene is a candidate gene in cardiovascular and renal diseases. We investigated a potential involvement of this polymorphism in chronic renal failure. A case-control study involved 78 children with chronic kidney disease (CKD) and 30 healthy controls. All participants were genotyped for the ecNOS4 polymorphism by the polymerase chain reaction (PCR). Dialyzed (maintenance hemodialysis) and conservative treatment children had significantly higher frequency of the aa genotype and ecNOS4a allele (P<0.05) compared with controls. The combined genotype aa+ab vs. bb comparison validated that a allele is a high-risk allele for end-stage renal disease (ESRD) (P<0.05). Serum nitric oxide level was found to be lower in carriers of the ecNOS 4a allele than in noncarriers (100.29±27.32 vs. 152.73±60.39 μmol/l, P=0.04). Interestingly, 85.95% of the ecNOS 4a allele ESRD patients were found hypertensive in comparison to the 60.67% patients of non noncarriers (bb genotype) (P=0.04). Also, 35.90% of the ecNOS 4a allele ESRD patients were found to have cardiovascular disease in comparison to the 5.13% patients of noncarriers (bb genotype) (P=0.01). On multiple linear regression analysis, a allele was independently associated with hypertension (P=0.03). There was a significantly higher frequency of the ecNOS4a allele carriers among CKD children, both on MHD and conservative treatment than in controls. This suggests that the ecNOS gene polymorphism may be associated with an increased risk of chronic renal failure. PMID:21519233

  8. Fatty Acid Synthase Cooperates with Glyoxalase 1 to Protect against Sugar Toxicity

    PubMed Central

    Garrido, Damien; Rubin, Thomas; Poidevin, Mickael; Maroni, Brigitte; Le Rouzic, Arnaud; Parvy, Jean-Philippe; Montagne, Jacques

    2015-01-01

    Fatty acid (FA) metabolism is deregulated in several human diseases including metabolic syndrome, type 2 diabetes and cancers. Therefore, FA-metabolic enzymes are potential targets for drug therapy, although the consequence of these treatments must be precisely evaluated at the organismal and cellular levels. In healthy organism, synthesis of triacylglycerols (TAGs)—composed of three FA units esterified to a glycerol backbone—is increased in response to dietary sugar. Saturation in the storage and synthesis capacity of TAGs is associated with type 2 diabetes progression. Sugar toxicity likely depends on advanced-glycation-end-products (AGEs) that form through covalent bounding between amine groups and carbonyl groups of sugar or their derivatives α-oxoaldehydes. Methylglyoxal (MG) is a highly reactive α-oxoaldehyde that is derived from glycolysis through a non-enzymatic reaction. Glyoxalase 1 (Glo1) works to neutralize MG, reducing its deleterious effects. Here, we have used the power of Drosophila genetics to generate Fatty acid synthase (FASN) mutants, allowing us to investigate the consequence of this deficiency upon sugar-supplemented diets. We found that FASN mutants are lethal but can be rescued by an appropriate lipid diet. Rescued animals do not exhibit insulin resistance, are dramatically sensitive to dietary sugar and accumulate AGEs. We show that FASN and Glo1 cooperate at systemic and cell-autonomous levels to protect against sugar toxicity. We observed that the size of FASN mutant cells decreases as dietary sucrose increases. Genetic interactions at the cell-autonomous level, where glycolytic enzymes or Glo1 were manipulated in FASN mutant cells, revealed that this sugar-dependent size reduction is a direct consequence of MG-derived-AGE accumulation. In summary, our findings indicate that FASN is dispensable for cell growth if extracellular lipids are available. In contrast, FA-synthesis appears to be required to limit a cell

  9. Silencing of the ACC synthase gene ACACS2 causes delayed flowering in pineapple [Ananas comosus (L.) Merr.].

    PubMed

    Trusov, Yuri; Botella, José Ramón

    2006-01-01

    Flowering is a crucial developmental stage in the plant life cycle. A number of different factors, from environmental to chemical, can trigger flowering. In pineapple, and other bromeliads, it has been proposed that flowering is triggered by a small burst of ethylene production in the meristem in response to environmental cues. A 1-amino-cyclopropane-1-carboxylate synthase (ACC synthase) gene has been cloned from pineapple (ACACS2), which is induced in the meristem under the same environmental conditions that induce flowering. Two transgenic pineapple lines have been produced containing co-suppression constructs designed to down-regulate the expression of the ACACS2 gene. Northern analysis revealed that the ACACS2 gene was silenced in a number of transgenic plants in both lines. Southern hybridization revealed clear differences in the methylation status of silenced versus non-silenced plants by the inability of a methylation-sensitive enzyme to digest within the ACACS2 DNA extracted from silenced plants, indicating that methylation is the cause of the observed co-suppression of the ACACS2 gene. Flowering characteristics of the transgenic plants were studied under field conditions in South East Queensland, Australia. Flowering dynamics studies revealed significant differences in flowering behaviour, with transgenic plants exhibiting silencing showing a marked delay in flowering when compared with non-silenced transgenic plants and control non-transformed plants. It is argued that the ACACS2 gene is one of the key contributors towards triggering 'natural flowering' in mature pineapples under commercial field conditions.

  10. Effect of the expression and knockdown of citrate synthase gene on carbon flux during triacylglycerol biosynthesis by green algae Chlamydomonas reinhardtii

    PubMed Central

    2013-01-01

    Background The regulation of lipid biosynthesis is essential in photosynthetic eukaryotic cells. This regulation occurs during the direct synthesis of fatty acids and triacylglycerols (TAGs), as well as during other controlling processes in the main carbon metabolic pathway. Results In this study, the mRNA levels of Chlamydomonas citrate synthase (CrCIS) were found to decrease under nitrogen-limited conditions, which suggests suppressed gene expression. Gene silencing by RNA interference (RNAi) was conducted to determine whether CrCIS suppression affected the carbon flux in TAG biosynthesis. Results showed that the TAG level increased by 169.5%, whereas the CrCIS activities in the corresponding transgenic algae decreased by 16.7% to 37.7%. Moreover, the decrease in CrCIS expression led to the increased expression of TAG biosynthesis-related genes, such as acyl-CoA:diacylglycerol acyltransferase and phosphatidate phosphatase. Conversely, overexpression of CrCIS gene decreased the TAG level by 45% but increased CrCIS activity by 209% to 266% in transgenic algae. Conclusions The regulation of CrCIS gene can indirectly control the lipid content of algal cells. Our findings propose that increasing oil by suppressing CrCIS expression in microalgae is feasible. PMID:24373252

  11. Citrus nobiletin suppresses inducible nitric oxide synthase gene expression in interleukin-1β-treated hepatocytes

    SciTech Connect

    Yoshigai, Emi; Machida, Toru; Okuyama, Tetsuya; Mori, Masatoshi; Murase, Hiromitsu; Yamanishi, Ryota; Okumura, Tadayoshi; Ikeya, Yukinobu; Nishino, Hoyoku; Nishizawa, Mikio

    2013-09-13

    Highlights: •Nobiletin is a polymethoxylated flavone that is abundant in citrus peels. •Nobiletin is a major constituent of the Citrus unshiu peel extract. •Nobiletin suppresses induction of NO and reduces iNOS expression in hepatocytes. •Nobiletin reduces the iNOS promoter activity and the DNA-binding activity of NF-κB. -- Abstract: Background: Nobiletin is a polymethoxylated flavone that is abundant in the peels of citrus fruits, such as Citrus unshiu (Satsuma mandarin) and Citrus sinensis. The dried peels of C. unshiu (chinpi) have been included in several formulae of Japanese Kampo medicines. Nobiletin may suppress the induction of inducible nitric oxide synthase (iNOS), which synthesizes the inflammatory mediator nitric oxide (NO) in hepatocytes. Methods: A C. unshiu peel (CUP) extract was prepared. Primary cultured rat hepatocytes were treated with the CUP extract or nobiletin in the presence of interleukin 1β (IL-1β), which induces iNOS expression. NO production and iNOS gene expression were analyzed. Results: High-performance liquid chromatography analyses revealed that the nobiletin content in the CUP extract was 0.14%. Nobiletin dose-dependently reduced the NO levels and decreased iNOS expression at the protein, mRNA and antisense transcript levels. Flavone, which does not contain any methoxy groups, also suppressed iNOS induction. Nobiletin reduced the transcriptional activity of iNOS promoter-luciferase constructs and the DNA-binding activity of nuclear factor κB (NF-κB) in the nuclei. Conclusions: The suppression of iNOS induction by nobiletin suggests that nobiletin may be responsible for the anti-inflammatory effects of citrus peels and have a therapeutic potential for liver diseases.

