Science.gov

Sample records for acid synthesis enzymes

  1. Indoleacetic Acid and the Synthesis of Glucanases and Pectic Enzymes

    PubMed Central

    Datko, Anne Harmon; Maclachlan, G. A.

    1968-01-01

    Indoleacetic acid (IAA) and/or inhibitors of DNA, RNA or protein synthesis were added to the apex of decapitated seedlings of Pisum sativum L. var. Alaska. At various times up to 4 days, enzymic protein was extracted from a segment of epicotyl immediately below the apex and assayed for its ability to hydrolyse polysaccharides or their derivatives. With the exception of amylase, the total amounts per segment of all of the tested enzymes increased due to IAA treatment. The development of β-1,4-glucanase (cellulase) activity per unit of protein or fresh weight proceeded according to a typical sigmoid induction curve. Pectinase was formed for about 2 days in control segments and IAA treatment resulted in continued synthesis for at least another 2 days provided cell division took place. β-1,3-glucanase and pectinesterase activities were only enhanced by IAA to the extent that total protein levels increased. Reaction mechanisms for these effects and functions for the enzymes during growth are discussed. PMID:16656834

  2. Role of malic enzyme during fatty acid synthesis in the oleaginous fungus Mortierella alpina.

    PubMed

    Hao, Guangfei; Chen, Haiqin; Wang, Lei; Gu, Zhennan; Song, Yuanda; Zhang, Hao; Chen, Wei; Chen, Yong Q

    2014-05-01

    The generation of NADPH by malic enzyme (ME) was postulated to be a rate-limiting step during fatty acid synthesis in oleaginous fungi, based primarily on the results from research focusing on ME in Mucor circinelloides. This hypothesis is challenged by a recent study showing that leucine metabolism, rather than ME, is critical for fatty acid synthesis in M. circinelloides. To clarify this, the gene encoding ME isoform E from Mortierella alpina was homologously expressed. ME overexpression increased the fatty acid content by 30% compared to that for a control. Our results suggest that ME may not be the sole rate-limiting enzyme, but does play a role, during fatty acid synthesis in oleaginous fungi.

  3. Synthesis of amino-acid derivatives and dipeptides with an original peptidase enzyme.

    PubMed

    Auriol, D; Paul, F; Yoshpe, I; Gripon, J C; Monsan, P

    1991-01-01

    A peptidase from the non pathogenic Staphylococcus sp. strain BEC 299 was purified to a final specific activity of 84,400 U/mg protein. Its molecular weight is 450 kDa and optimum pH 10.0. This enzyme catalyzes the synthesis of dipeptides (aspartame) and alpha-amino acid derivatives (N-L-malyl-L-tyrosine ethyl ester). The influence of cosolvents and pH on dipeptides and alpha-amino acid derivative synthesis is described. Finally, we detail the use of the peptidase as a reagent in protease-catalyzed peptide synthesis.

  4. Relationship of lipogenic enzyme activities to the rate of rat liver fatty acid synthesis

    SciTech Connect

    Nelson, G.; Kelley, D.; Schmidt, P.; Virk, S.; Serrato, C.

    1986-05-01

    The mechanism by which diet regulates liver lipogenesis is unclear. Here the authors report how dietary alterations effect the activities of key enzymes of fatty acid (FA) synthesis. Male Sprague-Dawley rats, 400-500 g, were fasted for 48h and then refed a fat-free, high carbohydrate (HC) diet (75% cal. from sucrose) for 0,3,9,24 and 48h, or refed a HC diet for 48h, then fed a high-fat (HF) diet (44% cal. from corn oil) for 3,9,24 and 48h. The FA synthesis rate and the activities of acetyl CoA carboxylase (AC), fatty acid synthase (FAS), ATP citrate lyase (CL), and glucose 6-phosphate dehydrogenase (G6PDH) were determined in the livers. FA synthesis was assayed with /sup 3/H/sub 2/O, enzyme activities were measured spectrophotometrically except for AC which was assayed with /sup 14/C-bicarbonate. There was no change in the activity of AC during fasting or on the HC diet. Fasting decreased the rate of FA synthesis by 25% and the activities of FAS and CL by 50%; refeeding the HC diet induced parallel changes in FA synthesis and the activities of FAS, CL, and G6PDH. After 9h on the HF diet, FA synthesis had decreased sharply, AC activity increased significantly while no changes were detected in the other activities. Subsequently FA synthesis did not change while the activities of the enzymes decreased slowly. These enzymes did not appear to regulate FA synthesis during inhibition of lipogenesis, but FAS, CL or G6PDH may be rate limiting in the induction phase. Other key factors may regulate FA synthesis during dietary alterations.

  5. Synthesis of Oxalic Acid by Enzymes from Lettuce Leaves

    PubMed Central

    Davies, David D.; Asker, Hassan

    1983-01-01

    A rapid purification of lactate dehydrogenase and glycolate oxidase from lettuce (Lactuca sativa) leaves is described. The kinetics of both enzymes are reported in relation to their possible roles in the production of oxalate. Lettuce lactate dehydrogenase behaves like mammalian dehydrogenase, catalyzing the dismutation of glyoxylate to glycolate and oxalate. A model is proposed in which glycolate oxidase in the peroxisomes and lactate dehydrogenase in the cytosol are involved in the production of oxalate. The effect of pH on the balance between oxalate and glycolate produced from glyoxylate suggests that in leaves lactate dehydrogenase may function as part of an oxalate-based biochemical, pH-stat. PMID:16662946

  6. Okadaic acid disrupts Golgi structure and impairs enzyme synthesis and secretion in the rat pancreas.

    PubMed

    Waschulewski, I H; Kruse, M L; Agricola, B; Kern, H F; Schmidt, W E

    1996-06-01

    Okadaic acid, a serine/threonine phosphatase inhibitor, has been shown to inhibit rat pancreatic enzyme secretion by interference with late processes in stimulus-secretion coupling. To further characterize its action, we studied the effect of okadaic acid on secretion of newly synthesized proteins, protein synthesis, and cellular ultrastructure in pancreatic lobules derived from rats stimulated in vivo by feeding the synthetic proteinase inhibitor FOY-305. Okadaic acid completely blocked protein secretion at concentrations that inhibit the Ca2+/calmodulin-dependent protein phosphatase 2b, calcineurin. Protein synthesis was abolished at 10(-6) mol/l and reduced by 60% at 5 x 10(-7) mol/l okadaic acid. Pancreatic lobules exposed to 5 x 10(-7) mol/l okadaic acid for 20 min fully restored their secretory capacity on removal of the drug; whereas, after a preincubation with okadaic acid for > 40 min, protein secretion remained impaired during the recovery period. Electron microscopic examination of pancreatic acinar cells treated with 5 x 10(-7) mol/l okadaic acid revealed a dilated Golgi complex after 15 and 30 min and a subsequent fragmentation of Golgi cisternae into clouds of small uniform vesicles after 60 min. Reassembly of Golgi stacks occurred after a 60-min recovery without okadaic acid. These data indicate that serine/threonine phosphatases play an important role not only in the regulation of pancreatic enzyme synthesis and exocytosis but also are crucial for the maintenance of normal Golgi architecture and function in the exocrine rat pancreas. These effects are probably not exclusively mediated via type 2b calcineurin-like protein phosphatases.

  7. Implementing bacterial acid resistance into cell-free protein synthesis for buffer-free expression and screening of enzymes.

    PubMed

    Kim, Ho-Cheol; Kim, Kwang-Soo; Kang, Taek-Jin; Choi, Jong Hyun; Song, Jae Jun; Choi, Yun Hee; Kim, Byung-Gee; Kim, Dong-Myung

    2015-12-01

    Cell-free protein synthesis utilizes translational machinery isolated from the cells for in vitro expression of template genes. Because it produces proteins without gene cloning and cell cultivation steps, cell-free protein synthesis can be used as a versatile platform for high-throughput expression of enzyme libraries. Furthermore, the open nature of cell-free protein synthesis allows direct integration of enzyme synthesis with subsequent screening steps. However, the presence of high concentration of chemical buffers in the conventional reaction mixture makes it difficult to streamline cell-free protein synthesis with pH-based assay of the synthesized enzymes. In this study, we have implemented an enzyme-assisted bacterial acid resistance mechanism into an Escherichia coli (E.coli) extract-based cell-free protein synthesis system in place of chemical buffers. When deployed in the reaction mixture for cell-free synthesis of enzymes, through proton-consuming conversion of glutamate into γ-aminobutyric acid (GABA), an engineered glutamate decarboxylase (GADβ) was able to maintain the pH of reaction mixture during enzyme synthesis. Because the reaction mixture becomes free of buffering capacity upon the depletion of glutamate, synthesized enzyme could be directly assayed without purification steps. The designed method was successfully applied to the screening of mutant library of sialyltransferase genes to identify mutants with improved enzymatic activity.

  8. The synthesis of glutamic acid in the absence of enzymes: Implications for biogenesis

    NASA Technical Reports Server (NTRS)

    Morowitz, Harold; Peterson, Eta; Chang, Sherwood

    1995-01-01

    This paper reports on the non-enzymatic aqueous phase synthesis of amino acids from keto acids, ammonia and reducing agents. The facile synthesis of key metabolic intermediates, particularly in the glycolytic pathway, the citric acid cycle, and the first step of amino acid synthesis, lead to new ways of looking at the problem of biogenesis.

  9. Structural and Mechanistic Insight into the Listeria monocytogenes Two-enzyme Lipoteichoic Acid Synthesis System*

    PubMed Central

    Campeotto, Ivan; Percy, Matthew G.; MacDonald, James T.; Förster, Andreas; Freemont, Paul S.; Gründling, Angelika

    2014-01-01

    Lipoteichoic acid (LTA) is an important cell wall component required for proper cell growth in many Gram-positive bacteria. In Listeria monocytogenes, two enzymes are required for the synthesis of this polyglycerolphosphate polymer. The LTA primase LtaPLm initiates LTA synthesis by transferring the first glycerolphosphate (GroP) subunit onto the glycolipid anchor and the LTA synthase LtaSLm extends the polymer by the repeated addition of GroP subunits to the tip of the growing chain. Here, we present the crystal structures of the enzymatic domains of LtaPLm and LtaSLm. Although the enzymes share the same fold, substantial differences in the cavity of the catalytic site and surface charge distribution contribute to enzyme specialization. The eLtaSLm structure was also determined in complex with GroP revealing a second GroP binding site. Mutational analysis confirmed an essential function for this binding site and allowed us to propose a model for the binding of the growing chain. PMID:25128528

  10. [Reconstitution of polyunsaturated fatty acid synthesis enzymes in mammalian cells to convert LA to DHA].

    PubMed

    Zhu, Guiming; Saleh, Abdulmomen Ali Mohammed; Bahwal, Said Ahmed; Qiu, Lihong; Sun, Jie; Shang, Yu; Jiang, Xudong; Ge, Tangdong; Zhang, Tao

    2015-02-01

    DHA (22:6n-3) is a Ω-3 polyunsaturated fatty acid with 22 carbon atoms and 6 double bonds, which has important biological functions in human body. Human and other mammals synthesize only limited amounts of DHA, more requirements must be satisfied from food resources. However, the natural resources of DHA (Mainly deep-sea fish and other marine products) are prone to depletion. New resources development is still insufficient to satisfy the growing market demand. Previous studies have revealed that the mammals can increase the synthesis of DHA and other long-chain polyunsaturated fatty acids after transgenic procedures. In this study, mammalian cells were transfected with Δ6, Δ5 desaturase, Δ6, Δ5 elongase, Δ15 desaturase (Isolated from nematode Caenorhabditis elegans) and Δ4 desaturase (Isolated from Euglena gracilis), simultaneously. Results show that the expression or overexpression of these 6 enzymes is capable of conversion of the o-6 linoleic acid (LA, 18:2n-6) in DHA (22:6n-3). DHA content has increased from 16.74% in the control group to 25.3% in the experimental group. The strategy and related technology in our research provided important data for future production the valuable DHA (22:6n-3) by using genetically modified animals.

  11. RDH10 is the primary enzyme responsible for the first step of embryonic Vitamin A metabolism and retinoic acid synthesis.

    PubMed

    Farjo, Krysten M; Moiseyev, Gennadiy; Nikolaeva, Olga; Sandell, Lisa L; Trainor, Paul A; Ma, Jian-xing

    2011-09-15

    Retinoic acid (atRA) signaling is essential for regulating embryonic development, and atRA levels must be tightly controlled in order to prevent congenital abnormalities and fetal death which can result from both excessive and insufficient atRA signaling. Cellular enzymes synthesize atRA from Vitamin A, which is obtained from dietary sources. Embryos express multiple enzymes that are biochemically capable of catalyzing the initial step of Vitamin A oxidation, but the precise contribution of these enzymes to embryonic atRA synthesis remains unknown. Using Rdh10(trex)-mutant embryos, dietary supplementation of retinaldehyde, and retinol dehydrogenase (RDH) activity assays, we demonstrate that RDH10 is the primary RDH responsible for the first step of embryonic Vitamin A oxidation. Moreover, we show that this initial step of atRA synthesis occurs predominantly in a membrane-bound cellular compartment, which prevents inhibition by the cytosolic cellular retinol-binding protein (RBP1). These studies reveal that widely expressed cytosolic enzymes with RDH activity play a very limited role in embryonic atRA synthesis under normal dietary conditions. This provides a breakthrough in understanding the precise cellular mechanisms that regulate Vitamin A metabolism and the synthesis of the essential embryonic regulatory molecule atRA.

  12. Evidence for separate elongation enzymes for very-long-chain-fatty-acid synthesis in potato (Solanum tuberosum).

    PubMed Central

    Walker, K A; Harwood, J L

    1986-01-01

    Aging potato (Solanum tuberosum) tuber discs in a Ca2+-containing medium resulted in increased rates of fatty acid labelling from [1-14C]acetate with time. Maximal labelling rates were seen after 6-8 h aging in a number of varieties. Saturated very-long-chain fatty acids (C20 and particularly C22 and C24) were very poorly labelled in freshly cut tissue. They were synthesized in increasing amounts and in a homologous sequence with progressive aging times. Use of increasing induction times and cycloheximide or puromycin as protein-synthesis inhibitors indicated that the sequence of fatty acid elongation was dependent on protein synthesis de novo and was controlled by three separate specific elongase enzymes. PMID:3800889

  13. Hormonal Control of Enzyme Synthesis: On the Mode of Action of Gibberellic Acid and Abscisin in Aleurone Layers of Barley 1

    PubMed Central

    Chrispeels, Maarten J.; Varner, J. E.

    1967-01-01

    Gibberellic acid (GA) enhances the synthesis of α-amylase and ribonuclease in isolated aleurone layers and this process is inhibited by abscisin. Removal of gibberellic acid in mid-course of α-amylase production results in a slowing down of α-amylase synthesis, suggesting a continued requirement of GA for enzyme synthesis. This is paralleled by a continuous requirement for RNA synthesis. Addition of 6-methylpurine or 8-azaguanine in mid-course results in an inhibition of α-amylase synthesis within 3 to 4 hours. However, actinomycin D added in mid-course is almost without effect. This is not due to its failure to enter the cells, because it does inhibit 14C-uridine incorporation at this stage. Addition of abscisin to aleurone layers which are synthesizing α-amylase results in an inhibition of this synthesis within 2 to 3 hours. Cycloheximide on the other hand inhibits enzyme synthesis immediately upon its addition. These data are consistent with the hypothesis that the expression of the GA effect requires the synthesis of enzyme-specific RNA molecules. The similarity in the kinetics of inhibition between abscisin on the one hand and 8-azaguanine or 6-methylpurine on the other suggests that abscisin may exert its action by inhibiting the synthesis of these enzyme-specific RNA molecules or by preventing their incorporation into an active enzyme-synthesising unit. PMID:16656590

  14. Analysis of ATP-citrate lyase and malic enzyme mutants of Yarrowia lipolytica points out the importance of mannitol metabolism in fatty acid synthesis.

    PubMed

    Dulermo, Thierry; Lazar, Zbigniew; Dulermo, Rémi; Rakicka, Magdalena; Haddouche, Ramedane; Nicaud, Jean-Marc

    2015-09-01

    The role of the two key enzymes of fatty acid (FA) synthesis, ATP-citrate lyase (Acl) and malic enzyme (Mae), was analyzed in the oleaginous yeast Yarrowia lipolytica. In most oleaginous yeasts, Acl and Mae are proposed to provide, respectively, acetyl-CoA and NADPH for FA synthesis. Acl was mainly studied at the biochemical level but no strain depleted for this enzyme was analyzed in oleaginous microorganisms. On the other hand the role of Mae in FA synthesis in Y. lipolytica remains unclear since it was proposed to be a mitochondrial NAD(H)-dependent enzyme and not a cytosolic NADP(H)-dependent enzyme. In this study, we analyzed for the first time strains inactivated for corresponding genes. Inactivation of ACL1 decreases FA synthesis by 60 to 80%, confirming its essential role in FA synthesis in Y. lipolytica. Conversely, inactivation of MAE1 has no effects on FA synthesis, except in a FA overaccumulating strain where it improves FA synthesis by 35%. This result definitively excludes Mae as a major key enzyme for FA synthesis in Y. lipolytica. During the analysis of both mutants, we observed a negative correlation between FA and mannitol level. As mannitol and FA pathways may compete for carbon storage, we inactivated YlSDR, encoding a mannitol dehydrogenase converting fructose and NADPH into mannitol and NADP+. The FA content of the resulting mutant was improved by 60% during growth on fructose, demonstrating that mannitol metabolism may modulate FA synthesis in Y. lipolytica.

  15. Synthesis of 2-monoacylglycerols and structured triacylglycerols rich in polyunsaturated fatty acids by enzyme catalyzed reactions.

    PubMed

    Rodríguez, Alicia; Esteban, Luis; Martín, Lorena; Jiménez, María José; Hita, Estrella; Castillo, Beatriz; González, Pedro A; Robles, Alfonso

    2012-08-10

    This paper studies the synthesis of structured triacylglycerols (STAGs) by a four-step process: (i) obtaining 2-monoacylglycerols (2-MAGs) by alcoholysis of cod liver oil with several alcohols, catalyzed by lipases Novozym 435, from Candida antartica and DF, from Rhizopus oryzae, (ii) purification of 2-MAGs, (iii) formation of STAGs by esterification of 2-MAGs with caprylic acid catalyzed by lipase DF, from R. oryzae, and (iv) purification of these STAGs. For the alcoholysis of cod liver oil, absolute ethanol, ethanol 96% (v/v) and 1-butanol were compared; the conditions with ethanol 96% were then optimized and 2-MAG yields of around 54-57% were attained using Novozym 435. In these 2-MAGs, DHA accounted for 24-31% of total fatty acids. In the operational conditions this lipase maintained a stable level of activity over at least 11 uses. These results were compared with those obtained with lipase DF, which deactivated after only three uses. The alcoholysis of cod liver oil and ethanol 96% catalyzed by Novozym 435 was scaled up by multiplying the reactant amounts 100-fold and maintaining the intensity of treatment constant (IOT=3g lipase h/g oil). In these conditions, the 2-MAG yield attained was about 67%; these 2-MAGs contained 36.6% DHA. The synthesized 2-MAGs were separated and purified from the alcoholysis reaction products by solvent extraction using solvents of low toxicity (ethanol and hexane); 2-MAG recovery yield and purity of the target product were approximately 96.4% and 83.9%, respectively. These 2-MAGs were transformed to STAGs using the optimal conditions obtained in a previous work. After synthesis and purification, 93% pure STAGs were obtained, containing 38% DHA at sn-2 position and 60% caprylic acid (CA) at sn-1,3 positions (of total fatty acids at these positions), i.e. the major TAG is the STAG with the structure CA-DHA-CA. PMID:22759534

  16. Synthesis of 2-monoacylglycerols and structured triacylglycerols rich in polyunsaturated fatty acids by enzyme catalyzed reactions.

    PubMed

    Rodríguez, Alicia; Esteban, Luis; Martín, Lorena; Jiménez, María José; Hita, Estrella; Castillo, Beatriz; González, Pedro A; Robles, Alfonso

    2012-08-10

    This paper studies the synthesis of structured triacylglycerols (STAGs) by a four-step process: (i) obtaining 2-monoacylglycerols (2-MAGs) by alcoholysis of cod liver oil with several alcohols, catalyzed by lipases Novozym 435, from Candida antartica and DF, from Rhizopus oryzae, (ii) purification of 2-MAGs, (iii) formation of STAGs by esterification of 2-MAGs with caprylic acid catalyzed by lipase DF, from R. oryzae, and (iv) purification of these STAGs. For the alcoholysis of cod liver oil, absolute ethanol, ethanol 96% (v/v) and 1-butanol were compared; the conditions with ethanol 96% were then optimized and 2-MAG yields of around 54-57% were attained using Novozym 435. In these 2-MAGs, DHA accounted for 24-31% of total fatty acids. In the operational conditions this lipase maintained a stable level of activity over at least 11 uses. These results were compared with those obtained with lipase DF, which deactivated after only three uses. The alcoholysis of cod liver oil and ethanol 96% catalyzed by Novozym 435 was scaled up by multiplying the reactant amounts 100-fold and maintaining the intensity of treatment constant (IOT=3g lipase h/g oil). In these conditions, the 2-MAG yield attained was about 67%; these 2-MAGs contained 36.6% DHA. The synthesized 2-MAGs were separated and purified from the alcoholysis reaction products by solvent extraction using solvents of low toxicity (ethanol and hexane); 2-MAG recovery yield and purity of the target product were approximately 96.4% and 83.9%, respectively. These 2-MAGs were transformed to STAGs using the optimal conditions obtained in a previous work. After synthesis and purification, 93% pure STAGs were obtained, containing 38% DHA at sn-2 position and 60% caprylic acid (CA) at sn-1,3 positions (of total fatty acids at these positions), i.e. the major TAG is the STAG with the structure CA-DHA-CA.

