Science.gov

Sample records for acid synthesis characterisation

  1. [New biological active derivatives of indomethacin and acetylsalicylic acid. Synthesis, physico-chemical characterisation and structure validation].

    PubMed

    Stan, Catalina; Stefanache, Alina; Dumitrache, M

    2006-01-01

    It is well known that niflumic acid glycinamide has a good antiinflammatory action useful in gum inflammatory diseases. The objective of this study was to obtain new glycinamides of acetylsalicylic acid and indomethacin, which could have a better antiinflammatory action than niflumic acid glycinamide. The study presents the synthesis, physico-chemical characterisation and structure validation of these glycinamides.

  2. Synthesis and structural characterisation of amides from picolinic acid and pyridine-2,6-dicarboxylic acid

    PubMed Central

    Devi, Prarthana; Barry, Sarah M.; Houlihan, Kate M.; Murphy, Michael J.; Turner, Peter; Jensen, Paul; Rutledge, Peter J.

    2015-01-01

    Coupling picolinic acid (pyridine-2-carboxylic acid) and pyridine-2,6-dicarboxylic acid with N-alkylanilines affords a range of mono- and bis-amides in good to moderate yields. These amides are of interest for potential applications in catalysis, coordination chemistry and molecular devices. The reaction of picolinic acid with thionyl chloride to generate the acid chloride in situ leads not only to the N-alkyl-N-phenylpicolinamides as expected but also the corresponding 4-chloro-N-alkyl-N-phenylpicolinamides in the one pot. The two products are readily separated by column chromatography. Chlorinated products are not observed from the corresponding reactions of pyridine-2,6-dicarboxylic acid. X-Ray crystal structures for six of these compounds are described. These structures reveal a general preference for cis amide geometry in which the aromatic groups (N-phenyl and pyridyl) are cis to each other and the pyridine nitrogen anti to the carbonyl oxygen. Variable temperature 1H NMR experiments provide a window on amide bond isomerisation in solution. PMID:25954918

  3. Synthesis, characterisation and antioxidant features of procyanidin B4 and malvidin-3-glucoside stearic acid derivatives.

    PubMed

    Cruz, Luis; Fernandes, Virgínia C; Araújo, Paula; Mateus, Nuno; de Freitas, Victor

    2015-05-01

    The acylation of procyanidin B4 with a saturated fatty acid chloride containing 18 carbon atoms was studied in order to obtain procyanidin B4 3-O-di-stearic acid conjugate. This compound was structurally characterised by mass spectrometry and 1D and 2D NMR techniques. Derivatization of malvidin-3-glucoside using stearoyl chloride in acetonitrile was also performed yielding mono-, di- and tri-stearic ester derivatives. The novel derivatives obtained revealed significant antioxidant activity, although lower than the respective precursors. However, the chemical modification of anthocyanins and procyanidins (water soluble pigments) to more lipophilic compounds has the advantage of increased bioavailability in biological matrices, and to potentiate their application in food matrices and cosmetic products.

  4. Structural Characterisation of FabG from Yersinia pestis, a Key Component of Bacterial Fatty Acid Synthesis

    PubMed Central

    Nanson, Jeffrey D.; Forwood, Jade K.

    2015-01-01

    Ketoacyl-acyl carrier protein reductases (FabG) are ubiquitously expressed enzymes that catalyse the reduction of acyl carrier protein (ACP) linked thioesters within the bacterial type II fatty acid synthesis (FASII) pathway. The products of these enzymes, saturated and unsaturated fatty acids, are essential components of the bacterial cell envelope. The FASII reductase enoyl-ACP reductase (FabI) has been the focus of numerous drug discovery efforts, some of which have led to clinical trials, yet few studies have focused on FabG. Like FabI, FabG appears to be essential for survival in many bacteria, similarly indicating the potential of this enzyme as a drug target. FabG enzymes are members of the short-chain alcohol dehydrogenase/reductase (SDR) family, and like other SDRs, exhibit highly conserved secondary and tertiary structures, and contain a number of conserved sequence motifs. Here we describe the crystal structures of FabG from Yersinia pestis (YpFabG), the causative agent of bubonic, pneumonic, and septicaemic plague, and three human pandemics. Y. pestis remains endemic in many parts of North America, South America, Southeast Asia, and Africa, and a threat to human health. YpFabG shares a high degree of structural similarity with bacterial homologues, and the ketoreductase domain of the mammalian fatty acid synthase from both Homo sapiens and Sus scrofa. Structural characterisation of YpFabG, and comparison with other bacterial FabGs and the mammalian fatty acid synthase, provides a strong platform for virtual screening of potential inhibitors, rational drug design, and the development of new antimicrobial agents to combat Y. pestis infections. PMID:26539719

  5. Synthesis, characterisation and biological evaluation of copper and silver complexes based on acetylsalicylic acid.

    PubMed

    Rubner, Gerhard; Bensdorf, Kerstin; Wellner, Anja; Bergemann, Silke; Gust, Ronald

    2011-10-01

    Metalcarbonyl complexes with ligands derived from acetylsalicylic acid demonstrated high cytotoxic potential against various tumor cell lines and strong inhibition of the cyclooxygenase enzymes COX-1 and 2. In this study we tried to achieve comparable effects with [alkyne]silver or copper trifluoromethanesulfonate complexes which are more hydrophilic then the uncharged metalcarbonyl derivatives. All compounds were evaluated for growth inhibition against breast (MCF-7, MDA-MB 231) and colon cancer (HT-29) cell lines and for COX-1 and COX-2 inhibitory effects at isolated isoenzymes. Pure ligands showed neither cytotoxic nor COX-inhibitory effects. While the silver complexes of (but-2-ynyl)-2-acetoxybenzoate (But-ASS-Ag) and (but-2-yne-1,4-diyl)-bis(2-acetoxybenzoate) (Di-ASS-But-Ag) were strong cytostatics, only the copper complex Di-ASS-But-Cu was active. At the COX enzymes the complexes were more effective than their ligands and aspirin.

  6. Synthesis and characterisation of chromium carbides

    NASA Astrophysics Data System (ADS)

    Detroye, M.; Reniers, F.; Buess-Herman, C.; Vereecken, J.

    1997-11-01

    This paper presents the synthesis and the characterisation of various chromium carbide compounds. Thin Cr 23C 6 films were deposited by reactive sputtering while Cr 7C 3 films were formed by the carburisation of chromium films in a CH 4/H 2 atmosphere. Cr xC y powders were synthesised from various precursors (Cr, CrN, Cr 2O 3) by reaction with CH 4/H 2 at high temperature. The samples were characterised by AES, XRD and electron diffraction. The effects of the experimental parameters (gas composition, temperature, reaction time) on the purity, the phase formed and the composition of the product of reaction are examined and discussed.

  7. Synthesis and characterisation of mucoadhesive thiolated polyallylamine.

    PubMed

    Duggan, Sarah; Hughes, Helen; Owens, Eleanor; Duggan, Elaine; Cummins, Wayne; O' Donovan, Orla

    2016-02-29

    The thiolation of polyallylamine (PAAm) for use in mucoadhesive drug delivery has been achieved. PAAm was reacted with different ratios of Traut's reagent, yielding products with thiol contents ranging from 134-487μmol/g. Full mucoadhesive characterisation of the thiolated PAAm samples was conducted using swelling studies, mucoadhesive testing on porcine intestinal tissue and rheology. Both swelling and cohesive properties of the thiolated PAAm products were vastly improved in comparison to an unmodified PAAm control. The swelling abilities of the thiolated samples were high and the degree of thiolation of the products affected the initial rate of swelling. High levels of mucoadhesion were demonstrated by the thiolated PAAm samples, with adhesion times of greater than 24h measured for all three samples and, thus, thiol content did not appear to influence mucoadhesion. Rheological studies of the thiolated PAAm samples showed an increase in G' and G″ values upon the addition of a mucin solution which was not observed in the unmodified control, again highlighting the mucoadhesive interactions between these thiolated polymers and mucin. The synthesis of thiolated PAAm by reaction with Traut's reagent and resulting mucoadhesive properties demonstrates its potential for use a mucoadhesive drug delivery device.

  8. The synthesis and characterisation of coordination and hydrogen-bonded networks based on 4-(3,5-dimethyl-1H-pyrazol-4-yl)benzoic acid.

    PubMed

    Bryant, Macguire R; Burrows, Andrew D; Fitchett, Christopher M; Hawes, Chris S; Hunter, Sally O; Keenan, Luke L; Kelly, David J; Kruger, Paul E; Mahon, Mary F; Richardson, Christopher

    2015-05-21

    The synthesis, structural and thermal characterisation of a number of coordination complexes featuring the N,O-heteroditopic ligand 4-(3,5-dimethyl-1H-pyrazol-4-yl)benzoate, HL are reported. The reaction of H2L with cobalt(II) and nickel(II) nitrates at room temperature in basic DMF/H2O solution gave discrete mononuclear coordination complexes with the general formula {[M(HL)2(H2O)4]·2DMF} (M = Co (1), Ni (2)), whereas the reaction with zinc(II) nitrate gave [Zn(HL)2]∞, 3, a coordination polymer with distorted diamondoid topology and fourfold interpenetration. Coordination about the tetrahedral Zn(II) nodes in 3 are furnished by two pyrazolyl nitrogen atoms and two carboxylate oxygen atoms to give a mixed N2O2 donor set. Isotopological coordination polymers of zinc(II), {[Zn(HL)2]·2CH3OH·H2O}∞, 4, and cobalt(II), [Co(HL)2]∞, 5, are formed when the reactions are carried out under solvothermal conditions in methanol (80 °C) and water (180 °C), respectively. The reaction of H2L with cadmium(II) nitrate at room temperature in methanol gives {[Cd(HL)2(MeOH)2]·1.8MeOH}∞6, a 2-D (4,4)-connected coordination polymer, whereas with copper(II) the formation of green crystals that transform into purple crystals is observed. The metastable green phase [Cu3(HL)4(μ2-SO4)(H2O)3]∞, 7, crystallises with conserved binding domains of the heteroditopic ligand and contains two different metal nodes: a dicopper carboxylate paddle wheel motif, and, a dicopper unit bridged by sulfate ions and coordinated by ligand pyrazolyl nitrogen atoms. The resultant purple phase {[Cu(HL)2]·4CH3OH·H2O}∞, 8, however, has single copper ion nodes coordinated by mixed N2O2 donor sets with trans-square planar geometry and is threefold interpenetrated. The desolvation of 8 was followed by powder X-ray diffraction and single crystal X-ray diffraction which show desolvation induces the transition to a more closely packed structure while the coordination geometry about the copper ions and

  9. Molecularly imprinted polymers: synthesis and characterisation.

    PubMed

    Cormack, Peter A G; Elorza, Amaia Zurutuza

    2004-05-01

    This short review aims to present, in clear English, a summary of the principal synthetic considerations pertaining to good practice in the polymerisation aspects of molecular imprinting, and is primarily aimed at researchers familiar with molecular imprinting methods but with little or no prior experience in polymer synthesis. It is our hope that this will facilitate researchers to plan their own syntheses of molecular imprints in a more logical and structured fashion, and to begin to appreciate the limitations of the present synthetic approaches in this molecularly complex area, as well as the scope for rationally designing improved imprinted materials in the future.

  10. Synthesis of amino acids

    DOEpatents

    Davis, J.W. Jr.

    1979-09-21

    A method is described for synthesizing amino acids preceding through novel intermediates of the formulas: R/sub 1/R/sub 2/C(OSOC1)CN, R/sub 1/R/sub 2/C(C1)CN and (R/sub 1/R/sub 2/C(CN)O)/sub 2/SO wherein R/sub 1/ and R/sub 2/ are each selected from hydrogen and monovalent hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  11. Synthesis, characterisation of polyaniline-Fe3O4 magnetic nanocomposite and its application for removal of an acid violet 19 dye

    NASA Astrophysics Data System (ADS)

    Patil, Manohar R.; Khairnar, Subhash D.; Shrivastava, V. S.

    2016-04-01

    The present work deals with the development of a new method for the removal of dyes from an aqueous solution using polyaniline (PANI)-Fe3O4 magnetic nanocomposite. It is synthesised in situ through self-polymerisation of monomer aniline. Photocatalytic degradation studies were carried out for cationic acid violet 19 (acid fuchsine) dye using PANI-Fe3O4 nanocomposite in aqueous solution. Different parameters like catalyst dose, contact time and pH have been studied to optimise reaction condition. The optimum conditions for the removal of the dye are initial concentration 20 mg/l, adsorbent dose 6 gm/l, pH 7. The EDS technique gives elemental composition of synthesised PANI-Fe3O4. The SEM and XRD studies were carried for morphological feature characteristics of PANI-Fe3O4 nanocomposite. The VSM (vibrating sample magnetometer) gives magnetic property of PANI-Fe3O4 nanocomposite; also FT-IR analysis gives characteristics frequency of synthesised PANI-Fe3O4. Besides the above studies kinetic study has also been carried out.

  12. Electrochemical synthesis, characterisation and phytogenic properties of silver nanoparticles

    NASA Astrophysics Data System (ADS)

    Singaravelan, R.; Bangaru Sudarsan Alwar, S.

    2015-11-01

    This work exemplifies a simple and rapid method for the synthesis of silver nanodendrite with a novel electrochemical technique. The antibacterial activity of these silver nanoparticles (Ag NPs) against pathogenic bacteria was investigated along with the routine study of optical and spectral characterisation. The optical properties of the silver nanoparticles were characterised by diffuse reflectance spectroscopy. The optical band gap energy of the electrodeposited Ag NPs was determined from the diffuse reflectance using Kubelka-Munk formula. X-ray diffraction (XRD) studies were carried out to determine the crystalline nature of the silver nanoparticles which confirmed the formation of silver nanocrystals. The XRD pattern revealed that the electrodeposited Ag NPs were in the cubic geometry with dendrite preponderance. The average particle size and the peak broadening were deliberated using Debye-Scherrer equation and lattice strain due to the peak broadening was studied using Williamson-Hall method. Surface morphology of the Ag NPs was characterised by high-resolution scanning electron microscope and the results showed the high degree of aggregation in the particles. The antibacterial activity of the Ag NPs was evaluated and showed unprecedented level antibacterial activity against multidrug resistant strains such as Staphylococcus aureus, Bacillus subtilis, Klebsiella pneumonia and Escherichia coli in combination with Streptomycin.

  13. Synthesis, characterisation and microbial utilisation of amorphous polysugars from lactose.

    PubMed

    Daines, Alison M; Smart, Zlatka; Sims, Ian M; Tannock, Gerald W; Hinkley, Simon F R

    2015-03-01

    The melt polymerisations of glucose, galactose, xylose and fucose with citric acid, and mixtures of sugars therein are reported. Characterisation of the citric-acid catalysed reaction products indicated similar degrees of branched polymerisation but differences in the overall molecular weight of the polymers produced. The dairy by-product lactose could not be polymerised in a similar fashion but was shown to be readily hydrolysed using microwave radiation and a polymer generated from the melt condensation of the resultant glucose and galactose monosaccharides. A preliminary assessment of the bifido-bacterial utilisation of the lactose-derived polymerised products demonstrated a significantly different growth profile compared to commercially utilised galactooligosaccharides (GOS). PMID:25498629

  14. Characterisation of blends of paracetamol and citric acid.

    PubMed

    Hoppu, Pekka; Jouppila, Kirsi; Rantanen, Jukka; Schantz, Staffan; Juppo, Anne M

    2007-03-01

    The purpose of this study was to characterise physically stable amorphous blends that were sticky (low glass transition temperature) in ambient conditions. The effects of composition, melting time and melting temperature were evaluated with respect to physical and chemical property. Citric acid anhydrate and paracetamol were melt-quenched as binary mixtures and as pure materials. Bulk samples were characterised by differential scanning calorimetry, X-ray powder diffractometry, and Raman and Fourier transform infrared spectroscopy. The composition and the sample exposure to moisture affected significantly the physical stability of samples. The extreme melting conditions, coupled with long exposure to heat and a high melting temperature, lowered the overall crystallisation rate. Paracetamol had a stronger tendency to crystallise from the blends than did citric acid. The 50:50% (w/w) blend was physically stable for at least 27 weeks in dry conditions and was partly crystalline after 4 weeks of storage at a relative humidity of 43%. The result of the physical stability of blends is discussed in terms of hydrogen bonding interaction between paracetamol and citric acid and in relation to degradation products formed in a mixing state. PMID:17331340

  15. The capacity for long-chain polyunsaturated fatty acid synthesis in a carnivorous vertebrate: Functional characterisation and nutritional regulation of a Fads2 fatty acyl desaturase with Δ4 activity and an Elovl5 elongase in striped snakehead (Channa striata).

    PubMed

    Kuah, Meng-Kiat; Jaya-Ram, Annette; Shu-Chien, Alexander Chong

    2015-03-01

    The endogenous production of long-chain polyunsaturated fatty acids (LC-PUFA) in carnivorous teleost species inhabiting freshwater environments is poorly understood. Although a predatory lifestyle could potentially supply sufficient LC-PUFA to satisfy the requirements of these species, the nutrient-poor characteristics of the freshwater food web could impede this advantage. In this study, we report the cloning and functional characterisation of an elongase enzyme in the LC-PUFA biosynthesis pathway from striped snakehead (Channa striata), which is a strict freshwater piscivore that shows high deposition of LC-PUFA in its flesh. We also functionally characterised a previously isolated fatty acyl desaturase cDNA from this species. Results showed that the striped snakehead desaturase is capable of Δ4 and Δ5 desaturation activities, while the elongase showed the characteristics of Elovl5 elongases. Collectively, these findings reveal that striped snakehead exhibits the genetic resources to synthesise docosahexaenoic acid (DHA; 22:6n-3) from eicosapentaenoic acid (EPA; 20:5n-3). Both genes are expressed at considerable levels in the brain and the liver. In liver, both genes were up-regulated by dietary C18 PUFA, although this increase did not correspond to a significant rise in the deposition of muscle LC-PUFA. Brain tissue of fish fed with plant oil diets showed higher expression of fads2 gene compared to fish fed with fish oil-based diet, which could ensure DHA levels remain constant under limited dietary DHA intake. This suggests the importance of DHA production from EPA via the ∆4 desaturation step in order to maintain an optimal reserve of DHA in the neuronal tissues of carnivores.

  16. The capacity for long-chain polyunsaturated fatty acid synthesis in a carnivorous vertebrate: Functional characterisation and nutritional regulation of a Fads2 fatty acyl desaturase with Δ4 activity and an Elovl5 elongase in striped snakehead (Channa striata).

    PubMed

    Kuah, Meng-Kiat; Jaya-Ram, Annette; Shu-Chien, Alexander Chong

    2015-03-01

    The endogenous production of long-chain polyunsaturated fatty acids (LC-PUFA) in carnivorous teleost species inhabiting freshwater environments is poorly understood. Although a predatory lifestyle could potentially supply sufficient LC-PUFA to satisfy the requirements of these species, the nutrient-poor characteristics of the freshwater food web could impede this advantage. In this study, we report the cloning and functional characterisation of an elongase enzyme in the LC-PUFA biosynthesis pathway from striped snakehead (Channa striata), which is a strict freshwater piscivore that shows high deposition of LC-PUFA in its flesh. We also functionally characterised a previously isolated fatty acyl desaturase cDNA from this species. Results showed that the striped snakehead desaturase is capable of Δ4 and Δ5 desaturation activities, while the elongase showed the characteristics of Elovl5 elongases. Collectively, these findings reveal that striped snakehead exhibits the genetic resources to synthesise docosahexaenoic acid (DHA; 22:6n-3) from eicosapentaenoic acid (EPA; 20:5n-3). Both genes are expressed at considerable levels in the brain and the liver. In liver, both genes were up-regulated by dietary C18 PUFA, although this increase did not correspond to a significant rise in the deposition of muscle LC-PUFA. Brain tissue of fish fed with plant oil diets showed higher expression of fads2 gene compared to fish fed with fish oil-based diet, which could ensure DHA levels remain constant under limited dietary DHA intake. This suggests the importance of DHA production from EPA via the ∆4 desaturation step in order to maintain an optimal reserve of DHA in the neuronal tissues of carnivores. PMID:25542509

  17. Synthesis, characterisation and application of silica-magnetite nanocomposites

    NASA Astrophysics Data System (ADS)

    Bruce, Ian J.; Taylor, James; Todd, Michael; Davies, Martin J.; Borioni, Enrico; Sangregorio, Claudio; Sen, Tapas

    2004-12-01

    Silica-magnetite composites were prepared for eventual applications in biomolecular separations (nucleic acids). Their production on large scale has been optimised and they have been extensively characterised in a physical and chemical context. They perform at least as well, if not better than a commercially available equivalent at adsorbing and eluting DNA. Several methods for the preparation of magnetite were compared in order to select one, which produced particles, possessing high magnetic susceptibility, low rate of sedimentation and good chemical stability. Of the main methods studied: (i) oxidative hydrolysis of iron(II) sulphate in alkaline media, (ii) alkaline hydrolysis of iron(II) and iron(III) chloride solutions, and (iii) precipitation from iron(II) and iron(III) chloride solutions by hydrolysis of urea, method (i) produced the 'best' magnetite particles. Silica-magnetite composites were prepared using the 'best' magnetite, and, for comparison, two methods for depositing silica were used to coat the silica onto magnetite nanoparticles, from silicic acid at pH 10 and by acid hydrolysis of tetraethoxysilane (TEOS) at 90 °C. The best method for yielding silica-magnetite composites that worked well in DNA adsorption and elution proved to be that involving silicic acid and this material could be made in 20 g batch sizes. Silica-magnetite composites from the two methods proved to have distinct and different physical and chemical properties. All magnetite and silica-magnetite samples were fully characterised for their relative chemical composition using Fourier-transform infrared, XRF and thermo-gravimetric analysis. Their physical characteristics were determined using scanning electron microscopy and N2 adsorption and Mossbauer spectroscopy was used to confirm the identity of the iron oxides produced. Selected samples were comparatively tested for their ability to adsorb, and subsequently elute, 2-deoxyguanosine-5-monophosphate (GMP) and its non

  18. Chemical characterisation and application of acid whey in fermented milk.

    PubMed

    Lievore, Paolla; Simões, Deise R S; Silva, Karolline M; Drunkler, Northon L; Barana, Ana C; Nogueira, Alessandro; Demiate, Ivo M

    2015-04-01

    Acid whey is a by-product from cheese processing that can be employed in beverage formulations due to its high nutritional quality. The objective of the present work was to study the physicochemical characterisation of acid whey from Petit Suisse-type cheese production and use this by-product in the formulation of fermented milk, substituting water. In addition, a reduction in the fermentation period was tested. Both the final product and the acid whey were analysed considering physicochemical determinations, and the fermented milk was evaluated by means of sensory analysis, including multiple comparison and acceptance tests, as well as purchase intention. The results of the physicochemical analyses showed that whey which was produced during both winter and summer presented higher values of protein (1.22 and 0.97 %, w/v, respectively), but there were no differences in lactose content. During the autumn, the highest solid extract was found in whey (6.00 %, w/v), with larger amounts of lactose (4.73 %, w/v) and ash (0.83 %, w/v). When analysing the fermented milk produced with added acid whey, the acceptance test resulted in 90 % of acceptance; the purchase intention showed that 54 % of the consumers would 'certainly buy' and 38 % would 'probably buy' the product. Using acid whey in a fermented milk formulation was technically viable, allowing by-product value aggregation, avoiding discharge, lowering water consumption and shortening the fermentation period. PMID:25829588

  19. Isolation and characterisation of lactic acid bacteria from donkey milk.

    PubMed

    Soto Del Rio, Maria de Los Dolores; Andrighetto, Christian; Dalmasso, Alessandra; Lombardi, Angiolella; Civera, Tiziana; Bottero, Maria Teresa

    2016-08-01

    During the last years the interest in donkey milk has increased significantly mainly because of its compelling functional elements. Even if the composition and nutritional properties of donkey milk are known, its microbiota is less studied. This Research Communication aimed to provide a comprehensive characterisation of the lactic acid bacteria in raw donkey milk. RAPD-PCR assay combined with 16S rDNA sequencing analysis were used to describe the microbial diversity of several donkey farms in the North West part of Italy. The more frequently detected species were: Lactobacillus paracasei, Lactococcus lactis and Carnobacterium maltaromaticum. Less abundant genera were Leuconostoc, Enterococcus and Streptococcus. The yeast Kluyveromyces marxianus was also isolated. The bacterial and biotype distribution notably diverged among the farms. Several of the found species, not previously detected in donkey milk, could have an important probiotic activity and biotechnological potential. This study represents an important insight to the ample diversity of the microorganisms present in the highly selective ecosystem of raw donkey milk. PMID:27600975

  20. Purification, amino acid sequence and characterisation of kangaroo IGF-I.

    PubMed

    Yandell, C A; Francis, G L; Wheldrake, J F; Upton, Z

    1998-01-01

    Insulin-like growth factor-I (IGF-I) and IGF-II have been purified to homogeneity from kangaroo (Macropus fuliginosus) serum, thus this represents the first report of the purification, sequencing and characterisation of marsupial IGFs. N-Terminal protein sequencing reveals that there are six amino acid differences between kangaroo and human IGF-I. Kangaroo IGF-II has been partially sequenced and no differences were found between human and kangaroo IGF-II in the 53 residues identified. Thus the IGFs appear to be remarkably structurally conserved during mammalian radiation. In addition, in vitro characterisation of kangaroo IGF-I demonstrated that the functional properties of human, kangaroo and chicken IGF-I are very similar. In an assay measuring the ability of the proteins to stimulate protein synthesis in rat L6 myoblasts, all IGF-I proteins were found to be equally potent. The ability of all three proteins to compete for binding with radiolabelled human IGF-I to type-1 IGF receptors in L6 myoblasts and in Sminthopsis crassicaudata transformed lung fibroblasts, a marsupial cell line, was comparable. Furthermore, kangaroo and human IGF-I react equally in a human IGF-I RIA using a human reference standard, radiolabelled human IGF-I and a polyclonal antibody raised against recombinant human IGF-I. This study indicates that not only is the primary structure of eutherian and metatherian IGF-I conserved, but also the proteins appear to be functionally similar.

  1. Simulated synthesis of lithium manganese oxide nanostructures and their characterisation.

    NASA Astrophysics Data System (ADS)

    Ngoepe, Phuti; Ledwaba, Sylvia; Sayle, Dean

    Simulated amorphisation recrystallization methods, are now routinely used to generate models of various nano-architectures for metal oxides with complex microstructural details. Nano-architectures, i.e. nano- sphere, sheet, porous and bulk, associated with the Li-Mn-O ternary were synthesised from amorphous spinel nanosphere. The resulting crystallised nanostructures are characterised from visual images, radial distribution functions, XRDs and simulated microstructures. An analysis of microstructures and simulated X-ray diffractions reveals the presence of the layered Li2MnO3 and spinel LiMn2O4 together with a wide variety of defects, including grain boundaries and ion vacancies. Acknowledge support from the National Research Fundation, Pretoria.

  2. Abiotic synthesis of fatty acids

    NASA Technical Reports Server (NTRS)

    Leach, W. W.; Nooner, D. W.; Oro, J.

    1978-01-01

    The formation of fatty acids by Fischer-Tropsch-type synthesis was investigated with ferric oxide, ammonium carbonate, potassium carbonate, powdered Pueblito de Allende carbonaceous chondrite, and filings from the Canyon Diablo meteorite used as catalysts. Products were separated and identified by gas chromatography and mass spectrometry. Iron oxide, Pueblito de Allende chondrite, and Canyon Diablo filings in an oxidized catalyst form yielded no fatty acids. Canyon Diablo filings heated overnight at 500 C while undergoing slow purging by deuterium produced fatty acids only when potassium carbonate was admixed; potassium carbonate alone also produced these compounds. The active catalytic combinations gave relatively high yields of aliphatic and aromatic hydrocarbons; substantial amounts of n-alkenes were almost invariably observed when fatty acids were produced; the latter were in the range C6 to C18, with maximum yield in C9 or 10.

  3. Synthesis and characterisation of cationically modified phospholipid polymers.

    PubMed

    Lewis, Andrew L; Berwick, James; Davies, Martyn C; Roberts, Clive J; Wang, Jin-Hai; Small, Sharon; Dunn, Anthony; O'Byrne, Vincent; Redman, Richard P; Jones, Stephen A

    2004-07-01

    Phospholipid-like copolymers based on 2-(methacryloyloxyethyl) phosphorylcholine were synthesised using monomer-starved free radical polymerisation methods and incorporating cationic charge in the form of the choline methacrylate monomer in amounts varying from 0 to 30 wt%, together with a 5 wt% silyl cross-linking agent in order to render them water-insoluble once thermally cured. Characterisation using a variety of techniques including nuclear magnetic resonance spectroscopy, high-pressure liquid chromatography and gel permeation chromatography showed the cationic monomer did not interfere with the polymerisation and that the desired amount of charge had been incorporated. Gravimetric and differential scanning calorimetry methods were used to evaluate the water contents of polymer membranes cured at 70 degrees C, which was seen to increase with increasing cation content, producing materials with water contents ranging from 50% to 98%. Surface plasmon resonance indicated that the coatings swelled rapidly in water, the rate and extent of swelling increasing with increasing cation level. Dynamic contact angle showed that coatings of all the polymers possessed a hydrophobic surface when dry in air, characteristic of the alkyl chains expressed at the surface (>100 degrees advancing angle). Rearrangement of the hydrophilic groups to the surface occurred once wet, to produce highly wettable surfaces with a decrease in advancing angle with increasing cation content. Atomic force microscopy showed all polymer films to be smooth with no features in topographical or phase imaging. Mechanical properties of the dry films were also unaffected by the increase in cation content.

  4. Synthesis and characterisation: Zinc oxide-sulfide nanocomposites

    NASA Astrophysics Data System (ADS)

    Verma, Prinsa; Pandey, Avinash C.; Bhargava, R. N.

    2009-11-01

    A novel synthesis method is presented for the preparation of nanosized-semiconductor zinc oxide-sulphide (ZnO/ZnS) core-shell nanocomposites, both formed sequentially from a single-source solid precursor. ZnO nanocrystals were synthesized by a simple co-precipitation method and ZnO/ZnS core-shell nanocomposites were successfully fabricated by sulfidation of ZnO nanocrystals via a facile chemical synthesis at room temperature. The as-obtained samples were characterized by X-ray diffraction and transmission electron microscopy. The results showed that the pure ZnO nanocrystals were hexagonal wurtzite crystal structures and the ZnS nanoparticles were sphalerite structure with the size of about 10 nm grown on the surface of the ZnO nanocrystals. Optical properties measured reveal that ZnO/ZnS core-shell nanocomposites have integrated the photoluminescent effect of ZnO and ZnS. Based on the results of the experiments, a possible formation mechanism of ZnO/ZnS core-shell nanocomposites was also suggested. This treatment is suggested to improve various properties of optoelectronically valuable ZnO/ZnS nanocomposites. These nanosized semiconductor nanocomposites can form a new class of luminescent materials for various applications.

  5. Isotopic characterisation of prebiotic synthesis of organic material

    NASA Technical Reports Server (NTRS)

    Kerridge, J. F.; Chang, S.

    1986-01-01

    Many primitive meteorites contain an insoluble organic material, much like terrestrial kerogen, whose mode of origin is currently unknown. When sujbected to stepwise decomposition, this material, unlike its terrestrial counterpart, reveals characteristic release patterns for the stable isotopes of carbon, hydrogen and nitrogen as a function of fractional release of each element. The purpose of this study is to try to match those release patterns using organic matter synthesised in the laboratory under controlled conditions. If successful, such a study would shed light on the origin of kerogen-like organic matter in the early solar system and, by extension, on prebiotic organic synthesis in general. The range of possible syntheses, starting materials and reaction conditions to be investigated is considerable. Samples analysed to date include: a heavy oil produced by Fischer-Tropsch-type catalysis of CO + H2; a solid residue generated by a plasma discharge in CO + H2 + N2; a solid deposited on the electrodes of a Miller-Urey synthesis operating on CH4 + H2O + N2; and a solid residue formed by polymerization of light hydrocarbons procured by a Miller-Urey discharge acting on CH4. Significant structure is observed in the release patterns for the carbon and hydrogen isotopes from the synthetic samples, though there is little evidence for isotopic fractionation during the analysis itself.

  6. Synthesis and characterisation of nonclassical ruthenium hydride complexes containing chelating bidentate and tridentate phosphine ligands.

    PubMed

    Prechtl, Martin H G; Ben-David, Yehoshoa; Giunta, Daniela; Busch, Stefan; Taniguchi, Yuki; Wisniewski, Wolfgang; Görls, Helmar; Mynott, Richard J; Theyssen, Nils; Milstein, David; Leitner, Walter

    2007-01-01

    The synthesis and characterisation of nonclassical ruthenium hydride complexes containing bidentate PP and tridentate PCP and PNP pincer-type ligands are described. The mononuclear and dinuclear ruthenium complexes presented have been synthesised in moderate to high yields by the direct hydrogenation route (one-pot synthesis) or in a two-step procedure. In both cases [Ru(cod)(metallyl)(2)] served as a readily available precursor. The influences of the coordination geometry and the ligand framework on the structure, binding, and chemical properties of the M--H(2) fragments were studied by X-ray crystal structure analysis, spectroscopic methods, and reactivity towards N(2), D(2), and deuterated solvents.

  7. Synthesis, characterisation, electrical and optical properties of copper borate compounds

    SciTech Connect

    Kipcak, Azmi Seyhun; Senberber, Fatma Tugce; Aydin Yuksel, Sureyya; Derun, Emek Moroydor; Piskin, Sabriye

    2015-10-15

    Highlights: • Cu(BO{sub 2}){sub 2} was synthesized at the form of with pdf number of “00-001-0472”. • Particle sizes were found between 162.72 and 56.44 nm and 195.76 and 75.73 nm at CuSNaH. • Reaction yields were 90.4 ± 0.84, 96.9 ± 0.78 and 78.9 ± 0.76% for CuST, CuSB and CuSNaH. • The resistivity of CuST, CuSB and CuSNaH are 1.10 × 10{sup 7}, 7.02 × 10{sup 6} and 8.62 × 10{sup 5} Ωm. • The optical energy gap was 3.76 eV. - Abstract: The hydrothermal synthesis of copper borate compounds [Cu(BO{sub 2}){sub 2}] was studied, and several parameters were found to affect the synthesis. Raw materials, including CuSO{sub 4}·5H{sub 2}O, Na{sub 2}B{sub 4}O{sub 7}·5H{sub 2}O, Na{sub 2}B{sub 4}O{sub 7}·10H{sub 2}O, NaOH and H{sub 3}BO{sub 3}, were used. Reaction temperatures and reaction times between 40 °C and 100 °C and 15 and 240 min, respectively, were used. The as-synthesised copper borate was analysed using X-ray diffraction (XRD), Fourier transform infrared spectroscopy (FT-IR) and scanning electron microscopy (SEM). The yields of the reactions were also calculated. Single-phase, nanoparticulate copper borate compounds (Cu(BO{sub 2}){sub 2}) possessing high XRD crystal scores were obtained; the reactions used to obtain these materials were highly efficient. Electrical resistivity and optical absorbance measurements were carried out on the compounds obtained from the highest yielding reactions. The results of this study showed that even using a reaction time of 15 min, copper borate formation was successfully achieved.

  8. Radiation synthesis and characterisation of the network structure of natural/synthetic double-network superabsorbent polymers

    NASA Astrophysics Data System (ADS)

    Şen, Murat; Hayrabolulu, Hande

    2012-09-01

    In this study radiation synthesis and characterisation of the network structure of acrylic acid sodium salt/locust bean gum, (AAcNa/LBG) natural/synthetic double-network super absorbent polymers were investigated. Quartet systems composed of acrylic acid sodium salt/locust bean gum/N,N methylene bis acrylamide/water (AAcNa/LBG/MBAAm/water) were prepared at varying degree of neutralisations (DN) by controlling the DN value of AAc and irradiated with gamma rays at ambient temperature at a very low dose rate. The influences of the DN on the swelling and network properties were examined. It was observed that the DN strongly affected the gelation and super absorption properties of the gels. Molecular weight between crosslinks (M), effective crosslink density (νe) and mesh size (ξ) of SAPs were calculated from swelling and shear modules data obtained from compression and oscillatory frequency sweep tests. M values obtained from the uniaxial deformation experiments were very close to those obtained from the oscillatory shear experiments excluding the completely neutralised gel system. It was concluded that the uniaxial compression technique could be used for the characterisation of the network structure of a hydrogel as along with the rheological analyses; however, a very precise control of the gel size was also needed.

  9. Synthesis and crystal structure characterisation of sodium neptunate compounds

    NASA Astrophysics Data System (ADS)

    Smith, A. L.; Raison, P. E.; Konings, R. J. M.

    2011-06-01

    The present work reports studies of the chemical reactions between neptunium dioxide and sodium oxide either in the presence of oxygen or inert gas (Ar), leading to compounds with hexavalent, heptavalent or pentavalent/tetravalent neptunium, respectively. Solid state synthesis with different NpO 2/Na 2O ratios led to the following polycrystalline compounds: Na 2Np 2O 7 monoclinic (P12 11), α-Na 2NpO 4 orthorhombic (Pbam), β-Na 2NpO 4 orthorhombic (Pbca), β-Na 4NpO 5 tetragonal (I4/mmm), Na 5NpO 6 monoclinic (C2/m) and a cubic compound (Fm-3m) that could either be Na 3NpO 4 or Na 4NpO 4. The crystal structures of the α-Na 2NpO 4 and Na 2Np 2O 7 compounds were refined by Rietveld analysis. Evolution of the cell parameters of α-Na 2NpO 4 was also followed as a function of temperature up to 1273 K by X-ray diffraction. The corresponding linear thermal expansion coefficients along the different axis were determined: αa = 41.3 × 10 -6 K -1, αb = 35.0 × 10 -6 K -1, αc ˜ 0 K -1. From the high temperature X-ray diffraction experiment it was also possible to evidence formation of diverse phases at different temperatures and to review parts of the Na-Np-O system.

  10. Genetics Home Reference: congenital bile acid synthesis defect type 1

    MedlinePlus

    ... bile acid synthesis defect type 1 congenital bile acid synthesis defect type 1 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 1 is a disorder characterized ...

  11. Genetics Home Reference: congenital bile acid synthesis defect type 2

    MedlinePlus

    ... bile acid synthesis defect type 2 congenital bile acid synthesis defect type 2 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 2 is a disorder characterized ...

  12. Hydroxamic Acids in Asymmetric Synthesis

    PubMed Central

    Li, Zhi; Yamamoto, Hisashi

    2012-01-01

    Metal-catalyzed stereoselective reactions are a central theme in organic chemistry research. In these reactions, the stereoselection is achieved predominantly by introducing chiral ligands at the metal catalyst’s center. For decades, researchers have sought better chiral ligands for asymmetric catalysis and have made great progress. Nevertheless, to achieve optimal stereoselectivity and to catalyze new reactions, new chiral ligands are needed. Due to their high metal affinity, hydroxamic acids play major roles across a broad spectrum of fields from biochemistry to metal extraction. Dr. K. Barry Sharpless first revealed their potential as chiral ligands for asymmetric synthesis in 1977: He published the chiral vanadium-hydroxamic-acid-catalyzed, enantioselective epoxidation of allylic alcohols before his discovery of Sharpless Asymmetric Epoxidation, which uses titanium-tartrate complex as the chiral reagent. However, researchers have reported few highly enantioselective reactions using metal-hydroxamic acid as catalysts since then. This Account summarizes our research on metal-catalyzed asymmetric epoxidation using hydroxamic acids as chiral ligands. We designed and synthesized a series of new hydroxamic acids, most notably the C2-symmetric bis-hydroxamic acid (BHA) family. V-BHA-catalyzed epoxidation of allylic and homoallylic alcohols achieved higher activity and stereoselectivity than Sharpless Asymmetric Epoxidation in many cases. Changing the metal species led to a series of unprecedented asymmetric epoxidation reactions, such as (i) single olefins and sulfides with Mo-BHA, (ii) homoallylic and bishomoallylic alcohols with Zr- and Hf-BHA, and (iii) N-alkenyl sulfonamides and N-sulfonyl imines with Hf-BHA. These reactions produce uniquely functionalized chiral epoxides with good yields and enantioselectivities. PMID:23157425

  13. Phosphatidic Acid Synthesis in Bacteria

    PubMed Central

    Yao, Jiangwei; Rock, Charles O.

    2012-01-01

    Membrane phospholipid synthesis is a vital facet of bacterial physiology. Although the spectrum of phospholipid headgroup structures produced by bacteria is large, the key precursor to all of these molecules is phosphatidic acid (PtdOH). Glycerol-3-phosphate derived from the glycolysis via glycerol-phosphate synthase is the universal source for the glycerol backbone of PtdOH. There are two distinct families of enzymes responsible for the acylation of the 1-position of glycerol-3-phosphate. The PlsB acyltransferase was discovered in Escherichia coli, and homologs are present in many eukaryotes. This protein family primarily uses acyl-acyl carrier protein (ACP) endproducts of fatty acid synthesis as acyl donors, but may also use acyl-CoA derived from exogenous fatty acids. The second protein family, PlsY, is more widely distributed in bacteria and utilizes the unique acyl donor, acyl-phosphate, which is produced from acyl-ACP by the enzyme PlsX. The acylation of the 2-position is carried out by members of the PlsC protein family. All PlsCs use acyl-ACP as the acyl donor, although the PlsCs of the γ-proteobacteria also may use acyl-CoA. Phospholipid headgroups are precursors in the biosynthesis of other membrane-associated molecules and the diacylglycerol product of these reactions is converted to PtdOH by one of two distinct families of lipid kinases. The central importance of the de novo and recycling pathways to PtdOH in cell physiology suggest these enzymes are suitable targets for the development of antibacterial therapeutics in Gram-positive pathogens. This article is part of a Special Issue entitled Phospholipids and Phospholipid Metabolism. PMID:22981714

  14. Abscisic Acid Synthesis and Response

    PubMed Central

    Finkelstein, Ruth

    2013-01-01

    Abscisic acid (ABA) is one of the “classical” plant hormones, i.e. discovered at least 50 years ago, that regulates many aspects of plant growth and development. This chapter reviews our current understanding of ABA synthesis, metabolism, transport, and signal transduction, emphasizing knowledge gained from studies of Arabidopsis. A combination of genetic, molecular and biochemical studies has identified nearly all of the enzymes involved in ABA metabolism, almost 200 loci regulating ABA response, and thousands of genes regulated by ABA in various contexts. Some of these regulators are implicated in cross-talk with other developmental, environmental or hormonal signals. Specific details of the ABA signaling mechanisms vary among tissues or developmental stages; these are discussed in the context of ABA effects on seed maturation, germination, seedling growth, vegetative stress responses, stomatal regulation, pathogen response, flowering, and senescence. PMID:24273463

  15. Synthesis and characterisation of ruthenium dihydrogen complexes and their reactivity towards B-H bonds.

    PubMed

    Choi, Jong-Hoo; Schloerer, Nils E; Berger, Josefine; Prechtl, Martin H G

    2014-01-01

    In this paper the synthesis and characterisation of ruthenium dihydrogen complexes bearing rigid aliphatic PNP pincer-type ligands are described. As one result hydride complexes were synthesised in good to high yields by a one-pot direct hydrogenation reaction. As another finding the dihydrogen complex, stabilised with a N-Me group in the ligand frame, can be converted with dimethylamine borane into a rare σ-boron complex [RuH2(BH3)(Me-PNP)] with rapid B-N decoupling. Additionally, we present the first mass spectrometric analysis of the synthesised σ-complexes via liquid injection field desorption/ionisation technique (LIFDI-MS).

  16. Synthesis and characterisation of biologically compatible TiO2 nanoparticles

    NASA Astrophysics Data System (ADS)

    Cheyne, Richard W.; Smith, Tim Ad; Trembleau, Laurent; McLaughlin, Abbie C.

    2011-06-01

    We describe for the first time the synthesis of biocompatible TiO2 nanoparticles containing a functional NH2 group which are easily dispersible in water. The synthesis of water dispersible TiO2 nanoparticles coated with mercaptosuccinic acid is also reported. We show that it is possible to exchange the stearic acid from pre-synthesised fatty acid-coated anatase 5-nm nanoparticles with a range of organic ligands with no change in the size or morphology. With further organic functionalisation, these nanoparticles could be used for medical imaging or to carry cytotoxic radionuclides for radioimmunotherapy where ultrasmall nanoparticles will be essential for rapid renal clearance.

  17. Synthesis and characterisation of multifunctional alginate microspheres via the in situ formation of ZnO quantum dots and the graft of 4-(1-pyrenyl) butyric acid to sodium alginate.

    PubMed

    Luo, Guilin; Wang, Jianxin; Wang, Yingying; Feng, Bo; Weng, Jie

    2015-01-01

    Growth factor-loaded fluorescent alginate microspheres, which can realise sustained growth factor release and fluorescence imaging, were synthesised by in situ formation of ZnO quantum dots (QDs) and covalent graft of 4-(1-pyrenyl) butyric acid (PBA). BSA was chosen as a growth factor model protein to study the release kinetic of growth factors from alginate microspheres. The microsphere size and fluorescent properties were also investigated. Investigations of cell culture were used for evaluating biocompatibility of BSA-loaded fluorescent microspheres and fluorescence imaging property of ZnO QDs and PBA-grafted sodium alginate from the microspheres. The results show that they have good fluorescent property either to microspheres or to cells and fluorescent microspheres have good biocompatibility and property in sustained release of growth factors. The obtained microspheres will be expected to realise the imaging of cells and materials and also the release of growth factor in tissue engineering or in cell culture. PMID:25265058

  18. Synthesis and characterisation of multifunctional alginate microspheres via the in situ formation of ZnO quantum dots and the graft of 4-(1-pyrenyl) butyric acid to sodium alginate.

    PubMed

    Luo, Guilin; Wang, Jianxin; Wang, Yingying; Feng, Bo; Weng, Jie

    2015-01-01

    Growth factor-loaded fluorescent alginate microspheres, which can realise sustained growth factor release and fluorescence imaging, were synthesised by in situ formation of ZnO quantum dots (QDs) and covalent graft of 4-(1-pyrenyl) butyric acid (PBA). BSA was chosen as a growth factor model protein to study the release kinetic of growth factors from alginate microspheres. The microsphere size and fluorescent properties were also investigated. Investigations of cell culture were used for evaluating biocompatibility of BSA-loaded fluorescent microspheres and fluorescence imaging property of ZnO QDs and PBA-grafted sodium alginate from the microspheres. The results show that they have good fluorescent property either to microspheres or to cells and fluorescent microspheres have good biocompatibility and property in sustained release of growth factors. The obtained microspheres will be expected to realise the imaging of cells and materials and also the release of growth factor in tissue engineering or in cell culture.

  19. Synthesis and Isolation of Chelidonic Acid

    ERIC Educational Resources Information Center

    Gagan, J. M. F.; Herbert, R. B.

    1976-01-01

    Described is an undergraduate laboratory experiment involving synthesis of chelidonic acid and its identification in plants. The experiment is offered as an ancillary topic for biology or chemistry classes. (SL)

  20. Characterisation of acid-base abnormalities in pigs experimentally infected with Chlamydia suis.

    PubMed

    Reinhold, Petra; Hartmann, Helmut; Constable, Peter D

    2010-05-01

    This study characterises the acid-base abnormalities in pigs experimentally infected with Chlamydia suis (Henderson-Hasselbalch equation and Constable's simplified strong ion equation). Eight pigs were challenged with the respiratory pathogen C. suis and four pigs served as non-infected controls. Pigs were monitored from 7 days before challenge to 8 days post-inoculation. Clinical examination was performed twice daily and venous blood samples were collected every two days. Blood-gas analysis, haemoxymetry, serum biochemical analysis and electrophoresis were performed in order to characterise the acid-base derangement. Aerosol challenge with C. suis resulted in severe acid-base disturbance characterised by acute respiratory acidosis and strong ion (metabolic) acidosis secondary to anaerobic metabolism and hyper L-lactataemia. Maximal changes were seen at day 3 post-inoculation when severe clinical signs of respiratory dysfunction were evident. The results of the study provide new information regarding the pathophysiology of respiratory infection caused by C. suis and the applicability and diagnostic utility of different approaches for assessing acid-base status in pigs.

  1. Characterising the phase behaviour of stearic acid and its triethanolamine soap and acid-soap by infrared spectroscopy.

    PubMed

    Pudney, Paul D A; Mutch, Kevin J; Zhu, Shiping

    2009-07-01

    The behaviour of stearic acid neutralised by triethanolamine to form soap and its acid-soap has been examined by infrared spectroscopy. It was found that not only could the neutralisation behaviour be characterised, but the thermotropic behaviour could also be followed. The neutralisation confirmed the formation of a fixed stoichiometeric ratio, 2 : 1, acid-soap. When following the thermotropic behaviour the break up of the acid-soap could be followed along with various disordering and melting transitions of the alkyl chain tail. This allowed all the thermal transitions that have been observed to be characterised in terms of the type of molecular rearrangement that was occurring and also the transition temperature at which they occurred. This allowed the binary phase diagram to be plotted and understood for this system. This is the first time IR has been used to measure a whole phase diagram of this type. The nature of the acid-soap complex itself was also characterised, with very short hydrogen bonds being present as well as a free, non-hydrogen bonded, hydroxyl group.

  2. Enzymatic synthesis of cinnamic acid derivatives.

    PubMed

    Lee, Gia-Sheu; Widjaja, Arief; Ju, Yi-Hsu

    2006-04-01

    Using Novozym 435 as catalyst, the syntheses of ethyl ferulate (EF) from ferulic acid (4-hydroxy 3-methoxy cinnamic acid) and ethanol, and octyl methoxycinnamate (OMC) from p-methoxycinnamic acid and 2-ethyl hexanol were successfully carried out in this study. A conversion of 87% was obtained within 2 days at 75 degrees C for the synthesis of EF. For the synthesis of OMC at 80 degrees C, 90% conversion can be obtained within 1 day. The use of solvent and high reaction temperature resulted in better conversion for the synthesis of cinnamic acid derivatives. Some cinnamic acid esters could also be obtained with higher conversion and shorter reaction times in comparison to other methods reported in the literature. The enzyme can be reused several times before significant activity loss was observed.

  3. Synthesis, characterisation and crystal structures of two bi-oxadiazole derivatives featuring the trifluoromethyl group.

    PubMed

    Kettner, Marcos A; Klapötke, Thomas M; Witkowski, Tomasz G; von Hundling, Felix

    2015-03-01

    The synthesis, characterisation, and crystal structure determination of the closely related compounds 3,3'-bi-(5-trifluoromethyl-1,2,4-oxadiazole) and 5,5'-bi-(2-trifluoromethyl-1,3,4-oxadiazole) are reported. These two compounds are known for their bioactivity; however, in this study they serve as model compounds to evaluate the suitability of the heterocyclic oxadiazole ring system for energetic materials when the fluorine atoms in the exocyclic CF3 groups are substituted successively by nitro groups. Quantum chemical calculations for the bi-1,3,4-oxadiazole derivatives with difluoronitromethyl, fluorodinitromethyl, and trinitromethyl groups have been carried out and predict promising energetic performances for both explosive and propulsive applications.

  4. Cloning and characterisation of rosmarinic acid synthase from Melissa officinalis L.

    PubMed

    Weitzel, Corinna; Petersen, Maike

    2011-05-01

    Lemon balm (Melissa officinalis L.; Lamiaceae) is a well-known medicinal plant mainly due to two groups of compounds, the essential oil and the phenylpropanoid derivatives. The prominent phenolic compound is rosmarinic acid (RA), an ester of caffeic acid and 3,4-dihydroxyphenyllactic acid. RA shows a number of interesting biological activities. Rosmarinic acid synthase (RAS; 4-coumaroyl-CoA:hydroxyphenyllactic acid hydroxycinnamoyltransferase) catalyses the ester formation. Cell cultures of M. officinalis have been established in order to characterise the formation of RA in an important diploid medicinal plant. RAS activity as well as the expression of the RAS gene are closely correlated with the accumulation of RA in suspension cultures of M. officinalis. The RAS cDNA and gene (MoRAS) were isolated. The RAS gene was shown to be intron-free. MoRAS belongs to the BAHD superfamily of acyltransferases. Southern-blot analysis suggests the presence of only one RAS gene copy in the M. officinalis genome. The enzyme was characterised with respect to enzyme properties, substrate preferences and kinetic data in crude plant extracts and as heterologously synthesised protein from Escherichia coli. PMID:21354582

  5. Cloning and characterisation of rosmarinic acid synthase from Melissa officinalis L.

    PubMed

    Weitzel, Corinna; Petersen, Maike

    2011-05-01

    Lemon balm (Melissa officinalis L.; Lamiaceae) is a well-known medicinal plant mainly due to two groups of compounds, the essential oil and the phenylpropanoid derivatives. The prominent phenolic compound is rosmarinic acid (RA), an ester of caffeic acid and 3,4-dihydroxyphenyllactic acid. RA shows a number of interesting biological activities. Rosmarinic acid synthase (RAS; 4-coumaroyl-CoA:hydroxyphenyllactic acid hydroxycinnamoyltransferase) catalyses the ester formation. Cell cultures of M. officinalis have been established in order to characterise the formation of RA in an important diploid medicinal plant. RAS activity as well as the expression of the RAS gene are closely correlated with the accumulation of RA in suspension cultures of M. officinalis. The RAS cDNA and gene (MoRAS) were isolated. The RAS gene was shown to be intron-free. MoRAS belongs to the BAHD superfamily of acyltransferases. Southern-blot analysis suggests the presence of only one RAS gene copy in the M. officinalis genome. The enzyme was characterised with respect to enzyme properties, substrate preferences and kinetic data in crude plant extracts and as heterologously synthesised protein from Escherichia coli.

  6. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  7. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  8. Polyamines in the Synthesis of Bacteriophage Deoxyribonucleic Acid. I. Lack of Dependence of Polyamine Synthesis on Bacteriophage Deoxyribonucleic Acid Synthesis

    PubMed Central

    Dion, Arnold S.; Cohen, Seymour S.

    1972-01-01

    To determine whether polyamine synthesis is dependent on deoxyribonucleic acid (DNA) synthesis, polyamine levels were estimated after infection of bacterial cells with ultraviolet-irradiated T4 or T4 am N 122, a DNA-negative mutant. Although phage DNA accumulation was restricted to various degrees in comparison to cells infected with T4D, nearly commensurate levels of putrescine and spermidine synthesis were observed after infection, regardless of the rate of phage DNA synthesis. We conclude from these data that polyamine synthesis after infection is independent of phage DNA synthesis. PMID:4552549

  9. [Lipid synthesis by an acidic acid tolerant Rhodotorula glutinis].

    PubMed

    Lin, Zhangnan; Liu, Hongjuan; Zhang, Jian'an; Wang, Gehua

    2016-03-01

    Acetic acid, as a main by-product generated in the pretreatment process of lignocellulose hydrolysis, significantly affects cell growth and lipid synthesis of oleaginous microorganisms. Therefore, we studied the tolerance of Rhodotorula glutinis to acetic acid and its lipid synthesis from substrate containing acetic acid. In the mixed sugar medium containing 6 g/L glucose and 44 g/L xylose, and supplemented with acetic acid, the cell growth was not:inhibited when the acetic acid concentration was below 10 g/L. Compared with the control, the biomass, lipid concentration and lipid content of R. glutinis increased 21.5%, 171% and 122% respectively when acetic acid concentration was 10 g/L. Furthermore, R. glutinis could accumulate lipid with acetate as the sole carbon source. Lipid concentration and lipid yield reached 3.20 g/L and 13% respectively with the initial acetic acid concentration of 25 g/L. The lipid composition was analyzed by gas chromatograph. The main composition of lipid produced with acetic acid was palmitic acid, stearic acid, oleic acid, linoleic acid and linolenic acid, including 40.9% saturated fatty acids and 59.1% unsaturated fatty acids. The lipid composition was similar to that of plant oil, indicating that lipid from oleaginous yeast R. glutinis had potential as the feedstock of biodiesel production. These results demonstrated that a certain concentration of acetic acid need not to be removed in the detoxification process when using lignocelluloses hydrolysate to produce microbial lipid by R. glutinis. PMID:27349116

  10. Synthesis, characterisation and drug release properties of microspheres of polystyrene with aliphatic polyester side-chains.

    PubMed

    Kukut, Manolya; Karal-Yilmaz, Oksan; Yagci, Yusuf

    2014-01-01

    A series of graft copolymers consisting of polystyrene backbone with biocompatible side chains based on (co)polymers of l-lactic acid and glycolic acid were synthesised by combination two controlled polymerisations, namely, nitroxide mediated radical polymerisation (NMRP) and ring opening polymerisation (ROP) with "Click" chemistry. The main goal of this work was to design new biodegradable microspheres using obtained graft copolymers for long-term sustained release of imatinib mesylate (IMM) as a model drug. The IMM loaded microspheres of the graft copolymers, polystyrene-g-poly(lactide-co-glycolide) (PS-g-PLLGA), polystyrene-g-poly(lactic acid) (PS-g-PLLA) and poly(lactic-coglycolic acid) (PLLGA) were then prepared by a modified water-in-oil-in-water (w1/o/w2) double emulsion/solvent evaporation technique. The optimised microspheres were characterised by particle size, encapsulation efficiency, and surface morphology also; their degradation and release properties were studied in vitro. The degradation studies of three different types of microspheres showed that the PS backbone of the graft copolymers slows down the degradation rate compared to PLLGA.

  11. Characterisation of hyaluronic acid and chondroitin/dermatan sulfate from the lumpsucker fish, C. lumpus.

    PubMed

    Panagos, Charalampos G; Thomson, Derek; Moss, Claire; Bavington, Charles D; Olafsson, Halldór G; Uhrín, Dušan

    2014-06-15

    The lumpsucker, Cyclopterus lumpus, a cottoid teleost fish found in the cold waters of the North Atlantic, and North Pacific, was identified as a possible source of GAGs. The GAGs present in the C. lumpus dorsal hump and body wall tissue were isolated and purified. Two fractions were analysed by NMR and their GAG structures determined as hyaluronic acid and CS/DS chains. The latter fraction contained GlcA (65% of the total uronic acids) and IdoA (the remaining 35%). All uronic acid residues were unsulfated, whilst 86% of the GalNAc was 4-sulfated and 14% was 6-sulfated. The presence of GlcA-GalNAc4S, IdoA-GalNAc4S and GlcA-GalNAc6S disaccharide fragments was confirmed. The isolated GAGs obtained from each tissue were biochemically characterised. The lumpsucker offers a high yield source of GAGs, which compares favourably with other sources such as shark cartilage.

  12. Synthesis of pyromellitic acid esters

    NASA Technical Reports Server (NTRS)

    Fedorova, V. A.; Donchak, V. A.; Martynyuk-Lototskaya, A. N.

    1985-01-01

    The ester acids necessary for studyng the thermochemical properties of pyromellitic acid (PMK)-based peroxides were investigated. Obtaining a tetramethyl ester of a PMK was described. The mechanism of an esterification reaction is discussed, as is the complete esterification of PMK with primary alcohol.

  13. Synthesis of higher monocarboxylic acids

    SciTech Connect

    Taikov, B.F.; Novakovskii, E.M.; Zhelkovskaya, V.P.; Shadrova, V.N.; Shcherbik, P.K.

    1981-01-01

    Brown-coal and peat waxes contain higher monocarboxylic acids, alcohols and esters of them as their main components. In view of this, considerable interest is presented by the preparation of individual compounds among those mentioned above, which is particularly important in the study of the composition and development of the optimum variants of the chemical processing of the waxes. In laboratory practice, to obtain higher monocarboxylic acids use is generally made of electrosynthesis according to Kolbe which permits unbranched higher aliphatic acids with given lengths of the hydrocarbon chain to be obtained. The aim of the present work was to synthesize higher monocarboxylic acids: arachidic, behenic, lignoceric, pentacosanoic, erotic, heptacosanoic, montanic, nonacosanoic, melissic, dotriacontanoic and tetratriacontanoic, which are present in waxes. Characteristics of synthesized acids are tabulated. 20 refs.

  14. Characterisation of the FAD2 gene family from Hiptage benghalensis: a ricinoleic acid accumulating plant.

    PubMed

    Zhou, Xue-Rong; Singh, Surinder P; Green, Allan G

    2013-08-01

    We have characterised the FAD2 gene family from Hiptage benghalensis, a tropical plant that accumulates high levels of ricinoleic acid in its seeds. Functional characterisation of six FAD2 gene family members showed that two of them were capable of functioning as Δ12-hydroxylases while the other FAD2 members were confirmed to be Δ12-desaturases. The Δ12-hydroxylation function of these two genes was confirmed in yeast cells, using C16:1(Δ9) and C18:1(Δ9) monounsaturated fatty acids as substrates. These Δ12-hydroxylases, like the other Δ12-hydroxylases previously cloned from plants Ricinus communis (castor), Physaria fendleri and fungus Claviceps purpurea, also showed some Δ12-desaturase activity. The hydroxylation activity of the two Hiptage hydroxylases was further confirmed by their expression in the Arabidopsis fad2/fae1 double mutant where they were able to produce equivalent or higher levels hydroxylated fatty acids in the seed oil when compared with the other known hydroxylases.

  15. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the snythesis methods of the prior art.

  16. Combined liquid and gas chromatographic characterisation of polyglycerol fatty acid esters.

    PubMed

    De Meulenaer, B; Van Royen, G; Vanhoutte, B; Huyghebaert, A

    2000-10-27

    In the present study a combined liquid and gas chromatographic technique is described for the analysis of polyglycerol fatty acid esters. Liquid chromatographic fractionation of samples resulted in pure standards of monoesters of di- and triglycerols and diesters of di- and triglycerols. Confirmation of their identity was achieved by LC-MS analysis. Moreover, a chromatographic identification of the mono- and diesters of cyclic diglycerol was proposed. From the isolation of pure esters and their gas chromatographic analysis, it was revealed that co-elution of several compounds occurred. Thus it was shown that prefractionation of the sample using a simplified liquid chromatographic separation, was necessary in order to characterise the esters correctly. In combination with some other chemical analyses, a complete profile of the chemical composition of polyglycerol fatty acid esters can be obtained.

  17. Pectin functionalised by fatty acids: Diffuse reflectance infrared Fourier transform (DRIFT) spectroscopic characterisation

    NASA Astrophysics Data System (ADS)

    Kamnev, Alexander A.; Calce, Enrica; Tarantilis, Petros A.; Tugarova, Anna V.; De Luca, Stefania

    2015-01-01

    Chemically modified pectin derivatives obtained by partial esterification of its hydroxyl moieties with fatty acids (FA; oleic, linoleic and palmitic acids), as well as the initial apple peel pectin were comparatively characterised using diffuse reflectance infrared Fourier transform (DRIFT) spectroscopy. Characteristic changes observed in DRIFT spectra in going from pectin to its FA esters are related to the corresponding chemical modifications. Comparing the DRIFT spectra with some reported data on FTIR spectra of the same materials measured in KBr or NaCl matrices has revealed noticeable shifts of several polar functional groups both in pectin and in its FA-esterified products induced by the halide salts. The results obtained have implications for careful structural analyses of biopolymers with hydrophilic functional groups by means of different FTIR spectroscopic methodologies.

  18. Synthesis of alpha-amino acids

    DOEpatents

    Davis, J.W. Jr.

    1983-01-25

    A method is described for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R[sub 1]R[sub 2]C(OSOCl)CN, R[sub 1]R[sub 2]C(Cl)CN and [R[sub 1]R[sub 2]C(CN)O][sub 2]SO wherein R[sub 1] and R[sub 2] are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art. No Drawings

  19. Synthesis and characterisation of macroporous poly(methyl methacrylate) with plasma-polymerised hydrophilic coating

    NASA Astrophysics Data System (ADS)

    Serrano Aroca, Angel

    This thesis focuses on the synthesis and characterisation of a new macroporous biomatenal made of poly(methyl methacrylate) and plasma-polymerised poly(hydroxyethyl acrylate). A series of porous and non-porous PMMA networks with different degrees of porosity and cross-linker contents were synthesised by polymerisation in the presence of ethanol and bulk polymerisation. Macroporous PMMA was allowed to adsorb 2-hydroxyethyl acrylate monomer vapour. The absence of thermal or photoinitiators makes difficult the initiation of the polymerisation process of the adsorbed monomer. However, by plasma treatment this problem can be solved. This method of forming a pure hydrophilic coating by plasma polymerisation is very interesting because the porosity of the scaffold hardly changes at the end of the process. The DMS spectrum shows that these materials are a new kind of macroporous hydrogel with a high mechanical modulus at room temperature and able to adsorb water while keeping their mechanical properties. Takayanagi's block model was applied to these results to characterise the biphasic behaviour of these systems. Porosity measurements were performed to determine the volume fraction of pores in the samples before and after the plasma treatment. The structure and morphology of these macroporous systems were observed by Scanning Electron Microscope (SEM). The nature, homogeneity and stability of the hydrophilic coating was studied by DSC, ATR FTIR, TGA and immersion in water. It was found that the plPHEA is very stable and only in very drastic conditions (boiling water) can suffer hydrolytic degradation. The water sorption and diffusion properties of these biomaterials were studied by dynamic desorption, contact angle, equilibrium sorption isotherms and immersion experiments. Thermal analysis of water in the hydrophilic layer was performed by DSC. All these experimental techniques suggested that the plasma-polymerised PHEA is more homogeneously interpenetrated with

  20. Sol-gel synthesis and characterisation of nano-scale hydroxyapatite

    NASA Astrophysics Data System (ADS)

    Bilton, M.; Brown, A. P.; Milne, S. J.

    2010-07-01

    Hydroxyapatite (HAp) forms the main mineral component of bone and teeth. This naturally occurring HAp is in the form of nano-metre sized crystallites of Ca10(PO4)6(OH)2 that contain a number of cation and anion impurities, for example CO32-, F-, Na+, Mg2+ and Sr2+. Synthetic nano-sized HAp particles exhibit favourable biocompatibility and bioactivity and in order to better match the composition to natural HAp there is great interest in producing a range of chemically modified powders. In this study, two HAp powders have been synthesised via a water-based low-temperature sol-gel method and a third, commercial powder from Sigma-Aldrich have been analysed. Subsequent powder calcination has been carried out within the temperature range of 500-700 °C and the products characterised by bulk chemical analysis, X-ray diffraction and electron microscopy. Energy dispersive X-ray spectroscopy (EDX) in the TEM has been used to assess the composition of individual HAp particles. In order to do this accurately it is first necessary to account for the sensitivity of the HAp structure and composition to irradiation by the high energy electron beam of the TEM. This was done by monitoring the estimated Ca/P ratio derived from TEM-EDX of stoichiometric HAp under increasing levels of electron fluence. A fluence threshold (at a given beam energy) was established below which the measured Ca/P ratio can be considered to be stable. Subsequent elemental analysis at or below this threshold has enabled the variation in composition between particles both within and between synthesis batches to be accurately assessed. Compositional variability between particles is also evident, even in the commercial powder, but is far greater in the powders prepared by the sol-gel method.

  1. Characterisation of a proposed internet synthesis of N,N-dimethyltryptamine using liquid chromatography/electrospray ionisation tandem mass spectrometry.

    PubMed

    Martins, Cláudia P B; Freeman, Sally; Alder, John F; Brandt, Simon D

    2009-08-14

    The psychoactive properties of N,N-dimethyltryptamine (DMT) are known to induce altered states of consciousness in humans. These properties attract great interest from clinical, neuroscientific, clandestine and forensic communities. The Breath of Hope Synthesis was reported on an internet website as a convenient two-step methodology for the preparation of DMT. The analytical characterisation of the first stage was the subject of previous publications by the authors and involved the thermal decarboxylation of tryptophan and the formation of tryptamine. The present study reports on the characterisation of the second step of this procedure which was based on the methylation of tryptamine. This employed methyl iodide and benzyltriethylammonium chloride/sodium hydroxide as a phase transfer catalyst. The reaction product was characterised by liquid chromatography/electrospray ionisation tandem mass spectrometry and orthogonal acceleration time-of-flight mass spectrometry. Quantitative evaluation was carried out in positive multiple reaction monitoring mode (MRM), which included synthesis of the identified reaction products. MRM screening of the product did not lead to the detection of DMT. Instead, 11.1% tryptamine starting material, 21.0% N,N,N-trimethyltryptammonium iodide (TMT) and 47.4% 1-N-methyl-TMT were detected. A 0.5% trace of the monomethylated N-methyltryptamine was also detected. This study demonstrated the impact on product purity of doubtful synthetic methodologies discussed on the internet. PMID:19592003

  2. Development and characterisation of molecularly imprinted polymers based on methacrylic acid for selective recognition of drugs.

    PubMed

    Shi, Xizhi; Wu, Aibo; Qu, Guorun; Li, Rongxiu; Zhang, Dabing

    2007-09-01

    Specific molecularly imprinted polymers (MIPs) for the drug reserpine (RES) using methacrylic acid (MAA) as the functional monomer were developed and characterised for the first time in this study. Evaluation of the various polymers by binding assays indicated that the optimum ratio of functional monomer to template was 4:1. Furthermore, the imprinting effect of the MIPs was assessed by the chromatographic method, which demonstrated that the MIPs had better chromatographic behavior and selectivity than those of the corresponding NIPs. A combination of BET, NMR, UV spectroscopy, and MISPE analyses for investigation of the imprinting and recognition properties revealed that strong specific interactions between the functional monomer and RES in the prepolymerization solutions and the aqueous solutions were probably responsible for RES recognition. The preparation of RES MIPs and elucidation of imprinting and recognition mechanisms may serve as useful references for other drug MIPs.

  3. Synthesis and characterisation of new types of side chain cholesteryl polymers.

    PubMed

    Wang, Bin; Du, Haiyan; Zhang, Junhua

    2011-01-01

    A series of cholesterol derivatives have been synthesised via the alkylation reaction of the 3-hydroxyl group with the aliphatic bromide compounds with different chain lengths, namely 3β-alkyloxy-cholesterol. The double bond between the C5 and C6 positions in these cholesterol derivatives was oxidised into epoxy, followed by an epoxy-ring-opening reaction with the treatment with acrylic acid, resulting in a series of 3β-alkyloxy-5α-hydroxy-6β-acryloyloxycholesterol, C(n)OCh (n=1, 2, 4, 6, 8, 10, 12), The acrylate group is connected to the C6 position, which is confirmed by the single crystal structure analysis. The corresponding polymers, PC(n)OCh, were prepared via free radical polymerisation. The structure of monomers and the resulting polymers were characterised with nuclear magnetic resonance (NMR), Fourier transform infrared spectroscopy (FT-IR) and gel permeation chromatography (GPC). The thermal properties of PC(n)OCh were studied using differential scanning calorimetry (DSC) and thermogravimetric analysis (TGA). To determine the secondary structure of polymers, circular dichroism (CD) spectra were performed. It was found that not all monomers produce high-molecular-weight polymers because of steric hindrance. However, all polymers have a helical structure, which can be enhanced by increasing the alkoxy chain length. In addition, increasing the alkoxy chain length decreases the glass transition temperature and increases the decomposition temperature of the polymers. PMID:21070795

  4. Synthesis and characterisation of new types of side chain cholesteryl polymers.

    PubMed

    Wang, Bin; Du, Haiyan; Zhang, Junhua

    2011-01-01

    A series of cholesterol derivatives have been synthesised via the alkylation reaction of the 3-hydroxyl group with the aliphatic bromide compounds with different chain lengths, namely 3β-alkyloxy-cholesterol. The double bond between the C5 and C6 positions in these cholesterol derivatives was oxidised into epoxy, followed by an epoxy-ring-opening reaction with the treatment with acrylic acid, resulting in a series of 3β-alkyloxy-5α-hydroxy-6β-acryloyloxycholesterol, C(n)OCh (n=1, 2, 4, 6, 8, 10, 12), The acrylate group is connected to the C6 position, which is confirmed by the single crystal structure analysis. The corresponding polymers, PC(n)OCh, were prepared via free radical polymerisation. The structure of monomers and the resulting polymers were characterised with nuclear magnetic resonance (NMR), Fourier transform infrared spectroscopy (FT-IR) and gel permeation chromatography (GPC). The thermal properties of PC(n)OCh were studied using differential scanning calorimetry (DSC) and thermogravimetric analysis (TGA). To determine the secondary structure of polymers, circular dichroism (CD) spectra were performed. It was found that not all monomers produce high-molecular-weight polymers because of steric hindrance. However, all polymers have a helical structure, which can be enhanced by increasing the alkoxy chain length. In addition, increasing the alkoxy chain length decreases the glass transition temperature and increases the decomposition temperature of the polymers.

  5. Synthesis and Characterisation of Biocompatible Polymer-Conjugated Magnetic Beads for Enhancement Stability of Urease.

    PubMed

    Doğaç, Yasemin Ispirli; Teke, Mustafa

    2016-04-01

    We reported natural polymer-conjugated magnetic featured urease systems for removal of urea effectively. The optimum temperature (20-60 °C), optimum pH (3.0-10.0), kinetic parameters, thermal stability (4-70 °C), pH stability (4.0-9.0), operational stability (0-250 min), reusability (18 times) and storage stability (24 weeks) were studied for characterisation of the urease-encapsulated biocompatible polymer-conjugated magnetic beads. Also, the surface groups and chemical structure of the magnetic beads were determined by using attenuated total reflectance Fourier transform infrared spectroscopy (ATR-FTIR). The all urease-encapsulated magnetic beads protected their stability of 30-45 % relative activity at 70 °C. A significant increase was observed at their pH stability compared with the free urease for both acidic and alkaline medium. Besides this, their repeatability activity were approximately 100 % during 4(th) run. They showed residual activity of 50 % after 16 weeks. The importance of this work is enhancement stability of immobilised urease by biocompatible polymer-conjugated magnetic beads for the industrial application based on removal of urea.

  6. Synthesis and structural characterisation using Rietveld and pair distribution function analysis of layered mixed titaniumzirconium phosphates

    SciTech Connect

    Burnell, Victoria A.; Readman, Jennifer E.; Tang, Chiu C; Parker, Julia E.; Thompson, Stephen P.; Hriljac, Joseph A.

    2010-07-24

    Crystalline metal (IV) phosphates with variable zirconium-to-titanium molar ratios of general formula (Ti1-xZrx)(HPO4)2 • H2O have been prepared by precipitation of soluble salts of the metals with phosphoric acid and heating the amorphous solids in 12 M H3PO4 in an autoclave. The new materials are structurally characterised by Rietveld analysis of synchrotron X-ray powder diffraction data and pair distribution function (PDF) analysis of high energy synchrotron X-ray total scattering data. A broad range of zirconium-titanium phosphate solid solutions were formed showing isomorphous substitution of titanium by zirconium in the α-titanium phosphate lattice and vice versa for titanium substitution into the α-zirconium phosphate lattice. In both cases the solubility is partial with the coexistence of two substituted phases observed in samples with nominal compositions between the solubility limits.