  12. Molecular Cloning, Characterization and mRNA Expression of a Chitin Synthase 2 Gene from the Oriental Fruit Fly, Bactrocera dorsalis (Diptera: Tephritidae)

    PubMed Central

    Chen, Li; Yang, Wen-Jia; Cong, Lin; Xu, Kang-Kang; Wang, Jin-Jun

    2013-01-01

    Chitin synthase (CHS), a potential target for eco-friendly insecticides, plays an essential role in chitin formation in insects. In this study, a full-length cDNA encoding chitin synthase 2 (BdCHS2) was cloned and characterized in the oriental fruit fly, Bactrocera dorsalis. The BdCHS2 cDNA had 4417 nucleotides, containing an open reading frame of 4122 nucleotides, which encoded 1373 amino acid residues with a predicted molecular weight of 158.5 kDa. Phylogenetic analysis with other insect CHSs suggested that BdCHS2 belongs to insect CHS2. The BdCHS2 transcript was predominately found in midgut but was detected at low levels in fat body, Malpighian tubules, integument, and trachea. Moreover, BdCHS2 was expressed in all developmental stages, and highly expressed in the feeding stages. There was a positive relationship between BdCHS2 expression and total chitin content during development. Furthermore, both the gene expression and chitin content in midgut decreased when the insect was fed for 24 h, then starved for 24 h, while they increased dramatically and rapidly under the condition of starvation for 24 h then feeding for 24 h. These results suggest that BdCHS2 may play an important role in regulating chitin content of the midgut, and subsequently affect the growth and development of B. dorsalis. PMID:23965972

  13. Exposure to Diflubenzuron Results in an Up-Regulation of a Chitin Synthase 1 Gene in Citrus Red Mite, Panonychus citri (Acari: Tetranychidae)

    PubMed Central

    Xia, Wen-Kai; Ding, Tian-Bo; Niu, Jin-Zhi; Liao, Chong-Yu; Zhong, Rui; Yang, Wen-Jia; Liu, Bin; Dou, Wei; Wang, Jin-Jun

    2014-01-01

    Chitin synthase synthesizes chitin, which is critical for the arthropod exoskeleton. In this study, we cloned the cDNA sequences of a chitin synthase 1 gene, PcCHS1, in the citrus red mite, Panonychus citri (McGregor), which is one of the most economically important pests of citrus worldwide. The full-length cDNA of PcCHS1 contains an open reading frame of 4605 bp of nucleotides, which encodes a protein of 1535 amino acid residues with a predicted molecular mass of 175.0 kDa. A phylogenetic analysis showed that PcCHS1 was most closely related to CHS1 from Tetranychus urticae. During P. citri development, PcCHS1 was constantly expressed in all stages but highly expressed in the egg stage (114.8-fold higher than in the adult). When larvae were exposed to diflubenzuron (DFB) for 6 h, the mite had a significantly high mortality rate, and the mRNA expression levels of PcCHS1 were significantly enhanced. These results indicate a promising use of DFB to control P. citri, by possibly acting as an inhibitor in chitin synthesis as indicated by the up-regulation of PcCHS1 after exposure to DFB. PMID:24590130

  14. The Arabidopsis thaliana Myo-Inositol 1-Phosphate Synthase1 Gene Is Required for Myo-inositol Synthesis and Suppression of Cell Death[W

    PubMed Central

    Donahue, Janet L.; Alford, Shannon R.; Torabinejad, Javad; Kerwin, Rachel E.; Nourbakhsh, Aida; Ray, W. Keith; Hernick, Marcy; Huang, Xinyi; Lyons, Blair M.; Hein, Pyae P.; Gillaspy, Glenda E.

    2010-01-01

    l-myo-inositol 1-phosphate synthase (MIPS; EC 5.5.1.4) catalyzes the rate-limiting step in the synthesis of myo-inositol, a critical compound in the cell. Plants contain multiple MIPS genes, which encode highly similar enzymes. We characterized the expression patterns of the three MIPS genes in Arabidopsis thaliana and found that MIPS1 is expressed in most cell types and developmental stages, while MIPS2 and MIPS3 are mainly restricted to vascular or related tissues. MIPS1, but not MIPS2 or MIPS3, is required for seed development, for physiological responses to salt and abscisic acid, and to suppress cell death. Specifically, a loss in MIPS1 resulted in smaller plants with curly leaves and spontaneous production of lesions. The mips1 mutants have lower myo-inositol, ascorbic acid, and phosphatidylinositol levels, while basal levels of inositol (1,4,5)P3 are not altered in mips1 mutants. Furthermore, mips1 mutants exhibited elevated levels of ceramides, sphingolipid precursors associated with cell death, and were complemented by a MIPS1-green fluorescent protein (GFP) fusion construct. MIPS1-, MIPS2-, and MIPS3-GFP each localized to the cytoplasm. Thus, MIPS1 has a significant impact on myo-inositol levels that is critical for maintaining levels of ascorbic acid, phosphatidylinositol, and ceramides that regulate growth, development, and cell death. PMID:20215587

  15. Genomic organization and expression analysis of a farnesyl diphosphate synthase gene (FPPS2) in apples (Malus domestica Borkh.).

    PubMed

    Yuan, Kejun; Wang, Changjun; Xin, Li; Zhang, Anning; Ai, Chengxiang

    2013-07-25

    A farnesyl diphosphate synthase gene (FPPS2), which contains 11 introns and 12 exons, was isolated from the apple cultivar "White Winter Pearmain". When it was compared to our previously reported FPPS1, its each intron size was different, its each exon size was the same as that of FPPS1 gene, 30 nucleotide differences were found in its coding sequence. Based on these nucleotide differences, specific primers were designed to perform expression analysis; the results showed that it expressed in both fruit and leaf, its expression level was obviously lower than that of FPPS1 gene in fruit which was stored at 4°C for 5 weeks. This is the first report concerning two FPPS genes and their expression comparison in apples.

  16. [Distinctive Features of the Microbial Diversity and the Polyketide Synthase GenesSpectrum in the Community of the Endemic Baikal Sponge Swartschewskia papyracea].

    PubMed

    Kaluzhnaya, O V; Itskovich, V B

    2016-01-01

    The diversity of the symbiotic community of the endemic Baikal sponge Swartschewskia papyracea was studied, and an analysis of the polyketide synthases genes spectrum in sponge-associated microorganisms was carried out. Six bacterial phyla were detected in the S. papyracea microbiome, namely, Verrucomicrobia, Cyanobacteria, Actinobacteria, Bacteroidetes, Proteobacteria, and Planctomycetes. Unlike the microbial associations of other freshwater sponges, the community under study was dominated by the Verrucomicrobia (42.1%) and Cyanobacteria (17.5%) phyla, while the proportion of the Proteobacteria was unusually low (9.7%). In the S. papyracea community metagenome, there were identified 18 polyketide synthases genes fragments, the closest homologs of which included the polyketide synthases of the microorganisms belonging to the bacterial phyla Cyanobacteria, Proteobacteria (Betaproteobacteria, Deltaproteobacteria, and Gammaproteobacteria classes), and Acidobacteria and to the eukaryotic algae of the Heterokonta phylum (Eustigmatophyceae class). Polyketide synthase sequences from S. papyracea formed three groups on the phylogenetic tree: a group of hybrid NRPS/PKS complexes, a group of cyanobacterial polyketide synthases, and a group of homologs of the eukaryotic alga Nannochloropsis galiana. Notably, the identified polyketide synthase genes fragments showed only a 57-88% similarity to the sequences in the databases, which implies the presence of genes controlling the synthesis of the novel, still unstudied, polyketide compounds in the S. papyracea community. It was proposed that the habitation conditions of S. papyracea affect the taxonomic composition of the microorganisms associated with the sponge, including the diversity of the producers of secondary metabolites.