  17. Recent advances in inhibitors of bacterial fatty acid synthesis type II (FASII) system enzymes as potential antibacterial agents.

    PubMed

    Wang, Yi; Ma, Shutao

    2013-10-01

    Bacterial infections are a constant and serious threat to human health. With the increase of multidrug resistance of clinically pathogenic bacteria, common antibiotic therapies have been less effective. Fatty acid synthesis type II (FASII) system enzymes are essential for bacterial membrane lipid biosynthesis and represent increasingly promising targets for the discovery of antibacterial agents with new mechanisms of action. This review highlights recent advances in inhibitors of bacterial FASII as potential antibacterial agents, paying special attention to the activities, mechanisms, and structure-activity relationships of those inhibitors that mainly target β-ketoacyl-ACP synthase, β-ketoacyl-ACP reductase, β-hydroxyacyl-ACP dehydratase, and enoyl-ACP reductase. Although inhibitors with low nanomolar and selective activity against various bacterial FASII have entered clinical trials, further research is needed to expand upon both available and yet unknown scaffolds to identify new FASII inhibitors that may have antibacterial potential, particularly against resistant bacterial strains.

  18. Role of AMACR (α-methylacyl-CoA racemase) and MFE-1 (peroxisomal multifunctional enzyme-1) in bile acid synthesis in mice.

    PubMed

    Autio, Kaija J; Schmitz, Werner; Nair, Remya R; Selkälä, Eija M; Sormunen, Raija T; Miinalainen, Ilkka J; Crick, Peter J; Wang, Yuqin; Griffiths, William J; Reddy, Janardan K; Baes, Myriam; Hiltunen, J Kalervo

    2014-07-01

    Cholesterol is catabolized to bile acids by peroxisomal β-oxidation in which the side chain of C27-bile acid intermediates is shortened by three carbon atoms to form mature C24-bile acids. Knockout mouse models deficient in AMACR (α-methylacyl-CoA racemase) or MFE-2 (peroxisomal multifunctional enzyme type 2), in which this β-oxidation pathway is prevented, display a residual C24-bile acid pool which, although greatly reduced, implies the existence of alternative pathways of bile acid synthesis. One alternative pathway could involve Mfe-1 (peroxisomal multifunctional enzyme type 1) either with or without Amacr. To test this hypothesis, we generated a double knockout mouse model lacking both Amacr and Mfe-1 activities and studied the bile acid profiles in wild-type, Mfe-1 and Amacr single knockout mouse line and Mfe-1 and Amacr double knockout mouse lines. The total bile acid pool was decreased in Mfe-1-/- mice compared with wild-type and the levels of mature C24-bile acids were reduced in the double knockout mice when compared with Amacr-deficient mice. These results indicate that Mfe-1 can contribute to the synthesis of mature bile acids in both Amacr-dependent and Amacr-independent pathways.

  19. Enzymatic characterization of ELOVL1, a key enzyme in very long-chain fatty acid synthesis.

    PubMed

    Schackmann, Martin J A; Ofman, Rob; Dijkstra, Inge M E; Wanders, Ronald J A; Kemp, Stephan

    2015-02-01

    X-linked adrenoleukodystrophy (X-ALD) is a neurometabolic disease that is caused by mutations in the ABCD1 gene. ABCD1 protein deficiency impairs peroxisomal very long-chain fatty acid (VLCFA) degradation resulting in increased cytosolic VLCFA-CoA levels, which are further elongated by the VLCFA-specific elongase, ELOVL1. In adulthood, X-ALD most commonly manifests as a gradually progressive myelopathy (adrenomyeloneuropathy; AMN) without any curative or disease modifying treatments. We recently showed that bezafibrate reduces VLCFA accumulation in X-ALD fibroblasts by inhibiting ELOVL1. Although, in a clinical trial, bezafibrate was unable to lower VLCFA levels in plasma or lymphocytes in X-ALD patients, inhibition of ELOVL1 remains an attractive therapeutic option. In this study, we investigated the kinetic characteristics of ELOVL1 using X-ALD fibroblasts and microsomal fractions from ELOVL1 over-expressing HEK293 cell lines and analyzed the inhibition kinetics of a series of fibrates. Our data show that the CoA esters of bezafibrate and gemfibrozil reduce chain elongation by specifically inhibiting ELOVL1. These fibrates can therefore serve as lead compounds for the development of more potent and more specific inhibitors for ELOVL1. PMID:25499606

  20. Structural and Functional Characterization of BaiA, An Enzyme Involved in Secondary Bile Acid Synthesis in Human Gut Microbe

    PubMed Central

    Bhowmik, Shiva; Jones, David H.; Chiu, Hsien-Po; Park, In-Hee; Chiu, Hsiu-Ju; Axelrod, Herbert L.; Farr, Carol L.; Tien, Henry J.; Agarwalla, Sanjay; Lesley, Scott A.

    2014-01-01

    Despite significant influence of secondary bile acids on human health and disease, limited structural and biochemical information is available for the key gut microbial enzymes catalyzing its synthesis. Herein, we report apo- and co-factor bound crystal structures of BaiA2, a short chain dehydrogenase/reductase from Clostridium scindens VPI 12708 that represent the first protein structure of this pathway. The structures elucidated the basis of co-factor specificity and mechanism of proton relay. A conformational restriction involving Glu42 located in the co-factor binding site seems crucial in determining co-factor specificity. Limited flexibility of Glu42 results in imminent steric and electrostatic hindrance with 2′-phosphate group of NADP(H). Consistent with crystal structures, steady-state kinetic characterization performed with both BaiA2 and BaiA1, a close homolog with 92% sequence identity, revealed specificity constant (kcat/KM) of NADP+ at least an order of magnitude lower than NAD+. Substitution of Glu42 with Ala improved specificity towards NADP+ by 10- fold compared to wild type. The co-factor bound structure uncovered a novel nicotinamide-hydroxyl ion (NAD+-OH−) adduct contraposing previously reported adducts. The OH− of the adduct in BaiA2 is distal to C4 atom of nicotinamide and proximal to 2′-hydroxyl group of the ribose moiety. Moreover, it is located at intermediary distances between terminal functional groups of active site residues Tyr157 (2.7 Å) and Lys161 (4.5 Å). Based on these observations we propose an involvement of NAD+-OH− adduct in proton relay instead of hydride transfer as noted for previous adducts. PMID:23836456

  1. Insolubilized enzymes for food synthesis

    NASA Technical Reports Server (NTRS)

    Marshall, D. L.

    1972-01-01

    Cellulose matrix with numerous enzyme-coated silica particles of colloidal size permanently bound at various sites within matrix was produced that has high activity and possesses requisite physical characteristics for filtration or column operations. Product also allows coupling step in synthesis of edible food to proceed under mild conditions.

  2. The role of pyruvate hub enzymes in supplying carbon precursors for fatty acid synthesis in photosynthetic microalgae.

    PubMed

    Shtaida, Nastassia; Khozin-Goldberg, Inna; Boussiba, Sammy

    2015-09-01

    Photosynthetic microalgae are currently the focus of basic and applied research due to an ever-growing interest in renewable energy resources. This review discusses the role of carbon-unit supply for the production of acetyl-CoA, a direct precursor of fatty acid biosynthesis and the primary building block of the growing acyl chains for the purpose of triacylglycerol (TAG) production in photosynthetic microalgae under stressful conditions. It underscores the importance of intraplastidic acetyl-CoA generation for storage lipid accumulation. The main focus is placed on two enzymatic steps linking the central carbon metabolism and fatty acid synthesis, namely the reactions catalyzed by the plastidic isoform of pyruvate kinase and the chloroplastic pyruvate dehydrogenase complex. Alternative routes for plastidic acetyl-CoA synthesis are also reviewed. A separate section is devoted to recent advances in functional genomics studies related to fatty acid and TAG biosynthesis. PMID:25846135

  3. The role of pyruvate hub enzymes in supplying carbon precursors for fatty acid synthesis in photosynthetic microalgae.

    PubMed

    Shtaida, Nastassia; Khozin-Goldberg, Inna; Boussiba, Sammy

    2015-09-01

    Photosynthetic microalgae are currently the focus of basic and applied research due to an ever-growing interest in renewable energy resources. This review discusses the role of carbon-unit supply for the production of acetyl-CoA, a direct precursor of fatty acid biosynthesis and the primary building block of the growing acyl chains for the purpose of triacylglycerol (TAG) production in photosynthetic microalgae under stressful conditions. It underscores the importance of intraplastidic acetyl-CoA generation for storage lipid accumulation. The main focus is placed on two enzymatic steps linking the central carbon metabolism and fatty acid synthesis, namely the reactions catalyzed by the plastidic isoform of pyruvate kinase and the chloroplastic pyruvate dehydrogenase complex. Alternative routes for plastidic acetyl-CoA synthesis are also reviewed. A separate section is devoted to recent advances in functional genomics studies related to fatty acid and TAG biosynthesis.

  4. Function of heterologous Mycobacterium tuberculosis InhA, a type 2 fatty acid synthase enzyme involved in extending C20 fatty acids to C60-to-C90 mycolic acids, during de novo lipoic acid synthesis in Saccharomyces cerevisiae.

    PubMed

    Gurvitz, Aner; Hiltunen, J Kalervo; Kastaniotis, Alexander J

    2008-08-01

    We describe the physiological function of heterologously expressed Mycobacterium tuberculosis InhA during de novo lipoic acid synthesis in yeast (Saccharomyces cerevisiae) mitochondria. InhA, representing 2-trans-enoyl-acyl carrier protein reductase and the target for the front-line antituberculous drug isoniazid, is involved in the activity of dissociative type 2 fatty acid synthase (FASII) that extends associative type 1 fatty acid synthase (FASI)-derived C(20) fatty acids to form C(60)-to-C(90) mycolic acids. Mycolic acids are major constituents of the protective layer around the pathogen that contribute to virulence and resistance to certain antimicrobials. Unlike FASI, FASII is thought to be incapable of de novo biosynthesis of fatty acids. Here, the genes for InhA (Rv1484) and four similar proteins (Rv0927c, Rv3485c, Rv3530c, and Rv3559c) were expressed in S. cerevisiae etr1Delta cells lacking mitochondrial 2-trans-enoyl-thioester reductase activity. The phenotype of the yeast mutants includes the inability to produce sufficient levels of lipoic acid, form mitochondrial cytochromes, respire, or grow on nonfermentable carbon sources. Yeast etr1Delta cells expressing mitochondrial InhA were able to respire, grow on glycerol, and produce lipoic acid. Commensurate with a role in mitochondrial de novo fatty acid biosynthesis, InhA could accept in vivo much shorter acyl-thioesters (C(4) to C(8)) than was previously thought (>C(12)). Moreover, InhA functioned in the absence of AcpM or protein-protein interactions with its native FASII partners KasA, KasB, FabD, and FabH. None of the four proteins similar to InhA complemented the yeast mutant phenotype. We discuss the implications of our findings with reference to lipoic acid synthesis in M. tuberculosis and the potential use of yeast FASII mutants for investigating the physiological function of drug-targeted pathogen enzymes involved in fatty acid biosynthesis. PMID:18552191

  5. Secretion of three enzymes for fatty acid synthesis into mouse milk in association with fat globules, and rapid decrease of the secreted enzymes by treatment with rapamycin.

    PubMed

    Moriya, Hitomi; Uchida, Kana; Okajima, Tetsuya; Matsuda, Tsukasa; Nadano, Daita

    2011-04-01

    The mammary epithelium produces numerous lipid droplets during lactation and secretes them in plasma membrane-enclosed vesicles known as milk fat globules. The biogenesis of such fat globules is considered to provide a model for clarifying the mechanisms of lipogenesis in mammals. In the present study, we identified acetyl coenzyme A carboxylase, ATP citrate lyase, and fatty acid synthase in mouse milk. Fractionation of milk showed that these three enzymes were located predominantly in milk fat globules. The three enzymes were resistant to trypsin digestion without Triton X-100, indicating that they were not located on the outer surface of the globules and thus associated with the precursors of the globules before secretion. When a low dose of rapamycin, an inhibitor of the mammalian target of rapamycin (mTOR), was injected into lactating mice, the levels of the three enzymes in milk were decreased within 3h after injection. Since the protein levels of the three enzymes in tissues were not obviously altered by this short-term treatment, known transcriptional control by mTOR signaling was unlikely to account for this decrease in their levels in milk. Our findings suggest a new, putatively mTOR-dependent localization of the three enzymes for de novo lipogenesis. PMID:21281598

  6. Fatty acid composition of muscle fat and enzymes of storage lipid synthesis in whole muscle from beef cattle.

    PubMed

    Kazala, E Chris; Lozeman, Fred J; Mir, Priya S; Aalhus, Jennifer L; Schmutz, Sheila M; Weselake, Randall J

    2006-11-01

    Enhanced intramuscular fat content (i.e., marbling) in beef is a desirable trait, which can result in increased product value. This study was undertaken with the aim of revealing biochemical factors associated with the marbling trait in beef cattle. Samples of longissimus lumborum (LL) and pars costalis diaphragmatis (PCD) were taken from a group of intact crossbred males and females at slaughter, lipids extracted, and the resulting FAME examined for relationships with marbling fat deposition. For LL, significant associations were found between degree of marbling and myristic (14:0, r = 0.55, P < 0.01), palmitic (16:0, r = 0.80, P < 0.001), stearic (18:0, r = -0.58, P < 0.01), and oleic (18:1c-9, r = 0.79, P < 0.001) acids. For PCD, significant relationships were found between marbling and palmitic (r = 0.71, P < 0.001) and oleic (r = 0.74, P < 0.001) acids. Microsomal fractions prepared from PCD muscle were assayed for diacylglycerol acyltransferase (DGAT), lysophosphatidic acid acyltransferase (LPAAT), and phosphatidic acid phosphatase-1 (PAP-1) activity, and the results examined for relationships with degree of intramuscular fat deposition. None of the enzyme activities from PCD displayed an association with marbling fat content, but DGAT specific activity showed significant positive associations with LPAAT (r = 0.54, P < 0.01), total PAP (r = 0.66, P < 0.001), and PAP-1 (r = 0.63, P < 0.01) specific activities. The results on FA compositions of whole muscle tissues provide insight into possible enzyme action associated with the production of specific FA. The increased proportion of oleic acid associated with enhanced lipid content of whole muscle is noteworthy given the known health benefits of this FA. PMID:17263304

  7. Fatty acid composition of muscle fat and enzymes of storage lipid synthesis in whole muscle from beef cattle.

    PubMed

    Kazala, E Chris; Lozeman, Fred J; Mir, Priya S; Aalhus, Jennifer L; Schmutz, Sheila M; Weselake, Randall J

    2006-11-01

    Enhanced intramuscular fat content (i.e., marbling) in beef is a desirable trait, which can result in increased product value. This study was undertaken with the aim of revealing biochemical factors associated with the marbling trait in beef cattle. Samples of longissimus lumborum (LL) and pars costalis diaphragmatis (PCD) were taken from a group of intact crossbred males and females at slaughter, lipids extracted, and the resulting FAME examined for relationships with marbling fat deposition. For LL, significant associations were found between degree of marbling and myristic (14:0, r = 0.55, P < 0.01), palmitic (16:0, r = 0.80, P < 0.001), stearic (18:0, r = -0.58, P < 0.01), and oleic (18:1c-9, r = 0.79, P < 0.001) acids. For PCD, significant relationships were found between marbling and palmitic (r = 0.71, P < 0.001) and oleic (r = 0.74, P < 0.001) acids. Microsomal fractions prepared from PCD muscle were assayed for diacylglycerol acyltransferase (DGAT), lysophosphatidic acid acyltransferase (LPAAT), and phosphatidic acid phosphatase-1 (PAP-1) activity, and the results examined for relationships with degree of intramuscular fat deposition. None of the enzyme activities from PCD displayed an association with marbling fat content, but DGAT specific activity showed significant positive associations with LPAAT (r = 0.54, P < 0.01), total PAP (r = 0.66, P < 0.001), and PAP-1 (r = 0.63, P < 0.01) specific activities. The results on FA compositions of whole muscle tissues provide insight into possible enzyme action associated with the production of specific FA. The increased proportion of oleic acid associated with enhanced lipid content of whole muscle is noteworthy given the known health benefits of this FA.

  8. Identification of a novel operon in Lactococcus lactis encoding three enzymes for lactic acid synthesis: phosphofructokinase, pyruvate kinase, and lactate dehydrogenase.

    PubMed Central

    Llanos, R M; Harris, C J; Hillier, A J; Davidson, B E

    1993-01-01

    The discovery of a novel multicistronic operon that encodes phosphofructokinase, pyruvate kinase, and lactate dehydrogenase in the lactic acid bacterium Lactococcus lactis is reported. The three genes in the operon, designated pfk, pyk, and ldh, contain 340, 502, and 325 codons, respectively. The intergenic distances are 87 bp between pfk and pyk and 117 bp between pyk and ldh. Plasmids containing pfk and pyk conferred phosphofructokinase and pyruvate kinase activity, respectively, on their host. The identity of ldh was established previously by the same approach (R. M. Llanos, A. J. Hillier, and B. E. Davidson, J. Bacteriol. 174:6956-6964, 1992). Each of the genes is preceded by a potential ribosome binding site. The operon is expressed in a 4.1-kb transcript. The 5' end of the transcript was determined to be a G nucleotide positioned 81 bp upstream from the pfk start codon. The pattern of codon usage within the operon is highly biased, with 11 unused amino acid codons. This degree of bias suggests that the operon is highly expressed. The three proteins encoded on the operon are key enzymes in the Embden-Meyerhoff pathway, the central pathway of energy production and lactic acid synthesis in L. lactis. For this reason, we have called the operon the las (lactic acid synthesis) operon. Images PMID:8478320

  9. The hydroxymethyldihydropterin pyrophosphokinase domain of the multifunctional folic acid synthesis Fas protein of Pneumocystis carinii expressed as an independent enzyme in Escherichia coli: refolding and characterization of the recombinant enzyme.

    PubMed

    Ballantine, S P; Volpe, F; Delves, C J

    1994-08-01

    The folic acid synthesis (Fas) protein of Pneumocystis carinii is a multifunctional enzyme containing dihydroneopterin aldolase, 6-hydroxymethyl-7,8-dihydropterin pyrophosphokinase (PPPK), and dihydropteroate synthase activities. Isolation of the stretch of fas cDNA shown by amino acid similarity to the bacterial counterparts to code for PPPK activity (fasC domain) is described. FasC was expressed to high levels in Escherichia coli inclusion bodies using an inducible tac promoter expression system. Solubilization of the inclusion bodies in 6 M guanidine hydrochloride and refolding of the recombinant protein yielded enzymatically active PPPK which was purified to homogeneity by anion-exchange and gel-filtration chromatography. Sequence analysis showed that the first 13 amino acids of the purified protein were in agreement with those predicted from the DNA sequence and, furthermore, that the amino-terminal methionine had been removed. The enzyme is active in the monomeric form, exhibiting maximum activity at around pH 8.0. Isoelectric focusing gave a pI of 9.1. The Km value for 6-hydroxymethyl-7,8-dihydropterin was 3.6 microM in 50 mM Tris buffer, pH 8.2. The production of independently folded, active P. carinii PPPK will allow detailed biochemical and structural studies, increasing our understanding of this enzyme domain.

  10. Δ9-Tetrahydrocannabinolic acid synthase: The application of a plant secondary metabolite enzyme in biocatalytic chemical synthesis.

    PubMed

    Lange, Kerstin; Schmid, Andreas; Julsing, Mattijs K

    2016-09-10

    Δ(9)-Tetrahydrocannabinolic acid synthase (THCAS) from the secondary metabolism of Cannabis sativa L. catalyzes the oxidative formation of an intramolecular CC bond in cannabigerolic acid (CBGA) to synthesize Δ(9)-tetrahydrocannabinolic acid (THCA), which is the direct precursor of Δ(9)-tetrahydrocannabinol (Δ(9)-THC). Aiming on a biotechnological production of cannabinoids, we investigated the potential of the heterologously produced plant oxidase in a cell-free system on preparative scale. THCAS was characterized in an aqueous/organic two-liquid phase setup in order to solubilize the hydrophobic substrate and to allow in situ product removal. Compared to the single phase aqueous setup the specific activity decreased by a factor of approximately 2 pointing to a substrate limitation of CBGA in the two-liquid phase system. However, the specific activity remained stable for at least 3h illustrating the benefit of the two-liquid phase setup. In a repeated-batch setup, THCAS showed only a minor loss of specific activity in the third batch pointing to a high intrinsic stability and high solvent tolerance of the enzyme. Maximal space-time-yields of 0.121gL(-1)h(-1) were reached proving the two-liquid phase concept suitable for biotechnological production of cannabinoids. PMID:27369551

  11. Fumarate and cytosolic pH as modulators of the synthesis or consumption of C(4) organic acids through NADP-malic enzyme in Arabidopsis thaliana.