  7. Characterisation of quaternary polymethacrylate films containing tartaric acid, metoprolol free base or metoprolol tartrate.

    PubMed

    Glaessl, B; Siepmann, F; Tucker, I; Siepmann, J; Rades, T

    2009-11-01

    The aim of this study was to better understand the interactions between metoprolol tartrate and quaternary polymethacrylate (Eudragit RL and Eudragit RS) films. For reasons of comparison, polymeric films containing the free base metoprolol or free tartaric acid were also prepared. Systems containing various amounts of the free base, free acid and the salt were characterised using polarising light microscopy, X-ray powder diffraction, differential scanning calorimetry and mechanical analysis (puncture test). The free base is the most efficient plasticiser of the three species for Eudragit RL and Eudragit RS, but with limited solubility in the polymers. Due to its hydrophobicity, it can interact with the hydrophobic polymer backbones. In contrast, in salt containing films, ionic interactions between the positively charged quaternary ammonium groups and the negatively charged tartrate anions apparently occur, this being suggested by the different effects on Eudragit RL versus RS, which have different contents of quaternary ammonium groups. Importantly, the combination of acid and base as a salt avoids drug precipitation at higher metoprolol contents. The obtained new insight into the occurring drug-polymer interactions can help to facilitate the development/optimisation of this type of dosage forms.

  8. A thermoactive uropygial esterase from chicken: purification, characterisation and synthesis of flavour esters.

    PubMed

    Fendri, Ahmed; Louati, Hanen; Sellami, Mohamed; Gargouri, Héla; Smichi, Nabil; Zarai, Zied; Aissa, Imen; Miled, Nabil; Gargouri, Youssef

    2012-06-01

    A lipolytic activity was located in the chicken uropygial glands, from which a carboxylesterase (CUE) was purified. Pure CUE has an apparent molecular mass of 50 kDa. The purified esterase displayed its maximal activity (200 U/mg) on short-chain triacylglycerols (tributyrin) at a temperature of 50°C. No significant lipolytic activity was found when medium chain (trioctanoin) or long chain (olive oil) triacylglycerols were used as substrates. The enzyme retained 75% of its maximal activity when incubated during 2h at 50°C. The NH(2)-terminal amino acid sequence showed similarities with the esterase purified recently from turkey pharyngeal tissue. Esterase activity remains stable after its incubation during 30 min in presence of organic solvents such as hexane or butanol. CUE is a serine enzyme since it was inactivated by phenylmethanesulphonyl fluoride (PMSF), a serine-specific inhibitor. The purified enzyme, which tolerates the presence of some organic solvent and a high temperature, can be used in non-aqueous synthesis reactions. Hence, the uropygial esterase immobilised onto CaCO(3) was tested to produce the isoamyl and the butyl acetate (flavour esters). Reactions were performed at 50°C in presence of hexane. High synthesis yields of 91 and 67.8% were obtained for isoamyl and butyl acetate, respectively. PMID:22531158

  9. Characterisation of Drosophila CMP-sialic acid synthetase activity reveals unusual enzymatic properties

    PubMed Central

    Mertsalov, Ilya B.; Novikov, Boris N.; Scott, Hilary; Dangott, Lawrence; Panin, Vladislav M.

    2016-01-01

    CMP-sialic acid synthetase (CSAS) is a key enzyme of the sialylation pathway. CSAS produces the activated sugar donor, CMP-sialic acid, which serves as a substrate for sialyltransferases to modify glycan termini with sialic acid. Unlike other animal CMP-Sia synthetases that normally localize in the nucleus, Drosophila melanogaster CSAS (DmCSAS) localizes in the cell secretory compartment, predominantly in the Golgi, which suggests that this enzyme has properties distinct from those of its vertebrate counterparts. To test this hypothesis, we purified recombinant DmCSAS and characterised its activity in vitro. Our experiments revealed several unique features of this enzyme. DmCSAS displays specificity for N-acetylneuraminic acid as a substrate, shows preference for lower pH and can function with a broad range of metal cofactors. When tested at a pH corresponding to the Golgi compartment, the enzyme showed significant activity with several metal cations, including Zn2+, Fe2+, Co2+ and Mn2+, while the activity with Mg2+ was found to be low. Protein sequence analysis and site-specific mutagenesis identified an aspartic acid residue that is necessary for enzymatic activity and predicted to be involved in coordinating a metal cofactor. DmCSAS enzymatic activity was found to be essential in vivo for rescuing the phenotype of DmCSAS mutants. Finally, our experiments revealed a steep dependence of the enzymatic activity on temperature. Taken together, our results indicate that DmCSAS underwent evolutionary adaptation to pH and ionic environment different from that of counterpart synthetases in vertebrates. Our data also suggest that environmental temperatures can regulate Drosophila sialylation, thus modulating neural transmission. PMID:27114558

  10. Characterisation of patients with primary biliary cirrhosis responding to long term ursodeoxycholic acid treatment

    PubMed Central

    Leuschner, M; Dietrich, C; You, T; Seidl, C; Raedle, J; Herrmann, G; Ackermann, H; Leuschner, U

    2000-01-01

    BACKGROUND—In some patients with primary biliary cirrhosis, ursodeoxycholic acid causes full biochemical normalisation of laboratory data; in others, indexes improve but do not become normal.
AIMS—To characterise complete and incomplete responders.
METHODS—Seventy patients with primary biliary cirrhosis were treated with ursodeoxycholic acid 10-15 mg/kg/day and followed up for 6-13 years.
RESULTS—In 23 patients (33%) with mainly stage I or II disease, cholestasis indexes and aminotransferases normalised within 1-5 years, except for antimitochondrial antibodies. Histological findings improved. Indexes were not normalised in 47 patients (67%) although the improvement of their biochemical functions parallelled the trend in the first group. In these incomplete responders histological findings improved to a lesser extent. The only difference between the two groups before treatment was higher levels of alkaline phosphatase and γ glutamyl transpeptidase in the incomplete responders. At onset of treatment the discriminant value separating responders from incomplete responders was 660 U/l for alkaline phosphatase and 131 U/l for γ glutamyl transpeptidase. One year later it was 239 and 27 U/l (overall predictive value for responders 92%, for incomplete responders 81%). There were no differences between the two groups concerning immune status, antimitochondrial antibody subtypes, liver histology, or any other data. HLA-B39, DRB1*08, DQB1*04 dominated in both groups.
CONCLUSIONS—In patients with mainly early stages of primary biliary cirrhosis, higher values of alkaline phosphatase and γ glutamyl transpeptidase are the only biochemical indexes which allow discrimination between patients who will completely or incompletely respond to ursodeoxycholic acid treatment.


Keywords: primary biliary cirrhosis; prognostic indexes; full response to ursodeoxycholic acid; incomplete responders; anti-p53 autoantibodies; HLA typing PMID:10601067

  11. Characterisation of a highly saturated Irvingia gabonensis seed kernel oil with unusual linolenic acid content.

    PubMed

    Zoué, Lessoy T; Bédikou, Micaël E; Faulet, Betty M; Gonnety, Jean T; Niamké, Sébastien L

    2013-02-01

    The search for new sources of oil with improved characteristics has focused our attention on the characterisation of Irvingia gabonensis seed kernel oil. Physicochemical analysis have revealed the following assets: refractive index (1.42 ± 0.00), free fatty acids (2.3 ± 0.8%), peroxide value (3.33 ± 0.57 meq O(2)/kg), iodine value (32.43 ± 1.22 g I(2)/100 g), saponification value (233.75 ± 2.60 mg KOH/g), unsaponifiable matter (1.5 ± 0.02%), carotenoids (63 ± 0.01 mg β-carotene/100 g) and phospholipids (2.1 ± 0.01%). Absorbance of this oil decreased abruptly in the range of UV-B and UV-A wavelengths. Gas chromatography analysis showed that the major fatty acids were saturated, being mainly composed of lauric (C12:0, 39.35 ± 0.01%) and myristic acids (C14:0, 20.54 ± 0.01%). Nevertheless, an unusually high amount (6.44 ± 0.02%) of linolenic acid was also noted. Mass spectrometer analysis of volatile compounds highlighted the presence of various aromatic and aliphatic organic compounds. I. gabonensis seed kernel oil also showed oxidative stability at 60 °C after 12 days of storage with maximum peroxide value of 34.66 meq O(2)/kg. In view of these interesting characteristics, I. gabonensis seed kernel could be used as an alternative source of oil for lipid industries. PMID:23345325

  12. Isolation, characterisation and identification of lactic acid bacteria from bushera: a Ugandan traditional fermented beverage.

    PubMed

    Muyanja, C M B K; Narvhus, J A; Treimo, J; Langsrud, T

    2003-02-15

    One hundred and thirteen strains of lactic acid bacteria (LAB) were selected from 351 isolates from 15 samples of traditionally fermented household bushera from Uganda and also from laboratory-prepared bushera. Isolates were phenotypically characterised by their ability to ferment 49 carbohydrates using API 50 CHL kits and additional biochemical tests. Coliforms, yeasts and LAB were enumerated in bushera. The pH, volatile organic compounds and organic acids were also determined. The LAB counts in household bushera varied between 7.1 and 9.4 log cfu ml(-1). The coliform counts varied between < 1 and 5.2 log cfu ml(-1). The pH of bushera ranged from 3.7 to 4.5. Ethanol (max, 0.27%) was the major volatile organic compound while lactic acid (max, 0.52%) was identified as the dominant organic acid in household bushera. The initial numbers of LAB and coliforms in laboratory-fermented bushera were similar; however, the LAB numbers increased faster during the first 24 h. LAB counts increased from 5.5 to 9.0 log cfu ml(-1) during the laboratory fermentation. Coliform counts increased from 5.9 to 7.8 log cfu ml(-1) at 24 h, but after 48 h, counts were less 4 log cfu ml(-1). Yeasts increased from 4.3 to 7.7 log cfu ml(-1) at 48 h, but thereafter decreased slightly. The pH declined from 7.0 to around 4.0. Lactic acid and ethanol increased from zero to 0.75% and 0.20%, respectively. Lactic acid bacteria isolated from household bushera belonged to Lactobacillus, Streptococcus and Enterococcus genera. Tentatively, Lactobacillus isolates were identified as Lactobacillus plantarum, L. paracasei subsp. paracasei, L. fermentum, L. brevis and L. delbrueckii subsp. delbrueckii. Streptococcus thermophilus strains were also identified in household bushera. LAB isolated from bushera produced in the laboratory belonged to five genera (Lactococcus, Leuconostoc, Lactobacillus, Weissella and Enterococcus. Eight isolates were able to produce acid from starch and were identified as Lactococcus

  13. Development of a SCAR (sequence-characterised amplified region) marker for acid resistance-related gene in Lactobacillus plantarum.

    PubMed

    Liu, Shu-Wen; Li, Kai; Yang, Shi-Ling; Tian, Shu-Fen; He, Ling

    2015-03-01

    A sequence characterised amplified region marker was developed to determine an acid resistance-related gene in Lactobacillus plantarum. A random amplified polymorphic DNA marker named S116-680 was reported to be closely related to the acid resistance of the strains. The DNA band corresponding to this marker was cloned and sequenced with the induction of specific designed PCR primers. The results of PCR test helped to amplify a clear specific band of 680 bp in the tested acid-resistant strains. S116-680 marker would be useful to explore the acid-resistant mechanism of L. plantarum and to screen desirable malolactic fermentation strains.

  14. Synthesis of Lipoteichoic Acids in Bacillus anthracis

    PubMed Central

    Garufi, Gabriella; Hendrickx, Antoni P.; Beeri, Karen; Kern, Justin W.; Sharma, Anshika; Richter, Stefan G.; Schneewind, Olaf

    2012-01-01

    Lipoteichoic acid (LTA), a glycerol phosphate polymer, is a component of the envelope of Gram-positive bacteria that has hitherto not been identified in Bacillus anthracis, the causative agent of anthrax. LTA synthesis in Staphylococcus aureus and other microbes is catalyzed by the product of the ltaS gene, a membrane protein that polymerizes polyglycerol phosphate from phosphatidyl glycerol. Here we identified four ltaS homologues, designated ltaS1 to -4, in the genome of Bacillus anthracis. Polyglycerol phosphate-specific monoclonal antibodies were used to detect LTA in the envelope of B. anthracis strain Sterne (pXO1+ pXO2−) vegetative forms. B. anthracis mutants lacking ltaS1, ltaS2, ltaS3, or ltaS4 did not display defects in growth or LTA synthesis. In contrast, B. anthracis strains lacking both ltaS1 and ltaS2 were unable to synthesize LTA and exhibited reduced viability, altered envelope morphology, aberrant separation of vegetative forms, and decreased sporulation efficiency. Expression of ltaS1 or ltaS2 alone in B. anthracis as well as in other microbes was sufficient for polyglycerol phosphate synthesis. Thus, similar to S. aureus, B. anthracis employs LtaS enzymes to synthesize LTA, an envelope component that promotes bacterial growth and cell division. PMID:22685279

  15. Characterisation of a cell wall-anchored protein of Staphylococcus saprophyticus associated with linoleic acid resistance

    PubMed Central

    2012-01-01

    Background The Gram-positive bacterium Staphylococcus saprophyticus is the second most frequent causative agent of community-acquired urinary tract infections (UTI), accounting for up to 20% of cases. A common feature of staphylococci is colonisation of the human skin. This involves survival against innate immune defenses including antibacterial unsaturated free fatty acids such as linoleic acid which act by disrupting bacterial cell membranes. Indeed, S. saprophyticus UTI is usually preceded by perineal skin colonisation. Results In this study we identified a previously undescribed 73.5 kDa cell wall-anchored protein of S. saprophyticus, encoded on plasmid pSSAP2 of strain MS1146, which we termed S. saprophyticus surface protein F (SssF). The sssF gene is highly prevalent in S. saprophyticus clinical isolates and we demonstrate that the SssF protein is expressed at the cell surface. However, unlike all other characterised cell wall-anchored proteins of S. saprophyticus, we were unable to demonstrate a role for SssF in adhesion. SssF shares moderate sequence identity to a surface protein of Staphylococcus aureus (SasF) recently shown to be an important mediator of linoleic acid resistance. Using a heterologous complementation approach in a S. aureus sasF null genetic background, we demonstrate that SssF is associated with resistance to linoleic acid. We also show that S. saprophyticus strains lacking sssF are more sensitive to linoleic acid than those that possess it. Every staphylococcal genome sequenced to date encodes SssF and SasF homologues. Proteins in this family share similar predicted secondary structures consisting almost exclusively of α-helices in a probable coiled-coil formation. Conclusions Our data indicate that SssF is a newly described and highly prevalent surface-localised protein of S. saprophyticus that contributes to resistance against the antibacterial effects of linoleic acid. SssF is a member of a protein family widely disseminated

  16. Synthesis of novel acid electrolytes for phosphoric acid fuel cells

    NASA Astrophysics Data System (ADS)

    Adcock, James L.

    1988-11-01

    A 40 millimole per hour scale aerosol direct fluorination reactor was constructed. F-Methyl F-4-methoxybutanoate and F-4-methoxybutanoyl fluoride were synthesized by aerosol direct fluorination of methyl 4-methoxybutanoate. Basic hydrolysis of the perfluorinated derivatives produce sodium F-4 methoxybutanoate which was pyrolyzed to F-3-methoxy-1-propene. Purification and shipment of 33 grams of F-3-methoxy-1-propene followed. Syntheses by analogous methods allowed production and shipment of 5 grams of F-3-ethoxy 1-propene, 18 grams of F-3-(2-methoxy.ethoxy) 1-propene, and 37 grams of F-3,3-dimethyl 1-butene. Eighteen grams of F-2,2-dimethyl 1-chloropropane was produced directly and shipped. As suggested by other contractors, 5 grams of F-3-methoxy 1-iodopropane, and 5 grams of F-3-(2-methoxy.ethoxy) 1-iodopropane were produced by converting the respective precursor acid sodium salts produced for olefin synthesis to the silver salts and pyrolyzing them with iodine. Each of these compounds was prepared for the first time by the aerosol fluorination process during the course of the contract. These samples were provided to other Gas Research Institute (GRI) contractors for synthesis of perfluorinated sulfur (VI) and phosphorous (V) acids.

  17. Selection of enhanced antimicrobial activity posing lactic acid bacteria characterised by (GTG)5-PCR fingerprinting.

    PubMed

    Šalomskienė, Joana; Abraitienė, Asta; Jonkuvienė, Dovilė; Mačionienė, Irena; Repečkienė, Jūratė

    2015-07-01

    The aim of the study was a detail evaluation of genetic diversity among the lactic acid bacteria (LAB) strains having an advantage of a starter culture in order to select genotypically diverse strains with enhanced antimicrobial effect on some harmfull and pathogenic microorganisms. Antimicrobial activity of LAB was performed by the agar well diffusion method and was examined against the reference strains and foodborne isolates of Bacillus cereus, Listeria monocytogenes, Escherichia coli, Staphylococcus aureus and Salmonella Typhimurium. Antifungal activity was tested against the foodborne isolates of Candida parapsilosis, Debaromyces hansenii, Kluyveromyces marxianus, Pichia guilliermondii, Yarowia lipolytica, Aspergillus brasiliensis, Aspergillus versicolor, Cladosporium herbarum, Penicillium chrysogenum and Scopulariopsis brevicaulis. A total 40 LAB strains representing Lactobacillus (23 strains), Lactococcus (13 strains) and Streptococcus spp. (4 strains) were characterised by repetitive sequence based polymerase chain reaction fingerprinting which generated highly discriminatory profiles, confirmed the identity and revealed high genotypic heterogeneity among the strains. Many of tested LAB demonstrated strong antimicrobial activity specialised against one or few indicator strains. Twelve LAB strains were superior in suppressing growth of the whole complex of pathogenic bacteria and fungi. These results demonstrated that separate taxonomic units offered different possibilities of selection for novel LAB strains could be used as starter cultures enhancing food preservation.

  18. Physicochemical characterisation of a novel thermogelling formulation for percutaneous penetration of 5-aminolevulinic acid.

    PubMed

    Grüning, Nadja; Müller-Goymann, Christel Charlotte

    2008-06-01

    The present contribution was dedicated to the development and characterisation of a semisolid formulation of 5-aminolevulinic acid (5-ALA), appropriate for the diagnosis and treatment of actinic keratosis in photodynamic therapy. To achieve sufficiently high concentrations of the polar substance within the living epithelium after topical application, the semisolid base was enriched with penetration enhancers. A semisolid liquid crystalline system for drug delivering was the formulation of choice. It was composed of isopropyl alcohol, dimethyl isosorbide, medium chain triglycerides, water, and Pluronic F 127 as a polyoxyethylene-polyoxypropylene surface-active block copolymer. Rheometrical investigations were performed in the oscillatory mode and showed a thermo reversible gelification behaviour of the formulation, which therefore was denoted Thermogel. Permeation studies through human stratum corneum revealed higher permeation coefficients for 5-ALA from the Thermogel than from different German Pharmacopoeia creams. For example a 7.5-fold increase in comparison with Basiscreme DAC, and a 19.5-fold increase compared to water containing hydrophilic ointment. With respect to Dolgit(R) Mikrogel, the permeation coefficient from the Thermogel was 6.4-fold higher. These results were in accordance with those of differential scanning calorimetry measurements. Thermogel disclosed the strongest interactions with stratum corneum lipids.

  19. Electrochemical synthesis and characterisation of hybrid materials polypyrrole/dodecatungstophosphate as protective agents against steel corrosion

    NASA Astrophysics Data System (ADS)

    Bonastre Cano, Jose Antonio

    hand, this pretreatment should guarantee appropriate conditions in order to obtain a coating with high adhesion on carbon steel. Once studied the better parameters for the synthesis of the hybrid material by cyclic voltammetry, hybrid material is morphological, chemical and electrochemical characterised by the following techniques: Cyclic Voltammetry, Scanning Electron Microscopy, Energy Dispersive X Ray, X Ray Photoelectron Spectroscopy and Electrochemical Impedance Spectroscopy. The hybrid material polypyrrole/PW 12O403-. chemical structure presents Fe oxides and hydroxide within the polypyrrole polycationic matrix. Hybrid material polypyrrol/PW12O403- diminishes the corrosion of carbon steel in NaOH and Porland cement filtering solutions. These cement solutions simulate the pore fluid conditions existing in cured mortar or concrete elements. Fe ion concentration data were determinated in corrosion tests. Voltammetric response of polymeric coatings was evaluated by cyclic voltammetry. Finally, the protection provided by hybrid material polypyrrole/PW 12O403, in oxidised and reduced state, was evaluated on carbon steel electrodes embedded in Portland cement mortars immersed in seawater and submitted to an accelerated carbonation process for 265 days. Polymeric material covered carbon steel electrodes in reduced state suffer a Fe gravimetric loss 15 times lower than the ones of bare electrodes against chlorides attack, due to the effect of physical barrier. Hybrid material covered electrodes in oxidised state after being submitted to a carbonation process suffer a Fe gravimetric loss 2.5 times lower than the ones of bare electrodes, due to galvanic protection provided by hybrid material polypyrrole/PW 12O403- on carbon steel.

  20. Catalysis of the Carbonylation of Alcohols to Carboxylic Acids Including Acetic Acid Synthesis from Methanol.

    ERIC Educational Resources Information Center

    Forster, Denis; DeKleva, Thomas W.

    1986-01-01

    Monsanto's highly successful synthesis of acetic acid from methanol and carbon monoxide illustrates use of new starting materials to replace pretroleum-derived ethylene. Outlines the fundamental aspects of the acetic acid process and suggests ways of extending the synthesis to higher carboxylic acids. (JN)

  1. Synthesis and characterisation of YSZ-Al2O3 nanostructured materials.

    PubMed

    Santoyo-Salazar, J; González, G; Schabes-Retchkiman, P S; Ascencio, J A; Tartaj-Salvador, J; Chávez-Carvayar, J A

    2006-07-01

    In this work a co-precipitation route was used to synthesise two yttria-stabilised-zirconia (YSZ) phases with different concentrations of alumina (Al2O3). A tetragonal, with 3 mol% yttria, and a cubic, with 8 mol% yttria, phases were added with alumina in different weight proportions, 90/10, 80/20, 70/30, and 60/40, respectively. After synthesised, products were sintered in a range 800-1100 degrees C for different intervals of time. Compounds were characterised by X-ray diffraction, transmission electron microscopy (TEM), high resolution transmission electron microscopy (HRTEM), scanning electron microscopy (SEM), and atomic force microscopy (AFM). Rietveld refinements, using FULPROF-Suite software, were carried out to obtain the cell parameters and structural characterisation of products.

  2. Platinum(iv) N-heterocyclic carbene complexes: their synthesis, characterisation and cytotoxic activity.

    PubMed

    Bouché, M; Dahm, G; Wantz, M; Fournel, S; Achard, T; Bellemin-Laponnaz, S

    2016-07-28

    Platinum(ii) N-heterocyclic carbene complexes have been oxidized by bromine or iodobenzene dichloride to provide the fully characterised corresponding platinum(iv) NHC complexes. Antiproliferative activities of Pt(iv) NHC complexes were assayed against several cancer cell lines and the results were correlated with respect to their stability. Mechanistic investigations revealed that mitochondrial dysfunction and ROS production were associated with the cytotoxic process induced by these compounds. PMID:27331604

  3. Synthesis of ettringite: a way to deal with the acid wastewaters of aluminium anodising industry.

    PubMed

    Alvarez-Ayuso, E; Nugteren, H W

    2005-01-01

    Synthesis of ettringite from acid wastewaters of the aluminium anodising industry has been studied as a possible route of reducing the emissions to the environment, recovering at the same time resource materials as a useful marketable mineral. Wastewaters of different concentrations have been subjected to the process of synthesis suspending calcium oxide and calcium aluminate powders at different time and pH conditions. High caustic alkalinity (pH approximately 12) and low sulphate concentrations (<0.1 M) are the most suitable conditions to synthesise ettringite. The mineral characterisation has been performed using X-ray diffraction (XRD), Fourier transform infrared spectroscopy (FTIR), thermogravimetric analysis (TGA) and differential thermal analysis (DTA), proving the high purity of the pursued solid product when hydrated in the appropriate sodium hydroxide concentrations. In such conditions, around 90% of the aluminium initially present in the wastewater solutions is recovered in the form of ettringite. PMID:15607165

  4. Synthesis of ettringite: a way to deal with the acid wastewaters of aluminium anodising industry.

    PubMed

    Alvarez-Ayuso, E; Nugteren, H W

    2005-01-01

    Synthesis of ettringite from acid wastewaters of the aluminium anodising industry has been studied as a possible route of reducing the emissions to the environment, recovering at the same time resource materials as a useful marketable mineral. Wastewaters of different concentrations have been subjected to the process of synthesis suspending calcium oxide and calcium aluminate powders at different time and pH conditions. High caustic alkalinity (pH approximately 12) and low sulphate concentrations (<0.1 M) are the most suitable conditions to synthesise ettringite. The mineral characterisation has been performed using X-ray diffraction (XRD), Fourier transform infrared spectroscopy (FTIR), thermogravimetric analysis (TGA) and differential thermal analysis (DTA), proving the high purity of the pursued solid product when hydrated in the appropriate sodium hydroxide concentrations. In such conditions, around 90% of the aluminium initially present in the wastewater solutions is recovered in the form of ettringite.

  5. Synthesis and characterisation of 5-acyl-6,7-dihydrothieno[3,2-c]pyridine inhibitors of Hedgehog acyltransferase

    PubMed Central

    Lanyon-Hogg, Thomas; Masumoto, Naoko; Bodakh, George; Konitsiotis, Antonio D.; Thinon, Emmanuelle; Rodgers, Ursula R.; Owens, Raymond J.; Magee, Anthony I.; Tate, Edward W.

    2016-01-01

    In this data article we describe synthetic and characterisation data for four members of the 5-acyl-6,7-dihydrothieno[3,2-c]pyridine (termed “RU-SKI”) class of inhibitors of Hedgehog acyltransferase, including associated NMR spectra for final compounds. RU-SKI compounds were selected for synthesis based on their published high potencies against the enzyme target. RU-SKI 41 (9a), RU-SKI 43 (9b), RU-SKI 101 (9c), and RU-SKI 201 (9d) were profiled for activity in the related article “Click chemistry armed enzyme linked immunosorbent assay to measure palmitoylation by Hedgehog acyltransferase” (Lanyon-Hogg et al., 2015) [1]. 1H NMR spectral data indicate different amide conformational ratios between the RU-SKI inhibitors, as has been observed in other 5-acyl-6,7-dihydrothieno[3,2-c]pyridines. The synthetic and characterisation data supplied in the current article provide validated access to the class of RU-SKI inhibitors. PMID:27077078

  6. Synthesis and characterisation of 5-acyl-6,7-dihydrothieno[3,2-c]pyridine inhibitors of Hedgehog acyltransferase.

    PubMed

    Lanyon-Hogg, Thomas; Masumoto, Naoko; Bodakh, George; Konitsiotis, Antonio D; Thinon, Emmanuelle; Rodgers, Ursula R; Owens, Raymond J; Magee, Anthony I; Tate, Edward W

    2016-06-01

    In this data article we describe synthetic and characterisation data for four members of the 5-acyl-6,7-dihydrothieno[3,2-c]pyridine (termed "RU-SKI") class of inhibitors of Hedgehog acyltransferase, including associated NMR spectra for final compounds. RU-SKI compounds were selected for synthesis based on their published high potencies against the enzyme target. RU-SKI 41 (9a), RU-SKI 43 (9b), RU-SKI 101 (9c), and RU-SKI 201 (9d) were profiled for activity in the related article "Click chemistry armed enzyme linked immunosorbent assay to measure palmitoylation by Hedgehog acyltransferase" (Lanyon-Hogg et al., 2015) [1]. (1)H NMR spectral data indicate different amide conformational ratios between the RU-SKI inhibitors, as has been observed in other 5-acyl-6,7-dihydrothieno[3,2-c]pyridines. The synthetic and characterisation data supplied in the current article provide validated access to the class of RU-SKI inhibitors. PMID:27077078

  7. Synthesis and Characterisation of Porous Titania-Silica Composite Aerogel for NO(x) and Acetaldehyde Removal.

    PubMed

    Lee, Kwang Young; Park, Se Min; Kim, Jong Beom; El Saliby, Ibrahim; Shahid, Mohammad; Kim, Geon-Joong; Shon, Ho Kyong; Kim, Jong-Ho

    2016-05-01

    In this study, the synthesis of porous titania-silica (TiO2-SiO2) composite aerogel at ambient pressure by using non-hazardous chemicals as a source of silica was investigated. TiO2-SiO2 composite aerogels were characterised and their photocatalytic performances were investigated for the removal efficiency of acetaldehyde and NO(x) under UV light. Results showed that porous composite aerogel with aggregated morphology, high surface area and an increased mesoporosity were formed. TiO2-SiO2(1.8) composite, with high Ti/Si ratio, showed the best results in terms of photocatalytic removal of acetaldehyde and nitrogen oxide. PMID:27483782

  8. Synthesis and characterisation of a novel mixed donor P,O,P' nixantphos ligand and its metal complex

    NASA Astrophysics Data System (ADS)

    Marimuthu, Thashree; Bala, Muhammad D.; Friedrich, Holger B.

    2016-02-01

    The complex [(NixC8OH)Ir(cod)Cl] 4 has been synthesized and structurally characterized by NMR, IR and single crystal X-ray diffraction. The synthesis and characterisation of the novel ligand NixC8OH is also presented. The coordination around Ir is trigonal bipyramidal with both P groups of the NixC8OH ligand bound in a bis-equatorial mode. The bis-chelating cod (C8H12) ligand occupies the remaining equatorial position and an axial position. This mode of bonding has resulted in a large bite angle (P1-Ir-P2) of 102.92(12)° for the title complex 4. The IR and NMR data further support the elucidated structure. Thermal analyses of 4 indicate that it is thermally stable up to a decomposition temperature of >400 °C.

  9. Synthesis and Characterisation of Porous Titania-Silica Composite Aerogel for NO(x) and Acetaldehyde Removal.

    PubMed

    Lee, Kwang Young; Park, Se Min; Kim, Jong Beom; El Saliby, Ibrahim; Shahid, Mohammad; Kim, Geon-Joong; Shon, Ho Kyong; Kim, Jong-Ho

    2016-05-01

    In this study, the synthesis of porous titania-silica (TiO2-SiO2) composite aerogel at ambient pressure by using non-hazardous chemicals as a source of silica was investigated. TiO2-SiO2 composite aerogels were characterised and their photocatalytic performances were investigated for the removal efficiency of acetaldehyde and NO(x) under UV light. Results showed that porous composite aerogel with aggregated morphology, high surface area and an increased mesoporosity were formed. TiO2-SiO2(1.8) composite, with high Ti/Si ratio, showed the best results in terms of photocatalytic removal of acetaldehyde and nitrogen oxide.

  10. Synthesis and characterisation of metal nanoparticles and their effects on seed germination and seedling growth in commercially important Eruca sativa.

    PubMed

    Zaka, Mehreen; Abbasi, Bilal Haider; Rahman, Latif-Ur; Shah, Afzal; Zia, Muhammad

    2016-06-01

    The synthesis, characterisation and application of metal nanoparticles have become an important and attractive branch of nanotechnology. In current study, metallic nanoparticles of silver, copper, and gold were synthesised using environment friendly method (polyols process), and applied on medicinally important plant: Eruca sativa. Effects of application of these nanoparticles were evaluated on seed germination frequency and biochemical parameters of plant tissues. Seeds of E. sativa were germinated on Murashige and Skoog (MS) medium incorporated with various combinations of nanoparticles suspension (30 µg/ml). Phytotoxicity study showed that nanoparticles could induce stress in plants by manipulating the endogenous mechanisms. In response to these stresses, plants release various defensive compounds; known as antioxidant secondary metabolites. These plants derived secondary metabolites having a great potential in treating the common human ailments. In the authors study, small-sized nanoparticles showed higher toxicity levels and enhanced secondary metabolites production, total protein content, total flavonoids content and total phenolics content.

  11. Synthesis and characterisation of metal nanoparticles and their effects on seed germination and seedling growth in commercially important Eruca sativa.

    PubMed

    Zaka, Mehreen; Abbasi, Bilal Haider; Rahman, Latif-Ur; Shah, Afzal; Zia, Muhammad

    2016-06-01

    The synthesis, characterisation and application of metal nanoparticles have become an important and attractive branch of nanotechnology. In current study, metallic nanoparticles of silver, copper, and gold were synthesised using environment friendly method (polyols process), and applied on medicinally important plant: Eruca sativa. Effects of application of these nanoparticles were evaluated on seed germination frequency and biochemical parameters of plant tissues. Seeds of E. sativa were germinated on Murashige and Skoog (MS) medium incorporated with various combinations of nanoparticles suspension (30 µg/ml). Phytotoxicity study showed that nanoparticles could induce stress in plants by manipulating the endogenous mechanisms. In response to these stresses, plants release various defensive compounds; known as antioxidant secondary metabolites. These plants derived secondary metabolites having a great potential in treating the common human ailments. In the authors study, small-sized nanoparticles showed higher toxicity levels and enhanced secondary metabolites production, total protein content, total flavonoids content and total phenolics content. PMID:27256893

  12. Synthesis and characterisation of a novel mixed donor P,O,P' nixantphos ligand and its metal complex

    NASA Astrophysics Data System (ADS)

    Marimuthu, Thashree; Bala, Muhammad D.; Friedrich, Holger B.

    2016-02-01

    The complex [(NixC8OH)Ir(cod)Cl] 4 has been synthesized and structurally characterized by NMR, IR and single crystal X-ray diffraction. The synthesis and characterisation of the novel ligand NixC8OH is also presented. The coordination around Ir is trigonal bipyramidal with both P groups of the NixC8OH ligand bound in a bis-equatorial mode. The bis-chelating cod (C8H12) ligand occupies the remaining equatorial position and an axial position. This mode of bonding has resulted in a large bite angle (P1-Ir-P2) of 102.92(12)° for the title complex 4. The IR and NMR data further support the elucidated structure. Thermal analyses of 4 indicate that it is thermally stable up to a decomposition temperature of >400 °C.

  13. Energetics of amino acid synthesis in hydrothermal ecosystems

    NASA Technical Reports Server (NTRS)

    Amend, J. P.; Shock, E. L.

    1998-01-01

    Thermodynamic calculations showed that the autotrophic synthesis of all 20 protein-forming amino acids was energetically favored in hot (100 degrees C), moderately reduced, submarine hydrothermal solutions relative to the synthesis in cold (18 degrees C), oxidized, surface seawater. The net synthesis reactions of 11 amino acids were exergonic in the hydrothermal solution, but all were endergonic in surface seawater. The synthesis of the requisite amino acids of nine thermophilic and hyperthermophilic proteins in a 100 degreesC hydrothermal solution yielded between 600 and 8000 kilojoules per mole of protein, which is energy that is available to drive the intracellular synthesis of enzymes and other biopolymers in hyperthermophiles thriving in these ecosystems.

  14. Inhibition of plant fatty acid synthesis by nitroimidazoles.

    PubMed Central

    Jones, A V; Harwood, J L; Stratford, M R; Stumpf, P K

    1981-01-01

    1. The effect of the addition of a number of nitroimidazoles was tested on fatty acid synthesis by germinating pea seeds, isolated lettuce chloroplasts and a soluble fraction from pea seeds. 2. All the compounds tested had a marked inhibition on stearate desaturation by lettuce chloroplasts and on the synthesis of very-long-chain fatty acids by pea seeds. 3. In contrast, the effect of the drugs on total fatty acid synthesis from [14C]acetate in chloroplasts was related to the compound's electron reduction potentials. 4. Of the compounds used, only metronidazole had a marked inhibition on palmitate elongation in the systems tested. 5. The mechanism of inhibition of plant fatty acid synthesis by nitroimidazoles is discussed and the possible relevance of these findings to their neurotoxicity is suggested. PMID:7325993

  15. Characterisation of Fe-oxide nanoparticles coated with humic acid and Suwannee River natural organic matter.

    PubMed

    Chekli, Laura; Phuntsho, Sherub; Roy, Maitreyee; Shon, Ho Kyong

    2013-09-01

    Iron oxide nanoparticles are becoming increasingly popular for various applications including the treatment of contaminated soil and groundwater; however, their mobility and reactivity in the subsurface environment are significantly affected by their tendency to aggregate. One solution to overcome this issue is to coat the nanoparticles with dissolved organic matter (DOM). The advantages of DOM over conventional surface modifiers are that DOM is naturally abundant in the environment, inexpensive, non-toxic and readily adsorbed onto the surface of metal oxide nanoparticles. In this study, humic acid (HA) and Suwannee River natural organic matter (SRNOM) were tested and compared as surface modifiers for Fe2O3 nanoparticles (NPs). The DOM-coated Fe2O3 NPs were characterised by various analytical methods including: flow field-flow fractionation (FlFFF), high performance size exclusion chromatography (HPSEC) and Fourier transform infrared spectroscopy (FTIR). The stability of the coated NPs was then evaluated by assessing their aggregation and disaggregation behaviour over time. Results showed that both HA and SRNOM were rapidly and readily adsorbed on the surface of Fe2O3 NPs, providing electrosteric stabilisation over a wide range of pH. HPSEC results showed that the higher molecular weight components of DOM were preferentially adsorbed onto the surface of Fe2O3. As SRNOM consists of macromolecules with a higher molecular weight than HA, the measured size of the SRNOM-coated Fe2O3 NPs was 30% larger than the HA-coated Fe2O3 NPs. FTIR results indicated the occurrence of hydrogen bonding arising from electrostatic interaction between the DOM and Fe2O3 NPs. Finally, a stability study showed that after 14 days, small agglomerates and aggregates were formed. The HA-coated Fe2O3 NPs formed agglomerates which were easily disaggregated using a vortex mixer, with the coated NPs returning to their initial size. However, SRNOM-coated Fe2O3 NPs were only partially disaggregated

  16. Characterisation of Non-Autoinducing Tropodithietic Acid (TDA) Production from Marine Sponge Pseudovibrio Species

    PubMed Central

    Harrington, Catriona; Reen, F. Jerry; Mooij, Marlies J.; Stewart, Fiona A.; Chabot, Jean-Baptiste; Guerra, Antonio F.; Glöckner, Frank O.; Nielsen, Kristian F.; Gram, Lone; Dobson, Alan D. W.; Adams, Claire; O’Gara, Fergal

    2014-01-01

    The search for new antimicrobial compounds has gained added momentum in recent years, paralleled by the exponential rise in resistance to most known classes of current antibiotics. While modifications of existing drugs have brought some limited clinical success, there remains a critical need for new classes of antimicrobial compound to which key clinical pathogens will be naive. This has provided the context and impetus to marine biodiscovery programmes that seek to isolate and characterize new activities from the aquatic ecosystem. One new antibiotic to emerge from these initiatives is the antibacterial compound tropodithietic acid (TDA). The aim of this study was to provide insight into the bioactivity of and the factors governing the production of TDA in marine Pseudovibrio isolates from a collection of marine sponges. The TDA produced by these Pseudovibrio isolates exhibited potent antimicrobial activity against a broad spectrum of clinical pathogens, while TDA tolerance was frequent in non-TDA producing marine isolates. Comparative genomics analysis suggested a high degree of conservation among the tda biosynthetic clusters while expression studies revealed coordinated regulation of TDA synthesis upon transition from log to stationary phase growth, which was not induced by TDA itself or by the presence of the C10-acyl homoserine lactone quorum sensing signal molecule. PMID:25513851

  17. Direct Catalytic Asymmetric Synthesis of β-Hydroxy Acids from Malonic Acid.

    PubMed

    Gao, Hang; Luo, Zhenli; Ge, Pingjin; He, Junqian; Zhou, Feng; Zheng, Peipei; Jiang, Jun

    2015-12-18

    A nickel(II) catalyzed asymmetric synthesis of β-hydroxy acids from malonic acid and ketones was developed, revealing for the first time the synthetic utility of malonic acid in the construction of chiral carboxyl acids; importantly, the synthetic potential of this strategy was further demonstrated by the rapid construction of cephalanthrin A, phaitanthrin B, cruciferane, and rice metabolites.

  18. Synthesis, characterisation, and oxygen atom transfer reactions involving the first gold(I)-alkylperoxo complexes.

    PubMed

    Collado, Alba; Gómez-Suárez, Adrián; Oonishi, Yoshihiro; Slawin, Alexandra M Z; Nolan, Steven P

    2013-11-25

    The synthesis of a new class of organogold species containing a peroxo moiety is reported. Complexes [Au(IPr)(OO(t)Bu)] and [Au(SIPr)(OO(t)Bu)] have been synthesised via a straightforward methodology using the parent gold(I) hydroxide complexes as synthons. These complexes have been successfully used in oxygen-transfer reactions to triphenylphosphine.

  19. Prebiotic Amino Acid Thioester Synthesis: Thiol-Dependent Amino Acid Synthesis from Formose substrates (Formaldehyde and Glycolaldehyde) and Ammonia

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1998-01-01

    Formaldehyde and glycolaldehyde (substrates of the formose autocatalytic cycle) were shown to react with ammonia yielding alanine and homoserine under mild aqueous conditions in the presence of thiol catalysts. Since similar reactions carried out without ammonia yielded alpha-hydroxy acid thioesters, the thiol-dependent synthesis of alanine and homoserine is presumed to occur via amino acid thioesters-intermediates capable of forming peptides. A pH 5.2 solution of 20 mM formaldehyde, 20 mM glycolaldehyde, 20 mM ammonium chloride, 23 mM 3-mercaptopropionic acid, and 23 mM acetic acid that reacted for 35 days at 40 C yielded (based on initial formaldehyde) 1.8% alanine and 0.08% homoserine. In the absence of thiol catalyst, the synthesis of alanine and homoserine was negligible. Alanine synthesis required both formaldehyde and glycolaldehyde, but homoserine synthesis required only glycolaldehyde. At 25 days the efficiency of alanine synthesis calculated from the ratio of alanine synthesized to formaldehyde reacted was 2.1%, and the yield (based on initial formaldehyde) of triose and tetrose intermediates involved in alanine and homoserine synthesis was 0.3 and 2.1%, respectively. Alanine synthesis was also seen in similar reactions containing only 10 mM each of aldehyde substrates, ammonia, and thiol. The prebiotic significance of these reactions that use the formose reaction to generate sugar intermediates that are converted to reactive amino acid thioesters is discussed.

  20. Building, characterising and catalytic activity testing of Co-C-protected amino acid complexes covalently grafted onto chloropropylated silica gel

    NASA Astrophysics Data System (ADS)

    Varga, G.; Timár, Z.; Csendes, Z.; Bajnóczi, É. G.; Carlson, S.; Canton, S. E.; Bagi, L.; Sipos, P.; Pálinkó, I.

    2015-06-01

    Co-C-protected amino acid (C-protected L-histidine, L-tyrosine, L-cysteine and L-cystine) complexes were covalently grafted onto chloropropylated silica gel, and the materials thus obtained were structurally characterised by mid/far IR and X-ray absorption spectroscopies. The superoxide dismutase-like activities of the substances were determined via the Beauchamp-Fridovich test reaction. It was found that covalent grafting and the preparation of the anchored complexes were successful in most cases. The coordinating groups varied upon changing the conditions of the syntheses. All materials displayed catalytic activity, although catalytic activities differed widely.

  1. Synthesis, purification and mass spectrometric characterisation of a fluorescent Au9@BSA nanocluster and its enzymatic digestion by trypsin

    NASA Astrophysics Data System (ADS)

    Fernández-Iglesias, Nerea; Bettmer, Jörg

    2013-12-01

    Nanoclusters of noble metals like Ag and Au have attracted great attention as they form a missing link between isolated metal atoms and nanoparticles. Their particular properties like luminescence in the visible range and nontoxicity make them attractive for bioimaging and biolabelling purposes, especially with use of proteins as stabilising agents. In this context, this study intends the synthesis of a specific Au nanocluster covered by bovine serum albumin (BSA). It is shown that size-exclusion chromatography is feasible for the purification and isolation of the nanocluster. A mass spectrometric characterisation, preferably by ESI-MS, indicates the presence of an Au9@BSA nanocluster. Enzymatic digestion of the nanocluster with trypsin results in a significant increase of the fluorescence intensity at 650 and 710 nm, whereas complementary MALDI-MS studies are presented for the identification of generated peptides and show a distinctive pattern in comparison to the pure protein. It can be concluded that Au9@BSA might be, in future, an interesting candidate for in vitro studies of protease activities.Nanoclusters of noble metals like Ag and Au have attracted great attention as they form a missing link between isolated metal atoms and nanoparticles. Their particular properties like luminescence in the visible range and nontoxicity make them attractive for bioimaging and biolabelling purposes, especially with use of proteins as stabilising agents. In this context, this study intends the synthesis of a specific Au nanocluster covered by bovine serum albumin (BSA). It is shown that size-exclusion chromatography is feasible for the purification and isolation of the nanocluster. A mass spectrometric characterisation, preferably by ESI-MS, indicates the presence of an Au9@BSA nanocluster. Enzymatic digestion of the nanocluster with trypsin results in a significant increase of the fluorescence intensity at 650 and 710 nm, whereas complementary MALDI-MS studies are presented

  2. Oleochemical synthesis of an acid cleavable hydrophobe for surfactant use

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The synthesis of a series of branched hydroxy stearates from commercially available methyl oleate and common organic acids is reported. A variety of different acids, with 3 to 8 carbon atoms, and also varying in their branching and functionality, were used. The kinetics of the ring opening reactio...

  3. Nucleic acid arrays and methods of synthesis

    DOEpatents

    Sabanayagam, Chandran R.; Sano, Takeshi; Misasi, John; Hatch, Anson; Cantor, Charles

    2001-01-01

    The present invention generally relates to high density nucleic acid arrays and methods of synthesizing nucleic acid sequences on a solid surface. Specifically, the present invention contemplates the use of stabilized nucleic acid primer sequences immobilized on solid surfaces, and circular nucleic acid sequence templates combined with the use of isothermal rolling circle amplification to thereby increase nucleic acid sequence concentrations in a sample or on an array of nucleic acid sequences.

  4. Synthesis and electrochemical characterisation of Molybdenum(VI) complexes of disalicylaldehyde malonoyl-dihydrazone

    NASA Astrophysics Data System (ADS)

    Ahmed, Aziz; Lal, Ram A.

    2013-09-01

    Molybdenum(VI) complexes composition [(μ2-O)2(MoO2)2(H4L)2]ṡ2A (where H4L = H4slmh; A = H2O (1), pyridine (py, 2), 2-picoline (2-pic, 3), 3-picoline (3-pic, 4), 4-picoline (4-pic, 5)) have been isolated in solid state from the reaction of MoO2(acac)2 and disalicylaldehyde malonoyldihydrazone in 1:1 M ratio in ethanol at higher temperature. The complexes have been synthesised and characterised by various physiochemical and spectroscopic studies. The structure of the molybdenum(VI) of all complexes has been established by elemental analyses, electronic, IR, 1H NMR and CV spectral studies. The dihydrazone is coordinated to the metal centres in keto enol form in all the complexes (1)-(5). The electronic spectra of the complexes are dominated by strong charge transfer bands. All of the complexes involve six coordinated molybdenum centre with octahedral arrangement of donor atoms.

  5. Synthesis, structural characterisation, bio-potential efficiency and DNA cleavage applications of nicotinamide metal complexes

    NASA Astrophysics Data System (ADS)

    Surendra Dilip, C.; Siva Kumar, V.; John Venison, S.; Vetha potheher, I.; Rajalaxmi (a) Subahashini, D.

    2013-05-01

    Mixed ligand complexes were synthesised using nicotinamide as the primary ligand and nitrite as the secondary ligand were characterised by FT-IR, UV-Vis, 1H NMR, TG-DTA-DTG, X-ray powder diffraction and physical analytical studies. From the molar conductance, magnetic moment and electronic spectral data of the synthesised complexes a general formula of [M(ONO)2(NA)2] where M = Co(II), Ni(II), Cu(II), Zn(II), Cd(II) and Hg(II) and [Cr2(ONO)6(NA)2] with a distorted octahedral structure were proposed. Thermal analyses show that the complexes lose molecules of hydration initially and subsequently expel anionic and organic ligands in continuous steps. The kinetic parameter values, such as, E*, ΔH*, ΔS* and ΔG* illustrate the spontaneous association of the metal and ligands in the formation of the complexes. The antimicrobial efficacy of the ligand and its complexes were examined by in vitro method against various pathogenic bacterial and fungal strains. The metal complexes were found to posses efficient antimicrobial properties compared to nicotinamide and a few of these complexes could turn out to be excellent models for the design of effective antibiotic drug substances. The intercalating interaction of Cu(II) complex with CT-DNA was inspected by absorption spectral and viscosity studies, thermal denaturation and electro-analytical experiments.

  6. Synthesis and characterisation of thiosemicarbazonato molybdenum(VI) complexes and their in vitro antitumor activity.

    PubMed

    Vrdoljak, Visnja; Dilović, Ivica; Rubcić, Mirta; Kraljević Pavelić, Sandra; Kralj, Marijeta; Matković-Calogović, Dubravka; Piantanida, Ivo; Novak, Predrag; Rozman, Andrea; Cindrić, Marina

    2010-01-01

    New dioxomolybdenum(VI) complexes were obtained by the reaction of [MoO2(acac)2] with thiosemicarbazone ligands derived from 3-thiosemicarbazide and 4-(diethylamino)salicylaldehyde (H2L1), 2-hydroxy-3-methoxybenzaldehyde (H2L2) or 2-hydroxy-1-naphthaldehyde (H2L3). In all complexes thiosemicarbazonato ligands are coordinated to molybdenum as tridentate ONS-donors. Octahedral coordination of each molybdenum atom is completed by methanol molecule (in 1a-3a) or by oxygen atom of Mo=O unit from the neighbouring molecule (in 1-3). All complexes were characterized by means of chemical analyses, IR spectroscopy, TG and NMR measurements. The molecular structures of the ligand H2L2 and complex [MoO2L2(CH3OH)].CH3OH (2a) have been determined by single crystal X-ray crystallography. The characterisation of thiosemicarbazonato molybdenum(VI) complexes (1-4) as well as of the 4-phenylthisemicarbazonato molybdenum(VI) complexes (5-8) in aqueous medium revealed that upon dissolving complexes in water, most likely to some extent dissociation took place, although experimental data didn't allow exact quantification of dissociation. The antiproliferative effects of studied molybdenum(VI) complexes (1-8) on the human cell lines were identical to the activity of their corresponding ligands.

  7. Rapid hydrothermal flow synthesis and characterisation of carbonate- and silicate-substituted calcium phosphates

    PubMed Central

    Knowles, Jonathan C; Rehman, Ihtesham; Darr, Jawwad A

    2013-01-01

    A range of crystalline and nano-sized carbonate- and silicate-substituted hydroxyapatite has been successfully produced by using continuous hydrothermal flow synthesis technology. Ion-substituted calcium phosphates are better candidates for bone replacement applications (due to improved bioactivity) as compared to phase-pure hydroxyapatite. Urea was used as a carbonate source for synthesising phase pure carbonated hydroxyapatite (CO3-HA) with ≈5 wt% substituted carbonate content (sample 7.5CO3-HA) and it was found that a further increase in urea concentration in solution resulted in biphasic mixtures of carbonate-substituted hydroxyapatite and calcium carbonate. Transmission electron microscopy images revealed that the particle size of hydroxyapatite decreased with increasing urea concentration. Energy-dispersive X-ray spectroscopy result revealed a calcium deficient apatite with Ca:P molar ratio of 1.45 (±0.04) in sample 7.5CO3-HA. For silicate-substituted hydroxyapatite (SiO4-HA) silicon acetate was used as a silicate ion source. It was observed that a substitution threshold of ∼1.1 wt% exists for synthesis of SiO4-HA in the continuous hydrothermal flow synthesis system, which could be due to the decreasing yields with progressive increase in silicon acetate concentration. All the as-precipitated powders (without any additional heat treatments) were analysed using techniques including Transmission electron microscopy, X-ray powder diffraction, Differential scanning calorimetry, Thermogravimetric analysis, Raman spectroscopy and Fourier transform infrared spectroscopy. PMID:22983020

  8. Concise total synthesis of (±)-actinophyllic acid

    PubMed Central

    Granger, Brett A.; Jewett, Ivan T.; Butler, Jeffrey D.; Martin, Stephen F.

    2014-01-01

    A concise total synthesis of the complex indole alkaloid (±)-actinophyllic acid was accomplished by a sequence of reactions requiring only 10 steps from readily-available, known starting materials. The approach featured a Lewis acid-catalyzed cascade of reactions involving stabilized carbocations that delivered the tetracyclic core of the natural product in a single chemical operation. Optimal conversion of this key intermediate into (±)-actinophyllic acid required judicious selection of a protecting group strategy. PMID:24882888

  9. A novel Schiff base: Synthesis, structural characterisation and comparative sensor studies for metal ion detections.

    PubMed

    Köse, Muhammet; Purtas, Savas; Güngör, Seyit Ali; Ceyhan, Gökhan; Akgün, Eyup; McKee, Vickie

    2015-02-01

    A novel Schiff base ligand was synthesized by the condensation reaction of 2,6-diformylpyridine and 4-aminoantipyrine in MeOH and characterised by its melting point, elemental analysis, FT-IR, (1)H, (13)C NMR and mass spectroscopic studies. Molecular structure of the ligand was determined by single crystal X-ray diffraction technique. The electrochemical properties of the Schiff base ligand were studied in different solvents at various scan rates. Sensor ability of the Schiff base ligand was investigated by colorimetric and fluorometric methods. Visual colour change of the ligand was investigated in MeOH solvent in presence of various metal ions Na(+), Mg(2+), Al(3+), K(+), Cr(3+), Mn(2+), Fe(3+), Co(2+), Ni(2+), Cu(2+), Zn(2+), Cd(2+), Hg(2+) and Pb(2+). Upon addition of Al(3+) ion into a MeOH solution of the ligand, an orange colour developed which is detectable by naked eye. Fluorescence emission studies showed that the ligand showed single emission band at 630-665nm upon excitation at 560nm. Addition of metal ions Na(+), Mg(2+), K(+), Cr(3+), Mn(2+), Fe(3+), Co(2+), Ni(2+), Cu(2+), Zn(2+), Cd(2+), Hg(2+) and Pb(2+) (1:1M ratio) cause fluorescence quenching, however addition of Al(+3) resulted in an increase in fluorescence intensity. No significant variation was observed in the fluorescence intensity caused by Al(3+) in presence of other metal ions. Therefore, the Schiff base ligand can be used for selective detection of Al(3+) ions in the presence of the other metal ions studied.

  10. A novel Schiff base: Synthesis, structural characterisation and comparative sensor studies for metal ion detections

    NASA Astrophysics Data System (ADS)

    Köse, Muhammet; Purtas, Savas; Güngör, Seyit Ali; Ceyhan, Gökhan; Akgün, Eyup; McKee, Vickie

    2015-02-01

    A novel Schiff base ligand was synthesized by the condensation reaction of 2,6-diformylpyridine and 4-aminoantipyrine in MeOH and characterised by its melting point, elemental analysis, FT-IR, 1H, 13C NMR and mass spectroscopic studies. Molecular structure of the ligand was determined by single crystal X-ray diffraction technique. The electrochemical properties of the Schiff base ligand were studied in different solvents at various scan rates. Sensor ability of the Schiff base ligand was investigated by colorimetric and fluorometric methods. Visual colour change of the ligand was investigated in MeOH solvent in presence of various metal ions Na+, Mg2+, Al3+, K+, Cr3+, Mn2+, Fe3+, Co2+, Ni2+, Cu2+, Zn2+, Cd2+, Hg2+ and Pb2+. Upon addition of Al3+ ion into a MeOH solution of the ligand, an orange colour developed which is detectable by naked eye. Fluorescence emission studies showed that the ligand showed single emission band at 630-665 nm upon excitation at 560 nm. Addition of metal ions Na+, Mg2+, K+, Cr3+, Mn2+, Fe3+, Co2+, Ni2+, Cu2+, Zn2+, Cd2+, Hg2+ and Pb2+ (1:1 M ratio) cause fluorescence quenching, however addition of Al+3 resulted in an increase in fluorescence intensity. No significant variation was observed in the fluorescence intensity caused by Al3+ in presence of other metal ions. Therefore, the Schiff base ligand can be used for selective detection of Al3+ ions in the presence of the other metal ions studied.

  11. Development of nanocomposites based on hydroxyapatite/sodium alginate: Synthesis and characterisation

    SciTech Connect

    Rajkumar, M.; Meenakshisundaram, N.; Rajendran, V.

    2011-05-15

    In this study, a novel method was used to produce a nanostructured composite consisting of hydroxyapatite and sodium alginate by varying the composition of sodium alginate. The structure, morphology, simulated body fluid response and mechanical properties of the synthesised nanocomposites were characterised. From X-ray diffraction analysis, an increase in crystallite size and degree of crystallinity with an increase in the composition of sodium alginate up to 1.5 wt.% was observed. Further, it was found to decrease with an increase in the composition of sodium alginate. A notable peak shift from 1635 to 1607 cm{sup -1} and 1456 to 1418 cm{sup -1} in the Fourier transform infrared spectra of the nanocomposite was observed towards the lower wave number side when compared with pure hydroxyapatite. It reveals a strong interaction between the positively charged calcium (Ca{sup 2+}) and the negatively charged carboxyl group (COO{sup -}) in sodium alginate. Transmission electron microscopy images of pure hydroxyapatite showed a short nanorod-like morphology with an average particle size of 13 nm. Bioresorbability of the samples was observed by immersing them in simulated body fluid medium for 14 days to evaluate the changes in pH and Ca{sup 2+} ion strength. Microhardness shows an increasing trend with an increase in the composition of sodium alginate from 1.5 to 3.0 wt.%, which is similar to that in the density. - Research Highlights: {yields} We have prepared nanohydroxyapatite/sodium alginate as a composite. {yields} Effect of sodium alginate on the properties of nanohydrroxyapatite has been studied. {yields} The sodium alginate ranges from 0 to 3.75 wt.% has been used. {yields} Composites show improved biological and mechanical properties.

  12. N-benzoylimido complexes of palladium. Synthesis, structural characterisation and structure-reactivity relationship.

    PubMed

    Besenyei, Gábor; Párkányi, László; Szalontai, Gábor; Holly, Sándor; Pápai, Imre; Keresztury, Gábor; Nagy, Andrea

    2004-07-01

    Benzoyl azides, ArC(O)N3, 2, (Ar = phenyl or substituted phenyl), react with [Pd2Cl2(dppm)2], 1, [dppm = bis(diphenylphosphino)methane] with the formation of novel [Pd2Cl2(mu-NC(O)Ar)(dppm)2], 3, benzoylnitrene complexes that were structurally characterised by multinuclear magnetic resonance and IR spectroscopy and, in several instances, by single crystal X-ray diffraction. As shown by crystallographic studies, the C2P4Pd2 rings adopt extended twist-boat conformations with methylene groups bending towards the bridging benzoylimido moieties. X-ray diffraction studies have revealed the chiral nature of the imido complexes, the chiral element being the propeller-like C2P4Pd2 ring. Structural data accumulated on complexes 3 such as short C-N distances (1.32 A), elongated C=O bonds (1.30 A) as well as the outstandingly high barrier to internal rotation around the N-C(O) linkage (88.3 kJ mol(-1)) are in line with extensive ppi-ppi interaction between the bridging nitrogen and the carbonyl carbon atoms. Theoretical calculations indicate an electron shift from the dimer towards the apical nitrogen atom, which, in turn, facilitates the donation of electrons towards the carbonyl moiety. To elucidate the structure-reactivity relationship of benzoyl azides towards 1, crystallographic and solution IR spectroscopic studies were carried out on a series of para-substituted benzoyl azides. The reaction obeys the Hammett equation. The large positive value of the reaction constant indicates that the azides act as electrophiles in the reaction studied. The enhanced reactivity of 2-nitrobenzoyl azide has been attributed to a decreased conjugation of the phenyl and carbonyl moieties in this reagent.

  13. Tin(IV) complexes of pyrrolidinedithiocarbamate: synthesis, characterisation and antifungal activity.

    PubMed

    Menezes, D C; Vieira, F T; de Lima, G M; Porto, A O; Cortés, M E; Ardisson, J D; Albrecht-Schmitt, T E

    2005-12-01

    The reaction of ammonium pyrrolidinedithiocarbamate, [NH4{S2CN(CH2)4}], with SnCl2, [Sn(C6H5)2Cl2], [Sn(C6H5)3Cl], [Sn(C4H9)2Cl2] and [Sn(C6H11)3Cl] produced in good yield the compounds [Sn{S2CN(CH2)4}2Cl2] (1), [Sn{S2CN(CH2)4}2Ph2] (2), [Sn{S2CN(CH2)4}Ph3] (3), [Sn{S2CN(CH2)4}2 n-Bu2] (4) and [Sn{S2CN(CH2)4}Cy3] (5). The complexes were characterised by infrared, multinuclear NMR (1H, 13C{1H} and 119Sn{1H}) and 119Sn Mössbauer spectroscopies. In addition, the crystal structure of 4 was determined by X-ray crystallography. The in vitro antifungal activity of the tin(IV) complexes as well of the ligand was performed on human pathogenic fungi, Candida albicans, in concentrations of 0.025; 0.050; 0.100; 0.200; 0.400; 0.800; 1.600 and 3.200 mM. The microorganism presented resistance to the dithiocarbamate ligand and all tin(IV) complexes tested were actives. The highest activity was found for compounds 1 and 4. PMID:16139393

  14. Synthesis, purification and mass spectrometric characterisation of a fluorescent Au9@BSA nanocluster and its enzymatic digestion by trypsin.

    PubMed

    Fernández-Iglesias, Nerea; Bettmer, Jörg

    2014-01-21

    Nanoclusters of noble metals like Ag and Au have attracted great attention as they form a missing link between isolated metal atoms and nanoparticles. Their particular properties like luminescence in the visible range and nontoxicity make them attractive for bioimaging and biolabelling purposes, especially with use of proteins as stabilising agents. In this context, this study intends the synthesis of a specific Au nanocluster covered by bovine serum albumin (BSA). It is shown that size-exclusion chromatography is feasible for the purification and isolation of the nanocluster. A mass spectrometric characterisation, preferably by ESI-MS, indicates the presence of an Au9@BSA nanocluster. Enzymatic digestion of the nanocluster with trypsin results in a significant increase of the fluorescence intensity at 650 and 710 nm, whereas complementary MALDI-MS studies are presented for the identification of generated peptides and show a distinctive pattern in comparison to the pure protein. It can be concluded that Au9@BSA might be, in future, an interesting candidate for in vitro studies of protease activities.

  15. Facile synthesis of mosquitocidal silver nanoparticles using Mussaenda glabra leaf extract: characterisation and impact on non-target aquatic organisms.

    PubMed

    Govindarajan, Marimuthu; Rajeswary, Mohan; Hoti, S L; Nicoletti, Marcello; Benelli, Giovanni

    2016-11-01

    Plant-borne compounds have been proposed for extracellular synthesis of mosquitocidal nanoparticles. However, their impact against mosquito natural enemies has been scarcely studied. Here, we synthesised silver nanoparticles (Ag NPs) using Mussaenda glabra leaf extract as reducing and stabilising agent. Biofabricated Ag NPs were characterised by UV-vis spectrophotometry, X-ray diffraction, Fourier transform infrared (FTIR) spectroscopy, scanning electron microscopy (SEM) and transmission electron microscopy (TEM). Compared to the leaf aqueous extract, biosynthesised Ag NPs showed higher toxicity against mosquito vectors Anopheles subpictus, Aedes albopictus and Culex tritaeniorhynchus with LC50 of 17-19 μg/mL, respectively. Ag NPs were found safer to non-target organisms Diplonychus indicus and Gambusia affinis, with respective LC50 values ranging from 1446 to 8628 μg/mL. Overall, M. glabra-fabricated Ag NPs are a promising and eco-friendly tool against larval populations of mosquito vectors of medical and veterinary importance, with negligible toxicity against other non-target aquatic organisms.

  16. Facile synthesis of mosquitocidal silver nanoparticles using Mussaenda glabra leaf extract: characterisation and impact on non-target aquatic organisms.

    PubMed

    Govindarajan, Marimuthu; Rajeswary, Mohan; Hoti, S L; Nicoletti, Marcello; Benelli, Giovanni

    2016-11-01

    Plant-borne compounds have been proposed for extracellular synthesis of mosquitocidal nanoparticles. However, their impact against mosquito natural enemies has been scarcely studied. Here, we synthesised silver nanoparticles (Ag NPs) using Mussaenda glabra leaf extract as reducing and stabilising agent. Biofabricated Ag NPs were characterised by UV-vis spectrophotometry, X-ray diffraction, Fourier transform infrared (FTIR) spectroscopy, scanning electron microscopy (SEM) and transmission electron microscopy (TEM). Compared to the leaf aqueous extract, biosynthesised Ag NPs showed higher toxicity against mosquito vectors Anopheles subpictus, Aedes albopictus and Culex tritaeniorhynchus with LC50 of 17-19 μg/mL, respectively. Ag NPs were found safer to non-target organisms Diplonychus indicus and Gambusia affinis, with respective LC50 values ranging from 1446 to 8628 μg/mL. Overall, M. glabra-fabricated Ag NPs are a promising and eco-friendly tool against larval populations of mosquito vectors of medical and veterinary importance, with negligible toxicity against other non-target aquatic organisms. PMID:27209898

  17. Fatty acid synthesis is inhibited by inefficient utilization of unusual fatty acids for glycerolipid assembly.

    PubMed

    Bates, Philip D; Johnson, Sean R; Cao, Xia; Li, Jia; Nam, Jeong-Won; Jaworski, Jan G; Ohlrogge, John B; Browse, John

    2014-01-21

    Degradation of unusual fatty acids through β-oxidation within transgenic plants has long been hypothesized as a major factor limiting the production of industrially useful unusual fatty acids in seed oils. Arabidopsis seeds expressing the castor fatty acid hydroxylase accumulate hydroxylated fatty acids up to 17% of total fatty acids in seed triacylglycerols; however, total seed oil is also reduced up to 50%. Investigations into the cause of the reduced oil phenotype through in vivo [(14)C]acetate and [(3)H]2O metabolic labeling of developing seeds surprisingly revealed that the rate of de novo fatty acid synthesis within the transgenic seeds was approximately half that of control seeds. RNAseq analysis indicated no changes in expression of fatty acid synthesis genes in hydroxylase-expressing plants. However, differential [(14)C]acetate and [(14)C]malonate metabolic labeling of hydroxylase-expressing seeds indicated the in vivo acetyl-CoA carboxylase activity was reduced to approximately half that of control seeds. Therefore, the reduction of oil content in the transgenic seeds is consistent with reduced de novo fatty acid synthesis in the plastid rather than fatty acid degradation. Intriguingly, the coexpression of triacylglycerol synthesis isozymes from castor along with the fatty acid hydroxylase alleviated the reduced acetyl-CoA carboxylase activity, restored the rate of fatty acid synthesis, and the accumulation of seed oil was substantially recovered. Together these results suggest a previously unidentified mechanism that detects inefficient utilization of unusual fatty acids within the endoplasmic reticulum and activates an endogenous pathway for posttranslational reduction of fatty acid synthesis within the plastid.

  18. Effects of bile acid administration on bile acid synthesis and its circadian rhythm in man

    SciTech Connect

    Pooler, P.A.; Duane, W.C.

    1988-09-01

    In man bile acid synthesis has a distinct circadian rhythm but the relationship of this rhythm to feedback inhibition by bile acid is unknown. We measured bile acid synthesis as release of 14CO2 from (26-14C)cholesterol every 2 hr in three normal volunteers during five separate 24-hr periods. Data were fitted by computer to a cosine curve to estimate amplitude and acrophase of the circadian rhythm. In an additional six volunteers, we measured synthesis every 2 hr from 8:00 a.m. to 4:00 p.m. only. During the control period, amplitude (expressed as percentage of mean synthesis) averaged 52% and acrophase averaged 6:49 a.m. During administration of ursodeoxycholic acid (15 mg per kg per day), synthesis averaged 126% of baseline (p less than 0.1), amplitude averaged 43% and acrophase averaged 6:20 a.m. During administration of chenodeoxycholic acid (15 mg per kg per day), synthesis averaged 43% of baseline (p less than 0.001), amplitude averaged 53% and acrophase averaged 9:04 a.m. Addition of prednisone to this regimen of chenodeoxycholic acid to eliminate release of 14CO2 from corticosteroid hormone synthesis resulted in a mean amplitude of 62% and a mean acrophase of 6:50 a.m., values very similar to those in the baseline period. Administration of prednisone alone also did not significantly alter the baseline amplitude (40%) or acrophase (6:28 a.m.). We conclude that neither chenodeoxycholic acid nor ursodeoxycholic acid significantly alters the circadian rhythm of bile acid synthesis in man.

  19. Synthesis and characterisation of an N-heterocyclic carbene with spatially-defined steric impact.

    PubMed

    Shaw, Paul; Kennedy, Alan R; Nelson, David J

    2016-08-01

    The synthesis and co-ordination chemistry of a new 'bulky yet flexible' N-heterocyclic carbene ("IPaul") is reported. This carbene has spatially-defined steric impact; steric maps show that two quadrants are very bulky while the other two are quite open. The electronic properties of this carbene are very similar to those of other 1,3-diarylimidazol-2-ylidenes. Copper, silver, iridium, and nickel complexes of the new ligand have been prepared. In solution, the ligand adopts two different conformations, while X-ray crystallographic analyses of the transition metal complexes suggest that the syn-conformer is preferred in the solid state due to intermolecular interactions. The copper(i) chloride complex of this new ligand has been shown to be highly-active in the hydrosilylation of carbonyl compounds, when compared to the analogous IPr, IMes, IPr* and IPr*(OMe) complexes. PMID:27335266

  20. The synthesis of glutamic acid in the absence of enzymes: Implications for biogenesis

    NASA Technical Reports Server (NTRS)

    Morowitz, Harold; Peterson, Eta; Chang, Sherwood

    1995-01-01

    This paper reports on the non-enzymatic aqueous phase synthesis of amino acids from keto acids, ammonia and reducing agents. The facile synthesis of key metabolic intermediates, particularly in the glycolytic pathway, the citric acid cycle, and the first step of amino acid synthesis, lead to new ways of looking at the problem of biogenesis.

  1. Kinetic investigation of erucamide synthesis using fatty acid and urea.

    PubMed

    Awasthi, Neeraj Praphulla; Upadhayay, Santosh K; Singh, R P

    2008-01-01

    Fatty acid amides like erucamide are mainly used for lubrication and as slip agent to decrease friction in polymer and plastic industry. Erucamide is normally synthesized by ammonolysis of triglycerides or fatty acids at 200 degrees C and at high pressure (345-690 kPa.). However using urea in place of ammonia the economic synthesis of erucamide is possible at atmospheric pressure at approx 190 degrees C. In present investigation, the kinetics of synthesis of erucamide by ammonolysis of erucic acid has been investigated. The optimum conditions for the synthesis of erucamide have also been determined. 1:4 molar ratio of erucic acid to urea, 190 degrees C temperature and catalyst [P2O5 with (NH4)2H PO4, {(1:1) w/w }] concentration 3% (by wt. of erucic acid) were the optimum condition for synthesis of erucamide from erucic acid and can obtain a maximum yield of 92% of pure erucamide. Some other catalysts as titanium-iso -propoxide, phosphorus pent oxide were also tried but these catalysts were not economical. PMID:18685229

  2. Co(II) and Cd(II) Complexes Derived from Heterocyclic Schiff-Bases: Synthesis, Structural Characterisation, and Biological Activity

    PubMed Central

    Ahmed, Riyadh M.; Yousif, Enaam I.; Al-Jeboori, Mohamad J.

    2013-01-01

    New monomeric cobalt and cadmium complexes with Schiff-bases, namely, N′-[(E)-(3-hydroxy-4-methoxyphenyl)methylidene]furan-2-carbohydrazide (L1) and N′-[(E)-(3-hydroxy-4-methoxyphenyl)methylidene]thiophene-2-carbohydrazide (L2) are reported. Schiff-base ligands L1 and L2 were derived from condensation of 3-hydroxy-4-methoxybenzaldehyde (iso-vanillin) with furan-2-carboxylic acid hydrazide and thiophene-2-carboxylic acid hydrazide, respectively. Complexes of the general formula [M(L)2]Cl2 (where M = Co(II) or Cd(II), L = L1 or L2) have been obtained from the reaction of the corresponding metal chloride with the ligands. The ligands and their metal complexes were characterised by spectroscopic methods (FTIR, UV-Vis, 1H, and 13C NMR spectra), elemental analysis, metal content, magnetic measurement, and conductance. These studies revealed the formation of four-coordinate complexes in which the geometry about metal ion is tetrahedral. Biological activity of the ligands and their metal complexes against gram positive bacterial strain Bacillus (G+) and gram negative bacteria Pseudomonas (G−) revealed that the metal complexes become less resistive to the microbial activities as compared to the free ligands. PMID:24027449

  3. Synthesis of α-aminoboronic acids.

    PubMed

    Andrés, Patricia; Ballano, Gema; Calaza, M Isabel; Cativiela, Carlos

    2016-04-21

    This review describes available methods for the preparation of α-aminoboronic acids in their racemic or in their enantiopure form. Both, highly stereoselective syntheses and asymmetric procedures leading to the stereocontrolled generation of α-aminoboronic acid derivatives are included. The preparation of acyclic, carbocyclic and azacyclic α-aminoboronic acid derivatives is covered. Within each section, the different synthetic approaches have been classified according to the key bond which is formed to complete the α-aminoboronic acid skeleton.

