Science.gov

Sample records for acid synthesis enzymes

  1. Indoleacetic Acid and the Synthesis of Glucanases and Pectic Enzymes

    PubMed Central

    Datko, Anne Harmon; Maclachlan, G. A.

    1968-01-01

    Indoleacetic acid (IAA) and/or inhibitors of DNA, RNA or protein synthesis were added to the apex of decapitated seedlings of Pisum sativum L. var. Alaska. At various times up to 4 days, enzymic protein was extracted from a segment of epicotyl immediately below the apex and assayed for its ability to hydrolyse polysaccharides or their derivatives. With the exception of amylase, the total amounts per segment of all of the tested enzymes increased due to IAA treatment. The development of β-1,4-glucanase (cellulase) activity per unit of protein or fresh weight proceeded according to a typical sigmoid induction curve. Pectinase was formed for about 2 days in control segments and IAA treatment resulted in continued synthesis for at least another 2 days provided cell division took place. β-1,3-glucanase and pectinesterase activities were only enhanced by IAA to the extent that total protein levels increased. Reaction mechanisms for these effects and functions for the enzymes during growth are discussed. PMID:16656834

  2. Role of Malic Enzyme during Fatty Acid Synthesis in the Oleaginous Fungus Mortierella alpina

    PubMed Central

    Hao, Guangfei; Chen, Haiqin; Wang, Lei; Gu, Zhennan; Song, Yuanda; Zhang, Hao

    2014-01-01

    The generation of NADPH by malic enzyme (ME) was postulated to be a rate-limiting step during fatty acid synthesis in oleaginous fungi, based primarily on the results from research focusing on ME in Mucor circinelloides. This hypothesis is challenged by a recent study showing that leucine metabolism, rather than ME, is critical for fatty acid synthesis in M. circinelloides. To clarify this, the gene encoding ME isoform E from Mortierella alpina was homologously expressed. ME overexpression increased the fatty acid content by 30% compared to that for a control. Our results suggest that ME may not be the sole rate-limiting enzyme, but does play a role, during fatty acid synthesis in oleaginous fungi. PMID:24532075

  3. Relationship of lipogenic enzyme activities to the rate of rat liver fatty acid synthesis

    SciTech Connect

    Nelson, G.; Kelley, D.; Schmidt, P.; Virk, S.; Serrato, C.

    1986-05-01

    The mechanism by which diet regulates liver lipogenesis is unclear. Here the authors report how dietary alterations effect the activities of key enzymes of fatty acid (FA) synthesis. Male Sprague-Dawley rats, 400-500 g, were fasted for 48h and then refed a fat-free, high carbohydrate (HC) diet (75% cal. from sucrose) for 0,3,9,24 and 48h, or refed a HC diet for 48h, then fed a high-fat (HF) diet (44% cal. from corn oil) for 3,9,24 and 48h. The FA synthesis rate and the activities of acetyl CoA carboxylase (AC), fatty acid synthase (FAS), ATP citrate lyase (CL), and glucose 6-phosphate dehydrogenase (G6PDH) were determined in the livers. FA synthesis was assayed with /sup 3/H/sub 2/O, enzyme activities were measured spectrophotometrically except for AC which was assayed with /sup 14/C-bicarbonate. There was no change in the activity of AC during fasting or on the HC diet. Fasting decreased the rate of FA synthesis by 25% and the activities of FAS and CL by 50%; refeeding the HC diet induced parallel changes in FA synthesis and the activities of FAS, CL, and G6PDH. After 9h on the HF diet, FA synthesis had decreased sharply, AC activity increased significantly while no changes were detected in the other activities. Subsequently FA synthesis did not change while the activities of the enzymes decreased slowly. These enzymes did not appear to regulate FA synthesis during inhibition of lipogenesis, but FAS, CL or G6PDH may be rate limiting in the induction phase. Other key factors may regulate FA synthesis during dietary alterations.

  4. The synthesis of glutamic acid in the absence of enzymes: Implications for biogenesis

    NASA Technical Reports Server (NTRS)

    Morowitz, Harold; Peterson, Eta; Chang, Sherwood

    1995-01-01

    This paper reports on the non-enzymatic aqueous phase synthesis of amino acids from keto acids, ammonia and reducing agents. The facile synthesis of key metabolic intermediates, particularly in the glycolytic pathway, the citric acid cycle, and the first step of amino acid synthesis, lead to new ways of looking at the problem of biogenesis.

  5. [Reconstitution of polyunsaturated fatty acid synthesis enzymes in mammalian cells to convert LA to DHA].

    PubMed

    Zhu, Guiming; Saleh, Abdulmomen Ali Mohammed; Bahwal, Said Ahmed; Qiu, Lihong; Sun, Jie; Shang, Yu; Jiang, Xudong; Ge, Tangdong; Zhang, Tao

    2015-02-01

    DHA (22:6n-3) is a Ω-3 polyunsaturated fatty acid with 22 carbon atoms and 6 double bonds, which has important biological functions in human body. Human and other mammals synthesize only limited amounts of DHA, more requirements must be satisfied from food resources. However, the natural resources of DHA (Mainly deep-sea fish and other marine products) are prone to depletion. New resources development is still insufficient to satisfy the growing market demand. Previous studies have revealed that the mammals can increase the synthesis of DHA and other long-chain polyunsaturated fatty acids after transgenic procedures. In this study, mammalian cells were transfected with Δ6, Δ5 desaturase, Δ6, Δ5 elongase, Δ15 desaturase (Isolated from nematode Caenorhabditis elegans) and Δ4 desaturase (Isolated from Euglena gracilis), simultaneously. Results show that the expression or overexpression of these 6 enzymes is capable of conversion of the o-6 linoleic acid (LA, 18:2n-6) in DHA (22:6n-3). DHA content has increased from 16.74% in the control group to 25.3% in the experimental group. The strategy and related technology in our research provided important data for future production the valuable DHA (22:6n-3) by using genetically modified animals. PMID:26062349

  6. Changes in the Enzymes for Fatty Acid Synthesis and Desaturation during Acclimation of Developing Soybean Seeds to Altered Growth Temperature

    PubMed Central

    Cheesbrough, Thomas M.

    1989-01-01

    Temperature-induced changes in the enzymes for fatty acid synthesis and desaturation were studied in developing soybean seeds (Glycine max L. var Williams 82). Changes were induced by culture of the seed pods for 20 hours in liquid media at 20, 25, or 35°C. Linoleoyl and oleoyl desaturases were 94 and 10 times as active, respectively, in seeds cultured at 20°C as those cultured at 25°C. Both desaturases had negligible activity in seeds cultured at 35°C compared to seeds cultured at 20°C. Though less dramatic, other enzymes also showed differences in activity after 20 hours in culture at 20, 25, or 35°C. Stearoyl-acyl carrier protein (ACP) desaturase and CDP-choline:diacylglycerol phosphorylcholine transferase were most active in preparations from 20°C cultures. Activities were twofold lower at 25°C and a further threefold lower in 35°C cultures. Cultures from 25 and 35°C had 60 and 40%, respectively, of the phosphorylcholine:CTP cytidylyl transferase activity present in cultures grown at 20°C. Fatty acid synthetase, malonyl-coenzyme A:ACP transacylase, palmitoyl-ACP elongation, and choline kinase were not significantly altered by culture temperature. These data suggest that the enzymes for fatty acid desaturation and phosphatidylcholine synthesis can be rapidly modulated in response to altered growth temperatures, while the enzymes for fatty acid synthesis and elongation are not. PMID:16666840

  7. Optimization of the enzyme-catalyzed synthesis of amino acid-based surfactants from palm oil fractions.

    PubMed

    Soo, Ee Lin; Salleh, Abu Bakar; Basri, Mahiran; Zaliha Raja Abdul Rahman, Raja Noor; Kamaruddin, Kamarulzaman

    2003-01-01

    The feasibility of using palm oil fractions as cheap and abundant sources of raw material for the synthesis of amino acid surfactants was investigated. Of a number of enzymes screened, the best results were obtained with the immobilized enzyme, Lipozyme. The effects of temperature, solvent, incubation period, fatty substrate/amino acid molar ratio, enzyme amount, and water removal on the reactions were analyzed and compared to those on reactions with free fatty acids and pure triglycerides as fatty substrates. All reactions were most efficient when carried out at high temperatures (70-80 degrees C) in hexane as a solvent. However, while reactions with free fatty acids proceeded better when a slight excess of the free fatty acids over the amino acids was used, reactions with triglycerides and palm oil fractions were best performed at equimolar ratios. Also, the addition of molecular sieves slightly enhanced reactions with free fatty acids but adversely affected reactions with triglycerides and palm oil fractions. Although reactions with palm oil fractions took longer (6 d) to reach equilibrium compared to reactions with free fatty acids (4 d) and pure triglycerides (4 d), better yields were obtained. Such lipase-catalyzed transacylation of palm oil fractions with amino acids is potentially useful in the production of mixed medium- to long-chain surfactants for specific applications. PMID:16233420

  8. Analysis of ATP-citrate lyase and malic enzyme mutants of Yarrowia lipolytica points out the importance of mannitol metabolism in fatty acid synthesis.

    PubMed

    Dulermo, Thierry; Lazar, Zbigniew; Dulermo, Rémi; Rakicka, Magdalena; Haddouche, Ramedane; Nicaud, Jean-Marc

    2015-09-01

    The role of the two key enzymes of fatty acid (FA) synthesis, ATP-citrate lyase (Acl) and malic enzyme (Mae), was analyzed in the oleaginous yeast Yarrowia lipolytica. In most oleaginous yeasts, Acl and Mae are proposed to provide, respectively, acetyl-CoA and NADPH for FA synthesis. Acl was mainly studied at the biochemical level but no strain depleted for this enzyme was analyzed in oleaginous microorganisms. On the other hand the role of Mae in FA synthesis in Y. lipolytica remains unclear since it was proposed to be a mitochondrial NAD(H)-dependent enzyme and not a cytosolic NADP(H)-dependent enzyme. In this study, we analyzed for the first time strains inactivated for corresponding genes. Inactivation of ACL1 decreases FA synthesis by 60 to 80%, confirming its essential role in FA synthesis in Y. lipolytica. Conversely, inactivation of MAE1 has no effects on FA synthesis, except in a FA overaccumulating strain where it improves FA synthesis by 35%. This result definitively excludes Mae as a major key enzyme for FA synthesis in Y. lipolytica. During the analysis of both mutants, we observed a negative correlation between FA and mannitol level. As mannitol and FA pathways may compete for carbon storage, we inactivated YlSDR, encoding a mannitol dehydrogenase converting fructose and NADPH into mannitol and NADP+. The FA content of the resulting mutant was improved by 60% during growth on fructose, demonstrating that mannitol metabolism may modulate FA synthesis in Y. lipolytica. PMID:25959598

  9. Synthesis of 2-monoacylglycerols and structured triacylglycerols rich in polyunsaturated fatty acids by enzyme catalyzed reactions.

    PubMed

    Rodríguez, Alicia; Esteban, Luis; Martín, Lorena; Jiménez, María José; Hita, Estrella; Castillo, Beatriz; González, Pedro A; Robles, Alfonso

    2012-08-10

    This paper studies the synthesis of structured triacylglycerols (STAGs) by a four-step process: (i) obtaining 2-monoacylglycerols (2-MAGs) by alcoholysis of cod liver oil with several alcohols, catalyzed by lipases Novozym 435, from Candida antartica and DF, from Rhizopus oryzae, (ii) purification of 2-MAGs, (iii) formation of STAGs by esterification of 2-MAGs with caprylic acid catalyzed by lipase DF, from R. oryzae, and (iv) purification of these STAGs. For the alcoholysis of cod liver oil, absolute ethanol, ethanol 96% (v/v) and 1-butanol were compared; the conditions with ethanol 96% were then optimized and 2-MAG yields of around 54-57% were attained using Novozym 435. In these 2-MAGs, DHA accounted for 24-31% of total fatty acids. In the operational conditions this lipase maintained a stable level of activity over at least 11 uses. These results were compared with those obtained with lipase DF, which deactivated after only three uses. The alcoholysis of cod liver oil and ethanol 96% catalyzed by Novozym 435 was scaled up by multiplying the reactant amounts 100-fold and maintaining the intensity of treatment constant (IOT=3g lipase h/g oil). In these conditions, the 2-MAG yield attained was about 67%; these 2-MAGs contained 36.6% DHA. The synthesized 2-MAGs were separated and purified from the alcoholysis reaction products by solvent extraction using solvents of low toxicity (ethanol and hexane); 2-MAG recovery yield and purity of the target product were approximately 96.4% and 83.9%, respectively. These 2-MAGs were transformed to STAGs using the optimal conditions obtained in a previous work. After synthesis and purification, 93% pure STAGs were obtained, containing 38% DHA at sn-2 position and 60% caprylic acid (CA) at sn-1,3 positions (of total fatty acids at these positions), i.e. the major TAG is the STAG with the structure CA-DHA-CA. PMID:22759534

  10. RALDH2, the enzyme for retinoic acid synthesis, mediates meiosis initiation in germ cells of the female embryonic chickens.

    PubMed

    Yu, Minli; Yu, Ping; Leghari, Imdad H; Ge, Chutian; Mi, Yuling; Zhang, Caiqiao

    2013-02-01

    Meiosis is a process unique to the differentiation of germ cells and exhibits sex-specific in timing. Previous studies showed that retinoic acid (RA) as the vitamin A metabolite is crucial for controlling Stra8 (Stimulated by retinoic acid gene 8) expression in the gonad and to initiate meiosis; however, the mechanism by which retinoid-signaling acts has remained unclear. In the present study, we investigated the role of the enzyme retinaldehyde dehydrogenase 2 (RALDH2) which catalyzes RA synthesizes by initiating meiosis in chicken ovarian germ cells. Meiotic germ cells were first detected at day 15.5 in chicken embryo ovary when the expression of synaptonemal complex protein 3 (Scp3) and disrupted meiotic cDNA 1 homologue (Dmc1) became elevated, while Stra8 expression was specifically up-regulated at day 12.5 before meiosis onset. It was observed from the increase in Raldh2 mRNA expression levels and decreases in Cyp26b1 (the enzyme for RA catabolism) expression levels during meiosis that requirement for RA accumulation is essential to sustain meiosis. This was also revealed by RA stimulation of the cultured ovaries with the initiation of meiosis response, and the knocking down of the Raldh2 expression during meiosis, leading to abolishment of RA-dependent action. Altogether, these studies indicate that RA synthesis by the enzyme RALDH2 and signaling through its receptor is crucial for meiosis initiation in chicken embryonic ovary. PMID:22733143

  11. Enzymes of type II fatty acid synthesis and apicoplast differentiation and division in Eimeria tenella⋆

    PubMed Central

    Ferguson, D.J.P.; Campbell, S.A.; Henriquez, F.L.; Phan, L.; Mui, E.; Richards, T.A.; Muench, S.P.; Allary, M.; Lu, J.Z.; Prigge, S.T.; Tomley, F.; Shirley, M.W.; Rice, D.W.; McLeod, R.; Roberts, C.W.

    2009-01-01

    Apicomplexan parasites, Eimeria tenella, Plasmodium spp. and Toxoplasma gondii, possess a homologous plastid-like organelle termed the apicoplast, derived from the endosymbiotic enslavement of a photosynthetic alga. However, currently no eimerian nuclear encoded apicoplast targeted proteins have been identified, unlike in Plasmodium spp. and T. gondii. In this study, we demonstrate that nuclear encoded enoyl reductase of E. tenella (EtENR) has a predicted N-terminal bipartite transit sequence, typical of apicoplast-targeted proteins. Using a combination of immunocytochemistry and EM we demonstrate that this fatty acid biosynthesis protein is located in the apicoplast of E. tenella. Using the EtENR as a tool to mark apicoplast development during the Eimeria lifecycle, we demonstrate that nuclear and apicoplast division appear to be independent events, both organelles dividing prior to daughter cell formation, with each daughter cell possessing one to four apicoplasts. We believe this is the first report of multiple apicoplasts present in the infectious stage of an apicomplexan parasite. Furthermore, the microgametes lacked an identifiable apicoplast consistent with maternal inheritance via the macrogamete. It was found that the size of the organelle and the abundance of EtENR varied with developmental stage of the E. tenella lifecycle. The high levels of EtENR protein observed during asexual development and macrogametogony is potentially associated with the increased synthesis of fatty acids required for the rapid formation of numerous merozoites and for the extracellular development and survival of the oocyst. Taken together the data demonstrate that the E. tenella apicoplast participates in type II fatty acid biosynthesis with increased expression of ENR during parasite growth. Apicoplast division results in the simultaneous formation of multiple fragments. The division mechanism is unknown, but is independent of nuclear division and occurs prior to daughter

  12. Draft Genome Sequence of Escherichia coli Strain VKPM B-10182, Producing the Enzyme for Synthesis of Cephalosporin Acids

    PubMed Central

    Mardanov, Andrey V.; Eldarov, Mikhail A.; Sklyarenko, Anna V.; Dumina, Maria V.; Beletsky, Alexey V.; Yarotsky, Sergey V.

    2014-01-01

    Escherichia coli strain VKPM B-10182, obtained by chemical mutagenesis from E. coli strain ATCC 9637, produces cephalosporin acid synthetase employed in the synthesis of β-lactam antibiotics, such as cefazolin. The draft genome sequence of strain VKPM B-10182 revealed 32 indels and 1,780 point mutations that might account for the improvement in antibiotic synthesis that we observed. PMID:25414512

  13. Enzymatic characterization of ELOVL1, a key enzyme in very long-chain fatty acid synthesis.

    PubMed

    Schackmann, Martin J A; Ofman, Rob; Dijkstra, Inge M E; Wanders, Ronald J A; Kemp, Stephan

    2015-02-01

    X-linked adrenoleukodystrophy (X-ALD) is a neurometabolic disease that is caused by mutations in the ABCD1 gene. ABCD1 protein deficiency impairs peroxisomal very long-chain fatty acid (VLCFA) degradation resulting in increased cytosolic VLCFA-CoA levels, which are further elongated by the VLCFA-specific elongase, ELOVL1. In adulthood, X-ALD most commonly manifests as a gradually progressive myelopathy (adrenomyeloneuropathy; AMN) without any curative or disease modifying treatments. We recently showed that bezafibrate reduces VLCFA accumulation in X-ALD fibroblasts by inhibiting ELOVL1. Although, in a clinical trial, bezafibrate was unable to lower VLCFA levels in plasma or lymphocytes in X-ALD patients, inhibition of ELOVL1 remains an attractive therapeutic option. In this study, we investigated the kinetic characteristics of ELOVL1 using X-ALD fibroblasts and microsomal fractions from ELOVL1 over-expressing HEK293 cell lines and analyzed the inhibition kinetics of a series of fibrates. Our data show that the CoA esters of bezafibrate and gemfibrozil reduce chain elongation by specifically inhibiting ELOVL1. These fibrates can therefore serve as lead compounds for the development of more potent and more specific inhibitors for ELOVL1. PMID:25499606

  14. Biochemical and Structural Characterization of the Arabidopsis Bifunctional Enzyme Dethiobiotin Synthetase–Diaminopelargonic Acid Aminotransferase: Evidence for Substrate Channeling in Biotin Synthesis[C][W

    PubMed Central

    Cobessi, David; Dumas, Renaud; Pautre, Virginie; Meinguet, Céline; Ferrer, Jean-Luc; Alban, Claude

    2012-01-01

    Diaminopelargonic acid aminotransferase (DAPA-AT) and dethiobiotin synthetase (DTBS) catalyze the antepenultimate and the penultimate steps, respectively, of biotin synthesis. Whereas DAPA-AT and DTBS are encoded by distinct genes in bacteria, in biotin-synthesizing eukaryotes (plants and most fungi), both activities are carried out by a single enzyme encoded by a bifunctional gene originating from the fusion of prokaryotic monofunctional ancestor genes. In few angiosperms, including Arabidopsis thaliana, this chimeric gene (named BIO3-BIO1) also produces a bicistronic transcript potentially encoding separate monofunctional proteins that can be produced following an alternative splicing mechanism. The functional significance of the occurrence of a bifunctional enzyme in biotin synthesis pathway in eukaryotes and the relative implication of each of the potential enzyme forms (bifunctional versus monofunctional) in the plant biotin pathway are unknown. In this study, we demonstrate that the BIO3-BIO1 fusion protein is the sole protein form produced by the BIO3-BIO1 locus in Arabidopsis. The enzyme catalyzes both DAPA-AT and DTBS reactions in vitro and is targeted to mitochondria in vivo. Our biochemical and kinetic characterizations of the pure recombinant enzyme show that in the course of the reaction, the DAPA intermediate is directly transferred from the DAPA-AT active site to the DTBS active site. Analysis of several structures of the enzyme crystallized in complex with and without its ligands reveals key structural elements involved for acquisition of bifunctionality and brings, together with mutagenesis experiments, additional evidences for substrate channeling. PMID:22547782

  15. Structural and Functional Characterization of BaiA, An Enzyme Involved in Secondary Bile Acid Synthesis in Human Gut Microbe

    PubMed Central

    Bhowmik, Shiva; Jones, David H.; Chiu, Hsien-Po; Park, In-Hee; Chiu, Hsiu-Ju; Axelrod, Herbert L.; Farr, Carol L.; Tien, Henry J.; Agarwalla, Sanjay; Lesley, Scott A.

    2014-01-01

    Despite significant influence of secondary bile acids on human health and disease, limited structural and biochemical information is available for the key gut microbial enzymes catalyzing its synthesis. Herein, we report apo- and co-factor bound crystal structures of BaiA2, a short chain dehydrogenase/reductase from Clostridium scindens VPI 12708 that represent the first protein structure of this pathway. The structures elucidated the basis of co-factor specificity and mechanism of proton relay. A conformational restriction involving Glu42 located in the co-factor binding site seems crucial in determining co-factor specificity. Limited flexibility of Glu42 results in imminent steric and electrostatic hindrance with 2′-phosphate group of NADP(H). Consistent with crystal structures, steady-state kinetic characterization performed with both BaiA2 and BaiA1, a close homolog with 92% sequence identity, revealed specificity constant (kcat/KM) of NADP+ at least an order of magnitude lower than NAD+. Substitution of Glu42 with Ala improved specificity towards NADP+ by 10- fold compared to wild type. The co-factor bound structure uncovered a novel nicotinamide-hydroxyl ion (NAD+-OH−) adduct contraposing previously reported adducts. The OH− of the adduct in BaiA2 is distal to C4 atom of nicotinamide and proximal to 2′-hydroxyl group of the ribose moiety. Moreover, it is located at intermediary distances between terminal functional groups of active site residues Tyr157 (2.7 Å) and Lys161 (4.5 Å). Based on these observations we propose an involvement of NAD+-OH− adduct in proton relay instead of hydride transfer as noted for previous adducts. PMID:23836456

  16. Insolubilized enzymes for food synthesis

    NASA Technical Reports Server (NTRS)

    Marshall, D. L.

    1972-01-01

    Cellulose matrix with numerous enzyme-coated silica particles of colloidal size permanently bound at various sites within matrix was produced that has high activity and possesses requisite physical characteristics for filtration or column operations. Product also allows coupling step in synthesis of edible food to proceed under mild conditions.

  17. Function of heterologous Mycobacterium tuberculosis InhA, a type 2 fatty acid synthase enzyme involved in extending C20 fatty acids to C60-to-C90 mycolic acids, during de novo lipoic acid synthesis in Saccharomyces cerevisiae.

    PubMed

    Gurvitz, Aner; Hiltunen, J Kalervo; Kastaniotis, Alexander J

    2008-08-01

    We describe the physiological function of heterologously expressed Mycobacterium tuberculosis InhA during de novo lipoic acid synthesis in yeast (Saccharomyces cerevisiae) mitochondria. InhA, representing 2-trans-enoyl-acyl carrier protein reductase and the target for the front-line antituberculous drug isoniazid, is involved in the activity of dissociative type 2 fatty acid synthase (FASII) that extends associative type 1 fatty acid synthase (FASI)-derived C(20) fatty acids to form C(60)-to-C(90) mycolic acids. Mycolic acids are major constituents of the protective layer around the pathogen that contribute to virulence and resistance to certain antimicrobials. Unlike FASI, FASII is thought to be incapable of de novo biosynthesis of fatty acids. Here, the genes for InhA (Rv1484) and four similar proteins (Rv0927c, Rv3485c, Rv3530c, and Rv3559c) were expressed in S. cerevisiae etr1Delta cells lacking mitochondrial 2-trans-enoyl-thioester reductase activity. The phenotype of the yeast mutants includes the inability to produce sufficient levels of lipoic acid, form mitochondrial cytochromes, respire, or grow on nonfermentable carbon sources. Yeast etr1Delta cells expressing mitochondrial InhA were able to respire, grow on glycerol, and produce lipoic acid. Commensurate with a role in mitochondrial de novo fatty acid biosynthesis, InhA could accept in vivo much shorter acyl-thioesters (C(4) to C(8)) than was previously thought (>C(12)). Moreover, InhA functioned in the absence of AcpM or protein-protein interactions with its native FASII partners KasA, KasB, FabD, and FabH. None of the four proteins similar to InhA complemented the yeast mutant phenotype. We discuss the implications of our findings with reference to lipoic acid synthesis in M. tuberculosis and the potential use of yeast FASII mutants for investigating the physiological function of drug-targeted pathogen enzymes involved in fatty acid biosynthesis. PMID:18552191

  18. The role of pyruvate hub enzymes in supplying carbon precursors for fatty acid synthesis in photosynthetic microalgae.

    PubMed

    Shtaida, Nastassia; Khozin-Goldberg, Inna; Boussiba, Sammy

    2015-09-01

    Photosynthetic microalgae are currently the focus of basic and applied research due to an ever-growing interest in renewable energy resources. This review discusses the role of carbon-unit supply for the production of acetyl-CoA, a direct precursor of fatty acid biosynthesis and the primary building block of the growing acyl chains for the purpose of triacylglycerol (TAG) production in photosynthetic microalgae under stressful conditions. It underscores the importance of intraplastidic acetyl-CoA generation for storage lipid accumulation. The main focus is placed on two enzymatic steps linking the central carbon metabolism and fatty acid synthesis, namely the reactions catalyzed by the plastidic isoform of pyruvate kinase and the chloroplastic pyruvate dehydrogenase complex. Alternative routes for plastidic acetyl-CoA synthesis are also reviewed. A separate section is devoted to recent advances in functional genomics studies related to fatty acid and TAG biosynthesis. PMID:25846135

  19. Secretion of three enzymes for fatty acid synthesis into mouse milk in association with fat globules, and rapid decrease of the secreted enzymes by treatment with rapamycin.

    PubMed

    Moriya, Hitomi; Uchida, Kana; Okajima, Tetsuya; Matsuda, Tsukasa; Nadano, Daita

    2011-04-01

    The mammary epithelium produces numerous lipid droplets during lactation and secretes them in plasma membrane-enclosed vesicles known as milk fat globules. The biogenesis of such fat globules is considered to provide a model for clarifying the mechanisms of lipogenesis in mammals. In the present study, we identified acetyl coenzyme A carboxylase, ATP citrate lyase, and fatty acid synthase in mouse milk. Fractionation of milk showed that these three enzymes were located predominantly in milk fat globules. The three enzymes were resistant to trypsin digestion without Triton X-100, indicating that they were not located on the outer surface of the globules and thus associated with the precursors of the globules before secretion. When a low dose of rapamycin, an inhibitor of the mammalian target of rapamycin (mTOR), was injected into lactating mice, the levels of the three enzymes in milk were decreased within 3h after injection. Since the protein levels of the three enzymes in tissues were not obviously altered by this short-term treatment, known transcriptional control by mTOR signaling was unlikely to account for this decrease in their levels in milk. Our findings suggest a new, putatively mTOR-dependent localization of the three enzymes for de novo lipogenesis. PMID:21281598

  20. Fatty acid composition of muscle fat and enzymes of storage lipid synthesis in whole muscle from beef cattle.

    PubMed

    Kazala, E Chris; Lozeman, Fred J; Mir, Priya S; Aalhus, Jennifer L; Schmutz, Sheila M; Weselake, Randall J

    2006-11-01

    Enhanced intramuscular fat content (i.e., marbling) in beef is a desirable trait, which can result in increased product value. This study was undertaken with the aim of revealing biochemical factors associated with the marbling trait in beef cattle. Samples of longissimus lumborum (LL) and pars costalis diaphragmatis (PCD) were taken from a group of intact crossbred males and females at slaughter, lipids extracted, and the resulting FAME examined for relationships with marbling fat deposition. For LL, significant associations were found between degree of marbling and myristic (14:0, r = 0.55, P < 0.01), palmitic (16:0, r = 0.80, P < 0.001), stearic (18:0, r = -0.58, P < 0.01), and oleic (18:1c-9, r = 0.79, P < 0.001) acids. For PCD, significant relationships were found between marbling and palmitic (r = 0.71, P < 0.001) and oleic (r = 0.74, P < 0.001) acids. Microsomal fractions prepared from PCD muscle were assayed for diacylglycerol acyltransferase (DGAT), lysophosphatidic acid acyltransferase (LPAAT), and phosphatidic acid phosphatase-1 (PAP-1) activity, and the results examined for relationships with degree of intramuscular fat deposition. None of the enzyme activities from PCD displayed an association with marbling fat content, but DGAT specific activity showed significant positive associations with LPAAT (r = 0.54, P < 0.01), total PAP (r = 0.66, P < 0.001), and PAP-1 (r = 0.63, P < 0.01) specific activities. The results on FA compositions of whole muscle tissues provide insight into possible enzyme action associated with the production of specific FA. The increased proportion of oleic acid associated with enhanced lipid content of whole muscle is noteworthy given the known health benefits of this FA. PMID:17263304

  1. Identification of a novel operon in Lactococcus lactis encoding three enzymes for lactic acid synthesis: phosphofructokinase, pyruvate kinase, and lactate dehydrogenase.

    PubMed Central

    Llanos, R M; Harris, C J; Hillier, A J; Davidson, B E

    1993-01-01

    The discovery of a novel multicistronic operon that encodes phosphofructokinase, pyruvate kinase, and lactate dehydrogenase in the lactic acid bacterium Lactococcus lactis is reported. The three genes in the operon, designated pfk, pyk, and ldh, contain 340, 502, and 325 codons, respectively. The intergenic distances are 87 bp between pfk and pyk and 117 bp between pyk and ldh. Plasmids containing pfk and pyk conferred phosphofructokinase and pyruvate kinase activity, respectively, on their host. The identity of ldh was established previously by the same approach (R. M. Llanos, A. J. Hillier, and B. E. Davidson, J. Bacteriol. 174:6956-6964, 1992). Each of the genes is preceded by a potential ribosome binding site. The operon is expressed in a 4.1-kb transcript. The 5' end of the transcript was determined to be a G nucleotide positioned 81 bp upstream from the pfk start codon. The pattern of codon usage within the operon is highly biased, with 11 unused amino acid codons. This degree of bias suggests that the operon is highly expressed. The three proteins encoded on the operon are key enzymes in the Embden-Meyerhoff pathway, the central pathway of energy production and lactic acid synthesis in L. lactis. For this reason, we have called the operon the las (lactic acid synthesis) operon. Images PMID:8478320

  2. Δ9-Tetrahydrocannabinolic acid synthase: The application of a plant secondary metabolite enzyme in biocatalytic chemical synthesis.

    PubMed

    Lange, Kerstin; Schmid, Andreas; Julsing, Mattijs K

    2016-09-10

    Δ(9)-Tetrahydrocannabinolic acid synthase (THCAS) from the secondary metabolism of Cannabis sativa L. catalyzes the oxidative formation of an intramolecular CC bond in cannabigerolic acid (CBGA) to synthesize Δ(9)-tetrahydrocannabinolic acid (THCA), which is the direct precursor of Δ(9)-tetrahydrocannabinol (Δ(9)-THC). Aiming on a biotechnological production of cannabinoids, we investigated the potential of the heterologously produced plant oxidase in a cell-free system on preparative scale. THCAS was characterized in an aqueous/organic two-liquid phase setup in order to solubilize the hydrophobic substrate and to allow in situ product removal. Compared to the single phase aqueous setup the specific activity decreased by a factor of approximately 2 pointing to a substrate limitation of CBGA in the two-liquid phase system. However, the specific activity remained stable for at least 3h illustrating the benefit of the two-liquid phase setup. In a repeated-batch setup, THCAS showed only a minor loss of specific activity in the third batch pointing to a high intrinsic stability and high solvent tolerance of the enzyme. Maximal space-time-yields of 0.121gL(-1)h(-1) were reached proving the two-liquid phase concept suitable for biotechnological production of cannabinoids. PMID:27369551

  3. [The synthesis of specific enzyme inhibitors].

    PubMed

    Iakovleva, G M

    1987-04-01

    The review deals with directed synthesis of specific enzyme inhibitors. They are classified within the framework of the mechanistic approach, namely, stable analogues of substrates, which form enzyme complexes mimicking the Michaelis complex or those which influence the chemical stages of enzyme catalysis; conformational inhibitors; substrate analogues participating in enzyme reactions and producing modified products; suicide inhibitors; stage inhibitors (inhibitors influencing certain stages of enzyme reaction); transition state analogues; multisubstrate analogues and collected substrates. Types of chemical modification used in synthesis of the specific inhibitors are discussed. Some possibilities of the quantity structure-activity relationship methods, computer modelling and molecular graphics in designing the optimal structure of inhibitors are mentioned. PMID:3300658

  4. Lead inhibition of enzyme synthesis in soil.

    PubMed Central

    Cole, M A

    1977-01-01

    Addition of 2 mg of Pb2+/g of soil concident with or after amendment with starch or maltose resulted in 75 and 50% decreases in net synthesis of amylase and alpha-glucosidase, respectively. Invertase synthesis in sucrose-amended soil was transiently reduced after Pb2+ addition. Amylase activity was several times less sensitive to Pb2+ inhibition than was enzyme synthesis. In most cases, the rate of enzyme synthesis returned to control (Pb2+) values 24 to 48 h after the addition of Pb. The decrease in amylase synthesis was paralleled by a decrease in the number of Pb-sensitive, amylase-producing bacteria, whereas recovery of synthesis was associated with an increase in the number of amylase-producing bacteria. The degree of inhibition of enzyme synthesis was related to the quantity of Pb added and to the specific form of lead. PbSO4 decreased amylase synthesis at concentrations of 10.2 mg of Pb2+/g of soil or more, whereas PbO did not inhibit amylase synthesis at 13 mg of Pb2+/g of soil. Lead acetate, PbCl2, and PbS reduced amylase synthesis at total Pb2+ concentrations of 0.45 mg of Pb2+/g of soil or higher. The results indicated that lead is a potent but somewhat selective inhibitor of enzyme synthesis in soil, and that highly insoluble lead compounds, such as PbS, may be potent modifiers of soil biological activity. PMID:848950

  5. The Yeast Eukaryotic Translation Initiation Factor 2B Translation Initiation Complex Interacts with the Fatty Acid Synthesis Enzyme YBR159W and Endoplasmic Reticulum Membranes

    PubMed Central

    Browne, Christopher M.; Samir, Parimal; Fites, J. Scott; Villarreal, Seth A.

    2013-01-01

    Using affinity purifications coupled with mass spectrometry and yeast two-hybrid assays, we show the Saccharomyces cerevisiae translation initiation factor complex eukaryotic translation initiation factor 2B (eIF2B) and the very-long-chain fatty acid (VLCFA) synthesis keto-reductase enzyme YBR159W physically interact. The data show that the interaction is specifically between YBR159W and eIF2B and not between other members of the translation initiation or VLCFA pathways. A ybr159wΔ null strain has a slow-growth phenotype and a reduced translation rate but a normal GCN4 response to amino acid starvation. Although YBR159W localizes to the endoplasmic reticulum membrane, subcellular fractionation experiments show that a fraction of eIF2B cofractionates with lipid membranes in a YBR159W-independent manner. We show that a ybr159wΔ yeast strain and other strains with null mutations in the VLCFA pathway cause eIF2B to appear as numerous foci throughout the cytoplasm. PMID:23263984

  6. Synthesis of amino acids

    DOEpatents

    Davis, J.W. Jr.

    1979-09-21

    A method is described for synthesizing amino acids preceding through novel intermediates of the formulas: R/sub 1/R/sub 2/C(OSOC1)CN, R/sub 1/R/sub 2/C(C1)CN and (R/sub 1/R/sub 2/C(CN)O)/sub 2/SO wherein R/sub 1/ and R/sub 2/ are each selected from hydrogen and monovalent hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  7. Synthesis of (+)-Coronafacic Acid

    PubMed Central

    Taber, Douglass F.; Sheth, Ritesh B.; Tian, Weiwei

    2009-01-01

    An enantioselective synthesis of (+)-coronafacic acid has been achieved. Rhodium catalyzed cyclization of an α-diazoester provided the intermediate cyclopentanone in high enantiomeric purity. Subsequent Fe-mediated cyclocarbonylation of a derived alkenyl cyclopropane gave a bicyclic enone, that then was hydrogenated and carried on to the natural product. PMID:19231870

  8. Indoleamine 2,3-dioxygenase depletes tryptophan, activates general control non-derepressible 2 kinase and down-regulates key enzymes involved in fatty acid synthesis in primary human CD4+ T cells.

    PubMed

    Eleftheriadis, Theodoros; Pissas, Georgios; Antoniadi, Georgia; Liakopoulos, Vassilios; Stefanidis, Ioannis

    2015-10-01

    Indoleamine 2,3-dioxygenase (IDO) is expressed in antigen-presenting cells and exerts immunosuppressive effects on CD4(+) T cells. One mechanism is through the inhibition of aerobic glycolysis. Another prerequisite for T-cell proliferation and differentiation into effector cells is increased fatty acid (FA) synthesis. The effect of IDO on enzymes involved in FA synthesis was evaluated in primary human cells both in mixed lymphocyte reactions in the presence or not of the IDO inhibitor 1-dl-methyl-tryptophan, and in stimulated CD4(+) T cells in the presence or not of the general control non-derepressible 2 (GCN2) kinase activator tryptophanol (TRP). IDO or TRP inhibited cell proliferation. By assessing the level of GCN2 kinase or mammalian target of rapamycin complex 1 substrates along with a kynurenine free system we showed that IDO exerts its effect mainly through activation of GCN2 kinase. IDO or TRP down-regulated ATP-citrate lyase and acetyl coenzyme A carboxylase 1, key enzymes involved in FA synthesis. Also, IDO or TRP altered the expression of enzymes that control the availability of carbon atoms for FA synthesis, such as lactate dehydrogenase-A, pyruvate dehydrogenase, glutaminase 1 and glutaminase 2, in a way that inhibits FA synthesis. In conclusion, IDO through GCN2 kinase activation inhibits CD4(+) T-cell proliferation and down-regulates key enzymes that directly or indirectly promote FA synthesis, a prerequisite for CD4(+) T-cell proliferation and differentiation into effector cell lineages. PMID:26147366

  9. Phosphatidic Acid Synthesis in Bacteria

    PubMed Central

    Yao, Jiangwei; Rock, Charles O.

    2012-01-01

    Membrane phospholipid synthesis is a vital facet of bacterial physiology. Although the spectrum of phospholipid headgroup structures produced by bacteria is large, the key precursor to all of these molecules is phosphatidic acid (PtdOH). Glycerol-3-phosphate derived from the glycolysis via glycerol-phosphate synthase is the universal source for the glycerol backbone of PtdOH. There are two distinct families of enzymes responsible for the acylation of the 1-position of glycerol-3-phosphate. The PlsB acyltransferase was discovered in Escherichia coli, and homologs are present in many eukaryotes. This protein family primarily uses acyl-acyl carrier protein (ACP) endproducts of fatty acid synthesis as acyl donors, but may also use acyl-CoA derived from exogenous fatty acids. The second protein family, PlsY, is more widely distributed in bacteria and utilizes the unique acyl donor, acyl-phosphate, which is produced from acyl-ACP by the enzyme PlsX. The acylation of the 2-position is carried out by members of the PlsC protein family. All PlsCs use acyl-ACP as the acyl donor, although the PlsCs of the γ-proteobacteria also may use acyl-CoA. Phospholipid headgroups are precursors in the biosynthesis of other membrane-associated molecules and the diacylglycerol product of these reactions is converted to PtdOH by one of two distinct families of lipid kinases. The central importance of the de novo and recycling pathways to PtdOH in cell physiology suggest these enzymes are suitable targets for the development of antibacterial therapeutics in Gram-positive pathogens. This article is part of a Special Issue entitled Phospholipids and Phospholipid Metabolism. PMID:22981714

  10. Abscisic Acid Synthesis and Response

    PubMed Central

    Finkelstein, Ruth

    2013-01-01

    Abscisic acid (ABA) is one of the “classical” plant hormones, i.e. discovered at least 50 years ago, that regulates many aspects of plant growth and development. This chapter reviews our current understanding of ABA synthesis, metabolism, transport, and signal transduction, emphasizing knowledge gained from studies of Arabidopsis. A combination of genetic, molecular and biochemical studies has identified nearly all of the enzymes involved in ABA metabolism, almost 200 loci regulating ABA response, and thousands of genes regulated by ABA in various contexts. Some of these regulators are implicated in cross-talk with other developmental, environmental or hormonal signals. Specific details of the ABA signaling mechanisms vary among tissues or developmental stages; these are discussed in the context of ABA effects on seed maturation, germination, seedling growth, vegetative stress responses, stomatal regulation, pathogen response, flowering, and senescence. PMID:24273463

  11. Horseradish peroxidase-catalyzed synthesis of poly(thiophene-3-boronic acid) biocomposites for mono-/bi-enzyme immobilization and amperometric biosensing.

    PubMed

    Huang, Yi; Wang, Wen; Li, Zou; Qin, Xiaoli; Bu, Lijuan; Tang, Zhiyong; Fu, Yingchun; Ma, Ming; Xie, Qingji; Yao, Shouzhuo; Hu, Jiming

    2013-06-15

    We report here on a facile enzymatic polymerization protocol to prepare enzyme-poly(thiophene-3-boronic acid) (PTBA) polymeric biocomposites (PBCs) for high-performance mono-/bi-enzyme amperometric biosensing. Horseradish peroxidase (HRP)-catalyzed polymerization of thiophene-3-boronic acid (TBA) monomer was conducted in aqueous solution containing HRP (or plus glucose oxidase (GOx)) by either directly added or GOx-glucose generated oxidant H2O2. The mono-/bi-enzyme amperometric biosensors were prepared simply by casting the dialysis-isolated PBCs on Au-plated Au electrode (Auplate/Au), followed by coating with an outer-layer chitosan (CS) film. The boronic acid residues are capable of covalent bonding with enzyme at the glycosyl sites (boronic acid-diols interaction), which should less affect the enzymatic activity as compared with the common cases of covalent bonding at the peptide chains, and UV-vis spectrophotometric tests confirmed that the encapsulated HRP almost possesses its pristine enzymatic specific activity. The enzyme electrodes were studied by cyclic voltammetry, electrochemical impedance spectroscopy and chronoamperometry in the presence of Fe(CN)6(4-) mediator. The CS/HRP-PTBA/Auplate/Au electrode responded linearly to H2O2 concentration from 1 to 300 μM with a sensitivity of 390 μA mM(-1)cm(-2) and a limit of detection (LOD) of 0.1 μM. The bienzyme CS/GOx-HRP-PTBA(H2O2)/Auplate/Au electrode responded linearly to glucose concentration from 5 μM to 0.83 mM with a sensitivity of 75.1 μA mM(-1)cm(-2) and a LOD of 1 μM, and it is found here that the use of Fe(CN)6(4-) that can only efficiently mediate HRP favorably avoids the "unusual amperometric responses" observed when other mediators that can efficiently turn over both HRP and GOx are used. PMID:23391705

  12. Rhodotorula glutinis Phenylalanine/Tyrosine Ammonia Lyase Enzyme Catalyzed Synthesis of the Methyl Ester of para-Hydroxycinnamic Acid and its Potential Antibacterial Activity.

    PubMed

    MacDonald, Marybeth C; Arivalagan, Pugazhendhi; Barre, Douglas E; MacInnis, Judith A; D'Cunha, Godwin B

    2016-01-01

    Biotransformation of L-tyrosine methyl ester (L-TM) to the methyl ester of para- hydroxycinnamic acid (p-HCAM) using Rhodotorula glutinis yeast phenylalanine/tyrosine ammonia lyase (PTAL; EC 4.3.1.26) enzyme was successfully demonstrated for the first time; progress of the reaction was followed by spectrophotometric determination at 315 nm. The following conditions were optimized for maximal formation of p-HCAM: pH (8.5), temperature (37°C), speed of agitation (50 rpm), enzyme concentration (0.080 μM), and substrate concentration (0.50 mM). Under these conditions, the yield of the reaction was ∼15% in 1 h incubation period and ∼63% after an overnight (∼18 h) incubation period. The product (p-HCAM) of the reaction of PTAL with L-TM was confirmed using Nuclear Magnetic Resonance spectroscopy (NMR). Fourier Transform Infra-Red spectroscopy (FTIR) was carried out to rule out potential hydrolysis of p-HCAM during overnight incubation. Potential antibacterial activity of p-HCAM was tested against several strains of Gram-positive and Gram-negative bacteria. This study describes a synthetically useful transformation, and could have future clinical and industrial applications. PMID:27014206

  13. Rhodotorula glutinis Phenylalanine/Tyrosine Ammonia Lyase Enzyme Catalyzed Synthesis of the Methyl Ester of para-Hydroxycinnamic Acid and its Potential Antibacterial Activity

    PubMed Central

    MacDonald, Marybeth C.; Arivalagan, Pugazhendhi; Barre, Douglas E.; MacInnis, Judith A.; D’Cunha, Godwin B.

    2016-01-01

    Biotransformation of L-tyrosine methyl ester (L-TM) to the methyl ester of para- hydroxycinnamic acid (p-HCAM) using Rhodotorula glutinis yeast phenylalanine/tyrosine ammonia lyase (PTAL; EC 4.3.1.26) enzyme was successfully demonstrated for the first time; progress of the reaction was followed by spectrophotometric determination at 315 nm. The following conditions were optimized for maximal formation of p-HCAM: pH (8.5), temperature (37°C), speed of agitation (50 rpm), enzyme concentration (0.080 μM), and substrate concentration (0.50 mM). Under these conditions, the yield of the reaction was ∼15% in 1 h incubation period and ∼63% after an overnight (∼18 h) incubation period. The product (p-HCAM) of the reaction of PTAL with L-TM was confirmed using Nuclear Magnetic Resonance spectroscopy (NMR). Fourier Transform Infra-Red spectroscopy (FTIR) was carried out to rule out potential hydrolysis of p-HCAM during overnight incubation. Potential antibacterial activity of p-HCAM was tested against several strains of Gram-positive and Gram-negative bacteria. This study describes a synthetically useful transformation, and could have future clinical and industrial applications. PMID:27014206

  14. Enzymic Capacities of Purified Cauliflower Bud Plastids for Lipid Synthesis and Carbohydrate Metabolism 1

    PubMed Central

    Journet, Etienne-Pascal; Douce, Roland

    1985-01-01

    Isolated cauliflower (Brassica oleracea) bud plastids, purified by isopycnic centrifugation in density gradients of Percoll, were found to be highly intact, to be practically devoid of extraplastidial contaminations, and to retain all the enzymes involved in fatty acid, phosphatidic acid, and monogalactosyldiacylglycerol synthesis. Purified plastids possess all the enzymes needed to convert triose phosphate to starch and vice versa, and are capable of conversion of glycerate 3-phosphate to pyruvate for fatty acid synthesis. They are also capable of oxidation of hexose phosphate and conversion to triose phosphate via the oxidative pentosephosphate pathway. Cauliflower bud plastids prove to be, therefore, biochemically very flexible organelles. Images Fig. 1 PMID:16664432

  15. Enzymic synthesis of indole-3-acetyl-1-O-beta-d-glucose. II. Metabolic characteristics of the enzyme

    NASA Technical Reports Server (NTRS)

    Leznicki, A. J.; Bandurski, R. S.

    1988-01-01

    The synthesis of indole-3-acetyl-1-O-beta-D-glucose from indole-3-acetic acid (IAA) and uridine diphosphoglucose (UDPG) has been shown to be a reversible reaction with the equilibrium away from ester formation and toward formation of IAA. The enzyme occurs primarily in the liquid endosperm of the corn kernel but some activity occurs in the embryo. It is relatively specific showing no glucose ester formation with oxindole-3-acetic acid or 7-hydroxy-oxindole-3-acetic acid, and low activity with phenylpropene acids, such as rho-coumaric acid. The enzyme is also specific for the nucleotide sugar showing no activity with UDPGalactose or UDPXylose. The enzyme is inhibited by inorganic pyrophosphate, by phosphate esters and by phospholipids, particularly phosphatidyl ethanolamine. The enzyme is inhibited by zeatin, by 2,4-dichlorophenoxy-acetic acid, by IAA-myo-inositol and IAA-glucan, but not by zeatin riboside, and only weakly by gibberellic acid, abscisic acid and kinetin. The reaction is slightly stimulated by both calcium and calmodulin and, in some cases, by thiol compounds. The role of this enzyme in the homeostatic control of indole-3-acetic acid levels in Zea mays is discussed.

  16. Enzyme immunoassay for carminic acid in foods.

    PubMed

    Yoshida, A; Takagaki, Y; Nishimune, T

    1995-01-01

    A competitive enzyme immunoassay (EIA) for carminic acid was investigated. Monoclonal anticarminic acid antibody was obtained from A/J mice immunized with carminic acid-human immunoglobulin G (IgG) conjugate. Carminic acid was extracted with distilled water from beverage, jelly, candy, pasta sauce, yogurt, or ice cream samples. Ham or fish paste samples were digested with pronase, then carminic acid was extracted from samples with sodium hydroxide solution. The extract was diluted more than 10-fold with 1% gelatin in borate buffer solution. Microtiter plates were coated with carminic acid-bovine serum albumin (BSA) conjugate or just BSA. Goat anti-mouse IgG(H+L)-peroxidase complex was used as a second antibody, and 3,3',5,5'-tetramethylbenzidine was used as a substrate for the peroxidase. The working range for quantitative analysis was 0.3-10 ng/mL, and the detection limit was 0.2 micrograms/g original sample. Recoveries of carminic acid by this assay were > 95% for milk beverage and jelly, and > 85% for yogurt and fish paste. Carminic acid was detected in 7 of 26 red-colored commercial food products and ranged from 3.5 to 356 micrograms/g. This EIA system also responded to the structural analogue of carminic acid, laccaic acid. PMID:7756895

  17. The synthesis of polyribonucleotides by cytoplasmic enzymes

    PubMed Central

    Wykes, J. R.; Smellie, R. M. S.

    1966-01-01

    1. The possibility that the cell cytoplasm contains enzymes catalysing the biosynthesis of RNA was investigated in fractions obtained by differential centrifugation of homogenates of Landschutz ascites-tumour cells. 2. The microsomal fraction was shown to be most active in incorporating UMP residues from [α-32P]UTP into polyribonucleotide material. 3. The same fraction also incorporated [3H]CTP, [3H]ATP and [3H]GTP separately and independently of the presence of complementary ribonucleoside 5′-triphosphates. 4. The reaction was promoted by the addition of RNA and showed an absolute requirement for Mg2+ ions. 5. Analysis of alkaline hydrolysates of the reaction products after the incorporation of [α-32P]UTP showed that most of the radioactivity was recovered in (2′,3′)-UMP residues irrespective of whether CTP, ATP and GTP were present in the reaction mixture. 6. Extraction of RNA from the reaction mixtures after the incorporation of [3H]ATP, [3H]GTP or [3H]CTP and analysis by sucrosedensity-gradient centrifugation showed no labelling of the ribosomal RNA. Radioactive material appeared between the 4s region and the meniscus of the sucrose gradient. In agreement with this observation, determinations of the chain length of the product showed that only short sequences of polynucleotides were synthesized. It is concluded that only homopolyribonucleotide synthesis is catalysed by the microsomal fractions and that there is little or no synthesis of RNA-like heteropolymers. PMID:5947148

  18. Synthesis of the Enzymes of the Mandelate Pathway by Pseudomonas putida I. Synthesis of Enzymes by the Wild Type

    PubMed Central

    Hegeman, G. D.

    1966-01-01

    Hegeman, G. D. (University of California, Berkeley). Synthesis of the enzymes of the mandelate pathway by Pseudomonas putida. I. Synthesis of enzymes by the wild type. J. Bacteriol. 91:1140–1154. 1966.—The control of synthesis of the five enzymes responsible for the conversion of d(−)-mandelate to benzoate by Pseudomonas putida was investigated. The first three compounds occurring in the pathway, d(−)-mandelate, l(+)-mandelate, and benzoylformate, are equipotent inducers of all five enzymes. A nonmetabolizable inducer, phenoxyacetate, also induces synthesis of these enzymes; but, unlike the metabolizable inducer-substrates, it does not elicit synthesis of enzymes that mediate steps in the pathway beyond benzoate. Under conditions of semigratuity, dl-mandelate elicits immediate synthesis at a steady rate of the first two enzymes of the pathway, but two enzymes which act below the level of benzoate are synthesized only after a considerable lag. Succinate and asparagine do not significantly repress the synthesis of the enzymes responsible for mandelate oxidation. PMID:5929747

  19. Dual Enzyme-Responsive Capsules of Hyaluronic Acid-block-Poly(Lactic Acid) for Sensing Bacterial Enzymes.

    PubMed

    Tücking, Katrin-Stephanie; Grützner, Verena; Unger, Ronald E; Schönherr, Holger

    2015-07-01

    The synthesis of novel amphiphilic hyaluronic acid (HYA) and poly(lactic acid) (PLA) block copolymers is reported as the key element of a strategy to detect the presence of pathogenic bacterial enzymes. In addition to the formation of defined HYA-block-PLA assemblies, the encapsulation of fluorescent reporter dyes and the selective enzymatic degradation of the capsules by hyaluronidase and proteinase K are studied. The synthesis of the dual enzyme-responsive HYA-b-PLA is carried out by copper-catalyzed Huisgen 1,3-dipolar cycloaddition. The resulting copolymers are assembled in water to form vesicular structures, which are characterized by scanning electron microscopy, transmission electron microscopy, dynamic light scattering (DLS), and fluorescence lifetime imaging microscopy (FLIM). DLS measurements show that both enzymes cause a rapid decrease in the hydrodynamic diameter of the nanocapsules. Fluorescence spectroscopy data confirm the liberation of encapsulated dye, which indicates the disintegration of the capsules and validates the concept of enzymatically triggered payload release. Finally, cytotoxicity assays confirm that the HYA-b-PLA nanocapsules are biocompatible with primary human dermal microvascular endothelial cells. PMID:25940300

  20. Energetics of amino acid synthesis in hydrothermal ecosystems

    NASA Technical Reports Server (NTRS)

    Amend, J. P.; Shock, E. L.

    1998-01-01

    Thermodynamic calculations showed that the autotrophic synthesis of all 20 protein-forming amino acids was energetically favored in hot (100 degrees C), moderately reduced, submarine hydrothermal solutions relative to the synthesis in cold (18 degrees C), oxidized, surface seawater. The net synthesis reactions of 11 amino acids were exergonic in the hydrothermal solution, but all were endergonic in surface seawater. The synthesis of the requisite amino acids of nine thermophilic and hyperthermophilic proteins in a 100 degreesC hydrothermal solution yielded between 600 and 8000 kilojoules per mole of protein, which is energy that is available to drive the intracellular synthesis of enzymes and other biopolymers in hyperthermophiles thriving in these ecosystems.

  1. Site-specific immobilization of enzymes on magnetic nanoparticles and their use in organic synthesis.

    PubMed

    Yu, Ching-Ching; Kuo, Yu-Ying; Liang, Chien-Fu; Chien, Wei-Ting; Wu, Huan-Ting; Chang, Tsung-Che; Jan, Fan-Dan; Lin, Chun-Cheng

    2012-04-18

    Magnetic nanoparticles (MNPs) are attractive materials that serve as a support for enzyme immobilization and facilitate separations by applying an external magnetic field; this could facilitate the recycling of enzymes and broaden their applications in organic synthesis. Herein, we report the methods for the immobilization of water-soluble and membrane-bound enzymes, and the activity difference between free and immobilized enzymes is discussed. Sialyltransferase (PmST1, from Pasteurella multocida ) and cytidine monophosphate (CMP)-sialic acid synthetase (CSS, from Neisseria meningitides ) were chosen as water-soluble enzymes and expressed using an intein expression system. The enzymes were site-specifically and covalently immobilized on PEGylated-N-terminal cysteine MNPs through native chemical ligation (NCL). Increasing the length of the PEG linker between the enzyme and the MNP surface increased the activity of the immobilized enzymes relative to the free parent enzymes. In addition, the use of a fluorescent acceptor tag for PmST1 affected enzyme kinetics. In contrast, sialyltransferase from Neisseria gonorrheae (NgST, a membrane-bound enzyme) was modified with a biotin-labeled cysteine at the C-terminus using NCL, and the enzyme was then assembled on streptavidin-functionalized MNPs. Using a streptavidin-biotin interaction, it was possible to immobilize NgST on a solid support under mild ligation conditions, which prevented the enzyme from high-temperature decomposition and provided an approximately 2-fold increase in activity compared to other immobilization methods on MNPs. Finally, the ganglioside GM3-derivative (sialyl-lactose derivative) was synthesized in a one-pot system by combining the use of immobilized PmST1 and CSS. The enzymes retained 50% activity after being reused ten times. Furthermore, the results obtained using the one-pot two-immobilized-enzyme system demonstrated that it can be applied to large-scale reactions with acceptable yields and

  2. Pancreatic enzyme synthesis and turnover in human subjects.

    PubMed

    O'Keefe, S J; Bennet, W M; Zinsmeister, A R; Haymond, M W

    1994-05-01

    Animal studies have shown that pancreatic enzyme secretion is independent of enzyme synthesis. To investigate this relationship in humans, we have coinfused 14C-labeled leucine tracer with cholecystokinin octapeptide in nine healthy adults for 4 h and measured the rate of appearance of secreted and newly labeled enzymes in the duodenum. Enzyme secretion was well maintained throughout, but newly labeled enzymes only appeared in juice between 75 and 101 min (median time, 86 min), indicating that initial secretion was dependent on the release of zymogen stores and that the median production time for new enzymes was 86 min. Between 85 and 225 min there was a curvilinear increase in the enrichment of secreted enzymes with newly synthesized enzymes, suggesting a median turnover rate of zymogen stores of 29%/h (range 12-47%/h). In conclusion, our results suggest that in healthy humans, postprandial pancreatic enzyme secretion is maintained by the export of a large stored pool and is not rate limited by enzyme synthesis, since it takes approximately 86 min for newly synthesized enzymes to take part in the digestive process. PMID:7515573

  3. Polyester and polycarbonate synthesis by in vitro enzyme catalysis.

    PubMed

    Gross, R A; Kalra, B; Kumar, A

    2001-06-01

    Enzyme technology has significantly expanded in scope and impact over the past 10 years to include organic transformations in non-traditional environments. This is in part due to an increased understanding and capability of using enzyme catalysis in a wide variety of organic solvents, at interfaces, and at high temperatures and pressures. This review focuses on a relatively new but rapidly expanding research activity where in vitro enzyme catalysis is used for the synthesis of non-natural polyesters and polycarbonates. The inclination to use of enzymes for polymer synthesis has been fueled by a desire to carry out these reactions in the absence of heavy metals, at lower temperatures, and with increased selectivity. Aspects of this work that include enzyme-catalyzed step-growth condensation reactions, chain-growth ring-opening polymerizations, and corresponding transesterification of macromolecular substrates are discussed. PMID:11525611

  4. Abiotic synthesis of fatty acids

    NASA Technical Reports Server (NTRS)

    Leach, W. W.; Nooner, D. W.; Oro, J.

    1978-01-01

    The formation of fatty acids by Fischer-Tropsch-type synthesis was investigated with ferric oxide, ammonium carbonate, potassium carbonate, powdered Pueblito de Allende carbonaceous chondrite, and filings from the Canyon Diablo meteorite used as catalysts. Products were separated and identified by gas chromatography and mass spectrometry. Iron oxide, Pueblito de Allende chondrite, and Canyon Diablo filings in an oxidized catalyst form yielded no fatty acids. Canyon Diablo filings heated overnight at 500 C while undergoing slow purging by deuterium produced fatty acids only when potassium carbonate was admixed; potassium carbonate alone also produced these compounds. The active catalytic combinations gave relatively high yields of aliphatic and aromatic hydrocarbons; substantial amounts of n-alkenes were almost invariably observed when fatty acids were produced; the latter were in the range C6 to C18, with maximum yield in C9 or 10.

  5. Cell Wall Polymers of Bacillus sphaericus 9602 II. Synthesis of the First Enzyme Unique to Cortex Synthesis During Sporulation

    PubMed Central

    Tipper, Donald J.; Pratt, Iona

    1970-01-01

    The cell wall peptidoglycan of vegetative cells of Bacillus sphaericus 9602 contains l-lysine and d-isoasparagine and is devoid of diaminopimelic acid (Dap), whereas the peptidoglycan of its spore cortex is devoid of l-lysine and d-isoasparagine and contains meso-Dap. These two structures have a common biosynthetic precursor, uridine-diphospho-N-acetylmuramyl-l- alanyl-d-glutamic acid, which accepts either l-lysine or meso-Dap, the latter reaction being the first unique to the synthesis of the spore cortex peptidoglycan. l-lysine-adding activity decays at the end of vegetative growth to a level which is maintained until Dap-adding activity appears, when it declines rapidly again. Dap-adding activity is not detectable in refractile spores, in vegetative cells, or in sporulating cells until about 4 hr after the end of vegetative growth, when it increases rapidly for about 1.5 hr in a process dependent on continued protein and ribonucleic acid (RNA) synthesis. This process apparently involves transcription and translation during this period of a “sporulation-specific” gene whose product is essential for and unique to sporulation. It is closely followed by the acquirement of refractility. Another sporulation-specific gene, that for dipicolinate synthase, is apparently transcribed and translated in an overlapping period commencing about 0.5 hr later, although dipicolinate does not accumulate rapidly until 1.5 hr later, when about 75% of the cells are already refractile. Inhibition of protein synthesis with chloramphenicol or of RNA synthesis with streptolydigin inhibited accumulation of these enzymes in sporulating cells; this inhibition could be reversed by washing out the antibiotics after 1.5 hr. Sporulation recommenced with an unaltered sequence of events but with poorer synchrony. There was no evidence for a messenger RNA for either enzyme of lifetime greater than a small fraction of the period of enzyme accumulation, although dilution with 10 volumes of fresh

  6. Immobilization of enzymes on alginic acid-polyacrylamide copolymers

    SciTech Connect

    Kumaraswamy, M.D.K.; Panduranga R.K.; Thomas J.K.; Santappa, M.

    1981-08-01

    In this report, the authors present initial results and limitations of a polymeric system for the immobilization of enzymes. Enzymes attached to insoluble polymers of natural and synthetic origin are gaining importance in many industrial and biomedical applications. Graft copolymers are used as enzyme supports and in this study a novel polymeric system of alginic acid-polyacrylamide graft copolymer is described which was used for immobilizing enzymes. (Refs. 4).

  7. Novel 2-oxoimidazolidine-4-carboxylic acid derivatives as Hepatitis C virus NS3-4A serine protease inhibitors: synthesis, activity, and X-ray crystal structure of an enzyme inhibitor complex

    SciTech Connect

    Arasappan, Ashok; Njoroge, F. George; Parekh, Tejal N.; Yang, Xiaozheng; Pichardo, John; Butkiewicz, Nancy; Prongay, Andrew; Yao, Nanhua; Girijavallabhan, Viyyoor

    2008-06-30

    Synthesis and HCV NS3 serine protease inhibitory activity of some novel 2-oxoimidazolidine-4-carboxylic acid derivatives are reported. Inhibitors derived from this new P2 core exhibited activity in the low {micro}M range. X-ray structure of an inhibitor, 15c bound to the protease is presented.

  8. Genetics Home Reference: congenital bile acid synthesis defect type 1

    MedlinePlus

    ... bile acid synthesis defect type 1 congenital bile acid synthesis defect type 1 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 1 is a disorder characterized ...

  9. Genetics Home Reference: congenital bile acid synthesis defect type 2

    MedlinePlus

    ... bile acid synthesis defect type 2 congenital bile acid synthesis defect type 2 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 2 is a disorder characterized ...

  10. Hydroxamic acids in asymmetric synthesis.

    PubMed

    Li, Zhi; Yamamoto, Hisashi

    2013-02-19

    Metal-catalyzed stereoselective reactions are a central theme in organic chemistry research. In these reactions, the stereoselection is achieved predominantly by introducing chiral ligands at the metal catalyst's center. For decades, researchers have sought better chiral ligands for asymmetric catalysis and have made great progress. Nevertheless, to achieve optimal stereoselectivity and to catalyze new reactions, new chiral ligands are needed. Because of their high metal affinity, hydroxamic acids play major roles across a broad spectrum of fields from biochemistry to metal extraction. Dr. K. Barry Sharpless first revealed their potential as chiral ligands for asymmetric synthesis in 1977: He published the chiral vanadium-hydroxamic-acid-catalyzed, enantioselective epoxidation of allylic alcohols before his discovery of Sharpless asymmetric epoxidation, which uses the titanium-tartrate complex as the chiral reagent. However, researchers have reported few highly enantioselective reactions using metal-hydroxamic acid as catalysts since then. This Account summarizes our research on metal-catalyzed asymmetric epoxidation using hydroxamic acids as chiral ligands. We designed and synthesized a series of new hydroxamic acids, most notably the C2-symmetric bis-hydroxamic acid (BHA) family. V-BHA-catalyzed epoxidation of allylic and homoallylic alcohols achieved higher activity and stereoselectivity than Sharpless asymmetric epoxidation in many cases. Changing the metal species led to a series of unprecedented asymmetric epoxidation reactions, such as (i) single olefins and sulfides with Mo-BHA, (ii) homoallylic and bishomoallylic alcohols with Zr- and Hf-BHA, and (iii) N-alkenyl sulfonamides and N-sulfonyl imines with Hf-BHA. These reactions produce uniquely functionalized chiral epoxides with good yields and enantioselectivities. PMID:23157425

  11. Hydroxamic Acids in Asymmetric Synthesis

    PubMed Central

    Li, Zhi; Yamamoto, Hisashi

    2012-01-01

    Metal-catalyzed stereoselective reactions are a central theme in organic chemistry research. In these reactions, the stereoselection is achieved predominantly by introducing chiral ligands at the metal catalyst’s center. For decades, researchers have sought better chiral ligands for asymmetric catalysis and have made great progress. Nevertheless, to achieve optimal stereoselectivity and to catalyze new reactions, new chiral ligands are needed. Due to their high metal affinity, hydroxamic acids play major roles across a broad spectrum of fields from biochemistry to metal extraction. Dr. K. Barry Sharpless first revealed their potential as chiral ligands for asymmetric synthesis in 1977: He published the chiral vanadium-hydroxamic-acid-catalyzed, enantioselective epoxidation of allylic alcohols before his discovery of Sharpless Asymmetric Epoxidation, which uses titanium-tartrate complex as the chiral reagent. However, researchers have reported few highly enantioselective reactions using metal-hydroxamic acid as catalysts since then. This Account summarizes our research on metal-catalyzed asymmetric epoxidation using hydroxamic acids as chiral ligands. We designed and synthesized a series of new hydroxamic acids, most notably the C2-symmetric bis-hydroxamic acid (BHA) family. V-BHA-catalyzed epoxidation of allylic and homoallylic alcohols achieved higher activity and stereoselectivity than Sharpless Asymmetric Epoxidation in many cases. Changing the metal species led to a series of unprecedented asymmetric epoxidation reactions, such as (i) single olefins and sulfides with Mo-BHA, (ii) homoallylic and bishomoallylic alcohols with Zr- and Hf-BHA, and (iii) N-alkenyl sulfonamides and N-sulfonyl imines with Hf-BHA. These reactions produce uniquely functionalized chiral epoxides with good yields and enantioselectivities. PMID:23157425

  12. Transient repression of catabolite-sensitive enzyme synthesis elicited by 2,4-dinitrophenol.

    PubMed

    Oki, R

    1975-09-01

    Transient inhibition of catabolic enzyme synthesis in Escherichia coli occurred when a low concentration of 2,4-dinitrophenol (DNP) was simultaneously added with inducer. Using mutant strains defective for gamma-gene product or constitutive for lac enzymes, it was found that the inhibition is not due to the exclusion of inducer by uncoupling. The addition of cyclic adenosine 3',5'-monophosphate overcame repression. The components of the lac operon coordinately responded to DNP inhibition. From deoxyribonucleic acid-ribonucleic acid hybridization experiments, it was found that the inhibition of beta-galactosidase induction occurred at the level of messenger ribonucleic acid synthesis specific for the lac operon. It seems probable that DNP represses induction in a similar manner to that of transient repression observed upon the addition of glucose. Furthermore, it was found that transient repression disappeared if cells were preincubated with DNP before induction. This indicates that new contact of cells with DNP is obligatory for transient repression. From these results, it is suggested that the cell membrane may be responsible for regulation of catabolite-sensitive enzyme synthesis. PMID:169228

  13. Enzymes as Green Catalysts for Precision Macromolecular Synthesis.

    PubMed

    Shoda, Shin-Ichiro; Uyama, Hiroshi; Kadokawa, Jun-Ichi; Kimura, Shunsaku; Kobayashi, Shiro

    2016-02-24

    The present article comprehensively reviews the macromolecular synthesis using enzymes as catalysts. Among the six main classes of enzymes, the three classes, oxidoreductases, transferases, and hydrolases, have been employed as catalysts for the in vitro macromolecular synthesis and modification reactions. Appropriate design of reaction including monomer and enzyme catalyst produces macromolecules with precisely controlled structure, similarly as in vivo enzymatic reactions. The reaction controls the product structure with respect to substrate selectivity, chemo-selectivity, regio-selectivity, stereoselectivity, and choro-selectivity. Oxidoreductases catalyze various oxidation polymerizations of aromatic compounds as well as vinyl polymerizations. Transferases are effective catalysts for producing polysaccharide having a variety of structure and polyesters. Hydrolases catalyzing the bond-cleaving of macromolecules in vivo, catalyze the reverse reaction for bond forming in vitro to give various polysaccharides and functionalized polyesters. The enzymatic polymerizations allowed the first in vitro synthesis of natural polysaccharides having complicated structures like cellulose, amylose, xylan, chitin, hyaluronan, and chondroitin. These polymerizations are "green" with several respects; nontoxicity of enzyme, high catalyst efficiency, selective reactions under mild conditions using green solvents and renewable starting materials, and producing minimal byproducts. Thus, the enzymatic polymerization is desirable for the environment and contributes to "green polymer chemistry" for maintaining sustainable society. PMID:26791937

  14. GFP Reporter Screens for the Engineering of Amino Acid Degrading Enzymes from Libraries Expressed in Bacteria

    PubMed Central

    Paley, Olga; Agnello, Giulia; Cantor, Jason; Yoo, Tae Hyun; Georgiou, George; Stone, Everett

    2014-01-01

    There is significant interest in engineering human amino acid degrading enzymes as non-immunogenic chemotherapeutic agents. We describe a high-throughput fluorescence activated cell sorting (FACS) assay for detecting the catalytic activity of amino acid degrading enzymes in bacteria, at the single cell level. This assay relies on coupling the synthesis of the GFP reporter to the catalytic activity of the desired amino acid degrading enzyme in an appropriate E. coli genetic background. The method described here allows facile screening of much larger libraries (106–107) than was previously possible. We demonstrate the application of this technique in the screening of libraries of bacterial and human asparaginases and also for the catalytic optimization of an engineered human methionine gamma lyase. PMID:23423887

  15. Enzymic synthesis of indole-3-acetyl-1-O-beta-d-glucose. I. Partial purification and characterization of the enzyme from Zea mays

    NASA Technical Reports Server (NTRS)

    Leznicki, A. J.; Bandurski, R. S.

    1988-01-01

    The first enzyme-catalyzed reaction leading from indole-3-acetic acid (IAA) to the myo-inositol esters of IAA is the synthesis of indole-3-acetyl-1-O-beta-D-glucose from uridine-5'-diphosphoglucose (UDPG) and IAA. The reaction is catalyzed by the enzyme, UDPG-indol-3-ylacetyl glucosyl transferase (IAA-glucose-synthase). This work reports methods for the assay of the enzyme and for the extraction and partial purification of the enzyme from kernels of Zea mays sweet corn. The enzyme has an apparent molecular weight of 46,500 an isoelectric point of 5.5, and its pH optimum lies between 7.3 and 7.6. The enzyme is stable to storage at zero degrees but loses activity during column chromatographic procedures which can be restored only fractionally by addition of column eluates. The data suggest either multiple unknown cofactors or conformational changes leading to activity loss.

  16. Affinity labelling enzymes with esters of aromatic sulfonic acids

    DOEpatents

    Wong, Show-Chu; Shaw, Elliott

    1977-01-01

    Novel esters of aromatic sulfonic acids are disclosed. The specific esters are nitrophenyl p- and m-amidinophenylmethanesulfonate. Also disclosed is a method for specific inactivation of the enzyme, thrombin, employing nitrophenyl p-amidinophenylmethanesulfonate.

  17. Bile Acid Synthesis in the Isolated, Perfused Rabbit Liver

    PubMed Central

    Mosbach, E. H.; Rothschild, M. A.; Bekersky, I.; Oratz, M.; Mongelli, J.

    1971-01-01

    These experiments were carried out to demonstrate the usefulness of the perfused rabbit liver for studies of bile acid metabolism, and to determine the rate-limiting enzyme of bile acid synthesis. Rabbits were fed a semisynthetic diet, with or without the addition of 1% cholestyramine, under controlled conditions. At the end of 2-5 wk, the livers were removed and perfused for 2.5 hr employing various 14C-labeled precursors to measure de novo cholic acid synthesis. The livers were then analyzed for cholesterol, and the bile collected during the perfusion was analyzed for cholesterol and bile acids. Control bile contained, on the average, 0.34 mg of glycocholate, 7.4 mg of glycodeoxycholate, and 0.06 mg of cholesterol. After cholestyramine treatment of the donor rabbits, the bile contained 3.3 mg of glycocholate, 3.7 mg of glycodeoxycholate, and 0.05 mg of cholesterol. It was assumed that in cholestyramine-treated animals the enterohepatic circulation of the bile acids had been interrupted sufficiently to release the feedback inhibition of the rate-controlling enzyme of bile acid synthesis. Therefore, a given precursor should be incorporated into bile acids at a more rapid rate in livers of cholestyramine-treated animals, provided that the precursor was acted upon by the rate-controlling enzyme. It was found that the incorporation of acetate-14C, mevalonolactone-14C, and cholesterol-14C into cholate was 5-20 times greater in the livers of cholestyramine-treated animals than in the controls. In contrast, there was no difference in the incorporation of 7α-hydroxycholesterol-14C into cholate regardless of dietary pretreatment. It was concluded that given an adequate precursor pool, the 7α-hydroxylation of cholesterol is the rate-limiting step in bile acid formation. PMID:5097576

  18. An improved synthesis for the (Z)-14-methyl-9-pentadecenoic acid and its topoisomerase I inhibitory activity

    PubMed Central

    Carballeira, Néstor M.; Sanabria, David; Oyola, Delise

    2006-01-01

    An improved synthesis for the (Z)-14-methyl-9-pentadecenoic acid was developed based on the appropriate use of (trimethylsilyl)acetylene as the key reagent in the synthesis. The reported synthesis started with commercially available 8-bromo-1-octanol and furnished the desired acid in seven steps and in a 16% overall yield, a significant improvement over the previous reported synthesis for this fatty acid. The synthesis reported herein afforded sufficient amounts to study the acid topoisomerase I inhibitory potential and it was found that the title acid inhibits the human placenta DNA topoisomerase I enzyme at concentrations of 500 μM. PMID:17680032

  19. Method for Enzyme Design with Genetically Encoded Unnatural Amino Acids.

    PubMed

    Hu, C; Wang, J

    2016-01-01

    We describe the methodologies for the design of artificial enzymes with genetically encoded unnatural amino acids. Genetically encoded unnatural amino acids offer great promise for constructing artificial enzymes with novel activities. In our studies, the designs of artificial enzyme were divided into two steps. First, we considered the unnatural amino acids and the protein scaffold separately. The scaffold is designed by traditional protein design methods. The unnatural amino acids are inspired by natural structure and organic chemistry methods, and synthesized by either organic chemistry methods or enzymatic conversion. With the increasing number of published unnatural amino acids with various functions, we described an unnatural amino acids toolkit containing metal chelators, redox mediators, and click chemistry reagents. These efforts enable a researcher to search the toolkit for appropriate unnatural amino acids for the study, rather than design and synthesize the unnatural amino acids from the beginning. After the first step, the model enzyme was optimized by computational methods and directed evolution. Lastly, we describe a general method for evolving aminoacyl-tRNA synthetase and expressing unnatural amino acids incorporated into a protein. PMID:27586330

  20. Stereoselective synthesis of stable-isotope-labeled amino acids

    SciTech Connect

    Unkefer, C.J.; Martinez, R.A.; Silks, L.A. III; Lodwig, S.N.

    1994-12-01

    For magnetic resonance and vibrational spectroscopies to reach their full potential, they must be used in combination with sophisticated site-specific stable isotope labeling of biological macromolecules. Labeled amino acids are required for the study of the structure and function of enzymes and proteins. Because there are 20 common amino acids, each with its own distinguishing chemistry, they remain a synthetic challenge. The Oppolzer chiral auxiliary provides a general tool with which to approach the synthesis of labeled amino acids. By using the Oppolzer auxiliary, amino acids can be constructed from several small molecules, which is ideal for stable isotope labeling. In addition to directing the stereochemistry at the {alpha}-carbon, the camphorsultam can be used for stereo-specific isotope labeling at prochiral centers in amino acids. By using the camphorsultam auxiliary we have the potential to synthesize virtually any isotopomer of all of the common amino acids.