  17. [Distinctive Features of the Microbial Diversity and the Polyketide Synthase GenesSpectrum in the Community of the Endemic Baikal Sponge Swartschewskia papyracea].

    PubMed

    Kaluzhnaya, O V; Itskovich, V B

    2016-01-01

    The diversity of the symbiotic community of the endemic Baikal sponge Swartschewskia papyracea was studied, and an analysis of the polyketide synthases genes spectrum in sponge-associated microorganisms was carried out. Six bacterial phyla were detected in the S. papyracea microbiome, namely, Verrucomicrobia, Cyanobacteria, Actinobacteria, Bacteroidetes, Proteobacteria, and Planctomycetes. Unlike the microbial associations of other freshwater sponges, the community under study was dominated by the Verrucomicrobia (42.1%) and Cyanobacteria (17.5%) phyla, while the proportion of the Proteobacteria was unusually low (9.7%). In the S. papyracea community metagenome, there were identified 18 polyketide synthases genes fragments, the closest homologs of which included the polyketide synthases of the microorganisms belonging to the bacterial phyla Cyanobacteria, Proteobacteria (Betaproteobacteria, Deltaproteobacteria, and Gammaproteobacteria classes), and Acidobacteria and to the eukaryotic algae of the Heterokonta phylum (Eustigmatophyceae class). Polyketide synthase sequences from S. papyracea formed three groups on the phylogenetic tree: a group of hybrid NRPS/PKS complexes, a group of cyanobacterial polyketide synthases, and a group of homologs of the eukaryotic alga Nannochloropsis galiana. Notably, the identified polyketide synthase genes fragments showed only a 57-88% similarity to the sequences in the databases, which implies the presence of genes controlling the synthesis of the novel, still unstudied, polyketide compounds in the S. papyracea community. It was proposed that the habitation conditions of S. papyracea affect the taxonomic composition of the microorganisms associated with the sponge, including the diversity of the producers of secondary metabolites. PMID:27183792

  18. pks63787, a Polyketide Synthase Gene Responsible for the Biosynthesis of Benzenoids in the Medicinal Mushroom Antrodia cinnamomea.

    PubMed

    Yu, Po-Wei; Chang, Ya-Chih; Liou, Ruey-Fen; Lee, Tzong-Huei; Tzean, Shean-Shong

    2016-06-24

    Antrodia cinnamomea, a unique resupinate basidiomycete endemic to Taiwan, has potent medicinal activities. The reddish basidiocarps and mycelia generally exhibit abundant metabolites and higher biological activity. To investigate the pigments of A. cinnamomea, polyketide synthase (PKS) genes were characterized based on its partially deciphered genome and the construction of a fosmid library. Furthermore, a gene disruption platform was established via protoplast transformation and homologous recombination. Of four putative polyketide synthase genes, pks63787 was selected and disrupted in the monokaryotic wild-type (wt) strain f101. Transformant Δpks63787 was deficient in the synthesis of several aromatic metabolites, including five benzenoids and two benzoquinone derivatives. Based on these results, a biosynthetic pathway for benzenoid derivatives was proposed. The pks63787 deletion mutant not only displayed a reduced red phenotype compared to the wt strain but also displayed less 1,1-biphenyl-2-picrylhydrazyl free radical scavenging activity. This finding suggests that PKS63787 is responsible for the biosynthesis of pigments and metabolites related to the antioxidant activity of A. cinnamomea. The present study focuses on the functional characterization of the PKS gene, the fluctuations of its profile of secondary metabolites, and interpretation of the biosynthesis of benzenoids. PMID:27227778

  19. Deletion of the pyc Gene Blocks Clavulanic Acid Biosynthesis Except in Glycerol-Containing Medium: Evidence for Two Different Genes in Formation of the C3 Unit

    PubMed Central

    Pérez-Redondo, Rosario; Rodríguez-García, Antonio; Martín, Juan F.; Liras, Paloma

    1999-01-01

    The β-lactamase inhibitor clavulanic acid is formed by condensation of a pyruvate-derived C3 unit with a molecule of arginine. A gene (pyc, for pyruvate converting) located upstream of the bls gene in the clavulanic acid gene cluster of Streptomyces clavuligerus encodes a 582-amino-acid protein with domains recognizing pyruvate and thiamine pyrophosphate that shows 29.9% identity to acetohydroxyacid synthases. Amplification of the pyc gene resulted in an earlier onset and higher production of clavulanic acid. Replacement of the pyc gene with the aph gene did not cause isoleucine-valine auxotrophy in the mutant. The pyc replacement mutant did not produce clavulanic acid in starch-asparagine (SA) or in Trypticase soy broth (TSB) complex medium, suggesting that the pyc gene product is involved in the conversion of pyruvate into the C3 unit of clavulanic acid. However, the β-lactamase inhibitor was still formed at the same level as in the wild-type strain in defined medium containing d-glycerol, glutamic acid, and proline (GSPG medium) as confirmed by high-pressure liquid chromatography and paper chromatography. The production of clavulanic acid by the replacement mutant was dependent on addition of glycerol to the medium, and glycerol-free GSPG medium did not support clavulanic acid biosynthesis, suggesting that an alternative gene product catalyzes the incorporation of glycerol into clavulanic acid in the absence of the Pyc protein. The pyc replacement mutant overproduces cephamycin. PMID:10559157

  20. Biosynthesis of Dictyostelium discoideum differentiation-inducing factor by a hybrid type I fatty acid-type III polyketide synthase.

    PubMed

    Austin, Michael B; Saito, Tamao; Bowman, Marianne E; Haydock, Stephen; Kato, Atsushi; Moore, Bradley S; Kay, Robert R; Noel, Joseph P

    2006-09-01

    Differentiation-inducing factors (DIFs) are well known to modulate formation of distinct communal cell types from identical Dictyostelium discoideum amoebas, but DIF biosynthesis remains obscure. We report complimentary in vivo and in vitro experiments identifying one of two approximately 3,000-residue D. discoideum proteins, termed 'steely', as responsible for biosynthesis of the DIF acylphloroglucinol scaffold. Steely proteins possess six catalytic domains homologous to metazoan type I fatty acid synthases (FASs) but feature an iterative type III polyketide synthase (PKS) in place of the expected FAS C-terminal thioesterase used to off load fatty acid products. This new domain arrangement likely facilitates covalent transfer of steely N-terminal acyl products directly to the C-terminal type III PKS active sites, which catalyze both iterative polyketide extension and cyclization. The crystal structure of a steely C-terminal domain confirms conservation of the homodimeric type III PKS fold. These findings suggest new bioengineering strategies for expanding the scope of fatty acid and polyketide biosynthesis. PMID:16906151

  1. The condensing activities of the Mycobacterium tuberculosis type II fatty acid synthase are differentially regulated by phosphorylation.

    PubMed

    Molle, Virginie; Brown, Alistair K; Besra, Gurdyal S; Cozzone, Alain J; Kremer, Laurent

    2006-10-01

    Phosphorylation of proteins by Ser/Thr protein kinases (STPKs) has recently become of major physiological importance because of its possible involvement in virulence of bacterial pathogens. Although Mycobacterium tuberculosis has eleven STPKs, the nature and function of the substrates of these enzymes remain largely unknown. In this work, we have identified for the first time STPK substrates in M. tuberculosis forming part of the type II fatty acid synthase (FAS-II) system involved in mycolic acid biosynthesis: the malonyl-CoA::AcpM transacylase mtFabD, and the beta-ketoacyl AcpM synthases KasA and KasB. All three enzymes were phosphorylated in vitro by different kinases, suggesting a complex network of interactions between STPKs and these substrates. In addition, both KasA and KasB were efficiently phosphorylated in M. bovis BCG each at different sites and could be dephosphorylated by the M. tuberculosis Ser/Thr phosphatase PstP. Enzymatic studies revealed that, whereas phosphorylation decreases the activity of KasA in the elongation process of long chain fatty acids synthesis, this modification enhances that of KasB. Such a differential effect of phosphorylation may represent an unusual mechanism of FAS-II system regulation, allowing pathogenic mycobacteria to produce full-length mycolates, which are required for adaptation and intracellular survival in macrophages. PMID:16873379

  2. Mycolic acid biosynthesis and enzymic characterization of the beta-ketoacyl-ACP synthase A-condensing enzyme from Mycobacterium tuberculosis.