  4. Regulation of collagen synthesis by ascorbic acid.

    PubMed Central

    Murad, S; Grove, D; Lindberg, K A; Reynolds, G; Sivarajah, A; Pinnell, S R

    1981-01-01

    After prolonged exposure to ascorbate, collagen synthesis in cultured human skin fibroblasts increased approximately 8-fold with no significant change in synthesis of noncollagen protein. This effect of ascorbate appears to be unrelated to its cofactor function in collagen hydroxylation. The collagenous protein secreted in the absence of added ascorbate was normal in hydroxylysine but was mildly deficient in hydroxyproline. In parallel experiments, lysine hydroxylase (peptidyllysine, 2-oxoglutarate:oxygen 5-oxidoreductase, EC 1.14.11.4) activity increased 3-fold in response to ascorbate administration whereas proline hydroxylase (prolyl-glycyl-peptide, 2-oxoglutarate:oxygen oxidoreductase, EC 1.14.11.2) activity decreased considerably. These results suggest that collage polypeptide synthesis, posttranslational hydroxylations, and activities of the two hydroxylases are independently regulated by ascorbate. PMID:6265920

  5. Synthesis of Triamino Acid Building Blocks with Different Lipophilicities

    PubMed Central

    Maity, Jyotirmoy; Honcharenko, Dmytro; Strömberg, Roger

    2015-01-01

    To obtain different amino acids with varying lipophilicity and that can carry up to three positive charges we have developed a number of new triamino acid building blocks. One set of building blocks was achieved by aminoethyl extension, via reductive amination, of the side chain of ortnithine, diaminopropanoic and diaminobutanoic acid. A second set of triamino acids with the aminoethyl extension having hydrocarbon side chains was synthesized from diaminobutanoic acid. The aldehydes needed for the extension by reductive amination were synthesized from the corresponding Fmoc-L-2-amino fatty acids in two steps. Reductive amination of these compounds with Boc-L-Dab-OH gave the C4-C8 alkyl-branched triamino acids. All triamino acids were subsequently Boc-protected at the formed secondary amine to make the monomers appropriate for the N-terminus position when performing Fmoc-based solid-phase peptide synthesis. PMID:25876040

  6. Synthesis and characterisation of large chlorapatite single-crystals with controlled morphology and surface roughness.

    PubMed

    García-Tuñón, Esther; Couceiro, Ramiro; Franco, Jaime; Saiz, Eduardo; Guitián, Francisco

    2012-10-01

    This work describes the synthesis of chlorapatite single crystals using the molten salt method with CaCl(2) as a flux. By manipulating the processing conditions (amount of flux, firing time and temperature, and cooling rates) it is possible to manipulate the crystal morphology from microscopic fibres to large crystals (up to few millimetre long and ~100 μm thick). The crystal roughness can be controlled to achieve very flat surfaces by changing the melt composition "in situ" at high temperature. The Young modulus and hardness of the crystals are 110 ± 15 and 6.6 ± 1.5 GPa respectively as measured by nanoindentation. Crystal dissolution in Hanks solution starts around the defects. Several in vitro assays were performed; ClAp crystals with different size and shape are biocompatible. Cell apoptosis was very low at 5, 10, and 15 days (Caspase-3) for all the samples. Proliferation (MTT) showed to be influenced by surface roughness and size of the crystals.

  7. Synthesis, characterisation and antibacterial activity of PVA/TEOS/Ag-Np hybrid thin films.

    PubMed

    Bryaskova, Rayna; Pencheva, Daniela; Kale, Girish M; Lad, Umesh; Kantardjiev, T

    2010-09-01

    Novel hybrid material thin films based on polyvinyl alcohol (PVA)/tetraethyl orthosilicate (TEOS) with embedded silver nanoparticles (AgNps) were synthesized using sol-gel method. Two different strategies for the synthesis of silver nanoparticles in PVA/TEOS matrix were applied based on reduction of the silver ions by thermal annealing of the films or by preliminary preparation of silver nanoparticles using PVA as a reducing agent. The successful incorporation of silver nanoparticles ranging from 5 to 7nm in PVA/TEOS matrix was confirmed by TEM and EDX analysis, UV-Vis spectroscopy and XRD analysis. The antibacterial activity of the synthesized hybrid materials against etalon strains of three different groups of bacteria -Staphylococcus aureus (gram-positive bacteria), Escherichia coli (gram-negative bacteria), Pseudomonas aeruginosa (non-ferment gram-negative bacteria) has been studied as they are commonly found in hospital environment. The hybrid materials showed a strong bactericidal effect against E. coli, S. aureus and P. aeruginosa and therefore have potential applications in biotechnology and biomedical science.

  8. Mass spectrometry characterisation of fatty acids from metabolically engineered soybean seeds.

    PubMed

    Murad, André M; Vianna, Giovanni R; Machado, Alex M; da Cunha, Nicolau B; Coelho, Cíntia M; Lacerda, Valquiria A M; Coelho, Marly C; Rech, Elibio L

    2014-05-01

    Improving the quality and performance of soybean oil as biodiesel depends on the chemical composition of its fatty acids and requires an increase in monounsaturated acids and a reduction in polyunsaturated acids. Despite its current use as a source of biofuel, soybean oil contains an average of 25 % oleic acid and 13 % palmitic acid, which negatively impacts its oxidative stability and freezing point, causing a high rate of nitrogen oxide emission. Gas chromatography and ion mobility mass spectrometry were conducted on soybean fatty acids from metabolically engineered seed extracts to determine the nature of the structural oleic and palmitic acids. The soybean genes FAD2-1 and FatB were placed under the control of the 35SCaMV constitutive promoter, introduced to soybean embryonic axes by particle bombardment and down-regulated using RNA interference technology. Results indicate that the metabolically engineered plants exhibited a significant increase in oleic acid (up to 94.58 %) and a reduction in palmitic acid (to <3 %) in their seed oil content. No structural differences were observed between the fatty acids of the transgenic and non-transgenic oil extracts.

  9. Synthesis and characterisation of polyol-capped transition metal oxide nanoparticles.

    PubMed

    Varadwaj, K S K; Ghose, J

    2005-04-01

    In-situ capped nanocrystalline gamma-Fe2O3, Co3O4, and Cu2O were prepared in 1,4-butanediol in aerobic conditions. X-ray diffraction (XRD) patterns show that the synthesised samples are nanocrystalline cubic oxides with crystallite sizes 9.5 nm, 13.4 nm, and 11 nm, respectively. Raman spectroscopy shows peaks at 350 cm(-1), 500 cm(-1), and 700 cm(-1), indicating that the iron oxide is gamma-Fe2O3; Mössbauer spectroscopy shows the presence of two Fe3(3+) sites. Transmission electron microscopy images show that the particle sizes of gamma-Fe2O3 and Co3O4 samples are 8.9 nm and 7 nm, respectively. The absence of agglomeration indicates that the synthesised nanoparticles are capped. FT-IR spectra show the presence of an organic moiety in the sample which acts as a capping agent. Thermogravimetry shows that the capping is stable up to 873 K in gamma-Fe2O3, and up to 400 K in Co3O4. The samples are soluble in water to form stable hydrosols. During synthesis of gamma-Fe2O3 a 6-line ferrihydrite is formed as an intermediate, which is stable in solution up to 473 K, and transforms to gamma-Fe2O3 at 483 K, by rapid dissolution-reprecipitation. In the syntheses of Co3O4 and Cu2O, no intermediates are formed.

  10. Synthesis and characterisation of polyol-capped transition metal oxide nanoparticles.

    PubMed

    Varadwaj, K S K; Ghose, J

    2005-04-01

    In-situ capped nanocrystalline gamma-Fe2O3, Co3O4, and Cu2O were prepared in 1,4-butanediol in aerobic conditions. X-ray diffraction (XRD) patterns show that the synthesised samples are nanocrystalline cubic oxides with crystallite sizes 9.5 nm, 13.4 nm, and 11 nm, respectively. Raman spectroscopy shows peaks at 350 cm(-1), 500 cm(-1), and 700 cm(-1), indicating that the iron oxide is gamma-Fe2O3; Mössbauer spectroscopy shows the presence of two Fe3(3+) sites. Transmission electron microscopy images show that the particle sizes of gamma-Fe2O3 and Co3O4 samples are 8.9 nm and 7 nm, respectively. The absence of agglomeration indicates that the synthesised nanoparticles are capped. FT-IR spectra show the presence of an organic moiety in the sample which acts as a capping agent. Thermogravimetry shows that the capping is stable up to 873 K in gamma-Fe2O3, and up to 400 K in Co3O4. The samples are soluble in water to form stable hydrosols. During synthesis of gamma-Fe2O3 a 6-line ferrihydrite is formed as an intermediate, which is stable in solution up to 473 K, and transforms to gamma-Fe2O3 at 483 K, by rapid dissolution-reprecipitation. In the syntheses of Co3O4 and Cu2O, no intermediates are formed. PMID:16004130

  11. Lipase-catalyzed synthesis of fatty acid amide (erucamide) using fatty acid and urea.

    PubMed

    Awasthi, Neeraj Praphulla; Singh, R P

    2007-01-01

    Ammonolysis of fatty acids to the corresponding fatty acid amides is efficiently catalysed by Candida antartica lipase (Novozym 435). In the present paper lipase-catalysed synthesis of erucamide by ammonolysis of erucic acid and urea in organic solvent medium was studied and optimal conditions for fatty amides synthesis were established. In this process erucic acid gave 88.74 % pure erucamide after 48 hour and 250 rpm at 60 degrees C with 1:4 molar ratio of erucic acid and urea, the organic solvent media is 50 ml tert-butyl alcohol (2-methyl-2-propanol). This process for synthesis is economical as we used urea in place of ammonia or other amidation reactant at atmospheric pressure. The amount of catalyst used is 3 %.

  12. Lipase-catalyzed synthesis of fatty acid amide (erucamide) using fatty acid and urea.

    PubMed

    Awasthi, Neeraj Praphulla; Singh, R P

    2007-01-01

    Ammonolysis of fatty acids to the corresponding fatty acid amides is efficiently catalysed by Candida antartica lipase (Novozym 435). In the present paper lipase-catalysed synthesis of erucamide by ammonolysis of erucic acid and urea in organic solvent medium was studied and optimal conditions for fatty amides synthesis were established. In this process erucic acid gave 88.74 % pure erucamide after 48 hour and 250 rpm at 60 degrees C with 1:4 molar ratio of erucic acid and urea, the organic solvent media is 50 ml tert-butyl alcohol (2-methyl-2-propanol). This process for synthesis is economical as we used urea in place of ammonia or other amidation reactant at atmospheric pressure. The amount of catalyst used is 3 %. PMID:17898456

  13. Synthesis and antituberculosis activity of new fatty acid amides.

    PubMed

    D'Oca, Caroline Da Ros Montes; Coelho, Tatiane; Marinho, Tamara Germani; Hack, Carolina Rosa Lopes; Duarte, Rodrigo da Costa; da Silva, Pedro Almeida; D'Oca, Marcelo Gonçalves Montes

    2010-09-01

    This work reports the synthesis of new fatty acid amides from C16:0, 18:0, 18:1, 18:1 (OH), and 18:2 fatty acids families with cyclic and acyclic amines and demonstrate for the first time the activity of these compounds as antituberculosis agents against Mycobacterium tuberculosis H(37)Rv, M. tuberculosis rifampicin resistance (ATCC 35338), and M. tuberculosis isoniazid resistance (ATCC 35822). The fatty acid amides derivate from ricinoleic acid were the most potent one among a series of tested compounds, with a MIC 6.25 microg/mL for resistance strains.

  14. Synthesis, characterisation and antioxidant activity of luteolin-vanadium(II) complex.

    PubMed

    Roy, Souvik; Mallick, Sougata; Chakraborty, Tania; Ghosh, Nilanjan; Singh, Amit Kumar; Manna, Subhadip; Majumdar, Sumana

    2015-04-15

    The complex formation between luteolin (L) and vanadium(IV) oxide sulphate monohydrate (VOSO4·H2O) was examined under UV-visible, infra-red spectroscopy, mass spectroscopy and NMR techniques. The spectroscopic data indicated that luteolin reacts with vanadium oxide cation (VO(+2)) through 4-carbonyl-5-hydroxy chelation site in the two luteolin molecule. The free radical antioxidant activity of the complex with respect to the parent molecule was evaluated using 1,1-diphenyl-2-picrylhydrazyl (DPPH), ferric reducing antioxidant power (FRAP) and 2,2'-azinobis 3-ethylbenzothiazoline-6-sulphonic acid diammonium salt (ABTS) methods. It was observed that the free radical scavenging activity and ferric ion reducing potential of luteolin was increased after the formation of complex with vanadium oxide (VO(+2)) cation.

  15. Phosphorus promotion and poisoning in zeolite-based materials: synthesis, characterisation and catalysis

    PubMed Central

    van der Bij, Hendrik E.

    2015-01-01

    Phosphorus and microporous aluminosilicates, better known as zeolites, have a unique but poorly understood relationship. For example, phosphatation of the industrially important zeolite H-ZSM-5 is a well-known, relatively inexpensive and seemingly straightforward post-synthetic modification applied by the chemical industry not only to alter its hydrothermal stability and acidity, but also to increase its selectivity towards light olefins in hydrocarbon catalysis. On the other hand, phosphorus poisoning of zeolite-based catalysts, which are used for removing nitrogen oxides from exhaust fuels, poses a problem for their use in diesel engine catalysts. Despite the wide impact of phosphorus–zeolite chemistry, the exact physicochemical processes that take place require a more profound understanding. This review article provides the reader with a comprehensive and state-of-the-art overview of the academic literature, from the first reports in the late 1970s until the most recent studies. In the first part an in-depth analysis is undertaken, which will reveal universal physicochemical and structural effects of phosphorus–zeolite chemistry on the framework structure, accessibility, and strength of acid sites. The second part discusses the hydrothermal stability of zeolites and clarifies the promotional role that phosphorus plays. The third part of the review paper links the structural and physicochemical effects of phosphorus on zeolite materials with their catalytic performance in a variety of catalytic processes, including alkylation of aromatics, catalytic cracking, methanol-to-hydrocarbon processing, dehydration of bioalcohol, and ammonia selective catalytic reduction (SCR) of NOx. Based on these insights, we discuss potential applications and important directions for further research. PMID:26051875

  16. Phosphorus promotion and poisoning in zeolite-based materials: synthesis, characterisation and catalysis.

    PubMed

    van der Bij, Hendrik E; Weckhuysen, Bert M

    2015-10-21

    Phosphorus and microporous aluminosilicates, better known as zeolites, have a unique but poorly understood relationship. For example, phosphatation of the industrially important zeolite H-ZSM-5 is a well-known, relatively inexpensive and seemingly straightforward post-synthetic modification applied by the chemical industry not only to alter its hydrothermal stability and acidity, but also to increase its selectivity towards light olefins in hydrocarbon catalysis. On the other hand, phosphorus poisoning of zeolite-based catalysts, which are used for removing nitrogen oxides from exhaust fuels, poses a problem for their use in diesel engine catalysts. Despite the wide impact of phosphorus-zeolite chemistry, the exact physicochemical processes that take place require a more profound understanding. This review article provides the reader with a comprehensive and state-of-the-art overview of the academic literature, from the first reports in the late 1970s until the most recent studies. In the first part an in-depth analysis is undertaken, which will reveal universal physicochemical and structural effects of phosphorus-zeolite chemistry on the framework structure, accessibility, and strength of acid sites. The second part discusses the hydrothermal stability of zeolites and clarifies the promotional role that phosphorus plays. The third part of the review paper links the structural and physicochemical effects of phosphorus on zeolite materials with their catalytic performance in a variety of catalytic processes, including alkylation of aromatics, catalytic cracking, methanol-to-hydrocarbon processing, dehydration of bioalcohol, and ammonia selective catalytic reduction (SCR) of NOx. Based on these insights, we discuss potential applications and important directions for further research.

  17. Synthesis of biobased succinonitrile from glutamic acid and glutamine.

    PubMed

    Lammens, Tijs M; Le Nôtre, Jérôme; Franssen, Maurice C R; Scott, Elinor L; Sanders, Johan P M

    2011-06-20

    Succinonitrile is the precursor of 1,4-diaminobutane, which is used for the industrial production of polyamides. This paper describes the synthesis of biobased succinonitrile from glutamic acid and glutamine, amino acids that are abundantly present in many plant proteins. Synthesis of the intermediate 3-cyanopropanoic amide was achieved from glutamic acid 5-methyl ester in an 86 mol% yield and from glutamine in a 56 mol % yield. 3-Cyanopropanoic acid can be converted into succinonitrile, with a selectivity close to 100% and a 62% conversion, by making use of a palladium(II)-catalyzed equilibrium reaction with acetonitrile. Thus, a new route to produce biobased 1,4-diaminobutane has been discovered. PMID:21557494

  18. Synthesis and characterisation of Copper Zinc Tin Sulphide (CZTS) compound for absorber material in solar-cells

    NASA Astrophysics Data System (ADS)

    Kheraj, Vipul; Patel, K. K.; Patel, S. J.; Shah, D. V.

    2013-01-01

    The development of thin-film semiconductor compounds, such as Copper Indium Gallium Selenide (CIGS), has caused remarkable progress in the field of thin-film photovoltaics. However, the scarcity and the increasing prices of indium impose the hunt for alternative materials. The Copper Zinc Tin Sulphide (CZTS) is one of the promising emerging materials with Kesterite-type crystal structure and favourable material properties like high absorption co-efficient and direct band-gap. Moreover, all the constituent elements of CZTS are non-toxic and aplenty on the earth-crust, making it a potential candidate for the thin-film photovoltaics. Here we report the synthesis of CZTS powder from its constituent elements, viz. copper, zinc, tin and sulphur, in an evacuated Quartz ampoule at 1030 K temperature. The sulphur content in the raw mixture in the ampoule was varied and optimised in order to attain the desired atomic stoichiometry of the compound. The synthesised powder was characterised by X-Ray diffraction technique (XRD), Raman Scattering Spectroscopy, Energy Dispersive Analysis of X-Ray (EDAX) and UV-Visible Absorption Spectra. The XRD Patterns of the synthesised compound show the preferred orientation of (112), (220) and (312) planes, confirming the Kesterite structure of CZTS. The chemical composition of the powder was analysed by EDAX and shows good atomic stoichiometry of the constituent elements in the CZTS compound. The UV-Vis absorption spectra confirm the direct band-gap of about 1.45 eV, which is quite close to the optimum value for the semiconductor material as an absorber in solar-cells.

  19. Stereoselective synthesis of unsaturated α-amino acids.

    PubMed

    Fanelli, Roberto; Jeanne-Julien, Louis; René, Adeline; Martinez, Jean; Cavelier, Florine

    2015-06-01

    Stereoselective synthesis of unsaturated α-amino acids was performed by asymmetric alkylation. Two methods were investigated and their enantiomeric excess measured and compared. The first route consisted of an enantioselective approach induced by the Corey-Lygo catalyst under chiral phase transfer conditions while the second one involved the hydroxypinanone chiral auxiliary, both implicating Schiff bases as substrate. In all cases, the use of a prochiral Schiff base gave higher enantiomeric excess and yield in the final desired amino acid.

  20. Synthesis of sulfonate analogs of bile acids.

    PubMed

    Kihira, K; Mikami, T; Ikawa, S; Okamoto, A; Yoshii, M; Miki, S; Mosbach, E H; Hoshita, T

    1992-04-01

    Sulfonate analogs of C23 and C24 bile acids were synthesized from norcholic, norchenodeoxycholic, norursodeoxycholic, nordeoxycholic, norhyodeoxycholic, cholic, deoxycholic, hyodeoxycholic, and lithocholic acids. The principal reactions used were (1) reduction of the bile acids with NaBH4 to the corresponding bile alcohols, (2) selective tosylation of the terminal hydroxyl group, (3) iodination of the tosyl esters with NaI, and (4) treatment of the iodides with Na2SO3 to form the sulfonate analogs of the bile acids. The sulfonate analogs showed polarity similar to that of taurine-conjugated bile acids on thin-layer chromatography. The carbon 13 nuclear magnetic resonance spectral data for the sulfonate analogs were tabulated.

  1. Synthesis, characterisation and evaluation of N-mannich bases of 2-substituted Benzimidazole derivatives

    PubMed Central

    Vinoth Kumar, Sekar; Subramanian, Mohan Raj; Chinnaiyan, Santhosh Kumar

    2013-01-01

    Rationale Benzimidazoles and its derivatives represent one of the mainly biological active classes of literature. Aim In this present study aimed to synthesize N-mannich bases derivatives compounds bearing of 2-substituted benzimidazole moiety, in order to investigate their possible biological activity. Method Benzimidazole compounds were prepared from the condensation reaction between ortho phenylene diamine and various acids. Mannich base of newly synthesized Benzimidazole derivatives were synthesized from 2-substituted Benzimidazoles by reacting with secondary amines. The purity of the compounds was ascertained by melting point (m.p) and thin layer chromatography (TLC). Structures of the synthesized compounds were elucidated by spectral data. Antimicrobial assay was performed by microbroth dilution method. Bacterial genomic DNA cleavage was assessed by Agarose gel electrophoresis. Toxicity of the most effective compounds was studied by Brine-shrimp lethality assay. Result Among the synthesized compounds, compound 5E (a) and (b) was establish to be the most potent against all tested microorganisms. This two compounds exhibited complete bacterial DNA cleavage and non-toxic. Conclusion These results suggest that it an interesting compound compared to the current therapeutic agents and are considered to investigate further for the same. PMID:24563595

  2. Synthesis, characterisation and bioimaging of a fluorescent rhenium-containing PNA bioconjugate.

    PubMed

    Gasser, Gilles; Pinto, Antonio; Neumann, Sebastian; Sosniak, Anna M; Seitz, Michael; Merz, Klaus; Heumann, Rolf; Metzler-Nolte, Nils

    2012-02-28

    A new rhenium tricarbonyl complex of a bis(quinoline)-derived ligand (2-azido-N,N-bis((quinolin-2-yl)methyl)ethanamine, L-N(3)), namely [Re(CO)(3)(L-N(3))]Br was synthesized and characterized in-depth, including by X-ray crystallography. [Re(CO)(3)(L-N(3))]Br exhibits a strong UV absorbance in the range 300-400 nm with a maximum at 322 nm, and upon photoexcitation, shows two distinct emission bands at about 430 and 560 nm in various solvents (water, ethylene glycol). [Re(CO)(3)(L-N(3))]Br could be conjugated, on a solid phase, to a peptide nucleic acid (PNA) oligomer using the copper(I)-catalyzed azide-alkyne cycloaddition reaction (Cu-AAC, "click" chemistry) and an alkyne-containing PNA building block to give Re-PNA. It was demonstrated that upon hybridisation with a complementary DNA strand (DNA), the position of the maxima and emission intensity for the hybrid Re-PNA·DNA remained mainly unchanged compared to those of the single strand Re-PNA. The rhenium-containing PNA oligomer Re-PNA could be then mediated in living cells where they have been shown to be non-toxic contrary to the general notion that organometallic compounds are usually unstable under physiological conditions and/or cytotoxic. Furthermore, Re-PNA could be detected in living cells using fluorescent microscopy.

  3. The spark discharge synthesis of amino acids from various hydrocarbons

    NASA Technical Reports Server (NTRS)

    Ring, D.; Miller, S. L.

    1984-01-01

    The spark discharge synthesis of amino acids using an atmosphere of CH4+N2+H2O+NH3 has been investigated with variable pNH3. The amino acids produced using higher hydrocarbons (ethane, ethylene, acetylene, propane, butane, and isobutane) instead of CH4 were also investigated. There was considerable range in the absolute yields of amino acids, but the yields relative to glycine (or alpha-amino-n-butyric acid) were more uniform. The relative yields of the C3 to C6 aliphatic alpha-amino acids are nearly the same (with a few exceptions) with all the hydrocarbons. The glycine yields are more variable. The precursors to the C3-C6 aliphatic amino acids seem to be produced in the same process, which is separate from the synthesis of glycine precursors. It may be possible to use these relative yields as a signature for a spark discharge synthesis provided corrections can be made for subsequent decomposition events (e.g. in the Murchison meteorite).

  4. Cyclic phosphatidic acid and lysophosphatidic acid induce hyaluronic acid synthesis via CREB transcription factor regulation in human skin fibroblasts.

    PubMed

    Maeda-Sano, Katsura; Gotoh, Mari; Morohoshi, Toshiro; Someya, Takao; Murofushi, Hiromu; Murakami-Murofushi, Kimiko

    2014-09-01

    Cyclic phosphatidic acid (cPA) is a naturally occurring phospholipid mediator and an analog of the growth factor-like phospholipid lysophosphatidic acid (LPA). cPA has a unique cyclic phosphate ring at the sn-2 and sn-3 positions of its glycerol backbone. We showed before that a metabolically stabilized cPA derivative, 2-carba-cPA, relieved osteoarthritis pathogenesis in vivo and induced hyaluronic acid synthesis in human osteoarthritis synoviocytes in vitro. This study focused on hyaluronic acid synthesis in human fibroblasts, which retain moisture and maintain health in the dermis. We investigated the effects of cPA and LPA on hyaluronic acid synthesis in human fibroblasts (NB1RGB cells). Using particle exclusion and enzyme-linked immunosorbent assays, we found that both cPA and LPA dose-dependently induced hyaluronic acid synthesis. We revealed that the expression of hyaluronan synthase 2 messenger RNA and protein is up-regulated by cPA and LPA treatment time dependently. We then characterized the signaling pathways up-regulating hyaluronic acid synthesis mediated by cPA and LPA in NB1RGB cells. Pharmacological inhibition and reporter gene assays revealed that the activation of the LPA receptor LPAR1, Gi/o protein, phosphatidylinositol-3 kinase (PI3K), extracellular-signal-regulated kinase (ERK), and cyclic adenosine monophosphate response element-binding protein (CREB) but not nuclear factor κB induced hyaluronic acid synthesis by the treatment with cPA and LPA in NB1RGB cells. These results demonstrate for the first time that cPA and LPA induce hyaluronic acid synthesis in human skin fibroblasts mainly through the activation of LPAR1-Gi/o followed by the PI3K, ERK, and CREB signaling pathway.

  5. Synthesis of monomethyl 5,5'-dehydrodiferulic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Synthesis of the internal reference compound, monomethyl 5,5’-dehydrodiferulic acid, is described. The synthetic scheme relies on a selective monomethylation of the known compound 5,5-dehydrodivanillin, followed by elaboration into the dehydrodiferulic framework through a dual Horner-Emmons-Wadswort...

  6. Acid-base chemistry of white wine: analytical characterisation and chemical modelling.

    PubMed

    Prenesti, Enrico; Berto, Silvia; Toso, Simona; Daniele, Pier Giuseppe

    2012-01-01

    A chemical model of the acid-base properties is optimized for each white wine under study, together with the calculation of their ionic strength, taking into account the contributions of all significant ionic species (strong electrolytes and weak one sensitive to the chemical equilibria). Coupling the HPLC-IEC and HPLC-RP methods, we are able to quantify up to 12 carboxylic acids, the most relevant substances responsible of the acid-base equilibria of wine. The analytical concentration of carboxylic acids and of other acid-base active substances was used as input, with the total acidity, for the chemical modelling step of the study based on the contemporary treatment of overlapped protonation equilibria. New protonation constants were refined (L-lactic and succinic acids) with respect to our previous investigation on red wines. Attention was paid for mixed solvent (ethanol-water mixture), ionic strength, and temperature to ensure a thermodynamic level to the study. Validation of the chemical model optimized is achieved by way of conductometric measurements and using a synthetic "wine" especially adapted for testing.

  7. Characterisation of calamansi (Citrus microcarpa). Part I: volatiles, aromatic profiles and phenolic acids in the peel.

    PubMed

    Cheong, Mun Wai; Chong, Zhi Soon; Liu, Shao Quan; Zhou, Weibiao; Curran, Philip; Bin Yu

    2012-09-15

    Volatile compounds in the peel of calamansi (Citrus microcarpa) from Malaysia, the Philippines and Vietnam were extracted with dichloromethane and hexane, and then analysed by gas chromatography-mass spectroscopy/flame ionisation detector. Seventy-nine compounds representing >98% of the volatiles were identified. Across the three geographical sources, a relatively small proportion of potent oxygenated compounds was significantly different, exemplified by the highest amount of methyl N-methylanthranilate in Malaysian calamansi peel. Principal component analysis and canonical discriminant analysis were applied to interpret the complex volatile compounds in the calamansi peel extracts, and to verify the discrimination among the different origins. In addition, four common hydroxycinnamic acids (caffeic, p-coumaric, ferulic and sinapic acids) were determined in the methanolic extracts of calamansi peel using ultra-fast liquid chromatography coupled to photodiode array detector. The Philippines calamansi peel contained the highest amount of total phenolic acids. In addition, p-Coumaric acid was the dominant free phenolic acids, whereas ferulic acid was the main bound phenolic acid.

  8. Acid-Base Chemistry of White Wine: Analytical Characterisation and Chemical Modelling

    PubMed Central

    Prenesti, Enrico; Berto, Silvia; Toso, Simona; Daniele, Pier Giuseppe

    2012-01-01

    A chemical model of the acid-base properties is optimized for each white wine under study, together with the calculation of their ionic strength, taking into account the contributions of all significant ionic species (strong electrolytes and weak one sensitive to the chemical equilibria). Coupling the HPLC-IEC and HPLC-RP methods, we are able to quantify up to 12 carboxylic acids, the most relevant substances responsible of the acid-base equilibria of wine. The analytical concentration of carboxylic acids and of other acid-base active substances was used as input, with the total acidity, for the chemical modelling step of the study based on the contemporary treatment of overlapped protonation equilibria. New protonation constants were refined (L-lactic and succinic acids) with respect to our previous investigation on red wines. Attention was paid for mixed solvent (ethanol-water mixture), ionic strength, and temperature to ensure a thermodynamic level to the study. Validation of the chemical model optimized is achieved by way of conductometric measurements and using a synthetic “wine” especially adapted for testing. PMID:22566762

  9. Synthesis and characterisation of coating polyurethane cationomers containing fluorine built-in hard urethane segments

    PubMed Central

    Król, Bożena; Pikus, Stanisław; Chmielarz, Paweł; Skrzypiec, Krzysztof

    2010-01-01

    Polyurethane cationomers were synthesised in the reaction of 4,4’-methylenebis(phenyl isocyanate) with polyoxyethylene glycol (M = 2,000) or poly(tetrafluoroethyleneoxide-co-difluoromethylene oxide) α,ω-diisocyanate and N-methyl diethanolamine. Amine segments were built-in to the urethane-isocyanate prepolymer in the reaction with 1-bromobutane or formic acid, and then they were converted to alkylammonium cations. The obtained isocyanate prepolymers were then extended in the aqueous medium that yielded stable aqueous dispersions which were applied on the surfaces of test poly(tetrafluoroethylene) plates. After evaporation of water, the dispersions formed thin polymer coatings. 1H, 13C NMR and IR spectral methods were employed to confirm chemical structures of synthesised cationomers. Based on 1H NMR and IR spectra, the factors κ and α were calculated, which represented the polarity level of the obtained cationomers. The DSC, wide angle X-ray scattering and atom force microscopy methods were employed for the microstructural assessment of the obtained materials. Changes were discussed in the surface free energy and its components, as calculated independently according to the method suggested by van Oss–Good, in relation to chemical and physical structures of cationomers as well as morphology of coating surfaces obtained from those cationomers. Fluorine incorporated into cationomers (about 30%) contributed to lower surface free energy values, down to about 15 mJ/m2. That was caused by gradual weakening of long-range interactions within which the highest share is taken by dispersion interactions. PMID:20927181

  10. Physical and structural characterisation of starch/polyester blends with tartaric acid.

    PubMed

    Olivato, J B; Müller, C M O; Carvalho, G M; Yamashita, F; Grossmann, M V E

    2014-06-01

    Starch/PBAT blends were produced by reactive extrusion with tartaric acid (TA) as an additive. The effects of TA, glycerol and starch+PBAT on the mechanical, optical and structural properties of the films were evaluated, with formulations based in a constrained mixture design. Tartaric acid acts as a compatibiliser and promotes the acid hydrolysis of starch chains. These two functions explain the observed film resistance and opacity. TA reduced the weight loss in water. Scanning electron microscopy (SEM) images showed that TA reduces the interfacial tension between the polymeric phases, resulting in more homogeneous films. Nuclear magnetic resonance ((13)C CPMAS) and Fourier transform infrared spectroscopy (FT-IR) suggest that tartaric acid is able to react with the hydroxyl groups of the starch by esterification/transesterification reactions, confirming its role as a compatibiliser. The addition of TA results in materials with better properties that are suitable for use in food packaging. PMID:24863194

  11. Physical and structural characterisation of starch/polyester blends with tartaric acid.

    PubMed

    Olivato, J B; Müller, C M O; Carvalho, G M; Yamashita, F; Grossmann, M V E

    2014-06-01

    Starch/PBAT blends were produced by reactive extrusion with tartaric acid (TA) as an additive. The effects of TA, glycerol and starch+PBAT on the mechanical, optical and structural properties of the films were evaluated, with formulations based in a constrained mixture design. Tartaric acid acts as a compatibiliser and promotes the acid hydrolysis of starch chains. These two functions explain the observed film resistance and opacity. TA reduced the weight loss in water. Scanning electron microscopy (SEM) images showed that TA reduces the interfacial tension between the polymeric phases, resulting in more homogeneous films. Nuclear magnetic resonance ((13)C CPMAS) and Fourier transform infrared spectroscopy (FT-IR) suggest that tartaric acid is able to react with the hydroxyl groups of the starch by esterification/transesterification reactions, confirming its role as a compatibiliser. The addition of TA results in materials with better properties that are suitable for use in food packaging.

  12. Amino Acid Synthesis in a Supercritical Carbon Dioxide - Water System

    PubMed Central

    Fujioka, Kouki; Futamura, Yasuhiro; Shiohara, Tomoo; Hoshino, Akiyoshi; Kanaya, Fumihide; Manome, Yoshinobu; Yamamoto, Kenji

    2009-01-01

    Mars is a CO2-abundant planet, whereas early Earth is thought to be also CO2-abundant. In addition, water was also discovered on Mars in 2008. From the facts and theory, we assumed that soda fountains were present on both planets, and this affected amino acid synthesis. Here, using a supercritical CO2/liquid H2O (10:1) system which mimicked crust soda fountains, we demonstrate production of amino acids from hydroxylamine (nitrogen source) and keto acids (oxylic acid sources). In this research, several amino acids were detected with an amino acid analyzer. Moreover, alanine polymers were detected with LC-MS. Our research lights up a new pathway in the study of life’s origin. PMID:19582225

  13. Stereoselective synthesis of stable-isotope-labeled amino acids

    SciTech Connect

    Unkefer, C.J.; Martinez, R.A.; Silks, L.A. III; Lodwig, S.N.

    1994-12-01

    For magnetic resonance and vibrational spectroscopies to reach their full potential, they must be used in combination with sophisticated site-specific stable isotope labeling of biological macromolecules. Labeled amino acids are required for the study of the structure and function of enzymes and proteins. Because there are 20 common amino acids, each with its own distinguishing chemistry, they remain a synthetic challenge. The Oppolzer chiral auxiliary provides a general tool with which to approach the synthesis of labeled amino acids. By using the Oppolzer auxiliary, amino acids can be constructed from several small molecules, which is ideal for stable isotope labeling. In addition to directing the stereochemistry at the {alpha}-carbon, the camphorsultam can be used for stereo-specific isotope labeling at prochiral centers in amino acids. By using the camphorsultam auxiliary we have the potential to synthesize virtually any isotopomer of all of the common amino acids.

  14. Synthesis of gold nanoparticles using various amino acids.

    PubMed

    Maruyama, Tatsuo; Fujimoto, Yuhei; Maekawa, Tetsuya

    2015-06-01

    Gold nanoparticles (4-7nm) were synthesized from tetraauric acid using various amino acids as reducing and capping agents. The gold nanoparticles were produced from the incubation of a AuCl4(-) solution with an amino acid at 80°C for 20min. Among the twenty amino acids tested, several amino acids produced gold nanoparticles. The color of the nanoparticle solutions varied with the amino acids used for the reduction. We adopted l-histidine as a reducing agent and investigated the effects of the synthesis conditions on the gold nanoparticles. The His and AuCl4(-) concentrations affected the size of the gold nanoparticles and their aggregates. The pH of the reaction solution also affected the reaction yields and the shape of the gold nanoparticles.

  15. Investigation of supramolecular synthons and structural characterisation of aminopyridine-carboxylic acid derivatives

    PubMed Central

    2014-01-01

    Background Co-crystal is a structurally homogeneous crystalline material that contains two or more neutral building blocks that are present in definite stoichiometric amounts. The main advantage of co-crystals is their ability to generate a variety of solid forms of a drug that have distinct physicochemical properties from the solid co-crystal components. In the present investigation, five co-crystals containing 2-amino-6-chloropyridine (AMPY) moiety were synthesized and characterized. Results The crystal structure of 2-amino-6-chloropyridine (AMPY) (I), and the robustness of pyridine-acid supramolecular synthon were discussed in four stoichiometry co-crystals of AMPY…BA (II), AMPY…2ABA (III), AMPY…3CLBA (IV) and AMPY…4NBA (V). The abbreviated designations used are benzoic acid (BA), 2-aminobenzoic acid (2ABA), 3-chlorobenzoic acid (3CLBA) and 4-nitrobenzoic acid (4NBA). All the crystalline materials have been characterized by 1HNMR, 13CNMR, IR, photoluminescence, TEM analysis and X-ray diffraction. The supramolecular assembly of each co-crystal is analyzed and discussed. Conclusions Extensive N---H · · · N/N---H · · · O/O---H · · · N hydrogen bonds are found in (I-V), featuring different supramolecular synthons. In the crystal structure, for compound (I), the 2-amino-6-chloropyridine molecules are linked together into centrosymmetric dimers by hydrogen bonds to form homosynthon, whereas for compounds (II-V), the carboxylic group of the respective acids (benzoic acid, 2-aminobenzoic acid, 3-chlorobenzoic acid and 4-nitrobenzoic acid) interacts with pyridine molecule in a linear fashion through a pair of N---H · · · O and O---H · · · N hydrogen bonds, generating cyclic hydrogen-bonded motifs with the graph-set notation R 2 2 8 , to form heterosynthon. In compound (II), another intermolecular N---H · · · O hydrogen bonds further link these heterosynthons into zig-zag chains. Whereas in

  16. Synthesis and chirality of amino acids under interstellar conditions.

    PubMed

    Giri, Chaitanya; Goesmann, Fred; Meinert, Cornelia; Evans, Amanda C; Meierhenrich, Uwe J

    2013-01-01

    Amino acids are the fundamental building blocks of proteins, the biomolecules that provide cellular structure and function in all living organisms. A majority of amino acids utilized within living systems possess pre-specified orientation geometry (chirality); however the original source for this specific orientation remains uncertain. In order to trace the chemical evolution of life, an appreciation of the synthetic and evolutional origins of the first chiral amino acids must first be gained. Given that the amino acids in our universe are likely to have been synthesized in molecular clouds in interstellar space, it is necessary to understand where and how the first synthesis might have occurred. The asymmetry of the original amino acid synthesis was probably the result of exposure to chiral photons in the form of circularly polarized light (CPL), which has been detected in interstellar molecular clouds. This chirality transfer event, from photons to amino acids, has been successfully recreated experimentally and is likely a combination of both asymmetric synthesis and enantioselective photolysis. A series of innovative studies have reported successful simulation of these environments and afforded production of chiral amino acids under realistic circumstellar and interstellar conditions: irradiation of interstellar ice analogues (CO, CO2, NH3, CH3OH, and H2O) with circularly polarized ultraviolet photons at low temperatures does result in enantiomer enriched amino acid structures (up to 1.3% ee). This topical review summarizes current knowledge and recent discoveries about the simulated interstellar environments within which amino acids were probably formed. A synopsis of the COSAC experiment onboard the ESA cometary mission ROSETTA concludes this review: the ROSETTA mission will soft-land on the nucleus of the comet 67P/Churyumov-Gerasimenko in November 2014, anticipating the first in situ detection of asymmetric organic molecules in cometary ices.

  17. Synthesis and chirality of amino acids under interstellar conditions.

    PubMed

    Giri, Chaitanya; Goesmann, Fred; Meinert, Cornelia; Evans, Amanda C; Meierhenrich, Uwe J

    2013-01-01

    Amino acids are the fundamental building blocks of proteins, the biomolecules that provide cellular structure and function in all living organisms. A majority of amino acids utilized within living systems possess pre-specified orientation geometry (chirality); however the original source for this specific orientation remains uncertain. In order to trace the chemical evolution of life, an appreciation of the synthetic and evolutional origins of the first chiral amino acids must first be gained. Given that the amino acids in our universe are likely to have been synthesized in molecular clouds in interstellar space, it is necessary to understand where and how the first synthesis might have occurred. The asymmetry of the original amino acid synthesis was probably the result of exposure to chiral photons in the form of circularly polarized light (CPL), which has been detected in interstellar molecular clouds. This chirality transfer event, from photons to amino acids, has been successfully recreated experimentally and is likely a combination of both asymmetric synthesis and enantioselective photolysis. A series of innovative studies have reported successful simulation of these environments and afforded production of chiral amino acids under realistic circumstellar and interstellar conditions: irradiation of interstellar ice analogues (CO, CO2, NH3, CH3OH, and H2O) with circularly polarized ultraviolet photons at low temperatures does result in enantiomer enriched amino acid structures (up to 1.3% ee). This topical review summarizes current knowledge and recent discoveries about the simulated interstellar environments within which amino acids were probably formed. A synopsis of the COSAC experiment onboard the ESA cometary mission ROSETTA concludes this review: the ROSETTA mission will soft-land on the nucleus of the comet 67P/Churyumov-Gerasimenko in November 2014, anticipating the first in situ detection of asymmetric organic molecules in cometary ices. PMID:22976459

  18. Salicylic Acid Inhibits Synthesis of Proteinase Inhibitors in Tomato Leaves Induced by Systemin and Jasmonic Acid.

    PubMed Central

    Doares, S. H.; Narvaez-Vasquez, J.; Conconi, A.; Ryan, C. A.

    1995-01-01

    Salicylic acid (SA) and acetylsalicylic acid (ASA), previously shown to inhibit proteinase inhibitor synthesis induced by wounding, oligouronides (H.M. Doherty, R.R. Selvendran, D.J. Bowles [1988] Physiol Mol Plant Pathol 33: 377-384), and linolenic acid (H. Pena-Cortes, T. Albrecht, S. Prat, E.W. Weiler, L. Willmitzer [1993] Planta 191: 123-128), are shown here to be potent inhibitors of systemin-induced and jasmonic acid (JA)-induced synthesis of proteinase inhibitor mRNAs and proteins. The inhibition by SA and ASA of proteinase inhibitor synthesis induced by systemin and JA, as well as by wounding and oligosaccharide elicitors, provides further evidence that both oligosaccharide and polypeptide inducer molecules utilize the octadecanoid pathway to signal the activation of proteinase inhibitor genes. Tomato (Lycopersicon esculentum) leaves were pulse labeled with [35S]methionine, followed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and the inhibitory effects of SA are shown to be specific for the synthesis of a small number of JA-inducible proteins that includes the proteinase inhibitors. Previous results have shown that SA inhibits the conversion of 13S-hydroperoxy linolenic acid to 12-oxo-phytodienoic acid, thereby inhibiting the signaling pathway by blocking synthesis of JA. Here we report that the inhibition of synthesis of proteinase inhibitor proteins and mRNAs by SA in both light and darkness also occurs at a step in the signal transduction pathway, after JA synthesis but preceding transcription of the inhibitor genes. PMID:12228577

  19. Characterisation of a fatty acid and retinol binding protein orthologue from the hookworm Ancylostoma ceylanicum.

    PubMed

    Fairfax, Keke C; Vermeire, Jon J; Harrison, Lisa M; Bungiro, Richard D; Grant, Wayne; Husain, Sohail Z; Cappello, Michael

    2009-12-01

    Hookworms, bloodfeeding intestinal nematodes, infect nearly one billion people in resource limited countries and are a leading cause of anaemia and malnutrition. Like other nematodes, hookworms lack the capacity to synthesise essential fatty acids de novo and therefore must acquire those from exogenous sources. The cDNA corresponding to a putative Ancylostoma ceylanicum fatty acid and retinol binding protein-1 (AceFAR-1) was amplified from adult hookworm mRNA. Studies using quantitative reverse transcriptase real-time PCR demonstrate that AceFAR-1 transcripts are most abundant in the earliest developmental stages of the parasite, and greater in females than males. Using in vitro assays, the recombinant AceFAR-1 (rAceFAR-1) was shown to bind individual fatty acids with equilibrium dissociation constants in the low micromolar range. The pattern of fatty acid uptake by live adult worms cultured ex vivo was similar to the in vitro binding profile of rAceFAR-1, raising the possibility that the native protein may be involved in acquisition of fatty acids by A. ceylanicum. Animals vaccinated orally with rAceFAR-1 and the mucosal adjuvant cholera toxin exhibited a statistically significant (40-47%) reduction in intestinal worm burden compared with controls immunized with antigen or adjuvant alone. Together, these data suggest a potential role for AceFAR-1 in hookworm biology, making it a potentially valuable target for drug and vaccine development.

  20. Benzylidene Acetal Protecting Group as Carboxylic Acid Surrogate: Synthesis of Functionalized Uronic Acids and Sugar Amino Acids.

    PubMed

    Banerjee, Amit; Senthilkumar, Soundararasu; Baskaran, Sundarababu

    2016-01-18

    Direct oxidation of the 4,6-O-benzylidene acetal protecting group to C-6 carboxylic acid has been developed that provides an easy access to a wide range of biologically important and synthetically challenging uronic acid and sugar amino acid derivatives in good yields. The RuCl3 -NaIO4 -mediated oxidative cleavage method eliminates protection and deprotection steps and the reaction takes place under mild conditions. The dual role of the benzylidene acetal, as a protecting group and source of carboxylic acid, was exploited in the efficient synthesis of six-carbon sialic acid analogues and disaccharides bearing uronic acids, including glycosaminoglycan analogues.

  1. Lactide Synthesis and Chirality Control for Polylactic acid Production.

    PubMed

    Van Wouwe, Pieter; Dusselier, Michiel; Vanleeuw, Evelien; Sels, Bert

    2016-05-10

    Polylactic acid (PLA) is a very promising biodegradable, renewable, and biocompatible polymer. Aside from its production, its application field is also increasing, with use not only in commodity applications but also as durables and in biomedicine. In the current PLA production scheme, the most expensive part is not the polymerization itself but obtaining the building blocks lactic acid (LA) and lactide, the actual cyclic monomer for polymerization. Although the synthesis of LA and the polymerization have been studied systematically, reports of lactide synthesis are scarce. Most lactide synthesis methods are described in patent literature, and current energy-intensive, aselective industrial processes are based on archaic scientific literature. This Review, therefore, highlights new methods with a technical comparison and description of the different approaches. Water-removal methodologies are compared, as this is a crucial factor in PLA production. Apart from the synthesis of lactide, this Review also emphasizes the use of chemically produced racemic lactic acid (esters) as a starting point in the PLA production scheme. Stereochemically tailored PLA can be produced according to such a strategy, giving access to various polymer properties.

  2. Functionalisation of mesoporous silica gel with 2-[(phosphonomethyl)-amino]acetic acid functional groups. Characterisation and application

    NASA Astrophysics Data System (ADS)

    Caldarola, Dario; Mitev, Dimitar P.; Marlin, Lucile; Nesterenko, Ekaterina P.; Paull, Brett; Onida, Barbara; Bruzzoniti, Maria Concetta; Carlo, Rosa Maria De; Sarzanini, Corrado; Nesterenko, Pavel N.

    2014-01-01

    A new complexing adsorbent was prepared by chemical modification of mesoporous silica Kieselgel 60 (dp = 37-63 μm, average pore size 6 nm, specific surface area 425 m2 g-1) with 3-glycidoxypropyltrimethoxysilane and 2-[(phosphonomethyl)amino]acetic acid (PMA), commonly known as glyphosate. The prepared adsorbent was fully characterised using elemental analysis, thermal gravimetric analysis (TGA), acid-base potentiometric titration, Fourier Transform Infrared spectroscopy (FTIR), X-ray photoelectron spectroscopy (XPS), nitrogen adsorption isotherms at 77 K (BET), scanning electron microscopy with energy dispersive X-ray spectroscopy (SEM-EDS). The concentration of bonded PMA groups calculated from the nitrogen content was 0.38 mmol per gram. The adsorption of transition metal ions on PMA functionalised silica (HEPMAS) was studied from aqueous solutions having different pH and the following selectivity was established, Zn(II) < Co(II) < Cd(II) < Mn(II) < Ni(II) < Cu(II). The calculated values of distribution coefficients D for the adsorption of ecotoxic metal ions on HEPMAS are 5.0 × 104, 4.9 × 105 and 2.6 × 104 for Zn(II), Pb(II) and Cd(II), respectively.

  3. A novel approach in cinnamic acid synthesis: direct synthesis of cinnamic acids from aromatic aldehydes and aliphatic carboxylic acids in the presence of boron tribromide.

    PubMed

    Chiriac, Constantin I; Tanasa, Fulga; Onciu, Marioara

    2005-02-28

    Cinnamic acids have been prepared in moderate to high yields by a new direct synthesis using aromatic aldehydes and aliphatic carboxylic acids, in the presence of boron tribromide as reagent, 4-dimethylaminopyridine (4-DMAP) and pyridine (Py) as bases and N-methyl-2-pyrolidinone (NMP) as solvent, at reflux (180-190 degrees C) for 8-12 hours.

  4. Is docosahexaenoic acid synthesis from α-linolenic acid sufficient to supply the adult brain?

    PubMed

    Domenichiello, Anthony F; Kitson, Alex P; Bazinet, Richard P

    2015-07-01

    Docosahexaenoic acid (DHA) is important for brain function, and can be obtained directly from the diet or synthesized in the body from α-linolenic acid (ALA). Debate exists as to whether DHA synthesized from ALA can provide sufficient DHA for the adult brain, as measures of DHA synthesis from ingested ALA are typically <1% of the oral ALA dose. However, the primary fate of orally administered ALA is β-oxidation and long-term storage in adipose tissue, suggesting that DHA synthesis measures involving oral ALA tracer ingestion may underestimate total DHA synthesis. There is also evidence that DHA synthesized from ALA can meet brain DHA requirements, as animals fed ALA-only diets have brain DHA concentrations similar to DHA-fed animals, and the brain DHA requirement is estimated to be only 2.4-3.8 mg/day in humans. This review summarizes evidence that DHA synthesis from ALA can provide sufficient DHA for the adult brain by examining work in humans and animals involving estimates of DHA synthesis and brain DHA requirements. Also, an update on methods to measure DHA synthesis in humans is presented highlighting a novel approach involving steady-state infusion of stable isotope-labeled ALA that bypasses several limitations of oral tracer ingestion. It is shown that this method produces estimates of DHA synthesis that are at least 3-fold higher than brain uptake rates in rats.

  5. Characterisation and expression of fatty acid modifying enzyme produced by Staphylococcus epidermidis.

    PubMed

    Chamberlain, N R; Brueggemann, S A

    1997-08-01

    The production of fatty-acid modifying enzyme (FAME) - first identified as a possible virulence factor in Staphylococcus aureus - has also been identified in S. epidermidis. This extracellular enzyme inactivates bactericidal fatty acids by esterifying them to cholesterol. FAME may provide protection for S. epidermidis by inactivating these lipids present on the skin. Over 88% of 51 randomly collected S. epidermidis isolates produced FAME; 92.2% and 13.7% of the same strains produced lipase and slime, respectively. There appeared to be no correlation of lipase activity or slime production with FAME production. The temperature optimum for FAME was between 20 degrees C and 35 degrees C, and the pH optimum was 6.0. Optimal enzyme activity was present at NaCl concentrations of between 250 and 500 mM. FAME was not detected in culture filtrates until early stationary phase, indicating some regulatory control over enzyme production.

  6. Characterisation and expression of fatty acid modifying enzyme produced by Staphylococcus epidermidis.

    PubMed

    Chamberlain, N R; Brueggemann, S A

    1997-08-01

    The production of fatty-acid modifying enzyme (FAME) - first identified as a possible virulence factor in Staphylococcus aureus - has also been identified in S. epidermidis. This extracellular enzyme inactivates bactericidal fatty acids by esterifying them to cholesterol. FAME may provide protection for S. epidermidis by inactivating these lipids present on the skin. Over 88% of 51 randomly collected S. epidermidis isolates produced FAME; 92.2% and 13.7% of the same strains produced lipase and slime, respectively. There appeared to be no correlation of lipase activity or slime production with FAME production. The temperature optimum for FAME was between 20 degrees C and 35 degrees C, and the pH optimum was 6.0. Optimal enzyme activity was present at NaCl concentrations of between 250 and 500 mM. FAME was not detected in culture filtrates until early stationary phase, indicating some regulatory control over enzyme production. PMID:9511818

  7. Fatty acid effects on fibroblast cholesterol synthesis

    SciTech Connect

    Shireman, R.B.; Muth, J.; Lopez, C.

    1987-05-01

    Two cell lines of normal (CRL 1475, GM5565) and of familial hypercholesterolemia (FH) (CM 486,488) fibroblasts were preincubated with medium containing the growth factor ITS, 2.5 mg/ml fatty acid-free BSA, or 35.2 ..mu..mol/ml of these fatty acids complexed with 2.5 mg BSA/ml: stearic (18:0), caprylic (8:0), oleic (18:1;9), linoleic (18:2;9,12), linolenic (18:3;9,12,15), docosahexaenoic (22:6;4,7,10,13,16,19)(DHA) or eicosapentaenoic (20:5;5,8,11,14,17)(EPA). After 20 h, cells were incubated for 2 h with 0.2 ..mu..Ci (/sup 14/C)acetate/ml. Cells were hydrolyzed; an aliquot was quantitated for radioactivity and protein. After saponification and extraction with hexane, radioactivity in the aqueous and organic phases was determined. The FH cells always incorporated 30-90% more acetate/mg protein than normal cells but the pattern of the fatty acid effects was similar in both types. When the values were normalized to 1 for the BSA-only group, cells with ITS had the greatest (/sup 14/C)acetate incorporation (1.45) followed by the caprylic group (1.14). Cells incubated with 18:3, 20:6 or 22:6 incorporated about the same amount as BSA-only. Those preincubated with 18:2, 18:1, 18:0 showed the least acetate incorporation (0.87, 0.59 and 0.52, respectively). The percentage of total /sup 14/C counts which extracted into hexane was much greater in FH cells; however, these values varied with the fatty acid, e.g., 1.31(18:0) and 0.84(8:0) relative to 1(BSA).

  8. Novel synthesis of steryl esters from phytosterols and amino Acid.

    PubMed

    Pang, Min; Jiang, Shaotong; Cao, Lili; Pan, Lijun

    2011-10-12

    The feasibility of esterification of phytosterol with the amino acid l-glutamic acid was established. The influence of various organic solvents was investigated, and n-butanol was selected as an ideal solvent for phytosteryl esters synthesis with l-glutamic acid. The reaction conditions were further optimized by orthogonal experiments, and a 92.3% degree of esterification was obtained when optimum conditions were used. FT-IR spectral, GC-MS, and NMR analyses were adopted to determine the steryl esters of l-glutamic acid. The FT-IR spectrum indicated the presence of ester bonds in the phytosteryl esters with l-glutamic acid, and on the basis of the detailed mass spectrography analysis, GC-MS and NMR offered an efficient and reliable way to confirm the steryl esters. This novel synthesis approach of phytosteryl esters with amino acid supplied a promising alternative to the substrate on esterification of phytosterols and thus can be readily applied to further studies of functional food ingredients of phytosteryl esters.

  9. Fatty acid phytyl ester synthesis in chloroplasts of Arabidopsis.

    PubMed

    Lippold, Felix; vom Dorp, Katharina; Abraham, Marion; Hölzl, Georg; Wewer, Vera; Yilmaz, Jenny Lindberg; Lager, Ida; Montandon, Cyrille; Besagni, Céline; Kessler, Felix; Stymne, Sten; Dörmann, Peter

    2012-05-01

    During stress or senescence, thylakoid membranes in chloroplasts are disintegrated, and chlorophyll and galactolipid are broken down, resulting in the accumulation of toxic intermediates, i.e., tetrapyrroles, free phytol, and free fatty acids. Chlorophyll degradation has been studied in detail, but the catabolic pathways for phytol and fatty acids remain unclear. A large proportion of phytol and fatty acids is converted into fatty acid phytyl esters and triacylglycerol during stress or senescence in chloroplasts. We isolated two genes (PHYTYL ESTER SYNTHASE1 [PES1] and PES2) of the esterase/lipase/thioesterase family of acyltransferases from Arabidopsis thaliana that are involved in fatty acid phytyl ester synthesis in chloroplasts. The two proteins are highly expressed during senescence and nitrogen deprivation. Heterologous expression in yeast revealed that PES1 and PES2 have phytyl ester synthesis and diacylglycerol acyltransferase activities. The enzymes show broad substrate specificities and can employ acyl-CoAs, acyl carrier proteins, and galactolipids as acyl donors. Double mutant plants (pes1 pes2) grow normally but show reduced phytyl ester and triacylglycerol accumulation. These results demonstrate that PES1 and PES2 are involved in the deposition of free phytol and free fatty acids in the form of phytyl esters in chloroplasts, a process involved in maintaining the integrity of the photosynthetic membrane during abiotic stress and senescence.

  10. Ribosomal Synthesis of Peptides with Multiple β-Amino Acids.

    PubMed

    Fujino, Tomoshige; Goto, Yuki; Suga, Hiroaki; Murakami, Hiroshi

    2016-02-17

    The compatibility of β-amino acids with ribosomal translation was studied for decades, but it has been still unclear whether the ribosome can accept various β-amino acids, and whether the ribosome can introduce multiple β-amino acids in a peptide. In the present study, by using the Escherichia coli reconstituted cell-free translation system with a reprogramed genetic code, we screened β-amino acids that give high single incorporation efficiency and used them to synthesize peptides containing multiple β-amino acids. The experiments of single β-amino acid incorporation into a peptide revealed that 13 β-amino acids are compatible with ribosomal translation. Six of the tested β-amino acids (βhGly, l-βhAla, l-βhGln, l-βhPhg, l-βhMet, and d-βhPhg) showed high incorporation efficiencies, and seven (l-βhLeu, l-βhIle, l-βhAsn, l-βhPhe, l-βhLys, d-βhAla, and d-βhLeu) showed moderate incorporation efficiencies; whereas no full-length peptide was produced using other β-amino acids (l-βhPro, l-βhTrp, and l-βhGlu). Subsequent double-incorporation experiments using β-amino acids with high single incorporation efficiency revealed that elongation of peptides with successive β-amino acids is prohibited. Efficiency of the double-incorporation of the β-amino acids was restored by the insertion of Tyr or Ile between the two β-amino acids. On the basis of these experiments, we also designed mRNA sequences of peptides, and demonstrated the ribosomal synthesis of peptides containing different types of β-amino acids at multiple positions.

  11. Stimulation of protein synthesis by phosphatidic acid in rat cardiomyocytes.

    PubMed

    Xu, Y J; Yau, L; Yu, L P; Elimban, V; Zahradka, P; Dhalla, N S

    1996-12-13

    Phosphatidic acid (PA) was observed to stimulate protein synthesis in adult cardiomyocytes in a time- and concentration-dependent manner. The maximal stimulation in protein synthesis (142 +/- 12% vs 100% as the control) was achieved at 10 microM PA within 60 min and was inhibited by actinomycin D (107 +/- 4% of the control) or cycloheximide (105 +/- 6% of the control). The increase in protein synthesis due to PA was attenuated or abolished by preincubation of cardiomyocytes with a tyrosine kinase inhibitor, genistein (94 +/- 9% of the control), phospholipase C inhibitors 2-nitro-4-carboxyphenyl N,N-diphenyl carbamate or carbon-odithioic acid O-(octahydro-4,7-methanol-1H-inden-5-yl (101 +/- 6 and 95 +/- 5% of the control, respectively), protein kinase C inhibitors staurosporine or polymyxin B (109 +/- 3 and 93 +/- 3% of the control), and chelators of extracellular and intracellular free Ca2+ EGTA or BAPTA/AM (103 +/- 6 and 95 +/- 6% of the control, respectively). PA at different concentrations (0.1 to 100 microM) also caused phosphorylation of a cell surface protein of approximately 24 kDa. In addition, mitogen-activated protein kinase was stimulated by PA in a concentration-dependent manner; maximal stimulation (217 +/- 6% of the control) was seen at 10 microM PA. These data suggest that PA increases protein synthesis in adult rat cardiomyocytes and thus may play an important role in the development of cardiac hypertrophy.

  12. Microwave-Assisted Rapid Enzymatic Synthesis of Nucleic Acids.

    PubMed

    Hari Das, Rakha; Ahirwar, Rajesh; Kumar, Saroj; Nahar, Pradip

    2016-07-01

    Herein we report microwave-induced enhancement of the reactions catalyzed by Escherichia coli DNA polymerase I and avian myeloblastosis virus-reverse transcriptase. The reactions induced by microwaves result in a highly selective synthesis of nucleic acids in 10-50 seconds. In contrast, same reactions failed to give desired reaction products when carried out in the same time periods, but without microwave irradiation. Each of the reactions was carried out for different duration of microwave exposure time to find the optimum reaction time. The products produced by the respective enzyme upon microwave irradiation of the reaction mixtures were identical to that produced by the conventional procedures. As the microwave-assisted reactions are rapid, microwave could be a useful alternative to the conventional and time consuming procedures of enzymatic synthesis of nucleic acids. PMID:27159147

  13. A New Process for Acrylic Acid Synthesis by Fermentative Process

    NASA Astrophysics Data System (ADS)

    Lunelli, B. H.; Duarte, E. R.; de Toledo, E. C. Vasco; Wolf Maciel, M. R.; Maciel Filho, R.

    With the synthesis of chemical products through biotechnological processes, it is possible to discover and to explore innumerable routes that can be used to obtain products of high addes value. Each route may have particular advantages in obtaining a desired product, compared with others, especially in terms of yield, productivity, easiness to separate the product, economy, and environmental impact. The purpose of this work is the development of a deterministic model for the biochemical synthesis of acrylic acid in order to explore an alternative process. The model is built-up with the tubular reactor equations together with the kinetic representation based on the structured model. The proposed process makes possible to obtain acrylic acid continuously from the sugar cane fermentation.

  14. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1987-01-01

    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20 percent for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  15. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, A. L.

    1986-01-01

    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20% for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  16. Is Acetylcarnitine a Substrate for Fatty Acid Synthesis in Plants?

    PubMed

    Roughan, G.; Post-Beittenmiller, D.; Ohlrogge, J.; Browse, J.

    1993-04-01

    Long-chain fatty acid synthesis from [1-14C]acetylcarnitine by chloroplasts isolated from spinach (Spinacia oleracea), pea (Pisum sativum), amaranthus (Amaranthus lividus), or maize (Zea mays) occurred at less than 2% of the rate of fatty acid synthesis from [1-14C]acetate irrespective of the maturity of the leaves or whether the plastids were purified using sucrose or Percoll medium. [1-14C]-Acetylcarnitine was not significantly utilized by highly active chloroplasts rapidly prepared from pea and spinach using methods not involving density gradient centrifugation. [1-14C]Acetylcarnitine was recovered quantitatively from chloroplast incubations following 10 min in the light. Unlabeled acetyl-L-carnitine (0.4 mM) did not compete with [1-14C]acetate (0.2 mM) as a substrate for fatty acid synthesis by any of the more than 70 chloroplast preparations tested in this study. Carnitine acetyltransferase activity was not detected in any chloroplast preparation and was present in whole leaf homogenates at about 0.1% of the level of acetyl-coenzyme A synthetase activity. When supplied to detached pea shoots and detached spinach, amaranthus, and maize leaves via the transpiration stream, 1 to 4% of the [1-14C]acetylcarnitine and 47 to 57% of the [1-14C]acetate taken up was incorporated into lipids. Most (78-82%) of the [1-14C]acetylcarnitine taken up was recovered intact. It is concluded that acetylcarnitine is not a major precursor for fatty acid synthesis in plants.

  17. Is acetylcarnitine a substrate for fatty acid synthesis in plants

    SciTech Connect

    Roughan, G. ); Post-Beittenmiller, D.; Ohlrogge, J. ); Browse, J. )

    1993-04-01

    Long-chain fatty acid synthesis from [1-[sup 14]C]acetylcarnitine by chloroplasts isolated from spinach (Spinacia oleracea), pea (Pisum sativum), amaranthus (Amaranthus lividus), or maize (Zea mays) occurred at less than 2% of the rate of fatty acid synthesis from [1-[sup 14]C]acetate irrespective of the maturity of the leaves or whether the plastids were purified using sucrose or Percoll medium. [1-[sup 14]C]Acetylcarnitine was not significantly utilized by highly active chloroplasts rapidly prepared from pea and spinach using methods not involving density gradient centrifugation. [1-[sup 14]C]Acetylcarnitine was recovered quantitatively from chloroplast incubations following 10 min in the light. Unlabeled acetyl-L-carnitine (0.4 mM) did not compete with [1-[sup 14]C]acetate (0.2 mM) as a substrate for fatty acid synthesis by any of the more than 70 chloroplast preparations tested in this study. Carnitine acetyltransferase activity was not detected in any chloroplast preparation and was present in whole leaf homogenates at about 0.1% of the level of acetyl-coenzyme A synthetase activity. When supplied to detached pea shoots and detached spinach, amaranthus, and maize leaves via the transpiration stream, 1 to 4% of the [1-[sup 14]C]acetylcarnitine and 47 to 57% of the [1-[sup 14]C]acetate taken up was incorporated into lipids. Most (78--82%) of the [1-[sup 14]C]acetylcarnitine taken up was recovered intact. It is concluded that acetylcarnitine is not a major precursor for fatty acid synthesis in plants. 29 refs., 5 tabs.

  18. Fatty acid synthesis: from CO2 to functional genomics.

    PubMed

    Ohlrogge, J; Pollard, M; Bao, X; Focke, M; Girke, T; Ruuska, S; Mekhedov, S; Benning, C

    2000-12-01

    For over 25 years there has been uncertainty over the pathway from CO(2) to acetyl-CoA in chloroplasts. On the one hand, free acetate is the most effective substrate for fatty acid synthesis by isolated chloroplasts, and free acetate concentrations reported in leaf tissue (0.1-1 mM) appear adequate to saturate fatty acid synthase. On the other hand, a clear mechanism to generate sufficient free acetate for fatty acid synthesis is not established and direct production of acetyl-CoA from pyruvate by a plastid pyruvate dehydrogenase seems a more simple and direct path. We have re-examined this question and attempted to distinguish between the alternatives. The kinetics of (13)CO(2) and (14)CO(2) movement into fatty acids and the absolute rate of fatty acid synthesis in leaves was determined in light and dark. Because administered (14)C appears in fatty acids within < 2-3 min our results are inconsistent with a large pool of free acetate as an intermediate in leaf fatty acid synthesis. In addition, these studies provide an estimate of the turnover rate of fatty acid in leaves. Studies similar to the above are more complex in seeds, and some questions about the regulation of plant lipid metabolism seem difficult to solve using conventional biochemical or molecular approaches. For example, we have little understanding of why or how some seeds produce >50% oil whereas other seeds store largely carbohydrate or protein. Major control over complex plant biochemical pathways may only become possible by understanding regulatory networks which provide 'global' control over these pathways. To begin to discover such networks and provide a broad analysis of gene expression in developing oilseeds, we have produced microarrays that display approx. 5000 seed-expressed Arabidopsis genes. Sensitivity of the arrays was 1-2 copies of mRNA/cell. The arrays have been hybridized with probes derived from seeds, leaves and roots, and analysis of expression ratios between the different tissues

  19. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  20. Characterisation of acid mine drainage in a high rainfall mountain environment, New Zealand.

    PubMed

    Davies, Hugh; Weber, Paul; Lindsay, Phil; Craw, Dave; Pope, James

    2011-07-01

    The Stockton coal mine lies at 700-1100 m above sea level in a mountainous orographic precipitation zone on the West Coast of the South Island of New Zealand. Rainfall exceeds 6000 mm/year and arrives with frequent flood events that can deliver > 200 mm/day. Streams vary in discharges by up to two orders of magnitude over a time scale of hours. Pyritic waste rock at the mine interacts chemically with even the most intense rainfall, and almost all runoff is acidic to some degree. In the most intense rain event recorded in this study (> 10 mm/hour), dilution of acid mine drainage (AMD) occurred and pH rose from 3 to >5 over several hours, with stream discharge at a monitoring point rising from <0.5 to >100 cumecs. However, most rain events of similar magnitude are less intense, longer duration, and only raise AMD pH to ~4 with similar high discharges. Results presented here for Stockton confirm that it is the intensity of rain events on the hourly scale, rather than the total amount of rainwater delivered to the site, that governs the amount and composition of AMD generated during flood events. Stream discharge loads of dissolved iron and aluminium range from ~20 to 1000 kg/hour. Dissolved sulfate and acidity loads are typically ~500 kg/hour but can exceed 20 tonnes/hour in rain events. First flush effects observable elsewhere around the world involving peak metal loads following dry periods or seasonal changes are not obvious at Stockton due to the high and variable rainfall environment. Dissolved Fe concentrations may be limited in runoff waters by precipitation of jarosite and schwertmannite, especially when rainfall is sufficiently intense to raise pH to 4 or higher. These minerals are widespread in the exposed waste rock on site. Likewise, precipitation of alunite may occur as pH rises in rain events, but no field evidence for this has been observed.

  1. Characterisation of acid mine drainage in a high rainfall mountain environment, New Zealand.

    PubMed

    Davies, Hugh; Weber, Paul; Lindsay, Phil; Craw, Dave; Pope, James

    2011-07-01

    The Stockton coal mine lies at 700-1100 m above sea level in a mountainous orographic precipitation zone on the West Coast of the South Island of New Zealand. Rainfall exceeds 6000 mm/year and arrives with frequent flood events that can deliver > 200 mm/day. Streams vary in discharges by up to two orders of magnitude over a time scale of hours. Pyritic waste rock at the mine interacts chemically with even the most intense rainfall, and almost all runoff is acidic to some degree. In the most intense rain event recorded in this study (> 10 mm/hour), dilution of acid mine drainage (AMD) occurred and pH rose from 3 to >5 over several hours, with stream discharge at a monitoring point rising from <0.5 to >100 cumecs. However, most rain events of similar magnitude are less intense, longer duration, and only raise AMD pH to ~4 with similar high discharges. Results presented here for Stockton confirm that it is the intensity of rain events on the hourly scale, rather than the total amount of rainwater delivered to the site, that governs the amount and composition of AMD generated during flood events. Stream discharge loads of dissolved iron and aluminium range from ~20 to 1000 kg/hour. Dissolved sulfate and acidity loads are typically ~500 kg/hour but can exceed 20 tonnes/hour in rain events. First flush effects observable elsewhere around the world involving peak metal loads following dry periods or seasonal changes are not obvious at Stockton due to the high and variable rainfall environment. Dissolved Fe concentrations may be limited in runoff waters by precipitation of jarosite and schwertmannite, especially when rainfall is sufficiently intense to raise pH to 4 or higher. These minerals are widespread in the exposed waste rock on site. Likewise, precipitation of alunite may occur as pH rises in rain events, but no field evidence for this has been observed. PMID:21669330

  2. A direct method for the synthesis of orthogonally protected furyl- and thienyl- amino acids.

    PubMed

    Hudson, Alex S; Caron, Laurent; Colgin, Neil; Cobb, Steven L

    2015-04-01

    The synthesis of unnatural amino acids plays a key part in expanding the potential application of peptide-based drugs and in the total synthesis of peptide natural products. Herein, we report a direct method for the synthesis of orthogonally protected 5-membered heteroaromatic amino acids.

  3. Synthesis of rosin acid starch catalyzed by lipase.

    PubMed

    Lin, Rihui; Li, He; Long, Han; Su, Jiating; Huang, Wenqin

    2014-01-01

    Rosin, an abundant raw material from pine trees, was used as a starting material directly for the synthesis of rosin acid starch. The esterification reaction was catalyzed by lipase (Novozym 435) under mild conditions. Based on single factor experimentation, the optimal esterification conditions were obtained as follows: rosin acid/anhydrous glucose unit in the molar ratio 2:1, reaction time 4 h at 45°C, and 15% of lipase dosage. The degree of substitution (DS) reaches 0.098. Product from esterification of cassava starch with rosin acid was confirmed by FTIR spectroscopy and iodine coloration analysis. Scanning electron microscopy and X-ray diffraction analysis showed that the morphology and crystallinity of the cassava starch were largely destroyed. Thermogravimetric analysis indicated that thermal stability of rosin acid starch decreased compared with native starch.

  4. Pterandric acid--its isolation, synthesis and stereochemistry.

    PubMed

    Haleem, Muhammad A; Capellari, Simone C; Sympson, Beryl B; Marsaioli, Anita J

    2015-01-01

    Some plant families have a specialized type of pollination system, with floral lipid rewards for pollinators, which is common. In neotropical Malpighiaceae species like Pterandra pyroidea, this specialized type of pollination system is apparently shifting from floral oils/lipids to pollen reward. Mass spectrometric analysis (GC/MS-EI) indicated that P. pyroidea floral oil has a unique chemical composition, i.e., few fatty acid constituents possessing acetoxy groups at positions 5 and 7, which is distinct from the other floral oils of sympatric Malpighiaceae species. The structure of the major floral oil constituent, a novel fatty acid, anti-5,7-diacetoxydocosanoic acid, was confirmed based on synthesis, mass fragmentation, and 1H and 13C NMR analyses; the compound is herein named pterandric acid.

  5. Very long chain fatty acid synthesis in sunflower kernels.

    PubMed

    Salas, Joaquín J; Martínez-Force, Enrique; Garcés, Rafael

    2005-04-01

    Most common seed oils contain small amounts of very long chain fatty acids (VLCFAs), the main components of oils from species such as Brassica napus or Lunnaria annua. These fatty acids are synthesized from acyl-CoA precursors in the endoplasmic reticulum through the activity of a dissociated enzyme complex known as fatty acid elongase. We studied the synthesis of the arachidic, behenic, and lignoceric VLCFAs in sunflower kernels, in which they account for 1-3% of the saturated fatty acids. These VLCFAs are synthesized from 18:0-CoA by membrane-bound fatty acid elongases, and their biosynthesis is mainly dependent on NADPH equivalents. Two condensing enzymes appear to be responsible for the synthesis of VLCFAs in sunflower kernels, beta-ketoacyl-CoA synthase-I (KCS-I) and beta-ketoacyl-CoA synthase-II (KCS-II). Both of these enzymes were resolved by ion exchange chromatography and display different substrate specificities. While KCS-I displays a preference for 20:0-CoA, 18:0-CoA was more efficiently elongated by KCS-II. Both enzymes have different sensitivities to pH and Triton X-100, and their kinetic properties indicate that both are strongly inhibited by the presence of their substrates. In light of these results, the VLCFA composition of sunflower oil is considered in relation to that in other commercially exploited oils.