    PubMed

    Arias, Cintia Lucía; Andreo, Carlos Santiago; Drincovich, María Fabiana; Gerrard Wheeler, Mariel Claudia

    2013-02-01

    Arabidopsis thaliana is a plant species that accumulates high levels of organic acids and uses them as carbon, energy and reducing power sources. Among the enzymes that metabolize these compounds, one of the most important ones is malic enzyme (ME). A. thaliana contains four malic enzymes (NADP-ME 1-4) to catalyze the reversible oxidative decarboxylation of malate in the presence of NADP. NADP-ME2 is the only one located in the cell cytosol of all Arabidopsis organs providing most of the total NADP-ME activity. In the present work, the regulation of this key enzyme by fumarate was investigated by kinetic assays, structural analysis and a site-directed mutagenesis approach. The final effect of this metabolite on NADP-ME2 forward activity not only depends on fumarate and substrate concentrations but also on the pH of the reaction medium. Fumarate produced an increase in NADP-ME2 activity by binding to an allosteric site. However at higher concentrations, fumarate caused a competitive inhibition, excluding the substrate malate from binding to the active site. The characterization of ME2-R115A mutant, which is not activated by fumarate, confirms this hypothesis. In addition, the reverse reaction (reductive carboxylation of pyruvate) is also modulated by fumarate, but in a different way. The results indicate pH-dependence of the fumarate modulation with opposite behavior on the two activities analyzed. Thereby, the coordinated action of fumarate over the direct and reverse reactions would allow a precise and specific modulation of the metabolic flux through this enzyme, leading to the synthesis or degradation of C(4) compounds under certain conditions. Thus, the physiological context might be exerting an accurate control of ME activity in planta, through changes in metabolite and substrate concentrations and cytosolic pH.

  12. Dietary gallate esters of tea catechins reduce deposition of visceral fat, hepatic triacylglycerol, and activities of hepatic enzymes related to fatty acid synthesis in rats.

    PubMed

    Ikeda, Ikuo; Hamamoto, Reina; Uzu, Kazunori; Imaizumi, Katsumi; Nagao, Koji; Yanagita, Teruyoshi; Suzuki, Yuko; Kobayashi, Makoto; Kakuda, Takami

    2005-05-01

    Tea catechins, rich in (-)-epigallocatechin gallate and (-)-epicatechin gallate, or heat-treated tea catechins in which about 50% of the (-)-epigallocatechin gallate and (-)-epicatechin gallate in tea catechins was epimerized to (-)-gallocatechin gallate and (-)-catechin gallate, were fed to rats at 1% level for 23 d. Visceral fat deposition and the concentration of hepatic triacylglycerol were significantly lower in the tea catechin and heat-treated tea catechin groups than in the control group. The activities of fatty acid synthase and the malic enzyme in the liver cytosol were significantly lower in the two catechin groups than in the control group. In contrast, the activities of carnitine palmitoyltransferase and acyl-CoA oxidase in the liver homogenate were not significantly different among the three groups. These results suggest that the reduction in activities of enzymes related to hepatic fatty acid synthesis by the feeding of tea catechins or heat-treated tea catechins can cause reductions of hepatic triacylglycerol and possibly of visceral fat deposition.

  13. The Yeast Eukaryotic Translation Initiation Factor 2B Translation Initiation Complex Interacts with the Fatty Acid Synthesis Enzyme YBR159W and Endoplasmic Reticulum Membranes

    PubMed Central

    Browne, Christopher M.; Samir, Parimal; Fites, J. Scott; Villarreal, Seth A.

    2013-01-01

    Using affinity purifications coupled with mass spectrometry and yeast two-hybrid assays, we show the Saccharomyces cerevisiae translation initiation factor complex eukaryotic translation initiation factor 2B (eIF2B) and the very-long-chain fatty acid (VLCFA) synthesis keto-reductase enzyme YBR159W physically interact. The data show that the interaction is specifically between YBR159W and eIF2B and not between other members of the translation initiation or VLCFA pathways. A ybr159wΔ null strain has a slow-growth phenotype and a reduced translation rate but a normal GCN4 response to amino acid starvation. Although YBR159W localizes to the endoplasmic reticulum membrane, subcellular fractionation experiments show that a fraction of eIF2B cofractionates with lipid membranes in a YBR159W-independent manner. We show that a ybr159wΔ yeast strain and other strains with null mutations in the VLCFA pathway cause eIF2B to appear as numerous foci throughout the cytoplasm. PMID:23263984

  14. Synthesis of amino acids

    DOEpatents

    Davis, J.W. Jr.

    1979-09-21

    A method is described for synthesizing amino acids preceding through novel intermediates of the formulas: R/sub 1/R/sub 2/C(OSOC1)CN, R/sub 1/R/sub 2/C(C1)CN and (R/sub 1/R/sub 2/C(CN)O)/sub 2/SO wherein R/sub 1/ and R/sub 2/ are each selected from hydrogen and monovalent hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  15. Activity and mRNA Levels of Enzymes Involved in Hepatic Fatty Acid Synthesis in Rats Fed Naringenin.

    PubMed

    Hashimoto, Toru; Ide, Takashi

    2015-11-01

    We investigated the physiological activity of naringenin in affecting hepatic lipogenesis and serum and liver lipid levels in rats. Rats were fed diets containing 0, 1, or 2.5 g/kg naringenin for 15 d. Naringenin at a dietary level of 2.5 g/kg significantly decreased the activities and the mRNA levels of various lipogenic enzymes and sterol regulatory element binding protein-1c (SREBP-1c) mRNA level. The activities and the mRNA levels were also 9-22% and 12-38% lower, respectively, in rats fed a 1 g/kg naringenin diet than in the animals fed a naringenin-free diet, although the differences were not significant in many cases. Naringenin at 2.5 g/kg significantly lowered serum triacylglycerol, cholesterol, and phospholipid and hepatic triacylglycerol and cholesterol. This flavonoid at 1.0 g/kg also significantly lowered these parameters except for serum triacylglycerol. Naringenin levels in serum and liver dose-dependently increased, and hepatic concentrations reached levels that can affect various signaling pathways.

  16. Phosphatidic Acid Synthesis in Bacteria

    PubMed Central

    Yao, Jiangwei; Rock, Charles O.

    2012-01-01

    Membrane phospholipid synthesis is a vital facet of bacterial physiology. Although the spectrum of phospholipid headgroup structures produced by bacteria is large, the key precursor to all of these molecules is phosphatidic acid (PtdOH). Glycerol-3-phosphate derived from the glycolysis via glycerol-phosphate synthase is the universal source for the glycerol backbone of PtdOH. There are two distinct families of enzymes responsible for the acylation of the 1-position of glycerol-3-phosphate. The PlsB acyltransferase was discovered in Escherichia coli, and homologs are present in many eukaryotes. This protein family primarily uses acyl-acyl carrier protein (ACP) endproducts of fatty acid synthesis as acyl donors, but may also use acyl-CoA derived from exogenous fatty acids. The second protein family, PlsY, is more widely distributed in bacteria and utilizes the unique acyl donor, acyl-phosphate, which is produced from acyl-ACP by the enzyme PlsX. The acylation of the 2-position is carried out by members of the PlsC protein family. All PlsCs use acyl-ACP as the acyl donor, although the PlsCs of the γ-proteobacteria also may use acyl-CoA. Phospholipid headgroups are precursors in the biosynthesis of other membrane-associated molecules and the diacylglycerol product of these reactions is converted to PtdOH by one of two distinct families of lipid kinases. The central importance of the de novo and recycling pathways to PtdOH in cell physiology suggest these enzymes are suitable targets for the development of antibacterial therapeutics in Gram-positive pathogens. This article is part of a Special Issue entitled Phospholipids and Phospholipid Metabolism. PMID:22981714

  17. Enzymatic synthesis of cinnamic acid derivatives.

    PubMed

    Lee, Gia-Sheu; Widjaja, Arief; Ju, Yi-Hsu

    2006-04-01

    Using Novozym 435 as catalyst, the syntheses of ethyl ferulate (EF) from ferulic acid (4-hydroxy 3-methoxy cinnamic acid) and ethanol, and octyl methoxycinnamate (OMC) from p-methoxycinnamic acid and 2-ethyl hexanol were successfully carried out in this study. A conversion of 87% was obtained within 2 days at 75 degrees C for the synthesis of EF. For the synthesis of OMC at 80 degrees C, 90% conversion can be obtained within 1 day. The use of solvent and high reaction temperature resulted in better conversion for the synthesis of cinnamic acid derivatives. Some cinnamic acid esters could also be obtained with higher conversion and shorter reaction times in comparison to other methods reported in the literature. The enzyme can be reused several times before significant activity loss was observed.

  18. Abscisic Acid Synthesis and Response

    PubMed Central

    Finkelstein, Ruth

    2013-01-01

    Abscisic acid (ABA) is one of the “classical” plant hormones, i.e. discovered at least 50 years ago, that regulates many aspects of plant growth and development. This chapter reviews our current understanding of ABA synthesis, metabolism, transport, and signal transduction, emphasizing knowledge gained from studies of Arabidopsis. A combination of genetic, molecular and biochemical studies has identified nearly all of the enzymes involved in ABA metabolism, almost 200 loci regulating ABA response, and thousands of genes regulated by ABA in various contexts. Some of these regulators are implicated in cross-talk with other developmental, environmental or hormonal signals. Specific details of the ABA signaling mechanisms vary among tissues or developmental stages; these are discussed in the context of ABA effects on seed maturation, germination, seedling growth, vegetative stress responses, stomatal regulation, pathogen response, flowering, and senescence. PMID:24273463

  19. Horseradish peroxidase-catalyzed synthesis of poly(thiophene-3-boronic acid) biocomposites for mono-/bi-enzyme immobilization and amperometric biosensing.

    PubMed

    Huang, Yi; Wang, Wen; Li, Zou; Qin, Xiaoli; Bu, Lijuan; Tang, Zhiyong; Fu, Yingchun; Ma, Ming; Xie, Qingji; Yao, Shouzhuo; Hu, Jiming

    2013-06-15

    We report here on a facile enzymatic polymerization protocol to prepare enzyme-poly(thiophene-3-boronic acid) (PTBA) polymeric biocomposites (PBCs) for high-performance mono-/bi-enzyme amperometric biosensing. Horseradish peroxidase (HRP)-catalyzed polymerization of thiophene-3-boronic acid (TBA) monomer was conducted in aqueous solution containing HRP (or plus glucose oxidase (GOx)) by either directly added or GOx-glucose generated oxidant H2O2. The mono-/bi-enzyme amperometric biosensors were prepared simply by casting the dialysis-isolated PBCs on Au-plated Au electrode (Auplate/Au), followed by coating with an outer-layer chitosan (CS) film. The boronic acid residues are capable of covalent bonding with enzyme at the glycosyl sites (boronic acid-diols interaction), which should less affect the enzymatic activity as compared with the common cases of covalent bonding at the peptide chains, and UV-vis spectrophotometric tests confirmed that the encapsulated HRP almost possesses its pristine enzymatic specific activity. The enzyme electrodes were studied by cyclic voltammetry, electrochemical impedance spectroscopy and chronoamperometry in the presence of Fe(CN)6(4-) mediator. The CS/HRP-PTBA/Auplate/Au electrode responded linearly to H2O2 concentration from 1 to 300 μM with a sensitivity of 390 μA mM(-1)cm(-2) and a limit of detection (LOD) of 0.1 μM. The bienzyme CS/GOx-HRP-PTBA(H2O2)/Auplate/Au electrode responded linearly to glucose concentration from 5 μM to 0.83 mM with a sensitivity of 75.1 μA mM(-1)cm(-2) and a LOD of 1 μM, and it is found here that the use of Fe(CN)6(4-) that can only efficiently mediate HRP favorably avoids the "unusual amperometric responses" observed when other mediators that can efficiently turn over both HRP and GOx are used. PMID:23391705

  20. Synthesis of screening substrates for the directed evolution of sialic acid aldolase: towards tailored enzymes for the preparation of influenza A sialidase inhibitor analogues.

    PubMed

    Woodhall, Thomas; Williams, Gavin; Berry, Alan; Nelson, Adam

    2005-05-01

    The stereoselective synthesis of two epimeric screening substrates, (4R, 5R, 6R)- and (4S, 5R, 6R)-6-dipropylcarbamoyl-2-oxo-4,5,6-trihydroxy-hexanoic acid, for the directed evolution of sialic acid aldolase is described. The complementary methods relied on stereoselective indium-mediated additions of ethyl alpha-bromomethyl acrylate to functionalised aldehydes. With an alpha-hydroxy aldehyde, (2R, 3R)-2,3-dihydroxy-4-oxo butanoic acid dipropylamide, the addition was chelation controlled, and the syn product, (6R, 5R, 4S)-6-dipropylcarbamoyl-2-methylidene-4,5,6-trihydroxy-hexanoic acid ethyl ester, was obtained. In contrast, the stereochemical outcome of the addition to (2R, 3R)-N,N-dipropyl-2,3-O-isopropylidene-4-oxobutyramide was consistent with Felkin-Anh control, and the anti adduct, (4R, 5R, 6R)-6-dipropylcarbamoyl-2-methylidene-4-hydroxy-5,6-O-isopropylidene-hexanoic acid ethyl ester, was the major product. Ozonolysis and deprotection gave the screening substrates as mixtures of furanose and pyranose forms, in good yields.

  1. Genome-Wide Identification of BAHD Acyltransferases and In vivo Characterization of HQT-like Enzymes Involved in Caffeoylquinic Acid Synthesis in Globe Artichoke

    PubMed Central

    Moglia, Andrea; Acquadro, Alberto; Eljounaidi, Kaouthar; Milani, Anna M.; Cagliero, Cecilia; Rubiolo, Patrizia; Genre, Andrea; Cankar, Katarina; Beekwilder, Jules; Comino, Cinzia

    2016-01-01

    Globe artichoke (Cynara cardunculus L. var. scolymus) is a rich source of compounds promoting human health (phytonutrients), among them caffeoylquinic acids (CQAs), mainly represented by chlorogenic acid (CGA), and dicaffeoylquinic acids (diCQAs). The enzymes involved in their biosynthesis belong to the large family of BAHD acyltransferases. Following a survey of the globe artichoke genome, we identified 69 BAHD proteins carrying the catalytic site (HXXXD). Their phylogenetic analysis together with another 43 proteins, from 21 species, representative of the BAHD family, highlighted their grouping in seven major clades. Nine globe artichoke acyltransferases clustered in a sub-group of Clade V, with 3 belonging to hydroxycinnamoyl-CoA:quinate hydroxycinnamoyl transferase (HQT) and 2 to hydroxycinnamoyl-CoA:shikimate/quinate hydroxycinnamoyl transferase (HCT) like proteins. We focused our attention on the former, HQT1, HQT2, and HQT3, as they are known to play a key role in CGA biosynthesis. The expression of genes coding for the three HQTs and correlation of expression with the CQA content is reported for different globe artichoke tissues. For the first time in the globe artichoke, we developed and applied the virus-induced gene silencing approach with the goal of assessing in vivo the effect of HQT1 silencing, which resulted in a marked reduction of both CGA and diCQAs. On the other hand, when the role of the three HQTs was assessed in leaves of Nicotiana benthamiana through their transient overexpression, significant increases in mono- and diCQAs content were observed. Using transient GFP fusion proteins expressed in N. benthamiana leaves we also established the sub-cellular localization of these three enzymes. PMID:27721818

  2. Rhodotorula glutinis Phenylalanine/Tyrosine Ammonia Lyase Enzyme Catalyzed Synthesis of the Methyl Ester of para-Hydroxycinnamic Acid and its Potential Antibacterial Activity.

    PubMed

    MacDonald, Marybeth C; Arivalagan, Pugazhendhi; Barre, Douglas E; MacInnis, Judith A; D'Cunha, Godwin B

    2016-01-01

    Biotransformation of L-tyrosine methyl ester (L-TM) to the methyl ester of para- hydroxycinnamic acid (p-HCAM) using Rhodotorula glutinis yeast phenylalanine/tyrosine ammonia lyase (PTAL; EC 4.3.1.26) enzyme was successfully demonstrated for the first time; progress of the reaction was followed by spectrophotometric determination at 315 nm. The following conditions were optimized for maximal formation of p-HCAM: pH (8.5), temperature (37°C), speed of agitation (50 rpm), enzyme concentration (0.080 μM), and substrate concentration (0.50 mM). Under these conditions, the yield of the reaction was ∼15% in 1 h incubation period and ∼63% after an overnight (∼18 h) incubation period. The product (p-HCAM) of the reaction of PTAL with L-TM was confirmed using Nuclear Magnetic Resonance spectroscopy (NMR). Fourier Transform Infra-Red spectroscopy (FTIR) was carried out to rule out potential hydrolysis of p-HCAM during overnight incubation. Potential antibacterial activity of p-HCAM was tested against several strains of Gram-positive and Gram-negative bacteria. This study describes a synthetically useful transformation, and could have future clinical and industrial applications.

  3. Rhodotorula glutinis Phenylalanine/Tyrosine Ammonia Lyase Enzyme Catalyzed Synthesis of the Methyl Ester of para-Hydroxycinnamic Acid and its Potential Antibacterial Activity

    PubMed Central

    MacDonald, Marybeth C.; Arivalagan, Pugazhendhi; Barre, Douglas E.; MacInnis, Judith A.; D’Cunha, Godwin B.

    2016-01-01

    Biotransformation of L-tyrosine methyl ester (L-TM) to the methyl ester of para- hydroxycinnamic acid (p-HCAM) using Rhodotorula glutinis yeast phenylalanine/tyrosine ammonia lyase (PTAL; EC 4.3.1.26) enzyme was successfully demonstrated for the first time; progress of the reaction was followed by spectrophotometric determination at 315 nm. The following conditions were optimized for maximal formation of p-HCAM: pH (8.5), temperature (37°C), speed of agitation (50 rpm), enzyme concentration (0.080 μM), and substrate concentration (0.50 mM). Under these conditions, the yield of the reaction was ∼15% in 1 h incubation period and ∼63% after an overnight (∼18 h) incubation period. The product (p-HCAM) of the reaction of PTAL with L-TM was confirmed using Nuclear Magnetic Resonance spectroscopy (NMR). Fourier Transform Infra-Red spectroscopy (FTIR) was carried out to rule out potential hydrolysis of p-HCAM during overnight incubation. Potential antibacterial activity of p-HCAM was tested against several strains of Gram-positive and Gram-negative bacteria. This study describes a synthetically useful transformation, and could have future clinical and industrial applications. PMID:27014206

  4. Enzymic synthesis of indole-3-acetyl-1-O-beta-d-glucose. II. Metabolic characteristics of the enzyme

    NASA Technical Reports Server (NTRS)

    Leznicki, A. J.; Bandurski, R. S.

    1988-01-01

    The synthesis of indole-3-acetyl-1-O-beta-D-glucose from indole-3-acetic acid (IAA) and uridine diphosphoglucose (UDPG) has been shown to be a reversible reaction with the equilibrium away from ester formation and toward formation of IAA. The enzyme occurs primarily in the liquid endosperm of the corn kernel but some activity occurs in the embryo. It is relatively specific showing no glucose ester formation with oxindole-3-acetic acid or 7-hydroxy-oxindole-3-acetic acid, and low activity with phenylpropene acids, such as rho-coumaric acid. The enzyme is also specific for the nucleotide sugar showing no activity with UDPGalactose or UDPXylose. The enzyme is inhibited by inorganic pyrophosphate, by phosphate esters and by phospholipids, particularly phosphatidyl ethanolamine. The enzyme is inhibited by zeatin, by 2,4-dichlorophenoxy-acetic acid, by IAA-myo-inositol and IAA-glucan, but not by zeatin riboside, and only weakly by gibberellic acid, abscisic acid and kinetin. The reaction is slightly stimulated by both calcium and calmodulin and, in some cases, by thiol compounds. The role of this enzyme in the homeostatic control of indole-3-acetic acid levels in Zea mays is discussed.

  5. [Enzyme immunoassay of usnic acid in lichens].

    PubMed

    Burkin, A A; Kononenko, G P; Tolpysheva, T Iu

    2013-01-01

    An enzyme immunoassay for usnic acid in lichens was developed, the sensitivity of which was 0.1 microg/g of air-dried material (0.00001%). Polyclonal rabbit antibodies against bovine serum albumin conjugated to (+)-usnic acid under the conditions of formaldehyde condensation made it possible to determine the analyzed substance in solutions at concentrations from 1 ng/mL when it interacts with an immobilized gelatin conjugate homologous in the binding mode. Usnic acid in 2-26600 microg/g (0.0002-2.6%) amounts was found in all 236 studied samples of lichens belonging to 53 species and 8 families.

  6. A new amino acid, 3-(2,5-SS-dicysteinyl-3,4-dihydroxyphenyl)alanine, from the tapetum lucidum of the gar (Lepisosteidae) and its enzymic synthesis.