  1. An enzyme-encapsulated microreactor for efficient theanine synthesis.

    PubMed

    Matsuura, Shun-ichi; Yokoyama, Takuji; Ishii, Ryo; Itoh, Tetsuji; Tomon, Emiko; Hamakawa, Satoshi; Tsunoda, Tatsuo; Mizukami, Fujio; Nanbu, Hironobu; Hanaoka, Taka-aki

    2012-07-18

    A flow-type microreactor containing glutaminase-mesoporous silica composites with 10.6 nm pore diameter (TMPS10.6) was developed for the continuous synthesis of theanine, a unique amino acid. High enzymatic activity was exhibited by the local control of the reaction temperature. PMID:22674037

  2. Association of lignifying enzymes in shell synthesis of oil palm fruit (Elaeis guineensis--dura variety).

    PubMed

    Bhasker, S; Mohankumar, C

    2001-02-01

    Scanning electron microscopic (SEM) observation demonstrates the differentiation of mesocarp and endocarp tissues and their lignified nature in dura fruits at 8 weeks after pollination (WAP). During shell formation, the endocarp cells become lignified to a hard shell while the mesocarp tissue remains cellular and fibrous. A transition zone made up of fibrous units was also visible beneath the shell. The soluble phenols of mesocarp and endocarp tissues at their developmental stage was analyzed using Reverse phase high performance liquid chromatography (RP-HPLC). The appearance of ferulic acid at 4 WAP and its absence at 8 WAP indicates the role of ferulic acid in lignin synthesis. The HPLC data was supported by the lignin concentration. To ascertain the biochemical relationship of lignin pathway enzymes, phenylalanine ammonia lyase (PAL), cinnamyl alcohol-NADPH-dehydrogenase (CAD) and peroxidase (POD) with shell synthesis, the activities of these enzymes and lignin content were assessed during development of the shell between 4 and 8 WAP. The three enzymes, PAL, CAD and POD expressed high level of activity in the mesocarp and endocarp at 4 WAP. At 8 WAP a sharp decline in activity was observed in the endocarp whereas the mesocarp showed a moderate reduction. This variation is an indication of the role of these enzymes in shell formation. PMID:11480213

  3. Cyclic phosphatidic acid and lysophosphatidic acid induce hyaluronic acid synthesis via CREB transcription factor regulation in human skin fibroblasts.

    PubMed

    Maeda-Sano, Katsura; Gotoh, Mari; Morohoshi, Toshiro; Someya, Takao; Murofushi, Hiromu; Murakami-Murofushi, Kimiko

    2014-09-01

    Cyclic phosphatidic acid (cPA) is a naturally occurring phospholipid mediator and an analog of the growth factor-like phospholipid lysophosphatidic acid (LPA). cPA has a unique cyclic phosphate ring at the sn-2 and sn-3 positions of its glycerol backbone. We showed before that a metabolically stabilized cPA derivative, 2-carba-cPA, relieved osteoarthritis pathogenesis in vivo and induced hyaluronic acid synthesis in human osteoarthritis synoviocytes in vitro. This study focused on hyaluronic acid synthesis in human fibroblasts, which retain moisture and maintain health in the dermis. We investigated the effects of cPA and LPA on hyaluronic acid synthesis in human fibroblasts (NB1RGB cells). Using particle exclusion and enzyme-linked immunosorbent assays, we found that both cPA and LPA dose-dependently induced hyaluronic acid synthesis. We revealed that the expression of hyaluronan synthase 2 messenger RNA and protein is up-regulated by cPA and LPA treatment time dependently. We then characterized the signaling pathways up-regulating hyaluronic acid synthesis mediated by cPA and LPA in NB1RGB cells. Pharmacological inhibition and reporter gene assays revealed that the activation of the LPA receptor LPAR1, Gi/o protein, phosphatidylinositol-3 kinase (PI3K), extracellular-signal-regulated kinase (ERK), and cyclic adenosine monophosphate response element-binding protein (CREB) but not nuclear factor κB induced hyaluronic acid synthesis by the treatment with cPA and LPA in NB1RGB cells. These results demonstrate for the first time that cPA and LPA induce hyaluronic acid synthesis in human skin fibroblasts mainly through the activation of LPAR1-Gi/o followed by the PI3K, ERK, and CREB signaling pathway. PMID:24845645

  4. The Roles of Acids and Bases in Enzyme Catalysis

    ERIC Educational Resources Information Center

    Weiss, Hilton M.

    2007-01-01

    Many organic reactions are catalyzed by strong acids or bases that protonate or deprotonate neutral reactants leading to reactive cations or anions that proceed to products. In enzyme reactions, only weak acids and bases are available to hydrogen bond to reactants and to transfer protons in response to developing charges. Understanding this…

  5. Structure-Function Relationships of Glucansucrase and Fructansucrase Enzymes from Lactic Acid Bacteria

    PubMed Central

    van Hijum, Sacha A. F. T.; Kralj, Slavko; Ozimek, Lukasz K.; Dijkhuizen, Lubbert; van Geel-Schutten, Ineke G. H.

    2006-01-01

    Lactic acid bacteria (LAB) employ sucrase-type enzymes to convert sucrose into homopolysaccharides consisting of either glucosyl units (glucans) or fructosyl units (fructans). The enzymes involved are labeled glucansucrases (GS) and fructansucrases (FS), respectively. The available molecular, biochemical, and structural information on sucrase genes and enzymes from various LAB and their fructan and α-glucan products is reviewed. The GS and FS enzymes are both glycoside hydrolase enzymes that act on the same substrate (sucrose) and catalyze (retaining) transglycosylation reactions that result in polysaccharide formation, but they possess completely different protein structures. GS enzymes (family GH70) are large multidomain proteins that occur exclusively in LAB. Their catalytic domain displays clear secondary-structure similarity with α-amylase enzymes (family GH13), with a predicted permuted (β/α)8 barrel structure for which detailed structural and mechanistic information is available. Emphasis now is on identification of residues and regions important for GS enzyme activity and product specificity (synthesis of α-glucans differing in glycosidic linkage type, degree and type of branching, glucan molecular mass, and solubility). FS enzymes (family GH68) occur in both gram-negative and gram-positive bacteria and synthesize β-fructan polymers with either β-(2→6) (inulin) or β-(2→1) (levan) glycosidic bonds. Recently, the first high-resolution three-dimensional structures have become available for FS (levansucrase) proteins, revealing a rare five-bladed β-propeller structure with a deep, negatively charged central pocket. Although these structures have provided detailed mechanistic insights, the structural features in FS enzymes dictating the synthesis of either β-(2→6) or β-(2→1) linkages, degree and type of branching, and fructan molecular mass remain to be identified. PMID:16524921

  6. Synthesis of new polysialic acid derivatives.

    PubMed

    Su, Yi; Kasper, Cornelia; Kirschning, Andreas; Dräger, Gerald; Berski, Silke

    2010-09-01

    In this paper we report the first synthesis of novel polysialic acid derivatives which is initiated by treatment of polysialic acid with EDC-HCl to yield the inter-residual delta-lactone. Subsequent reaction with amines or hydrazine gives the corresponding polysialic acid amides and hydrazide. Alkylation of the tetrabutylammonium salt of polysialic acid yields polysialic acid esters. In contrast a variety of N-derivatives of polysialic acid can be prepared starting from deacetylated polysialic acid. The N-derivatives prepared in this communication can be used for the Cu-catalyzed as well as Cu-free "click" chemistry. PMID:20602419

  7. Protein synthesis in liposomes with a minimal set of enzymes.

    PubMed

    Murtas, Giovanni; Kuruma, Yutetsu; Bianchini, Paolo; Diaspro, Alberto; Luisi, Pier Luigi

    2007-11-01

    In a significant step towards the construction of the semi-synthetic minimal cell, a protein expression system with a minimal set of pure and specific enzymes is required. A novel cell-free transcription and translation system named PURESYSTEM (PS), consisting of a specified set of 36 enzymes and ribosomes, has been entrapped in POPC liposomes for protein synthesis. The PS has been used to transcribe and translate an Enhanced Green Fluorescent Protein (EGFP) gene from plasmid DNA. The synthesis is confirmed by the EGFP fluorescence emitting liposomes on fluorometric analysis and on confocal microscopy analysis. Furthermore the PS encapsulated into POPC liposomes can drive the expression of the plsB and plsC genes encoding for the sn-glycerol-3-phosphate acyltransferase (GPAT) and 1-acyl-sn-glycerol-3-phosphate acyltransferase (LPAAT) involved in the first step of the "salvage pathway" for synthesis of POPC. The expression of GPAT and LPAAT in liposomes would in principle allow the production of the cell boundary from within. PMID:17850764

  8. Production of 5-aminolevulinic acid by cell free multi-enzyme catalysis.

    PubMed

    Meng, Qinglong; Zhang, Yanfei; Ju, Xiaozhi; Ma, Chunling; Ma, Hongwu; Chen, Jiuzhou; Zheng, Ping; Sun, Jibin; Zhu, Jun; Ma, Yanhe; Zhao, Xueming; Chen, Tao

    2016-05-20

    5-Aminolevulinic acid (ALA) is the precursor for the biosynthesis of tetrapyrroles and has broad agricultural and medical applications. Currently ALA is mainly produced by chemical synthesis and microbial fermentation. Cell free multi-enzyme catalysis is a promising method for producing high value chemicals. Here we reported our work on developing a cell free process for ALA production using thermostable enzymes. Cheap substrates (succinate and glycine) were used for ALA synthesis by two enzymes: 5-aminolevulinic acid synthase (ALAS) from Laceyella sacchari (LS-ALAS) and succinyl-CoA synthase (Suc) from Escherichia coli. ATP was regenerated by polyphosphate kinase (Ppk) using polyphosphate as the substrate. Succinate was added into the reaction system in a fed-batch mode to avoid its inhibition effect on Suc. After reaction for 160min, ALA concentration was increased to 5.4mM. This is the first reported work on developing the cell free process for ALA production. Through further process and enzyme optimization the cell free process could be an effective and economic way for ALA production. PMID:27012885

  9. In Vitro Optimization of Enzymes Involved in Precorrin-2 Synthesis Using Response Surface Methodology

    PubMed Central

    Fang, Huan; Dong, Huina; Cai, Tao; Zheng, Ping; Li, Haixing; Zhang, Dawei; Sun, Jibin

    2016-01-01

    In order to maximize the production of biologically-derived chemicals, kinetic analyses are first necessary for predicting the role of enzyme components and coordinating enzymes in the same reaction system. Precorrin-2 is a key precursor of cobalamin and siroheme synthesis. In this study, we sought to optimize the concentrations of several molecules involved in precorrin-2 synthesis in vitro: porphobilinogen synthase (PBGS), porphobilinogen deaminase (PBGD), uroporphyrinogen III synthase (UROS), and S-adenosyl-l-methionine-dependent urogen III methyltransferase (SUMT). Response surface methodology was applied to develop a kinetic model designed to maximize precorrin-2 productivity. The optimal molar ratios of PBGS, PBGD, UROS, and SUMT were found to be approximately 1:7:7:34, respectively. Maximum precorrin-2 production was achieved at 0.1966 ± 0.0028 μM/min, agreeing with the kinetic model’s predicted value of 0.1950 μM/min. The optimal concentrations of the cofactor S-adenosyl-L-methionine (SAM) and substrate 5-aminolevulinic acid (ALA) were also determined to be 200 μM and 5 mM, respectively, in a tandem-enzyme assay. By optimizing the relative concentrations of these enzymes, we were able to minimize the effects of substrate inhibition and feedback inhibition by S-adenosylhomocysteine on SUMT and thereby increase the production of precorrin-2 by approximately five-fold. These results demonstrate the effectiveness of kinetic modeling via response surface methodology for maximizing the production of biologically-derived chemicals. PMID:26974652

  10. Total synthesis of (+)-zaragozic acid C.

    PubMed

    Armstrong, A; Barsanti, P A; Jones, L H; Ahmed, G

    2000-10-20

    A total synthesis of (+)-zaragozic acid C is described. Key features of the synthesis are the use of a double Sharpless asymmetric dihydroxylation reaction of diene 6 to control stereochemistry at four contiguous stereocenters from C3 to C6; the introduction of the C1-side chain by reaction between the anion derived from the dithiane monosulfoxide 27 and the core aldehyde 12; a high yielding, acid-mediated simultaneous acetonide deprotection-dithiane removal-ketalization procedure leading exclusively to the 2, 8-dioxabicyclo[3.2.1]octane core 34; and a novel triple oxidation procedure allowing installation of the tricarboxylic acid. PMID:11031024

  11. Microwave-Assisted Rapid Enzymatic Synthesis of Nucleic Acids.

    PubMed

    Hari Das, Rakha; Ahirwar, Rajesh; Kumar, Saroj; Nahar, Pradip

    2016-07-01

    Herein we report microwave-induced enhancement of the reactions catalyzed by Escherichia coli DNA polymerase I and avian myeloblastosis virus-reverse transcriptase. The reactions induced by microwaves result in a highly selective synthesis of nucleic acids in 10-50 seconds. In contrast, same reactions failed to give desired reaction products when carried out in the same time periods, but without microwave irradiation. Each of the reactions was carried out for different duration of microwave exposure time to find the optimum reaction time. The products produced by the respective enzyme upon microwave irradiation of the reaction mixtures were identical to that produced by the conventional procedures. As the microwave-assisted reactions are rapid, microwave could be a useful alternative to the conventional and time consuming procedures of enzymatic synthesis of nucleic acids. PMID:27159147

  12. Induction of Arabidopsis tryptophan pathway enzymes and camalexin by amino acid starvation, oxidative stress, and an abiotic elicitor.

    PubMed Central

    Zhao, J; Williams, C C; Last, R L

    1998-01-01

    The tryptophan (Trp) biosynthetic pathway leads to the production of many secondary metabolites with diverse functions, and its regulation is predicted to respond to the needs for both protein synthesis and secondary metabolism. We have tested the response of the Trp pathway enzymes and three other amino acid biosynthetic enzymes to starvation for aromatic amino acids, branched-chain amino acids, or methionine. The Trp pathway enzymes and cytosolic glutamine synthetase were induced under all of the amino acid starvation test conditions, whereas methionine synthase and acetolactate synthase were not. The mRNAs for two stress-inducible enzymes unrelated to amino acid biosynthesis and accumulation of the indolic phytoalexin camalexin were also induced by amino acid starvation. These results suggest that regulation of the Trp pathway enzymes under amino acid deprivation conditions is largely a stress response to allow for increased biosynthesis of secondary metabolites. Consistent with this hypothesis, treatments with the oxidative stress-inducing herbicide acifluorfen and the abiotic elicitor alpha-amino butyric acid induced responses similar to those induced by the amino acid starvation treatments. The role of salicylic acid in herbicide-mediated Trp and camalexin induction was investigated. PMID:9501110

  13. Molecular annotation of ketol-acid reductoisomerases from Streptomyces reveals a novel amino acid biosynthesis interlock mediated by enzyme promiscuity.

    PubMed

    Verdel-Aranda, Karina; López-Cortina, Susana T; Hodgson, David A; Barona-Gómez, Francisco

    2015-03-01

    The 6-phosphogluconate dehydrogenase superfamily oxidize and reduce a wide range of substrates, making their functional annotation challenging. Ketol-acid reductoisomerase (KARI), encoded by the ilvC gene in branched-chain amino acids biosynthesis, is a promiscuous reductase enzyme within this superfamily. Here, we obtain steady-state enzyme kinetic parameters for 10 IlvC homologues from the genera Streptomyces and Corynebacterium, upon eight selected chemically diverse substrates, including some not normally recognized by enzymes of this superfamily. This biochemical data suggested a Streptomyces biosynthetic interlock between proline and the branched-chain amino acids, mediated by enzyme substrate promiscuity, which was confirmed via mutagenesis and complementation analyses of the proC, ilvC1 and ilvC2 genes in Streptomyces coelicolor. Moreover, both ilvC orthologues and paralogues were analysed, such that the relationship between gene duplication and functional diversification could be explored. The KARI paralogues present in S. coelicolor and Streptomyces lividans, despite their conserved high sequence identity (97%), were shown to be more promiscuous, suggesting a recent functional diversification. In contrast, the KARI paralogue from Streptomyces viridifaciens showed selectivity towards the synthesis of valine precursors, explaining its recruitment within the biosynthetic gene cluster of valanimycin. These results allowed us to assess substrate promiscuity indices as a tool to annotate new molecular functions with metabolic implications. PMID:25296650

  14. Molecular annotation of ketol-acid reductoisomerases from Streptomyces reveals a novel amino acid biosynthesis interlock mediated by enzyme promiscuity

    PubMed Central

    Verdel-Aranda, Karina; López-Cortina, Susana T; Hodgson, David A; Barona-Gómez, Francisco

    2015-01-01

    The 6-phosphogluconate dehydrogenase superfamily oxidize and reduce a wide range of substrates, making their functional annotation challenging. Ketol-acid reductoisomerase (KARI), encoded by the ilvC gene in branched-chain amino acids biosynthesis, is a promiscuous reductase enzyme within this superfamily. Here, we obtain steady-state enzyme kinetic parameters for 10 IlvC homologues from the genera Streptomyces and Corynebacterium, upon eight selected chemically diverse substrates, including some not normally recognized by enzymes of this superfamily. This biochemical data suggested a Streptomyces biosynthetic interlock between proline and the branched-chain amino acids, mediated by enzyme substrate promiscuity, which was confirmed via mutagenesis and complementation analyses of the proC, ilvC1 and ilvC2 genes in Streptomyces coelicolor. Moreover, both ilvC orthologues and paralogues were analysed, such that the relationship between gene duplication and functional diversification could be explored. The KARI paralogues present in S. coelicolor and Streptomyces lividans, despite their conserved high sequence identity (97%), were shown to be more promiscuous, suggesting a recent functional diversification. In contrast, the KARI paralogue from Streptomyces viridifaciens showed selectivity towards the synthesis of valine precursors, explaining its recruitment within the biosynthetic gene cluster of valanimycin. These results allowed us to assess substrate promiscuity indices as a tool to annotate new molecular functions with metabolic implications. PMID:25296650

  15. Nitrated fatty acids: Synthesis and measurement

    PubMed Central

    Woodcock, Steven R.; Bonacci, Gustavo; Gelhaus, Stacy L.; Schopfer, Francisco J.

    2012-01-01

    Nitrated fatty acids are the product of nitrogen dioxide reaction with unsaturated fatty acids. The discovery of peroxynitrite and peroxidase-induced nitration of biomolecules led to the initial reports of endogenous nitrated fatty acids. These species increase during ischemia reperfusion, but concentrations are often at or near the limits of detection. Here, we describe multiple methods for nitrated fatty acid synthesis, sample extraction from complex biological matrices, and a rigorous method of qualitative and quantitative detection of nitrated fatty acids by LC-MS. In addition, optimized instrument conditions and caveats regarding data interpretation are discussed. PMID:23200809

  16. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  17. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  18. Identification of RALDH2 as a Visually Regulated Retinoic Acid Synthesizing Enzyme in the Chick Choroid

    PubMed Central

    Hollaway, Lindsey R.; Lam, Wengtse; Li, Nan; Napoli, Joseph L.

    2012-01-01

    Purpose. All-trans-retinoic acid (atRA) has been implicated in the local regulation of scleral proteoglycan synthesis in vivo. The purpose of the present study was to identify the enzymes involved in the synthesis of atRA during visually guided ocular growth, the cells involved in modulation of atRA biosynthesis in the choroid, and the effect of choroid-derived atRA on scleral proteoglycan synthesis. Methods. Myopia was induced in White leghorn chicks by form deprivation for 10 days, followed by up to 15 days of unrestricted vision (recovery). Expression of atRA synthesizing enzymes was evaluated by semiquantitative qRT-PCR, in situ hybridization, and immunohistochemistry. atRA synthesis was measured in organ cultures of isolated choroids using LC-tandem MS quantification. Scleral proteoglycan synthesis was measured in vitro by the incorporation of 35SO4 in CPC-precipitable glycosaminoglycans. Results. RALDH2 was the predominant RALDH transcript in the choroid (>100-fold that of RALDH3). RALDH2 mRNA was elevated after 12 and 24 hours of recovery (60% and 188%, respectively; P < 0.01). The atRA concentration was significantly higher in cultures of choroids from 24-hour to 15-day recovering eyes than in paired controls (∼195%; P < 0.01). Choroid conditioned medium from recovering choroids inhibited proteoglycan synthesis to 43% of controls (P < 0.02, paired t-test; n = 16) and produced a relative inhibition corresponding to a RA concentration of 7.20 × 10−8 M. Conclusions. The results of this study suggest that RALDH2 is the major retinal dehydrogenase in the chick choroid and is responsible for increased atRA synthesis in response to myopic defocus. PMID:22323456

  19. Polyamines in the Synthesis of Bacteriophage Deoxyribonucleic Acid. I. Lack of Dependence of Polyamine Synthesis on Bacteriophage Deoxyribonucleic Acid Synthesis

    PubMed Central

    Dion, Arnold S.; Cohen, Seymour S.

    1972-01-01

    To determine whether polyamine synthesis is dependent on deoxyribonucleic acid (DNA) synthesis, polyamine levels were estimated after infection of bacterial cells with ultraviolet-irradiated T4 or T4 am N 122, a DNA-negative mutant. Although phage DNA accumulation was restricted to various degrees in comparison to cells infected with T4D, nearly commensurate levels of putrescine and spermidine synthesis were observed after infection, regardless of the rate of phage DNA synthesis. We conclude from these data that polyamine synthesis after infection is independent of phage DNA synthesis. PMID:4552549

  20. Enantioselective Total Synthesis of Secalonic Acid E.

    PubMed

    Ganapathy, Dhandapani; Reiner, Johannes R; Löffler, Lorenz E; Ma, Ling; Gnanaprakasam, Boopathy; Niepötter, Benedikt; Koehne, Ingo; Tietze, Lutz F

    2015-11-16

    The first enantioselective synthesis of a secalonic acid containing a dimeric tetrahydroxanthenone skeleton is described, using a Wacker-type cyclization of a methoxyphenolic compound to form a chiral chroman with a quaternary carbon stereogenic center with >99% ee. Further steps are a Sharpless dihydroxylation and a Dieckmann condensation to give a tetrahydroxanthenone. A late-stage one-pot palladium-catalyzed Suzuki-dimerization reaction leads to the 2,2'-biphenol linkage to complete the enantioselective total synthesis of secalonic acid E in 18 steps with 8% overall yield. PMID:26447631

  1. [Lipid synthesis by an acidic acid tolerant Rhodotorula glutinis].

    PubMed

    Lin, Zhangnan; Liu, Hongjuan; Zhang, Jian'an; Wang, Gehua

    2016-03-01

    Acetic acid, as a main by-product generated in the pretreatment process of lignocellulose hydrolysis, significantly affects cell growth and lipid synthesis of oleaginous microorganisms. Therefore, we studied the tolerance of Rhodotorula glutinis to acetic acid and its lipid synthesis from substrate containing acetic acid. In the mixed sugar medium containing 6 g/L glucose and 44 g/L xylose, and supplemented with acetic acid, the cell growth was not:inhibited when the acetic acid concentration was below 10 g/L. Compared with the control, the biomass, lipid concentration and lipid content of R. glutinis increased 21.5%, 171% and 122% respectively when acetic acid concentration was 10 g/L. Furthermore, R. glutinis could accumulate lipid with acetate as the sole carbon source. Lipid concentration and lipid yield reached 3.20 g/L and 13% respectively with the initial acetic acid concentration of 25 g/L. The lipid composition was analyzed by gas chromatograph. The main composition of lipid produced with acetic acid was palmitic acid, stearic acid, oleic acid, linoleic acid and linolenic acid, including 40.9% saturated fatty acids and 59.1% unsaturated fatty acids. The lipid composition was similar to that of plant oil, indicating that lipid from oleaginous yeast R. glutinis had potential as the feedstock of biodiesel production. These results demonstrated that a certain concentration of acetic acid need not to be removed in the detoxification process when using lignocelluloses hydrolysate to produce microbial lipid by R. glutinis. PMID:27349116

  2. The effect of linoleic acid on the whole body synthesis rates of polyunsaturated fatty acids from α-linolenic acid and linoleic acid in free-living rats.

    PubMed

    Domenichiello, Anthony F; Kitson, Alex P; Chen, Chuck T; Trépanier, Marc-Olivier; Stavro, P Mark; Bazinet, Richard P

    2016-04-01

    Docosahexaenoic acid (DHA) is thought to be important for brain function. The main dietary source of DHA is fish, however, DHA can also be synthesized from precursor omega-3 polyunsaturated fatty acids (n-3 PUFA), the most abundantly consumed being α-linolenic acid (ALA). The enzymes required to synthesize DHA from ALA are also used to synthesize longer chain omega-6 (n-6) PUFA from linoleic acid (LNA). The large increase in LNA consumption that has occurred over the last century has led to concern that LNA and other n-6 PUFA outcompete n-3 PUFA for enzymes involved in DHA synthesis, and therefore, decrease overall DHA synthesis. To assess this, rats were fed diets containing LNA at 53 (high LNA diet), 11 (medium LNA diet) or 1.5% (low LNA diet) of the fatty acids with ALA being constant across all diets (approximately 4% of the fatty acids). Rats were maintained on these diets from weaning for 8 weeks, at which point they were subjected to a steady-state infusion of labeled ALA and LNA to measure DHA and arachidonic acid (ARA) synthesis rates. DHA and ARA synthesis rates were generally highest in rats fed the medium and high LNA diets, while the plasma half-life of DHA was longer in rats fed the low LNA diet. Therefore, increasing dietary LNA, in rats, did not impair DHA synthesis; however, low dietary LNA led to a decrease in DHA synthesis with tissue concentrations of DHA possibly being maintained by a longer DHA half-life. PMID:27012633

  3. One-pot three-enzyme chemoenzymatic approach to the synthesis of sialosides containing natural and non-natural functionalities

    PubMed Central

    Yu, Hai; Chokhawala, Harshal; Huang, Shengshu; Chen, Xi

    2008-01-01

    Chemoenzymatic synthesis, which combines the flexibility of chemical synthesis and the highly selectivity of enzymatic synthesis, is a powerful approach to obtain complex carbohydrates. It is a preferred method for synthesizing sialic acid-containing structures, including those with diverse naturally occurring and non-natural sialic acid forms, different sialyl linkages, and different glycans that link to the sialic acid. Starting from N-acetylmannosamine, mannose, or their chemically or enzymatically modified derivatives, sialic acid aldolase-catalyzed condensation reaction leads to the formation of sialic acids and their derivatives. These compounds are subsequently activated by a CMP-sialic acid synthetase and transferred to a wide range of suitable acceptors by a suitable sialyltransferase for the formation of sialosides containing natural and non-natural functionalities. The three-enzyme coupled synthesis of sialosides can be carried out in one pot without the isolation of intermediates. The time for synthesis is 4–18 h. Purification and characterization of the product can be completed in 2–3 d. PMID:17406495

  4. Identification of enzyme activity that conjugates indole-3-acetic acid to aspartate in immature seeds of pea (Pisum sativum).

    PubMed

    Ostrowski, Maciej; Jakubowska, Anna

    2008-01-01

    This study describes the first identification of plant enzyme activity catalyzing the conjugation of indole-3-acetic acid to amino acids. Enzymatic synthesis of indole-3-acetylaspartate (IAA-Asp) by a crude enzyme preparation from immature seeds of pea (Pisum sativum) was observed. The reaction yielded a product with the same Rf as IAA-Asp standard after thin layer chromatography. The identity of IAA-Asp was verified by HPLC analysis. IAA-Asp formation was dependent on ATP and Mg2+, and was linear during a 60 min period. The enzyme preparation obtained after poly(ethylene glycol) 6000 fractionation showed optimum activity at pH 8.0, and the temperature optimum for IAA-Asp synthesis was 30 degrees C. PMID:17920159

  5. Synthesis of (+) and (-)-phaselic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    (2S)-Phaselic acid (2S-O-caffeoylmalate) is a common plant metabolite belonging to the o-diphenol subclass of phenolic secondary metabolites. Our interest in this metabolite stems from previous studies showing that the presence of (2S)-phaselic acid in red clover is crucial to the preservation of ut...

  6. Synthesis of (+)- and (-)-phaselic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    (2S)-Phaselic acid (2S-O-caffeoylmalate) is a common plant metabolite belonging to the o-diphenol subclass of phenolic secondary metabolites. Our interest in this metabolite stems from previous studies showing that the presence of (2S)-phaselic acid in red clover is crucial to the preservation of ut...

  7. Synthesis of pyromellitic acid esters

    NASA Technical Reports Server (NTRS)

    Fedorova, V. A.; Donchak, V. A.; Martynyuk-Lototskaya, A. N.

    1985-01-01

    The ester acids necessary for studyng the thermochemical properties of pyromellitic acid (PMK)-based peroxides were investigated. Obtaining a tetramethyl ester of a PMK was described. The mechanism of an esterification reaction is discussed, as is the complete esterification of PMK with primary alcohol.

  8. Synthesis of higher monocarboxylic acids

    SciTech Connect

    Taikov, B.F.; Novakovskii, E.M.; Zhelkovskaya, V.P.; Shadrova, V.N.; Shcherbik, P.K.

    1981-01-01

    Brown-coal and peat waxes contain higher monocarboxylic acids, alcohols and esters of them as their main components. In view of this, considerable interest is presented by the preparation of individual compounds among those mentioned above, which is particularly important in the study of the composition and development of the optimum variants of the chemical processing of the waxes. In laboratory practice, to obtain higher monocarboxylic acids use is generally made of electrosynthesis according to Kolbe which permits unbranched higher aliphatic acids with given lengths of the hydrocarbon chain to be obtained. The aim of the present work was to synthesize higher monocarboxylic acids: arachidic, behenic, lignoceric, pentacosanoic, erotic, heptacosanoic, montanic, nonacosanoic, melissic, dotriacontanoic and tetratriacontanoic, which are present in waxes. Characteristics of synthesized acids are tabulated. 20 refs.

  9. Synthesis of nucleic acid methylphosphonothioates.

    PubMed Central

    Roelen, H C; de Vroom, E; van der Marel, G A; van Boom, J H

    1988-01-01

    The reagent obtained in situ by treating methylphosphonothioic dichloride with 1-hydroxy-6-trifluoromethylbenzotriazole could be used for the introduction of methylphosphonothioate linkages. The individual diastereomers of the protected dimer d-Tp(S,Me)A were applied in the synthesis of the chiral pure (R or S) hexamers d-[CpCpTp(S,Me)ApGpG]. The reagent showed also to be very effective for the preparation of the 3',5'-cyclic methylphosphonothioate of uridine. PMID:3412896

  10. Fluorogenic Substrates for Visualizing Acidic Organelle Enzyme Activities.

    PubMed

    Harlan, Fiona Karen; Lusk, Jason Scott; Mohr, Breanna Michelle; Guzikowski, Anthony Peter; Batchelor, Robert Hardy; Jiang, Ying; Naleway, John Joseph

    2016-01-01

    Lysosomes are acidic cytoplasmic organelles that are present in all nucleated mammalian cells and are involved in a variety of cellular processes including repair of the plasma membrane, defense against pathogens, cholesterol homeostasis, bone remodeling, metabolism, apoptosis and cell signaling. Defects in lysosomal enzyme activity have been associated with a variety of neurological diseases including Parkinson's Disease, Lysosomal Storage Diseases, Alzheimer's disease and Huntington's disease. Fluorogenic lysosomal staining probes were synthesized for labeling lysosomes and other acidic organelles in a live-cell format and were shown to be capable of monitoring lysosomal metabolic activity. The new targeted substrates were prepared from fluorescent dyes having a low pKa value for optimum fluorescence at the lower physiological pH found in lysosomes. They were modified to contain targeting groups to direct their accumulation in lysosomes as well as enzyme-cleavable functions for monitoring specific enzyme activities using a live-cell staining format. Application to the staining of cells derived from blood and skin samples of patients with Metachromatic Leukodystrophy, Krabbe and Gaucher Diseases as well as healthy human fibroblast and leukocyte control cells exhibited localization to the lysosome when compared with known lysosomal stain LysoTracker® Red DND-99 as well as with anti-LAMP1 Antibody staining. When cell metabolism was inhibited with chloroquine, staining with an esterase substrate was reduced, demonstrating that the substrates can be used to measure cell metabolism. When applied to diseased cells, the intensity of staining was reflective of lysosomal enzyme levels found in diseased cells. Substrates specific to the enzyme deficiencies in Gaucher or Krabbe disease patient cell lines exhibited reduced staining compared to that in non-diseased cells. The new lysosome-targeted fluorogenic substrates should be useful for research, diagnostics and

  11. Fluorogenic Substrates for Visualizing Acidic Organelle Enzyme Activities

    PubMed Central

    Harlan, Fiona Karen; Lusk, Jason Scott; Mohr, Breanna Michelle; Guzikowski, Anthony Peter; Batchelor, Robert Hardy; Jiang, Ying

    2016-01-01

    Lysosomes are acidic cytoplasmic organelles that are present in all nucleated mammalian cells and are involved in a variety of cellular processes including repair of the plasma membrane, defense against pathogens, cholesterol homeostasis, bone remodeling, metabolism, apoptosis and cell signaling. Defects in lysosomal enzyme activity have been associated with a variety of neurological diseases including Parkinson’s Disease, Lysosomal Storage Diseases, Alzheimer's disease and Huntington's disease. Fluorogenic lysosomal staining probes were synthesized for labeling lysosomes and other acidic organelles in a live-cell format and were shown to be capable of monitoring lysosomal metabolic activity. The new targeted substrates were prepared from fluorescent dyes having a low pKa value for optimum fluorescence at the lower physiological pH found in lysosomes. They were modified to contain targeting groups to direct their accumulation in lysosomes as well as enzyme-cleavable functions for monitoring specific enzyme activities using a live-cell staining format. Application to the staining of cells derived from blood and skin samples of patients with Metachromatic Leukodystrophy, Krabbe and Gaucher Diseases as well as healthy human fibroblast and leukocyte control cells exhibited localization to the lysosome when compared with known lysosomal stain LysoTracker® Red DND-99 as well as with anti-LAMP1 Antibody staining. When cell metabolism was inhibited with chloroquine, staining with an esterase substrate was reduced, demonstrating that the substrates can be used to measure cell metabolism. When applied to diseased cells, the intensity of staining was reflective of lysosomal enzyme levels found in diseased cells. Substrates specific to the enzyme deficiencies in Gaucher or Krabbe disease patient cell lines exhibited reduced staining compared to that in non-diseased cells. The new lysosome-targeted fluorogenic substrates should be useful for research, diagnostics and

  12. Enzyme Regulation in Crassulacean Acid Metabolism Photosynthesis : Studies on Thioredoxin-Linked Enzymes of KalanchoE daigremontiana.

    PubMed

    Hutcheson, S W; Buchanan, B B

    1983-07-01

    Fructose-1,6-bisphosphatase (FBPase) and sedoheptulose-1,7-bisphosphatase (SBPase) were identified and purified from the Crassulacean acid metabolism (CAM) plant, Kalanchoë daigremontiana. FBPase and SBPase showed respective molecular weights of 180,000 and 76,000, and exhibited immunological cross-reactivity with their counterparts from chloroplasts of C(3) (spinach) and C(4) (corn) plants. Based on Western blot analysis, FBPase was composed of four identical 45,000-dalton subunits and SBPase of two identical 38,000-dalton subunits. Immunological evidence, together with physical properties, indicated that both enzymes were of chloroplast origin.Kalanchoë FBPase and SBPase could be activated by thioredoxin f reduced chemically by dithiothreitol or photochemically by a reconstituted Kalanchoë ferredoxin/thioredoxin system. Both enzymes were activated synergistically by reduced thioredoxin f and thier respective substrates.Kalanchoë FBPase could be partially activated by Mg(2+) at concentrations greater than 10 millimolar; however, such activation was considerably less than that observed in the presence of reduced thioredoxin and Ca(2+), especially in the pH range between 7.8 and 8.3. In contrast to FBPase, Kalanchoë SBPase exhibited an absolute requirement for a dithiol such as reduced thioredoxin irrespective of Mg(2+) concentration. However, like FBPase, increased Mg(2+) concentrations enhanced the thioredoxin-linked activation of this enzyme.In conjunction with these studies, an NADP-linked malate dehydrogenase (NADP-MDH) was identified in cell-free preparations of Kalanchoë leaves which required reduced thioredoxin m for activity.These results indicate that Kalanchoë FBPase, SBPase, and NADP-MDH share physical and regulatory properties with their equivalents in C(3) and C(4) plants. In contrast to previous evidence, all three enzymes appear to have the capacity to be photoregulated in chloroplasts of CAM plants, thereby providing a means for the

  13. Ammonium Metabolism Enzymes Aid Helicobacter pylori Acid Resistance

    PubMed Central

    Miller, Erica F.

    2014-01-01

    The gastric pathogen Helicobacter pylori possesses a highly active urease to support acid tolerance. Urea hydrolysis occurs inside the cytoplasm, resulting in the production of NH3 that is immediately protonated to form NH4+. This ammonium must be metabolized or effluxed because its presence within the cell is counterproductive to the goal of raising pH while maintaining a viable proton motive force (PMF). Two compatible hypotheses for mitigating intracellular ammonium toxicity include (i) the exit of protonated ammonium outward via the UreI permease, which was shown to facilitate diffusion of both urea and ammonium, and/or (ii) the assimilation of this ammonium, which is supported by evidence that H. pylori assimilates urea nitrogen into its amino acid pools. We investigated the second hypothesis by constructing strains with altered expression of the ammonium-assimilating enzymes glutamine synthetase (GS) and glutamate dehydrogenase (GDH) and the ammonium-evolving periplasmic enzymes glutaminase (Ggt) and asparaginase (AsnB). H. pylori strains expressing elevated levels of either GS or GDH are more acid tolerant than the wild type, exhibit enhanced ammonium production, and are able to alkalize the medium faster than the wild type. Strains lacking the genes for either Ggt or AsnB are acid sensitive, have 8-fold-lower urea-dependent ammonium production, and are more acid sensitive than the parent. Additionally, we found that purified H. pylori GS produces glutamine in the presence of Mg2+ at a rate similar to that of unadenylated Escherichia coli GS. These data reveal that all four enzymes contribute to whole-cell acid resistance in H. pylori and are likely important for assimilation and/or efflux of urea-derived ammonium. PMID:24936052

  14. Biotin and Lipoic Acid: Synthesis, Attachment, and Regulation.

    PubMed

    Cronan, John E

    2014-05-01

    Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as "swinging arms" that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like "arm" of biotin were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise, and the BioH esterase is responsible for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl acyl carrier protein of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyltransferase followed by sulfur insertion at carbons C-6 and C-8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized, and, thus, there is no transcriptional control of the synthetic genes. In contrast, transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system, exerted through BirA, a dual-function protein

  15. Biotin and Lipoic Acid: Synthesis, Attachment, and Regulation.

    PubMed

    Cronan, John E

    2008-09-01

    Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as "swinging arms" that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid was discovered 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway, in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like "arm" of biotin, were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise and the BioH esterase for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl-ACP of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyl transferase, followed by sulfur insertion at carbons C6 and C8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized, and thus there is no transcriptional control of the synthetic genes. In contrast, transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system exerted through BirA, a dual-function protein that both represses

  16. Biotin and Lipoic Acid: Synthesis, Attachment and Regulation

    PubMed Central

    Cronan, John E.

    2014-01-01

    Summary Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as “swinging arms” that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well-described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like “arm” of biotin were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise and the BioH esterase for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl-ACP of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyl transferase followed by sulfur insertion at carbons C6 and C8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized and thus there is no transcriptional control of the synthetic genes. In contrast transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system, exerted through BirA a dual function protein that both represses

  17. Genetic dissection of polyunsaturated fatty acid synthesis in Caenorhabditis elegans

    PubMed Central

    Watts, Jennifer L.; Browse, John

    2002-01-01

    Polyunsaturated fatty acids (PUFAs) are important membrane components and precursors of signaling molecules. To investigate the roles of these fatty acids in growth, development, and neurological function in an animal system, we isolated Caenorhabditis elegans mutants deficient in PUFA synthesis by direct analysis of fatty acid composition. C. elegans possesses all the desaturase and elongase activities to synthesize arachidonic acid and eicosapentaenoic acid from saturated fatty acid precursors. In our screen we identified mutants with defects in each fatty acid desaturation and elongation step of the PUFA biosynthetic pathway. The fatty acid compositions of the mutants reveal the substrate preferences of the desaturase and elongase enzymes and clearly demarcate the steps of this pathway. The mutants show that C. elegans does not require n3 or Δ5-unsaturated PUFAs for normal development under laboratory conditions. However, mutants with more severe PUFA deficiencies display growth and neurological defects. The mutants provide tools for investigating the roles of PUFAs in membrane biology and cell function in this animal model. PMID:11972048

  18. Parallel Chemoenzymatic Synthesis of Sialosides Containing a C5-Diversified Sialic Acid

    PubMed Central

    Cao, Hongzhi; Muthana, Saddam; Li, Yanhong; Cheng, Jiansong; Chen, Xi

    2009-01-01

    A convenient chemoenzymatic strategy for synthesizing sialosides containing a C5-diversified sialic acid was developed. The α2,3- and α2,6-linked sialosides containing a 5-azido neuraminic acid synthesized by a highly efficient one-pot three-enzyme approach were converted to C5″-amino sialosides, which were used as common intermediates for chemical parallel synthesis to quickly generate a series of sialosides containing various sialic acid forms. PMID:19740656

  19. Enzyme degradable polymersomes from hyaluronic acid-block-poly(ε-caprolactone) copolymers for the detection of enzymes of pathogenic bacteria.

    PubMed

    Haas, Simon; Hain, Nicole; Raoufi, Mohammad; Handschuh-Wang, Stephan; Wang, Tao; Jiang, Xin; Schönherr, Holger

    2015-03-01

    We introduce a new hyaluronidase-responsive amphiphilic block copolymer system, based on hyaluronic acid (HYA) and polycaprolactone (PCL), that can be assembled into polymersomes by an inversed solvent shift method. By exploiting the triggered release of encapsulated dye molecules, these HYA-block-PCL polymersomes lend themselves as an autonomous sensing system for the detection of the presence of hyaluronidase, which is produced among others by the pathogenic bacterium Staphylococcus aureus. The synthesis of the enzyme-responsive HYA-block-PCL block copolymers was carried out by copper-catalyzed Huisgen 1,3-dipolar cycloaddition of ω-azide-terminated PCL and ω-alkyne-functionalized HYA. The structure of the HYA-block-PCL assemblies and their enzyme-triggered degradation and concomitant cargo release were investigated by dynamic light scattering, fluorescence spectroscopy, confocal laser-scanning microscopy, scanning and transmission electron, and atomic force microscopy. As shown, a wide range of reporter dye molecules as well as antimicrobials can be encapsulated into the vesicles during formation and are released upon the addition of hyaluronidase. PMID:25654495

  20. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the snythesis methods of the prior art.

  1. Synthesis of Alkyl Methylphosphonic Acid Esters

    SciTech Connect

    Mong, Gary M.; Harvey, Scott D.; Campbell, James A.

    2005-08-01

    This manuscript describes a simple synthesis and purification of cyclohexyl methylphosphonic and isopropyl methylphosphonic acids that provides high purity (>95% purity) product in gram quantities. Based on needs for improved analytical methods for indirect detection of nerve agent use, there is an increasing demand for these nerve agent hydrolysis products. These products are not commercially available. Synthesis is based on reaction of equimolar amounts of alcohol with methylphosphonic dichloride in toluene followed by the addition of excess water (two mole equivalents). The product was then extracted from the resulting aqueous layer into chloroform. The extraction scheme proved highly effective in removing unreacted starting materials and reaction by-products.

  2. Transgenic Production of Epoxy Fatty Acids by Expression of a Cytochrome P450 Enzyme from Euphorbia lagascae Seed

    PubMed Central

    Cahoon, Edgar B.; Ripp, Kevin G.; Hall, Sarah E.; McGonigle, Brian

    2002-01-01

    Seed oils of a number of Asteraceae and Euphorbiaceae species are enriched in 12-epoxyoctadeca-cis-9-enoic acid (vernolic acid), an unusual 18-carbon Δ12-epoxy fatty acid with potential industrial value. It has been previously demonstrated that the epoxy group of vernolic acid is synthesized by the activity of a Δ12-oleic acid desaturase-like enzyme in seeds of the Asteraceae Crepis palaestina and Vernonia galamensis. In contrast, results from metabolic studies have suggested the involvement of a cytochrome P450 enzyme in vernolic acid synthesis in seeds of the Euphorbiaceae species Euphorbia lagascae. To clarify the biosynthetic origin of vernolic acid in E. lagascae seed, an expressed sequence tag analysis was conducted. Among 1,006 randomly sequenced cDNAs from developing E. lagascae seeds, two identical expressed sequence tags were identified that encode a cytochrome P450 enzyme classified as CYP726A1. Consistent with the seed-specific occurrence of vernolic acid in E. lagascae, mRNA corresponding to the CYP726A1 gene was abundant in developing seeds, but was not detected in leaves. In addition, expression of the E. lagascae CYP726A1 cDNA in Saccharomyces cerevisiae was accompanied by production of vernolic acid in cultures supplied with linoleic acid and an epoxy fatty acid tentatively identified as 12-epoxyoctadeca-9,15-dienoic acid (12-epoxy-18:2Δ9,15) in cultures supplied with α-linolenic acid. Consistent with this, expression of CYP726A1 in transgenic tobacco (Nicotiana tabacum) callus or somatic soybean (Glycine max) embryos resulted in the accumulation of vernolic acid and 12-epoxy-18:2Δ9,15. Overall, these results conclusively demonstrate that Asteraceae species and the Euphorbiaceae E. lagascae have evolved structurally unrelated enzymes to generate the Δ12-epoxy group of vernolic acid. PMID:11842164

  3. Chromatographic assay to study the activity of multiple enzymes involved in the synthesis and metabolism of dopamine and serotonin.

    PubMed

    Morgan, Lindsay D; Baker, Hannah; Yeoman, Mark S; Patel, Bhavik Anil

    2012-03-21

    Serotonin and dopamine are crucial regulators of signalling in the peripheral and central nervous systems. We present an ex-vivo, isocratic chromatographic method that allows for the measurement of tyrosine, L-3,4-dihydroxyphenylalanine (L-DOPA), dopamine, 3,4-dihydroxyphenylacetic acid (DOPAC), tryptophan, 5-hydroxytryptophan (5-HTP), serotonin and 5-hydroxy-3-indoleacetic acid (5-HIAA) in a model central nervous (CNS) system, to study the role of key enzymes involved in the synthesis and metabolism of serotonin and dopamine. By utilising a sample splitting technique, we could test a single CNS sample at multiple time points under various pharmacological treatments. In, addition, we were able to conduct this assay by utilising the endogenous biochemical components of the CNS to study the synthesis and metabolism of serotonin and dopamine, negating the requirement of additional enzyme activators or stabilisers in the biological matrix. Finally we utilised NSD-1015, an aromatic amino acid decarboxylase enzyme inhibitor used to study the synthesis of dopamine and serotonin to monitor alterations in levels of key neurochemicals. 3-hydroxybenzylhydrazine dihydrochloride (NSD-1015) was able to reduce levels of serotonin and dopamine, whilst elevating precursors L-DOPA and 5-HTP. PMID:22290325

  4. Synthesis and theoretical calculations of carbazole substituted chalcone urea derivatives and studies their polyphenol oxidase enzyme activity.

    PubMed

    Nixha, Arleta Rifati; Arslan, Mustafa; Atalay, Yusuf; Gençer, Nahit; Ergün, Adem; Arslan, Oktay

    2013-08-01

    Synthesis of carbazole substituted chalcone urea derivatives and their polyphenol oxidase enzyme activity effects on the diphenolase activity of banana tyrosinase were evaluated. Tyrosinase has been purified from banana on an affinity gel comprised of Sepharose 4B-L-tyrosine-p-aminobenzoic acid. The results showed that most of the compounds (3,4,5a,5d-h) inhibited and some of them (5c,5i-l) activated the tyrosinase enzyme activity. The molecular calculations were performed using Gaussian software for the synthesized compounds to explain the experimental results. PMID:22803668

  5. Synthesis of carbon-13-labeled tetradecanoic acids.

    PubMed

    Sparrow, J T; Patel, K M; Morrisett, J D

    1983-07-01

    The synthesis of tetradecanoic acid enriched with 13C at carbons 1, 3, or 6 is described. The label at the carbonyl carbon was introduced by treating 1-bromotridecane with K13CN (90% enriched) to form the 13C-labeled nitrile, which upon hydrolysis yielded the desired acid. The [3-13C]tetradecanoic acid was synthesized by alkylation of diethyl sodio-malonate with [1-13C]1-bromododecane; the acid was obtained upon saponification and decarboxylation. The label at the 6 position was introduced by coupling the appropriately labeled alkylcadmium chloride with the half acid chloride methyl ester of the appropriate dioic acid, giving the corresponding oxo fatty acid ester. Formation of the tosylhydrazone of the oxo-ester followed by reduction with sodium cyanoborohydride gave the labeled methyl tetradecanoate which, upon hydrolysis, yielded the desired tetradecanoic acid. All tetradecanoic acids were identical to unlabeled analogs as evaluated by gas-liquid chromatography and infrared or NMR spectroscopy. These labeled fatty acids were used subsequently to prepare the correspondingly labeled diacyl phosphatidylcholines. PMID:6631228

  6. Design and synthesis of phosphonoacetic acid (PPA) ester and amide bioisosters of ribofuranosylnucleoside diphosphates as potential ribonucleotide reductase inhibitors and evaluation of their enzyme inhibitory, cytostatic and antiviral activity.

    PubMed

    Manfredini, Stefano; Solaroli, Nicola; Angusti, Angela; Nalin, Federico; Durini, Elisa; Vertuani, Silvia; Pricl, Sabrina; Ferrone, Marco; Spadari, Silvio; Focher, Federico; Verri, Annalisa; De Clercq, Erik; Balzarini, Jan

    2003-07-01

    Continuing our investigations on inhibitors of ribonucleotide reductase (RNR), the crucial enzyme that catalyses the reduction of ribonucleotides to deoxyribonucleotides, we have now prepared and evaluated 5'-phosphonoacetic acid, amide and ester analogues of adenosine, uridine and cytidine with the aim to verify both substrate specificity and contribution to biological activity of diphosphate mimic moieties. A molecular modelling study has been conducted on the RNR R1 subunit, in order to verify the possible interaction of the proposed bioisosteric moieties. The study compounds were finally tested on the recombinant murine RNR showing a degree of inhibition that ranged from 350 microM for the UDP analogue 5'-deoxy-5'-N-(phosphon-acetyl)uridine sodium salt (amide) to 600 microM for the CDP analogue 5'-O-[(diethyl-phosphon)acetyl]cytidine (ester). None of the tested compounds displayed noteworthy cytostatic activity at 100-500 microM concentrations, whereas ADP analogue 5'-N-[(diethyl-phosphon) acetyl]adenosine (amide) and 5'-deoxy-5'-N-(phosphon-acetyl)adenosine sodium salt (amide) showed a moderate inhibitory activity (EC50: 48 microM) against HSV-2 and a modest inhibitory activity (EC50: 110 microM) against HIV-1, respectively. PMID:14582847

  7. Role of antioxidant enzymes in bacterial resistance to organic acids.

    PubMed

    Bruno-Bárcena, Jose M; Azcárate-Peril, M Andrea; Hassan, Hosni M

    2010-05-01

    Growth in aerobic environments has been shown to generate reactive oxygen species (ROS) and to cause oxidative stress in most organisms. Antioxidant enzymes (i.e., superoxide dismutases and hydroperoxidases) and DNA repair mechanisms provide protection against ROS. Acid stress has been shown to be associated with the induction of Mn superoxide dismutase (MnSOD) in Lactococcus lactis and Staphylococcus aureus. However, the relationship between acid stress and oxidative stress is not well understood. In the present study, we showed that mutations in the gene coding for MnSOD (sodA) increased the toxicity of lactic acid at pH 3.5 in Streptococcus thermophilus. The inclusion of the iron chelators 2,2'-dipyridyl (DIP), diethienetriamine-pentaacetic acid (DTPA), and O-phenanthroline (O-Phe) provided partial protection against 330 mM lactic acid at pH 3.5. The results suggested that acid stress triggers an iron-mediated oxidative stress that can be ameliorated by MnSOD and iron chelators. These findings were further validated in Escherichia coli strains lacking both MnSOD and iron SOD (FeSOD) but expressing a heterologous MnSOD from S. thermophilus. We also found that, in E. coli, FeSOD did not provide the same protection afforded by MnSOD and that hydroperoxidases are equally important in protecting the cells against acid stress. These findings may explain the ability of some microorganisms to survive better in acidified environments, as in acid foods, during fermentation and accumulation of lactic acid or during passage through the low pH of the stomach. PMID:20305033

  8. Synthesis of alpha-amino acids

    DOEpatents

    Davis, J.W. Jr.

    1983-01-25

    A method is described for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R[sub 1]R[sub 2]C(OSOCl)CN, R[sub 1]R[sub 2]C(Cl)CN and [R[sub 1]R[sub 2]C(CN)O][sub 2]SO wherein R[sub 1] and R[sub 2] are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art. No Drawings

  9. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  10. Adapting capillary gel electrophoresis as a sensitive, high-throughput method to accelerate characterization of nucleic acid metabolic enzymes

    PubMed Central

    Greenough, Lucia; Schermerhorn, Kelly M.; Mazzola, Laurie; Bybee, Joanna; Rivizzigno, Danielle; Cantin, Elizabeth; Slatko, Barton E.; Gardner, Andrew F.

    2016-01-01

    Detailed biochemical characterization of nucleic acid enzymes is fundamental to understanding nucleic acid metabolism, genome replication and repair. We report the development of a rapid, high-throughput fluorescence capillary gel electrophoresis method as an alternative to traditional polyacrylamide gel electrophoresis to characterize nucleic acid metabolic enzymes. The principles of assay design described here can be applied to nearly any enzyme system that acts on a fluorescently labeled oligonucleotide substrate. Herein, we describe several assays using this core capillary gel electrophoresis methodology to accelerate study of nucleic acid enzymes. First, assays were designed to examine DNA polymerase activities including nucleotide incorporation kinetics, strand displacement synthesis and 3′-5′ exonuclease activity. Next, DNA repair activities of DNA ligase, flap endonuclease and RNase H2 were monitored. In addition, a multicolor assay that uses four different fluorescently labeled substrates in a single reaction was implemented to characterize GAN nuclease specificity. Finally, a dual-color fluorescence assay to monitor coupled enzyme reactions during Okazaki fragment maturation is described. These assays serve as a template to guide further technical development for enzyme characterization or nucleoside and non-nucleoside inhibitor screening in a high-throughput manner. PMID:26365239

  11. Synthesis and evaluation of colletoic acid core derivatives.

    PubMed

    Ling, Taotao; Gautam, Lekh Nath; Griffith, Elizabeth; Das, Sourav; Lang, Walter; Shadrick, William R; Shelat, Anang; Lee, Richard; Rivas, Fatima

    2016-03-01

    Cortisol homeostasis has been linked to the pathogenesis of metabolic syndrome (MetS), since it stimulates hepatic gluconeogenesis and adipogenesis. MetS is classified as a constellation of health conditions that increase the risk of type 2 diabetes and cardiovascular disease. Intracellular cortisol levels are regulated by 11β-hydroxysteroid dehydrogenase (type 1 and type 2) in a tissue dependent manner. The type 1 enzyme (11β-HSD1) is widely expressed in glucocorticoid targeted tissues and is responsible for the conversion of cortisone to the active cortisol. Local reduction of cortisol regeneration presents a potential strategy for MetS treatment. Recently we disclosed the total synthesis of (+)-colletoic acid as a potent 11β-HSD1 inhibitor. Herein, we describe our improved processing chemistry for the synthesis of the colletoic acid core to access a diverse number of derivatives for evaluation against 11β-HSD1. The Evan's chiral auxiliary was utilized to construct the acyclic precursor 12 to afford the acorane core 9 using a modified Heck reaction in excellent chemical yields. The colletoic acid core derivatives showed modest activity against 11β-HSD1 and will serve for further biological evaluation. PMID:26820555

  12. Increased fatty acid unsaturation and production of arachidonic acid by homologous over-expression of the mitochondrial malic enzyme in Mortierella alpina

    PubMed Central

    Hao, Guangfei; Du, Kai; Huang, Xiaoyun; Song, Yuanda; Gu, Zhennan; Wang, Lei; Zhang, Hao; Chen, Wei; Chen, Yong Q.

    2015-01-01

    Malic enzyme (ME) catalyses the oxidative decarboxylation of L-malate to pyruvate and provides NADPH for intracellular metabolism, such as fatty acid synthesis. Here, the mitochondrial ME (mME) gene from Mortierella alpina was homologously over-expressed. Compared with controls, fungal arachidonic acid (ARA; 20:4 n-6) content increased by 60 % without affecting the total fatty acid content. Our results suggest that enhancing mME activity may be an effective mean to increase industrial production of ARA in M. alpina. PMID:24863290

  13. Carboxylic acid reductase is a versatile enzyme for the conversion of fatty acids into fuels and chemical commodities.

    PubMed

    Akhtar, M Kalim; Turner, Nicholas J; Jones, Patrik R

    2013-01-01

    Aliphatic hydrocarbons such as fatty alcohols and petroleum-derived alkanes have numerous applications in the chemical industry. In recent years, the renewable synthesis of aliphatic hydrocarbons has been made possible by engineering microbes to overaccumulate fatty acids. However, to generate end products with the desired physicochemical properties (e.g., fatty aldehydes, alkanes, and alcohols), further conversion of the fatty acid is necessary. A carboxylic acid reductase (CAR) from Mycobacterium marinum was found to convert a wide range of aliphatic fatty acids (C(6)-C(18)) into corresponding aldehydes. Together with the broad-substrate specificity of an aldehyde reductase or an aldehyde decarbonylase, the catalytic conversion of fatty acids to fatty alcohols (C(8)-C(16)) or fatty alkanes (C(7)-C(15)) was reconstituted in vitro. This concept was applied in vivo, in combination with a chain-length-specific thioesterase, to engineer Escherichia coli BL21(DE3) strains that were capable of synthesizing fatty alcohols and alkanes. A fatty alcohol titer exceeding 350 mg·L(-1) was obtained in minimal media supplemented with glucose. Moreover, by combining the CAR-dependent pathway with an exogenous fatty acid-generating lipase, natural oils (coconut oil, palm oil, and algal oil bodies) were enzymatically converted into fatty alcohols across a broad chain-length range (C(8)-C(18)). Together with complementing enzymes, the broad substrate specificity and kinetic characteristics of CAR opens the road for direct and tailored enzyme-catalyzed conversion of lipids into user-ready chemical commodities. PMID:23248280

  14. Carboxylic acid reductase is a versatile enzyme for the conversion of fatty acids into fuels and chemical commodities

    PubMed Central

    Akhtar, M. Kalim; Turner, Nicholas J.; Jones, Patrik R.

    2013-01-01

    Aliphatic hydrocarbons such as fatty alcohols and petroleum-derived alkanes have numerous applications in the chemical industry. In recent years, the renewable synthesis of aliphatic hydrocarbons has been made possible by engineering microbes to overaccumulate fatty acids. However, to generate end products with the desired physicochemical properties (e.g., fatty aldehydes, alkanes, and alcohols), further conversion of the fatty acid is necessary. A carboxylic acid reductase (CAR) from Mycobacterium marinum was found to convert a wide range of aliphatic fatty acids (C6–C18) into corresponding aldehydes. Together with the broad-substrate specificity of an aldehyde reductase or an aldehyde decarbonylase, the catalytic conversion of fatty acids to fatty alcohols (C8–C16) or fatty alkanes (C7–C15) was reconstituted in vitro. This concept was applied in vivo, in combination with a chain-length-specific thioesterase, to engineer Escherichia coli BL21(DE3) strains that were capable of synthesizing fatty alcohols and alkanes. A fatty alcohol titer exceeding 350 mg·L−1 was obtained in minimal media supplemented with glucose. Moreover, by combining the CAR-dependent pathway with an exogenous fatty acid-generating lipase, natural oils (coconut oil, palm oil, and algal oil bodies) were enzymatically converted into fatty alcohols across a broad chain-length range (C8–C18). Together with complementing enzymes, the broad substrate specificity and kinetic characteristics of CAR opens the road for direct and tailored enzyme-catalyzed conversion of lipids into user-ready chemical commodities. PMID:23248280

  15. Oxidation of indole-3-acetic acid to oxindole-3-acetic acid by an enzyme preparation from Zea mays

    NASA Technical Reports Server (NTRS)

    Reinecke, D. M.; Bandurski, R. S.

    1988-01-01

    Indole-3-acetic acid is oxidized to oxindole-3-acetic acid by Zea mays tissue extracts. Shoot, root, and endosperm tissues have enzyme activities of 1 to 10 picomoles per hour per milligram protein. The enzyme is heat labile, is soluble, and requires oxygen for activity. Cofactors of mixed function oxygenase, peroxidase, and intermolecular dioxygenase are not stimulatory to enzymic activity. A heat-stable, detergent-extractable component from corn enhances enzyme activity 6- to 10-fold. This is the first demonstration of the in vitro enzymic oxidation of indole-3-acetic acid to oxindole-3-acetic acid in higher plants.

  16. Akt phosphorylation and regulation of transketolase is a nodal point for amino acid control of purine synthesis.

    PubMed

    Saha, Arindam; Connelly, Stephen; Jiang, Jingjing; Zhuang, Shunhui; Amador, Deron T; Phan, Tony; Pilz, Renate B; Boss, Gerry R

    2014-07-17

    The phosphatidylinositol 3-kinase (PI3K)/Akt pathway integrates environmental clues to regulate cell growth and survival. We showed previously that depriving cells of a single essential amino acid rapidly and reversibly arrests purine synthesis. Here we demonstrate that amino acids via mammalian target of rapamycin 2 and IκB kinase regulate Akt activity and Akt association and phosphorylation of transketolase (TKT), a key enzyme of the nonoxidative pentose phosphate pathway (PPP). Akt phosphorylates TKT on Thr382, markedly enhancing enzyme activity and increasing carbon flow through the nonoxidative PPP, thereby increasing purine synthesis. Mice fed a lysine-deficient diet for 2 days show decreased Akt activity, TKT activity, and purine synthesis in multiple organs. These results provide a mechanism whereby Akt coordinates amino acid availability with glucose utilization, purine synthesis, and RNA and DNA synthesis. PMID:24981175

  17. The biosynthetic gene cluster for coronamic acid, an ethylcyclopropyl amino acid, contains genes homologous to amino acid-activating enzymes and thioesterases.

    PubMed Central

    Ullrich, M; Bender, C L

    1994-01-01

    Coronamic acid (CMA), an ethylcyclopropyl amino acid derived from isoleucine, functions as an intermediate in the biosynthesis of coronatine, a chlorosis-inducing phytotoxin produced by Pseudomonas syringae pv. glycinea PG4180. The DNA required for CMA biosynthesis (6.9 kb) was sequenced, revealing three distinct open reading frames (ORFs) which share a common orientation for transcription. The deduced amino acid sequence of a 2.7-kb ORF designated cmaA contained six core sequences and two conserved motifs which are present in a variety of amino acid-activating enzymes, including nonribosomal peptide synthetases. Furthermore, CmaA contained a spatial arrangement of histidine, aspartate, and arginine residues which are conserved in the ferrous active site of some nonheme iron(II) enzymes which catalyze oxidative cyclizations. The deduced amino acid sequence of a 1.2-kb ORF designated cmaT was related to thioesterases of both procaryotic and eucaryotic origins. These data suggest that CMA assembly is similar to the thiotemplate mechanism of nonribosomal peptide synthesis. No significant similarities between a 0.9-kb ORF designated cmaU and other database entries were found. The start sites of two transcripts required for CMA biosynthesis were identified in the present study. pRG960sd, a vector containing a promoterless glucuronidase gene, was used to localize and study the promoter regions upstream of the two transcripts. Data obtained in the present study indicate that CMA biosynthesis is regulated at the transcriptional level by temperature. Images PMID:8002582

  18. Characterization of the branched-chain amino acid aminotransferase enzyme family in tomato.

    PubMed

    Maloney, Gregory S; Kochevenko, Andrej; Tieman, Denise M; Tohge, Takayuki; Krieger, Uri; Zamir, Dani; Taylor, Mark G; Fernie, Alisdair R; Klee, Harry J

    2010-07-01

    Branched-chain amino acids (BCAAs) are synthesized in plants from branched-chain keto acids, but their metabolism is not completely understood. The interface of BCAA metabolism lies with branched-chain aminotransferases (BCAT) that catalyze both the last anabolic step and the first catabolic step. In this study, six BCAT genes from the cultivated tomato (Solanum lycopersicum) were identified and characterized. SlBCAT1, -2, -3, and -4 are expressed in multiple plant tissues, while SlBCAT5 and -6 were undetectable. SlBCAT1 and -2 are located in the mitochondria, SlBCAT3 and -4 are located in chloroplasts, while SlBCAT5 and -6 are located in the cytosol and vacuole, respectively. SlBCAT1, -2, -3, and -4 were able to restore growth of Escherichia coli BCAA auxotrophic cells, but SlBCAT1 and -2 were less effective than SlBCAT3 and -4 in growth restoration. All enzymes were active in the forward (BCAA synthesis) and reverse (branched-chain keto acid synthesis) reactions. SlBCAT3 and -4 exhibited a preference for the forward reaction, while SlBCAT1 and -2 were more active in the reverse reaction. While overexpression of SlBCAT1 or -3 in tomato fruit did not significantly alter amino acid levels, an expression quantitative trait locus on chromosome 3, associated with substantially higher expression of Solanum pennellii BCAT4, did significantly increase BCAA levels. Conversely, antisense-mediated reduction of SlBCAT1 resulted in higher levels of BCAAs. Together, these results support a model in which the mitochondrial SlBCAT1 and -2 function in BCAA catabolism while the chloroplastic SlBCAT3 and -4 function in BCAA synthesis. PMID:20435740

  19. Combinatorial Effects of Fatty Acid Elongase Enzymes on Nervonic Acid Production in Camelina sativa

    PubMed Central

    Huai, Dongxin; Zhang, Yuanyuan; Zhang, Chunyu; Cahoon, Edgar B.; Zhou, Yongming

    2015-01-01

    Very long chain fatty acids (VLCFAs) with chain lengths of 20 carbons and longer provide feedstocks for various applications; therefore, improvement of VLCFA contents in seeds has become an important goal for oilseed enhancement. VLCFA biosynthesis is controlled by a multi-enzyme protein complex referred to as fatty acid elongase, which is composed of β-ketoacyl-CoA synthase (KCS), β-ketoacyl-CoA reductase (KCR), β-hydroxyacyl-CoA dehydratase (HCD) and enoyl reductase (ECR). KCS has been identified as the rate-limiting enzyme, but little is known about the involvement of other three enzymes in VLCFA production. Here, the combinatorial effects of fatty acid elongase enzymes on VLCFA production were assessed by evaluating the changes in nervonic acid content. A KCS gene from Lunaria annua (LaKCS) and the other three elongase genes from Arabidopsis thaliana were used for the assessment. Five seed-specific expressing constructs, including LaKCS alone, LaKCS with AtKCR, LaKCS with AtHCD, LaKCS with AtECR, and LaKCS with AtKCR and AtHCD, were transformed into Camelina sativa. The nervonic acid content in seed oil increased from null in wild type camelina to 6-12% in LaKCS-expressing lines. However, compared with that from the LaKCS-expressing lines, nervonic acid content in mature seeds from the co-expressing lines with one or two extra elongase genes did not show further increases. Nervonic acid content from LaKCS, AtKCR and AtHCD co-expressing line was significantly higher than that in LaKCS-expressing line during early seed development stage, while the ultimate nervonic acid content was not significantly altered. The results from this study thus provide useful information for future engineering of oilseed crops for higher VLCFA production. PMID:26121034

  20. Combinatorial Effects of Fatty Acid Elongase Enzymes on Nervonic Acid Production in Camelina sativa.

    PubMed

    Huai, Dongxin; Zhang, Yuanyuan; Zhang, Chunyu; Cahoon, Edgar B; Zhou, Yongming

    2015-01-01

    Very long chain fatty acids (VLCFAs) with chain lengths of 20 carbons and longer provide feedstocks for various applications; therefore, improvement of VLCFA contents in seeds has become an important goal for oilseed enhancement. VLCFA biosynthesis is controlled by a multi-enzyme protein complex referred to as fatty acid elongase, which is composed of β-ketoacyl-CoA synthase (KCS), β-ketoacyl-CoA reductase (KCR), β-hydroxyacyl-CoA dehydratase (HCD) and enoyl reductase (ECR). KCS has been identified as the rate-limiting enzyme, but little is known about the involvement of other three enzymes in VLCFA production. Here, the combinatorial effects of fatty acid elongase enzymes on VLCFA production were assessed by evaluating the changes in nervonic acid content. A KCS gene from Lunaria annua (LaKCS) and the other three elongase genes from Arabidopsis thaliana were used for the assessment. Five seed-specific expressing constructs, including LaKCS alone, LaKCS with AtKCR, LaKCS with AtHCD, LaKCS with AtECR, and LaKCS with AtKCR and AtHCD, were transformed into Camelina sativa. The nervonic acid content in seed oil increased from null in wild type camelina to 6-12% in LaKCS-expressing lines. However, compared with that from the LaKCS-expressing lines, nervonic acid content in mature seeds from the co-expressing lines with one or two extra elongase genes did not show further increases. Nervonic acid content from LaKCS, AtKCR and AtHCD co-expressing line was significantly higher than that in LaKCS-expressing line during early seed development stage, while the ultimate nervonic acid content was not significantly altered. The results from this study thus provide useful information for future engineering of oilseed crops for higher VLCFA production. PMID:26121034

  1. Identification and Functional Analysis of Delta-9 Desaturase, a Key Enzyme in PUFA Synthesis, Isolated from the Oleaginous Diatom Fistulifera

    PubMed Central

    Muto, Masaki; Kubota, Chihiro; Tanaka, Masayoshi; Satoh, Akira; Matsumoto, Mitsufumi; Yoshino, Tomoko; Tanaka, Tsuyoshi

    2013-01-01

    Oleaginous microalgae are one of the promising resource of nonedible biodiesel fuel (BDF) feed stock alternatives. Now a challenge task is the decrease of the long-chain polyunsaturated fatty acids (PUFAs) content affecting on the BDF oxidative stability by using gene manipulation techniques. However, only the limited knowledge has been available concerning the fatty acid and PUFA synthesis pathways in microalgae. Especially, the function of Δ9 desaturase, which is a key enzyme in PUFA synthesis pathway, has not been determined in diatom. In this study, 4 Δ9 desaturase genes (fD9desA, fD9desB, fD9desC and fD9desD) from the oleaginous diatom Fistulifera were newly isolated and functionally characterized. The putative Δ9 acyl-CoA desaturases in the endoplasmic reticulum (ER) showed 3 histidine clusters that are well-conserved motifs in the typical Δ9 desaturase. Furthermore, the function of these Δ9 desaturases was confirmed in the Saccharomyces cerevisiae ole1 gene deletion mutant (Δole1). All the putative Δ9 acyl-CoA desaturases showed Δ9 desaturation activity for C16∶0 fatty acids; fD9desA and fD9desB also showed desaturation activity for C18∶0 fatty acids. This study represents the first functional analysis of Δ9 desaturases from oleaginous microalgae and from diatoms as the first enzyme to introduce a double bond in saturated fatty acids during PUFA synthesis. The findings will provide beneficial insights into applying metabolic engineering processes to suppressing PUFA synthesis in this oleaginous microalgal strain. PMID:24039966

  2. Decreased hepatotoxic bile acid composition and altered synthesis in progressive human nonalcoholic fatty liver disease

    SciTech Connect

    Lake, April D.; Novak, Petr; Shipkova, Petia; Aranibar, Nelly; Robertson, Donald; Reily, Michael D.; Lu, Zhenqiang; Lehman-McKeeman, Lois D.; Cherrington, Nathan J.

    2013-04-15

    Bile acids (BAs) have many physiological roles and exhibit both toxic and protective influences within the liver. Alterations in the BA profile may be the result of disease induced liver injury. Nonalcoholic fatty liver disease (NAFLD) is a prevalent form of chronic liver disease characterized by the pathophysiological progression from simple steatosis to nonalcoholic steatohepatitis (NASH). The hypothesis of this study is that the ‘classical’ (neutral) and ‘alternative’ (acidic) BA synthesis pathways are altered together with hepatic BA composition during progression of human NAFLD. This study employed the use of transcriptomic and metabolomic assays to study the hepatic toxicologic BA profile in progressive human NAFLD. Individual human liver samples diagnosed as normal, steatosis, and NASH were utilized in the assays. The transcriptomic analysis of 70 BA genes revealed an enrichment of downregulated BA metabolism and transcription factor/receptor genes in livers diagnosed as NASH. Increased mRNA expression of BAAT and CYP7B1 was observed in contrast to decreased CYP8B1 expression in NASH samples. The BA metabolomic profile of NASH livers exhibited an increase in taurine together with elevated levels of conjugated BA species, taurocholic acid (TCA) and taurodeoxycholic acid (TDCA). Conversely, cholic acid (CA) and glycodeoxycholic acid (GDCA) were decreased in NASH liver. These findings reveal a potential shift toward the alternative pathway of BA synthesis during NASH, mediated by increased mRNA and protein expression of CYP7B1. Overall, the transcriptomic changes of BA synthesis pathway enzymes together with altered hepatic BA composition signify an attempt by the liver to reduce hepatotoxicity during disease progression to NASH. - Highlights: ► Altered hepatic bile acid composition is observed in progressive NAFLD. ► Bile acid synthesis enzymes are transcriptionally altered in NASH livers. ► Increased levels of taurine and conjugated bile acids

  3. The synthesis of starch from carbon dioxide using isolubilized stabilized enzymes

    NASA Technical Reports Server (NTRS)

    Bassham, J. A.; Bearden, L.; Wilke, C.; Carroad, P.; Mitra, G.; Ige, R.

    1972-01-01

    Systems for artificial manufacture of starch and for delineation of technological areas, and the rationale for studying them are considered. A discussion of the enzyme-catalyzed routes of synthesis available and a choice as to the most promising route are presented. A discussion of the enzymes involved, of enzyme insolubilization technology, and of possible engineering approaches, with examples in the form of model calculations for both reactors and separators, are also presented.

  4. Synthesis and scavenging role of furan fatty acids

    PubMed Central

    Lemke, Rachelle A. S.; Peterson, Amelia C.; Ziegelhoffer, Eva C.; Westphall, Michael S.; Tjellström, Henrik; Coon, Joshua J.; Donohue, Timothy J.

    2014-01-01

    Fatty acids play important functional and protective roles in living systems. This paper reports on the synthesis of a previously unidentified 19 carbon furan-containing fatty acid, 10,13-epoxy-11-methyl-octadecadienoate (9-(3-methyl-5-pentylfuran-2-yl)nonanoic acid) (19Fu-FA), in phospholipids from Rhodobacter sphaeroides. We show that 19Fu-FA accumulation is increased in cells containing mutations that increase the transcriptional response of this bacterium to singlet oxygen (1O2), a reactive oxygen species generated by energy transfer from one or more light-excited donors to molecular oxygen. We identify a previously undescribed class of S-adenosylmethionine-dependent methylases that convert a phospholipid 18 carbon cis unsaturated fatty acyl chain to a 19 carbon methylated trans unsaturated fatty acyl chain (19M-UFA). We also identify genes required for the O2-dependent conversion of this 19M-UFA to 19Fu-FA. Finally, we show that the presence of 1O2 leads to turnover of 19Fu-Fa in vivo. We propose that furan-containing fatty acids like 19Fu-FA can act as a membrane-bound scavenger of 1O2, which is naturally produced by integral membrane enzymes of the R. sphaeroides photosynthetic apparatus. PMID:25092314

  5. Increased Biomass Yield of Lactococcus lactis by Reduced Overconsumption of Amino Acids and Increased Catalytic Activities of Enzymes

    PubMed Central

    Adamberg, Kaarel; Seiman, Andrus; Vilu, Raivo

    2012-01-01

    Steady state cultivation and multidimensional data analysis (metabolic fluxes, absolute proteome, and transcriptome) are used to identify parameters that control the increase in biomass yield of Lactococcus lactis from 0.10 to 0.12 C-mol C-mol−1 with an increase in specific growth rate by 5 times from 0.1 to 0.5 h−1. Reorganization of amino acid consumption was expressed by the inactivation of the arginine deiminase pathway at a specific growth rate of 0.35 h−1 followed by reduced over-consumption of pyruvate directed amino acids (asparagine, serine, threonine, alanine and cysteine) until almost all consumed amino acids were used only for protein synthesis at maximal specific growth rate. This balanced growth was characterized by a high glycolytic flux carrying up to 87% of the carbon flow and only amino acids that relate to nucleotide synthesis (glutamine, serine and asparagine) were consumed in higher amounts than required for cellular protein synthesis. Changes in the proteome were minor (mainly increase in the translation apparatus). Instead, the apparent catalytic activities of enzymes and ribosomes increased by 3.5 times (0.1 vs 0.5 h−1). The apparent catalytic activities of glycolytic enzymes and ribosomal proteins were seen to follow this regulation pattern while those of enzymes involved in nucleotide metabolism increased more than the specific growth rate (over 5.5 times). Nucleotide synthesis formed the most abundant biomonomer synthetic pathway in the cells with an expenditure of 6% from the total ATP required for biosynthesis. Due to the increase in apparent catalytic activity, ribosome translation was more efficient at higher growth rates as evidenced by a decrease of protein to mRNA ratios. All these effects resulted in a 30% decrease of calculated ATP spilling (0.1 vs 0.5 h−1). Our results show that bioprocesses can be made more efficient (using a balanced metabolism) by varying the growth conditions. PMID:23133574

  6. Potency of individual bile acids to regulate bile acid synthesis and transport genes in primary human hepatocyte cultures.