  6. Characterisation of the products from pyrolysis of residues after acid hydrolysis of Miscanthus.

    PubMed

    Melligan, F; Dussan, K; Auccaise, R; Novotny, E H; Leahy, J J; Hayes, M H B; Kwapinski, W

    2012-03-01

    Platform chemicals such as furfural and hydroxymethylfurfural are major products formed during the acid hydrolysis of lignocellulosic biomass in second generation biorefining processes. Solid hydrolysis residues (HR) can amount to 50 wt.% of the starting biomass materials. Pyrolysis of the HRs gives rise to biochar, bio-liquids, and gases. Time and temperature were variables during the pyrolysis of HRs in a fixed bed tubular reactor, and both parameters have major influences on the amounts and properties of the products. Biochar, with potential for carbon sequestration and soil conditioning, composed about half of the HR pyrolysis product. The amounts (11-20 wt.%) and compositions (up to 77% of phenols in organic fraction) of the bio-liquids formed suggest that these have little value as fuels, but could be sources of phenols, and the gas can have application as a fuel. PMID:22281143

  7. PlsX deletion impacts fatty acid synthesis and acid adaptation in Streptococcus mutans.

    PubMed

    Cross, Benjamin; Garcia, Ariana; Faustoferri, Roberta; Quivey, Robert G

    2016-04-01

    Streptococcus mutans, one of the primary causative agents of dental caries in humans, ferments dietary sugars in the mouth to produce organic acids. These acids lower local pH values, resulting in demineralization of the tooth enamel, leading to caries. To survive acidic environments, Strep. mutans employs several adaptive mechanisms, including a shift from saturated to unsaturated fatty acids in membrane phospholipids. PlsX is an acyl-ACP : phosphate transacylase that links the fatty acid synthase II (FASII) pathway to the phospholipid synthesis pathway, and is therefore central to the movement of unsaturated fatty acids into the membrane. Recently, we discovered that plsX is not essential in Strep. mutans. A plsX deletion mutant was not a fatty acid or phospholipid auxotroph. Gas chromatography of fatty acid methyl esters indicated that membrane fatty acid chain length in the plsX deletion strain differed from those detected in the parent strain, UA159. The deletion strain displayed a fatty acid shift similar to WT, but had a higher percentage of unsaturated fatty acids at low pH. The deletion strain survived significantly longer than the parent strain when cultures were subjected to an acid challenge of pH 2.5.The ΔplsX strain also exhibited elevated F-ATPase activity at pH 5.2, compared with the parent. These results indicate that the loss of plsX affects both the fatty acid synthesis pathway and the acid-adaptive response of Strep. mutans. PMID:26850107

  8. A Study on Amino Acids: Synthesis of Alpha-Aminophenylacetic Acid (Phenylglycine) and Determination of its Isoelectric Point.

    ERIC Educational Resources Information Center

    Barrelle, M.; And Others

    1983-01-01

    Background information and procedures are provided for an experimental study on aminophenylacetic acid (phenylglycine). These include physical chemistry (determination of isoelectric point by pH measurement) and organic chemistry (synthesis of an amino acid in racemic form) experiments. (JN)

  9. Structural and rheological characterisation of heteropolysaccharides produced by lactic acid bacteria in wheat and sorghum sourdough.

    PubMed

    Galle, Sandra; Schwab, Clarissa; Arendt, Elke K; Gänzle, Michael G

    2011-05-01

    Hydrocolloids improve the volume, texture, and shelf life of bread. Exopolysaccharides (EPS) produced by lactic acid bacteria (LAB) during sourdough fermentation can replace hydrocolloids. It was the aim of this study to determine whether heteropolysaccharides (HePS) synthesized intracellularly from sugar nucleotides by glycosyltransferases are produced in wheat and gluten-free sorghum sourdough at effective levels. The HePS-producing strains Lactobacillus casei FUA3185, L. casei FUA3186, and Lactobacillus buchneri FUA3154 were used; Weissella cibaria 10M producing no EPS in the absence of sucrose served as control strain. Cell suspensions of L. buchneri in MRS showed the highest viscosity at low shear rate. Glycosyltransferase genes responsible of HePS formation in LAB were expressed in sorghum and wheat sourdough. However, only HePS produced by L. buchneri influenced the rheological properties of sorghum sourdoughs but not of wheat sourdoughs. Sorghum sourdough fermented with L. buchneri exhibited a low |G*| compared to the control, indicating a decrease in resistance to deformation. An increase in tan δ indicated decreased elasticity. The use of LAB producing HePS expands the diversity of EPS and increases the variety of cultures for use in baking.

  10. Genetic and Technological Characterisation of Vineyard- and Winery-Associated Lactic Acid Bacteria

    PubMed Central

    Nisiotou, Aspasia A.; Filippousi, Maria-Evangelia; Fragkoulis, Petros; Tassou, Chryssoula; Banilas, Georgios

    2015-01-01

    Vineyard- and winery-associated lactic acid bacteria (LAB) from two major PDO regions in Greece, Peza and Nemea, were surveyed. LAB were isolated from grapes, fermenting musts, and winery tanks performing spontaneous malolactic fermentations (MLF). Higher population density and species richness were detected in Nemea than in Peza vineyards and on grapes than in fermenting musts. Pediococcus pentosaceus and Lactobacillus graminis were the most abundant LAB on grapes, while Lactobacillus plantarum dominated in fermenting musts from both regions. No particular structure of Lactobacillus plantarum populations according to the region of origin was observed, and strain distribution seems random. LAB species diversity in winery tanks differed significantly from that in vineyard samples, consisting principally of Oenococcus oeni. Different strains were analysed as per their enological characteristics and the ability to produce biogenic amines (BAs). Winery-associated species showed higher resistance to low pH, ethanol, SO2, and CuSO4 than vineyard-associated isolates. The frequency of BA-producing strains was relatively low but not negligible, considering that certain winery-associated Lactobacillus hilgardii strains were able to produce BAs. Present results show the necessity of controlling the MLF by selected starters in order to avoid BA accumulation in wine. PMID:25866789

  11. The first proton sponge-based amino acids: synthesis, acid-base properties and some reactivity.

    PubMed

    Ozeryanskii, Valery A; Gorbacheva, Anastasia Yu; Pozharskii, Alexander F; Vlasenko, Marina P; Tereznikov, Alexander Yu; Chernov'yants, Margarita S

    2015-08-21

    The first hybrid base constructed from 1,8-bis(dimethylamino)naphthalene (proton sponge or DMAN) and glycine, N-methyl-N-(8-dimethylamino-1-naphthyl)aminoacetic acid, was synthesised in high yield and its hydrobromide was structurally characterised and used to determine the acid-base properties via potentiometric titration. It was found that the basic strength of the DMAN-glycine base (pKa = 11.57, H2O) is on the level of amidine amino acids like arginine and creatine and its structure, zwitterionic vs. neutral, based on the spectroscopic (IR, NMR, mass) and theoretical (DFT) approaches has a strong preference to the zwitterionic form. Unlike glycine, the DMAN-glycine zwitterion is N-chiral and is hydrolytically cleaved with the loss of glycolic acid on heating in DMSO. This reaction together with the mild decarboxylative conversion of proton sponge-based amino acids into 2,3-dihydroperimidinium salts under air-oxygen was monitored with the help of the DMAN-alanine amino acid. The newly devised amino acids are unique as they combine fluorescence, strongly basic and redox-active properties.

  12. The first proton sponge-based amino acids: synthesis, acid-base properties and some reactivity.

    PubMed

    Ozeryanskii, Valery A; Gorbacheva, Anastasia Yu; Pozharskii, Alexander F; Vlasenko, Marina P; Tereznikov, Alexander Yu; Chernov'yants, Margarita S

    2015-08-21

    The first hybrid base constructed from 1,8-bis(dimethylamino)naphthalene (proton sponge or DMAN) and glycine, N-methyl-N-(8-dimethylamino-1-naphthyl)aminoacetic acid, was synthesised in high yield and its hydrobromide was structurally characterised and used to determine the acid-base properties via potentiometric titration. It was found that the basic strength of the DMAN-glycine base (pKa = 11.57, H2O) is on the level of amidine amino acids like arginine and creatine and its structure, zwitterionic vs. neutral, based on the spectroscopic (IR, NMR, mass) and theoretical (DFT) approaches has a strong preference to the zwitterionic form. Unlike glycine, the DMAN-glycine zwitterion is N-chiral and is hydrolytically cleaved with the loss of glycolic acid on heating in DMSO. This reaction together with the mild decarboxylative conversion of proton sponge-based amino acids into 2,3-dihydroperimidinium salts under air-oxygen was monitored with the help of the DMAN-alanine amino acid. The newly devised amino acids are unique as they combine fluorescence, strongly basic and redox-active properties. PMID:26159785

  13. Synthesis and Characterization of Fatty Acid Conjugates of Niacin and Salicylic Acid.

    PubMed

    Vu, Chi B; Bemis, Jean E; Benson, Ericka; Bista, Pradeep; Carney, David; Fahrner, Richard; Lee, Diana; Liu, Feng; Lonkar, Pallavi; Milne, Jill C; Nichols, Andrew J; Picarella, Dominic; Shoelson, Adam; Smith, Jesse; Ting, Amal; Wensley, Allison; Yeager, Maisy; Zimmer, Michael; Jirousek, Michael R

    2016-02-11

    This report describes the synthesis and preliminary biological characterization of novel fatty acid niacin conjugates and fatty acid salicylate conjugates. These molecular entities were created by covalently linking two bioactive molecules, either niacin or salicylic acid, to an omega-3 fatty acid. This methodology allows the simultaneous intracellular delivery of two bioactives in order to elicit a pharmacological response that could not be replicated by administering the bioactives individually or in combination. The fatty acid niacin conjugate 5 has been shown to be an inhibitor of the sterol regulatory element binding protein (SREBP), a key regulator of cholesterol metabolism proteins such as PCSK9, HMG-CoA reductase, ATP citrate lyase, and NPC1L1. On the other hand, the fatty acid salicylate conjugate 11 has been shown to have a unique anti-inflammatory profile based on its ability to modulate the NF-κB pathway through the intracellular release of the two bioactives.

  14. Ribonucleic Acid Regulation in Permeabilized Cells of Escherichia coli Capable of Ribonucleic Acid and Protein Synthesis1

    PubMed Central

    Atherly, Alan G.

    1974-01-01

    A cell permeabilization procedure is described that reduces viability less than 10% and does not significantly reduce the rates of ribonucleic acid and protein synthesis when appropriately supplemented. Permeabilization abolishes the normal stringent coupling of protein and ribonucleic acid synthesis. PMID:4364330

  15. Synthesis and characterization of magnetite nanoparticles coated with lauric acid

    SciTech Connect

    Mamani, J.B.; Costa-Filho, A.J.; Cornejo, D.R.; Vieira, E.D.; Gamarra, L.F.

    2013-07-15

    Understanding the process of synthesis of magnetic nanoparticles is important for its implementation in in vitro and in vivo studies. In this work we report the synthesis of magnetic nanoparticles made from ferrous oxide through coprecipitation chemical process. The nanostructured material was coated with lauric acid and dispersed in aqueous medium containing surfactant that yielded a stable colloidal suspension. The characterization of magnetic nanoparticles with distinct physico-chemical configurations is fundamental for biomedical applications. Therefore magnetic nanoparticles were characterized in terms of their morphology by means of TEM and DLS, which showed a polydispersed set of spherical nanoparticles (average diameter of ca. 9 nm) as a result of the protocol. The structural properties were characterized by using X-ray diffraction (XRD). XRD pattern showed the presence of peaks corresponding to the spinel phase of magnetite (Fe{sub 3}O{sub 4}). The relaxivities r{sub 2} and r{sub 2}* values were determined from the transverse relaxation times T{sub 2} and T{sub 2}* at 3 T. Magnetic characterization was performed using SQUID and FMR, which evidenced the superparamagnetic properties of the nanoparticles. Thermal characterization using DSC showed exothermic events associated with the oxidation of magnetite to maghemite. - Highlights: • Synthesis of magnetic nanoparticles coated with lauric acid • Characterization of magnetic nanoparticles • Morphological, structural, magnetic, calorimetric and relaxometric characterization.

  16. Ravynic acid, an antibiotic polyeneyne tetramic acid from Penicillium sp. elucidated through synthesis.

    PubMed

    Myrtle, J D; Beekman, A M; Barrow, R A

    2016-09-21

    A new antibiotic natural product, ravynic acid, has been isolated from a Penicillium sp. of fungus, collected from Ravensbourne National Park. The 3-acylpolyenyne tetramic acid structure was definitively elucidated via synthesis. Highlights of the synthetic method include the heat induced formation of the 3-acylphosphorane tetramic acid and a selective Wittig cross-coupling to efficiently prepare the natural compounds carbon skeleton. The natural compound was shown to inhibit the growth of Staphylococcus aureus down to concentrations of 2.5 µg mL(-1). PMID:27519121

  17. Enzymatic synthesis of oligo- and polysaccharide fatty acid esters.

    PubMed

    van den Broek, Lambertus A M; Boeriu, Carmen G

    2013-03-01

    Amphiphilic oligo- and polysaccharides (e.g. polysaccharide alkyl or alkyl-aryl esters) form a new class of polymers with exceptional properties. They function as polymeric surfactants, whilst maintaining most of the properties of the starting polymeric material such as emulsifying, gelling, and film forming properties combined with partial water solubility or permeability. At present carbohydrate fatty acid esters are generally obtained by chemical methods using toxic solvents and organic and inorganic catalysts that leave residual traces in the final products. Enzymatic reactions offer an attractive alternative route for the synthesis of polysaccharide esters. In this review the state of the art of enzymatic synthesis of oligo- and polysaccharides fatty esters has been described.

  18. Activation of PPARα by Fatty Acid Accumulation Enhances Fatty Acid Degradation and Sulfatide Synthesis.

    PubMed

    Yang, Yang; Feng, Yuyao; Zhang, Xiaowei; Nakajima, Takero; Tanaka, Naoki; Sugiyama, Eiko; Kamijo, Yuji; Aoyama, Toshifumi

    2016-01-01

    Very-long-chain acyl-CoA dehydrogenase (VLCAD) catalyzes the first reaction in the mitochondrial fatty acid β-oxidation pathway. VLCAD deficiency is associated with the accumulation of fat in multiple organs and tissues, which results in specific clinical features including cardiomyopathy, cardiomegaly, muscle weakness, and hepatic dysfunction in infants. We speculated that the abnormal fatty acid metabolism in VLCAD-deficient individuals might cause cell necrosis by fatty acid toxicity. The accumulation of fatty acids may activate peroxisome proliferator-activated receptor (PPAR), a master regulator of fatty acid metabolism and a potent nuclear receptor for free fatty acids. We examined six skin fibroblast lines, derived from VLCAD-deficient patients and identified fatty acid accumulation and PPARα activation in these cell lines. We then found that the expression levels of three enzymes involved in fatty acid degradation, including long-chain acyl-CoA synthetase (LACS), were increased in a PPARα-dependent manner. This increased expression of LACS might enhance the fatty acyl-CoA supply to fatty acid degradation and sulfatide synthesis pathways. In fact, the first and last reactions in the sulfatide synthesis pathway are regulated by PPARα. Therefore, we also measured the expression levels of enzymes involved in sulfatide metabolism and the regulation of cellular sulfatide content. The levels of these enzymes and cellular sulfatide content both increased in a PPARα-dependent manner. These results indicate that PPARα activation plays defensive and compensative roles by reducing cellular toxicity associated with fatty acids and sulfuric acid. PMID:27644403

  19. [Synthesis of new mandelic acid derivatives with preservative action. Synthesis and acute toxicity study].

    PubMed

    Stan, Cătălina; Năstase, V; Pavelescu, M; Vasile, Cornelia; Dumitrache, M; Gherase, Florenţa; Năstasă, Veronica

    2004-01-01

    Starting from the antiseptic action of DL mandelic acid, there were synthesized a series of esters of the mandelic acid, esters which could have preservative action. This study present the synthesis, structure validation and the acute toxicity study, for the new synthesized compounds. The esters were obtained by acylating 4-hydroxybenzoic acid propyl, ethyl, methyl esters and salicylic acid with the DL mandelic chloride (that was protected initially by the hydroxylic group). The structure of the synthesized compounds was confirmed by quantitative elemental analysis and RMN 1H spectral measurements. The acute toxicity was determined for two of the esters, who proved to had a preservative action (previously studied) and indicated that these esters have a small toxicity.

  20. Increased expression of fatty acid binding protein 4 and leptin in resident macrophages characterises atherosclerotic plaque rupture

    PubMed Central

    Lee, K.; Santibanez-Koref, M.; Polvikoski, T.; Birchall, D.; Mendelow, A.D.; Keavney, B.

    2013-01-01

    Objective Resident macrophages play an important role in atheromatous plaque rupture. The macrophage gene expression signature associated with plaque rupture is incompletely defined due to the complex cellular heterogeneity in the plaque. We aimed to characterise differential gene expression in resident plaque macrophages from ruptured and stable human atheromatous lesions. Methods and results We performed genome-wide expression analyses of isolated macrophage-rich regions of stable and ruptured human atherosclerotic plaques. Plaques present in carotid endarterectomy specimens were designated as stable or ruptured using clinical, radiological and histopathological criteria. Macrophage-rich regions were excised from 5 ruptured and 6 stable plaques by laser micro-dissection. Transcriptional profiling was performed using Affymetrix microarrays. The profiles were characteristic of activated macrophages. At a false discovery rate of 10%, 914 genes were differentially expressed between stable and ruptured plaques. The findings were confirmed in fourteen further stable and ruptured samples for a subset of eleven genes with the highest expression differences (p < 0.05). Pathway analysis revealed that components of the PPAR/Adipocytokine signaling pathway were the most significantly upregulated in ruptured compared to stable plaques (p = 5.4 × 10−7). Two key components of the pathway, fatty-acid binding-protein 4 (FABP4) and leptin, showed nine-fold (p = 0.0086) and five-fold (p = 0.0012) greater expression respectively in macrophages from ruptured plaques. Conclusions We found differences in gene expression signatures between macrophages isolated from stable and ruptured human atheromatous plaques. Our findings indicate the involvement of FABP4 and leptin in the progression of atherosclerosis and plaque rupture, and suggest that down-regulation of PPAR/adipocytokine signaling within plaques may have therapeutic potential. PMID:23122912

  1. Chromatographic characterisation, under highly aqueous conditions, of a molecularly imprinted polymer binding the herbicide 2,4-dichlorophenoxyacetic acid.

    PubMed

    Legido-Quigley, C; Oxelbark, J; De Lorenzi, E; Zurutuza-Elorza, A; Cormack, P A G

    2007-05-15

    The affinity of a 2,4-dichlorophenoxyacetic acid (2,4-D) molecularly imprinted polymer (MIP), which was synthesised directly in an aqueous organic solvent, for its template (2,4-D) was studied and compared with the affinity exhibited by two other reference (control) polymers, NIPA and NIPB, for the same analyte. Zonal chromatography was performed to establish the optimal selectivity, expressed as imprinting factor (IF), under chromatographic conditions more aqueous than those described so far in the literature. Frontal analysis (FA) was performed on columns packed with these polymers, using an optimized mobile phase composed of methanol/phosphate buffer (50/50, v/v), to extract adsorption isotherm data and retrieve binding parameters from the best isotherm model. Surprisingly, the template had comparable and strong affinity for both MIP (K = 3.8x10(4) M(-1)) and NIPA (K = 1.9x10(4) M(-1)), although there was a marked difference in the saturation capacities of selective and non-selective sites, as one would expect for an imprinted polymer. NIPB acts as a true control polymer in the sense that it has relatively low affinity for the template (K = 8.0x10(2) M(-1)). This work provides the first frontal chromatographic characterization of such a polymer in a water-rich environment over a wide concentration range. The significance of this work stems from the fact that the chromatographic approach used is generic and can be applied readily to other analytes, but also because there is an increasing demand for well-characterised imprinted materials that function effectively in aqueous media and are thus well-suited for analytical science applications involving, for example, biofluids and environmental water samples.

  2. Purification and characterisation of a glutamic acid-containing peptide with calcium-binding capacity from whey protein hydrolysate.

    PubMed

    Huang, Shun-Li; Zhao, Li-Na; Cai, Xixi; Wang, Shao-Yun; Huang, Yi-Fan; Hong, Jing; Rao, Ping-Fan

    2015-02-01

    The bioavailability of dietary ionised calcium is affected by intestinal basic environment. Calcium-binding peptides can form complexes with calcium to improve its absorption and bioavailability. The aim of this study was focused on isolation and characterisation of a calcium-binding peptide from whey protein hydrolysates. Whey protein was hydrolysed using Flavourzyme and Protamex with substrate to enzyme ratio of 25:1 (w/w) at 49 °C for 7 h. The calcium-binding peptide was isolated by DEAE anion-exchange chromatography, Sephadex G-25 gel filtration and reversed phase high-performance liquid chromatography (RP-HPLC). A purified peptide of molecular mass 204 Da with strong calcium binding ability was identified on chromatography/electrospray ionisation (LC/ESI) tandem mass spectrum to be Glu-Gly (EG) after analysis and alignment in database. The calcium binding capacity of EG reached 67·81 μg/mg, and the amount increased by 95% compared with whey protein hydrolysate complex. The UV and infrared spectrometer analysis demonstrated that the principal sites of calcium-binding corresponded to the carboxyl groups and carbonyl groups of glutamic acid. In addition, the amino group and peptide amino are also the related groups in the interaction between EG and calcium ion. Meanwhile, the sequestered calcium percentage experiment has proved that EG-Ca is significantly more stable than CaCl2 in human gastrointestinal tract in vitro. The findings suggest that the purified dipeptide has the potential to be used as ion-binding ingredient in dietary supplements.

  3. Calcineurin mediates homeostatic synaptic plasticity by regulating retinoic acid synthesis

    PubMed Central

    Arendt, Kristin L.; Zhang, Zhenjie; Ganesan, Subhashree; Hintze, Maik; Shin, Maggie M.; Tang, Yitai; Cho, Ahryon; Graef, Isabella A.; Chen, Lu

    2015-01-01

    Homeostatic synaptic plasticity is a form of non-Hebbian plasticity that maintains stability of the network and fidelity for information processing in response to prolonged perturbation of network and synaptic activity. Prolonged blockade of synaptic activity decreases resting Ca2+ levels in neurons, thereby inducing retinoic acid (RA) synthesis and RA-dependent homeostatic synaptic plasticity; however, the signal transduction pathway that links reduced Ca2+-levels to RA synthesis remains unknown. Here we identify the Ca2+-dependent protein phosphatase calcineurin (CaN) as a key regulator for RA synthesis and homeostatic synaptic plasticity. Prolonged inhibition of CaN activity promotes RA synthesis in neurons, and leads to increased excitatory and decreased inhibitory synaptic transmission. These effects of CaN inhibitors on synaptic transmission are blocked by pharmacological inhibitors of RA synthesis or acute genetic deletion of the RA receptor RARα. Thus, CaN, acting upstream of RA, plays a critical role in gating RA signaling pathway in response to synaptic activity. Moreover, activity blockade-induced homeostatic synaptic plasticity is absent in CaN knockout neurons, demonstrating the essential role of CaN in RA-dependent homeostatic synaptic plasticity. Interestingly, in GluA1 S831A and S845A knockin mice, CaN inhibitor- and RA-induced regulation of synaptic transmission is intact, suggesting that phosphorylation of GluA1 C-terminal serine residues S831 and S845 is not required for CaN inhibitor- or RA-induced homeostatic synaptic plasticity. Thus, our study uncovers an unforeseen role of CaN in postsynaptic signaling, and defines CaN as the Ca2+-sensing signaling molecule that mediates RA-dependent homeostatic synaptic plasticity. PMID:26443861

  4. Limiting amino acid for protein synthesis with mammary cells in tissue culture.

    PubMed

    Park, C S; Chandler, P T; Norman, A W

    1976-05-01

    To identify the limiting amino acid in the minimal essential medium as published by Eagle (Science 130:432, 1959) for milk protein synthesis in rat mammary cells in tissue culture, two different experimental approaches were used. The first study involved the reduction of amino acids singly from the total amino acid complement of the medium for milk protein synthesis. The second study was to investigate the effect on milk protein synthesis of single amino acid addition to the basic complement of amino acids. Order of limiting amino acids was lysine (first) and possible methionine, valine, or arginine (second).

  5. (-)-Hydroxycitric Acid Nourishes Protein Synthesis via Altering Metabolic Directions of Amino Acids in Male Rats.

    PubMed

    Han, Ningning; Li, Longlong; Peng, Mengling; Ma, Haitian

    2016-08-01

    (-)-Hydroxycitric acid (HCA), a major active ingredient of Garcinia Cambogia extracts, had shown to suppress body weight gain and fat accumulation in animals and humans. While, the underlying mechanism of (-)-HCA has not fully understood. Thus, this study was aimed to investigate the effects of long-term supplement with (-)-HCA on body weight gain and variances of amino acid content in rats. Results showed that (-)-HCA treatment reduced body weight gain and increased feed conversion ratio in rats. The content of hepatic glycogen, muscle glycogen, and serum T4 , T3 , insulin, and Leptin were increased in (-)-HCA treatment groups. Protein content in liver and muscle were significantly increased in (-)-HCA treatment groups. Amino acid profile analysis indicated that most of amino acid contents in serum and liver, especially aromatic amino acid and branched amino acid, were higher in (-)-HCA treatment groups. However, most of the amino acid contents in muscle, especially aromatic amino acid and branched amino acid, were reduced in (-)-HCA treatment groups. These results indicated that (-)-HCA treatment could reduce body weight gain through promoting energy expenditure via regulation of thyroid hormone levels. In addition, (-)-HCA treatment could promote protein synthesis by altering the metabolic directions of amino acids. Copyright © 2016 John Wiley & Sons, Ltd. PMID:27145492

  6. Synthesis and biological activity of novel deoxycholic acid derivatives.

    PubMed

    Popadyuk, Irina I; Markov, Andrey V; Salomatina, Oksana V; Logashenko, Evgeniya B; Shernyukov, Andrey V; Zenkova, Marina A; Salakhutdinov, Nariman F

    2015-08-01

    We report the synthesis and biological activity of new semi-synthetic derivatives of naturally occurring deoxycholic acid (DCA) bearing 2-cyano-3-oxo-1-ene, 3-oxo-1(2)-ene or 3-oxo-4(5)-ene moieties in ring A and 12-oxo or 12-oxo-9(11)-ene moieties in ring C. Bioassays using murine macrophage-like cells and tumour cells show that the presence of the 9(11)-double bond associated with the increased polarity of ring A or with isoxazole ring joined to ring A, improves the ability of the compounds to inhibit cancer cell growth. PMID:26037611

  7. Synthesis and biological activity of novel deoxycholic acid derivatives.

    PubMed

    Popadyuk, Irina I; Markov, Andrey V; Salomatina, Oksana V; Logashenko, Evgeniya B; Shernyukov, Andrey V; Zenkova, Marina A; Salakhutdinov, Nariman F

    2015-08-01

    We report the synthesis and biological activity of new semi-synthetic derivatives of naturally occurring deoxycholic acid (DCA) bearing 2-cyano-3-oxo-1-ene, 3-oxo-1(2)-ene or 3-oxo-4(5)-ene moieties in ring A and 12-oxo or 12-oxo-9(11)-ene moieties in ring C. Bioassays using murine macrophage-like cells and tumour cells show that the presence of the 9(11)-double bond associated with the increased polarity of ring A or with isoxazole ring joined to ring A, improves the ability of the compounds to inhibit cancer cell growth.

  8. Antimicrobial polyurethane thermosets based on undecylenic acid: synthesis and evaluation.

    PubMed

    Lluch, Cristina; Esteve-Zarzoso, Braulio; Bordons, Albert; Lligadas, Gerard; Ronda, Juan C; Galià, Marina; Cádiz, Virginia

    2014-08-01

    In the present study, plant oil-derived surface-modifiable polyurethane thermosets are presented. Polyol synthesis is carried out taking advantage of thiol-yne photopolymerization of undecylenic acid derivatives containing methyl ester or hydroxyl moieties. The prepared methyl ester-containing polyurethanes allow surface modification treatment to enhance their hydrophilicity and impart antimicrobial activity through the following two steps: i) grafting poly(propylene glycol) monoamine (Jeffamine M-600) via aminolysis and ii) Jeffamine M-600 layer complexation with iodine. The antimicrobial activity of the iodine-containing polyurethanes is demonstrated by its capacity to inhibit the growth of Staphylococcus aureus, and Candida albicans in agar media.

  9. Design and synthesis of boronic acid inhibitors of endothelial lipase.

    PubMed

    O'Connell, Daniel P; LeBlanc, Daniel F; Cromley, Debra; Billheimer, Jeffrey; Rader, Daniel J; Bachovchin, William W

    2012-02-01

    Endothelial lipase (EL) and lipoprotein lipase (LPL) are homologous lipases that act on plasma lipoproteins. EL is predominantly a phospholipase and appears to be a key regulator of plasma HDL-C. LPL is mainly a triglyceride lipase regulating (V)LDL levels. The existing biological data indicate that inhibitors selective for EL over LPL should have anti-atherogenic activity, mainly through increasing plasma HDL-C levels. We report here the synthesis of alkyl, aryl, or acyl-substituted phenylboronic acids that inhibit EL. Many of the inhibitors evaluated proved to be nearly equally potent against both EL and LPL, but several exhibited moderate to good selectivity for EL. PMID:22225633

  10. Synthesis of Nanoporous Iminodiacetic Acid Sorbents for Binding Transition Metals

    PubMed Central

    Busche, Brad; Wiacek, Robert; Davidson, Joseph; Koonsiripaiboon, View; Yantasee, Wassana; Addleman, R. Shane; Fryxell, Glen E.

    2009-01-01

    Iminodiacetic acid (IDAA) forms strong complexes with a wide variety of metal ions. Using self-assembled monolayers in mesoporous supports (SAMMS) to present the IDAA ligand potentially allows for multiple metal-ligand interactions to enhance the metal binding affinity relative to that of randomly oriented polymer-based supports. This manuscript describes the synthesis of a novel nanostructured sorbent material built using self-assembly of a IDAA ligand inside a nanoporous silica, and demonstrates its use for capturing transition metal cations, and anionic metal complexes, such as PdCl4−2. PMID:22068901

  11. Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments

    NASA Astrophysics Data System (ADS)

    Kitadai, Norio

    2015-12-01

    Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids.

  12. Synthesis, characterisation and adsorption properties of a porous copper(II) 3D coordination polymer exhibiting strong binding enthalpy and adsorption capacity for carbon dioxide.

    PubMed

    Eckold, Pierre; Gee, William J; Hill, Matthew R; Batten, Stuart R

    2012-11-21

    The synthesis and characterisation of microporous coordination polymers containing copper(II) or cobalt(II) and 2-(pyridin-4-yl)malonaldehyde (Hpma) is described and the gas adsorption properties evaluated. Single-crystal X-ray structure determinations identified the structures as [M(pma)(2)]·2X (M = Cu, 1; Co, 2; X = MeOH, MeCN), which contain 3D networks with rutile topology and continuous 1D rectangular channels with diameters ranging from 3 to 4 Å. The materials exhibit low BET surface areas of 143 m(2) g(-1), but possess large capacities for carbon dioxide capture of 14.1 wt%. The small pore channels are shown to account for this, delivering a particularly strong binding enthalpy to adsorbed CO(2) of 38 kJ mol(-1), and a very large adsorption capacity relative to the low surface area.

  13. Synthesis and characterisation of a new stable organo-mineral hybrid nanomaterial: 4-Chlorobenzenesulfonate in the zinc-aluminium layered double hydroxide

    SciTech Connect

    Lakraimi, Mohamed; Legrouri, Ahmed . E-mail: legrouri@aui.ma; Barroug, Allal; De Roy, Andre; Besse, Jean Pierre

    2006-09-14

    4-Chlorobenzenesulfonate (4-CBS) was intercalated between layers of Zn-Al layered double hydroxides (LDHs). Two methods of incorporation were applied: (1) direct synthesis by coprecipitation of metal nitrates and sodium 4-CBS and (2) ion exchange of the LDH nitrate with the organic ion. The solids were characterized by X-ray diffraction and infrared spectroscopy. The direct method, effected at different pH values, led to a hybrid material with good degree of intercalation. In order to optimise the exchange conditions, particular attention was given to the effect of solution pH, 4-CBS/NO{sub 3} ratio and exchange temperature. The total exchange was successful and a new stable hybrid nanostructured material was obtained at pH 8 and with a 4-CBS concentration of 0.0028 M. This solid was further characterised by chemical and thermal analyses.

  14. Electrocarboxylation: towards sustainable and efficient synthesis of valuable carboxylic acids

    PubMed Central

    Matthessen, Roman; Fransaer, Jan; Binnemans, Koen

    2014-01-01

    Summary The near-unlimited availability of CO2 has stimulated a growing research effort in creating value-added products from this greenhouse gas. This paper presents the trends on the most important methods used in the electrochemical synthesis of carboxylic acids from carbon dioxide. An overview is given of different substrate groups which form carboxylic acids upon CO2 fixation, including mechanistic considerations. While most work focuses on the electrocarboxylation of substrates with sacrificial anodes, this review considers the possibilities and challenges of implementing other synthetic methodologies. In view of potential industrial application, the choice of reactor setup, electrode type and reaction pathway has a large influence on the sustainability and efficiency of the process. PMID:25383120

  15. Effect of mitochondrial ascorbic acid synthesis on photosynthesis.

    PubMed

    Senn, M E; Gergoff Grozeff, G E; Alegre, M L; Barrile, F; De Tullio, M C; Bartoli, C G

    2016-07-01

    Ascorbic acid (AA) is synthesized in plant mitochondria through the oxidation of l-galactono-1,4-lactone (l-GalL) and then distributed to different cell compartments. AA-deficient Arabidopsis thaliana mutants (vtc2) and exogenous applications of l-GalL were used to generate plants with different AA content in their leaves. This experimental approach allows determining specific AA-dependent effects on carbon metabolism. No differences in O2 uptake, malic and citric acid and NADH content suggest that AA synthesis or accumulation did not affect mitochondrial activity; however, l-GalL treatment increased CO2 assimilation and photosynthetic electron transport rate in vtc2 (but not wt) leaves demonstrating a stimulation of photosynthesis after l-GalL treatment. Increased CO2 assimilation correlated with increased leaf stomatal conductance observed in l-GalL-treated vtc2 plants.

  16. Synthesis and characterization of acidic mesoporous borosilicate thin films.

    PubMed

    Xiu, Tongping; Liu, Qian; Wang, Jiacheng

    2009-02-01

    Work on the synthesis and characterization of acidic wormhole-like ordered mesoporous borosilicate thin films (MBSTFs) on silicon wafers is described in this paper. The MBSTFs coated by the dip-coating method were prepared through an evaporation-induced self-assembly (EISA) process using nonionic block copolymers as structure-directing agents. Fourier transform infrared (FT-IR) spectroscopy confirmed the formation of borosiloxane bonds (Si-O-B). High-resolution transmission electron microscopy (HRTEM) and N2 sorption evidenced a wormhole-like mesoporous structure in the MBSTFs obtained. Scanning electron microscopy (SEM) images of the cross sections and surfaces of the samples showed that MBSTFs on silicon wafers were continuous, homogeneous and did not crack. The acidic properties of the MBSTFs were characterized by FT-IR spectra of chemisorbed pyridine. The MBSTFs thus prepared may find their future applications in many fields including chemical sensors, catalysis, optical coating, molecule separation, etc.

  17. Effect of mitochondrial ascorbic acid synthesis on photosynthesis.

    PubMed

    Senn, M E; Gergoff Grozeff, G E; Alegre, M L; Barrile, F; De Tullio, M C; Bartoli, C G

    2016-07-01

    Ascorbic acid (AA) is synthesized in plant mitochondria through the oxidation of l-galactono-1,4-lactone (l-GalL) and then distributed to different cell compartments. AA-deficient Arabidopsis thaliana mutants (vtc2) and exogenous applications of l-GalL were used to generate plants with different AA content in their leaves. This experimental approach allows determining specific AA-dependent effects on carbon metabolism. No differences in O2 uptake, malic and citric acid and NADH content suggest that AA synthesis or accumulation did not affect mitochondrial activity; however, l-GalL treatment increased CO2 assimilation and photosynthetic electron transport rate in vtc2 (but not wt) leaves demonstrating a stimulation of photosynthesis after l-GalL treatment. Increased CO2 assimilation correlated with increased leaf stomatal conductance observed in l-GalL-treated vtc2 plants. PMID:27010742

  18. Alternative kynurenic acid synthesis routes studied in the rat cerebellum

    PubMed Central

    Blanco Ayala, Tonali; Lugo Huitrón, Rafael; Carmona Aparicio, Liliana; Ramírez Ortega, Daniela; González Esquivel, Dinora; Pedraza Chaverrí, José; Pérez de la Cruz, Gonzalo; Ríos, Camilo; Schwarcz, Robert; Pérez de la Cruz, Verónica

    2015-01-01

    Kynurenic acid (KYNA), an astrocyte-derived, endogenous antagonist of α7 nicotinic acetylcholine and excitatory amino acid receptors, regulates glutamatergic, GABAergic, cholinergic and dopaminergic neurotransmission in several regions of the rodent brain. Synthesis of KYNA in the brain and elsewhere is generally attributed to the enzymatic conversion of L-kynurenine (L-KYN) by kynurenine aminotransferases (KATs). However, alternative routes, including KYNA formation from D-kynurenine (D-KYN) by D-amino acid oxidase (DAAO) and the direct transformation of kynurenine to KYNA by reactive oxygen species (ROS), have been demonstrated in the rat brain. Using the rat cerebellum, a region of low KAT activity and high DAAO activity, the present experiments were designed to examine KYNA production from L-KYN or D-KYN by KAT and DAAO, respectively, and to investigate the effect of ROS on KYNA synthesis. In chemical combinatorial systems, both L-KYN and D-KYN interacted directly with peroxynitrite (ONOO−) and hydroxyl radicals (OH•), resulting in the formation of KYNA. In tissue homogenates, the non-specific KAT inhibitor aminooxyacetic acid (AOAA; 1 mM) reduced KYNA production from L-KYN and D-KYN by 85.1 ± 1.7% and 27.1 ± 4.5%, respectively. Addition of DAAO inhibitors (benzoic acid, kojic acid or 3-methylpyrazole-5-carboxylic acid; 5 μM each) attenuated KYNA formation from L-KYN and D-KYN by ~35% and ~66%, respectively. ONOO− (25 μM) potentiated KYNA production from both L-KYN and D-KYN, and these effects were reduced by DAAO inhibition. AOAA attenuated KYNA production from L-KYN + ONOO− but not from D-KYN + ONOO−. In vivo, extracellular KYNA levels increased rapidly after perfusion of ONOO− and, more prominently, after subsequent perfusion with L-KYN or D-KYN (100 μM). Taken together, these results suggest that different mechanisms are involved in KYNA production in the rat cerebellum, and that, specifically, DAAO and ROS can function as alternative

  19. Alternative kynurenic acid synthesis routes studied in the rat cerebellum.

    PubMed

    Blanco Ayala, Tonali; Lugo Huitrón, Rafael; Carmona Aparicio, Liliana; Ramírez Ortega, Daniela; González Esquivel, Dinora; Pedraza Chaverrí, José; Pérez de la Cruz, Gonzalo; Ríos, Camilo; Schwarcz, Robert; Pérez de la Cruz, Verónica

    2015-01-01

    Kynurenic acid (KYNA), an astrocyte-derived, endogenous antagonist of α7 nicotinic acetylcholine and excitatory amino acid receptors, regulates glutamatergic, GABAergic, cholinergic and dopaminergic neurotransmission in several regions of the rodent brain. Synthesis of KYNA in the brain and elsewhere is generally attributed to the enzymatic conversion of L-kynurenine (L-KYN) by kynurenine aminotransferases (KATs). However, alternative routes, including KYNA formation from D-kynurenine (D-KYN) by D-amino acid oxidase (DAAO) and the direct transformation of kynurenine to KYNA by reactive oxygen species (ROS), have been demonstrated in the rat brain. Using the rat cerebellum, a region of low KAT activity and high DAAO activity, the present experiments were designed to examine KYNA production from L-KYN or D-KYN by KAT and DAAO, respectively, and to investigate the effect of ROS on KYNA synthesis. In chemical combinatorial systems, both L-KYN and D-KYN interacted directly with peroxynitrite (ONOO(-)) and hydroxyl radicals (OH•), resulting in the formation of KYNA. In tissue homogenates, the non-specific KAT inhibitor aminooxyacetic acid (AOAA; 1 mM) reduced KYNA production from L-KYN and D-KYN by 85.1 ± 1.7% and 27.1 ± 4.5%, respectively. Addition of DAAO inhibitors (benzoic acid, kojic acid or 3-methylpyrazole-5-carboxylic acid; 5 μM each) attenuated KYNA formation from L-KYN and D-KYN by ~35% and ~66%, respectively. ONOO(-) (25 μM) potentiated KYNA production from both L-KYN and D-KYN, and these effects were reduced by DAAO inhibition. AOAA attenuated KYNA production from L-KYN + ONOO(-) but not from D-KYN + ONOO(-). In vivo, extracellular KYNA levels increased rapidly after perfusion of ONOO(-) and, more prominently, after subsequent perfusion with L-KYN or D-KYN (100 μM). Taken together, these results suggest that different mechanisms are involved in KYNA production in the rat cerebellum, and that, specifically, DAAO and ROS can function as alternative

  20. A novel ruthenium(II)-cobaloxime supramolecular complex for photocatalytic H2 evolution: Synthesis, characterisation, and mechanistic studies

    PubMed Central

    Cropek, Donald M.; Metz, Anja; Müller, Astrid M.; Gray, Harry B.; Horne, Toyketa; Horton, Dorothy C.; Poluektov, Oleg; Tiede, David M.; Weber, Ralph T.; Jarrett, William L.; Phillips, Joshua D.

    2012-01-01

    We report the synthesis and characterization of novel mixed-metal binuclear ruthenium(II)-cobalt(II) photocatalysts for hydrogen evolution in acidic acetonitrile. First, 2-(2′-pyridyl)benzothiazole (pbt), 1, was reacted with RuCl3·xH2O to produce [Ru(pbt)2Cl2] ·0.25CH3COCH3, 2, which was then reacted with 1,10-phenanthroline-5,6-dione (phendione), 3 in order to produce [Ru(pbt)2(phendione)](PF6)2·4H2O, 4. Compound 4 was then reacted with 4-pyridinecarboxaldehyde in order to produce [Ru(pbt)2(L-pyr)](PF6)2·9.5H2O, 5 (where L-pyr = (4-pyridine)oxazolo[4,5-f]phenanthroline). Compound 5 was then reacted with [Co(dmgBF2)2(H2O)2] (where dmgBF2 = difluorboryldimethylglyoximate) in order to produce the mixed-metal binuclear complex, [Ru(pbt)2(L-pyr)Co(dmgBF2)2(H2O)](PF6)2·11H2O·1.5CH3COCH3, 6. [Ru(Me2bpy)2(L-pyr)Co(dmgBF2)2(OH2)](PF6)2, 7 (where Me2bpy = 1,10-phenanthroline, 4,4′-dimethyl-2,2′-bipyridine) and [Ru(phen)2(L-pyr)Co(dmgBF2)2(OH2)](PF6)2, 8 were also synthesised. All complexes were characterized by elemental analysis, UV-visible absorption, 11B, 19F, and 59Co NMR, ESR spectroscopy, and cyclic voltammetry, where appropriate. Photocatalytic studies carried out in acidified acetonitrile demonstrated constant hydrogen generation longer than a 42 hour period as detected by gas chromatography. Time resolved spectroscopic measurements were performed on compound 6, which proved an intramolecular electron transfer from an excited Ru(II) metal centre to the Co(II) metal centre via the bridging L-pyr ligand. This resulted in the formation of a cobalt(I)-containing species that is essential for the production of H2 gas in the presence of H+ ions. A proposed mechanism for the generation of hydrogen is presented. PMID:23001132

  1. On the Light Dependence of Fatty Acid Synthesis in Spinach Chloroplasts

    PubMed Central

    Sauer, Andreas; Heise, Klaus-Peter

    1983-01-01

    The capacity of intact chloroplasts to synthesize long chain fatty acids from acetate depends on the stroma pH in Spinacia oleracea, U. S. hybrid 424. The pH optimum is close to 8.5. Lowering of the stroma pH leads to a reduction of acetate incorporation but does not suffice to eliminate fatty acid synthesis completely. Chain elongation from palmitic to oleic acid shows the same pH dependence. Fatty acid synthesis is activated in the dark upon the simultaneous addition of dihydroxyacetone phosphate and orthophosphate supplying ATP and oxaloacetate for reoxidation of NADPH in the stroma. Under these conditions both dark fatty acid synthesis and synthesis of oleate from palmitate show the same pH dependence as in the light. Dark fatty acid synthesis is further stimulated by increasing the stromal Mg2+ concentration with the ionophore A 23187. In contrast to CO2 fixation, dark fatty acid synthesis is considerably reduced by dithiothreitol (DTT). This observation may be due to an acetyl-CoA deficiency, caused by a nonenzymic acylation of DTT, and a competition for ATP between DTT-activated CO2 fixation and fatty acid synthesis. Because d,l-glyceraldehyde as inhibitor of CO2 fixation compensates the DTT effect on dark fatty acid synthesis, reducing equivalents may be involved in the light dependence of acetate activation. PMID:16663156

  2. Cyclic diguanylic acid and cellulose synthesis in Agrobacterium tumefaciens

    SciTech Connect

    Amikam, D.; Benziman, M. )

    1989-12-01

    The occurrence of the novel regulatory nucleotide bis(3',5')-cyclic diguanylic acid (c-di-GMP) and its relation to cellulose biogenesis in the plant pathogen Agrobacterium tumefaciens was studied. c-di-GMP was detected in acid extracts of {sup 32}P-labeled cells grown in various media, and an enzyme responsible for its formation from GTP was found to be present in cell-free preparations. Cellulose synthesis in vivo was quantitatively assessed with ({sup 14}C)glucose as a tracer. The organism produced cellulose during growth in the absence of plant cells, and this capacity was retained in resting cells. Synthesis of a cellulosic product from UDP-glucose in vitro with membrane preparations was markedly stimulated by c-di-GMP and its precursor GTP and was further enhanced by Ca2+. The calcium effect was attributed to inhibition of a c-di-GMP-degrading enzyme shown to be present in the cellulose synthase-containing membranes.

  3. Nuclear synthesis of cytoplasmic ribonucleic acid in Amoeba proteus.

    PubMed

    PRESCOTT, D M

    1959-10-01

    The enucleation technique has been applied to Amoeba proteus by several laboratories in attempts to determine whether the cytoplasm is capable of nucleus-independent ribonucleic acid synthesis. This cell is very convenient for micrurgy, but its use requires a thorough starvation period to eliminate the possibility of metabolic influence by food vacuoles and frequent washings and medium renewal to maintain asepsis. In the experiments described here, amoebae were starved for periods of 24 to 96 hours, cut into nucleated and enucleated halves, and exposed to either C-14 uracil, C-14 adenine, C-14 orotic acid, or a mixture of all three. When the starvation period was short (less than 72 hours), organisms (especially yeast cells) contained within amoeba food vacuoles frequently showed RNA synthesis in both nucleated and enucleated amoebae. When the preperiod of starvation was longer than 72 hours, food vacuole influence was apparently negligible, and a more meaningful comparison between enucleated and nucleated amoebae was possible. Nucleated cells incorporated all three precursors into RNA; enucleated cells were incapable of such incorporation. The experiments indicate a complete dependence on the nucleus for RNA synthesis. The conflict with the experimental results of others on this problem could possibly stem from differences in culture conditions, starvation treatment, or experimental conditions. For an unequivocal answer in experiments of this design, ideally the cells should be capable of growth on an entirely synthetic medium under aseptic conditions. The use of a synthetic medium (experiments with A. proteus are done under starvation conditions) would permit, moreover, a more realistic comparison of metabolic capacities of nucleated and enucleated cells.

  4. Quantification of ethylenediamine-N,N'-bis(hydroxysulfophenylacetic) acid regioisomers and structural characterisation of its related polycondensation products by porous graphitic carbon high-performance liquid chromatography coupled to electrospray tandem mass spectrometry.

    PubMed

    Biasone, Alessandro; Cianci, Giusto; Di Tommaso, Donata; Piaggesi, Alberto; D'Alessandro, Nicola

    2013-10-18

    Among the commercial ethylenediamine-N,N'-bis(2-hydroxy)phenylacetic acid/iron(III) derivatives, ethylenediamine-N,N'-bis(2-hydroxy-5-sulphophenylacetic) acid/iron(III) (EDDHSA/Fe) represents one of the promising chelates for the treatment of chlorotic plants. Industrial synthesis of EDDHSA/Fe leads to relevant amounts of o,o-EDDHSA condensation products (o,o-EDDHSAcps) and other secondary products that might have important relevance from the agronomic point of view. However, their chemical structures have remained unknown to date. Analysis of iron complexes by ion-pair reversed-phase chromatography, coupled with electrospray tandem mass spectrometry revealed the presence of the meso-o,o-EDDHSA/Fe, rac-o,o-EDDHSA/Fe, o,p-EDDHSA/Fe regioisomers, the hydroxyl derivative of o,o-EDDHSA/Fe, and the three main EDDHSA condensation products chelating the iron(III) (EDDHSAcps/nFe). However, the chromatographic peaks of EDDHSAcps/Fe are not well resolved due to the large numbers of stereoisomers and the poor efficiency of the ion-pair reversed-phase separation method. An alternative chromatographic method is based on porous graphitic carbon (PGC) separation after pre-column decomplexation of the chelates with trifluoracetic acid, which was developed to allow detection of EDDHSA stereo/regioisomers, EDDHSAcps, and low-molecular-weight by-products. This extensive PGC-HPLC-ESI-MS/MS investigation provides quantitative determination of meso-o,o-EDDHSA, rac-o,o-EDDHSA and o,p-EDDHSA, in addition to characterisation of EDDHSAcps and the low-molecular-weight by-products. PGC separation coupled to a triple quadrupole ESI-MS detector allowed characterisation of free ligands using collision-induced dissociation experiments in positive and negative ionisation mode, providing comparative evaluation of EDDHSAcps in three commercial samples. For detection, the PGC-HPLC-ESI-MS/MS is the best method according to the limit of quantification and limit of detection (picomolar and sub

  5. Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway

    PubMed Central

    Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z.; Yazdani, Syed Shams

    2016-01-01

    Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817

  6. Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway.

    PubMed

    Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z; Yazdani, Syed Shams

    2016-01-01

    Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817

  7. Regulation of bile acid synthesis in rat hepatocyte monolayer cultures

    SciTech Connect

    Kubaska, W.M.

    1986-01-01

    Primary hepatocyte monolayer cultures (PHC) were prepared and incubated in serum free media. Cells from a cholestyramine fed rat converted exogenous (/sup 14/C)-cholesterol into (/sup 14/C)-bile acids at a 3-fold greater rate than rats fed a normal diet. PHC synthesize bile acids (BA) at a rate of approximately 0.06 ..mu..g/mg protein/h. The major bile acid composition, as determined by GLC, was ..beta..-muricholic acid (BMC) and cholic acid (CA) in a 3:1 ratio, respectively. PHC rapidly converted free BA and BA intermediates into taurine conjugated trihydroxy-BA up to 87h after plating. 3-Hydroxy-3-methylglutaryl-coenzyme A-reductase activity assayed in microsomes prepared from PHC, decreased during the initial 48h, then remained constant. Cholesterol 7..cap alpha..-hydroxylase activity decreased during the initial 48h, then increased during the next 48h. This occurred while whole cells produced BA at a linear rate. The effect of individual BA on bile acid synthesis (BAS) was also studied. Relative rates of BAS were measured as the conversion of (/sup 14/C)-cholesterol into (/sup 14/C)-BA. BA combinations were tested in order to simulate the composition of the enterohepatic circulation. The addition of TCA (525 ..mu..M) plus TCDCA (80..mu..M), in concentrations which greatly exceed the concentration of BA (60..mu..M) in rate portal blood, failed to inhibit BAS. BA plus phospholipid and/or cholesterol also did not inhibit BAS. Surprisingly, crude rat bile with a final concentration comparable to those in the synthetic mix inhibited (/sup 14/C)-cholesterol conversion into (/sup 14/C)-BA.

  8. Baker's Yeast Deficient in Storage Lipid Synthesis Uses cis-Vaccenic Acid to Reduce Unsaturated Fatty Acid Toxicity.

    PubMed

    Sec, Peter; Garaiova, Martina; Gajdos, Peter; Certik, Milan; Griac, Peter; Hapala, Ivan; Holic, Roman

    2015-07-01

    The role of cis-vaccenic acid (18:1n-7) in the reduction of unsaturated fatty acids toxicity was investigated in baker's yeast Saccharomyces cerevisiae. The quadruple mutant (QM, dga1Δ lro1Δ are1Δ are2Δ) deficient in enzymes responsible for triacylglycerol and steryl ester synthesis has been previously shown to be highly sensitive to exogenous unsaturated fatty acids. We have found that cis-vaccenic acid accumulated during cultivation in the QM cells but not in the corresponding wild type strain. This accumulation was accompanied by a reduction in palmitoleic acid (16:1n-7) content in the QM cells that is consistent with the proposed formation of cis-vaccenic acid by elongation of palmitoleic acid. Fatty acid analysis of individual lipid classes from the QM strain revealed that cis-vaccenic acid was highly enriched in the free fatty acid pool. Furthermore, production of cis-vaccenic acid was arrested if the mechanism of fatty acids release to the medium was activated. We also showed that exogenous cis-vaccenic acid did not affect viability of the QM strain at concentrations toxic for palmitoleic or oleic acids. Moreover, addition of cis-vaccenic acid to the growth medium provided partial protection against the lipotoxic effects of exogenous oleic acid. Transformation of palmitoleic acid to cis-vaccenic acid is thus a rescue mechanism enabling S. cerevisiae cells to survive in the absence of triacylglycerol synthesis as the major mechanism for unsaturated fatty acid detoxification.

  9. The effect of linoleic acid on the whole body synthesis rates of polyunsaturated fatty acids from α-linolenic acid and linoleic acid in free-living rats.

    PubMed

    Domenichiello, Anthony F; Kitson, Alex P; Chen, Chuck T; Trépanier, Marc-Olivier; Stavro, P Mark; Bazinet, Richard P

    2016-04-01

    Docosahexaenoic acid (DHA) is thought to be important for brain function. The main dietary source of DHA is fish, however, DHA can also be synthesized from precursor omega-3 polyunsaturated fatty acids (n-3 PUFA), the most abundantly consumed being α-linolenic acid (ALA). The enzymes required to synthesize DHA from ALA are also used to synthesize longer chain omega-6 (n-6) PUFA from linoleic acid (LNA). The large increase in LNA consumption that has occurred over the last century has led to concern that LNA and other n-6 PUFA outcompete n-3 PUFA for enzymes involved in DHA synthesis, and therefore, decrease overall DHA synthesis. To assess this, rats were fed diets containing LNA at 53 (high LNA diet), 11 (medium LNA diet) or 1.5% (low LNA diet) of the fatty acids with ALA being constant across all diets (approximately 4% of the fatty acids). Rats were maintained on these diets from weaning for 8 weeks, at which point they were subjected to a steady-state infusion of labeled ALA and LNA to measure DHA and arachidonic acid (ARA) synthesis rates. DHA and ARA synthesis rates were generally highest in rats fed the medium and high LNA diets, while the plasma half-life of DHA was longer in rats fed the low LNA diet. Therefore, increasing dietary LNA, in rats, did not impair DHA synthesis; however, low dietary LNA led to a decrease in DHA synthesis with tissue concentrations of DHA possibly being maintained by a longer DHA half-life.

  10. The synthesis and characterisation of MDMA derived from a catalytic oxidation of material isolated from black pepper reveals potential route specific impurities.

    PubMed

    Plummer, Christopher M; Breadon, Thomas W; Pearson, James R; Jones, Oliver A H

    2016-05-01

    This work examines the chemical synthesis of 3,4-methylenedioxy-N-methylamphetamine (MDMA) from piperonal prepared via a catalytic ruthenium tetroxide oxidation of piperine extracted from black pepper. A variety of oxidation conditions were experimented with including different solvent systems and co-oxidants. A sample of prepared piperonal was successfully converted into MDMA via 3,4-methylenedioxyphenyl-2-nitropropene (MDP2NP) and 3,4-methylenedioxyphenyl-2-propanone (MDP2P) and the impurities within each product characterised by GC-MS to give a contaminant profile of the synthetic pathway. Interestingly, it was discovered that a chlorinated analogue of piperonal (6-chloropiperonal) was created during the oxidation process by an as yet unknown mechanism. This impurity reacted alongside piperonal to give chlorinated analogues of each precursor, ultimately yielding 2-chloro-4,5-methylenedioxymethamphetamine (6-Cl-MDMA) as an impurity within the MDMA sample. The methodology developed is a simple way to synthesise a substantial amount of precursor material with easy to obtain reagents. The results also show that chlorinated MDMA analogues, previously thought to be deliberately included adulterants, may in fact be route specific impurities with potential application in determining the origin and synthesis method of seized illicit drugs. PMID:27162021

  11. The synthesis and characterisation of MDMA derived from a catalytic oxidation of material isolated from black pepper reveals potential route specific impurities.

    PubMed

    Plummer, Christopher M; Breadon, Thomas W; Pearson, James R; Jones, Oliver A H

    2016-05-01

    This work examines the chemical synthesis of 3,4-methylenedioxy-N-methylamphetamine (MDMA) from piperonal prepared via a catalytic ruthenium tetroxide oxidation of piperine extracted from black pepper. A variety of oxidation conditions were experimented with including different solvent systems and co-oxidants. A sample of prepared piperonal was successfully converted into MDMA via 3,4-methylenedioxyphenyl-2-nitropropene (MDP2NP) and 3,4-methylenedioxyphenyl-2-propanone (MDP2P) and the impurities within each product characterised by GC-MS to give a contaminant profile of the synthetic pathway. Interestingly, it was discovered that a chlorinated analogue of piperonal (6-chloropiperonal) was created during the oxidation process by an as yet unknown mechanism. This impurity reacted alongside piperonal to give chlorinated analogues of each precursor, ultimately yielding 2-chloro-4,5-methylenedioxymethamphetamine (6-Cl-MDMA) as an impurity within the MDMA sample. The methodology developed is a simple way to synthesise a substantial amount of precursor material with easy to obtain reagents. The results also show that chlorinated MDMA analogues, previously thought to be deliberately included adulterants, may in fact be route specific impurities with potential application in determining the origin and synthesis method of seized illicit drugs.

  12. Synthesis of acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters

    DOEpatents

    Moens, Luc

    2003-06-24

    A process of preparing an acid addition salt of delta-aminolevulinc acid comprising: a) dissolving a lower alkyl 5-bromolevulinate and hexamethylenetetramine in a solvent selected from the group consisting of water, ethyl acetate, chloroform, acetone, ethanol, tetrahydrofuran and acetonitrile, to form a quaternary ammonium salt of the lower alkyl 5-bromolevulinate; and b) hydrolyzing the quaternary ammonium salt with an inorganic acid to form an acid addition salt of delta-aminolevulinic acid.

  13. Expression of fatty acid synthesis genes and fatty acid accumulation in haematococcus pluvialis under different stressors

    PubMed Central

    2012-01-01

    Background Biofuel has been the focus of intensive global research over the past few years. The development of 4th generation biofuel production (algae-to-biofuels) based on metabolic engineering of algae is still in its infancy, one of the main barriers is our lacking of understanding of microalgal growth, metabolism and biofuel production. Although fatty acid (FA) biosynthesis pathway genes have been all cloned and biosynthesis pathway was built up in some higher plants, the molecular mechanism for its regulation in microalgae is far away from elucidation. Results We cloned main key genes for FA biosynthesis in Haematococcus pluvialis, a green microalga as a potential biodiesel feedstock, and investigated the correlations between their expression alternation and FA composition and content detected by GC-MS under different stress treatments, such as nitrogen depletion, salinity, high or low temperature. Our results showed that high temperature, high salinity, and nitrogen depletion treatments played significant roles in promoting microalgal FA synthesis, while FA qualities were not changed much. Correlation analysis showed that acyl carrier protein (ACP), 3-ketoacyl-ACP-synthase (KAS), and acyl-ACP thioesterase (FATA) gene expression had significant correlations with monounsaturated FA (MUFA) synthesis and polyunsaturated FA (PUFA) synthesis. Conclusions We proposed that ACP, KAS, and FATA in H. pluvialis may play an important role in FA synthesis and may be rate limiting genes, which probably could be modified for the further study of metabolic engineering to improve microalgal biofuel quality and production. PMID:22448811

  14. Fructose utilization for nucleic acid synthesis in the fetal pig.

    PubMed

    White, C E; Piper, E L; Noland, P R; Daniels, L B

    1982-07-01

    Eight fetal pigs, in utero, were injected ip with 20 microCi/fetus [U14C]-fructose between d 55 and 65 pregnancy. The isotope was allowed to equilibrate between blood and tissues within injected fetuses for a period of 240 min. Fetal pigs were then sacrificed and nucleic acids were extracted from cold tissue homogenates of skeletal muscle and liver. Nuclide disintegrations per minute recovered in extracted DNA and RNA were used to calculate incorporation of labeled C from fructose. The recovery of labeled C per mmol of nucleic acids from skeletal muscle was greater (P less than .05) than that from liver. Relative incorporation of labeled C into skeletal muscle RNA (395.9 pmol/mmol) was greater (P less than .05) than for DNA (189.5 pmol/mmol). The same trend was observed for liver RNA (78.0 pmol/mmol) and DNA (55.6 pmol/mmol), but differences were nonsignificant. These data suggest that at least part of the high concentration of endogenous fructose measured in fetal pigs in utero is involved in synthesis of nucleic acids, thereby providing substrate for anabolic functions necessary for fetal growth and development. PMID:6181047

  15. New stabilized FastPrep-CLEAs for sialic acid synthesis.

    PubMed

    García-García, María Inmaculada; Sola-Carvajal, Agustín; Sánchez-Carrón, Guiomar; García-Carmona, Francisco; Sánchez-Ferrer, Alvaro

    2011-05-01

    N-acetyl-D-neuraminic acid aldolase, a key enzyme in the biotechnological production of N-acetyl-D-neuraminic acid (sialic acid) from N-acetyl-D-mannosamine and pyruvate, was immobilized as cross-linked enzyme aggregates (CLEAs) by precipitation with 90% ammonium sulfate and crosslinking with 1% glutaraldehyde. Because dispersion in a reciprocating disruptor (FastPrep) was only able to recover 40% of the activity, improved CLEAs were then prepared by co-aggregation of the enzyme with 10mg/mL bovine serum albumin followed by a sodium borohydride treatment and final disruption by FastPrep (FastPrep-CLEAs). This produced a twofold increase in activity up to 86%, which is a 30% more than that reported for this aldolase in cross-linked inclusion bodies (CLIBs). In addition, these FastPrep-CLEAs presented remarkable biotechnological features for Neu5Ac synthesis, including, good activity and stability at alkaline pHs, a high K(M) for ManNAc (lower for pyruvate) and good operational stability. These results reinforce the practicability of using FastPrep-CLEAs in biocatalysis, thus reducing production costs and favoring reusability.

  16. Synthesis and characterisation of chitosan crosslinked-β-cyclodextrin grafted silylated magnetic nanoparticles for controlled release of Indomethacin

    NASA Astrophysics Data System (ADS)

    Anirudhan, T. S.; Dilu, D.; Sandeep, S.

    2013-10-01

    In this work, a novel hydrogel, chitosan crosslinked β-cyclodextrin grafted silylated magnetic nanoparticle (CTSCD-g-SilylMNP) was synthesised as a drug delivery system onto which Indomethacin (IND) drug was loaded. Characterisation of the drug delivery system was carried out by Tunnelling electron microscopy, Scanning electron microscopy, Fourier transform infrared spectroscopy, X-ray diffraction analysis, Dynamic light scattering and a Vibrating sample magnetometer. Swelling behaviour, in vitro drug release kinetics, and encapsulation efficiency of CTSCD-g-SilylMNP were studied. Swelling behaviour varied according to pH. In vitro release studies revealed that CTSCD-g-SilylMNP demonstrated a swelling and diffusion controlled release. Dependence of pH was also studied. Encapsulation efficiency (EE) at different percentages of drug loadings was studied. The results collectively suggest that the hydrogel has promising application in the field of controlled drug release. The biodegradability also adds to the advantage.

  17. Synthesis and characterisation of new MO(OH)2 (M = Zr, Hf) oxyhydroxides and related Li2MO3 salts.

    PubMed

    Baklanova, Yana V; Denisova, Tatyana A; Maksimova, Lidiya G; Tyutyunnik, Alexander P; Baklanova, Inna V; Shein, Igor R; Neder, Reinhard B; Tarakina, Nadezda V

    2014-02-21

    Two new solid MO(OH)2 (M = Zr, Hf) oxyhydroxides have been synthesised by an ion-exchange reaction from Li2MO3 (M = Zr, Hf) precursors obtained by a citrate combustion technique. The crystal structure of the oxyhydroxides has been solved by direct methods and refined using Rietveld full profile fitting based on X-ray powder diffraction data. Both oxyhydroxides crystallize in a P2(1)/c monoclinic unit cell and have a structure resembling that of the related salts. Detailed characterisation of the fine-structure features and chemical bonding in precursors and oxyhydroxide powders has been performed using vibrational spectroscopy, nuclear magnetic resonance spectroscopy, scanning electron microscopy, pair distribution function analysis and quantum-chemical modelling. PMID:24343584

  18. Synthesis, characterisation and in vitro anticancer activity of hexanuclear thiolato-bridged arene ruthenium metalla-prisms.

    PubMed

    Furrer, Mona A; Garci, Amine; Denoyelle-Di-Muro, Emmanuel; Trouillas, Patrick; Giannini, Federico; Furrer, Julien; Clavel, Catherine M; Dyson, Paul J; Süss-Fink, Georg; Therrien, Bruno

    2013-02-25

    Hexanuclear thiolato-bridged arene ruthenium metalla-prisms of the general formula [(p-cymene)(6)Ru(6)(SR)(6)(tpt)(2) ](6+) (R=CH(2)Ph, CH(2)C(6)H(4)-p-tBu, CH(2)CH(2)Ph; tpt=2,4,6-tris(4-pyridyl)-1,3,5-triazine), obtained from the dinuclear precursors [(p-cymene)(2)Ru(2)(SR)(2)Cl(2)], AgCF(3)SO(3) and tpt, have been isolated and fully characterised as triflate salts. The metalla-prisms are highly cytotoxic against human ovarian cancer cells, especially towards the cisplatin-resistant cell line A2780cisR (IC(50) <0.25 μM).

  19. [Effect of gibberellic acid on RNA synthesis in dwarf peas].

    PubMed

    Kilev, S N; Kholodar', A V; Chekurov, V M; Mertvetsov, N P

    1982-04-01

    The effect of gibberellic acid (GA) on total RNA and polysomal poly-[A]+-RNA synthesis in epicotylia and embryos of dwarf pea of two varieties differing in their physiological sensitivity to GA was studied. It was found that incubation with GA increases the accumulation of total RNA in pea epicotylia, var. "Pioner" and "Polzunok". The maximal stimulation of RNA accumulation makes up to 40% for the low sensitivity variety "Polzunok" and 150% for the highly sensitive variety "Pioner". GA increases the synthesis of polysomal poly (A)+-mRNA in 5-year-old pea sprouts and that of newly synthesized poly (A)+-mRNA in epicotylian polysomes of both varieties 5, 24, 48 and 72 hrs after incubation with GA. GA at concentrations of 10(-6) and 10(-5) stimulates the incorporation of [3H]uridine into polysomal mRNA during the first 1--3 hours after treatment and enhances the accumulation of newly synthesized mRNA in pea embryonic polyribosomes. The stimulating effect is directly proportional to the dose of the hormone. The mechanisms of GA effect on the transcription and translation in pea plant cells are discussed. PMID:6177351

  20. Indoleacetic Acid and the Synthesis of Glucanases and Pectic Enzymes

    PubMed Central

    Datko, Anne Harmon; Maclachlan, G. A.

    1968-01-01

    Indoleacetic acid (IAA) and/or inhibitors of DNA, RNA or protein synthesis were added to the apex of decapitated seedlings of Pisum sativum L. var. Alaska. At various times up to 4 days, enzymic protein was extracted from a segment of epicotyl immediately below the apex and assayed for its ability to hydrolyse polysaccharides or their derivatives. With the exception of amylase, the total amounts per segment of all of the tested enzymes increased due to IAA treatment. The development of β-1,4-glucanase (cellulase) activity per unit of protein or fresh weight proceeded according to a typical sigmoid induction curve. Pectinase was formed for about 2 days in control segments and IAA treatment resulted in continued synthesis for at least another 2 days provided cell division took place. β-1,3-glucanase and pectinesterase activities were only enhanced by IAA to the extent that total protein levels increased. Reaction mechanisms for these effects and functions for the enzymes during growth are discussed. PMID:16656834

  1. Efficient ytterbium triflate catalyzed microwave-assisted synthesis of 3-acylacrylic acid building blocks.

    PubMed

    Tolstoluzhsky, Nikita V; Gorobets, Nikolay Yu; Kolos, Nadezhda N; Desenko, Sergey M

    2008-01-01

    The derivatives of 4-(hetero)aryl-4-oxobut-2-enoic acid are useful as building blocks in the synthesis of biologically active compounds. An efficient general protocol for the synthesis of these building blocks was developed. This method combines microwave assistance and ytterbium triflate catalyst and allows the fast preparation of the target acids starting from different (hetero)aromatic ketones and glyoxylic acid monohydrate giving pure products in 52-75% isolated yields.

  2. Amino acids inhibit kynurenic acid formation via suppression of kynurenine uptake or kynurenic acid synthesis in rat brain in vitro.

    PubMed

    Sekine, Airi; Okamoto, Misaki; Kanatani, Yuka; Sano, Mitsue; Shibata, Katsumi; Fukuwatari, Tsutomu

    2015-01-01

    The tryptophan metabolite, kynurenic acid (KYNA), is a preferential antagonist of the α7 nicotinic acetylcholine receptor at endogenous brain concentrations. Recent studies have suggested that increase of brain KYNA levels is involved in psychiatric disorders such as schizophrenia and depression. KYNA-producing enzymes have broad substrate specificity for amino acids, and brain uptake of kynurenine (KYN), the immediate precursor of KYNA, is via large neutral amino acid transporters (LAT). In the present study, to find out amino acids with the potential to suppress KYNA production, we comprehensively investigated the effects of proteinogenic amino acids on KYNA formation and KYN uptake in rat brain in vitro. Cortical slices of rat brain were incubated for 2 h in Krebs-Ringer buffer containing a physiological concentration of KYN with individual amino acids. Ten out of 19 amino acids (specifically, leucine, isoleucine, phenylalanine, methionine, tyrosine, alanine, cysteine, glutamine, glutamate, and aspartate) significantly reduced KYNA formation at 1 mmol/L. These amino acids showed inhibitory effects in a dose-dependent manner, and partially inhibited KYNA production at physiological concentrations. Leucine, isoleucine, methionine, phenylalanine, and tyrosine, all LAT substrates, also reduced tissue KYN concentrations in a dose-dependent manner, with their inhibitory rates for KYN uptake significantly correlated with KYNA formation. These results suggest that five LAT substrates inhibit KYNA formation via blockade of KYN transport, while the other amino acids act via blockade of the KYNA synthesis reaction in brain. Amino acids can be a good tool to modulate brain function by manipulation of KYNA formation in the brain. This approach may be useful in the treatment and prevention of neurological and psychiatric diseases associated with increased KYNA levels.

  3. Xylonucleic acid: synthesis, structure, and orthogonal pairing properties

    PubMed Central

    Maiti, Mohitosh; Maiti, Munmun; Knies, Christine; Dumbre, Shrinivas; Lescrinier, Eveline; Rosemeyer, Helmut; Ceulemans, Arnout; Herdewijn, Piet

    2015-01-01

    There is a common interest for studying xeno-nucleic acid systems in the fields of synthetic biology and the origin of life, in particular, those with an engineered backbone and possessing novel properties. Along this line, we have investigated xylonucleic acid (XyloNA) containing a potentially prebiotic xylose sugar (a 3′-epimer of ribose) in its backbone. Herein, we report for the first time the synthesis of four XyloNA nucleotide building blocks and the assembly of XyloNA oligonucleotides containing all the natural nucleobases. A detailed investigation of pairing and structural properties of XyloNAs in comparison to DNA/RNA has been performed by thermal UV-melting, CD, and solution state NMR spectroscopic studies. XyloNA has been shown to be an orthogonal self-pairing system which adopts a slightly right-handed extended helical geometry. Our study on one hand, provides understanding for superior structure-function (-pairing) properties of DNA/RNA over XyloNA for selection as an informational polymer in the prebiotic context, while on the other hand, finds potential of XyloNA as an orthogonal genetic system for application in synthetic biology. PMID:26175047

  4. Inhibition of Interjacent Ribonucleic Acid (26S) Synthesis in Cells Infected by Sindbis Virus

    PubMed Central

    Scheele, Christina M.; Pfefferkorn, E. R.

    1969-01-01

    The interrelationship of viral ribonucleic acid (RNA) and protein synthesis in cells infected by Sindbis virus was investigated. When cultures were treated with puromycin early in the course of infection, the synthesis of interjacent RNA (26S) was preferentially inhibited. A similar result was obtained by shifting cells infected by one temperature-sensitive mutant defective in RNA synthesis from the permissive (29 C) to the nonpermissive (41.5 C) temperature. Under both conditions, the viral RNA produced appeared to be fully active biologically. Once underway, the synthesis of viral RNA in wild-type Sindbis infections did not require concomitant protein synthesis. PMID:5817400

  5. Synthesis and characterisation of cyclopentadienyl complexes of barium: precursors for atomic layer deposition of BaTiO3.

    PubMed

    Hatanpää, Timo; Vehkamäki, Marko; Mutikainen, Ilpo; Kansikas, Jarno; Ritala, Mikko; Leskelä, Markku

    2004-04-21

    Cyclopentadienyl complexes Ba(C5Me5)2(THF)2 (1), Ba(C5Me5)2(A) (A = THF, dien, trien, diglyme, triglyme) (2-5), Ba(Pr(i)3C5H2)2(THF)2 (6), Ba(Bu(t)3C5H2)2(THF) (7), Ba(Me2NC2H4C5Me4)2 (8) and Ba(EtOC2H4C5Me4)2 (9) were prepared and characterised with TGA/SDTA, NMR and MS. Crystal structures of 2, 4, 5, 7, 8 and 9 are presented. All complexes prepared sublime under reduced pressure and complexes 1, 6 and 7 showed volatility also under atmospheric pressure. Complexes 1, 6 and 7 lose the coordinated THF when evaporated while complexes 2-5 are sublimable as complete molecules under reduced pressure. Complexes with bulky cyclopentadienyl ligands (6 and 7) are the most thermally stable and volatile among the prepared barocenes. X-ray structure determinations reveal that all the complexes studied are monomeric. Complexes 1, 7 and 8 were successfully tested in BaTiO3 thin film depositions by atomic layer deposition (ALD).