    PubMed

    Ito, S; Nicol, J A

    1977-03-01

    The tapetum lucidum of the alligator gar Lepisosteus was shown by t.l.c. to contain a new phenolic amino acid, which is apparently a major constituent of the reflecting material. It was isolated in a yield of 0.5 mg/eye and its physical and chemical characteristics, especially reductive hydrolysis with hydriodic acid giving dopa (3,4-dihydroxyphenylalanine) and cysteine, suggested that it might to SS-dicysteinyldopa. Tyrosinase oxidation of L-dopa in the presence of an excess of L-cysteine yielded, in addition to known 5- and 2-S-cysteinyldopa, the same amino acid as that isolated from the eye of the gar, thus confirming the gross structure. The position of the two cysteine residues was established by the fact that tyrosinase oxidation of catechol and cyteine gave 3-S-cysteinylcatechol and 3,6-SS-dicysteinylcatechol. The natural amino acid is therefore formulated as 3-(2,5-SS-dicysteinyl-3,4-dihydroxyphenyl)alanine (2,5-SS-dicysteinyldopa), which may be formed by two consecutive additions of cysteine, first to dopaquinone and then to 5-S-cysteinyldopaquinone. The enzymic synthesis of 2,5-SS-dicysteinyldopa in vitro suggests that it may also be involved in the biosynthesis of phaeomelanin. PMID:403909

  7. A new amino acid, 3-(2,5-SS-dicysteinyl-3,4-dihydroxyphenyl)alanine, from the tapetum lucidum of the gar (Lepisosteidae) and its enzymic synthesis.

    PubMed

    Ito, S; Nicol, J A

    1977-03-01

    The tapetum lucidum of the alligator gar Lepisosteus was shown by t.l.c. to contain a new phenolic amino acid, which is apparently a major constituent of the reflecting material. It was isolated in a yield of 0.5 mg/eye and its physical and chemical characteristics, especially reductive hydrolysis with hydriodic acid giving dopa (3,4-dihydroxyphenylalanine) and cysteine, suggested that it might to SS-dicysteinyldopa. Tyrosinase oxidation of L-dopa in the presence of an excess of L-cysteine yielded, in addition to known 5- and 2-S-cysteinyldopa, the same amino acid as that isolated from the eye of the gar, thus confirming the gross structure. The position of the two cysteine residues was established by the fact that tyrosinase oxidation of catechol and cyteine gave 3-S-cysteinylcatechol and 3,6-SS-dicysteinylcatechol. The natural amino acid is therefore formulated as 3-(2,5-SS-dicysteinyl-3,4-dihydroxyphenyl)alanine (2,5-SS-dicysteinyldopa), which may be formed by two consecutive additions of cysteine, first to dopaquinone and then to 5-S-cysteinyldopaquinone. The enzymic synthesis of 2,5-SS-dicysteinyldopa in vitro suggests that it may also be involved in the biosynthesis of phaeomelanin.

  8. A new amino acid, 3-(2,5-SS-dicysteinyl-3,4-dihydroxyphenyl)alanine, from the tapetum lucidum of the gar (Lepisosteidae) and its enzymic synthesis.

    PubMed Central

    Ito, S; Nicol, J A

    1977-01-01

    The tapetum lucidum of the alligator gar Lepisosteus was shown by t.l.c. to contain a new phenolic amino acid, which is apparently a major constituent of the reflecting material. It was isolated in a yield of 0.5 mg/eye and its physical and chemical characteristics, especially reductive hydrolysis with hydriodic acid giving dopa (3,4-dihydroxyphenylalanine) and cysteine, suggested that it might to SS-dicysteinyldopa. Tyrosinase oxidation of L-dopa in the presence of an excess of L-cysteine yielded, in addition to known 5- and 2-S-cysteinyldopa, the same amino acid as that isolated from the eye of the gar, thus confirming the gross structure. The position of the two cysteine residues was established by the fact that tyrosinase oxidation of catechol and cyteine gave 3-S-cysteinylcatechol and 3,6-SS-dicysteinylcatechol. The natural amino acid is therefore formulated as 3-(2,5-SS-dicysteinyl-3,4-dihydroxyphenyl)alanine (2,5-SS-dicysteinyldopa), which may be formed by two consecutive additions of cysteine, first to dopaquinone and then to 5-S-cysteinyldopaquinone. The enzymic synthesis of 2,5-SS-dicysteinyldopa in vitro suggests that it may also be involved in the biosynthesis of phaeomelanin. PMID:403909

  9. Enzyme immunoassay for carminic acid in foods.

    PubMed

    Yoshida, A; Takagaki, Y; Nishimune, T

    1995-01-01

    A competitive enzyme immunoassay (EIA) for carminic acid was investigated. Monoclonal anticarminic acid antibody was obtained from A/J mice immunized with carminic acid-human immunoglobulin G (IgG) conjugate. Carminic acid was extracted with distilled water from beverage, jelly, candy, pasta sauce, yogurt, or ice cream samples. Ham or fish paste samples were digested with pronase, then carminic acid was extracted from samples with sodium hydroxide solution. The extract was diluted more than 10-fold with 1% gelatin in borate buffer solution. Microtiter plates were coated with carminic acid-bovine serum albumin (BSA) conjugate or just BSA. Goat anti-mouse IgG(H+L)-peroxidase complex was used as a second antibody, and 3,3',5,5'-tetramethylbenzidine was used as a substrate for the peroxidase. The working range for quantitative analysis was 0.3-10 ng/mL, and the detection limit was 0.2 micrograms/g original sample. Recoveries of carminic acid by this assay were > 95% for milk beverage and jelly, and > 85% for yogurt and fish paste. Carminic acid was detected in 7 of 26 red-colored commercial food products and ranged from 3.5 to 356 micrograms/g. This EIA system also responded to the structural analogue of carminic acid, laccaic acid. PMID:7756895

  10. Dual Enzyme-Responsive Capsules of Hyaluronic Acid-block-Poly(Lactic Acid) for Sensing Bacterial Enzymes.

    PubMed

    Tücking, Katrin-Stephanie; Grützner, Verena; Unger, Ronald E; Schönherr, Holger

    2015-07-01

    The synthesis of novel amphiphilic hyaluronic acid (HYA) and poly(lactic acid) (PLA) block copolymers is reported as the key element of a strategy to detect the presence of pathogenic bacterial enzymes. In addition to the formation of defined HYA-block-PLA assemblies, the encapsulation of fluorescent reporter dyes and the selective enzymatic degradation of the capsules by hyaluronidase and proteinase K are studied. The synthesis of the dual enzyme-responsive HYA-b-PLA is carried out by copper-catalyzed Huisgen 1,3-dipolar cycloaddition. The resulting copolymers are assembled in water to form vesicular structures, which are characterized by scanning electron microscopy, transmission electron microscopy, dynamic light scattering (DLS), and fluorescence lifetime imaging microscopy (FLIM). DLS measurements show that both enzymes cause a rapid decrease in the hydrodynamic diameter of the nanocapsules. Fluorescence spectroscopy data confirm the liberation of encapsulated dye, which indicates the disintegration of the capsules and validates the concept of enzymatically triggered payload release. Finally, cytotoxicity assays confirm that the HYA-b-PLA nanocapsules are biocompatible with primary human dermal microvascular endothelial cells. PMID:25940300

  11. Dual Enzyme-Responsive Capsules of Hyaluronic Acid-block-Poly(Lactic Acid) for Sensing Bacterial Enzymes.

    PubMed

    Tücking, Katrin-Stephanie; Grützner, Verena; Unger, Ronald E; Schönherr, Holger

    2015-07-01

    The synthesis of novel amphiphilic hyaluronic acid (HYA) and poly(lactic acid) (PLA) block copolymers is reported as the key element of a strategy to detect the presence of pathogenic bacterial enzymes. In addition to the formation of defined HYA-block-PLA assemblies, the encapsulation of fluorescent reporter dyes and the selective enzymatic degradation of the capsules by hyaluronidase and proteinase K are studied. The synthesis of the dual enzyme-responsive HYA-b-PLA is carried out by copper-catalyzed Huisgen 1,3-dipolar cycloaddition. The resulting copolymers are assembled in water to form vesicular structures, which are characterized by scanning electron microscopy, transmission electron microscopy, dynamic light scattering (DLS), and fluorescence lifetime imaging microscopy (FLIM). DLS measurements show that both enzymes cause a rapid decrease in the hydrodynamic diameter of the nanocapsules. Fluorescence spectroscopy data confirm the liberation of encapsulated dye, which indicates the disintegration of the capsules and validates the concept of enzymatically triggered payload release. Finally, cytotoxicity assays confirm that the HYA-b-PLA nanocapsules are biocompatible with primary human dermal microvascular endothelial cells.

  12. Chronic ethanol feeding modulates the synthesis of digestive enzymes

    SciTech Connect

    Ponnappa, B.C.; Hoek, J.B.; Rubin, E.

    1987-05-01

    The effects of chronic ethanol feeding on pancreatic protein synthesis were investigated. Protein synthesis was assessed by studying the rate of incorporation of /sup 3/H-leucine into TCA-precipitable proteins in isolated pancreatic acini from rats. Chronic ethanol ingestion increased the rate of pancreatic protein synthesis by 2-4 fold. The onset of the increase in protein synthesis was detectable two days after ethanol feeding, reached a maximum after 7 days and remained unchanged after 4 months on the ethanol-containing diet. The rate of synthesis of individual digestive enzymes was studied by SDS-PAGE on extracts obtained from purified zymogen granules. Ethanol feeding induced an increase in the rate of synthesis of most of the digestive enzymes; chymotrypsinogen, trypsinogen and an unidentified protein were increased to a greater extent than other digestive enzymes. By contrast, the synthesis of amylase was selectively decreased after ethanol feeding. These results suggest that chronic ethanol ingestion has specific effects on the rate of synthesis of individual digestive enzymes in the exocrine pancreas.

  13. Energetics of amino acid synthesis in hydrothermal ecosystems

    NASA Technical Reports Server (NTRS)

    Amend, J. P.; Shock, E. L.

    1998-01-01

    Thermodynamic calculations showed that the autotrophic synthesis of all 20 protein-forming amino acids was energetically favored in hot (100 degrees C), moderately reduced, submarine hydrothermal solutions relative to the synthesis in cold (18 degrees C), oxidized, surface seawater. The net synthesis reactions of 11 amino acids were exergonic in the hydrothermal solution, but all were endergonic in surface seawater. The synthesis of the requisite amino acids of nine thermophilic and hyperthermophilic proteins in a 100 degreesC hydrothermal solution yielded between 600 and 8000 kilojoules per mole of protein, which is energy that is available to drive the intracellular synthesis of enzymes and other biopolymers in hyperthermophiles thriving in these ecosystems.

  14. Typical Lignocellulose-degrading Enzymes: a Synthesis of Kinetic Properties

    NASA Astrophysics Data System (ADS)

    Wang, G.; Post, W. M.; Mayes, M. A.; Frerichs, J.; Jagadamma, S.

    2011-12-01

    While soil enzymes have been explicitly included in the soil organic carbon (SOC) decomposition models, there are big concerns on the model parameterization. Our object is to study the kinetic parameters of five typical lignocellulose-degrading enzymes through literature research and data synthesis. The kinetic parameters refer to the maximum specific enzyme activity (Vmax) and half-saturation constant (Km) in the Michaelis-Menton equation. The Activation energy (Ea) and the pH optimum and sensitivity (pHopt and pHsen) were also analyzed. pHsen was estimated by curve fitting of an exponential-quadratic function. The Vmax values in different units under various conditions were converted into the same units at a reference temperature (20°C) and optimum pH. The scaling issue on Vmax and Km and the effects of soil temperature, pH, and SWC were discussed later. Major findings are summarized as follows. (i) Both Vmax and Km are log-normal distributed. (ii) No significant difference in Vmax is found between groups (ligninases and cellulases). The one-standard-deviation interval of Vmax falls within 10-1000 (mean ≈ 100) mg C mg^-1 Enz h^-1. However, there is significant difference in Km between groups. (iii) Significant difference in activation energy, i.e., 53±17 and 37±15 kJ mol^-1 is found for ligninases and cellulases, respectively. (iv) Both ligninases and cellulases prefer to acid environment. The average ratio of pHsen to pHopt ranges 0.3-0.4 and the optimum pH for ligninases is significantly lower than pHopt for cellulases. (v) A preliminary analysis of Vmax indicates a scaling factor 0.01-0.1 for transforming the Vmax from lab measurements to SOC decomposition models. This study provides useful information for the parameterization of enzyme-driven SOC decomposition models.

  15. Unnatural amino acid mutagenesis-based enzyme engineering.

    PubMed

    Ravikumar, Yuvaraj; Nadarajan, Saravanan Prabhu; Yoo, Tae Hyeon; Lee, Chong-soon; Yun, Hyungdon

    2015-08-01

    Traditional enzyme engineering relies on substituting one amino acid by one of the other 19 natural amino acids to change the functional properties of an enzyme. However, incorporation of unnatural amino acids (UAAs) has been harnessed to engineer efficient enzymes for biocatalysis. Residue-specific and site-specific in vivo incorporation methods are becoming the preferred approach for producing enzymes with altered or improved functions. We describe the contribution of in vivo UAA incorporation methodologies to enzyme engineering as well as the future prospects for the field, including the integration of UAAs with other new advances in enzyme engineering.

  16. Abiotic synthesis of fatty acids

    NASA Technical Reports Server (NTRS)

    Leach, W. W.; Nooner, D. W.; Oro, J.

    1978-01-01

    The formation of fatty acids by Fischer-Tropsch-type synthesis was investigated with ferric oxide, ammonium carbonate, potassium carbonate, powdered Pueblito de Allende carbonaceous chondrite, and filings from the Canyon Diablo meteorite used as catalysts. Products were separated and identified by gas chromatography and mass spectrometry. Iron oxide, Pueblito de Allende chondrite, and Canyon Diablo filings in an oxidized catalyst form yielded no fatty acids. Canyon Diablo filings heated overnight at 500 C while undergoing slow purging by deuterium produced fatty acids only when potassium carbonate was admixed; potassium carbonate alone also produced these compounds. The active catalytic combinations gave relatively high yields of aliphatic and aromatic hydrocarbons; substantial amounts of n-alkenes were almost invariably observed when fatty acids were produced; the latter were in the range C6 to C18, with maximum yield in C9 or 10.

  17. Integrated microdroplet-based system for enzyme synthesis and sampling

    NASA Astrophysics Data System (ADS)

    Lapierre, Florian; Best, Michel; Stewart, Robert; Oakeshott, John; Peat, Thomas; Zhu, Yonggang

    2013-12-01

    Microdroplet-based microfluidic devices are emerging as powerful tools for a wide range of biochemical screenings and analyses. Monodispersed aqueous microdroplets from picoliters to nanoliters in volume are generated inside microfluidic channels within an immiscible oil phase. This results in the formation of emulsions which can contain various reagents for chemical reactions and can be considered as discrete bioreactors. In this paper an integrated microfluidic platform for the synthesis, screening and sorting of libraries of an organophosphate degrading enzyme is presented. The variants of the selected enzyme are synthesized from a DNA source using in-vitro transcription and translation method. The synthesis occurs inside water-in-oil emulsion droplets, acting as bioreactors. Through a fluorescence based detection system, only the most efficient enzymes are selected. All the necessary steps from the enzyme synthesis to selection of the best genes (producing the highest enzyme activity) are thus integrated inside a single and unique device. In the second part of the paper, an innovative design of the microfluidic platform is presented, integrating an electronic prototyping board for ensuring the communication between the various components of the platform (camera, syringe pumps and high voltage power supply), resulting in a future handheld, user-friendly, fully automated device for enzyme synthesis, screening and selection. An overview on the capabilities as well as future perspectives of this new microfluidic platform is provided.

  18. Evidence for messenger ribonucleic acid of an ammonium-inducible glutamate dehydrogenase and synthesis, covalent modification, and degradation of enzyme subunits in uninduced Chlorella sorokiniana cells.

    PubMed Central

    Turner, K J; Bascomb, N F; Lynch, J J; Molin, W T; Thurston, C F; Schmidt, R R

    1981-01-01

    The cells of Chlorella sorokiniana cultured in nitrate medium contain no detectable catalytic activity of an ammonium-inducible nicotinamide adenine dinucleotide phosphate-specific glutamate dehydrogenase (NADP-GDH). However, several lines of experimental evidence indicated that the NADP-GDH messenger ribonucleic acid was present at high levels and was being translated in uninduced cells. First, binding studies with 125I-labeled anti-NADP-GDH immunoglobulin G and total polysomes isolated from uninduced and induced cells showed that NADP-GDH subunits were being synthesized on polysomes from both types of cells. Second, when polyadenylic acid-containing ribonucleic acid was extracted from polysomes from uninduced and induced cells and placed into a messenger ribonucleic acid-dependent in vitro translation system, NADP-GDH subunits were synthesized from the ribonucleic acid from both sources. Third, when ammonia was added to uninduced cells, NADP-GDH antigen accumulated without an apparent induction lag. Fourth, by use of a specific immunoprecipitation procedure coupled to pulse-chase studies with [35S]sulfate, it was shown that the NADP-GDH subunits are rapidly synthesized, covalently modified, and then degraded in uninduced cells. PMID:7217012

  19. Crown gall oncogenesis: evidence that a T-DNA gene from the Agrobacterium Ti plasmid pTiA6 encodes an enzyme that catalyzes synthesis of indoleacetic acid.

    PubMed Central

    Thomashow, L S; Reeves, S; Thomashow, M F

    1984-01-01

    Stable incorporation of tumor-inducing (Ti) plasmid sequences, the T-DNA, into the genomes of dicotyledonous plants results in the formation of crown gall tumors. Previous genetic studies have suggested that the products of the genes encoding transcripts 1 and 2, which are encoded by the TL-DNA region of pTiA6, are responsible for inducing the auxin-independent phenotype of crown gall tissues. Here we report the construction of a plasmid, pMTlacT2, which directs the synthesis of the Mr 49,800 polypeptide encoded by the transcript 2 gene. Cell-free extracts prepared from Escherichia coli harboring this plasmid converted indoleacetamide to indoleacetic acid, the natural auxin of plants; extracts prepared from plasmidless strains of E. coli or strains harboring the cloning vehicle pBR322 did not carry out this reaction. We conclude that the transcript 2 gene of pTiA6 codes for an enzyme that participates in auxin biosynthesis, probably an indoleacetamide hydrolase. Images PMID:6089175

  20. Synthesis of Lipoteichoic Acids in Bacillus anthracis

    PubMed Central

    Garufi, Gabriella; Hendrickx, Antoni P.; Beeri, Karen; Kern, Justin W.; Sharma, Anshika; Richter, Stefan G.; Schneewind, Olaf

    2012-01-01

    Lipoteichoic acid (LTA), a glycerol phosphate polymer, is a component of the envelope of Gram-positive bacteria that has hitherto not been identified in Bacillus anthracis, the causative agent of anthrax. LTA synthesis in Staphylococcus aureus and other microbes is catalyzed by the product of the ltaS gene, a membrane protein that polymerizes polyglycerol phosphate from phosphatidyl glycerol. Here we identified four ltaS homologues, designated ltaS1 to -4, in the genome of Bacillus anthracis. Polyglycerol phosphate-specific monoclonal antibodies were used to detect LTA in the envelope of B. anthracis strain Sterne (pXO1+ pXO2−) vegetative forms. B. anthracis mutants lacking ltaS1, ltaS2, ltaS3, or ltaS4 did not display defects in growth or LTA synthesis. In contrast, B. anthracis strains lacking both ltaS1 and ltaS2 were unable to synthesize LTA and exhibited reduced viability, altered envelope morphology, aberrant separation of vegetative forms, and decreased sporulation efficiency. Expression of ltaS1 or ltaS2 alone in B. anthracis as well as in other microbes was sufficient for polyglycerol phosphate synthesis. Thus, similar to S. aureus, B. anthracis employs LtaS enzymes to synthesize LTA, an envelope component that promotes bacterial growth and cell division. PMID:22685279

  1. Very long chain fatty acid synthesis in sunflower kernels.

    PubMed

    Salas, Joaquín J; Martínez-Force, Enrique; Garcés, Rafael

    2005-04-01

    Most common seed oils contain small amounts of very long chain fatty acids (VLCFAs), the main components of oils from species such as Brassica napus or Lunnaria annua. These fatty acids are synthesized from acyl-CoA precursors in the endoplasmic reticulum through the activity of a dissociated enzyme complex known as fatty acid elongase. We studied the synthesis of the arachidic, behenic, and lignoceric VLCFAs in sunflower kernels, in which they account for 1-3% of the saturated fatty acids. These VLCFAs are synthesized from 18:0-CoA by membrane-bound fatty acid elongases, and their biosynthesis is mainly dependent on NADPH equivalents. Two condensing enzymes appear to be responsible for the synthesis of VLCFAs in sunflower kernels, beta-ketoacyl-CoA synthase-I (KCS-I) and beta-ketoacyl-CoA synthase-II (KCS-II). Both of these enzymes were resolved by ion exchange chromatography and display different substrate specificities. While KCS-I displays a preference for 20:0-CoA, 18:0-CoA was more efficiently elongated by KCS-II. Both enzymes have different sensitivities to pH and Triton X-100, and their kinetic properties indicate that both are strongly inhibited by the presence of their substrates. In light of these results, the VLCFA composition of sunflower oil is considered in relation to that in other commercially exploited oils.