    PubMed

    Liu, Jie; Lu, Hong; Lu, Yuan-Fu; Lei, Xiaohong; Cui, Julia Yue; Ellis, Ewa; Strom, Stephen C; Klaassen, Curtis D

    2014-10-01

    Bile acids (BAs) are known to regulate their own homeostasis, but the potency of individual bile acids is not known. This study examined the effects of cholic acid (CA), chenodeoxycholic acid (CDCA), deoxycholic acid (DCA), lithocholic acid (LCA) and ursodeoxycholic acid (UDCA) on expression of BA synthesis and transport genes in human primary hepatocyte cultures. Hepatocytes were treated with the individual BAs at 10, 30, and 100μM for 48 h, and RNA was extracted for real-time PCR analysis. For the classic pathway of BA synthesis, BAs except for UDCA markedly suppressed CYP7A1 (70-95%), the rate-limiting enzyme of bile acid synthesis, but only moderately (35%) down-regulated CYP8B1 at a high concentration of 100μM. BAs had minimal effects on mRNA of two enzymes of the alternative pathway of BA synthesis, namely CYP27A1 and CYP7B1. BAs increased the two major target genes of the farnesoid X receptor (FXR), namely the small heterodimer partner (SHP) by fourfold, and markedly induced fibroblast growth factor 19 (FGF19) over 100-fold. The BA uptake transporter Na(+)-taurocholate co-transporting polypeptide was unaffected, whereas the efflux transporter bile salt export pump was increased 15-fold and OSTα/β were increased 10-100-fold by BAs. The expression of the organic anion transporting polypeptide 1B3 (OATP1B3; sixfold), ATP-binding cassette (ABC) transporter G5 (ABCG5; sixfold), multidrug associated protein-2 (MRP2; twofold), and MRP3 (threefold) were also increased, albeit to lesser degrees. In general, CDCA was the most potent and effective BA in regulating these genes important for BA homeostasis, whereas DCA and CA were intermediate, LCA the least, and UDCA ineffective. PMID:25055961

  7. Enzymes of 2-oxo acid degradation and biosynthesis in cell-free extracts of mixed rumen micro-organisms.

    PubMed Central

    Bush, R S; Sauer, F D

    1976-01-01

    The enzymes of 2-oxo acid decarboxylation and 2-oxo acid synthesis (EC 1.2.7.1 and EC 1.2.7.2) were isolated and partially purified from cell-free extracts of rumen micro-organisms. The lyase was active with pyruvate, 3-hydroxypyruvate and 2-oxobutyrate. The synthase was active with acetate, 2-oxoglutarate or succinate. Pyruvate synthase was separated from pyruvate lyase by Sephadex G-200 gel filtration. With Sephadex filtration, approximate mol.wts. of 310000 and 210000 were determined for pyruvate lyase and pyruvate synthase respectively. Images PLATE 1 PMID:962871

  8. Chemical Synthesis of a Hyaluronic Acid Decasaccharide

    PubMed Central

    Lu, Xiaowei; Kamat, Medha N.; Huang, Lijun; Huang, Xuefei

    2009-01-01

    The chemical synthesis of a hyaluronic acid decasaccharide using the pre-activation based chemoselective glycosylation strategy is described. Assembly of large oligosaccharides is generally challenging due to the increased difficulties in both glycosylation and deprotection. Indeed, the same building blocks previously employed for hyaluronic acid hexasaccharide syntheses failed to yield the desired decasaccharide. After extensive experimentation, the decasaccharide backbone was successfully constructed with an overall yield of 37% from disaccharide building blocks. The trichloroacetyl group was used as the nitrogen protective group for the glucosamine units and the addition of TMSOTf was found to be crucial to suppress the formation of trichloromethyl oxazoline side-product and enable high glycosylation yield. For deprotections, the combination of a mild basic condition and the monitoring methodology using 1H-NMR allowed the removal of all base-labile protective groups, which facilitated the generation of the fully deprotected HA decasaccharide. PMID:19764799

  9. Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway

    PubMed Central

    Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z.; Yazdani, Syed Shams

    2016-01-01

    Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817

  10. Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway.

    PubMed

    Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z; Yazdani, Syed Shams

    2016-01-01

    Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817

  11. Retinol metabolism in LLC-PK1 Cells. Characterization of retinoic acid synthesis by an established mammalian cell line.

    PubMed

    Napoli, J L

    1986-10-15

    Specific assays, based on gas chromatography-mass spectrometry and high-performance liquid chromatography, were used to quantify the conversion of retinol and retinal into retinoic acid by the pig kidney cell line LLC-PK1. Retinoic acid synthesis was linear for 2-4 h as well as with graded amounts of either substrate to at least 50 microM. Retinoic acid concentrations increased through 6-8 h, but decreased thereafter because of substrate depletion (t1/2 of retinol = 13 h) and product metabolism (1/2 = 2.3 h). Retinoic acid metabolism was accelerated by treating cells with 100 nM retinoic acid for 10 h (t1/2 = 1.7 h) and was inhibited by the antimycotic imidazole ketoconazole. Feedback inhibition was not indicated since retinoic acid up to 100 nM did not inhibit its own synthesis. Retinol dehydrogenation was rate-limiting. The reduction and dehydrogenation of retinal were 4-8-fold and 30-60-fold faster, respectively. Greater than 95% of retinol was converted into metabolites other than retinoic acid, whereas the major metabolite of retinal was retinoic acid. The synthetic retinoid 13-cis-N-ethylretinamide inhibited retinoic acid synthesis, but 4-hydroxylphenylretinamide did not. 4'-(9-Acridinylamino)methanesulfon-m-anisidide, an inhibitor of aldehyde oxidase, and ethanol did not inhibit retinoic acid synthesis. 4-Methylpyrazole was a weak inhibitor: disulfiram was a potent inhibitor. These data indicate that retinol dehydrogenase is a sulfhydryl group-dependent enzyme, distinct from ethanol dehydrogenase. Homogenates of LLC-PK1 cells converted retinol into retinoic acid and retinyl palmitate and hydrolyzed retinyl palmitate. This report suggests that substrate availability, relative to enzyme activity/amount, is a primary determinant of the rate of retinoic acid synthesis, identifies inhibitors of retinoic acid synthesis, and places retinoic acid synthesis into perspective with several other known pathways of retinoid metabolism. PMID:3759984

  12. Structural characterization of the Mycobacterium tuberculosis biotin biosynthesis enzymes 7,8-diaminopelargonic acid synthase and dethiobiotin synthetase .

    PubMed

    Dey, Sanghamitra; Lane, James M; Lee, Richard E; Rubin, Eric J; Sacchettini, James C

    2010-08-10

    Mycobacterium tuberculosis (Mtb) depends on biotin synthesis for survival during infection. In the absence of biotin, disruption of the biotin biosynthesis pathway results in cell death rather than growth arrest, an unusual phenotype for an Mtb auxotroph. Humans lack the enzymes for biotin production, making the proteins of this essential Mtb pathway promising drug targets. To this end, we have determined the crystal structures of the second and third enzymes of the Mtb biotin biosynthetic pathway, 7,8-diaminopelargonic acid synthase (DAPAS) and dethiobiotin synthetase (DTBS), at respective resolutions of 2.2 and 1.85 A. Superimposition of the DAPAS structures bound either to the SAM analogue sinefungin or to 7-keto-8-aminopelargonic acid (KAPA) allowed us to map the putative binding site for the substrates and to propose a mechanism by which the enzyme accommodates their disparate structures. Comparison of the DTBS structures bound to the substrate 7,8-diaminopelargonic acid (DAPA) or to ADP and the product dethiobiotin (DTB) permitted derivation of an enzyme mechanism. There are significant differences between the Mtb enzymes and those of other organisms; the Bacillus subtilis DAPAS, presented here at a high resolution of 2.2 A, has active site variations and the Escherichia coli and Helicobacter pylori DTBS have alterations in their overall folds. We have begun to exploit the unique characteristics of the Mtb structures to design specific inhibitors against the biotin biosynthesis pathway in Mtb. PMID:20565114

  13. Enzyme-catalyzed synthesis of polyamides and polypeptides

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyamides and polypeptides are important polymers in biological systems and industrial processes. Usually polyamides are produced via chemical synthesis, whereas polypeptides and proteins are isolated from living systems or produced from Merrifield synthesis. An area of active research is to use ...

  14. Hyaluronic acid lipoate: synthesis and physicochemical properties.

    PubMed

    Picotti, Fabrizio; Fabbian, Matteo; Gianni, Rita; Sechi, Alessandra; Stucchi, Luca; Bosco, Marco

    2013-03-01

    The synthesis and physicochemical characterisation of mixed lipoic and formic esters of hyaluronan (Lipohyal) are presented in this paper. The synthesis was conducted by activating lipoic acid with 1,1'-carbonyldiimidazole to obtain lipoyl imidazolide, which reacted with hyaluronan (HA) in formamide under basic conditions. This procedure allows researchers to modulate easily the degree of substitution over a range of 0.05-1.8. Radical scavenger properties were analysed by UV-vis spectroscopy, where improved performance was demonstrated for Lipohyal with respect to the HA row material and lipoic acid. The chemical modification also causes HA to show an improved resistance to hyaluronidase digestion. These findings show that Lipohyal is a highly interesting derivative for applications in the tricological and dermo-cosmetic field and as an anti-aging ingredient. Moreover, Lipohyal can be easily crosslinked by UV irradiation, resulting in an innovative hydrogel with distinctive viscoelastic properties that is suitable as both a dermal-filler and as an intra-articular medical device. PMID:23465930

  15. Synthesis of novel acid electrolytes for phosphoric acid fuel cells

    NASA Astrophysics Data System (ADS)

    Adcock, James L.

    1988-11-01

    A 40 millimole per hour scale aerosol direct fluorination reactor was constructed. F-Methyl F-4-methoxybutanoate and F-4-methoxybutanoyl fluoride were synthesized by aerosol direct fluorination of methyl 4-methoxybutanoate. Basic hydrolysis of the perfluorinated derivatives produce sodium F-4 methoxybutanoate which was pyrolyzed to F-3-methoxy-1-propene. Purification and shipment of 33 grams of F-3-methoxy-1-propene followed. Syntheses by analogous methods allowed production and shipment of 5 grams of F-3-ethoxy 1-propene, 18 grams of F-3-(2-methoxy.ethoxy) 1-propene, and 37 grams of F-3,3-dimethyl 1-butene. Eighteen grams of F-2,2-dimethyl 1-chloropropane was produced directly and shipped. As suggested by other contractors, 5 grams of F-3-methoxy 1-iodopropane, and 5 grams of F-3-(2-methoxy.ethoxy) 1-iodopropane were produced by converting the respective precursor acid sodium salts produced for olefin synthesis to the silver salts and pyrolyzing them with iodine. Each of these compounds was prepared for the first time by the aerosol fluorination process during the course of the contract. These samples were provided to other Gas Research Institute (GRI) contractors for synthesis of perfluorinated sulfur (VI) and phosphorous (V) acids.

  16. In Silico Phylogenetic Analysis and Molecular Modelling Study of 2-Haloalkanoic Acid Dehalogenase Enzymes from Bacterial and Fungal Origin

    PubMed Central

    Satpathy, Raghunath; Konkimalla, V. B.; Ratha, Jagnyeswar

    2016-01-01

    2-Haloalkanoic acid dehalogenase enzymes have broad range of applications, starting from bioremediation to chemical synthesis of useful compounds that are widely distributed in fungi and bacteria. In the present study, a total of 81 full-length protein sequences of 2-haloalkanoic acid dehalogenase from bacteria and fungi were retrieved from NCBI database. Sequence analysis such as multiple sequence alignment (MSA), conserved motif identification, computation of amino acid composition, and phylogenetic tree construction were performed on these primary sequences. From MSA analysis, it was observed that the sequences share conserved lysine (K) and aspartate (D) residues in them. Also, phylogenetic tree indicated a subcluster comprised of both fungal and bacterial species. Due to nonavailability of experimental 3D structure for fungal 2-haloalkanoic acid dehalogenase in the PDB, molecular modelling study was performed for both fungal and bacterial sources of enzymes present in the subcluster. Further structural analysis revealed a common evolutionary topology shared between both fungal and bacterial enzymes. Studies on the buried amino acids showed highly conserved Leu and Ser in the core, despite variation in their amino acid percentage. Additionally, a surface exposed tryptophan was conserved in all of these selected models. PMID:26880911

  17. Short communication: Measuring the angiotensin-converting enzyme inhibitory activity of an 8-amino acid (8mer) fragment of the C12 antihypertensive peptide

    Technology Transfer Automated Retrieval System (TEKTRAN)

    An eight amino acid fragment (PFPEVFGK) of a known milk protein-derived antihypertensive peptide was synthesized by microwave-assisted solid phase peptide synthesis and purified by reverse phase HPLC. Its ability to inhibit the angiotensin-converting enzyme was assessed and compared to that of the ...

  18. NADP+-dependent farnesol dehydrogenase, a corpora allata enzyme involved in juvenile hormone synthesis

    PubMed Central

    Mayoral, Jaime G.; Nouzova, Marcela; Navare, Arti; Noriega, Fernando G.

    2009-01-01

    The synthesis of juvenile hormone (JH) is an attractive target for control of insect pests and vectors of disease, but the minute size of the corpora allata (CA), the glands that synthesize JH, has made it difficult to identify important biosynthetic enzymes by classical biochemical approaches. Here, we report identification and characterization of an insect farnesol dehydrogenase (AaSDR-1) that oxidizes farnesol into farnesal, a precursor of JH, in the CA. AaSDR-1 was isolated as an EST in a library of the corpora allata-corpora cardiaca of the mosquito Aedes aegypti. The 245-amino acid protein presents the typical short-chain dehydrogenase (SDR) Rossmann-fold motif for nucleotide binding. This feature, together with other conserved sequence motifs, place AaSDR-1 into the “classical” NADP+-dependent cP2 SDR subfamily. The gene is part of a group of highly conserved paralogs that cluster together in the mosquito genome; similar clusters of orthologs were found in other insect species. AaSDR-1 acts as a homodimer and efficiently oxidizes C10 to C15 isoprenoid and aliphatic alcohols, showing the highest affinity for the conversion of farnesol into farnesal. Farnesol dehydrogenase activity was not detected in the CA of newly emerged mosquitoes but significant activity was detected 24 h later. Real time PCR experiments revealed that AaSDR-1 mRNA levels were very low in the inactive CA of the newly emerged female, but increased >30-fold 24 h later during the peak of JH synthesis. These results suggest that oxidation of farnesol might be a rate-limiting step in JH III synthesis in adult mosquitoes. PMID:19940247

  19. Enzyme

    MedlinePlus

    Enzymes are complex proteins that cause a specific chemical change in all parts of the body. For ... use them. Blood clotting is another example of enzymes at work. Enzymes are needed for all body ...

  20. Rapid synthesis of the 7-deoxy zaragozic acid core.

    PubMed

    Calter, Michael A; Zhu, Cheng; Lachicotte, Rene J

    2002-01-24

    [reaction: see text] We have developed an efficient synthesis of the 7-deoxy zaragozic acid core. The synthesis begins with a Feist-Bénary reaction that assembles all three carbons of the polycarboxylic acid portion of the core. This reaction is followed by highly diastereoselective aldol and dihydroxylation reactions that set the remaining stereocenters of the core. The synthesis finishes with lactol oxidation and lactone alcoholysis/ketal formation reactions to construct the bicyclic ring system of the core. PMID:11796052

  1. First total synthesis of prasinic acid and its anticancer activity.

    PubMed

    Chakor, Narayan; Patil, Ganesh; Writer, Diana; Periyasamy, Giridharan; Sharma, Rajiv; Roychowdhury, Abhijit; Mishra, Prabhu Dutt

    2012-11-01

    The first total synthesis of prasinic acid is being reported along with its biological evaluation. The ten step synthesis involved readily available and cheap starting materials and can easily be transposed to large scale manufacturing. The crucial steps of the synthesis included the formation of two different aromatic units (7 and 9) and their coupling reaction. The synthetic prasinic acid exhibited moderate antitumor activity (IC(50) 4.3-9.1 μM) in different lines of cancer cells. PMID:23031589

  2. Thermostable lipoxygenase, a key enzyme in bioconversion of linoleic acid to trihycroxy-octadecenoic acid by Pseudomonas aeruginosa PR3

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Lipoxygenases, enzymes that contain non-heme iron, catalyze the oxidation of unsaturated fatty acids with a (1Z,4Z)-pentadiene moiety leading to conjugated (Z,E)-hydroperoxydienoic acids. These enzymes are widely distributed in plants and animals, and a few microorganisms are reported as well. It ...

  3. Nanostructured Membranes for Green Synthesis of Nanoparticles and Enzyme Catalysis

    EPA Science Inventory

    Macroporous membranes functionalized with ionizable macromolecules provide promising applications in toxic metal capture at high capacity, nanoparticle synthesis, and catalysis. Our low‐pressure membrane approach is marked by reaction and separation selectivity and their tunabili...

  4. Nanostructured Membranes for Enzyme Catalysis and Green Synthesis of Nanoparticles

    EPA Science Inventory

    Macroporous membranes functionalized with ionizable macromolecules provide promising applications in toxic metal capture at high capacity, nanoparticle synthesis, and catalysis. Our low-pressure membrane approach is marked by reaction and separation selectivity and their tunabil...

  5. Unusual Fatty Acids Produced by Microbial Expression of Enzymes from the Tung Tree

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Tung oil, produced by fruit of the tung tree (Aleurites fordii), is a valuable industrial oil used in formulations of inks, dyes, coatings, and resins. The fruit contains all of the genes and enzymes required for synthesis of the oil, and such enzymes could be used for conversion of low-cost veget...

  6. Catalysis of the Carbonylation of Alcohols to Carboxylic Acids Including Acetic Acid Synthesis from Methanol.

    ERIC Educational Resources Information Center

    Forster, Denis; DeKleva, Thomas W.

    1986-01-01

    Monsanto's highly successful synthesis of acetic acid from methanol and carbon monoxide illustrates use of new starting materials to replace pretroleum-derived ethylene. Outlines the fundamental aspects of the acetic acid process and suggests ways of extending the synthesis to higher carboxylic acids. (JN)

  7. Gallic acid and gallic acid derivatives: effects on drug metabolizing enzymes.

    PubMed

    Ow, Yin-Yin; Stupans, Ieva

    2003-06-01

    Gallic acid and its structurally related compounds are found widely distributed in fruits and plants. Gallic acid, and its catechin derivatives are also present as one of the main phenolic components of both black and green tea. Esters of gallic acid have a diverse range of industrial uses, as antioxidants in food, in cosmetics and in the pharmaceutical industry. In addition, gallic acid is employed as a source material for inks, paints and colour developers. Studies utilising these compounds have found them to possess many potential therapeutic properties including anti-cancer and antimicrobial properties. In this review, studies of the effects of gallic acid, its esters, and gallic acid catechin derivatives on Phase I and Phase II enzymes are examined. Many published reports of the effects of the in vitro effects of gallic acid and its derivatives on drug metabolising enzymes concern effects directly on substrate (generally drug or mutagen) metabolism or indirectly through observed effects in Ames tests. In the case of the Ames test an antimutagenic effect may be observed through inhibition of CYP activation of indirectly acting mutagens and/or by scavenging of metabolically generated mutagenic electrophiles. There has been considerable interest in the in vivo effects of the gallate esters because of their incorporation into foodstuffs as antioxidants and in the catechin gallates with their potential role as chemoprotective agents. Principally an induction of Phase II enzymes has been observed however more recent studies using HepG2 cells and primary cultures of human hepatocytes provide evidence for the overall complexity of actions of individual components versus complex mixtures, such as those in food. Further systematic studies of mechanisms of induction and inhibition of drug metabolising enzymes by this group of compounds are warranted in the light of their distribution and consequent ingestion, current uses and suggested therapeutic potential. However, it

  8. Seasonal changes in enzymes of lipogenesis and triacylglycerol synthesis in the golden-mantled ground squirrel (Spermophilus lateralis).

    PubMed

    Wang, P; Walter, R D; Bhat, B G; Florant, G L; Coleman, R A

    1997-10-01

    In order to determine whether critical enzyme activities of glycerolipid synthesis change seasonally in the golden-mantled ground squirrel (Spermophilus lateralis), we collected summer and winter samples of liver, brown adipose tissue (BAT), and white adipose tissue (WAT). Compared with fatty acid synthase activity during hibernation, summer activities were 2.5- to 8-fold higher in adipose tissue and liver. Diacylglycerol acyltransferase (DGAT) activity was 2.6-fold higher in WAT during the summer, consistent with increased seasonal triacylglycerol storage, but the activity did not change in liver or BAT, suggesting that in these tissues, triacylglycerol synthesis is equally active in summer and winter. Lack of change in acyl-CoA synthetase in liver and BAT may reflect high synthetic rates for acyl-CoAs that are destined in the summer for glycerolipid synthesis and in the winter for beta-oxidation. Monoacylglycerol acyltransferase (MGAT) activity increased significantly in both liver and WAT during the summer but decreased in BAT. Although the changes were consistent with active year-round triacylglycerol synthesis, the higher summer MGAT activity observed in the squirrel liver and WAT suggest that MGATs function may not be limited to conserving essential fatty acids during physiological states of lipolysis. Seasonal changes observed in the ground squirrel were similar to those previously reported in the yellow-bellied marmot (Marmota flaviventris), confirming that important adjustments occur in energy metabolism necessitated by long seasonal hibernation. PMID:9440219

  9. Chemoenzymatic synthesis of CMP-N-acetyl-7-fluoro-7-deoxy-neuraminic acid.

    PubMed

    Hartlieb, Sina; Günzel, Almut; Gerardy-Schahn, Rita; Münster-Kühnel, Anja K; Kirschning, Andreas; Dräger, Gerald

    2008-08-11

    7-Fluoro sialic acid was prepared and activated as cytidine monophosphate (CMP) ester. The synthesis started with d-glucose, which was efficiently converted into N-acetyl-4-fluoro-4-deoxy-d-mannosamine. Aldolase catalyzed transformation yielded the corresponding fluorinated sialic acid which was activated as CMP ester using three different synthetases in the presence as well as in the absence of pyrophosphatase which possesses inhibitory properties. Finally, conditions were optimized to perform a one-pot reaction starting from fluorinated mannosamine, which yielded the 7-fluoro-7-deoxy-CMP-sialic acid by incubation with three enzymes. PMID:18353292

  10. Recent Updates on DTD (D-Tyr-tRNATyr Deacylase): An Enzyme Essential for Fidelity and Quality of Protein Synthesis

    PubMed Central

    Bhatt, Tarun K.; Soni, Rani; Sharma, Drista

    2016-01-01

    During protein synthesis, there are several checkpoints in the cell to ensure that the information encoded within genetic material is decoded correctly. Charging of tRNA with its cognate amino acid is one of the important steps in protein synthesis and is carried out by aminoacyl-tRNA synthetase (aaRS) with great accuracy. However, due to presence of D-amino acids in the cell, sometimes aaRS charges tRNA with D-amino acids resulting in the hampering of protein translational process, which is lethal to the cell. Every species has some mechanism in order to prevent the formation of D-amino acid-tRNA complex, for instance DTD (D-Tyr-tRNA deacylase) is an enzyme responsible for the cleavage of ester bond formed between D-amino acid and tRNA leading to error free translation process. In this review, structure, function, and enzymatic mechanism of DTD are discussed. The role of DTD as a drug target is also considered. PMID:27200345

  11. Tailored fatty acid synthesis via dynamic control of fatty acid elongation

    SciTech Connect

    Torella, JP; Ford, TJ; Kim, SN; Chen, AM; Way, JC; Silver, PA

    2013-07-09

    Medium-chain fatty acids (MCFAs, 4-12 carbons) are valuable as precursors to industrial chemicals and biofuels, but are not canonical products of microbial fatty acid synthesis. We engineered microbial production of the full range of even-and odd-chain-length MCFAs and found that MCFA production is limited by rapid, irreversible elongation of their acyl-ACP precursors. To address this limitation, we programmed an essential ketoacyl synthase to degrade in response to a chemical inducer, thereby slowing acyl-ACP elongation and redirecting flux from phospholipid synthesis to MCFA production. Our results show that induced protein degradation can be used to dynamically alter metabolic flux, and thereby increase the yield of a desired compound. The strategy reported herein should be widely useful in a range of metabolic engineering applications in which essential enzymes divert flux away from a desired product, as well as in the production of polyketides, bioplastics, and other recursively synthesized hydrocarbons for which chain-length control is desired.

  12. Application of metagenomic techniques in mining enzymes from microbial communities for biofuel synthesis.

    PubMed

    Xing, Mei-Ning; Zhang, Xue-Zhu; Huang, He

    2012-01-01

    Feedstock for biofuel synthesis is transitioning to lignocelluosic biomass to address criticism over competition between first generation biofuels and food production. As microbial catalysis is increasingly applied for the conversion of biomass to biofuels, increased import has been placed on the development of novel enzymes. With revolutionary advances in sequencer technology and metagenomic sequencing, mining enzymes from microbial communities for biofuel synthesis is becoming more and more practical. The present article highlights the latest research progress on the special characteristics of metagenomic sequencing, which has been a powerful tool for new enzyme discovery and gene functional analysis in the biomass energy field. Critical enzymes recently developed for the pretreatment and conversion of lignocellulosic materials are evaluated with respect to their activity and stability, with additional explorations into xylanase, laccase, amylase, chitinase, and lipolytic biocatalysts for other biomass feedstocks. PMID:22306331

  13. Loss of nuclear receptor SHP impairs but does not eliminate negative feedback regulation of bile acid synthesis.

    PubMed

    Kerr, Thomas A; Saeki, Shigeru; Schneider, Manfred; Schaefer, Karen; Berdy, Sara; Redder, Thadd; Shan, Bei; Russell, David W; Schwarz, Margrit

    2002-06-01

    The in vivo role of the nuclear receptor SHP in feedback regulation of bile acid synthesis was examined. Loss of SHP in mice caused abnormal accumulation and increased synthesis of bile acids due to derepression of rate-limiting CYP7A1 and CYP8B1 hydroxylase enzymes in the biosynthetic pathway. Dietary bile acids induced liver damage and restored feedback regulation. A synthetic agonist of the nuclear receptor FXR was not hepatotoxic and had no regulatory effects. Reduction of the bile acid pool with cholestyramine enhanced CYP7A1 and CYP8B1 expression. We conclude that input from three negative regulatory pathways controls bile acid synthesis. One is mediated by SHP, and two are SHP independent and invoked by liver damage and changes in bile acid pool size. PMID:12062084

  14. Enzyme reaction engineering: design of peptide synthesis by stabilized trypsin.

    PubMed

    Blanco, R M; Alvaro, G; Guisán, J M

    1991-07-01

    By using very active and very stable trypsin agarose derivatives, we have optimized the design of the synthesis of a model dipeptide, benzoylarginine leucinamide, by two different strategies: (i) kinetically controlled synthesis (KCS), by using benzoyl arginine ethyl ester and leucinamide as substrates, and (ii) thermodynamically controlled synthesis (TCS), by using benzoyl arginine and leucinamide as substrates. In each strategy, we have studied the integrated effect of a number of variables that define the reaction medium on different parameters of industrial interest, e.g. time course of peptide synthesis, higher synthetic yields, and stability of the catalyst, as well as aminolysis/hydrolysis ratios and rate of peptide hydrolysis in the case of KCS. Both synthetic approaches were carried out in monophasic water or water-organic cosolvent systems. We have mainly tested a number of variables, e.g. temperature, polarity of the reaction medium (presence of cosolvents, presence of ammonium sulfate), and exact structure of the trypsin derivatives. Optimal experimental conditions for these synthetic approaches were established in order to simultaneously obtain good values for all industrial parameters. The use of previously stabilized trypsin derivatives greatly improves the design of these synthetic approaches (e.g. by using drastic experimental conditions: 1 M ammonium sulfate (KCS) or 90% organic cosolvents (TCS]. In these conditions, our derivatives preserve more than 95% of activity after 2 months and we have been able to reach synthetic productivities of 180 (KCS) and 1 (TCS) tons of dipeptide per year per liter of catalyst. PMID:1367640

  15. Characterization of a novel N-acetylneuraminic acid lyase favoring N-acetylneuraminic acid synthesis.

    PubMed

    Ji, Wenyan; Sun, Wujin; Feng, Jinmei; Song, Tianshun; Zhang, Dalu; Ouyang, Pingkai; Gu, Zhen; Xie, Jingjing

    2015-01-01

    N-Acetylneuraminic acid lyase (NAL, E.C. number 4.1.3.3) is a Class I aldolase that catalyzes the reversible aldol cleavage of N-acetylneuraminic acid (Neu5Ac) from pyruvate and N-acetyl-D-mannosamine (ManNAc). Due to the equilibrium favoring Neu5Ac cleavage, the enzyme catalyzes the rate-limiting step of two biocatalytic reactions producing Neu5Ac in industry. We report the biochemical characterization of a novel NAL from a "GRAS" (General recognized as safe) strain C. glutamicum ATCC 13032 (CgNal). Compared to all previously reported NALs, CgNal exhibited the lowest kcat/Km value for Neu5Ac and highest kcat/Km values for ManNAc and pyruvate, which makes CgNal favor Neu5Ac synthesis the most. The recombinant CgNal reached the highest expression level (480 mg/L culture), and the highest reported yield of Neu5Ac was achieved (194 g/L, 0.63 M). All these unique properties make CgNal a promising biocatalyst for industrial Neu5Ac biosynthesis. Additionally, although showing the best Neu5Ac synthesis activity among the NAL family, CgNal is more related to dihydrodipicolinate synthase (DHDPS) by phylogenetic analysis. The activities of CgNal towards both NAL's and DHDPS' substrates are fairly high, which indicates CgNal a bi-functional enzyme. The sequence analysis suggests that CgNal might have adopted a unique set of residues for substrates recognition. PMID:25799411

  16. Mutation of L-2,3-diaminopropionic acid synthase genes blocks staphyloferrin B synthesis in Staphylococcus aureus

    PubMed Central

    2011-01-01

    Background Staphylococcus aureus synthesizes two siderophores, staphyloferrin A and staphyloferrin B, that promote iron-restricted growth. Previous work on the biosynthesis of staphyloferrin B has focused on the role of the synthetase enzymes, encoded from within the sbnA-I operon, which build the siderophore from the precursor molecules citrate, alpha-ketoglutarate and L-2,3-diaminopropionic acid. However, no information yet exists on several other enzymes, expressed from the biosynthetic cluster, that are thought to be involved in the synthesis of the precursors (or synthetase substrates) themselves. Results Using mutants carrying insertions in sbnA and sbnB, we show that these two genes are essential for the synthesis of staphyloferrin B, and that supplementation of the growth medium with L-2,3-diaminopropionic acid can bypass the block in staphyloferrin B synthesis displayed by the mutants. Several mechanisms are proposed for how the enzymes SbnA, with similarity to cysteine synthase enzymes, and SbnB, with similarity to amino acid dehydrogenases and ornithine cyclodeaminases, function together in the synthesis of this unusual nonproteinogenic amino acid L-2,3-diaminopropionic acid. Conclusions Mutation of either sbnA or sbnB result in abrogation of synthesis of staphyloferrin B, a siderophore that contributes to iron-restricted growth of S. aureus. The loss of staphyloferrin B synthesis is due to an inability to synthesize the unusual amino acid L-2,3-diaminopropionic acid which is an important, iron-liganding component of the siderophore structure. It is proposed that SbnA and SbnB function together as an L-Dap synthase in the S. aureus cell. PMID:21906287

  17. The synthesis of pteroylpolyglutamates by sheep liver enzymes in vitro

    PubMed Central

    Gawthorne, Jeffrey M.; Smith, Richard M.

    1973-01-01

    1. Sephadex G-15 was used to separate pteroylmonoglutamates from corresponding polyglutamate derivatives. 2. Pteroylpolyglutamates were formed when 5-formyltetrahydro[2-14C]pteroylglutamic acid, 5-[methyl-14C]tetrahydropteroylglutamic acid or tetrahydro[2-14C]pteroylglutamic acid was incubated at pH8.4 with ATP, MgCl2, KCl, l-glutamic acid and sheep liver cytosol. The γ-glutamyl side chain appeared to be lengthened by the stepwise addition of single glutamate moieties. 3. The subcellular distribution of pteroylpolyglutamates paralleled that of pteroylpolyglutamate synthetase activity, and followed the order cytosol>`nuclear' fraction>microsomal fraction>mitochondria. PMID:4774396

  18. In vitro effects of selected environmental toxicants on two heme synthesis enzymes

    SciTech Connect

    Johnson, D.J.; Williams, H.L.; Slater, S.; Haut, M.J.; Altstatt, L.B.

    1985-11-01

    Benzene and some of its substitution products become environmental toxicants due to improper disposal procedures. Benzene has been found to alter heme and globin synthesis in anucleate rabbit reticulocytes (Forte et al., 1976; Wildman et al., 1976) and based on these findings we felt it would be useful to determine what, if any, effect these derivatives would have on heme synthesis in vitro by studying their influence on delta-aminolevulinic acid synthetase (ALAS) and ferrochelatase (FC) activities in rat liver homogenates. ALAS was measured according to Ebert et al. (1970). FC was measured after Williams et al. (1980). Final concentrations of each added compound to the reaction mixture were 10(-3) to 10(-6) M. Normal values for rat liver ALAS were 250-350 nmol ALA/g protein/30 min, mean 290 +/- 40, and for FC were 12-40 mumol heme/g protein/45 min, mean 20 +/- 7. At 10(-3) M and lower concentrations these compounds inhibited ALAS and stimulated FC activities. Their effect on ALAS activity expressed as percentage of control of three analyses performed in triplicate +/- SEM was: o- and p-dinitrobenzenes-46 +/- 2; trinitrotoluenes-55 +/- 2; dinitrotoluenes-70 +/- 2; and amino-dinitrotoluenes-171 +/- 4. The stimulatory effect of these compounds expressed as percentage of control +/- SEM on FC was: dinitrotoluenes-171 +/- 3; dinitrobenzenes-152 +/- 3; trinitrotoluenes-142 +/- 4; and amino-dinitrotoluenes-130 +/- 4. Other classes of compounds tested did not significantly affect these enzymes at the same concentrations. These in vitro techniques may prove useful for predicting in vivo toxicologic effects of pollutants on species of interest.

  19. NAD[S], an NAD analogue with reduced susceptibility to phosphodiesterase. Chemical synthesis and enzymic properties.

    PubMed

    Meyer, T; Wielckens, K; Thiem, J; Hilz, H

    1984-05-01

    The chemical synthesis of adenosine(5') [alpha-thio]diphospho(5')ribofuranosyl-nicotinamide (NAD[S]) is described. The product occurs as a pair of diastereomers with different configuration at the sulfur-bearing phosphorus atom. The diastereomers were separated by high-performance liquid chromatography and their absolute configuration was determined after chemical degradation to the ADP[alpha S] diastereomers and chromatographic comparison with enzymically synthesized ADP[alpha S] diastereomers of known absolute configuration. Additional support for this assignment is based on different rates in the phosphodiesterase-catalyzed hydrolysis. Furthermore the synthesis of [14C]NAD[S] is described. The coenzyme activity of NAD[S] in the reaction with alcohol dehydrogenase from baker's yeast and lactate dehydrogenase from pig heart is very similar to that of beta-NAD. Also, NAD and NAD[S] serve equally well as substrates for NAD glycohydrolase from calf spleen. In contrast, no reaction was detected with NAD pyrophosphorylase, and hydrolysis of the separated NAD[S] diastereomers with snake venom phosphodiesterase showed a 26-fold and a 33-fold slower reaction rate than that of NAD. Nucleotide pyrophosphatase was less sensitive to the S substitution, hydrolyzing NAD[S] 14-times slower than NAD. Poly(ADP-ribose) polymerase from Ehrlich ascites tumor cell nuclei accepted NAD[S] as a substrate but the reaction was significantly slower and approached saturation at much lower values than with NAD. Alkaline hydrolysis of the products insoluble in trichloroacetic acid yielded AMP[S] as the main derivative. It is concluded that with NAD[S] as a substrate the nuclear acceptors were nearly exclusively mono(ADP-ribosyl) ated . PMID:6144544

  20. The effects of age on glutathione synthesis enzymes in lenses of Old World simians and prosimians.

    PubMed

    Rathbun, W B; Holleschau, A M

    1992-07-01

    The activities of gamma-glutamylcysteine synthetase and glutathione synthetase, the two enzymes required for glutathione synthesis, were determined as a function of age in lenses of three species of Old World higher primates: orangutan, pigtail monkey and olive baboon. These were compared to enzyme activities in lenses of two prosimians: mouse lemur and galago. gamma-Glutamylcysteine synthetase activity decreased as a function of age in all three Old World simians. The rate of decrease was greatest in the juvenile lenses. In contrast, the enzyme activity increased continuously with age in the galago lens. In the mouse lemur the enzyme activity increased per lens, but was constant when expressed as specific activity or as units per gram of lens. The loss of enzyme activity with age was limited to Old World higher primates apparently representing genetic change. Glutathione synthetase activity decreased logarithmically with age in the lenses of all five species. PMID:1355706

  1. Non-enzymic beta-decarboxylation of aspartic acid.

    NASA Technical Reports Server (NTRS)

    Doctor, V. M.; Oro, J.

    1972-01-01

    Study of the mechanism of nonenzymic beta-decarboxylation of aspartic acid in the presence of metal ions and pyridoxal. The results suggest that aspartic acid is first converted to oxalacetic acid by transamination with pyridoxal which in turn is converted to pyridoxamine. This is followed by decarboxylation of oxalacetic acid to form pyruvic acid which transaminates with pyridoxamine to form alanine. The possible significance of these results to prebiotic molecular evolution is briefly discussed.

  2. Total synthesis and complete stereostructure of gambieric acid A.

    PubMed

    Fuwa, Haruhiko; Ishigai, Kazuya; Hashizume, Keisuke; Sasaki, Makoto

    2012-07-25

    Total synthesis of gambieric acid A, a potent antifungal polycyclic ether metabolite, has been accomplished for the first time, which firmly established the complete stereostructure of this natural product. PMID:22779404

  3. Synthesis of fatty acids in the perused mouse liver.

    PubMed

    Salmon, D M; Bowen, N L; Hems, D A

    1974-09-01

    1. Fatty acid synthesis de novo was measured in the perfused liver of fed mice. 2. The total rate, measured by the incorporation into fatty acid of (3)H from (3)H(2)O (1-7mumol of fatty acid/h per g of fresh liver), resembled the rate found in the liver of intact mice. 3. Perfusions with l-[U-(14)C]lactic acid and [U-(14)C]glucose showed that circulating glucose at concentrations less than about 17mm was not a major carbon source for newly synthesized fatty acid, whereas lactate (10mm) markedly stimulated fatty acid synthesis, and contributed extensive carbon to lipogenesis. 4. The identification of 50% of the carbon converted into newly synthesized fatty acid lends further credibility to the use of (3)H(2)O to measure hepatic fatty acid synthesis. 5. The total rate of fatty acid synthesis, and the contribution of glucose carbon to lipogenesis, were directly proportional to the initial hepatic glycogen concentration. 6. The proportion of total newly synthesized lipid that was released into the perfusion medium was 12-16%. 7. The major products of lipogenesis were saturated fatty acids in triglyceride and phospholipid. 8. The rate of cholesterol synthesis, also measured with (3)H(2)O, expressed as acetyl residues consumed, was about one-fourth of the basal rate of fatty acid synthesis. 9. These results are discussed in terms of the carbon sources of hepatic newly synthesized fatty acids, and the effect of glucose, glycogen and lactate in stimulating lipogenesis, independently of their role as precursors. PMID:4464843

  4. A symmetry-based formal synthesis of zaragozic acid A.

    PubMed

    Freeman-Cook, K D; Halcomb, R L

    2000-09-22

    A symmetry-based strategy for the synthesis of the zaragozic acids is reported. Two enantioselective dihydroxylations were used to establish the absolute configuration of a C(2) symmetric intermediate. Noteworthy transformations include a group-selective lactonization, which accomplished an end-differentiation of a pseudo-C(2) symmetric intermediate. Late stage protecting group adjustments and oxidations accomplished a formal synthesis of zaragozic acid A. PMID:10987953

  5. Photoorganocatalytic One-Pot Synthesis of Hydroxamic Acids from Aldehydes.

    PubMed

    Papadopoulos, Giorgos N; Kokotos, Christoforos G

    2016-05-10

    An efficient one-pot synthesis of hydroxamic acids from aldehydes and hydroxylamine is described. A fast, visible-light-mediated metal-free hydroacylation of dialkyl azodicarboxylates was used to develop the subsequent addition of hydroxylamine hydrochloride. A range of aliphatic and aromatic aldehydes were employed in this reaction to give hydroxamic acids in high to excellent yields. Application of the current methodology was demonstrated in the synthesis of the anticancer medicine vorinostat. PMID:27038037

  6. Overexpression of malate dehydrogenase in transgenic alfalfa enhances organic acid synthesis and confers tolerance to aluminum.

    PubMed

    Tesfaye, M; Temple, S J; Allan, D L; Vance, C P; Samac, D A

    2001-12-01

    Al toxicity is a severe impediment to production of many crops in acid soil. Toxicity can be reduced through lime application to raise soil pH, however this amendment does not remedy subsoil acidity, and liming may not always be practical or cost-effective. Addition of organic acids to plant nutrient solutions alleviates phytotoxic Al effects, presumably by chelating Al and rendering it less toxic. In an effort to increase organic acid secretion and thereby enhance Al tolerance in alfalfa (Medicago sativa), we produced transgenic plants using nodule-enhanced forms of malate dehydrogenase and phosphoenolpyruvate carboxylase cDNAs under the control of the constitutive cauliflower mosaic virus 35S promoter. We report that a 1.6-fold increase in malate dehydrogenase enzyme specific activity in root tips of selected transgenic alfalfa led to a 4.2-fold increase in root concentration as well as a 7.1-fold increase in root exudation of citrate, oxalate, malate, succinate, and acetate compared with untransformed control alfalfa plants. Overexpression of phosphoenolpyruvate carboxylase enzyme specific activity in transgenic alfalfa did not result in increased root exudation of organic acids. The degree of Al tolerance by transformed plants in hydroponic solutions and in naturally acid soil corresponded with their patterns of organic acid exudation and supports the concept that enhancing organic acid synthesis in plants may be an effective strategy to cope with soil acidity and Al toxicity. PMID:11743127

  7. Uronic Acid products release from enzymically active cell wall from tomato fruit and its dependency on enzyme quantity and distribution.

    PubMed

    Huber, D J; Lee, J H

    1988-07-01

    Isolated cell wall from tomato (Lycopersicon esculentum Mill. cv Rutgers) fruit released polymeric (degree of polymerization [DP] > 8), oligomeric, and monomeric uronic acids in a reaction mediated by bound polygalacturonase (PG) (EC 3.2.1.15). Wall autolytic capacity increased with ripening, reflecting increased levels of bound PG; however, characteristic oligomeric and monomeric products were recovered from all wall isolates exhibiting net pectin release. The capacity of wall from fruit at early ripening (breaker, turning) to generate oligomeric and monomeric uronic acids was attributed to the nonuniform ripening pattern of the tomato fruit and, consequently, a locally dense distribution of enzyme in wall originating from those fruit portions at more temporally advanced stages of ripening. Artificial autolytically active wall, prepared by permitting solubilized PG to bind to enzymically inactive wall from maturegreen fruit, released products which were similar in size characteristics to those recovered from active wall isolates. Extraction of wall-bound PG using high concentrations of NaCl (1.2 molar) did not attenuate subsequent autolytic activity but greatly suppressed the production of oligomeric and monomeric products. An examination of water-soluble uronic acids recovered from ripe pericarp tissue disclosed the presence of polymeric and monomeric uronic acids but only trace quantities of oligomers. The significance in autolytic reactions of enzyme quantity and distribution and their possible relevance to in vivo pectin degradation will be discussed. PMID:16666191

  8. Enzyme-catalyzed synthesis of aliphatic-aromatic oligoamides.

    PubMed

    Stavila, E; Alberda van Ekenstein, G O R; Loos, K

    2013-05-13

    Enzymatically catalyzed polycondensation of p-xylylenediamine and diethyl sebacate resulted in oligo(p-xylylene sebacamide) with high melting temperatures (223-230 °C) and the enzymatic polycondensation of dimethyl terephthalate and 1,8-diaminooctane leads to oligo(octamethylene terephthalamide) with two melting temperatures at 186 and 218 °C. No oligoamides, but products 1 and 2, were formed from the enzymatic reaction of dimethyl terephthalate and p-xylylenediamine. All reactions were catalyzed by CAL-B, icutinase, or CLEA cutinase. All reactions catalyzed by CAL-B show higher conversion than reactions catalyzed by icutinase or CLEA cutinase. The highest DPmax of 15 was achieved in a one-step and two-step synthesis of oligo(p-xylylene sebacamide) catalyzed by CLEA cutinase. PMID:23544613

  9. Prebiotic Amino Acid Thioester Synthesis: Thiol-Dependent Amino Acid Synthesis from Formose substrates (Formaldehyde and Glycolaldehyde) and Ammonia

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1998-01-01

    Formaldehyde and glycolaldehyde (substrates of the formose autocatalytic cycle) were shown to react with ammonia yielding alanine and homoserine under mild aqueous conditions in the presence of thiol catalysts. Since similar reactions carried out without ammonia yielded alpha-hydroxy acid thioesters, the thiol-dependent synthesis of alanine and homoserine is presumed to occur via amino acid thioesters-intermediates capable of forming peptides. A pH 5.2 solution of 20 mM formaldehyde, 20 mM glycolaldehyde, 20 mM ammonium chloride, 23 mM 3-mercaptopropionic acid, and 23 mM acetic acid that reacted for 35 days at 40 C yielded (based on initial formaldehyde) 1.8% alanine and 0.08% homoserine. In the absence of thiol catalyst, the synthesis of alanine and homoserine was negligible. Alanine synthesis required both formaldehyde and glycolaldehyde, but homoserine synthesis required only glycolaldehyde. At 25 days the efficiency of alanine synthesis calculated from the ratio of alanine synthesized to formaldehyde reacted was 2.1%, and the yield (based on initial formaldehyde) of triose and tetrose intermediates involved in alanine and homoserine synthesis was 0.3 and 2.1%, respectively. Alanine synthesis was also seen in similar reactions containing only 10 mM each of aldehyde substrates, ammonia, and thiol. The prebiotic significance of these reactions that use the formose reaction to generate sugar intermediates that are converted to reactive amino acid thioesters is discussed.

  10. Neurons expressing individual enzymes of dopamine synthesis in the mediobasal hypothalamus of adult rats: functional significance and topographic interrelations.

    PubMed

    Ugrumov, M; Taxi, J; Pronina, T; Kurina, A; Sorokin, A; Sapronova, A; Calas, A

    2014-09-26

    Besides dopaminergic (DA-ergic) neurons having all enzymes of DA synthesis, tyrosine hydroxylase (TH) and aromatic l-amino acid decarboxylase (AADC), "monoenzymatic" neurons expressing only one of them were found in the brain, mostly in the mediobasal hypothalamus (MBH). The aim of this study was to test our hypothesis that DA is synthesized by monoenzymatic neurons, i.e. l-3,4-dihydroxyphenylalanine (l-DOPA), which produced in the monoenzymatic TH neurons is transported in the monoenzymatic AADC neurons for DA synthesis. Incubation of MBH in Krebs-Ringer solution with l-leucine, a competitive inhibitor of l-DOPA uptake, was used to prevent a hypothetical l-DOPA capture into AADC-containing neurons. Incubation of the substantia nigra containing DA-ergic neurons under the same conditions served as the control. According to our data, the l-leucine administration provoked a decrease of DA concentration in MBH and in the incubation medium but not in the substantia nigra and respective incubation medium, showing a decrease of cooperative synthesis of DA in MBH. This conclusion was supported by an observation of higher concentration of l-DOPA in the incubation medium under perfusion of MBH with Krebs-Ringer solution containing tolcapone, an inhibitor of catechol-O-methyltransferase, and l-leucine than under perfusion with the same solution, but without l-leucine. Functional interaction between monoenzymatic TH and AADC neurons was indirectly confirmed by finding in electron microscopy their close relations in MBH. Besides monoenzymatic AADC neurons, any AADC-possessing neurons, catecholaminergic and serotoninergic, apparently, could participate in DA synthesis together with monoenzymatic TH neurons. This idea was confirmed by the observation of close topographic relations between monoenzymatic TH neurons and those containing both enzymes, i.e. DA-ergic, noradrenergic or adrenergic. Thus, monoenzymatic neurons possessing TH or AADC and being in close topographic relations

  11. Effect of glucagon on digestive enzyme synthesis, transport and secretion in mouse pancreatic acinar cells.

    PubMed Central

    Singh, M

    1980-01-01

    ). 7. It is concluded that glucagon increased digestive enzyme secretion from pancreatic acinar cells by a direct action (in contrast to its reported indirect effect in vivo) and decreased digestive enzyme synthesis. The data on transport and secretion do not support the suggested role of glucagon as an inhibitor in the intact animal. PMID:6162027

  12. Human fibroblast collagenase: glycosylation and tissue-specific levels of enzyme synthesis.

    PubMed Central

    Wilhelm, S M; Eisen, A Z; Teter, M; Clark, S D; Kronberger, A; Goldberg, G

    1986-01-01

    Human skin fibroblasts secrete collagenase as two proenzyme forms (57 and 52 kDa). The minor (57-kDa) proenzyme form is the result of a partial posttranslational modification of the major (52-kDa) proenzyme through the addition of N-linked complex oligosaccharides. Human endothelial cells as well as fibroblasts from human colon, cornea, gingiva, and lung also secrete collagenase in two forms indistinguishable from those of the skin fibroblast enzyme. In vitro tissue culture studies have shown that the level of constitutive synthesis of this fibroblast-type interstitial collagenase is tissue specific, varies widely, and correlates with the steady-state level of a single collagenase-specific mRNA of 2.5 kilobases. The tumor promoter, phorbol 12-myristate 13-acetate, apparently blocks the control of collagenase synthesis resulting in a similarly high level of collagenase expression (approximately equal to 3-7 micrograms of collagenase per 10(6) cells per 24 hr) in all examined cells. The constitutive level of synthesis of a 28-kDa collagenase inhibitor does not correlate with that of the enzyme. Phorbol 12-myristate 13-acetate stimulates the production of this inhibitor that in turn modulates the activity of collagenase in the conditioned media. As a result, the apparent activity of the enzyme present in the medium does not accurately reflect the rate of its synthesis and secretion. Images PMID:3012533

  13. Evolution of Abscisic Acid Synthesis and Signaling Mechanisms

    PubMed Central

    Hauser, Felix; Waadt, Rainer; Schroeder, Julian I.

    2011-01-01

    The plant hormone abscisic acid (ABA) mediates seed dormancy, controls seedling development and triggers tolerance to abiotic stresses, including drought. Core ABA signaling components consist of a recently identified group of ABA receptor proteins of the PYRABACTIN RESISTANCE (PYR)/REGULATORY COMPONENT OF ABA RECEPTOR (RCAR) family that act as negative regulators of members of the PROTEIN PHOSPHATASE 2C (PP2C) family. Inhibition of PP2C activity enables activation of SNF1-RELATED KINASE 2 (SnRK2) protein kinases, which target downstream components, including transcription factors, ion channels and NADPH oxidases. These and other components form a complex ABA signaling network. Here, an in depth analysis of the evolution of components in this ABA signaling network shows that (i) PYR/RCAR ABA receptor and ABF-type transcription factor families arose during land colonization of plants and are not found in algae and other species, (ii) ABA biosynthesis enzymes have evolved to plant- and fungal-specific forms, leading to different ABA synthesis pathways, (iii) existing stress signaling components, including PP2C phosphatases and SnRK kinases, were adapted for novel roles in this plant-specific network to respond to water limitation. In addition, evolutionarily conserved secondary structures in the PYR/RCAR ABA receptor family are visualized. PMID:21549957

  14. Increased Production of Fatty Acids and Triglycerides in Aspergillus oryzae by Enhancing Expressions of Fatty Acid Synthesis-Related Genes

    SciTech Connect

    Tamano, Koichi; Bruno, Kenneth S.; Karagiosis, Sue A.; Culley, David E.; Deng, Shuang; Collett, James R.; Umemura, Myco; Koike, Hideaki; Baker, Scott E.; Machida, Masa

    2013-01-01

    Microbial production of fats and oils is being developedas a means of converting biomass to biofuels. Here we investigate enhancing expression of enzymes involved in the production of fatty acids and triglycerides as a means to increase production of these compounds in Aspergillusoryzae. Examination of the A.oryzaegenome demonstrates that it contains twofatty acid synthases and several other genes that are predicted to be part of this biosynthetic pathway. We enhancedthe expressionof fatty acid synthesis-related genes by replacing their promoters with thepromoter fromthe constitutively highly expressedgene tef1. We demonstrate that by simply increasing the expression of the fatty acid synthasegenes we successfullyincreasedtheproduction of fatty acids and triglyceridesby more than two fold. Enhancement of expression of the fatty acid pathway genes ATP-citrate lyase and palmitoyl-ACP thioesteraseincreasedproductivity to a lesser extent.Increasing expression ofacetyl-CoA carboxylase caused no detectable change in fatty acid levels. Increases in message level for each gene were monitored usingquantitative real-time RT-PCR. Our data demonstrates that a simple increase in the abundance of fatty acid synthase genes can increase the detectable amount of fatty acids.

  15. Kinetic characteristics of polygalacturonase enzymes hydrolyzing galacturonic acid oligomers using isothermal titration calorimetry

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polygalacturonase enzymes hydrolyze the polygalacturonic acid chains found in pectin. Interest in polygalacturonase enzymes continues as they are useful in a number of industrial processes and conversely, detrimental, as they are involved in maceration of economically important crops. While a good...

  16. Lysophosphatidic acid synthesis and phospholipid metabolism in rat mast cells

    SciTech Connect

    Fagan, D.L.

    1986-01-01

    The role of lysophosphatidic acid in mast cell response to antigen was investigated using an isolated rat serosal mast cell model. The cells were incubated with monoclonal murine immunoglobulin E to the dinitrophenyl hapten and prelabeled with /sup 32/P-orthophosphate or /sup 3/H-fatty acids. Lysophosphatidic acid was isolated form cell extracts by 2-dimensional thin-layer chromatography, and the incorporated radioactivity was assessed by liquid scintillation counting. Lysophosphatidic acid labeling with /sup 32/P was increased 2-4 fold within 5 minutes after the addition of antigen or three other mast cell agonists. Functional group analyses unequivocally showed that the labeled compound was lysophosphatidic acid. Lysophosphatidic acid synthesis was dependent on the activity of diacylglycerol lipase, suggesting formation from monoacylglycerol. In addition, the studies of lysophosphatidic acid synthesis suggest that the addition of antigen to mast cells may initiate more than one route of phospholipid degradation and resynthesis. Whatever the origin of lysophosphatidic acid, the results of this study demonstrated that lysophosphatidic acid synthesis is stimulated by a variety of mast cell agonists. Dose-response, kinetic, and pharmacologic studies showed close concordance between histamine release and lysophosphatidic acid labeling responses. These observations provide strong evidence that lysophosphatidic acid plays an important role in mast cell activation.

  17. Effects of Non-Natural Amino Acid Incorporation into the Enzyme Core Region on Enzyme Structure and Function

    PubMed Central

    Wong, H. Edward; Kwon, Inchan

    2015-01-01

    Techniques to incorporate non-natural amino acids (NNAAs) have enabled biosynthesis of proteins containing new building blocks with unique structures, chemistry, and reactivity that are not found in natural amino acids. It is crucial to understand how incorporation of NNAAs affects protein function because NNAA incorporation may perturb critical function of a target protein. This study investigates how the site-specific incorporation of NNAAs affects catalytic properties of an enzyme. A NNAA with a hydrophobic and bulky sidechain, 3-(2-naphthyl)-alanine (2Nal), was site-specifically incorporated at six different positions in the hydrophobic core of a model enzyme, murine dihydrofolate reductase (mDHFR). The mDHFR variants with a greater change in van der Waals volume upon 2Nal incorporation exhibited a greater reduction in the catalytic efficiency. Similarly, the steric incompatibility calculated using RosettaDesign, a protein stability calculation program, correlated with the changes in the catalytic efficiency. PMID:26402667

  18. Oleochemical synthesis of an acid cleavable hydrophobe for surfactant use

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The synthesis of a series of branched hydroxy stearates from commercially available methyl oleate and common organic acids is reported. A variety of different acids, with 3 to 8 carbon atoms, and also varying in their branching and functionality, were used. The kinetics of the ring opening reactio...

  19. Cloning-independent expression and screening of enzymes using cell-free protein synthesis systems.

    PubMed

    Kwon, Yong-Chan; Song, Jae-Kwang; Kim, Dong-Myung

    2014-01-01

    We present a strategy for expression and screening of microbial enzymes without involving cloning procedures. Libraries of putative ω-transaminases (ω-TA) and mutated Candida antarctica lipase B (CalB) are PCR-amplified from bacterial colonies and directly expressed in an Escherichia coli-based cell-free protein synthesis system. The open nature of cell-free protein synthesis system also allows streamlined analysis of the enzymatic activity of the expressed enzymes, which greatly shortens the time required for enzyme screening. We expect that the proposed strategy will provide a universal platform for bridging the information gap between nucleotide sequence and protein function, in order to accelerate the discovery of novel enzymes. The proposed strategy can also serve as a viable option for the rapid and precise tuning of enzyme molecules, not only for analytical purposes, but also for industrial applications. This is accomplished via large-scale production using microbial cells transformed with variant genes selected from the cell-free expression screening. PMID:24395411

  20. Nucleic acid arrays and methods of synthesis

    DOEpatents

    Sabanayagam, Chandran R.; Sano, Takeshi; Misasi, John; Hatch, Anson; Cantor, Charles

    2001-01-01

    The present invention generally relates to high density nucleic acid arrays and methods of synthesizing nucleic acid sequences on a solid surface. Specifically, the present invention contemplates the use of stabilized nucleic acid primer sequences immobilized on solid surfaces, and circular nucleic acid sequence templates combined with the use of isothermal rolling circle amplification to thereby increase nucleic acid sequence concentrations in a sample or on an array of nucleic acid sequences.

  1. Lipoxygenase, a key enzyme in bioconversion of linoleic acid into trihydroxy-octadecenoic acid by Pseudomonas aeruginosa PR3

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Lipoxygenases catalyze the oxidation of unsaturated fatty acids with a (1Z,4Z)-pentadiene structure leading to the formation of conjugated (Z,E)-hydroperoxydienoic acids, which in turn result in production of hydroxy lipid. These enzymes are widely distributed in plants, animals, and microorganisms...

  2. Effect of n-3 and n-6 Polyunsaturated Fatty Acids on Microsomal P450 Steroidogenic Enzyme Activities and In Vitro Cortisol Production in Adrenal Tissue From Yorkshire Boars.

    PubMed

    Xie, Xuemei; Wang, Xudong; Mick, Gail J; Kabarowski, Janusz H; Wilson, Landon Shay; Barnes, Stephen; Walcott, Gregory P; Luo, Xiaoping; McCormick, Kenneth

    2016-04-01

    Dysregulation of adrenal glucocorticoid production is increasingly recognized to play a supportive role in the metabolic syndrome although the mechanism is ill defined. The adrenal cytochrome P450 (CYP) enzymes, CYP17 and CYP21, are essential for glucocorticoid synthesis. The omega-3 and omega-6 polyunsaturated fatty acids (PUFA) may ameliorate metabolic syndrome, but it is unknown whether they have direct actions on adrenal CYP steroidogenic enzymes. The aim of this study was to determine whether PUFA modify adrenal glucocorticoid synthesis using isolated porcine microsomes. The enzyme activities of CYP17, CYP21, 11β-hydroxysteroid dehydrogenase type 1, hexose-6-phosphate dehydrogenase (H6PDH), and CYP2E1 were measured in intact microsomes treated with fatty acids of disparate saturated bonds. Cortisol production was measured in a cell-free in vitro model. Microsomal lipid composition after arachidonic acid (AA) exposure was determined by sequential window acquisition of all theoretical spectra-mass spectrometry. Results showed that adrenal microsomal CYP21 activity was decreased by docosapentaenoic acid (DPA), docosahexaenoic acid (DHA), eicosapentaenoic acid, α-linolenic acid, AA, and linoleic acid, and CYP17 activity was inhibited by DPA, DHA, eicosapentaenoic acid, and AA. Inhibition was associated with the number of the PUFA double bonds. Similarly, cortisol production in vitro was decreased by DPA, DHA, and AA. Endoplasmic enzymes with intraluminal activity were unaffected by PUFA. In microsomes exposed to AA, the level of AA or oxidative metabolites of AA in the membrane was not altered. In conclusion, these observations suggest that omega-3 and omega-6 PUFA, especially those with 2 or more double bonds (DPA, DHA, and AA), impede adrenal glucocorticoid production. PMID:26889941

  3. Enzymatic acylation of di- and trisaccharides with fatty acids: choosing the appropriate enzyme, support and solvent.

    PubMed

    Plou, Francisco J; Cruces, M Angeles; Ferrer, Manuel; Fuentes, Gloria; Pastor, Eitel; Bernabé, Manuel; Christensen, Morten; Comelles, Francisco; Parra, José L; Ballesteros, Antonio

    2002-06-13

    Enzymatic synthesis of fatty acid esters of di- and trisaccharides is limited by the fact that most biological catalysts are inactivated by the polar solvents (e.g. dimethylsulfoxide, dimethylformamide) where these carbohydrates are soluble. This article reviews the methodologies developed to overcome this limitation, namely those involving control over the reaction medium, the enzyme and the support. We have proposed the use of mixtures of miscible solvents (e.g. dimethylsulfoxide and 2-methyl-2-butanol) as a general strategy to acylate enzymatically hydrophilic substrates. We observed that decreasing the hydrophobicity of the medium (i.e. lowering the percentage of DMSO) the molar ratio sucrose diesters versus sucrose monoesters can be substantially enhanced. The different regioselectivity exhibited by several lipases and proteases makes feasible to synthesise different positional isomers, whose properties may vary considerably. In particular, the lipase from Thermomyces lanuginosus displays a notable selectivity for only one hydroxyl group in the acylation of sucrose, maltose, leucrose and maltotriose, compared with lipase from Candida antarctica. We have examined three immobilisation methods (adsorption on polypropylene, covalent coupling to Eupergit C, and silica-granulation) for sucrose acylation catalysed by T. lanuginosus lipase. The morphology of the support affected significantly the reaction rate and/or the selectivity of the process. PMID:12142143

  4. EFFECT OF LEAD ON GAMMA AMINO BUTYRIC ACID SYNTHESIS

    EPA Science Inventory

    The project studies the inhibitory effect of lead on the enzymatic activity of brain glutamic amino acid decarboxylase (GADC). The enzyme is responsible for the catalytic formation of gamma amino butyric acid (GABA) inhibitory neurons which is believed to be involved with the tra...

  5. Crystal structure of MraY, an essential membrane enzyme for bacterial cell wall synthesis.

    PubMed

    Chung, Ben C; Zhao, Jinshi; Gillespie, Robert A; Kwon, Do-Yeon; Guan, Ziqiang; Hong, Jiyong; Zhou, Pei; Lee, Seok-Yong

    2013-08-30

    MraY (phospho-MurNAc-pentapeptide translocase) is an integral membrane enzyme that catalyzes an essential step of bacterial cell wall biosynthesis: the transfer of the peptidoglycan precursor phospho-MurNAc-pentapeptide to the lipid carrier undecaprenyl phosphate. MraY has long been considered a promising target for the development of antibiotics, but the lack of a structure has hindered mechanistic understanding of this critical enzyme and the enzyme superfamily in general. The superfamily includes enzymes involved in bacterial lipopolysaccharide/teichoic acid formation and eukaryotic N-linked glycosylation, modifications that are central in many biological processes. We present the crystal structure of MraY from Aquifex aeolicus (MraYAA) at 3.3 Å resolution, which allows us to visualize the overall architecture, locate Mg(2+) within the active site, and provide a structural basis of catalysis for this class of enzyme. PMID:23990562

  6. Improving polyketide and fatty acid synthesis by engineering of the yeast acetyl-CoA carboxylase.

    PubMed

    Choi, Jin Wook; Da Silva, Nancy A

    2014-10-10

    Polyketides and fatty acids are important in the production of pharmaceuticals, industrial chemicals, and biofuels. The synthesis of the malonyl-CoA building block, catalyzed by acetyl-CoA carboxylase (Acc1), is considered a limiting step to achieving high titers of polyketides and fatty acids in Saccharomyces cerevisiae. Acc1 is deactivated by AMP-activated serine/threonine protein kinase (Snf1) when glucose is depleted. To prevent this deactivation, the enzyme was aligned with the Rattus norvegicus (rat) Acc1 to identify a critical amino acid (Ser-1157) for phosphorylation and deactivation. Introduction of a S1157A mutation into Acc1 resulted in 9-fold higher specific activity following glucose depletion. The enzyme was tested in yeast engineered to produce the polyketide 6-methylsalisylic acid (6-MSA). Both 6-MSA and native fatty acid levels increased by 3-fold. Utilization of this modified Acc1 enzyme will also be beneficial for other products built from malonyl-CoA. PMID:25078432

  7. Stereoselective Synthesis of α-Amino-C-phosphinic Acids and Derivatives.

    PubMed

    Viveros-Ceballos, José Luis; Ordóñez, Mario; Sayago, Francisco J; Cativiela, Carlos

    2016-01-01

    α-Amino-C-phosphinic acids and derivatives are an important group of compounds of synthetic and medicinal interest and particular attention has been dedicated to their stereoselective synthesis in recent years. Among these, phosphinic pseudopeptides have acquired pharmacological importance in influencing physiologic and pathologic processes, primarily acting as inhibitors for proteolytic enzymes where molecular stereochemistry has proven to be critical. This review summarizes the latest developments in the asymmetric synthesis of acyclic and phosphacyclic α-amino-C-phosphinic acids and derivatives, following in the first case an order according to the strategy used, whereas for cyclic compounds the nitrogen embedding in the heterocyclic core is considered. In addition selected examples of pharmacological implications of title compounds are also disclosed. PMID:27589703

  8. A tailor-made chimeric thiamine diphosphate dependent enzyme for the direct asymmetric synthesis of (S)-benzoins.

    PubMed

    Westphal, Robert; Vogel, Constantin; Schmitz, Carlo; Pleiss, Jürgen; Müller, Michael; Pohl, Martina; Rother, Dörte

    2014-08-25

    Thiamine diphosphate dependent enzymes are well known for catalyzing the asymmetric synthesis of chiral α-hydroxy ketones from simple prochiral substrates. The steric and chemical properties of the enzyme active site define the product spectrum. Enzymes catalyzing the carboligation of aromatic aldehydes to (S)-benzoins have not so far been identified. We were able to close this gap by constructing a chimeric enzyme, which catalyzes the synthesis of various (S)-benzoins with excellent enantiomeric excess (>99%) and very good conversion. PMID:25044968

  9. Concise total synthesis of (±)-actinophyllic acid

    PubMed Central

    Granger, Brett A.; Jewett, Ivan T.; Butler, Jeffrey D.; Martin, Stephen F.

    2014-01-01

    A concise total synthesis of the complex indole alkaloid (±)-actinophyllic acid was accomplished by a sequence of reactions requiring only 10 steps from readily-available, known starting materials. The approach featured a Lewis acid-catalyzed cascade of reactions involving stabilized carbocations that delivered the tetracyclic core of the natural product in a single chemical operation. Optimal conversion of this key intermediate into (±)-actinophyllic acid required judicious selection of a protecting group strategy. PMID:24882888

  10. Solid Phase Synthesis of C-Terminal Boronic Acid Peptides.

    PubMed

    Behnam, Mira A M; Sundermann, Tom R; Klein, Christian D

    2016-05-01

    Peptides and peptidomimetics with a C-terminal boronic acid group have prolific applications in numerous fields of research, but their synthetic accessibility remains problematic. A convenient, high yield synthesis of peptide-boronic acids on a solid support is described here, using commercially available 1-glycerol polystyrene resin. The method is compatible with Fmoc chemistry and offers a versatile approach to aryl and alkyl aminoboronic acids without additional purification steps. PMID:27104613

  11. Fatty acid synthesis is inhibited by inefficient utilization of unusual fatty acids for glycerolipid assembly

    PubMed Central

    Bates, Philip D.; Johnson, Sean R.; Cao, Xia; Li, Jia; Nam, Jeong-Won; Jaworski, Jan G.; Ohlrogge, John B.; Browse, John

    2014-01-01

    Degradation of unusual fatty acids through β-oxidation within transgenic plants has long been hypothesized as a major factor limiting the production of industrially useful unusual fatty acids in seed oils. Arabidopsis seeds expressing the castor fatty acid hydroxylase accumulate hydroxylated fatty acids up to 17% of total fatty acids in seed triacylglycerols; however, total seed oil is also reduced up to 50%. Investigations into the cause of the reduced oil phenotype through in vivo [14C]acetate and [3H]2O metabolic labeling of developing seeds surprisingly revealed that the rate of de novo fatty acid synthesis within the transgenic seeds was approximately half that of control seeds. RNAseq analysis indicated no changes in expression of fatty acid synthesis genes in hydroxylase-expressing plants. However, differential [14C]acetate and [14C]malonate metabolic labeling of hydroxylase-expressing seeds indicated the in vivo acetyl–CoA carboxylase activity was reduced to approximately half that of control seeds. Therefore, the reduction of oil content in the transgenic seeds is consistent with reduced de novo fatty acid synthesis in the plastid rather than fatty acid degradation. Intriguingly, the coexpression of triacylglycerol synthesis isozymes from castor along with the fatty acid hydroxylase alleviated the reduced acetyl–CoA carboxylase activity, restored the rate of fatty acid synthesis, and the accumulation of seed oil was substantially recovered. Together these results suggest a previously unidentified mechanism that detects inefficient utilization of unusual fatty acids within the endoplasmic reticulum and activates an endogenous pathway for posttranslational reduction of fatty acid synthesis within the plastid. PMID:24398521

  12. Synthesis and preliminary biological evaluations of (+)-isocampholenic acid-derived amides.

    PubMed

    Grošelj, Uroš; Golobič, Amalija; Knez, Damijan; Hrast, Martina; Gobec, Stanislav; Ričko, Sebastijan; Svete, Jurij

    2016-08-01

    The synthesis of two novel (+)-isocampholenic acid-derived amines has been realized starting from commercially available (1S)-(+)-10-camphorsulfonic acid. The novel amines as well as (+)-isocampholenic acid have been used as building blocks in the construction of a library of amides using various aliphatic, aromatic, and amino acid-derived coupling partners using BPC and CDI as activating agents. Amide derivatives have been assayed against several enzymes that hold potential for the development of new drugs to battle bacterial infections and Alzheimer's disease. Compounds 20c and 20e showed promising selective sub-micromolar inhibition of human butyrylcholinesterase [Formula: see text] ([Formula: see text] values [Formula: see text] and [Formula: see text], respectively). PMID:27017352

  13. In vitro and in silico studies of the inhibitory effects of some novel kojic acid derivatives on tyrosinase enzyme

    PubMed Central

    Asadzadeh, Azizeh; Sirous, Hajar; Pourfarzam, Morteza; Yaghmaei, Parichehreh; Afshin, Fassihi

    2016-01-01

    Objective(s): Tyrosinase is a key enzyme in pigment synthesis. Overproduction of melanin in parts of the skin results in hyperpigmentation diseases. This enzyme is also responsible for the enzymatic browning in fruits and vegetables. Thus, its inhibitors are of great importance in the medical, cosmetic and agricultural fields. Materials and Methods: A series of twelve kojic acid derivatives were designed to be evaluated as tyrosinase activity inhibitors. The potential inhibitory activity of these compounds was investigated in silico using molecular docking simulation method. Four compounds with a range of predicted tyrosinase inhibitory activities were prepared and their inhibitory effect on tyrosinase activity was evaluated. The antioxidant properties of these compounds were also investigated by in vitro DPPH (2,2-diphenyl-1-picrylhydrazyl) and hydrogen peroxide scavenging assays. Results: Compound IIId exhibited the highest tyrosinase inhibitory activity with an IC50 value of 0.216 ± 0.009 mM which was in accordance with the in silico ΔGbind results (-13.24 Kcal/mol). Conclusion: Based on the docking studies, from the twelve compounds studied, one (IIId) appeared to have the highest inhibition on tyrosinase activity. This was confirmed by enzyme activity measurements. Compound IIId has an NO2 group which binds to both of Cu2+ ions located inside the active site of the enzyme. This compound appeared to be even stronger than kojic acid in inhibiting tyrosinase activity. The DPPH free radical scavenging ability of all the studied compounds was more than that of BHT. However, they were not as strong as BHT or gallic acid in scavenging hydrogen peroxide. PMID:27081457

  14. Effects of bile acid administration on bile acid synthesis and its circadian rhythm in man

    SciTech Connect

    Pooler, P.A.; Duane, W.C.

    1988-09-01

    In man bile acid synthesis has a distinct circadian rhythm but the relationship of this rhythm to feedback inhibition by bile acid is unknown. We measured bile acid synthesis as release of 14CO2 from (26-14C)cholesterol every 2 hr in three normal volunteers during five separate 24-hr periods. Data were fitted by computer to a cosine curve to estimate amplitude and acrophase of the circadian rhythm. In an additional six volunteers, we measured synthesis every 2 hr from 8:00 a.m. to 4:00 p.m. only. During the control period, amplitude (expressed as percentage of mean synthesis) averaged 52% and acrophase averaged 6:49 a.m. During administration of ursodeoxycholic acid (15 mg per kg per day), synthesis averaged 126% of baseline (p less than 0.1), amplitude averaged 43% and acrophase averaged 6:20 a.m. During administration of chenodeoxycholic acid (15 mg per kg per day), synthesis averaged 43% of baseline (p less than 0.001), amplitude averaged 53% and acrophase averaged 9:04 a.m. Addition of prednisone to this regimen of chenodeoxycholic acid to eliminate release of 14CO2 from corticosteroid hormone synthesis resulted in a mean amplitude of 62% and a mean acrophase of 6:50 a.m., values very similar to those in the baseline period. Administration of prednisone alone also did not significantly alter the baseline amplitude (40%) or acrophase (6:28 a.m.). We conclude that neither chenodeoxycholic acid nor ursodeoxycholic acid significantly alters the circadian rhythm of bile acid synthesis in man.

  15. Ketol-acid reductoisomerase enzymes and methods of use

    DOEpatents

    Govindarajan, Sridhar; Li, Yougen; Liao, Der-Ing; O'Keefe, Daniel P.; Minshull, Jeremy Stephen; Rothman, Steven Cary; Tobias, Alexander Vincent

    2016-07-12

    Provided herein are polypeptides having ketol-acid reductoisomerase activity as well as microbial host cells comprising such polypeptides. Polypeptides provided herein may be used in biosynthetic pathways, including, but not limited to, isobutanol biosynthetic pathways.

  16. Expression of the neurotransmitter-synthesizing enzyme glutamic acid decarboxylase in male germ cells.

    PubMed Central

    Persson, H; Pelto-Huikko, M; Metsis, M; Söder, O; Brene, S; Skog, S; Hökfelt, T; Ritzén, E M

    1990-01-01

    The gene encoding glutamic acid decarboxylase (GAD), the key enzyme in the synthesis of the inhibitory neurotransmitter gamma-aminobutyric acid, is shown to be expressed in the testis of several different species. Nucleotide sequence analysis of a cDNA clone isolated from the human testis confirmed the presence of GAD mRNA in the testis. The major GAD mRNA in the testis was 2.5 kilobases. Smaller amounts of a 3.7-kilobase mRNA with the same size as GAD mRNA in the brain was also detected in the testis. In situ hybridization using a GAD-specific probe revealed GAD mRNA expressing spermatocytes and spermatids located in the middle part of rat seminiferous tubules. Studies on the ontogeny of GAD mRNA expression showed low levels of GAD mRNA in testes of prepubertal rats, with increasing levels as sexual maturation is reached, compatible with GAD mRNA expression in germ cells. In agreement with this, fractionation of cells from the rat seminiferous epithelium followed by Northern (RNA) blot analysis showed the highest levels of GAD mRNA associated with spermatocytes and spermatids. Evidence for the presence of GAD protein in the rat testis was obtained from the demonstration of GAD-like immunoreactivity in seminiferous tubules, predominantly at a position where spermatids and spermatozoa are found. Furthermore, GAD-like immunoreactivity was seen in the midpiece of ejaculated human spermatozoa, the part that is responsible for generating energy for spermatozoan motility. Images PMID:1697032

  17. Metabolic Transformation of Mevalonic Acid by an Enzyme System from Peas 1

    PubMed Central

    Pollard, C. J.; Bonner, J.; Haagen-Smit, A. J.; Nimmo, C. C.

    1966-01-01

    En enzyme system has been found in peas which converts mevalonic acid to isoprenoid compounds. Among the intermediates in such conversion are mevalonic acid-5-phosphate and pyrophosphate, isopentenyl pyrophosphate and dimethylallylpyrophosphate. Among the products formed by the system are the pyrophosphates of geraniol, farnesol, nerolidol and higher isoprenoid alcohols. PMID:16656233

  18. Characterization of the Branched-Chain Amino Acid Aminotransferase Enzyme Family in Tomato1[W][OA

    PubMed Central

    Maloney, Gregory S.; Kochevenko, Andrej; Tieman, Denise M.; Tohge, Takayuki; Krieger, Uri; Zamir, Dani; Taylor, Mark G.; Fernie, Alisdair R.; Klee, Harry J.

    2010-01-01

    Branched-chain amino acids (BCAAs) are synthesized in plants from branched-chain keto acids, but their metabolism is not completely understood. The interface of BCAA metabolism lies with branched-chain aminotransferases (BCAT) that catalyze both the last anabolic step and the first catabolic step. In this study, six BCAT genes from the cultivated tomato (Solanum lycopersicum) were identified and characterized. SlBCAT1, -2, -3, and -4 are expressed in multiple plant tissues, while SlBCAT5 and -6 were undetectable. SlBCAT1 and -2 are located in the mitochondria, SlBCAT3 and -4 are located in chloroplasts, while SlBCAT5 and -6 are located in the cytosol and vacuole, respectively. SlBCAT1, -2, -3, and -4 were able to restore growth of Escherichia coli BCAA auxotrophic cells, but SlBCAT1 and -2 were less effective than SlBCAT3 and -4 in growth restoration. All enzymes were active in the forward (BCAA synthesis) and reverse (branched-chain keto acid synthesis) reactions. SlBCAT3 and -4 exhibited a preference for the forward reaction, while SlBCAT1 and -2 were more active in the reverse reaction. While overexpression of SlBCAT1 or -3 in tomato fruit did not significantly alter amino acid levels, an expression quantitative trait locus on chromosome 3, associated with substantially higher expression of Solanum pennellii BCAT4, did significantly increase BCAA levels. Conversely, antisense-mediated reduction of SlBCAT1 resulted in higher levels of BCAAs. Together, these results support a model in which the mitochondrial SlBCAT1 and -2 function in BCAA catabolism while the chloroplastic SlBCAT3 and -4 function in BCAA synthesis. PMID:20435740

  19. Inhibitors of the Hydrolytic Enzyme Dimethylarginine Dimethylaminohydrolase (DDAH): Discovery, Synthesis and Development.