  6. Distribution, industrial applications, and enzymatic synthesis of D-amino acids.

    PubMed

    Gao, Xiuzhen; Ma, Qinyuan; Zhu, Hailiang

    2015-04-01

    D-Amino acids exist widely in microbes, plants, animals, and food and can be applied in pharmaceutical, food, and cosmetics. Because of their widespread applications in industry, D-amino acids have recently received more and more attention. Enzymes including D-hydantoinase, N-acyl-D-amino acid amidohydrolase, D-amino acid amidase, D-aminopeptidase, D-peptidase, L-amino acid oxidase, D-amino acid aminotransferase, and D-amino acid dehydrogenase can be used for D-amino acids synthesis by kinetic resolution or asymmetric amination. In this review, the distribution, industrial applications, and enzymatic synthesis methods are summarized. And, among all the current enzymatic methods, D-amino acid dehydrogenase method not only produces D-amino acid by a one-step reaction but also takes environment and atom economics into consideration; therefore, it is deserved to be paid more attention.

  7. Synthesis and application of acid labile anchor groups for the synthesis of peptide amides by Fmoc-solid-phase peptide synthesis.

    PubMed

    Breipohl, G; Knolle, J; Stüber, W

    1989-10-01

    The preparation and application of a new linker for the synthesis of peptide amides using a modified Fmoc-method is described. The new anchor group was developed based on our experience with 4,4'-dimethoxybenzhydryl (Mbh)-protecting group for amides. Lability towards acid treatment was increased dramatically and results in an easy cleavage procedure for the preparation of peptide amides. The synthesis of N-9-fluorenylmethoxycarbonyl- ([5-carboxylatoethyl-2.4-dimethoxyphenyl)- 4'-methoxyphenyl]-methylamin is reported in detail. This linker was coupled to a commercially available aminomethyl polystyrene resin. Peptide synthesis proceeded smoothly using HOOBt esters of Fmoc-amino acids. Release of the peptide amide and final cleavage of the side chain protecting groups was accomplished by treatment with trifluoroacetic acid-dichloromethane mixtures in the presence of scavengers. The synthesis of peptide amides such as LHRH and C-terminal hexapeptide of secretin are given as examples.

  8. Synthesis and characterisation of methyl 2-O-(beta-D- glucopyranosyl)-6-O-(alpha-L-rhamnopyranosyl)-alpha-D-glucopyranoside.

    PubMed

    Hansmann, C F

    1990-09-01

    The branched trisaccharide, 2-O-(beta-D-glucopyranosyl)-6-O-(alpha-L-rhamnopyranosyl)-D-glucopyranos e (2), is regarded as the sugar moiety of an anthocyanin pigment isolated from the fruits and flowers of certain Begonia, Clivia, Rubus, Prunus, and Ribis species. The cyanidin-3-glycoside of 1 has been identified as one of the major pigments of Montmorency cherries (Prunus cerasus). It has also been isolated as quercetin and kaempherol glycosides from the flowers of potato (Solanum tuberosum). Synthesis of the methyl glycoside of 1, methyl 2-O-(beta-D-glucopyranosyl)-6-O-(alpha-L-rhamnopyranosyl)-alpha-D-glucop yranoside (2) is reported. PMID:2279247

  9. Amino Acid Synthesis in Seafloor Environments on Icy Worlds

    NASA Astrophysics Data System (ADS)

    Flores, Erika; Barge, Laura; VanderVelde, David; Kallas, Kayo; Baum, Marc M.; Russell, Michael J.; Kanik, Isik

    2016-10-01

    In 2005, the Cassini mission detected plumes erupting from Enceladus' surface, containing carbon dioxide, methane, silica, and possibly ammonia. Subsequent laboratory experiments indicated that the silica particles in the plumes were generated under alkaline conditions and at moderate temperatures of ~90°C (Hsu et al., 2015); one scenario for such conditions would be the existence of alkaline (serpentinization-driven) hydrothermal activity within Enceladus. Alkaline vents are significant since they have been proposed as a likely environment for the emergence of metabolism on the early Earth (Russell et al. 2014) and thus could also provide a mechanism for origin of life on ocean worlds with a water-rock interface. Alkaline vents in an acidic, iron-containing ocean could produce mineral precipitates that could act as primitive enzymes or catalysts mediating organic reactions; for example, metal sulfides can catalyze the reductive amination of pyruvate to alanine (Novikov and Copley 2013). We have conducted experiments testing the synthesis of amino acids catalyzed by other iron minerals that might be expected to precipitate on the seafloor of early Earth or Enceladus. Preliminary results indicate that amino acids as well as other organic products can be synthesized in 1-3 days under alkaline hydrothermal conditions. We also find that the yield and type of organic products is highly dependent on pH and temperature, implying that understanding the specifics of the geochemical hydrothermal gradients on Enceladus (or other ocean worlds) will be significant in determining their potential for synthesizing building blocks for life.Hsu, H.-W. et al. (2015), Nature 519, 207-210.Russell, M. J. et al. (2014), Astrobiology, 14, 308-43.Novikov Y. and Copley S. D. (2013) PNAS 110, 33, 13283-13288.

  10. Regulation of protein synthesis by amino acids in muscle of neonates.

    PubMed

    Suryawan, Agus; Davis, Teresa A

    2011-01-01

    The marked increase in skeletal muscle mass during the neonatal period is largely due to a high rate of postprandial protein synthesis that is modulated by an enhanced sensitivity to insulin and amino acids. The amino acid signaling pathway leading to the stimulation of protein synthesis has not been fully elucidated. Among the amino acids, leucine is considered to be a principal anabolic agent that regulates protein synthesis. mTORC1, which controls protein synthesis, has been implicated as a target for leucine. Until recently, there have been few studies exploring the role of amino acids in enhancing muscle protein synthesis in vivo. In this review, we discuss amino acid-induced protein synthesis in muscle in the neonate, focusing on current knowledge of the role of amino acids in the activation of mTORC1 leading to mRNA translation. The role of the amino acid transporters, SNAT2, LAT1, and PAT, in the modulation of mTORC1 activation and the role of amino acids in the activation of putative regulators of mTORC1, i.e., raptor, Rheb, MAP4K3, Vps34, and Rag GTPases, are discussed.

  11. Synthesis of L-ascorbic acid in the phloem

    PubMed Central

    Hancock, Robert D; McRae, Diane; Haupt, Sophie; Viola, Roberto

    2003-01-01

    Background Although plants are the main source of vitamin C in the human diet, we still have a limited understanding of how plants synthesise L-ascorbic acid (AsA) and what regulates its concentration in different plant tissues. In particular, the enormous variability in the vitamin C content of storage organs from different plants remains unexplained. Possible sources of AsA in plant storage organs include in situ synthesis and long-distance transport of AsA synthesised in other tissues via the phloem. In this paper we examine a third possibility, that of synthesis within the phloem. Results We provide evidence for the presence of AsA in the phloem sap of a wide range of crop species using aphid stylectomy and histochemical approaches. The activity of almost all the enzymes of the primary AsA biosynthetic pathway were detected in phloem-rich vascular exudates from Cucurbita pepo fruits and AsA biosynthesis was demonstrated in isolated phloem strands from Apium graveolens petioles incubated with a range of precursors (D-glucose, D-mannose, L-galactose and L-galactono-1,4-lactone). Phloem uptake of D-[U-14C]mannose and L-[1-14C]galactose (intermediates of the AsA biosynthetic pathway) as well as L-[1-14C]AsA and L-[1-14C]DHA, was observed in Nicotiana benthamiana leaf discs. Conclusions We present the novel finding that active AsA biosynthesis occurs in the phloem. This process must now be considered in the context of mechanisms implicated in whole plant AsA distribution. This work should provoke studies aimed at elucidation of the in vivo substrates for phloem AsA biosynthesis and its contribution to AsA accumulation in plant storage organs. PMID:14633288

  12. Tailored fatty acid synthesis via dynamic control of fatty acid elongation

    SciTech Connect

    Torella, JP; Ford, TJ; Kim, SN; Chen, AM; Way, JC; Silver, PA

    2013-07-09

    Medium-chain fatty acids (MCFAs, 4-12 carbons) are valuable as precursors to industrial chemicals and biofuels, but are not canonical products of microbial fatty acid synthesis. We engineered microbial production of the full range of even-and odd-chain-length MCFAs and found that MCFA production is limited by rapid, irreversible elongation of their acyl-ACP precursors. To address this limitation, we programmed an essential ketoacyl synthase to degrade in response to a chemical inducer, thereby slowing acyl-ACP elongation and redirecting flux from phospholipid synthesis to MCFA production. Our results show that induced protein degradation can be used to dynamically alter metabolic flux, and thereby increase the yield of a desired compound. The strategy reported herein should be widely useful in a range of metabolic engineering applications in which essential enzymes divert flux away from a desired product, as well as in the production of polyketides, bioplastics, and other recursively synthesized hydrocarbons for which chain-length control is desired.

  13. Tailored fatty acid synthesis via dynamic control of fatty acid elongation.

    PubMed

    Torella, Joseph P; Ford, Tyler J; Kim, Scott N; Chen, Amanda M; Way, Jeffrey C; Silver, Pamela A

    2013-07-01

    Medium-chain fatty acids (MCFAs, 4-12 carbons) are valuable as precursors to industrial chemicals and biofuels, but are not canonical products of microbial fatty acid synthesis. We engineered microbial production of the full range of even- and odd-chain-length MCFAs and found that MCFA production is limited by rapid, irreversible elongation of their acyl-ACP precursors. To address this limitation, we programmed an essential ketoacyl synthase to degrade in response to a chemical inducer, thereby slowing acyl-ACP elongation and redirecting flux from phospholipid synthesis to MCFA production. Our results show that induced protein degradation can be used to dynamically alter metabolic flux, and thereby increase the yield of a desired compound. The strategy reported herein should be widely useful in a range of metabolic engineering applications in which essential enzymes divert flux away from a desired product, as well as in the production of polyketides, bioplastics, and other recursively synthesized hydrocarbons for which chain-length control is desired. PMID:23798438

  14. Synthesis, structural and magnetic characterisation of the fully fluorinated compound 6H-BaFeO{sub 2}F

    SciTech Connect

    Clemens, Oliver; Wright, Adrian J.; Berry, Frank J.; Smith, Ronald I.; Slater, Peter R.

    2013-02-15

    The compound 6H-BaFeO{sub 2}F (P6{sub 3}/mmc) was synthesised by the low temperature fluorination of 6H-BaFeO{sub 3-d} using polyvinylidenedifluoride (PVDF) as a fluorination agent. Structural characterisation by XRD and NPD suggests that the local positions of the oxygen and fluorine atoms vary with no evidence for ordering on the anion sites. This compound shows antiferromagnetic ordering at room temperature with antiparallel alignment of the magnetic moments along the c-axis. The use of PVDF also allows the possibility of tuning the fluorine content in materials of composition 6H-BaFeO{sub 3-d}F{sub y} to any value of 0

  15. Thioacetic acid/NaSH-mediated synthesis of N-protected amino thioacids and their utility in peptide synthesis.

    PubMed

    Mali, Sachitanand M; Gopi, Hosahudya N

    2014-03-21

    Thioacids are recently gaining momentum due to their versatile reactivity. The reactivity of thioacids has been widely explored in the selective amide/peptide bond formation. Thioacids are generally synthesized from the reaction between activated carboxylic acids such as acid chlorides, active esters, etc., and Na2S, H2S, or NaSH. We sought to investigate whether the versatile reactivity of the thioacids can be tuned for the conversion of carboxylic acids into corresponding thioacids in the presence of NaSH. Herein, we report that thioacetic acid- and NaSH-mediated synthesis of N-protected amino thioacids from the corresponding N-protected amino acids, oxidative dimerization of thioacids, crystal conformations of thioacid oxidative dimers, and the utility of thioacids and oxidative dimers in peptide synthesis. Our results suggest that peptides can be synthesized without using standard coupling agents.

  16. Selective synthesis of 3-hydroxy acids from Meldrum's acids using SmI2-H2O.

    PubMed

    Szostak, Michal; Spain, Malcolm; Procter, David J

    2012-05-01

    The single-step synthesis of 3-hydroxy carboxylic acids from readily available Meldrum's acids involves a selective monoreduction using a SmI(2)-H(2)O complex to give products in high crude purity, and it represents a considerable advancement over other methods for the synthesis of 3-hydroxy acids. The protocol includes a detailed guide to the preparation of a single electron-reducing SmI(2)-H(2)O complex and describes two representative examples of the methodology: monoreduction of a fully saturated Meldrum's acid (5-(4-bromobenzyl)-2,2-dimethyl-1,3-dioxane-4,6-dione) and tandem conjugate reduction-selective monoreduction of α,β-unsaturated Meldrum's acid (5-(4-methoxybenzylidene)-2,2-dimethyl-1,3-dioxane-4,6-dione). The protocol for selective monoreduction of Meldrum's acids takes ∼6 h to complete. PMID:22538848

  17. Aluminosilicates with varying alumina-silica ratios: synthesis via a hybrid sol-gel route and structural characterisation.

    PubMed

    Nampi, Padmaja Parameswaran; Moothetty, Padmanabhan; Berry, Frank John; Mortimer, Michael; Warrier, Krishna Gopakumar

    2010-06-01

    Aluminosilicates with varying Al2O3:SiO2 molar ratios (3:1, 3:2, 3:3 and 3:4) have been synthesized using a hybrid sol-gel route using boehmite sol as the precursor for alumina and tetraethyl orthosilicate (TEOS) as the precursor for silica. The synthesis of boehmite sol from aluminium nitrate, and its use as the alumina precursor, is cost effective compared to alkoxide precursors. Structural aspects, including bonding and coordination, are studied in detail for samples calcined in the temperature range 400-1400 °C using both NMR and FTIR spectroscopy: the results are correlated with phase formation data (spinel and high temperature phases) obtained from XRD and thermal analysis. FTIR results show a broadening of peaks at 800 °C indicating a disordered distribution of octahedral sites caused by crosslinking between AlO6 octahedral and SiO4 tetrahedral units prior to the formation of mullite. (27)Al MAS NMR spectra are consistent with a progressive decrease in the number of AlO6 polyhedra with increasing temperature corresponding to Al in these units being forced to adopt a tetrahedral coordination due to the increasing presence of similarly coordinated Si species. XRD results confirm the formation of pure mullite at 1250 °C for a 3Al2O3:2SiO2 system. At 1400 °C, phase pure mullite is observed for all compositions except 3Al2O3:SiO2 where α-Al2O3 is the major phase with traces of mullite. The synthesis of aluminosilicates through a hybrid sol-gel route and the detailed insight into structural features gained from spectroscopic and diffraction techniques contributes further to the development of these materials in applications ranging from nanocatalysts to high-temperature ceramics.

  18. Optimisation and Characterisation of Lipase-Catalysed Synthesis of a Kojic Monooleate Ester in a Solvent-Free System by Response Surface Methodology

    PubMed Central

    Jumbri, Khairulazhar; Al-Haniff Rozy, Mohd Fahruddin; Ashari, Siti Efliza; Mohamad, Rosfarizan; Basri, Mahiran; Fard Masoumi, Hamid Reza

    2015-01-01

    Kojic acid is widely used to inhibit the browning effect of tyrosinase in cosmetic and food industries. In this work, synthesis of kojic monooleate ester (KMO) was carried out using lipase-catalysed esterification of kojic acid and oleic acid in a solvent-free system. Response Surface Methodology (RSM) based on central composite rotatable design (CCRD) was used to optimise the main important reaction variables, such as enzyme amount, reaction temperature, substrate molar ratio, and reaction time along with immobilised lipase from Candida Antarctica (Novozym 435) as a biocatalyst. The RSM data indicated that the reaction temperature was less significant in comparison to other factors for the production of a KMO ester. By using this statistical analysis, a quadratic model was developed in order to correlate the preparation variable to the response (reaction yield). The optimum conditions for the enzymatic synthesis of KMO were as follows: an enzyme amount of 2.0 wt%, reaction temperature of 83.69°C, substrate molar ratio of 1:2.37 (mmole kojic acid:oleic acid) and a reaction time of 300.0 min. Under these conditions, the actual yield percentage obtained was 42.09%, which is comparably well with the maximum predicted value of 44.46%. Under the optimal conditions, Novozym 435 could be reused for 5 cycles for KMO production percentage yield of at least 40%. The results demonstrated that statistical analysis using RSM can be used efficiently to optimise the production of a KMO ester. Moreover, the optimum conditions obtained can be applied to scale-up the process and minimise the cost. PMID:26657030

  19. Optimisation and Characterisation of Lipase-Catalysed Synthesis of a Kojic Monooleate Ester in a Solvent-Free System by Response Surface Methodology.

    PubMed

    Jumbri, Khairulazhar; Al-Haniff Rozy, Mohd Fahruddin; Ashari, Siti Efliza; Mohamad, Rosfarizan; Basri, Mahiran; Fard Masoumi, Hamid Reza

    2015-01-01

    Kojic acid is widely used to inhibit the browning effect of tyrosinase in cosmetic and food industries. In this work, synthesis of kojic monooleate ester (KMO) was carried out using lipase-catalysed esterification of kojic acid and oleic acid in a solvent-free system. Response Surface Methodology (RSM) based on central composite rotatable design (CCRD) was used to optimise the main important reaction variables, such as enzyme amount, reaction temperature, substrate molar ratio, and reaction time along with immobilised lipase from Candida Antarctica (Novozym 435) as a biocatalyst. The RSM data indicated that the reaction temperature was less significant in comparison to other factors for the production of a KMO ester. By using this statistical analysis, a quadratic model was developed in order to correlate the preparation variable to the response (reaction yield). The optimum conditions for the enzymatic synthesis of KMO were as follows: an enzyme amount of 2.0 wt%, reaction temperature of 83.69°C, substrate molar ratio of 1:2.37 (mmole kojic acid:oleic acid) and a reaction time of 300.0 min. Under these conditions, the actual yield percentage obtained was 42.09%, which is comparably well with the maximum predicted value of 44.46%. Under the optimal conditions, Novozym 435 could be reused for 5 cycles for KMO production percentage yield of at least 40%. The results demonstrated that statistical analysis using RSM can be used efficiently to optimise the production of a KMO ester. Moreover, the optimum conditions obtained can be applied to scale-up the process and minimise the cost. PMID:26657030

  20. Synthesis of functionalized fluorescent gold nanoclusters for acid phosphatase sensing

    NASA Astrophysics Data System (ADS)

    Sun, Jian; Yang, Fan; Yang, Xiurong

    2015-10-01

    A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au+ complexes, and then a class of ~2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ~1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by introducing an alkaline aqueous solution of MUA into the GSH-Au+ complexes or AuNC@GSH solution. Subsequently, a reliable AuNC@GSH/MUA-based real-time assay of acid phosphatase (ACP) is established for the first time, inspired by the selective coordination of Fe3+ with surface ligands of AuNCs, the higher binding affinity between the pyrophosphate ion (PPi) and Fe3+, and the hydrolysis of PPi into orthophosphate by ACP. Our fluorescent chemosensor can also be applied to assay ACP in a real biological sample and, furthermore, to screen the inhibitor of ACP. This report paves a new avenue for synthesizing AuNCs based on either the bottom-up reduction or top-down etching method, establishing real-time fluorescence assays for ACP by means of PPi as the substrate, and further exploring the sensing applications of fluorescent AuNCs.A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au+ complexes, and then a class of ~2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ~1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by

  1. Synthesis and characterisation of new titanium amino-alkoxides: precursors for the formation of TiO2 materials.

    PubMed

    Hollingsworth, Nathan; Kanna, Miki; Kociok-Köhn, Gabriele; Molloy, Kieran C; Wongnawa, Sumpun

    2008-02-01

    Reaction of the amino-alkoxides HOCH(CH(2)NMe(2))(2) (Hbdmap) and HOC(CH(2)NMe(2))(3) (Htdmap) with [Ti(OR)(4)] yields a series of heteroleptic titanium alkoxides [Ti(OR)(4-n)(L)(n)] (L = bdmap, tdmap). Substitution of the monodentate alkoxide with the chelating alkoxides becomes progressively more difficult, with homogeneous products being obtained only for n = 1, 2. The structure of [Ti(OEt)(3)(bdmap)](2), a mu-OEt bridged dimer, has been determined. Hydrolysis of [Ti(OR)(2)(L)(2)], by adventitious moisture affords the dimeric oxo-alkoxides [Ti(O)(L)(2)](2), both of which have been characterised crystallographically. These two compounds have also been prepared by reaction of [Ti(NMe(2))(2)(L)(2)] with the hydrated metal salts [Zn(acac)(2).2H(2)O] and [Zn(OAc)(2).2H(2)O] using the intrinsic water molecules in these salts to react with the labile amido groups, though the former also produces Me(Me(2)N)C=C(H)C(O)Me from reaction of liberated HNMe(2) with the coordinated acac ligand, while the latter also affords the ligand exchange product [Zn(OAc)(bdmap)]. In neither case does the free dimethylamino group of [Ti(O)(L)(2)](2) coordinate a second metal. The dimeric structure of [Zn(OAc)(bdmap)](2) has been established, and the structure of the tetrameric oxo-alkoxide [Ti(O)(OPr(i))(OCH(2)CH(2)NMe(2))](4) is reported for comparison with others in this study. [Ti(OEt)(3)(bdmap)](2) has been used as a precursor in AACVD (Aerosol-Assisted Chemical Vapour Deposition) to generate amorphous TiO(2) films on glass at 440 degrees C, and TiO(2)@C nanoparticles of approximate diameter 350 nm with a carbon coating of width ca. 75 nm on heating in a sealed container at 700 degrees C. PMID:18217119

  2. Synthesis, structural and magnetic characterisation of the fluorinated compound 15R-BaFeO{sub 2}F

    SciTech Connect

    Clemens, Oliver; Berry, Frank J.; Bauer, Jessica; Wright, Adrian J.; Knight, Kevin S.; Slater, Peter R.

    2013-07-15

    The compounds 15R-BaFeO{sub 2}F and 15R-BaFeO{sub 2.27}F{sub 0.5} have been synthesised by the low temperature fluorination of 15R-BaFeO{sub 3−d}F{sub 0.2} using polyvinylidenedifluoride (PVDF) as a fluorination agent. The materials have been structurally characterised by Rietveld analysis of the X-ray- and HRPD-powder neutron diffraction data. A detailed analysis of bond valence sums suggests that the oxide and fluoride ions order on the different anion sites. A reinvestigation of our recently published structure (Clemens et al., 2013) [34] of 6H-BaFeO{sub 2}F is also reported and incorporation of fluoride in h-type layers is also confirmed in this compound. The magnetic moments for 15R-BaFeO{sub 2}F and 15R-BaFeO{sub 2.25}F{sub 0.5} align in the a/b-plane with antiferromagnetic alignment of the moments between adjacent layers, and are flipped by 90° as compared to the precursor compound. 15R-BaFeO{sub 2}F exhibits very robust antiferromagnetism with a Néel temperature between 300 and 400 °C. - Graphical abstract: The crystal and magnetic structure of the perovskite phase 15R-BaFeO{sub 2}F. - Highlights: • 15R-BaFeO{sub 2}F and 15R-BaFeO{sub 2.27}F{sub 0.5}were prepared via low temperature fluorination using PVDF. • A structural investigation of the compounds BaFeO{sub 2}F is presented in detail. • This analysis suggests ordering of O{sup 2−} and F{sup −} anions between different layers. • 15R-BaFeO{sub 2}F shows antiferromagnetic ordering at 300 K with T{sub N} ∼300–400 °C. • The magnetic moments align in the a/b-plane.

  3. Versatile Multicomponent Reaction Macrocycle Synthesis Using α-Isocyano-ω-carboxylic Acids.

    PubMed

    Liao, George P; Abdelraheem, Eman M M; Neochoritis, Constantinos G; Kurpiewska, Katarzyna; Kalinowska-Tłuścik, Justyna; McGowan, David C; Dömling, Alexander

    2015-10-16

    The direct macrocycle synthesis of α-isocyano-ω-carboxylic acids via an Ugi multicomponent reaction is introduced. This multicomponent reaction (MCR) protocol differs by being especially short, convergent, and versatile, giving access to 12-22 membered rings.

  4. Synthesis and self-assembly of poly(3-hexylthiophene)-block-poly(acrylic acid)

    SciTech Connect

    Li, Zicheng; Ono, Robert J.; Wu, Zong-Quan; Bielawski, Christopher W.

    2011-01-01

    A modular and convenient synthesis of ethynyl end functionalized poly(3-hexylthiophene) in high purity is reported; this material facilitated access to poly(3-hexylthiophene)-block-poly(acrylic acid) which self-assembled into hierarchical structures.

  5. The Synthesis of an Amino Acid Derivative and Spectroscopic Monitoring of Dipeptide Formation.

    ERIC Educational Resources Information Center

    Simmonds, Richard J.

    1987-01-01

    Described are experiments to give students experience in the synthesis of peptides from amino acids and to use visible spectroscopy to measure a rate of reaction. The activities were designed for undergraduate courses. (RH)

  6. Synthesis of functionalized fluorescent gold nanoclusters for acid phosphatase sensing.

    PubMed

    Sun, Jian; Yang, Fan; Yang, Xiurong

    2015-10-21

    A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au(+) complexes, and then a class of ∼2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ∼1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by introducing an alkaline aqueous solution of MUA into the GSH-Au(+) complexes or AuNC@GSH solution. Subsequently, a reliable AuNC@GSH/MUA-based real-time assay of acid phosphatase (ACP) is established for the first time, inspired by the selective coordination of Fe(3+) with surface ligands of AuNCs, the higher binding affinity between the pyrophosphate ion (PPi) and Fe(3+), and the hydrolysis of PPi into orthophosphate by ACP. Our fluorescent chemosensor can also be applied to assay ACP in a real biological sample and, furthermore, to screen the inhibitor of ACP. This report paves a new avenue for synthesizing AuNCs based on either the bottom-up reduction or top-down etching method, establishing real-time fluorescence assays for ACP by means of PPi as the substrate, and further exploring the sensing applications of fluorescent AuNCs. PMID:26391420

  7. Evolution of Abscisic Acid Synthesis and Signaling Mechanisms

    PubMed Central

    Hauser, Felix; Waadt, Rainer; Schroeder, Julian I.

    2011-01-01

    The plant hormone abscisic acid (ABA) mediates seed dormancy, controls seedling development and triggers tolerance to abiotic stresses, including drought. Core ABA signaling components consist of a recently identified group of ABA receptor proteins of the PYRABACTIN RESISTANCE (PYR)/REGULATORY COMPONENT OF ABA RECEPTOR (RCAR) family that act as negative regulators of members of the PROTEIN PHOSPHATASE 2C (PP2C) family. Inhibition of PP2C activity enables activation of SNF1-RELATED KINASE 2 (SnRK2) protein kinases, which target downstream components, including transcription factors, ion channels and NADPH oxidases. These and other components form a complex ABA signaling network. Here, an in depth analysis of the evolution of components in this ABA signaling network shows that (i) PYR/RCAR ABA receptor and ABF-type transcription factor families arose during land colonization of plants and are not found in algae and other species, (ii) ABA biosynthesis enzymes have evolved to plant- and fungal-specific forms, leading to different ABA synthesis pathways, (iii) existing stress signaling components, including PP2C phosphatases and SnRK kinases, were adapted for novel roles in this plant-specific network to respond to water limitation. In addition, evolutionarily conserved secondary structures in the PYR/RCAR ABA receptor family are visualized. PMID:21549957

  8. Synthesis of carboranyl amino acids, hydantoins, and barbiturates

    SciTech Connect

    Wyzlic, I.M.; Tjarks, W.; Soloway, A.H.

    1996-07-31

    The syntheses of three novel boronated hydantoins, 5-(o-carboran-1-ylmethyl)hydantoin, 14, the tetraphenylphosphonium salt of 7-(hydantoin-5-ylmethyl)dodecahydro-7,8-dicarba-nido-undecaborate, 15, 5-(o-carboran-1-ylmethyl)-2-thiohydantoin, 16, and two new barbiturates, 5,5-bis(but-2-ynyl)barbiturate, 18, and 5,5-bis[(2-methyl-0-carboran-1-yl)methyl]barbiturate, 20, are described. Hydantoins 14-16 were synthesized from o-carboranylalanine (Car, 13). The detailed synthesis of Car and two other carborane-containing amino acids, O-(o-carboran-1-ylmethyl)tyrosine (CBT, 5a) and p-(o-carboran-1-yl)phenylalanine (CBPA, 5b), presented earlier as a communication, {sup 16} are also described. Hydantoin 14 and barbiturates 18 and 20 were tested for their potential anticonvulsant activity. Initial qualitative screening showed moderate activities for hydantoin 14 and barbiturate 18. Barbiturate 20 had no activity. Compound 14 appeared to be nontoxic at doses of 300 mg/kg (mice, ip) and 50 mg/kg (rats, oral). However, 18 was very toxic under similar conditions.

  9. Distribution, synthesis, and absorption of kynurenic acid in plants.

    PubMed

    Turski, Michal P; Turska, Monika; Zgrajka, Wojciech; Bartnik, Magdalena; Kocki, Tomasz; Turski, Waldemar A

    2011-05-01

    Kynurenic acid (KYNA) is an endogenous antagonist of the ionotropic glutamate receptors and the α7 nicotinic acetylcholine receptor as well as an agonist of the G-protein-coupled receptor GPR35. In this study, KYNA distribution and synthesis in plants as well as its absorption was researched. KYNA level was determined by means of the high-performance liquid chromatography with fluorescence detection. KYNA was found in leaves, flowers, and roots of tested medicinal herbs: dandelion (Taraxacum officinale), common nettle (Urtica dioica), and greater celandine (Chelidoniummajus). The highest concentration of this compound was detected in leaves of dandelion--a mean value of 0.49 µg/g wet weight. It was shown that KYNA can be synthesized enzymatically in plants from its precursor, L-kynurenine, or absorbed by plants from the soil. Finally, the content of KYNA was investigated in 21 herbal tablets, herbal tea, herbs in sachets, and single herbs in bags. The highest content of KYNA in a maximum daily dose of herbal medicines appeared in St. John's wort--33.75 µg (tablets) or 32.60 µg (sachets). The pharmacological properties of KYNA and its presence in high concentrations in medicinal herbs may suggest that it possesses therapeutic potential, especially in the digestive system and should be considered a new valuable dietary supplement. PMID:21157681

  10. Cetalox and analogues: synthesis via acid-mediated polyene cyclizations.

    PubMed

    Snowden, Roger L

    2008-06-01

    Using a novel, acid-mediated cyclization methodology, a direct access to Cetalox ((+/-)-1; a commercially important ambergris-type odorant) and various structurally related didehydro (i.e., 19, 26, and 30) and tetradehydro (i.e., 28 and 37/38) analogues is described. Treatment of either (E,E)-14 or (E)-15 with an excess of FSO(3)H in 2-nitropropane at -90 degrees stereospecifically afforded (+/-)-1 in 40 and 42% yield, respectively. Under similar conditions, cyclization of (E)-18 or 20 furnished 19 in 60 and 64% yield, respectively. Analogously, using an excess of ClSO(3)H in CH(2)Cl(2) at -80 degrees, 26 is formed with high stereoselectivity by cyclization of either (E)-24 or (Z)-25 (52 and 31% yield, resp.); in the same manner, 28 was prepared from 27 (22% yield). The same principle was applied to the synthesis of racemic Superambrox (30), via cyclization of 35, but only with poor selectivity (22%) and low yield (7%). Another approach via cyclization of (E)-40 under solvolysis conditions (excess TFA in CH(2)Cl(2) at -10 degrees) gave a higher yield (15%) with improved selectivity (43%). Finally, cyclization of 34 (1:1 diastereoisomer mixture) afforded 37/38 (10:1) in 27% yield. The qualitative organoleptic properties of 19, 26, 28, 30, and 37/38 (10:1) are briefly discussed.

  11. Synthesis of stable C-linked ferrocenyl amino acids and their use in solution-phase peptide synthesis.

    PubMed

    Philip, Anijamol T; Chacko, Shibin; Ramapanicker, Ramesh

    2015-12-01

    Incorporation of ferrocenyl group to peptides is an efficient method to alter their hydrophobicity. Ferrocenyl group can also act as an electrochemical probe when incorporated onto functional peptides. Most often, ferrocene is incorporated onto peptides post-synthesis via amide, ester or triazole linkages. Stable amino acids containing ferrocene as a C-linked side chain are potentially useful building units for the synthesis of ferrocene-containing peptides. We report here an efficient route to synthesize ferrocene-containing amino acids that are stable and can be used in peptide synthesis. Coupling of 2-ferrocenyl-1,3-dithiane and iodides derived from aspartic acid or glutamic acid using n-butyllithium leads to the incorporation of a ferrocenyl unit to the δ-position or ε-position of an α-amino acid. The reduction or hydrolysis of the dithiane group yields an alkyl or an oxo derivative. The usability of the synthesized amino acids is demonstrated by incorporating one of the amino acids in both C-terminus and N-terminus of tripeptides in solution phase.

  12. Fluorine containing amino acids: synthesis and peptide coupling of amino acids containing the all-cis tetrafluorocyclohexyl motif.

    PubMed

    Ayoup, Mohammed Salah; Cordes, David B; Slawin, Alexandra M Z; O'Hagan, David

    2015-05-28

    A synthesis of two (S)-phenylalanine derivatives is described which have the all-cis, 2,3,5,6-tetrafluorocyclohexyl motif attached to the aromatic ring at the meta and para positions; the para substituted isomer is elaborated into illustrative dipeptides via the free amine and carboxylate respectively demonstrating its utility as a novel amino acid for peptide synthesis and offering a vehicle for incorporation of this unique and facially polarized ring system into bioactive compounds.

  13. 4-hydroxyphenylacetic acid derivatives of inositol from dandelion (Taraxacum officinale) root characterised using LC-SPE-NMR and LC-MS techniques.

    PubMed

    Kenny, O; Smyth, T J; Hewage, C M; Brunton, N P; McLoughlin, P

    2014-02-01

    The combination of hyphenated techniques, LC-SPE-NMR and LC-MS, to isolate and identify minor isomeric compounds from an ethyl acetate fraction of Taraxacum officinale root was employed in this study. Two distinct fractions of 4-hydroxyphenylacetic acid derivatives of inositol were isolated and characterised by spectroscopic methods. The (1)H NMR spectra and MS data revealed two groups of compounds, one of which were derivatives of the di-4-hydroxyphenylacetic acid derivative of the inositol compound tetrahydroxy-5-[2-(4-hydroxyphenyl)acetyl] oxycyclohexyl-2-(4-hydroxyphenyl) acetate, while the other group consisted of similar tri-substituted inositol derivatives. For both fractions the derivatives of inositols vary in the number of 4-hydroxyphenylacetic acid groups present and their position and geometry on the inositol ring. In total, three di-substituted and three tri-substituted 4-hydroxyphenylacetic acid inositol derivates were identified for the first time along with a further two previously reported di-substituted inositol derivatives.

  14. WRINKLED1 Rescues Feedback Inhibition of Fatty Acid Synthesis in Hydroxylase-Expressing Seeds.

    PubMed

    Adhikari, Neil D; Bates, Philip D; Browse, John

    2016-05-01

    Previous attempts at engineering Arabidopsis (Arabidopsis thaliana) to produce seed oils containing hydroxy fatty acids (HFA) have resulted in low yields of HFA compared with the native castor (Ricinus communis) plant and caused undesirable effects, including reduced total oil content. Recent studies have led to an understanding of problems involved in the accumulation of HFA in oils of transgenic plants, which include metabolic bottlenecks and a decrease in the rate of fatty acid synthesis. Focusing on engineering the triacylglycerol assembly mechanisms led to modest increases in the HFA content of seed oil, but much room for improvement still remains. We hypothesized that engineering fatty acid synthesis in the plastids to increase flux would facilitate enhanced total incorporation of fatty acids, including HFA, into seed oil. The transcription factor WRINKLED1 (WRI1) positively regulates the expression of genes involved in fatty acid synthesis and controls seed oil levels. We overexpressed Arabidopsis WRI1 in seeds of a transgenic line expressing the castor fatty acid hydroxylase. The proportion of HFA in the oil, the total HFA per seed, and the total oil content of seeds increased to an average of 20.9%, 1.26 µg, and 32.2%, respectively, across five independent lines, compared with 17.6%, 0.83 µg, and 27.9%, respectively, for isogenic segregants. WRI1 and WRI1-regulated genes involved in fatty acid synthesis were up-regulated, providing for a corresponding increase in the rate of fatty acid synthesis. PMID:27208047

  15. WRINKLED1 Rescues Feedback Inhibition of Fatty Acid Synthesis in Hydroxylase-Expressing Seeds1[OPEN

    PubMed Central

    Browse, John

    2016-01-01

    Previous attempts at engineering Arabidopsis (Arabidopsis thaliana) to produce seed oils containing hydroxy fatty acids (HFA) have resulted in low yields of HFA compared with the native castor (Ricinus communis) plant and caused undesirable effects, including reduced total oil content. Recent studies have led to an understanding of problems involved in the accumulation of HFA in oils of transgenic plants, which include metabolic bottlenecks and a decrease in the rate of fatty acid synthesis. Focusing on engineering the triacylglycerol assembly mechanisms led to modest increases in the HFA content of seed oil, but much room for improvement still remains. We hypothesized that engineering fatty acid synthesis in the plastids to increase flux would facilitate enhanced total incorporation of fatty acids, including HFA, into seed oil. The transcription factor WRINKLED1 (WRI1) positively regulates the expression of genes involved in fatty acid synthesis and controls seed oil levels. We overexpressed Arabidopsis WRI1 in seeds of a transgenic line expressing the castor fatty acid hydroxylase. The proportion of HFA in the oil, the total HFA per seed, and the total oil content of seeds increased to an average of 20.9%, 1.26 µg, and 32.2%, respectively, across five independent lines, compared with 17.6%, 0.83 µg, and 27.9%, respectively, for isogenic segregants. WRI1 and WRI1-regulated genes involved in fatty acid synthesis were up-regulated, providing for a corresponding increase in the rate of fatty acid synthesis. PMID:27208047

  16. Highly efficient procedure for the synthesis of fructone fragrance using a novel carbon based acid.

    PubMed

    Hu, Baowei; Li, Chunqing; Zhao, Sheng-Xian; Rong, Lin-Mei; Lv, Shao-Qin; Liang, Xuezheng; Qi, Chenze

    2010-08-01

    The novel carbon based acid has been synthesized via one-step hydrothermal carbonization of furaldehyde and hydroxyethylsulfonic acid. A highly efficient procedure for the synthesis of fructone has been developed using the novel carbon based acid. The results showed that the catalyst possessed high activity for the reaction, giving a yield of over 95%. The advantages of high activity, stability, reusability and low cost for a simple synthesis procedure and wide applicability to various diols and beta-keto esters make this novel carbon based acid one of the best choices for the reaction.

  17. The role of submarine hydrothermal systems in the synthesis of amino acids.

    PubMed

    Aubrey, A D; Cleaves, H J; Bada, Jeffrey L

    2009-04-01

    There is little consensus regarding the plausibility of organic synthesis in submarine hydrothermal systems (SHSs) and its possible relevance to the origin of life. The primary reason for the persistence of this debate is that most experimental high temperature and high-pressure organic synthesis studies have neglected important geochemical constraints with respect to source material composition. We report here the results of experiments exploring the potential for amino acid synthesis at high temperature from synthetic seawater solutions of varying composition. The synthesis of amino acids was examined as a function of temperature, heating time, starting material composition and concentration. Using very favorable reactant conditions (high concentrations of reactive, reduced species), small amounts of a limited set of amino acids are generated at moderate temperature conditions ( approximately 125-175 degrees C) over short heating times of a few days, but even these products are significantly decomposed after exposure times of approximately 1 week. The high concentration dependence observed for these synthetic reactions are demonstrated by the fact that a 10-fold drop in concentration results in orders of magnitude lower yields of amino acids. There may be other synthetic mechanisms not studied herein that merit investigation, but the results are likely to be similar. We conclude that although amino acids can be generated from simple likely environmentally available precursors under SHS conditions, the equilibrium at high temperatures characteristic of SHSs favors net amino acid degradation rather than synthesis, and that synthesis at lower temperatures may be more favorable. PMID:19034685

  18. Synthesis and characterization of Fatty acid/amino Acid self-assemblies.

    PubMed

    Gajowy, Joanna; Bolikal, Durgadas; Kohn, Joachim; Fray, Miroslawa El

    2014-01-01

    In this paper, we discuss the synthesis and self-assembling behavior of new copolymers derived from fatty acid/amino acid components, namely dimers of linoleic acid (DLA) and tyrosine derived diphenols containing alkyl ester pendent chains, designated as "R" (DTR). Specific pendent chains were ethyl (E) and hexyl (H). These poly(aliphatic/aromatic-ester-amide)s were further reacted with poly(ethylene glycol) (PEG) and poly(ethylene glycol methyl ether) of different molecular masses, thus resulting in ABA type (hydrophilic-hydrophobic-hydrophilic) triblock copolymers. We used Fourier transform infrared (FTIR) and nuclear magnetic resonance (NMR) spectroscopies to evaluate the chemical structure of the final materials. The molecular masses were estimated by gel permeation chromatography (GPC) measurements. The self-organization of these new polymeric systems into micellar/nanospheric structures in aqueous environment was evaluated using ultraviolet/visible (UV-VIS) spectroscopy, dynamic light scattering (DLS) and transmission electron microscopy (TEM). The polymers were found to spontaneously self-assemble into nanoparticles with sizes in the range 196-239 nm and critical micelle concentration (CMC) of 0.125-0.250 mg/mL. The results are quite promising and these materials are capable of self-organizing into well-defined micelles/nanospheres encapsulating bioactive molecules, e.g., vitamins or antibacterial peptides for antibacterial coatings on medical devices. PMID:25347356

  19. Synthesis and Characterization of Fatty Acid/Amino Acid Self-Assemblies

    PubMed Central

    Gajowy, Joanna; Bolikal, Durgadas; Kohn, Joachim; El Fray, Miroslawa

    2014-01-01

    In this paper, we discuss the synthesis and self-assembling behavior of new copolymers derived from fatty acid/amino acid components, namely dimers of linoleic acid (DLA) and tyrosine derived diphenols containing alkyl ester pendent chains, designated as “R” (DTR). Specific pendent chains were ethyl (E) and hexyl (H). These poly(aliphatic/aromatic-ester-amide)s were further reacted with poly(ethylene glycol) (PEG) and poly(ethylene glycol methyl ether) of different molecular masses, thus resulting in ABA type (hydrophilic-hydrophobic-hydrophilic) triblock copolymers. We used Fourier transform infrared (FTIR) and nuclear magnetic resonance (NMR) spectroscopies to evaluate the chemical structure of the final materials. The molecular masses were estimated by gel permeation chromatography (GPC) measurements. The self-organization of these new polymeric systems into micellar/nanospheric structures in aqueous environment was evaluated using ultraviolet/visible (UV-VIS) spectroscopy, dynamic light scattering (DLS) and transmission electron microscopy (TEM). The polymers were found to spontaneously self-assemble into nanoparticles with sizes in the range 196–239 nm and critical micelle concentration (CMC) of 0.125–0.250 mg/mL. The results are quite promising and these materials are capable of self-organizing into well-defined micelles/nanospheres encapsulating bioactive molecules, e.g., vitamins or antibacterial peptides for antibacterial coatings on medical devices. PMID:25347356

  20. Preparation, characterization and catalytic properties of MCM-48 supported tungstophosphoric acid mesoporous materials for green synthesis of benzoic acid

    SciTech Connect

    Wu, Hai-Yan; Zhang, Xiao-Li; Chen, Xi; Chen, Ya; Zheng, Xiu-Cheng

    2014-03-15

    MCM-48 and tungstophosphoric acid (HPW) were prepared and applied for the synthesis of HPW/MCM-48 mesoporous materials. The characterization results showed that HPW/MCM-48 obtained retained the typical mesopore structure of MCM-48, and the textural parameters decreased with the increase loading of HPW. The catalytic oxidation results of benzyl alcohol and benzaldehyde with 30% H{sub 2}O{sub 2} indicated that HPW/MCM-48 was an efficient catalyst for the green synthesis of benzoic acid. Furthermore, 35 wt% HPW/MCM-48 sample showed the highest activity under the reaction conditions. Highlights: • 5–45 wt% HPW/MCM-48 mesoporous catalysts were prepared and characterized. • Their catalytic activities for the green synthesis of benzoic acid were investigated. • HPW/MCM-48 was approved to be an efficient catalyst. • 5 wt% HPW/MCM-48 exhibited the highest catalytic activity.

  1. Use of Raman spectroscopy in the characterisation of the acid-base reaction in glass-ionomer cements.

    PubMed

    Young, A M; Sherpa, A; Pearson, G; Schottlander, B; Waters, D N

    2000-10-01

    Raman spectra of various combinations of glass-ionomer cement components have been compared with those of the reactants and the salts of polyacrylic and tartaric acids. The components consisted of a fast-setting acid-degradable dental glass (containing, inter alia, oxides of Si, Al, Ca, Ba and Na), polyacrylic acid (PAA) and/or tartaric acid (TA). On the addition of water to the glass and tartaric acid, Raman spectroscopy indicated loss of acid and production of tartrate salts within seconds of mixing. Mixtures containing the glass, PAA and water in mass ratios 2:1:(0.1-4) reacted to form polyacrylate salts. The maximum fraction of unreacted PAA was found to decrease linearly with initial water/PAA mass ratio to a minimum of approximately 20% when this ratio exceeds 1.5. The data are consistent with 5.6 moles of water being required when each mole of acidic groups is neutralised. In newly prepared cements containing glass, water, polyacrylic and tartaric acids, polyacrylic acid and its salts, in both ionised and solid state form, can be detected. After about 1 h, however, Raman peaks associated with ionised species disappear.

  2. Synthesis of amino-acid derivatives and dipeptides with an original peptidase enzyme.

    PubMed

    Auriol, D; Paul, F; Yoshpe, I; Gripon, J C; Monsan, P

    1991-01-01

    A peptidase from the non pathogenic Staphylococcus sp. strain BEC 299 was purified to a final specific activity of 84,400 U/mg protein. Its molecular weight is 450 kDa and optimum pH 10.0. This enzyme catalyzes the synthesis of dipeptides (aspartame) and alpha-amino acid derivatives (N-L-malyl-L-tyrosine ethyl ester). The influence of cosolvents and pH on dipeptides and alpha-amino acid derivative synthesis is described. Finally, we detail the use of the peptidase as a reagent in protease-catalyzed peptide synthesis.

  3. The use of dielectric spectroscopy for the characterisation of the precipitation of hydrophobically modified poly(acrylic-acid) with divalent barium ions.

    PubMed

    Christensen, Peter Vittrup; Keiding, Kristian

    2009-12-01

    The use of dielectric spectroscopy as a monitor for coagulation processes was investigated. Hydrophobically modified poly(acrylic-acid) polymers were used as model macromolecules and coagulated with barium ions. The coagulation process was quantified using a photometric dispersion analyser, thereby serving as a point of reference for the dielectric spectroscopy. It was found that the hydrophobic modification increased the dosage of barium needed to obtain complete coagulation, whereas the dosage required to initiate coagulation was lowered. The coagulation of the polymer samples caused the relaxation time of the measured dielectric dispersion to increase, and this parameter was found to be a good indicator of the formation of polymer aggregates. The magnitude of the dielectric dispersion decreased as a function of barium dosage, but when coagulation was initiated an increase was observed. The observed agreement between the onset of coagulation and the changes in the dielectric dispersion shows the potential use of dielectric spectroscopy for the characterisation of coagulation processes. PMID:19751938

  4. Preparation, characterization and catalytic properties of MCM-48 supported tungstophosphoric acid mesoporous materials for green synthesis of benzoic acid

    NASA Astrophysics Data System (ADS)

    Wu, Hai-Yan; Zhang, Xiao-Li; Chen, Xi; Chen, Ya; Zheng, Xiu-Cheng

    2014-03-01

    MCM-48 and tungstophosphoric acid (HPW) were prepared and applied for the synthesis of HPW/MCM-48 mesoporous materials. The characterization results showed that HPW/MCM-48 obtained retained the typical mesopore structure of MCM-48, and the textural parameters decreased with the increase loading of HPW. The catalytic oxidation results of benzyl alcohol and benzaldehyde with 30% H2O2 indicated that HPW/MCM-48 was an efficient catalyst for the green synthesis of benzoic acid. Furthermore, 35 wt% HPW/MCM-48 sample showed the highest activity under the reaction conditions.

  5. Leucine-Enriched Essential Amino Acids Augment Mixed Protein Synthesis, But Not Collagen Protein Synthesis, in Rat Skeletal Muscle after Downhill Running

    PubMed Central

    Kato, Hiroyuki; Suzuki, Hiromi; Inoue, Yoshiko; Suzuki, Katsuya; Kobayashi, Hisamine

    2016-01-01

    Mixed and collagen protein synthesis is elevated for as many as 3 days following exercise. Immediately after exercise, enhanced amino acid availability increases synthesis of mixed muscle protein, but not muscle collagen protein. However, the potential for synergic effects of amino acid ingestion with exercise on both mixed and collagen protein synthesis remains unclear. We investigated muscle collagen protein synthesis in rats following post-exercise ingestion of leucine-enriched essential amino acids. We determined fractional protein synthesis rates (FSR) at different time points following exercise. Mixed protein and collagen protein FSRs in skeletal muscle were determined by measuring protein-bound enrichments of hydroxyproline and proline, and by measuring the intracellular enrichment of proline, using injections of flooding d3-proline doses. A leucine-enriched mixture of essential amino acids (or distilled water as a control) was administrated 30 min or 1 day post-exercise. The collagen protein synthesis in the vastus lateralis was elevated for 2 days after exercise. Although amino acid administration did not increase muscle collagen protein synthesis, it did lead to augmented mixed muscle protein synthesis 1 day following exercise. Thus, contrary to the regulation of mixed muscle protein synthesis, muscle collagen protein synthesis is not affected by amino acid availability after damage-inducing exercise. PMID:27367725

  6. Leucine-Enriched Essential Amino Acids Augment Mixed Protein Synthesis, But Not Collagen Protein Synthesis, in Rat Skeletal Muscle after Downhill Running.

    PubMed

    Kato, Hiroyuki; Suzuki, Hiromi; Inoue, Yoshiko; Suzuki, Katsuya; Kobayashi, Hisamine

    2016-01-01

    Mixed and collagen protein synthesis is elevated for as many as 3 days following exercise. Immediately after exercise, enhanced amino acid availability increases synthesis of mixed muscle protein, but not muscle collagen protein. However, the potential for synergic effects of amino acid ingestion with exercise on both mixed and collagen protein synthesis remains unclear. We investigated muscle collagen protein synthesis in rats following post-exercise ingestion of leucine-enriched essential amino acids. We determined fractional protein synthesis rates (FSR) at different time points following exercise. Mixed protein and collagen protein FSRs in skeletal muscle were determined by measuring protein-bound enrichments of hydroxyproline and proline, and by measuring the intracellular enrichment of proline, using injections of flooding d₃-proline doses. A leucine-enriched mixture of essential amino acids (or distilled water as a control) was administrated 30 min or 1 day post-exercise. The collagen protein synthesis in the vastus lateralis was elevated for 2 days after exercise. Although amino acid administration did not increase muscle collagen protein synthesis, it did lead to augmented mixed muscle protein synthesis 1 day following exercise. Thus, contrary to the regulation of mixed muscle protein synthesis, muscle collagen protein synthesis is not affected by amino acid availability after damage-inducing exercise. PMID:27367725

  7. Thermal synthesis and hydrolysis of polyglyceric acid. [in orgin of life studying

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1989-01-01

    Polyglyceric acid was synthesized by thermal condensation of glyceric acid at 80 C in the presence and absence of two mole percent of sulfuric acid catalyst. The acid catalyst accelerated the polymerization over 100-fold and made possible the synthesis of insoluble polymers of both L- and DL-glyceric acid by heating for less than 1 day. Racemization of L-glyceric acid yielded less than 1 percent D-glyceric acid in condensations carried out at 80 C with catalyst for 1 day and without catalyst for 12 days. The condensation of L-glyceric acid yielded an insoluble polymer much more readily than condensation of DL-glyceric acid. Studies of the hydrolysis of poly-DL-glyceric acid revealed that it was considerably more stable under mild acidic conditions compared to neutral pH. The relationship of this study to the origin of life is discussed.

  8. Crystal structure of Spot 14, a modulator of fatty acid synthesis

    SciTech Connect

    Colbert, Christopher L.; Kim, Chai-Wan; Moon, Young-Ah; Henry, Lisa; Palnitkar, Maya; McKean, William B.; Fitzgerald, Kevin; Deisenhofer, Johann; Horton, Jay D.; Kwon, Hyock Joo

    2011-09-06

    Spot 14 (S14) is a protein that is abundantly expressed in lipogenic tissues and is regulated in a manner similar to other enzymes involved in fatty acid synthesis. Deletion of S14 in mice decreased lipid synthesis in lactating mammary tissue, but the mechanism of S14's action is unknown. Here we present the crystal structure of S14 to 2.65 {angstrom} and biochemical data showing that S14 can form heterodimers with MIG12. MIG12 modulates fatty acid synthesis by inducing the polymerization and activity of acetyl-CoA carboxylase, the first committed enzymatic reaction in the fatty acid synthesis pathway. Coexpression of S14 and MIG12 leads to heterodimers and reduced acetyl-CoA carboxylase polymerization and activity. The structure of S14 suggests a mechanism whereby heterodimer formation with MIG12 attenuates the ability of MIG12 to activate ACC.

  9. NANS-mediated synthesis of sialic acid is required for brain and skeletal development.

    PubMed

    van Karnebeek, Clara D M; Bonafé, Luisa; Wen, Xiao-Yan; Tarailo-Graovac, Maja; Balzano, Sara; Royer-Bertrand, Beryl; Ashikov, Angel; Garavelli, Livia; Mammi, Isabella; Turolla, Licia; Breen, Catherine; Donnai, Dian; Cormier, Valerie; Heron, Delphine; Nishimura, Gen; Uchikawa, Shinichi; Campos-Xavier, Belinda; Rossi, Antonio; Hennet, Thierry; Brand-Arzamendi, Koroboshka; Rozmus, Jacob; Harshman, Keith; Stevenson, Brian J; Girardi, Enrico; Superti-Furga, Giulio; Dewan, Tammie; Collingridge, Alissa; Halparin, Jessie; Ross, Colin J; Van Allen, Margot I; Rossi, Andrea; Engelke, Udo F; Kluijtmans, Leo A J; van der Heeft, Ed; Renkema, Herma; de Brouwer, Arjan; Huijben, Karin; Zijlstra, Fokje; Heisse, Thorben; Boltje, Thomas; Wasserman, Wyeth W; Rivolta, Carlo; Unger, Sheila; Lefeber, Dirk J; Wevers, Ron A; Superti-Furga, Andrea

    2016-07-01

    We identified biallelic mutations in NANS, the gene encoding the synthase for N-acetylneuraminic acid (NeuNAc; sialic acid), in nine individuals with infantile-onset severe developmental delay and skeletal dysplasia. Patient body fluids showed an elevation in N-acetyl-D-mannosamine levels, and patient-derived fibroblasts had reduced NANS activity and were unable to incorporate sialic acid precursors into sialylated glycoproteins. Knockdown of nansa in zebrafish embryos resulted in abnormal skeletal development, and exogenously added sialic acid partially rescued the skeletal phenotype. Thus, NANS-mediated synthesis of sialic acid is required for early brain development and skeletal growth. Normal sialylation of plasma proteins was observed in spite of NANS deficiency. Exploration of endogenous synthesis, nutritional absorption, and rescue pathways for sialic acid in different tissues and developmental phases is warranted to design therapeutic strategies to counteract NANS deficiency and to shed light on sialic acid metabolism and its implications for human nutrition.

  10. NANS-mediated synthesis of sialic acid is required for brain and skeletal development.

    PubMed

    van Karnebeek, Clara D M; Bonafé, Luisa; Wen, Xiao-Yan; Tarailo-Graovac, Maja; Balzano, Sara; Royer-Bertrand, Beryl; Ashikov, Angel; Garavelli, Livia; Mammi, Isabella; Turolla, Licia; Breen, Catherine; Donnai, Dian; Cormier, Valerie; Heron, Delphine; Nishimura, Gen; Uchikawa, Shinichi; Campos-Xavier, Belinda; Rossi, Antonio; Hennet, Thierry; Brand-Arzamendi, Koroboshka; Rozmus, Jacob; Harshman, Keith; Stevenson, Brian J; Girardi, Enrico; Superti-Furga, Giulio; Dewan, Tammie; Collingridge, Alissa; Halparin, Jessie; Ross, Colin J; Van Allen, Margot I; Rossi, Andrea; Engelke, Udo F; Kluijtmans, Leo A J; van der Heeft, Ed; Renkema, Herma; de Brouwer, Arjan; Huijben, Karin; Zijlstra, Fokje; Heisse, Thorben; Boltje, Thomas; Wasserman, Wyeth W; Rivolta, Carlo; Unger, Sheila; Lefeber, Dirk J; Wevers, Ron A; Superti-Furga, Andrea

    2016-07-01

    We identified biallelic mutations in NANS, the gene encoding the synthase for N-acetylneuraminic acid (NeuNAc; sialic acid), in nine individuals with infantile-onset severe developmental delay and skeletal dysplasia. Patient body fluids showed an elevation in N-acetyl-D-mannosamine levels, and patient-derived fibroblasts had reduced NANS activity and were unable to incorporate sialic acid precursors into sialylated glycoproteins. Knockdown of nansa in zebrafish embryos resulted in abnormal skeletal development, and exogenously added sialic acid partially rescued the skeletal phenotype. Thus, NANS-mediated synthesis of sialic acid is required for early brain development and skeletal growth. Normal sialylation of plasma proteins was observed in spite of NANS deficiency. Exploration of endogenous synthesis, nutritional absorption, and rescue pathways for sialic acid in different tissues and developmental phases is warranted to design therapeutic strategies to counteract NANS deficiency and to shed light on sialic acid metabolism and its implications for human nutrition. PMID:27213289

  11. Synthesis and structural and magnetic characterisation of cobalt(ii) complexes of mixed phosphonate-antimonate ligands.

    PubMed

    Ali, Shoaib; Muryn, Christopher A; Tuna, Floriana; Winpenny, Richard E P

    2010-10-28

    The polynucleating oxygen donor ligands, [(SbAr)(4)O(2)(PhPO(3)H)(4)(PhPO(3))(4)] 1 and [(SbAr)(2)O(HO(3)P(t)Bu)(6)] 2, based on condensation of p-chlorophenylstibonic acid (ArSbO(3)H(2)) and phosphonic acids, were used to prepare polymetallic cobalt(ii) complexes. Reaction of 1 with cobalt acetate under solvothermal conditions produces three different types of polymetallic cobalt complexes. With LiOMe/pyridine as base in MeOH a dinuclear cobalt cage, [Co(2)(SbAr)(4)O(4)(O(3)PPh)(4)(OMe)(4)py(2)] 3, is formed, with four Sb(ii) and two Co(ii) centres bridged by μ(3)-oxides and phosphonates. The pyridine in the structure can be replaced by 3-picoline 4, 4-picoline 5, quinoline 6, 1,2-diazole 7, 4-phenylpyridine 8, 4-ethyl pyridine 9 and methanol 10. Using pyrazine (pyz) instead of pyridine under the same conditions a polymer, [Co(2)(SbAr)(4)O(4)(O(3)PPh)(4)(OMe)(4)(C(4)H(4)N(2))](n)11, is formed. A similar 1D-polymer forms with 4,4'-bipyridyl-ethylene 12 in place of pyrazine. With Et(3)N/pyridine as base in MeCN a tetranuclear cobalt cage, [Co(4)(SbAr)(5)O(9)(O(3)PPh)(6)(py)(4)] 13, with five Sb(ii) centres forming a "bowtie" and bridging to four Co(ii) centres by phosphonates and μ(3)-oxides, is formed. The reaction of 2 with cobalt acetate using LiOMe/pyridine as base in methanol, under solvothermal conditions, produces a dinuclear Co(ii) complex, [Co(2)(SbAr)(2)(O(3)P(t)Bu)(3)O(2)(OMe)(2)(py)(2)] 14, with two Co(II) and two Sb centres at the vertices of a distorted tetrahedron. Magnetic measurements on selected number of these cobalt cages are reported.

  12. Ribonucleic acid synthesis during fruiting body formation in Myxococcus xanthus.

    PubMed

    Smith, B A; Dworkin, M

    1981-04-01

    A method has been devised that allowed us, for the first time, to pulse-label M. xanthus cells with precursors for ribonucleic acid biosynthesis while they were undergoing fruiting body formation. Using this method, we examined patterns of ribonucleic acid (RNA) accumulation throughout the process of fruiting body formation. As development proceeded, the rate of RNA accumulation increased at two periods of the developmental cycle: once just before aggregation and once late in the cycle, when sporulation was essentially completed. In contrast to vegetatively growing cells, in which only stable RNA species are labeled during a 30-min pulse, the majority of radioactivity found in RNA from 30-min pulse-labeled developing cells was found in an unstable heterodisperse fraction that migrated to the 5S to 16S region of sucrose density gradients and sodium dodecyl sulfate-polyacrylamide gels. This pattern of incorporation could not be induced (i) by a shift down of vegetatively growing cells to a nutritionally poor medium, in which the generation time was increased to that of developing cells during the growth phase, or (ii) by plating of vegetative cells onto the same solid-surface environment as that of developing cells, but which surface supported vegetative growth rather than fruiting body formation. Thus, the RNA synthesis pattern observed appeared to be related to development per se rather than to nutritional depletion or growth on a solid surface alone. The radioactivity incorporated into the unstable 5S to 16S RNA fraction accumulated as the pulse length was increased from 10 to 30 min; in contrast, an analogous unstable fraction from vegetative cells decreased as pulse length was increased. This suggested that developmental 5S to 16S RNA was more stable than vegetative cell 5S to 16S RNA (presumptive messenger RNA). However, during a 45-min chase period, radioactivity in 30-min-pulse-labeled developmental 5S to 16S RNA decayed to an extent twice that of

  13. Synthesis and characterisation of immunogens for the production of antibodies against small hydrophobic molecules with biosignature properties.

    PubMed

    Sathe, Manisha; Derveni, Mariliza; Broadbent, Gillian; Bodlenner, Anne; Charlton, Keith; Ravi, Bindu; Rohmer, Michel; Sims, Mark R; Cullen, David C

    2011-12-01

    In the present study, five different classes of small hydrophobic molecular targets, atypical for antibody generation, were structurally modified in order to introduce suitable reactive functionalities and/or spacers which allow covalent coupling to a carrier protein resulting in a stable carrier-hapten complex. These targets were chosen to serve as markers of extant and/or extinct life in the context of the development of the Life Marker Chip (LMC), an antibody-based instrument, which is being developed by a UK-led international consortium for flight to Mars on board the joint ESA/NASA Mars exploration ExoMars mission. The hapten-protein conjugates were designed to be used as immunogens for antibody generation and immunoassay reagents in subsequent stages of the LMC development. The extent of protein modification due to covalent attachment of hapten was determined by two independent methods, i.e. trinitrobenzenesulfonic acid (TNBSA) titrations of remaining protein reactive groups and matrix-assisted laser desorption/ionization mass spectrometry (MALDI-MS) of the resultant hapten-protein conjugates. In a further quality validation step, the conjugates were presented to an animal's immune system and polyclonal antibody titres with moderate specificity were obtained. These results suggest that conjugates synthesized as described herein can successfully be used in the generation of antibodies targeting small hydrophobic molecules. PMID:22093350

  14. The Prebiotic Synthesis of Ethylenediamine Monoacetic Acid, The Repeating Unit of Peptide Nucleic Acids

    NASA Technical Reports Server (NTRS)

    Nelson, Kevin E.; Miller, Stanley L.

    1992-01-01

    The polymerization of ribonucleic acids or their precursors constitutes an important event in prebiotic chemistry. The various problems using ribonucleotides to make RNA suggest that there may have been a precursor. An attractive possibility are the peptide nucleic acids (PNA). PNAs are nucleotide analogs that make use of a polymer of ethylenediamine monoacetic acid (EDMA or 2-amninoethyl glycine) with the bases attached by an acetic acid. EDMA is an especially attractive alternative to the ribose phosphate or deoxyribose phosphate backbone because it contains no chiral centers and is potentially prebiotic, but there is no reported prebiotic synthesis. We have synthesized both EDMA and ethylenediamine diacetic acid (EDDA) from the prebiotic compounds ethylenediamine, formaldehyde, and hydrogen cyanide. The yields of EDMA range from 11 to 79% along with some sEDDA and uEDDA. These reactions work with concentrations of 10(exp -1)M and as low as 10(exp -4)M, and the reaction is likely to be effective at even lower concentrations. Ethylenediamine is a likely prebiotic compound, but it has not yet been demonstrated, although compounds such as ethanolamine and cysteamine have been proven to be prebiotic. Under neutral pH and heating at l00 C, EDMA is converted to the lactam, monoketopiperazine (MKP). The cyclization occurs and has an approximate ratio of MKP/EDMA = 3 at equilibrium. We have measured the solubilities of EDMA center dot H20 as 6.4 m, EDMA center dot HCl center dot H20 as 13.7 m, and EDMA center dot 2HCl center dot H20 as 3.4 m. These syntheses together with the high solubility of EDMA suggest that EDMA would concentrate in drying lagoons and might efficiently form polymers. Given the instability of ribose and the poor polymerizability of nucleotides, the prebiotic presence of EDMA and the possibility of its polymerization raises the possibility that PNAs are the progenitors of present day nucleic acids. A pre-RNA world may have existed in which PNAs or

  15. Synthesis of Long Chain Unsaturated-alpha,omega-Dicarboxylic Acids from Renewable Materials via Olefin Metathesis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The self-metathesis reaction of soy, rapeseed, tall, and linseed oil fatty acids was investigated for the synthesis of symmetrical long-chain unsaturated-alpha,omega-dicarboxylic acids. The metathesis reactions were carried out in the presence of a Grubbs catalyst under solvent-free conditions at a...

  16. Synthesis of novel trivalent amino acid glycoconjugates based on the cyclotriveratrylene ('CTV') scaffold.

    PubMed

    van Ameijde, Jeroen; Liskamp, Rob M J

    2003-08-01

    The convenient synthesis of novel trivalent amino acid glycoconjugates based on cyclotriveratrylene ('CTV') is described. These constructs consist of the CTV scaffold, three oligoethylene glycol spacers of variable length connected to a glyco amino acid residue which can also be varied. The resulting library of trivalent glycoconjugates can be used for studying multivalent interactions. PMID:12948190

  17. Synthesis and antibacterial evaluation of anziaic acid and analogues as topoisomerase I inhibitors

    PubMed Central

    Lin, Hao; Annamalai, Thirunavukkarasu; Bansod, Priyanka; Tse-Dinh, Yuk-Ching

    2013-01-01

    Naturally occurring anziaic acid was very recently reported as a topoisomerase I inhibitor with antibacterial activity. Herein total synthesis of anziaic acid and structural analogues is described and the preliminary structure-activity relationship (SAR) has been developed based on topoisomerase inhibition and whole cell antibacterial activity. PMID:24363888

  18. 4-Dimenthylaminopyridine or Acid-Catalyzed Synthesis of Esters: A Comparison

    ERIC Educational Resources Information Center

    van den Berg, Annemieke W. C.; Hanefeld, Ulf

    2006-01-01

    A set of highly atom-economic experiments was developed to highlight the differences between acid- and base-catalyzed ester syntheses and to introduce the principles of atom economy. The hydrochloric acid-catalyzed formation of an ester was compared with the 4-dimethylaminopyradine-catalyzed ester synthesis.

  19. Potency of individual bile acids to regulate bile acid synthesis and transport genes in primary human hepatocyte cultures.

    PubMed

    Liu, Jie; Lu, Hong; Lu, Yuan-Fu; Lei, Xiaohong; Cui, Julia Yue; Ellis, Ewa; Strom, Stephen C; Klaassen, Curtis D

    2014-10-01

    Bile acids (BAs) are known to regulate their own homeostasis, but the potency of individual bile acids is not known. This study examined the effects of cholic acid (CA), chenodeoxycholic acid (CDCA), deoxycholic acid (DCA), lithocholic acid (LCA) and ursodeoxycholic acid (UDCA) on expression of BA synthesis and transport genes in human primary hepatocyte cultures. Hepatocytes were treated with the individual BAs at 10, 30, and 100μM for 48 h, and RNA was extracted for real-time PCR analysis. For the classic pathway of BA synthesis, BAs except for UDCA markedly suppressed CYP7A1 (70-95%), the rate-limiting enzyme of bile acid synthesis, but only moderately (35%) down-regulated CYP8B1 at a high concentration of 100μM. BAs had minimal effects on mRNA of two enzymes of the alternative pathway of BA synthesis, namely CYP27A1 and CYP7B1. BAs increased the two major target genes of the farnesoid X receptor (FXR), namely the small heterodimer partner (SHP) by fourfold, and markedly induced fibroblast growth factor 19 (FGF19) over 100-fold. The BA uptake transporter Na(+)-taurocholate co-transporting polypeptide was unaffected, whereas the efflux transporter bile salt export pump was increased 15-fold and OSTα/β were increased 10-100-fold by BAs. The expression of the organic anion transporting polypeptide 1B3 (OATP1B3; sixfold), ATP-binding cassette (ABC) transporter G5 (ABCG5; sixfold), multidrug associated protein-2 (MRP2; twofold), and MRP3 (threefold) were also increased, albeit to lesser degrees. In general, CDCA was the most potent and effective BA in regulating these genes important for BA homeostasis, whereas DCA and CA were intermediate, LCA the least, and UDCA ineffective.

  20. Synthesis, characterisation, and evaluation of a cross-linked disulphide amide-anhydride-containing polymer based on cysteine for colonic drug delivery.

    PubMed

    Lim, Vuanghao; Peh, Kok Khiang; Sahudin, Shariza

    2013-12-18

    The use of disulphide polymers, a low redox potential responsive delivery, is one strategy for targeting drugs to the colon so that they are specifically released there. The objective of this study was to synthesise a new cross-linked disulphide-containing polymer based on the amino acid cysteine as a colon drug delivery system and to evaluate the efficiency of the polymers for colon targeted drug delivery under the condition of a low redox potential. The disulphide cross-linked polymers were synthesised via air oxidation of 1,2-ethanedithiol and 3-mercapto-N-2-(3-mercaptopropionamide)-3-mercapto propionic anhydride (trithiol monomers) using different ratio combinations. Four types of polymers were synthesised: P10, P11, P151, and P15. All compounds synthesised were characterised by NMR, IR, LC-MS, CHNS analysis, Raman spectrometry, SEM-EDX, and elemental mapping. The synthesised polymers were evaluated in chemical reduction studies that were performed in zinc/acetic acid solution. The suitability of each polymer for use in colon-targeted drug delivery was investigated in vitro using simulated conditions. Chemical reduction studies showed that all polymers were reduced after 0.5-1.0 h, but different polymers had different thiol concentrations. The bacterial degradation studies showed that the polymers were biodegraded in the anaerobic colonic bacterial medium. Degradation was most pronounced for polymer P15. This result complements the general consensus that biodegradability depends on the swellability of polymers in an aqueous environment. Overall, these results suggest that the cross-linked disulphide-containing polymers described herein could be used as coatings for drugs delivered to the colon.

  1. Prebiotic Synthesis of Hydrophobic and Protein Amino Acids

    PubMed Central

    Ring, David; Wolman, Yecheskel; Friedmann, Nadav; Miller, Stanley L.

    1972-01-01

    The formation of amino acids by the action of electric discharges on a mixture of methane, nitrogen, and water with traces of ammonia was studied in detail. The presence of glycine, alanine, α-amino-n-butyric acid, α-aminoisobutyric acid, valine, norvaline, isovaline, leucine, isoleucine, alloisoleucine, norleucine, proline, aspartic acid, glutamic acid, serine, threonine, allothreonine, α-hydroxy-γ-aminobutyric acid, and α,γ-diaminobutyric acid was confirmed by ion-exchange chromatography and gas chromatography-mass spectrometry. All of the primary α-amino acids found in the Murchison Meteorite have been synthesized by this electric discharge experiment. PMID:4501592

  2. Role of malic enzyme during fatty acid synthesis in the oleaginous fungus Mortierella alpina.

    PubMed

    Hao, Guangfei; Chen, Haiqin; Wang, Lei; Gu, Zhennan; Song, Yuanda; Zhang, Hao; Chen, Wei; Chen, Yong Q

    2014-05-01

    The generation of NADPH by malic enzyme (ME) was postulated to be a rate-limiting step during fatty acid synthesis in oleaginous fungi, based primarily on the results from research focusing on ME in Mucor circinelloides. This hypothesis is challenged by a recent study showing that leucine metabolism, rather than ME, is critical for fatty acid synthesis in M. circinelloides. To clarify this, the gene encoding ME isoform E from Mortierella alpina was homologously expressed. ME overexpression increased the fatty acid content by 30% compared to that for a control. Our results suggest that ME may not be the sole rate-limiting enzyme, but does play a role, during fatty acid synthesis in oleaginous fungi.

  3. Pyroglutamic acid stimulates DNA synthesis in rat primary hepatocytes through the mitogen-activated protein kinase pathway.

    PubMed

    Inoue, Shinjiro; Okita, Yoichi; de Toledo, Andreia; Miyazaki, Hiroyuki; Hirano, Eiichi; Morinaga, Tetsuo

    2015-01-01

    We purified pyroglutamic acid from human placental extract and identified it as a potent stimulator of rat primary hepatocyte DNA synthesis. Pyroglutamic acid dose-dependently stimulated DNA synthesis, and this effect was inhibited by PD98059, a dual specificity mitogen-activated protein kinase kinase 1 (MAP2K1) inhibitor. Therefore, pyroglutamic acid stimulated DNA synthesis in rat primary hepatocytes via MAPK signaling.

  4. [New synthesis of the anticoagulant pentasaccharide idraparinux and preparation of its analogues containing sulfonic acid moieties].

    PubMed

    Herczeg, Mihály

    2012-01-01

    Two novel synthetic pathways were elaborated for the preparation of idraparinux, a heparin-related fully O-sulfated, O-methylated anticoagulant pentasaccharide. Both methods based upon a [2+3] block synthesis utilizing the same trisaccharide acceptor which was coupled to either a uronic acid disaccharide donor or its nonoxidized precursor. Two bioisosteric sulfonic acid analogues of idraparinux were also prepared, in which two or three primary sulfate esters were replaced by sodium-sulfonatomethyl moieties. The sulfonic acid groups were formed on a monosaccharide level and the obtained carbohydrate sulfonic acid esters were found to be excellent donors and acceptors in the glycosylation reactions. The disulfonic-acid analogue was prepared in a [2+3] block synthesis by using a trisaccharide disulfonic acid as an acceptor and a glucuronide disaccharide as a donor. For the synthesis of the pentasaccharide trisulfonic acid, a more-efficient approach, which involved elongation of the trisaccharide acceptor with a non-oxidized precursor of the glucuronic acid followed by post-glycosidation oxidation at the tetrasaccharide level and a subsequent [1+4] coupling reaction, was elaborated. In vitro evaluation of the anticoagulant activity of the reference compound idraparinux and the new sulfonic acid derivatives revealed that the disulfonate analogue inhibited the blood-coagulation-proteinase factor Xa with outstanding efficacy; however, the introduction of the third sulfonic acid moiety resulted in a notable decrease in the anti-Xa activity.