  2. Genetics Home Reference: congenital bile acid synthesis defect type 1

    MedlinePlus

    ... bile acid synthesis defect type 1 congenital bile acid synthesis defect type 1 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 1 is a disorder characterized ...

  3. Genetics Home Reference: congenital bile acid synthesis defect type 2

    MedlinePlus

    ... bile acid synthesis defect type 2 congenital bile acid synthesis defect type 2 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 2 is a disorder characterized ...

  4. Hydroxamic Acids in Asymmetric Synthesis

    PubMed Central

    Li, Zhi; Yamamoto, Hisashi

    2012-01-01

    Metal-catalyzed stereoselective reactions are a central theme in organic chemistry research. In these reactions, the stereoselection is achieved predominantly by introducing chiral ligands at the metal catalyst’s center. For decades, researchers have sought better chiral ligands for asymmetric catalysis and have made great progress. Nevertheless, to achieve optimal stereoselectivity and to catalyze new reactions, new chiral ligands are needed. Due to their high metal affinity, hydroxamic acids play major roles across a broad spectrum of fields from biochemistry to metal extraction. Dr. K. Barry Sharpless first revealed their potential as chiral ligands for asymmetric synthesis in 1977: He published the chiral vanadium-hydroxamic-acid-catalyzed, enantioselective epoxidation of allylic alcohols before his discovery of Sharpless Asymmetric Epoxidation, which uses titanium-tartrate complex as the chiral reagent. However, researchers have reported few highly enantioselective reactions using metal-hydroxamic acid as catalysts since then. This Account summarizes our research on metal-catalyzed asymmetric epoxidation using hydroxamic acids as chiral ligands. We designed and synthesized a series of new hydroxamic acids, most notably the C2-symmetric bis-hydroxamic acid (BHA) family. V-BHA-catalyzed epoxidation of allylic and homoallylic alcohols achieved higher activity and stereoselectivity than Sharpless Asymmetric Epoxidation in many cases. Changing the metal species led to a series of unprecedented asymmetric epoxidation reactions, such as (i) single olefins and sulfides with Mo-BHA, (ii) homoallylic and bishomoallylic alcohols with Zr- and Hf-BHA, and (iii) N-alkenyl sulfonamides and N-sulfonyl imines with Hf-BHA. These reactions produce uniquely functionalized chiral epoxides with good yields and enantioselectivities. PMID:23157425

  5. Novel 2-oxoimidazolidine-4-carboxylic acid derivatives as Hepatitis C virus NS3-4A serine protease inhibitors: synthesis, activity, and X-ray crystal structure of an enzyme inhibitor complex

    SciTech Connect

    Arasappan, Ashok; Njoroge, F. George; Parekh, Tejal N.; Yang, Xiaozheng; Pichardo, John; Butkiewicz, Nancy; Prongay, Andrew; Yao, Nanhua; Girijavallabhan, Viyyoor

    2008-06-30

    Synthesis and HCV NS3 serine protease inhibitory activity of some novel 2-oxoimidazolidine-4-carboxylic acid derivatives are reported. Inhibitors derived from this new P2 core exhibited activity in the low {micro}M range. X-ray structure of an inhibitor, 15c bound to the protease is presented.

  6. Enzymes as Green Catalysts for Precision Macromolecular Synthesis.

    PubMed

    Shoda, Shin-ichiro; Uyama, Hiroshi; Kadokawa, Jun-ichi; Kimura, Shunsaku; Kobayashi, Shiro

    2016-02-24

    The present article comprehensively reviews the macromolecular synthesis using enzymes as catalysts. Among the six main classes of enzymes, the three classes, oxidoreductases, transferases, and hydrolases, have been employed as catalysts for the in vitro macromolecular synthesis and modification reactions. Appropriate design of reaction including monomer and enzyme catalyst produces macromolecules with precisely controlled structure, similarly as in vivo enzymatic reactions. The reaction controls the product structure with respect to substrate selectivity, chemo-selectivity, regio-selectivity, stereoselectivity, and choro-selectivity. Oxidoreductases catalyze various oxidation polymerizations of aromatic compounds as well as vinyl polymerizations. Transferases are effective catalysts for producing polysaccharide having a variety of structure and polyesters. Hydrolases catalyzing the bond-cleaving of macromolecules in vivo, catalyze the reverse reaction for bond forming in vitro to give various polysaccharides and functionalized polyesters. The enzymatic polymerizations allowed the first in vitro synthesis of natural polysaccharides having complicated structures like cellulose, amylose, xylan, chitin, hyaluronan, and chondroitin. These polymerizations are "green" with several respects; nontoxicity of enzyme, high catalyst efficiency, selective reactions under mild conditions using green solvents and renewable starting materials, and producing minimal byproducts. Thus, the enzymatic polymerization is desirable for the environment and contributes to "green polymer chemistry" for maintaining sustainable society.

  7. Transient repression of catabolite-sensitive enzyme synthesis elicited by 2,4-dinitrophenol.

    PubMed

    Oki, R

    1975-09-01

    Transient inhibition of catabolic enzyme synthesis in Escherichia coli occurred when a low concentration of 2,4-dinitrophenol (DNP) was simultaneously added with inducer. Using mutant strains defective for gamma-gene product or constitutive for lac enzymes, it was found that the inhibition is not due to the exclusion of inducer by uncoupling. The addition of cyclic adenosine 3',5'-monophosphate overcame repression. The components of the lac operon coordinately responded to DNP inhibition. From deoxyribonucleic acid-ribonucleic acid hybridization experiments, it was found that the inhibition of beta-galactosidase induction occurred at the level of messenger ribonucleic acid synthesis specific for the lac operon. It seems probable that DNP represses induction in a similar manner to that of transient repression observed upon the addition of glucose. Furthermore, it was found that transient repression disappeared if cells were preincubated with DNP before induction. This indicates that new contact of cells with DNP is obligatory for transient repression. From these results, it is suggested that the cell membrane may be responsible for regulation of catabolite-sensitive enzyme synthesis. PMID:169228

  8. Enzymic synthesis of indole-3-acetyl-1-O-beta-d-glucose. I. Partial purification and characterization of the enzyme from Zea mays

    NASA Technical Reports Server (NTRS)

    Leznicki, A. J.; Bandurski, R. S.

    1988-01-01

    The first enzyme-catalyzed reaction leading from indole-3-acetic acid (IAA) to the myo-inositol esters of IAA is the synthesis of indole-3-acetyl-1-O-beta-D-glucose from uridine-5'-diphosphoglucose (UDPG) and IAA. The reaction is catalyzed by the enzyme, UDPG-indol-3-ylacetyl glucosyl transferase (IAA-glucose-synthase). This work reports methods for the assay of the enzyme and for the extraction and partial purification of the enzyme from kernels of Zea mays sweet corn. The enzyme has an apparent molecular weight of 46,500 an isoelectric point of 5.5, and its pH optimum lies between 7.3 and 7.6. The enzyme is stable to storage at zero degrees but loses activity during column chromatographic procedures which can be restored only fractionally by addition of column eluates. The data suggest either multiple unknown cofactors or conformational changes leading to activity loss.

  9. Affinity labelling enzymes with esters of aromatic sulfonic acids

    DOEpatents

    Wong, Show-Chu; Shaw, Elliott

    1977-01-01

    Novel esters of aromatic sulfonic acids are disclosed. The specific esters are nitrophenyl p- and m-amidinophenylmethanesulfonate. Also disclosed is a method for specific inactivation of the enzyme, thrombin, employing nitrophenyl p-amidinophenylmethanesulfonate.

  10. Azospirillum brasilense Produces the Auxin-Like Phenylacetic Acid by Using the Key Enzyme for Indole-3-Acetic Acid Biosynthesis

    PubMed Central

    Somers, E.; Ptacek, D.; Gysegom, P.; Srinivasan, M.; Vanderleyden, J.

    2005-01-01

    An antimicrobial compound was isolated from Azospirillum brasilense culture extracts by high-performance liquid chromatography and further identified by gas chromatography-mass spectrometry as the auxin-like molecule, phenylacetic acid (PAA). PAA synthesis was found to be mediated by the indole-3-pyruvate decarboxylase, previously identified as a key enzyme in indole-3-acetic acid (IAA) production in A. brasilense. In minimal growth medium, PAA biosynthesis by A. brasilense was only observed in the presence of phenylalanine (or precursors thereof). This observation suggests deamination of phenylalanine, decarboxylation of phenylpyruvate, and subsequent oxidation of phenylacetaldehyde as the most likely pathway for PAA synthesis. Expression analysis revealed that transcription of the ipdC gene is upregulated by PAA, as was previously described for IAA and synthetic auxins, indicating a positive feedback regulation. The synthesis of PAA by A. brasilense is discussed in relation to previously reported biocontrol properties of A. brasilense. PMID:15812004

  11. Stereoselective synthesis of stable-isotope-labeled amino acids

    SciTech Connect

    Unkefer, C.J.; Martinez, R.A.; Silks, L.A. III; Lodwig, S.N.

    1994-12-01

    For magnetic resonance and vibrational spectroscopies to reach their full potential, they must be used in combination with sophisticated site-specific stable isotope labeling of biological macromolecules. Labeled amino acids are required for the study of the structure and function of enzymes and proteins. Because there are 20 common amino acids, each with its own distinguishing chemistry, they remain a synthetic challenge. The Oppolzer chiral auxiliary provides a general tool with which to approach the synthesis of labeled amino acids. By using the Oppolzer auxiliary, amino acids can be constructed from several small molecules, which is ideal for stable isotope labeling. In addition to directing the stereochemistry at the {alpha}-carbon, the camphorsultam can be used for stereo-specific isotope labeling at prochiral centers in amino acids. By using the camphorsultam auxiliary we have the potential to synthesize virtually any isotopomer of all of the common amino acids.

  12. Cyclic phosphatidic acid and lysophosphatidic acid induce hyaluronic acid synthesis via CREB transcription factor regulation in human skin fibroblasts.

    PubMed

    Maeda-Sano, Katsura; Gotoh, Mari; Morohoshi, Toshiro; Someya, Takao; Murofushi, Hiromu; Murakami-Murofushi, Kimiko

    2014-09-01

    Cyclic phosphatidic acid (cPA) is a naturally occurring phospholipid mediator and an analog of the growth factor-like phospholipid lysophosphatidic acid (LPA). cPA has a unique cyclic phosphate ring at the sn-2 and sn-3 positions of its glycerol backbone. We showed before that a metabolically stabilized cPA derivative, 2-carba-cPA, relieved osteoarthritis pathogenesis in vivo and induced hyaluronic acid synthesis in human osteoarthritis synoviocytes in vitro. This study focused on hyaluronic acid synthesis in human fibroblasts, which retain moisture and maintain health in the dermis. We investigated the effects of cPA and LPA on hyaluronic acid synthesis in human fibroblasts (NB1RGB cells). Using particle exclusion and enzyme-linked immunosorbent assays, we found that both cPA and LPA dose-dependently induced hyaluronic acid synthesis. We revealed that the expression of hyaluronan synthase 2 messenger RNA and protein is up-regulated by cPA and LPA treatment time dependently. We then characterized the signaling pathways up-regulating hyaluronic acid synthesis mediated by cPA and LPA in NB1RGB cells. Pharmacological inhibition and reporter gene assays revealed that the activation of the LPA receptor LPAR1, Gi/o protein, phosphatidylinositol-3 kinase (PI3K), extracellular-signal-regulated kinase (ERK), and cyclic adenosine monophosphate response element-binding protein (CREB) but not nuclear factor κB induced hyaluronic acid synthesis by the treatment with cPA and LPA in NB1RGB cells. These results demonstrate for the first time that cPA and LPA induce hyaluronic acid synthesis in human skin fibroblasts mainly through the activation of LPAR1-Gi/o followed by the PI3K, ERK, and CREB signaling pathway.

  13. Synthesis and Isolation of Chelidonic Acid

    ERIC Educational Resources Information Center

    Gagan, J. M. F.; Herbert, R. B.

    1976-01-01

    Described is an undergraduate laboratory experiment involving synthesis of chelidonic acid and its identification in plants. The experiment is offered as an ancillary topic for biology or chemistry classes. (SL)

  14. A specific enzyme for glucose 1,6-bisphosphate synthesis.

    PubMed

    Rose, I A; Warms, J V; Kaklij, G

    1975-05-10

    The reaction: glycerate-1,3-P2 PLUS GLUCOSE-1-P YIELDS TO GLUCOSE-1,6-P2 plus glycerate-P is catalyzed by a distinct enzyme of mouse brain. A divalent metal requirement was shown when the enzyme was treated with imidazole and EDTA. Mg2+, Mn2+, Ca2+, Zn2+, Ni2+, Co2+, and Cd2+ were quite effective cofactors. The enzyme, in better than 50 percent yield, has been purified away from 99 percent of the phosphoglucomutase, phosphoglycrate mutase, and phosphofructokinase. Acetyl-P, ATP, enolpyruvate-P, creatine-P, and fructose-1,6-P2 are not phosphoryl donors. Glucose-6-P and mannose-1-P are good alternate acceptors. Mannose-6-P, galactose-Ps, and fructose-Ps have little or no acceptor activity. Strong inhibition was found with fructose-1,6-P2, glycerate-2,3-P2, enolpyruvate-P, and acetyl CoA. From the amount of activity and the kinetic constants of the purified enzyme it seems likely that this enzyme is responsible for the glucose-1,6-P2 synthesis of brain.

  15. Method for Enzyme Design with Genetically Encoded Unnatural Amino Acids.

    PubMed

    Hu, C; Wang, J

    2016-01-01

    We describe the methodologies for the design of artificial enzymes with genetically encoded unnatural amino acids. Genetically encoded unnatural amino acids offer great promise for constructing artificial enzymes with novel activities. In our studies, the designs of artificial enzyme were divided into two steps. First, we considered the unnatural amino acids and the protein scaffold separately. The scaffold is designed by traditional protein design methods. The unnatural amino acids are inspired by natural structure and organic chemistry methods, and synthesized by either organic chemistry methods or enzymatic conversion. With the increasing number of published unnatural amino acids with various functions, we described an unnatural amino acids toolkit containing metal chelators, redox mediators, and click chemistry reagents. These efforts enable a researcher to search the toolkit for appropriate unnatural amino acids for the study, rather than design and synthesize the unnatural amino acids from the beginning. After the first step, the model enzyme was optimized by computational methods and directed evolution. Lastly, we describe a general method for evolving aminoacyl-tRNA synthetase and expressing unnatural amino acids incorporated into a protein. PMID:27586330

  16. Method for Enzyme Design with Genetically Encoded Unnatural Amino Acids.

    PubMed

    Hu, C; Wang, J

    2016-01-01

    We describe the methodologies for the design of artificial enzymes with genetically encoded unnatural amino acids. Genetically encoded unnatural amino acids offer great promise for constructing artificial enzymes with novel activities. In our studies, the designs of artificial enzyme were divided into two steps. First, we considered the unnatural amino acids and the protein scaffold separately. The scaffold is designed by traditional protein design methods. The unnatural amino acids are inspired by natural structure and organic chemistry methods, and synthesized by either organic chemistry methods or enzymatic conversion. With the increasing number of published unnatural amino acids with various functions, we described an unnatural amino acids toolkit containing metal chelators, redox mediators, and click chemistry reagents. These efforts enable a researcher to search the toolkit for appropriate unnatural amino acids for the study, rather than design and synthesize the unnatural amino acids from the beginning. After the first step, the model enzyme was optimized by computational methods and directed evolution. Lastly, we describe a general method for evolving aminoacyl-tRNA synthetase and expressing unnatural amino acids incorporated into a protein.

  17. Enzymophoresis of nucleic acids by tandem capillary enzyme reactor-capillary zone electrophoresis.

    PubMed

    Nashabeh, W; el Rassi, Z

    1992-04-10

    Enzymophoresis with coupled heterogeneous capillary enzyme reactor-capillary zone electrophoresis was developed and evaluated in the area of nucleic acids. Ribonuclease T1, hexokinase and adenosine deaminase were successfully immobilized on the inner walls of short fused-silica capillaries through glutaraldehyde attachment. These open-tubular capillary enzyme reactors were quite stable for a prolonged period of use under operation conditions normally used in capillary zone electrophoresis. The capillary enzyme reactors coupled in series with capillary zone electrophoresis served as peak locator on the electropherogram, improved the system selectivity, and facilitated the quantitative determination of the analytes with good accuracy. Also, they allowed the on-line digestion and mapping of minute amounts of transfer ribonucleic acids, and the simultaneous synthesis and separation of nanogram quantities of oligonucleotides.

  18. The Roles of Acids and Bases in Enzyme Catalysis

    ERIC Educational Resources Information Center

    Weiss, Hilton M.

    2007-01-01

    Many organic reactions are catalyzed by strong acids or bases that protonate or deprotonate neutral reactants leading to reactive cations or anions that proceed to products. In enzyme reactions, only weak acids and bases are available to hydrogen bond to reactants and to transfer protons in response to developing charges. Understanding this…

  19. Activation of PPARα by Fatty Acid Accumulation Enhances Fatty Acid Degradation and Sulfatide Synthesis.

    PubMed

    Yang, Yang; Feng, Yuyao; Zhang, Xiaowei; Nakajima, Takero; Tanaka, Naoki; Sugiyama, Eiko; Kamijo, Yuji; Aoyama, Toshifumi

    2016-01-01

    Very-long-chain acyl-CoA dehydrogenase (VLCAD) catalyzes the first reaction in the mitochondrial fatty acid β-oxidation pathway. VLCAD deficiency is associated with the accumulation of fat in multiple organs and tissues, which results in specific clinical features including cardiomyopathy, cardiomegaly, muscle weakness, and hepatic dysfunction in infants. We speculated that the abnormal fatty acid metabolism in VLCAD-deficient individuals might cause cell necrosis by fatty acid toxicity. The accumulation of fatty acids may activate peroxisome proliferator-activated receptor (PPAR), a master regulator of fatty acid metabolism and a potent nuclear receptor for free fatty acids. We examined six skin fibroblast lines, derived from VLCAD-deficient patients and identified fatty acid accumulation and PPARα activation in these cell lines. We then found that the expression levels of three enzymes involved in fatty acid degradation, including long-chain acyl-CoA synthetase (LACS), were increased in a PPARα-dependent manner. This increased expression of LACS might enhance the fatty acyl-CoA supply to fatty acid degradation and sulfatide synthesis pathways. In fact, the first and last reactions in the sulfatide synthesis pathway are regulated by PPARα. Therefore, we also measured the expression levels of enzymes involved in sulfatide metabolism and the regulation of cellular sulfatide content. The levels of these enzymes and cellular sulfatide content both increased in a PPARα-dependent manner. These results indicate that PPARα activation plays defensive and compensative roles by reducing cellular toxicity associated with fatty acids and sulfuric acid. PMID:27644403

  20. Novel Enzyme Family Found in Filamentous Fungi Catalyzing trans-4-Hydroxylation of l-Pipecolic Acid

    PubMed Central

    Hibi, Makoto; Mori, Ryosuke; Miyake, Ryoma; Kawabata, Hiroshi; Kozono, Shoko; Takahashi, Satomi

    2016-01-01

    Hydroxypipecolic acids are bioactive compounds widely distributed in nature and are valuable building blocks for the organic synthesis of pharmaceuticals. We have found a novel hydroxylating enzyme with activity toward l-pipecolic acid (l-Pip) in a filamentous fungus, Fusarium oxysporum c8D. The enzyme l-Pip trans-4-hydroxylase (Pip4H) of F. oxysporum (FoPip4H) belongs to the Fe(II)/α-ketoglutarate-dependent dioxygenase superfamily, catalyzes the regio- and stereoselective hydroxylation of l-Pip, and produces optically pure trans-4-hydroxy-l-pipecolic acid (trans-4-l-HyPip). Amino acid sequence analysis revealed several fungal enzymes homologous with FoPip4H, and five of these also had l-Pip trans-4-hydroxylation activity. In particular, the homologous Pip4H enzyme derived from Aspergillus nidulans FGSC A4 (AnPip4H) had a broader substrate specificity spectrum than other homologues and reacted with the l and d forms of various cyclic and aliphatic amino acids. Using FoPip4H as a biocatalyst, a system for the preparative-scale production of chiral trans-4-l-HyPip was successfully developed. Thus, we report a fungal family of l-Pip hydroxylases and the enzymatic preparation of trans-4-l-HyPip, a bioactive compound and a constituent of secondary metabolites with useful physiological activities. PMID:26801577

  1. In Vitro Optimization of Enzymes Involved in Precorrin-2 Synthesis Using Response Surface Methodology.

    PubMed

    Fang, Huan; Dong, Huina; Cai, Tao; Zheng, Ping; Li, Haixing; Zhang, Dawei; Sun, Jibin

    2016-01-01

    In order to maximize the production of biologically-derived chemicals, kinetic analyses are first necessary for predicting the role of enzyme components and coordinating enzymes in the same reaction system. Precorrin-2 is a key precursor of cobalamin and siroheme synthesis. In this study, we sought to optimize the concentrations of several molecules involved in precorrin-2 synthesis in vitro: porphobilinogen synthase (PBGS), porphobilinogen deaminase (PBGD), uroporphyrinogen III synthase (UROS), and S-adenosyl-l-methionine-dependent urogen III methyltransferase (SUMT). Response surface methodology was applied to develop a kinetic model designed to maximize precorrin-2 productivity. The optimal molar ratios of PBGS, PBGD, UROS, and SUMT were found to be approximately 1:7:7:34, respectively. Maximum precorrin-2 production was achieved at 0.1966 ± 0.0028 μM/min, agreeing with the kinetic model's predicted value of 0.1950 μM/min. The optimal concentrations of the cofactor S-adenosyl-L-methionine (SAM) and substrate 5-aminolevulinic acid (ALA) were also determined to be 200 μM and 5 mM, respectively, in a tandem-enzyme assay. By optimizing the relative concentrations of these enzymes, we were able to minimize the effects of substrate inhibition and feedback inhibition by S-adenosylhomocysteine on SUMT and thereby increase the production of precorrin-2 by approximately five-fold. These results demonstrate the effectiveness of kinetic modeling via response surface methodology for maximizing the production of biologically-derived chemicals.