    PubMed

    Murphy, Rhys B; Tommasi, Sara; Lewis, Benjamin C; Mangoni, Arduino A

    2016-01-01

    Dimethylarginine dimethylaminohydrolase (DDAH) is a highly conserved hydrolytic enzyme found in numerous species, including bacteria, rodents, and humans. In humans, the DDAH-1 isoform is known to metabolize endogenous asymmetric dimethylarginine (ADMA) and monomethyl arginine (l-NMMA), with ADMA proposed to be a putative marker of cardiovascular disease. Current literature reports identify the DDAH family of enzymes as a potential therapeutic target in the regulation of nitric oxide (NO) production, mediated via its biochemical interaction with the nitric oxide synthase (NOS) family of enzymes. Increased DDAH expression and NO production have been linked to multiple pathological conditions, specifically, cancer, neurodegenerative disorders, and septic shock. As such, the discovery, chemical synthesis, and development of DDAH inhibitors as potential drug candidates represent a growing field of interest. This review article summarizes the current knowledge on DDAH inhibition and the derived pharmacokinetic parameters of the main DDAH inhibitors reported in the literature. Furthermore, current methods of development and chemical synthetic pathways are discussed. PMID:27187323

  20. Cannabidiolic-acid synthase, the chemotype-determining enzyme in the fiber-type Cannabis sativa.

    PubMed

    Taura, Futoshi; Sirikantaramas, Supaart; Shoyama, Yoshinari; Yoshikai, Kazuyoshi; Shoyama, Yukihiro; Morimoto, Satoshi

    2007-06-26

    Cannabidiolic-acid (CBDA) synthase is the enzyme that catalyzes oxidative cyclization of cannabigerolic-acid into CBDA, the dominant cannabinoid constituent of the fiber-type Cannabis sativa. We cloned a novel cDNA encoding CBDA synthase by reverse transcription and polymerase chain reactions with degenerate and gene-specific primers. Biochemical characterization of the recombinant enzyme demonstrated that CBDA synthase is a covalently flavinylated oxidase. The structural and functional properties of CBDA synthase are quite similar to those of tetrahydrocannabinolic-acid (THCA) synthase, which is responsible for the biosynthesis of THCA, the major cannabinoid in drug-type Cannabis plants. PMID:17544411

  1. Synthesis of fatty acid ethyl esters in mammalian tissues after ethanol exposure: a systematic review of the literature.

    PubMed

    Zelner, Irene; Matlow, Jeremy N; Natekar, Aniket; Koren, Gideon

    2013-08-01

    The ability to undergo non-oxidative metabolism from ethanol to fatty acid ethyl esters (FAEEs) varies greatly among tissues and organs. To gain a greater understanding of non-oxidative ethanol metabolism to FAEE, we aimed to collect all published data on FAEE synthesis in mammalian organs and tissues to identify all tissues, organs, and enzymes that are known to, or likely possess FAEE-synthetic activity. A systematic search for relevant papers was performed and two independent reviewers examined potentially relevant abstracts (articles on FAEEs that pertain to ethanol exposure) to determine whether they met the inclusion criteria. Information on FAEE synthesis was retrieved from papers meeting the inclusion/exclusion criteria and summarized by organ/tissue/matrix examined. The systematic search through four databases yielded 78 articles that investigated FAEE synthesis by tissues, tissue fractions and cell lines, and 29 articles that attempted to purify and/or characterize the enzymes involved in FAEE synthesis. Two enzyme activities have been studied: FAEE synthase (FAEES, which conjugates ethanol and free fatty acid) and acyl-CoA: ethanol O-acyltransferase (AEAT, which conjugates ethanol and fatty acyl-CoA). Both activities are expressed by a variety of different enzymes. FAEES activity is the most widely studied and has been purified from several tissues and shown to be associated with several well-known enzymes, while the identity of enzymes possessing AEAT activity remains unknown. The organs and tissues that have been shown to synthesize FAEEs are discussed, with special emphasis on the studies that attempted to elucidate the enzymology of FAEE synthesis in those tissues. PMID:23713893

  2. Total synthesis of legionaminic acid as basis for serological studies.

    PubMed

    Matthies, Stefan; Stallforth, Pierre; Seeberger, Peter H

    2015-03-01

    Legionaminic acid is a nine-carbon diamino monosaccharide that is found coating the surface of various bacterial human pathogens. Its unique structure makes it a valuable biological probe, but access via isolation is difficult and no practical synthesis has been reported. We describe a stereoselective synthesis that yields a legionaminic acid building block as well as linker-equipped conjugation-ready legionaminic acid starting from cheap d-threonine. To set the desired amino and hydroxyl group pattern of the target, we designed a concise sequence of stereoselective reactions. The key transformations rely on chelation-controlled organometallic additions and a Petasis multicomponent reaction. The legionaminic acid was synthesized in a form that enables attachment to surfaces. Glycan microarray containing legionaminic acid revealed that human antibodies bind the synthetic glycoside. The synthetic bacterial monosaccharide is a valuable probe to detect an immune response to bacterial pathogens such as Legionella pneumophila, the causative agent of Legionnaire's disease. PMID:25668389

  3. Antitumor effects of a drug combination targeting glycolysis, glutaminolysis and de novo synthesis of fatty acids.

    PubMed

    Cervantes-Madrid, Diana; Dueñas-González, Alfonso

    2015-09-01

    There is a strong rationale for targeting the metabolic alterations of cancer cells. The most studied of these are the higher rates of glycolysis, glutaminolysis and de novo synthesis of fatty acids (FAs). Despite the availability of pharmacological inhibitors of these pathways, no preclinical studies targeting them simultaneously have been performed. In the present study it was determined whether three key enzymes for glycolysis, glutaminolysis and de novo synthesis of FAs, hexokinase-2, glutaminase and fatty acid synthase, respectively, were overexpressed as compared to primary fibroblasts. In addition, we showed that at clinically relevant concentrations lonidamine, 6-diazo-5-oxo-L-norleucine and orlistat, known inhibitors of the mentioned enzymes, exerted a cell viability inhibitory effect. Genetic downregulation of the three enzymes also reduced cell viability. The three drugs were highly synergistic when administered as a triple combination. Of note, the cytotoxicity of the triple combination was low in primary fibroblasts and was well tolerated when administered into healthy BALB/c mice. The results suggest the feasibility and potential clinical utility of the triple metabolic targeting which merits to be further studied by using either repositioned old drugs or newer, more selective inhibitors. PMID:26134042

  4. Synthesis of α-aminoboronic acids.

    PubMed

    Andrés, Patricia; Ballano, Gema; Calaza, M Isabel; Cativiela, Carlos

    2016-04-21

    This review describes available methods for the preparation of α-aminoboronic acids in their racemic or in their enantiopure form. Both, highly stereoselective syntheses and asymmetric procedures leading to the stereocontrolled generation of α-aminoboronic acid derivatives are included. The preparation of acyclic, carbocyclic and azacyclic α-aminoboronic acid derivatives is covered. Within each section, the different synthetic approaches have been classified according to the key bond which is formed to complete the α-aminoboronic acid skeleton. PMID:26853637

  5. Synthesis of Triamino Acid Building Blocks with Different Lipophilicities

    PubMed Central

    Maity, Jyotirmoy; Honcharenko, Dmytro; Strömberg, Roger

    2015-01-01

    To obtain different amino acids with varying lipophilicity and that can carry up to three positive charges we have developed a number of new triamino acid building blocks. One set of building blocks was achieved by aminoethyl extension, via reductive amination, of the side chain of ortnithine, diaminopropanoic and diaminobutanoic acid. A second set of triamino acids with the aminoethyl extension having hydrocarbon side chains was synthesized from diaminobutanoic acid. The aldehydes needed for the extension by reductive amination were synthesized from the corresponding Fmoc-L-2-amino fatty acids in two steps. Reductive amination of these compounds with Boc-L-Dab-OH gave the C4-C8 alkyl-branched triamino acids. All triamino acids were subsequently Boc-protected at the formed secondary amine to make the monomers appropriate for the N-terminus position when performing Fmoc-based solid-phase peptide synthesis. PMID:25876040

  6. Synthesis of monoacylglycerol containing pinolenic acid via stepwise esterification using a cold active lipase.

    PubMed

    Pyo, Young-Gil; Hong, Seung In; Kim, Yangha; Kim, Byung Hee; Kim, In-Hwan

    2012-01-01

    High purity monoacylglycerol (MAG) containing pinolenic acid was synthesized via stepwise esterification of glycerol and fatty acids from pine nut oil using a cold active lipase from Penicillium camembertii as a biocatalyst. Effects of temperature, molar ratio, water content, enzyme loading, and vacuum on the synthesis of MAG by lipase-catalyzed esterification of glycerol and fatty acid from pine nut oil were investigated. Diacylglycerol (DAG) as well as MAG increased significantly when temperature was increased from 20 to 40 °C. At a molar ratio of 1:1, MAG content decreased because of the significant increase in DAG content. Water has a profound influence on both MAG and DAG content through the entire course of reaction. The reaction rate increased significantly as enzyme loading increased up to 600 units. Vacuum was an effective method to reduce DAG content. The optimum temperature, molar ratio, water content, enzyme loading, vacuum, and reaction time were 20 °C, 1:5 (fatty acid to glycerol), 2%, 600 units, 5 torr, and 24 h, respectively. MAG content further increased via lipase-catalyzed second step esterification at subzero temperature. P. camembertii lipase exhibited esterification activity up to -30 °C. PMID:22753389

  7. Discrimination of acidic and alkaline enzyme using Chou's pseudo amino acid composition in conjunction with probabilistic neural network model.

    PubMed

    Khan, Zaheer Ullah; Hayat, Maqsood; Khan, Muazzam Ali

    2015-01-21

    Enzyme catalysis is one of the most essential and striking processes among of all the complex processes that have evolved in living organisms. Enzymes are biological catalysts, which play a significant role in industrial applications as well as in medical areas, due to profound specificity, selectivity and catalytic efficiency. Refining catalytic efficiency of enzymes has become the most challenging job of enzyme engineering, into acidic and alkaline. Discrimination of acidic and alkaline enzymes through experimental approaches is difficult, sometimes impossible due to lack of established structures. Therefore, it is highly desirable to develop a computational model for discriminating acidic and alkaline enzymes from primary sequences. In this study, we have developed a robust, accurate and high throughput computational model using two discrete sample representation methods Pseudo amino acid composition (PseAAC) and split amino acid composition. Various classification algorithms including probabilistic neural network (PNN), K-nearest neighbor, decision tree, multi-layer perceptron and support vector machine are applied to predict acidic and alkaline with high accuracy. 10-fold cross validation test and several statistical measures namely, accuracy, F-measure, and area under ROC are used to evaluate the performance of the proposed model. The performance of the model is examined using two benchmark datasets to demonstrate the effectiveness of the model. The empirical results show that the performance of PNN in conjunction with PseAAC is quite promising compared to existing approaches in the literature so for. It has achieved 96.3% accuracy on dataset1 and 99.2% on dataset2. It is ascertained that the proposed model might be useful for basic research and drug related application areas. PMID:25452135

  8. Intersection of RNA Processing and the Type II Fatty Acid Synthesis Pathway in Yeast Mitochondria▿

    PubMed Central

    Schonauer, Melissa S.; Kastaniotis, Alexander J.; Hiltunen, J. Kalervo; Dieckmann, Carol L.

    2008-01-01

    Distinct metabolic pathways can intersect in ways that allow hierarchical or reciprocal regulation. In a screen of respiration-deficient Saccharomyces cerevisiae gene deletion strains for defects in mitochondrial RNA processing, we found that lack of any enzyme in the mitochondrial fatty acid type II biosynthetic pathway (FAS II) led to inefficient 5′ processing of mitochondrial precursor tRNAs by RNase P. In particular, the precursor containing both RNase P RNA (RPM1) and tRNAPro accumulated dramatically. Subsequent Pet127-driven 5′ processing of RPM1 was blocked. The FAS II pathway defects resulted in the loss of lipoic acid attachment to subunits of three key mitochondrial enzymes, which suggests that the octanoic acid produced by the pathway is the sole precursor for lipoic acid synthesis and attachment. The protein component of yeast mitochondrial RNase P, Rpm2, is not modified by lipoic acid in the wild-type strain, and it is imported in FAS II mutant strains. Thus, a product of the FAS II pathway is required for RNase P RNA maturation, which positively affects RNase P activity. In addition, a product is required for lipoic acid production, which is needed for the activity of pyruvate dehydrogenase, which feeds acetyl-coenzyme A into the FAS II pathway. These two positive feedback cycles may provide switch-like control of mitochondrial gene expression in response to the metabolic state of the cell. PMID:18779316

  9. Lipase-catalyzed synthesis of fatty acid amide (erucamide) using fatty acid and urea.

    PubMed

    Awasthi, Neeraj Praphulla; Singh, R P

    2007-01-01

    Ammonolysis of fatty acids to the corresponding fatty acid amides is efficiently catalysed by Candida antartica lipase (Novozym 435). In the present paper lipase-catalysed synthesis of erucamide by ammonolysis of erucic acid and urea in organic solvent medium was studied and optimal conditions for fatty amides synthesis were established. In this process erucic acid gave 88.74 % pure erucamide after 48 hour and 250 rpm at 60 degrees C with 1:4 molar ratio of erucic acid and urea, the organic solvent media is 50 ml tert-butyl alcohol (2-methyl-2-propanol). This process for synthesis is economical as we used urea in place of ammonia or other amidation reactant at atmospheric pressure. The amount of catalyst used is 3 %. PMID:17898456

  10. A Condensing Enzyme from the Seeds of Lesquerella fendleri That Specifically Elongates Hydroxy Fatty Acids1

    PubMed Central

    Moon, Hangsik; Smith, Mark A.; Kunst, Ljerka

    2001-01-01

    Lesquerella fendleri seed oil contains up to 60% hydroxy fatty acids, nearly all of which is the 20-carbon hydroxy fatty acid lesquerolic acid (d-14-hydroxyeicos-cis-11-enoic acid). Previous work suggested that lesquerolic acid in L. fendleri was formed by the elongation of the 18-carbon hydroxy fatty acid, ricinoleic acid. To identify a gene encoding the enzyme involved in hydroxy fatty acid elongation, an L. fendleri genomic DNA library was screened using the coding region of the Arabidopsis Fatty Acid Elongation1 gene as a probe. A gene, LfKCS3, with a high sequence similarity to known very long-chain fatty acid condensing enzymes, was isolated. LfKCS3 has a 2,062-bp open reading frame interrupted by two introns, which encodes a polypeptide of 496 amino acids. LfKCS3 transcripts accumulated only in the embryos of L. fendleri and first appeared in the early stages of development. Fusion of the LfKCS3 promoter to the uidA reporter gene and expression in transgenic Arabidopsis resulted in a high level of β-glucuronidase activity exclusively in developing embryos. Seeds of Arabidopsis plants transformed with LfKCS3 showed no change in their very long-chain fatty acid content. However, when these Arabidopsis plants were crossed with the transgenic plants expressing the castor oleate 12-hydroxylase, significant amounts of 20-carbon hydroxy fatty acids accumulated in the seed, indicating that the LfKCS3 condensing enzyme specifically catalyzes elongation of 18-carbon hydroxy fatty acids. PMID:11743108

  11. The Catalytic Machinery of a Key Enzyme in Amino Acid Biosynthesis

    SciTech Connect

    Viola, Ronald E.; Faehnle, Christopher R.; Blanco, Julio; Moore, Roger A.; Liu, Xuying; Arachea, Buenafe T.; Pavlovsky, Alexander G.

    2013-02-28

    The aspartate pathway of amino acid biosynthesis is essential for all microbial life but is absent in mammals. Characterizing the enzyme-catalyzed reactions in this pathway can identify new protein targets for the development of antibiotics with unique modes of action. The enzyme aspartate {beta}-semialdehyde dehydrogenase (ASADH) catalyzes an early branch point reaction in the aspartate pathway. Kinetic, mutagenic, and structural studies of ASADH from various microbial species have been used to elucidate mechanistic details and to identify essential amino acids involved in substrate binding, catalysis, and enzyme regulation. Important structural and functional differences have been found between ASADHs isolated from these bacterial and fungal organisms, opening the possibility for developing species-specific antimicrobial agents that target this family of enzymes.

  12. The Catalytic Machinery of a Key Enzyme in Amino Acid Biosynthesis

    PubMed Central

    Viola, Ronald E.; Faehnle, Christopher R.; Blanco, Julio; Moore, Roger A.; Liu, Xuying; Arachea, Buenafe T.; Pavlovsky, Alexander G.

    2011-01-01

    The aspartate pathway of amino acid biosynthesis is essential for all microbial life but is absent in mammals. Characterizing the enzyme-catalyzed reactions in this pathway can identify new protein targets for the development of antibiotics with unique modes of action. The enzyme aspartate β-semialdehyde dehydrogenase (ASADH) catalyzes an early branch point reaction in the aspartate pathway. Kinetic, mutagenic, and structural studies of ASADH from various microbial species have been used to elucidate mechanistic details and to identify essential amino acids involved in substrate binding, catalysis, and enzyme regulation. Important structural and functional differences have been found between ASADHs isolated from these bacterial and fungal organisms, opening the possibility for developing species-specific antimicrobial agents that target this family of enzymes. PMID:22332000

  13. The catalytic machinery of a key enzyme in amino Acid biosynthesis.

    PubMed

    Viola, Ronald E; Faehnle, Christopher R; Blanco, Julio; Moore, Roger A; Liu, Xuying; Arachea, Buenafe T; Pavlovsky, Alexander G

    2011-01-01

    The aspartate pathway of amino acid biosynthesis is essential for all microbial life but is absent in mammals. Characterizing the enzyme-catalyzed reactions in this pathway can identify new protein targets for the development of antibiotics with unique modes of action. The enzyme aspartate β-semialdehyde dehydrogenase (ASADH) catalyzes an early branch point reaction in the aspartate pathway. Kinetic, mutagenic, and structural studies of ASADH from various microbial species have been used to elucidate mechanistic details and to identify essential amino acids involved in substrate binding, catalysis, and enzyme regulation. Important structural and functional differences have been found between ASADHs isolated from these bacterial and fungal organisms, opening the possibility for developing species-specific antimicrobial agents that target this family of enzymes. PMID:22332000

  14. Comparison of bile acid synthesis determined by isotope dilution versus fecal acidic sterol output in human subjects

    SciTech Connect

    Duane, W.C.; Holloway, D.E.; Hutton, S.W.; Corcoran, P.J.; Haas, N.A.

    1982-05-01

    Fecal acidic sterol output has been found to be much lower than bile acid synthesis determined by isotope dilution. Because of this confusing discrepancy, we compared these 2 measurements done simultaneously on 13 occasions in 5 normal volunteers. In contrast to previous findings, bile acid synthesis by the Lindstedt isotope dilution method averaged 16.3% lower than synthesis simultaneously determined by fecal acidic sterol output (95% confidence limit for the difference - 22.2 to -10.4%). When one-sample determinations of bile acid pools were substituted for Lindstedt pools, bile acid synthesis by isotope dilution averaged 5.6% higher than synthesis by fecal acidic sterol output (95% confidence limits -4.9 to 16.1%). These data indicate that the 2 methods yield values in reasonably close agreement with one another. If anything, fecal acidic sterol outputs are slightly higher than synthesis by isotope dilution.

  15. Synthesis of biobased succinonitrile from glutamic acid and glutamine.

    PubMed

    Lammens, Tijs M; Le Nôtre, Jérôme; Franssen, Maurice C R; Scott, Elinor L; Sanders, Johan P M

    2011-06-20

    Succinonitrile is the precursor of 1,4-diaminobutane, which is used for the industrial production of polyamides. This paper describes the synthesis of biobased succinonitrile from glutamic acid and glutamine, amino acids that are abundantly present in many plant proteins. Synthesis of the intermediate 3-cyanopropanoic amide was achieved from glutamic acid 5-methyl ester in an 86 mol% yield and from glutamine in a 56 mol % yield. 3-Cyanopropanoic acid can be converted into succinonitrile, with a selectivity close to 100% and a 62% conversion, by making use of a palladium(II)-catalyzed equilibrium reaction with acetonitrile. Thus, a new route to produce biobased 1,4-diaminobutane has been discovered. PMID:21557494

  16. Functional diversification of two UGT80 enzymes required for steryl glucoside synthesis in Arabidopsis

    PubMed Central

    Stucky, Daniel F.; Arpin, James C.

    2015-01-01

    Steryl glucosides (SG) are abundant steroid conjugates in plant membranes. Beyond structural roles in lipid bilayers, functions in sugar transport, storage, and/or signalling are predicted. UDP-glucose:sterol glucosyltransferase 80A2 (UGT80A2) and UGT80B1, which share similarity to fungal counterparts, are implicated in SG synthesis in Arabidopsis thaliana. A third related enzyme, which seems specific to the plant lineage, is encoded by UGT713B1/At5g24750. Genetic and biochemical approaches were employed to determine the role of each UGT gene in the production of specific SGs and acyl SGs (ASGs). Using direct infusion electrospray ionization tandem mass spectrometry (ESI-MS/MS), SG and acyl SG (ASG) contents of ugt80 and ugt713 mutants, and triple and double mutants were profiled in seeds. In vitro enzyme assays were performed to assay substrate preferences. Both UGT80A2 and UGT80B1, but not UGT713B1 were shown to be coordinately down-regulated during seed imbibition when SG levels decline, consistent with similar functions as UGT80 enzymes. UGT80A2 was found to be required for normal levels of major SGs in seeds, whereas UGT80B1 is involved in accumulation of minor SG and ASG compounds. Although the results demonstrate specific activities for UGT80A2 and UGT80B1, a role for UGT713B1 in SG synthesis was not supported. The data show that UGT80A2, the more highly conserved enzyme, is responsible for the bulk production of SGs in seeds, whereas UGT80B1 plays a critical accessory role. This study extends our knowledge of UGT80 enzymes and provides evidence for specialized functions for distinct classes of SG and ASG molecules in plants. PMID:25316063

  17. Influence of light on the free amino acid content and γ-aminobutyric acid synthesis in Brassica juncea seedlings.

    PubMed

    Li, Xiaohua; Kim, Yeon Bok; Uddin, Md Romij; Lee, Sanghyun; Kim, Sun-Ju; Park, Sang Un

    2013-09-11

    Glutamate decarboxylase (GAD; EC 4.1.1.15) is an important enzyme in γ-aminobutyric acid (GABA) biosynthesis. Here we report the influence of light on amino acid accumulation and investigate the molecular mechanism by which light influences GABA biosynthesis at the seedling stage of two mustard (Brassica juncea) cultivars (green-leaf and purple-leaf). Gene expression profiles of four GAD-encoding genes (GAD1, GAD2, GAD4a, and GAD4b) and their impact on GABA biosynthesis were analyzed. Light exerted an obvious influence on amino acid accumulation in mustard seedlings. GAD gene expression was also significantly regulated by light/dark or dark treatment, which differentially regulated GABA biosynthesis in B. juncea seedlings. High-performance liquid chromatography (HPLC) revealed that the seeds of purple cultivars contain a higher amount of free amino acids and GABA than do the seeds of green cultivars. After seed germination, however, the accumulation of free amino acids peaked in dark-treated seedlings on day 9 in both cultivars, whereas GABA synthesis peaked at 9 days under light conditions. This study may provide a foundation for understanding the effect of light on amino acids, particularly GABA biosynthesis in Brassica plants. PMID:23909820

  18. Oxidase-peroxidase enzymes of Datura innoxia. Oxidation of formylphenylacetic acid ethyl ester.

    PubMed Central

    Kalyanaraman, V S; Mahadevan, S; Kumar, S A

    1975-01-01

    An enzyme system from Datura innoxia roots oxidizing formylphenylacetic acid ethyl ester was purified 38-fold by conventional methods such as (NH4)2SO4 fractionation, negative adsorption on alumina Cy gel and chromatography on DEAE-cellulose. The purified enzyme was shown to catalyse the stoicheiometric oxidation of formylphenylacetic acid ethyl ester to benzoylformic acid ethyl ester and formic acid, utilizing molecular O2. Substrate analogues such as phenylacetaldehyde and phenylpyruvate were oxidized at a very low rate, and formylphenylacetonitrile was an inhilating agents, cyanide, thiol compounds and ascorbic acid. This enzyme was identical with an oxidase-peroxidase isoenzyme. Another oxidase-peroxidase isoenzyme which separated on DEAE-chromatography also showed formylphenylacetic acid ethyl ester oxidase activity, albeit to a lesser extent. The properties of the two isoenzymes of the oxidase were compared and shown to differ in their oxidation and peroxidation properties. The oxidation of formylphenylacetic acid ethyl ester was also catalysed by horseradish peroxidase. The Datura isoenzymes exhibited typical haemoprotein spectra. The oxidation of formylphenylacetic acid ethyl ester was different from other peroxidase-catalysed reactions in not being activated by either Mn2+ or monophenols. The oxidation was inhibited by several mono- and poly-phenols and by catalase. A reaction mechanism for the oxidation is proposed. PMID:997

  19. Creation of a Broad-Range and Highly Stereoselective d-Amino Acid Dehydrogenase for the One-Step Synthesis of d-Amino Acids

    PubMed Central

    Vedha-Peters, Kavitha; Gunawardana, Manjula; Rozzell, J. David; Novick, Scott J.

    2008-01-01

    Using both rational and random mutagenesis, we have created the first known broad substrate range, nicotinamide cofactor dependent, and highly stereoselective d-amino acid dehydrogenase. This new enzyme is capable of producing d-amino acids via the reductive amination of the corresponding 2-keto acid with ammonia. This biocatalyst was the result of three rounds of mutagenesis and screening performed on the enzyme meso-diaminopimelate d-dehydrogenase. The first round targeted the active site of the wild-type enzyme and produced mutants that were no longer strictly dependent on the native substrate. The second and third rounds produced mutants that had an increased substrate range including straight- and branched-aliphatic amino acids and aromatic amino acids. The very high selectivity towards the d-enantiomer (95 to > 99% e.e) was shown to be preserved even after the addition of the five mutations found in the three rounds of mutagenesis and screening. This new enzyme could complement and improve upon current methods for d-amino acid synthesis. PMID:16910688

  20. Antioxidant activity and enzyme inhibition of phenolic acids from fermented rice bran with fungus Rizhopus oryzae.

    PubMed

    Schmidt, Cristiano G; Gonçalves, Letícia M; Prietto, Luciana; Hackbart, Helen S; Furlong, Eliana B

    2014-03-01

    The solid-state fermentation (SSF) has been employed as a form making available a higher content of functional compounds from agroindustrial wastes. In this work, the effect of SSF with the Rhizopus oryzae fungus on the phenolic acid content of rice bran was studied. Phenolic extracts derived from rice bran and fermented rice bran were evaluated for their ability to reduce free radical 1,1-diphenyl-2-picrihidrazil (DPPH) and for the ability to inhibit the enzymes peroxidase and polyphenol oxidase. The phenolic compound content increased by more than two times with fermentation. A change in the content of phenolic acids was observed, with ferulic acid presenting the greatest increase with the fermentation, starting from 33μg/g in rice bran and reaching 765μg/g in the fermented bran. [corrected]. The phenolic extracts showed an inhibition potential for DPPH and for the peroxidase enzyme, however did not inhibit the polyphenol oxidase enzyme. PMID:24176356

  1. By-products of electrochemical synthesis of suberic acid

    SciTech Connect

    Shirobokova, O.I.; Adamov, A.A.; Freidlin, G.N.; Antonenko, N.S.; Grudtsyn, Yu.D.

    1988-05-10

    By-products of the electrochemical synthesis of dimethyl suberate from glutaric anhydride were studied. This is isolated by thermal dehydration of a mixture of lower dicarboxylic acids that are wastes from the production of adipic acid. To isolate the by-products, they used the methods of vacuum rectification and preparative gas-liquid chromatography, and for their identification, PMR, IR spectroscopy, gas-liquid chromatography, and other known physicochemical methods of investigation.

  2. Stereoselective synthesis of unsaturated α-amino acids.

    PubMed

    Fanelli, Roberto; Jeanne-Julien, Louis; René, Adeline; Martinez, Jean; Cavelier, Florine

    2015-06-01

    Stereoselective synthesis of unsaturated α-amino acids was performed by asymmetric alkylation. Two methods were investigated and their enantiomeric excess measured and compared. The first route consisted of an enantioselective approach induced by the Corey-Lygo catalyst under chiral phase transfer conditions while the second one involved the hydroxypinanone chiral auxiliary, both implicating Schiff bases as substrate. In all cases, the use of a prochiral Schiff base gave higher enantiomeric excess and yield in the final desired amino acid. PMID:25715756

  3. Cell Wall Polymers of Bacillus sphaericus: Activities of Enzymes Involved in Peptidoglycan Precursor Synthesis During Sporulation

    PubMed Central

    Linnett, Paul E.; Tipper, Donald J.

    1974-01-01

    In synchronously sporulating cells of Bacillus sphaericus 9602, the specific activities of those enzymes specifically required for the synthesis of the UDP-N-acetyl-muramyl-pentapeptide precursor of vegetative cell wall peptidoglycan decay by 50% after the end of exponential cell division, probably as a consequence of dilution by newly synthesized protein. The meso-diaminopimelate ligase is the only new activity whose synthesis is required for synthesis of the nucleotide-pentapeptide precursor of spore cortex peptidoglycan. The addition of d-Ala-d-Ala to the nucleotide tripeptide is catalyzed by an enzyme present in both vegetative and sporulating cells, which apparently does not discriminate between lysine- and diaminopimelate-containing acceptors. The activities of the l-Ala and d-Ala-d-Ala ligases and of the d-Ala-d-Ala synthetase increases in parallel with the appearance of the diaminopimelate ligase, indicating coordinate derepression and suggesting operon-like organization of the appropriate structural genes. PMID:4417383

  4. Enzyme-entrapped mesoporous silica for treatment of uric acid disorders.

    PubMed

    Muthukoori, Shanthini; Narayanan, Naagarajan; Chandra, Manuguri Sesha Sarath; Sethuraman, Swaminathan; Krishnan, Uma Maheswari

    2013-05-01

    Gout is an abnormality in the body resulting in the accumulation of uric acid mainly in joints. Dissolution of uric acid crystals into soluble allantoin by the enzyme uricase might provide a better alternative for the treatment of gout. This work aims to investigate the feasibility of a transdermal patch loaded with uricase for better patient compliance. Mesoporous silica (SBA-15) was chosen as the matrix for immobilisation of uricase. Highly oriented mesoporous SBA-15 was synthesized, characterized and uricase was physisorbed in the mesoporous material. The percentage adsorption and release of enzyme in borate buffer was monitored. The release followed linear kinetics and greater than 80% enzyme activity was retained indicating the potential of this system as an effective enzyme immobilization matrix. The enzyme permeability was studied with Wistar rat skin and human cadaver skin. It was found that in case of untreated rat skin 10% of enzyme permeated through skin in 100 h. The permeation increased by adding permeation enhancer (combination of oleic acid in propylene glycol (OA in PG)). The permeation enhancement was studied under two concentrations of OA in PG (1%, 5%) in both rat and human cadaver skin and it was found that 1% OA in PG showed better result in rat skin and 5% OA in PG showed good results in human cadaver skin. PMID:23802423

  5. Characterization of the heme synthesis enzyme coproporphyrinogen oxidase (CPO) in zebrafish erythrogenesis.

    PubMed

    Hanaoka, Ryuki; Katayama, Shiori; Dawid, Igor B; Kawahara, Atsuo

    2006-03-01

    Hemoglobin consists of heme and globin proteins and is essential for oxygen transport in all vertebrates. Although biochemical features of heme synthesis enzymes have been well characterized, the function of these enzymes in early embryogenesis is not fully understood. We found that the sixth heme synthesis enzyme, coproporphyrinogen oxidase (CPO), is predominantly expressed in the intermediate cell mass (ICM) that is a major site of zebrafish primitive hematopoiesis. Knockdown of zebrafish CPO using anti-sense morpholinos (CPO-MO) leads to a significant suppression of hemoglobin production without apparent reduction of blood cells. Injection of human CPO RNA, but not a mutant CPO RNA that is similar to a mutant responsible for a hereditary coproporphyria (HCP), restores hemoglobin production in the CPO-MO-injected embryos. Furthermore, expression of CPO in the ICM is severely suppressed in both vlad tepes/gata1 mutants and in biklf-MO-injected embryos. In contrast, over-expression of biklf and gata1 significantly induces ectopic CPO expression. The function of CPO in heme biosynthesis is apparently conserved between zebrafish and human, suggesting that CPO-MO-injected zebrafish embryos might be a useful in vivo assay system to measure the biological activity of human CPO mutations. PMID:16483317

  6. The spark discharge synthesis of amino acids from various hydrocarbons

    NASA Technical Reports Server (NTRS)

    Ring, D.; Miller, S. L.

    1984-01-01

    The spark discharge synthesis of amino acids using an atmosphere of CH4+N2+H2O+NH3 has been investigated with variable pNH3. The amino acids produced using higher hydrocarbons (ethane, ethylene, acetylene, propane, butane, and isobutane) instead of CH4 were also investigated. There was considerable range in the absolute yields of amino acids, but the yields relative to glycine (or alpha-amino-n-butyric acid) were more uniform. The relative yields of the C3 to C6 aliphatic alpha-amino acids are nearly the same (with a few exceptions) with all the hydrocarbons. The glycine yields are more variable. The precursors to the C3-C6 aliphatic amino acids seem to be produced in the same process, which is separate from the synthesis of glycine precursors. It may be possible to use these relative yields as a signature for a spark discharge synthesis provided corrections can be made for subsequent decomposition events (e.g. in the Murchison meteorite).

  7. Δ(9)-Tetrahydrocannabinolic acid synthase production in Pichia pastoris enables chemical synthesis of cannabinoids.

    PubMed

    Lange, Kerstin; Schmid, Andreas; Julsing, Mattijs K

    2015-10-10

    Δ(9)-Tetrahydrocannabinol (THC) is of increasing interest as a pharmaceutical and bioactive compound. Chemical synthesis of THC uses a laborious procedure and does not satisfy the market demand. The implementation of biocatalysts for specific synthesis steps might be beneficial for making natural product availability independent from the plant. Δ(9)-Tetrahydrocannabinolic acid synthase (THCAS) from C. sativa L. catalyzes the cyclization of cannabigerolic acid (CBGA) to Δ(9)-tetrahydrocannabinolic acid (THCA), which is non-enzymatically decarboxylated to THC. We report the preparation of THCAS in amounts sufficient for the biocatalytic production of THC(A). Active THCAS was most efficiently obtained from Pichia pastoris. THCAS was produced on a 2L bioreactor scale and the enzyme was isolated by single-step chromatography with a specific activity of 73Ug(-1)total protein. An organic/aqueous two-liquid phase setup for continuous substrate delivery facilitated in situ product removal. In addition, THCAS activity in aqueous environments lasted for only 20min whereas the presence of hexane stabilized the activity over 3h. In conclusion, production of THCAS in P. pastoris Mut(S) KM71 KE1, subsequent isolation, and its application in a two-liquid phase setup enables the synthesis of THCA on a mg scale. PMID:26197418

  8. Synthesis of monomethyl 5,5'-dehydrodiferulic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Synthesis of the internal reference compound, monomethyl 5,5’-dehydrodiferulic acid, is described. The synthetic scheme relies on a selective monomethylation of the known compound 5,5-dehydrodivanillin, followed by elaboration into the dehydrodiferulic framework through a dual Horner-Emmons-Wadswort...

  9. Enantioselective synthesis of isotopically labeled homocitric acid lactone.

    PubMed

    Moore, Jared T; Hanhan, Nadine V; Mahoney, Maximillian E; Cramer, Stephen P; Shaw, Jared T

    2013-11-15

    A concise synthesis of homocitric acid lactone was developed to accommodate systematic placement of carbon isotopes (specifically (13)C) for detailed studies of this cofactor. This new route uses a chiral allylic alcohol, available in multigram quantities from enzymatic resolution, as a starting material, which transposes asymmetry through an Ireland-Claisen rearrangement. PMID:24180620

  10. Amino acid metabolism and protein synthesis in malarial parasites*

    PubMed Central

    Sherman, I. W.

    1977-01-01

    Malaria-infected red cells and free parasites have limited capabilities for the biosynthesis of amino acids. Therefore, the principal amino acid sources for parasite protein synthesis are the plasma free amino acids and host cell haemoglobin. Infected cells and plasmodia incorporate exogenously supplied amino acids into protein. However, the hypothesis that amino acid utilization (from an external source) is related to availability of that amino acid in haemoglobin is without universal support: it is true for isoleucine and for Plasmodium knowlesi and P. falciparum, but not for methionine, cysteine, and other amino acids, and it does not apply to P. lophurae. More by default than by direct evidence, haemoglobin is believed to be the main amino acid reservoir available to the intraerythrocytic plasmodium. Haemoglobin, ingested via the cytostome, is held in food vacuoles where auto-oxidation takes place. As a consequence, haem is released and accumulates in the vacuole as particulate haemozoin (= malaria pigment). Current evidence favours the view that haemozoin is mainly haematin. Acid and alkaline proteases (identified in crude extracts from mammalian and avian malarias) are presumably secreted directly into the food vacuole. They then digest the denatured globin and the resulting amino acids are incorporated into parasite protein. Cell-free protein synthesizing systems have been developed using P. knowlesi and P. lophurae ribosomes. In the main these systems are typically eukaryotic. Studies of amino acid metabolism are exceedingly limited. Arginine, lysine, methionine, and proline are incorporated into protein, whereas glutamic acid is metabolized via an NADP-specific glutamic dehydrogenase. Glutamate oxidation generates NADPH and auxiliary energy (in the form of α-ketoglutarate). The role of red cell glutathione in the economy of the parasite remains obscure. Important goals for future research should be: quantitative assessment of the relative importance of

  11. Crystal Structure of TDP-Fucosamine Acetyl Transferase (WECD) from Escherichia Coli, an Enzyme Required for Enterobacterial Common Antigen Synthesis

    SciTech Connect

    Hung,M.; Rangarajan, E.; Munger, C.; Nadeau, G.; Sulea, T.; Matte, A.

    2006-01-01

    Enterobacterial common antigen (ECA) is a polysaccharide found on the outer membrane of virtually all gram-negative enteric bacteria and consists of three sugars, N-acetyl-D-glucosamine, N-acetyl-D-mannosaminuronic acid, and 4-acetamido-4,6-dideoxy-D-galactose, organized into trisaccharide repeating units having the sequence {yields}(3)-{alpha}-D-Fuc4NAc-(1{yields}4)-{beta}-D-ManNAcA-(1{yields}4)-{alpha}-D-GlcNAc-(1{yields}). While the precise function of ECA is unknown, it has been linked to the resistance of Shiga-toxin-producing Escherichia coli (STEC) O157:H7 to organic acids and the resistance of Salmonella enterica to bile salts. The final step in the synthesis of 4-acetamido-4,6-dideoxy-D-galactose, the acetyl-coenzyme A (CoA)-dependent acetylation of the 4-amino group, is carried out by TDP-fucosamine acetyltransferase (WecD). We have determined the crystal structure of WecD in apo form at a 1.95-Angstroms resolution and bound to acetyl-CoA at a 1.66-Angstroms resolution. WecD is a dimeric enzyme, with each monomer adopting the GNAT N-acetyltransferase fold, common to a number of enzymes involved in acetylation of histones, aminoglycoside antibiotics, serotonin, and sugars. The crystal structure of WecD, however, represents the first structure of a GNAT family member that acts on nucleotide sugars. Based on this cocrystal structure, we have used flexible docking to generate a WecD-bound model of the acetyl-CoA-TDP-fucosamine tetrahedral intermediate, representing the structure during acetyl transfer. Our structural data show that WecD does not possess a residue that directly functions as a catalytic base, although Tyr208 is well positioned to function as a general acid by protonating the thiolate anion of coenzyme A.

  12. d-Amino Acids Indirectly Inhibit Biofilm Formation in Bacillus subtilis by Interfering with Protein Synthesis

    PubMed Central

    Leiman, Sara A.; May, Janine M.; Lebar, Matthew D.; Kahne, Daniel; Kolter, Roberto

    2013-01-01

    The soil bacterium Bacillus subtilis forms biofilms on surfaces and at air-liquid interfaces. It was previously reported that these biofilms disassemble late in their life cycle and that conditioned medium from late-stage biofilms inhibits biofilm formation. Such medium contained a mixture of d-leucine, d-methionine, d-tryptophan, and d-tyrosine and was reported to inhibit biofilm formation via the incorporation of these d-amino acids into the cell wall. Here, we show that l-amino acids were able to specifically reverse the inhibitory effects of their cognate d-amino acids. We also show that d-amino acids inhibited growth and the expression of biofilm matrix genes at concentrations that inhibit biofilm formation. Finally, we report that the strain routinely used to study biofilm formation has a mutation in the gene (dtd) encoding d-tyrosyl-tRNA deacylase, an enzyme that prevents the misincorporation of d-amino acids into protein in B. subtilis. When we repaired the dtd gene, B. subtilis became resistant to the biofilm-inhibitory effects of d-amino acids without losing the ability to incorporate at least one noncanonical d-amino acid, d-tryptophan, into the peptidoglycan peptide side chain. We conclude that the susceptibility of B. subtilis to the biofilm-inhibitory effects of d-amino acids is largely, if not entirely, due to their toxic effects on protein synthesis. PMID:24097941

  13. D-amino acids indirectly inhibit biofilm formation in Bacillus subtilis by interfering with protein synthesis.

    PubMed

    Leiman, Sara A; May, Janine M; Lebar, Matthew D; Kahne, Daniel; Kolter, Roberto; Losick, Richard

    2013-12-01

    The soil bacterium Bacillus subtilis forms biofilms on surfaces and at air-liquid interfaces. It was previously reported that these biofilms disassemble late in their life cycle and that conditioned medium from late-stage biofilms inhibits biofilm formation. Such medium contained a mixture of D-leucine, D-methionine, D-tryptophan, and D-tyrosine and was reported to inhibit biofilm formation via the incorporation of these D-amino acids into the cell wall. Here, we show that L-amino acids were able to specifically reverse the inhibitory effects of their cognate D-amino acids. We also show that D-amino acids inhibited growth and the expression of biofilm matrix genes at concentrations that inhibit biofilm formation. Finally, we report that the strain routinely used to study biofilm formation has a mutation in the gene (dtd) encoding D-tyrosyl-tRNA deacylase, an enzyme that prevents the misincorporation of D-amino acids into protein in B. subtilis. When we repaired the dtd gene, B. subtilis became resistant to the biofilm-inhibitory effects of D-amino acids without losing the ability to incorporate at least one noncanonical D-amino acid, D-tryptophan, into the peptidoglycan peptide side chain. We conclude that the susceptibility of B. subtilis to the biofilm-inhibitory effects of D-amino acids is largely, if not entirely, due to their toxic effects on protein synthesis. PMID:24097941

  14. Production of Cell Wall Hydrolyzing Enzymes by Barley Aleurone Layers in Response to Gibberellic Acid 1

    PubMed Central

    Taiz, Lincoln; Honigman, William A.

    1976-01-01

    The cell walls of barley (Hordeum vulgare var. Himalaya) aleurone layers undergo extensive degradation during the tissue's response to gibberellic acid. Previous work had shown that these cell walls consist almost entirely of arabinoxylan. In this study we show that gibberellic acid stimulates endo-β-1,4-xylanase activity in isolated aleurone layers. In addition, gibberellic acid enhances the activity of two glycosidases: β-xylopyranosidase and α-arabinofuranosidase. No gibberellic acid-stimulated cellulase activity was detected. Germination studies showed a similar pattern of enzyme development in intact seeds. Images PMID:16659683

  15. Interrelated effects of dihomo-γ-linolenic and arachidonic acids, and sesamin on hepatic fatty acid synthesis and oxidation in rats.

    PubMed

    Ide, Takashi; Ono, Yoshiko; Kawashima, Hiroshi; Kiso, Yoshinobu

    2012-12-14

    Interrelated effects of dihomo-γ-linolenic acid (DGLA) and arachidonic acid (ARA), and sesamin, a sesame lignan, on hepatic fatty acid synthesis and oxidation were examined in rats. Rats were fed experimental diets supplemented with 0 or 2 g/kg sesamin (1:1 mixture of sesamin and episesamin), containing 100 g/kg of maize oil or fungal oil rich in DGLA or ARA for 16 d. Among the groups fed sesamin-free diets, oils rich in DGLA or ARA, especially the latter, compared with maize oil strongly reduced the activity and mRNA levels of various lipogenic enzymes. Sesamin, irrespective of the type of fat, reduced the parameters of lipogenic enzymes except for malic enzyme. The type of dietary fat was rather irrelevant in affecting hepatic fatty acid oxidation among rats fed the sesamin-free diets. Sesamin increased the activities of enzymes involved in fatty acid oxidation in all groups of rats given different fats. The extent of the increase depended on the dietary fat type, and the values became much higher with a diet containing sesamin and oil rich in ARA in combination than with a diet containing lignan and maize oil. Analyses of mRNA levels revealed that the combination of sesamin and oil rich in ARA compared with the combination of lignan and maize oil markedly increased the gene expression of various peroxisomal fatty acid oxidation enzymes but not mitochondrial enzymes. The enhancement of sesamin action on hepatic fatty acid oxidation was also confirmed with oil rich in DGLA but to a lesser extent. PMID:22370182

  16. Exploring omega-3 fatty acids, enzymes and biodiesel producing thraustochytrids from Australian and Indian marine biodiversity.

    PubMed

    Gupta, Adarsha; Singh, Dilip; Byreddy, Avinesh R; Thyagarajan, Tamilselvi; Sonkar, Shailendra P; Mathur, Anshu S; Tuli, Deepak K; Barrow, Colin J; Puri, Munish

    2016-03-01

    The marine environment harbours a vast diversity of microorganisms, many of which are unique, and have potential to produce commercially useful materials. Therefore, marine biodiversity from Australian and Indian habitat has been explored to produce novel bioactives, and enzymes. Among these, thraustochytrids collected from Indian habitats were shown to be rich in saturated fatty acids (SFAs) and monounsaturated fatty acids (MUFAs), together constituting 51-76% of total fatty acids (TFA). Indian and Australian thraustochytrids occupy separate positions in the dendrogram, showing significant differences exist in the fatty acid profiles in these two sets of thraustochytrid strains. In general, Australian strains had a higher docosahexaenoic acid (DHA) content than Indian strains with DHA at 17-31% of TFA. A range of enzyme activities were observed in the strains, with Australian strains showing overall higher levels of enzyme activity, with the exception of one Indian strain (DBTIOC-1). Comparative analysis of the fatty acid profile of 34 strains revealed that Indian thraustochytrids are more suitable for biodiesel production since these strains have higher fatty acids content for biodiesel (FAB, 76%) production than Australian thraustochytrids, while the Australian strains are more suitable for omega-3 (40%) production. PMID:26580151

  17. Amino acid synthesis in Europa's subsurface environment

    NASA Astrophysics Data System (ADS)

    Abbas, Sam H.; Schulze-Makuch, Dirk

    2008-10-01

    It has been suggested that Europa's subsurface environment may provide a haven for prebiotic evolution and the development of exotic biotic systems. The detection of hydrogen peroxide, sulfuric acid, water, hydrates and related species on the surface, coupled with observed mobility of icebergs, suggests the presence of a substantial subsurface liquid reservoir that actively exchanges materials with the surface environment. The atmospheric, surface and subsurface environments are described with their known chemistry. Three synthetic schemes using hydrogen peroxide, sulfuric acid and hydrocyanic acid leading to the production of larger biologically important molecules such as amino acids are described. Metabolic pathways based on properties of the subsurface ocean environment are detailed. Tidal heating, osmotic gradients, chemical cycling, as well as hydrothermal vents, provide energy and materials that may support a course of prebiotic evolution leading to the development or sustenance of simple biotic systems. Putative organisms may employ metabolic pathways based on chemical oxidation reduction cycles occurring in the putative subsurface ocean environment.

  18. High-yield synthesis of bioactive ethyl cinnamate by enzymatic esterification of cinnamic acid.

    PubMed

    Wang, Yun; Zhang, Dong-Hao; Zhang, Jiang-Yan; Chen, Na; Zhi, Gao-Ying

    2016-01-01

    In this paper, Lipozyme TLIM-catalyzed synthesis of ethyl cinnamate through esterification of cinnamic acid with ethanol was studied. In order to increase the yield of ethyl cinnamate, several media, including acetone, isooctane, DMSO and solvent-free medium, were investigated in this reaction. The reaction showed a high yield by using isooctane as reaction medium, which was found to be much higher than the yields reported previously. Furthermore, several parameters such as shaking rate, water activity, reaction temperature, substrate molar ratio and enzyme loading had important influences on this reaction. For instance, when temperature increased from 10 to 50 °C, the initial reaction rate increased by 18 times and the yield of ethyl cinnamate increased by 6.2 times. Under the optimum conditions, lipase-catalyzed synthesis of ethyl cinnamate gave a maximum yield of 99%, which was of general interest for developing industrial processes for the preparation of ethyl cinnamate. PMID:26213020

  19. Amino Acid Synthesis in a Supercritical Carbon Dioxide - Water System

    PubMed Central

    Fujioka, Kouki; Futamura, Yasuhiro; Shiohara, Tomoo; Hoshino, Akiyoshi; Kanaya, Fumihide; Manome, Yoshinobu; Yamamoto, Kenji

    2009-01-01

    Mars is a CO2-abundant planet, whereas early Earth is thought to be also CO2-abundant. In addition, water was also discovered on Mars in 2008. From the facts and theory, we assumed that soda fountains were present on both planets, and this affected amino acid synthesis. Here, using a supercritical CO2/liquid H2O (10:1) system which mimicked crust soda fountains, we demonstrate production of amino acids from hydroxylamine (nitrogen source) and keto acids (oxylic acid sources). In this research, several amino acids were detected with an amino acid analyzer. Moreover, alanine polymers were detected with LC-MS. Our research lights up a new pathway in the study of life’s origin. PMID:19582225

  20. Benzylidene Acetal Protecting Group as Carboxylic Acid Surrogate: Synthesis of Functionalized Uronic Acids and Sugar Amino Acids.

    PubMed

    Banerjee, Amit; Senthilkumar, Soundararasu; Baskaran, Sundarababu

    2016-01-18

    Direct oxidation of the 4,6-O-benzylidene acetal protecting group to C-6 carboxylic acid has been developed that provides an easy access to a wide range of biologically important and synthetically challenging uronic acid and sugar amino acid derivatives in good yields. The RuCl3 -NaIO4 -mediated oxidative cleavage method eliminates protection and deprotection steps and the reaction takes place under mild conditions. The dual role of the benzylidene acetal, as a protecting group and source of carboxylic acid, was exploited in the efficient synthesis of six-carbon sialic acid analogues and disaccharides bearing uronic acids, including glycosaminoglycan analogues. PMID:26572799

  1. Synthesis and chirality of amino acids under interstellar conditions.

    PubMed

    Giri, Chaitanya; Goesmann, Fred; Meinert, Cornelia; Evans, Amanda C; Meierhenrich, Uwe J

    2013-01-01

    Amino acids are the fundamental building blocks of proteins, the biomolecules that provide cellular structure and function in all living organisms. A majority of amino acids utilized within living systems possess pre-specified orientation geometry (chirality); however the original source for this specific orientation remains uncertain. In order to trace the chemical evolution of life, an appreciation of the synthetic and evolutional origins of the first chiral amino acids must first be gained. Given that the amino acids in our universe are likely to have been synthesized in molecular clouds in interstellar space, it is necessary to understand where and how the first synthesis might have occurred. The asymmetry of the original amino acid synthesis was probably the result of exposure to chiral photons in the form of circularly polarized light (CPL), which has been detected in interstellar molecular clouds. This chirality transfer event, from photons to amino acids, has been successfully recreated experimentally and is likely a combination of both asymmetric synthesis and enantioselective photolysis. A series of innovative studies have reported successful simulation of these environments and afforded production of chiral amino acids under realistic circumstellar and interstellar conditions: irradiation of interstellar ice analogues (CO, CO2, NH3, CH3OH, and H2O) with circularly polarized ultraviolet photons at low temperatures does result in enantiomer enriched amino acid structures (up to 1.3% ee). This topical review summarizes current knowledge and recent discoveries about the simulated interstellar environments within which amino acids were probably formed. A synopsis of the COSAC experiment onboard the ESA cometary mission ROSETTA concludes this review: the ROSETTA mission will soft-land on the nucleus of the comet 67P/Churyumov-Gerasimenko in November 2014, anticipating the first in situ detection of asymmetric organic molecules in cometary ices. PMID:22976459

  2. Glucose and Insulin Induction of Bile Acid Synthesis

    PubMed Central

    Li, Tiangang; Francl, Jessica M.; Boehme, Shannon; Ochoa, Adrian; Zhang, Youcai; Klaassen, Curtis D.; Erickson, Sandra K.; Chiang, John Y. L.

    2012-01-01

    Bile acids facilitate postprandial absorption of nutrients. Bile acids also activate the farnesoid X receptor (FXR) and the G protein-coupled receptor TGR5 and play a major role in regulating lipid, glucose, and energy metabolism. Transgenic expression of cholesterol 7α-hydroxylase (CYP7A1) prevented high fat diet-induced diabetes and obesity in mice. In this study, we investigated the nutrient effects on bile acid synthesis. Refeeding of a chow diet to fasted mice increased CYP7A1 expression, bile acid pool size, and serum bile acids in wild type and humanized CYP7A1-transgenic mice. Chromatin immunoprecipitation assays showed that glucose increased histone acetylation and decreased histone methylation on the CYP7A1 gene promoter. Refeeding also induced CYP7A1 in fxr-deficient mice, indicating that FXR signaling did not play a role in postprandial regulation of bile acid synthesis. In streptozocin-induced type I diabetic mice and genetically obese type II diabetic ob/ob mice, hyperglycemia increased histone acetylation status on the CYP7A1 gene promoter, leading to elevated basal Cyp7a1 expression and an enlarged bile acid pool with altered bile acid composition. However, refeeding did not further increase CYP7A1 expression in diabetic mice. In summary, this study demonstrates that glucose and insulin are major postprandial factors that induce CYP7A1 gene expression and bile acid synthesis. Glucose induces CYP7A1 gene expression mainly by epigenetic mechanisms. In diabetic mice, CYP7A1 chromatin is hyperacetylated, and fasting to refeeding response is impaired and may exacerbate metabolic disorders in diabetes. PMID:22144677

  3. Salicylic Acid Inhibits Synthesis of Proteinase Inhibitors in Tomato Leaves Induced by Systemin and Jasmonic Acid.

    PubMed Central

    Doares, S. H.; Narvaez-Vasquez, J.; Conconi, A.; Ryan, C. A.

    1995-01-01

    Salicylic acid (SA) and acetylsalicylic acid (ASA), previously shown to inhibit proteinase inhibitor synthesis induced by wounding, oligouronides (H.M. Doherty, R.R. Selvendran, D.J. Bowles [1988] Physiol Mol Plant Pathol 33: 377-384), and linolenic acid (H. Pena-Cortes, T. Albrecht, S. Prat, E.W. Weiler, L. Willmitzer [1993] Planta 191: 123-128), are shown here to be potent inhibitors of systemin-induced and jasmonic acid (JA)-induced synthesis of proteinase inhibitor mRNAs and proteins. The inhibition by SA and ASA of proteinase inhibitor synthesis induced by systemin and JA, as well as by wounding and oligosaccharide elicitors, provides further evidence that both oligosaccharide and polypeptide inducer molecules utilize the octadecanoid pathway to signal the activation of proteinase inhibitor genes. Tomato (Lycopersicon esculentum) leaves were pulse labeled with [35S]methionine, followed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and the inhibitory effects of SA are shown to be specific for the synthesis of a small number of JA-inducible proteins that includes the proteinase inhibitors. Previous results have shown that SA inhibits the conversion of 13S-hydroperoxy linolenic acid to 12-oxo-phytodienoic acid, thereby inhibiting the signaling pathway by blocking synthesis of JA. Here we report that the inhibition of synthesis of proteinase inhibitor proteins and mRNAs by SA in both light and darkness also occurs at a step in the signal transduction pathway, after JA synthesis but preceding transcription of the inhibitor genes. PMID:12228577

  4. Amino Acid Synthesis in Photosynthesizing Spinach Cells 1

    PubMed Central

    Larsen, Peder Olesen; Cornwell, Karen L.; Gee, Sherry L.; Bassham, James A.

    1981-01-01

    Isolated cells from leaves of Spinacia oleracea have been maintained in a state capable of high rates of photosynthetic CO2 fixation for more than 60 hours. The incorporation of 14CO2 under saturating CO2 conditions into carbohydrates, carboxylic acids, and amino acids, and the effect of ammonia on this incorporation have been studied. Total incorporation, specific radioactivity, and pool size have been determined as a function of time for most of the protein amino acids and for γ-aminobutyric acid. The measurements of specific radio-activities and of the approaches to 14C “saturation” of some amino acids indicate the presence and relative sizes of metabolically active and passive pools of these amino acids. Added ammonia decreased carbon fixation into carbohydrates and increased fixation into carboxylic acids and amino acids. Different amino acids were, however, affected in different and highly specific ways. Ammonia caused large stimulatory effects in incorporation of 14C into glutamine (a factor of 21), aspartate, asparagine, valine, alanine, arginine, and histidine. No effect or slight decreases were seen in glycine, serine, phenylalanine, and tyrosine labeling. In the case of glutamate, 14C labeling decreased, but specific radioactivity increased. The production of labeled γ-aminobutyric acid was virtually stopped by ammonia. The results indicate that added ammonia stimulates the reactions mediated by pyruvate kinase and phosphoenolpyruvate carboxylase, as seen with other plant systems. The data on the effects of added ammonia on total labeling, pool sizes, and specific radioactivities of several amino acids provides a number of indications about the intracellular sites of principal synthesis from carbon skeletons of these amino acids and the selective nature of effects of increased intracellular ammonia concentration on such synthesis. PMID:16661904

  5. Heat shock inhibits. alpha. -amylase synthesis in barley aleurone without inhibiting the activity of endoplasmic reticulum marker enzymes

    SciTech Connect

    Sticher, L.; Biswas, A.K.; Bush, D.S.; Jones, R.L. )

    1990-02-01

    The effects of heat shock on the synthesis of {alpha}-amylase and on the membranes of the endoplasmic reticulum (ER) of barley (Hordeum vulgare) aleurone were studied. Heat shock, imposed by raising the temperature of incubation from 25{degree}C to 40{degree}C for 3 hours, inhibits the accumulation of {alpha}-amylase and other proteins in the incubation medium of barley aleurone layers treated with gibberellic acid and Ca{sup 2+}. When ER is isolated from heat-shocked aleurone layers, less newly synthesized {alpha}-amylase is found associated with this membrane system. ER membranes, as indicated by the activities of NADH cytochrome c reductase and ATP-dependent Ca{sup 2+} transport, are not destroyed by heat stress, however. Although heat shock did not reduce the activity of ER membrane marker enzymes, it altered the buoyant density of these membranes. Whereas ER from control tissue showed a peak of marker enzyme activity at 27% to 28% sucrose (1.113-1.120 grams per cubic centimeter), ER from heat-shocked tissue peaked at 30% to 32% sucrose (1.127-1.137 grams per cubic centimeter). The synthesis of a group of proteins designated as heat-shock proteins (HSPs) was stimulated by heat shock. These HSPs were localized to different compartments of the aleurone cell. Several proteins ranging from 15 to 30 kilodaltons were found in the ER and the mitochondrial/plasma membrane fractions of heat-shocked cells, but none of the HSPs accumulated in the incubation medium of heat-shocked aleurone layers.

  6. Decreased hepatotoxic bile acid composition and altered synthesis in progressive human nonalcoholic fatty liver disease.

    PubMed

    Lake, April D; Novak, Petr; Shipkova, Petia; Aranibar, Nelly; Robertson, Donald; Reily, Michael D; Lu, Zhenqiang; Lehman-McKeeman, Lois D; Cherrington, Nathan J

    2013-04-15

    Bile acids (BAs) have many physiological roles and exhibit both toxic and protective influences within the liver. Alterations in the BA profile may be the result of disease induced liver injury. Nonalcoholic fatty liver disease (NAFLD) is a prevalent form of chronic liver disease characterized by the pathophysiological progression from simple steatosis to nonalcoholic steatohepatitis (NASH). The hypothesis of this study is that the 'classical' (neutral) and 'alternative' (acidic) BA synthesis pathways are altered together with hepatic BA composition during progression of human NAFLD. This study employed the use of transcriptomic and metabolomic assays to study the hepatic toxicologic BA profile in progressive human NAFLD. Individual human liver samples diagnosed as normal, steatosis, and NASH were utilized in the assays. The transcriptomic analysis of 70 BA genes revealed an enrichment of downregulated BA metabolism and transcription factor/receptor genes in livers diagnosed as NASH. Increased mRNA expression of BAAT and CYP7B1 was observed in contrast to decreased CYP8B1 expression in NASH samples. The BA metabolomic profile of NASH livers exhibited an increase in taurine together with elevated levels of conjugated BA species, taurocholic acid (TCA) and taurodeoxycholic acid (TDCA). Conversely, cholic acid (CA) and glycodeoxycholic acid (GDCA) were decreased in NASH liver. These findings reveal a potential shift toward the alternative pathway of BA synthesis during NASH, mediated by increased mRNA and protein expression of CYP7B1. Overall, the transcriptomic changes of BA synthesis pathway enzymes together with altered hepatic BA composition signify an attempt by the liver to reduce hepatotoxicity during disease progression to NASH. PMID:23391614

  7. Simple, high-yield synthesis of polyhedral carborane amino acids

    SciTech Connect

    Kahl, S.B.; Kasar, R.A.

    1996-02-07

    Boron neutron capture therapy (BNCT) is a form of binary cancer therapy that offers the potential of delivering spatially selective, high linear energy transfer radiation to the target cells while sparing surrounding normal tissue. We have demonstarted a versatile, general method for the conversion of o- ,m-, and p-carborane to their corresponding Boc-protected amino acids. Heterobifunctional polyhedral carboranes are exceedingly rare in the literature, and the amino acids prepared by this general method may prove to be valuable synthons for use in the synthesis of tumor-seeking compounds for BNCT or PDT. Morever, these conformationally constrained amino acids should be particularly interesting for use in peptide synthesis. The dihedral angle between the carbon atoms of these polyhedra increases in the order 60{degree} (ortho), 110{degree} (meta), and 180{degree} (para), allowing the peptide chemist to select a desired conformation. 11 refs.

  8. Knockout of mouse Cyp3a gene enhances synthesis of cholesterol and bile acid in the liver[S

    PubMed Central

    Hashimoto, Mari; Kobayashi, Kaoru; Watanabe, Mio; Kazuki, Yasuhiro; Takehara, Shoko; Inaba, Asumi; Nitta, Shin-ichiro; Senda, Naoto; Oshimura, Mitsuo; Chiba, Kan

    2013-01-01

    Here, we studied the effects of cytochrome P450 (CYP)3A deficiency on the mRNA expression of genes encoding regulators of hepatic cholesterol levels using Cyp3a-knockout (Cyp3a−/−) mice. The mRNA expression levels of genes encoding enzymes involved in cholesterol biosynthesis in the livers of Cyp3a−/− mice were higher than those of wild-type (WT) mice. Nuclear levels of sterol regulatory element-binding protein-2 (SREBP-2), which enhances cholesterol biosynthesis, were also higher in the livers of Cyp3a−/− mice. Binding of SREBP-2 to the Hmgcs1 gene promoter was more abundant in the livers of Cyp3a−/− mice. These results suggest that deficiency of CYP3A enzymes enhances transcription of genes encoding enzymes involved in cholesterol biosynthesis via activation of SREBP-2. On the other hand, hepatic cholesterol levels in Cyp3a−/− mice were 20% lower than those in WT mice. The mRNA expression levels of genes encoding enzymes involved in bile acid synthesis, plasma levels of 7α-hydroxy-4-cholesten-3-one and hepatic levels of total bile acid were significantly higher in Cyp3a−/− mice than in WT mice. These findings suggest that reduction of hepatic total cholesterol in Cyp3a−/− mice would be the consequence of enhanced bile acid synthesis. Therefore, CYP3A enzymes appear to play roles in the synthesis of cholesterol and bile acid in vivo. PMID:23709690

  9. Enzymatic synthesis and modification of structured phospholipids: recent advances in enzyme preparation and biocatalytic processes.

    PubMed

    Hama, Shinji; Ogino, Chiaki; Kondo, Akihiko

    2015-10-01

    Phospholipids (PLs) containing specific polar head groups and fatty acids, artificially synthesized from a complex mixture of natural PLs, have considerable industrial applications. The biocatalytic approaches to synthesizing structured PLs are of great interest because the enzymes used show high selectivity and performance under mild conditions, leading to the generation of products that cannot easily be obtained by chemical catalysis. Although the limited supply of phospholipases (e.g., phospholipase D) has thus far been an obstacle to the widespread use of enzymatic processing, recent advances in enzyme preparation have opened up various applications for PL modification. In this review, attempts to increase the productivity and utility of microbial phospholipases and lipases are presented. We also summarize recent developments in enzyme-catalyzed modification of PLs, focusing particularly on the relevant reactions, bioreactor design, and novel proof-of-concept experiments. PMID:26245679

  10. Metabolic effects of inhibitors of two enzymes of the branched-chain amino acid pathway in Salmonella typhimurium.

    PubMed Central

    Epelbaum, S; Chipman, D M; Barak, Z

    1996-01-01

    The metabolic effects of inhibitors of two enzymes in the pathway for biosynthesis of branched-chain amino acids were examined in Salmonella typhimurium mutant strain TV105, expressing a single isozyme of acetohydroxy acid synthase (AHAS), AHAS isozyme II. One inhibitor was the sulfonylurea herbicide sulfometuron methyl (SMM), which inhibits this isozyme and AHAS of other organisms, and the other was N-isopropyl oxalylhydroxamate (IpOHA), which inhibits ketol-acid reductoisomerase (KARI). The effects of the inhibitors on growth, levels of several enzymes of the pathway, and levels of intermediates of the pathway were measured. The intracellular concentration of the AHAS substrate 2-ketobutyrate increased on addition of SMM, but a lack of correlation between increased ketobutyrate and growth inhibition suggests that the former is not the immediate cause of the latter. The levels of the keto acid precursor of valine, but not of the precursor of isoleucine, were drastically decreased by SMM, and valine, but not isoleucine, partially overcame SMM inhibition. This apparent stronger effect of SMM on the flux into the valine arm, as opposed to the isoleucine arm, of the branched-chain amino acid pathway is explained by the kinetics of the AHAS reaction, as well as by the different roles of pyruvate, ketobutyrate, and the valine precursor in metabolism. The organization of the pathway thus potentiates the inhibitory effect of SMM. IpOHA has strong initial effects at lower concentrations than does SMM and leads to increases both in the acetohydroxy acid substrates of KARI and, surprisingly, in ketobutyrate. Valine completely protected strain TV105 from IpOHA at the MIC. A number of explanations for this effect can be ruled out, so that some unknown arrangement of the enzymes involved must be suggested. IpOHA led to initial cessation of growth, with partial recovery after a time whose duration increased with the inhibitor concentration. The recovery is apparently due to

  11. Metabolic effects of inhibitors of two enzymes of the branched-chain amino acid pathway in Salmonella typhimurium.

    PubMed

    Epelbaum, S; Chipman, D M; Barak, Z

    1996-02-01

    The metabolic effects of inhibitors of two enzymes in the pathway for biosynthesis of branched-chain amino acids were examined in Salmonella typhimurium mutant strain TV105, expressing a single isozyme of acetohydroxy acid synthase (AHAS), AHAS isozyme II. One inhibitor was the sulfonylurea herbicide sulfometuron methyl (SMM), which inhibits this isozyme and AHAS of other organisms, and the other was N-isopropyl oxalylhydroxamate (IpOHA), which inhibits ketol-acid reductoisomerase (KARI). The effects of the inhibitors on growth, levels of several enzymes of the pathway, and levels of intermediates of the pathway were measured. The intracellular concentration of the AHAS substrate 2-ketobutyrate increased on addition of SMM, but a lack of correlation between increased ketobutyrate and growth inhibition suggests that the former is not the immediate cause of the latter. The levels of the keto acid precursor of valine, but not of the precursor of isoleucine, were drastically decreased by SMM, and valine, but not isoleucine, partially overcame SMM inhibition. This apparent stronger effect of SMM on the flux into the valine arm, as opposed to the isoleucine arm, of the branched-chain amino acid pathway is explained by the kinetics of the AHAS reaction, as well as by the different roles of pyruvate, ketobutyrate, and the valine precursor in metabolism. The organization of the pathway thus potentiates the inhibitory effect of SMM. IpOHA has strong initial effects at lower concentrations than does SMM and leads to increases both in the acetohydroxy acid substrates of KARI and, surprisingly, in ketobutyrate. Valine completely protected strain TV105 from IpOHA at the MIC. A number of explanations for this effect can be ruled out, so that some unknown arrangement of the enzymes involved must be suggested. IpOHA led to initial cessation of growth, with partial recovery after a time whose duration increased with the inhibitor concentration. The recovery is apparently due to

  12. Chemoenzymatic synthesis of sialosides containing C7-modified sialic acids and their application in sialidase substrate specificity studies

    PubMed Central

    Khedri, Zahra; Li, Yanhong; Muthana, Saddam; Muthana, Musleh M.; Hsiao, Ching-Wen; Yu, Hai; Chen, Xi

    2014-01-01

    Modification at the glycerol side chain of sialic acid in sialosides modulate their recognition by sialic acid-binding proteins and sialidases. However, limited work has been focused on the synthesis and functional studies of sialosides with C7-modified sialic acids. Here we report chemical synthesis of C4-modified ManNAc and mannose and their application as sialic acid precursors in a highly efficient one-pot three-enzyme system for chemoenzymatic synthesis of α2–3- and α2–6-linked sialyl para-nitrophenyl galactosides in which the C7-hydroxyl group in sialic acid (N-acetylneuraminic acid, Neu5Ac, or 2-keto-3-deoxynonulosonic acid, Kdn) was systematically substituted by -F, -OMe, -H, and -N3 groups. Substrate specificity study of bacterial and human sialidases using the obtained sialoside library containing C7-modified sialic acids showed that sialosides containing C7-deoxy Neu5Ac were selective substrates for all bacterial sialidases tested but not for human NEU2. The information obtained from sialidase substrate specificity can be used to guide the design of new inhibitors that are selective against bacterial sialidases. PMID:24680514

  13. Production of Glucaric Acid from Hemicellulose Substrate by Rosettasome Enzyme Assemblies.

    PubMed

    Lee, Charles C; Kibblewhite, Rena E; Paavola, Chad D; Orts, William J; Wagschal, Kurt

    2016-07-01

    Hemicellulose biomass is a complex polymer with many different chemical constituents that can be utilized as industrial feedstocks. These molecules can be released from the polymer and transformed into value-added chemicals through multistep enzymatic pathways. Some bacteria produce cellulosomes which are assemblies composed of lignocellulolytic enzymes tethered to a large protein scaffold. Rosettasomes are artificial engineered ring scaffolds designed to mimic the bacterial cellulosome. Both cellulosomes and rosettasomes have been shown to facilitate much higher rates of biomass hydrolysis compared to the same enzymes free in solution. We investigated whether tethering enzymes involved in both biomass hydrolysis and oxidative transformation to glucaric acid onto a rosettasome scaffold would result in an analogous production enhancement in a combined hydrolysis and bioconversion metabolic pathway. Three different enzymes were used to hydrolyze birchwood hemicellulose and convert the substituents to glucaric acid, a top-12 DOE value added chemical feedstock derived from biomass. It was demonstrated that colocalizing the three different enzymes to the synthetic scaffold resulted in up to 40 % higher levels of product compared to uncomplexed enzymes. PMID:27198564

  14. Benzoic acid derivatives with improved antifungal activity: Design, synthesis, structure-activity relationship (SAR) and CYP53 docking studies.

    PubMed

    Berne, Sabina; Kovačič, Lidija; Sova, Matej; Kraševec, Nada; Gobec, Stanislav; Križaj, Igor; Komel, Radovan

    2015-08-01

    Previously, we identified CYP53 as a fungal-specific target of natural phenolic antifungal compounds and discovered several inhibitors with antifungal properties. In this study, we performed similarity-based virtual screening and synthesis to obtain benzoic acid-derived compounds and assessed their antifungal activity against Cochliobolus lunatus, Aspergillus niger and Pleurotus ostreatus. In addition, we generated structural models of CYP53 enzyme and used them in docking trials with 40 selected compounds. Finally, we explored CYP53-ligand interactions and identified structural elements conferring increased antifungal activity to facilitate the development of potential new antifungal agents that specifically target CYP53 enzymes of animal and plant pathogenic fungi. PMID:26154240

  15. Lactide Synthesis and Chirality Control for Polylactic acid Production.

    PubMed

    Van Wouwe, Pieter; Dusselier, Michiel; Vanleeuw, Evelien; Sels, Bert

    2016-05-10

    Polylactic acid (PLA) is a very promising biodegradable, renewable, and biocompatible polymer. Aside from its production, its application field is also increasing, with use not only in commodity applications but also as durables and in biomedicine. In the current PLA production scheme, the most expensive part is not the polymerization itself but obtaining the building blocks lactic acid (LA) and lactide, the actual cyclic monomer for polymerization. Although the synthesis of LA and the polymerization have been studied systematically, reports of lactide synthesis are scarce. Most lactide synthesis methods are described in patent literature, and current energy-intensive, aselective industrial processes are based on archaic scientific literature. This Review, therefore, highlights new methods with a technical comparison and description of the different approaches. Water-removal methodologies are compared, as this is a crucial factor in PLA production. Apart from the synthesis of lactide, this Review also emphasizes the use of chemically produced racemic lactic acid (esters) as a starting point in the PLA production scheme. Stereochemically tailored PLA can be produced according to such a strategy, giving access to various polymer properties. PMID:27071863

  16. Mycolic acid biosynthesis and enzymic characterization of the beta-ketoacyl-ACP synthase A-condensing enzyme from Mycobacterium tuberculosis.

    PubMed

    Kremer, Laurent; Dover, Lynn G; Carrère, Séverine; Nampoothiri, K Madhavan; Lesjean, Sarah; Brown, Alistair K; Brennan, Patrick J; Minnikin, David E; Locht, Camille; Besra, Gurdyal S

    2002-06-01

    Mycolic acids consist of long-chain alpha-alkyl-beta-hydroxy fatty acids that are produced by successive rounds of elongation catalysed by a type II fatty acid synthase (FAS-II). A key feature in the elongation process is the condensation of a two-carbon unit from malonyl-acyl-carrier protein (ACP) to a growing acyl-ACP chain catalysed by a beta-ketoacyl-ACP synthase (Kas). In the present study, we provide evidence that kasA from Mycobacterium tuberculosis encodes an enzyme that elongates in vivo the meromycolate chain, in both Mycobacterium smegmatis and Mycobacterium chelonae. We demonstrate that KasA belongs to the FAS-II system, which utilizes primarily palmitoyl-ACP rather than short-chain acyl-ACP primers. Furthermore, in an in vitro condensing assay using purified recombinant KasA, palmitoyl-AcpM and malonyl-AcpM, KasA was found to express Kas activity. Also, mutated KasA proteins, with mutation of Cys(171), His(311), Lys(340) and His(345) to Ala abrogated the condensation activity of KasA in vitro completely. Finally, purified KasA was highly sensitive to cerulenin, a well-known inhibitor of Kas, which may lead to the development of novel anti-mycobacterial drugs targeting KasA. PMID:12023885

  17. Identification of genes and pathways involved in the synthesis of Mead acid (20:3n-9), an indicator of essential fatty acid deficiency.

    PubMed

    Ichi, Ikuyo; Kono, Nozomu; Arita, Yuka; Haga, Shizuka; Arisawa, Kotoko; Yamano, Misato; Nagase, Mana; Fujiwara, Yoko; Arai, Hiroyuki

    2014-01-01

    In mammals, 5,8,11-eicosatrienoic acid (Mead acid, 20:3n-9) is synthesized from oleic acid during a state of essential fatty acid deficiency (EFAD). Mead acid is thought to be produced by the same enzymes that synthesize arachidonic acid and eicosapentaenoic acid, but the genes and the pathways involved in the conversion of oleic acid to Mead acid have not been fully elucidated. The levels of polyunsaturated fatty acids in cultured cells are generally very low compared to those in mammalian tissues. In this study, we found that cultured cells, such as NIH3T3 and Hepa1-6 cells, have significant levels of Mead acid, indicating that cells in culture are in an EFAD state under normal culture conditions. We then examined the effect of siRNA-mediated knockdown of fatty acid desaturases and elongases on the level of Mead acid, and found that knockdown of Elovl5, Fads1, or Fads2 decreased the level of Mead acid. This and the measured levels of possible intermediate products for the synthesis of Mead acid such as 18:2n-9, 20:1n-9 and 20:2n-9 in the knocked down cells indicate two pathways for the synthesis of Mead acid: pathway 1) 18:1n-9→(Fads2)→18:2n-9→(Elovl5)→20:2n-9→(Fads1)→20:3n-9 and pathway 2) 18:1n-9→(Elovl5)→20:1n-9→(Fads2)→20:2n-9→(Fads1)→20:3n-9. PMID:24184513

  18. Expression of Escherichia coli glycogen branching enzyme in an Arabidopsis mutant devoid of endogenous starch branching enzymes induces the synthesis of starch-like polyglucans.

    PubMed

    Boyer, Laura; Roussel, Xavier; Courseaux, Adeline; Ndjindji, Ofilia M; Lancelon-Pin, Christine; Putaux, Jean-Luc; Tetlow, Ian J; Emes, Michael J; Pontoire, Bruno; D' Hulst, Christophe; Wattebled, Fabrice

    2016-07-01

    Starch synthesis requires several enzymatic activities including branching enzymes (BEs) responsible for the formation of α(1 → 6) linkages. Distribution and number of these linkages are further controlled by debranching enzymes that cleave some of them, rendering the polyglucan water-insoluble and semi-crystalline. Although the activity of BEs and debranching enzymes is mandatory to sustain normal starch synthesis, the relative importance of each in the establishment of the plant storage polyglucan (i.e. water insolubility, crystallinity and presence of amylose) is still debated. Here, we have substituted the activity of BEs in Arabidopsis with that of the Escherichia coli glycogen BE (GlgB). The latter is the BE counterpart in the metabolism of glycogen, a highly branched water-soluble and amorphous storage polyglucan. GlgB was expressed in the be2 be3 double mutant of Arabidopsis, which is devoid of BE activity and consequently free of starch. The synthesis of a water-insoluble, partly crystalline, amylose-containing starch-like polyglucan was restored in GlgB-expressing plants, suggesting that BEs' origin only has a limited impact on establishing essential characteristics of starch. Moreover, the balance between branching and debranching is crucial for the synthesis of starch, as an excess of branching activity results in the formation of highly branched, water-soluble, poorly crystalline polyglucan. PMID:26715025

  19. Inhibition of Vibrio harveyi bioluminescence by cerulenin: In vivo evidence for covalent modification of the reductase enzyme involved in aldehyde synthesis

    SciTech Connect

    Byers, D.M. ); Meighen, E.A. )

    1989-07-01

    Bacterial bioluminescence is very sensitive to cerulenin, a fungal antibiotic which is known to inhibit fatty acid synthesis. When Vibrio harveyi cells pretreated with cerulenin were incubated with ({sup 3}H)myristic acid in vivo, acylation of the 57-kilodalton reductase subunit of the luminescence-specific fatty acid reductase complex was specifically inhibited. Light emission of wild-type V. harveyi was 20-fold less sensitive to cerulenin at low concentrations (10{mu}g/ml) than that of the dark mutant strain M17, which requires exogenous myristic acid for luminescence because of a defective transferase subunit. The sensitivity of myristic acid-stimulated luminescence in the mutant strain M17 exceeded that of phospholipid synthesis from ({sup 14}C)acetate, whereas uptake and incorporation of exogenous ({sup 14}C)myristic acid into phospholipids was increased by cerulenin. The reductase subunit could be labeled by incubating M17 cells with ({sup 3}H)tetrahydrocerulenin; this labeling was prevented by preincubation with either unlabeled cerulenin or myristic acid. Labeling of the reductase subunit with ({sup 3}H)tetrahydrocerulenin was also noted in an aldehyde-stimulated mutant (A16) but not in wild-type cells or in another aldehyde-stimulated mutant (M42) in which ({sup 3}H)myristoyl turnover at the reductase subunit was found to be defective. These results indicate that (i) cerulenin specifically and covalently inhibits the reductase component of aldehyde synthesis, (ii) this enzyme is partially protected from cerulenin inhibition in the wild-type strain in vivo, and (iii) two dark mutants which exhibit similar luminescence phenotypes (mutants A16 and M42) are blocked at different stages of fatty acid reduction.