    PubMed

    Kremer, Laurent; Dover, Lynn G; Carrère, Séverine; Nampoothiri, K Madhavan; Lesjean, Sarah; Brown, Alistair K; Brennan, Patrick J; Minnikin, David E; Locht, Camille; Besra, Gurdyal S

    2002-06-01

    Mycolic acids consist of long-chain alpha-alkyl-beta-hydroxy fatty acids that are produced by successive rounds of elongation catalysed by a type II fatty acid synthase (FAS-II). A key feature in the elongation process is the condensation of a two-carbon unit from malonyl-acyl-carrier protein (ACP) to a growing acyl-ACP chain catalysed by a beta-ketoacyl-ACP synthase (Kas). In the present study, we provide evidence that kasA from Mycobacterium tuberculosis encodes an enzyme that elongates in vivo the meromycolate chain, in both Mycobacterium smegmatis and Mycobacterium chelonae. We demonstrate that KasA belongs to the FAS-II system, which utilizes primarily palmitoyl-ACP rather than short-chain acyl-ACP primers. Furthermore, in an in vitro condensing assay using purified recombinant KasA, palmitoyl-AcpM and malonyl-AcpM, KasA was found to express Kas activity. Also, mutated KasA proteins, with mutation of Cys(171), His(311), Lys(340) and His(345) to Ala abrogated the condensation activity of KasA in vitro completely. Finally, purified KasA was highly sensitive to cerulenin, a well-known inhibitor of Kas, which may lead to the development of novel anti-mycobacterial drugs targeting KasA. PMID:12023885

  3. Physiological Roles of the β-Substituted Alanine Synthase Gene Family in Arabidopsis1[W][OA

    PubMed Central

    Watanabe, Mutsumi; Kusano, Miyako; Oikawa, Akira; Fukushima, Atsushi; Noji, Masaaki; Saito, Kazuki

    2008-01-01

    The β-substituted alanine (Ala) synthase (Bsas) family in the large superfamily of pyridoxal 5′-phosphate-dependent enzymes comprises cysteine (Cys) synthase (CSase) [O-acetyl-serine (thiol) lyase] and β-cyano-Ala synthase (CASase) in plants. Nine genomic sequences encode putative Bsas proteins in Arabidopsis thaliana. The physiological roles of these Bsas isoforms in vivo were investigated by the characterization of T-DNA insertion mutants. Analyses of gene expression, activities of CSase and CASase, and levels of Cys and glutathione in the bsas mutants indicated that cytosolic Bsas1;1, plastidic Bsas2;1, and mitochondrial Bsas2;2 play major roles in Cys biosynthesis. Cytosolic Bsas1;1 has the most dominant contribution both in leaf and root, and mitochondrial Bsas2;2 plays a significant role in root. Mitochondrial Bsas3;1 is a genuine CASase. Nontargeted metabolome analyses of knockout mutants were carried out by a combination of gas chromatography time-of-flight mass spectrometry and capillary electrophoresis time-of-flight mass spectrometry. The level of γ-glutamyl-β-cyano-Ala decreased in the mutant bsas3;1, indicating the crucial role of Bsas3;1 in β-cyano-Ala metabolism in vivo. PMID:18024555

  4. Ketide Synthase (KS) Domain Prediction and Analysis of Iterative Type II PKS Gene in Marine Sponge-Associated Actinobacteria Producing Biosurfactants and Antimicrobial Agents

    PubMed Central

    Selvin, Joseph; Sathiyanarayanan, Ganesan; Lipton, Anuj N.; Al-Dhabi, Naif Abdullah; Valan Arasu, Mariadhas; Kiran, George S.

    2016-01-01

    The important biological macromolecules, such as lipopeptide and glycolipid biosurfactant producing marine actinobacteria were analyzed and their potential linkage between type II polyketide synthase (PKS) genes was explored. A unique feature of type II PKS genes is their high amino acid (AA) sequence homology and conserved gene organization. These enzymes mediate the biosynthesis of polyketide natural products with enormous structural complexity and chemical nature by combinatorial use of various domains. Therefore, deciphering the order of AA sequence encoded by PKS domains tailored the chemical structure of polyketide analogs still remains a great challenge. The present work deals with an in vitro and in silico analysis of PKS type II genes from five actinobacterial species to correlate KS domain architecture and structural features. Our present analysis reveals the unique protein domain organization of iterative type II PKS and KS domain of marine actinobacteria. The findings of this study would have implications in metabolic pathway reconstruction and design of semi-synthetic genomes to achieve rational design of novel natural products. PMID:26903957

  5. Expression of fatty acid synthesis genes and fatty acid accumulation in haematococcus pluvialis under different stressors

    PubMed Central

    2012-01-01

    Background Biofuel has been the focus of intensive global research over the past few years. The development of 4th generation biofuel production (algae-to-biofuels) based on metabolic engineering of algae is still in its infancy, one of the main barriers is our lacking of understanding of microalgal growth, metabolism and biofuel production. Although fatty acid (FA) biosynthesis pathway genes have been all cloned and biosynthesis pathway was built up in some higher plants, the molecular mechanism for its regulation in microalgae is far away from elucidation. Results We cloned main key genes for FA biosynthesis in Haematococcus pluvialis, a green microalga as a potential biodiesel feedstock, and investigated the correlations between their expression alternation and FA composition and content detected by GC-MS under different stress treatments, such as nitrogen depletion, salinity, high or low temperature. Our results showed that high temperature, high salinity, and nitrogen depletion treatments played significant roles in promoting microalgal FA synthesis, while FA qualities were not changed much. Correlation analysis showed that acyl carrier protein (ACP), 3-ketoacyl-ACP-synthase (KAS), and acyl-ACP thioesterase (FATA) gene expression had significant correlations with monounsaturated FA (MUFA) synthesis and polyunsaturated FA (PUFA) synthesis. Conclusions We proposed that ACP, KAS, and FATA in H. pluvialis may play an important role in FA synthesis and may be rate limiting genes, which probably could be modified for the further study of metabolic engineering to improve microalgal biofuel quality and production. PMID:22448811

  6. Important roles of drought- and cold-inducible genes for galactinol synthase in stress tolerance in Arabidopsis thaliana.

    PubMed

    Taji, Teruaki; Ohsumi, Chieko; Iuchi, Satoshi; Seki, Motoaki; Kasuga, Mie; Kobayashi, Masatomo; Yamaguchi-Shinozaki, Kazuko; Shinozaki, Kazuo

    2002-02-01

    Raffinose family oligosaccharides (RFO) accumulating during seed development are thought to play a role in the desiccation tolerance of seeds. However, the functions of RFO in desiccation tolerance have not been elucidated. Here we examine the functions of RFO in Arabidopsis thaliana plants under drought- and cold-stress conditions, based on the analyses of function and expression of genes involved in RFO biosynthesis. Sugar analysis showed that drought-, high salinity- and cold-treated Arabidopsis plants accumulate a large amount of raffinose and galactinol, but not stachyose. Raffinose and galactinol were not detected in unstressed plants. This suggests that raffinose and galactinol are involved in tolerance to drought, high salinity and cold stresses. Galactinol synthase (GolS) catalyses the first step in the biosynthesis of RFO from UDP-galactose. We identified three stress-responsive GolS genes (AtGolS1, 2 and 3) among seven Arabidopsis GolS genes. AtGolS1 and 2 were induced by drought and high-salinity stresses, but not by cold stress. By contrast, AtGolS3 was induced by cold stress but not by drought or salt stress. All the GST fusion proteins of GST-AtGolS1, 2 and 3 expressed in Escherichia coli had galactinol synthase activities. Overexpression of AtGolS2 in transgenic Arabidopsis caused an increase in endogenous galactinol and raffinose, and showed reduced transpiration from leaves to improve drought tolerance. These results show that stress-inducible galactinol synthase plays a key role in the accumulation of galactinol and raffinose under abiotic stress conditions, and that galactinol and raffinose may function as osmoprotectants in drought-stress tolerance of plants.