  2. In Vitro Optimization of Enzymes Involved in Precorrin-2 Synthesis Using Response Surface Methodology

    PubMed Central

    Fang, Huan; Dong, Huina; Cai, Tao; Zheng, Ping; Li, Haixing; Zhang, Dawei; Sun, Jibin

    2016-01-01

    In order to maximize the production of biologically-derived chemicals, kinetic analyses are first necessary for predicting the role of enzyme components and coordinating enzymes in the same reaction system. Precorrin-2 is a key precursor of cobalamin and siroheme synthesis. In this study, we sought to optimize the concentrations of several molecules involved in precorrin-2 synthesis in vitro: porphobilinogen synthase (PBGS), porphobilinogen deaminase (PBGD), uroporphyrinogen III synthase (UROS), and S-adenosyl-l-methionine-dependent urogen III methyltransferase (SUMT). Response surface methodology was applied to develop a kinetic model designed to maximize precorrin-2 productivity. The optimal molar ratios of PBGS, PBGD, UROS, and SUMT were found to be approximately 1:7:7:34, respectively. Maximum precorrin-2 production was achieved at 0.1966 ± 0.0028 μM/min, agreeing with the kinetic model’s predicted value of 0.1950 μM/min. The optimal concentrations of the cofactor S-adenosyl-L-methionine (SAM) and substrate 5-aminolevulinic acid (ALA) were also determined to be 200 μM and 5 mM, respectively, in a tandem-enzyme assay. By optimizing the relative concentrations of these enzymes, we were able to minimize the effects of substrate inhibition and feedback inhibition by S-adenosylhomocysteine on SUMT and thereby increase the production of precorrin-2 by approximately five-fold. These results demonstrate the effectiveness of kinetic modeling via response surface methodology for maximizing the production of biologically-derived chemicals. PMID:26974652

  3. Microwave-Assisted Rapid Enzymatic Synthesis of Nucleic Acids.

    PubMed

    Hari Das, Rakha; Ahirwar, Rajesh; Kumar, Saroj; Nahar, Pradip

    2016-07-01

    Herein we report microwave-induced enhancement of the reactions catalyzed by Escherichia coli DNA polymerase I and avian myeloblastosis virus-reverse transcriptase. The reactions induced by microwaves result in a highly selective synthesis of nucleic acids in 10-50 seconds. In contrast, same reactions failed to give desired reaction products when carried out in the same time periods, but without microwave irradiation. Each of the reactions was carried out for different duration of microwave exposure time to find the optimum reaction time. The products produced by the respective enzyme upon microwave irradiation of the reaction mixtures were identical to that produced by the conventional procedures. As the microwave-assisted reactions are rapid, microwave could be a useful alternative to the conventional and time consuming procedures of enzymatic synthesis of nucleic acids. PMID:27159147

  4. Production of 5-aminolevulinic acid by cell free multi-enzyme catalysis.

    PubMed

    Meng, Qinglong; Zhang, Yanfei; Ju, Xiaozhi; Ma, Chunling; Ma, Hongwu; Chen, Jiuzhou; Zheng, Ping; Sun, Jibin; Zhu, Jun; Ma, Yanhe; Zhao, Xueming; Chen, Tao

    2016-05-20

    5-Aminolevulinic acid (ALA) is the precursor for the biosynthesis of tetrapyrroles and has broad agricultural and medical applications. Currently ALA is mainly produced by chemical synthesis and microbial fermentation. Cell free multi-enzyme catalysis is a promising method for producing high value chemicals. Here we reported our work on developing a cell free process for ALA production using thermostable enzymes. Cheap substrates (succinate and glycine) were used for ALA synthesis by two enzymes: 5-aminolevulinic acid synthase (ALAS) from Laceyella sacchari (LS-ALAS) and succinyl-CoA synthase (Suc) from Escherichia coli. ATP was regenerated by polyphosphate kinase (Ppk) using polyphosphate as the substrate. Succinate was added into the reaction system in a fed-batch mode to avoid its inhibition effect on Suc. After reaction for 160min, ALA concentration was increased to 5.4mM. This is the first reported work on developing the cell free process for ALA production. Through further process and enzyme optimization the cell free process could be an effective and economic way for ALA production.

  5. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  6. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  7. Polyamines in the Synthesis of Bacteriophage Deoxyribonucleic Acid. I. Lack of Dependence of Polyamine Synthesis on Bacteriophage Deoxyribonucleic Acid Synthesis

    PubMed Central

    Dion, Arnold S.; Cohen, Seymour S.

    1972-01-01

    To determine whether polyamine synthesis is dependent on deoxyribonucleic acid (DNA) synthesis, polyamine levels were estimated after infection of bacterial cells with ultraviolet-irradiated T4 or T4 am N 122, a DNA-negative mutant. Although phage DNA accumulation was restricted to various degrees in comparison to cells infected with T4D, nearly commensurate levels of putrescine and spermidine synthesis were observed after infection, regardless of the rate of phage DNA synthesis. We conclude from these data that polyamine synthesis after infection is independent of phage DNA synthesis. PMID:4552549

  8. Induction of Arabidopsis tryptophan pathway enzymes and camalexin by amino acid starvation, oxidative stress, and an abiotic elicitor.

    PubMed Central

    Zhao, J; Williams, C C; Last, R L

    1998-01-01

    The tryptophan (Trp) biosynthetic pathway leads to the production of many secondary metabolites with diverse functions, and its regulation is predicted to respond to the needs for both protein synthesis and secondary metabolism. We have tested the response of the Trp pathway enzymes and three other amino acid biosynthetic enzymes to starvation for aromatic amino acids, branched-chain amino acids, or methionine. The Trp pathway enzymes and cytosolic glutamine synthetase were induced under all of the amino acid starvation test conditions, whereas methionine synthase and acetolactate synthase were not. The mRNAs for two stress-inducible enzymes unrelated to amino acid biosynthesis and accumulation of the indolic phytoalexin camalexin were also induced by amino acid starvation. These results suggest that regulation of the Trp pathway enzymes under amino acid deprivation conditions is largely a stress response to allow for increased biosynthesis of secondary metabolites. Consistent with this hypothesis, treatments with the oxidative stress-inducing herbicide acifluorfen and the abiotic elicitor alpha-amino butyric acid induced responses similar to those induced by the amino acid starvation treatments. The role of salicylic acid in herbicide-mediated Trp and camalexin induction was investigated. PMID:9501110

  9. Fatty acid phytyl ester synthesis in chloroplasts of Arabidopsis.

    PubMed

    Lippold, Felix; vom Dorp, Katharina; Abraham, Marion; Hölzl, Georg; Wewer, Vera; Yilmaz, Jenny Lindberg; Lager, Ida; Montandon, Cyrille; Besagni, Céline; Kessler, Felix; Stymne, Sten; Dörmann, Peter

    2012-05-01

    During stress or senescence, thylakoid membranes in chloroplasts are disintegrated, and chlorophyll and galactolipid are broken down, resulting in the accumulation of toxic intermediates, i.e., tetrapyrroles, free phytol, and free fatty acids. Chlorophyll degradation has been studied in detail, but the catabolic pathways for phytol and fatty acids remain unclear. A large proportion of phytol and fatty acids is converted into fatty acid phytyl esters and triacylglycerol during stress or senescence in chloroplasts. We isolated two genes (PHYTYL ESTER SYNTHASE1 [PES1] and PES2) of the esterase/lipase/thioesterase family of acyltransferases from Arabidopsis thaliana that are involved in fatty acid phytyl ester synthesis in chloroplasts. The two proteins are highly expressed during senescence and nitrogen deprivation. Heterologous expression in yeast revealed that PES1 and PES2 have phytyl ester synthesis and diacylglycerol acyltransferase activities. The enzymes show broad substrate specificities and can employ acyl-CoAs, acyl carrier proteins, and galactolipids as acyl donors. Double mutant plants (pes1 pes2) grow normally but show reduced phytyl ester and triacylglycerol accumulation. These results demonstrate that PES1 and PES2 are involved in the deposition of free phytol and free fatty acids in the form of phytyl esters in chloroplasts, a process involved in maintaining the integrity of the photosynthetic membrane during abiotic stress and senescence.

  10. Molecular annotation of ketol-acid reductoisomerases from Streptomyces reveals a novel amino acid biosynthesis interlock mediated by enzyme promiscuity

    PubMed Central

    Verdel-Aranda, Karina; López-Cortina, Susana T; Hodgson, David A; Barona-Gómez, Francisco

    2015-01-01

    The 6-phosphogluconate dehydrogenase superfamily oxidize and reduce a wide range of substrates, making their functional annotation challenging. Ketol-acid reductoisomerase (KARI), encoded by the ilvC gene in branched-chain amino acids biosynthesis, is a promiscuous reductase enzyme within this superfamily. Here, we obtain steady-state enzyme kinetic parameters for 10 IlvC homologues from the genera Streptomyces and Corynebacterium, upon eight selected chemically diverse substrates, including some not normally recognized by enzymes of this superfamily. This biochemical data suggested a Streptomyces biosynthetic interlock between proline and the branched-chain amino acids, mediated by enzyme substrate promiscuity, which was confirmed via mutagenesis and complementation analyses of the proC, ilvC1 and ilvC2 genes in Streptomyces coelicolor. Moreover, both ilvC orthologues and paralogues were analysed, such that the relationship between gene duplication and functional diversification could be explored. The KARI paralogues present in S. coelicolor and Streptomyces lividans, despite their conserved high sequence identity (97%), were shown to be more promiscuous, suggesting a recent functional diversification. In contrast, the KARI paralogue from Streptomyces viridifaciens showed selectivity towards the synthesis of valine precursors, explaining its recruitment within the biosynthetic gene cluster of valanimycin. These results allowed us to assess substrate promiscuity indices as a tool to annotate new molecular functions with metabolic implications. PMID:25296650

  11. [Lipid synthesis by an acidic acid tolerant Rhodotorula glutinis].

    PubMed

    Lin, Zhangnan; Liu, Hongjuan; Zhang, Jian'an; Wang, Gehua

    2016-03-01

    Acetic acid, as a main by-product generated in the pretreatment process of lignocellulose hydrolysis, significantly affects cell growth and lipid synthesis of oleaginous microorganisms. Therefore, we studied the tolerance of Rhodotorula glutinis to acetic acid and its lipid synthesis from substrate containing acetic acid. In the mixed sugar medium containing 6 g/L glucose and 44 g/L xylose, and supplemented with acetic acid, the cell growth was not:inhibited when the acetic acid concentration was below 10 g/L. Compared with the control, the biomass, lipid concentration and lipid content of R. glutinis increased 21.5%, 171% and 122% respectively when acetic acid concentration was 10 g/L. Furthermore, R. glutinis could accumulate lipid with acetate as the sole carbon source. Lipid concentration and lipid yield reached 3.20 g/L and 13% respectively with the initial acetic acid concentration of 25 g/L. The lipid composition was analyzed by gas chromatograph. The main composition of lipid produced with acetic acid was palmitic acid, stearic acid, oleic acid, linoleic acid and linolenic acid, including 40.9% saturated fatty acids and 59.1% unsaturated fatty acids. The lipid composition was similar to that of plant oil, indicating that lipid from oleaginous yeast R. glutinis had potential as the feedstock of biodiesel production. These results demonstrated that a certain concentration of acetic acid need not to be removed in the detoxification process when using lignocelluloses hydrolysate to produce microbial lipid by R. glutinis. PMID:27349116

  12. Enzyme-assisted process for DAG synthesis in edible oils.

    PubMed

    von der Haar, Daniela; Stäbler, Andreas; Wichmann, Rolf; Schweiggert-Weisz, Ute

    2015-06-01

    This study deals with the enzymatic synthesis of diacylglycerols in rapeseed oil by the esterification of free fatty acids and monoacylglycerols. As enzymatic reactions are influenced by many factors, a statistical design of experiments was conducted to investigate the enrichment of diacylglycerols, systematically. Simultaneously, the investigated method contributes to the refining process, as the amount of free fatty acids could be reduced significantly from 2% to 0.3%. Utilizing an immobilized lipase from Rhizomucormiehei, a maximum diacylglycerol content of 23% was obtained, after optimization. By washing with iso-propanol and hexane the immobilised lipase could be reused in 14 consecutive batches. In addition, glycerol was proven to be an alternative to MAG as acyl-group acceptor. However, the diacylglycerol enrichment was not accomplished in the same yields as for monoacylglycerols. Summarizing, the present study revealed the potential of an enzymatic diacylglycerol synthesis in edible oils as a suitable alternative to conventional processes also enabling the reduction of free fatty acids in crude oils.

  13. Distribution, industrial applications, and enzymatic synthesis of D-amino acids.

    PubMed

    Gao, Xiuzhen; Ma, Qinyuan; Zhu, Hailiang

    2015-04-01

    D-Amino acids exist widely in microbes, plants, animals, and food and can be applied in pharmaceutical, food, and cosmetics. Because of their widespread applications in industry, D-amino acids have recently received more and more attention. Enzymes including D-hydantoinase, N-acyl-D-amino acid amidohydrolase, D-amino acid amidase, D-aminopeptidase, D-peptidase, L-amino acid oxidase, D-amino acid aminotransferase, and D-amino acid dehydrogenase can be used for D-amino acids synthesis by kinetic resolution or asymmetric amination. In this review, the distribution, industrial applications, and enzymatic synthesis methods are summarized. And, among all the current enzymatic methods, D-amino acid dehydrogenase method not only produces D-amino acid by a one-step reaction but also takes environment and atom economics into consideration; therefore, it is deserved to be paid more attention.

  14. The effect of linoleic acid on the whole body synthesis rates of polyunsaturated fatty acids from α-linolenic acid and linoleic acid in free-living rats.

    PubMed

    Domenichiello, Anthony F; Kitson, Alex P; Chen, Chuck T; Trépanier, Marc-Olivier; Stavro, P Mark; Bazinet, Richard P

    2016-04-01

    Docosahexaenoic acid (DHA) is thought to be important for brain function. The main dietary source of DHA is fish, however, DHA can also be synthesized from precursor omega-3 polyunsaturated fatty acids (n-3 PUFA), the most abundantly consumed being α-linolenic acid (ALA). The enzymes required to synthesize DHA from ALA are also used to synthesize longer chain omega-6 (n-6) PUFA from linoleic acid (LNA). The large increase in LNA consumption that has occurred over the last century has led to concern that LNA and other n-6 PUFA outcompete n-3 PUFA for enzymes involved in DHA synthesis, and therefore, decrease overall DHA synthesis. To assess this, rats were fed diets containing LNA at 53 (high LNA diet), 11 (medium LNA diet) or 1.5% (low LNA diet) of the fatty acids with ALA being constant across all diets (approximately 4% of the fatty acids). Rats were maintained on these diets from weaning for 8 weeks, at which point they were subjected to a steady-state infusion of labeled ALA and LNA to measure DHA and arachidonic acid (ARA) synthesis rates. DHA and ARA synthesis rates were generally highest in rats fed the medium and high LNA diets, while the plasma half-life of DHA was longer in rats fed the low LNA diet. Therefore, increasing dietary LNA, in rats, did not impair DHA synthesis; however, low dietary LNA led to a decrease in DHA synthesis with tissue concentrations of DHA possibly being maintained by a longer DHA half-life.

  15. Identification of RALDH2 as a Visually Regulated Retinoic Acid Synthesizing Enzyme in the Chick Choroid

    PubMed Central

    Hollaway, Lindsey R.; Lam, Wengtse; Li, Nan; Napoli, Joseph L.

    2012-01-01

    Purpose. All-trans-retinoic acid (atRA) has been implicated in the local regulation of scleral proteoglycan synthesis in vivo. The purpose of the present study was to identify the enzymes involved in the synthesis of atRA during visually guided ocular growth, the cells involved in modulation of atRA biosynthesis in the choroid, and the effect of choroid-derived atRA on scleral proteoglycan synthesis. Methods. Myopia was induced in White leghorn chicks by form deprivation for 10 days, followed by up to 15 days of unrestricted vision (recovery). Expression of atRA synthesizing enzymes was evaluated by semiquantitative qRT-PCR, in situ hybridization, and immunohistochemistry. atRA synthesis was measured in organ cultures of isolated choroids using LC-tandem MS quantification. Scleral proteoglycan synthesis was measured in vitro by the incorporation of 35SO4 in CPC-precipitable glycosaminoglycans. Results. RALDH2 was the predominant RALDH transcript in the choroid (>100-fold that of RALDH3). RALDH2 mRNA was elevated after 12 and 24 hours of recovery (60% and 188%, respectively; P < 0.01). The atRA concentration was significantly higher in cultures of choroids from 24-hour to 15-day recovering eyes than in paired controls (∼195%; P < 0.01). Choroid conditioned medium from recovering choroids inhibited proteoglycan synthesis to 43% of controls (P < 0.02, paired t-test; n = 16) and produced a relative inhibition corresponding to a RA concentration of 7.20 × 10−8 M. Conclusions. The results of this study suggest that RALDH2 is the major retinal dehydrogenase in the chick choroid and is responsible for increased atRA synthesis in response to myopic defocus. PMID:22323456

  16. Synthesis of pyromellitic acid esters

    NASA Technical Reports Server (NTRS)

    Fedorova, V. A.; Donchak, V. A.; Martynyuk-Lototskaya, A. N.

    1985-01-01

    The ester acids necessary for studyng the thermochemical properties of pyromellitic acid (PMK)-based peroxides were investigated. Obtaining a tetramethyl ester of a PMK was described. The mechanism of an esterification reaction is discussed, as is the complete esterification of PMK with primary alcohol.

  17. Synthesis of higher monocarboxylic acids

    SciTech Connect

    Taikov, B.F.; Novakovskii, E.M.; Zhelkovskaya, V.P.; Shadrova, V.N.; Shcherbik, P.K.

    1981-01-01

    Brown-coal and peat waxes contain higher monocarboxylic acids, alcohols and esters of them as their main components. In view of this, considerable interest is presented by the preparation of individual compounds among those mentioned above, which is particularly important in the study of the composition and development of the optimum variants of the chemical processing of the waxes. In laboratory practice, to obtain higher monocarboxylic acids use is generally made of electrosynthesis according to Kolbe which permits unbranched higher aliphatic acids with given lengths of the hydrocarbon chain to be obtained. The aim of the present work was to synthesize higher monocarboxylic acids: arachidic, behenic, lignoceric, pentacosanoic, erotic, heptacosanoic, montanic, nonacosanoic, melissic, dotriacontanoic and tetratriacontanoic, which are present in waxes. Characteristics of synthesized acids are tabulated. 20 refs.

  18. Cell growth and enzyme synthesis of a mutant of Arthrobacter sp. (DSM 3747) used for the production of L-amino acids from D,L-5-monosubstituted hydantoins.

    PubMed

    Syldatk, C; Mackowiak, V; Höke, H; Gross, C; Dombach, G; Wagner, F

    1990-06-01

    A microorganism with the ability to form L-tryptophan from D,L-5-(3-indolyl-methyl)hydantoin (D,L-5-IMH) was isolated and identified as Arthrobacter sp. (DSM 3747). After isolation of a mutant with high tryptophan production activity but low tryptophan degradation, cultural conditions were optimized to achieve high amounts of biomass with good specific activities concerning the enzymatic hydantoin-cleaving reactions. The ability of the microorganism to perform these bioconversions was found to be inducible by D,L-5-IMH as well as to be dependent on the presence of Mn2+. The highest specific D,L-5-IMH-cleaving activity of the cells was observed in the exponential phase of growth. The addition of yeast extract to the mineral salts medium was found to be essential for obtaining biomass concentrations of about 25 g l-1 cell dry mass by bioreactor cultivations. In order to obtain a constantly high growth rate, feeding of the C-source was pO2-controlled. The inducer D,L-5-IMH had to be continuously fed to prevent a decline of the L-tryptophan-forming enzyme activities, because it was subjected to degradation with the enzymes induced and higher concentrations of D,L-5-IMH aggravated the growth significantly. The synthesis of the enzymes was also inducible, when inducer and Mn2+ were not added until the late growth phase. Using this process, the consumption of D,L-5-IMH was reduced remarkably. So, under these conditions biomass concentrations of 25 g l-1 cell dry weight with a specific enzymatic activity of 0.20 mmol g-1 h-1 (tryptophan per dry mass per time) could be obtained within 13 h. Using 1 g l-1 of the chemically modified inducer D,L-5-(3-indolylmethyl)-3-N-methylhydantoin, which was not degradable by the microorganisms, a biomass concentration of 28 g l-1 cell dry weight with a specific activity of 0.34 mmol g-1 h-1 (tryptophan per dry mass per time) could be obtained within 28 h.