  20. Occurrence of Arginine Deiminase Pathway Enzymes in Arginine Catabolism by Wine Lactic Acid Bacteria

    PubMed Central

    Liu, S.; Pritchard, G. G.; Hardman, M. J.; Pilone, G. J.

    1995-01-01

    l-Arginine, an amino acid found in significant quantities in grape juice and wine, is known to be catabolized by some wine lactic acid bacteria. The correlation between the occurrence of arginine deiminase pathway enzymes and the ability to catabolize arginine was examined in this study. The activities of the three arginine deiminase pathway enzymes, arginine deiminase, ornithine transcarbamylase, and carbamate kinase, were measured in cell extracts of 35 strains of wine lactic acid bacteria. These enzymes were present in all heterofermentative lactobacilli and most leuconostocs but were absent in all the homofermentative lactobacilli and pediococci examined. There was a good correlation among arginine degradation, formation of ammonia and citrulline, and the occurrence of arginine deiminase pathway enzymes. Urea was not detected during arginine degradation, suggesting that the catabolism of arginine did not proceed via the arginase-catalyzed reaction, as has been suggested in some earlier studies. Detection of ammonia with Nessler's reagent was shown to be a simple, rapid test to assess the ability of wine lactic acid bacteria to degrade arginine, although in media containing relatively high concentrations (>0.5%) of fructose, ammonia formation is inhibited. PMID:16534912

  1. Biological Monitoring of 3-Phenoxybenzoic Acid in Urine by an Enzyme -Linked Immunosorbent Assay

    EPA Science Inventory

    An enzyme-linked immunosorbent assay (ELISA) method was employed for determination of the pyrethroid biomarker, 3-phenoxybenzoic acid (3-PBA) in human urine samples. The optimized coating antigen concentration was 0.5 ng/mL with a dilution of 1:4000 for the 3-PBA antibody and 1:6...

  2. A Study of Krebs Citric Acid Cycle Enzymes in Rice Larvae (Corcyrace phalonica St) During Mycotoxicosis

    PubMed Central

    Hegde, Umashashi C.; Shanmugasundaram, E. R. B.

    1967-01-01

    Krebs citric acid cycle enzymes have been studied in rice moth larvae (Corcyra cephalonica St) reared in groundnut meal control and contaminated with A. flavus, wheat bran control and wheat bran contaminated with A. flavus and also wheat bran containing aflatoxin. It was observed that the activity of enzymes other than succinic oxidase, succinic dehydrogenase and isocitric dehydrogenase were reduced significantly in larvae reared in contaminated groundnut meal when compared with the control. In the case of larvae reared in contaminated wheat bran all the enzymes except succinic oxidase were inhibited when compared to the control larvae. It was also observed that the inhibition of these enzymes is greater in the case of larvae reared in contaminated wheat bran than in contaminated groundnut meal. The higher toxicity of wheat bran has been discussed. PMID:4229935

  3. Acid ceramidase and the treatment of ceramide diseases: The expanding role of enzyme replacement therapy.

    PubMed

    Schuchman, Edward H

    2016-09-01

    Ceramides are a diverse group of sphingolipids that play important roles in many biological processes. Acid ceramidase (AC) is one key enzyme that regulates ceramide metabolism. Early research on AC focused on the fact that it is the enzyme deficient in the rare genetic disorder, Farber Lipogranulomatosis. Recent research has revealed that deficiency of the same enzyme is responsible for a rare form of spinal muscular atrophy associated with myoclonic epilepsy (SMA-PME). Due to their diverse role in biology, accumulation of ceramides also has been implicated in the pathobiology of many other common diseases, including infectious lung diseases, diabetes, cancers and others. This has revealed the potential of AC as a therapy for many of these diseases. This review will focus on the biology of AC and the potential role of this enzyme in the treatment of human disease. PMID:27155573

  4. Characterization of the first enzyme in 2,4-dichlorophenoxyacetic acid metabolism.

    PubMed Central

    Hausinger, R P; Fukumori, F

    1995-01-01

    This paper reviews the properties of the Alcaligenes eutrophus JMP134 tfdA gene product, the enzyme responsible for the first step in 2,4-dichlorophenoxyacetic acid (2,4-D) biodegradation. The gene was overexpressed in Escherichia coli and several of its enzymatic properties were characterized. Although this enzyme catalyzes a hydroxylation reaction, it is not a monooxygenase. Rather, TfdA is an Fe(II) and alpha-ketoglutarate-dependent dioxygenase that metabolizes the latter cosubstrate to succinate and carbon dioxide. A variety of other phenoxyacetates and alpha-ketoacids can be used by the enzyme, but the greatest catalytic efficiencies were found using 2,4-D and alpha-ketoglutarate. The enzyme possesses multiple essential histidine residues, whereas catalytically essential cysteine and lysine groups do not appear to be present. PMID:8565907

  5. Steroselective synthesis and application of L-( sup 15 N) amino acids

    SciTech Connect

    Unkefer, C.J. ); Lodwig, S.N. . Div. of Science)

    1991-01-01

    We have developed two general approaches to the stereoselective synthesis of {sup 15}N- and {sup 13}C-labeled amino acids. First, labeled serine, biosynthesized using the methylotrophic bacterium M. extorquens AM1, serves as a chiral precursor for the synthesis of other amino acids. For example, pyridoxal phosphate enzymes can be used for the conversion of L-({alpha}-{sup 15}N)serine to L-({alpha}-{sup 15}N)tyrosine, L-({alpha}-{sup 15}N)tryptophan, and L-({alpha}-{sup 15}N)cysteine. In the second approach, developed by Oppolzer and Tamura, an electrophilic amination'' reagent, 1-chloro-1-nitrosocyclohexane, was used to convert chiral enolates into L-{alpha}-amino acids. We prepared 1-chloro-1-({sup 15}N) nitrosocyclohexane and used it to aminate chiral enolates to produce L-({alpha}-{sup 15}N)amino acids. The stereoselectivity of this scheme using the Oppolzer sultam chiral auxiliary is remarkable, producing enantiomer ratios of 200 to 1. 22 refs., 4 figs.

  6. Structural basis for the recognition of mycolic acid precursors by KasA, a condensing enzyme and drug target from Mycobacterium tuberculosis.

    PubMed

    Schiebel, Johannes; Kapilashrami, Kanishk; Fekete, Agnes; Bommineni, Gopal R; Schaefer, Christin M; Mueller, Martin J; Tonge, Peter J; Kisker, Caroline

    2013-11-22

    The survival of Mycobacterium tuberculosis depends on mycolic acids, very long α-alkyl-β-hydroxy fatty acids comprising 60-90 carbon atoms. However, despite considerable efforts, little is known about how enzymes involved in mycolic acid biosynthesis recognize and bind their hydrophobic fatty acyl substrates. The condensing enzyme KasA is pivotal for the synthesis of very long (C38-42) fatty acids, the precursors of mycolic acids. To probe the mechanism of substrate and inhibitor recognition by KasA, we determined the structure of this protein in complex with a mycobacterial phospholipid and with several thiolactomycin derivatives that were designed as substrate analogs. Our structures provide consecutive snapshots along the reaction coordinate for the enzyme-catalyzed reaction and support an induced fit mechanism in which a wide cavity is established through the concerted opening of three gatekeeping residues and several α-helices. The stepwise characterization of the binding process provides mechanistic insights into the induced fit recognition in this system and serves as an excellent foundation for the development of high affinity KasA inhibitors. PMID:24108128

  7. Structural Basis for the Recognition of Mycolic Acid Precursors by KasA, a Condensing Enzyme and Drug Target from Mycobacterium Tuberculosis *

    PubMed Central

    Schiebel, Johannes; Kapilashrami, Kanishk; Fekete, Agnes; Bommineni, Gopal R.; Schaefer, Christin M.; Mueller, Martin J.; Tonge, Peter J.; Kisker, Caroline

    2013-01-01

    The survival of Mycobacterium tuberculosis depends on mycolic acids, very long α-alkyl-β-hydroxy fatty acids comprising 60–90 carbon atoms. However, despite considerable efforts, little is known about how enzymes involved in mycolic acid biosynthesis recognize and bind their hydrophobic fatty acyl substrates. The condensing enzyme KasA is pivotal for the synthesis of very long (C38–42) fatty acids, the precursors of mycolic acids. To probe the mechanism of substrate and inhibitor recognition by KasA, we determined the structure of this protein in complex with a mycobacterial phospholipid and with several thiolactomycin derivatives that were designed as substrate analogs. Our structures provide consecutive snapshots along the reaction coordinate for the enzyme-catalyzed reaction and support an induced fit mechanism in which a wide cavity is established through the concerted opening of three gatekeeping residues and several α-helices. The stepwise characterization of the binding process provides mechanistic insights into the induced fit recognition in this system and serves as an excellent foundation for the development of high affinity KasA inhibitors. PMID:24108128

  8. Synthesis of some glucose-fatty acid esters by lipase from Candida antarctica and their emulsion functions.

    PubMed

    Ren, Kangzi; Lamsal, Buddhi P

    2017-01-01

    The synthesis of glucose esters with palmitic acid, lauric acid and hexanoic acid using lipase enzyme was studied and their emulsion functionality in oil-in-water system were compared. Reactions at 3:1M ratio of fatty acids-to-glucose had the highest conversion percentages (over 90% for each of the fatty acid). Initial conversion rate increased as substrate solubility increased. Ester bond formation was confirmed by nuclear magnetic resonance technique that the chemical shifts of glucose H-6 and α-carbon protons of fatty acids in the ester molecules shifted to the higher fields. Contact angle of water on esters' pelleted surface increased as the hydrophobicity increased. Glucose esters' and commercial sucrose esters' functionality as emulsifiers were compared. Glucose esters delayed, but did not prevent coalescence, because the oil droplets diameter doubled during 7days. Sucrose esters prevented coalescence during 7days since the droplets diameter did not have significant change. PMID:27507510

  9. Involvement of phylogenetically conserved acidic amino acid residues in catalysis by an oxidative DNA damage enzyme formamidopyrimidine glycosylase.

    PubMed

    Lavrukhin, O V; Lloyd, R S

    2000-12-12

    Formamidopyrimidine glycosylase (Fpg) is an important bacterial base excision repair enzyme, which initiates removal of damaged purines such as the highly mutagenic 8-oxoguanine. Similar to other glycosylase/AP lyases, catalysis by Fpg is known to proceed by a nucleophilic attack by an amino group (the secondary amine of its N-terminal proline) on C1' of the deoxyribose sugar at a damaged base, which results in the departure of the base from the DNA and removal of the sugar ring by beta/delta-elimination. However, in contrast to other enzymes in this class, in which acidic amino acids have been shown to be essential for glycosyl and phosphodiester bond scission, the catalytically essential acidic residues have not been documented for Fpg. Multiple sequence alignments of conserved acidic residues in all known bacterial Fpg-like proteins revealed six conserved glutamic and aspartic acid residues. Site-directed mutagenesis was used to change glutamic and aspartic acid residues to glutamines and asparagines, respectively. While the Asp to Asn mutants had no effect on the incision activity on 8-oxoguanine-containing DNA, several of the substitutions at glutamates reduced Fpg activity on the 8-oxoguanosine DNA, with the E3Q and E174Q mutants being essentially devoid of activity. The AP lyase activity of all of the glutamic acid mutants was slightly reduced as compared to the wild-type enzyme. Sodium borohydride trapping of wild-type Fpg and its E3Q and E174Q mutants on 8-oxoguanosine or AP site containing DNA correlated with the relative activity of the mutants on either of these substrates. PMID:11106507

  10. Synthesis of phosphatidylcholines in ozone-exposed alveolar type II cells isolated from adult rat lung: is glycerolphosphate acyltransferase a rate-limiting enzyme

    SciTech Connect

    Haagsman, H.P.; Schuurmans, E.A.; Batenburg, J.J.; van Golde, L.M.

    1988-01-01

    Type II cells were exposed to ozone by gas diffusion through the thin Teflon bottom of culture dishes. The rate of phosphatidylcholine synthesis by type II cells, monitored by the incorporation of (Me-/sup 14/C)choline, was impaired by ozone at concentrations that did not affect other cellular parameters. The enzymes choline kinase and cholinephosphate cytidylyltransferase were not susceptible to inactivation by ozone at concentrations at which the activity of glycerolphosphate acyltransferase was decreased. The enzyme activity of lactate dehydrogenase increased after ozone exposure. The specific activity of choline kinase in the cytosolic fraction of type II cells was fivefold that in whole lung. The metabolism of (Me-/sup 14/C)choline was studied as a function of the choline concentration. Maximal rates of phosphatidylcholine synthesis were already attained at a concentration of 20 microM choline. Exposure of type II cells to ozone did not affect the recovery of label from (Me-/sup 14/C)choline in choline phosphate and CDP choline. However, the maximal rate of phosphatidylcholine synthesis decreased after ozone exposure, which indicates that the decreased apparent activity of glycerolphosphate acyltransferase limits the supply of diacylglycerols and thereby the rate of phosphatidylcholine synthesis. If the flux through the diacylglycerol pathway was stimulated by the addition of palmitic acid, a higher maximal rate of phosphatidylcholine synthesis was observed. The uptake of (Me-/sup 14/C)choline and the recovery of label in CDPcholine were not altered by the addition of different concentrations of palmitate. It is concluded that type II cells take up choline very efficiently, probably due to the high specific activity of choline kinase. At low choline concentrations the rate of phosphatidylcholine synthesis is determined by the supply of CDPcholine.

  11. Ribosomal Synthesis of Peptides with Multiple β-Amino Acids.

    PubMed

    Fujino, Tomoshige; Goto, Yuki; Suga, Hiroaki; Murakami, Hiroshi

    2016-02-17

    The compatibility of β-amino acids with ribosomal translation was studied for decades, but it has been still unclear whether the ribosome can accept various β-amino acids, and whether the ribosome can introduce multiple β-amino acids in a peptide. In the present study, by using the Escherichia coli reconstituted cell-free translation system with a reprogramed genetic code, we screened β-amino acids that give high single incorporation efficiency and used them to synthesize peptides containing multiple β-amino acids. The experiments of single β-amino acid incorporation into a peptide revealed that 13 β-amino acids are compatible with ribosomal translation. Six of the tested β-amino acids (βhGly, l-βhAla, l-βhGln, l-βhPhg, l-βhMet, and d-βhPhg) showed high incorporation efficiencies, and seven (l-βhLeu, l-βhIle, l-βhAsn, l-βhPhe, l-βhLys, d-βhAla, and d-βhLeu) showed moderate incorporation efficiencies; whereas no full-length peptide was produced using other β-amino acids (l-βhPro, l-βhTrp, and l-βhGlu). Subsequent double-incorporation experiments using β-amino acids with high single incorporation efficiency revealed that elongation of peptides with successive β-amino acids is prohibited. Efficiency of the double-incorporation of the β-amino acids was restored by the insertion of Tyr or Ile between the two β-amino acids. On the basis of these experiments, we also designed mRNA sequences of peptides, and demonstrated the ribosomal synthesis of peptides containing different types of β-amino acids at multiple positions. PMID:26807980

  12. Synthesis of Branched Methyl Hydroxy Stearates Including an Ester from Bio-Based Levulinic Acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We report the synthesis of 5 useful branched methyl alpha-hydroxy oleate esters from commercially available methyl oleate and common organic acids. Of special interest is the synthesis utilizing the natural byproduct, levulinic acid. The other common organic acids used herein were propionic acid, ...

  13. Immobilization of uricase enzyme on self-assembled gold nanoparticles for application in uric acid biosensor.

    PubMed

    Ahuja, T; Tanwar, V K; Mishra, S K; Kumar, D; Biradar, A M; Rajesh

    2011-06-01

    An enzyme immobilization matrix is described by preparing a self-assembly of gold nanoparticles (GNPs) over a self-assembled monolayer (SAM) of 3-aminopropyltriethoxysilane (APTES) on an indium-tin-oxide (ITO) coated glass plate. The surface of the GNPs was modified with a mixed (1:9) SAM of 11-mercaptoundecanoic acid (MUA) and 3-mercapto-propionic acid (MPA). The enzyme, uricase was covalently immobilized to the carboxyl groups of the mixed SAM of MUA/MPA through carbodiimide coupling reaction. The whole assembly was constructed on 1 cm2 area of ITO-glass plate and was tested as an amperometric biosensor for the detection of uric acid in aqueous solution. The biosensor assembly was characterized by atomic force microscopy (AFM) and electrochemical techniques. The AFM of the enzyme biosensor assembly reveals an asymmetrical sharp regular island-like structure with an average roughness parameter value of 2.81 nm. Chronoamperometric response was measured as a function of uric acid concentration in aqueous solution (pH 7.4), which exhibits a linear response over a concentration range of 0.07 to 0.63 mM with a sensitivity of 19.27 microAmM(-1) and a response of 25 s with excellent reproducibility. These results are not influenced by the presence of interfering reagents such as ascorbic acid, urea and glucose. GNPs-biomolecule assemblies constructed using this method may facilitate development of new hybrid biosensing materials. PMID:21770094

  14. Cinnamic acid 4-hydroxylase of sorghum [Sorghum biocolor (L.) Moench] gene SbC4H1 restricts lignin synthesis in Arabidopsis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cinnamic acid 4-hydroxylase (C4H) is the first hydroxylase enzyme of the phenylpropanoid pathway, and its content and activity affects the lignin synthesis. In this study, we isolated a C4H gene SbC4H1 from the suppression subtractive hybridization library of brown midrib (bmr) mutants of Sorghum b...

  15. Origin of fatty acid synthesis - Thermodynamics and kinetics of reaction pathways

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1991-01-01

    The primitiveness of contemporary fatty acid biosynthesis was evaluated by using the thermodynamics and kinetics of its component reactions to estimate the extent of its dependence on powerful and selective catalysis by enzymes. Since this analysis indicated that the modern pathway is not primitive because it requires sophisticated enzymatic catalysis, an alternative pathway of primitive fatty acid synthesis is proposed that uses glycolaldehyde as a substrate. In contrast to the modern pathway, this primitive pathway is not dependent on an exogenous source of phosphoanhydride energy. Furthermore, the chemical spontaneity of its reactions suggests that it could have been readily catalyzed by the rudimentary biocatalysts available at an early stage in the origin of life.

  16. Non-enzymic phosphorylation of polyphosphoinositides and phosphatidic acid is catalysed by bivalent metal ions.

    PubMed Central

    Gumber, S C; Lowenstein, J M

    1986-01-01

    Phosphatidylinositol 4-phosphate, phosphatidylinositol 4,5-bisphosphate and phosphatidic acid undergo non-enzymic phosphorylation by ATP in the presence of bivalent metal ions. The non-enzymic reaction is more rapid in a mixture of water, chloroform and methanol than in water alone. Chemical evidence indicates that the product formed from phosphatidylinositol 4-phosphate is the corresponding 4-pyrophosphate. This product shows an RF value very close to that of phosphatidylinositol 4,5-bisphosphate on t.l.c. with an acidic solvent commonly used to characterize and measure the latter; however, it can be separated readily with an alkaline solvent. Chemical evidence indicates that the products formed from phosphatidylinositol 4,5-bisphosphate and phosphatidic acid are also pyrophosphates. Images Fig. 1. Fig. 2. PMID:3017309

  17. The acid and enzymic hydrolysis of O-acetylated sialic acid residues from rabbit Tamm–Horsfall glycoprotein

    PubMed Central

    Neuberger, A.; Ratcliffe, Wendy A.

    1972-01-01

    Rabbit Tamm–Horsfall glycoprotein and bovine submaxillary glycoprotein were both found to contain sialic acid residues which are released at a slow rate by the standard conditions of acid hydrolysis. These residues are also resistant to neuraminidases from Vibrio cholerae and Clostridium perfringens. This behaviour was attributed to the presence of O-acetylated sialic acid, since the removal of O-acetyl groups by mild alkaline treatment normalized the subsequent release of sialic acid from rabbit Tamm–Horsfall glycoprotein by acid and by enzymic hydrolysis. Determination of the O-acetyl residues in rabbit Tamm–Horsfall glycoprotein indicated that on average two hydroxyl groups of sialic acid are O-acetylated, and these were located on the polyhydroxy side-chain of sialic acid or on C-4 and C-8. These findings confirm the assumption that certain O-acetylated forms of sialic acid are not substrates for bacterial neuraminidases. Several explanations have been suggested to explain the effect of O-acetylation of the side-chain on the rate of acidcatalysed hydrolysis of sialic acid residues. PMID:4349114

  18. Impacts of simulated acid rain on soil enzyme activities in a latosol.

    PubMed

    Ling, Da-Jiong; Huang, Qian-Chun; Ouyang, Ying

    2010-11-01

    Acid rain pollution is a serious environmental problem in the world. This study investigated impacts of simulated acid rain (SAR) upon four types of soil enzymes, namely the catalase, acid phosphatase, urease, and amylase, in a latosol. Latosol is an acidic red soil and forms in the tropical rainforest biome. Laboratory experiments were performed by spraying the soil columns with the SAR at pH levels of 2.5, 3.0, 3.5., 4.0, 4.5, 5.0, and 7.0 (control) over a 20-day period. Mixed results were obtained in enzyme activities for different kinds of enzymes under the influences of the SAR. The catalase activities increased rapidly from day 0 to 5, then decreased slightly from day 5 to 15, and finally decreased sharply to the end of the experiments, whereas the acid phosphatase activities decreased rapidly from day 0 to 5, then increased slightly from day 5 to 15, and finally decreased dramatically to the end of the experiments. A decrease in urease activities was observed at all of the SAR pH levels for the entire experimental period, while an increase from day 0 to 5 and then a decrease from day 5 to 20 in amylase activities were observed at all of the SAR pH levels. In general, the catalase, acid phosphatase, and urease activities increased with the SAR pH levels. However, the maximum amylase activity was found at pH 4.0 and decreased as the SAR pH increased from 4.0 to 5.0 or decreased from 4.0 to 2.5. It is apparent that acid rain had adverse environmental impacts on soil enzyme activities in the latosol. Our study further revealed that impacts of the SAR upon soil enzyme activities were in the following order: amylase>catalase>acid phosphatase>urease. These findings provide useful information on better understanding and managing soil biological processes in the nature under the influence of acid rains. PMID:20701974

  19. Synthesis and bioactivities of silver nanoparticles capped with 5-Amino-?-resorcylic acid hydrochloride dihydrate

    PubMed Central

    2014-01-01

    Background Conjugated and drug loaded silver nanoparticles are getting an increased attention for various biomedical applications. Nanoconjugates showed significant enhancement in biological activity in comparison to free drug molecules. In this perspective, we report the synthesis of bioactive silver capped with 5-Amino-?-resorcylic acid hydrochloride dihydrate (AR). The in vitro antimicrobial (antibacterial, antifungal), enzyme inhibition (xanthine oxidase, urease, carbonic anhydrase, ?-chymotrypsin, cholinesterase) and antioxidant activities of the developed nanostructures was investigated before and after conjugation to silver metal. Results The conjugation of AR to silver was confirmed through FTIR, UV¿vis and TEM techniques. The amount of AR conjugated with silver was characterized through UV¿vis spectroscopy and found to be 9% by weight. The stability of synthesized nanoconjugates against temperature, high salt concentration and pH was found to be good. Nanoconjugates, showed significant synergic enzyme inhibition effect against xanthine and urease enzymes in comparison to standard drugs, pure ligand and silver. Conclusions Our synthesized nanoconjugate was found be to efficient selective xanthine and urease inhibitors in comparison to Ag and AR. On a per weight basis, our nanoconjugates required less amount of AR (about 11 times) for inhibition of these enzymes. PMID:25201390

  20. Comparative genomics of citric-acid producing Aspergillus niger ATCC 1015 versus enzyme-producing CBS 513.88

    SciTech Connect

    Andersen, Mikael R.; Salazar, Margarita; Schaap, Peter; van de Vondervoort, Peter; Culley, David E.; Thykaer, Jette; Frisvad, Jens C.; Nielsen, Kristian F.; Albang, Richard; Albermann, Kaj; Berka, Randy; Braus, Gerhard; Braus-Stromeyer, Susanna A.; Corrochano, Luis; Dai, Ziyu; van Dijck, Piet; Hofmann, Gerald; Lasure, Linda L.; Magnuson, Jon K.; Menke, Hildegard; Meijer, Martin; Meijer, Susan; Nielsen, Jakob B.; Nielsen, Michael L.; van Ooyen, Albert; Pel, Herman J.; Poulsen, Lars; Samson, Rob; Stam, Hein; Tsang, Adrian; van den Brink, Johannes M.; ATkins, Alex; Aerts, Andrea; Shapiro, Harris; Pangilinan, Jasmyn; Salamov, Asaf; Lou, Yigong; Lindquist, Erika; Lucas, Susan; Grimwood, Jane; Grigoriev, Igor V.; Kubicek, Christian P.; Martinez, Diego; van Peij, Noel; Roubos, Johannes A.; Nielsen, Jens B.; Baker, Scott E.

    2011-06-01

    The filamentous fungus Aspergillus niger exhibits great diversity in its phenotype. It is found globally, both as marine and terrestrial strains, produces both organic acids and hydrolytic enzymes in high amounts, and some isolates exhibit pathogenicity. Although the genome of an industrial enzyme-producing A. niger strain (CBS 513.88) has already been sequenced, the versatility and diversity of this species compels additional exploration. We therefore undertook whole genome sequencing of the acidogenic A. niger wild type strain (ATCC 1015), and produced a genome sequence of very high quality. Only 15 gaps are present in the sequence and half the telomeric regions have been elucidated. Moreover, sequence information from ATCC 1015 was utilized to improve the genome sequence of CBS 513.88. Chromosome-level comparisons uncovered several genome rearrangements, deletions, a clear case of strain-specific horizontal gene transfer, and identification of 0.8 megabase of novel sequence. Single nucleotide polymorphisms per kilobase (SNPs/kb) between the two strains were found to be exceptionally high (average: 7.8, maximum: 160 SNPs/kb). High variation within the species was confirmed with exo-metabolite profiling and phylogenetics. Detailed lists of alleles were generated, and genotypic differences were observed to accumulate in metabolic pathways essential to acid production and protein synthesis. A transcriptome analysis revealed up-regulation of the electron transport chain, specifically the alternative oxidative pathway in ATCC 1015, while CBS 513.88 showed significant up regulation of genes associated with biosynthesis of amino acids that are abundant in glucoamylase A, tRNA-synthases and protein transporters.

  1. Daily rhythms of glycerophospholipid synthesis in fibroblast cultures involve differential enzyme contributions[S

    PubMed Central

    Acosta-Rodríguez, Victoria A.; Márquez, Sebastián; Salvador, Gabriela A.; Pasquaré, Susana J.; Gorné, Lucas D.; Garbarino-Pico, Eduardo; Giusto, Norma M.; Guido, Mario Eduardo

    2013-01-01

    Circadian clocks regulate the temporal organization of several biochemical processes, including lipid metabolism, and their disruption leads to severe metabolic disorders. Immortalized cell lines acting as circadian clocks display daily variations in [32P]phospholipid labeling; however, the regulation of glycerophospholipid (GPL) synthesis by internal clocks remains unknown. Here we found that arrested NIH 3T3 cells synchronized with a 2 h-serum shock exhibited temporal oscillations in a) the labeling of total [3H] GPLs, with lowest levels around 28 and 56 h, and b) the activity of GPL-synthesizing and GPL-remodeling enzymes, such as phosphatidate phosphohydrolase 1 (PAP-1) and lysophospholipid acyltransferases (LPLAT), respectively, with antiphase profiles. In addition, we investigated the temporal regulation of phosphatidylcholine (PC) biosynthesis. PC is mainly synthesized through the Kennedy pathway with choline kinase (ChoK) and CTP:phosphocholine cytidylyltranferase (CCT) as key regulatory enzymes. We observed that the PC labeling exhibited daily changes, with the lowest levels every ∼28 h, that were accompanied by brief increases in CCT activity and the oscillation in ChoK mRNA expression and activity. Results demonstrate that the metabolisms of GPLs and particularly of PC in synchronized fibroblasts are subject to a complex temporal control involving concerted changes in the expression and/or activities of specific synthesizing enzymes. PMID:23641021

  2. Enzyme-catalyzed synthesis of heptyl-β-glycosides: effect of water coalescence at high temperature.

    PubMed

    Montiel, Carmina; Bustos-Jaimes, Ismael; Bárzana, Eduardo

    2013-09-01

    Alkyl glycosides can be synthesized by glycosidases in organic media with limited amounts of water. These systems, however, limit the solubility of the sugar substrates and decrease reaction yields. Herein we report the enzymatic synthesis of heptyl-β-glycosides in heptanol catalyzed by a hyperthermophilic β-glycosidase at 90°C. Our results indicate that dispersion of water in heptanol changes with time producing coalescence of water at the bottom of the reactor, playing a key role in the reaction yield. Water-soluble substrate, enzyme and products are concentrated in the aqueous phase, according to their partition coefficients, promoting side reactions that inactivate the enzyme. Reaction yield of heptyl-β-glycosides was 35% relative to lactose, at 7% water. The increase in the water phase to 12% diminished the enzyme inactivation and increased the heptyl-β-glycosides yield to 52%. Surface-active compounds, SDS and octyl glucoside, increased water dispersion but were unable to prevent coalescence. PMID:23863873

  3. Purification and characterization of cannabidiolic-acid synthase from Cannabis sativa L.. Biochemical analysis of a novel enzyme that catalyzes the oxidocyclization of cannabigerolic acid to cannabidiolic acid.

    PubMed

    Taura, F; Morimoto, S; Shoyama, Y

    1996-07-19

    We identified a unique enzyme that catalyzes the oxidocyclization of cannabigerolic acid to cannabidiolic acid (CBDA) in Cannabis sativa L. (CBDA strain). The enzyme, named CBDA synthase, was purified to apparent homogeneity by a four-step procedure: ammonium sulfate precipitation followed by chromatography on DEAE-cellulose, phenyl-Sepharose CL-4B, and hydroxylapatite. The active enzyme consists of a single polypeptide with a molecular mass of 74 kDa and a pI of 6.1. The NH2-terminal amino acid sequence of CBDA synthase is similar to that of Delta1-tetrahydrocannabinolic-acid synthase. CBDA synthase does not require coenzymes, molecular oxygen, hydrogen peroxide, and metal ion cofactors for the oxidocyclization reaction. These results indicate that CBDA synthase is neither an oxygenase nor a peroxidase and that the enzymatic cyclization does not proceed via oxygenated intermediates. CBDA synthase catalyzes the formation of CBDA from cannabinerolic acid as well as cannabigerolic acid, although the kcat for the former (0.03 s-1) is lower than that for the latter (0.19 s-1). Therefore, we conclude that CBDA is predominantly biosynthesized from cannabigerolic acid rather than cannabinerolic acid. PMID:8663284

  4. Does single-amino-acid replacement work in favor of or against improvement of the thermostability of immobilized enzyme?

    PubMed Central

    Koizumi, J; Zhang, M; Imanaka, T; Aiba, S

    1990-01-01

    Thermostabilities of kanamycin nucleotidyltransferase and of its mutants that became thermostable, in the free state, because of single-amino-acid replacements were studied after immobilization of the enzymes on cyanogen bromide-activated Sephadex G-200 particles. Lys in place of Gln at position 102 decreased the thermostability of the immobilized enzyme, whereas replacement with other amino acids enhanced it. PMID:2176451

  5. Location and characteristics of enzymes involved in the breakdown of polygalacturonic acid by Bacteroides thetaiotaomicron.

    PubMed Central

    McCarthy, R E; Kotarski, S F; Salyers, A A

    1985-01-01

    When Bacteroides thetaiotaomicron is grown in medium which contains polygalacturonic acid (PGA) as the sole carbon source, two different polygalacturonases are produced: a PGA lyase (EC 4.2.2.2) and a PGA hydrolase (EC 3.2.1.15). Both enzymes are cell associated. The PGA hydrolase appears to be an inner membrane protein. The PGA lyase is a soluble protein that associates with membranes under certain conditions. The PGA lyase was purified to apparent homogeneity. It has a molecular weight (from sodium dodecyl sulfate-polyacrylamide gel electrophoresis) of 74,000, a pH optimum of 8.7, a pI of 7.5, and a Km for PGA of 40 to 70 micrograms/ml. It requires calcium for maximal activity. The main product of this enzyme appears to be a disaccharide that contains a delta 4,5-unsaturated galacturonic acid residue. The PGA hydrolase can be solubilized from membranes with 2% Triton X-100 and has been partially purified. It has a pH optimum of 5.4 to 5.5, a pI of 4.7 to 4.9, and a Km for PGA of 350 to 400 micrograms/ml. The main product of this enzyme appears to be galacturonic acid. The specific activities of both PGA hydrolase and PGA lyase increase at the same rate when bacteria are exposed to PGA. The two enzymes therefore appear to be similarly regulated. Images PMID:3968032

  6. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, A. L.

    1986-01-01

    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20% for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  7. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1987-01-01

    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20 percent for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  8. A New Process for Acrylic Acid Synthesis by Fermentative Process

    NASA Astrophysics Data System (ADS)

    Lunelli, B. H.; Duarte, E. R.; de Toledo, E. C. Vasco; Wolf Maciel, M. R.; Maciel Filho, R.

    With the synthesis of chemical products through biotechnological processes, it is possible to discover and to explore innumerable routes that can be used to obtain products of high addes value. Each route may have particular advantages in obtaining a desired product, compared with others, especially in terms of yield, productivity, easiness to separate the product, economy, and environmental impact. The purpose of this work is the development of a deterministic model for the biochemical synthesis of acrylic acid in order to explore an alternative process. The model is built-up with the tubular reactor equations together with the kinetic representation based on the structured model. The proposed process makes possible to obtain acrylic acid continuously from the sugar cane fermentation.

  9. Tannic acid-mediated green synthesis of antibacterial silver nanoparticles.

    PubMed

    Kim, Tae Yoon; Cha, Song-Hyun; Cho, Seonho; Park, Youmie

    2016-04-01

    The search for novel antibacterial agents is necessary to combat microbial resistance to current antibiotics. Silver nanoparticles (AgNPs) have been reported to be effective antibacterial agents. Tannic acid is a polyphenol compound from plants with antioxidant and antibacterial activities. In this report, AgNPs were prepared from silver ions by tannic acid-mediated green synthesis (TA-AgNPs). The reaction process was facile and involved mixing both silver ions and tannic acid. The absorbance at 423 nm in the UV-Visible spectra demonstrated that tannic acid underwent a reduction reaction to produce TA-AgNPs from silver ions. The synthetic yield of TA-AgNPs was 90.5 % based on inductively coupled plasma mass spectrometry analysis. High-resolution transmission electron microscopy and atomic force microscopy images indicated that spherical-shaped TA-AgNPs with a mean particle size of 27.7-46.7 nm were obtained. Powder high-resolution X-ray diffraction analysis indicated that the TA-AgNP structure was face-centered cubic with a zeta potential of -27.56 mV. The hydroxyl functional groups of tannic acid contributed to the synthesis of TA-AgNPs, which was confirmed by Fourier transform infrared spectroscopy. The in vitro antibacterial activity was measured using the minimum inhibitory concentration (MIC) method. The TA-AgNPs were more effective against Gram-negative bacteria than Gram-positive bacteria. The MIC for the TA-AgNPs in all of the tested strains was in a silver concentration range of 6.74-13.48 μg/mL. The tannic acid-mediated synthesis of AgNPs afforded biocompatible nanocomposites for antibacterial applications. PMID:26895244

  10. Novel Hydroxycinnamoyl-Coenzyme A Quinate Transferase Genes from Artichoke Are Involved in the Synthesis of Chlorogenic Acid1[W

    PubMed Central

    Sonnante, Gabriella; D'Amore, Rosalinda; Blanco, Emanuela; Pierri, Ciro L.; De Palma, Monica; Luo, Jie; Tucci, Marina; Martin, Cathie

    2010-01-01

    Artichoke (Cynara cardunculus subsp. scolymus) extracts have high antioxidant capacity, due primarily to flavonoids and phenolic acids, particularly chlorogenic acid (5-caffeoylquinic acid [CGA]), dicaffeoylquinic acids, and caffeic acid, which are abundant in flower bracts and bioavailable to humans in the diet. The synthesis of CGA can occur following different routes in plant species, and hydroxycinnamoyl-coenzyme A transferases are important enzymes in these pathways. Here, we report on the isolation and characterization of two novel genes both encoding hydroxycinnamoyl-coenzyme A quinate transferases (HQT) from artichoke. The recombinant proteins (HQT1 and HQT2) were assayed after expression in Escherichia coli, and both showed higher affinity for quinate over shikimate. Their preferences for acyl donors, caffeoyl-coenzyme A or p-coumaroyl-coenzyme A, were examined. Modeling and docking analyses were used to propose possible pockets and residues involved in determining substrate specificities in the HQT enzyme family. Quantitative real-time polymerase chain reaction analysis of gene expression indicated that HQT1 might be more directly associated with CGA content. Transient and stable expression of HQT1 in Nicotiana resulted in a higher production of CGA and cynarin (1,3-dicaffeoylquinic acid). These findings suggest that several isoforms of HQT contribute to the synthesis of CGA in artichoke according to physiological needs and possibly following various metabolic routes. PMID:20431089

  11. Regulation of Bile Acid Synthesis by Fat-soluble Vitamins A and D*

    PubMed Central

    Schmidt, Daniel R.; Holmstrom, Sam R.; Fon Tacer, Klementina; Bookout, Angie L.; Kliewer, Steven A.; Mangelsdorf, David J.

    2010-01-01

    Bile acids are required for proper absorption of dietary lipids, including fat-soluble vitamins. Here, we show that the dietary vitamins A and D inhibit bile acid synthesis by repressing hepatic expression of the rate-limiting enzyme CYP7A1. Receptors for vitamin A and D induced expression of Fgf15, an intestine-derived hormone that acts on liver to inhibit Cyp7a1. These effects were mediated through distinct cis-acting response elements in the promoter and intron of Fgf15. Interestingly, transactivation of both response elements appears to be required to maintain basal Fgf15 expression levels in vivo. Furthermore, whereas induction of Fgf15 by vitamin D is mediated through its receptor, the induction of Fgf15 by vitamin A is mediated through the retinoid X receptor/farnesoid X receptor heterodimer and is independent of bile acids, suggesting that this heterodimer functions as a distinct dietary vitamin A sensor. Notably, vitamin A treatment reversed the effects of the bile acid sequestrant cholestyramine on Fgf15, Shp, and Cyp7a1 expression, suggesting a potential therapeutic benefit of vitamin A under conditions of bile acid malabsorption. These results reveal an unexpected link between the intake of fat-soluble vitamins A and D and bile acid metabolism, which may have evolved as a means for these dietary vitamins to regulate their own absorption. PMID:20233723

  12. Synthesis of bosutinib from 3-methoxy-4-hydroxybenzoic acid.

    PubMed

    Yin, Xiao Jia; Xu, Guan Hong; Sun, Xu; Peng, Yan; Ji, Xing; Jiang, Ke; Li, Fei

    2010-06-01

    This paper reports a novel synthesis of bosutinib starting from 3-methoxy-4-hydroxybenzoic acid. The process starts with esterification of the starting material, followed by alkylation, nitration, reduction, cyclization, chlorination and two successive amination reactions. The intermediates and target molecule were characterized by (1)H-NMR, (13)C-NMR, MS and the purities of all the compounds were determined by HPLC. PMID:20657439

  13. Is acetylcarnitine a substrate for fatty acid synthesis in plants

    SciTech Connect

    Roughan, G. ); Post-Beittenmiller, D.; Ohlrogge, J. ); Browse, J. )

    1993-04-01

    Long-chain fatty acid synthesis from [1-[sup 14]C]acetylcarnitine by chloroplasts isolated from spinach (Spinacia oleracea), pea (Pisum sativum), amaranthus (Amaranthus lividus), or maize (Zea mays) occurred at less than 2% of the rate of fatty acid synthesis from [1-[sup 14]C]acetate irrespective of the maturity of the leaves or whether the plastids were purified using sucrose or Percoll medium. [1-[sup 14]C]Acetylcarnitine was not significantly utilized by highly active chloroplasts rapidly prepared from pea and spinach using methods not involving density gradient centrifugation. [1-[sup 14]C]Acetylcarnitine was recovered quantitatively from chloroplast incubations following 10 min in the light. Unlabeled acetyl-L-carnitine (0.4 mM) did not compete with [1-[sup 14]C]acetate (0.2 mM) as a substrate for fatty acid synthesis by any of the more than 70 chloroplast preparations tested in this study. Carnitine acetyltransferase activity was not detected in any chloroplast preparation and was present in whole leaf homogenates at about 0.1% of the level of acetyl-coenzyme A synthetase activity. When supplied to detached pea shoots and detached spinach, amaranthus, and maize leaves via the transpiration stream, 1 to 4% of the [1-[sup 14]C]acetylcarnitine and 47 to 57% of the [1-[sup 14]C]acetate taken up was incorporated into lipids. Most (78--82%) of the [1-[sup 14]C]acetylcarnitine taken up was recovered intact. It is concluded that acetylcarnitine is not a major precursor for fatty acid synthesis in plants. 29 refs., 5 tabs.

  14. Strategies for the Total Synthesis of Clavicipitic Acid.

    PubMed

    Ito, Mamoru; Tahara, Yu-Ki; Shibata, Takanori

    2016-04-11

    Clavicipitic acid is an ergot alkaloid, which was isolated from Claviceps strain and Claviceps fusiformis. Its unique tricyclic azepinoindole skeleton has attracted synthetic chemists, and various strategies have been developed for its total synthesis. These strategies can be generally categorized into two types based on the synthetic intermediates, namely, 4-substituted gramine derivatives and 4-substituted tryptophan derivatives. This Minireview summarizes the reported total syntheses from the point of these two key intermediates. PMID:26822254

  15. Total Synthesis of (−)-Nodulisporic Acid D

    PubMed Central

    Zou, Yike; Melvin, Jason E.; Gonzales, Stephen S.; Spafford, Matthew J.; Smith, Amos B.

    2015-01-01

    A convergent total synthesis of the architecturally complex indole diterpenoid (−)-nodulisporic acid D has been achieved. Key synthetic transformations include vicinal difunctionalization of an advanced α,β-unsaturated aldehyde to form the E,F-transfused 5,6-ring system of the eastern hemisphere and a cascade cross-coupling/indolization protocol leading to the CDE multisubstituted indole core. PMID:26029849

  16. The Impact of Enzyme Characteristics on Corn Stover Fiber Degradation and Acid Production During Ensiled Storage

    NASA Astrophysics Data System (ADS)

    Ren, Haiyu; Richard, Tom L.; Moore, Kenneth J.

    Ensilage can be used to store lignocellulosic biomass before industrial bioprocessing. This study investigated the impacts of seven commerical enzyme mixtures derived from Aspergillus niger, Trichoderma reesei, and T. longibrachiatum. Treatments included three size grades of corn stover, two enzyme levels (1.67 and 5 IU/g dry matter based on hemicellulase), and various ratios of cellulase to hemicellulase (C ∶ H). The highest C ∶ H ratio tested, 2.38, derived from T. reesei, resulted in the most effective fermentation, with lactic acid as the dominant product. Enzymatic activity during storage may complement industrial pretreatment; creating synergies that could reduce total bioconversion costs.

  17. Morphological characteristics, oxidative stability and enzymic hydrolysis of amylose-fatty acid complexes.

    PubMed

    Marinopoulou, Anna; Papastergiadis, Efthimios; Raphaelides, Stylianos N; Kontominas, Michael G

    2016-05-01

    Complexes of amylose with fatty acids varying in carbon chain length and degree of unsaturation were prepared at 30, 50 or 70°C by dissolving amylose in 0.1N KOH and mixing with fatty acid potassium soap solution. The complexes were obtained in solid form as precipitates after neutralization. SEM microscopy revealed that the morphology of the complexes was that of ordered lamellae separated from amorphous regions whereas confocal laser scanning microscopy showed images of the topography of the guest molecules in the complex matrix. FTIR spectroscopy revealed that the absorption peak attributed to carbonyl group of free fatty acid was shifted when the fatty acid was in the form of amylose complex. Thermo-gravimetry showed that the unsaturated fatty acids were effectively protected from oxidation when they were complexed with amylose whereas enzymic hydrolysis experiments showed that the guest molecules were quantitatively released from the amylose complexes. PMID:26877002

  18. Synthesis of Rosin Acid Starch Catalyzed by Lipase

    PubMed Central

    Lin, Rihui; Li, He; Long, Han; Su, Jiating; Huang, Wenqin

    2014-01-01

    Rosin, an abundant raw material from pine trees, was used as a starting material directly for the synthesis of rosin acid starch. The esterification reaction was catalyzed by lipase (Novozym 435) under mild conditions. Based on single factor experimentation, the optimal esterification conditions were obtained as follows: rosin acid/anhydrous glucose unit in the molar ratio 2 : 1, reaction time 4 h at 45°C, and 15% of lipase dosage. The degree of substitution (DS) reaches 0.098. Product from esterification of cassava starch with rosin acid was confirmed by FTIR spectroscopy and iodine coloration analysis. Scanning electron microscopy and X-ray diffraction analysis showed that the morphology and crystallinity of the cassava starch were largely destroyed. Thermogravimetric analysis indicated that thermal stability of rosin acid starch decreased compared with native starch. PMID:24977156

  19. Production of L-lactic Acid from Biomass Wastes Using Scallop Crude Enzymes and Novel Lactic Acid Bacterium

    NASA Astrophysics Data System (ADS)

    Yanagisawa, Mitsunori; Nakamura, Kanami; Nakasaki, Kiyohiko

    In the present study, biomass waste raw materials including paper mill sludge, bamboo, sea lettuce, and shochu residue (from a distiller) and crude enzymes derived from inedible and discarded scallop parts were used to produce L-lactic acid for the raw material of biodegradable plastic poly-lactic acid. The activities of cellulase and amylase in the crude enzymes were 22 and 170units/L, respectively, and L-lactic acid was produced from every of the above mentioned biomass wastes, by the method of liquid-state simultaneous saccharification and fermentation (SSF) . The L-lactic acid concentrations produced from sea lettuce and shochu residue, which contain high concentration of starch were 3.6 and 9.3g/L, respectively, and corresponded to greater than 25% of the conversion of glucans contained in these biomass wastes. Furthermore, using the solid state SSF method, concentrations as high as 13g/L of L-lactic acid were obtained from sea lettuce and 26g/L were obtained from shochu residue.

  20. PlsX deletion impacts fatty acid synthesis and acid adaptation in Streptococcus mutans.

    PubMed

    Cross, Benjamin; Garcia, Ariana; Faustoferri, Roberta; Quivey, Robert G

    2016-04-01

    Streptococcus mutans, one of the primary causative agents of dental caries in humans, ferments dietary sugars in the mouth to produce organic acids. These acids lower local pH values, resulting in demineralization of the tooth enamel, leading to caries. To survive acidic environments, Strep. mutans employs several adaptive mechanisms, including a shift from saturated to unsaturated fatty acids in membrane phospholipids. PlsX is an acyl-ACP : phosphate transacylase that links the fatty acid synthase II (FASII) pathway to the phospholipid synthesis pathway, and is therefore central to the movement of unsaturated fatty acids into the membrane. Recently, we discovered that plsX is not essential in Strep. mutans. A plsX deletion mutant was not a fatty acid or phospholipid auxotroph. Gas chromatography of fatty acid methyl esters indicated that membrane fatty acid chain length in the plsX deletion strain differed from those detected in the parent strain, UA159. The deletion strain displayed a fatty acid shift similar to WT, but had a higher percentage of unsaturated fatty acids at low pH. The deletion strain survived significantly longer than the parent strain when cultures were subjected to an acid challenge of pH 2.5.The ΔplsX strain also exhibited elevated F-ATPase activity at pH 5.2, compared with the parent. These results indicate that the loss of plsX affects both the fatty acid synthesis pathway and the acid-adaptive response of Strep. mutans. PMID:26850107

  1. A Study on Amino Acids: Synthesis of Alpha-Aminophenylacetic Acid (Phenylglycine) and Determination of its Isoelectric Point.

    ERIC Educational Resources Information Center

    Barrelle, M.; And Others

    1983-01-01

    Background information and procedures are provided for an experimental study on aminophenylacetic acid (phenylglycine). These include physical chemistry (determination of isoelectric point by pH measurement) and organic chemistry (synthesis of an amino acid in racemic form) experiments. (JN)

  2. Vanillin formation from ferulic acid in Vanilla planifolia is catalysed by a single enzyme

    PubMed Central

    Gallage, Nethaji J.; Hansen, Esben H.; Kannangara, Rubini; Olsen, Carl Erik; Motawia, Mohammed Saddik; Jørgensen, Kirsten; Holme, Inger; Hebelstrup, Kim; Grisoni, Michel; Møller, Birger Lindberg

    2014-01-01

    Vanillin is a popular and valuable flavour compound. It is the key constituent of the natural vanilla flavour obtained from cured vanilla pods. Here we show that a single hydratase/lyase type enzyme designated vanillin synthase (VpVAN) catalyses direct conversion of ferulic acid and its glucoside into vanillin and its glucoside, respectively. The enzyme shows high sequence similarity to cysteine proteinases and is specific to the substitution pattern at the aromatic ring and does not metabolize caffeic acid and p-coumaric acid as demonstrated by coupled transcription/translation assays. VpVAN localizes to the inner part of the vanilla pod and high transcript levels are found in single cells located a few cell layers from the inner epidermis. Transient expression of VpVAN in tobacco and stable expression in barley in combination with the action of endogenous alcohol dehydrogenases and UDP-glucosyltransferases result in vanillyl alcohol glucoside formation from endogenous ferulic acid. A gene encoding an enzyme showing 71% sequence identity to VpVAN was identified in another vanillin-producing plant species Glechoma hederacea and was also shown to be a vanillin synthase as demonstrated by transient expression in tobacco. PMID:24941968

  3. Vanillin formation from ferulic acid in Vanilla planifolia is catalysed by a single enzyme.

    PubMed

    Gallage, Nethaji J; Hansen, Esben H; Kannangara, Rubini; Olsen, Carl Erik; Motawia, Mohammed Saddik; Jørgensen, Kirsten; Holme, Inger; Hebelstrup, Kim; Grisoni, Michel; Møller, Birger Lindberg

    2014-01-01

    Vanillin is a popular and valuable flavour compound. It is the key constituent of the natural vanilla flavour obtained from cured vanilla pods. Here we show that a single hydratase/lyase type enzyme designated vanillin synthase (VpVAN) catalyses direct conversion of ferulic acid and its glucoside into vanillin and its glucoside, respectively. The enzyme shows high sequence similarity to cysteine proteinases and is specific to the substitution pattern at the aromatic ring and does not metabolize caffeic acid and p-coumaric acid as demonstrated by coupled transcription/translation assays. VpVAN localizes to the inner part of the vanilla pod and high transcript levels are found in single cells located a few cell layers from the inner epidermis. Transient expression of VpVAN in tobacco and stable expression in barley in combination with the action of endogenous alcohol dehydrogenases and UDP-glucosyltransferases result in vanillyl alcohol glucoside formation from endogenous ferulic acid. A gene encoding an enzyme showing 71% sequence identity to VpVAN was identified in another vanillin-producing plant species Glechoma hederacea and was also shown to be a vanillin synthase as demonstrated by transient expression in tobacco. PMID:24941968

  4. Chemical synthesis and enzymatic, stereoselective hydrolysis of a functionalized dihydropyrimidine for the synthesis of β-amino acids.

    PubMed

    Slomka, Christin; Zhong, Sabilla; Fellinger, Anna; Engel, Ulrike; Syldatk, Christoph; Bräse, Stefan; Rudat, Jens

    2015-12-01

    A novel substrate, 6-(4-nitrophenyl)dihydropyrimidine-2,4(1H,3H)-dione (pNO2PheDU), was chemically synthesized and analytically verified for the potential biocatalytic synthesis of enantiopure β-amino acids. The hydantoinase (EC 3.5.2.2) from Arthrobacter crystallopoietes DSM20117 was chosen to prove the enzymatic hydrolysis of this substrate, since previous investigations showed activities of this enzyme toward 6-monosubstituted dihydrouracils. Whole cell biotransformations with recombinant Escherichia coli expressing the hydantoinase showed degradation of pNO2PheDU. Additionally, the corresponding N-carbamoyl-β-amino acid (NCarbpNO2 βPhe) was chemically synthesized, an HPLC-method with chiral stationary phases for detection of this product was established and thus (S)-enantioselectivity toward pNO2PheDU has been shown. Consequently this novel substrate is a potential precursor for the enantiopure β-amino acid para-nitro-β-phenylalanine (pNO2 βPhe). PMID:26705241

  5. Cytochemical localisation of lysosomal enzymes and acidic mucopolysaccharides in the salivary glands of Aplysia depilans (Opisthobranchia).

    PubMed

    Lobo-da-Cunha, A

    2002-04-01

    Three types of secretory cells were reported in the salivary glands of Aplysia depilans: granular cells, vacuolated cells and mucocytes. To improve the characterisation of these cells, cytochemical methods for the detection of lysosomal enzymes and acidic mucopolysaccharides were applied. In granular cells, acid phosphatase and arylsulphatase were present in small lysosomes and in some secretory granules. The secretory granules could have received these enzymes after fusion with the small lysosomes that were frequently found very close to them. These cells were not stained with colloidal iron because they do not contain acidic mucopolysaccharides. In vacuolated cells, acid phosphatase and arylsulphatase were detected in lysosomes but not in the secretory vacuoles. Colloidal iron staining revealed the presence of acidic mucopolysaccharides in the vacuoles and in the Golgi apparatus of these cells. In mucocytes, lysosomes were very rare, but the secretion of these cells was very rich in acidic mucopolysaccharides. The filamentous network within the secretory vesicles was completely covered with iron particles, but practically no particles were observed over the granular masses attached to the membrane of the vesicles. Iron particles were also found in the trans-face cisternae of the U-shaped Golgi stacks, but were not seen in the cis-face cisternae or in the rough endoplasmic reticulum. PMID:12117284

  6. The Secreted Enzyme PM20D1 Regulates Lipidated Amino Acid Uncouplers of Mitochondria.

    PubMed

    Long, Jonathan Z; Svensson, Katrin J; Bateman, Leslie A; Lin, Hua; Kamenecka, Theodore; Lokurkar, Isha A; Lou, Jesse; Rao, Rajesh R; Chang, Mi Ra; Jedrychowski, Mark P; Paulo, Joao A; Gygi, Steven P; Griffin, Patrick R; Nomura, Daniel K; Spiegelman, Bruce M

    2016-07-14

    Brown and beige adipocytes are specialized cells that express uncoupling protein 1 (UCP1) and dissipate chemical energy as heat. These cells likely possess alternative UCP1-independent thermogenic mechanisms. Here, we identify a secreted enzyme, peptidase M20 domain containing 1 (PM20D1), that is enriched in UCP1(+) versus UCP1(-) adipocytes. We demonstrate that PM20D1 is a bidirectional enzyme in vitro, catalyzing both the condensation of fatty acids and amino acids to generate N-acyl amino acids and also the reverse hydrolytic reaction. N-acyl amino acids directly bind mitochondria and function as endogenous uncouplers of UCP1-independent respiration. Mice with increased circulating PM20D1 have augmented respiration and increased N-acyl amino acids in blood. Lastly, administration of N-acyl amino acids to mice improves glucose homeostasis and increases energy expenditure. These data identify an enzymatic node and a family of metabolites that regulate energy homeostasis. This pathway might be useful for treating obesity and associated disorders. PMID:27374330

  7. In Vitro Fatty Acid Synthesis and Complex Lipid Metabolism in the Cyanobacterium Anabaena variabilis: I. Some Characteristics of Fatty Acid Synthesis.

    PubMed

    Lem, N W; Stumpf, P K

    1984-01-01

    In vitro fatty acid synthesis was examined in crude cell extracts, soluble fractions, and 80% (NH(4))(2)SO(4) fractions from Anabaena variabilis M3. Fatty acid synthesis was absolutely dependent upon acyl carrier protein and required NADPH and NADH. Moreover, fatty acid synthesis and elongation occurred in the cytoplasm of the cell. The major fatty acid products were palmitic acid (16:0) and stearic acid (18:0). Of considerable interest, both stearoyl-acyl carrier protein and stearoyl-coenzyme A desaturases were not detected in any of the fractions from A. variabilis. The similarities and differences in fatty acid synthesis between A. variabilis and higher plant tissues are discussed with respect to the endosymbiotic theory of chloroplast evolution. PMID:16663367

  8. CYP4 Enzymes as potential drug targets: focus on enzyme multiplicity, inducers and inhibitors, and therapeutic modulation of 20-hydroxyeicosatetraenoic acid (20-HETE) synthase and fatty acid ω-hydroxylase activities

    PubMed Central

    Edson, Katheryne Z.; Rettie, Allan E.

    2014-01-01

    The Cytochrome P450 4 (CYP4) family of enzymes in humans is comprised of thirteen isozymes that typically catalyze the ω-oxidation of endogenous fatty acids and eicosanoids. Several CYP4 enzymes can biosynthesize 20-hydroxyeicosatetraenoic acid or 20-HETE, an important signaling eicosanoid involved in regulation of vascular tone and kidney reabsorption. Additionally, accumulation of certain fatty acids is a hallmark of the rare genetic disorders, Refsum disease and X-ALD. Therefore, modulation of CYP4 enzyme activity, either by inhibition or induction, is a potential strategy for drug discovery. Here we review the substrate specificities, sites of expression, genetic regulation, and inhibition by exogenous chemicals of the human CYP4 enzymes, and discuss the targeting of CYP4 enzymes in the development of new treatments for hypertension, stroke, certain cancers and the fatty acid-linked orphan diseases. PMID:23688133

  9. Pistagremic acid, a novel β-secretase enzyme (BACE1) inhibitor from Pistacia integerrima Stewart.

    PubMed

    Rauf, Abdur; Uddin, Ghias; Khan, Ajmal; Siddiqui, Bina S; Arfan, Mohammad; Dalvandi, Kourosh; Ben Hadda, Taibi

    2015-01-01

    A new triterpenic compound named pistagremic acid (PA) was once again isolated from Pistaciaintegerrima. The β-secretase inhibition study was carried out. Compound PA was found significantly active against β-secretase enzyme (BACE1) with IC50 value of 350 ± 2 nM in comparison to the standard inhibitors [Asn670, Sta671, Val672]-amyloid-β/A4 precursor protein 770 fragment 662-675 (IC50 = 290.71 ± 1 nM). The selectivity of this compound was also evaluated against the acetylcholinesterase and butyrylcholinesterase enzymes. Interestingly compound PA was found to be inactive against them and showed selectivity towards β-secretase enzyme (BACE1). PMID:25588845

  10. Ascorbic acid intake and oxalate synthesis.

    PubMed

    Knight, John; Madduma-Liyanage, Kumudu; Mobley, James A; Assimos, Dean G; Holmes, Ross P

    2016-08-01

    In humans, approximately 60 mg of ascorbic acid (AA) breaks down in the body each day and has to be replaced by a dietary intake of 70 mg in women and 90 mg in men to maintain optimal health and AA homeostasis. The breakdown of AA is non-enzymatic and results in oxalate formation. The exact amount of oxalate formed has been difficult to ascertain primarily due to the limited availability of healthy human tissue for such research and the difficulty in measuring AA and its breakdown products. The breakdown of 60 mg of AA to oxalate could potentially result in the formation of up to 30 mg oxalate per day. This exceeds our estimates of the endogenous production of 10-25 mg oxalate per day, indicating that degradative pathways that do not form oxalate exist. In this review, we examine what is known about the pathways of AA metabolism and how oxalate forms. We further identify how gaps in our knowledge may be filled to more precisely determine the contribution of AA breakdown to oxalate production in humans. The use of stable isotopes of AA to directly assess the conversion of vitamin to oxalate should help fill this void. PMID:27002809

  11. Rhodobacter capsulatus OlsA is a bifunctional enzyme active in both ornithine lipid and phosphatidic acid biosynthesis.

    PubMed

    Aygun-Sunar, Semra; Bilaloglu, Rahmi; Goldfine, Howard; Daldal, Fevzi

    2007-12-01

    The Rhodobacter capsulatus genome contains three genes (olsA [plsC138], plsC316, and plsC3498) that are annotated as lysophosphatidic acid (1-acyl-sn-glycerol-3-phosphate) acyltransferase (AGPAT). Of these genes, olsA was previously shown to be an O-acyltransferase in the second step of ornithine lipid biosynthesis, which is important for optimal steady-state levels of c-type cytochromes (S. Aygun-Sunar, S. Mandaci, H.-G. Koch, I. V. J. Murray, H. Goldfine, and F. Daldal. Mol. Microbiol. 61:418-435, 2006). The roles of the remaining plsC316 and plsC3498 genes remained unknown. In this work, these genes were cloned, and chromosomal insertion-deletion mutations inactivating them were obtained to define their function. Characterization of these mutants indicated that, unlike the Escherichia coli plsC, neither plsC316 nor plsC3498 was essential in R. capsulatus. In contrast, no plsC316 olsA double mutant could be isolated, indicating that an intact copy of either olsA or plsC316 was required for R. capsulatus growth under the conditions tested. Compared to OlsA null mutants, PlsC316 null mutants contained ornithine lipid and had no c-type cytochrome-related phenotype. However, they exhibited slight growth impairment and highly altered total fatty acid and phospholipid profiles. Heterologous expression in an E. coli plsC(Ts) mutant of either R. capsulatus plsC316 or olsA gene products supported growth at a nonpermissive temperature, exhibited AGPAT activity in vitro, and restored phosphatidic acid biosynthesis. The more vigorous AGPAT activity displayed by PlsC316 suggested that plsC316 encodes the main AGPAT required for glycerophospholipid synthesis in R. capsulatus, while olsA acts as an alternative AGPAT that is specific for ornithine lipid synthesis. This study therefore revealed for the first time that some OlsA enzymes, like the enzyme of R. capsulatus, are bifunctional and involved in both membrane ornithine lipid and glycerophospholipid biosynthesis. PMID

  12. Synthesis and Characterization of Fatty Acid Conjugates of Niacin and Salicylic Acid.

    PubMed

    Vu, Chi B; Bemis, Jean E; Benson, Ericka; Bista, Pradeep; Carney, David; Fahrner, Richard; Lee, Diana; Liu, Feng; Lonkar, Pallavi; Milne, Jill C; Nichols, Andrew J; Picarella, Dominic; Shoelson, Adam; Smith, Jesse; Ting, Amal; Wensley, Allison; Yeager, Maisy; Zimmer, Michael; Jirousek, Michael R

    2016-02-11

    This report describes the synthesis and preliminary biological characterization of novel fatty acid niacin conjugates and fatty acid salicylate conjugates. These molecular entities were created by covalently linking two bioactive molecules, either niacin or salicylic acid, to an omega-3 fatty acid. This methodology allows the simultaneous intracellular delivery of two bioactives in order to elicit a pharmacological response that could not be replicated by administering the bioactives individually or in combination. The fatty acid niacin conjugate 5 has been shown to be an inhibitor of the sterol regulatory element binding protein (SREBP), a key regulator of cholesterol metabolism proteins such as PCSK9, HMG-CoA reductase, ATP citrate lyase, and NPC1L1. On the other hand, the fatty acid salicylate conjugate 11 has been shown to have a unique anti-inflammatory profile based on its ability to modulate the NF-κB pathway through the intracellular release of the two bioactives. PMID:26784936

  13. Assembly of Lipoic Acid on Its Cognate Enzymes: an Extraordinary and Essential Biosynthetic Pathway.

    PubMed

    Cronan, John E

    2016-06-01

    Although the structure of lipoic acid and its role in bacterial metabolism were clear over 50 years ago, it is only in the past decade that the pathways of biosynthesis of this universally conserved cofactor have become understood. Unlike most cofactors, lipoic acid must be covalently bound to its cognate enzyme proteins (the 2-oxoacid dehydrogenases and the glycine cleavage system) in order to function in central metabolism. Indeed, the cofactor is assembled on its cognate proteins rather than being assembled and subsequently attached as in the typical pathway, like that of biotin attachment. The first lipoate biosynthetic pathway determined was that of Escherichia coli, which utilizes two enzymes to form the active lipoylated protein from a fatty acid biosynthetic intermediate. Recently, a more complex pathway requiring four proteins was discovered in Bacillus subtilis, which is probably an evolutionary relic. This pathway requires the H protein of the glycine cleavage system of single-carbon metabolism to form active (lipoyl) 2-oxoacid dehydrogenases. The bacterial pathways inform the lipoate pathways of eukaryotic organisms. Plants use the E. coli pathway, whereas mammals and fungi probably use the B. subtilis pathway. The lipoate metabolism enzymes (except those of sulfur insertion) are members of PFAM family PF03099 (the cofactor transferase family). Although these enzymes share some sequence similarity, they catalyze three markedly distinct enzyme reactions, making the usual assignment of function based on alignments prone to frequent mistaken annotations. This state of affairs has possibly clouded the interpretation of one of the disorders of human lipoate metabolism. PMID:27074917

  14. Dual Role for Phospholipid:Diacylglycerol Acyltransferase: Enhancing Fatty Acid Synthesis and Diverting Fatty Acids from Membrane Lipids to Triacylglycerol in Arabidopsis Leaves[C][W

    PubMed Central

    Fan, Jilian; Yan, Chengshi; Zhang, Xuebin; Xu, Changcheng

    2013-01-01

    There is growing interest in engineering green biomass to expand the production of plant oils as feed and biofuels. Here, we show that PHOSPHOLIPID:DIACYLGLYCEROL ACYLTRANSFERASE1 (PDAT1) is a critical enzyme involved in triacylglycerol (TAG) synthesis in leaves. Overexpression of PDAT1 increases leaf TAG accumulation, leading to oil droplet overexpansion through fusion. Ectopic expression of oleosin promotes the clustering of small oil droplets. Coexpression of PDAT1 with oleosin boosts leaf TAG content by up to 6.4% of the dry weight without affecting membrane lipid composition and plant growth. PDAT1 overexpression stimulates fatty acid synthesis (FAS) and increases fatty acid flux toward the prokaryotic glycerolipid pathway. In the trigalactosyldiacylglycerol1-1 mutant, which is defective in eukaryotic thylakoid lipid synthesis, the combined overexpression of PDAT1 with oleosin increases leaf TAG content to 8.6% of the dry weight and total leaf lipid by fourfold. In the plastidic glycerol-3-phosphate acyltransferase1 mutant, which is defective in the prokaryotic glycerolipid pathway, PDAT1 overexpression enhances TAG content at the expense of thylakoid membrane lipids, leading to defects in chloroplast division and thylakoid biogenesis. Collectively, these results reveal a dual role for PDAT1 in enhancing fatty acid and TAG synthesis in leaves and suggest that increasing FAS is the key to engineering high levels of TAG accumulation in green biomass. PMID:24076979

  15. Isolation of a mutation resulting in constitutive synthesis of L-fucose catabolic enzymes.

    PubMed Central

    Bartkus, J M; Mortlock, R P

    1986-01-01

    A ribitol-positive transductant of Escherichia coli K-12, JM2112, was used to facilitate the isolation and identification of mutations affecting the L-fucose catabolic pathway. Analysis of L-fucose-negative mutants of JM2112 enabled us to confirm that L-fucose-1-phosphate is the apparent inducer of the fucose catabolic enzymes. Plating of an L-fuculokinase-negative mutant of JM2112 on D-arabinose yielded an isolate containing a second fucose mutation which resulted in the constitutive synthesis of L-fucose permease, isomerase, and kinase. This constitutive mutation differs from the constitutive mutation described by Chen et al. (J. Bacteriol. 159:725-729, 1984) in that it is tightly linked to the fucose genes and appears to be located in the gene believed to code for the positive activator of the L-fucose genes. PMID:3005235

  16. Biochemistry, physiology, and genetics of GPAT, AGPAT, and lipin enzymes in triglyceride synthesis

    PubMed Central

    Takeuchi, Kazuharu; Reue, Karen

    2009-01-01

    Triacylglycerol (TAG) synthesis and storage in tissues such as adipose tissue and liver have important roles in metabolic homeostasis. The molecular identification of genes encoding enzymes that catalyze steps in TAG biosynthesis from glycerol 3-phosphate has revealed an unexpected number of protein isoforms of the glycerol phosphate acyltransferase (GPAT), acylglycerolphosphate acyltransferase (AGPAT), and lipin (phosphatidate phosphatase) families that appear to catalyze similar biochemical reactions. However, on the basis of available data for a few members in which genetic deficiencies in mouse and/or human have been studied, we postulate that each GPAT, AGPAT, and lipin family member likely has a specialized role that may be uncovered through careful biochemical and physiological analyses. PMID:19336658

  17. Ribonucleic Acid Regulation in Permeabilized Cells of Escherichia coli Capable of Ribonucleic Acid and Protein Synthesis1

    PubMed Central

    Atherly, Alan G.

    1974-01-01

    A cell permeabilization procedure is described that reduces viability less than 10% and does not significantly reduce the rates of ribonucleic acid and protein synthesis when appropriately supplemented. Permeabilization abolishes the normal stringent coupling of protein and ribonucleic acid synthesis. PMID:4364330

  18. Plastid-localized amino acid biosynthetic pathways of Plantae are predominantly composed of non-cyanobacterial enzymes

    PubMed Central

    Reyes-Prieto, Adrian; Moustafa, Ahmed

    2012-01-01

    Studies of photosynthetic eukaryotes have revealed that the evolution of plastids from cyanobacteria involved the recruitment of non-cyanobacterial proteins. Our phylogenetic survey of >100 Arabidopsis nuclear-encoded plastid enzymes involved in amino acid biosynthesis identified only 21 unambiguous cyanobacterial-derived proteins. Some of the several non-cyanobacterial plastid enzymes have a shared phylogenetic origin in the three Plantae lineages. We hypothesize that during the evolution of plastids some enzymes encoded in the host nuclear genome were mistargeted into the plastid. Then, the activity of those foreign enzymes was sustained by both the plastid metabolites and interactions with the native cyanobacterial enzymes. Some of the novel enzymatic activities were favored by selective compartmentation of additional complementary enzymes. The mosaic phylogenetic composition of the plastid amino acid biosynthetic pathways and the reduced number of plastid-encoded proteins of non-cyanobacterial origin suggest that enzyme recruitment underlies the recompartmentation of metabolic routes during the evolution of plastids. PMID:23233874

  19. Enzyme-catalyzed synthesis of saccharide acrylate monomers from nonedible biomass.

    PubMed

    Kloosterman, Wouter M J; Brouwer, Sander G M; Loos, Katja

    2014-08-01

    Various cellulase preparations were found to catalyze the transglycosidation between cotton linters and 2-hydroxyethyl acrylate. The conversion and enzyme activity were found to be optimal in reaction mixtures that contained 5 vol % of the acrylate. The structures of the products were revealed by using TLC and (1) H and (13) C NMR spectroscopy. The enzyme-catalyzed reaction resulted in two products. The minor product originated from transglycosidation to hemicellulose and was found to be 2-(β-xylosyloxy)-ethyl acrylate. The major product was identified as 2-(β-glucosyloxy)-ethyl acrylate and the yield of the product was 5 wt % based on the amount of consumed cellulose. Glycosidation products with oligosaccharide moieties could not be detected in the reaction mixture. This result can be explained by the hydrolytic activities of the used cellulase preparation. Cellulase from Trichoderma reesei was found to possess, in addition to endoglucanase activity, cellobiosidase and β-glucosidase activities. Five other cellulase preparations from different origins were tested as well for catalysis of oligosaccharide acrylate synthesis. For most cellulase preparations the major transglycosidation product appeared to be 2-(β-glucosyloxy)-ethyl acrylate. Nevertheless, the endo-β-(1,4)-glucanase from Trichoderma longibrachiatum was found to catalyze the synthesis of 2-(β-cellobiosyloxy)-ethyl acrylate. Unlike the other cellulase preparations, endo-β-(1,4)-glucanase from T. longibrachiatum showed no detectable β-glucosidase activity and therefore oligosaccharide acrylate monomers were not further hydrolyzed into the monosaccharide acrylate 2-(β-glucosyloxy)-ethyl acrylate. PMID:24866837

  20. The Unusual Acid-Accumulating Behavior during Ripening of Cherimoya (Annona cherimola Mill.) is Linked to Changes in Transcription and Enzyme Activity Related to Citric and Malic Acid Metabolism.

    PubMed

    González-Agüero, Mauricio; Tejerina Pardo, Luis; Zamudio, María Sofía; Contreras, Carolina; Undurraga, Pedro; Defilippi, Bruno G

    2016-01-01

    Cherimoya (Annona cherimola Mill.) is a subtropical fruit characterized by a significant increase in organic acid levels during ripening, making it an interesting model for studying the relationship between acidity and fruit flavor. In this work, we focused on understanding the balance between the concentration of organic acids and the gene expression and activity of enzymes involved in the synthesis and degradation of these metabolites during the development and ripening of cherimoya cv. "Concha Lisa". Our results showed an early accumulation of citric acid and other changes associated with the accumulation of transcripts encoding citrate catabolism enzymes. During ripening, a 2-fold increase in malic acid and a 6-fold increase in citric acid were detected. By comparing the contents of these compounds with gene expression and enzymatic activity levels, we determined that cytoplasmic NAD-dependent malate dehydrogenase (cyNAD-MDH) and mitochondrial citrate synthase (mCS) play important regulatory roles in the malic and citric acid biosynthetic pathways. PMID:27120592

  1. Highly efficient enzymatic synthesis of an ascorbyl unstaturated fatty acid ester with ecofriendly biomass-derived 2-methyltetrahydrofuran as cosolvent.

    PubMed

    Hu, Ying-Dan; Qin, Ye-Zhi; Li, Ning; Zong, Min-Hua

    2014-01-01

    Enzymatic synthesis of ascorbyl undecylenate, an unsaturated fatty acid ester of ascorbic acid, was reported with biomass-derived 2-methyltetrahydrofuran (MeTHF) as the cosolvent. Of the immobilized lipases tested, Candida antarctica lipase B (CAL-B) showed the highest activity for enzymatic synthesis of ascorbyl undecylenate. Effect of reaction media on the enzymatic reaction was studied. The cosolvent mixture, t-butanol-MeTHF (1:4, v/v) proved to be the optimal medium, in which not only ascorbic acid had moderate solubility, but also CAL-B showed a high activity, thus addressing the major problem of the solvent conflict for dissolving substrate and keeping satisfactory enzyme activity. In addition, the enzyme was much more stable in MeTHF and t-butanol-MeTHF (1:4) than in previously widely used organic solvents, t-butanol, 2-methyl-2-butanol, and acetone. The much higher initial reaction rate in this cosolvent mixture may be rationalized by the much lower apparent activation energy of this enzymatic reaction (26.6 vs. 38.1-39.1 kJ/mol) and higher enzyme catalytic efficiency (Vmax /Km , 8.4 vs. 1.3-1.4 h(-1) ). Ascorbyl undecylenate was obtained with the yields of 84-89% and 6-regioselectivity of >99% in t-butanol-MeTHF (1:4) at supersaturated substrate concentrations (60 and 100 mM) after 5-8 h. PMID:24891225

  2. Evolutionary distinctiveness of fatty acid and polyketide synthesis in eukaryotes.

    PubMed

    Kohli, Gurjeet S; John, Uwe; Van Dolah, Frances M; Murray, Shauna A

    2016-08-01

    Fatty acids, which are essential cell membrane constituents and fuel storage molecules, are thought to share a common evolutionary origin with polyketide toxins in eukaryotes. While fatty acids are primary metabolic products, polyketide toxins are secondary metabolites that are involved in ecologically relevant processes, such as chemical defence, and produce the adverse effects of harmful algal blooms. Selection pressures on such compounds may be different, resulting in differing evolutionary histories. Surprisingly, some studies of dinoflagellates have suggested that the same enzymes may catalyse these processes. Here we show the presence and evolutionary distinctiveness of genes encoding six key enzymes essential for fatty acid production in 13 eukaryotic lineages for which no previous sequence data were available (alveolates: dinoflagellates, Vitrella, Chromera; stramenopiles: bolidophytes, chrysophytes, pelagophytes, raphidophytes, dictyochophytes, pinguiophytes, xanthophytes; Rhizaria: chlorarachniophytes, haplosporida; euglenids) and 8 other lineages (apicomplexans, bacillariophytes, synurophytes, cryptophytes, haptophytes, chlorophyceans, prasinophytes, trebouxiophytes). The phylogeny of fatty acid synthase genes reflects the evolutionary history of the organism, indicating selection to maintain conserved functionality. In contrast, polyketide synthase gene families are highly expanded in dinoflagellates and haptophytes, suggesting relaxed constraints in their evolutionary history, while completely absent from some protist lineages. This demonstrates a vast potential for the production of bioactive polyketide compounds in some lineages of microbial eukaryotes, indicating that the evolution of these compounds may have played an important role in their ecological success. PMID:26784357

  3. Crystal structure of FadD32, an enzyme essential for mycolic acid biosynthesis in mycobacteria

    PubMed Central

    Li, Wenjuan; Gu, Shoujin; Fleming, Joy; Bi, Lijun

    2015-01-01

    Fatty acid degradation protein D32 (FadD32), an enzyme required for mycolic acid biosynthesis and essential for mycobacterial growth, has recently been identified as a valid and promising target for anti-tuberculosis drug development. Here we report the crystal structures of Mycobacterium smegmatis FadD32 in the apo and ATP-bound states at 2.4 Å and 2.25 Å resolution, respectively. FadD32 consists of two globular domains connected by a flexible linker. ATP binds in a cleft at the interface between the N- and C-terminal domains and its binding induces significant local conformational changes in FadD32. The binding sites of meromycolic acid and phosphopantetheine are identified by structural comparison with other members of the adenylating enzyme superfamily. These results will improve our understanding of the catalytic mechanism of FadD32 and help in the design of inhibitors of this essential enzyme. PMID:26628098

  4. Crystal structure of FadD32, an enzyme essential for mycolic acid biosynthesis in mycobacteria.

    PubMed

    Li, Wenjuan; Gu, Shoujin; Fleming, Joy; Bi, Lijun

    2015-01-01

    Fatty acid degradation protein D32 (FadD32), an enzyme required for mycolic acid biosynthesis and essential for mycobacterial growth, has recently been identified as a valid and promising target for anti-tuberculosis drug development. Here we report the crystal structures of Mycobacterium smegmatis FadD32 in the apo and ATP-bound states at 2.4 Å and 2.25 Å resolution, respectively. FadD32 consists of two globular domains connected by a flexible linker. ATP binds in a cleft at the interface between the N- and C-terminal domains and its binding induces significant local conformational changes in FadD32. The binding sites of meromycolic acid and phosphopantetheine are identified by structural comparison with other members of the adenylating enzyme superfamily. These results will improve our understanding of the catalytic mechanism of FadD32 and help in the design of inhibitors of this essential enzyme. PMID:26628098

  5. Catalytic nucleic acid enzymes for the study and development of therapies in the central nervous system

    PubMed Central

    Tritz, Richard; Habita, Cellia; Robbins, Joan M.; Gomez, German G.; Kruse, Carol A.