  5. [New synthesis of the anticoagulant pentasaccharide idraparinux and preparation of its analogues containing sulfonic acid moieties].

    PubMed

    Herczeg, Mihály

    2012-01-01

    Two novel synthetic pathways were elaborated for the preparation of idraparinux, a heparin-related fully O-sulfated, O-methylated anticoagulant pentasaccharide. Both methods based upon a [2+3] block synthesis utilizing the same trisaccharide acceptor which was coupled to either a uronic acid disaccharide donor or its nonoxidized precursor. Two bioisosteric sulfonic acid analogues of idraparinux were also prepared, in which two or three primary sulfate esters were replaced by sodium-sulfonatomethyl moieties. The sulfonic acid groups were formed on a monosaccharide level and the obtained carbohydrate sulfonic acid esters were found to be excellent donors and acceptors in the glycosylation reactions. The disulfonic-acid analogue was prepared in a [2+3] block synthesis by using a trisaccharide disulfonic acid as an acceptor and a glucuronide disaccharide as a donor. For the synthesis of the pentasaccharide trisulfonic acid, a more-efficient approach, which involved elongation of the trisaccharide acceptor with a non-oxidized precursor of the glucuronic acid followed by post-glycosidation oxidation at the tetrasaccharide level and a subsequent [1+4] coupling reaction, was elaborated. In vitro evaluation of the anticoagulant activity of the reference compound idraparinux and the new sulfonic acid derivatives revealed that the disulfonate analogue inhibited the blood-coagulation-proteinase factor Xa with outstanding efficacy; however, the introduction of the third sulfonic acid moiety resulted in a notable decrease in the anti-Xa activity. PMID:23230650

  6. Decreased hepatotoxic bile acid composition and altered synthesis in progressive human nonalcoholic fatty liver disease

    SciTech Connect

    Lake, April D.; Novak, Petr; Shipkova, Petia; Aranibar, Nelly; Robertson, Donald; Reily, Michael D.; Lu, Zhenqiang; Lehman-McKeeman, Lois D.; Cherrington, Nathan J.

    2013-04-15

    Bile acids (BAs) have many physiological roles and exhibit both toxic and protective influences within the liver. Alterations in the BA profile may be the result of disease induced liver injury. Nonalcoholic fatty liver disease (NAFLD) is a prevalent form of chronic liver disease characterized by the pathophysiological progression from simple steatosis to nonalcoholic steatohepatitis (NASH). The hypothesis of this study is that the ‘classical’ (neutral) and ‘alternative’ (acidic) BA synthesis pathways are altered together with hepatic BA composition during progression of human NAFLD. This study employed the use of transcriptomic and metabolomic assays to study the hepatic toxicologic BA profile in progressive human NAFLD. Individual human liver samples diagnosed as normal, steatosis, and NASH were utilized in the assays. The transcriptomic analysis of 70 BA genes revealed an enrichment of downregulated BA metabolism and transcription factor/receptor genes in livers diagnosed as NASH. Increased mRNA expression of BAAT and CYP7B1 was observed in contrast to decreased CYP8B1 expression in NASH samples. The BA metabolomic profile of NASH livers exhibited an increase in taurine together with elevated levels of conjugated BA species, taurocholic acid (TCA) and taurodeoxycholic acid (TDCA). Conversely, cholic acid (CA) and glycodeoxycholic acid (GDCA) were decreased in NASH liver. These findings reveal a potential shift toward the alternative pathway of BA synthesis during NASH, mediated by increased mRNA and protein expression of CYP7B1. Overall, the transcriptomic changes of BA synthesis pathway enzymes together with altered hepatic BA composition signify an attempt by the liver to reduce hepatotoxicity during disease progression to NASH. - Highlights: ► Altered hepatic bile acid composition is observed in progressive NAFLD. ► Bile acid synthesis enzymes are transcriptionally altered in NASH livers. ► Increased levels of taurine and conjugated bile acids

  7. A review on synthesis and characterization of solid acid materials for fuel cell applications

    NASA Astrophysics Data System (ADS)

    Mohammad, Norsyahida; Mohamad, Abu Bakar; Kadhum, Abdul Amir H.; Loh, Kee Shyuan

    2016-08-01

    Solid acids emerged as an electrolyte material for application in fuel cells due to their high protonic conductivity and stability at high temperatures between 100 °C and 250 °C. This paper gives an overview of the different solid acid materials and their properties, such as high protonic conductivity and thermal stability, in relation to phase transitions and mechanisms of proton transport. Various solid acid synthesis methods including aqueous and dry mixing, electrospinning, sol-gel, impregnation and thin-film casting will be discussed, and the impact of synthesis methods on the properties of solid acids will be highlighted. The properties of solid acids synthesized as either single crystals and or polycrystalline powders were identified via X-ray diffraction, nuclear magnetic resonance, thermal analyses, optical microscopy and infrared spectroscopy. A selection of electrolyte-electrode assembly methods and the performance of solid acid fuel cell prototypes are also reviewed.

  8. De novo synthesis of amino acids by the ruminal anaerobic fungi, Piromyces communis and Neocallimastix frontalis.

    PubMed

    Atasoglu, Cengiz; Wallace, R John

    2002-07-01

    Anaerobic fungi are an important component of the cellulolytic ruminal microflora. Ammonia alone as N source supports growth, but amino acid mixtures are stimulatory. In order to evaluate the extent of de novo synthesis of individual amino acids in Piromyces communis and Neocallimastix frontalis, isotope enrichment in amino acids was determined during growth on (15)NH(4)Cl in different media. Most cell N (0.78 and 0.63 for P. communis and N. frontalis, respectively) and amino acid N (0.73 and 0.59) continued to be formed de novo from ammonia when 1 g l(-1) trypticase was added to the medium; this concentration approximates the peak concentration of peptides in the rumen after feeding. Higher peptide/amino acid concentrations decreased de novo synthesis. Lysine was exceptional, in that its synthesis decreased much more than other amino acids when Trypticase or amino acids were added to the medium, suggesting that lysine synthesis might limit fungal growth in the rumen.

  9. Synthesis and optical resolution of an allenoic acid by diastereomeric salt formation induced by chiral alkaloids.

    PubMed

    Nyhlén, Jonas; Eriksson, Lars; Bäckvall, Jan-E

    2008-01-01

    A synthetic procedure for the preparation of 4-cyclohexyl-2-methyl-buta-2,3-dienoic acid in the two optically active forms has been developed. Synthesis of the racemic allenoic acid was made by an efficient route with good overall yield. Resolution of the enantiomers was achieved by forming the cinchonidine and cinchonine diastereomeric salt, respectively, and the enantiomers were isolated in up to 95% enantiomeric excess. The absolute configuration of the allenoic acid was determined by X-ray crystallography.

  10. Advances in the synthesis of α-quaternary α-ethynyl α-amino acids.

    PubMed

    Boibessot, Thibaut; Bénimélis, David; Meffre, Patrick; Benfodda, Zohra

    2016-09-01

    α-Quaternary α-ethynyl α-amino acids are an important class of non-proteinogenic amino acids that play an important role in the development of peptides and peptidomimetics as therapeutic agents and in the inhibition of enzyme activities. This review provides an overview of the literature concerning synthesis and applications of α-quaternary α-ethynyl α-amino acids covering the period from 1977 to 2015.

  11. Parallel Chemoenzymatic Synthesis of Sialosides Containing a C5-Diversified Sialic Acid

    PubMed Central

    Cao, Hongzhi; Muthana, Saddam; Li, Yanhong; Cheng, Jiansong; Chen, Xi

    2009-01-01

    A convenient chemoenzymatic strategy for synthesizing sialosides containing a C5-diversified sialic acid was developed. The α2,3- and α2,6-linked sialosides containing a 5-azido neuraminic acid synthesized by a highly efficient one-pot three-enzyme approach were converted to C5″-amino sialosides, which were used as common intermediates for chemical parallel synthesis to quickly generate a series of sialosides containing various sialic acid forms. PMID:19740656

  12. Characterisation of SalRAB a Salicylic Acid Inducible Positively Regulated Efflux System of Rhizobium leguminosarum bv viciae 3841

    PubMed Central

    Tett, Adrian J.; Karunakaran, Ramakrishnan; Poole, Philip S.

    2014-01-01

    Salicylic acid is an important signalling molecule in plant-microbe defence and symbiosis. We analysed the transcriptional responses of the nitrogen fixing plant symbiont, Rhizobium leguminosarum bv viciae 3841 to salicylic acid. Two MFS-type multicomponent efflux systems were induced in response to salicylic acid, rmrAB and the hitherto undescribed system salRAB. Based on sequence similarity salA and salB encode a membrane fusion and inner membrane protein respectively. salAB are positively regulated by the LysR regulator SalR. Disruption of salA significantly increased the sensitivity of the mutant to salicylic acid, while disruption of rmrA did not. A salA/rmrA double mutation did not have increased sensitivity relative to the salA mutant. Pea plants nodulated by salA or rmrA strains did not have altered nodule number or nitrogen fixation rates, consistent with weak expression of salA in the rhizosphere and in nodule bacteria. However, BLAST analysis revealed seventeen putative efflux systems in Rlv3841 and several of these were highly differentially expressed during rhizosphere colonisation, host infection and bacteroid differentiation. This suggests they have an integral role in symbiosis with host plants. PMID:25133394

  13. Characterisation of fatty acid, carotenoid, tocopherol/tocotrienol compositions and antioxidant activities in seeds of three Chenopodium quinoa Willd. genotypes.

    PubMed

    Tang, Yao; Li, Xihong; Chen, Peter X; Zhang, Bing; Hernandez, Marta; Zhang, Hua; Marcone, Massimo F; Liu, Ronghua; Tsao, Rong

    2015-05-01

    Composition of fatty acids, tocopherols, tocotrienols, and carotenoids, and their contribution to antioxidant activities were investigated in seeds of three coloured quinoa cultivars (white, red and black). The major components and individual compounds were significantly different, and their concentrations were higher in darker seeds (p < 0.05). The oil yield was 6.58-7.17% which contained predominantly unsaturated fatty acids (89.42%). The ratio of omega-6/omega-3 fatty acid was ca. 6/1. The total tocopherol content ranged from 37.49 to 59.82 μg/g and mainly consisted of γ-tocopherol. Trace amount of α- and β-tocotrienols was also found. Black quinoa had the highest vitamin E followed by red and white quinoas. Carotenoids, mainly trans-lutein (84.7-85.6%) and zeaxanthin were confirmed for the first time in quinoa seeds, and the concentration was also the highest in black seeds. The antioxidant activities of lipophilic extracts were positively correlated with polyunsaturated fatty acids, total carotenoids and total tocopherols.

  14. Characterisation of fatty acid, carotenoid, tocopherol/tocotrienol compositions and antioxidant activities in seeds of three Chenopodium quinoa Willd. genotypes.

    PubMed

    Tang, Yao; Li, Xihong; Chen, Peter X; Zhang, Bing; Hernandez, Marta; Zhang, Hua; Marcone, Massimo F; Liu, Ronghua; Tsao, Rong

    2015-05-01

    Composition of fatty acids, tocopherols, tocotrienols, and carotenoids, and their contribution to antioxidant activities were investigated in seeds of three coloured quinoa cultivars (white, red and black). The major components and individual compounds were significantly different, and their concentrations were higher in darker seeds (p < 0.05). The oil yield was 6.58-7.17% which contained predominantly unsaturated fatty acids (89.42%). The ratio of omega-6/omega-3 fatty acid was ca. 6/1. The total tocopherol content ranged from 37.49 to 59.82 μg/g and mainly consisted of γ-tocopherol. Trace amount of α- and β-tocotrienols was also found. Black quinoa had the highest vitamin E followed by red and white quinoas. Carotenoids, mainly trans-lutein (84.7-85.6%) and zeaxanthin were confirmed for the first time in quinoa seeds, and the concentration was also the highest in black seeds. The antioxidant activities of lipophilic extracts were positively correlated with polyunsaturated fatty acids, total carotenoids and total tocopherols. PMID:25529712

  15. Characterisation of SalRAB a salicylic acid inducible positively regulated efflux system of Rhizobium leguminosarum bv viciae 3841.

    PubMed

    Tett, Adrian J; Karunakaran, Ramakrishnan; Poole, Philip S

    2014-01-01

    Salicylic acid is an important signalling molecule in plant-microbe defence and symbiosis. We analysed the transcriptional responses of the nitrogen fixing plant symbiont, Rhizobium leguminosarum bv viciae 3841 to salicylic acid. Two MFS-type multicomponent efflux systems were induced in response to salicylic acid, rmrAB and the hitherto undescribed system salRAB. Based on sequence similarity salA and salB encode a membrane fusion and inner membrane protein respectively. salAB are positively regulated by the LysR regulator SalR. Disruption of salA significantly increased the sensitivity of the mutant to salicylic acid, while disruption of rmrA did not. A salA/rmrA double mutation did not have increased sensitivity relative to the salA mutant. Pea plants nodulated by salA or rmrA strains did not have altered nodule number or nitrogen fixation rates, consistent with weak expression of salA in the rhizosphere and in nodule bacteria. However, BLAST analysis revealed seventeen putative efflux systems in Rlv3841 and several of these were highly differentially expressed during rhizosphere colonisation, host infection and bacteroid differentiation. This suggests they have an integral role in symbiosis with host plants.

  16. Direct microwave-assisted amino acid synthesis by reaction of succinic acid and ammonia in the presence of magnetite

    NASA Astrophysics Data System (ADS)

    Jiang, Nan; Liu, Dandan; Shi, Weiguang; Hua, Yingjie; Wang, Chongtai; Liu, Xiaoyang

    2013-10-01

    Since the discovery of submarine hot vents in the late 1970s, it has been postulated that submarine hydrothermal environments would be suitable for emergence of life on Earth. To simulate warm spring conditions, we designed a series of microwave-assisted amino acid synthesis involving direct reactions between succinic acid and ammonia in the presence of the magnetite catalyst. These reactions which generated aspartic acid and glycine were carried out under mild temperatures and pressures (90-180 °C, 4-19 bar). We studied this specific reaction inasmuch as succinic acid and ammonia were traditionally identified as prebiotic compounds in primitive deep-sea hydrothermal systems on Earth. The experimental results were discussed in both biochemical and geochemical context to offer a possible route for abiotic amino acid synthesis. With extremely diluted starting materials (0.002 M carboxylic acid and 0.002 M ammonia) and catalyst loading, an obvious temperature dependency was observed in both cases [neither product was detected at 90 °C in comparison with 21.08 μmol L-1 (aspartic acid) and 70.25 umol L-1 (glycine) in 180 °C]. However, an opposite trend presented for reaction time factor, namely a positive correlation for glycine, but a negative one for aspartic acid.

  17. Dietary Sugars Stimulate Fatty Acid Synthesis in Adults123

    PubMed Central

    Parks, Elizabeth J.; Skokan, Lauren E.; Timlin, Maureen T.; Dingfelder, Carlus S.

    2008-01-01

    The goal of this study was to determine the magnitude by which acute consumption of fructose in a morning bolus would stimulate lipogenesis (measured by infusion of 13C1-acetate and analysis by GC-MS) immediately and after a subsequent meal. Six healthy subjects [4 men and 2 women; aged (mean ± SD) 28 ± 8 y; BMI, 24.3 ± 2.8 kg/m2; and serum triacylglycerols (TG), 1.03 ± 0.32 mmol/L] consumed carbohydrate boluses of sugars (85 g each) in a random and blinded order, followed by a standardized lunch 4 h later. Subjects completed a control test of glucose (100:0) and a mixture of 50:50 glucose:fructose and one of 25:75 (wt:wt). Following the morning boluses, serum glucose and insulin after 100:0 were greater than both other treatments (P < 0.05) and this pattern occurred again after lunch. In the morning, fractional lipogenesis was stimulated when subjects ingested fructose and peaked at 15.9 ± 5.4% after the 50:50 treatment and at 16.9 ± 5.2% after the 25:75 treatment, values that were greater than after the 100:0 treatment (7.8 ± 5.7%; P < 0.02). When fructose was consumed, absolute lipogenesis was 2-fold greater than when it was absent (100:0). Postlunch, serum TG were 11–29% greater than 100:0 and TG-rich lipoprotein-TG concentrations were 76–200% greater after 50:50 and 25:75 were consumed (P < 0.05). The data demonstrate that an early stimulation of lipogenesis after fructose, consumed in a mixture of sugars, augments subsequent postprandial lipemia. The postlunch blood TG elevation was only partially due to carry-over from the morning. Acute intake of fructose stimulates lipogenesis and may create a metabolic milieu that enhances subsequent esterification of fatty acids flowing to the liver to elevate TG synthesis postprandially. PMID:18492831

  18. Visible-light photoredox synthesis of unnatural chiral α-amino acids.

    PubMed

    Jiang, Min; Jin, Yunhe; Yang, Haijun; Fu, Hua

    2016-05-17

    Unnatural chiral α-amino acids are widely used in fields of organic chemistry, biochemistry and medicinal chemistry, and their synthesis has attracted extensive attention. Although the asymmetric synthesis provides some efficient protocols, noble and elaborate catalysts, ligands and additives are usually required which leads to high cost. Distinctly, it is attractive to make unnatural chiral α-amino acids from readily available natural α-amino acids through keeping of the existing chiral α-carbon. However, it is a great challenge to construct them under mild conditions. In this paper, 83 unnatural chiral α-amino acids were prepared at room temperature under visible-light assistance. The protocol uses two readily available genetically coded proteinogenic amino acids, L-aspartic acid and glutamic acid derivatives as the chiral sources and radical precursors, olefins, alkynyl and alkenyl sulfones, and 2-isocyanobiphenyl as the radical acceptors, and various unnatural chiral α-amino acids were prepared in good to excellent yields. The simple protocol, mild conditions, fast reactions, and high efficiency make the method an important strategy for synthesis of diverse unnatural chiral α-amino acids.

  19. Visible-light photoredox synthesis of unnatural chiral α-amino acids

    PubMed Central

    Jiang, Min; Jin, Yunhe; Yang, Haijun; Fu, Hua

    2016-01-01

    Unnatural chiral α-amino acids are widely used in fields of organic chemistry, biochemistry and medicinal chemistry, and their synthesis has attracted extensive attention. Although the asymmetric synthesis provides some efficient protocols, noble and elaborate catalysts, ligands and additives are usually required which leads to high cost. Distinctly, it is attractive to make unnatural chiral α-amino acids from readily available natural α-amino acids through keeping of the existing chiral α-carbon. However, it is a great challenge to construct them under mild conditions. In this paper, 83 unnatural chiral α-amino acids were prepared at room temperature under visible-light assistance. The protocol uses two readily available genetically coded proteinogenic amino acids, L-aspartic acid and glutamic acid derivatives as the chiral sources and radical precursors, olefins, alkynyl and alkenyl sulfones, and 2-isocyanobiphenyl as the radical acceptors, and various unnatural chiral α-amino acids were prepared in good to excellent yields. The simple protocol, mild conditions, fast reactions, and high efficiency make the method an important strategy for synthesis of diverse unnatural chiral α-amino acids. PMID:27185220

  20. Visible-light photoredox synthesis of unnatural chiral α-amino acids.

    PubMed

    Jiang, Min; Jin, Yunhe; Yang, Haijun; Fu, Hua

    2016-01-01

    Unnatural chiral α-amino acids are widely used in fields of organic chemistry, biochemistry and medicinal chemistry, and their synthesis has attracted extensive attention. Although the asymmetric synthesis provides some efficient protocols, noble and elaborate catalysts, ligands and additives are usually required which leads to high cost. Distinctly, it is attractive to make unnatural chiral α-amino acids from readily available natural α-amino acids through keeping of the existing chiral α-carbon. However, it is a great challenge to construct them under mild conditions. In this paper, 83 unnatural chiral α-amino acids were prepared at room temperature under visible-light assistance. The protocol uses two readily available genetically coded proteinogenic amino acids, L-aspartic acid and glutamic acid derivatives as the chiral sources and radical precursors, olefins, alkynyl and alkenyl sulfones, and 2-isocyanobiphenyl as the radical acceptors, and various unnatural chiral α-amino acids were prepared in good to excellent yields. The simple protocol, mild conditions, fast reactions, and high efficiency make the method an important strategy for synthesis of diverse unnatural chiral α-amino acids. PMID:27185220

  1. How Bacterial Pathogens Eat Host Lipids: Implications for the Development of Fatty Acid Synthesis Therapeutics*

    PubMed Central

    Yao, Jiangwei; Rock, Charles O.

    2015-01-01

    Bacterial type II fatty acid synthesis (FASII) is a target for the development of novel therapeutics. Bacteria incorporate extracellular fatty acids into membrane lipids, raising the question of whether pathogens use host fatty acids to bypass FASII and defeat FASII therapeutics. Some pathogens suppress FASII when exogenous fatty acids are present to bypass FASII therapeutics. FASII inhibition cannot be bypassed in many bacteria because essential fatty acids cannot be obtained from the host. FASII antibiotics may not be effective against all bacteria, but a broad spectrum of Gram-negative and -positive pathogens can be effectively treated with FASII inhibitors. PMID:25648887

  2. Wavelength dependence of mycosporine-like amino acid synthesis in Gyrodinium dorsum.

    PubMed

    Klisch, M; Häder, D-P

    2002-02-01

    The synthesis or accumulation of mycosporine-like amino acids (MAAs) is an important UV tolerance mechanism in aquatic organisms. To investigate the wavelength dependence of MAA synthesis in the marine dinoflagellate Gyrodinium dorsum, the organism was exposed to polychromatic radiation (PAR and UV) from a solar simulator for up to 72 h. Different irradiance spectra were produced by inserting various cut-off filters between lamp and samples. A polychromatic action spectrum for the synthesis of MAA synthesis was constructed. PAR and long wavelength UV-A radiation showed almost no effect while the most effective wavelength range was around 310 nm. Shorter wavelengths where less effective in the induction of MAA synthesis. Wavelengths below 300 nm damaged the organisms severely as indicated by a decrease in chlorophyll a absorption.

  3. Copper-mediated arylation with arylboronic acids: Facile and modular synthesis of triarylmethanes

    PubMed Central

    Rao, A Veera Bhadra

    2016-01-01

    Summary A facile and modular synthesis of triarylmethanes was achieved in good yield via a two-step sequence in which the final step is the copper(II)-catalyzed arylation of diarylmethanols with arylboronic acids. By using this protocol a variety of symmetrical and unsymmetrical triarylmethanes were synthesized. As an application of the newly developed methodology, we demonstrate a high-yielding synthesis of the triarylmethane intermediate towards an anti-breast-cancer drug candidate. PMID:27340442

  4. Isolation and structural characterisation of acid- and pepsin-soluble collagen from the skin of squid Sepioteuthis lessoniana (Lesson, 1830).

    PubMed

    Ramasamy, Pasiyappazham; Subhapradha, Namasivayam; Shanmugam, Vairamani; Shanmugam, Annaian

    2014-01-01

    Acid-solubilised collagen (ASC) and pepsin-solubilised collagen (PSC) were effectively isolated from squid skin with good yield and total protein content. ASC and PSC consist of two α-chains with an imino acid content of 182.6 and 184 imino acid residues/1000 residues. The molecular weight was determined to be between 73 and 107 kDa by using SDS-PAGE. For peptide mapping, collagens were digested with achromo endopeptidase, and all components, including α, β-chains, were markedly hydrolysed. Degradation peptides with molecular weights between 106.9 and 15.47 kDa were obtained. UV-vis absorption spectrum revealed distinct absorption at 220-240 nm. FT-IR spectra of collagens were almost similar when compared with standard. In differential scanning calorimetry profile, ASC and PSC exhibited a To of 59.10, 62.18°C and TP of 104.91, 98.10 °C, respectively. This investigation indicates that the collagen isolated from the squid skin, which is thrown as waste in the seafood-processing plant, might supplement the vertebrate collagen in industrial applications.

  5. Kinetic Characterisation of a Single Chain Antibody against the Hormone Abscisic Acid: Comparison with Its Parental Monoclonal.

    PubMed

    Badescu, George O; Marsh, Andrew; Smith, Timothy R; Thompson, Andrew J; Napier, Richard M

    2016-01-01

    A single-chain Fv fragment antibody (scFv) specific for the plant hormone abscisic acid (ABA) has been expressed in the bacterium Escherichia coli as a fusion protein. The kinetics of ABA binding have been measured using surface plasmon resonance spectrometry (BIAcore 2000) using surface and solution assays. Care was taken to calculate the concentration of active protein in each sample using initial rate measurements under conditions of partial mass transport limitation. The fusion product, parental monoclonal antibody and the free scFv all have low nanomolar affinity constants, but there is a lower dissociation rate constant for the parental monoclonal resulting in a three-fold greater affinity. Analogue specificity was tested and structure-activity binding preferences measured. The biologically-active (+)-ABA enantiomer is recognised with an affinity three orders of magnitude higher than the inactive (-)-ABA. Metabolites of ABA including phaseic acid, dihydrophaseic acid and deoxy-ABA have affinities over 100-fold lower than that for (+)-ABA. These properties of the scFv make it suitable as a sensor domain in bioreporters specific for the naturally occurring form of ABA.

  6. Kinetic Characterisation of a Single Chain Antibody against the Hormone Abscisic Acid: Comparison with Its Parental Monoclonal

    PubMed Central

    Badescu, George O.; Marsh, Andrew; Smith, Timothy R.; Thompson, Andrew J.; Napier, Richard M.

    2016-01-01

    A single-chain Fv fragment antibody (scFv) specific for the plant hormone abscisic acid (ABA) has been expressed in the bacterium Escherichia coli as a fusion protein. The kinetics of ABA binding have been measured using surface plasmon resonance spectrometry (BIAcore 2000) using surface and solution assays. Care was taken to calculate the concentration of active protein in each sample using initial rate measurements under conditions of partial mass transport limitation. The fusion product, parental monoclonal antibody and the free scFv all have low nanomolar affinity constants, but there is a lower dissociation rate constant for the parental monoclonal resulting in a three-fold greater affinity. Analogue specificity was tested and structure-activity binding preferences measured. The biologically-active (+)-ABA enantiomer is recognised with an affinity three orders of magnitude higher than the inactive (-)-ABA. Metabolites of ABA including phaseic acid, dihydrophaseic acid and deoxy-ABA have affinities over 100-fold lower than that for (+)-ABA. These properties of the scFv make it suitable as a sensor domain in bioreporters specific for the naturally occurring form of ABA. PMID:27023768

  7. Receptor-mediated uptake of low density lipoprotein stimulates bile acid synthesis by cultured rat hepatocytes

    SciTech Connect

    Junker, L.H.; Davis, R.A. )

    1989-12-01

    The cellular mechanisms responsible for the lipoprotein-mediated stimulation of bile acid synthesis in cultured rat hepatocytes were investigated. Adding 280 micrograms/ml of cholesterol in the form of human or rat low density lipoprotein (LDL) to the culture medium increased bile acid synthesis by 1.8- and 1.6-fold, respectively. As a result of the uptake of LDL, the synthesis of (14C)cholesterol from (2-14C)acetate was decreased and cellular cholesteryl ester mass was increased. Further studies demonstrated that rat apoE-free LDL and apoE-rich high density lipoprotein (HDL) both stimulated bile acid synthesis 1.5-fold, as well as inhibited the formation of (14C)cholesterol from (2-14C)acetate. Reductive methylation of LDL blocked the inhibition of cholesterol synthesis, as well as the stimulation of bile acid synthesis, suggesting that these processes require receptor-mediated uptake. To identify the receptors responsible, competitive binding studies using 125I-labeled apoE-free LDL and 125I-labeled apoE-rich HDL were performed. Both apoE-free LDL and apoE-rich HDL displayed an equal ability to compete for binding of the other, suggesting that a receptor or a group of receptors that recognizes both apolipoproteins is involved. Additional studies show that hepatocytes from cholestyramine-treated rats displayed 2.2- and 3.4-fold increases in the binding of apoE-free LDL and apoE-rich HDL, respectively. These data show for the first time that receptor-mediated uptake of LDL by the liver is intimately linked to processes activating bile acid synthesis.

  8. Approach to Merosesquiterpenes via Lewis Acid Catalyzed Nazarov-Type Cyclization: Total Synthesis of Akaol A.

    PubMed

    Kakde, Badrinath N; Kumar, Nivesh; Mondal, Pradip Kumar; Bisai, Alakesh

    2016-04-15

    A Lewis acid catalyzed Nazarov-type cyclization of arylvinylcarbinol has been developed for the asymmetric synthesis of carbotetracyclic core of merosesquiterpenes. The reaction works only in the presence of 2 mol % of Sn(OTf)2 and Bi(OTf)3 in dichloroethane under elevated temperature. The methodology offers the synthesis of a variety of enantioenriched arylvinylcarbinols from commercially available (3aR)-sclareolide 9 in six steps with an eventual concise total synthesis of marine sesquiterpene quinol, akaol A (1a). PMID:27028314

  9. Retinoic acid response element in the human alcohol dehydrogenase gene ADH3: implications for regulation of retinoic acid synthesis.

    PubMed Central

    Duester, G; Shean, M L; McBride, M S; Stewart, M J

    1991-01-01

    Retinoic acid regulation of one member of the human class I alcohol dehydrogenase (ADH) gene family was demonstrated, suggesting that the retinol dehydrogenase function of ADH may play a regulatory role in the biosynthetic pathway for retinoic acid. Promoter activity of human ADH3, but not ADH1 or ADH2, was shown to be activated by retinoic acid in transient transfection assays of Hep3B human hepatoma cells. Deletion mapping experiments identified a region in the ADH3 promoter located between -328 and -272 bp which confers retinoic acid activation. This region was also demonstrated to confer retinoic acid responsiveness on the ADH1 and ADH2 genes in heterologous promoter fusions. Within a 34-bp stretch, the ADH3 retinoic acid response element (RARE) contains two TGACC motifs and one TGAAC motif, both of which exist in RAREs controlling other genes. A block mutation of the TGACC sequence located at -289 to -285 bp eliminated the retinoic acid response. As assayed by gel shift DNA binding studies, the RARE region (-328 to -272 bp) of ADH3 bound the human retinoic acid receptor beta (RAR beta) and was competed for by DNA containing a RARE present in the gene encoding RAR beta. Since ADH catalyzes the conversion of retinol to retinal, which can be further converted to retinoic acid by aldehyde dehydrogenase, these results suggest that retinoic acid activation of ADH3 constitutes a positive feedback loop regulating retinoic acid synthesis. Images PMID:1996113

  10. Synthesis and biological properties of amino acids and peptides containing a tetrazolyl moiety

    NASA Astrophysics Data System (ADS)

    Popova, E. A.; Trifonov, R. E.

    2015-09-01

    Literature data published mainly in the last 15 years on the synthesis and biological properties of amino acid analogues and derivatives containing tetrazolyl moieties are analyzed. Tetrazolyl analogues and derivatives of amino acids and peptides are shown to be promising for medicinal chemistry. Being polynitrogen heterocyclic systems comprising four endocyclic nitrogen atoms, tetrazoles can behave as acids and bases and form strong hydrogen bonds with proton donors (more rarely, with acceptors). They have high metabolic stability and are able to penetrate biological membranes. The review also considers the synthesis and properties of linear and cyclic peptides based on modified amino acids incorporating a tetrazolyl moiety. A special issue is the discussion of the biological properties of tetrazole-containing amino acids and peptides, which exhibit high biological activity and can be used to design new drugs. The bibliography includes 200 references.

  11. Solvent-free lipase-catalyzed synthesis of a novel hydroxyl-fatty acid derivative of kojic acid.

    PubMed

    El-Boulifi, Noureddin; Ashari, Siti Efliza; Serrano, Marta; Aracil, Jose; Martínez, Mercedes

    2014-02-01

    The aim of this work was the synthesis of a novel hydroxyl-fatty acid derivative of kojic acid rich in kojic acid monoricinoleate (KMR) which can be widely used in the cosmetic and food industry. The synthesis of KMR was carried out by lipase-catalysed esterification of ricinoleic and kojic acids in solvent-free system. Three immobilized lipases were tested and the best KMR yields were attained with Lipozyme TL IM and Novozym 435. Since Lipozyme TL IM is the cheapest, it was selected to optimize the reaction conditions. The optimal reaction conditions were 80 °C for the temperature, 1:1 for the alcohol/acid molar ratio, 600 rpm for stirring speed and 7.8% for the catalyst concentration. Under these conditions, the reaction was scaled up in a 5×10⁻³ m³ stirred tank reactor. ¹H-¹³C HMBC-NMR showed that the primary hydroxyl group of kojic acid was regioselectively esterified. The KMR has more lipophilicity than kojic acid and showed antioxidant activity that improves the oxidation stability of biodiesel.

  12. Rh(III)-catalyzed synthesis of sultones through C-H activation directed by a sulfonic acid group.

    PubMed

    Qi, Zisong; Wang, Mei; Li, Xingwei

    2014-09-01

    A new rhodium-catalyzed synthesis of sultones via the oxidative coupling of sulfonic acids with internal alkynes is described. The reaction proceeds via aryl C-H activation assisted by a sulfonic acid group.

  13. Synthesis of Hydroxymethylenebisphosphonic Acid Derivatives in Different Solvents.

    PubMed

    Nagy, Dávid Illés; Grün, Alajos; Garadnay, Sándor; Greiner, István; Keglevich, György

    2016-01-01

    The syntheses of hydroxymethylenebisphosphonic acid derivatives (dronic acid derivatives) starting from the corresponding substituted acetic acids and P-reagents, mainly phosphorus trichloride and phosphorous acid are surveyed according to the solvents applied. The nature of the solvent is a critical point due to the heterogeneity of the reaction mixtures. This review sheds light on the optimum choice and ratio of the P-reactants, and on the optimum conditions. PMID:27529200

  14. Kinetics of Ethyl Acetate Synthesis Catalyzed by Acidic Resins

    ERIC Educational Resources Information Center

    Antunes, Bruno M.; Cardoso, Simao P.; Silva, Carlos M.; Portugal, Ines

    2011-01-01

    A low-cost experiment to carry out the second-order reversible reaction of acetic acid esterification with ethanol to produce ethyl acetate is presented to illustrate concepts of kinetics and reactor modeling. The reaction is performed in a batch reactor, and the acetic acid concentration is measured by acid-base titration versus time. The…

  15. Synthesis of alpha-hydroxyphosphonic acids from Lesquerella oil

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Lesquerella oil has been a substance of growing chemical interest, due to the ease with which it is produced and its similarity in structure to castor oil. The primary fatty acid in Lesquerella oil, lesquerolic acid, is very similar to the principal component of castor oil, ricinoleic acid, and may ...

  16. Myristic acid potentiates palmitic acid-induced lipotoxicity and steatohepatitis associated with lipodystrophy by sustaning de novo ceramide synthesis

    PubMed Central

    Martínez, Laura; Torres, Sandra; Baulies, Anna; Alarcón-Vila, Cristina; Elena, Montserrat; Fabriàs, Gemma; Casas, Josefina; Caballeria, Joan; Fernandez-Checa, Jose C.; García-Ruiz, Carmen

    2015-01-01

    Palmitic acid (PA) induces hepatocyte apoptosis and fuels de novo ceramide synthesis in the endoplasmic reticulum (ER). Myristic acid (MA), a free fatty acid highly abundant in copra/palmist oils, is a predictor of nonalcoholic steatohepatitis (NASH) and stimulates ceramide synthesis. Here we investigated the synergism between MA and PA in ceramide synthesis, ER stress, lipotoxicity and NASH. Unlike PA, MA is not lipotoxic but potentiated PA-mediated lipoapoptosis, ER stress, caspase-3 activation and cytochrome c release in primary mouse hepatocytes (PMH). Moreover, MA kinetically sustained PA-induced total ceramide content by stimulating dehydroceramide desaturase and switched the ceramide profile from decreased to increased ceramide 14:0/ceramide16:0, without changing medium and long-chain ceramide species. PMH were more sensitive to equimolar ceramide14:0/ceramide16:0 exposure, which mimics the outcome of PA plus MA treatment on ceramide homeostasis, than to either ceramide alone. Treatment with myriocin to inhibit ceramide synthesis and tauroursodeoxycholic acid to prevent ER stress ameliorated PA plus MA induced apoptosis, similar to the protection afforded by the antioxidant BHA, the pan-caspase inhibitor z-VAD-Fmk and JNK inhibition. Moreover, ruthenium red protected PMH against PA and MA-induced cell death. Recapitulating in vitro findings, mice fed a diet enriched in PA plus MA exhibited lipodystrophy, hepatosplenomegaly, increased liver ceramide content and cholesterol levels, ER stress, liver damage, inflammation and fibrosis compared to mice fed diets enriched in PA or MA alone. The deleterious effects of PA plus MA-enriched diet were largely prevented by in vivo myriocin treatment. These findings indicate a causal link between ceramide synthesis and ER stress in lipotoxicity, and imply that the consumption of diets enriched in MA and PA can cause NASH associated with lipodystrophy. PMID:26539645

  17. Myristic acid potentiates palmitic acid-induced lipotoxicity and steatohepatitis associated with lipodystrophy by sustaning de novo ceramide synthesis.

    PubMed

    Martínez, Laura; Torres, Sandra; Baulies, Anna; Alarcón-Vila, Cristina; Elena, Montserrat; Fabriàs, Gemma; Casas, Josefina; Caballeria, Joan; Fernandez-Checa, Jose C; García-Ruiz, Carmen

    2015-12-01

    Palmitic acid (PA) induces hepatocyte apoptosis and fuels de novo ceramide synthesis in the endoplasmic reticulum (ER). Myristic acid (MA), a free fatty acid highly abundant in copra/palmist oils, is a predictor of nonalcoholic steatohepatitis (NASH) and stimulates ceramide synthesis. Here we investigated the synergism between MA and PA in ceramide synthesis, ER stress, lipotoxicity and NASH. Unlike PA, MA is not lipotoxic but potentiated PA-mediated lipoapoptosis, ER stress, caspase-3 activation and cytochrome c release in primary mouse hepatocytes (PMH). Moreover, MA kinetically sustained PA-induced total ceramide content by stimulating dehydroceramide desaturase and switched the ceramide profile from decreased to increased ceramide 14:0/ceramide16:0, without changing medium and long-chain ceramide species. PMH were more sensitive to equimolar ceramide14:0/ceramide16:0 exposure, which mimics the outcome of PA plus MA treatment on ceramide homeostasis, than to either ceramide alone. Treatment with myriocin to inhibit ceramide synthesis and tauroursodeoxycholic acid to prevent ER stress ameliorated PA plus MA induced apoptosis, similar to the protection afforded by the antioxidant BHA, the pan-caspase inhibitor z-VAD-Fmk and JNK inhibition. Moreover, ruthenium red protected PMH against PA and MA-induced cell death. Recapitulating in vitro findings, mice fed a diet enriched in PA plus MA exhibited lipodystrophy, hepatosplenomegaly, increased liver ceramide content and cholesterol levels, ER stress, liver damage, inflammation and fibrosis compared to mice fed diets enriched in PA or MA alone. The deleterious effects of PA plus MA-enriched diet were largely prevented by in vivo myriocin treatment. These findings indicate a causal link between ceramide synthesis and ER stress in lipotoxicity, and imply that the consumption of diets enriched in MA and PA can cause NASH associated with lipodystrophy.

  18. Crystal growth, structure analysis and characterisation of 2 - (1, 3 - dioxoisoindolin - 2 - yl) acetic acid single crystal

    SciTech Connect

    Sankari, R. Siva; Perumal, Rajesh Narayana

    2014-04-24

    Single crystal of dielectric material 2 - (1, 3 - dioxoisoindolin - 2 - yl) acetic acid has been grown by slow evaporation solution growth method. The grown crystal was harvested in 25 days. The crystal structure was analyzed by Single crystal X - ray diffraction. UV-vis-NIR analysis was performed to examine the optical property of the grown crystal. The thermal property of the grown crystal was studied by thermogravimetric analysis (TGA) and differential thermal analysis (DTA). The dielectric measurements were carried out and the dielectric constant was calculated and plotted at all frequencies.

  19. Insulin rapidly increases diacylglycerol by activating de novo phosphatidic acid synthesis.

    PubMed

    Farese, R V; Konda, T S; Davis, J S; Standaert, M L; Pollet, R J; Cooper, D R

    1987-05-01

    The mechanisms whereby insulin increases diacylglycerol in BC3H-1 myocytes were examined. When [3H]arachidonate labeling of phospholipids was used as an indicator of phospholipase C activation, transient increases in [3H]diacylglycerol were observed between 0.5 and 10 minutes after the onset of insulin treatment. With [3H]glycerol labeling as an indicator of de novo phospholipid synthesis, [3H]diacylglycerol was increased maximally at 1 minute and remained elevated for 20 minutes. [3H]Glycerol-labeled diacylglycerol was largely derived directly from phosphatidic acid. Insulin increased de novo phosphatidic acid synthesis within 5 to 10 seconds; within 1 minute, this synthesis was 60 times greater than that of controls. Thus, the initial increase in diacylglycerol is due to both increased hydrolysis of phospholipids and a burst of de novo phosphatidic acid synthesis. After 5 to 10 minutes, de novo phosphatidic acid synthesis continues as a major source of diacylglycerol. Both phospholipid effects of insulin seem important for generating diacylglycerol and other phospholipid-derived intracellular signaling substances.

  20. Characterisation and evaluation of metal-loaded iminodiacetic acid-silica of different porosity for the selective enrichment of phosphopeptides.

    PubMed

    Trojer, L; Stecher, G; Feuerstein, I; Lubbad, S; Bonn, G K

    2005-06-24

    Silica particles of different porosity were functionalised with iminodiacetic acid (IDA) and loaded with Fe(III) to yield immobilised metal affinity chromatography stationary phases (Fe(III)-IDA-silica) for phosphopeptide enrichment. The elution step of bound phosphopeptides was optimised with a 32P radioactive labelled peptide by a comprehensive study. Several elution systems, including phosphate buffers of different pH and concentration and ethylenediaminetetraacetic acid solutions were employed. Furthermore the effect of support porosity on elution behaviour was investigated. Under best conditions recoveries higher than 90% were achieved. A solid-phase extraction (SPE) protocol was developed for fractionation of phosphorylated and non-phosphorylated peptides and desalting of the fractions which is essential for subsequent mass spectrometric analysis by the combination of Fe(III)-IDA-silica and C18-silica particles. The pH of the loading buffer was found to be a critical parameter for the efficiency of the SPE protocol. As tryptic digests of alpha-lactalbumin, lysozyme and ribonuclease A mixed with three synthetic phosphopeptides were fractionated, pH 2.5 provided minimal proportion of unspecific bound peptides when comparing the fractions after mu-LC-electrospray ionization MS separation. The effect of a sample derivatisation reaction (methylation) on the efficiency of phosphopeptide enrichment was further investigated. Blocking carboxylate groups by methyl ester formation totally prevented unspecific interaction with the immobilised Fe(III) ions, but generated partially methylated phosphopeptides that increased the complexity of the phosphorylated fraction. PMID:16038305

  1. Isolation and characterisation of selected lactic acid bacteria for improved processing of Nem chua, a traditional fermented meat from Vietnam.

    PubMed

    Nguyen, H T H; Elegado, F B; Librojo-Basilio, N T; Mabesa, R C; Dizon, E I

    2010-03-01

    Nem chua is a traditional lactic acid fermented meat of Vietnam that is consumed raw. During fermentation, the number of acid-producing bacteria increased significantly and by the final day (4th), it had reached approximately 8.4 log cfu/g, contributing to 94% of the total microbiota of the product. Out of 85 isolates obtained from the product, only 44 were confirmed Gram-positive and catalase-negative. These putative LAB isolates were purified and screened for antimicrobial and proteolytic activity. None of the isolates showed bacteriocin activity using the 'spot-on lawn' method, but showed antimicrobial activity against Lactobacillus sakei and Enterococcus faecium using deferred assay. Four isolates showed good proteolytic activities at pH 7.0. These isolates were identified as Lactobacillus plantarum using an API 50 CHL i.d. kit. Sequencing of the partial 16S rRNA gene amplified by primers 1101F (5'-AACGAGCGCAACCC-3') and 1407R (5'-GACGGGCGGTGTGTAC-3') showed 98% homology to Lactobacillus plantarum WCFS1.

  2. Characterisation of Fecal Soap Fatty Acids, Calcium Contents, Bacterial Community and Short-Chain Fatty Acids in Sprague Dawley Rats Fed with Different sn-2 Palmitic Triacylglycerols Diets

    PubMed Central

    Wan, Jianchun; Hu, Songyou; Ni, Kefeng; Chang, Guifang; Sun, Xiangjun; Yu, Liangli

    2016-01-01

    The structure of dietary triacylglycerols is thought to influence fatty acid and calcium absorption, as well as intestinal microbiota population of the host. In the present study, we investigated the impact of palmitic acid (PA) esterified at the sn-2 position on absorption of fatty acid and calcium and composition of intestinal microorganisms in rats fed high-fat diets containing either low sn-2 PA (12.1%), medium sn-2 PA (40.4%) or high sn-2 PA (56.3%), respectively. Fecal fatty acid profiles in the soaps were measured by gas chromatography (GC), while fecal calcium concentration was detected by ICP-MS. The fecal microbial composition was assessed using a 16S rRNA high-throughput sequencing technology and fecal short-chain fatty acids were detected by ion chromatograph. Dietary supplementation with a high sn-2 PA fat significantly reduced total fecal contents of fatty acids soap and calcium compared with the medium or low sn-2 PA fat groups. Diet supplementation with sn-2 PA fat did not change the entire profile of the gut microbiota community at phylum level and the difference at genera level also were minimal in the three treatment groups. However, high sn-2 PA fat diet could potentially improve total short-chain fatty acids content in the feces, suggesting that high dietary sn-2 PA fat might have a beneficial effect on host intestinal health. PMID:27783700

  3. Selenium Catalyzed Oxidation of Aldehydes: Green Synthesis of Carboxylic Acids and Esters.

    PubMed

    Sancineto, Luca; Tidei, Caterina; Bagnoli, Luana; Marini, Francesca; Lenardão, Eder J; Santi, Claudio

    2015-01-01

    The stoichiometric use of hydrogen peroxide in the presence of a selenium-containing catalyst in water is here reported as a new ecofriendly protocol for the synthesis of variously functionalized carboxylic acids and esters. The method affords the desired products in good to excellent yields under very mild conditions starting directly from commercially available aldehydes. Using benzaldehyde as a prototype the gram scale synthesis of benzoic acid is described, in which the aqueous medium and the catalyst could be recycled at last five times while achieving an 87% overall yield.

  4. Communic acids: occurrence, properties and use as chirons for the synthesis of bioactive compounds.

    PubMed

    Barrero, Alejandro F; Herrador, M Mar; Arteaga, Pilar; Arteaga, Jesús F; Arteaga, Alejandro F

    2012-01-01

    Communic acids are diterpenes with labdane skeletons found in many plant species, mainly conifers, predominating in the genus Juniperus (fam. Cupresaceae). In this review we briefly describe their distribution and different biological activities (anti- bacterial, antitumoral, hypolipidemic, relaxing smooth muscle, etc.). This paper also includes a detailed explanation of their use as chiral building blocks for the synthesis of bioactive natural products. Among other uses, communic acids have proven useful as chirons for the synthesis of quassinoids (formal), abietane antioxidants, ambrox and other perfume fixatives, podolactone herbicides, etc., featuring shorter and more efficient processes.

  5. Measurement of Microbial Activity and Growth in the Ocean by Rates of Stable Ribonucleic Acid Synthesis

    PubMed Central

    Karl, David M.

    1979-01-01

    A relatively simple and extremely sensitive technique for measuring rates of stable ribonucleic acid (RNA) synthesis was devised and applied to bacterial cultures and seawater samples. The procedure is based upon the uptake and incorporation of exogenous radiolabeled adenine into cellular RNA. To calculate absolute rates of synthesis, measurements of the specific radioactivity of the intracellular adenosine 5′-triphosphate pools (precursor to RNA) and of the total amount of radioactivity incorporated into stable cellular RNA per unit time are required. Since the rate of RNA synthesis is positively correlated with growth rate, measurements of RNA synthesis should be extremely useful for estimating and comparing the productivities of microbial assemblages in nature. Adenosine 5′-triphosphate, adenylate energy charge, and rates of stable RNA synthesis have been measured at a station located in the Columbian Basin of the Caribbean Sea. A subsurface peak in RNA synthesis (and therefore growth) was located within the dissolved oxygen minimum zone (450 m), suggesting in situ microbiological utilization of dissolved molecular oxygen. Calculations of the specific rates of RNA synthesis (i.e., RNA synthesis per unit of biomass) revealed that the middepth maximum corresponded to the highest specific rate of growth (420 pmol of adenine incorporated into RNA·day−1) of all depths sampled, including the euphotic zone. The existence of an intermediate depth zone of active microbial growth may be an important site for nutrient regeneration and may serve as a source of reduced carbon for mesopelagic and deep sea environments. PMID:16345461

  6. Squaric acid ester-based total synthesis of echinochrome A.

    PubMed

    Peña-Cabrera, Eduardo; Liebeskind, Lanny S

    2002-03-01

    The total synthesis of echinochrome A is described. Both key intermediates 5 and 8 were efficiently prepared from diisopropyl squarate 7. Nucleophilic addition of aryllithium 8 to 5, followed by thermal ring-expansion/cyclization of the 1,2-adduct 4, furnished hydroquinone 3. Oxidation and full deprotection of 3 gave the title compound.

  7. MAFG is a transcriptional repressor of bile acid synthesis and metabolism.

    PubMed

    de Aguiar Vallim, Thomas Q; Tarling, Elizabeth J; Ahn, Hannah; Hagey, Lee R; Romanoski, Casey E; Lee, Richard G; Graham, Mark J; Motohashi, Hozumi; Yamamoto, Masayuki; Edwards, Peter A

    2015-02-01

    Specific bile acids are potent signaling molecules that modulate metabolic pathways affecting lipid, glucose and bile acid homeostasis, and the microbiota. Bile acids are synthesized from cholesterol in the liver, and the key enzymes involved in bile acid synthesis (Cyp7a1, Cyp8b1) are regulated transcriptionally by the nuclear receptor FXR. We have identified an FXR-regulated pathway upstream of a transcriptional repressor that controls multiple bile acid metabolism genes. We identify MafG as an FXR target gene and show that hepatic MAFG overexpression represses genes of the bile acid synthetic pathway and modifies the biliary bile acid composition. In contrast, loss-of-function studies using MafG(+/-) mice causes de-repression of the same genes with concordant changes in biliary bile acid levels. Finally, we identify functional MafG response elements in bile acid metabolism genes using ChIP-seq analysis. Our studies identify a molecular mechanism for the complex feedback regulation of bile acid synthesis controlled by FXR.

  8. MAFG Is a Transcriptional Repressor of Bile Acid Synthesis and Metabolism

    PubMed Central

    de Aguiar Vallim, Thomas Q.; Tarling, Elizabeth J.; Ahn, Hannah; Hagey, Lee R.; Romanoski, Casey E.; Lee, Richard G.; Graham, Mark J.; Motohashi, Hozumi; Yamamoto, Masayuki; Edwards, Peter A.

    2015-01-01

    Summary Specific bile acids are potent signaling molecules that modulate metabolic pathways affecting lipid, glucose and bile acid homeostasis and the microbiota. Bile acids are synthesized from cholesterol in the liver, and the key enzymes involved in bile acid synthesis (Cyp7a1, Cyp8b1) are regulated transcriptionally by the nuclear receptor FXR. We have identified an FXR-regulated pathway upstream of a transcriptional repressor that controls multiple bile acid metabolism genes. We identify MafG as an FXR target gene and show that hepatic MAFG overexpression represses genes of the bile acid synthetic pathway, and modifies the biliary bile acid composition. In contrast, loss-of-function studies using MafG+/− mice causes de-repression of the same genes with concordant changes in biliary bile acid levels. Finally, we identify functional MafG response elements in bile acid metabolism genes using ChIP-Seq analysis. Our studies identify a molecular mechanism for the complex feedback regulation of bile acid synthesis controlled by FXR. PMID:25651182

  9. Racemic synthesis and solid phase peptide synthesis application of the chimeric valine/leucine derivative 2-amino-3,3,4-trimethyl-pentanoic acid.

    PubMed

    Pelà, M; Del Zoppo, L; Allegri, L; Marzola, E; Ruzza, C; Calo, G; Perissutti, E; Frecentese, F; Salvadori, S; Guerrini, R

    2014-07-01

    The synthesis of non natural amino acid 2-amino-3,3,4-trimethyl-pentanoic acid (Ipv) ready for solid phase peptide synthesis has been developed. Copper (I) chloride Michael addition, followed by a Curtius rearrangement are the key steps for the lpv synthesis. The racemic valine/leucine chimeric amino acid was then successfully inserted in position 5 of neuropeptide S (NPS) and the diastereomeric mixture separated by reverse phase HPLC. The two diastereomeric NPS derivatives were tested for intracellular calcium mobilization using HEK293 cells stably expressing the mouse NPS receptor where they behaved as partial agonist and pure antagonist.

  10. Relationship of lipogenic enzyme activities to the rate of rat liver fatty acid synthesis

    SciTech Connect

    Nelson, G.; Kelley, D.; Schmidt, P.; Virk, S.; Serrato, C.

    1986-05-01

    The mechanism by which diet regulates liver lipogenesis is unclear. Here the authors report how dietary alterations effect the activities of key enzymes of fatty acid (FA) synthesis. Male Sprague-Dawley rats, 400-500 g, were fasted for 48h and then refed a fat-free, high carbohydrate (HC) diet (75% cal. from sucrose) for 0,3,9,24 and 48h, or refed a HC diet for 48h, then fed a high-fat (HF) diet (44% cal. from corn oil) for 3,9,24 and 48h. The FA synthesis rate and the activities of acetyl CoA carboxylase (AC), fatty acid synthase (FAS), ATP citrate lyase (CL), and glucose 6-phosphate dehydrogenase (G6PDH) were determined in the livers. FA synthesis was assayed with /sup 3/H/sub 2/O, enzyme activities were measured spectrophotometrically except for AC which was assayed with /sup 14/C-bicarbonate. There was no change in the activity of AC during fasting or on the HC diet. Fasting decreased the rate of FA synthesis by 25% and the activities of FAS and CL by 50%; refeeding the HC diet induced parallel changes in FA synthesis and the activities of FAS, CL, and G6PDH. After 9h on the HF diet, FA synthesis had decreased sharply, AC activity increased significantly while no changes were detected in the other activities. Subsequently FA synthesis did not change while the activities of the enzymes decreased slowly. These enzymes did not appear to regulate FA synthesis during inhibition of lipogenesis, but FAS, CL or G6PDH may be rate limiting in the induction phase. Other key factors may regulate FA synthesis during dietary alterations.

  11. A Nitrogen-Assisted One-Pot Heteroaryl Ketone Synthesis from Carboxylic Acids and Heteroaryl Halides.

    PubMed

    Demkiw, Krystyna; Araki, Hirofumi; Elliott, Eric L; Franklin, Christopher L; Fukuzumi, Yoonjoo; Hicks, Frederick; Hosoi, Kazushi; Hukui, Tadashi; Ishimaru, Yoichiro; O'Brien, Erin; Omori, Yoshimasa; Mineno, Masahiro; Mizufune, Hideya; Sawada, Naotaka; Sawai, Yasuhiro; Zhu, Lei

    2016-04-15

    A practical and highly effective one-pot synthesis of versatile heteroaryl ketones directly from carboxylic acids and heteroaryl halides under mild conditions is reported. This method does not require derivatization of carboxylic acids (preparation of acid chlorides, Weinreb amides, etc.) or the use of any additives/catalysts. A wide substrate scope of carboxylic acids with high functional group tolerance has also been demonstrated. The results reveal that the presence of an α-nitrogen on the halide substrate greatly improves the desired ketone formation.

  12. A note on the prebiotic synthesis of organic acids in carbonaceous meteorites

    NASA Technical Reports Server (NTRS)

    Kerridge, John F.

    1991-01-01

    Strong similarities between monocarboxylic and hydrocarboxylic acids in the Murchison meteorite suggest corresponding similarities in their origins. However, various lines of evidence apparently implicate quite different precursor compounds in the synthesis of the different acids. These seeming inconsistencies can be resolved by postulating that the apparent precursors also share a related origin. Pervasive D enrichment indicates that this origin was in a presolar molecular cloud. The organic acids themselves were probably synthesized in an aqueous environment on an asteroidal parent body, the hydroxy (and amino) acids by means of the Strecker cyanohydrin reaction.

  13. Physical Characterisation as an Insight into a Gene Delivery System Containing Cyclodextrins with Pluronic®-F127 and Folic acid as Non-Viral Vectors.

    PubMed

    Eng, Matthew; Elkordy, Amal A; McCarron, Paul A; Elkordy, Eman A; Faheem, Ahmed

    2014-01-01

    Gene delivery into cells offers opportunities to treat various human genetic diseases. Effective gene delivery is dependent on its stability and ability to transfect across cells. DNA is susceptible to enzymatic degradation and its negatively charge are barriers towards successful transfection. DNA has to be protected from degradation and neutralised. Non-viral vectors are preferred carrier systems, therefore, the use of cyclodextrins with Pluronic(®)-F127 and folic acid at different concentrations to stabilise the formulation was investigated. Formulations were characterised in fresh and freeze dried forms. DNA stability in formulations was tested by determining the stability of DNA against enzymatic degradation. Degree of DNA inclusion into cyclodextrins was investigated using fluorescence spectroscopy. Thermal behaviour was studied using Differential Scanning Calorimetry (DSC). Incorporation of Pluronic(®)-F127 produced most stable formulations regarding enzymatic degradation. These formulations show high percentage inclusion. Shift of peaks in FTIR data, appearance of uniform particulate as detected by SEM and changing in the denaturation temperature as demonstrated by DSC data for Pluronic(®)-F127 containing formulations confirm clear interaction between Pluronic(®)-F127 and cyclodextrin/ DNA complex. It was noted that γ-cyclodextrin provide better protection and inclusion compared to β-cyclodextrin. Pluronic(®)-F127 with cyclodextrins is a promising combination to improve stability.

  14. Modulation by Amino Acids: Toward Superior Control in the Synthesis of Zirconium Metal-Organic Frameworks.

    PubMed

    Gutov, Oleksii V; Molina, Sonia; Escudero-Adán, Eduardo C; Shafir, Alexandr

    2016-09-12

    The synthesis of zirconium metal-organic frameworks (Zr MOFs) modulated by various amino acids, including l-proline, glycine, and l-phenylalanine, is shown to be a straightforward approach toward functional-group incorporation and particle-size control. High yields in Zr-MOF synthesis are achieved by employing 5 equivalents of the modulator at 120 °C. At lower temperatures, the method provides a series of Zr MOFs with increased particle size, including many suitable for single-crystal X-ray diffraction studies. Furthermore, amino acid modulators can be incorporated at defect sites in Zr MOFs with an amino acid/ligand ratio of up to 1:1, depending on the ligand structure and reaction conditions. The MOFs obtained through amino acid modulation exhibit an improved CO2 -capture capacity relative to nonfunctionalized materials. PMID:27482849

  15. Bacterial synthesis of polysialic acid lactosides in recombinant Escherichia coli K-12.

    PubMed

    Richard, Emeline; Buon, Laurine; Drouillard, Sophie; Fort, Sébastien; Priem, Bernard

    2016-07-01

    Bacterial polysialyltransferases (PSTs) are processive enzymes involved in the synthesis of polysialic capsular polysaccharides. They can also synthesize polysialic acid in vitro from disialylated and trisialylated lactoside acceptors, which are the carbohydrate moieties of GD3 and GT3 gangliosides, respectively. Here, we engineered a non-pathogenic Escherichia coli strain that overexpresses recombinant sialyltransferases and sialic acid synthesis genes and can convert an exogenous lactoside into polysialyl lactosides. Several PSTs were assayed for their ability to synthesize polysialyl lactosides in the recombinant strains. Fed-batch cultures produced α-2,8 polysialic acid or alternate α-2,8-2,9 polysialic acid in quantities reaching several grams per liter. Bacterial culture in the presence of propargyl-β-lactoside as the exogenous acceptor led to the production of conjugatable polysaccharides by means of copper-assisted click chemistry. PMID:26927318

  16. Modulation by Amino Acids: Toward Superior Control in the Synthesis of Zirconium Metal-Organic Frameworks.

    PubMed

    Gutov, Oleksii V; Molina, Sonia; Escudero-Adán, Eduardo C; Shafir, Alexandr

    2016-09-12

    The synthesis of zirconium metal-organic frameworks (Zr MOFs) modulated by various amino acids, including l-proline, glycine, and l-phenylalanine, is shown to be a straightforward approach toward functional-group incorporation and particle-size control. High yields in Zr-MOF synthesis are achieved by employing 5 equivalents of the modulator at 120 °C. At lower temperatures, the method provides a series of Zr MOFs with increased particle size, including many suitable for single-crystal X-ray diffraction studies. Furthermore, amino acid modulators can be incorporated at defect sites in Zr MOFs with an amino acid/ligand ratio of up to 1:1, depending on the ligand structure and reaction conditions. The MOFs obtained through amino acid modulation exhibit an improved CO2 -capture capacity relative to nonfunctionalized materials.

  17. Prediction and Characterisation of the System Effects of Aristolochic Acid: A Novel Joint Network Analysis towards Therapeutic and Toxicological Mechanisms

    PubMed Central

    Nie, Wenna; Lv, Yana; Yan, Leyu; Chen, Xi; Lv, Haitao

    2015-01-01

    Aristolochic acid (AA) is the major active component of medicinal plants from the Aristolochiaceae family of flowering plants widely utilized for medicinal purposes. However, the molecular mechanisms of AA systems effects remain poorly understood. Here, we employed a joint network analysis that combines network pharmacology, a protein–protein interaction (PPI) database, biological processes analysis and functional annotation analysis to explore system effects. Firstly, we selected 15 protein targets (14 genes) in the PubChem database as the potential target genes and used PPI knowledge to incorporate these genes into an AA-specific gene network that contains 129 genes. Secondly, we performed biological processes analysis for these AA-related targets using ClueGO, some of new targeted genes were randomly selected and experimentally verified by employing the Quantitative Real-Time PCR assay for targeting the systems effects of AA in HK-2 cells with observed dependency of concentration. Thirdly, the pathway-based functional enrichment analysis was manipulated using WebGestalt to identify the mostly significant pathways associated with AA. At last, we built an AA target pathway network of significant pathways to predict the system effects. Taken together, this joint network analysis revealed that the systematic regulatory effects of AA on multidimensional pathways involving both therapeutic action and toxicity. PMID:26620132

  18. Development and characterisation of ursolic acid nanocrystals without stabiliser having improved dissolution rate and in vitro anticancer activity.

    PubMed

    Song, Ju; Wang, Yancai; Song, Yuelin; Chan, Hokman; Bi, Chao; Yang, Xiao; Yan, Ru; Wang, Yitao; Zheng, Ying

    2014-02-01

    Ursolic acid (UA), which is a natural pentacyclic triterpenoid, has the potential to be developed as an anticancer drug, whereas its poor aqueous solubility and dissolution rate limit its clinical application. The aim of the present study was to develop UA nanocrystals to enhance its aqueous dispersibility, dissolution rate and anticancer activity. Following the investigation on the effects of stabiliser, the ratio of organic phase to aqueous solution and drug concentration, the UA nanocrystals without stabiliser were successfully prepared by anti-solvent precipitation approach. The nanocrystals maintained similar crystallinity with particle size, polydispersion index and zeta potential values of 188.0 ± 4.4 nm, 0.154 ± 0.022, and -25.0 ± 5.9 mV, respectively. Compared with the raw material, the UA nanocrystals showed good aqueous dispensability and a higher dissolution rate, and they could be completely dissolved in 0.5% SDS solution within 120 min. Moreover, the suspension of UA nanocrystals was physically stable after storage at 4°C for 7 weeks. By inducing G2/M phase cell cycle arrest, the UA nanocrystals significantly induced stronger cell growth inhibition activity against MCF-7 cells compared with free drug in vitro, although the uptake of free UA was approximately twice higher than that of the UA nanocrystals. The UA nanocrystals may be used as a potential delivery formulation for intravenous injection with enhanced dissolution velocity and anticancer activity. PMID:24022345

  19. Increased Production of Fatty Acids and Triglycerides in Aspergillus oryzae by Enhancing Expressions of Fatty Acid Synthesis-Related Genes

    SciTech Connect

    Tamano, Koichi; Bruno, Kenneth S.; Karagiosis, Sue A.; Culley, David E.; Deng, Shuang; Collett, James R.; Umemura, Myco; Koike, Hideaki; Baker, Scott E.; Machida, Masa

    2013-01-01

    Microbial production of fats and oils is being developedas a means of converting biomass to biofuels. Here we investigate enhancing expression of enzymes involved in the production of fatty acids and triglycerides as a means to increase production of these compounds in Aspergillusoryzae. Examination of the A.oryzaegenome demonstrates that it contains twofatty acid synthases and several other genes that are predicted to be part of this biosynthetic pathway. We enhancedthe expressionof fatty acid synthesis-related genes by replacing their promoters with thepromoter fromthe constitutively highly expressedgene tef1. We demonstrate that by simply increasing the expression of the fatty acid synthasegenes we successfullyincreasedtheproduction of fatty acids and triglyceridesby more than two fold. Enhancement of expression of the fatty acid pathway genes ATP-citrate lyase and palmitoyl-ACP thioesteraseincreasedproductivity to a lesser extent.Increasing expression ofacetyl-CoA carboxylase caused no detectable change in fatty acid levels. Increases in message level for each gene were monitored usingquantitative real-time RT-PCR. Our data demonstrates that a simple increase in the abundance of fatty acid synthase genes can increase the detectable amount of fatty acids.

  20. Polymers from fatty acids: poly(ω-hydroxyl tetradecanoic acid) synthesis and physico-mechanical studies.

    PubMed

    Liu, Chen; Liu, Fei; Cai, Jiali; Xie, Wenchun; Long, Timothy E; Turner, S Richard; Lyons, Alan; Gross, Richard A

    2011-09-12

    This Article describes the synthesis and physicomechanical properties of bioplastics prepared from methyl ω-hydroxytetradecanoic acid (Me-ω-OHC14), a new monomer available by a fermentation process using an engineered Candida tropicalis strain. Melt-condensation experiments were conducted using titanium tetraisopropoxide (Ti[OiPr](4)) as a catalyst in a two-stage polymerization (2 h at 200 °C under N(2), 4 h at 220 °C under 0.1 mmHg). Poly(ω-hydroxytetradecanoate), P(ω-OHC14), M(w), determined by SEC-MALLS, increased from 53K to 110K as the Ti(OiPr)(4) concentration increased from 50 to 300 ppm. By varying the polymerization conditions (catalyst concentration, reaction time, second-stage reaction temperature) a series of P(ω-OHC14) samples were prepared with M(w) values from 53K to 140K. The synthesized polyesters with M(w) ranging from 53K to 140K were subjected to characterization by DSC, TGA, DMTA, and tensile testing. Influences of P(ω-OHC14) molecular weight, melting point, and enthalpies of melting/crystallization on material tensile properties were explored. Cold-drawing tensile tests at room temperature for P(ω-OHC14) with M(w) 53K-78K showed a brittle-to-ductile transition. In contrast, P(ω-OHC14) with M(w) 53K undergoes brittle fracture. Increasing P(ω-OHC14) M(w) above 78K resulted in a strain-hardening phenomena and tough properties with elongation at break ~700% and true tensile strength of ~50 MPa. Comparisons between high density polyethylene and P(ω-OHC14) mechanical and thermal properties as a function of their respective molecular weights are discussed. PMID:21793591

  1. [Synthesis, characterization and application of polyglycerols and polyglycerol fatty acid esters].

    PubMed

    Behrens, H; Mieth, G

    1984-01-01

    The current state of knowledge in the field of synthesis and properties of polyglycerols and polyglycerol fatty acid esters is presented. Alternatives for the analytical characterization of these families by means of physico-chemical methods, with special reference to chromatography and spectroscopy, are described. Furthermore, the use of polyglycerol fatty acid esters as food additives is considered from the view-points of the physiology of nutrition and of processing technology.

  2. 5'to 3' nucleic acid synthesis using 3'-photoremovable protecting group

    DOEpatents

    Pirrung, Michael C.; Shuey, Steven W.; Bradley, Jean-Claude

    1999-01-01

    The present invention relates, in general, to a method of synthesizing a nucleic acid, and, in particular, to a method of effecting 5' to 3' nucleic acid synthesis. The method can be used to prepare arrays of oligomers bound to a support via their 5' end. The invention also relates to a method of effecting mutation analysis using such arrays. The invention further relates to compounds and compositions suitable for use in such methods.

  3. 5[prime] to 3[prime] nucleic acid synthesis using 3[prime]-photoremovable protecting group

    DOEpatents

    Pirrung, M.C.; Shuey, S.W.; Bradley, J.C.

    1999-06-01

    The present invention relates, in general, to a method of synthesizing a nucleic acid, and, in particular, to a method of effecting 5[prime] to 3[prime] nucleic acid synthesis. The method can be used to prepare arrays of oligomers bound to a support via their 5[prime] end. The invention also relates to a method of effecting mutation analysis using such arrays. The invention further relates to compounds and compositions suitable for use in such methods.

  4. Novel enzymatic synthesis of 4-O-cinnamoyl quinic and shikimic acid derivatives.

    PubMed

    Armesto, Nuria; Ferrero, Miguel; Fernández, Susana; Gotor, Vicente

    2003-07-11

    The first direct synthesis of 4-O-cinnamoyl derivatives of quinic and shikimic acids were accomplished by regioselective esterification with Candida antarctica lipase A. For hydrocinnamic esters, enzymatic transesterification with vinyl esters gave excellent yields. However, more reactive acylating agents such as anhydrides were used to synthesize cinnamic derivatives of both acids. An inhibitory effect was observed with this lipase for p-methoxy, p-hydroxy, and p-acetoxy vinyl ester and anhydride derivatives (coumarate and ferulate derivatives).

  5. Improved synthesis of isostearic acid using zeolite catalysts

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Isostearic acids are unique and important biobased products with superior properties. Unfortunately, they are not widely utilized in industry because they are produced as byproducts from a process called clay-catalyzed oligomerization of tall oil fatty acids. Generally, this clay method results in...

  6. Differential regulation of protein synthesis by amino acids and insulin in peripheral and visceral tissues of neonatal pigs.

    PubMed

    Suryawan, Agus; O'Connor, Pamela M J; Bush, Jill A; Nguyen, Hanh V; Davis, Teresa A

    2009-05-01

    The high efficiency of protein deposition during the neonatal period is driven by high rates of protein synthesis, which are maximally stimulated after feeding. In the current study, we examined the individual roles of amino acids and insulin in the regulation of protein synthesis in peripheral and visceral tissues of the neonate by performing pancreatic glucose-amino acid clamps in overnight-fasted 7-day-old pigs. We infused pigs (n = 8-12/group) with insulin at 0, 10, 22, and 110 ng kg(-0.66) min(-1) to achieve approximately 0, 2, 6 and 30 muU ml(-1) insulin so as to simulate below fasting, fasting, intermediate, and fed insulin levels, respectively. At each insulin dose, amino acids were maintained at the fasting or fed level. In conjunction with the highest insulin dose, amino acids were also allowed to fall below the fasting level. Tissue protein synthesis was measured using a flooding dose of L: -[4-(3)H] phenylalanine. Both insulin and amino acids increased fractional rates of protein synthesis in longissimus dorsi, gastrocnemius, masseter, and diaphragm muscles. Insulin, but not amino acids, increased protein synthesis in the skin. Amino acids, but not insulin, increased protein synthesis in the liver, pancreas, spleen, and lung and tended to increase protein synthesis in the jejunum and kidney. Neither insulin nor amino acids altered protein synthesis in the stomach. The results suggest that the stimulation of protein synthesis by feeding in most tissues of the neonate is regulated by the post-prandial rise in amino acids. However, the feeding-induced stimulation of protein synthesis in skeletal muscles is independently mediated by insulin as well as amino acids.

  7. Mutation affecting regulation of synthesis of acetohydroxy acid synthetase in Escherichia coli K-12.

    PubMed Central

    Jackson, J H; Henderson, E K

    1975-01-01

    Altered regulation of synthesis of acetohydroxy acid synthetase (AHAS) was previously reported in a mutant of Escherichia coli strain K-12. The mutant strain, growing in minimal medium, exhibits a partial growth limiatation and derepression of AHAS, owing to deficient synthesis of isoleucine. The genetic lesion (ilvE503) causing the isoleucine limitation was shown to cause derepression of a valine-sensitive AHAS activity. The derepression effect of the ilvE503 mutation upon synthesis of AHAS was conclusively demonstrated by introducing both the ilvE503 allele and an altered AHAS (ilv-521) into the same cell. Evidence is presented that suggests the presence of multiple genetic regions for synthesis and control of the valine-sensitive AHAS activity. PMID:1089632

  8. Regulation of de novo fatty acid synthesis in maturing oilseeds of Arabidopsis.

    PubMed

    Baud, Sébastien; Lepiniec, Loïc

    2009-06-01

    As a Brassicaceae, Arabidopsis thaliana constitutes an excellent model system to investigate oil biosynthesis in seeds. Extensive tools for the genetic and molecular dissection of this model species are now available. Together with analytical procedures adapted to its tiny seeds, these tools have allowed major advances in isolating and characterising the factors that participate in the metabolic and developmental control of seed filling. Once the biochemical pathways producing storage lipids, namely triacylglycerols, were elucidated, the question of the regulation of this metabolic network has arisen. The coordinated up regulation of genes encoding enzymes of the fatty acid biosynthetic pathway observed at the onset of seed maturation suggests that the pathway may be subjected to a system of global transcriptional regulation. This has been further established by the study of master regulators of the maturation program like LEAFY COTYLEDON2 and the characterisation of the WRINKLED1 transcription factor. These factors have been shown to participate in a regulatory cascade controlling the induction of the genes involved in fatty acid biosynthesis at the onset of the maturation phase. Although much remains to be elucidated, the framework of the regulatory system controlling fatty acid biosynthesis in Arabidopsis seeds is coming into focus.

  9. Asymmetric synthesis of aromatic β-amino acids using ω-transaminase: Optimizing the lipase concentration to obtain thermodynamically unstable β-keto acids.