  7. Association between endothelial nitric oxide synthase gene polymorphism (-786T>C) and interleukin-6 in acute coronary syndrome.

    PubMed

    Piccoli, J C E; Manfredini, V; Faoro, D; Farias, F M; Bodanese, L C; Bogo, M R

    2014-04-01

    Atherosclerosis is morphologically an inflammatory disease, where endothelial dysfunction plays a key role in all the stages. The nitric oxide (NO) synthase 3 (NOS3) gene is responsible for the synthesis of endothelial NO synthase (eNOS) in humans and some genetic polymorphisms are considered "polymorphisms associated with risk" for the development of coronary artery diseases, such as acute coronary syndrome. Thus, the present study aimed to evaluate the influence of the -786T>C polymorphism of the eNOS gene on inflammatory and oxidative process. A prospective cohort study of 125 consecutive patients with clinical diagnosis of non-ST-elevation acute coronary syndromes was conducted. Patients were assessed using a standardized questionnaire. Blood samples were drawn to measure serum levels of high-sensitivity C-reactive protein, soluble CD40 ligand, interleukin-6 (IL-6), N-terminal prohormone of brain natriuretic peptide, immunoglobulin G antibodies against oxidized low-density lipoprotein. The genotypes for the -786T>C polymorphism in the 5'-flanking region of eNOS gene were determined. The -786C allele was found in 92 of 250 alleles (38.8%). No statistical association was observed between demographic and clinical characteristics and distribution of eNOS-786T>C polymorphism. We found that -786CC was associated with lower levels of IL-6. No significant differences were observed between the distribution of -786T>C polymorphism and other investigated markers.

  8. Detection of the enzymatically-active polyhydroxyalkanoate synthase subunit gene, phaC, in cyanobacteria via colony PCR.

    PubMed

    Lane, Courtney E; Benton, Michael G

    2015-12-01

    A colony PCR-based assay was developed to rapidly determine if a cyanobacterium of interest contains the requisite genetic material, the PHA synthase PhaC subunit, to produce polyhydroxyalkanoates (PHAs). The test is both high throughput and robust, owing to an extensive sequence analysis of cyanobacteria PHA synthases. The assay uses a single detection primer set and a single reaction condition across multiple cyanobacteria strains to produce an easily detectable positive result - amplification via PCR as evidenced by a band in electrophoresis. In order to demonstrate the potential of the presence of phaC as an indicator of a cyanobacteria's PHA accumulation capabilities, the ability to produce PHA was assessed for five cyanobacteria with a traditional in vivo PHA granule staining using an oxazine dye. The confirmed in vivo staining results were then compared to the PCR-based assay results and found to be in agreement. The colony PCR assay was capable of successfully detecting the phaC gene in all six of the diverse cyanobacteria tested which possessed the gene, while exhibiting no undesired product formation across the nine total cyanobacteria strains tested. The colony PCR quick prep provides sufficient usable DNA template such that this assay could be readily expanded to assess multiple genes of interest simultaneously.

  9. Discovery of bacterial polyhydroxyalkanoate synthase (PhaC)-encoding genes from seasonal Baltic Sea ice and cold estuarine waters.

    PubMed

    Pärnänen, Katariina; Karkman, Antti; Virta, Marko; Eronen-Rasimus, Eeva; Kaartokallio, Hermanni

    2015-01-01

    Polyhydroxyalkanoates (PHAs) are macromolecules produced by bacteria as means for storing carbon and energy in intracellular granules. PHAs have physical properties similar to those of plastics and have become of interest to industry as materials for environmentally friendly bioplastic production. There is an ongoing search for new PHA-producing bacterial strains and PHA-synthesizing enzymes tolerating extreme conditions to find ways of producing PHAs at cold temperatures and high solute concentrations. Moreover, the study of PHA producers in the sea-ice biome can aid in understanding the microbial ecology of carbon cycling in ice-associated ecosystems. In this study, PHA producers and PHA synthase genes were examined under the extreme environmental conditions of sea ice and cold seawater to find evidence of PHA production in an environment requiring adaptation to high salinity and cold temperatures. Sea ice and cold estuarine water samples were collected from the northern Baltic Sea and evidence of PHA production was gathered, using microscopy with Nile Blue A staining of PHA-granules and PCR assays detecting PHA-synthesis genes. The PHA granules and PHA synthases were found at all sampling locations, in both sea ice and water, and throughout the sampling period spanning over 10 years. Our study shows, for the first time, that PHA synthesis occurs in Baltic Sea cold-adapted bacteria in their natural environment, which makes the Baltic Sea and its cold environments an interesting choice in the quest for PHA-synthesizing bacteria and synthesis genes. PMID:25280551

  10. Patterning of virus-infected Glycine max seed coat is associated with suppression of endogenous silencing of chalcone synthase genes.

    PubMed

    Senda, Mineo; Masuta, Chikara; Ohnishi, Shizen; Goto, Kazunori; Kasai, Atsushi; Sano, Teruo; Hong, Jin-Sung; MacFarlane, Stuart

    2004-04-01

    Most commercial Glycine max (soybean) varieties have yellow seeds because of loss of pigmentation in the seed coat. It has been suggested that inhibition of seed coat pigmentation in yellow G. max may be controlled by homology-dependent silencing of chalcone synthase (CHS) genes. Our analysis of CHS mRNA and short-interfering RNAs provide clear evidence that the inhibition of seed coat pigmentation in yellow G. max results from posttranscriptional rather than transcriptional silencing of the CHS genes. Furthermore, we show that mottling symptoms present on the seed coat of G. max plants infected with some viruses can be caused by suppression of CHS posttranscriptional gene silencing (PTGS) by a viral silencing suppressor protein. These results demonstrate that naturally occurring PTGS plays a key role in expression of a distinctive phenotype in plants and present a simple clear example of the elucidation of the molecular mechanism for viral symptom induction. PMID:15037735

  11. Analysis of the endothelial nitric oxide synthase gene as a modifier of the cerebral response to ischemia.

    PubMed

    Dutra, Ana Virginia; Lin, Hsiu-Fen; Juo, Suh-Hang Hank; Boyadjis, Melanie; Moussouttas, Michael; Reddy, P Leema; Grewal, Raji Paul

    2006-01-01

    We studied the endothelial nitric oxide synthase (eNOS or NOS-3) gene as a potential modifier of the cerebral response to ischemia by investigating the association of two common polymorphisms with ischemic stroke volume. We genotyped an intronic variable number tandem repeat and a single nucleotide polymorphism, G894T, in 132 patients with nonlacunar ischemic strokes in whom clinical data and stroke lesion volume were recorded. Our results show that all genotypes are in Hardy-Weinberg equilibrium. After adjustment of covariates, neither of the NOS-3 polymorphisms showed significant differences comparing the genotypes and mean stroke volume (analysis of variance). Our results do not suggest a major gene effect of the NOS-3 gene as a modifier of the cerebral response to ischemia. PMID:17904064

  12. Transcriptional profiling of canker-resistant transgenic sweet orange (Citrus sinensis Osbeck) constitutively overexpressing a spermidine synthase gene.

    PubMed

    Fu, Xing-Zheng; Liu, Ji-Hong

    2013-01-01

    Citrus canker disease caused by Xanthomonas citri subsp. citri (Xcc) is one of the most devastating diseases affecting the citrus industry worldwide. In our previous study, the canker-resistant transgenic sweet orange (Citrus sinensis Osbeck) plants were produced via constitutively overexpressing a spermidine synthase. To unravel the molecular mechanisms underlying Xcc resistance of the transgenic plants, in the present study global transcriptional profiling was compared between untransformed line (WT) and the transgenic line (TG9) by hybridizing with Affymetrix Citrus GeneChip. In total, 666 differentially expressed genes (DEGs) were identified, 448 upregulated, and 218 downregulated. The DEGs were classified into 33 categories after Gene ontology (GO) annotation, in which 68 genes are in response to stimulus and involved in immune system process, 12 genes are related to cell wall, and 13 genes belong to transcription factors. These genes and those related to starch and sucrose metabolism, glutathione metabolism, biosynthesis of phenylpropanoids, and plant hormones were hypothesized to play major roles in the canker resistance of TG9. Semiquantitative RT-PCR analysis showed that the transcript levels of several candidate genes in TG9 were significantly higher than in WT both before and after Xcc inoculation, indicating their potential association with canker disease.