    2005-01-01

    Summary Nucleic acid enzymes have been used with great success for studying natural processes in the central nervous system (CNS). We first provide information on the structural and enzymatic differences of various ribozymes and DNAzymes. We then discuss how they have been used to explore new therapeutic approaches for treating diseases of the CNS. They have been tested in various systems modeling retinitis pigmentosum, proliferative vitreoretinopathy, Alzheimer's disease, and malignant brain tumors. For these models, effective targets for nucleic acid enzymes have been readily identified and the rules for selecting cleavage sites have been well established. The bulk of studies, including those from our laboratory, have emphasized their use for gliomas. With the availability of multiple excellent animal models to test glioma treatments, good progress has been made in the initial testing of nucleic acid enzymes for brain tumor therapy. However, opportunities still exist to significantly improve the delivery and efficacy of ribozymes to achieve effective treatment. The future holds significant potential for the molecular targeting and therapy of eye diseases, neurodegenerative disorders, and brain tumors with these unique treatment agents. PMID:16467915

  6. Synthesis and characterization of magnetite nanoparticles coated with lauric acid

    SciTech Connect

    Mamani, J.B.; Costa-Filho, A.J.; Cornejo, D.R.; Vieira, E.D.; Gamarra, L.F.

    2013-07-15

    Understanding the process of synthesis of magnetic nanoparticles is important for its implementation in in vitro and in vivo studies. In this work we report the synthesis of magnetic nanoparticles made from ferrous oxide through coprecipitation chemical process. The nanostructured material was coated with lauric acid and dispersed in aqueous medium containing surfactant that yielded a stable colloidal suspension. The characterization of magnetic nanoparticles with distinct physico-chemical configurations is fundamental for biomedical applications. Therefore magnetic nanoparticles were characterized in terms of their morphology by means of TEM and DLS, which showed a polydispersed set of spherical nanoparticles (average diameter of ca. 9 nm) as a result of the protocol. The structural properties were characterized by using X-ray diffraction (XRD). XRD pattern showed the presence of peaks corresponding to the spinel phase of magnetite (Fe{sub 3}O{sub 4}). The relaxivities r{sub 2} and r{sub 2}* values were determined from the transverse relaxation times T{sub 2} and T{sub 2}* at 3 T. Magnetic characterization was performed using SQUID and FMR, which evidenced the superparamagnetic properties of the nanoparticles. Thermal characterization using DSC showed exothermic events associated with the oxidation of magnetite to maghemite. - Highlights: • Synthesis of magnetic nanoparticles coated with lauric acid • Characterization of magnetic nanoparticles • Morphological, structural, magnetic, calorimetric and relaxometric characterization.

  7. Increased Bile Acid Synthesis and Deconjugation After Biliopancreatic Diversion.

    PubMed

    Ferrannini, Ele; Camastra, Stefania; Astiarraga, Brenno; Nannipieri, Monica; Castro-Perez, Jose; Xie, Dan; Wang, Liangsu; Chakravarthy, Manu; Haeusler, Rebecca A

    2015-10-01

    Biliopancreatic diversion (BPD) improves insulin sensitivity and decreases serum cholesterol out of proportion with weight loss. Mechanisms of these effects are unknown. One set of proposed contributors to metabolic improvements after bariatric surgeries is bile acids (BAs). We investigated the early and late effects of BPD on plasma BA levels, composition, and markers of BA synthesis in 15 patients with type 2 diabetes (T2D). We compared these to the early and late effects of Roux-en-Y gastric bypass (RYGB) in 22 patients with T2D and 16 with normal glucose tolerance. Seven weeks after BPD, insulin sensitivity had doubled and serum cholesterol had halved. At this time, BA synthesis markers and total plasma BAs, particularly unconjugated BAs, had markedly risen; this effect could not be entirely explained by low FGF19. In contrast, after RYGB, insulin sensitivity improved gradually with weight loss and cholesterol levels declined marginally; BA synthesis markers were decreased at an early time point (2 weeks) after surgery and returned to the normal range 1 year later. These findings indicate that BA synthesis contributes to the decreased serum cholesterol after BPD. Moreover, they suggest a potential role for altered enterohepatic circulation of BAs in improving insulin sensitivity and cholesterol metabolism after BPD. PMID:26015549

  8. Tetrahydrofolate enzyme levels in Acetobacterium woodii and their implication in the synthesis of acetate from CO2.

    PubMed Central

    Tanner, R S; Wolfe, R S; Ljungdahl, L G

    1978-01-01

    Acetate synthesis from CO2 by Acetobacterium woodii may occur as in homoacetate-fermenting clostridia, as indicated by high levels of enzymes of the tetrahydrofolate pathway and by pyruvate-dependent formation of acetate from methyl-B12 and methyltetrahydrofolate. PMID:659361

  9. Tetrahydrofolate enzyme levels in Acetobacterium woodii and their implication in the synthesis of acetate from CO2.

    PubMed

    Tanner, R S; Wolfe, R S; Ljungdahl, L G

    1978-05-01

    Acetate synthesis from CO2 by Acetobacterium woodii may occur as in homoacetate-fermenting clostridia, as indicated by high levels of enzymes of the tetrahydrofolate pathway and by pyruvate-dependent formation of acetate from methyl-B12 and methyltetrahydrofolate. PMID:659361

  10. The acid tolerance response of Salmonella typhimurium involves transient synthesis of key acid shock proteins.

    PubMed Central

    Foster, J W

    1993-01-01

    Although Salmonella typhimurium prefers neutral-pH environments, it can adapt to survive conditions of severe low-pH stress (pH 3.3). The process, termed the acid tolerance response (ATR), includes two distinct stages. The first stage, called pre-acid shock, is induced at pH 5.8 and involves the production of an inducible pH homeostasis system functional at external pH values below 4.0. The second stage occurs following an acid shock shift to pH 4.5 or below and is called the post-acid shock stage. During this stage of the ATR, 43 acid shock proteins (ASPs) are synthesized. The present data reveal that several ASPs important for pH 3.3 acid tolerance are only transiently produced. Their disappearance after 30 to 40 min of pH 4.4 acid shock coincides with an inability to survive subsequent pH 3.3 acid challenge. Clearly, an essential feature of inducible acid tolerance is an ability to synthesize these key ASPs. The pre-acid shock stage, with its inducible pH homeostasis system, offers the cell an enhanced ability to synthesize ASPs following rapid shifts to conditions below pH 4.0, an external pH that normally prevents ASP synthesis. The data also address possible signals for ASP synthesis. The inducing signal for 22 ASPs appears to be internal acidification, while external pH serves to induce 13 others. Of the 14 transient ASPs, 10 are induced in response to changes in internal pH. Mutations in the fur (ferric uptake regulator) locus that produce an Atr- acid-sensitive phenotype also eliminate induction of six transiently induced ASPs. Images PMID:8458840

  11. Toward "stable-on-the-table" enzymes: improving key properties of catalase by covalent conjugation with poly(acrylic acid).

    PubMed

    Riccardi, Caterina M; Cole, Kyle S; Benson, Kyle R; Ward, Jessamyn R; Bassett, Kayla M; Zhang, Yiren; Zore, Omkar V; Stromer, Bobbi; Kasi, Rajeswari M; Kumar, Challa V

    2014-08-20

    Several key properties of catalase such as thermal stability, resistance to protease degradation, and resistance to ascorbate inhibition were improved, while retaining its structure and activity, by conjugation to poly(acrylic acid) (PAA, Mw 8000) via carbodiimide chemistry where the amine groups on the protein are appended to the carboxyl groups of the polymer. Catalase conjugation was examined at three different pH values (pH 5.0, 6.0, and 7.0) and at three distinct mole ratios (1:100, 1:500, and 1:1000) of catalase to PAA at each reaction pH. The corresponding products are labeled as Cat-PAA(x)-y, where x is the protein to polymer mole ratio and y is the pH used for the synthesis. The coupling reaction consumed about 60-70% of the primary amines on the catalase; all samples were completely water-soluble and formed nanogels, as evidenced by gel electrophoresis and electron microscopy. The UV circular dichroism (CD) spectra indicated substantial retention of protein secondary structure for all samples, which increased to 100% with increasing pH of the synthesis and polymer mole fraction. Soret CD bands of all samples indicated loss of ∼50% of band intensities, independent of the reaction pH. Catalytic activities of the conjugates increased with increasing synthesis pH, where 55-80% and 90-100% activity was retained for all samples synthesized at pH 5.0 and pH 7.0, respectively, and the Km or Vmax values of Cat-PAA(100)-7 did not differ significantly from those of the free enzyme. All conjugates synthesized at pH 7.0 were thermally stable even when heated to ∼85-90 °C, while native catalase denatured between 55 and 65 °C. All conjugates retained 40-90% of their original activities even after storing for 10 weeks at 8 °C, while unmodified catalase lost all of its activity within 2 weeks, under similar storage conditions. Interestingly, PAA surrounding catalase limited access to the enzyme from large molecules like proteases and significantly increased

  12. DEVELOPMENT OF ENZYME-LINKED IMMUNOSORBENT ASSAYS FOR ISOCUPRESSIC ACID AND SERUM METABOLITES OF ISOCUPRESSIC ACID

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The consumption of ponderosa pine (Pinus ponderosa), lodgepole pine (Pinus contorta), common juniper (Juniperus communis) and Monterey cypress (Cupressus macrocarpa) causes abortions in pregnant cattle. Recent studies have identified isocupressic acid as the primary abortifacient compound in these ...

  13. Enzymes useful for chiral compound synthesis: structural biology, directed evolution, and protein engineering for industrial use.

    PubMed

    Kataoka, Michihiko; Miyakawa, Takuya; Shimizu, Sakayu; Tanokura, Masaru

    2016-07-01

    Biocatalysts (enzymes) have many advantages as catalysts for the production of useful compounds as compared to chemical catalysts. The stereoselectivity of the enzymes is one advantage, and thus the stereoselective production of chiral compounds using enzymes is a promising approach. Importantly, industrial application of the enzymes for chiral compound production requires the discovery of a novel useful enzyme or enzyme function; furthermore, improving the enzyme properties through protein engineering and directed evolution approaches is significant. In this review, the significance of several enzymes showing stereoselectivity (quinuclidinone reductase, aminoalcohol dehydrogenase, old yellow enzyme, and threonine aldolase) in chiral compound production is described, and the improvement of these enzymes using protein engineering and directed evolution approaches for further usability is discussed. Currently, enzymes are widely used as catalysts for the production of chiral compounds; however, for further use of enzymes in chiral compound production, improvement of enzymes should be more essential, as well as discovery of novel enzymes and enzyme functions. PMID:27188776

  14. The Crystal Structure of the Adenylation Enzyme VinN Reveals a Unique β-Amino Acid Recognition Mechanism*

    PubMed Central

    Miyanaga, Akimasa; Cieślak, Jolanta; Shinohara, Yuji; Kudo, Fumitaka; Eguchi, Tadashi

    2014-01-01

    Adenylation enzymes play important roles in the biosynthesis and degradation of primary and secondary metabolites. Mechanistic insights into the recognition of α-amino acid substrates have been obtained for α-amino acid adenylation enzymes. The Asp residue is invariant and is essential for the stabilization of the α-amino group of the substrate. In contrast, the β-amino acid recognition mechanism of adenylation enzymes is still unclear despite the importance of β-amino acid activation for the biosynthesis of various natural products. Herein, we report the crystal structure of the stand-alone adenylation enzyme VinN, which specifically activates (2S,3S)-3-methylaspartate (3-MeAsp) in vicenistatin biosynthesis. VinN has an overall structure similar to that of other adenylation enzymes. The structure of the complex with 3-MeAsp revealed that a conserved Asp230 residue is used in the recognition of the β-amino group of 3-MeAsp similar to α-amino acid adenylation enzymes. A mutational analysis and structural comparison with α-amino acid adenylation enzymes showed that the substrate-binding pocket of VinN has a unique architecture to accommodate 3-MeAsp as a β-amino acid substrate. Thus, the VinN structure allows the first visualization of the interaction of an adenylation enzyme with a β-amino acid and provides new mechanistic insights into the selective recognition of β-amino acids in this family of enzymes. PMID:25246523

  15. The crystal structure of the adenylation enzyme VinN reveals a unique β-amino acid recognition mechanism.

    PubMed

    Miyanaga, Akimasa; Cieślak, Jolanta; Shinohara, Yuji; Kudo, Fumitaka; Eguchi, Tadashi

    2014-11-01

    Adenylation enzymes play important roles in the biosynthesis and degradation of primary and secondary metabolites. Mechanistic insights into the recognition of α-amino acid substrates have been obtained for α-amino acid adenylation enzymes. The Asp residue is invariant and is essential for the stabilization of the α-amino group of the substrate. In contrast, the β-amino acid recognition mechanism of adenylation enzymes is still unclear despite the importance of β-amino acid activation for the biosynthesis of various natural products. Herein, we report the crystal structure of the stand-alone adenylation enzyme VinN, which specifically activates (2S,3S)-3-methylaspartate (3-MeAsp) in vicenistatin biosynthesis. VinN has an overall structure similar to that of other adenylation enzymes. The structure of the complex with 3-MeAsp revealed that a conserved Asp(230) residue is used in the recognition of the β-amino group of 3-MeAsp similar to α-amino acid adenylation enzymes. A mutational analysis and structural comparison with α-amino acid adenylation enzymes showed that the substrate-binding pocket of VinN has a unique architecture to accommodate 3-MeAsp as a β-amino acid substrate. Thus, the VinN structure allows the first visualization of the interaction of an adenylation enzyme with a β-amino acid and provides new mechanistic insights into the selective recognition of β-amino acids in this family of enzymes. PMID:25246523

  16. Enzymatic synthesis of oligo- and polysaccharide fatty acid esters.

    PubMed

    van den Broek, Lambertus A M; Boeriu, Carmen G

    2013-03-01

    Amphiphilic oligo- and polysaccharides (e.g. polysaccharide alkyl or alkyl-aryl esters) form a new class of polymers with exceptional properties. They function as polymeric surfactants, whilst maintaining most of the properties of the starting polymeric material such as emulsifying, gelling, and film forming properties combined with partial water solubility or permeability. At present carbohydrate fatty acid esters are generally obtained by chemical methods using toxic solvents and organic and inorganic catalysts that leave residual traces in the final products. Enzymatic reactions offer an attractive alternative route for the synthesis of polysaccharide esters. In this review the state of the art of enzymatic synthesis of oligo- and polysaccharides fatty esters has been described. PMID:23465902

  17. Simian Virus 40 Deoxyribonucleic Acid Synthesis: Analysis by Gel Electrophoresis

    PubMed Central

    Tegtmeyer, Peter; Macasaet, Francisco

    1972-01-01

    An agarose-gel electrophoresis technique has been developed to study simian virus 40 deoxyribonucleic acid (DNA) synthesis. Superhelical DNA I, relaxed DNA II, and replicative intermediate (RI) molecules were clearly resolved from one another for analytical purposes. Moreover, the RI molecules could be identified as early or late forms on the basis of their electrophoretic migration in relation to that of DNA II. The technique has been utilized to study the kinetics of simian virus 40 DNA synthesis in pulse and in pulse-chase experiments. The average time required to complete the replication of prelabeled RI molecules and to convert them into DNA I was approximately 10 min under the experimental conditions employed. PMID:4343542

  18. Study and comparison of two enzyme membrane reactors for fatty acids and glycerol production

    SciTech Connect

    Molinari, R.; Santoro, M.E.; Drioli, E. . Dept. of Chemical Engineering and Materials Inst. on Membranes and Chemical Reactors-CNR, Arcavacata di Rende )

    1994-11-01

    Two enzyme membrane reactors (EMR), (1) with one substrate (olive oil) in an oil-in-water emulsion (E-EMR) and (2) with two separated liquid phases (oil and water) (TSLP-EMR), have been studied for the conversion of the triglycerides to fatty acids and glycerol. The enzyme was Candida cylindracea lipase confined on the pressurized face or entrapped in the sponge side of capillary ultrafiltration membranes. Two methods for immobilizing the enzyme in the TSLP-EMR were used: ultrafiltration on a virgin membrane and ultrafiltration on glutaraldehyde pretreated membranes. A multiple use of the reactor was obtained immobilizing the enzyme on the membrane preactivated with glutaraldehyde. The TSLP-EMR showed a specific activity of 0.529 mmol/(mg[center dot]h) versus a specific activity of 0.170 mmol/(mg[center dot]h) of the E-EMR. The rate of fatty acid production in the TSLP-EMR was linear with time showing no enzyme deactivation in an operating time of 80 h. The kinetics observed in the two reactors was different: an equilibrium reaction product-inhibited for the E-EMR and an apparent irreversible reaction of zero order for the TSLP-EMR. Taking into account that in the TSLP-EMR, compared to the E-EMR, (1) the specific activity was higher, (2) the specific rate was constant with the time, and (3) the two products were already separated after the reaction, the TSLP-EMR configuration seems the more convenient.

  19. Trifluorosubstrates as mechanistic probes for an FMN-dependent l-2-hydroxy acid-oxidizing enzyme.

    PubMed

    Lederer, Florence; Vignaud, Caroline; North, Paul; Bodevin, Sabrina

    2016-09-01

    A controversy exists with respect to the mechanism of l-2-hydroxy acid oxidation by members of a family of FMN-dependent enzymes. A so-called carbanion mechanism was initially proposed, in which the active site histidine abstracts the substrate α-hydrogen as a proton, followed by electron transfer from the carbanion to the flavin. But an alternative mechanism was not incompatible with some results, a mechanism in which the active site histidine instead picks up the substrate hydroxyl proton and a hydride transfer occurs. Even though more recent experiments ruling out such a mechanism were published (Rao & Lederer (1999) Protein Science 7, 1531-1537), a few authors have subsequently interpreted their results with variant enzymes in terms of a hydride transfer. In the present work, we analyse the reactivity of trifluorolactate, a substrate analogue, with the flavocytochrome b2 (Fcb2) flavodehydrogenase domain, compared to its reactivity with an NAD-dependent lactate dehydrogenase (LDH), for which this compound is known to be an inhibitor (Pogolotti & Rupley (1973) Biochem. Biophys. Res. Commun, 55, 1214-1219). Indeed, electron attraction by the three fluorine atoms should make difficult the removal of the α-H as a hydride. We also analyse the reactivity of trifluoropyruvate with the FMN- and NAD-dependent enzymes. The results substantiate a different effect of the fluorine substituents on the two enzymes compared to their normal substrates. In the discussion we analyse the conclusions of recent papers advocating a hydride transfer mechanism for the family of l-2-hydroxy acid oxidizing FMN-dependent enzymes. PMID:27155230

  20. (-)-Hydroxycitric Acid Nourishes Protein Synthesis via Altering Metabolic Directions of Amino Acids in Male Rats.

    PubMed

    Han, Ningning; Li, Longlong; Peng, Mengling; Ma, Haitian

    2016-08-01

    (-)-Hydroxycitric acid (HCA), a major active ingredient of Garcinia Cambogia extracts, had shown to suppress body weight gain and fat accumulation in animals and humans. While, the underlying mechanism of (-)-HCA has not fully understood. Thus, this study was aimed to investigate the effects of long-term supplement with (-)-HCA on body weight gain and variances of amino acid content in rats. Results showed that (-)-HCA treatment reduced body weight gain and increased feed conversion ratio in rats. The content of hepatic glycogen, muscle glycogen, and serum T4 , T3 , insulin, and Leptin were increased in (-)-HCA treatment groups. Protein content in liver and muscle were significantly increased in (-)-HCA treatment groups. Amino acid profile analysis indicated that most of amino acid contents in serum and liver, especially aromatic amino acid and branched amino acid, were higher in (-)-HCA treatment groups. However, most of the amino acid contents in muscle, especially aromatic amino acid and branched amino acid, were reduced in (-)-HCA treatment groups. These results indicated that (-)-HCA treatment could reduce body weight gain through promoting energy expenditure via regulation of thyroid hormone levels. In addition, (-)-HCA treatment could promote protein synthesis by altering the metabolic directions of amino acids. Copyright © 2016 John Wiley & Sons, Ltd. PMID:27145492

  1. N-3 fatty acid intake altered fat content and fatty acid distribution in chicken breast muscle, but did not influence mRNA expression of lipid-related enzymes

    PubMed Central

    2014-01-01

    Background The conversions of the n-3 and n-6 fatty acid of plant origin to the C20 and C22 very long chain fatty acids (LCPUFAs) is regulated by several cellular enzymes such as elongases and desaturases. Methods Sixty-five male one-day old chickens (Ross 308) were randomly divided into four groups and given one of four diets; with or without linseed oil (LO), (the diets contained equal amounts of fat) and with low or high selenium (Se). Final body weight, amount of Se and fat in breast muscle, fatty acid profile, and gene expression for fatty acid desaturases (Fads1, Fads2, Fads9), HMG-CoA reductase, Acyl-CoA oxidase (Acox), carnitine palmitoyl transferase1 (Cpt1), superoxide dismutase (Sod) and glutathione peroxidase4 (Gpx4) were analyzed in all animals, and Gpx activity in whole blood was determined. Results mRNA expression of elongases and desaturases in chicken breast muscle was not affected by feed rich in C18:3n-3. The highly positive correlation between amount of fat in breast muscle and the product/precursor indices of monounsaturated fatty acid synthesis, and the negative correlation between muscle fat and indices of LCPUFA synthesis should be further studied. Conclusion mRNA expression in chicken breast muscle of elongases and desaturases was not affected by feed rich in C18:3n-3. The highly positive correlation between amount of fat in breast muscle and the product/precursor indices of monounsaturated fatty acid synthesis, and the negative correlation between muscle fat and indices of LCPUFA synthesis should be further studied. PMID:24894510

  2. Effects of Omega-3 Fatty Acids Supplement on Antioxidant Enzymes Activity in Type 2 Diabetic Patients

    PubMed Central

    TOORANG, Fatemeh; DJAZAYERY, Abolghassem; DJALALI, Mahmoud

    2016-01-01

    Background: Diabetes is a major cause of death. Oxidative stress mainly caused by hyperglycemia is the primary reason of related complications. Omega-3 fatty acids are prescribed in diabetes but the effect on antioxidant defense is controversial. This study investigated effects of omega-3 supplementation on antioxidant enzymes activity in type 2 diabetic patients. Methods: A randomized, placebo controlled, double blind clinical trial was performed on 90 type2 diabetic patients. The treatment group took, daily, three capsules of omega-3 for two mo, which totally provided 2714mg omega-3 (EPA=1548 mg, DHA=828 mg and 338 mg of other omega=3 fatty acids). Placebo contained 2100 mg sunflower oil (12% SFA, 65% linoleic acid, 23% MUFA), which is the main oil used in the study population. Food intakes, anthropometric and demographic characteristics, and therapeutic regimen data were recorded before and after the intervention. Fasting blood samples were taken before and after the intervention to measure super oxide dismutase, glutathione peroxidase, glutathione reductase, catalase and total antioxidant capacity in erythrocytes. Results: A total of 81 subjects completed the study. Two study groups were similar as regards duration of diabetes, age and the enzymes at baseline. Energy and macro- and micronutrients intakes, weight and hypoglycemic agent consumption were similar in the two groups at baseline and did not change. Supplementation had no effect on antioxidant enzyme status. Glycated hemoglobin showed a significant reduction by supplementation. Conclusion: Daily supplementation of 2714 mg mega-3 for two mo results in a significant reduction in HbA1c level in type2 diabetic patients with no effects on antioxidant enzymes activity. PMID:27141496

  3. Interference of L-α-aminoocy-β-phenylpropionic acid with cold-induced sphagnorubin synthesis in Sphagnum magellanicum BRID.

    PubMed

    Tutschek, R

    1982-08-01

    The ability of the phenylalanine ammonia-lyase (PAL)-inhibitor L-α-aminooxy-β-phenyl-propionic acid (AOPP) to suppress the synthesis of the main reddish-violet wall pigment of Sphagnum magellanicum (sphagnorubin) was investigated. Fifty percent inhibition is achieved with 14 μM AOPP in mosses stimulated to intensive coloring by sugar feeding. AOPP does not affect the content of free amino acids, except for phenylalanine, during cold-induced sphagnorubin synthesis. AOPP dramatically amplifies the increase in extractable PAL activity in response to cold treatment. Phenylalanine applied in vivo causes an eminent increase in PAL activity, above the level of the cold-treated mosses. The results from the feeding experiments are discussed in connection with a possible end-product repression in PAL activity with sphagnorubin-synthesizing mosses. These results are correspond best to the theory that the enzyme level is regulated independently from a mechanism of feedback repression. PMID:24271864

  4. Calcineurin mediates homeostatic synaptic plasticity by regulating retinoic acid synthesis

    PubMed Central

    Arendt, Kristin L.; Zhang, Zhenjie; Ganesan, Subhashree; Hintze, Maik; Shin, Maggie M.; Tang, Yitai; Cho, Ahryon; Graef, Isabella A.; Chen, Lu

    2015-01-01

    Homeostatic synaptic plasticity is a form of non-Hebbian plasticity that maintains stability of the network and fidelity for information processing in response to prolonged perturbation of network and synaptic activity. Prolonged blockade of synaptic activity decreases resting Ca2+ levels in neurons, thereby inducing retinoic acid (RA) synthesis and RA-dependent homeostatic synaptic plasticity; however, the signal transduction pathway that links reduced Ca2+-levels to RA synthesis remains unknown. Here we identify the Ca2+-dependent protein phosphatase calcineurin (CaN) as a key regulator for RA synthesis and homeostatic synaptic plasticity. Prolonged inhibition of CaN activity promotes RA synthesis in neurons, and leads to increased excitatory and decreased inhibitory synaptic transmission. These effects of CaN inhibitors on synaptic transmission are blocked by pharmacological inhibitors of RA synthesis or acute genetic deletion of the RA receptor RARα. Thus, CaN, acting upstream of RA, plays a critical role in gating RA signaling pathway in response to synaptic activity. Moreover, activity blockade-induced homeostatic synaptic plasticity is absent in CaN knockout neurons, demonstrating the essential role of CaN in RA-dependent homeostatic synaptic plasticity. Interestingly, in GluA1 S831A and S845A knockin mice, CaN inhibitor- and RA-induced regulation of synaptic transmission is intact, suggesting that phosphorylation of GluA1 C-terminal serine residues S831 and S845 is not required for CaN inhibitor- or RA-induced homeostatic synaptic plasticity. Thus, our study uncovers an unforeseen role of CaN in postsynaptic signaling, and defines CaN as the Ca2+-sensing signaling molecule that mediates RA-dependent homeostatic synaptic plasticity. PMID:26443861

  5. Calcineurin mediates homeostatic synaptic plasticity by regulating retinoic acid synthesis.

    PubMed

    Arendt, Kristin L; Zhang, Zhenjie; Ganesan, Subhashree; Hintze, Maik; Shin, Maggie M; Tang, Yitai; Cho, Ahryon; Graef, Isabella A; Chen, Lu

    2015-10-20

    Homeostatic synaptic plasticity is a form of non-Hebbian plasticity that maintains stability of the network and fidelity for information processing in response to prolonged perturbation of network and synaptic activity. Prolonged blockade of synaptic activity decreases resting Ca(2+) levels in neurons, thereby inducing retinoic acid (RA) synthesis and RA-dependent homeostatic synaptic plasticity; however, the signal transduction pathway that links reduced Ca(2+)-levels to RA synthesis remains unknown. Here we identify the Ca(2+)-dependent protein phosphatase calcineurin (CaN) as a key regulator for RA synthesis and homeostatic synaptic plasticity. Prolonged inhibition of CaN activity promotes RA synthesis in neurons, and leads to increased excitatory and decreased inhibitory synaptic transmission. These effects of CaN inhibitors on synaptic transmission are blocked by pharmacological inhibitors of RA synthesis or acute genetic deletion of the RA receptor RARα. Thus, CaN, acting upstream of RA, plays a critical role in gating RA signaling pathway in response to synaptic activity. Moreover, activity blockade-induced homeostatic synaptic plasticity is absent in CaN knockout neurons, demonstrating the essential role of CaN in RA-dependent homeostatic synaptic plasticity. Interestingly, in GluA1 S831A and S845A knockin mice, CaN inhibitor- and RA-induced regulation of synaptic transmission is intact, suggesting that phosphorylation of GluA1 C-terminal serine residues S831 and S845 is not required for CaN inhibitor- or RA-induced homeostatic synaptic plasticity. Thus, our study uncovers an unforeseen role of CaN in postsynaptic signaling, and defines CaN as the Ca(2+)-sensing signaling molecule that mediates RA-dependent homeostatic synaptic plasticity. PMID:26443861

  6. Dissecting Proton Delocalization in an Enzyme's Hydrogen Bond Network with Unnatural Amino Acids.

    PubMed

    Wu, Yufan; Fried, Stephen D; Boxer, Steven G

    2015-12-01

    Extended hydrogen bond networks are a common structural motif of enzymes. A recent analysis proposed quantum delocalization of protons as a feature present in the hydrogen bond network spanning a triad of tyrosines (Y(16), Y(32), and Y(57)) in the active site of ketosteroid isomerase (KSI), contributing to its unusual acidity and large isotope shift. In this study, we utilized amber suppression to substitute each tyrosine residue with 3-chlorotyrosine to test the delocalization model and the proton affinity balance in the triad. X-ray crystal structures of each variant demonstrated that the structure, notably the O-O distances within the triad, was unaffected by 3-chlorotyrosine substitutions. The changes in the cluster's acidity and the acidity's isotope dependence in these variants were assessed via UV-vis spectroscopy and the proton sharing pattern among individual residues with (13)C nuclear magnetic resonance. Our data show pKa detuning at each triad residue alters the proton delocalization behavior in the H-bond network. The extra stabilization energy necessary for the unusual acidity mainly comes from the strong interactions between Y(57) and Y(16). This is further enabled by Y(32), which maintains the right geometry and matched proton affinity in the triad. This study provides a rich picture of the energetics of the hydrogen bond network in enzymes for further model refinement. PMID:26571340

  7. Structural analysis of Bacillus pumilus phenolic acid decarboxylase, a lipocalin-fold enzyme.

    PubMed

    Matte, Allan; Grosse, Stephan; Bergeron, Hélène; Abokitse, Kofi; Lau, Peter C K

    2010-11-01

    The decarboxylation of phenolic acids, including ferulic and p-coumaric acids, to their corresponding vinyl derivatives is of importance in the flavouring and polymer industries. Here, the crystal structure of phenolic acid decarboxylase (PAD) from Bacillus pumilus strain UI-670 is reported. The enzyme is a 161-residue polypeptide that forms dimers both in the crystal and in solution. The structure of PAD as determined by X-ray crystallography revealed a β-barrel structure and two α-helices, with a cleft formed at one edge of the barrel. The PAD structure resembles those of the lipocalin-fold proteins, which often bind hydrophobic ligands. Superposition of structurally related proteins bound to their cognate ligands shows that they and PAD bind their ligands in a conserved location within the β-barrel. Analysis of the residue-conservation pattern for PAD-related sequences mapped onto the PAD structure reveals that the conservation mainly includes residues found within the hydrophobic core of the protein, defining a common lipocalin-like fold for this enzyme family. A narrow cleft containing several conserved amino acids was observed as a structural feature and a potential ligand-binding site. PMID:21045284

  8. Structural analysis of Bacillus pumilus phenolic acid decarboxylase, a lipocalin-fold enzyme

    SciTech Connect

    Matte, Allan; Grosse, Stephan; Bergeron, Hélène; Abokitse, Kofi; Lau, Peter C.K.

    2012-04-30

    The decarboxylation of phenolic acids, including ferulic and p-coumaric acids, to their corresponding vinyl derivatives is of importance in the flavoring and polymer industries. Here, the crystal structure of phenolic acid decarboxylase (PAD) from Bacillus pumilus strain UI-670 is reported. The enzyme is a 161-residue polypeptide that forms dimers both in the crystal and in solution. The structure of PAD as determined by X-ray crystallography revealed a -barrel structure and two -helices, with a cleft formed at one edge of the barrel. The PAD structure resembles those of the lipocalin-fold proteins, which often bind hydrophobic ligands. Superposition of structurally related proteins bound to their cognate ligands shows that they and PAD bind their ligands in a conserved location within the -barrel. Analysis of the residue-conservation pattern for PAD-related sequences mapped onto the PAD structure reveals that the conservation mainly includes residues found within the hydrophobic core of the protein, defining a common lipocalin-like fold for this enzyme family. A narrow cleft containing several conserved amino acids was observed as a structural feature and a potential ligand-binding site.

  9. Effect of exogenous amylolytic enzymes on the accumulation of chlorogenic acid isomers in wounded potato tubers.

    PubMed

    Torres-Contreras, Ana Mariel; Nair, Vimal; Cisneros-Zevallos, Luis; Jacobo-Velázquez, Daniel A

    2014-08-01

    Potato tubers under wounding stress synthesize chlorogenic acid isomers, which are phenolic compounds that prevent chronic diseases. The biosynthesis of phenolic compounds in plants requires aromatic amino acids that are produced from sugars. Therefore, in this study, we hypothesized that the wound-induced accumulation of chlorogenic acid isomers in potatoes could be enhanced if the availability of sugars is increased by exogenous amylolytic enzymes applied to the surface of the site of wounding. To test this hypothesis, wounded potatoes stored at 20 °C were treated with amylolytic enzymes (pullulanase and amyloglucosidase, 282 units/mL, 10 mL/kg) after being stored for 0 (E0h), 48 (E48h), or 96 h (E96h). The highest level of accumulation of total chlorogenic acid isomers (∼210% higher than that of time 0 h samples) was observed after storage for 120 h for the E96h treatment. The results suggest that increasing the availability of carbon sources needed for the biosynthesis of phenolic compounds would trigger their accumulation in wounded plants. PMID:25032895

  10. Ensemble Methods for Monitoring Enzyme Translocation along Single Stranded Nucleic Acids

    PubMed Central

    Tomko, Eric J.; Fischer, Christopher J.; Lohman, Timothy M.

    2010-01-01

    We review transient kinetic methods developed to study the mechanism of translocation of nucleic acid motor proteins. One useful stopped-flow fluorescence method monitors arrival of the translocase at the end of a fluorescently labeled nucleic acid. When conducted under single-round conditions the time courses can be analyzed quantitatively using n-step sequential models to determine the kinetic parameters for translocation (rate, kinetic step size and processivity). The assay and analysis discussed here can be used to study enzyme translocation along a linear lattice such as ssDNA or ssRNA. We outline the methods for experimental design and two approaches, along with their limitations, that can be used to analyze the time courses. Analysis of the full time courses using n-step sequential models always yields an accurate estimate of the translocation rate. An alternative semi-quantitative “time to peak” analysis yields accurate estimates of translocation rates only if the enzyme initiates translocation from a unique site on the nucleic acid. However, if initiation occurs at random sites along the nucleic acid, then the “time to peak” analysis can yield inaccurate estimates of even the rates of translocation depending on the values of other kinetic parameters, especially the rate of dissociation of the translocase. Thus, in those cases analysis of the full time course is needed to obtain accurate estimates of translocation rates. PMID:20371288

  11. Experiment K-7-21: Effect of Microgravity on 1: Metabolic Enzymes of Type 1 and Type 2 Muscle Fibers, and on 2: Metabolic Enzymes, Neurotransmitter Amino Acids, and Neurotransmitter Associated Enzymes in Selected Regions of the Central Nervous System. Part 2; The Distribution of Selected Enzymes and Amino Acids in the Hippocampal Formation

    NASA Technical Reports Server (NTRS)

    Lowry, O. H.; Krasnov, I.; Ilyina-Kakueva, E. I.; Nemeth, P. M.; McDougal, D. B., Jr.; Choksi, R.; Carter, J. G.; Chi, M. M. Y.; Manchester, J. K.; Pusateri, M. E.

    1994-01-01

    Six key metabolic enzymes plus glutaminase and glutamate decarboxylase, as well as glutamate, aspartate and GABA, were measured in 11 regions of the hippocampal formation of synchronous, flight and tail suspension rats. Major differences were observed in the normal distribution patterns of each enzyme and amino acid, but no substantive effects of either microgravity or tail suspension on these patterns were clearly demonstrated.

  12. Effect of mevalonic acid on cholesterol synthesis in bovine intramuscular and subcutaneous adipocytes.

    PubMed

    Liu, Xiaomu; You, Wei; Cheng, Haijian; Zhang, Qingfeng; Song, Enliang; Wan, Fachun; Han, Hong; Liu, Guifen

    2016-02-01

    Mevalonic acid (MVA) is a key material in the synthesis of cholesterol; indeed, intracellular cholesterol synthesis is also called the mevalonic acid pathway. 3-Hydroxy-3-methylglutaryl-CoA reductase (HMGR) is an essential enzyme in cholesterol biosynthesis. This study suggests that MVA may play an important role in the differentiation of bovine adipose tissue in vivo. We investigated differential mRNA expression in bovine intramuscular preadipocytes (BIPs) and bovine subcutaneous preadipocytes (BSPs) by culturing cells from the longissimus dorsi muscle and subcutaneous fat tissues of Luxi yellow cattle. The morphology of lipid accumulation of bovine preadipocytes was detected by Oil Red O staining, and total cholesterol (TC), low-density lipoprotein cholesterol (LDLC), and high-density lipoprotein cholesterol (HDLC) levels were measured. Temporospatial expression of HMGR was investigated by real-time quantitative polymerase chain reaction (PCR). The TC, LDLC, and HDLC content did not significantly differ over time but increased slowly with increasing MVA concentration. HMGR expression increased over time and with increasing concentrations of MVA. MVA increased adipose cell proliferation in a dose-dependent and time-dependent manner. MVA stimulated HMGR expression in two cell types and its influence on adipocyte differentiation. PMID:26122311

  13. Retinoid resistance and multifaceted impairment of retinoic acid synthesis in glioblastoma.

    PubMed

    Campos, Benito; Weisang, Sarah; Osswald, Florian; Ali, Ramadan; Sedlmeier, Georg; Bageritz, Josephine; Mallm, Jan-Philipp; Hartmann, Christian; von Deimling, Andreas; Popanda, Odillia; Goidts, Violaine; Plass, Christoph; Unterberg, Andreas; Schmezer, Peter; Burhenne, Jürgen; Herold-Mende, Christel

    2015-10-01

    Measuring concentrations of the differentiation-promoting hormone retinoic acid (RA) in glioblastoma tissues would help to understand the reason why RA treatment has been inefficient in clinical trials involving brain tumor patients. Here, we apply a recently established extraction and measurement protocol to screen glioblastoma tissues for the levels of the RA precursor retinol and biologically active RA. Combining this approach with mRNA analyses of 26 tumors and 8 normal brains, we identify a multifaceted disturbance of RA synthesis in glioblastoma, involving multiple aldehyde dehydrogenase 1 family and retinol dehydrogenase enzymes. Through database studies and methylation analyses, we narrow down chromosomal deletions and aberrant promoter hypermethylation as potential mechanisms accounting for these alterations. Employing chromatin immunoprecipitation analyses and cell-culture studies, we further show that chromatin at RA target genes is poised to RA substitution, but most glioblastoma cell cultures are completely resistant to RA treatment. This paradoxical RA response is unrelated to alternative RA signaling through the fatty acid-binding protein 5/peroxisome proliferator-activated receptor delta axis. Our data suggest a multifaceted disturbance of RA synthesis in glioblastoma and contribute to reconsider current RA treatment strategies. PMID:25944104

  14. The intracellular parasite Toxoplasma gondii depends on the synthesis of long chain and very long-chain unsaturated fatty acids not supplied by the host cell

    PubMed Central

    Ramakrishnan, Srinivasan; Docampo, Melissa D.; MacRae, James I.; Ralton, Julie E.; Rupasinghe, Thusitha; McConville, Malcolm J.; Striepen, Boris

    2015-01-01

    SUMMARY Apicomplexa are parasitic protozoa that cause important human diseases including malaria, cryptosporidiosis and toxoplasmosis. The replication of these parasites within their target host cell is dependent on both salvage as well as de novo synthesis of fatty acids. In T. gondii, fatty acid synthesis via the apicoplast-localized FASII is essential for pathogenesis, while the role of two other fatty acid biosynthetic complexes remains unclear. Here we demonstrate that the ER-localized fatty acid elongation (ELO) is essential for parasite growth. Conditional knock-down of the non-redundant hydroxyacyl-CoA dehydratase and enoyl-CoA reductase enzymes in the ELO pathway severely repressed intracellular parasite growth. 13C-glucose and 13C-acetate labeling and comprehensive lipidomic analyses of these mutants showed a selective defect in synthesis of unsaturated long and very long chain fatty acids (LCFAs and VLCFAs) and depletion of phosphatidylinositol and phosphatidylethanolamine species containing unsaturated LCFAs and VLCFAs. This requirement for ELO pathway was by-passed by supplementing the media with specific fatty acids, indicating active, but inefficient import of host fatty acids. Our experiments highlight a gap between the fatty acid needs of the parasite and availability of specific fatty acids in the host cell that the parasite has to close using a dedicated synthesis and modification pathway. PMID:25825226

  15. Multi-enzyme co-embedded organic-inorganic hybrid nanoflowers: synthesis and application as a colorimetric sensor

    NASA Astrophysics Data System (ADS)

    Sun, Jiayu; Ge, Jiechao; Liu, Weimin; Lan, Minhua; Zhang, Hongyan; Wang, Pengfei; Wang, Yanming; Niu, Zhongwei

    2013-12-01

    This study reports a facile method for the synthesis of multi-enzyme co-embedded organic-inorganic hybrid nanoflowers, using glucose oxidase (GOx) and horseradish peroxidase (HRP) as the organic components, and Cu3(PO4)2.3H2O as the inorganic component. The synthesized nanoflowers enable the combination of a two-enzyme cascade reaction in one step, in which the GOx component of the nanoflowers oxidizes glucose to generate H2O2, which then reacts with the adjacent HRP component on the nanoflowers to oxidize the chromogenic substrates, resulting in an apparent color change. Given the close proximity of the two enzyme components in a single nanoflower, this novel sensor greatly reduces the diffusion and decomposition of H2O2, and greatly enhances the sensitivity of glucose detection. Thus, the obtained multi-enzyme co-embedded organic-inorganic hybrid nanoflowers can be unquestionably used as highly sensitive colorimetric sensors for the detection of glucose. Notably, this work presents a very facile route for the synthesis of multi-enzyme co-embedded nanomaterials for the simultaneous catalysis of multi-step cascade enzymatic reactions. Furthermore, it has great potential for application in biotechnology, and biomedical and environmental chemistry.This study reports a facile method for the synthesis of multi-enzyme co-embedded organic-inorganic hybrid nanoflowers, using glucose oxidase (GOx) and horseradish peroxidase (HRP) as the organic components, and Cu3(PO4)2.3H2O as the inorganic component. The synthesized nanoflowers enable the combination of a two-enzyme cascade reaction in one step, in which the GOx component of the nanoflowers oxidizes glucose to generate H2O2, which then reacts with the adjacent HRP component on the nanoflowers to oxidize the chromogenic substrates, resulting in an apparent color change. Given the close proximity of the two enzyme components in a single nanoflower, this novel sensor greatly reduces the diffusion and decomposition of H2O2

  16. Alternative Routes for the Synthesis of 5-Aminolevulinic Acid in Maize Leaves 1

    PubMed Central

    Harel, Eitan; Ne'Eman, Emma

    1983-01-01

    Intact plastids from greening maize (Zea mays L.) leaves converted [14C]glutamate and [14C]2-ketoglutarate (KG) to [14C]5-aminolevulinic acid (ALA). Glutamate appeared to be the immediate precursor of ALA, while KG was first converted to glutamate, as shown by the effect of various inhibitors of amino acid metabolism. Plastids from greening leaves contained markedly higher activity as compared with etioplasts or chloroplasts. The synthesis of ALA by intact plastids was light dependent. The enzyme system resides in the stroma of plastids or may be lightly bound to membranes. The solubilized system showed maximal activity around pH 7.9 and required Mg2+, ATP, and NADPH although dependence on the latter was not clear-cut. A relatively high level of activity could be extracted from etioplasts. Maximal activity was obtained from plastids of leaves which had been illuminated for 90 minutes, after which activity declined sharply. The enzyme system solubilized from plastids also catalyzed the conversion of putative glutamate 1-semialdehyde to ALA in a reaction which was not dependent on the addition of an amino donor. The system in maize greatly resembled the one which had been reported from barley. It is suggested that this system is the one responsible for the biosynthesis of ALA destined for chlorophyll formation. PMID:16663121

  17. Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments

    NASA Astrophysics Data System (ADS)

    Kitadai, Norio

    2015-12-01

    Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids.

  18. Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments.

    PubMed

    Kitadai, Norio

    2015-12-01

    Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids. PMID:25796392

  19. Integrated engineering of β-oxidation reversal and ω-oxidation pathways for the synthesis of medium chain ω-functionalized carboxylic acids.

    PubMed

    Clomburg, James M; Blankschien, Matthew D; Vick, Jacob E; Chou, Alexander; Kim, Seohyoung; Gonzalez, Ramon

    2015-03-01

    An engineered reversal of the β-oxidation cycle was exploited to demonstrate its utility for the synthesis of medium chain (6-10-carbons) ω-hydroxyacids and dicarboxylic acids from glycerol as the only carbon source. A redesigned β-oxidation reversal facilitated the production of medium chain carboxylic acids, which were converted to ω-hydroxyacids and dicarboxylic acids by the action of an engineered ω-oxidation pathway. The selection of a key thiolase (bktB) and thioesterase (ydiI) in combination with previously established core β-oxidation reversal enzymes, as well as the development of chromosomal expression systems for the independent control of pathway enzymes, enabled the generation of C6-C10 carboxylic acids and provided a platform for vector based independent expression of ω-functionalization enzymes. Using this approach, the expression of the Pseudomonas putida alkane monooxygenase system, encoded by alkBGT, in combination with all β-oxidation reversal enzymes resulted in the production of 6-hydroxyhexanoic acid, 8-hydroxyoctanoic acid, and 10-hydroxydecanoic acid. Following identification and characterization of potential alcohol and aldehyde dehydrogenases, chnD and chnE from Acinetobacter sp. strain SE19 were expressed in conjunction with alkBGT to demonstrate the synthesis of the C6-C10 dicarboxylic acids, adipic acid, suberic acid, and sebacic acid. The potential of a β-oxidation cycle with ω-oxidation termination pathways was further demonstrated through the production of greater than 0.8 g/L C6-C10 ω-hydroxyacids or about 0.5 g/L dicarboxylic acids of the same chain lengths from glycerol (an unrelated carbon source) using minimal media. PMID:25638687

  20. Design and synthesis of boronic acid inhibitors of endothelial lipase.

    PubMed

    O'Connell, Daniel P; LeBlanc, Daniel F; Cromley, Debra; Billheimer, Jeffrey; Rader, Daniel J; Bachovchin, William W

    2012-02-01

    Endothelial lipase (EL) and lipoprotein lipase (LPL) are homologous lipases that act on plasma lipoproteins. EL is predominantly a phospholipase and appears to be a key regulator of plasma HDL-C. LPL is mainly a triglyceride lipase regulating (V)LDL levels. The existing biological data indicate that inhibitors selective for EL over LPL should have anti-atherogenic activity, mainly through increasing plasma HDL-C levels. We report here the synthesis of alkyl, aryl, or acyl-substituted phenylboronic acids that inhibit EL. Many of the inhibitors evaluated proved to be nearly equally potent against both EL and LPL, but several exhibited moderate to good selectivity for EL. PMID:22225633

  1. Synthesis of Nanoporous Iminodiacetic Acid Sorbents for Binding Transition Metals

    PubMed Central

    Busche, Brad; Wiacek, Robert; Davidson, Joseph; Koonsiripaiboon, View; Yantasee, Wassana; Addleman, R. Shane; Fryxell, Glen E.

    2009-01-01

    Iminodiacetic acid (IDAA) forms strong complexes with a wide variety of metal ions. Using self-assembled monolayers in mesoporous supports (SAMMS) to present the IDAA ligand potentially allows for multiple metal-ligand interactions to enhance the metal binding affinity relative to that of randomly oriented polymer-based supports. This manuscript describes the synthesis of a novel nanostructured sorbent material built using self-assembly of a IDAA ligand inside a nanoporous silica, and demonstrates its use for capturing transition metal cations, and anionic metal complexes, such as PdCl4−2. PMID:22068901

  2. Synthesis and biological activity of novel deoxycholic acid derivatives.

    PubMed

    Popadyuk, Irina I; Markov, Andrey V; Salomatina, Oksana V; Logashenko, Evgeniya B; Shernyukov, Andrey V; Zenkova, Marina A; Salakhutdinov, Nariman F

    2015-08-01

    We report the synthesis and biological activity of new semi-synthetic derivatives of naturally occurring deoxycholic acid (DCA) bearing 2-cyano-3-oxo-1-ene, 3-oxo-1(2)-ene or 3-oxo-4(5)-ene moieties in ring A and 12-oxo or 12-oxo-9(11)-ene moieties in ring C. Bioassays using murine macrophage-like cells and tumour cells show that the presence of the 9(11)-double bond associated with the increased polarity of ring A or with isoxazole ring joined to ring A, improves the ability of the compounds to inhibit cancer cell growth. PMID:26037611

  3. Antioxidant enzymes and fatty acid composition as related to disease resistance in postharvest loquat fruit.

    PubMed

    Cao, Shifeng; Yang, Zhenfeng; Cai, Yuting; Zheng, Yonghua

    2014-11-15

    Two cultivars of loquat fruit were stored at 20°C for 10days to investigate the relationship between disease resistance, and fatty acid composition and activities of endogenous antioxidant enzymes. The results showed that decay incidence increased with storage time in both cultivars. A significantly lower disease incidence was observed in 'Qingzhong' fruit than in 'Fuyang', suggesting 'Qingzhong' had increased disease resistance. Meanwhile, 'Qingzhong' fruit also had lower levels of superoxide radical and hydrogen peroxide, and lower lipoxygenase activity, but higher levels of linolenic and linoleic acids and higher activities of catalase (CAT) and ascorbate peroxidase (APX) compared with 'Fuyang'. These results suggest that the higher levels of linolenic and linoleic acids and the higher activity of CAT and APX have a role in disease resistance of postharvest loquat fruit. PMID:24912701

  4. Human prostatic acid phosphatase directly stimulates collagen synthesis and alkaline phosphatase content of isolated bone cells

    SciTech Connect

    Ishibe, M.; Rosier, R.N.; Puzas, J.E. )

    1991-10-01

    Human prostatic acid phosphatase (hPAP) directly enhances the differentiated characteristics of isolated bone cells in vitro. This enzyme, when added to cell cultures for 24 h in vitro stimulates collagen synthesis and the production of alkaline phosphatase. The effects are dose dependent, with statistically significant effects occurring from 0.1-100 nM hPAP. Concentrations higher than 100 nM do not evoke greater effects. The maximal effect of hPAP occurs between 12 and 24 h of exposure. The cells stimulated to the greatest degree are osteoprogenitor cells and osteoblasts. Fibroblasts isolated from the same tissue show a lesser sensitivity to hPAP. hPAP has no detectable effect on cell proliferation, as measured by radiolabeled thymidine incorporation or total DNA synthesis. None of the observations reported in this work can be attributed to contaminating proteins in the hPAP preparation. hPAP was radiolabeled with 125I and was used for affinity binding and cross-linking studies. Scatchard analysis of specific binding indicated the presence of 1.0 X 10(5) high affinity binding sites/cell, with a Kd of 6.5 nM. Cross-linking studies demonstrated the presence of one 320-kDa binding complex. The pH profile and kinetic determinations of Km and maximum velocity for hPAP were similar to those previously reported, except for the finding of positive cooperativity of the substrate with the enzyme under the conditions of our assay. We believe that the direct stimulation of bone-forming cells by hPAP may contribute to the sclerotic nature of skeletal bone around sites of neoplastic prostatic metastases and that the effect of the enzyme is probably mediated by a plasma membrane receptor.

  5. Circadian control of bile acid synthesis by a KLF15-Fgf15 axis

    PubMed Central

    Han, Sean (Shuxin); Zhang, Rongli; Jain, Rajan; Shi, Hong; Zhang, Lilei; Zhou, Guangjin; Sangwung, Panjamaporn; Tugal, Derin; Atkins, G. Brandon; Prosdocimo, Domenick A.; Lu, Yuan; Han, Xiaonan; Tso, Patrick; Liao, Xudong; Epstein, Jonathan A.; Jain, Mukesh K.

    2015-01-01

    Circadian control of nutrient availability is critical to efficiently meet the energetic demands of an organism. Production of bile acids (BAs), which facilitate digestion and absorption of nutrients, is a major regulator of this process. Here we identify a KLF15-Fgf15 signalling axis that regulates circadian BA production. Systemic Klf15 deficiency disrupted circadian expression of key BA synthetic enzymes, tissue BA levels and triglyceride/cholesterol absorption. Studies in liver-specific Klf15-knockout mice suggested a non-hepatic basis for regulation of BA production. Ileal Fgf15 is a potent inhibitor of BA synthesis. Using a combination of biochemical, molecular and functional assays (including ileectomy and bile duct catheterization), we identify KLF15 as the first endogenous negative regulator of circadian Fgf15 expression. Elucidation of this novel pathway controlling circadian BA production has important implications for physiologic control of nutrient availability and metabolic homeostasis. PMID:26040986

  6. Synthesis of beta-hydroxy-alpha-amino acids with a reengineered alanine racemase.

    PubMed

    Fesko, Kateryna; Giger, Lars; Hilvert, Donald

    2008-11-15

    The Y265A mutant of alanine racemase (alrY265A) was evaluated as a catalyst for the synthesis of beta-hydroxy-alpha-amino acids. It promotes the PLP-dependent aldol condensation of glycine with a range of aromatic aldehydes. The desired products were obtained with complete stereocontrol at C(alpha) (ee>99%, D) and moderate to high selectivity at C(beta) (up to 97% de). The designed enzyme is thus similar to natural d-threonine aldolases in its substrate specificity and stereoselectivity. Moreover, its ability to utilize alanine as an alternative donor suggests an expanded scope of potential utility for the production of biologically active compounds. PMID:18760921

  7. [Recombinant cephalosporin-acid synthesase: optimisation of expression in E.coli cells, immobilisation and application for biocatalytic cefazolin synthesis].

    PubMed

    Eldarov, M A; Sklyarenko, A V; Dumina, M V; Medvedeva, N V; Jgoun, A A; Satarova, J E; Sidorenko, A I; Emperian, A S; Yarotsky, S V

    2015-01-01

    Cephalosporin acid synthetase (CASA) is responsible for specific to synthesis of cephalosporin-acids, its expression in Escherichia coli cells is accompanied by accumulation of unprocessed insoluble precursor. In order to optimize conditions of recombinant CASA production we have studied the effects of several parameters of strain cultivation, including growth media composition, temperature, and inoculation dose. Also plasmids for production of CASA variants with the signal sequence of Erwinia carotovora L-asparaginase (ansCASA) and "leaderless" CASA were created in search of more efficient expression constructs. Removal of the N-terminal secretion signal sequence reduced the production of functionally active CASA more than 10-fold and inhibited strain growth. Insertion of the L-asparaginase signal sequence increased the specific enzyme activity in the resultant recombinant strain. The ansCASA producing strain was used to develop the method of immobilization of the recombinant enzyme on an epoxy-activated macroporous acrylic support. The resultant biocatalyst performed effective synthesis of cefazolin from 3-[(5-methyl-1,3,4-thiadiazol-2-il)-thiomethyl]-7- aminocephalosporanic acid (MMTD-7-ACA) and methyl ester of 1(H)-tetrazolilacetic acid (МETzAA), under mild conditions a transformation level of MMTD-7-ACA to cefazolin of 95% is reached. PMID:26539875

  8. Green Synthesis and Urease Inhibitory Activity of Spiro-Pyrimidinethiones/Spiro-Pyrimidinones-Barbituric Acid Derivatives.

    PubMed

    Mohammadi Ziarani, Ghodsi; Asadi, Shima; Faramarzi, Sakineh; Amanlou, Massoud

    2015-01-01

    Sulfonic acid functionalized SBA-15 (SBA-Pr-SO3H) with pore size 6 nm as an efficient heterogeneous nanoporous solid acid catalyst exhibited good catalytic activity in the Biginelli-like reaction in the synthesis of spiroheterobicyclic rings with good yield and good recyclability. Spiro-pyrimidinethiones/spiro-pyrimidinones-barbituric acid derivatives were synthesized in a simple and efficient method using the one-pot three-component reaction of a cyclic 1,3- dicarbonyl compounds (barbituric acid), an aromatic aldehyde and urea or thiourea in the presence of nanoporous silica SBA-Pr-SO3H under solvent free conditions. Urease inhibitory activity of spiro compounds were tested against Jack bean urease using Berthelot alkaline phenol-hypochlorite method. Five of 13 compounds were inhibitor and two of them were enzyme activators. Analysis of the docking results showed that, in most of the spiro molecules, one of the carbonyl groups is coordinated with both nickel atoms, while the other one is involved in the formation of hydrogen bonds with important active-site residues. The effect of inserting two methyl groups on N atoms of barbiturate ring, S substituted, ortho, meta and para substituted compounds were investigated too. PMID:26664377

  9. Green Synthesis and Urease Inhibitory Activity of Spiro-Pyrimidinethiones/Spiro-Pyrimidinones-Barbituric Acid Derivatives

    PubMed Central

    Mohammadi Ziarani, Ghodsi; Asadi, Shima; Faramarzi, Sakineh; Amanlou, Massoud

    2015-01-01

    Sulfonic acid functionalized SBA-15 (SBA-Pr-SO3H) with pore size 6 nm as an efficient heterogeneous nanoporous solid acid catalyst exhibited good catalytic activity in the Biginelli-like reaction in the synthesis of spiroheterobicyclic rings with good yield and good recyclability. Spiro-pyrimidinethiones/spiro-pyrimidinones-barbituric acid derivatives were synthesized in a simple and efficient method using the one-pot three-component reaction of a cyclic 1,3- dicarbonyl compounds (barbituric acid), an aromatic aldehyde and urea or thiourea in the presence of nanoporous silica SBA-Pr-SO3H under solvent free conditions. Urease inhibitory activity of spiro compounds were tested against Jack bean urease using Berthelot alkaline phenol–hypochlorite method. Five of 13 compounds were inhibitor and two of them were enzyme activators. Analysis of the docking results showed that, in most of the spiro molecules, one of the carbonyl groups is coordinated with both nickel atoms, while the other one is involved in the formation of hydrogen bonds with important active-site residues. The effect of inserting two methyl groups on N atoms of barbiturate ring, S substituted, ortho, meta and para substituted compounds were investigated too. PMID:26664377

  10. Combined Effects of Lanthanum (III) and Acid Rain on Antioxidant Enzyme System in Soybean Roots

    PubMed Central

    Zhang, Xuanbo; Du, Yuping; Wang, Lihong; Zhou, Qing; Huang, Xiaohua; Sun, Zhaoguo

    2015-01-01

    Rare earth element pollution (REEs) and acid rain (AR) pollution simultaneously occur in many regions, which resulted in a new environmental issue, the combined pollution of REEs and AR. The effects of the combined pollution on the antioxidant enzyme system of plant roots have not been reported. Here, the combined effects of lanthanum ion (La3+), one type of REE, and AR on the antioxidant enzyme system of soybean roots were investigated. In the combined treatment of La3+ (0.08 mM) and AR, the cell membrane permeability and the peroxidation of cell membrane lipid of soybean roots increased, and the superoxide dismutase, catalase, peroxidase and reduced ascorbic acid served as scavengers of reactive oxygen species. In other combined treatments of La3+ (0.40 mM, 1.20 mM) and AR, the membrane permeability, malonyldialdehyde content, superoxide dismutase activity, peroxidase activity and reduced ascorbic acid content increased, while the catalase activity decreased. The increased superoxide dismutase activity, peroxidase activity and reduced ascorbic acid content were inadequate to scavenge the excess hydrogen peroxide and superoxide, leading to the damage of the cell membrane, which was aggravated with the increase in the concentration of La3+ and the level of AR. The deleterious effects of the combined treatment of La3+ and AR were stronger than those of the single treatment of La3+ or AR. Moreover, the activity of antioxidant enzyme system in the combined treatment group was affected directly and indirectly by mineral element content in soybean plants. PMID:26230263

  11. Combined Effects of Lanthanum (III) and Acid Rain on Antioxidant Enzyme System in Soybean Roots.

    PubMed

    Zhang, Xuanbo; Du, Yuping; Wang, Lihong; Zhou, Qing; Huang, Xiaohua; Sun, Zhaoguo

    2015-01-01

    Rare earth element pollution (REEs) and acid rain (AR) pollution simultaneously occur in many regions, which resulted in a new environmental issue, the combined pollution of REEs and AR. The effects of the combined pollution on the antioxidant enzyme system of plant roots have not been reported. Here, the combined effects of lanthanum ion (La3+), one type of REE, and AR on the antioxidant enzyme system of soybean roots were investigated. In the combined treatment of La3+ (0.08 mM) and AR, the cell membrane permeability and the peroxidation of cell membrane lipid of soybean roots increased, and the superoxide dismutase, catalase, peroxidase and reduced ascorbic acid served as scavengers of reactive oxygen species. In other combined treatments of La3+ (0.40 mM, 1.20 mM) and AR, the membrane permeability, malonyldialdehyde content, superoxide dismutase activity, peroxidase activity and reduced ascorbic acid content increased, while the catalase activity decreased. The increased superoxide dismutase activity, peroxidase activity and reduced ascorbic acid content were inadequate to scavenge the excess hydrogen peroxide and superoxide, leading to the damage of the cell membrane, which was aggravated with the increase in the concentration of La3+ and the level of AR. The deleterious effects of the combined treatment of La3+ and AR were stronger than those of the single treatment of La3+ or AR. Moreover, the activity of antioxidant enzyme system in the combined treatment group was affected directly and indirectly by mineral element content in soybean plants. PMID:26230263

  12. Immunohistochemical Localization of Key Arachidonic Acid Metabolism Enzymes during Fracture Healing in Mice

    PubMed Central

    Lin, Hsuan-Ni; O’Connor, J. Patrick

    2014-01-01

    This study investigated the localization of critical enzymes involved in arachidonic acid metabolism during the initial and regenerative phases of mouse femur fracture healing. Previous studies found that loss of cyclooxygenase-2 activity impairs fracture healing while loss of 5-lipoxygenase activity accelerates healing. These diametric results show that arachidonic acid metabolism has an essential function during fracture healing. To better understand the function of arachidonic acid metabolism during fracture healing, expression of cyclooxygenase-1 (COX-1), cyclooxygenase -2 (COX-2), 5-lipoxygenase (5-LO), and leukotriene A4 hydrolase (LTA4H) was localized by immunohistochemistry in time-staged fracture callus specimens. All four enzymes were detected in leukocytes present in the bone marrow and attending inflammatory response that accompanied the fracture. In the tissues surrounding the fracture site, the proportion of leukocytes expressing COX-1, COX-2, or LTA4H decreased while those expressing 5-LO remained high at 4 and 7 days after fracture. This may indicate an inflammation resolution function for 5-LO during fracture healing. Only COX-1 was consistently detected in fracture callus osteoblasts during the later stages of healing (day 14 after fracture). In contrast, callus chondrocytes expressed all four enzymes, though 5-LO appeared to be preferentially expressed in newly differentiated chondrocytes. Most interestingly, osteoclasts consistently and strongly expressed COX-2. In addition to bone surfaces and the growth plate, COX-2 expressing osteoclasts were localized at the chondro-osseous junction of the fracture callus. These observations suggest that arachidonic acid mediated signaling from callus chondrocytes or from callus osteoclasts at the chondro-osseous junction regulate fracture healing. PMID:24516658

  13. Synthesis of all nineteen appropriately protected chiral alpha-hydroxy acid equivalents of the alpha-amino acids for Boc solid-phase depsi-peptide synthesis.

    PubMed

    Deechongkit, Songpon; You, Shu-Li; Kelly, Jeffery W

    2004-02-19

    [reaction: see text] The preparation of depsi-peptides, amide-to-ester-substituted peptides used to probe the role of hydrogen bonding in protein folding energetics, is accomplished by replacing specific l-alpha-amino acid residues by their alpha-hydroxy acid counterparts in a solid-phase synthesis employing a t-Boc strategy. Herein we describe the efficient stereoselective synthesis of all 19 appropriately protected alpha-hydroxy acid equivalents of the l-alpha-amino acids, employing commercially available materials, expanding the number of available alpha-hydroxy acids from 9 to 19. PMID:14961607

  14. A novel enzyme-based acidizing system: Matrix acidizing and drilling fluid damage removal

    SciTech Connect

    Harris, R.E.; McKay, D.M.; Moses, V.

    1995-12-31

    A novel acidizing process is used to increase the permeability of carbonate rock cores in the laboratory and to remove drilling fluid damage from cores and wafers. Field results show the benefits of the technology as applied both to injector and producer wells.

  15. Importance of ALDH1A enzymes in determining human testicular retinoic acid concentrations

    PubMed Central

    Arnold, Samuel L.; Kent, Travis; Hogarth, Cathryn A.; Schlatt, Stefan; Prasad, Bhagwat; Haenisch, Michael; Walsh, Thomas; Muller, Charles H.; Griswold, Michael D.; Amory, John K.; Isoherranen, Nina

    2015-01-01

    Retinoic acid (RA), the active metabolite of vitamin A, is required for spermatogenesis and many other biological processes. RA formation requires irreversible oxidation of retinal to RA by aldehyde dehydrogenase enzymes of the 1A family (ALDH1A). While ALDH1A1, ALDH1A2, and ALDH1A3 all form RA, the expression pattern and relative contribution of these enzymes to RA formation in the testis is unknown. In this study, novel methods to measure ALDH1A protein levels and intrinsic RA formation were used to accurately predict RA formation velocities in individual human testis samples and an association between RA formation and intratesticular RA concentrations was observed. The distinct localization of ALDH1A in the testis suggests a specific role for each enzyme in controlling RA formation. ALDH1A1 was found in Sertoli cells, while only ALDH1A2 was found in spermatogonia, spermatids, and spermatocytes. In the absence of cellular retinol binding protein (CRBP)1, ALDH1A1 was predicted to be the main contributor to intratesticular RA formation, but when CRBP1 was present, ALDH1A2 was predicted to be equally important in RA formation as ALDH1A1. This study provides a comprehensive novel methodology to evaluate RA homeostasis in human tissues and provides insight to how the individual ALDH1A enzymes mediate RA concentrations in specific cell types. PMID:25502770

  16. Are Phragmites australis enzymes involved in the degradation of the textile azo dye acid orange 7?

    PubMed

    Carias, Cátia C; Novais, Júlio M; Martins-Dias, Susete

    2008-01-01

    The role of antioxidant and detoxification enzymes of Phragmites australis, in the degradation of an azo dye, acid orange 7 (AO7), was studied. Activities of several enzymes involved in plant protection against stress were assayed through the activity characterization of superoxide dismutase (SOD), peroxidases (POD), catalase (CAT), ascorbate peroxidase (APOX), dehydroascorbate reductase (DHAR) and glutathione S-transferase (GST), obtained from P. australis crude extracts of leaves, stems and roots. A sub-surface vertical flow constructed wetland, planted with P. australis was used to test the plants response to the AO7 exposure at two different concentrations (130 and 700 mg l(-1)). An activity increase was detected for an AO7 concentration of 130 mg l(-1) for most enzymes studied (SOD, CAT and APOX), especially in leaves, suggesting a response of the reactive oxygen species scavenging enzymes to the chemical stress imposed. GST activity increase in this situation can also be interpreted as an activation of the detoxification pathway and subsequent AO7 conjugation. A totally different behaviour was observed for AO7 at 700 mg l(-1). An evident decrease in activity was observed for SOD, CAT, APOX and GST, probably due to enzymatic inhibition by AO7. Contrarily, DHAR activity augmented drastically in this situation. POD activity was not greatly affected during trial. Altogether these results suggest that P. australis effectively uses the ascorbate-glutathione pathway for the detoxification of AO7. PMID:17336060

  17. Oligomeric structure of proclavaminic acid amidino hydrolase: evolution of a hydrolytic enzyme in clavulanic acid biosynthesis.

    PubMed Central

    Elkins, Jonathan M; Clifton, Ian J; Hernández, Helena; Doan, Linh X; Robinson, Carol V; Schofield, Christopher J; Hewitson, Kirsty S

    2002-01-01

    During biosynthesis of the clinically used beta-lactamase inhibitor clavulanic acid, one of the three steps catalysed by clavaminic acid synthase is separated from the other two by a step catalysed by proclavaminic acid amidino hydrolase (PAH), in which the guanidino group of an intermediate is hydrolysed to give proclavaminic acid and urea. PAH shows considerable sequence homology with the primary metabolic arginases, which hydrolyse arginine to ornithine and urea, but does not accept arginine as a substrate. Like other members of the bacterial sub-family of arginases, PAH is hexameric in solution and requires Mn2+ ions for activity. Other metal ions, including Co2+, can substitute for Mn2+. Two new substrates for PAH were identified, N-acetyl-(L)-arginine and (3R)-hydroxy-N-acetyl-(L)-arginine. Crystal structures of PAH from Streptomyces clavuligerus (at 1.75 A and 2.45 A resolution, where 1 A=0.1 nm) imply how it binds beta-lactams rather than the amino acid substrate of the arginases from which it evolved. The structures also suggest how PAH selects for a particular alcohol intermediate in the clavam biosynthesis pathway. As observed for the arginases, each PAH monomer consists of a core of beta-strands surrounded by alpha-helices, and its active site contains a di-Mn2+ centre with a bridging water molecule responsible for hydrolytic attack on to the guanidino group of the substrate. Comparison of structures obtained under different conditions reveals different conformations of a flexible loop, which must move to allow substrate binding. PMID:12020346

  18. Reverse reaction of malic enzyme for HCO3- fixation into pyruvic acid to synthesize L-malic acid with enzymatic coenzyme regeneration.

    PubMed

    Ohno, Yoko; Nakamori, Toshihiko; Zheng, Haitao; Suye, Shin-ichiro

    2008-05-01

    Malic enzyme [L-malate: NAD(P)(+) oxidoreductase (EC 1.1.1.39)] catalyzes the oxidative decarboxylation of L-malic acid to produce pyruvic acid using the oxidized form of NAD(P) (NAD(P)(+)). We used a reverse reaction of the malic enzyme of Pseudomonas diminuta IFO 13182 for HCO(3)(-) fixation into pyruvic acid to produce L-malic acid with coenzyme (NADH) generation. Glucose-6-phosphate dehydrogenase (EC1.1.1.49) of Leuconostoc mesenteroides was suitable for coenzyme regeneration. Optimum conditions for the carboxylation of pyruvic acid were examined, including pyruvic acid, NAD(+), and both malic enzyme and glucose-6-phosphate dehydrogenase concentrations. Under optimal conditions, the ratio of HCO(3)(-) and pyruvic acid to malic acid was about 38% after 24 h of incubation at 30 degrees C, and the concentration of the accumulated L-malic acid in the reaction mixture was 38 mM. The malic enzyme reverse reaction was also carried out by the conjugated redox enzyme reaction with water-soluble polymer-bound NAD(+). PMID:18460807

  19. Synthesis and characterization of acidic mesoporous borosilicate thin films.

    PubMed

    Xiu, Tongping; Liu, Qian; Wang, Jiacheng

    2009-02-01

    Work on the synthesis and characterization of acidic wormhole-like ordered mesoporous borosilicate thin films (MBSTFs) on silicon wafers is described in this paper. The MBSTFs coated by the dip-coating method were prepared through an evaporation-induced self-assembly (EISA) process using nonionic block copolymers as structure-directing agents. Fourier transform infrared (FT-IR) spectroscopy confirmed the formation of borosiloxane bonds (Si-O-B). High-resolution transmission electron microscopy (HRTEM) and N2 sorption evidenced a wormhole-like mesoporous structure in the MBSTFs obtained. Scanning electron microscopy (SEM) images of the cross sections and surfaces of the samples showed that MBSTFs on silicon wafers were continuous, homogeneous and did not crack. The acidic properties of the MBSTFs were characterized by FT-IR spectra of chemisorbed pyridine. The MBSTFs thus prepared may find their future applications in many fields including chemical sensors, catalysis, optical coating, molecule separation, etc. PMID:19441565

  20. Effect of mitochondrial ascorbic acid synthesis on photosynthesis.

    PubMed

    Senn, M E; Gergoff Grozeff, G E; Alegre, M L; Barrile, F; De Tullio, M C; Bartoli, C G

    2016-07-01

    Ascorbic acid (AA) is synthesized in plant mitochondria through the oxidation of l-galactono-1,4-lactone (l-GalL) and then distributed to different cell compartments. AA-deficient Arabidopsis thaliana mutants (vtc2) and exogenous applications of l-GalL were used to generate plants with different AA content in their leaves. This experimental approach allows determining specific AA-dependent effects on carbon metabolism. No differences in O2 uptake, malic and citric acid and NADH content suggest that AA synthesis or accumulation did not affect mitochondrial activity; however, l-GalL treatment increased CO2 assimilation and photosynthetic electron transport rate in vtc2 (but not wt) leaves demonstrating a stimulation of photosynthesis after l-GalL treatment. Increased CO2 assimilation correlated with increased leaf stomatal conductance observed in l-GalL-treated vtc2 plants. PMID:27010742

  1. Electrocarboxylation: towards sustainable and efficient synthesis of valuable carboxylic acids

    PubMed Central

    Matthessen, Roman; Fransaer, Jan; Binnemans, Koen

    2014-01-01

    Summary The near-unlimited availability of CO2 has stimulated a growing research effort in creating value-added products from this greenhouse gas. This paper presents the trends on the most important methods used in the electrochemical synthesis of carboxylic acids from carbon dioxide. An overview is given of different substrate groups which form carboxylic acids upon CO2 fixation, including mechanistic considerations. While most work focuses on the electrocarboxylation of substrates with sacrificial anodes, this review considers the possibilities and challenges of implementing other synthetic methodologies. In view of potential industrial application, the choice of reactor setup, electrode type and reaction pathway has a large influence on the sustainability and efficiency of the process. PMID:25383120

  2. Spatial organisation of four enzymes from Stevia rebaudiana that are involved in steviol glycoside synthesis.

    PubMed

    Humphrey, Tania V; Richman, Alex S; Menassa, Rima; Brandle, Jim E

    2006-05-01

    The sweet steviol glycosides found in the leaves of Stevia rebaudiana Bert. are derived from the diterpene steviol which is produced from a branch of the gibberellic acid (GA) biosynthetic pathway. An understanding of the spatial organisation of the two pathways including subcellular compartmentation provides important insight for the metabolic engineering of steviol glycosides as well as other secondary metabolites in plants. The final step of GA biosynthesis, before the branch point for steviol production, is the formation of (-)-kaurenoic acid from (-)-kaurene, catalysed by kaurene oxidase (KO). Downstream of this, the first committed step in steviol glycoside synthesis is the hydroxylation of kaurenoic acid to form steviol which is then sequentially glucosylated by a series of UDP-glucosyltransferases (UGTs) to produce the variety of steviol glycosides. The subcellular location of KO and three of the UGTs involved in steviol glycoside biosynthesis was investigated by expression of GFP fusions and cell fractionation which revealed KO to be associated with the endoplasmic reticulum and the UGTs in the cytoplasm. It has also been shown by expressing the Stevia UGTs in Arabidopsis that the pathway can be partially reconstituted by recruitment of a native Arabidopsis glucosyltransferase. PMID:16786291

  3. Synthesis of 14C-labeled perfluorooctanoic and perfluorodecanoic acids; Purification of perfluorodecanoic acid

    SciTech Connect

    Reich, I.L.; Reich, H.J.; Menahan, L.A.; Peterson, R.E.

    1987-01-01

    Perfluorooctanoic and -decanoic acids are representative of a series of perfluorinated acids that have been used for a variety of industrial purposes primarily due to their surfactant properties. The toxicity of these compounds is being investigated in a number of laboratories. 14C-labeled materials would be useful in these studies but are not commercially available. Johncock prepared unlabeled PFOA in low yield by carbonation of the unstable perfluoroheptyllithium at -90 degrees Centigrade. We anticipated several problems in applying this procedure to the synthesis of the 14C-labeled material. Johncock's procedure was run on a fairly large scale (10 mmol) with excess CO2.