    PubMed

    Mathew, Sam; Jeong, Seong-Su; Chung, Taeowan; Lee, Sang-Hyeup; Yun, Hyungdon

    2016-01-01

    Synthesized aromatic β-amino acids have recently attracted considerable attention for their application as precursors in many pharmacologically relevant compounds. Previous studies on asymmetric synthesis of aromatic β-amino acids using ω-transaminases could not be done efficiently due to the instability of β-keto acids. In this study, a strategy to circumvent the instability problem of β-keto acids was utilized to generate β-amino acids efficiently via asymmetric synthesis. In this work, thermodynamically stable β-ketoesters were initially converted to β-keto acids using lipase, and the β-keto acids were subsequently aminated using ω-transaminase. By optimizing the lipase concentration, we successfully overcame the instability problem of β-keto acids and enhanced the production of β-amino acids. This strategy can be used as a general approach to efficiently generate β-amino acids from β-ketoesters.

  10. Oxidative allylic rearrangement of cycloalkenols: Formal total synthesis of enantiomerically pure trisporic acid B

    PubMed Central

    Dubberke, Silke; Abbas, Muhammad

    2011-01-01

    Summary Enantiomerically highly enriched unsaturated β-ketoesters bearing a quaternary stereocenter can be utilized as building blocks for the synthesis of natural occurring terpenes, i. a., trisporic acid and its derivatives. An advanced building block has been synthesized in a short reaction sequence, which involves an oxidative allylic rearrangement initiated by pyridinium dichromate (PDC) as the key step. PMID:21512603

  11. An Overview of Stereoselective Synthesis of α-Aminophosphonic Acids and Derivatives

    PubMed Central

    Ordóñez, Mario; Rojas-Cabrera, Haydée; Cativiela, Carlos

    2009-01-01

    An overview of all methodologies published during the last few years focused to the stereoselective (diastereoselective or enantioselective) synthesis of α-aminophosphonic acids and derivatives is reported. The procedures have been classified according a retrosynthetic strategy and taking into account the formation of each one of the bonds connected to the chiral centre. PMID:20871799

  12. POLYSTYRENE SULFONIC ACID CATALYZED GREENER SYNTHESIS OF HYDRAZONES IN AQUEOUS MEDIUM USING MICROWAVES

    EPA Science Inventory

    An environmentally benign aqueous protocol for the synthesis of cyclic, bi-cyclic, and heterocyclic hydrazones using polystyrene sulfonic acid (PSSA) as a catalyst has been developed; the simple reaction proceeds efficiently in water in the absence of any organic solvent under mi...

  13. o-Iodoxybenzoic acid mediated oxidative desulfurization initiated domino reactions for synthesis of azoles.

    PubMed

    Chaudhari, Pramod S; Pathare, Sagar P; Akamanchi, Krishnacharaya G

    2012-04-20

    A systematic exploration of thiophilic ability of o-iodoxybenzoic acid (IBX) for oxidative desulfurization to trigger domino reactions leading to new methodologies for synthesis of different azoles is described. A variety of highly substituted oxadiazoles, thiadiazoles, triazoles, and tetrazoles have been successfully synthesized in good to excellent yields, starting from readily accessible thiosemicarbazides, bis-diarylthiourea, 1,3-disubtituted thiourea, and thioamides.

  14. Recent Progress on the Stereoselective Synthesis of Cyclic Quaternary α-Amino Acids

    PubMed Central

    Cativiela, Carlos; Ordóñez, Mario

    2010-01-01

    The most recent papers describing the stereoselective synthesis of cyclic quaternary α-amino acids are collected in this review. The diverse synthetic approaches are classified according to the size of the ring and taking into account the bond that is formed to complete the quaternary skeleton. PMID:20300486

  15. Efficient Enantioselective Synthesis of Oxahelicenes Using Redox/Acid Cooperative Catalysts.

    PubMed

    Sako, Makoto; Takeuchi, Yoshiki; Tsujihara, Tetsuya; Kodera, Junpei; Kawano, Tomikazu; Takizawa, Shinobu; Sasai, Hiroaki

    2016-09-14

    An efficient and enantioselective synthesis of oxa[9]helicenes has been established via vanadium(V)-catalyzed oxidative coupling/intramolecular cyclization of polycyclic phenols. A newly developed vanadium complex cooperatively functions as both a redox and Lewis acid catalyst to promote the present sequential reaction and afford oxa[9]helicenes in good yields with up to 94% ee. PMID:27574874

  16. Insulin and amino acids stimulate whole body protein synthesis in neonates

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Insulin and amino acids (AA) stimulate muscle protein synthesis in neonatal pigs. To determine the effects of insulin and AA on whole body protein turnover, hyperinsulinemic (0 and 100 ng/(kg[0.66]/min))-euglycemic-AA clamps were performed during euaminoacidemia or hyperaminoacidemia in fasted 7-d-...

  17. Synthesis and transdermal properties of acetylsalicylic acid and selected esters.

    PubMed

    Gerber, Minja; Breytenbach, Jaco C; Hadgraft, Jonathan; du Plessis, Jeanetta

    2006-03-01

    The primary aim of this study was to determine the transdermal penetration of acetylsalicylic acid and some of its derivatives, to establish a correlation, if any, with selected physicochemical properties and to determine if transdermal application of acetylsalicylic acid and its derivatives will give therapeutic drug concentrations with respect to transdermal flux. Ten derivatives of acetylsalicylic acid were prepared by esterification of acetylsalicyloyl chloride with ten different alcohols. The experimental aqueous solubility, logD and transdermal flux values were determined for acetylsalicylic acid and its derivatives at pH 4.5. In vitro penetration was measured through excised female human abdominal skin in diffusion cells. The experimental aqueous solubility of acetylsalicylic acid (6.56 mg/ml) was higher than that of the synthesised acetylsalicylate derivatives (ranging from 1.76 x 10(-3) to 3.32 mg/ml), and the logD of acetylsalicylic acid (-0.85) was lower than that of its derivatives (ranging from -0.25 to 1.95). There was thus an inverse correlation between the aqueous solubility data and the logD values. The experimental transdermal flux of acetylsalicylic acid (263.83 nmol/cm(2)h) was much higher than that of its derivatives (ranging from 0.12 to 136.02 nmol/cm(2)h).

  18. [Asymmetric synthesis of aromatic L-amino acids catalyzed by transaminase].

    PubMed

    Xia, Wenna; Sun, Yu; Min, Cong; Han, Wei; Wu, Sheng

    2012-11-01

    Aromatic L-Amino acids are important chiral building blocks for the synthesis of many drugs, pesticides, fine chemicals and food additives. Due to the high activity and steroselectivity, enzymatic synthesis of chiral building blocks has become the main research direction in asymmetric synthesis field. Guided by the phylogenetic analysis of transaminases from different sources, two representative aromatic transaminases TyrB and Aro8 in type I subfamily, from the prokaryote Escherichia coli and eukaryote Saccharomyces cerevisia, respectively, were applied for the comparative study of asymmetric transamination reaction process and catalytic efficiency of reversely converting keto acids to the corresponding aromatic L-amino acid. Both TyrB and Aro8 could efficiently synthesize the natural aromatic amino acids phenylalanine and tyrosine as well as non-natural amino acid phenylglycine. The chiral HPLC analysis showed the produced amino acids were L-configuration and the e.e value was 100%. L-alanine was the optimal amino donor, and the transaminase TyrB and Aro8 could not use D-amino acids as amino donor. The optimal molar ratio of amino donor (L-alanine) and amino acceptor (aromatic alpha-keto acids) was 4:1. Both of the substituted group on the aromatic ring and the length of fatty acid carbon chain part in the molecular structure of aromatic substrate alpha-keto acid have the significant impact on the enzyme-catalyzed transamination efficiency. In the experiments of preparative-scale transamination synthesis of L-phenylglycine, L-phenylalanine and L-tyrosine, the specific production rate catalyzed by TryB were 0.28 g/(g x h), 0.31 g/(g x h) and 0.60 g/(g x h) and the specific production rate catalyzed by Aro8 were 0.61 g/(g x h), 0.48 g/(g x h) and 0.59 g/(g x h). The results obtained here were useful for applying the transaminases to asymmetric synthesis of L-amino acids by reversing the reaction balance in industry.

  19. Microbiologically produced carboxylic acids used as building blocks in organic synthesis.

    PubMed

    Aurich, Andreas; Specht, Robert; Müller, Roland A; Stottmeister, Ulrich; Yovkova, Venelina; Otto, Christina; Holz, Martina; Barth, Gerold; Heretsch, Philipp; Thomas, Franziska A; Sicker, Dieter; Giannis, Athanassios

    2012-01-01

    Oxo- and hydroxy-carboxylic acids are of special interest in organic synthesis. However, their introduction by chemical reactions tends to be troublesome especially with regard to stereoselectivity. We describe herein the biotechnological preparation of selected oxo- and hydroxycarboxylic acids under "green" conditions and their use as promising new building blocks. Thereby, our biotechnological goal was the development of process fundamentals regarding the variable use of renewable raw materials, the development of a multi purpose bioreactor and application of a pilot plant with standard equipment for organic acid production to minimize the technological effort. Furthermore the development of new product isolation procedures, with the aim of direct product recovery, capture of products or single step operation, was necessary. The application of robust and approved microorganisms, also genetically modified, capable of using a wide range of substrates as well as producing a large spectrum of products, was of special importance. Microbiologically produced acids, like 2-oxo-glutaric acid and 2-oxo-D-gluconic acid, are useful educts for the chemical synthesis of hydrophilic triazines, spiro-connected heterocycles, benzotriazines, and pyranoic amino acids. The chiral intermediate of the tricarboxylic acid cycle, (2R,3S)-isocitric acid, is another promising compound. For the first time our process provides large quantities of enantiopure trimethyl (2R,3S)-isocitrate which was used in subsequent chemical transformations to provide new chiral entities for further usage in total synthesis and pharmaceutical research.Oxo- and hydroxy-carboxylic acids are of special interest in organic synthesis. However, their introduction by chemical reactions tends to be troublesome especially with regard to stereoselectivity. We describe herein the biotechnological preparation of selected oxo- and hydroxycarboxylic acids under "green" conditions and their use as promising new building

  20. Synthesis and biological evaluation of novel lipoamino acid derivatives.

    PubMed

    Kaki, Shiva Shanker; Arukali, Sammaiah; Korlipara, Padmaja V; Prasad, R B N; Yedla, Poornachandra; Ganesh Kumar, C

    2016-01-01

    Seven novel lipoamino acid conjugates were synthesized from methyl oleate and amino acids. Methyl oleate was grafted to different amino acids using thioglycolic acid as a spacer group. Seven derivatives (3a-g) were prepared and characterized by spectral data (NMR, IR and MS spectral studies). All the derivatives were studied for their antimicrobial, anti-biofilm and anticancer activities. Among all the derivatives, it was found that compound 3b was the most potent antibacterial compound which showed good activity against four Gram positive bacterial strains and also exhibited excellent antifungal activity against a fungal strain. In the anti-biofilm assay, compound 3b showed promising activity with IC50 value of 2.8μM against Bacillus subtilis MTCC 121. All the compounds showed anticancer activities with 3c showing promising anticancer activity (IC50=15.3-22.4μM) against the four cell lines tested. PMID:26586599

  1. New multifunctional phosphonic acid for metal phosphonate synthesis

    NASA Astrophysics Data System (ADS)

    Garczarek, Piotr; Janczak, Jan; Zoń, Jerzy

    2013-03-01

    A new heterotopic phosphonic acid, 3-amino-5-(dihydroxyphosphoryl)benzoic acid (1) has been synthesized and obtained in the crystalline form. Second multifunctional phosphonic acid - namely 3-(dihydroxyphosphoryl)-5-nitrobenzoic acid (2) has also been obtained, following a different synthetic route than previously reported. Compound 1 crystallizes in a centrosymmetric space group of the triclinic system as monohydrate, sbnd C6H3(NH2)(COOH)PO3H2·H2O -1a. The molecule in the crystal exists in a zwitterionic form, in which one of the proton of the phosphonic group is transferred to the amine group. The zwitterionic molecules interact to each other and with water molecules via Nsbnd H…O and Osbnd H…O hydrogen bonds forming a three-dimensional network.

  2. Synthesis and evaluation of dioleoyl glyceric acids showing antitrypsin activity.

    PubMed

    Habe, Hiroshi; Fukuoka, Tokuma; Sato, Shun; Kitamoto, Dai; Sakaki, Keiji

    2011-01-01

    Previously, Lešová et al. reported the isolation and identification of metabolite OR-1, showing antitrypsin activity, produced during fermentation by Penicillium funiculosum. The structure of OR-1 was a mixture of glyceric acid (GA), esterified with C(14)-C(18) fatty acids, and oleic acid (C18:1) as the most predominant fatty acid (Folia Microbiol. 46, 21-23, 2001). In this study, dioleoyl D-GA and dioleoyl L-GA were synthesized via diesterification with oleoyl chloride, and their antitrypsin activities were evaluated using both a disk diffusion method and spectral absorption measurements. The results show that both compounds and their equivalent mixtures possess antitrypsin activities; however, their IC(50) values (approximately 2 mM) are much higher than that of OR-1 (4.25 µM), suggesting that dioleoyl GA does not play a major role in the OR-1 antitrypsin activity. PMID:21606621

  3. Selection on synthesis cost affects interprotein amino acid usage in all three domains of life.

    PubMed

    Swire, Jonathan

    2007-05-01

    Most investigations of the forces shaping protein evolution have focused on protein function. However, cells are typically 50%-75% protein by dry weight, with protein expression levels distributed over five orders of magnitude. Cells may, therefore, be under considerable selection pressure to incorporate amino acids that are cheap to synthesize into proteins that are highly expressed. Such selection pressure has been demonstrated to alter amino acid usage in a few organisms, but whether "cost selection" is a general phenomenon remains unknown. One reason for this is that reliable protein expression level data is not available for most organisms. Accordingly, I have developed a new method for detecting cost selection. This method depends solely on interprotein gradients in amino acid usage. Applying it to an analysis of 43 whole genomes from all three domains of life, I show that selection on the synthesis cost of amino acids is a pervasive force in shaping the composition of proteins. Moreover, some amino acids have different price tags for different organisms--the cost of amino acids is changed for organisms living in hydrothermal vents compared with those living at the sea surface or for organisms that have difficulty acquiring elements such as nitrogen compared with those that do not--so I also investigated whether differences between organisms in amino acid usage might reflect differences in synthesis or acquisition costs. The results suggest that organisms evolve to alter amino acid usage in response to environmental conditions.

  4. Synthesis of an indole analog of folic acid

    SciTech Connect

    Shengeliya, M.S.; Avramenko, V.G.; Kuleshova, L.N.; Ershova, Yu.A.; Chernov, V.A.; Surorov, N.N.

    1987-06-01

    The authors study the replacement of the p-aminobenzoic acid (PABA) moiety. The authors synthesized an indole analog of folic acid, namely dimethyl N-(5-(2'-amino-4'-oxo-6'-pteridinyl)methylaminoindol-2-yl)glutamate. The physicochemical properties and the chemical shifts in the PMR spectra of the compounds obtained are shown. The examination of the compound for antitumor activity was carried out using rats and mice.

  5. Synthesis and antifungal activity of cinnamic acid esters.

    PubMed

    Tawata, S; Taira, S; Kobamoto, N; Zhu, J; Ishihara, M; Toyama, S

    1996-05-01

    Cinnamic, p-coumaric and ferulic acids were isolated from pineapple stems (Ananas comosus var. Cayenne). Twenty-four kinds of esters were prepared from these acids, alcohols and the components of Alpinia. Isopropyl 4-hydroxycinnamate (11) and butyl 4-hydroxycinnamate (12) were found to have almost the same effectiveness in antifungal activity against Pythium sp. at 10 ppm as that of the commercial fungicide iprobenfos (kitazin P).

  6. Induction of cellular deoxyribonucleic acid synthesis in butyrate-treated cells by simian virus 40 deoxyribonucleic acid

    SciTech Connect

    Kawasaki, S.; Diamond, L.; Baserga, R.

    1981-11-01

    Sodium butyrate (3mM) inhibited the entry into the S phase of quiescent 3T3 cells stimulated by serum, but had no effect on the accumulation of cellular ribonucleic acid. Simian virus 40 infection or manual microinjection of cloned fragments from the simian virus 40 A gene caused quiescent 3T3 cells to enter the S phase even in the presence of butyrate. NGI cells, a line of 3T3 cells transformed by simian virus 40, grew vigorously in 3 mM butyrate. Homokaryons were formed between G/sub 1/ and S-phase 3T3 cells. Butyrate inhibited the induction of deoxyribonucleic acid synthesis that usually occurs in G/sub 1/ nuclei when G/sub 1/ cells are fused with S-phase cells. However, when G/sub 1/ 3T3 cells were fused with exponentially growing NGI cells, the 3T3 nuclei were induced to enter deoxyribonucleic acid synthesis. In tsAF8 cells, a ribonucleic acid polymerase II mutant that stops in the G/sub 1/ phase of the cell cycle, no temporal sequence was demonstrated between the butyrate block and the temperature-sensitive block. These results confirm previous reports that certain virally coded proteins can induce cell deoxyribonucleic acid synthesis in the absence of cellular functions that are required by serum-stimulated cells. The author's interpretation of these data is that butyrate inhibited cell growth by inhibiting the expression of genes required for the G/sub o/ ..-->.. G/sub 1/ ..-->.. S transition and that the product of the simian virus 40 A gene overrode this inhibition by providing all of the necessary functions for the entry into the S phase.

  7. Mitochondrial acyl carrier protein is involved in lipoic acid synthesis in Saccharomyces cerevisiae.

    PubMed

    Brody, S; Oh, C; Hoja, U; Schweizer, E

    1997-05-19

    The yeast gene, ACP1, encoding the mitochondrial acyl carrier protein, was deleted by gene replacement. The resulting acp1-deficient mutants had only 5-10% of the wild-type lipoic acid content remaining, and exhibited a respiratory-deficient phenotype. Upon meiosis, the lipoate deficiency co-segregated with the acp1 deletion. The role of ACP1 in long-chain fatty acid synthesis was studied in fast and fas2 null mutants completely lacking cytoplasmic fatty acid synthase. When grown on odd-chain (13:0 and 15:0) fatty acids, these cells showed less than 1% of C-16 and C-18 acids in their total lipids. Mitochondrial ACP is therefore suggested to be involved with the biosynthesis of octanoate, a precursor to lipoic acid. PMID:9187370

  8. Synthesis of locked cyclohexene and cyclohexane nucleic acids (LCeNA and LCNA) with modified adenosine units.

    PubMed

    Šála, Michal; Dejmek, Milan; Procházková, Eliška; Hřebabecký, Hubert; Rybáček, Jiří; Dračínský, Martin; Novák, Pavel; Rosenbergová, Šárka; Fukal, Jiří; Sychrovský, Vladimír; Rosenberg, Ivan; Nencka, Radim

    2015-03-01

    We describe here the preparation of conformationally locked cyclohexane nucleic acids designed as hybrids between locked nucleic acids (LNAs) and cyclohexene nucleic acids (CeNAs), both of which excel in hybridization with complementary RNAs. We have accomplished the synthesis of these adenine derivatives starting from a simple ketoester and installed all four chiral centres by means of total synthesis. The acquired monomers were incorporated into nonamer oligonucleotides.

  9. Retinol metabolism in LLC-PK1 Cells. Characterization of retinoic acid synthesis by an established mammalian cell line.

    PubMed

    Napoli, J L

    1986-10-15

    Specific assays, based on gas chromatography-mass spectrometry and high-performance liquid chromatography, were used to quantify the conversion of retinol and retinal into retinoic acid by the pig kidney cell line LLC-PK1. Retinoic acid synthesis was linear for 2-4 h as well as with graded amounts of either substrate to at least 50 microM. Retinoic acid concentrations increased through 6-8 h, but decreased thereafter because of substrate depletion (t1/2 of retinol = 13 h) and product metabolism (1/2 = 2.3 h). Retinoic acid metabolism was accelerated by treating cells with 100 nM retinoic acid for 10 h (t1/2 = 1.7 h) and was inhibited by the antimycotic imidazole ketoconazole. Feedback inhibition was not indicated since retinoic acid up to 100 nM did not inhibit its own synthesis. Retinol dehydrogenation was rate-limiting. The reduction and dehydrogenation of retinal were 4-8-fold and 30-60-fold faster, respectively. Greater than 95% of retinol was converted into metabolites other than retinoic acid, whereas the major metabolite of retinal was retinoic acid. The synthetic retinoid 13-cis-N-ethylretinamide inhibited retinoic acid synthesis, but 4-hydroxylphenylretinamide did not. 4'-(9-Acridinylamino)methanesulfon-m-anisidide, an inhibitor of aldehyde oxidase, and ethanol did not inhibit retinoic acid synthesis. 4-Methylpyrazole was a weak inhibitor: disulfiram was a potent inhibitor. These data indicate that retinol dehydrogenase is a sulfhydryl group-dependent enzyme, distinct from ethanol dehydrogenase. Homogenates of LLC-PK1 cells converted retinol into retinoic acid and retinyl palmitate and hydrolyzed retinyl palmitate. This report suggests that substrate availability, relative to enzyme activity/amount, is a primary determinant of the rate of retinoic acid synthesis, identifies inhibitors of retinoic acid synthesis, and places retinoic acid synthesis into perspective with several other known pathways of retinoid metabolism. PMID:3759984

  10. In vitro synthesis of arachidonoyl amino acids by cytochrome c.

    PubMed

    McCue, Jeffrey M; Driscoll, William J; Mueller, Gregory P

    2009-11-01

    Arachidonoyl amino acids are a class of endogenous lipid messengers that are expressed in the mammalian central nervous system and peripherally. While several of their prominent pharmacologic effects have been documented, the mechanism by which arachidonoyl amino acids are biosynthesized has not been defined. We have previously observed that the mitochondrial protein, cytochrome c, is capable of catalyzing the formation of the prototypic arachidonoyl amino acid, arachidonoyl glycine, utilizing arachidonoyl CoA and glycine as substrates, in the presence of hydrogen peroxide. Here we report that cytochrome c is similarly able to catalyze the formation of N-arachidonoyl serine, N-arachidonoyl alanine, and N-arachidonoyl gamma aminobutyric acid from arachidonoyl CoA and the respective amino acids. The identities of the arachidonoyl amino acid products were verified by mass spectral fragmentation pattern analysis. The synthetic reactions exhibited Michaelis-Menten kinetics and continued favorably at physiologic temperature and pH. Spectral data indicate that both cytochrome c protein structure and a +3 heme iron oxidation state are required for the reaction mechanism to proceed optimally. Reactions designed to catalyze the formation of N-arachidonoyl dopamine were not efficient due to the rapid oxidation of dopamine substrate by hydrogen peroxide, consuming both reactants. Finally, under standard assay conditions, arachidonoyl CoA and ethanolamine were found to react spontaneously to form anandamide, independent of cytochrome c and hydrogen peroxide. Accordingly, it was not possible to demonstrate a potential role for cytochrome c in the biosynthetic mechanism for either arachidonoyl dopamine or anandamide. However, the ability of cytochrome c to effectively catalyze the formation of N-arachidonoyl serine, N-arachidonoyl alanine, and N-arachidonoyl gamma aminobutyric acid in vitro highlights its potential role for the generation of these lipid messengers in vivo.

  11. Inhibition of Fatty Acid Synthesis Induces Apoptosis of Human Pancreatic Cancer Cells.

    PubMed

    Nishi, Koji; Suzuki, Kenta; Sawamoto, Junpei; Tokizawa, Yuma; Iwase, Yumiko; Yumita, Nagahiko; Ikeda, Toshihiko

    2016-09-01

    Cancer cells tend to have a high requirement for lipids, including fatty acids, cholesterol and triglyceride, because of their rapid proliferative rate compared to normal cells. In this study, we investigated the effects of inhibition of lipid synthesis on the proliferation and viability of human pancreatic cancer cells. Of the inhibitors of lipid synthesis that were tested, 5-(tetradecyloxy)-2-furoic acid (TOFA), which is an inhibitor of acetyl-CoA carboxylase, and the fatty acid synthase (FAS) inhibitors cerulenin and irgasan, significantly suppressed the proliferation of MiaPaCa-2 and AsPC-1 cells. Treatment of MiaPaCa-2 cells with these inhibitors significantly increased the number of apoptotic cells. In addition, TOFA increased caspase-3 activity and induced cleavage of poly (ADP-ribose) polymerase in MiaPaCa-2 cells. Moreover, addition of palmitate to MiaPaCa-2 cells treated with TOFA rescued cells from apoptotic cell death. These results suggest that TOFA induces apoptosis via depletion of fatty acids and that, among the various aspects of lipid metabolism, inhibition of fatty acid synthesis may be a notable target for the treatment of human pancreatic cancer cells. PMID:27630308

  12. Nature's Starships: Amino Acid Synthesis, Frequency, and Delivery to Earth via Meteorites

    NASA Astrophysics Data System (ADS)

    Cobb, Alyssa; Pudritz, Ralph

    2013-07-01

    Understanding the origin of organic molecules on Earth is vital to our understanding of the origins of life. One proposed mechanism for the introduction of organic material to our planet is via meteorite impacts. Meteoritic parent bodies contain organic material and water ice, which, given radionuclide decay in their interiors, cause the ice to melt and the parent bodies to undergo a process called aqueous alteration. An example of this internal chemistry is Strecker synthesis, a process resulting in the production of various amino acids. Our work summarizes recent discoveries regarding amino acid synthesis and concentration data. We present the amino acid concentrations collated from a variety of meteorites (~20) covering a range of meteorite classes. We can use the dependence of amino acid frequency on variables such as temperature and pressure to model Strecker synthesis inside a theoretical parent body. Our modeling software takes a set of chemical species and outputs their relative frequencies based on a minimization of their Gibbs free energies. The goal of this work is to predict and quantify the presence of amino acids on a foreign landscape using thermodynamic principles.

  13. One pot, rapid and efficient synthesis of water dispersible gold nanoparticles using alpha-amino acids.

    PubMed

    Wangoo, Nishima; Kaur, Sarabjit; Bajaj, Manish; Jain, D V S; Sharma, Rohit K

    2014-10-31

    A detailed study on the synthesis of spherical and monodispersed gold nanoparticles (AuNPs) using all of the 20 naturally occurring α-amino acids has been reported. The synthesized nanoparticles have been further characterized using various techniques such as absorbance spectroscopy, transmission electron microscopy, dynamic light scattering and nuclear magnetic resonance. Size control of the nanoparticles has been achieved by varying the ratio of the gold ion to the amino acid. These monodispersed water soluble AuNPs synthesized using non-toxic, naturally occurring α-amino acids as reducing and capping/stabilizing agents serve as a remarkable example of green chemistry.

  14. One pot, rapid and efficient synthesis of water dispersible gold nanoparticles using alpha-amino acids

    NASA Astrophysics Data System (ADS)

    Wangoo, Nishima; Kaur, Sarabjit; Bajaj, Manish; Jain, D. V. S.; Sharma, Rohit K.

    2014-10-01

    A detailed study on the synthesis of spherical and monodispersed gold nanoparticles (AuNPs) using all of the 20 naturally occurring α-amino acids has been reported. The synthesized nanoparticles have been further characterized using various techniques such as absorbance spectroscopy, transmission electron microscopy, dynamic light scattering and nuclear magnetic resonance. Size control of the nanoparticles has been achieved by varying the ratio of the gold ion to the amino acid. These monodispersed water soluble AuNPs synthesized using non-toxic, naturally occurring α-amino acids as reducing and capping/stabilizing agents serve as a remarkable example of green chemistry.

  15. Enzymatic Synthesis of Nucleic Acids with Defined Regioisomeric 2'-5' Linkages.

    PubMed

    Cozens, Christopher; Mutschler, Hannes; Nelson, Geoffrey M; Houlihan, Gillian; Taylor, Alexander I; Holliger, Philipp

    2015-12-14

    Information-bearing nucleic acids display universal 3'-5' linkages, but regioisomeric 2'-5' linkages occur sporadically in non-enzymatic RNA synthesis and may have aided prebiotic RNA replication. Herein we report on the enzymatic synthesis of both DNA and RNA with site-specific 2'-5' linkages by an engineered polymerase using 3'-deoxy- or 3'-O-methyl-NTPs as substrates. We also report the reverse transcription of the resulting modified nucleic acids back to 3'-5' linked DNA with good fidelity. This enables a fast and simple method for "structural mutagenesis" by the position-selective incorporation of 2'-5' linkages, whereby nucleic acid structure and function may be probed through local distortion by regioisomeric linkages while maintaining the wild-type base sequence as we demonstrate for the 10-23 RNA endonuclease DNAzyme.

  16. QUANTITATIVE CONTRIBUTIONS OF DIET AND LIVER SYNTHESIS TO DOCOSAHEXAENOIC ACID HOMEOSTASIS

    PubMed Central

    Rapoport, Stanley I.; Igarashi, Miki; Gao, Fei

    2010-01-01

    Dietary requirements for maintaining brain and heart docosahexaenoic acid (DHA, 22:6n-3) homeostasis are not agreed on, in part because rates of liver DHA synthesis from circulating α-linolenic acid (α-LNA, 18:2n-3) have not been quantified. These rates can be estimated in vivo using intravenous radiotracer- or heavy isotope-labeled α-LNA infusion. In adult unanesthetized male rats, such infusion shows that liver synthesis-secretion rates of DHA from α-LNA markedly exceed brain and heart DHA synthesis rates and brain DHA consumption rate, and that liver but not heart or brain synthesis is upregulated as dietary n-3 PUFA content is reduced. These differences in rate reflect much higher expression of DHA-synthesizing enzymes in liver, and upregulation of liver but not heart or brain enzyme expression by reduced dietary n-3 PUFA content. A noninvasive intravenous [U-13C]α-LNA infusion method that produces steady-state liver tracer metabolism gives exact liver DHA synthesis-secretion rates and could be extended for human studies. PMID:20226642

  17. Synthesis of l-(+)-Tartaric Acid from l-Ascorbic Acid via 5-Keto-d-Gluconic Acid in Grapes

    PubMed Central

    Saito, Kazumi; Kasai, Zenzaburo

    1984-01-01

    5-Keto-l-idionic acid (≡5-keto-d-gluconic acid, d-xylo-5-hexulosonic acid) was found as a metabolic product of l-ascorbic acid in slices of immature grapes, Vitis labrusca L. cv `Delaware'. Specifically labeled compounds, recognized as metabolic products of l-ascorbic acid in grapes, were fed to young grape tissues to investigate the metabolic pathway from l-ascorbic acid to l-(+)-tartaric acid. Label from dehydro-l-[1-14C]ascorbic acid, 2-keto-l-[1-14C]idonic acid (l-xylo-2-hexulosonic acid), l-[1-14C]idonic acid, or 5-keto-l-[1-14C] idonic acid was incorporated into l-(+)-tartaric acid in high yields as it was in the l-[1-14C]ascorbic acid experiment. In a double label experiment involving a mixture of l-[1-14C]idonic acid and l-[2-3H]idonic acid, the 3H/14C ratios of 5-keto-l-idonic acid and l-(+)-tartaric acid synthesized in young grape leaves were almost the same as the value of the l-idonic acid fed. Label from 5-keto-l-[6-14C]idonic acid was incorporated into sugars and insoluble residue in the same way as l-[6-14C]ascorbic acid was metabolized in grapes. These results provide strong evidence that in grapes l-(+)-tartaric acid is synthesized from the C4 fragment that corresponds to the C1 to C4 group of the 5-keto-l-idonic acid derived from l-ascorbic acid via 2-keto-l-idonic acid and l-idonic acid. PMID:16663792

  18. Studies on chemical modification and biology of a natural product, gambogic acid (II): Synthesis and bioevaluation of gambogellic acid and its derivatives from gambogic acid as antitumor agents.

    PubMed

    Wang, Jinxin; Ma, Junhai; You, Qidong; Zhao, Li; Wang, Fan; Li, Chong; Guo, Qinglong

    2010-09-01

    Gambogic acid (GA) has been reported to be a potent apoptosis inducer. The fact that it is amenable to chemical modification makes GA an attractive molecule for the development of anticancer agents. We firstly reported the synthesis of gambogellic acid, which was generated under acid catalysis from readily available GA by a base-catalyzed diene intramolecular annelation. Sequentially, thirteen new compounds were synthesized and their inhibitory activity on HT-29, Bel-7402, BGC-823, and A549 cell lines were evaluated in vitro by MTT assay, and (38, 40)-epoxy-33-chlorogambogellic acid (4) was identified as a BGC-823 cell apoptosis inducer through MTT cell assay, observations of morphological changes, and Annexin-V/PI double-staining assay. Compound 4 showed significant effects in inducing apoptosis and might serve as a potential lead compound for discovery of new anticancer drugs. Further structure-activity relationships (SARs) of gambogic acid derivatives were discussed.

  19. Synthesis of asymmetric tetracarboxylic acids and corresponding dianhydrides

    NASA Technical Reports Server (NTRS)

    Chuang, Chun-Hua (Inventor)

    2008-01-01

    This invention relates to processes for preparing asymmetrical biphenyl tetracarboxylic acids and the corresponding asymmetrical dianhydrides, namely 2,3,3',4'-biphenyl dianhydride (a-BPDA), 2,3,3',4'-benzophenone dianhydride (a-BTDA) and 3,4'-methylenediphthalic anhydride (-MDPA). By cross-coupling reactions of reactive metal substituted o-xylenes or by cross-coupling o-xylene derivatives in the presence of catalysts, this invention specifically produces asymmetrical biphenyl intermediates that are subsequently oxidized or hydrolyzed and oxidized to provide asymmetric biphenyl tetracarboxylic acids in comparatively high yields. These asymmetrical biphenyl tetracarboxylic acids are subsequently converted to the corresponding asymmetrical dianhydrides without contamination by symmetrical biphenyl dianhydrides.

  20. Synthesis and properties of synthetic fulvic acid derived from hematoxylin

    NASA Astrophysics Data System (ADS)

    Litvin, Valentina A.; Minaev, Boris F.; Baryshnikov, Gleb V.

    2015-04-01

    A model fulvic acid (FA) was synthesized from a natural dye, hematoxylin, in a slow oxidative polymerization/condensation reaction catalysed by OH- at pH ca. 12. The resulting dark-brown product, acidified to pH ca. 2, did not precipitate from the reaction solution. It was isolated and purified by cation-exchange resin. Its physicochemical and spectroscopic properties, as determined by means of elemental analysis, molecular weight analyses, Fourier transform infra red (FTIR) and ultraviolet-visible (UV-VIS) spectroscopy, X-ray diffraction and electron paramagnetic resonance (EPR) spectroscopy, showed a close resemblance to natural FA. The similarity and differences between synthetic fulvic acids derived from hematoxylin and the natural fulvic acids substances are discussed. Quantum-chemical calculations of the supposed primary oxidation products of hematoxylin are performed and compared with observations.

  1. Amino acids in a Fischer Tropsch type synthesis

    NASA Technical Reports Server (NTRS)

    Brown, D. L.; Lawless, J. G.

    1974-01-01

    One postulation is described for the presence of organic compounds in meteorites which states that they were formed during the condensation of the solar nebula. A viable laboratory simulation of these conditions can be modeled after the industrial Fischer Tropsch reaction, which is known to produce organic compounds called hydrocarbons. In this simulation, a mixture of carbon monoxide, hydrogen and ammonia is heated in the presence of iron meteorite. The reaction products for amino acids, a class of organic compounds important to life, were examined. A large number of these compounds is found in meteorites and other chemical evolution experiments, but only small quantities of a few amino acids were found in the present simulation work. These results are at odds with the existing literature in which many amino acids were reported.

  2. [Effect of citric acid on synthesis of surfactants in Rhodococcus erythropolis IMV Ac-5017].

    PubMed

    Pyroh, T P; Shevchuk, T A; Shuliakova, M O; Tarasenko, D O

    2011-01-01

    Expediency of sodium citrate (regulator of lipids synthesis) substitution is shown in the medium of cultivation of Rhodococcus erythropolis IMV Ac-5017 with ethanol (or hexadecane) and fumarate (gluconeogenesis precursor) by citric acid for pH maintenance at the level optimal for synthesis of surfactants. It has been established the maximum synthesis of surfactants of R. erythropolis IMV Ac-5017 was observed at pH 8.0. Introduction of 0.2% sodium fumarate at the end of experimental growth phase of the strain IMV Ac-5017 in the medium with 2% of ethanol with further periodic acidification of culture liquid by citric acid up to pH 8.0 was accompanied by the increase of conditional concentration of surfactants by 30, 40 and 95% as compared with an analogous process without pH regulation, by the use of sodium citrate as the regulator of lipids synthesis on the medium with ethanol as well as without organic acids, respectively.

  3. Five Decades with Polyunsaturated Fatty Acids: Chemical Synthesis, Enzymatic Formation, Lipid Peroxidation and Its Biological Effects

    PubMed Central

    Catalá, Angel

    2013-01-01

    I have been involved in research on polyunsaturated fatty acids since 1964 and this review is intended to cover some of the most important aspects of this work. Polyunsaturated fatty acids have followed me during my whole scientific career and I have published a number of studies concerned with different aspects of them such as chemical synthesis, enzymatic formation, metabolism, transport, physical, chemical, and catalytic properties of a reconstructed desaturase system in liposomes, lipid peroxidation, and their effects. The first project I became involved in was the organic synthesis of [1-14C] eicosa-11,14-dienoic acid, with the aim of demonstrating the participation of that compound as a possible intermediary in the biosynthesis of arachidonic acid “in vivo.” From 1966 to 1982, I was involved in several projects that study the metabolism of polyunsaturated fatty acids. In the eighties, we studied fatty acid binding protein. From 1990 up to now, our laboratory has been interested in the lipid peroxidation of biological membranes from various tissues and different species as well as liposomes prepared with phospholipids rich in PUFAs. We tested the effect of many antioxidants such as alpha tocopherol, vitamin A, melatonin and its structural analogues, and conjugated linoleic acid, among others. PMID:24490074

  4. Enhanced Synthesis of Alkyl Amino Acids in Miller's 1958 H2S Experiment

    NASA Technical Reports Server (NTRS)

    Parker, Eric T.; Cleaves, H. James; Callahan, Michael P.; Dworkin, James P.; Glavin, Daniel P.; Lazcano, Antonio; Bada, Jeffrey L.

    2011-01-01

    Stanley Miller's 1958 H2S-containing experiment, which included a simulated prebiotic atmosphere of methane (CH4), ammonia (NH3), carbon dioxide (CO2), and hydrogen sulfide (H2S) produced several alkyl amino acids, including the alpha-, beta-, and gamma-isomers of aminobutyric acid (ABA) in greater relative yields than had previously been reported from his spark discharge experiments. In the presence of H2S, aspariic and glutamic acids could yield alkyl amino acids via the formation of thioimide intermediates. Radical chemistry initiated by passing H2S through a spark discharge could have also enhanced alkyl amino acid synthesis by generating alkyl radicals that can help form the aldehyde and ketone precursors to these amino acids. We propose mechanisms that may have influenced the synthesis of certain amino acids in localized environments rich in H2S and lightning discharges, similar to conditions near volcanic systems on the early Earth, thus contributing to the prebiotic chemical inventory of the primordial Earth.

  5. Synthesis, structure, and biological applications of α-fluorinated β-amino acids and derivatives.

    PubMed

    March, Taryn L; Johnston, Martin R; Duggan, Peter J; Gardiner, James

    2012-11-01

    This review gives a broad overview of the state of play with respect to the synthesis, conformational properties, and biological activity of α-fluorinated β-amino acids and derivatives. General methods are described for the preparation of monosubstituted α-fluoro-β-amino acids (Scheme 1). Nucleophilic methods for the introduction of fluorine predominantly involve the reaction of DAST with alcohols derived from α-amino acids, whereas electrophilic sources of fluorine such as NFSI have been used in conjunction with Arndt-Eistert homologation, conjugate addition or organocatalyzed Mannich reactions. α,α-Difluoro-β-amino acids have also been prepared using DAST; however, this area of synthesis is largely dominated by the use of difluorinated Reformatsky reagents to introduce the difluoro ester functionality (Scheme 9). α-Fluoro-β-amino acids and derivatives analyzed by X-ray crystal and NMR solution techniques are found to adopt preferred conformations which are thought to result from stereoelectronic effects associated with F located close to amines, amides, and esters (Figs. 2-6). α-Fluoro amide and β-fluoro ethylamide/amine effects can influence the secondary structure of α-fluoro-β-amino acid-containing derivatives including peptides and peptidomimetics (Figs. 7-9). α-Fluoro-β-amino acids are also components of a diverse range of bioactive anticancer (e.g., 5-fluorouracil), antifungal, and antiinsomnia agents as well as protease inhibitors where such fluorinated analogs have shown increased potency and spectrum of activity.

  6. One-Pot synthesis of phosphorylated mesoporous carbon heterogeneous catalysts with tailored surface acidity

    SciTech Connect

    Fulvio, Pasquale F; Mahurin, Shannon Mark; Mayes, Richard T; Bauer, Christopher; Wang, Xiqing; Veith, Gabriel M; Dai, Sheng

    2012-01-01

    Soft-templated phosphorylated mesoporous carbons with homogeneous distributions of phosphate groups were prepared by a 'one-pot' synthesis method using mixtures of phosphoric acid with hydrochloric, or nitric acids in the presence of Pluronic F127 triblock copolymer. Adjusting the various ratios of phosphoric acid used in these mixtures resulted in carbons with distinct adsorption, structural and surface acidity properties. The pore size distributions (PSDs) from nitrogen adsorption at -196 C showed that mesoporous carbons exhibit specific surface areas as high as 551 m{sup 2}/g and mesopores as large as 13 nm. Both structural ordering of the mesopores and the final phosphate contents were strongly dependent on the ratios of H{sub 3}PO{sub 4} in the synthesis gels, as shown by transmission electron microscopy (TEM), X-ray photoelectron (XPS) and energy dispersive X-ray spectroscopy (EDS). The number of surface acid sites determined from temperature programmed desorption of ammonia (NH{sub 3}-TPD) were in the range of 0.3-1.5 mmol/g while the active surface areas are estimated to comprise 5-54% of the total surface areas. Finally, the conversion temperatures for the isopropanol dehydration were lowered by as much as 100 C by transitioning from the least acidic to the most acidic catalysts surface.

  7. Enhanced synthesis of alkyl amino acids in Miller's 1958 H2S experiment.

    PubMed

    Parker, Eric T; Cleaves, H James; Callahan, Michael P; Dworkin, Jason P; Glavin, Daniel P; Lazcano, Antonio; Bada, Jeffrey L

    2011-12-01

    Stanley Miller's 1958 H(2)S-containing experiment, which included a simulated prebiotic atmosphere of methane (CH(4)), ammonia (NH(3)), carbon dioxide (CO(2)), and hydrogen sulfide (H(2)S) produced several alkyl amino acids, including the α-, β-, and γ-isomers of aminobutyric acid (ABA) in greater relative yields than had previously been reported from his spark discharge experiments. In the presence of H(2)S, aspartic and glutamic acids could yield alkyl amino acids via the formation of thioimide intermediates. Radical chemistry initiated by passing H(2)S through a spark discharge could have also enhanced alkyl amino acid synthesis by generating alkyl radicals that can help form the aldehyde and ketone precursors to these amino acids. We propose mechanisms that may have influenced the synthesis of certain amino acids in localized environments rich in H(2)S and lightning discharges, similar to conditions near volcanic systems on the early Earth, thus contributing to the prebiotic chemical inventory of the primordial Earth. PMID:22139514

  8. Synthesis, antimicrobial evaluation and QSAR studies of stearic acid derivatives.

    PubMed

    Tahlan, S; Kumar, P; Narasimhan, B

    2014-02-01

    A series of Schiff bases (1-17) and esters (18-28) of stearic acid was synthesized and characterized by physicochemical as well as spectral means. The synthesized compounds were evaluated in vitro for their antimicrobial activity by tube dilution method. The antimicrobial screening results indicated that the compounds having electron releasing groups on benzylidene nucleus were found to be more active against bacterial strains and compounds having electron withdrawing groups on benzylidene nucleus were found to be more active against fungal strains. QSAR studies demonstrated that electronic parameters dipole moment (µ) and total energy (Te) were the most important descriptors in describing the antimicrobial activity of synthesized stearic acid derivatives.

  9. Okadaic acid disrupts Golgi structure and impairs enzyme synthesis and secretion in the rat pancreas.

    PubMed

    Waschulewski, I H; Kruse, M L; Agricola, B; Kern, H F; Schmidt, W E

    1996-06-01

    Okadaic acid, a serine/threonine phosphatase inhibitor, has been shown to inhibit rat pancreatic enzyme secretion by interference with late processes in stimulus-secretion coupling. To further characterize its action, we studied the effect of okadaic acid on secretion of newly synthesized proteins, protein synthesis, and cellular ultrastructure in pancreatic lobules derived from rats stimulated in vivo by feeding the synthetic proteinase inhibitor FOY-305. Okadaic acid completely blocked protein secretion at concentrations that inhibit the Ca2+/calmodulin-dependent protein phosphatase 2b, calcineurin. Protein synthesis was abolished at 10(-6) mol/l and reduced by 60% at 5 x 10(-7) mol/l okadaic acid. Pancreatic lobules exposed to 5 x 10(-7) mol/l okadaic acid for 20 min fully restored their secretory capacity on removal of the drug; whereas, after a preincubation with okadaic acid for > 40 min, protein secretion remained impaired during the recovery period. Electron microscopic examination of pancreatic acinar cells treated with 5 x 10(-7) mol/l okadaic acid revealed a dilated Golgi complex after 15 and 30 min and a subsequent fragmentation of Golgi cisternae into clouds of small uniform vesicles after 60 min. Reassembly of Golgi stacks occurred after a 60-min recovery without okadaic acid. These data indicate that serine/threonine phosphatases play an important role not only in the regulation of pancreatic enzyme synthesis and exocytosis but also are crucial for the maintenance of normal Golgi architecture and function in the exocrine rat pancreas. These effects are probably not exclusively mediated via type 2b calcineurin-like protein phosphatases.

  10. Effect of nerve growth factor on the synthesis of amino acids in PC12 cells

    SciTech Connect

    Zielke, H.R.; Tildon, J.T.; Kauffman, F.C.; Baab, P.J. )

    1989-04-01

    Radioactive short-chain fatty acids preferentially label glutamine relative to glutamate in brain due to compartmentation of glutamine and glutamate. To determine whether this phenomenon occurs in a single cell culture model, we examined the effect of fatty acid chain length on the synthesis as well as pool size of selected amino acids in rat pheochromocytoma PC12 cells, a cell culture model of the large glutamate compartment in neurons. Intracellular 14C-amino acids were quantitated by HPLC, and the incorporation of (U-14C)-glucose, (1-14C)-butyrate, (1-14C)-octanoate, and (1-14C)-palmitate into five amino acids was measured in native and NGF-treated PC12 cells. NGF pretreatment decreased the intracellular concentration of amino acids as did addition of fatty acids but these effects were not additive. Specific activities of amino acids in native cells labelled by 14C-octanoate were 1,300 DPM/nmol, 490 DPM/nmol, 200 DPM/nmol, and 110 DPM/nmol for glutamate, aspartate, glutamine, and serine, respectively. No radioactivity was detected in alanine. Similar specific activities were noted when 14C-butyrate was the precursor; however, there was at least 5-fold less if 14C-palmitate was the precursor. Pretreatment of cells with NGF decreased the specific activity of amino acids by 25-65%. Specific activities of amino acids synthesized from 14C-glucose decreased in the following order: glutamate, 1,640 DPM/nmol; aspartate, 1,210 DPM/nmol; alanine, 580 DPM/nmol; glutamine, 275 DPM/nmol; and serine, 80 DPM/nmol for native cells. NGF pretreatment decreased the specific activities of glutamate and glutamine, but not of the other 3 amino acids. The preferred precursor for glutamate synthesis in native PC12 cells was glucose followed by octanoate, butyrate and palmitate (16:6:3:1).

  11. Synthesis and phosphorylation of the glial fibrillary acidic protein during brain development: A tissue slice study

    SciTech Connect

    Noetzel, M.J. )

    1990-01-01

    Brain slices were incubated with either (3H) amino acids or (32P) orthophosphate in order to characterize the synthesis and phosphorylation of the glial fibrillary acidic protein (GFAP) in the rat nervous system. The incorporation of (3H) amino acids into GFAP was found to increase significantly during early postnatal development, reaching a peak of activity on day 5 of life and then declining over the next 2 weeks. Concomitant with this peak of synthetic activity the content of GFAP in rat brain was also observed to increase dramatically. GFAP continued to accumulate in brain through postnatal day 30 despite a decrease in the synthesis of the protein. These results indicate that the increase in GFAP during the first month of life cannot be ascribed solely to the rate of GFAP synthesis. The findings are consistent with the hypothesis that during later stages of astrocytic development the accumulation of GFAP may be primarily dependent upon a low rate of protein degradation. The pattern of GFAP phosphorylation in the developing rat brain differed from that observed for the incorporation of (3H) amino acids. The peak incorporation of 32P into GFAP occurred on postnatal day 10 at a time when synthesis of the protein had declined by 43%. These findings suggest that during development phosphorylation of GFAP is mediated by factors different from those directing its synthesis. In addition, phosphorylation of GFAP did not alter its solubility in cytoskeletal preparations indicating that GFAP phosphorylation is probably not a major regulatory mechanism in disassembly of the astroglial filaments.

  12. Evolutionary distinctiveness of fatty acid and polyketide synthesis in eukaryotes

    PubMed Central

    Kohli, Gurjeet S; John, Uwe; Van Dolah, Frances M; Murray, Shauna A

    2016-01-01

    Fatty acids, which are essential cell membrane constituents and fuel storage molecules, are thought to share a common evolutionary origin with polyketide toxins in eukaryotes. While fatty acids are primary metabolic products, polyketide toxins are secondary metabolites that are involved in ecologically relevant processes, such as chemical defence, and produce the adverse effects of harmful algal blooms. Selection pressures on such compounds may be different, resulting in differing evolutionary histories. Surprisingly, some studies of dinoflagellates have suggested that the same enzymes may catalyse these processes. Here we show the presence and evolutionary distinctiveness of genes encoding six key enzymes essential for fatty acid production in 13 eukaryotic lineages for which no previous sequence data were available (alveolates: dinoflagellates, Vitrella, Chromera; stramenopiles: bolidophytes, chrysophytes, pelagophytes, raphidophytes, dictyochophytes, pinguiophytes, xanthophytes; Rhizaria: chlorarachniophytes, haplosporida; euglenids) and 8 other lineages (apicomplexans, bacillariophytes, synurophytes, cryptophytes, haptophytes, chlorophyceans, prasinophytes, trebouxiophytes). The phylogeny of fatty acid synthase genes reflects the evolutionary history of the organism, indicating selection to maintain conserved functionality. In contrast, polyketide synthase gene families are highly expanded in dinoflagellates and haptophytes, suggesting relaxed constraints in their evolutionary history, while completely absent from some protist lineages. This demonstrates a vast potential for the production of bioactive polyketide compounds in some lineages of microbial eukaryotes, indicating that the evolution of these compounds may have played an important role in their ecological success. PMID:26784357

  13. Evolutionary distinctiveness of fatty acid and polyketide synthesis in eukaryotes.

    PubMed

    Kohli, Gurjeet S; John, Uwe; Van Dolah, Frances M; Murray, Shauna A

    2016-08-01

    Fatty acids, which are essential cell membrane constituents and fuel storage molecules, are thought to share a common evolutionary origin with polyketide toxins in eukaryotes. While fatty acids are primary metabolic products, polyketide toxins are secondary metabolites that are involved in ecologically relevant processes, such as chemical defence, and produce the adverse effects of harmful algal blooms. Selection pressures on such compounds may be different, resulting in differing evolutionary histories. Surprisingly, some studies of dinoflagellates have suggested that the same enzymes may catalyse these processes. Here we show the presence and evolutionary distinctiveness of genes encoding six key enzymes essential for fatty acid production in 13 eukaryotic lineages for which no previous sequence data were available (alveolates: dinoflagellates, Vitrella, Chromera; stramenopiles: bolidophytes, chrysophytes, pelagophytes, raphidophytes, dictyochophytes, pinguiophytes, xanthophytes; Rhizaria: chlorarachniophytes, haplosporida; euglenids) and 8 other lineages (apicomplexans, bacillariophytes, synurophytes, cryptophytes, haptophytes, chlorophyceans, prasinophytes, trebouxiophytes). The phylogeny of fatty acid synthase genes reflects the evolutionary history of the organism, indicating selection to maintain conserved functionality. In contrast, polyketide synthase gene families are highly expanded in dinoflagellates and haptophytes, suggesting relaxed constraints in their evolutionary history, while completely absent from some protist lineages. This demonstrates a vast potential for the production of bioactive polyketide compounds in some lineages of microbial eukaryotes, indicating that the evolution of these compounds may have played an important role in their ecological success. PMID:26784357

  14. Synthesis of 9-oxononanoic acid, a precursor for biopolymers.

    PubMed

    Otte, Konrad B; Kirtz, Marko; Nestl, Bettina M; Hauer, Bernhard

    2013-11-01

    Polymers based on renewable resources have become increasingly important. The natural functionalization of fats and oils enables an easy access to interesting monomeric building blocks, which in turn transform the derivative biopolymers into high-performance materials. Unfortunately, interesting building blocks of medium-chain length are difficult to obtain by traditional chemical means. Herein, a biotechnological pathway is established that could provide an environmentally suitable and sustainable alternative. A multiple enzyme two-step one-pot process efficiently catalyzed by a coupled 9S-lipoxygenase (St-LOX1, Solanum tuberosum) and 9/13-hydroperoxide lyase (Cm-9/13HPL, Cucumis melo) cascade reaction is proposed as a potential route for the conversion of linoleic acid into 9-oxononanoic acid, which is a precursor for biopolymers. Lipoxygenase catalyzes the insertion of oxygen into linoleic acid through a radical mechanism to give 9S-hydroperoxy-octadecadienoic acid (9S-HPODE) as a cascade intermediate, which is subsequently cleaved by the action of Cm-9/13HPL. This one-pot process afforded a yield of 73 % combined with high selectivity. The best reaction performance was achieved when lipoxygenase and hydroperoxide lyase were applied in a successive rather than a simultaneous manner. Green leaf volatiles, which are desired flavor and fragrance products, are formed as by-products in this reaction cascade. Furthermore, we have investigated the enantioselectivity of 9/13-HPLs, which exhibited a strong preference for 9S-HPODE over 9R-HPODE.

  15. Synthesis and characterization of ultraviolet light-emitting organic acids.

    PubMed

    An, Chun-Ai; Guo, Yanchao; Si, Zhenjun; Duan, Qian

    2014-05-01

    Three ultraviolet light-emitting organic acids of 3,3'-(4-phenyl-4H-1,2,4-triazole-3,5-diyl)dibenzoic acid (Tz-1), 4,4',4″-(4H-1,2,4-triazole-3,4,5-triyl)tribenzoic acid (Tz-2), and 4,4'-(4-(4'-carboxy-[1,1'-biphenyl]-4-yl)-4H-1,2,4-triazole-3,5-diyl)dibenzoic acid (Tz-3) were successfully synthesized and fully characterized by the (1)H NMR, the IR absorption spectra, and the X-ray single crystal diffraction. It was found that Tz-1, Tz-2, and Tz-3 could give out the ultraviolet photoluminescent spectra centered at 369 nm, 365 nm and 350 nm, respectively. The luminescence quantum yields of Tz-1 and Tz-2 were measured to be 0.20 and 0.14, respectively. Additionally, the density functional theory (DFT) and the time-dependent DFT calculations were also carried out for Tz-1, Tz-2, and Tz-3.

  16. Synthesis and physical properties of isostearic acids and their esters

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Saturated branched-chain fatty acids (sbc-FAs) are found as minor constituents in several natural fats and oils. Sbc-FAs are of interest since they have lower melting points than their linear counterparts and exhibit good oxidative stability; properties that make them ideally suited in a number of ...

  17. Recent Advances in Substrate-Controlled Asymmetric Induction Derived from Chiral Pool α-Amino Acids for Natural Product Synthesis.

    PubMed

    Paek, Seung-Mann; Jeong, Myeonggyo; Jo, Jeyun; Heo, Yu Mi; Han, Young Taek; Yun, Hwayoung

    2016-07-21

    Chiral pool α-amino acids have been used as powerful tools for the total synthesis of structurally diverse natural products. Some common naturally occurring α-amino acids are readily available in both enantiomerically pure forms. The applications of the chiral pool in asymmetric synthesis can be categorized prudently as chiral sources, devices, and inducers. This review specifically examines recent advances in substrate-controlled asymmetric reactions induced by the chirality of α-amino acid templates in natural product synthesis research and related areas.

  18. Synthesis of acetic acid via methanol hydrocarboxylation with CO2 and H2

    PubMed Central

    Qian, Qingli; Zhang, Jingjing; Cui, Meng; Han, Buxing

    2016-01-01

    Acetic acid is an important bulk chemical that is currently produced via methanol carbonylation using fossil based CO. Synthesis of acetic acid from the renewable and cheap CO2 is of great importance, but state of the art routes encounter difficulties, especially in reaction selectivity and activity. Here we report a route to produce acetic acid from CO2, methanol and H2. The reaction can be efficiently catalysed by Ru–Rh bimetallic catalyst using imidazole as the ligand and LiI as the promoter in 1,3-dimethyl-2-imidazolidinone (DMI) solvent. It is confirmed that methanol is hydrocarboxylated into acetic acid by CO2 and H2, which accounts for the outstanding reaction results. The reaction mechanism is proposed based on the control experiments. The strategy opens a new way for acetic acid production and CO2 transformation, and represents a significant progress in synthetic chemistry. PMID:27165850

  19. Synthesis and Biological Evaluation of Novel Phosphatidylcholine Analogues Containing Monoterpene Acids as Potent Antiproliferative Agents

    PubMed Central

    Gliszczyńska, Anna; Niezgoda, Natalia; Gładkowski, Witold; Czarnecka, Marta; Świtalska, Marta; Wietrzyk, Joanna

    2016-01-01

    The synthesis of novel phosphatidylcholines with geranic and citronellic acids in sn-1 and sn-2 positions is described. The structured phospholipids were obtained in high yields (59–87%) and evaluated in vitro for their cytotoxic activity against several cancer cell lines of different origin: MV4-11, A-549, MCF-7, LOVO, LOVO/DX, HepG2 and also towards non-cancer cell line BALB/3T3 (normal mice fibroblasts). The phosphatidylcholines modified with monoterpene acid showed a significantly higher antiproliferative activity than free monoterpene acids. The highest activity was observed for the terpene-phospholipids containing the isoprenoid acids in sn-1 position of phosphatidylcholine and palmitic acid in sn-2. PMID:27310666

  20. An amino acid depleted cell-free protein synthesis system for the incorporation of non-canonical amino acid analogs into proteins.

    PubMed

    Singh-Blom, Amrita; Hughes, Randall A; Ellington, Andrew D

    2014-05-20

    Residue-specific incorporation of non-canonical amino acids into proteins is usually performed in vivo using amino acid auxotrophic strains and replacing the natural amino acid with an unnatural amino acid analog. Herein, we present an efficient amino acid depleted cell-free protein synthesis system that can be used to study residue-specific replacement of a natural amino acid by an unnatural amino acid analog. This system combines a simple methodology and high protein expression titers with a high-efficiency analog substitution into a target protein. To demonstrate the productivity and efficacy of a cell-free synthesis system for residue-specific incorporation of unnatural amino acids in vitro, we use this system to show that 5-fluorotryptophan and 6-fluorotryptophan substituted streptavidin retain the ability to bind biotin despite protein-wide replacement of a natural amino acid for the amino acid analog. We envisage this amino acid depleted cell-free synthesis system being an economical and convenient format for the high-throughput screening of a myriad of amino acid analogs with a variety of protein targets for the study and functional characterization of proteins substituted with unnatural amino acids when compared to the currently employed in vivo methodologies.

  1. Synthesis and characterization of a pH responsive folic acid functionalized polymeric drug delivery system.

    PubMed

    Li, Xia; McTaggart, Matt; Malardier-Jugroot, Cecile

    2016-01-01

    We report the computational analysis, synthesis and characterization of folate functionalized poly(styrene-alt-maleic anhydride), PSMA for drug delivery purpose. The selection of the proper linker between the polymer and the folic acid group was performed before conducting the synthesis using Density Functional Theory (DFT). The computational results showed the bio-degradable linker 2, 4-diaminobutyric acid, DABA as a good candidate allowing flexibility of the folic acid group while maintaining the pH sensitivity of PSMA, used as a trigger for drug release. The synthesis was subsequently carried out in multi-step experimental procedures. The functionalized polymer was characterized using InfraRed spectroscopy, Nuclear Magnetic Resonance and Dynamic Light Scattering confirming both the chemical structure and the pH responsiveness of PSMA-DABA-Folate polymers. This study provides an excellent example of how computational chemistry can be used in selection process for the functional materials and product characterization. The pH sensitive polymers are expected to be used in delivering anti-cancer drugs to solid tumors with overly expressed folic acid receptors. PMID:27183249

  2. Synthesis and Verification of Biobased Terephthalic Acid from Furfural

    NASA Astrophysics Data System (ADS)

    Tachibana, Yuya; Kimura, Saori; Kasuya, Ken-Ichi

    2015-02-01

    Exploiting biomass as an alternative to petrochemicals for the production of commodity plastics is vitally important if we are to become a more sustainable society. Here, we report a synthetic route for the production of terephthalic acid (TPA), the monomer of the widely used thermoplastic polymer poly(ethylene terephthalate) (PET), from the biomass-derived starting material furfural. Biobased furfural was oxidised and dehydrated to give maleic anhydride, which was further reacted with biobased furan to give its Diels-Alder (DA) adduct. The dehydration of the DA adduct gave phthalic anhydride, which was converted via phthalic acid and dipotassium phthalate to TPA. The biobased carbon content of the TPA was measured by accelerator mass spectroscopy and the TPA was found to be made of 100% biobased carbon.

  3. Dihydroasparagusic acid: antioxidant and tyrosinase inhibitory activities and improved synthesis.

    PubMed

    Venditti, Alessandro; Mandrone, Manuela; Serrilli, Anna Maria; Bianco, Armandodoriano; Iannello, Carmelina; Poli, Ferruccio; Antognoni, Fabiana

    2013-07-17

    Dihydroasparagusic acid (DHAA) is the reduced form of asparagusic acid, a sulfur-containing flavor component produced by Asparagus plants. In this work, DHAA was synthetically produced by modifying some published protocols, and the synthesized molecule was tested in several in vitro assays (DPPH, ABTS, FRAP-ferrozine, BCB, deoxyribose assays) to evaluate its radical scavenging activity. Results show that DHAA is endowed with a significant in vitro antioxidant activity, comparable to that of Trolox. DHAA was also evaluated for its inhibitory activity toward tyrosinase, an enzyme involved, among others, in melanogenesis and in browning processes of plant-derived foods. DHAA was shown to exert an inhibitory effect on tyrosinase activity, and the inhibitor kinetics, analyzed by a Lineweaver-Burk plot, exhibited a competitive mechanism. Taken together, these results suggest that DHAA may be considered as a potentially active molecule for use in various fields of application, such as pharmaceutical, cosmetics, agronomic and food. PMID:23790134

  4. Synthesis and Verification of Biobased Terephthalic Acid from Furfural

    PubMed Central

    Tachibana, Yuya; Kimura, Saori; Kasuya, Ken-ichi

    2015-01-01

    Exploiting biomass as an alternative to petrochemicals for the production of commodity plastics is vitally important if we are to become a more sustainable society. Here, we report a synthetic route for the production of terephthalic acid (TPA), the monomer of the widely used thermoplastic polymer poly(ethylene terephthalate) (PET), from the biomass-derived starting material furfural. Biobased furfural was oxidised and dehydrated to give maleic anhydride, which was further reacted with biobased furan to give its Diels-Alder (DA) adduct. The dehydration of the DA adduct gave phthalic anhydride, which was converted via phthalic acid and dipotassium phthalate to TPA. The biobased carbon content of the TPA was measured by accelerator mass spectroscopy and the TPA was found to be made of 100% biobased carbon. PMID:25648201

  5. Synthesis and antifungal activity of bile acid-derived oxazoles.

    PubMed

    Fernández, Lucía R; Svetaz, Laura; Butassi, Estefanía; Zacchino, Susana A; Palermo, Jorge A; Sánchez, Marianela

    2016-04-01

    Peracetylated bile acids (1a-g) were used as starting materials for the preparation of fourteen new derivatives bearing an oxazole moiety in their side chain (6a-g, 8a-g). The key step for the synthetic path was a Dakin-West reaction followed by a Robinson-Gabriel cyclodehydration. A simpler model oxazole (12) was also synthesized. The antifungal activity of the new compounds (6a-g) as well as their starting bile acids (1a-g) was tested against Candida albicans. Compounds 6e and 6g showed the highest percentages of inhibition (63.84% and 61.40% at 250 μg/mL respectively). Deacetylation of compounds 6a-g, led to compounds 8a-g which showed lower activities than the acetylated derivatives. PMID:26827629

  6. First synthesis of thia steroids from cholic acid.

    PubMed

    Ibrahim-Ouali, Malika; Rocheblave, Luc

    2010-10-01

    Heterosteroids remain interesting due to their potential biological activities. This prompted us to synthesize novel thia steroids possessing the heteroatom in the A-ring. We set out to describe a new and versatile method for preparing 3-thia steroids from cholic acid via a selective oxidation of one hydroxyl group, a Baeyer-Villiger oxidation and a photolysis as the key steps. The characteristic (1)H and (13)C NMR spectroscopic features of the synthesized compounds are reported.

  7. Synthesis and properties of N-hexadecyl ethylenediamine triacetic acid.

    PubMed

    Wang, Xixin; Zhao, Jianling; Yao, Xingzhi; Chen, Wentao

    2004-11-15

    A new kind of surfactant named N-hexadecyl ethylenediamine triacetic acid (HED3A) was synthesized from anhydrous ethylenediamine, 1-bromohexadecane, and chloroacetic acid. Testing showed stability of HED3A in hard water, wetting power, dispersing power, and surface tension increased along with pH value. Stability in hard water of trisodium N-hexadecyl ethylenediamine triacetate (3NaHED3A) was at level 4, which was better than that of sodium dodecylsulfate (SDS) and sodium dodecylbenzene sulfonate (LAS). Other properties of 3NaHED3A including wetting power, dispersing power, emulsifying power, and surface tension had intermediate value between SDS, LAS, AES, peregal-O, and cetyltrimethylammonium chloride (CTAC). The ethylenediamine triacetic acid (ED3A) group in 3NaHED3A can chelate many kinds of metal ions, which indicates a promising application prospect in many fields including metal anticorrosion, corrosion control agent, additives in electroplating solution, and ore selection and solid surface treatment.

  8. Synthesis and bioactivity of 2',3'-benzoabscisic acid analogs.

    PubMed

    Han, Xiaoqiang; Wan, Chuan; Li, Xiuyun; Li, Hong; Yang, Dongyan; Du, Shijie; Xiao, Yumei; Qin, Zhaohai

    2015-06-01

    2',3'-Benzoabscisic acid 4a is significantly more active than (±)-ABA and can be potentially used as a plant growth regulator for agriculture. In this study, six 4a analogs were designed and synthesized. Bioassay showed that 4a displayed greater activity than (±)-ABA and the six analogs produced less inhibition than 4a itself. Specially, some analogs displayed markedly different activities to different physiological and biochemical process, which were largely different from ABA and 4a. Compared to (±)-ABA, 4b and 4c were more effective germination inhibitors for lettuce, but less effective inhibitors for rice elongation. Five-membered analog 5 was higher or slightly weaker in inhibiting Arabidopsis seed germination and rice elongation, respectively, but at least 10 times less effective than (±)-ABA in lettuce seed germination. Dual acid 6 and alkyne acid 20 nearly produced no inhibitory activity for Arabidopsis seed germination, but displayed excellent activity in inhibiting rice seedling growth. The preference of the analogs to different physiology process indicated that they might provide a strategy to develop novel ABA agonists or antagonist and be used as probe to investigate the function of different ABA receptors. PMID:25913114

  9. Fatty Acid Phytyl Ester Synthesis in Chloroplasts of Arabidopsis[W

    PubMed Central

    Lippold, Felix; vom Dorp, Katharina; Abraham, Marion; Hölzl, Georg; Wewer, Vera; Yilmaz, Jenny Lindberg; Lager, Ida; Montandon, Cyrille; Besagni, Céline; Kessler, Felix; Stymne, Sten; Dörmann, Peter

    2012-01-01

    During stress or senescence, thylakoid membranes in chloroplasts are disintegrated, and chlorophyll and galactolipid are broken down, resulting in the accumulation of toxic intermediates, i.e., tetrapyrroles, free phytol, and free fatty acids. Chlorophyll degradation has been studied in detail, but the catabolic pathways for phytol and fatty acids remain unclear. A large proportion of phytol and fatty acids is converted into fatty acid phytyl esters and triacylglycerol during stress or senescence in chloroplasts. We isolated two genes (PHYTYL ESTER SYNTHASE1 [PES1] and PES2) of the esterase/lipase/thioesterase family of acyltransferases from Arabidopsis thaliana that are involved in fatty acid phytyl ester synthesis in chloroplasts. The two proteins are highly expressed during senescence and nitrogen deprivation. Heterologous expression in yeast revealed that PES1 and PES2 have phytyl ester synthesis and diacylglycerol acyltransferase activities. The enzymes show broad substrate specificities and can employ acyl-CoAs, acyl carrier proteins, and galactolipids as acyl donors. Double mutant plants (pes1 pes2) grow normally but show reduced phytyl ester and triacylglycerol accumulation. These results demonstrate that PES1 and PES2 are involved in the deposition of free phytol and free fatty acids in the form of phytyl esters in chloroplasts, a process involved in maintaining the integrity of the photosynthetic membrane during abiotic stress and senescence. PMID:22623494

  10. Role of ferrocyanides in the prebiotic synthesis of α-amino acids.

    PubMed

    Ruiz-Bermejo, Marta; Osuna-Esteban, Susana; Zorzano, María-Paz

    2013-06-01

    We investigated the synthesis of α-amino acids under possible prebiotic terrestrial conditions in the presence of dissolved iron (II) in a simulated prebiotic ocean. An aerosol-liquid cycle with a prebiotic atmosphere is shown to produce amino acids via Strecker synthesis with relatively high yields. However, in the presence of iron, the HCN was captured in the form of a ferrocyanide, partially inhibiting the formation of amino acids. We showed how HCN captured as Prussian Blue (or another complex compound) may, in turn, have served as the HCN source when exposed to UV radiation, allowing for the sustained production of amino acids in conjunction with the production of oxyhydroxides that precipitate as by-products. We conclude that ferrocyanides and related compounds may have played a significant role as intermediate products in the prebiotic formation of amino acids and oxyhydroxides, such as those that are found in iron-containing soils and that the aerosol cycle of the primitive ocean may have enhanced the yield of the amino acid production.

  11. Concise synthesis of the A/BCD-ring fragment of gambieric acid A

    PubMed Central

    Fuwa, Haruhiko; Fukazawa, Ryo; Sasaki, Makoto

    2014-01-01

    Gambieric acid A (GAA) and its congeners belong to the family of marine polycyclic ether natural products. Their highly complex molecular architecture and unique biological activities have been of intense interest within the synthetic community. We have previously reported the first total synthesis, stereochemical reassignment, and preliminary structure–activity relationships of GAA. Here we disclose a concise synthesis of the A/BCD-ring fragment of GAA. The synthesis started from our previously reported synthetic intermediate that represents the A/B-ring. The C-ring was synthesized via an oxiranyl anion coupling and a 6-endo cyclization, and the D-ring was forged by means of an oxidative lactonization and subsequent palladium-catalyzed functionalization of the lactone ring. In this manner, the number of linear synthetic steps required for the construction of the C- and D-rings was reduced from 22 to 11. PMID:25629027

  12. Nucleic acid and protein synthesis during lateral root initiation in Marsilea quadrifolia (Marsileaceae)

    NASA Technical Reports Server (NTRS)

    Lin, B. L.; Raghavan, V.

    1991-01-01

    The pattern of DNA, RNA, and protein synthesis during lateral root initiation in Marsilea quadrifolia L. was monitored by autoradiography of incorporated of 3H-thymidine, 3H-uridine, and 3H-leucine, respectively. DNA synthesis was associated with the enlargement of the lateral root initial prior to its division. Consistent with histological studies, derivatives of the lateral root initial as well as the cells of the adjacent inner cortex and pericycle of the parent root also continued to synthesize DNA. RNA and protein synthetic activities were found to be higher in the lateral root initials than in the endodermal initials of the same longitudinal layer. The data suggest a role for nucleic acid and protein synthesis during cytodifferentiation of a potential endodermal cell into a lateral root initial.

  13. Eutectic Phases in Ice Facilitate Nonenzymatic Nucleic Acid Synthesis

    NASA Astrophysics Data System (ADS)

    Kanavarioti, Anastassia; Monnard, Pierre-Alain; Deamer, David W.

    2001-09-01

    Polymeric compounds similar to oligonucleotides are relevant to the origin of life and particularly to the concept of an RNA world. Although short oligomers of RNA can be synthesized nonenzymatically under laboratory conditions by second-order reactions in concentrated solutions, there is no consensus on how these polymers could have been synthesized de novo on the early Earth from dilute solutions of monomers. To address this question in the context of an RNA world, we have explored ice eutectic phases as a reaction medium. When an aqueous solution freezes, the solutes become concentrated in the spaces between the ice crystals. The increased concentration offsets the effect of the lower temperature and accelerates the reaction. Here we show that in the presence of metal ions in dilute solutions, frozen samples of phosphoimidazolide-activated uridine react within days at -18°C to form oligouridylates up to 11 bases long. Product yields typically exceed 90%, and ~30% of the oligomers include one or more 3‧-5‧ linkages. These conditions facilitate not only the notoriously difficult oligouridylate synthesis, but also the oligomerization of activated cytidylate, adenylate, and guanylate. To our knowledge, this represents the first report to indicate that ice matrices on the early Earth may have accelerated certain prebiotic polymerization reactions.

  14. Glutamic Acid - Amino Acid, Neurotransmitter, and Drug - Is Responsible for Protein Synthesis Rhythm in Hepatocyte Populations in vitro and in vivo.