  19. Baker's Yeast Deficient in Storage Lipid Synthesis Uses cis-Vaccenic Acid to Reduce Unsaturated Fatty Acid Toxicity.

    PubMed

    Sec, Peter; Garaiova, Martina; Gajdos, Peter; Certik, Milan; Griac, Peter; Hapala, Ivan; Holic, Roman

    2015-07-01

    The role of cis-vaccenic acid (18:1n-7) in the reduction of unsaturated fatty acids toxicity was investigated in baker's yeast Saccharomyces cerevisiae. The quadruple mutant (QM, dga1Δ lro1Δ are1Δ are2Δ) deficient in enzymes responsible for triacylglycerol and steryl ester synthesis has been previously shown to be highly sensitive to exogenous unsaturated fatty acids. We have found that cis-vaccenic acid accumulated during cultivation in the QM cells but not in the corresponding wild type strain. This accumulation was accompanied by a reduction in palmitoleic acid (16:1n-7) content in the QM cells that is consistent with the proposed formation of cis-vaccenic acid by elongation of palmitoleic acid. Fatty acid analysis of individual lipid classes from the QM strain revealed that cis-vaccenic acid was highly enriched in the free fatty acid pool. Furthermore, production of cis-vaccenic acid was arrested if the mechanism of fatty acids release to the medium was activated. We also showed that exogenous cis-vaccenic acid did not affect viability of the QM strain at concentrations toxic for palmitoleic or oleic acids. Moreover, addition of cis-vaccenic acid to the growth medium provided partial protection against the lipotoxic effects of exogenous oleic acid. Transformation of palmitoleic acid to cis-vaccenic acid is thus a rescue mechanism enabling S. cerevisiae cells to survive in the absence of triacylglycerol synthesis as the major mechanism for unsaturated fatty acid detoxification.

  20. Carboxylic acid reductase is a versatile enzyme for the conversion of fatty acids into fuels and chemical commodities.

    PubMed

    Akhtar, M Kalim; Turner, Nicholas J; Jones, Patrik R

    2013-01-01

    Aliphatic hydrocarbons such as fatty alcohols and petroleum-derived alkanes have numerous applications in the chemical industry. In recent years, the renewable synthesis of aliphatic hydrocarbons has been made possible by engineering microbes to overaccumulate fatty acids. However, to generate end products with the desired physicochemical properties (e.g., fatty aldehydes, alkanes, and alcohols), further conversion of the fatty acid is necessary. A carboxylic acid reductase (CAR) from Mycobacterium marinum was found to convert a wide range of aliphatic fatty acids (C(6)-C(18)) into corresponding aldehydes. Together with the broad-substrate specificity of an aldehyde reductase or an aldehyde decarbonylase, the catalytic conversion of fatty acids to fatty alcohols (C(8)-C(16)) or fatty alkanes (C(7)-C(15)) was reconstituted in vitro. This concept was applied in vivo, in combination with a chain-length-specific thioesterase, to engineer Escherichia coli BL21(DE3) strains that were capable of synthesizing fatty alcohols and alkanes. A fatty alcohol titer exceeding 350 mg·L(-1) was obtained in minimal media supplemented with glucose. Moreover, by combining the CAR-dependent pathway with an exogenous fatty acid-generating lipase, natural oils (coconut oil, palm oil, and algal oil bodies) were enzymatically converted into fatty alcohols across a broad chain-length range (C(8)-C(18)). Together with complementing enzymes, the broad substrate specificity and kinetic characteristics of CAR opens the road for direct and tailored enzyme-catalyzed conversion of lipids into user-ready chemical commodities.

  1. A complete enzymatic recovery of ferulic acid from corn residues with extracellular enzymes from Neosartorya spinosa NRRL185.

    PubMed

    Shin, Hyun-Dong; McClendon, Shara; Le, Tien; Taylor, Frank; Chen, Rachel Ruizhen

    2006-12-20

    An economic ferulic acid recovery from biomass via biological methods is of interest for a number of reasons. Ferulic acid is a precursor to vanillin synthesis. It is also a known antioxidant with potential food and medical applications. Despite its universal presence in all plant cell wall material, the complex structure of the plant cell wall makes ferulic acid recovery from biomass a challenging bioprocess. Previously, without pretreatment, very low (3-13%) recovery of ferulic acid from corn residues was achieved. We report here the discovery of a filamentous fungus Neosartorya spinosa NRRL185 capable of producing a full complement of enzymes to release ferulic acid and the development of an enzymatic process for a complete recovery of ferulic acid from corn bran and corn fibers. A partial characterization of the extracellular proteome of the microbe revealed the presence of at least seven cellulases and hemicellulases activities, including multiple iso-forms of xylanase and ferulic acid esterase. The recovered ferulic acid was bio-converted to vanillin, demonstrating its potential application in natural vanillin synthesis. The enzymatic ferulic acid recovery accompanied a significant release of reducing sugars (76-100%), suggesting much broader applications of the enzymes and enzyme mixtures from this organism.

  2. Identification of enzyme activity that conjugates indole-3-acetic acid to aspartate in immature seeds of pea (Pisum sativum).

    PubMed

    Ostrowski, Maciej; Jakubowska, Anna

    2008-01-01

    This study describes the first identification of plant enzyme activity catalyzing the conjugation of indole-3-acetic acid to amino acids. Enzymatic synthesis of indole-3-acetylaspartate (IAA-Asp) by a crude enzyme preparation from immature seeds of pea (Pisum sativum) was observed. The reaction yielded a product with the same Rf as IAA-Asp standard after thin layer chromatography. The identity of IAA-Asp was verified by HPLC analysis. IAA-Asp formation was dependent on ATP and Mg2+, and was linear during a 60 min period. The enzyme preparation obtained after poly(ethylene glycol) 6000 fractionation showed optimum activity at pH 8.0, and the temperature optimum for IAA-Asp synthesis was 30 degrees C. PMID:17920159

  3. New stabilized FastPrep-CLEAs for sialic acid synthesis.

    PubMed

    García-García, María Inmaculada; Sola-Carvajal, Agustín; Sánchez-Carrón, Guiomar; García-Carmona, Francisco; Sánchez-Ferrer, Alvaro

    2011-05-01

    N-acetyl-D-neuraminic acid aldolase, a key enzyme in the biotechnological production of N-acetyl-D-neuraminic acid (sialic acid) from N-acetyl-D-mannosamine and pyruvate, was immobilized as cross-linked enzyme aggregates (CLEAs) by precipitation with 90% ammonium sulfate and crosslinking with 1% glutaraldehyde. Because dispersion in a reciprocating disruptor (FastPrep) was only able to recover 40% of the activity, improved CLEAs were then prepared by co-aggregation of the enzyme with 10mg/mL bovine serum albumin followed by a sodium borohydride treatment and final disruption by FastPrep (FastPrep-CLEAs). This produced a twofold increase in activity up to 86%, which is a 30% more than that reported for this aldolase in cross-linked inclusion bodies (CLIBs). In addition, these FastPrep-CLEAs presented remarkable biotechnological features for Neu5Ac synthesis, including, good activity and stability at alkaline pHs, a high K(M) for ManNAc (lower for pyruvate) and good operational stability. These results reinforce the practicability of using FastPrep-CLEAs in biocatalysis, thus reducing production costs and favoring reusability.

  4. Advances in the synthesis of α-quaternary α-ethynyl α-amino acids.

    PubMed

    Boibessot, Thibaut; Bénimélis, David; Meffre, Patrick; Benfodda, Zohra

    2016-09-01

    α-Quaternary α-ethynyl α-amino acids are an important class of non-proteinogenic amino acids that play an important role in the development of peptides and peptidomimetics as therapeutic agents and in the inhibition of enzyme activities. This review provides an overview of the literature concerning synthesis and applications of α-quaternary α-ethynyl α-amino acids covering the period from 1977 to 2015.

  5. Parallel Chemoenzymatic Synthesis of Sialosides Containing a C5-Diversified Sialic Acid

    PubMed Central

    Cao, Hongzhi; Muthana, Saddam; Li, Yanhong; Cheng, Jiansong; Chen, Xi

    2009-01-01

    A convenient chemoenzymatic strategy for synthesizing sialosides containing a C5-diversified sialic acid was developed. The α2,3- and α2,6-linked sialosides containing a 5-azido neuraminic acid synthesized by a highly efficient one-pot three-enzyme approach were converted to C5″-amino sialosides, which were used as common intermediates for chemical parallel synthesis to quickly generate a series of sialosides containing various sialic acid forms. PMID:19740656

  6. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the snythesis methods of the prior art.

  7. Non-dopaminergic neurons expressing dopamine synthesis enzymes: differentiation and functional significance.

    PubMed

    Ugryumov, M V; Mel'nikova, V I; Ershov, P V; Balan, I S; Kalas, A

    2002-01-01

    The development and functional significance of neurons in the arcuate nucleus expressing tyrosine hydroxylase and/or aromatic L-amino acid decarboxylase were studied in rat fetuses, neonates, and adults using immunocytochemical (single and double immunolabeling of tyrosine hydroxylase and aromatic L-amino acid decarboxylase) methods with a confocal microscope and computerized image analysis, HPLC with electrochemical detection, and radioimmunological analysis. Single-enzyme neurons containing tyrosine hydroxylase were first seen on day 18 of embryonic development in the ventrolateral part of the arcuate nucleus. Neurons expressing only aromatic L-amino acid decarboxylase or both enzymes of the dopamine synthesis pathway were first seen on day 20 of embryonic development, in the dorsomedial part of the nucleus. On days 20-21 of embryonic development, dopaminergic (containing both enzymes) neurons amounted to less than 1% of all neurons expressing tyrosine hydroxylase and/or aromatic L-amino acid decarboxylase. Nonetheless, in the ex vivo arcuate nucleus and in primary neuron cultures from this structure, there were relatively high leveLs of dopamine and L-dihydroxyphenylalanine (L-DOPA), and these substances were secreted spontaneously and in response to stimulation. In addition. dopamine levels in the arcuate nucleus in fetuses were sufficient to support the inhibitory regulation of prolactin secretion by the hypophysis, which is typical of adult animals. During development, the proportion of dopaminergic neurons increased, reaching 38% in adult rats. Specialized contacts between single-enzyme tyrosine hydroxylase-containing and aromatic L-amino acid decarboxylase-containing neurons were present by day 21 of embryonic development; these were probably involved in transporting L-DOPA from the former neurons to the latter. It was also demonstrated that the axons of single-enzyme decarboxylase-containing neurons projected into the median eminence, supporting the

  8. Cyclic diguanylic acid and cellulose synthesis in Agrobacterium tumefaciens

    SciTech Connect

    Amikam, D.; Benziman, M. )

    1989-12-01

    The occurrence of the novel regulatory nucleotide bis(3',5')-cyclic diguanylic acid (c-di-GMP) and its relation to cellulose biogenesis in the plant pathogen Agrobacterium tumefaciens was studied. c-di-GMP was detected in acid extracts of {sup 32}P-labeled cells grown in various media, and an enzyme responsible for its formation from GTP was found to be present in cell-free preparations. Cellulose synthesis in vivo was quantitatively assessed with ({sup 14}C)glucose as a tracer. The organism produced cellulose during growth in the absence of plant cells, and this capacity was retained in resting cells. Synthesis of a cellulosic product from UDP-glucose in vitro with membrane preparations was markedly stimulated by c-di-GMP and its precursor GTP and was further enhanced by Ca2+. The calcium effect was attributed to inhibition of a c-di-GMP-degrading enzyme shown to be present in the cellulose synthase-containing membranes.

  9. Fluorogenic Substrates for Visualizing Acidic Organelle Enzyme Activities

    PubMed Central

    Harlan, Fiona Karen; Lusk, Jason Scott; Mohr, Breanna Michelle; Guzikowski, Anthony Peter; Batchelor, Robert Hardy; Jiang, Ying

    2016-01-01

    Lysosomes are acidic cytoplasmic organelles that are present in all nucleated mammalian cells and are involved in a variety of cellular processes including repair of the plasma membrane, defense against pathogens, cholesterol homeostasis, bone remodeling, metabolism, apoptosis and cell signaling. Defects in lysosomal enzyme activity have been associated with a variety of neurological diseases including Parkinson’s Disease, Lysosomal Storage Diseases, Alzheimer's disease and Huntington's disease. Fluorogenic lysosomal staining probes were synthesized for labeling lysosomes and other acidic organelles in a live-cell format and were shown to be capable of monitoring lysosomal metabolic activity. The new targeted substrates were prepared from fluorescent dyes having a low pKa value for optimum fluorescence at the lower physiological pH found in lysosomes. They were modified to contain targeting groups to direct their accumulation in lysosomes as well as enzyme-cleavable functions for monitoring specific enzyme activities using a live-cell staining format. Application to the staining of cells derived from blood and skin samples of patients with Metachromatic Leukodystrophy, Krabbe and Gaucher Diseases as well as healthy human fibroblast and leukocyte control cells exhibited localization to the lysosome when compared with known lysosomal stain LysoTracker® Red DND-99 as well as with anti-LAMP1 Antibody staining. When cell metabolism was inhibited with chloroquine, staining with an esterase substrate was reduced, demonstrating that the substrates can be used to measure cell metabolism. When applied to diseased cells, the intensity of staining was reflective of lysosomal enzyme levels found in diseased cells. Substrates specific to the enzyme deficiencies in Gaucher or Krabbe disease patient cell lines exhibited reduced staining compared to that in non-diseased cells. The new lysosome-targeted fluorogenic substrates should be useful for research, diagnostics and

  10. Fluorogenic Substrates for Visualizing Acidic Organelle Enzyme Activities.

    PubMed

    Harlan, Fiona Karen; Lusk, Jason Scott; Mohr, Breanna Michelle; Guzikowski, Anthony Peter; Batchelor, Robert Hardy; Jiang, Ying; Naleway, John Joseph

    2016-01-01

    Lysosomes are acidic cytoplasmic organelles that are present in all nucleated mammalian cells and are involved in a variety of cellular processes including repair of the plasma membrane, defense against pathogens, cholesterol homeostasis, bone remodeling, metabolism, apoptosis and cell signaling. Defects in lysosomal enzyme activity have been associated with a variety of neurological diseases including Parkinson's Disease, Lysosomal Storage Diseases, Alzheimer's disease and Huntington's disease. Fluorogenic lysosomal staining probes were synthesized for labeling lysosomes and other acidic organelles in a live-cell format and were shown to be capable of monitoring lysosomal metabolic activity. The new targeted substrates were prepared from fluorescent dyes having a low pKa value for optimum fluorescence at the lower physiological pH found in lysosomes. They were modified to contain targeting groups to direct their accumulation in lysosomes as well as enzyme-cleavable functions for monitoring specific enzyme activities using a live-cell staining format. Application to the staining of cells derived from blood and skin samples of patients with Metachromatic Leukodystrophy, Krabbe and Gaucher Diseases as well as healthy human fibroblast and leukocyte control cells exhibited localization to the lysosome when compared with known lysosomal stain LysoTracker® Red DND-99 as well as with anti-LAMP1 Antibody staining. When cell metabolism was inhibited with chloroquine, staining with an esterase substrate was reduced, demonstrating that the substrates can be used to measure cell metabolism. When applied to diseased cells, the intensity of staining was reflective of lysosomal enzyme levels found in diseased cells. Substrates specific to the enzyme deficiencies in Gaucher or Krabbe disease patient cell lines exhibited reduced staining compared to that in non-diseased cells. The new lysosome-targeted fluorogenic substrates should be useful for research, diagnostics and

  11. Patterns of diversity of citric acid cycle enzymes.

    PubMed

    Weitzman, P D

    1987-01-01

    The citric acid cycle performs a dual role in cell metabolism, acting as a source of both 'energy' and biosynthetic starting materials. The widespread occurrence of the cycle throughout Nature is an excellent example of the unity of biochemistry, but closer examination reveals that there is considerable diversity in the citric acid cycle of different organisms with respect to metabolic role, molecular enzymology and mode of regulation. Two enzymes of the cycle--citrate synthase and succinate thiokinase--have been found to exhibit particularly striking patterns of diversity in structure and catalytic and regulatory function. Some of these patterns show a correlation with the taxonomic groupings of the organisms and with their physiological characteristics. Comparative enzyme studies have a contribution to make to an ultimate understanding of the cycle and its cellular operation, and there are substantial benefits to be gained from interactive studies on both prokaryotic and eukaryotic systems.

  12. Liver Enzymes and Uric acid in Acute Heart Failure

    PubMed Central

    Vakilian, Farveh; Rafighdoost, Abbas Ali; Rafighdoost, Amir Hossein; Amin, Ahmad; Salehi, Maryam

    2015-01-01

    Background: Acute heart failure (AHF) is defined as the new onset or recurrence of gradual or rapidly worsening signs and symptoms of heart failure, requiring urgent or emergent therapy. Objectives: This study attempts to assess the association of liver function tests (LFT) and uric acid level with in hospital outcome and echocardiography parameters, in patients with acute decompensated heart failure. Patients and Methods: A total of 100 patients (aged 16 - 90 years, 60% men) admitted with AHF were enrolled. LFTs and uric acid levels were assessed on first day and before discharge, and patients were followed for 3 months. Results: In-hospital outcomes were considered. Mean Left Ventricular Ejection Fraction (LVEF) was 35% (20 - 45%). Mean Uric acid level was 8.4 mg/dL, significantly higher than chronic HF and normal groups (P < 0.02). Elevated liver enzymes were seen in 52% patients, mostly (87%) in transaminases. Liver enzymes were decreased in 85% patients before discharge. LFT and uric acid levels were inversely and significantly correlated with LVEF on echocardiography (P = 0.02), but not with diastolic parameters. Although there was no significant correlation between uric acid level and in-hospital mortality, risk of intubation and rehospitalization in 3 months, enzyme levels increased in these groups. Increased aspartate transaminase (AST level) was associated with inotrope infusion in AHF patients (42 vs. 82 mg/dL, P = 0.03). Conclusions: Abnormal transaminases and uric acid levels are seen in AHF patients. Increased AST levels may be a predictor of the need for inotrope during hospital course in these patients. PMID:26528447

  13. Regulation of amino acid metabolic enzymes and transporters in plants.

    PubMed

    Pratelli, Réjane; Pilot, Guillaume

    2014-10-01

    Amino acids play several critical roles in plants, from providing the building blocks of proteins to being essential metabolites interacting with many branches of metabolism. They are also important molecules that shuttle organic nitrogen through the plant. Because of this central role in nitrogen metabolism, amino acid biosynthesis, degradation, and transport are tightly regulated to meet demand in response to nitrogen and carbon availability. While much is known about the feedback regulation of the branched biosynthesis pathways by the amino acids themselves, the regulation mechanisms at the transcriptional, post-transcriptional, and protein levels remain to be identified. This review focuses mainly on the current state of our understanding of the regulation of the enzymes and transporters at the transcript level. Current results describing the effect of transcription factors and protein modifications lead to a fragmental picture that hints at multiple, complex levels of regulation that control and coordinate transport and enzyme activities. It also appears that amino acid metabolism, amino acid transport, and stress signal integration can influence each other in a so-far unpredictable fashion.

  14. Synthesis of alpha-amino acids

    DOEpatents

    Davis, J.W. Jr.

    1983-01-25

    A method is described for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R[sub 1]R[sub 2]C(OSOCl)CN, R[sub 1]R[sub 2]C(Cl)CN and [R[sub 1]R[sub 2]C(CN)O][sub 2]SO wherein R[sub 1] and R[sub 2] are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art. No Drawings

  15. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  16. Reduction of 7-ketolithocholic acid by human liver enzyme preparations in vitro.