  4. Synthesis of bisphosphonate derivatives of ATP by T4 DNA ligase, ubiquitin activating enzyme (E1) and other ligases.

    PubMed

    Günther Sillero, María A; de Diego, Anabel; Pérez-Zúñiga, Francisco J; Sillero, Antonio

    2008-05-15

    T4 DNA ligase and the ubiquitin activating enzyme (E1), catalyze the synthesis of ATP beta,gamma-bisphosphonate derivatives. Concerning T4 DNA ligase: (i) etidronate (pC(OH)(CH(3))p) displaced the AMP moiety of the complex E-AMP in a concentration dependent manner; (ii) the K(m) values and the rate of synthesis k(cat) (s(-1)), determined for the following compounds were, respectively: etidronate, 0.73+/-0.09 mM and (70+/-10)x10(-3) s(-1); clodronate (pCCl(2)p), 0.08+/-0.01 mM and (4.1+/-0.3)x10(-3) s(-1); methylenebisphosphonate (pCH(2)p), 0.024+/-0.001 mM and (0.6+/-0.1)x10(-3) s(-1); tripolyphosphate (P(3)) (in the synthesis of adenosine 5'-tetraphosphate, p(4)A), 1.30+/-0.30 mM and (6.2+/-1.1)x10(-3) s(-1); (iii) in the presence of GTP and ATP, inhibition of the synthesis of Ap(4)G was observed with clodronate but not with pamidronate (pC(OH)(CH(2)-CH(2)-NH(3))p). Concerning the ubiquitin activating enzyme (E1): methylenebisphosphonate was the only bisphosphonate, out of the ones tested, that served as substrate for the synthesis of an ATP derivative (K(m)=0.36+/-0.09 mM and k(cat)=0.15+/-0.02 s(-1)). None of the above bisphosphonates were substrates of the reaction catalyzed by luciferase or by acyl-CoA synthetase. The ability of acetyl-CoA synthetase to use methylenebisphosphonate as substrate depended on the commercial source of the enzyme. In our view this report widens our knowledge of the enzymes able to metabolize bisphosphonates, a therapeutic tool widely used in the treatment of osteoporosis. PMID:18378215

  5. Jasmonate-inducible plant enzymes degrade essential amino acids in the herbivore midgut

    PubMed Central

    Chen, Hui; Wilkerson, Curtis G.; Kuchar, Jason A.; Phinney, Brett S.; Howe, Gregg A.

    2005-01-01

    The plant hormone jasmonic acid (JA) activates host defense responses against a broad spectrum of herbivores. Although it is well established that JA controls the expression of a large set of target genes in response to tissue damage, very few gene products have been shown to play a direct role in reducing herbivore performance. To test the hypothesis that JA-inducible proteins (JIPs) thwart attack by disrupting digestive processes in the insect gut, we used a MS-based approach to identify host proteins that accumulate in the midgut of Manduca sexta larvae reared on tomato (Solanum lycopersicum) plants. We show that two JIPs, arginase and threonine deaminase (TD), act in the M. sexta midgut to catabolize the essential amino acids Arg and Thr, respectively. Transgenic plants that overexpress arginase were more resistant to M. sexta larvae, and this effect was correlated with reduced levels of midgut Arg. We present evidence indicating that the ability of TD to degrade Thr in the midgut is enhanced by herbivore-induced proteolytic removal of the enzyme's C-terminal regulatory domain, which confers negative feedback regulation by isoleucine in planta. Our results demonstrate that the JA signaling pathway strongly influences the midgut protein content of phytophagous insects and support the hypothesis that catabolism of amino acids in the insect digestive tract by host enzymes plays a role in plant protection against herbivores. PMID:16357201

  6. Alternative kynurenic acid synthesis routes studied in the rat cerebellum

    PubMed Central

    Blanco Ayala, Tonali; Lugo Huitrón, Rafael; Carmona Aparicio, Liliana; Ramírez Ortega, Daniela; González Esquivel, Dinora; Pedraza Chaverrí, José; Pérez de la Cruz, Gonzalo; Ríos, Camilo; Schwarcz, Robert; Pérez de la Cruz, Verónica

    2015-01-01

    Kynurenic acid (KYNA), an astrocyte-derived, endogenous antagonist of α7 nicotinic acetylcholine and excitatory amino acid receptors, regulates glutamatergic, GABAergic, cholinergic and dopaminergic neurotransmission in several regions of the rodent brain. Synthesis of KYNA in the brain and elsewhere is generally attributed to the enzymatic conversion of L-kynurenine (L-KYN) by kynurenine aminotransferases (KATs). However, alternative routes, including KYNA formation from D-kynurenine (D-KYN) by D-amino acid oxidase (DAAO) and the direct transformation of kynurenine to KYNA by reactive oxygen species (ROS), have been demonstrated in the rat brain. Using the rat cerebellum, a region of low KAT activity and high DAAO activity, the present experiments were designed to examine KYNA production from L-KYN or D-KYN by KAT and DAAO, respectively, and to investigate the effect of ROS on KYNA synthesis. In chemical combinatorial systems, both L-KYN and D-KYN interacted directly with peroxynitrite (ONOO−) and hydroxyl radicals (OH•), resulting in the formation of KYNA. In tissue homogenates, the non-specific KAT inhibitor aminooxyacetic acid (AOAA; 1 mM) reduced KYNA production from L-KYN and D-KYN by 85.1 ± 1.7% and 27.1 ± 4.5%, respectively. Addition of DAAO inhibitors (benzoic acid, kojic acid or 3-methylpyrazole-5-carboxylic acid; 5 μM each) attenuated KYNA formation from L-KYN and D-KYN by ~35% and ~66%, respectively. ONOO− (25 μM) potentiated KYNA production from both L-KYN and D-KYN, and these effects were reduced by DAAO inhibition. AOAA attenuated KYNA production from L-KYN + ONOO− but not from D-KYN + ONOO−. In vivo, extracellular KYNA levels increased rapidly after perfusion of ONOO− and, more prominently, after subsequent perfusion with L-KYN or D-KYN (100 μM). Taken together, these results suggest that different mechanisms are involved in KYNA production in the rat cerebellum, and that, specifically, DAAO and ROS can function as alternative

  7. AMINO ACIDS AUGMENT MUSCLE PROTEIN SYNTHESIS IN NEONATAL PIGS DURING ENDOTOXEMIA BY MODULATING TRANSLATION INITIATION

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In adults, sepsis reduces protein synthesis in skeletal muscle by restraining translation. The effect of sepsis on amino acid-stimulated muscle protein synthesis has not been determined in neonates, a population who is highly anabolic and whose muscle protein synthesis rates are uniquely sensitive ...

  8. Crystal structures of a purple acid phosphatase, representing different steps of this enzyme's catalytic cycle

    PubMed Central

    Schenk, Gerhard; Elliott, Tristan W; Leung, Eleanor; Carrington, Lyle E; Mitić, Nataša; Gahan, Lawrence R; Guddat, Luke W

    2008-01-01

    Background Purple acid phosphatases belong to the family of binuclear metallohydrolases and are involved in a multitude of biological functions, ranging from bacterial killing and bone metabolism in animals to phosphate uptake in plants. Due to its role in bone resorption purple acid phosphatase has evolved into a promising target for the development of anti-osteoporotic chemotherapeutics. The design of specific and potent inhibitors for this enzyme is aided by detailed knowledge of its reaction mechanism. However, despite considerable effort in the last 10 years various aspects of the basic molecular mechanism of action are still not fully understood. Results Red kidney bean purple acid phosphatase is a heterovalent enzyme with an Fe(III)Zn(II) center in the active site. Two new structures with bound sulfate (2.4 Å) and fluoride (2.2 Å) provide insight into the pre-catalytic phase of its reaction cycle and phosphorolysis. The sulfate-bound structure illustrates the significance of an extensive hydrogen bonding network in the second coordination sphere in initial substrate binding and orientation prior to hydrolysis. Importantly, both metal ions are five-coordinate in this structure, with only one nucleophilic μ-hydroxide present in the metal-bridging position. The fluoride-bound structure provides visual support for an activation mechanism for this μ-hydroxide whereby substrate binding induces a shift of this bridging ligand towards the divalent metal ion, thus increasing its nucleophilicity. Conclusion In combination with kinetic, crystallographic and spectroscopic data these structures of red kidney bean purple acid phosphatase facilitate the proposal of a comprehensive eight-step model for the catalytic mechanism of purple acid phosphatases in general. PMID:18234116

  9. Characterization of Two Streptomyces Enzymes That Convert Ferulic Acid to Vanillin

    PubMed Central

    Yang, Wenwen; Tang, Hongzhi; Ni, Jun; Wu, Qiulin; Hua, Dongliang; Tao, Fei; Xu, Ping

    2013-01-01

    Production of flavors from natural substrates by microbial transformation has become a growing and expanding field of study over the past decades. Vanillin, a major component of vanilla flavor, is a principal flavoring compound used worldwide. Streptomyces sp. strain V-1 is known to be one of the most promising microbial producers of natural vanillin from ferulic acid. Although identification of the microbial genes involved in the biotransformation of ferulic acid to vanillin has been previously reported, purification and detailed characterization of the corresponding enzymes with important functions have rarely been studied. In this study, we isolated and identified 2 critical genes, fcs and ech, encoding feruloyl-CoA synthetase and enoyl-CoA hydratase/aldolase, respectively, which are involved in the vanillin production from ferulic acid. Both genes were heterologously expressed in Escherichia coli, and the resting cell reactions for converting ferulic acid to vanillin were performed. The corresponding crucial enzymes, Fcs and Ech, were purified for the first time and the enzymatic activity of each purified protein was studied. Furthermore, Fcs was comprehensively characterized, at an optimal pH of 7.0 and temperature of 30°C. Kinetic constants for Fcs revealed the apparent Km, kcat, and Vmax values to be 0.35 mM, 67.7 s−1, and 78.2 U mg−1, respectively. The catalytic efficiency (kcat/Km) value of Fcs was 193.4 mM−1 s−1 for ferulic acid. The characterization of Fcs and Ech may be helpful for further research in the field of enzymatic engineering and metabolic regulation. PMID:23840666

  10. L-amino acid ligase from Pseudomonas syringae producing tabtoxin can be used for enzymatic synthesis of various functional peptides.

    PubMed

    Arai, Toshinobu; Arimura, Yasuhiro; Ishikura, Shun; Kino, Kuniki

    2013-08-01

    Functional peptides are expected to be beneficial compounds that improve our quality of life. To address the growing need for functional peptides, we have examined peptide synthesis by using microbial enzymes. l-Amino acid ligase (Lal) catalyzes the condensation of unprotected amino acids in an ATP-dependent manner and is applicable to fermentative production. Hence, Lal is a promising enzyme to achieve cost-effective synthesis. To obtain a Lal with novel substrate specificity, we focused on the putative Lal involved in the biosynthesis of the dipeptidic phytotoxin designated tabtoxin. The tabS gene was cloned from Pseudomonas syringae NBRC14081 and overexpressed in Escherichia coli cells. The recombinant TabS protein produced showed the broadest substrate specificity of any known Lal; it detected 136 of 231 combinations of amino acid substrates when dipeptide synthesis was examined. In addition, some new substrate specificities were identified and unusual amino acids, e.g., l-pipecolic acid, hydroxy-l-proline, and β-alanine, were found to be acceptable substrates. Furthermore, kinetic analysis and monitoring of the reactions over a short time revealed that TabS showed distinct substrate selectivity at the N and C termini, which made it possible to specifically synthesize a peptide without by-products such as homopeptides and heteropeptides with the reverse sequence. TabS specifically synthesized the following functional peptides, including their precursors: l-arginyl-l-phenylalanine (antihypertensive effect; yield, 62%), l-leucyl-l-isoleucine (antidepressive effect; yield, 77%), l-glutaminyl-l-tryptophan (precursor of l-glutamyl-l-tryptophan, which has antiangiogenic activity; yield, 54%), l-leucyl-l-serine (enhances saltiness; yield, 83%), and l-glutaminyl-l-threonine (precursor of l-glutamyl-l-threonine, which enhances saltiness; yield, 96%). Furthermore, our results also provide new insights into tabtoxin biosynthesis. PMID:23770908

  11. Efficient synthesis of D-branched-chain amino acids and their labeled compounds with stable isotopes using D-amino acid dehydrogenase.

    PubMed

    Akita, Hironaga; Suzuki, Hirokazu; Doi, Katsumi; Ohshima, Toshihisa

    2014-02-01

    D-Branched-chain amino acids (D-BCAAs) such as D-leucine, D-isoleucine, and D-valine are known to be peptide antibiotic intermediates and to exhibit a variety of bioactivities. Consequently, much effort is going into achieving simple stereospecific synthesis of D-BCAAs, especially analogs labeled with stable isotopes. Up to now, however, no effective method has been reported. Here, we report the establishment of an efficient system for enantioselective synthesis of D-BCAAs and production of D-BCAAs labeled with stable isotopes. This system is based on two thermostable enzymes: D-amino acid dehydrogenase, catalyzing NADPH-dependent enantioselective amination of 2-oxo acids to produce the corresponding D-amino acids, and glucose dehydrogenase, catalyzing NADPH regeneration from NADP(+) and D-glucose. After incubation with the enzymes for 2 h at 65°C and pH 10.5, 2-oxo-4-methylvaleric acid was converted to D-leucine with an excellent yield (>99 %) and optical purity (>99 %). Using this system, we produced five different D-BCAAs labeled with stable isotopes: D-[1-(13)C,(15)N]leucine, D-[1-(13)C]leucine, D-[(15)N]leucine, D-[(15)N]isoleucine, and D-[(15)N]valine. The structure of each labeled D-amino acid was confirmed using time-of-flight mass spectrometry and nuclear magnetic resonance analysis. These analyses confirmed that the developed system was highly useful for production of D-BCAAs labeled with stable isotopes, making this the first reported enzymatic production of D-BCAAs labeled with stable isotopes. Our findings facilitate tracer studies investigating D-BCAAs and their derivatives. PMID:23661083

  12. Interactive effect of salicylic acid on some physiological features and antioxidant enzymes activity in ginger (Zingiber officinale Roscoe).

    PubMed

    Ghasemzadeh, Ali; Jaafar, Hawa Z E

    2013-01-01

    The effect of foliar salicylic acid (SA) applications (10⁻³ and 10⁻⁵ M) on activities of nitrate reductase, guaiacol peroxidase (POD), superoxide dismutases (SOD), catalase (CAT) and proline enzymes and physiological parameters was evaluated in two ginger varieties (Halia Bentong and Halia Bara) under greenhouse conditions. In both varieties, tested treatments generally enhanced photosynthetic rate and total dry weight. Photosynthetic rate increases were generally accompanied by increased or unchanged stomatal conductance levels, although intercellular CO₂ concentrations of treated plants were typically lower than in controls. Lower SA concentrations were generally more effective in enhancing photosynthetic rate and plant growth. Exogenous application of SA increased antioxidant enzyme activities and proline content; the greatest responses were obtained in plants sprayed with 10⁻⁵ M SA, with significant increases observed in CAT (20.1%), POD (45.2%), SOD (44.1%) and proline (43.1%) activities. Increased CAT activity in leaves is naturally expected to increase photosynthetic efficiency and thus net photosynthesis by maintaining a constant CO₂ supply. Our results support the idea that low SA concentrations (10⁻⁵ M) may induce nitrite reductase synthesis by mobilizing intracellular NO³⁻ and can provide protection to nitrite reductase degradation in vivo in the absence of NO³⁻. Observed positive correlations among proline, SOD, CAT and POD activities in the studied varieties suggest that increased SOD activity was accompanied by increases in CAT and POD activities because of the high demands of H₂O₂ quenching. PMID:23698049

  13. Total synthesis of the squalene synthase inhibitor zaragozic acid C.

    PubMed

    Nakamura, Seiichi

    2005-01-01

    Zaragozic acids and squalestatins were documented by Merck, Glaxo, and Tokyo Noko University/Mitsubishi Kasei Corporation as part of a program aimed at identifying novel inhibitors of squalene synthase, as well as farnesyl transferase. These natural products have attracted considerable attention from numerous synthetic chemists because of their therapeutic potential and novel architecture. This review highlights our total syntheses of zaragozic acid C by two convergent strategies. The key steps in our first-generation synthesis involve 1) simultaneous creation of the C4 and C5 quaternary stereocenters through the Sn(OTf)2-promoted aldol coupling reaction between the alpha-keto ester and silyl ketene thioacetal derived from L- and D-tartaric acids, respectively; and 2) construction of the bicyclic core structure via acid-catalyzed internal ketalization under kinetically controlled conditions. The second-generation strategy relies on a tandem carbonyl ylide formation/1,3-dipolar cycloaddition approach and features elongation of the C1 alkyl side chain through an olefin cross-metathesis as well as high convergency and flexibility. PMID:15635219

  14. Molecular modeling and simulation of FabG, an enzyme involved in the fatty acid pathway of Streptococcus pyogenes.

    PubMed

    Shafreen, Rajamohmed Beema; Pandian, Shunmugiah Karutha

    2013-09-01

    Streptococcus pyogenes (SP) is the major cause of pharyngitis accompanied by strep throat infections in humans. 3-keto acyl reductase (FabG), an important enzyme involved in the elongation cycle of the fatty acid pathway of S. pyogenes, is essential for synthesis of the cell-membrane, virulence factors and quorum sensing-related mechanisms. Targeting SPFabG may provide an important aid for the development of drugs against S. pyogenes. However, the absence of a crystal structure for FabG of S. pyogenes limits the development of structure-based drug designs. Hence, in the present study, a homology model of FabG was generated using the X-ray crystallographic structure of Aquifex aeolicus (PDB ID: 2PNF). The modeled structure was refined using energy minimization. Furthermore, active sites were predicted, and a large dataset of compounds was screened against SPFabG. The ligands were docked using the LigandFit module that is available from Discovery Studio version 2.5. From this list, 13 best hit ligands were chosen based on the docking score and binding energy. All of the 13 ligands were screened for Absorption, Distribution, Metabolism, Excretion and Toxicity (ADMET) properties. From this, the two best descriptors, along with one descriptor that lay outside the ADMET plot, were selected for molecular dynamic (MD) simulation. In vitro testing of the ligands using biological assays further substantiated the efficacy of the ligands that were screened based on the in silico methods. PMID:23988477

  15. Mechanism of arginine regulation of acetylglutamate synthase, the first enzyme of arginine synthesis.

    PubMed

    Sancho-Vaello, Enea; Fernández-Murga, María L; Rubio, Vicente

    2009-01-01

    N-acetyl-L-glutamate synthase (NAGS), the first enzyme of arginine biosynthesis in bacteria/plants and an essential urea cycle activator in animals, is, respectively, arginine-inhibited and activated. Arginine binds to the hexameric ring-forming amino acid kinase (AAK) domain of NAGS. We show that arginine inhibits Pseudomonas aeruginosa NAGS by altering the functions of the distant, substrate binding/catalytic GCN5-related N-acetyltransferase (GNAT) domain, increasing K(m)(Glu), decreasing V(max) and triggering substrate inhibition by AcCoA. These effects involve centrally the interdomain linker, since we show that linker elongation or two-residue linker shortening hampers and mimics, respectively, arginine inhibition. We propose a regulatory mechanism in which arginine triggers the expansion of the hexameric NAGS ring, altering AAK-GNAT domain interactions, and the modulation by these interactions of GNAT domain functions, explaining arginine regulation. PMID:19084009

  16. A simple enzymic method for the synthesis of adenosine 5'-[alpha-32P]triphosphate on a preparative scale.

    PubMed Central

    Martin, B R; Voorheis, H P

    1977-01-01

    A simple, rapid and inexpensive method is described for the enzymic synthesis of [alpha-32P]ATP from [32P]Pi on a preparative scale with an overall yield of 53%. The final product contained all of the detectable radioactivity (less than 99.9%) in the alpha position and has been shown to behave identically with commerically availabe [alpha-32P]ATP during the synthesis of 3':5'-cyclic AMP in the reaction catalysed by adenylate cyclase. PMID:851430

  17. Synthesis of Sol-Gel Matrices for Encapsulation of Enzymes Using an Aqueous Route

    SciTech Connect

    Ashley, C.S.; Bhatia, R.B.; Brinker, C.J.; Harris, T.M.

    1998-11-23

    Sol-gel matrices are promising host materials for potential chemical and biosensor applications. Previous studies have focused on modified sol-gel routes using alkoxides for encapsulation of enzymes. However the formation of alcohol as a byproduct during hydrolysis and condensation reactions poses limitations. We report the immobilization of glucose oxidase and peroxidase in silica prepared by an aqueous route which may provide a more favorable environment for the biomolecules. A two step aqueous sol-gel procedure using sodium silicate as the precursor was developed to encapsulate the enzymes and the dye precursor, o-dianisidine. Glucose oxidase catalyzes the oxidation of glucose to give gluconic acid and hydrogen peroxide. Peroxidase then catalyzes the reaction of the dye precursor with hydrogen peroxide to produce a colored product. The kinetics of the coupled enzymatic reactions were monitored by optical spectroscopy and compared to those occurring in tetramethyl orthosilicate (TMOS) derived silica matrices developed by Yamanaka. Enhanced kinetics in the aqueous silicate matrices were related to differences in the host microstructure as elucidated by microstructural comparisons of the corresponding aerogels.

  18. Activation of the Constitutive Androstane Receptor Inhibits Gluconeogenesis without Affecting Lipogenesis or Fatty Acid Synthesis in Human Hepatocytes

    PubMed Central

    Lynch, Caitlin; Pan, Yongmei; Li, Linhao; Heyward, Scott; Moeller, Timothy; Swaan, Peter W.; Wang, Hongbing

    2014-01-01

    Objective Accumulating evidence suggests that activation of mouse constitutive androstane receptor (mCAR) alleviates type 2 diabetes and obesity by inhibiting hepatic gluconeogenesis, lipogenesis, and fatty acid synthesis. However, the role of human (h) CAR in energy metabolism is largely unknown. The present study aims to investigate the effects of selective hCAR activators on hepatic energy metabolism in human primary hepatocytes (HPH). Methods Ligand-based structure-activity models were used for virtual screening of the Specs database (www.specs.net) followed by biological validation in cell-based luciferase assays. The effects of two novel hCAR activators (UM104 and UM145) on hepatic energy metabolism were evaluated in HPH. Results Real-time PCR and Western blotting analyses reveal that activation of hCAR by UM104 and UM145 significantly repressed the expression of glucose-6-phosphatase and phosphoenolpyruvate carboxykinase, two pivotal gluconeogenic enzymes, while exerting negligible effects on the expression of genes associated with lipogenesis and fatty acid synthesis. Functional experiments show that UM104 and UM145 markedly inhibit hepatic synthesis of glucose but not triglycerides in HPH. In contrast, activation of mCAR by 1,4-bis[2-(3,5-dichloropyridyloxy)]benzene, a selective mCAR activator, repressed the expression of genes associated with gluconeogenesis, lipogenesis, and fatty acid synthesis in mouse primary hepatocytes, which were consistent with previous observations in mouse model in vivo. Conclusion Our findings uncover an important species difference between hCAR and mCAR in hepatic energy metabolism, where hCAR selectively inhibits gluconeogenesis without suppressing fatty acid synthesis. Implications Such species selectivity should be considered when exploring CAR as a potential therapeutic target for metabolic disorders. PMID:24878338

  19. Synthesis of acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters

    DOEpatents

    Moens, Luc

    2003-06-24

    A process of preparing an acid addition salt of delta-aminolevulinc acid comprising: a) dissolving a lower alkyl 5-bromolevulinate and hexamethylenetetramine in a solvent selected from the group consisting of water, ethyl acetate, chloroform, acetone, ethanol, tetrahydrofuran and acetonitrile, to form a quaternary ammonium salt of the lower alkyl 5-bromolevulinate; and b) hydrolyzing the quaternary ammonium salt with an inorganic acid to form an acid addition salt of delta-aminolevulinic acid.

  20. Corynebacterium glutamicum as a host for synthesis and export of D-Amino Acids.

    PubMed

    Stäbler, Norma; Oikawa, Tadao; Bott, Michael; Eggeling, Lothar

    2011-04-01

    A number of d-amino acids occur in nature, and there is growing interest in their function and metabolism, as well as in their production and use. Here we use the well-established l-amino-acid-producing bacterium Corynebacterium glutamicum to study whether d-amino acid synthesis is possible and whether mechanisms for the export of these amino acids exist. In contrast to Escherichia coli, C. glutamicum tolerates d-amino acids added extracellularly. Expression of argR (encoding the broad-substrate-specific racemase of Pseudomonas taetrolens) with its signal sequence deleted results in cytosolic localization of ArgR in C. glutamicum. The isolated enzyme has the highest activity with lysine (100%) but also exhibits activity with serine (2%). Upon overexpression of argR in an l-arginine, l-ornithine, or l-lysine producer, equimolar mixtures of the d- and l-enantiomers accumulated extracellularly. Unexpectedly, argR overexpression in an l-serine producer resulted in extracellular accumulation of a surplus of d-serine (81 mM d-serine and 37 mM l-serine) at intracellular concentrations of 125 mM d-serine plus 125 mM l-serine. This points to a nonlimiting ArgR activity for intracellular serine racemization and to the existence of a specific export carrier for d-serine. Export of d-lysine relies fully on the presence of lysE, encoding the exporter for l-lysine, which is apparently promiscuous with respect to the chirality of lysine. These data show that d-amino acids can also be produced with C. glutamicum and that in special cases, due to specific carriers, even a preferential extracellular accumulation of this enantiomer is possible. PMID:21257776

  1. Functional characterization of choline monooxygenase, an enzyme for betaine synthesis in plants.

    PubMed

    Hibino, Takashi; Waditee, Rungaroon; Araki, Etsuko; Ishikawa, Hiroshi; Aoki, Kenji; Tanaka, Yoshito; Takabe, Teruhiro

    2002-11-01

    In plants, the first step in betaine synthesis was shown to be catalyzed by a novel Rieske-type iron-sulfur enzyme, choline monooxygenase (CMO). Although CMO so far has been found only in Chenopodiaceae and Amaranthaceae, the recent genome sequence suggests the presence of a CMO-like gene in Arabidopsis, a betaine non-accumulating plant. Here, we examined the functional properties of CMO expressed in Escherichia coli, cyanobacterium, and Arabidopsis thaliana. We found that E. coli cells in which choline dehydrogenase (CDH) was replaced with spinach CMO accumulate betaine and complement the salt-sensitive phenotype of the CDH-deleted E. coli mutant. Changes of Cys-181 in spinach CMO to Ser, Thr, and Ala and His-287 to Gly, Val, and Ala abolished the accumulation of betaine. The Arabidopsis CMO-like gene was transcribed in Arabidopsis, but its protein was not detected. When the Arabidopsis CMO-like gene was expressed in E. coli, the protein was detected but was found not to promote betaine sysnthesis. Overexpression of spinach CMO in E. coli, Synechococcus sp. PCC7942, and Arabidopsis conferred resistance to abiotic stress. These facts clearly indicate that CMO, but not the CMO-like protein, could oxidize choline and that Cys-181 and His-287 are involved in the binding of Fe-S cluster and Fe, respectively. PMID:12192001

  2. Heparin and related polysaccharides: Synthesis using recombinant enzymes and metabolic engineering

    PubMed Central

    Suflita, Matthew; Fu, Li; He, Wenqin; Koffas, Mattheos; Linhardt, Robert J.

    2015-01-01

    Glycosaminoglycans are linear anionic polysaccharides that exhibit a number of important biological and pharmacological activities. The two most prominent members of this class of polysaccharides are heparin/heparan sulfate and the chondroitin sulfates (including dermatan sulfate). These polysaccharides, having complex structures and polydispersity, are biosynthesized in the Golgi of most animal cells. The chemical synthesis of these glycosaminoglycans is precluded by their structural complexity. Today, we depend on food animal tissues for their isolation and commercial production. Ton quantities of these glycosaminoglycans are used annually as pharmaceuticals and nutraceuticals. The variability of animal-sourced glycosaminoglycans, their inherent impurities, the limited availability of source tissues, the poor control of these source materials, and their manufacturing processes, suggest a need for new approaches for their production. Over the past decade there have been major efforts in the biotechnological production of these glycosaminoglycans. This mini-review focuses on the use of recombinant enzymes and metabolic engineering for the production of heparin and chondroitin sulfates. PMID:26219501

  3. Human Milk Oligosaccharides (HMOS): Structure, Function, and Enzyme-Catalyzed Synthesis.

    PubMed

    Chen, Xi

    2015-01-01

    The important roles played by human milk oligosaccharides (HMOS), the third major component of human milk, in the health of breast-fed infants have been increasingly recognized, as the structures of more than 100 different HMOS have now been elucidated. Despite the recognition of the various functions of HMOS as prebiotics, antiadhesive antimicrobials, and immunomodulators, the roles and the applications of individual HMOS species are less clear. This is mainly due to the limited accessibility to large amounts of individual HMOS in their pure forms. Current advances in the development of enzymatic, chemoenzymatic, whole-cell, and living-cell systems allow for the production of a growing number of HMOS in increasing amounts. This effort will greatly facilitate the elucidation of the important roles of HMOS and allow exploration into the applications of HMOS both as individual compounds and as mixtures of defined structures with desired functions. The structures, functions, and enzyme-catalyzed synthesis of HMOS are briefly surveyed to provide a general picture about the current progress on these aspects. Future efforts should be devoted to elucidating the structures of more complex HMOS, synthesizing more complex HMOS including those with branched structures, and developing HMOS-based or HMOS-inspired prebiotics, additives, and therapeutics. PMID:26613816

  4. Chloramphenicol-induced changes in the synthesis of ribosomal, transfer, and messenger ribonucleic acids in Escherichia coli B/r.

    PubMed

    Shen, V; Bremer, H

    1977-06-01

    , this fraction decreased with increasing growth rate; in the presence of amino acids, the fraction increased slightly with growth rate. These results are consistent with a regulation of rRNA and tRNA synthesis at the transcriptional level, e.g., with a CAM-induced increase in the affinity of RNA polymerase for the rRNA and tRNA promoters. The results also suggest the occurrence of a regulation of RNA polymerase enzyme activity, i.e., of an activation of RNA polymerase that is inactive during exponential growth. A distinction between these alternatives requires measurements of the rRNA chain growth rates during CAM treatment. PMID:324974

  5. Guanine nanowire based amplification strategy: Enzyme-free biosensing of nucleic acids and proteins.

    PubMed

    Gao, Zhong Feng; Huang, Yan Li; Ren, Wang; Luo, Hong Qun; Li, Nian Bing

    2016-04-15

    Sensitive and specific detection of nucleic acids and proteins plays a vital role in food, forensic screening, clinical and environmental monitoring. There remains a great challenge in the development of signal amplification method for biomolecules detection. Herein, we describe a novel signal amplification strategy based on the formation of guanine nanowire for quantitative detection of nucleic acids and proteins (thrombin) at room temperature. In the presence of analytes and magnesium ions, the guanine nanowire could be formed within 10 min. Compared to the widely used single G-quadruplex biocatalytic label unit, the detection limits are improved by two orders of magnitude in our assay. The proposed enzyme-free method avoids fussy chemical label-ling process, complex programming task, and sophisticated equipment, which might provide an ideal candidate for the fabrication of selective and sensitive biosensing platform. PMID:26649493

  6. Hyaluronic acid nanogels with enzyme-sensitive cross-linking group for drug delivery.

    PubMed

    Yang, Chenchen; Wang, Xin; Yao, Xikuang; Zhang, Yajun; Wu, Wei; Jiang, Xiqun

    2015-05-10

    A methacrylation strategy was employed to functionalize hyaluronic acid and prepare hyaluronic acid (HA) nanogels. Dynamic light scattering, zeta potential analyzer and electron microscopy were utilized to characterize the nanogels and their enzyme-degradability in vitro. It was found that these nanogels had a spherical morphology with the diameter of about 70nm, and negative surface potential. When doxorubicin (DOX) was loaded into the nanogels, the diameter decreased to approximately 50nm with a drug loading content of 16% and encapsulation efficiency of 62%. Cellular uptake examinations showed that HA nanogels could be preferentially internalized by two-dimensional (2D) cells and three-dimensional (3D) multicellular spheroids (MCs) which both overexpress CD44 receptor. Near-infrared fluorescence imaging, biodistribution and penetration examinations in tumor tissue indicated that the HA nanogels could efficiently accumulate and penetrate the tumor matrix. In vivo antitumor evaluation found that DOX-loaded HA nanogels exhibited a significantly superior antitumor effect. PMID:25665867

  7. Bioconjugation of therapeutic proteins and enzymes using the expanded set of genetically encoded amino acids.

    PubMed

    Lim, Sung In; Kwon, Inchan

    2016-10-01

    The last decade has witnessed striking progress in the development of bioorthogonal reactions that are strictly directed towards intended sites in biomolecules while avoiding interference by a number of physical and chemical factors in biological environment. Efforts to exploit bioorthogonal reactions in protein conjugation have led to the evolution of protein translational machineries and the expansion of genetic codes that systematically incorporate a range of non-natural amino acids containing bioorthogonal groups into recombinant proteins in a site-specific manner. Chemoselective conjugation of proteins has begun to find valuable applications to previously inaccessible problems. In this review, we describe bioorthogonal reactions useful for protein conjugation, and biosynthetic methods that produce proteins amenable to those reactions through an expanded genetic code. We then provide key examples in which novel protein conjugates, generated by the genetic incorporation of a non-natural amino acid and the chemoselective reactions, address unmet needs in protein therapeutics and enzyme engineering. PMID:26036278

  8. Synthesis and biological evaluation of enantiomerically pure glyceric acid derivatives as LpxC inhibitors.

    PubMed

    Tangherlini, Giovanni; Torregrossa, Tullio; Agoglitta, Oriana; Köhler, Jens; Melesina, Jelena; Sippl, Wolfgang; Holl, Ralph

    2016-03-01

    Inhibitors of the UDP-3-O-[(R)-3-hydroxymyristoyl]-N-acetylglucosamine deacetylase (LpxC) represent a promising class of novel antibiotics, selectively combating Gram-negative bacteria. In order to elucidate the impact of the hydroxymethyl groups of diol (S,S)-4 on the inhibitory activity against LpxC, glyceric acid ethers (R)-7a, (S)-7a, (R)-7b, and (S)-7b, lacking the hydroxymethyl group in benzylic position, were synthesized. The compounds were obtained in enantiomerically pure form by a chiral pool synthesis and a lipase-catalyzed enantioselective desymmetrization, respectively. The enantiomeric hydroxamic acids (R)-7b (Ki=230nM) and (S)-7b (Ki=390nM) show promising enzyme inhibition. However, their inhibitory activities do not substantially differ from each other leading to a low eudismic ratio. Generally, the synthesized glyceric acid derivatives 7 show antibacterial activities against two Escherichia coli strains exceeding the ones of their respective regioisomes 6. PMID:26827141

  9. Immobilization of dehydrogenase onto epoxy-functionalized nanoparticles for synthesis of (R)-mandelic acid.

    PubMed

    Jiang, Xiao-Ping; Lu, Ting-Ting; Liu, Cai-Hong; Ling, Xiao-Ming; Zhuang, Meng-Yao; Zhang, Jiu-Xun; Zhang, Ye-Wang

    2016-07-01

    Epoxy functionalized magnetic Fe3O4@SiO2 nanoparticles were successfully prepared and characterized by Fourier-transform infrared spectroscopy (FTIR) and transmission electron microscopy (TEM). The prepared nanoparticles were used for immobilization of alcohol dehydrogenase (ADH) from Saccharomyces cerevisiae by covalent attachment. The optimal immobilization conditions were obtained as follows: enzyme/support 4.49mg/g, pH 8.0, buffer concentration 0.05M, time 12h and temperature 30°C. Under these conditions, a high immobilization yield and efficiency of above 92% were obtained after the optimization. Broad pH tolerance and high thermostability were achieved by the immobilization. The immobilized ADH retained about 84% initial activity after five cycles. Kinetic parameters Vmax and Km of free and immobilized ADH were determined as 56.72μM/min, 44.27μM/min and 11.54mM, 31.32mM, respectively. (R)-mandelic acid synthesis with the immobilized ADH was carried out, and the yield of (R)-mandelic acid was as high as 64%. These results indicate that the ADH immobilized onto epoxy-functionalized nanoparticles is an efficient and simple way for preparation of stable ADH, and the immobilized ADH has potential applications in the production of (R)-mandelic acid. PMID:26995611

  10. Indole diterpene synthetic studies. Total synthesis of (+)-nodulisporic acid F and construction of the heptacyclic cores of (+)-nodulisporic acids A and B and (-)-nodulisporic acid D.

    PubMed

    Smith, Amos B; Davulcu, Akin H; Cho, Young Shin; Ohmoto, Kazuyuki; Kürti, László; Ishiyama, Haruaki

    2007-06-22

    A first-generation strategy for construction of (+)-nodulisporic acids A (1) and B (2) is described. The strategy entails union of the eastern and western hemisphere subtargets via the indole synthesis protocol developed in our laboratory. Subsequent elaboration of rings E and F, however, revealed the considerable acid instability of the C(24) hydroxyl, thereby preventing further advancement. Nonetheless, preparation of the heptacyclic core of (+)-nodulisporic acids A and B, the total synthesis of (+)-nodulisporic acid F, the simplest member of the nodulisporic acid family, and elaboration of the heptacyclic core of (-)-nodulisporic acid D were achieved. PMID:17511507

  11. Elevation of the Yields of Very Long Chain Polyunsaturated Fatty Acids via Minimal Codon Optimization of Two Key Biosynthetic Enzymes.

    PubMed

    Xia, Fei; Li, Xueying; Li, Xinzheng; Zheng, Desong; Sun, Quanxi; Liu, Jiang; Li, Yaxiao; Hua, Jinping; Qi, Baoxiu

    2016-01-01

    Eicosapentaenoic acid (EPA, 20:5Δ5,8,11,14,17) and Docosahexaenoic acid (DHA, 22:6Δ4,7,10,13,16,19) are nutritionally beneficial to human health. Transgenic production of EPA and DHA in oilseed crops by transferring genes originating from lower eukaryotes, such as microalgae and fungi, has been attempted in recent years. However, the low yield of EPA and DHA produced in these transgenic crops is a major hurdle for the commercialization of these transgenics. Many factors can negatively affect transgene expression, leading to a low level of converted fatty acid products. Among these the codon bias between the transgene donor and the host crop is one of the major contributing factors. Therefore, we carried out codon optimization of a fatty acid delta-6 desaturase gene PinD6 from the fungus Phytophthora infestans, and a delta-9 elongase gene, IgASE1 from the microalga Isochrysis galbana for expression in Saccharomyces cerevisiae and Arabidopsis respectively. These are the two key genes encoding enzymes for driving the first catalytic steps in the Δ6 desaturation/Δ6 elongation and the Δ9 elongation/Δ8 desaturation pathways for EPA/DHA biosynthesis. Hence expression levels of these two genes are important in determining the final yield of EPA/DHA. Via PCR-based mutagenesis we optimized the least preferred codons within the first 16 codons at their N-termini, as well as the most biased CGC codons (coding for arginine) within the entire sequences of both genes. An expression study showed that transgenic Arabidopsis plants harbouring the codon-optimized IgASE1 contained 64% more elongated fatty acid products than plants expressing the native IgASE1 sequence, whilst Saccharomyces cerevisiae expressing the codon optimized PinD6 yielded 20 times more desaturated products than yeast expressing wild-type (WT) PinD6. Thus the codon optimization strategy we developed here offers a simple, effective and low-cost alternative to whole gene synthesis for high expression of

  12. Elevation of the Yields of Very Long Chain Polyunsaturated Fatty Acids via Minimal Codon Optimization of Two Key Biosynthetic Enzymes

    PubMed Central

    Zheng, Desong; Sun, Quanxi; Liu, Jiang; Li, Yaxiao; Hua, Jinping

    2016-01-01

    Eicosapentaenoic acid (EPA, 20:5Δ5,8,11,14,17) and Docosahexaenoic acid (DHA, 22:6Δ4,7,10,13,16,19) are nutritionally beneficial to human health. Transgenic production of EPA and DHA in oilseed crops by transferring genes originating from lower eukaryotes, such as microalgae and fungi, has been attempted in recent years. However, the low yield of EPA and DHA produced in these transgenic crops is a major hurdle for the commercialization of these transgenics. Many factors can negatively affect transgene expression, leading to a low level of converted fatty acid products. Among these the codon bias between the transgene donor and the host crop is one of the major contributing factors. Therefore, we carried out codon optimization of a fatty acid delta-6 desaturase gene PinD6 from the fungus Phytophthora infestans, and a delta-9 elongase gene, IgASE1 from the microalga Isochrysis galbana for expression in Saccharomyces cerevisiae and Arabidopsis respectively. These are the two key genes encoding enzymes for driving the first catalytic steps in the Δ6 desaturation/Δ6 elongation and the Δ9 elongation/Δ8 desaturation pathways for EPA/DHA biosynthesis. Hence expression levels of these two genes are important in determining the final yield of EPA/DHA. Via PCR-based mutagenesis we optimized the least preferred codons within the first 16 codons at their N-termini, as well as the most biased CGC codons (coding for arginine) within the entire sequences of both genes. An expression study showed that transgenic Arabidopsis plants harbouring the codon-optimized IgASE1 contained 64% more elongated fatty acid products than plants expressing the native IgASE1 sequence, whilst Saccharomyces cerevisiae expressing the codon optimized PinD6 yielded 20 times more desaturated products than yeast expressing wild-type (WT) PinD6. Thus the codon optimization strategy we developed here offers a simple, effective and low-cost alternative to whole gene synthesis for high expression of

  13. Characterization of inulin hydrolyzing enzyme(s) in commercial glucoamylases and its application in lactic acid production from Jerusalem artichoke tubers (Jat).

    PubMed

    Dao, Thai Ha; Zhang, Jian; Bao, Jie

    2013-11-01

    A high inulinase activity was found in three commercially available glucoamylase enzymes. Its origin was investigated and two proteins in the commercial glucoamylases were identified as the potential enzymes showing inulinase activity. One of the commercial glucoamylases, GA-L New from Genencor, was used for Jerusalem artichoke tubers (Jat) hydrolysis and a high hydrolysis yield of fructose was obtained. The simultaneous saccharification and lactic acid fermentation (SSF) of Jat was carried out using GA-L New as the inulinase and Pediococcus acidilactici DQ2 as the fermenting strain. A high lactic acid titer, yield, and productivity of 111.5 g/L, 0.46 g/g DM, and 1.55 g/L/h, respectively, were obtained within 72 h. The enzyme cost using the commercial glucoamylase as inulinase was compared to that using the typical inulinase and a large profit margin was identified. The results provided a practical way of Jat application for lactic acid production using cheap commercial glucoamylase enzyme. PMID:24050923

  14. Ontogenetic changes in digestive enzyme activities and the amino acid profile of starry flounder Platichthys stellatus

    NASA Astrophysics Data System (ADS)

    Song, Zhidong; Wang, Jiying; Qiao, Hongjin; Li, Peiyu; Zhang, Limin; Xia, Bin

    2016-01-01

    Ontogenetic changes in digestive enzyme activities and the amino acid (AA) profile of starry flounder, Platichthys stellatus, were investigated and limiting amino acids were estimated compared with the essential AA profile between larvae and live food to clarify starry flounder larval nutritional requirements. Larvae were collected at the egg stage and 0, 2, 4, 7, 12, 17, 24 days after hatching (DAH) for analysis. Larvae grew from 1.91 mm at hatching to 12.13 mm at 24 DAH. Trypsin and chymotrypsin activities changed slightly by 4 DAH and then increased significantly 4 DAH. Pepsin activity increased sharply beginning 17 DAH. Lipase activity increased significantly 4 DAH and increased progressively with larval growth. Amylase activity was also detected in newly hatched larvae and increased 7 DAH followed by a gradual decrease. High free amino acid (FAA) content was detected in starry flounder eggs (110.72 mg/g dry weight). Total FAA content dropped to 43.29 mg/g in 4-DAH larvae and then decreased gradually to 13.74 mg/g in 24-DAH larvae. Most FAAs (except lysine and methionine) decreased >50% in 4-DAH larvae compared with those in eggs and then decreased to the lowest values in 24-DAH larvae. Changes in the protein amino acid (PAA) profile were much milder than those observed for FAAs. Most PAAs increased gradually during larval development, except lysine and phenylalanine. The percentages of free threonine, valine, isoleucine, and leucine decreased until the end of the trial, whereas the protein forms of these four AAs followed the opposite trend. A comparison of the essential AA composition of live food (rotifers, Artemia nauplii, and Artemia metanauplii) and larvae suggested that methionine was potentially the first limiting AA. These results may help develop starry flounder larviculture methods by solving the AA imbalance in live food. Moreover, the increased digestive enzyme activities indicate the possibility of introducing artificial compound feed.

  15. Ontogenetic changes in digestive enzyme activities and the amino acid profile of starry flounder Platichthys stellatus

    NASA Astrophysics Data System (ADS)

    Song, Zhidong; Wang, Jiying; Qiao, Hongjin; Li, Peiyu; Zhang, Limin; Xia, Bin

    2016-09-01

    Ontogenetic changes in digestive enzyme activities and the amino acid (AA) profile of starry flounder, Platichthys stellatus, were investigated and limiting amino acids were estimated compared with the essential AA profile between larvae and live food to clarify starry flounder larval nutritional requirements. Larvae were collected at the egg stage and 0, 2, 4, 7, 12, 17, 24 days after hatching (DAH) for analysis. Larvae grew from 1.91 mm at hatching to 12.13 mm at 24 DAH. Trypsin and chymotrypsin activities changed slightly by 4 DAH and then increased significantly 4 DAH. Pepsin activity increased sharply beginning 17 DAH. Lipase activity increased significantly 4 DAH and increased progressively with larval growth. Amylase activity was also detected in newly hatched larvae and increased 7 DAH followed by a gradual decrease. High free amino acid (FAA) content was detected in starry flounder eggs (110.72 mg/g dry weight). Total FAA content dropped to 43.29 mg/g in 4-DAH larvae and then decreased gradually to 13.74 mg/g in 24-DAH larvae. Most FAAs (except lysine and methionine) decreased >50% in 4-DAH larvae compared with those in eggs and then decreased to the lowest values in 24-DAH larvae. Changes in the protein amino acid (PAA) profile were much milder than those observed for FAAs. Most PAAs increased gradually during larval development, except lysine and phenylalanine. The percentages of free threonine, valine, isoleucine, and leucine decreased until the end of the trial, whereas the protein forms of these four AAs followed the opposite trend. A comparison of the essential AA composition of live food (rotifers, Artemia nauplii, and Artemia metanauplii) and larvae suggested that methionine was potentially the first limiting AA. These results may help develop starry flounder larviculture methods by solving the AA imbalance in live food. Moreover, the increased digestive enzyme activities indicate the possibility of introducing artificial compound feed.

  16. Characterization of fatty acid modifying enzyme activity in staphylococcal mastitis isolates and other bacteria

    PubMed Central

    2012-01-01

    Background Fatty acid modifying enzyme (FAME) has been shown to modify free fatty acids to alleviate their bactericidal effect by esterifying fatty acids to cholesterol or alcohols. Although it has been shown in previous studies that FAME is required for Staphylococcus aureus survival in skin abscesses, FAME is poorly studied compared to other virulence factors. FAME activity had also been detected in coagulase-negative staphylococci (CNS). However, FAME activity was only surveyed after a bacterial culture was grown for 24 h. Therefore if FAME activity was earlier in the growth phase, it would not have been detected by the assay and those strains would have been labeled as FAME negative. Results Fifty CNS bovine mastitis isolates and several S. aureus, Escherichia coli, and Streptococcus uberis strains were assayed for FAME activity over 24 h. FAME activity was detected in 54% of CNS and 80% S. aureus strains surveyed but none in E. coli or S. uberis. While some CNS strains produced FAME activity comparable to the lab strain of S. aureus, the pattern of FAME activity varied among strains and across species of staphylococci. All CNS that produced FAME activity also exhibited lipase activity. Lipase activity relative to colony forming units of these CNS decreased over the 24 h growth period. No relationship was observed between somatic cell count in the milk and FAME activity in CNS. Conclusions Some staphylococcal species surveyed produced FAME activity, but E. coli and S. uberis strains did not. All FAME producing CNS exhibited lipase activity which may indicate that both these enzymes work in concert to alter fatty acids in the bacterial environment. PMID:22726316

  17. Modulation of medium-chain fatty acid synthesis in Synechococcus sp. PCC 7002 by replacing FabH with a Chaetoceros Ketoacyl-ACP synthase

    DOE PAGESBeta

    Gu, Huiya; Jinkerson, Robert E.; Davies, Fiona K.; Sisson, Lyle A.; Schneider, Philip E.; Posewitz, Matthew C.

    2016-05-26

    The isolation or engineering of algal cells synthesizing high levels of medium-chain fatty acids (MCFAs) is attractive to mitigate the high clouding point of longer chain fatty acids in algal based biodiesel. To develop a more informed understanding of MCFA synthesis in photosynthetic microorganisms, we isolated several algae from Great Salt Lake and screened this collection for MCFA accumulation to identify strains naturally accumulating high levels of MCFA. A diatom, Chaetoceros sp. GSL56, accumulated particularly high levels of C14 (up to 40%), with the majority of C14 fatty acids allocated in triacylglycerols. Using whole cell transcriptome sequencing and de novomore » assembly, putative genes encoding fatty acid synthesis enzymes were identified. Enzymes from this Chaetoceros sp. were expressed in the cyanobacterium Synechococcus sp. PCC 7002 to validate gene function and to determine whether eukaryotic enzymes putatively lacking bacterial evolutionary control mechanisms could be used to improve MCFA production in this promising production strain. Replacement of the Synechococcus 7002 native FabH with a Chaetoceros ketoacyl-ACP synthase Ill increased MCFA synthesis up to fivefold. In conclusion, the level of increase is dependent on promoter strength and culturing conditions.« less

  18. Modulation of Medium-Chain Fatty Acid Synthesis in Synechococcus sp. PCC 7002 by Replacing FabH with a Chaetoceros Ketoacyl-ACP Synthase

    PubMed Central

    Gu, Huiya; Jinkerson, Robert E.; Davies, Fiona K.; Sisson, Lyle A.; Schneider, Philip E.; Posewitz, Matthew C.

    2016-01-01

    The isolation or engineering of algal cells synthesizing high levels of medium-chain fatty acids (MCFAs) is attractive to mitigate the high clouding point of longer chain fatty acids in algal based biodiesel. To develop a more informed understanding of MCFA synthesis in photosynthetic microorganisms, we isolated several algae from Great Salt Lake and screened this collection for MCFA accumulation to identify strains naturally accumulating high levels of MCFA. A diatom, Chaetoceros sp. GSL56, accumulated particularly high levels of C14 (up to 40%), with the majority of C14 fatty acids allocated in triacylglycerols. Using whole cell transcriptome sequencing and de novo assembly, putative genes encoding fatty acid synthesis enzymes were identified. Enzymes from this Chaetoceros sp. were expressed in the cyanobacterium Synechococcus sp. PCC 7002 to validate gene function and to determine whether eukaryotic enzymes putatively lacking bacterial evolutionary control mechanisms could be used to improve MCFA production in this promising production strain. Replacement of the Synechococcus 7002 native FabH with a Chaetoceros ketoacyl-ACP synthase III increased MCFA synthesis up to fivefold. The level of increase is dependent on promoter strength and culturing conditions. PMID:27303412

  19. Modulation of Medium-Chain Fatty Acid Synthesis in Synechococcus sp. PCC 7002 by Replacing FabH with a Chaetoceros Ketoacyl-ACP Synthase.

    PubMed

    Gu, Huiya; Jinkerson, Robert E; Davies, Fiona K; Sisson, Lyle A; Schneider, Philip E; Posewitz, Matthew C

    2016-01-01

    The isolation or engineering of algal cells synthesizing high levels of medium-chain fatty acids (MCFAs) is attractive to mitigate the high clouding point of longer chain fatty acids in algal based biodiesel. To develop a more informed understanding of MCFA synthesis in photosynthetic microorganisms, we isolated several algae from Great Salt Lake and screened this collection for MCFA accumulation to identify strains naturally accumulating high levels of MCFA. A diatom, Chaetoceros sp. GSL56, accumulated particularly high levels of C14 (up to 40%), with the majority of C14 fatty acids allocated in triacylglycerols. Using whole cell transcriptome sequencing and de novo assembly, putative genes encoding fatty acid synthesis enzymes were identified. Enzymes from this Chaetoceros sp. were expressed in the cyanobacterium Synechococcus sp. PCC 7002 to validate gene function and to determine whether eukaryotic enzymes putatively lacking bacterial evolutionary control mechanisms could be used to improve MCFA production in this promising production strain. Replacement of the Synechococcus 7002 native FabH with a Chaetoceros ketoacyl-ACP synthase III increased MCFA synthesis up to fivefold. The level of increase is dependent on promoter strength and culturing conditions. PMID:27303412

  20. Lactic acid bacteria affect serum cholesterol levels, harmful fecal enzyme activity, and fecal water content

    PubMed Central

    Lee, Do Kyung; Jang, Seok; Baek, Eun Hye; Kim, Mi Jin; Lee, Kyung Soon; Shin, Hea Soon; Chung, Myung Jun; Kim, Jin Eung; Lee, Kang Oh; Ha, Nam Joo

    2009-01-01

    Background Lactic acid bacteria (LAB) are beneficial probiotic organisms that contribute to improved nutrition, microbial balance, and immuno-enhancement of the intestinal tract, as well as lower cholesterol. Although present in many foods, most trials have been in spreads or dairy products. Here we tested whether Bifidobacteria isolates could lower cholesterol, inhibit harmful enzyme activities, and control fecal water content. Methods In vitro culture experiments were performed to evaluate the ability of Bifidobacterium spp. isolated from healthy Koreans (20~30 years old) to reduce cholesterol-levels in MRS broth containing polyoxyethanylcholesterol sebacate. Animal experiments were performed to investigate the effects on lowering cholesterol, inhibiting harmful enzyme activities, and controlling fecal water content. For animal studies, 0.2 ml of the selected strain cultures (108~109 CFU/ml) were orally administered to SD rats (fed a high-cholesterol diet) every day for 2 weeks. Results B. longum SPM1207 reduced serum total cholesterol and LDL levels significantly (p < 0.05), and slightly increased serum HDL. B. longum SPM1207 also increased fecal LAB levels and fecal water content, and reduced body weight and harmful intestinal enzyme activities. Conclusion Daily consumption of B. longum SPM1207 can help in managing mild to moderate hypercholesterolemia, with potential to improve human health by helping to prevent colon cancer and constipation. PMID:19515264

  1. Gluconic acid production from sucrose in an airlift reactor using a multi-enzyme system.

    PubMed

    Mafra, Agnes Cristina Oliveira; Furlan, Felipe Fernando; Badino, Alberto Colli; Tardioli, Paulo Waldir

    2015-04-01

    Sucrose from sugarcane is produced in abundance in Brazil, which provides an opportunity to manufacture other high-value products. Gluconic acid (GA) can be produced by multi-enzyme conversion of sucrose using the enzymes invertase, glucose oxidase, and catalase. In this process, one of the byproducts is fructose, which has many commercial applications. This work concerns the batch mode production of GA in an airlift reactor fed with sucrose as substrate. Evaluation was made of the influence of temperature and pH, as well as the thermal stability of the enzymes. Operational conditions of 40 °C and pH 6.0 were selected, based on the enzymatic activity profiles and the thermal stabilities. Under these conditions, the experimental data could be accurately described by kinetic models. The maximum yield of GA was achieved within 3.8 h, with total conversion of sucrose and glucose and a volumetric productivity of around 7.0 g L(-1) h(-1). PMID:25326720

  2. Biosynthesis of the mycotoxin tenuazonic acid by a fungal NRPS-PKS hybrid enzyme.

    PubMed

    Yun, Choong-Soo; Motoyama, Takayuki; Osada, Hiroyuki

    2015-01-01

    Tenuazonic acid (TeA) is a well-known mycotoxin produced by various plant pathogenic fungi. However, its biosynthetic gene has been unknown to date. Here we identify the TeA biosynthetic gene from Magnaporthe oryzae by finding two TeA-inducing conditions of a low-producing strain. We demonstrate that TeA is synthesized from isoleucine and acetoacetyl-coenzyme A by TeA synthetase 1 (TAS1). TAS1 is a unique non-ribosomal peptide synthetase and polyketide synthase (NRPS-PKS) hybrid enzyme that begins with an NRPS module. In contrast to other NRPS/PKS hybrid enzymes, the PKS portion of TAS1 has only a ketosynthase (KS) domain and this domain is indispensable for TAS1 activity. Phylogenetic analysis classifies this KS domain as an independent clade close to type I PKS KS domain. We demonstrate that the TAS1 KS domain conducts the final cyclization step for TeA release. These results indicate that TAS1 is a unique type of NRPS-PKS hybrid enzyme. PMID:26503170

  3. Biosynthesis of the mycotoxin tenuazonic acid by a fungal NRPS–PKS hybrid enzyme

    PubMed Central

    Yun, Choong-Soo; Motoyama, Takayuki; Osada, Hiroyuki

    2015-01-01

    Tenuazonic acid (TeA) is a well-known mycotoxin produced by various plant pathogenic fungi. However, its biosynthetic gene has been unknown to date. Here we identify the TeA biosynthetic gene from Magnaporthe oryzae by finding two TeA-inducing conditions of a low-producing strain. We demonstrate that TeA is synthesized from isoleucine and acetoacetyl-coenzyme A by TeA synthetase 1 (TAS1). TAS1 is a unique non-ribosomal peptide synthetase and polyketide synthase (NRPS–PKS) hybrid enzyme that begins with an NRPS module. In contrast to other NRPS/PKS hybrid enzymes, the PKS portion of TAS1 has only a ketosynthase (KS) domain and this domain is indispensable for TAS1 activity. Phylogenetic analysis classifies this KS domain as an independent clade close to type I PKS KS domain. We demonstrate that the TAS1 KS domain conducts the final cyclization step for TeA release. These results indicate that TAS1 is a unique type of NRPS–PKS hybrid enzyme. PMID:26503170

  4. Expression of fatty acid synthesis genes and fatty acid accumulation in haematococcus pluvialis under different stressors

    PubMed Central

    2012-01-01

    Background Biofuel has been the focus of intensive global research over the past few years. The development of 4th generation biofuel production (algae-to-biofuels) based on metabolic engineering of algae is still in its infancy, one of the main barriers is our lacking of understanding of microalgal growth, metabolism and biofuel production. Although fatty acid (FA) biosynthesis pathway genes have been all cloned and biosynthesis pathway was built up in some higher plants, the molecular mechanism for its regulation in microalgae is far away from elucidation. Results We cloned main key genes for FA biosynthesis in Haematococcus pluvialis, a green microalga as a potential biodiesel feedstock, and investigated the correlations between their expression alternation and FA composition and content detected by GC-MS under different stress treatments, such as nitrogen depletion, salinity, high or low temperature. Our results showed that high temperature, high salinity, and nitrogen depletion treatments played significant roles in promoting microalgal FA synthesis, while FA qualities were not changed much. Correlation analysis showed that acyl carrier protein (ACP), 3-ketoacyl-ACP-synthase (KAS), and acyl-ACP thioesterase (FATA) gene expression had significant correlations with monounsaturated FA (MUFA) synthesis and polyunsaturated FA (PUFA) synthesis. Conclusions We proposed that ACP, KAS, and FATA in H. pluvialis may play an important role in FA synthesis and may be rate limiting genes, which probably could be modified for the further study of metabolic engineering to improve microalgal biofuel quality and production. PMID:22448811

  5. Effects of traditionally used anxiolytic botanicals on enzymes of the gamma-aminobutyric acid (GABA) system.

    PubMed

    Awad, R; Levac, D; Cybulska, P; Merali, Z; Trudeau, V L; Arnason, J T

    2007-09-01

    In Canada, the use of botanical natural health products (NHPs) for anxiety disorders is on the rise, and a critical evaluation of their safety and efficacy is required. The purpose of this study was to determine whether commercially available botanicals directly affect the primary brain enzymes responsible for gamma-aminobutyric acid (GABA) metabolism. Anxiolytic plants may interact with either glutamic acid decarboxylase (GAD) or GABA transaminase (GABA-T) and ultimately influence brain GABA levels and neurotransmission. Two in vitro rat brain homogenate assays were developed to determine the inhibitory concentrations (IC50) of aqueous and ethanolic plant extracts. Approximately 70% of all extracts that were tested showed little or no inhibitory effect (IC50 values greater than 1 mg/mL) and are therefore unlikely to affect GABA metabolism as tested. The aqueous extract of Melissa officinalis (lemon balm) exhibited the greatest inhibition of GABA-T activity (IC50 = 0.35 mg/mL). Extracts from Centella asiatica (gotu kola) and Valeriana officinalis (valerian) stimulated GAD activity by over 40% at a dose of 1 mg/mL. On the other hand, both Matricaria recutita (German chamomile) and Humulus lupulus (hops) showed significant inhibition of GAD activity (0.11-0.65 mg/mL). Several of these species may therefore warrant further pharmacological investigation. The relation between enzyme activity and possible in vivo mode of action is discussed. PMID:18066140

  6. Adding an appropriate amino acid during crosslinking results in more stable crosslinked enzyme aggregates.

    PubMed

    Mukherjee, Joyeeta; Majumder, Abir Baran; Gupta, Munishwar Nath

    2016-08-15

    Carrier free immobilization, especially crosslinked enzyme aggregates (CLEAs), has become an important design for biocatalysis in several areas. Adding amino acids during formation of CLEAs was found to give biocatalysts more stable at 55 °C and in the presence of 60% acetonitrile. The half-lives of CLEAs prepared with and without Arg addition were 21 and 15 h (subtilisin) and 4 and 1.6 h (α-chymotrypsin) at 55 °C, respectively. The corresponding half-lives during acetonitrile presence were 4.1 and 3.0 h (subtilisin) and 39 and 22 min (α-chymotrypsin), respectively. CLEAs made with Arg had higher percentages of alpha helix. CLEAs made by adding Lys, Ala, or Asp also were more stable. In the case of Thermomyces lanuginosus lipase (TLL), CLEA with Ala was even more stable than CLEA with Arg. The addition of a suitable amino acid, thus, enhances CLEA stabilities. The results are discussed in the light of earlier results on chemical modification of proteins and the observation that the Arg/Lys ratio is invariably high in the case of enzymes from thermophiles. PMID:27237371

  7. Fructose utilization for nucleic acid synthesis in the fetal pig.

    PubMed

    White, C E; Piper, E L; Noland, P R; Daniels, L B

    1982-07-01

    Eight fetal pigs, in utero, were injected ip with 20 microCi/fetus [U14C]-fructose between d 55 and 65 pregnancy. The isotope was allowed to equilibrate between blood and tissues within injected fetuses for a period of 240 min. Fetal pigs were then sacrificed and nucleic acids were extracted from cold tissue homogenates of skeletal muscle and liver. Nuclide disintegrations per minute recovered in extracted DNA and RNA were used to calculate incorporation of labeled C from fructose. The recovery of labeled C per mmol of nucleic acids from skeletal muscle was greater (P less than .05) than that from liver. Relative incorporation of labeled C into skeletal muscle RNA (395.9 pmol/mmol) was greater (P less than .05) than for DNA (189.5 pmol/mmol). The same trend was observed for liver RNA (78.0 pmol/mmol) and DNA (55.6 pmol/mmol), but differences were nonsignificant. These data suggest that at least part of the high concentration of endogenous fructose measured in fetal pigs in utero is involved in synthesis of nucleic acids, thereby providing substrate for anabolic functions necessary for fetal growth and development. PMID:6181047

  8. Rapid and enzyme-free nucleic acid detection based on exponential hairpin assembly in complex biological fluids.

    PubMed

    Ma, Cuiping; Zhang, Menghua; Chen, Shan; Liang, Chao; Shi, Chao

    2016-05-10

    Herein, we have developed a rapid and enzyme-free nucleic acid amplification detection method that combined the exponential self-assembly of four DNA hairpins and the FRET pair Cy3 and Cy5. This strategy was very ingenious and rapid, and could detect nucleic acids at concentrations as low as 10 pM in 15 min in biological fluids. PMID:27138054

  9. An enzymic assay for uric acid in serum and urine compared with HPLC.

    PubMed

    Dubois, H; Delvoux, B; Ehrhardt, V; Greiling, H

    1989-03-01

    We evaluated a colorimetric method for the assay of uric acid in serum or urine, which utilises a Trinder chromogenic system modified by the inclusion of 2,4,6-tribromo-3-hydroxybenzoic acid for oxidative coupling to p-aminophenazone. Colour development (Amax: 512 nm) is complete within five minutes. Measurement of a sample blank is not needed. The procedure involves pre-incubation with ascorbic acid oxidase and detergent to eliminate interference by ascorbic acid and to abolish turbidity due to lipaemia; this pretreatment was effective up to 1.14 mmol/l ascorbate and up to at least 25 mmol/l triacylglycerol. Interference by icteric sera was insignificant up to about 170 mumol/l bilirubin. The method is linear up to at least 1428 mumol/l. In human serum and urine the procedure correlates well with HPLC and the uricase p-aminophenazone method on the SMAC analyser. Within-run and between-run imprecisions of the enzymic test were higher than for HPLC, but did not exceed 1.2% (CV) and 2.5% (CV), respectively. PMID:2708944

  10. The Mycobacterium tuberculosis FAS-II condensing enzymes: their role in mycolic acid biosynthesis, acid-fastness, pathogenesis and in future drug development.

    PubMed

    Bhatt, Apoorva; Molle, Virginie; Besra, Gurdyal S; Jacobs, William R; Kremer, Laurent

    2007-06-01

    Mycolic acids are very long-chain fatty acids representing essential components of the mycobacterial cell wall. Considering their importance, characterization of key enzymes participating in mycolic acid biosynthesis not only allows an understanding of their role in the physiology of mycobacteria, but also might lead to the identification of new drug targets. Mycolates are synthesized by at least two discrete elongation systems, the type I and type II fatty acid synthases (FAS-I and FAS-II respectively). Among the FAS-II components, the condensing enzymes that catalyse the formation of carbon-carbon bonds have received considerable interest. Four condensases participate in initiation (mtFabH), elongation (KasA and KasB) and termination (Pks13) steps, leading to full-length mycolates. We present the recent biochemical and structural data for these important enzymes. Special emphasis is given to their role in growth, intracellular survival, biofilm formation, as well as in the physiopathology of tuberculosis. Recent studies demonstrated that phosphorylation of these enzymes by mycobacterial kinases affects their activities. We propose here a model in which kinases that sense environmental changes can phosphorylate the condensing enzymes, thus representing a novel mechanism of regulating mycolic acid biosynthesis. Finally, we discuss the attractiveness of these enzymes as valid targets for future antituberculosis drug development. PMID:17555433

  11. Inhibitory action of Epilobium hirsutum extract and its constituent ellagic acid on drug-metabolizing enzymes.

    PubMed

    Celik, Gurbet; Semiz, Aslı; Karakurt, Serdar; Gencler-Ozkan, Ayse Mine; Arslan, Sevki; Adali, Orhan; Sen, Alaattin

    2016-04-01

    Epilobium hirsutum (EH) is a medicinal plant for treating various diseases. Despite its wide usage, there is no available information about its potential influences on drug metabolism. The present study was undertaken to determine the in vivo effects of EH on hepatic CYP2B, CYP2C, CYP2D, and CYP3A enzymes that are primarily involved in drug metabolism. Male Wistar rats were injected intraperitoneally with EH water extract (EHWE) and ellagic acid (EA) at a daily dose of 37.5 and 20 mg/kg, respectively, for 9 days and hepatic drug-metabolizing enzymes were assessed at activity, protein and mRNA levels. Erythromycin N-demethylase activity was inhibited by 53 and 21 % in EHWE- and EA-treated rats, respectively. Benzphetamine N-demethylase and 7-benzyloxyresorufin-O-debenzylase activities were decreased by 53 and 43 %, and 57 and 57 % in EHWE-and EA-treated rats, respectively. Moreover, protein levels of CYP2B1, CYP2C6, CYP2D2, and CYP3A1 also decreased by 55, 15, 33, and 82 % as a result of EHWE treatment of rats, respectively. Similarly, CYP2B1, CYP2C6, CYP2D2, and CYP3A1 protein levels decreased by 62, 63, 49, and 37 % with EA treatment, respectively. qRT-PCR analyses also showed that mRNA levels of these enzymes were significantly inhibited with bothEHWE and EA treatments. In conclusion, inhibition of drug clearances leading to drug toxicity because of the lowered activity and expression of drug-metabolizing enzymes might be observed in the people who used EH as complementary herbal remedy that might be contributed by its EA content. PMID:25425117

  12. Prediction of enzyme function based on 3D templates of evolutionarily important amino acids

    PubMed Central

    Kristensen, David M; Ward, R Matthew; Lisewski, Andreas Martin; Erdin, Serkan; Chen, Brian Y; Fofanov, Viacheslav Y; Kimmel, Marek; Kavraki, Lydia E; Lichtarge, Olivier

    2008-01-01

    Background Structural genomics projects such as the Protein Structure Initiative (PSI) yield many new structures, but often these have no known molecular functions. One approach to recover this information is to use 3D templates – structure-function motifs that consist of a few functionally critical amino acids and may suggest functional similarity when geometrically matched to other structures. Since experimentally determined functional sites are not common enough to define 3D templates on a large scale, this work tests a computational strategy to select relevant residues for 3D templates. Results Based on evolutionary information and heuristics, an Evolutionary Trace Annotation (ETA) pipeline built templates for 98 enzymes, half taken from the PSI, and sought matches in a non-redundant structure database. On average each template matched 2.7 distinct proteins, of which 2.0 share the first three Enzyme Commission digits as the template's enzyme of origin. In many cases (61%) a single most likely function could be predicted as the annotation with the most matches, and in these cases such a plurality vote identified the correct function with 87% accuracy. ETA was also found to be complementary to sequence homology-based annotations. When matches are required to both geometrically match the 3D template and to be sequence homologs found by BLAST or PSI-BLAST, the annotation accuracy is greater than either method alone, especially in the region of lower sequence identity where homology-based annotations are least reliable. Conclusion These data suggest that knowledge of evolutionarily important residues improves functional annotation among distant enzyme homologs. Since, unlike other 3D template approaches, the ETA method bypasses the need for experimental knowledge of the catalytic mechanism, it should prove a useful, large scale, and general adjunct to combine with other methods to decipher protein function in the structural proteome. PMID:18190718

  13. Expression of Vitis amurensis NAC26 in Arabidopsis enhances drought tolerance by modulating jasmonic acid synthesis

    PubMed Central

    Fang, Linchuan; Su, Lingye; Sun, Xiaoming; Li, Xinbo; Sun, Mengxiang; Karungo, Sospeter Karanja; Fang, Shuang; Chu, Jinfang; Li, Shaohua; Xin, Haiping

    2016-01-01

    The growth and fruit quality of grapevines are widely affected by abnormal climatic conditions such as water deficits, but many of the precise mechanisms by which grapevines respond to drought stress are still largely unknown. Here, we report that VaNAC26, a member of the NAC transcription factor family, was upregulated dramatically during cold, drought and salinity treatments in Vitis amurensis, a cold and drought-hardy wild Vitis species. Heterologous overexpression of VaNAC26 enhanced drought and salt tolerance in transgenic Arabidopsis. Higher activities of antioxidant enzymes and lower concentrations of H2O2 and O2 − were found in VaNAC26-OE lines than in wild type plants under drought stress. These results indicated that scavenging by reactive oxygen species (ROS) was enhanced by VaNAC26 in transgenic lines. Microarray-based transcriptome analysis revealed that genes related to jasmonic acid (JA) synthesis and signaling were upregulated in VaNAC26-OE lines under both normal and drought conditions. VaNAC26 showed a specific binding ability on the NAC recognition sequence (NACRS) motif, which broadly exists in the promoter regions of upregulated genes in transgenic lines. Endogenous JA content significantly increased in the VaNAC26-OE lines 2 and 3. Our data suggest that VaNAC26 responds to abiotic stresses and may enhance drought tolerance by transcriptional regulation of JA synthesis in Arabidopsis. PMID:27162276

  14. Expression of Vitis amurensis NAC26 in Arabidopsis enhances drought tolerance by modulating jasmonic acid synthesis.

    PubMed

    Fang, Linchuan; Su, Lingye; Sun, Xiaoming; Li, Xinbo; Sun, Mengxiang; Karungo, Sospeter Karanja; Fang, Shuang; Chu, Jinfang; Li, Shaohua; Xin, Haiping

    2016-04-01

    The growth and fruit quality of grapevines are widely affected by abnormal climatic conditions such as water deficits, but many of the precise mechanisms by which grapevines respond to drought stress are still largely unknown. Here, we report that VaNAC26, a member of the NAC transcription factor family, was upregulated dramatically during cold, drought and salinity treatments in Vitis amurensis, a cold and drought-hardy wild Vitis species. Heterologous overexpression of VaNAC26 enhanced drought and salt tolerance in transgenic Arabidopsis. Higher activities of antioxidant enzymes and lower concentrations of H2O2 and O2 (-) were found in VaNAC26-OE lines than in wild type plants under drought stress. These results indicated that scavenging by reactive oxygen species (ROS) was enhanced by VaNAC26 in transgenic lines. Microarray-based transcriptome analysis revealed that genes related to jasmonic acid (JA) synthesis and signaling were upregulated in VaNAC26-OE lines under both normal and drought conditions. VaNAC26 showed a specific binding ability on the NAC recognition sequence (NACRS) motif, which broadly exists in the promoter regions of upregulated genes in transgenic lines. Endogenous JA content significantly increased in the VaNAC26-OE lines 2 and 3. Our data suggest that VaNAC26 responds to abiotic stresses and may enhance drought tolerance by transcriptional regulation of JA synthesis in Arabidopsis. PMID:27162276

  15. First total synthesis and antileishmanial activity of (Z)-16-methyl-11-heptadecenoic acid, a new marine fatty acid from the sponge Dragmaxia undata

    PubMed Central

    Carballeira, Néstor M.; Montano, Nashbly; Cintrón, Gabriel A.; Márquez, Carmary; Rubio, Celia Fernández; Prada, Christopher Fernández; Balaña-Fouce, Rafael

    2010-01-01

    The first total synthesis for the (Z)-16-methyl-11-heptadecenoic acid, a novel fatty acid from the sponge Dragmaxia undata, was accomplished in seven steps and in a 44% overall yield. The use of (trimethylsilyl)acetylene was key in the synthesis. Based on a previous developed strategy in our laboratory the best synthetic route towards the title compound was first acetylide coupling of (trimethylsilyl)acetylene to the long-chain protected 10-bromo-1-decanol followed by a second acetylide coupling to the short-chain 1-bromo-4-methylpentane, which resulted in higher yields. Complete spectral data is also presented for the first time for this recently discovered fatty acid and the cis double bond stereochemistry of the natural acid was established. The title compound displayed antiprotozoal activity against Leishmania donovani (IC50 = 165.5 ± 23.4 µM) and inhibited the leishmania DNA topoisomerase IB enzyme (LdTopIB) with an IC50 = 62.3 ± 0.7 µM. PMID:21129369

  16. Thermostable Lipoxygenase, a Key Enzyme in the Conversion of Linoleic Acid into Thrihydroxy-octadecenoic Acid by Pseudomonas aeruginosa PR3

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Lipoxygenases (LOX) constitute a family of lipid-peroxidizing enzymes catalyzing the oxidation of unsaturated fatty acid with (1Z,4Z)-pentadiene structural unit, leading to formation of the conjugated (Z,E)-hydroperoxydienoic acid. LOXs have been known to be widely distributed in plants and animals...

  17. Clostridium thermocellum releases coumaric acid during degradation of untreated grasses by the action of an unknown enzyme.

    PubMed

    Herring, Christopher D; Thorne, Philip G; Lynd, Lee R

    2016-03-01

    Clostridium thermocellum is an anaerobic thermophile with the ability to digest lignocellulosic biomass that has not been pretreated with high temperatures. Thermophilic anaerobes have previously been shown to more readily degrade grasses than wood. Part of the explanation for this may be the presence of relatively large amounts of coumaric acid in grasses, with linkages to both hemicellulose and lignin. We found that C. thermocellum and cell-free cellulase preparations both release coumaric acid from bagasse and switchgrass. Cellulase preparations from a mutant strain lacking the scaffoldin cipA still showed activity, though diminished. Deletion of all three proteins in C. thermocellum with ferulic acid esterase domains, either singly or in combination, did not eliminate the activity. Further work will be needed to identify the novel enzyme(s) responsible for the release of coumaric acid from grasses and to determine whether these enzymes are important factors of microbial biomass degradation. PMID:26762388

  18. Characterization of enzymes in the oxidation of 1,2-propanediol to D: -(-)-lactic acid by Gluconobacter oxydans DSM 2003.

    PubMed

    Wei, Liujing; Yang, Xuepeng; Gao, Keliang; Lin, Jinping; Yang, Shengli; Hua, Qiang; Wei, Dongzhi

    2010-09-01

    Although Gluconobacter oxydans can convert 1,2-propanediol to D: -(-)-lactic acid, the enzyme(s) responsible for the conversion has remain unknown. In this study, the membrane-bound alcohol dehydrogenase (ADH) of Gluconobacter oxydans DSM 2003 was purified and confirmed to be essential for the process of D: -(-)-lactic acid production by gene knockout and complementation studies. A 25 percent decrease in D: -(-)-lactic acid production was found for the aldehyde dehydrogenase (ALDH) deficient strain of G. oxydans DSM 2003, indicating that this enzyme is involved in the reaction but not necessary. It is the first report that reveals the function of ADH and ALDH in the biooxidation of 1,2-propanediol to D: -(-)-lactic acid by G. oxydans DSM 2003. PMID:20300886

  19. The induction of two biosynthetic enzymes helps Escherichia coli sustain heme synthesis and activate catalase during hydrogen peroxide stress

    PubMed Central

    Mancini, Stefano; Imlay, James A.

    2015-01-01

    Summary Hydrogen peroxide pervades many natural environments, including the phagosomes that mediate cell-based immunity. Transcriptomic analysis showed that during protracted low-grade H2O2 stress, Escherichia coli responds by activating both the OxyR defensive regulon and the Fur iron-starvation response. OxyR induced synthesis of two members of the nine-step heme biosynthetic pathway: ferrochelatase (HemH) and an isozyme of coproporphyrinogen III oxidase (HemF). Mutations that blocked either adaptation caused the accumulation of porphyrin intermediates, inadequate activation of heme enzymes, low catalase activity, defective clearance of H2O2, and a failure to grow. Genetic analysis indicated that HemH induction is needed to compensate for iron sequestration by the mini-ferritin Dps. Dps activity protects DNA and proteins by limiting Fenton chemistry, but it interferes with the ability of HemH to acquire the iron that it needs to complete heme synthesis. HemF is a manganoprotein that displaces HemN, an iron-sulfur enzyme whose synthesis and/or stability is apparently problematic during H2O2 stress. Thus the primary responses to H2O2, including the sequestration of iron, require compensatory adjustments in the mechanisms of iron-cofactor synthesis. The results support the growing evidence that oxidative stress is primarily an iron pathology. PMID:25664592

  20. Synthesis of E. faecium wall teichoic acid fragments.

    PubMed

    van der Es, Daan; Groenia, Nadia A; Laverde, Diana; Overkleeft, Herman S; Huebner, Johannes; van der Marel, Gijsbert A; Codée, Jeroen D C

    2016-09-01

    The first synthesis of different Enterococcus faecium wall teichoic acid (WTA) fragments is presented. The structure of these major cell wall components was elucidated recently and it was shown that these glycerolphosphate (GroP) based polymers are built up from -6-(GalNAc-α(1-3)-GalNAc-β(1-2)-GroP)- repeating units. We assembled WTA fragments up to three repeating units in length, in two series that differ in the stereochemistry of the glycerolphosphate moiety. The key GalNAc-GalNAc-GroP synthons, required for the synthesis, were generated from galactosazide building blocks that were employed in highly stereoselective glycosylation reactions to furnish both the α- and β-configured linkages. By comparing the NMR spectra of the synthesized fragments with the isolated material it appears that the hereto undefined stereochemistry of the glycerol phosphate moiety is sn-glycerol-3-phosphate. The generated fragments will be valuable tools to study their immunological activity at the molecular level. PMID:26993744

  1. [Effect of gibberellic acid on RNA synthesis in dwarf peas].