  13. Transcriptional Profiling of Canker-Resistant Transgenic Sweet Orange (Citrus sinensis Osbeck) Constitutively Overexpressing a Spermidine Synthase Gene

    PubMed Central

    Fu, Xing-Zheng; Liu, Ji-Hong

    2013-01-01

    Citrus canker disease caused by Xanthomonas citri subsp. citri (Xcc) is one of the most devastating diseases affecting the citrus industry worldwide. In our previous study, the canker-resistant transgenic sweet orange (Citrus sinensis Osbeck) plants were produced via constitutively overexpressing a spermidine synthase. To unravel the molecular mechanisms underlying Xcc resistance of the transgenic plants, in the present study global transcriptional profiling was compared between untransformed line (WT) and the transgenic line (TG9) by hybridizing with Affymetrix Citrus GeneChip. In total, 666 differentially expressed genes (DEGs) were identified, 448 upregulated, and 218 downregulated. The DEGs were classified into 33 categories after Gene ontology (GO) annotation, in which 68 genes are in response to stimulus and involved in immune system process, 12 genes are related to cell wall, and 13 genes belong to transcription factors. These genes and those related to starch and sucrose metabolism, glutathione metabolism, biosynthesis of phenylpropanoids, and plant hormones were hypothesized to play major roles in the canker resistance of TG9. Semiquantitative RT-PCR analysis showed that the transcript levels of several candidate genes in TG9 were significantly higher than in WT both before and after Xcc inoculation, indicating their potential association with canker disease. PMID:23509803

  14. "Macrophage" nitric oxide synthase is a glucocorticoid-inhibitable primary response gene in 3T3 cells.

    PubMed

    Gilbert, R S; Herschman, H R

    1993-10-01

    Both nitric oxide and prostaglandins are potent paracrine mediators of intercellular communication. An endotoxin-lipopolysaccharide (LPS) inducible form of nitric oxide synthase (mac-NOS) has recently been cloned from murine macrophages. An inducible prostaglandin synthase (TIS10/PGS-2), cloned from 3T3 cells, is also induced in LPS-activated macrophage. Because of the wide range of ligands that induce primary response genes in 3T3 cells, the ease of studying chimeric promoter constructs in 3T3 cells, and the importance of both nitric oxide and prostaglandins as paracrine mediators, we examined expression of mac-NOS in 3T3 cells. Tetradecanoyl phorbol-13-acetate (TPA), forskolin, platelet-derived growth factor, fibroblast growth factor, and serum all induce mac-NOS expression in Swiss 3T3 cells. Thus the mac-NOS gene can respond to a far wider range of inducers than previously suspected. mac-NOS is a primary response gene; cycloheximide does not block induction. TPA-induced mac-NOS and TIS10/PGS-2 mRNA accumulation patterns are similar. LPS is a potent inducer of mac-NOS in Swiss 3T3 cells but cannot induce TIS10/PGS-2. In contrast, v-src expression induces TIS10/PGS-2 message, but not iNOS message in a BALB/c 3T3 cell line containing a temperature-sensitive v-src gene. Dexamethasone (DEX) prevents induction of TIS10/PGS-2, but not most other primary response genes. DEX also blocks mac-NOS induction in Swiss 3T3 cells. The inducible TIS10/PGS-2 and mac-NOS genes, responsible for the production of two distinct paracrine agents, appear to share many regulatory features in 3T3 cells.

  15. The application of the mutated acetolactate synthase gene from rice as the selectable marker gene in the production of transgenic soybeans.

    PubMed

    Tougou, Makoto; Yamagishi, Noriko; Furutani, Noriyuki; Kaku, Koichiro; Shimizu, Tsutomu; Takahata, Yoshihito; Sakai, Jun-ichi; Kanematsu, Seiji; Hidaka, Soh

    2009-05-01

    We investigated selective culturing conditions for the production of transgenic soybeans. In this culturing system, we used the acetolactate synthase (ALS)-inhibiting herbicide-resistance gene derived from rice (Os-mALS gene) as a selectable marker gene instead of that derived from bacteria, which interfered with the cultivation and practical usage of transgenic crops. T(1) soybeans grown from one regenerated plant after selection of the ALS-targeting pyrimidinyl carboxy (PC) herbicide bispyribac-sodium (BS) exhibited herbicide resistance, and the introduction and expression of the Os-mALS gene were confirmed by genetic analysis. The selective culturing system promoted by BS herbicide, in which the Os-mALS gene was used as a selectable marker, was proved to be applicable to the production of transgenic soybeans, despite the appearance of escaped soybean plants that did not contain the Os-mALS transgene.

  16. Crystallization and X-ray diffraction studies of a complete bacterial fatty-acid synthase type I

    SciTech Connect

    Enderle, Mathias; McCarthy, Andrew; Paithankar, Karthik Shivaji; Grininger, Martin

    2015-10-23

    Bacterial and fungal type I fatty-acid synthases (FAS I) are evolutionarily connected, as bacterial FAS I is considered to be the ancestor of fungal FAS I. In this work, the production, crystallization and X-ray diffraction data analysis of a bacterial FAS I are reported. While a deep understanding of the fungal and mammalian multi-enzyme type I fatty-acid synthases (FAS I) has been achieved in recent years, the bacterial FAS I family, which is narrowly distributed within the Actinomycetales genera Mycobacterium, Corynebacterium and Nocardia, is still poorly understood. This is of particular relevance for two reasons: (i) although homologous to fungal FAS I, cryo-electron microscopic studies have shown that bacterial FAS I has unique structural and functional properties, and (ii) M. tuberculosis FAS I is a drug target for the therapeutic treatment of tuberculosis (TB) and therefore is of extraordinary importance as a drug target. Crystals of FAS I from C. efficiens, a homologue of M. tuberculosis FAS I, were produced and diffracted X-rays to about 4.5 Å resolution.

  17. Analogs of the antituberculous agent pyrazinamide are competitive inhibitors of NADPH binding to M. tuberculosis fatty acid synthase I.

    PubMed

    Sayahi, Halimah; Pugliese, Kaitlin M; Zimhony, Oren; Jacobs, William R; Shekhtman, Alexander; Welch, John T

    2012-11-01

    Analogs of pyrazinamide (=pyrazine-2-carboxamide; PZA), an essential component of short-course antituberculous chemotherapy, such as 5-chloropyrazinamide (5-Cl-PZA) act as competitive inhibitors of NADPH binding to purified mycobacterial fatty acid synthase I (FAS I) as shown by Saturation Transfer Difference (STD) NMR studies. In addition, pyrazinoic acid esters (POE) and 5-Cl-POE reversibly bind to FAS I with the relatively greater affinity of longer-chain esters for FAS I, clear from the STD amplification factors. The competitive binding of PZA and 5-Cl-PZA clearly illustrates that both agents bind FAS. In contrast to PZA, at low NADPH concentrations 5-Cl-PZA is a cooperative inhibitor of NADPH binding.

  18. Campylobacter jejuni fatty acid synthase II: Structural and functional analysis of [beta]-hydroxyacyl-ACP dehydratase (FabZ)

    SciTech Connect

    Kirkpatrick, Andrew S.; Yokoyama, Takeshi; Choi, Kyoung-Jae; Yeo, Hye-Jeong

    2009-08-14

    Fatty acid biosynthesis is crucial for all living cells. In contrast to higher organisms, bacteria use a type II fatty acid synthase (FAS II) composed of a series of individual proteins, making FAS II enzymes excellent targets for antibiotics discovery. The {beta}-hydroxyacyl-ACP dehydratase (FabZ) catalyzes an essential step in the FAS II pathway. Here, we report the structure of Campylobacter jejuni FabZ (CjFabZ), showing a hexamer both in crystals and solution, with each protomer adopting the characteristic hot dog fold. Together with biochemical analysis of CjFabZ, we define the first functional FAS II enzyme from this pathogen, and provide a framework for investigation on roles of FAS II in C. jejuni virulence

  19. In vitro effect of nanosilver on gene expression of superoxide dismutases and nitric oxide synthases in chicken Sertoli cells.