    PubMed

    Brodsky, V Y; Malchenko, L A; Konchenko, D S; Zvezdina, N D; Dubovaya, T K

    2016-08-01

    Primary cultures of rat hepatocytes were studied in serum-free media. Ultradian protein synthesis rhythm was used as a marker of cell synchronization in the population. Addition of glutamic acid (0.2 mg/ml) to the medium of nonsynchronous sparse cultures resulted in detection of a common protein synthesis rhythm, hence in synchronization of the cells. The antagonist of glutamic acid metabotropic receptors MCPG (0.01 mg/ml) added together with glutamic acid abolished the synchronization effect; in sparse cultures, no rhythm was detected. Feeding rats with glutamic acid (30 mg with food) resulted in protein synthesis rhythm in sparse cultures obtained from the rats. After feeding without glutamic acid, linear kinetics of protein synthesis was revealed. Thus, glutamic acid, a component of blood as a non-neural transmitter, can synchronize the activity of hepatocytes and can form common rhythm of protein synthesis in vitro and in vivo. This effect is realized via receptors. Mechanisms of cell-cell communication are discussed on analyzing effects of non-neural functions of neurotransmitters. Glutamic acid is used clinically in humans. Hence, a previously unknown function of this drug is revealed.

  15. Glutamic Acid - Amino Acid, Neurotransmitter, and Drug - Is Responsible for Protein Synthesis Rhythm in Hepatocyte Populations in vitro and in vivo.

    PubMed

    Brodsky, V Y; Malchenko, L A; Konchenko, D S; Zvezdina, N D; Dubovaya, T K

    2016-08-01

    Primary cultures of rat hepatocytes were studied in serum-free media. Ultradian protein synthesis rhythm was used as a marker of cell synchronization in the population. Addition of glutamic acid (0.2 mg/ml) to the medium of nonsynchronous sparse cultures resulted in detection of a common protein synthesis rhythm, hence in synchronization of the cells. The antagonist of glutamic acid metabotropic receptors MCPG (0.01 mg/ml) added together with glutamic acid abolished the synchronization effect; in sparse cultures, no rhythm was detected. Feeding rats with glutamic acid (30 mg with food) resulted in protein synthesis rhythm in sparse cultures obtained from the rats. After feeding without glutamic acid, linear kinetics of protein synthesis was revealed. Thus, glutamic acid, a component of blood as a non-neural transmitter, can synchronize the activity of hepatocytes and can form common rhythm of protein synthesis in vitro and in vivo. This effect is realized via receptors. Mechanisms of cell-cell communication are discussed on analyzing effects of non-neural functions of neurotransmitters. Glutamic acid is used clinically in humans. Hence, a previously unknown function of this drug is revealed. PMID:27677557

  16. Acid gradient across plasma membrane can drive phosphate bond synthesis in cancer cells: acidic tumor milieu as a potential energy source.

    PubMed

    Dhar, Gautam; Sen, Suvajit; Chaudhuri, Gautam

    2015-01-01

    Aggressive cancers exhibit an efficient conversion of high amounts of glucose to lactate accompanied by acid secretion, a phenomenon popularly known as the Warburg effect. The acidic microenvironment and the alkaline cytosol create a proton-gradient (acid gradient) across the plasma membrane that represents proton-motive energy. Increasing experimental data from physiological relevant models suggest that acid gradient stimulates tumor proliferation, and can also support its energy needs. However, direct biochemical evidence linking extracellular acid gradient to generation of intracellular ATP are missing. In this work, we demonstrate that cancer cells can synthesize significant amounts of phosphate-bonds from phosphate in response to acid gradient across plasma membrane. The noted phenomenon exists in absence of glycolysis and mitochondrial ATP synthesis, and is unique to cancer. Biochemical assays using viable cancer cells, and purified plasma membrane vesicles utilizing radioactive phosphate, confirmed phosphate-bond synthesis from free phosphate (Pi), and also localization of this activity to the plasma membrane. In addition to ATP, predominant formation of pyrophosphate (PPi) from Pi was also observed when plasma membrane vesicles from cancer cells were subjected to trans-membrane acid gradient. Cancer cytosols were found capable of converting PPi to ATP, and also stimulate ATP synthesis from Pi from the vesicles. Acid gradient created through glucose metabolism by cancer cells, as observed in tumors, also proved critical for phosphate-bond synthesis. In brief, these observations reveal a role of acidic tumor milieu as a potential energy source and may offer a novel therapeutic target.

  17. Benign synthesis of 2-ethylhexanoic acid by cytochrome P450cam: enzymatic, crystallographic, and theoretical studies.

    PubMed

    French, K J; Strickler, M D; Rock, D A; Rock, D A; Bennett, G A; Wahlstrom, J L; Goldstein, B M; Jones, J P

    2001-08-14

    This study examines the ability of P450cam to catalyze the formation of 2-ethylhexanoic acid from 2-ethylhexanol relative to its activity on the natural substrate camphor. As is the case for camphor, the P450cam exhibits stereoselectivity for binding (R)- and (S)-2-ethylhexanol. Kinetic studies indicate (R)-2-ethylhexanoic acid is produced 3.5 times as fast as the (S)-enantiomer. In a racemic mixture of 2-ethylhexanol, P450cam produces 50% more (R)-2-ethylhexanoic acid than (S)-2-ethylhexanoic acid. The reason for stereoselective 2-ethylhexanoic acid production is seen in regioselectivity assays, where (R)-2-ethylhexanoic acid comprises 50% of total products while (S)-2-ethylhexanoic acid comprises only 13%. (R)- and (S)-2-ethylhexanol exhibit similar characteristics with respect to the amount of oxygen and reducing equivalents consumed, however, with (S)-2-ethylhexanol turnover producing more water than the (R)-enantiomer. Crystallographic studies of P450cam with (R)- or (S)-2-ethylhexanoic acid suggest that the (R)-enantiomer binds in a more ordered state. These results indicate that wild-type P450cam displays stereoselectivity toward 2-ethylhexanoic acid synthesis, providing a platform for rational active site design. PMID:11583152

  18. Study on Synthesis, Characterization and Antiproliferative Activity of Novel Diisopropylphenyl Esters of Selected Fatty Acids.

    PubMed

    Reddy, Yasa Sathyam; Kaki, Shiva Shanker; Rao, Bala Bhaskara; Jain, Nishant; Vijayalakshmi, Penumarthy

    2016-01-01

    The present study describes the synthesis, characterization and evaluation of antiproliferative activity of novel diisopropylphenyl esters of alpha-linolenic acid (ALA), valproic acid (VA), butyric acid (BA) and 2-ethylhexanoic acid (2-EHA). These esters were chemically synthesized by the esterification of fatty acids with 2,6-diisopropylphenol and 2,4-diisopropylphenol (propofol). The structure of new conjugates viz. propofol-(alpha-linolenic acid) (2,6P-ALA and 2,4P-ALA), propofol-valproic acid (2,6P-VA and 2,4P-VA), propofol-butyric acid (2,6P-BA and 2,4P-BA) and propofol-(2-ethylhexanoic acid) (2,6P2-EHA and 2,4P-2-EHA) were characterized by FT-IR, NMR ((1)H, (13)C) and mass spectral data. The synthesized conjugates having more lipophilic character were tested for antiproliferative in vitro studies on A549, MDA-MB-231, HeLa, Mia-Pa-Ca and HePG2 cancer cell lines. All the conjugates showed specific growth inhibition on studied cancer cell lines. Among the synthesized esters, the conjugates synthesized from BA, VA and 2-EHA exhibited prominent growth inhibition against A549, HeLa, Mia-Pa-Ca and HePG2 cancer cell lines. The preliminary results suggest that the entire novel conjugates possess antiproliferative properties that reduce the proliferation of cancer cells in vitro.

  19. Synthesis of alanyl nucleobase amino acids and their incorporation into proteins.

    PubMed

    Talukder, Poulami; Dedkova, Larisa M; Ellington, Andrew D; Yakovchuk, Petro; Lim, Jaebum; Anslyn, Eric V; Hecht, Sidney M

    2016-09-15

    Proteins which bind to nucleic acids and regulate their structure and functions are numerous and exceptionally important. Such proteins employ a variety of strategies for recognition of the relevant structural elements in their nucleic acid substrates, some of which have been shown to involve rather subtle interactions which might have been difficult to design from first principles. In the present study, we have explored the preparation of proteins containing unnatural amino acids having nucleobase side chains. In principle, the introduction of multiple nucleobase amino acids into the nucleic acid binding domain of a protein should enable these modified proteins to interact with their nucleic acid substrates using Watson-Crick and other base pairing interactions. We describe the synthesis of five alanyl nucleobase amino acids protected in a fashion which enabled their attachment to a suppressor tRNA, and their incorporation into each of two proteins with acceptable efficiencies. The nucleobases studied included cytosine, uracil, thymine, adenine and guanine, i.e. the major nucleobase constituents of DNA and RNA. Dihydrofolate reductase was chosen as one model protein to enable direct comparison of the facility of incorporation of the nucleobase amino acids with numerous other unnatural amino acids studied previously. The Klenow fragment of DNA polymerase I was chosen as a representative DNA binding protein whose mode of action has been studied in detail. PMID:27452282

  20. Synthesis of alanyl nucleobase amino acids and their incorporation into proteins.

    PubMed

    Talukder, Poulami; Dedkova, Larisa M; Ellington, Andrew D; Yakovchuk, Petro; Lim, Jaebum; Anslyn, Eric V; Hecht, Sidney M

    2016-09-15

    Proteins which bind to nucleic acids and regulate their structure and functions are numerous and exceptionally important. Such proteins employ a variety of strategies for recognition of the relevant structural elements in their nucleic acid substrates, some of which have been shown to involve rather subtle interactions which might have been difficult to design from first principles. In the present study, we have explored the preparation of proteins containing unnatural amino acids having nucleobase side chains. In principle, the introduction of multiple nucleobase amino acids into the nucleic acid binding domain of a protein should enable these modified proteins to interact with their nucleic acid substrates using Watson-Crick and other base pairing interactions. We describe the synthesis of five alanyl nucleobase amino acids protected in a fashion which enabled their attachment to a suppressor tRNA, and their incorporation into each of two proteins with acceptable efficiencies. The nucleobases studied included cytosine, uracil, thymine, adenine and guanine, i.e. the major nucleobase constituents of DNA and RNA. Dihydrofolate reductase was chosen as one model protein to enable direct comparison of the facility of incorporation of the nucleobase amino acids with numerous other unnatural amino acids studied previously. The Klenow fragment of DNA polymerase I was chosen as a representative DNA binding protein whose mode of action has been studied in detail.

  1. Stimulation of phosphatidic acid of calcium influx and cyclic GMP synthesis in neuroblastoma cells.

    PubMed

    Ohsako, S; Deguchi, T

    1981-11-10

    Phosphatidic acid added to the medium markedly elevated intracellular cyclic GMP content in cultured neuroblastoma N1E 115 cells. There was a significant elevation of cyclic GMP with 1 micrograms/ml and a maximum (70-fold) elevation with 100 micrograms/ml of phosphatidic acid. Other natural phospholipids did not increase, or increased only slightly, the cyclic GMP content in the cells. The elevation of cyclic GMP content by phosphatidic acid was absolutely dependent on extracellular calcium. Phosphatidic acid stimulated the influx of calcium into neuroblastoma cells 2- to 5-fold. The pattern of the calcium influx induced by phosphatidic acid was comparable to that of cyclic GMP elevation. The stimulation of calcium influx by phosphatidic acid was also observed in cultured heart cells, indicating that phosphatidic acid acts as a calcium ionophore or opens a specific calcium-gate in a variety of cell membranes. Treatment of neuroblastoma cells with phospholipase C increased 32Pi labeling of phosphatidic acid, stimulated the influx of calcium, and elevated the cyclic GMP content in the cells. Thus exogenous as well as endogenous phosphatidic acid stimulates the translocation of calcium across cell membranes and, as a consequence, induces the synthesis of cyclic GMP in the neuroblastoma cells.

  2. In situ synthesis of peptide nucleic acids in porous silicon for drug delivery and biosensing.

    PubMed

    Beavers, Kelsey R; Mares, Jeremy W; Swartz, Caleb M; Zhao, Yiliang; Weiss, Sharon M; Duvall, Craig L

    2014-07-16

    Peptide nucleic acids (PNA) are a unique class of synthetic molecules that have a peptide backbone and can hybridize with nucleic acids. Here, a versatile method has been developed for the automated, in situ synthesis of PNA from a porous silicon (PSi) substrate for applications in gene therapy and biosensing. Nondestructive optical measurements were performed to monitor single base additions of PNA initiated from (3-aminopropyl)triethoxysilane attached to the surface of PSi films, and mass spectrometry was conducted to verify synthesis of the desired sequence. Comparison of in situ synthesis to postsynthesis surface conjugation of the full PNA molecules showed that surface mediated, in situ PNA synthesis increased loading 8-fold. For therapeutic proof-of-concept, controlled PNA release from PSi films was characterized in phosphate buffered saline, and PSi nanoparticles fabricated from PSi films containing in situ grown PNA complementary to micro-RNA (miR) 122 generated significant anti-miR activity in a Huh7 psiCHECK-miR122 cell line. The applicability of this platform for biosensing was also demonstrated using optical measurements that indicated selective hybridization of complementary DNA target molecules to PNA synthesized in situ on PSi films. These collective data confirm that we have established a novel PNA-PSi platform with broad utility in drug delivery and biosensing.

  3. Synthesis, Preliminary Bioevaluation and Computational Analysis of Caffeic Acid Analogues

    PubMed Central

    Liu, Zhiqian; Fu, Jianjun; Shan, Lei; Sun, Qingyan; Zhang, Weidong

    2014-01-01

    A series of caffeic acid amides were designed, synthesized and evaluated for anti-inflammatory activity. Most of them exhibited promising anti-inflammatory activity against nitric oxide (NO) generation in murine macrophage RAW264.7 cells. A 3D pharmacophore model was created based on the biological results for further structural optimization. Moreover, predication of the potential targets was also carried out by the PharmMapper server. These amide analogues represent a promising class of anti-inflammatory scaffold for further exploration and target identification. PMID:24857914

  4. Synthesis and Evaluation of Aryl Boronic Acids as Fluorescent Artificial Receptors for Biological Carbohydrates

    PubMed Central

    Craig, Sandra

    2011-01-01

    Carbohydrates in various forms play a vital role in numerous critical biological processes. The detection of such saccharides can give insight into the progression of such diseases such as cancer. Boronic acids react with 1,2 and 1,3 diols of saccharides in non-aqueous or basic aqueous media. Herein, we describe the design, synthesis and evaluation of three bisboronic acid fluorescent probes, each having about ten linear steps in its synthesis. Among these compounds that were evaluated, 9b was shown to selectively label HepG2, liver carcinoma cell line within a concentration range of 0.5–10 μM in comparison to COS-7, a normal fibroblast cell line. PMID:22177855

  5. Synthesis of Aminoboronic Acid Derivatives from Amines and Amphoteric Boryl Carbonyl Compounds.

    PubMed

    Diaz, Diego B; Scully, Conor C G; Liew, Sean K; Adachi, Shinya; Trinchera, Piera; St Denis, Jeffrey D; Yudin, Andrei K

    2016-10-01

    Herein, we demonstrate the use of α-boryl aldehydes and acyl boronates in the synthesis of aminoboronic acid derivatives. This work highlights the untapped potential of boron-substituted iminium ions and offers insights into the behavior of N-methyliminodiacetyl (MIDA) boronates during condensation and tautomerization processes. The preparative value of this contribution lies in the demonstration that various amines, including linear and cyclic peptides, can be readily conjugated with boron-containing fragments. A mild deprotection of amino MIDA-boronates enables access to α- and β-aminoboronic acids in high chemical yields. This simple process should be applicable to the synthesis of a wide range of bioactive molecules as well as precursors for cross-coupling reactions. PMID:27584917

  6. Synthesis and in vitro Evaluation of Polymeric Prodrug of Ibuprofen with Amino Acid Spacer.

    PubMed

    Redasani, Vivekkumar K; Bari, Sanjay B

    2015-01-01

    The present work is an agreement with simple and efficient method of improving the therapeutic efficacy of ibuprofen by masking its acidic moiety. It aims to reduce gastrointestinal side effects by controlling the rate, duration and site of release. This is achieved by synthesis and evaluation of polymeric prodrug of ibuprofen with natural polymer sodium alginate. The synthesis was supported by N-protected serine as spacer due to chemical incompatibility of drug and polymer. Synthesized prodrug was characterized for confirmation of said structures. The in-vitro dissolution profile of ibuprofen-alginate prodrug showed that the release of the drug is significantly higher in case of pH 7.2 buffer as compared to ibuprofen, which might be due to ester group adjacent to drug get hydrolyzed. The hydrolysis was found to be with faster rate in alkaline media than that of in acidic media.

  7. Synthesis of peptides from amino acids and ATP with lysine-rich proteinoid

    NASA Technical Reports Server (NTRS)

    Nakashima, T.; Fox, S. W.

    1980-01-01

    The paper examines the synthesis of peptides from aminoacids and ATP with a lysine-rich protenoid. The latter in aqueous solution catalyzes the formation of peptides from free amino acids and ATP; this catalytic activity is not found in acidic protenoids, even though the latter contain a basic aminoacid. The pH optimum for the synthesis is about 11, but it is appreciable below 8 and above 13. Temperature data indicate an optimum at 20 C or above, with little increase in rate up to 60 C. Pyrophosphate can be used instead of ATP, but the yields are lower. The ATP-aided syntheses of peptides in aqueous solution occur with several types of proteinous aminoacids.

  8. Stereoselective Synthesis of α-Amino-C-phosphinic Acids and Derivatives.

    PubMed

    Viveros-Ceballos, José Luis; Ordóñez, Mario; Sayago, Francisco J; Cativiela, Carlos

    2016-01-01

    α-Amino-C-phosphinic acids and derivatives are an important group of compounds of synthetic and medicinal interest and particular attention has been dedicated to their stereoselective synthesis in recent years. Among these, phosphinic pseudopeptides have acquired pharmacological importance in influencing physiologic and pathologic processes, primarily acting as inhibitors for proteolytic enzymes where molecular stereochemistry has proven to be critical. This review summarizes the latest developments in the asymmetric synthesis of acyclic and phosphacyclic α-amino-C-phosphinic acids and derivatives, following in the first case an order according to the strategy used, whereas for cyclic compounds the nitrogen embedding in the heterocyclic core is considered. In addition selected examples of pharmacological implications of title compounds are also disclosed. PMID:27589703

  9. REGULATION OF CARDIAC AND SKELETAL MUSCLE PROTEIN SYNTHESIS BY INDIVIDUAL BRANCHED-CHAIN AMINO ACIDS IN NEONATAL PIGS

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Skeletal muscle grows at a very rapid rate in the neonatal pig, due in part to an enhanced sensitivity of protein synthesis to the postprandial rise in amino acids. An increase in leucine alone stimulates protein synthesis in skeletal muscle of the neonatal pig; however, the effect of isoleucine and...

  10. Highly diastereoselective synthesis of quaternary α-trifluoromethyl α-amino acids from chiral imines of trifluoropyruvate.

    PubMed

    Min, Qiao-Qiao; He, Chun-Yang; Zhou, Haibing; Zhang, Xingang

    2010-11-14

    An efficient method for highly diastereoselective synthesis of quaternary α-trifluoromethyl α-amino acids was developed via indium mediated allylation of (R)-phenylglycinol methyl ether based imines of trifluoropyruvate in good yields with high diastereoselectivities at room temperature; to illustrate the application of this method in organic synthesis, 2-allyl-2-(trifluoromethyl) aziridine was prepared in an efficient manner.

  11. Synthesis, biological activity, and bioavailability of moschamine, a safflomide-type phenylpropenoic acid amide found in Centaurea cyanus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Moschamine is a safflomide-type phenylpropenoic acid amide originally isolated from Centaurea cyanus. This paper describes the synthesis, detection of serotoninergic and COX inhibitory activities, and bioavailability of moschamine. Moschamine was chemically synthesized and identified using NMR spect...

  12. A practical synthesis of 3,4-diethoxybenzthioamide based on Friedel-Crafts reaction with potassium thiocyanate in methanesulfonic acid.

    PubMed

    Aki, Shinji; Fujioka, Takafumi; Ishigami, Masashi; Minamikawa, Jun-ichi

    2002-09-01

    The synthesis of 3,4-diethoxybenzthioamide, the key intermediate for OPC-6535, is achieved by employing Friedel-Crafts reaction of 1,2-diethoxybenzene with potassium thiocyanate in methanesulfonic acid at ambient temperature.

  13. Synthesis of Fused Polycyclic Indoles by Brønsted Acid-Catalyzed Intramolecular Alkylation of Indoles with Alcohols.

    PubMed

    Suárez, Anisley; Gohain, Mukut; Fernández-Rodríguez, Manuel A; Sanz, Roberto

    2015-10-16

    An efficient methodology for the synthesis of a series of new fused polyclyclic indoles has been developed by Brønsted acid-catalyzed intramolecular Friedel-Crafts reactions of properly designed indolyl alcohols. PMID:26418556

  14. Green Chemistry in the Organic Teaching Laboratory: An Environmentally Benign Synthesis of Adipic Acid

    NASA Astrophysics Data System (ADS)

    Reed, Scott M.; Hutchison, James E.

    2000-12-01

    Environmentally benign ("green") chemical techniques are growing in importance in academic and industrial research laboratories. Such chemistry has been slow to appear in teaching laboratories, owing in part to a lack of published material on this subject. Recent developments in green synthesis provide opportunities to introduce this material in teaching laboratories. We present a synthesis of adipic acid that utilizes green reagents (hydrogen peroxide as the oxidant), solvents (water), and methods (phase-transfer catalysis, catalyst recycling). The synthesis works well and provides an excellent forum for emphasizing green chemical concepts while teaching laboratory skills. It demonstrates reuse of a product, synthesis using a nonhazardous solvent, elimination of deleterious by-products, and use of a recyclable catalyst. It can be carried out on either the macroscale or microscale and generates little waste if the catalyst solution is recycled. This experiment fits well in a sophomore organic sequence; it covers the topics of oxidation, phase-transfer catalysis, and the technique of recrystallization, reinforces lecture topics such as alkene synthesis and reactivity, and provides an opportunity to introduce polymer chemistry.

  15. Studies on independent synthesis of cytoplasmic ribonucleic acids in Acetabularia mediterranea.

    PubMed

    NAORA, H; BRACHET, J

    1960-07-01

    1. The RNA content of anucleate and nucleate fragments of Acetabularia has been measured. It was found that there is a net synthesis of RNA in nucleate fragments. On the other hand, the RNA content of anucleate fragments did not change significantly after enucleation. 2. Anucleate fragments, however, can readily incorporate (14)C-labeled adenine, orotic acid, and carbon dioxide into their cytoplasmic RNA. 3. The results of experiments on (14)CO(2) incorporation into the RNA of anucleate and nucleate fragments suggest that there is a mechanism for de novo synthesis of RNA in anucleate cytoplasm. 4. In Acetabularia, 81 per cent of the cytoplasmic RNA is bound to a large granule fraction, consisting mainly of chloroplasts. Even after removal of the nucleus, RNA is synthesized in this "chloroplast" fraction. The chloroplasts are thus a major site of RNA synthesis in the cytoplasm of these algae. Synthesis of "chloroplastic" RNA, in anucleate fragments, possibly occurs at the expense of the RNA present in other fractions (microsomes and supernatant). 5. 8-Azaguanine stimulates regeneration and cap formation in anucleate fragments and does not inhibit RNA synthesis in these fragments.

  16. Oleic acid coated magnetic nano-particles: Synthesis and characterizations

    SciTech Connect

    Panda, Biswajit Goyal, P. S.

    2015-06-24

    Magnetic nano particles of Fe{sub 3}O{sub 4} coated with oleic acid were synthesized using wet chemical route, which involved co-precipitation of Fe{sup 2+} and Fe{sup 3+} ions. The nano particles were characterized using XRD, TEM, FTIR, TGA and VSM. X-ray diffraction studies showed that nano particles consist of single phase Fe{sub 3}O{sub 4} having inverse spinel structure. The particle size obtained from width of Bragg peak is about 12.6 nm. TEM analysis showed that sizes of nano particles are in range of 6 to 17 nm with a dominant population at 12 - 14 nm. FTIR and TGA analysis showed that -COOH group of oleic acid is bound to the surface of Fe{sub 3}O{sub 4} particles and one has to heat the sample to 278° C to remove the attached molecule from the surface. Further it was seen that Fe{sub 3}O{sub 4} particles exhibit super paramagnetism with a magnetization of about 53 emu/ gm.

  17. Enzymatic synthesis of enantiopure alpha- and beta-amino acids by phenylalanine aminomutase-catalysed amination of cinnamic acid derivatives.

    PubMed

    Wu, Bian; Szymanski, Wiktor; Wietzes, Piet; de Wildeman, Stefaan; Poelarends, Gerrit J; Feringa, Ben L; Janssen, Dick B

    2009-01-26

    The phenylalanine aminomutase (PAM) from Taxus chinensis catalyses the conversion of alpha-phenylalanine to beta-phenylalanine, an important step in the biosynthesis of the N-benzoyl phenylisoserinoyl side-chain of the anticancer drug taxol. Mechanistic studies on PAM have suggested that (E)-cinnamic acid is an intermediate in the mutase reaction and that it can be released from the enzyme's active site. Here we describe a novel synthetic strategy that is based on the finding that ring-substituted (E)-cinnamic acids can serve as a substrate in PAM-catalysed ammonia addition reactions for the biocatalytic production of several important beta-amino acids. The enzyme has a broad substrate range and a high enantioselectivity with cinnamic acid derivatives; this allows the synthesis of several non-natural aromatic alpha- and beta-amino acids in excellent enantiomeric excess (ee >99 %). The internal 5-methylene-3,5-dihydroimidazol-4-one (MIO) cofactor is essential for the PAM-catalysed amination reactions. The regioselectivity of amination reactions was influenced by the nature of the ring substituent.

  18. Polyanionic Carboxyethyl Peptide Nucleic Acids (ce-PNAs): Synthesis and DNA Binding

    PubMed Central

    Kirillova, Yuliya; Boyarskaya, Nataliya; Dezhenkov, Andrey; Tankevich, Mariya; Prokhorov, Ivan; Varizhuk, Anna; Eremin, Sergei; Esipov, Dmitry; Smirnov, Igor; Pozmogova, Galina

    2015-01-01

    New polyanionic modifications of polyamide nucleic acid mimics were obtained. Thymine decamers were synthesized from respective chiral α- and γ-monomers, and their enantiomeric purity was assessed. Here, we present the decamer synthesis, purification and characterization by MALDI-TOF mass spectrometry and an investigation of the hybridization properties of the decamers. We show that the modified γ-S-carboxyethyl-T10 PNA forms a stable triplex with polyadenine DNA. PMID:26469337

  19. Synthesis of milk specific fatty acids and proteins by dispersed goat mammary-gland epithelial cells.

    PubMed Central

    Hansen, H O; Tornehave, D; Knudsen, J

    1986-01-01

    The method now described for preparation of dispersed lactating goat mammary-gland cells gives a high yield of morphologically and functionally normal mammary cells. The cells synthesize specific goat milk fatty acids in the right proportions, and they respond to hormones by increased protein synthesis. The cells can be frozen and thawed without losing the above properties, which makes them an excellent tool for metabolic and hormonal studies. Images Fig. 1. Fig. 2. PMID:3800930

  20. o-Iodoxybenzoic acid mediated oxidative desulfurization initiated domino reactions for synthesis of azoles.

    PubMed

    Chaudhari, Pramod S; Pathare, Sagar P; Akamanchi, Krishnacharaya G

    2012-04-20

    A systematic exploration of thiophilic ability of o-iodoxybenzoic acid (IBX) for oxidative desulfurization to trigger domino reactions leading to new methodologies for synthesis of different azoles is described. A variety of highly substituted oxadiazoles, thiadiazoles, triazoles, and tetrazoles have been successfully synthesized in good to excellent yields, starting from readily accessible thiosemicarbazides, bis-diarylthiourea, 1,3-disubtituted thiourea, and thioamides. PMID:22423599

  1. Synthesis and activity of 2-oxoamides containing long chain beta-amino acids.

    PubMed

    Constantinou-Kokotou, Violetta; Peristeraki, Anna; Kokotos, Christoforos G; Six, David A; Dennis, Edward A

    2005-07-01

    2-Oxoamides based on long chain beta-amino acids were synthesized. 1-Benzyl substituted long chain amines, needed for such synthesis, were synthesized starting from Boc-phenylalaninol. The oxidative conversion of a phenyl group to a carboxyl group was used as the key transformation synthetic step. The compounds synthesized were studied for their activity against GIVA PLA(2), and were proven to be weak inhibitors. PMID:15635664

  2. Synthesis, structural diversity and fluorescent characterisation of a series of d10 metal-organic frameworks (MOFs): reaction conditions, secondary ligand and metal effects.

    PubMed

    Zhang, Wei Hong; Dong, Zhe; Wang, Yao Yu; Hou, Lei; Jin, Jun Cheng; Huang, Wen Huan; Shi, Qi Zhen

    2011-03-21

    Along with our recent investigation on the flexible ligand of H(2)ADA (1,3-adamantanediacetic acid), a series of Zn(II) and Cd(II) metal-organic frameworks, namely, [Zn(3)(ADA)(3)(H(2)O)(2)](n)·5nH(2)O (1), [Zn(ADA)(4,4'-bipy)(0.5)](n) (2), [Zn(2)(ADA)(2)(bpa)](n) (3), [Zn(2)(ADA)(2)(bpa)](n) (4), [Zn(2)(ADA)(2)(bpp)](n) (5), [Cd(HADA)(2)((4,4'-bipy)](n) (6), [Cd(3)(ADA)(3)(bpa)(2)(CH(3)OH)(H(2)O)](n) (7), and [Cd(2)(ADA)(2)(bpp)(2)](n)·7nH(2)O (8) have been synthesized and structurally characterized (where 4,4'-bipy = 4,4'-dipyridine, bpa = 1,2-bis(4-pyridyl)ethane and bpp = 1,3-bis(4-pyridyl)propane). Due to various coordination modes and conformations of the flexible dicarboxylate ligand and the different pyridyl-containing coligands, these complexes exhibit structural and dimensional diversity. Complex 1 exhibits a three-dimensional (3D) framework containing one-dimensional (1D) Zn(II)-O-C-O-Zn(II) clusters. Complex 2 exhibits a 2D structure constructed by 1D double chains based on [Zn(2)ADA(2)] units and a 4,4'-bipy pillar. Complexes 3 and 4 possess isomorphic 2D layer structures, resulting from the different coordination modes of carboxylate group of ADA ligands. Complex 5 features a 2D 4(4) layer in which ADA ligands and Zn(II) atoms construct a 1D looped chain and the chains are further connected by bpp ligands. Complex 6 is composed of 1D zig-zag chains that are entangled through hydrogen-bonding interactions to generate a 2D network. Complex 7 is a rare (3,5)-connected network. Complex 8 possesses a 3D microporous framework with lots of water molecules encapsulated in the channels. The structural diversity of the complexes perhaps mainly results from using diverse secondary ligands and different metal centre ions, and means the assistant ligand and metal centre play important roles in the design and synthesis of target metal-organic frameworks. This finding revealed that ADA could be used as an effective bridging ligand to construct MOFs and change

  3. Synthesis of kojic acid derivatives as secondary binding site probes of D-amino acid oxidase

    PubMed Central

    Raje, Mithun; Hin, Niyada; Duvall, Bridget; Ferraris, Dana V.; Berry, James F.; Thomas, Ajit G.; Alt, Jesse; Rojas, Camilo; Slusher, Barbara S.; Tsukamoto, Takashi

    2013-01-01

    A series of kojic acid (5-hydroxy-2-hydroxymethyl-4H-pyran-4-one) derivatives were synthesized and tested for their ability to inhibit D-amino acid oxidase (DAAO). Various substituents were incorporated into kojic acid at its 2-hydroxymethyl group. These analogs serve as useful molecular probes to explore the secondary binding site, which can be exploited in designing more potent DAAO inhibitors. PMID:23683589

  4. New Insight on the Synthesis of Neurotoxins Domoic Acid and Kainic Acid.

    PubMed

    Mollica, Adriano; Costante, Roberto; Stefanucci, Azzurra; Novellino, Ettore

    2015-01-01

    Mono or di-substituted prolines, namely proline chimeras of natural or synthetic origin, carry the side chain of other specific amino acids on the pyrrolidine ring. Thus, proline chimeras are useful tools for a wide range of chemical and biological applications as chiral synthons or building blocks for peptidomimetic design. We focused our attention on domoic acid and kainic acid and we report here a concise and up to date review on their stereoselective and asymmetric syntheses.

  5. Integrated process of distillation with side reactors for synthesis of organic acid esters

    SciTech Connect

    Panchal, Chandrakant B; Prindle, John C; Kolah, Aspri; Miller, Dennis J; Lira, Carl T

    2015-11-04

    An integrated process and system for synthesis of organic-acid esters is provided. The method of synthesizing combines reaction and distillation where an organic acid and alcohol composition are passed through a distillation chamber having a plurality of zones. Side reactors are used for drawing off portions of the composition and then recycling them to the distillation column for further purification. Water is removed from a pre-reactor prior to insertion into the distillation column. An integrated heat integration system is contained within the distillation column for further purification and optimizing efficiency in the obtaining of the final product.

  6. Enantioselective Synthesis of Dialkylated α-Hydroxy Carboxylic Acids through Asymmetric Phase-Transfer Catalysis.

    PubMed

    Duan, Shaobo; Li, Sanliang; Ye, Xinyi; Du, Nuan-Nuan; Tan, Choon-Hong; Jiang, Zhiyong

    2015-08-01

    In the presence of an L-tert-leucine-derived urea-ammonium salt as phase-transfer catalyst, a highly enantioselective alkylation of 5H-oxazol-4-ones with various benzyl bromides and allylic bromides has been developed to furnish catalytic asymmetric synthesis of biologically important dialkylated α-hydroxy carboxylic acids with a broad scope. This is the first example of an L-amino acid-derived urea-ammonium salt being used as a phase-transfer catalyst with excellent catalytic efficiency.

  7. Synthesis and sintering of nanocrystalline hydroxyapatite powders by citric acid sol-gel combustion method

    SciTech Connect

    Han Yingchao; Li Shipu; Wang Xinyu; Chen Xiaoming

    2004-01-03

    The citric acid sol-gel combustion method has been used for the synthesis of nanocrystalline hydroxyapatite (HAP) powder from calcium nitrate, diammonium hydrogen phosphate and citric acid. The phase composition of HAP powder was characterized by X-ray powder diffraction analysis (XRD). The morphology of HAP powder was observed by transmission electron microscope (TEM). The HAP powder has been sintered into microporous ceramic in air at 1200 deg. C with 3 h soaking time. The microstructure and phase composition of the resulting HAP ceramic were characterized by scanning electron microscope (SEM) and XRD, respectively. The physical characterization of open porosity and flexural strength have also been carried out.

  8. Total synthesis of leopolic acid A, a natural 2,3-pyrrolidinedione with antimicrobial activity.

    PubMed

    Dhavan, Atul A; Kaduskar, Rahul D; Musso, Loana; Scaglioni, Leonardo; Martino, Piera Anna; Dallavalle, Sabrina

    2016-01-01

    The first total synthesis of leopolic acid A, a fungal metabolite with a rare 2,3-pyrrolidinedione nucleus linked to an ureido dipeptide, was designed and carried out. Crucial steps for the strategy include a Dieckmann cyclization to obtain the 2,3-pyrrolidinedione ring and a Wittig olefination to install the polymethylene chain. An oxazolidinone-containing leopolic acid A analogue was also synthesized. The antibacterial activity showed by both compounds suggests that they could be considered as promising candidates for future developments. PMID:27559415

  9. Total synthesis of leopolic acid A, a natural 2,3-pyrrolidinedione with antimicrobial activity

    PubMed Central

    Dhavan, Atul A; Kaduskar, Rahul D; Musso, Loana; Scaglioni, Leonardo; Martino, Piera Anna

    2016-01-01

    Summary The first total synthesis of leopolic acid A, a fungal metabolite with a rare 2,3-pyrrolidinedione nucleus linked to an ureido dipeptide, was designed and carried out. Crucial steps for the strategy include a Dieckmann cyclization to obtain the 2,3-pyrrolidinedione ring and a Wittig olefination to install the polymethylene chain. An oxazolidinone-containing leopolic acid A analogue was also synthesized. The antibacterial activity showed by both compounds suggests that they could be considered as promising candidates for future developments. PMID:27559415

  10. Synthesis and bioactivity of analogues of the marine antibiotic tropodithietic acid

    PubMed Central

    Rabe, Patrick; Klapschinski, Tim A; Brock, Nelson L; Citron, Christian A; D’Alvise, Paul; Gram, Lone

    2014-01-01

    Summary Tropodithietic acid (TDA) is a structurally unique sulfur-containing antibiotic from the Roseobacter clade bacterium Phaeobacter inhibens DSM 17395 and a few other related species. We have synthesised several structural analogues of TDA and used them in bioactivity tests against Staphylococcus aureus and Vibrio anguillarum for a structure–activity relationship (SAR) study, revealing that the sulfur-free analogue of TDA, tropone-2-carboxylic acid, has an antibiotic activity that is even stronger than the bioactivity of the natural product. The synthesis of this compound and of several analogues is presented and the bioactivity of the synthetic compounds is discussed. PMID:25161739

  11. Total synthesis of gracilioether F. Development and application of Lewis acid promoted ketene–alkene [2+2] cycloadditions and late-stage C—H oxidation

    SciTech Connect

    Rasik, Christopher M.; Brown, M. Kevin

    2014-12-22

    The first synthesis of gracilioether F, a polyketide natural product with an unusual tricyclic core and five contiguous stereocenters, is described. Key steps of the synthesis include a Lewis acid promoted ketene–alkene [2+2] cycloaddition and a late-stage carboxylic acid directed C(sp³)—H oxidation. The synthesis requires only eight steps from norbornadiene.

  12. Synthesis and preliminary biological evaluations of (+)-isocampholenic acid-derived amides.

    PubMed

    Grošelj, Uroš; Golobič, Amalija; Knez, Damijan; Hrast, Martina; Gobec, Stanislav; Ričko, Sebastijan; Svete, Jurij

    2016-08-01

    The synthesis of two novel (+)-isocampholenic acid-derived amines has been realized starting from commercially available (1S)-(+)-10-camphorsulfonic acid. The novel amines as well as (+)-isocampholenic acid have been used as building blocks in the construction of a library of amides using various aliphatic, aromatic, and amino acid-derived coupling partners using BPC and CDI as activating agents. Amide derivatives have been assayed against several enzymes that hold potential for the development of new drugs to battle bacterial infections and Alzheimer's disease. Compounds 20c and 20e showed promising selective sub-micromolar inhibition of human butyrylcholinesterase [Formula: see text] ([Formula: see text] values [Formula: see text] and [Formula: see text], respectively). PMID:27017352

  13. A novel and highly regioselective synthesis of new carbamoylcarboxylic acids from dianhydrides.

    PubMed

    Ochoa-Terán, Adrián; Estrada-Manjarrez, Jesús; Martínez-Quiroz, Marisela; Landey-Álvarez, Marco A; Alcántar Zavala, Eleazar; Pina-Luis, Georgina; Santacruz Ortega, Hisila; Gómez-Pineda, Luis Enrique; Ramírez, José-Zeferino; Chávez, Daniel; Montes Ávila, Julio; Labastida-Galván, Victoria; Ordoñez, Mario

    2014-01-01

    A regioselective synthesis has been developed for the preparation of a series of N,N'-disubstituted 4,4'-carbonylbis(carbamoylbenzoic) acids and N,N'-disubstituted bis(carbamoyl) terephthalic acids by treatment of 3,3',4,4'-benzophenonetetracarboxylic dianhydride (1) and 1,2,4,5-benzenetetracarboxylic dianhydride (2) with arylalkyl primary amines (A-N). The carbamoylcarboxylic acid derivatives were synthesized with good yield and high purity. The specific reaction conditions were established to obtain carbamoyl and carboxylic acid functionalities over the thermodynamically most favored imide group. Products derived from both anhydrides 1 and 2 were isolated as pure regioisomeric compounds under innovative experimental conditions. The chemo- and regioselectivity of products derived from dianhydrides were determined by NMR spectroscopy and confirmed by density functional theory (DFT). All products were characterized by NMR, FTIR, and MS.

  14. A Novel and Highly Regioselective Synthesis of New Carbamoylcarboxylic Acids from Dianhydrides

    PubMed Central

    Ochoa-Terán, Adrián; Estrada-Manjarrez, Jesús; Martínez-Quiroz, Marisela; Landey-Álvarez, Marco A.; Alcántar Zavala, Eleazar; Pina-Luis, Georgina; Santacruz Ortega, Hisila; Gómez-Pineda, Luis Enrique; Ramírez, José-Zeferino; Chávez, Daniel; Montes Ávila, Julio; Labastida-Galván, Victoria; Ordoñez, Mario

    2014-01-01

    A regioselective synthesis has been developed for the preparation of a series of N,N′-disubstituted 4,4′-carbonylbis(carbamoylbenzoic) acids and N,N′-disubstituted bis(carbamoyl) terephthalic acids by treatment of 3,3′,4,4′-benzophenonetetracarboxylic dianhydride (1) and 1,2,4,5-benzenetetracarboxylic dianhydride (2) with arylalkyl primary amines (A-N). The carbamoylcarboxylic acid derivatives were synthesized with good yield and high purity. The specific reaction conditions were established to obtain carbamoyl and carboxylic acid functionalities over the thermodynamically most favored imide group. Products derived from both anhydrides 1 and 2 were isolated as pure regioisomeric compounds under innovative experimental conditions. The chemo- and regioselectivity of products derived from dianhydrides were determined by NMR spectroscopy and confirmed by density functional theory (DFT). All products were characterized by NMR, FTIR, and MS. PMID:24511299

  15. Ionic liquids as novel solvents for the synthesis of sugar fatty acid ester.

    PubMed

    Mai, Ngoc Lan; Ahn, Kihun; Bae, Sang Woo; Shin, Dong Woo; Morya, Vivek Kumar; Koo, Yoon-Mo

    2014-12-01

    Sugar fatty acid esters are bio-surfactants known for their non-toxic, non-ionic, and high biodegradability . With great emulsifying and conditioning effects, sugar fatty acids are widely used in the food, pharmaceutical, and cosmetic industries. Biosynthesis of sugar fatty acid esters has attracted growing attention in recent decades. In this study, the enzymatic synthesis of sugar fatty acid esters in ionic liquids was developed, optimized, and scaled up. Reaction parameters affecting the conversion yield of lipase-catalyzed synthesis of glucose laurate from glucose and vinyl laurate (i.e. temperature, vinyl laurate/glucose molar ratio, and enzyme loads) were optimized by response surface methodology (RSM). In addition, production was scaled up to 2.5 L, and recycling of enzyme and ionic liquids was investigated. The results showed that under optimal reaction conditions (66.86 °C, vinyl laurate/glucose molar ratio of 7.63, enzyme load of 73.33 g/L), an experimental conversion yield of 96.4% was obtained which is close to the optimal value predicted by RSM (97.16%). A similar conversion yield was maintained when the reaction was carried out at 2.5 L. Moreover, the enzymes and ionic liquids could be recycled and reused effectively for up to 10 cycles. The results indicate the feasibility of ionic liquids as novel solvents for the biosynthesis of sugar fatty acid esters.

  16. Synthesis of non-aggregated nicotinic acid coated magnetite nanorods via hydrothermal technique

    NASA Astrophysics Data System (ADS)

    Attallah, Olivia A.; Girgis, E.; Abdel-Mottaleb, Mohamed M. S. A.

    2016-02-01

    Non-aggregated magnetite nanorods with average diameters of 20-30 nm and lengths of up to 350 nm were synthesized via in situ, template free hydrothermal technique. These nanorods capped with different concentrations (1, 1.5, 2 and 2.5 g) of nicotinic acid (vitamin B3); possessed good magnetic properties and easy dispersion in aqueous solutions. Our new synthesis technique maintained the uniform shape of the nanorods even with increasing the coating material concentration. The effect of nicotinic acid on the shape, particle size, chemical structure and magnetic properties of the prepared nanorods was evaluated using different characterization methods. The length of nanorods increased from 270 nm to 350 nm in nicotinic acid coated nanorods. Goethite and magnetite phases with different ratios were the dominant phases in the coated samples while a pure magnetite phase was observed in the uncoated one. Nicotinic acid coated magnetic nanorods showed a significant decrease in saturation magnetization than uncoated samples (55 emu/g) reaching 4 emu/g in 2.5 g nicotinic acid coated sample. The novel synthesis technique proved its potentiality to prepare coated metal oxides with one dimensional nanostructure which can function effectively in different biological applications.

  17. Metabolic switch during adipogenesis: From branched chain amino acid catabolism to lipid synthesis.

    PubMed

    Halama, Anna; Horsch, Marion; Kastenmüller, Gabriele; Möller, Gabriele; Kumar, Pankaj; Prehn, Cornelia; Laumen, Helmut; Hauner, Hans; Hrabĕ de Angelis, Martin; Beckers, Johannes; Suhre, Karsten; Adamski, Jerzy

    2016-01-01

    Fat cell metabolism has an impact on body homeostasis and its proper function. Nevertheless, the knowledge about simultaneous metabolic processes, which occur during adipogenesis and in mature adipocytes, is limited. Identification of key metabolic events associated with fat cell metabolism could be beneficial in the field of novel drug development, drug repurposing, as well as for the discovery of patterns predicting obesity risk. The main objective of our work was to provide comprehensive characterization of metabolic processes occurring during adipogenesis and in mature adipocytes. In order to globally determine crucial metabolic pathways involved in fat cell metabolism, metabolomics and transcriptomics approaches were applied. We observed significantly regulated metabolites correlating with significantly regulated genes at different stages of adipogenesis. We identified the synthesis of phosphatidylcholines, the metabolism of even and odd chain fatty acids, as well as the catabolism of branched chain amino acids (BCAA; leucine, isoleucine and valine) as key regulated pathways. Our further analysis led to identification of an enzymatic switch comprising the enzymes Hmgcs2 (3-hydroxy-3-methylglutaryl-CoA synthase) and Auh (AU RNA binding protein/enoyl-CoA hydratase) which connects leucine degradation with cholesterol synthesis. In addition, propionyl-CoA, a product of isoleucine degradation, was identified as a putative substrate for odd chain fatty acid synthesis. The uncovered crosstalks between BCAA and lipid metabolism during adipogenesis might contribute to the understanding of molecular mechanisms of obesity and have potential implications in obesity prediction. PMID:26408941

  18. Abolished synthesis of cholic acid reduces atherosclerotic development in apolipoprotein E knockout mice.

    PubMed

    Slätis, Katharina; Gåfvels, Mats; Kannisto, Kristina; Ovchinnikova, Olga; Paulsson-Berne, Gabrielle; Parini, Paolo; Jiang, Zhao-Yan; Eggertsen, Gösta

    2010-11-01

    To investigate the effects of abolished cholic acid (CA) synthesis in the ApoE knockout model [apolipoprotein E (apoE) KO],a double-knockout (DKO) mouse model was created by crossbreeding Cyp8b1 knockout mice (Cyp8b1 KO), unable to synthesize the primary bile acid CA, with apoE KO mice. After 5 months of cholesterol feeding, the development of atherosclerotic plaques in the proximal aorta was 50% less in the DKO mice compared with the apoE KO mice. This effect was associated with reduced intestinal cholesterol absorption, decreased levels of apoB-containing lipoproteins in the plasma, enhanced bile acid synthesis, reduced hepatic cholesteryl esters, and decreased hepatic activity of ACAT2. The upregulation of Cyp7a1 in DKO mice seemed primarily caused by reduced expression of the intestinal peptide FGF15. Treatment of DKO mice with the farnesoid X receptor (FXR) agonist GW4064 did not alter the intestinal cholesterol absorption, suggesting that the action of CA in this process is confined mainly to formation of intraluminal micelles and less to its ability to activate the nuclear receptor FXR. Inhibition of CA synthesis may offer a therapeutic strategy for the treatment of hyperlipidemic conditions that lead to atherosclerosis.

  19. Acid synthesis of luminescent amine-functionalized or erbium-doped silica spheres for biological applications.

    PubMed

    Enrichi, Francesco; Trave, Enrico; Bersani, Marco

    2008-03-01

    In this work we discuss and investigate the morphological and optical properties of luminescent silica spheres which can have interesting applications in bioimaging and biosensing. The spheres are synthesized following an acid route by the hydrolysis and condensation of tetraethylortosilicate (TEOS) and can be functionalized by incorporation of aminopropyl-triethoxysilane (APTES) during the synthesis, inducing a significant luminescence that can be attributed to a recombination mechanism from localized organic defects related to -NH(2) groups. It is shown that the acid synthesis route produces very regular spherical particles, but their diameter vary in the range of 200-4,000 nm. The luminescence properties have been investigated and optimized by variation of the annealing temperature for the functionalized spheres, obtaining the most efficient PL emission after a thermal treatment of 1 h at 600 degrees C in air. Moreover, the possibility to introduce rare earths like erbium in the spheres was also studied and the corresponding Er(3) luminescence emission at 1.53 microm is reported in terms of intensity and lifetime, pointing out that erbium can be easily and efficiently incorporated during the acid synthesis giving high PL intensity with a good lifetime of 3.9 ms.

  20. Synthesis and characterization of agricultural controllable humic acid superabsorbent.

    PubMed

    Gao, Lijuan; Wang, Shiqiang; Zhao, Xuefei

    2013-12-01

    Humic acid superabsorbent polymer (P(AA/AM-HA)) and superabsorbent polymer (P(AA/AM)) were synthesized by aqueous solution polymerization method using acrylic acid (AA), acrylamide (AM) and humic acid (HA) as raw material. The effects of N,N'-methylenebisacrylamide (MBA) crosslinking agent, potassium peroxydisulfate (KPS) initiator, reaction temperature, HA content, ratio of AA to AM, concentration of monomer and neutralization of AA on water absorption were investigated. Absorption and desorption ratios of nitrogen fertilizer and phosphate fertilizer were also investigated by determination of absorption and desorption ratio of NH4(+), PO4(3-) on P(AA/AM-HA) and P(AA/AM). The P(AA/AM-HA) and P(AA/AM) were characterized by Fourier translation infrared spectroscopy, biological photomicroscope and scanning electron microscopy (SEM). The optimal conditions obtained were as follows: the weight ratio of MBA to AA and AM was 0.003; the weight ratio of KPS to AA and AM was 0.008; the weight ratio of HA to AA was 0.1; the mole ratio of AM to AA is 0.1; the mole ratio of NaOH to AA is 0.9; the reaction temperature was 60°C. P(AA/AM-HA) synthesized under optimal conditions, has a good saline tolerance, its water absorbency in distilled water and 0.9 wt.% saline solution is 1180 g/g and 110 g/g, respectively. P(AA/AM-HA) achieves half saturation in 6.5 min. P(AA/AM-HA) is superior to P(AA/AM) on absorption of NH4(+), PO4(3-). The SEM micrograph of P(AA/AM-HA) shows a fine alveolate structure. The biological optical microscope micrograph of P(AA/AM-HA) shows a network structure. Graft polymerization between P(AA/AM) and HA was demonstrated by infrared spectrum. The P(AA/AM-HA) superabsorbent has better absorbing ability of water and fertilizer, electrolytic tolerance and fewer cost than P(AA/AM) superabsorbent. PMID:25078843

  1. Radiation synthesis of nanosilver nanohydrogels of poly(methacrylic acid)

    NASA Astrophysics Data System (ADS)

    Gupta, Bhuvanesh; Gautam, Deepti; Anjum, Sadiya; Saxena, Shalini; Kapil, Arti

    2013-11-01

    Nanosilver nanohydrogels (nSnH) of poly(methacrylic acid) were synthesized and stabilized using gamma irradiation. The main objective of this study was to develop silver nanoparticles and to evaluate the antimicrobial activity. Radiation helps in the polymerization, crosslinking and reduction of silver nitrate as well. Highly stable and uniformly distributed silver nanoparticles have been obtained within hydrogel network by water in oil nanoemulsion polymerization and were evaluated by dynamic light scattering (DLS) and transmission electron microscopy (TEM) respectively. TEM showed almost spherical and uniform distribution of silver nanoparticles through the hydrogel network. The mean size of silver nanoparticles ranging is 10-50 nm. The nanohydrogels showed good swelling in water. Antibacterial studies of nSnH suggest that it can be a good candidate as coating material in biomedical applications.

  2. Proton donor acidity controls selectivity in nonaromatic nitrogen heterocycle synthesis.

    PubMed

    Duttwyler, Simon; Chen, Shuming; Takase, Michael K; Wiberg, Kenneth B; Bergman, Robert G; Ellman, Jonathan A

    2013-02-01

    Piperidines are prevalent in natural products and pharmaceutical agents and are important synthetic targets for drug discovery and development. We report on a methodology that provides highly substituted piperidine derivatives with regiochemistry selectively tunable by varying the strength of acid used in the reaction. Readily available starting materials are first converted to dihydropyridines via a cascade reaction initiated by rhodium-catalyzed carbon-hydrogen bond activation. Subsequent divergent regio- and diastereoselective protonation of the dihydropyridines under either kinetic or thermodynamic control provides two distinct iminium ion intermediates that then undergo highly diastereoselective nucleophilic additions. X-ray structural characterization of both the kinetically and thermodynamically favored iminium ions along with density functional theory calculations provide a theoretical underpinning for the high selectivities achieved for the reaction sequences.

  3. Synthesis and antiproliferative activity of glutamic acid-based dipeptides.

    PubMed

    Silveira-Dorta, Gastón; Martín, Víctor S; Padrón, José M

    2015-08-01

    A small and focused library of 22 dipeptides derived from N,N-dibenzylglutamic acid α- and γ-benzyl esters was prepared in a straightforward manner. The evaluation of the antiproliferative activity in the human solid tumor cell lines HBL-100 (breast), HeLa (cervix), SW1573 (non-small cell lung), T-47D (breast), and WiDr (colon) provided γ-glutamyl methionine (GI50 = 6.0-41 μM) and α-glutamyl proline (GI50 = 7.5-18 μM) as lead compounds. In particular, glutamyl serine and glutamyl proline dipeptides were more active in the resistant cancer cell line WiDr than the conventional anticancer drugs cisplatin and etoposide. Glutamyl tryptophan dipeptides did not affect cell growth of HBL-100, while in T-47D cells, proliferation was inhibited. This result might be attributed to the inhibition of the ATB(0,+) transporter.

  4. Synthesis and antiproliferative activity of glutamic acid-based dipeptides.

    PubMed

    Silveira-Dorta, Gastón; Martín, Víctor S; Padrón, José M

    2015-08-01

    A small and focused library of 22 dipeptides derived from N,N-dibenzylglutamic acid α- and γ-benzyl esters was prepared in a straightforward manner. The evaluation of the antiproliferative activity in the human solid tumor cell lines HBL-100 (breast), HeLa (cervix), SW1573 (non-small cell lung), T-47D (breast), and WiDr (colon) provided γ-glutamyl methionine (GI50 = 6.0-41 μM) and α-glutamyl proline (GI50 = 7.5-18 μM) as lead compounds. In particular, glutamyl serine and glutamyl proline dipeptides were more active in the resistant cancer cell line WiDr than the conventional anticancer drugs cisplatin and etoposide. Glutamyl tryptophan dipeptides did not affect cell growth of HBL-100, while in T-47D cells, proliferation was inhibited. This result might be attributed to the inhibition of the ATB(0,+) transporter. PMID:25900811

  5. Synthesis and degradation test of hyaluronic acid hydrogels.

    PubMed

    Hahn, Sei Kwang; Park, Jung Kyu; Tomimatsu, Takashi; Shimoboji, Tsuyoshi

    2007-03-10

    Hyaluronic acid (HA) hydrogels prepared with three different crosslinking reagents were assessed by in vitro and in vivo degradation tests for various tissue engineering applications. Adipic acid dihydrazide grafted HA (HA-ADH) was synthesized and used for the preparation of methacrylated HA (HA-MA) with methacrylic anhydride and thiolated HA (HA-SH) with Traut's reagent (imminothiolane). (1)H NMR analysis showed that the degrees of HA-ADH, HA-MA, and HA-SH modification were 69, 29, and 56 mol%, respectively. HA-ADH hydrogel was prepared by the crosslinking with bis(sulfosuccinimidyl) suberate (BS(3)), HA-MA hydrogel with dithiothreitol (DTT) by Michael addition, and HA-SH hydrogel with sodium tetrathionate by disulfide bond formation. According to in vitro degradation tests, HA-SH hydrogel was degraded very fast, compared to HA-ADH and HA-MA hydrogels. HA-ADH hydrogel was degraded slightly faster than HA-MA hydrogel. Based on these results, HA-MA hydrogels and HA-SH hydrogels were implanted in the back of SD rats and their degradation was assessed according to the pre-determined time schedule. As expected from the in vitro degradation test results, HA-SH hydrogel was in vivo degraded completely only in 2 weeks, whereas HA-MA hydrogels were degraded only partially even in 29 days. The degradation rate of HA hydrogels were thought to be controlled by changing the crosslinking reagents and the functional group of HA derivatives. In addition, the state of HA hydrogel was another factor in controlling the degradation rate. Dried HA hydrogel at 37 degrees C for a day resulted in relatively slow degradation compared to the bulk HA hydrogel. There was no adverse effect during the in vivo tests. PMID:17101173

  6. Synthesis of acid-base bifunctional mesoporous materials by oxidation and thermolysis

    SciTech Connect

    Yu, Xiaofang; Zou, Yongcun; Wu, Shujie; Liu, Heng; Guan, Jingqi; Kan, Qiubin

    2011-06-15

    Graphical abstract: A novel and efficient method has been developed for the synthesis of acid-base bifunctional catalyst. The obtained sample of SO{sub 3}H-MCM-41-NH{sub 2} containing amine and sulfonic acids exhibits excellent catalytic activity in aldol condensation reaction. Research highlights: {yields} Synthesize acid-base bifunctional mesoporous materials SO{sub 3}H-MCM-41-NH{sub 2}. {yields} Oxidation and then thermolysis to generate acidic site and basic site. {yields} Exhibit good catalytic performance in aldol condensation reaction between acetone and various aldehydes. -- Abstract: A novel and efficient method has been developed for the synthesis of acid-base bifunctional catalyst SO{sub 3}H-MCM-41-NH{sub 2}. This method was achieved by co-condensation of tetraethylorthosilicate (TEOS), 3-mercaptopropyltrimethoxysilane (MPTMS) and (3-triethoxysilylpropyl) carbamicacid-1-methylcyclohexylester (3TAME) in the presence of cetyltrimethylammonium bromide (CTAB), followed by oxidation and then thermolysis to generate acidic site and basic site. X-ray diffraction (XRD) and transmission electron micrographs (TEM) show that the resultant materials keep mesoporous structure. Thermogravimetric analysis (TGA), X-ray photoelectron spectra (XPS), back titration, solid-state {sup 13}C CP/MAS NMR and solid-state {sup 29}Si MAS NMR confirm that the organosiloxanes were condensed as a part of the silica framework. The bifunctional sample (SO{sub 3}H-MCM-41-NH{sub 2}) containing amine and sulfonic acids exhibits excellent acid-basic properties, which make it possess high activity in aldol condensation reaction between acetone and various aldehydes.

  7. Effects of Abscisic Acid and Ethylene on the Gibberellic Acid-Induced Synthesis of α-Amylase by Isolated Wheat Aleurone Layers 1

    PubMed Central

    Varty, Keith; Arreguín, Barbarín L.; Gómez, Miguel T.; López, Pablo Jaime T.; Gómez, Miguel Angel L.

    1983-01-01

    Gibberellic acid-induced α-amylase synthesis in wheat aleurone layers (Triticum aestivum L. var Potam S-70) escaped from transcriptional control 30 h after addition of the hormone, as evidenced by the tissue's loss of susceptibility to cordycepin. Abscisic acid inhibited the accumulation of α-amylase activity when added to the tissue during this cordycepin-insensitive phase of enzyme induction. α-Amylase synthesis was not restored by the addition of cordycepin, indicating that the response to abscisic acid was not dependent upon the continuous synthesis of a short lived RNA. When ethylene was added simultaneously or some time after abscisic acid, the accumulation of α-amylase activity was sustained or quickly restored. The loss of susceptibility to cordycepin was completely prevented when aleurone layers were incubated with a combination of gibberellic and abscisic acids from the start of the induction period. This effect of abscisic acid was not reversed by ethylene. On the basis of these observations, it is suggested that abscisic acid inhibits both the transcription and translation of α-amylase mRNA, and that only the latter site of action is susceptible to reversal by ethylene. The rate of incorporation of [methyl-14C]choline into phospholipids was also inhibited by abscisic acid. Ethylene reversed this effect. The effects of abscisic acid and ethylene on phospholipid synthesis were not dependent upon the presence of gibberellic acid. No direct relationship was found between the control of α-amylase synthesis and membrane formation by abscisic acid and ethylene. PMID:16663284

  8. The Synthesis and Isolation of N-Tert-Butyl-2-Phenylsuccinamic Acid and N-Tert-Butyl-3-Phenylsuccinamic Acid: An Undergraduate Organic Chemistry Laboratory Experiment

    ERIC Educational Resources Information Center

    Cesare, Victor; Sadarangani, Ishwar; Rollins, Janet; Costello, Dennis

    2004-01-01

    The facile, high yielding synthesis of phenylsuccinamic acids is described and one of these syntheses, the reaction of phenylsuccinic anhydride with tert-butylamine, is successfully modified and adapted for use in the second-semester organic chemistry laboratory at St. John's University. Succinamic acids are compounds that contain both the amide…

  9. Expanding the amino acid repertoire of ribosomal polypeptide synthesis via the artificial division of codon boxes

    NASA Astrophysics Data System (ADS)

    Iwane, Yoshihiko; Hitomi, Azusa; Murakami, Hiroshi; Katoh, Takayuki; Goto, Yuki; Suga, Hiroaki

    2016-04-01

    In ribosomal polypeptide synthesis the library of amino acid building blocks is limited by the manner in which codons are used. Of the proteinogenic amino acids, 18 are coded for by multiple codons and therefore many of the 61 sense codons can be considered redundant. Here we report a method to reduce the redundancy of codons by artificially dividing codon boxes to create vacant codons that can then be reassigned to non-proteinogenic amino acids and thereby expand the library of genetically encoded amino acids. To achieve this, we reconstituted a cell-free translation system with 32 in vitro transcripts of transfer RNASNN (tRNASNN) (S = G or C), assigning the initiator and 20 elongator amino acids. Reassignment of three redundant codons was achieved by replacing redundant tRNASNNs with tRNASNNs pre-charged with non-proteinogenic amino acids. As a demonstration, we expressed a 32-mer linear peptide that consists of 20 proteinogenic and three non-proteinogenic amino acids, and a 14-mer macrocyclic peptide that contains more than four non-proteinogenic amino acids.

  10. Synthesis and Anti-microbial Activity of Novel Phosphatidylethanolamine-N-amino Acid Derivatives.

    PubMed

    Vijeetha, Tadla; Balakrishna, Marrapu; Karuna, Mallampalli Sri Lakshmi; Surya Koppeswara Rao, Bhamidipati Venkata; Prasad, Rachapudi Badari Narayana; Kumar, Koochana Pranay; Surya Narayana Murthy, Upadyaula

    2015-01-01

    The study involved synthesis of five novel amino acid derivatives of phosphatidylethanolamine isolated from egg yolk lecithin employing a three step procedure i) N-protection of L-amino acids with BOC anhydride in alkaline medium ii) condensation of - CO2H group of N-protected amino acid with free -NH2 of PE by a peptide linkage and iii) deprotection of N-protected group of amino acids to obtain phosphatidylethanolamine-N-amino acid derivatives in 60-75% yield. The five L-amino acids used were L glycine, L-valine, L-leucine, L-isoleucine and L-phenylalanine. The amino acid derivatives were screened for anti-baterial activity against B. subtilis, S. aureus, P. aeroginosa and E. coli taking Streptomycin as reference compound and anti-fungal activity against C. albicans, S. cervisiae, A. niger taking AmphotericinB as reference compound. All the amino acid derivatives exhibited extraordinary anti-bacterial activities about 3 folds or comparable to Streptomycin and moderate or no anti-fungal activity against Amphotericin-B.

  11. Oxidative cleavage of erucic acid for the synthesis of brassylic acid

    SciTech Connect

    Mohammed J. Nasrullah; Pooja Thapliyal; Erica N. Pfarr; Nicholas S. Dusek; Kristofer L. Schiele; James A. Bahr

    2010-10-29

    The main focus of this work is to synthesize Brassylic Acid (BA) using oxidative cleavage of Erucic Acid (EA). Crambe (Crambe abyssinica) is an industrial oilseed grown in North Dakota. Crambe has potential as an industrial fatty acid feedstock as a source of Erucic acid (EA). It has approximately 50-60 % of EA, a C{sub 22} monounsaturated fatty acid. Oxidative cleavage of unsaturated fatty acids derived from oilseeds produces long chain (9, 11, and 13 carbon atoms) dibasic and monobasic acids. These acids are known commercial feedstocks for the preparation of nylons, polyesters, waxes, surfactants, and perfumes. Other sources of EA are Rapeseed seed oil which 50-60 % of EA. Rapeseed is grown outside USA. The oxidative cleavage of EA was done using a high throughput parallel pressure reactor system. Kinetics of the reaction shows that BA yields reach a saturation at 12 hours. H{sub 2}WO{sub 4} was found to be the best catalyst for the oxidative cleavage of EA. High yields of BA were obtained at 80 C with bubbling of O{sub 2} or 10 bar of O{sub 2} for 12 hours.

  12. Synthesis, growth of organic nonlinear optical crystal: Semicarbazone of 2-amino-5-chloro-benzophenone (S2A5CB) and its characterisation

    NASA Astrophysics Data System (ADS)

    Sethuraman, K.; Ramesh Babu, R.; Vijayan, N.; Gopalakrishnan, R.; Ramasamy, P.

    2006-05-01

    A new organic crystal of semicarbazone of 2-amino-5-chloro-benzophenone has been grown as a single crystal by slow evaporation solution growth technique for the first time in the literature. The grown crystal has been characterised by proton nuclear magnetic resonance spectral analysis and single crystal and powder X-ray diffraction studies. Functional groups of the crystallised molecules were confirmed by FT-IR and FT-Raman analyses. Mechanical strength of the crystals was studied by microhardness test. Optical transparency of the grown crystals has been studied by UV-Visible spectra. The second harmonic generation property of the compound was analysed.

  13. Synthesis of an acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters

    DOEpatents

    Moens, Luc

    1999-01-01

    A process of preparing an acid addition salt of delta-aminolevulinic acid comprising: dissolving a lower alkyl 5-bromolevulinate and an alkali metal diformylamide in an organic solvent selected from the group consisting of acetonitrile, methanol, tetrahydrofuran, 2-methyltetrahydrofuran and methylformate or mixtures thereof to form a suspension of an alkyl 5-(N,N-diformylamino) levulinate ester; and hydrolyzing said alkyl 5-(N,N-diformylamino) levulinate with an inorganic acid to form an acid addition salt of delta-amino levulinic acid.

  14. Synthesis of an acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters

    DOEpatents

    Moens, L.

    1999-05-25

    A process is disclosed for preparing an acid addition salt of delta-aminolevulinic acid comprising. The process involves dissolving a lower alkyl 5-bromolevulinate and an alkali metal diformylamide in an organic solvent selected from the group consisting of acetonitrile, methanol, tetrahydrofuran, 2-methyltetrahydrofuran and methylformate or mixtures to form a suspension of an alkyl 5-(N,N-diformylamino) levulinate ester; and hydrolyzing the alkyl 5-(N,N-diformylamino) levulinate with an inorganic acid to form an acid addition salt of delta-amino levulinic acid.

  15. A Direct, Biomass-Based Synthesis of Benzoic Acid: Formic Acid-Mediated Deoxygenation of the Glucose-Derived Materials Quinic Acid and Shikimic Acid

    SciTech Connect

    Arceo, Elena; Ellman, Jonathan; Bergman, Robert

    2010-05-03

    An alternative biomass-based route to benzoic acid from the renewable starting materials quinic acid and shikimic acid is described. Benzoic acid is obtained selectively using a highly efficient, one-step formic acid-mediated deoxygenation method.

  16. Chemical synthesis and enzymatic, stereoselective hydrolysis of a functionalized dihydropyrimidine for the synthesis of β-amino acids.

    PubMed

    Slomka, Christin; Zhong, Sabilla; Fellinger, Anna; Engel, Ulrike; Syldatk, Christoph; Bräse, Stefan; Rudat, Jens

    2015-12-01

    A novel substrate, 6-(4-nitrophenyl)dihydropyrimidine-2,4(1H,3H)-dione (pNO2PheDU), was chemically synthesized and analytically verified for the potential biocatalytic synthesis of enantiopure β-amino acids. The hydantoinase (EC 3.5.2.2) from Arthrobacter crystallopoietes DSM20117 was chosen to prove the enzymatic hydrolysis of this substrate, since previous investigations showed activities of this enzyme toward 6-monosubstituted dihydrouracils. Whole cell biotransformations with recombinant Escherichia coli expressing the hydantoinase showed degradation of pNO2PheDU. Additionally, the corresponding N-carbamoyl-β-amino acid (NCarbpNO2 βPhe) was chemically synthesized, an HPLC-method with chiral stationary phases for detection of this product was established and thus (S)-enantioselectivity toward pNO2PheDU has been shown. Consequently this novel substrate is a potential precursor for the enantiopure β-amino acid para-nitro-β-phenylalanine (pNO2 βPhe). PMID:26705241

  17. Template-directed synthesis of oligoguanylic acids - Metal ion catalysis

    NASA Technical Reports Server (NTRS)

    Bridson, P. K.; Fakhrai, H.; Lohrmann, R.; Orgel, L. E.; Van Roode, M.

    1981-01-01

    The effects of Zn(2+), Pb(2+) and other metal ions on the efficiency and stereo-selectivity of the template-directed oligomerization of guanosine 5'-phosphorimidazolide are investigated. Reactions were run in the presence of a polyC template in a 2,6-lutidine buffer, and products analyzed by high-performance liquid chromatography on an RPC-5 column. The presence of the Pb(2+) ion is found to lead to the formation of 2'-5' linked oligomers up to the 40-mer, while Zn(2+) favors the formation of predominantly 3'-5' linked oligomers up to the 35-mer. When amounts of uracil, cytidine or adenosine 5'-phosphorimidazole equal to those of the guanosine derivative are included in the reaction mixture, the incorrect base is incorporated into the oligomer about 10% of the time with a Pb(2+) catalyst, but less than 0.5% of the time with Zn(2+). The Sn(2+), Sb(3+) and Bi(3+) ions are also found to promote the formation of 2'-5' oligomers, although not as effectively as Pb(2+), while no metal ions other than Zn(2+) promote the formation of the 3'-5' oligomers. The results may be important for the understanding of the evolution of nucleic acid replication in the absence of enzymes.

  18. Synthesis and characterization of hybrid hyaluronic acid-gelatin hydrogels.

    PubMed

    Camci-Unal, Gulden; Cuttica, Davide; Annabi, Nasim; Demarchi, Danilo; Khademhosseini, Ali

    2013-04-01

    Biomimetic hybrid hydrogels have generated broad interest in tissue engineering and regenerative medicine. Hyaluronic acid (HA) and gelatin (hydrolyzed collagen) are naturally derived polymers and biodegradable under physiological conditions. Moreover, collagen and HA are major components of the extracellular matrix (ECM) in most of the tissues (e.g., cardiovascular, cartilage, neural). When used as a hybrid material, HA-gelatin hydrogels may enable mimicking the ECM of native tissues. Although HA-gelatin hybrid hydrogels are promising biomimetic substrates, their material properties have not been thoroughly characterized in the literature. Herein, we generated hybrid hydrogels with tunable physical and biological properties by using different concentrations of HA and gelatin. The physical properties of the fabricated hydrogels including swelling ratio, degradation, and mechanical properties were investigated. In addition, in vitro cellular responses in both two and three-dimensional culture conditions were assessed. It was found that the addition of gelatin methacrylate (GelMA) into HA methacrylate (HAMA) promoted cell spreading in the hybrid hydogels. Moreover, the hybrid hydrogels showed significantly improved mechanical properties compared to their single component analogs. The HAMA-GelMA hydrogels exhibited remarkable tunability behavior and may be useful for cardiovascular tissue engineering applications.

  19. Synthesis and Characterization of Hybrid Hyaluronic Acid-Gelatin Hydrogels

    PubMed Central

    Camci-Unal, Gulden; Cuttica, Davide; Annabi, Nasim; Demarchi, Danilo; Khademhosseini, Ali

    2013-01-01

    Biomimetic hybrid hydrogels have generated broad interest in tissue engineering and regenerative medicine. Hyaluronic acid (HA) and gelatin (hydrolyzed collagen) are naturally derived polymers and biodegradable under physiological conditions. Moreover, collagen and HA are major components of the extracellular matrix (ECM) in most of the tissues (e.g. cardiovascular, cartilage, neural). When used as a hybrid material, HA-gelatin hydrogels may enable mimicking the ECM of native tissues. Although HA-gelatin hybrid hydrogels are promising biomimetic substrates, their material properties have not been thoroughly characterized in the literature. Herein, we generated hybrid hydrogels with tunable physical and biological properties by using different concentrations of HA and gelatin. The physical properties of the fabricated hydrogels including swelling ratio, degradation, and mechanical properties were investigated. In addition, in vitro cellular responses in both two and three dimensional (2D and 3D) culture conditions were assessed. It was found that the addition of gelatin methacrylate (GelMA) into HA methacrylate (HAMA) promoted cell spreading in the hybrid hydogels. Moreover, the hybrid hydrogels showed significantly improved mechanical properties compared to their single component analogs. The HAMA-GelMA hydrogels exhibited remarkable tunability behavior and may be useful for cardiovascular tissue engineering applications. PMID:23419055

  20. Enantiopure synthesis of dihydrobenzo[1,4]-oxazine-3-carboxylic acids and a route to benzoxazinyl oxazolidinones.

    PubMed

    Malhotra, Rajesh; Dey, Tushar K; Basu, Sourav; Hajra, Saumen

    2015-03-21

    A two step protocol is developed for the efficient synthesis of enantiopure N-Boc-dihydrobenzo[b]-1,4-oxazine-3-carboxylic acids 4 from serine derived cyclic sulfamidate via intramolecular arylamination. The RuPhos Palladacycle along with additional RuPhos ligand is found to be an efficient catalyst for the arylamination of β-(2-bromoaryloxy)amino acids 3 to provide easy and direct access to a variety of dihydrobenzo[b]-1,4-oxazine-3-carboxylic acids 4 with complete retention of enantiopurity in moderate to high yields. Dihydrobenzo[b]-1,4-oxazine-3-carboxylic acids are not only important unnatural amino acids, but are key precursors for the synthesis of important compounds such as benzoxazinyl oxazolidinones. A general approach for the synthesis of benzoxazinyl oxazolidinone is presented.