    PubMed

    Kilev, S N; Kholodar', A V; Chekurov, V M; Mertvetsov, N P

    1982-04-01

    The effect of gibberellic acid (GA) on total RNA and polysomal poly-[A]+-RNA synthesis in epicotylia and embryos of dwarf pea of two varieties differing in their physiological sensitivity to GA was studied. It was found that incubation with GA increases the accumulation of total RNA in pea epicotylia, var. "Pioner" and "Polzunok". The maximal stimulation of RNA accumulation makes up to 40% for the low sensitivity variety "Polzunok" and 150% for the highly sensitive variety "Pioner". GA increases the synthesis of polysomal poly (A)+-mRNA in 5-year-old pea sprouts and that of newly synthesized poly (A)+-mRNA in epicotylian polysomes of both varieties 5, 24, 48 and 72 hrs after incubation with GA. GA at concentrations of 10(-6) and 10(-5) stimulates the incorporation of [3H]uridine into polysomal mRNA during the first 1--3 hours after treatment and enhances the accumulation of newly synthesized mRNA in pea embryonic polyribosomes. The stimulating effect is directly proportional to the dose of the hormone. The mechanisms of GA effect on the transcription and translation in pea plant cells are discussed. PMID:6177351

  2. Intermediates in the Synthesis of Type 2 Adenovirus Deoxyribonucleic Acid

    PubMed Central

    Horwitz, Marshall S.

    1971-01-01

    Intermediates in the synthesis of adenovirus type 2 deoxyribonucleic acid (DNA) were studied in HeLa cells. Pieces of DNA smaller than the viral genome were demonstrated after labeling with 3H-thymidine for 10 to 240 sec. Intermediates as small as the Okazaki fragments (8 to 10S) do not predominate at any of the above times. No detectable addition of nucleotides to parental genome could be shown, nor was there any breakdown of recently synthesized viral DNA. The DNA intermediates were of viral origin for they hybridized to viral DNA and were made at a stage of the cell cycle (G2) when host DNA is not synthesized. PMID:5132696

  3. Protein synthesis in isolated rabbit forelimb muscles. The possible role of metabolites of arachidonic acid in the response to intermittent stretching.

    PubMed Central

    Smith, R H; Palmer, R M; Reeds, P J

    1983-01-01

    Protein synthesis was measured in isolated intact rabbit muscles by the incorporation of [3H]phenylalanine added at a high concentration (2.5 mM) to the incubation medium. Intermittent mechanical stretching substantially increased the rate of protein synthesis relative to that in control muscles incubated under a constant tension. Indomethacin and meclofenamic acid, inhibitors of the enzyme cyclo-oxygenase, which converts free arachidonic acid into the prostaglandins, prostacyclins and thromboxanes, decreased the rate of protein synthesis in intermittently stretched muscles, but had no effect on synthesis rates in the unstimulated controls. Arachidonic acid at concentrations of 0.2 and 1.0 microM gave a highly significant increase in the rate of protein synthesis in muscles incubated under a constant tension. The ability of arachidonic acid to increase protein-synthesis rates was abolished by the addition of indomethacin. Activation of protein synthesis by intermittent stretching persisted for 10-20 min after the stretch stimulation had ceased. Indomethacin, added either during the initial incubation with intermittent stretching or during the subsequent period when protein synthesis was measured after stimulation had ceased, decreased protein-synthesis rates. This decrease was similar whether indomethacin was present during the initial, final or entire incubation period. In experiments analogous with those in (4) above, when Ca2+ was withheld and EGTA added for the entire incubation, rates of protein synthesis were again decreased. The rates of protein synthesis observed when Ca2+ was present during either an initial stimulation phase or a final, unstimulated, measurement phase were similar, and were intermediate between control rates and those in muscles incubated without Ca2+ for the whole experiment. Two prostaglandins, F2 alpha (2.8 microM) and A1 (28 microM), increased rates of protein synthesis in unstimulated muscles, but prostaglandins E2 and D2 and the

  4. Comparative genomics of citric-acid producing Aspergillus niger ATCC 1015 versus enzyme-producing CBS 513.88

    SciTech Connect

    Grigoriev, Igor V.; Baker, Scott E.; Andersen, Mikael R.; Salazar, Margarita P.; Schaap, Peter J.; Vondervoot, Peter J.I. van de; Culley, David; Thykaer, Jette; Frisvad, Jens C.; Nielsen, Kristen F.; Albang, Richard; Albermann, Kaj; Berka, Randy M.; Braus, Gerhard H.; Braus-Stromeyer, Susanna A.; Corrochano, Luis M.; Dai, Ziyu; Dijck, Piet W.M. van; Hofmann, Gerald; Lasure, Linda L.; Magnusson, Jon K.; Meijer, Susan L.; Nielsen, Jakob B.; Nielsen, Michael L.; Ooyen, Albert J.J. van; Panther, Kathyrn S.; Pel, Herman J.; Poulsen, Lars; Samson, Rob A.; Stam, Hen; Tsang, Adrian; Brink, Johannes M. van den; Atkins, Alex; Aerts, Andrea; Shapiro, Harris; Pangilinan, Jasmyn; Salamov, Asaf; Lou, Yigong; Lindquist, Erika; Lucas, Susan; Grimwood, Jane; Kubicek, Christian P.; Martinez, Diego; Peij, Noel N.M.E. van; Roubos, Johannes A.; Nielsen, Jens

    2011-04-28

    The filamentous fungus Aspergillus niger exhibits great diversity in its phenotype. It is found globally, both as marine and terrestrial strains, produces both organic acids and hydrolytic enzymes in high amounts, and some isolates exhibit pathogenicity. Although the genome of an industrial enzyme-producing A. niger strain (CBS 513.88) has already been sequenced, the versatility and diversity of this species compels additional exploration. We therefore undertook whole genome sequencing of the acidogenic A. niger wild type strain (ATCC 1015), and produced a genome sequence of very high quality. Only 15 gaps are present in the sequence and half the telomeric regions have been elucidated. Moreover, sequence information from ATCC 1015 was utilized to improve the genome sequence of CBS 513.88. Chromosome-level comparisons uncovered several genome rearrangements, deletions, a clear case of strain-specific horizontal gene transfer, and identification of 0.8 megabase of novel sequence. Single nucleotide polymorphisms per kilobase (SNPs/kb) between the two strains were found to be exceptionally high (average: 7.8, maximum: 160 SNPs/kb). High variation within the species was confirmed with exo-metabolite profiling and phylogenetics. Detailed lists of alleles were generated, and genotypic differences were observed to accumulate in metabolic pathways essential to acid production and protein synthesis. A transcriptome analysis revealed up-regulation of the electron transport chain, specifically the alternative oxidative pathway in ATCC 1015, while CBS 513.88 showed significant up-regulation of genes relevant to glucoamylase A production, such as tRNA-synthases and protein transporters. Our results and datasets from this integrative systems biology analysis resulted in a snapshot of fungal evolution and will support further optimization of cell factories based on filamentous fungi.[Supplemental materials (10 figures, three text documents and 16 tables) have been made available

  5. Photosynthetic Characteristics of Portulaca grandiflora, a Succulent C(4) Dicot : CELLULAR COMPARTMENTATION OF ENZYMES AND ACID METABOLISM.

    PubMed

    Ku, S B; Shieh, Y J; Reger, B J; Black, C C

    1981-11-01

    on enzyme localization, a scheme of C(4) photosynthesis in P. grandiflora is proposed.Well-watered plants of P. grandiflora exhibit a diurnal fluctuation of total titratable acidity, with an amplitude of 61 and 54 microequivalent per gram fresh weight for the leaves and stems, respectively. These changes were in parallel with changes in malic acid concentration in these tissues. Under severe drought conditions, diurnal changes in both titratable acidity and malic acid concentration in both leaves and stems were much reduced. However, another C(4) dicot Amaranthus graecizans (nonsucculent) did not show any diurnal acid fluctuation under the same conditions. These results confirm the suggestion made by Koch and Kennedy (Plant Physiol. 65: 193-197, 1980) that succulent C(4) dicots can exhibit an acid metabolism similar to Crassulacean acid metabolism plants in certain environments. PMID:16662054

  6. Alisol B 23-acetate protects against ANIT-induced hepatotoxity and cholestasis, due to FXR-mediated regulation of transporters and enzymes involved in bile acid homeostasis.

    PubMed

    Meng, Qiang; Chen, Xin-Li; Wang, Chang-Yuan; Liu, Qi; Sun, Hui-Jun; Sun, Peng-Yuan; Huo, Xiao-Kui; Liu, Zhi-Hao; Yao, Ji-Hong; Liu, Ke-Xin

    2015-03-15

    Intrahepatic cholestasis is a clinical syndrome with systemic and intrahepatic accumulation of excessive toxic bile acids that ultimately cause hepatobiliary injury. Appropriate regulation of bile acids in hepatocytes is critically important for protection against liver injury. In the present study, we characterized the protective effect of alisol B 23-acetate (AB23A), a natural triterpenoid, on alpha-naphthylisothiocyanate (ANIT)-induced liver injury and intrahepatic cholestasis in mice and further elucidated the mechanisms in vivo and in vitro. AB23A treatment dose-dependently protected against liver injury induced by ANIT through reducing hepatic uptake and increasing efflux of bile acid via down-regulation of hepatic uptake transporters (Ntcp) and up-regulation of efflux transporter (Bsep, Mrp2 and Mdr2) expression. Furthermore, AB23A reduced bile acid synthesis through repressing Cyp7a1 and Cyp8b1, increased bile acid conjugation through inducing Bal, Baat and bile acid metabolism through an induction in gene expression of Sult2a1. We further demonstrate the involvement of farnesoid X receptor (FXR) in the hepatoprotective effect of AB23A. The changes in transporters and enzymes, as well as ameliorative liver histology in AB23A-treated mice were abrogated by FXR antagonist guggulsterone in vivo. In vitro evidences also directly demonstrated the effect of AB23A on FXR activation in a dose-dependent manner using luciferase reporter assay in HepG2 cells. In conclusion, AB23A produces protective effect against ANIT-induced hepatotoxity and cholestasis, due to FXR-mediated regulation of transporters and enzymes. PMID:25655198

  7. Transcriptional profiling of canola developing embryo and identification of the important roles of BnDof5.6 in embryo development and fatty acids synthesis.

    PubMed

    Deng, Wei; Yan, Fang; Zhang, Xiaolan; Tang, Yuwei; Yuan, Yujin

    2015-08-01

    Canola is an important vegetable oil crop globally, and the understanding of the molecular mechanism underlying fatty acids biosynthesis during seed embryo development is an important research goal. Here we report the transcriptional profiling analysis of developing canola embryos using RNA-sequencing (RNA-Seq) method. RNA-Seq analysis generated 58,579,451 sequence reads aligned with 32,243 genes. It was found that a total of 55 differential expression genes (DEGs) encoding 28 enzymes function in carbon flow to fatty acids of storage TAG. Most of the DEGs encoding above enzymes showed similar expression pattern, indicating the DEGs are cooperatively involved in carbon flow into fatty acids. In addition, 41 DEGs associated with signal transductions, transport and metabolic processing of auxin, gibberellin, abscisic acid, cytokinin and salicylic acids were found in the RNA-Seq database, which indicates the important roles of the phytohormones in controlling embryo development and fatty acids synthesis. 122 DEGs encoding transcriptional factor family members were found in developing canola embryos. Furthermore, BnDOF5.6, a zinc finger transcriptional factor gene, found in RNA-Seq database was down-regulated in developing canola embryos. The transgenic plants displayed reduced embryo sizes, decreased fatty acids contents and altered seed fatty acids composition in canola. Down-regulated of BnDof5.6 also changed the expression levels of genes involved in fatty acids synthesis and desaturation. Our results indicate that BnDof5.6 is required for embryo development and fatty acids synthesis in canola. Overall this study presents new information on the global expression patterns of genes during embryo development and will expand our understanding of the complex molecular mechanism of carbon flow into fatty acids and embryo development in canola. PMID:26092973

  8. Enzyme-mimetic effects of gold@platinum nanorods on the antioxidant activity of ascorbic acid

    NASA Astrophysics Data System (ADS)

    Zhou, Yu-Ting; He, Weiwei; Wamer, Wayne G.; Hu, Xiaona; Wu, Xiaochun; Lo, Y. Martin; Yin, Jun-Jie

    2013-01-01

    Au@Pt nanorods were prepared by growing platinum nanodots on gold nanorods. Using electron spin resonance (ESR), we determined that the mechanisms for oxidation of ascorbic acid (AA) by Au@Pt nanorods and ascorbic acid oxidase (AAO) were kinetically similar and yielded similar products. In addition we observed that Au@Pt nanorods were stable with respect to temperature and pH. Using UV-VIS spectroscopy, the apparent kinetics of enzyme-mimetic activity of Au@Pt nanorods were studied and compared with the activity of AAO. With the help of ESR, we found that Au@Pt nanorods did not scavenge hydroxyl radicals but inhibited the antioxidant ability of AA for scavenging hydroxyl radicals produced by photoirradiating solutions containing titanium dioxide and zinc oxide. Moreover, the Au@Pt nanorods reduced the ability of AA to scavenge DPPH radicals and superoxide radicals. These results demonstrate that Au@Pt nanorods can reduce the antioxidant activity of AA. Therefore, it is necessary to consider the effects of using Pt nanoparticles together with other reducing agents or antioxidants such as AA due to the oxidase-like property of Au@Pt nanorods.Au@Pt nanorods were prepared by growing platinum nanodots on gold nanorods. Using electron spin resonance (ESR), we determined that the mechanisms for oxidation of ascorbic acid (AA) by Au@Pt nanorods and ascorbic acid oxidase (AAO) were kinetically similar and yielded similar products. In addition we observed that Au@Pt nanorods were stable with respect to temperature and pH. Using UV-VIS spectroscopy, the apparent kinetics of enzyme-mimetic activity of Au@Pt nanorods were studied and compared with the activity of AAO. With the help of ESR, we found that Au@Pt nanorods did not scavenge hydroxyl radicals but inhibited the antioxidant ability of AA for scavenging hydroxyl radicals produced by photoirradiating solutions containing titanium dioxide and zinc oxide. Moreover, the Au@Pt nanorods reduced the ability of AA to scavenge

  9. Endogenous Synthesis of Amino Acids Limits Growth, Lactation, and Reproduction in Animals.

    PubMed

    Hou, Yongqing; Yao, Kang; Yin, Yulong; Wu, Guoyao

    2016-03-01

    Amino acids (AAs) are building blocks of protein. Eight AAs (Ala, Asn, Asp, Glu, Gln, Gly, Pro, and Ser) are formed by all animals, whereas de novo synthesis of Arg occurs in a species-specific manner in most mammals (e.g., humans, pigs, and rats). Synthesizable AAs were traditionally classified as nutritionally nonessential for animals, because they were thought to be formed in sufficient amounts. However, this assumption is not supported by evidence showing that 1) rats grow slowly when their diets do not contain Arg, Glu, or Gln despite adequate provision of all other proteinogenous AAs; 2) pigs cannot achieve maximum growth, lactation, or reproduction performance when fed corn- and soybean meal-based diets meeting National Research Council-recommended requirements of protein and AAs without supplemental Arg, Glu, Gln, Gly, or Pro; 3) chickens exhibit increases in lean tissue gain and feed efficiency when their diets are supplemented with Glu, Gln, Gly, and Pro; 4) lactating cows cannot obtain maximum milk protein production without a postruminal supply of Gln or Pro; 5) fish cannot achieve maximum growth when diets do not contain Gln or Pro; and 6) men fail to sustain spermatogenesis when fed an Arg-deficient diet. Quantitative analysis of nitrogen metabolism showed that AA synthesis in animals is constrained by both precursor availability and enzyme activity. Taken together, these findings support the conclusion that the endogenous synthesis of AAs limits growth, lactation, and reproduction in animals. This new knowledge can guide the optimization of human nutrition for improving health and well-being. PMID:26980816

  10. Decreased bile-acid synthesis in livers of hepatocyte-conditional NADPH-cytochrome P450 reductase-null mice results in increased bile acids in serum.

    PubMed

    Cheng, Xingguo; Zhang, Youcai; Klaassen, Curtis D

    2014-10-01

    NADPH-cytochrome P450 reductase (Cpr) is essential for the function of microsomal cytochrome P450 monooxygenases (P450), including those P450s involved in bile acid (BA) synthesis. Mice with hepatocyte-specific deletion of NADPH-cytochrome P450 reductase (H-Cpr-null) have been engineered to understand the in vivo function of hepatic P450s in the metabolism of xenobiotics and endogenous compounds. However, the impact of hepatic Cpr on BA homeostasis is not clear. The present study revealed that H-Cpr-null mice had a 60% decrease in total BA concentration in liver, whereas the total BA concentration in serum was almost doubled. The decreased level of cholic acid (CA) in both serum and livers of H-Cpr-null mice is likely due to diminished enzyme activity of Cyp8b1 that is essential for CA biosynthesis. Feedback mechanisms responsible for the reduced liver BA concentrations and/or increased serum BA concentrations in H-Cpr-null mice included the following: 1) enhanced alternative BA synthesis pathway, as evidenced by the fact that classic BA synthesis is diminished but chenodeoxycholic acid still increases in both serum and livers of H-Cpr-null mice; 2) inhibition of farnesoid X receptor activation, which increased the mRNA of Cyp7a1 and 8b1; 3) induction of intestinal BA transporters to facilitate BA absorption from the intestine to the circulation; 4) induction of hepatic multidrug resistance-associated protein transporters to increase BA efflux from the liver to blood; and 5) increased generation of secondary BAs. In summary, the present study reveals an important contribution of the alternative BA synthesis pathway and BA transporters in regulating BA concentrations in H-Cpr-null mice. PMID:25034404

  11. Single-Cell Measurements of Enzyme Levels as a Predictive Tool for Cellular Fates during Organic Acid Production

    PubMed Central

    Zdraljevic, Stefan; Wagner, Drew; Cheng, Kevin; Ruohonen, Laura; Jäntti, Jussi; Penttilä, Merja; Resnekov, Orna

    2013-01-01

    Organic acids derived from engineered microbes can replace fossil-derived chemicals in many applications. Fungal hosts are preferred for organic acid production because they tolerate lignocellulosic hydrolysates and low pH, allowing economic production and recovery of the free acid. However, cell death caused by cytosolic acidification constrains productivity. Cytosolic acidification affects cells asynchronously, suggesting that there is an underlying cell-to-cell heterogeneity in acid productivity and/or in resistance to toxicity. We used fluorescence microscopy to investigate the relationship between enzyme concentration, cytosolic pH, and viability at the single-cell level in Saccharomyces cerevisiae engineered to synthesize xylonic acid. We found that cultures producing xylonic acid accumulate cells with cytosolic pH below 5 (referred to here as “acidified”). Using live-cell time courses, we found that the probability of acidification was related to the initial levels of xylose dehydrogenase and sharply increased from 0.2 to 0.8 with just a 60% increase in enzyme abundance (Hill coefficient, >6). This “switch-like” relationship likely results from an enzyme level threshold above which the produced acid overwhelms the cell's pH buffering capacity. Consistent with this hypothesis, we showed that expression of xylose dehydrogenase from a chromosomal locus yields ∼20 times fewer acidified cells and ∼2-fold more xylonic acid relative to expression of the enzyme from a plasmid with variable copy number. These results suggest that strategies that further reduce cell-to-cell heterogeneity in enzyme levels could result in additional gains in xylonic acid productivity. Our results demonstrate a generalizable approach that takes advantage of the cell-to-cell variation of a clonal population to uncover causal relationships in the toxicity of engineered pathways. PMID:24038690

  12. Single-cell measurements of enzyme levels as a predictive tool for cellular fates during organic acid production.

    PubMed

    Zdraljevic, Stefan; Wagner, Drew; Cheng, Kevin; Ruohonen, Laura; Jäntti, Jussi; Penttilä, Merja; Resnekov, Orna; Pesce, C Gustavo

    2013-12-01

    Organic acids derived from engineered microbes can replace fossil-derived chemicals in many applications. Fungal hosts are preferred for organic acid production because they tolerate lignocellulosic hydrolysates and low pH, allowing economic production and recovery of the free acid. However, cell death caused by cytosolic acidification constrains productivity. Cytosolic acidification affects cells asynchronously, suggesting that there is an underlying cell-to-cell heterogeneity in acid productivity and/or in resistance to toxicity. We used fluorescence microscopy to investigate the relationship between enzyme concentration, cytosolic pH, and viability at the single-cell level in Saccharomyces cerevisiae engineered to synthesize xylonic acid. We found that cultures producing xylonic acid accumulate cells with cytosolic pH below 5 (referred to here as "acidified"). Using live-cell time courses, we found that the probability of acidification was related to the initial levels of xylose dehydrogenase and sharply increased from 0.2 to 0.8 with just a 60% increase in enzyme abundance (Hill coefficient, >6). This "switch-like" relationship likely results from an enzyme level threshold above which the produced acid overwhelms the cell's pH buffering capacity. Consistent with this hypothesis, we showed that expression of xylose dehydrogenase from a chromosomal locus yields ∼20 times fewer acidified cells and ∼2-fold more xylonic acid relative to expression of the enzyme from a plasmid with variable copy number. These results suggest that strategies that further reduce cell-to-cell heterogeneity in enzyme levels could result in additional gains in xylonic acid productivity. Our results demonstrate a generalizable approach that takes advantage of the cell-to-cell variation of a clonal population to uncover causal relationships in the toxicity of engineered pathways. PMID:24038690

  13. Vanadate and selenium inhibit the triiodothyronine induced enzyme activity and mRNA level for both fatty acid synthase and malic enzyme

    SciTech Connect

    Zhu, Y.; Mirmiran, R.; Goodridge, A.G.; Stapleton, S.R. Western Michigan Univ., Kalamazoo )

    1991-03-15

    In chick-embryo hepatocytes in culture, triiodothyronine stimulates enzyme activity, mRNA level and transcription rate for both fatty acid synthase (FAS) and malic enzyme (ME). Insulin alone has no effect but amplifies the induction by T3. Recent evidence has demonstrated the insulin-mimicking action of vanadate and selenium on various physiological processes. Little information, however, is available on the affects of vanadate and selenium on the expression of genes that are regulated by insulin. These studies were initiated to test the potential of vanadate and selenium to mimic the amplification affect of insulin on the T3 induction of FAS and ME. In chick-embryo hepatocytes incubated in a chemically defined medium, addition of T3 for 48h causes an increase in the enzyme activity and mRNA level for both FAS and ME. Addition of sodium vanadate or sodium selenate (20 {mu}M) coincident with the T3 almost completely inhibited the stimulation of FAS and ME activity and accumulation of their respective mRNA's. Fifty percent maximal inhibition occurred at about 3-40{mu}M vanadate or 5-10{mu}M selenium. Vanadate and selenium similarity inhibited FAS and ME enzyme activity and mRNA level when the cells were incubated in the presence of insulin and T3. The effect of these metals was selective; isocitrate dehydrogenase activity as well as the level of glyceraldehyde 3-phosphate mRNA were not affected by any of the additions made to the cells in culture. This effect by vanadate and selenium also does not appear to be a generalized effect of metals on lipogenic enzymes as molydate under similar experimental conditions has no effect on either the enzyme activity or mRNA level of FAS or ME. Studies are continuing to determine the mechanism of action of these agents on the regulation of lipogenic enzymes.

  14. Xylonucleic acid: synthesis, structure, and orthogonal pairing properties

    PubMed Central

    Maiti, Mohitosh; Maiti, Munmun; Knies, Christine; Dumbre, Shrinivas; Lescrinier, Eveline; Rosemeyer, Helmut; Ceulemans, Arnout; Herdewijn, Piet

    2015-01-01

    There is a common interest for studying xeno-nucleic acid systems in the fields of synthetic biology and the origin of life, in particular, those with an engineered backbone and possessing novel properties. Along this line, we have investigated xylonucleic acid (XyloNA) containing a potentially prebiotic xylose sugar (a 3′-epimer of ribose) in its backbone. Herein, we report for the first time the synthesis of four XyloNA nucleotide building blocks and the assembly of XyloNA oligonucleotides containing all the natural nucleobases. A detailed investigation of pairing and structural properties of XyloNAs in comparison to DNA/RNA has been performed by thermal UV-melting, CD, and solution state NMR spectroscopic studies. XyloNA has been shown to be an orthogonal self-pairing system which adopts a slightly right-handed extended helical geometry. Our study on one hand, provides understanding for superior structure-function (-pairing) properties of DNA/RNA over XyloNA for selection as an informational polymer in the prebiotic context, while on the other hand, finds potential of XyloNA as an orthogonal genetic system for application in synthetic biology. PMID:26175047

  15. Synthesis, structural characterization and catalytic activity of a multifunctional enzyme mimetic oxoperoxovanadium(V) complex.

    PubMed

    Si, Tapan K; Paul, Shiv S; Drew, Michael G B; Mukherjea, Kalyan K

    2012-05-21

    The synthesis and structural characterization of a novel oxoperoxovanadium(V) complex [VO(O(2))(PAH)(phen)] containing the ligands 2-phenylacetohydroxamic acid (PAHH) and 1,10-phenanthroline (phen) has been accomplished. The oxoperoxovanadium(V) complex was found to mimic both vanadate-dependent haloperoxidase (VHPO) activity as well as nuclease activity through effective interaction with DNA. The complex is the first example of a structurally characterized stable oxoperoxovanadium(V) complex with a coordinated bi-dentate hydroximate moiety (-CONHO(-)) from 2-phenylacetohydroximate (PAH). The oxoperoxovanadium(V) complex has been used as catalyst for the peroxidative bromination reaction of some unsaturated alcohols (e.g. 4-pentene-1-ol, 1-octene-3-ol and 9-decene-1-ol) in the presence of H(2)O(2) and KBr. The catalytic products have been characterized by GC-MS analysis and spectrophotometric methods. The DNA binding of this complex has been established with CT DNA whereas the DNA cleavage was demonstrated with plasmid DNA. The interactions of the complex with DNA have been monitored by electronic absorption and fluorescence emission spectroscopy. Viscometric measurements suggest that the compound is a DNA intercalator. The nuclease activity of this complex was confirmed by gel electrophoresis studies. PMID:22441646

  16. An enzyme cascade synthesis of ε-caprolactone and its oligomers.

    PubMed

    Schmidt, Sandy; Scherkus, Christian; Muschiol, Jan; Menyes, Ulf; Winkler, Till; Hummel, Werner; Gröger, Harald; Liese, Andreas; Herz, Hans-Georg; Bornscheuer, Uwe T

    2015-02-23

    Poly-ε-caprolactone (PCL) is chemically produced on an industrial scale in spite of the need for hazardous peracetic acid as an oxidation reagent. Although Baeyer-Villiger monooxygenases (BVMO) in principle enable the enzymatic synthesis of ε-caprolactone (ε-CL) directly from cyclohexanone with molecular oxygen, current systems suffer from low productivity and are subject to substrate and product inhibition. The major limitations for such a biocatalytic route to produce this bulk chemical were overcome by combining an alcohol dehydrogenase with a BVMO to enable the efficient oxidation of cyclohexanol to ε-CL. Key to success was a subsequent direct ring-opening oligomerization of in situ formed ε-CL in the aqueous phase by using lipase A from Candida antarctica, thus efficiently solving the product inhibition problem and leading to the formation of oligo-ε-CL at more than 20 g L(-1) when starting from 200 mM cyclohexanol. This oligomer is easily chemically polymerized to PCL. PMID:25597635

  17. Design and synthesis of inhibitors incorporating beta -amino acids of metalloendopeptidase EC 3.4.24.15.

    PubMed

    Steer, D L; Lew, R A; Perlmutter, P; Smith, A I; Aguilar, M I

    2000-09-01

    Endopeptidase EC 3.4.24.15 (EP 24.15) is a thermolysin-like metalloendopeptidase which is expressed widely throughout the body, with the highest concentrations in the brain, pituitary and testis. While the precise role of EP 24.15 remains unknown, it is thought to participate in the regulated metabolism of a number of specific neuropeptides. Of the limited number of inhibitors described for EP 24.15, N-[1-(R,S)-carboxy-3-phenylpropyl]-Ala-Ala-Tyr-p-amino benzoate (CFP) is the most widely studied. CFP is a potent and specific inhibitor, but is unstable in vivo due to its cleavage between the alanine and tyrosine residues by the enzyme neprilysin (EP 24.11). The cpp-Ala-Ala N-terminal product of this cleavage is a potent inhibitor of angiotensin converting enzyme, which further limits the use of CFP in vivo. To generate specific inhibitors of EP 24.15 that are resistant to in vivo proteolysis by EP 24.11, beta-amino acids have been incorporated into the structure of CFP. We have prepared racemic mixtures of beta-amino acids containing proteogenic side chains, which are 9-fluorenylmethoxycarbonyl (Fmoc)-protected, and several analogues of CFP containing beta-amino acids have been synthesized by solid phase peptide synthesis. The results of stability and inhibitory studies of these new analogues show that the incorporation of beta-amino acids adjacent to the scissile bond can indeed stabilize the peptides against cleavage by EP 24.11 and still inhibit EP 24.15. The results obtained in these studies demonstrate the potential of these amino acids in the synthesis of peptidomimetics and in the design of new stable and specific therapeutics. PMID:11016884

  18. Structural Characterisation of FabG from Yersinia pestis, a Key Component of Bacterial Fatty Acid Synthesis.

    PubMed

    Nanson, Jeffrey D; Forwood, Jade K

    2015-01-01

    Ketoacyl-acyl carrier protein reductases (FabG) are ubiquitously expressed enzymes that catalyse the reduction of acyl carrier protein (ACP) linked thioesters within the bacterial type II fatty acid synthesis (FASII) pathway. The products of these enzymes, saturated and unsaturated fatty acids, are essential components of the bacterial cell envelope. The FASII reductase enoyl-ACP reductase (FabI) has been the focus of numerous drug discovery efforts, some of which have led to clinical trials, yet few studies have focused on FabG. Like FabI, FabG appears to be essential for survival in many bacteria, similarly indicating the potential of this enzyme as a drug target. FabG enzymes are members of the short-chain alcohol dehydrogenase/reductase (SDR) family, and like other SDRs, exhibit highly conserved secondary and tertiary structures, and contain a number of conserved sequence motifs. Here we describe the crystal structures of FabG from Yersinia pestis (YpFabG), the causative agent of bubonic, pneumonic, and septicaemic plague, and three human pandemics. Y. pestis remains endemic in many parts of North America, South America, Southeast Asia, and Africa, and a threat to human health. YpFabG shares a high degree of structural similarity with bacterial homologues, and the ketoreductase domain of the mammalian fatty acid synthase from both Homo sapiens and Sus scrofa. Structural characterisation of YpFabG, and comparison with other bacterial FabGs and the mammalian fatty acid synthase, provides a strong platform for virtual screening of potential inhibitors, rational drug design, and the development of new antimicrobial agents to combat Y. pestis infections. PMID:26539719

  19. The Hypothesis that the Genetic Code Originated in Coupled Synthesis of Proteins and the Evolutionary Predecessors of Nucleic Acids in Primitive Cells

    PubMed Central

    Francis, Brian R.

    2015-01-01

    Although analysis of the genetic code has allowed explanations for its evolution to be proposed, little evidence exists in biochemistry and molecular biology to offer an explanation for the origin of the genetic code. In particular, two features of biology make the origin of the genetic code difficult to understand. First, nucleic acids are highly complicated polymers requiring numerous enzymes for biosynthesis. Secondly, proteins have a simple backbone with a set of 20 different amino acid side chains synthesized by a highly complicated ribosomal process in which mRNA sequences are read in triplets. Apparently, both nucleic acid and protein syntheses have extensive evolutionary histories. Supporting these processes is a complex metabolism and at the hub of metabolism are the carboxylic acid cycles. This paper advances the hypothesis that the earliest predecessor of the nucleic acids was a β-linked polyester made from malic acid, a highly conserved metabolite in the carboxylic acid cycles. In the β-linked polyester, the side chains are carboxylic acid groups capable of forming interstrand double hydrogen bonds. Evolution of the nucleic acids involved changes to the backbone and side chain of poly(β-d-malic acid). Conversion of the side chain carboxylic acid into a carboxamide or a longer side chain bearing a carboxamide group, allowed information polymers to form amide pairs between polyester chains. Aminoacylation of the hydroxyl groups of malic acid and its derivatives with simple amino acids such as glycine and alanine allowed coupling of polyester synthesis and protein synthesis. Use of polypeptides containing glycine and l-alanine for activation of two different monomers with either glycine or l-alanine allowed simple coded autocatalytic synthesis of polyesters and polypeptides and established the first genetic code. A primitive cell capable of supporting electron transport, thioester synthesis, reduction reactions, and synthesis of polyesters and

  20. The Hypothesis that the Genetic Code Originated in Coupled Synthesis of Proteins and the Evolutionary Predecessors of Nucleic Acids in Primitive Cells.

    PubMed

    Francis, Brian R

    2015-01-01

    Although analysis of the genetic code has allowed explanations for its evolution to be proposed, little evidence exists in biochemistry and molecular biology to offer an explanation for the origin of the genetic code. In particular, two features of biology make the origin of the genetic code difficult to understand. First, nucleic acids are highly complicated polymers requiring numerous enzymes for biosynthesis. Secondly, proteins have a simple backbone with a set of 20 different amino acid side chains synthesized by a highly complicated ribosomal process in which mRNA sequences are read in triplets. Apparently, both nucleic acid and protein syntheses have extensive evolutionary histories. Supporting these processes is a complex metabolism and at the hub of metabolism are the carboxylic acid cycles. This paper advances the hypothesis that the earliest predecessor of the nucleic acids was a β-linked polyester made from malic acid, a highly conserved metabolite in the carboxylic acid cycles. In the β-linked polyester, the side chains are carboxylic acid groups capable of forming interstrand double hydrogen bonds. Evolution of the nucleic acids involved changes to the backbone and side chain of poly(β-d-malic acid). Conversion of the side chain carboxylic acid into a carboxamide or a longer side chain bearing a carboxamide group, allowed information polymers to form amide pairs between polyester chains. Aminoacylation of the hydroxyl groups of malic acid and its derivatives with simple amino acids such as glycine and alanine allowed coupling of polyester synthesis and protein synthesis. Use of polypeptides containing glycine and l-alanine for activation of two different monomers with either glycine or l-alanine allowed simple coded autocatalytic synthesis of polyesters and polypeptides and established the first genetic code. A primitive cell capable of supporting electron transport, thioester synthesis, reduction reactions, and synthesis of polyesters and

  1. Biodiesel synthesis via esterification of feedstock with high content of free fatty acids.

    PubMed

    Souza, Marcella S; Aguieiras, Erika C G; da Silva, Mônica A P; Langone, Marta A P

    2009-05-01

    The objective of this work was to study the synthesis of ethyl esters via esterification of soybean oil deodorizer distillate with ethanol, using solid acid catalysts and commercial immobilized lipases, in a solvent-free system. Three commercially immobilized lipases were used, namely, Lipozyme RM-IM, Lipozyme TL-IM, and Novozym 435, all from Novozymes. We aimed for optimum reaction parameters: temperature, enzyme concentration, initial amount of ethanol, and its feeding technique to the reactor (stepwise ethanolysis). Reaction was faster with Novozym 435. The highest conversion (83.5%) was obtained after 90 min using 3 wt.% of Novozym 435 and two-stage stepwise addition of ethanol at 50 degrees C. Four catalysts were also tested: zeolite CBV-780, SAPO-34, niobia, and niobic acid. The highest conversion (30%) was obtained at 100 degrees C, with 3 wt.% of CBV-780 after 2.5 h. The effects of zeolite CBV 780 concentration were studied, resulting in a conversion of 49% using 9 wt.% of catalyst. PMID:19067243

  2. Fatty acid carbon is essential for dNTP synthesis in endothelial cells

    PubMed Central

    Missiaen, Rindert; Queiroz, Karla CS; Borgers, Gitte; Elia, Ilaria; Zecchin, Annalisa; Cantelmo, Anna Rita; Christen, Stefan; Goveia, Jermaine; Heggermont, Ward; Goddé, Lucica; Vinckier, Stefan; Van Veldhoven, Paul P.; Eelen, Guy; Schoonjans, Luc; Gerhardt, Holger; Dewerchin, Mieke; Baes, Myriam; De Bock, Katrien; Ghesquière, Bart; Lunt, Sophia Y.; Fendt, Sarah-Maria; Carmeliet, Peter

    2015-01-01

    The metabolism of endothelial cells (ECs) during vessel sprouting remains poorly studied. Here, we report that endothelial loss of CPT1a, a rate-limiting enzyme of fatty acid oxidation (FAO), caused vascular sprouting defects due to impaired proliferation, not migration of ECs. Reduction of FAO in ECs did not cause energy depletion or disturb redox homeostasis, but impaired de novo nucleotide synthesis for DNA replication. Isotope labeling studies in control ECs showed that fatty acid carbons substantially replenished the Krebs cycle, and were incorporated into aspartate (a nucleotide precursor), uridine monophosphate (a precursor of pyrimidine nucleoside triphosphates) and DNA. CPT1a silencing reduced these processes and depleted EC stores of aspartate and deoxyribonucleoside triphosphates. Acetate (metabolized to acetyl-CoA, thereby substituting for the depleted FAO-derived acetyl-CoA) or a nucleoside mix rescued the phenotype of CPT1a-silenced ECs. Finally, CPT1 blockade inhibited pathological ocular angiogenesis, suggesting a novel strategy for blocking angiogenesis. PMID:25830893

  3. Functional analysis of a tomato salicylic acid methyl transferase and its role in synthesis of the flavor volatile methyl salicylate.

    PubMed

    Tieman, Denise; Zeigler, Michelle; Schmelz, Eric; Taylor, Mark G; Rushing, Sarah; Jones, Jeffrey B; Klee, Harry J

    2010-04-01

    Methyl salicylate (MeSA) is a volatile plant secondary metabolite that is an important contributor to taste and scent of many fruits and flowers. It is synthesized from salicylic acid (SA), a phytohormone that contributes to plant pathogen defense. MeSA is synthesized by members of a family of O-methyltransferases. In order to elaborate the mechanism of MeSA synthesis in tomato, we screened a set of O-methyltransferases for activity against multiple substrates. An enzyme that specifically catalyzes methylation of SA, SlSAMT, as well as enzymes that act upon jasmonic acid and indole-3-acetic acid were identified. Analyses of transgenic over- and under-producing lines validated the function of SlSAMT in vivo. The SlSAMT gene was mapped to a position near the bottom of chromosome 9. Analysis of MeSA emissions from an introgression population derived from a cross with Solanum pennellii revealed a quantitative trait locus (QTL) linked to higher fruit methyl salicylate emissions. The higher MeSA emissions associate with significantly higher SpSAMT expression, consistent with SAMT gene expression being rate limiting for ripening-associated MeSA emissions. Transgenic plants that constitutively over-produce MeSA exhibited only slightly delayed symptom development following infection with the disease-causing bacterial pathogen, Xanthomonas campestris pv. vesicatoria (Xcv). Unexpectedly, pathogen-challenged leaves accumulated significantly higher levels of SA as well as glycosylated forms of SA and MeSA, indicating a disruption in control of the SA-related metabolite pool. Taken together, the results indicate that SlSAMT is critical for methyl salicylate synthesis and methyl salicylate, in turn, likely has an important role in controlling SA synthesis. PMID:20070566

  4. CML10, a variant of calmodulin, modulates ascorbic acid synthesis.

    PubMed

    Cho, Kwang-Moon; Nguyen, Ha Thi Kim; Kim, Soo Youn; Shin, Jin Seok; Cho, Dong Hwa; Hong, Seung Beom; Shin, Jeong Sheop; Ok, Sung Han

    2016-01-01

    Calmodulins (CaMs) regulate numerous Ca(2+) -mediated cellular processes in plants by interacting with their respective downstream effectors. Due to the limited number of CaMs, other calcium sensors modulate the regulation of Ca(2+) -mediated cellular processes that are not managed by CaMs. Of 50 CaM-like (CML) proteins identified in Arabidopsis thaliana, we characterized the function of CML10. Yeast two-hybrid screening revealed phosphomannomutase (PMM) as a putative interaction partner of CML10. In vitro and in vivo interaction assays were performed to analyze the interaction mechanisms of CML10 and PMM. PMM activity and the phenotypes of cml10 knock-down mutants were studied to elucidate the role(s) of the CML10-PMM interaction. PMM interacted specifically with CML10 in the presence of Ca(2+) through its multiple interaction motifs. This interaction promoted the activity of PMM. The phenotypes of cml10 knock-down mutants were more sensitive to stress conditions than wild-type plants, corresponding with the fact that PMM is an enzyme which modulates the biosynthesis of ascorbic acid, an antioxidant. The results of this research demonstrate that a calcium sensor, CML10, which is an evolutionary variant of CaM, modulates the stress responses in Arabidopsis by regulating ascorbic acid production. PMID:26315131

  5. Active-site amino acid residues in γ-glutamyltransferase and the nature of the γ-glutamyl-enzyme bond

    PubMed Central

    Elce, John S.

    1980-01-01

    Active-site residues in rat kidney γ-glutamyltransferase (EC 2.3.2.2) were investigated by means of chemical modification. 1. In the presence of maleate, the activity was inhibited by phenylmethanesulphonyl fluoride, and the inhibition was not reversed by β-mercaptoethanol, suggesting that a serine residue is close to the active site, but is shielded except in the presence of maleate. 2. Treatment of the enzyme with N-acetylimidazole modified an amino group, exposed a previously inaccessible cysteine residue and inhibited hydrolysis of the γ-glutamyl-enzyme intermediate, but not its formation. 3. After reaction of the enzyme successively with N-acetylimidazole and with non-radioactive iodoacetamide/serine/borate, two active-site residues reacted with iodo[14C]acetamide. One of these possessed a carboxy group, which formed a [14C]glycollamide ester, and the other was cysteine, shown by isolation of S-[14C]carboxymethylcysteine after acid hydrolysis. When N-acetylimidazole treatment was omitted, only the carboxy group reacted with iodo[14C]acetamide. 4. Isolation of the γ-[14C]glutamyl-enzyme intermediate was made easier by prior treatment of the enzyme with N-acetylimidazole. The γ-glutamyl-enzyme bond was stable to performic acid, and to hydroxylamine/urea at pH10, but was hydrolysed slowly at pH12, indicating attachment of the γ-[14C]glutamyl group in amide linkage to an amino group on the enzyme. Proteolysis of the γ-[14C]glutamyl-enzyme after performic acid oxidation gave rise to a small acidic radioactive peptide that was resistant to further proteolysis and was not identical with γ-glutamyl-ε-lysine. 5. A scheme for the catalytic mechanism is proposed. PMID:6104953

  6. Aptamer- and nucleic acid enzyme-based systems for simultaneous detection of multiple analytes

    DOEpatents

    Lu, Yi; Liu, Juewen

    2011-11-15

    The present invention provides aptamer- and nucleic acid enzyme-based systems for simultaneously determining the presence and optionally the concentration of multiple analytes in a sample. Methods of utilizing the system and kits that include the sensor components are also provided. The system includes a first reactive polynucleotide that reacts to a first analyte; a second reactive polynucleotide that reacts to a second analyte; a third polynucleotide; a fourth polynucleotide; a first particle, coupled to the third polynucleotide; a second particle, coupled to the fourth polynucleotide; and at least one quencher, for quenching emissions of the first and second quantum dots, coupled to the first and second reactive polynucleotides. The first particle includes a quantum dot having a first emission wavelength. The second particle includes a second quantum dot having a second emission wavelength different from the first emission wavelength. The third polynucleotide and the fourth polynucleotide are different.

  7. Lysosomal Acid Phosphatase Biosynthesis and Dysfunction: A Mini Review Focused on Lysosomal Enzyme Dysfunction in Brain.

    PubMed

    Ashtari, N; Jiao, X; Rahimi-Balaei, M; Amiri, S; Mehr, S E; Yeganeh, B; Marzban, H

    2016-01-01

    Lysosomes are membrane-bound organelles that are responsible for degrading and recycling macromolecules. Lysosomal dysfunction occurs in enzymatic and non-enzymatic deficiencies, which result in abnormal accumulation of materials. Although lysosomal storage disorders affect different organs, the central nervous system is the most vulnerable. Evidence shows the role of lysosomal dysfunction in different neurodegenerative diseases, such as Niemann-Pick Type C disease, juvenile neuronal ceroid lipofuscinosis, Alzheimer's disease and Parkinson's disease. Lysosomal enzymes such as lysosomal acid phosphatase 2 (Acp2) play a critical role in mannose-6-phosphate removal and Acp2 controls molecular and cellular functions in the brain during development and adulthood. Acp2 is essential in cerebellar development, and mutations in this gene cause severe cerebellar neurodevelopmental and neurodegenerative disorders. In this mini-review, we highlight lysosomal dysfunctions in the pathogenesis of neurodevelopmental and/or neurodegenerative diseases with special attention to Acp2 dysfunction. PMID:27132795

  8. The role of CYP26 enzymes in defining appropriate retinoic acid exposure during embryogenesis.

    PubMed

    Pennimpede, Tracie; Cameron, Don A; MacLean, Glenn A; Li, Hui; Abu-Abed, Suzan; Petkovich, Martin

    2010-10-01

    Retinoic acid (RA) is a pleiotropic derivative of vitamin A, or retinol, which is responsible for all of the bioactivity associated with this vitamin. The teratogenic influences of vitamin A deficiency and excess RA in rodents were first observed more than 50 years ago. Efforts over the last 15-20 years have refined these observations by defining the molecular mechanisms that control RA availability and signaling during murine embryonic development. This review will discuss our current understanding of the role of RA in teratogenesis, with specific emphasis on the essential function of the RA catabolic CYP26 enzymes in preventing teratogenic consequences caused by uncontrolled distribution of RA. Particular focus will be paid to the RA-sensitive tissues of the caudal and cranial regions, the limb, and the testis, and how genetic mutation of factors controlling RA distribution have revealed important roles for RA during embryogenesis. PMID:20842651

  9. Physical interactions between tricarboxylic acid cycle enzymes in Bacillus subtilis: evidence for a metabolon.

    PubMed

    Meyer, Frederik M; Gerwig, Jan; Hammer, Elke; Herzberg, Christina; Commichau, Fabian M; Völker, Uwe; Stülke, Jörg

    2011-01-01

    The majority of all proteins of a living cell is active in complexes rather than in an isolated way. These protein-protein interactions are of high relevance for many biological functions. In addition to many well established protein complexes an increasing number of protein-protein interactions, which form rather transient complexes has recently been discovered. The formation of such complexes seems to be a common feature especially for metabolic pathways. In the Gram-positive model organism Bacillus subtilis, we identified a protein complex of three citric acid cycle enzymes. This complex consists of the citrate synthase, the isocitrate dehydrogenase, and the malate dehydrogenase. Moreover, fumarase and aconitase interact with malate dehydrogenase and with each other. These five enzymes catalyze sequential reaction of the TCA cycle. Thus, this interaction might be important for a direct transfer of intermediates of the TCA cycle and thus for elevated metabolic fluxes via substrate channeling. In addition, we discovered a link between the TCA cycle and gluconeogenesis through a flexible interaction of two proteins: the association between the malate dehydrogenase and phosphoenolpyruvate carboxykinase is directly controlled by the metabolic flux. The phosphoenolpyruvate carboxykinase links the TCA cycle with gluconeogenesis and is essential for B. subtilis growing on gluconeogenic carbon sources. Only under gluconeogenic growth conditions an interaction of these two proteins is detectable and disappears under glycolytic growth conditions. PMID:20933603

  10. Enzyme-free detection and quantification of double-stranded nucleic acids.

    PubMed

    Feuillie, Cécile; Merheb, Maxime Mohamad; Gillet, Benjamin; Montagnac, Gilles; Hänni, Catherine; Daniel, Isabelle

    2012-08-01

    We have developed a fully enzyme-free SERRS hybridization assay for specific detection of double-stranded DNA sequences. Although all DNA detection methods ranging from PCR to high-throughput sequencing rely on enzymes, this method is unique for being totally non-enzymatic. The efficiency of enzymatic processes is affected by alterations, modifications, and/or quality of DNA. For instance, a limitation of most DNA polymerases is their inability to process DNA damaged by blocking lesions. As a result, enzymatic amplification and sequencing of degraded DNA often fail. In this study we succeeded in detecting and quantifying, within a mixture, relative amounts of closely related double-stranded DNA sequences from Rupicapra rupicapra (chamois) and Capra hircus (goat). The non-enzymatic SERRS assay presented here is the corner stone of a promising approach to overcome the failure of DNA polymerase when DNA is too degraded or when the concentration of polymerase inhibitors is too high. It is the first time double-stranded DNA has been detected with a truly non-enzymatic SERRS-based method. This non-enzymatic, inexpensive, rapid assay is therefore a breakthrough in nucleic acid detection. PMID:22695500

  11. Boronic Acid-Appended Molecular Glues for ATP-Responsive Activity Modulation of Enzymes.

    PubMed

    Okuro, Kou; Sasaki, Mizuki; Aida, Takuzo

    2016-05-01

    Water-soluble linear polymers GumBAn (m/n = 18/6, 12/12, and 6/18) with multiple guanidinium ion (Gu(+)) and boronic acid (BA) pendants in their side chains were synthesized as ATP-responsive modulators for enzyme activity. GumBAn polymers strongly bind to the phosphate ion (PO4(-)) and 1,2-diol units of ATP via the Gu(+) and BA pendants, respectively. As only the Gu(+) pendants can be used for proteins, GumBAn is able to modulate the activity of enzymes in response to ATP. As a proof-of-concept study, we demonstrated that trypsin (Trp) can be deactivated by hybridization with GumBAn. However, upon addition of ATP, Trp was liberated to retrieve its hydrolytic activity due to a higher preference of GumBAn toward ATP than Trp. This event occurred in a much lower range of [ATP] than reported examples. Under cellular conditions, the hydrolytic activity of Trp was likewise modulated. PMID:27087468

  12. A new role for an old enzyme: Nitrate reductase-mediated nitric oxide generation is required for abscisic acid-induced stomatal closure in Arabidopsis thaliana

    PubMed Central

    Desikan, Radhika; Griffiths, Rachael; Hancock, John; Neill, Steven

    2002-01-01

    The plant hormone abscisic acid (ABA), synthesized in response to water-deficit stress, induces stomatal closure via activation of complex signaling cascades. Recent work has established that nitric oxide (NO) is a key signaling molecule mediating ABA-induced stomatal closure. However, the biosynthetic origin of NO in guard cells has not yet been resolved. Here, we provide pharmacological, physiological, and genetic evidence that NO synthesis in Arabidopsis guard cells is mediated by the enzyme nitrate reductase (NR). Guard cells of wild-type Arabidopsis generate NO in response to treatment with ABA and nitrite, a substrate for NR. Moreover, NR-mediated NO synthesis is required for ABA-induced stomatal closure. However, in the NR double mutant, nia1, nia2 that has diminished NR activity, guard cells do not synthesize NO nor do the stomata close in response to ABA or nitrite, although stomatal opening is still inhibited by ABA. Furthermore, by using the ABA-insensitive (ABI) abi1–1 and abi2–1 mutants, we show that the ABI1 and ABI2 protein phosphatases are downstream of NO in the ABA signal-transduction cascade. These data demonstrate a previously uncharacterized signaling role for NR, that of mediating ABA-induced NO synthesis in Arabidopsis guard cells. PMID:12446847

  13. Enzyme-catalysed synthesis and reactions of benzene oxide/oxepine derivatives of methyl benzoates.

    PubMed

    Boyd, Derek R; Sharma, Narain D; Harrison, John S; Malone, John F; McRoberts, W Colin; Hamilton, John T G; Harper, David B

    2008-04-01

    A series of twelve benzoate esters was metabolised, by species of the Phellinus genus of wood-rotting fungi, to yield the corresponding benzyl alcohol derivatives and eight salicylates. The isolation of a stable oxepine metabolite, from methyl benzoate, allied to evidence of the migration and retention of a carbomethoxy group (the NIH Shift), during enzyme-catalysed ortho-hydroxylation of alkyl benzoates to form salicylates, is consistent with a mechanism involving an initial arene epoxidation step. This mechanism was confirmed by the isolation of a remarkably stable, optically active, substituted benzene oxide metabolite of methyl 2-(trifluoromethyl)benzoate, which slowly converted into the racemic form. The arene oxide was found to undergo a cycloaddition reaction with 4-phenyl-1,2,4-triazoline-3,5-dione to yield a crystalline cycloadduct whose structure and racemic nature was established by X-ray crystallography. The metabolite was also found to undergo some novel benzene oxide reactions, including epoxidation to give an anti-diepoxide, base-catalysed hydrolysis to form a trans-dihydrodiol and acid-catalysed aromatisation to yield a salicylate derivative via the NIH Shift of a carbomethoxy group. PMID:18362966

  14. Structure and Evolution of the Archaeal Lipid Synthesis Enzyme sn-Glycerol-1-phosphate Dehydrogenase*

    PubMed Central

    Carbone, Vincenzo; Schofield, Linley R.; Zhang, Yanli; Sang, Carrie; Dey, Debjit; Hannus, Ingegerd M.; Martin, William F.; Sutherland-Smith, Andrew J.; Ronimus, Ron S.

    2015-01-01

    One of the most critical events in the origins of cellular life was the development of lipid membranes. Archaea use isoprenoid chains linked via ether bonds to sn-glycerol 1-phosphate (G1P), whereas bacteria and eukaryotes use fatty acids attached via ester bonds to enantiomeric sn-glycerol 3-phosphate. NAD(P)H-dependent G1P dehydrogenase (G1PDH) forms G1P and has been proposed to have played a crucial role in the speciation of the Archaea. We present here, to our knowledge, the first structures of archaeal G1PDH from the hyperthermophilic methanogen Methanocaldococcus jannaschii with bound substrate dihydroxyacetone phosphate, product G1P, NADPH, and Zn2+ cofactor. We also biochemically characterized the enzyme with respect to pH optimum, cation specificity, and kinetic parameters for dihydroxyacetone phosphate and NAD(P)H. The structures provide key evidence for the reaction mechanism in the stereospecific addition for the NAD(P)H-based pro-R hydrogen transfer and the coordination of the Zn2+ cofactor during catalysis. Structure-based phylogenetic analyses also provide insight into the origins of G1PDH. PMID:26175150

  15. Effect of inhibitors of arachidonic acid metabolism on efflux of intracellular enzymes from skeletal muscle following experimental damage.

    PubMed Central

    Jackson, M J; Wagenmakers, A J; Edwards, R H

    1987-01-01

    The role of arachidonic acid metabolism in the efflux of intracellular enzymes from damaged skeletal muscle has been examined in vitro using inhibitors of cyclo-oxygenase and lipoxygenase enzymes. Damage to skeletal muscle induced by either calcium ionophore A23187 (25 microM) or dinitrophenol (1 mM) caused an increase in the efflux of prostaglandins E2 and F2 alpha together with a large efflux of intracellular creatine kinase. Use of a cyclo-oxygenase inhibitor completely prevented the efflux of prostaglandins, but had no effect on creatine kinase efflux. However, several agents having the ability to inhibit lipoxygenase enzymes dramatically reduced creatine kinase efflux following damage. These data suggest that a product or products of lipoxygenase enzymes may be mediators of the changes in plasma membrane integrity which permit efflux of intracellular enzymes as a consequence of skeletal muscle damage. PMID:3109374

  16. [Effect of trace metals on cell morphology, enzyme activation, and production of citric acid in a strain of Aspergillus wentii].

    PubMed

    Majolli, M V; Aguirre, S N

    1999-01-01

    Data concerning the effect of very low concentrations of metals on citric acid production by microorganisms, as well as on the activity of enzymes presumptively involved in the process, are confuse. The bulk of information was obtained mainly studying selected strains of Aspergillus niger. Information concerning other citric acid producer filamentous fungi, such as A. wentii, is scanty. In the present article we report the effect of different cations on the growth pattern of A. wentii P1 as well as on the related citric acid production and the activity of several enzymes. It was found that without any addition to the culture medium the fungus developed a pelleted form of growth, pellets being about 1.5 mm in diameter. The citric acid yield was about 90%. The addition of Cu2+ impaired the sugar uptake, as well as the production of citric acid and biomass. The uptake of sugar increased in the presence of Zn2+, and there was a marked increase of the biomass production, which could account for the low citric acid production. The addition of Fe2+ impaired the citric acid production and, as sulfate, the sugar uptake. The presence of Fe3+ markedly impaired the citric acid production and increased the sugar uptake. There is no agreement about the enzymes involved in the accumulation of citric acid by microorganisms. In spite of this, aconitase (Ac), isocitrate lyase (IL), isocitrate dehydrogenase NAD(+)-dependent (ICDH- NAD+) and isocitrate dehydrogenase NADP(+)-dependent (ICDH-NADP+) are often postulated as key enzymes. In our case, these enzymes were active during the standard fermentation, although with variations, particularly concerning Ac and IL. The behavior of enzymes might be different when tested in vivo or in vitro, mainly from the quantitative point of view. Nevertheless, the activity determined in vitro might give some indication concerning the effect on fermentation of substances present in the medium. It was found that all the enzymes tested increased their

  17. Inulin and levan synthesis by probiotic Lactobacillus gasseri strains: characterization of three novel fructansucrase enzymes and their fructan products.

    PubMed

    Anwar, Munir A; Kralj, Slavko; Piqué, Anna Villar; Leemhuis, Hans; van der Maarel, Marc J E C; Dijkhuizen, Lubbert

    2010-04-01

    Fructansucrase enzymes polymerize the fructose moiety of sucrose into levan or inulin fructans, with beta(2-6) and beta(2-1) linkages, respectively. Here, we report an evaluation of fructan synthesis in three Lactobacillus gasseri strains, identification of the fructansucrase-encoding genes and characterization of the recombinant proteins and fructan (oligosaccharide) products. High-performance anion-exchange chromatography and nuclear magnetic resonance analysis of the fructo-oligosaccharides (FOS) and polymers produced by the L. gasseri strains and the recombinant enzymes revealed that, in situ, L. gasseri strains DSM 20604 and 20077 synthesize inulin (and oligosaccharides) and levan products, respectively. L. gasseri DSM 20604 is only the second Lactobacillus strain shown to produce inulin polymer and FOS in situ, and is unique in its distribution of FOS synthesized, ranging from DP2 to DP13. The probiotic bacterium L. gasseri DSM 20243 did not produce any fructan, although we identified a fructansucrase-encoding gene in its genome sequence. Further studies showed that this L. gasseri DSM 20243 gene was prematurely terminated by a stop codon. Exchanging the stop codon for a glutamine codon resulted in a recombinant enzyme producing inulin and FOS. The three recombinant fructansucrase enzymes characterized from three different L. gasseri strains have very similar primary protein structures, yet synthesize different fructan products. An interesting feature of the L. gasseri strains is that they were unable to ferment raffinose, whereas their respective recombinant enzymes converted raffinose into fructan and FOS. PMID:20075040

  18. Preparation of crosslinked enzyme aggregates (CLEAs) of acid urease with urethanase activity and their application.

    PubMed

    Zhang, Qian; Zha, Xiaohong; Zhou, Nandi; Tian, Yaping

    2016-04-01

    An acid urease from Providencia rettgeri JN-B815 was purified via ultrasonication, ethanol precipitation, and DEAE ion-exchange column chromatography. It was found that the enzyme exhibits not only urease activity, but also urethanase activity, which made it possible to reduce EC already existed or would produce and its precursor urea at the same time. Then, crosslinked enzyme aggregates of P. rettgeri urease (PRU-CLEAs) were prepared using genipin as crosslinking agent. The purification process of acid urease, the effects of genipin concentration, and crosslinking time on PRU-CLEAs activity were investigated. The crosslinking was performed at pH 4.5 for 2.5 h, using 0.3% genipin as crosslinking agent, and 0.3 g · L(-1) bovine serum albumin as protein feeder. Using the obtained PRU-CLEAs, the removal rate of urea was up to 9.31 mg · L(-1) · h(-1). The removal rate of urea was still up to 7.56 mg · L(-1) · h(-1) after PRU-CLEAs was re-used for 6 times. When PRU-CLEAs were applied in a batch stirred and membrane reactor, the removal rate of urea in rice wine reached 5.16 mg · L(-1) · h(-1) and the removal rate of EC was 9.21 μg · L(-1) · h(-1). Furthermore, the treatment with PRU-CLEAs revealed no significant change of volatile flavor substances in Chinese rice wine. Thus PRU-CLEAs have great potential in the elimination of EC in Chinese rice wine. PMID:26627914

  19. Production of succinic acid through overexpression of NAD(+)-dependent malic enzyme in an Escherichia coli mutant.

    PubMed Central

    Stols, L; Donnelly, M I

    1997-01-01

    NAD(+)-dependent malic enzyme was cloned from the Escherichia coli genome by PCR based on the published partial sequence of the gene. The enzyme was overexpressed and purified to near homogeneity in two chromatographic steps and was analyzed kinetically in the forward and reverse directions. The Km values determined in the presence of saturating cofactor and manganese ion were 0.26 mM for malate (physiological direction) and 16 mM for pyruvate (reverse direction). When malic enzyme was induced under appropriate culture conditions in a strain of E. coli that was unable to ferment glucose and accumulated pyruvate, fermentative metabolism of glucose was restored. Succinic acid was the major fermentation product formed. When this fermentation was performed in the presence of hydrogen, the yield of succinic acid increased. The constructed pathway represents an alternative metabolic route for the fermentative production of dicarboxylic acids from renewable feedstocks. PMID:9212416

  20. Use of aqueous two-phase systems for in situ extraction of water soluble antibiotics during their synthesis by enzymes immobilized on porous supports.

    PubMed

    Hernandez-Justiz, O; Fernandez-Lafuente, R; Terreni, M; Guisan, J M

    1998-07-01

    Yields of kinetically controlled synthesis of antibiotics catalyzed by penicillin G acylase from Escherichia coli (PGA) have been greatly increased by continuous extraction of water soluble products (cephalexin) away from the surroundings of the enzyme. In this way its very rapid enzymatic hydrolysis has been avoided. Enzymes covalently immobilized inside porous supports acting in aqueous two-phase systems have been used to achieve such improvements of synthetic yields. Before the reaction is started, the porous structure of the biocatalyst can be washed and filled with one selected phase. In this way, when the pre-equilibrated biocatalyst is mixed with the second phase (where the reaction product will be extracted), the immobilized enzyme remains in the first selected phase in spite of its possibly different natural trend. Partition coefficients (K) of cephalexin in very different aqueous two-phase systems were firstly evaluated. High K values were obtained under drastic conditions. The best K value for cephalexin (23) was found in 100% PEG 600-3 M ammonium sulfate where cephalexin was extracted to the PEG phase. Pre-incubation of immobilized PGA derivatives in ammonium sulfate and further suspension with 100% PEG 600 allowed us to obtain a 90% synthetic yield of cephalexin from 150 mM phenylglycine methyl ester and 100 mM 7-amino desacetoxicephalosporanic acid (7-ADCA). In this reaction system, the immobilized enzyme remains in the ammonium sulfate phase and hydrolysis of the antibiotic becomes suppressed because of its continuous extraction to the PEG phase. On the contrary, synthetic yields of a similar process carried out in monophasic systems were much lower (55%) because of a rapid enzymatic hydrolysis of cephalexin. PMID:10099316

  1. Enzyme-linked immunosorbent assay (ELISA) for the anthropogenic marker isolithocholic acid in water.

    PubMed

    Baldofski, Stefanie; Hoffmann, Holger; Lehmann, Andreas; Breitfeld, Stefan; Garbe, Leif-Alexander; Schneider, Rudolf J

    2016-11-01

    Bile acids are promising chemical markers to assess the pollution of water samples with fecal material. This study describes the optimization and validation of a direct competitive enzyme-linked immunosorbent assay for the bile acid isolithocholic acid (ILA). The quantification range of the optimized assay was between 0.09 and 15 μg/L. The assay was applied to environmental water samples. Most studies until now were focused on bile acid fractions in the particulate phase of water samples. In order to avoid tedious sample preparation, we undertook to evaluate the dynamics and significance of ILA levels in the aqueous phase. Very low concentrations in tap and surface water samples made a pre-concentration step necessary for this matrix as well as for wastewater treatment plant (WWTP) effluent. Mean recoveries for spiked water samples were between 97% and 109% for tap water and WWTP influent samples and between 102% and 136% for WWTP effluent samples. 90th percentiles of intra-plate and inter-plate coefficients of variation were below 10% for influents and below 20% for effluents and surface water. ILA concentrations were quantified in the range of 33-72 μg/L in influent, 21-49 ng/L in effluent and 18-48 ng/L in surface water samples. During wastewater treatment the ILA levels were reduced by more than 99%. ILA concentrations of influents determined by ELISA and LC-MS/MS were in good agreement. However, findings in LC-ELISA experiments suggest that the true ILA levels in concentrated samples are lower due to interfering effects of matrix compounds and/or cross-reactants. Yet, the ELISA will be a valuable tool for the performance check and comparison of WWTPs and the localization of fecal matter input into surface waters. PMID:27544648

  2. Production of organic acids by periplasmic enzymes present in free and immobilized cells of Zymomonas mobilis.

    PubMed

    Malvessi, Eloane; Carra, Sabrina; Pasquali, Flávia Cristina; Kern, Denise Bizarro; da Silveira, Mauricio Moura; Ayub, Marco Antônio Záchia

    2013-01-01

    In this work the periplasmic enzymatic complex glucose-fructose oxidoreductase (GFOR)/glucono-δ-lactonase (GL) of permeabilized free or immobilized cells of Zymomonas mobilis was evaluated for the bioconversion of mixtures of fructose and different aldoses into organic acids. For all tested pairs of substrates with permeabilized free-cells, the best enzymatic activities were obtained in reactions with pH around 6.4 and temperatures ranging from 39 to 45 °C. Decreasing enzyme/substrate affinities were observed when fructose was in the mixture with glucose, maltose, galactose, and lactose, in this order. In bioconversion runs with 0.7 mol l(-1) of fructose and with aldose, with permeabilized free-cells of Z. mobilis, maximal concentrations of the respective aldonic acids of 0.64, 0.57, 0.51, and 0.51 mol l(-1) were achieved, with conversion yields of 95, 88, 78, and 78 %, respectively. Due to the important applications of lactobionic acid, the formation of this substance by the enzymatic GFOR/GL complex in Ca-alginate-immobilized cells was assessed. The highest GFOR/GL activities were found at pH 7.0-8.0 and temperatures of 47-50 °C. However, when a 24 h bioconversion run was carried out, it was observed that a combination of pH 6.4 and temperature of 47 °C led to the best results. In this case, despite the fact that Ca-alginate acts as a barrier for the diffusion of substrates and products, maximal lactobionic acid concentration, conversion yields and specific productivity similar to those obtained with permeabilized free-cells were achieved. PMID:23053345

  3. Synthesis of novel acid electrolytes for phosphoric acid fuel cells. Final report, May 1985-October 1988

    SciTech Connect

    Adcock, J.L.

    1988-11-01

    Construction of a 40-millimole-per-hour-scale aerosol direct-fluorination reactor was completed June 26, 1986. F-Methyl F-4-methoxybutanoate and F-4-methoxybutanoyl fluoride were synthesized by aerosol direct fluorination of methyl 4-methoxybutanoate. Basic hydrolysis of the perfluorinated derivatives produce sodium F-4-methoxybutanoate which was pyrolyzed to F-3-methoxy-1-propene. Purification and shipment of 33 grams of F-3-methoxy-1-propene followed. Syntheses by analogous methods allowed production and shipment of 5 grams of F-3-ethoxy-1-propene, 18 grams of F-3-(2-methoxy.ethoxy)-1-propene, and 37 grams of F-3,3-dimethyl-1-butene. Eighteen grams of F-2,2-dimethyl-1-chloropropane was produced directly and shipped. As suggested by other contractors, 5 grams of F-3-methoxy-1-iodopropane, and 5 grams of F-3-(2-methoxy.ethoxy)-1-iodopropane were produced by converting the respective precursor acid sodium salts produced for olefin synthesis to the silver salts and pyrolyzing them with iodine. Each of these compounds was prepared for the first time by the aerosol fluorination process during the course of the contract. These samples were provided to other GRI contractors for synthesis of perfluorinated sulfur(VI) and phosphorous(V) acids.

  4. Activation of the constitutive androstane receptor inhibits gluconeogenesis without affecting lipogenesis or fatty acid synthesis in human hepatocytes

    SciTech Connect

    Lynch, Caitlin; Pan, Yongmei; Li, Linhao; Heyward, Scott; Moeller, Timothy; Swaan, Peter W.; Wang, Hongbing

    2014-08-15

    Objective: Accumulating evidence suggests that activation of mouse constitutive androstane receptor (mCAR) alleviates type 2 diabetes and obesity by inhibiting hepatic gluconeogenesis, lipogenesis, and fatty acid synthesis. However, the role of human (h) CAR in energy metabolism is largely unknown. The present study aims to investigate the effects of selective hCAR activators on hepatic energy metabolism in human primary hepatocytes (HPH). Methods: Ligand-based structure–activity models were used for virtual screening of the Specs database ( (www.specs.net)) followed by biological validation in cell-based luciferase assays. The effects of two novel hCAR activators (UM104 and UM145) on hepatic energy metabolism were evaluated in HPH. Results: Real-time PCR and Western blotting analyses reveal that activation of hCAR by UM104 and UM145 significantly repressed the expression of glucose-6-phosphatase and phosphoenolpyruvate carboxykinase, two pivotal gluconeogenic enzymes, while exerting negligible effects on the expression of genes associated with lipogenesis and fatty acid synthesis. Functional experiments show that UM104 and UM145 markedly inhibit hepatic synthesis of glucose but not triglycerides in HPH. In contrast, activation of mCAR by 1,4-bis[2-(3,5-dichloropyridyloxy)]benzene, a selective mCAR activator, repressed the expression of genes associated with gluconeogenesis, lipogenesis, and fatty acid synthesis in mouse primary hepatocytes, which were consistent with previous observations in mouse model in vivo. Conclusion: Our findings uncover an important species difference between hCAR and mCAR in hepatic energy metabolism, where hCAR selectively inhibits gluconeogenesis without suppressing fatty acid synthesis. Implications: Such species selectivity should be considered when exploring CAR as a potential therapeutic target for metabolic disorders. - Highlights: • Novel hCAR activators were identified by computational and biological approaches. • The role

  5. Synthesis of hyaluronic acid oligosaccharides and exploration of a fluorous-assisted approach.

    PubMed

    Macchione, Giuseppe; de Paz, José L; Nieto, Pedro M

    2014-07-23

    The synthesis of hyaluronic acid oligomers (tri- and tetrasaccharide) is described. We have followed a pre-glycosylation oxidation strategy. Glucuronic acid units were directly employed in coupling reactions with suitably protected glucosamine derivatives. In order to simplify the purification of synthetic intermediates, a fluorous-assisted strategy has been also explored. Using this approach, a hyaluronic acid trisaccharide was prepared. PMID:24930061

  6. Pore-expanded SBA-15 sulfonic acid silicas for biodiesel synthesis.

    PubMed

    Dacquin, J P; Lee, A F; Pirez, C; Wilson, K

    2012-01-01

    Here we present the first application of pore-expanded SBA-15 in heterogeneous catalysis. Pore expansion over the range 6-14 nm confers a striking activity enhancement towards fatty acid methyl ester (FAME) synthesis from triglycerides (TAG), and free fatty acid (FFA), attributed to improved mass transport and acid site accessibility. PMID:22089025

  7. The Expression and Prognostic Significance of Retinoic Acid Metabolising Enzymes in Colorectal Cancer

    PubMed Central

    Brown, Gordon T.; Cash, Beatriz Gimenez; Blihoghe, Daniela; Johansson, Petronella; Alnabulsi, Ayham; Murray, Graeme I.

    2014-01-01

    Colorectal cancer is one of the most common types of cancer with over fifty percent of patients presenting at an advanced stage. Retinoic acid is a metabolite of vitamin A and is essential for normal cell growth and aberrant retinoic acid metabolism is implicated in tumourigenesis. This study has profiled the expression of retinoic acid metabolising enzymes using a well characterised colorectal cancer tissue microarray containing 650 primary colorectal cancers, 285 lymph node metastasis and 50 normal colonic mucosal samples. Immunohistochemistry was performed on the tissue microarray using monoclonal antibodies which we have developed to the retinoic acid metabolising enzymes CYP26A1, CYP26B1, CYP26C1 and lecithin retinol acyl transferase (LRAT) using a semi-quantitative scoring scheme to assess expression. Moderate or strong expression of CYP26A1was observed in 32.5% of cancers compared to 10% of normal colonic epithelium samples (p<0.001). CYP26B1 was moderately or strongly expressed in 25.2% of tumours and was significantly less expressed in normal colonic epithelium (p<0.001). CYP26C1 was not expressed in any sample. LRAT also showed significantly increased expression in primary colorectal cancers compared with normal colonic epithelium (p<0.001). Strong CYP26B1 expression was significantly associated with poor prognosis (HR = 1.239, 95%CI = 1.104–1.390, χ2 = 15.063, p = 0.002). Strong LRAT was also associated with poorer outcome (HR = 1.321, 95%CI = 1.034–1.688, χ2 = 5.039, p = 0.025). In mismatch repair proficient tumours strong CYP26B1 (HR = 1.330, 95%CI = 1.173–1.509, χ2 = 21.493, p<0.001) and strong LRAT (HR = 1.464, 95%CI = 1.110–1.930, χ2 = 7.425, p = 0.006) were also associated with poorer prognosis. This study has shown that the retinoic acid metabolising enzymes CYP26A1, CYP26B1 and LRAT are significantly overexpressed in colorectal cancer and that CYP26B1 and LRAT are

  8. Endoplasmic reticulum stress inhibits collagen synthesis independent of collagen-modifying enzymes in different chondrocyte populations and dermal fibroblasts.

    PubMed

    Vonk, Lucienne A; Doulabi, Behrouz Zandieh; Huang, Chun-Ling; Helder, Marco N; Everts, Vincent; Bank, Ruud A

    2010-06-01

    Chondrocytes respond to glucose deprivation with a decreased collagen synthesis due to disruption of a proper functioning of the endoplasmic reticulum (ER): ER stress. Since the mechanisms involved in the decreased synthesis are unknown, we have investigated whether chaperones and collagen-modifying enzymes are affected by glucose deprivation. Chondrocytes obtained from nucleus pulposus, annulus fibrosus, articular cartilage, and meniscus and dermal fibroblasts were cultured under control conditions or exposed to the ER stress-inducing treatments of tunicamycin addition or glucose withdrawal. Both treatments resulted in an up-regulation of the gene expression of the ER stress markers in all cell types, but dermal fibroblasts showed a delayed response to glucose deprivation. Collagen gene expression was down-regulated, and less collagen protein was present in the cells under both ER stress-inducing conditions. The expression levels of the prolyl 4-hydroxylases were either not affected (P4ha3) or increased (P4ha1 and P4ha2), the levels of the lysyl hydroxylases decreased, and the N-propeptidase Adamts2 decreased. Both treatments induced apoptosis. Chondrocytes respond more quickly to glucose deprivation, but it appears that chondrocytes can cope better with tunicamycin-induced ER stress than fibroblasts. Although collagen synthesis was inhibited by the treatments, some collagen-modifying enzymes and chaperones were up-regulated, suggesting that there is no causal relation between them. PMID:20555395

  9. Selective synthesis of 3-hydroxy acids from Meldrum's acids using SmI2-H2O.

    PubMed

    Szostak, Michal; Spain, Malcolm; Procter, David J

    2012-05-01

    The single-step synthesis of 3-hydroxy carboxylic acids from readily available Meldrum's acids involves a selective monoreduction using a SmI(2)-H(2)O complex to give products in high crude purity, and it represents a considerable advancement over other methods for the synthesis of 3-hydroxy acids. The protocol includes a detailed guide to the preparation of a single electron-reducing SmI(2)-H(2)O complex and describes two representative examples of the methodology: monoreduction of a fully saturated Meldrum's acid (5-(4-bromobenzyl)-2,2-dimethyl-1,3-dioxane-4,6-dione) and tandem conjugate reduction-selective monoreduction of α,β-unsaturated Meldrum's acid (5-(4-methoxybenzylidene)-2,2-dimethyl-1,3-dioxane-4,6-dione). The protocol for selective monoreduction of Meldrum's acids takes ∼6 h to complete. PMID:22538848

  10. Imidase catalyzing desymmetric imide hydrolysis forming optically active 3-substituted glutaric acid monoamides for the synthesis of gamma-aminobutyric acid (GABA) analogs.

    PubMed

    Nojiri, Masutoshi; Hibi, Makoto; Shizawa, Hiroaki; Horinouchi, Nobuyuki; Yasohara, Yoshihiko; Takahashi, Satomi; Ogawa, Jun

    2015-12-01

    The recent use of optically active 3-substituted gamma-aminobutyric acid (GABA) analogs in human therapeutics has identified a need for an efficient, stereoselective method of their synthesis. Here, bacterial strains were screened for enzymes capable of stereospecific hydrolysis of 3-substituted glutarimides to generate (R)-3-substituted glutaric acid monoamides. The bacteria Alcaligenes faecalis NBRC13111 and Burkholderia phytofirmans DSM17436 were discovered to hydrolyze 3-(4-chlorophenyl) glutarimide (CGI) to (R)-3-(4-chlorophenyl) glutaric acid monoamide (CGM) with 98.1% enantiomeric excess (e.e.) and 97.5% e.e., respectively. B. phytofirmans DSM17436 could also hydrolyze 3-isobutyl glutarimide (IBI) to produce (R)-3-isobutyl glutaric acid monoamide (IBM) with 94.9% e.e. BpIH, an imidase, was purified from B. phytofirmans DSM17436 and found to generate (R)-CGM from CGI with specific activity of 0.95 U/mg. The amino acid sequence of BpIH had a 75% sequence identity to that of allantoinase from A. faecalis NBRC13111 (AfIH). The purified recombinant BpIH and AfIH catalyzed (R)-selective hydrolysis of CGI and IBI. In addition, a preliminary investigation of the enzymatic properties of BpIH and AfIH revealed that both enzymes were stable in the range of pH 6-10, with an optimal pH