    PubMed

    Hassanpour, H; Mirshokraei, P; Sadrabad, E Khalili; Dehkordi, A Esmailian; Layeghi, S; Afzali, A; Mohebbi, A

    2015-02-01

    To evaluate effects of different concentrations of nanosilver colloid on the cell culture of Sertoli cells, the proportion of lipid peroxidation, antioxidant capacity, nitric oxide (NO) production and genes expression of superoxide dismutases (SOD1 and SOD2) and nitric oxide synthases (eNOS and iNOS) were measured. Sertoli cells were incubated at concentrations of 25, 75 and 125 ppm nanosilver for 48 h. There was progressive lipid peroxidation in treatments according to increasing of nanosilver. Lipid peroxidation, as indicated by malondialdehyde levels, was significantly elevated by the highest concentration of silver colloid (125 ppm), although antioxidant capacity, as measured by ferric ion reduction, was unaffected. Nitrite, as an index of NO production was reduced only in 125 ppm of nanosilver. Expression of SOD1 gene was reduced in nanosilver-treated cells at all concentrations, whereas expression of SOD2 gene was reduced only in cells treated with 125 ppm nanosilver. Expression of iNOS gene was progressively increased with higher concentrations of nanosilver. Expression of eNOS gene was also increased in 125 ppm of nanosilver. In conclusion, toxic effects of nanosilver could be due to high lipid peroxidation and suppression of antioxidant mechanisms via reduced expression of SOD genes and increased expression of NOS genes.

  20. Evolutionary origin of the NCSI gene subfamily encoding norcoclaurine synthase is associated with the biosynthesis of benzylisoquinoline alkaloids in plants

    PubMed Central

    Vimolmangkang, Sornkanok; Deng, Xianbao; Owiti, Albert; Meelaph, Thitirat; Ogutu, Collins; Han, Yuepeng

    2016-01-01

    Sacred lotus is rich in biologically active compounds, particularly benzylisoquinoline alkaloids (BIAs). Here, we report on isolation of genes encoding (S)-norcoclaurine synthase (NCS) in sacred lotus, which is a key entry-enzyme in BIA biosynthesis. Seven NCS genes, designated NnNCS1 through NnNCS7, were identified in the sacred lotus genome, and five are located next to each other within a 83 kb region on scaffold 8. The NCS genes are divided into two subfamilies, designated NCSI and NCSII. The NCSII genes are universal in plants, while the NCSI genes are only identified in a limited number of dicotyledonous taxa that produce BIAs. In sacred lotus, only NnNCS4 belongs to the NCSII subfamily, whilst the rest NCS genes within the NCSI subfamily. Overall, the NnNCS7 gene was predominantly expressed in all tested tissues, and its expression is significantly correlated with alkaloid content in leaf. In contrast, the NnNCS4 expression shows no significant correlation with alkaloid accumulation in leaf, and its lack of expression cannot inhibit alkaloid accumulation. Taken together, these results suggest that the NCSI subfamily is crucial for BIA biosynthesis, and its origin may represent an important evolutionary event that allows certain plant taxa to produce BIAs. PMID:27189519

  1. Prevalence of cystathionine beta synthase gene mutation 852Ins68 as a possible risk for neural tube defects in eastern India.

    PubMed

    Saxena, A K; Gupta, J; Pandey, S; Gangopadhaya, A N; Pandey, L K

    2011-01-01

    Cystathionine beta synthase gene (CβS) catalyzes the condensation of homocysteine with serine, forming cystathionine by the transsulfuration pathway. Disruption of CβS enzyme activity due to defective folic acid metabolism increases the risk factor for neural tube defects. We evaluated the CβS gene mutation in 25 children with neural tube defects (NTDs), including lumbosacral and thoracic myelomeningocele and open NTDs and mothers of cases, along with 25 healthy children and their mothers, serving as controls. Genomic DNA was isolated to assess the polymorphism of 852Ins68 in the CβS gene using PCR-RFLP analysis and nucleotide sequencing techniques. The 68-bp insertion was observed in one of the 25 NTD cases (lumbosacral myelomeningocele), and in two of the mothers of NTD cases. Statistical analysis was carried out using the Fischer exact probability test, which showed a lack of significance (P > 0.05), but the odds ratio of 2.08 with 95% confidence interval of 0.17-24.6 in NTDs mother was quite high because of the small sample size. However, the study was further extended to find out the involvement of specific nucleotide sequences, which again confirmed the 852Ins68 insertion and replacement of nucleotides (TCCAT to GGGG) in lumbosacral myelomeningocele (due to other category of NTDs), suggesting that it could be an independent risk factor for birth defects, including NTDs.

  2. Ambient pH Controls Glycogen Levels by Regulating Glycogen Synthase Gene Expression in Neurospora crassa. New Insights into the pH Signaling Pathway

    PubMed Central

    Cupertino, Fernanda Barbosa; Freitas, Fernanda Zanolli; de Paula, Renato Magalhães; Bertolini, Maria Célia

    2012-01-01

    Glycogen is a polysaccharide widely distributed in microorganisms and animal cells and its metabolism is under intricate regulation. Its accumulation in a specific situation results from the balance between glycogen synthase and glycogen phosphorylase activities that control synthesis and degradation, respectively. These enzymes are highly regulated at transcriptional and post-translational levels. The existence of a DNA motif for the Aspergillus nidulans pH responsive transcription factor PacC in the promoter of the gene encoding glycogen synthase (gsn) in Neurospora crassa prompted us to investigate whether this transcription factor regulates glycogen accumulation. Transcription factors such as PacC in A. nidulans and Rim101p in Saccharomyces cerevisiae play a role in the signaling pathway that mediates adaptation to ambient pH by inducing the expression of alkaline genes and repressing acidic genes. We showed here that at pH 7.8 pacC was over-expressed and gsn was down-regulated in wild-type N. crassa coinciding with low glycogen accumulation. In the pacCKO strain the glycogen levels and gsn expression at alkaline pH were, respectively, similar to and higher than the wild-type strain at normal pH (5.8). These results characterize gsn as an acidic gene and suggest a regulatory role for PACC in gsn expression. The truncated recombinant protein, containing the DNA-binding domain specifically bound to a gsn DNA fragment containing the PacC motif. DNA-protein complexes were observed with extracts from cells grown at normal and alkaline pH and confirmed by ChIP-PCR analysis. The PACC present in these extracts showed equal molecular mass, indicating that the protein is already processed at normal pH, in contrast to A. nidulans. Together, these results show that the pH signaling pathway controls glycogen accumulation by regulating gsn expression and suggest the existence of a different mechanism for PACC activation in N. crassa. PMID:22952943

  3. A WDR Gene Is a Conserved Member of a Chitin Synthase Gene Cluster and Influences the Cell Wall in Aspergillus nidulans.

    PubMed

    Guerriero, Gea; Silvestrini, Lucia; Obersriebnig, Michael; Hausman, Jean-Francois; Strauss, Joseph; Ezcurra, Inés

    2016-01-01

    WD40 repeat (WDR) proteins are pleiotropic molecular hubs. We identify a WDR gene that is a conserved genomic neighbor of a chitin synthase gene in Ascomycetes. The WDR gene is unique to fungi and plants, and was called Fungal Plant WD (FPWD). FPWD is within a cell wall metabolism gene cluster in the Ascomycetes (Pezizomycotina) comprising chsD, a Chs activator and a GH17 glucanase. The FPWD, AN1556.2 locus was deleted in Aspergillus nidulans strain SAA.111 by gene replacement and only heterokaryon transformants were obtained. The re-annotation of Aspergilli genomes shows that AN1556.2 consists of two tightly linked separate genes, i.e., the WDR gene and a putative beta-flanking gene of unknown function. The WDR and the beta-flanking genes are conserved genomic neighbors localized within a recently identified metabolic cell wall gene cluster in genomes of Aspergilli. The heterokaryons displayed increased susceptibility to drugs affecting the cell wall, and their phenotypes, observed by optical, confocal, scanning electron and atomic force microscopy, suggest cell wall alterations. Quantitative real-time PCR shows altered expression of some cell wall-related genes. The possible implications on cell wall biosynthesis are discussed.

  4. A WDR Gene Is a Conserved Member of a Chitin Synthase Gene Cluster and Influences the Cell Wall in Aspergillus nidulans

    PubMed Central

    Guerriero, Gea; Silvestrini, Lucia; Obersriebnig, Michael; Hausman, Jean-Francois; Strauss, Joseph; Ezcurra, Inés

    2016-01-01

    WD40 repeat (WDR) proteins are pleiotropic molecular hubs. We identify a WDR gene that is a conserved genomic neighbor of a chitin synthase gene in Ascomycetes. The WDR gene is unique to fungi and plants, and was called Fungal Plant WD (FPWD). FPWD is within a cell wall metabolism gene cluster in the Ascomycetes (Pezizomycotina) comprising chsD, a Chs activator and a GH17 glucanase. The FPWD, AN1556.2 locus was deleted in Aspergillus nidulans strain SAA.111 by gene replacement and only heterokaryon transformants were obtained. The re-annotation of Aspergilli genomes shows that AN1556.2 consists of two tightly linked separate genes, i.e., the WDR gene and a putative beta-flanking gene of unknown function. The WDR and the beta-flanking genes are conserved genomic neighbors localized within a recently identified metabolic cell wall gene cluster in genomes of Aspergilli. The heterokaryons displayed increased susceptibility to drugs affecting the cell wall, and their phenotypes, observed by optical, confocal, scanning electron and atomic force microscopy, suggest cell wall alterations. Quantitative real-time PCR shows altered expression of some cell wall-related genes. The possible implications on cell wall biosynthesis are discussed. PMID:27367684

  5. Functional Genomics Reveals That a Compact Terpene Synthase Gene Family Can Account for Terpene Volatile Production in Apple1[W

    PubMed Central

    Nieuwenhuizen, Niels J.; Green, Sol A.; Chen, Xiuyin; Bailleul, Estelle J.D.; Matich, Adam J.; Wang, Mindy Y.; Atkinson, Ross G.

    2013-01-01

    Terpenes are specialized plant metabolites that act as attractants to pollinators and as defensive compounds against pathogens and herbivores, but they also play an important role in determining the quality of horticultural food products. We show that the genome of cultivated apple (Malus domestica) contains 55 putative terpene synthase (TPS) genes, of which only 10 are predicted to be functional. This low number of predicted functional TPS genes compared with other plant species was supported by the identification of only eight potentially functional TPS enzymes in apple ‘Royal Gala’ expressed sequence tag databases, including the previously characterized apple (E,E)-α-farnesene synthase. In planta functional characterization of these TPS enzymes showed that they could account for the majority of terpene volatiles produced in cv Royal Gala, including the sesquiterpenes germacrene-D and (E)-β-caryophyllene, the monoterpenes linalool and α-pinene, and the homoterpene (E)-4,8-dimethyl-1,3,7-nonatriene. Relative expression analysis of the TPS genes indicated that floral and vegetative tissues were the primary sites of terpene production in cv Royal Gala. However, production of cv Royal Gala floral-specific terpenes and TPS genes was observed in the fruit of some heritage apple cultivars. Our results suggest that the apple TPS gene family has been shaped by a combination of ancestral and more recent genome-wide duplication events. The relatively small number of functional enzymes suggests that the remaining terpenes produced in floral and vegetative and fruit tissues are maintained under a positive selective pressure, while the small number of terpenes found in the fruit of modern cultivars may be related to commercial breeding strategies. PMID:23256150

  6. Methylation and Gene Expression Responses to Ethanol Feeding and Betaine Supplementation in the Cystathionine Beta Synthase-Deficient Mouse

    PubMed Central

    Medici, Valentina; Schroeder, Diane I.; Woods, Rima; LaSalle, Janine M.; Geng, Yongzhi; Shibata, Noreene M.; Peerson, Janet; Hodzic, Emir; Dayal, Sanjana; Tsukamoto, Hidekazu; Kharbanda, Kusum K.; Tillman, Brittany; French, Samuel W.; Halsted, Charles H.

    2014-01-01

    Background Alcoholic steatohepatitis (ASH) is caused in part by the effects of ethanol on hepatic methionine metabolism. Methods To investigate the phenotypic and epigenetic consequences of altered methionine metabolism in this disease, we studied the effects of 4-wk intragastric ethanol feeding with and without the methyl donor betaine in cystathionine beta synthase (CβS) heterozygous C57BL/6J mice. Results The histopathology of early ASH was induced by ethanol feeding and prevented by betaine supplementation, while ethanol feeding reduced and betaine supplementation maintained the hepatic methylation ratio of the universal methyl donor S-adenosylmethionine (SAM) to the methyltransferase inhibitor S-adenosylhomocysteine (SAH). MethylC-Seq genomic sequencing of heterozygous liver samples from each diet group found 2–4% reduced methylation in gene bodies but not promoter regions of all autosomes of ethanol fed mice, each of which were normalized in samples from mice fed the betaine supplemented diet. The transcript levels of inducible nitric oxide synthase (Nos2) and DNA methyltransferase 1 (Dnmt1) were increased, while those of peroxisome proliferator receptor-a (Pparα) were reduced in ethanol fed mice, and each was normalized in mice fed the betaine supplemented diet. DNA pyrosequencing of CβS heterozygous samples found reduced methylation in a gene body of Nos2 by ethanol feeding that was restored by betaine supplementation, and was correlated inversely with its expression and positively with SAM: SAH ratios. Conclusions The present studies have demonstrated relationships among ethanol induction of ASH with aberrant methionine metabolism that was associated with gene body DNA hypomethylation in all autosomes and was prevented by betaine supplementation. The data imply that ethanol-induced changes in selected gene transcript levels and hypomethylation in gene bodies during the induction of ASH is a result of altered methionine metabolism that can be reversed

  7. Functional genomics reveals that a compact terpene synthase gene family can account for terpene volatile production in apple.

    PubMed

    Nieuwenhuizen, Niels J; Green, Sol A; Chen, Xiuyin; Bailleul, Estelle J D; Matich, Adam J; Wang, Mindy Y; Atkinson, Ross G

    2013-02-01

    Terpenes are specialized plant metabolites that act as attractants to pollinators and as defensive compounds against pathogens and herbivores, but they also play an important role in determining the quality of horticultural food products. We show that the genome of cultivated apple (Malus domestica) contains 55 putative terpene synthase (TPS) genes, of which only 10 are predicted to be functional. This low number of predicted functional TPS genes compared with other plant species was supported by the identification of only eight potentially functional TPS enzymes in apple 'Royal Gala' expressed sequence tag databases, including the previously characterized apple (E,E)-α-farnesene synthase. In planta functional characterization of these TPS enzymes showed that they could account for the majority of terpene volatiles produced in cv Royal Gala, including the sesquiterpenes germacrene-D and (E)-β-caryophyllene, the monoterpenes linalool and α-pinene, and the homoterpene (E)-4,8-dimethyl-1,3,7-nonatriene. Relative expression analysis of the TPS genes indicated that floral and vegetative tissues were the primary sites of terpene production in cv Royal Gala. However, production of cv Royal Gala floral-specific terpenes and TPS genes was observed in the fruit of some heritage apple cultivars. Our results suggest that the apple TPS gene family has been shaped by a combination of ancestral and more recent genome-wide duplication events. The relatively small number of functional enzymes suggests that the remaining terpenes produced in floral and vegetative and fruit tissues are maintained under a positive selective pressure, while the small number of terpenes found in the fruit of modern cultivars may be related to commercial breeding strategies. PMID:23256150

  8. Delayed ripening and improved fruit processing quality in tomato by RNAi-mediated silencing of three homologs of 1-aminopropane-1-carboxylate synthase gene.

    PubMed</