    PubMed

    Amuro, Y; Yamade, W; Kudo, K; Yamamoto, T; Hada, T; Higashino, K

    1989-01-01

    The formation of chenodeoxycholic and ursodeoxycholic acids from 7-ketolithocholic acid by human liver preparations was examined in vitro. Liver preparations were incubated with 7-ketolithocholic acid at pH 5.5 in a sodium-potassium-phosphate buffer containing NADPH or NADH. The products formed were analyzed by gas chromatography and gas chromatography-mass spectrometry. Results showed that chenodeoxycholic and ursodeoxycholic acids could be formed from 7-ketolithocholic acid by human liver enzyme(s). The enzyme(s) required NADPH but not NADH as coenzyme and was localized largely in the microsomes. The conjugated 7-ketolithocholic acid, especially the taurine conjugated, was predominantly reduced to chenodeoxycholic acid, whereas the unconjugated 7-ketolithocholic acid was not reduced well to either chenodeoxycholic acid or ursodeoxycholic acid. Thus the reduction of 7-ketolithocholic acid by human liver enzyme(s) was found to be dependent on whether the substrate was conjugated or not. PMID:2912152

  17. Control of ethylene synthesis by expression of a bacterial enzyme in transgenic tomato plants.

    PubMed Central

    Klee, H J; Hayford, M B; Kretzmer, K A; Barry, G F; Kishore, G M

    1991-01-01

    Synthesis of the phytohormone ethylene is believed to be essential for many plant developmental processes. The control of ripening in climacteric fruits and vegetables is among the best characterized of these processes. One approach to reduce ethylene synthesis in plants is metabolism of its immediate precursor, 1-aminocyclopropane-1-carboxylic acid (ACC). Soil bacteria containing an enzyme, ACC deaminase, were identified by their ability to grow on ACC as a sole nitrogen source. The gene encoding ACC deaminase was cloned and introduced into tomato plants. Reduction in ethylene synthesis in transgenic plants did not cause any apparent vegetative phenotypic abnormalities. However, fruits from these plants exhibited significant delays in ripening, and the mature fruits remained firm for at least 6 weeks longer than the nontransgenic control fruit. These results indicated that ACC deaminase is useful for examining the role of ethylene in many developmental and stress-related processes in plants as well as for extending the shelf life of fruits and vegetables whose ripening is mediated by ethylene. PMID:1821764

  18. Crystal structure of Spot 14, a modulator of fatty acid synthesis

    SciTech Connect

    Colbert, Christopher L.; Kim, Chai-Wan; Moon, Young-Ah; Henry, Lisa; Palnitkar, Maya; McKean, William B.; Fitzgerald, Kevin; Deisenhofer, Johann; Horton, Jay D.; Kwon, Hyock Joo

    2011-09-06

    Spot 14 (S14) is a protein that is abundantly expressed in lipogenic tissues and is regulated in a manner similar to other enzymes involved in fatty acid synthesis. Deletion of S14 in mice decreased lipid synthesis in lactating mammary tissue, but the mechanism of S14's action is unknown. Here we present the crystal structure of S14 to 2.65 {angstrom} and biochemical data showing that S14 can form heterodimers with MIG12. MIG12 modulates fatty acid synthesis by inducing the polymerization and activity of acetyl-CoA carboxylase, the first committed enzymatic reaction in the fatty acid synthesis pathway. Coexpression of S14 and MIG12 leads to heterodimers and reduced acetyl-CoA carboxylase polymerization and activity. The structure of S14 suggests a mechanism whereby heterodimer formation with MIG12 attenuates the ability of MIG12 to activate ACC.

  19. Carboxylic acid reductase is a versatile enzyme for the conversion of fatty acids into fuels and chemical commodities

    PubMed Central

    Akhtar, M. Kalim; Turner, Nicholas J.; Jones, Patrik R.

    2013-01-01

    Aliphatic hydrocarbons such as fatty alcohols and petroleum-derived alkanes have numerous applications in the chemical industry. In recent years, the renewable synthesis of aliphatic hydrocarbons has been made possible by engineering microbes to overaccumulate fatty acids. However, to generate end products with the desired physicochemical properties (e.g., fatty aldehydes, alkanes, and alcohols), further conversion of the fatty acid is necessary. A carboxylic acid reductase (CAR) from Mycobacterium marinum was found to convert a wide range of aliphatic fatty acids (C6–C18) into corresponding aldehydes. Together with the broad-substrate specificity of an aldehyde reductase or an aldehyde decarbonylase, the catalytic conversion of fatty acids to fatty alcohols (C8–C16) or fatty alkanes (C7–C15) was reconstituted in vitro. This concept was applied in vivo, in combination with a chain-length-specific thioesterase, to engineer Escherichia coli BL21(DE3) strains that were capable of synthesizing fatty alcohols and alkanes. A fatty alcohol titer exceeding 350 mg·L−1 was obtained in minimal media supplemented with glucose. Moreover, by combining the CAR-dependent pathway with an exogenous fatty acid-generating lipase, natural oils (coconut oil, palm oil, and algal oil bodies) were enzymatically converted into fatty alcohols across a broad chain-length range (C8–C18). Together with complementing enzymes, the broad substrate specificity and kinetic characteristics of CAR opens the road for direct and tailored enzyme-catalyzed conversion of lipids into user-ready chemical commodities. PMID:23248280

  20. Carboxylic acid reductase is a versatile enzyme for the conversion of fatty acids into fuels and chemical commodities.

    PubMed

    Akhtar, M Kalim; Turner, Nicholas J; Jones, Patrik R

    2013-01-01

    Aliphatic hydrocarbons such as fatty alcohols and petroleum-derived alkanes have numerous applications in the chemical industry. In recent years, the renewable synthesis of aliphatic hydrocarbons has been made possible by engineering microbes to overaccumulate fatty acids. However, to generate end products with the desired physicochemical properties (e.g., fatty aldehydes, alkanes, and alcohols), further conversion of the fatty acid is necessary. A carboxylic acid reductase (CAR) from Mycobacterium marinum was found to convert a wide range of aliphatic fatty acids (C(6)-C(18)) into corresponding aldehydes. Together with the broad-substrate specificity of an aldehyde reductase or an aldehyde decarbonylase, the catalytic conversion of fatty acids to fatty alcohols (C(8)-C(16)) or fatty alkanes (C(7)-C(15)) was reconstituted in vitro. This concept was applied in vivo, in combination with a chain-length-specific thioesterase, to engineer Escherichia coli BL21(DE3) strains that were capable of synthesizing fatty alcohols and alkanes. A fatty alcohol titer exceeding 350 mg·L(-1) was obtained in minimal media supplemented with glucose. Moreover, by combining the CAR-dependent pathway with an exogenous fatty acid-generating lipase, natural oils (coconut oil, palm oil, and algal oil bodies) were enzymatically converted into fatty alcohols across a broad chain-length range (C(8)-C(18)). Together with complementing enzymes, the broad substrate specificity and kinetic characteristics of CAR opens the road for direct and tailored enzyme-catalyzed conversion of lipids into user-ready chemical commodities. PMID:23248280

  1. Oxidation of indole-3-acetic acid to oxindole-3-acetic acid by an enzyme preparation from Zea mays

    NASA Technical Reports Server (NTRS)

    Reinecke, D. M.; Bandurski, R. S.

    1988-01-01

    Indole-3-acetic acid is oxidized to oxindole-3-acetic acid by Zea mays tissue extracts. Shoot, root, and endosperm tissues have enzyme activities of 1 to 10 picomoles per hour per milligram protein. The enzyme is heat labile, is soluble, and requires oxygen for activity. Cofactors of mixed function oxygenase, peroxidase, and intermolecular dioxygenase are not stimulatory to enzymic activity. A heat-stable, detergent-extractable component from corn enhances enzyme activity 6- to 10-fold. This is the first demonstration of the in vitro enzymic oxidation of indole-3-acetic acid to oxindole-3-acetic acid in higher plants.

  2. Identification and functional analysis of delta-9 desaturase, a key enzyme in PUFA Synthesis, isolated from the oleaginous diatom Fistulifera.

    PubMed

    Muto, Masaki; Kubota, Chihiro; Tanaka, Masayoshi; Satoh, Akira; Matsumoto, Mitsufumi; Yoshino, Tomoko; Tanaka, Tsuyoshi

    2013-01-01

    Oleaginous microalgae are one of the promising resource of nonedible biodiesel fuel (BDF) feed stock alternatives. Now a challenge task is the decrease of the long-chain polyunsaturated fatty acids (PUFAs) content affecting on the BDF oxidative stability by using gene manipulation techniques. However, only the limited knowledge has been available concerning the fatty acid and PUFA synthesis pathways in microalgae. Especially, the function of Δ9 desaturase, which is a key enzyme in PUFA synthesis pathway, has not been determined in diatom. In this study, 4 Δ(9) desaturase genes (fD9desA, fD9desB, fD9desC and fD9desD) from the oleaginous diatom Fistulifera were newly isolated and functionally characterized. The putative Δ(9) acyl-CoA desaturases in the endoplasmic reticulum (ER) showed 3 histidine clusters that are well-conserved motifs in the typical Δ(9) desaturase. Furthermore, the function of these Δ(9) desaturases was confirmed in the Saccharomyces cerevisiae ole1 gene deletion mutant (Δole1). All the putative Δ(9) acyl-CoA desaturases showed Δ(9) desaturation activity for C16∶0 fatty acids; fD9desA and fD9desB also showed desaturation activity for C18∶0 fatty acids. This study represents the first functional analysis of Δ(9) desaturases from oleaginous microalgae and from diatoms as the first enzyme to introduce a double bond in saturated fatty acids during PUFA synthesis. The findings will provide beneficial insights into applying metabolic engineering processes to suppressing PUFA synthesis in this oleaginous microalgal strain.

  3. Decreased hepatotoxic bile acid composition and altered synthesis in progressive human nonalcoholic fatty liver disease

    SciTech Connect

    Lake, April D.; Novak, Petr; Shipkova, Petia; Aranibar, Nelly; Robertson, Donald; Reily, Michael D.; Lu, Zhenqiang; Lehman-McKeeman, Lois D.; Cherrington, Nathan J.

    2013-04-15

    Bile acids (BAs) have many physiological roles and exhibit both toxic and protective influences within the liver. Alterations in the BA profile may be the result of disease induced liver injury. Nonalcoholic fatty liver disease (NAFLD) is a prevalent form of chronic liver disease characterized by the pathophysiological progression from simple steatosis to nonalcoholic steatohepatitis (NASH). The hypothesis of this study is that the ‘classical’ (neutral) and ‘alternative’ (acidic) BA synthesis pathways are altered together with hepatic BA composition during progression of human NAFLD. This study employed the use of transcriptomic and metabolomic assays to study the hepatic toxicologic BA profile in progressive human NAFLD. Individual human liver samples diagnosed as normal, steatosis, and NASH were utilized in the assays. The transcriptomic analysis of 70 BA genes revealed an enrichment of downregulated BA metabolism and transcription factor/receptor genes in livers diagnosed as NASH. Increased mRNA expression of BAAT and CYP7B1 was observed in contrast to decreased CYP8B1 expression in NASH samples. The BA metabolomic profile of NASH livers exhibited an increase in taurine together with elevated levels of conjugated BA species, taurocholic acid (TCA) and taurodeoxycholic acid (TDCA). Conversely, cholic acid (CA) and glycodeoxycholic acid (GDCA) were decreased in NASH liver. These findings reveal a potential shift toward the alternative pathway of BA synthesis during NASH, mediated by increased mRNA and protein expression of CYP7B1. Overall, the transcriptomic changes of BA synthesis pathway enzymes together with altered hepatic BA composition signify an attempt by the liver to reduce hepatotoxicity during disease progression to NASH. - Highlights: ► Altered hepatic bile acid composition is observed in progressive NAFLD. ► Bile acid synthesis enzymes are transcriptionally altered in NASH livers. ► Increased levels of taurine and conjugated bile acids

  4. The synthesis of starch from carbon dioxide using isolubilized stabilized enzymes

    NASA Technical Reports Server (NTRS)

    Bassham, J. A.; Bearden, L.; Wilke, C.; Carroad, P.; Mitra, G.; Ige, R.

    1972-01-01

    Systems for artificial manufacture of starch and for delineation of technological areas, and the rationale for studying them are considered. A discussion of the enzyme-catalyzed routes of synthesis available and a choice as to the most promising route are presented. A discussion of the enzymes involved, of enzyme insolubilization technology, and of possible engineering approaches, with examples in the form of model calculations for both reactors and separators, are also presented.

  5. Combinatorial Effects of Fatty Acid Elongase Enzymes on Nervonic Acid Production in Camelina sativa

    PubMed Central

    Huai, Dongxin; Zhang, Yuanyuan; Zhang, Chunyu; Cahoon, Edgar B.; Zhou, Yongming

    2015-01-01

    Very long chain fatty acids (VLCFAs) with chain lengths of 20 carbons and longer provide feedstocks for various applications; therefore, improvement of VLCFA contents in seeds has become an important goal for oilseed enhancement. VLCFA biosynthesis is controlled by a multi-enzyme protein complex referred to as fatty acid elongase, which is composed of β-ketoacyl-CoA synthase (KCS), β-ketoacyl-CoA reductase (KCR), β-hydroxyacyl-CoA dehydratase (HCD) and enoyl reductase (ECR). KCS has been identified as the rate-limiting enzyme, but little is known about the involvement of other three enzymes in VLCFA production. Here, the combinatorial effects of fatty acid elongase enzymes on VLCFA production were assessed by evaluating the changes in nervonic acid content. A KCS gene from Lunaria annua (LaKCS) and the other three elongase genes from Arabidopsis thaliana were used for the assessment. Five seed-specific expressing constructs, including LaKCS alone, LaKCS with AtKCR, LaKCS with AtHCD, LaKCS with AtECR, and LaKCS with AtKCR and AtHCD, were transformed into Camelina sativa. The nervonic acid content in seed oil increased from null in wild type camelina to 6-12% in LaKCS-expressing lines. However, compared with that from the LaKCS-expressing lines, nervonic acid content in mature seeds from the co-expressing lines with one or two extra elongase genes did not show further increases. Nervonic acid content from LaKCS, AtKCR and AtHCD co-expressing line was significantly higher than that in LaKCS-expressing line during early seed development stage, while the ultimate nervonic acid content was not significantly altered. The results from this study thus provide useful information for future engineering of oilseed crops for higher VLCFA production. PMID:26121034

  6. Potency of individual bile acids to regulate bile acid synthesis and transport genes in primary human hepatocyte cultures.

    PubMed

    Liu, Jie; Lu, Hong; Lu, Yuan-Fu; Lei, Xiaohong; Cui, Julia Yue; Ellis, Ewa; Strom, Stephen C; Klaassen, Curtis D

    2014-10-01

    Bile acids (BAs) are known to regulate their own homeostasis, but the potency of individual bile acids is not known. This study examined the effects of cholic acid (CA), chenodeoxycholic acid (CDCA), deoxycholic acid (DCA), lithocholic acid (LCA) and ursodeoxycholic acid (UDCA) on expression of BA synthesis and transport genes in human primary hepatocyte cultures. Hepatocytes were treated with the individual BAs at 10, 30, and 100μM for 48 h, and RNA was extracted for real-time PCR analysis. For the classic pathway of BA synthesis, BAs except for UDCA markedly suppressed CYP7A1 (70-95%), the rate-limiting enzyme of bile acid synthesis, but only moderately (35%) down-regulated CYP8B1 at a high concentration of 100μM. BAs had minimal effects on mRNA of two enzymes of the alternative pathway of BA synthesis, namely CYP27A1 and CYP7B1. BAs increased the two major target genes of the farnesoid X receptor (FXR), namely the small heterodimer partner (SHP) by fourfold, and markedly induced fibroblast growth factor 19 (FGF19) over 100-fold. The BA uptake transporter Na(+)-taurocholate co-transporting polypeptide was unaffected, whereas the efflux transporter bile salt export pump was increased 15-fold and OSTα/β were increased 10-100-fold by BAs. The expression of the organic anion transporting polypeptide 1B3 (OATP1B3; sixfold), ATP-binding cassette (ABC) transporter G5 (ABCG5; sixfold), multidrug associated protein-2 (MRP2; twofold), and MRP3 (threefold) were also increased, albeit to lesser degrees. In general, CDCA was the most potent and effective BA in regulating these genes important for BA homeostasis, whereas DCA and CA were intermediate, LCA the least, and UDCA ineffective.

  7. Boronic acid-based enzyme inhibitors: a review of recent progress.

    PubMed

    Fu, H; Fang, H; Sun, Jie; Wang, H; Liu, A; Sun, J; Wu, Z

    2014-01-01

    Since Bortezomib was approved by US FDA as the first drug to treat multiple myeloma, various boronic acid compounds have been developed as enzyme inhibitors. This paper reviewed the progress of boronic acid-based inhibitors against enzymes including proteasome, serine protease, HDACs and other enzymes in the past decade.

  8. Enzyme-catalyzed synthesis of polyamides and polypeptides

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polyamides and polypeptides are important polymers in biological systems and industrial processes. Usually polyamides are produced via chemical synthesis, whereas polypeptides and proteins are isolated from living systems or produced from Merrifield synthesis. An area of active research is to use ...

  9. Retinol metabolism in LLC-PK1 Cells. Characterization of retinoic acid synthesis by an established mammalian cell line.

    PubMed

    Napoli, J L

    1986-10-15

    Specific assays, based on gas chromatography-mass spectrometry and high-performance liquid chromatography, were used to quantify the conversion of retinol and retinal into retinoic acid by the pig kidney cell line LLC-PK1. Retinoic acid synthesis was linear for 2-4 h as well as with graded amounts of either substrate to at least 50 microM. Retinoic acid concentrations increased through 6-8 h, but decreased thereafter because of substrate depletion (t1/2 of retinol = 13 h) and product metabolism (1/2 = 2.3 h). Retinoic acid metabolism was accelerated by treating cells with 100 nM retinoic acid for 10 h (t1/2 = 1.7 h) and was inhibited by the antimycotic imidazole ketoconazole. Feedback inhibition was not indicated since retinoic acid up to 100 nM did not inhibit its own synthesis. Retinol dehydrogenation was rate-limiting. The reduction and dehydrogenation of retinal were 4-8-fold and 30-60-fold faster, respectively. Greater than 95% of retinol was converted into metabolites other than retinoic acid, whereas the major metabolite of retinal was retinoic acid. The synthetic retinoid 13-cis-N-ethylretinamide inhibited retinoic acid synthesis, but 4-hydroxylphenylretinamide did not. 4'-(9-Acridinylamino)methanesulfon-m-anisidide, an inhibitor of aldehyde oxidase, and ethanol did not inhibit retinoic acid synthesis. 4-Methylpyrazole was a weak inhibitor: disulfiram was a potent inhibitor. These data indicate that retinol dehydrogenase is a sulfhydryl group-dependent enzyme, distinct from ethanol dehydrogenase. Homogenates of LLC-PK1 cells converted retinol into retinoic acid and retinyl palmitate and hydrolyzed retinyl palmitate. This report suggests that substrate availability, relative to enzyme activity/amount, is a primary determinant of the rate of retinoic acid synthesis, identifies inhibitors of retinoic acid synthesis, and places retinoic acid synthesis into perspective with several other known pathways of retinoid metabolism. PMID:3759984

  10. Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway

    PubMed Central

    Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z.; Yazdani, Syed Shams

    2016-01-01

    Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817

  11. Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway.

    PubMed

    Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z; Yazdani, Syed Shams

    2016-01-01

    Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817

  12. Synthesis of novel acid electrolytes for phosphoric acid fuel cells

    NASA Astrophysics Data System (ADS)

    Adcock, James L.

    1988-11-01

    A 40 millimole per hour scale aerosol direct fluorination reactor was constructed. F-Methyl F-4-methoxybutanoate and F-4-methoxybutanoyl fluoride were synthesized by aerosol direct fluorination of methyl 4-methoxybutanoate. Basic hydrolysis of the perfluorinated derivatives produce sodium F-4 methoxybutanoate which was pyrolyzed to F-3-methoxy-1-propene. Purification and shipment of 33 grams of F-3-methoxy-1-propene followed. Syntheses by analogous methods allowed production and shipment of 5 grams of F-3-ethoxy 1-propene, 18 grams of F-3-(2-methoxy.ethoxy) 1-propene, and 37 grams of F-3,3-dimethyl 1-butene. Eighteen grams of F-2,2-dimethyl 1-chloropropane was produced directly and shipped. As suggested by other contractors, 5 grams of F-3-methoxy 1-iodopropane, and 5 grams of F-3-(2-methoxy.ethoxy) 1-iodopropane were produced by converting the respective precursor acid sodium salts produced for olefin synthesis to the silver salts and pyrolyzing them with iodine. Each of these compounds was prepared for the first time by the aerosol fluorination process during the course of the contract. These samples were provided to other Gas Research Institute (GRI) contractors for synthesis of perfluorinated sulfur (VI) and phosphorous (V) acids.

  13. Ionic liquids as novel solvents for the synthesis of sugar fatty acid ester.

    PubMed

    Mai, Ngoc Lan; Ahn, Kihun; Bae, Sang Woo; Shin, Dong Woo; Morya, Vivek Kumar; Koo, Yoon-Mo

    2014-12-01

    Sugar fatty acid esters are bio-surfactants known for their non-toxic, non-ionic, and high biodegradability . With great emulsifying and conditioning effects, sugar fatty acids are widely used in the food, pharmaceutical, and cosmetic industries. Biosynthesis of sugar fatty acid esters has attracted growing attention in recent decades. In this study, the enzymatic synthesis of sugar fatty acid esters in ionic liquids was developed, optimized, and scaled up. Reaction parameters affecting the conversion yield of lipase-catalyzed synthesis of glucose laurate from glucose and vinyl laurate (i.e. temperature, vinyl laurate/glucose molar ratio, and enzyme loads) were optimized by response surface methodology (RSM). In addition, production was scaled up to 2.5 L, and recycling of enzyme and ionic liquids was investigated. The results showed that under optimal reaction conditions (66.86 °C, vinyl laurate/glucose molar ratio of 7.63, enzyme load of 73.33 g/L), an experimental conversion yield of 96.4% was obtained which is close to the optimal value predicted by RSM (97.16%). A similar conversion yield was maintained when the reaction was carried out at 2.5 L. Moreover, the enzymes and ionic liquids could be recycled and reused effectively for up to 10 cycles. The results indicate the feasibility of ionic liquids as novel solvents for the biosynthesis of sugar fatty acid esters.

  14. Increased Biomass Yield of Lactococcus lactis by Reduced Overconsumption of Amino Acids and Increased Catalytic Activities of Enzymes

    PubMed Central

    Adamberg, Kaarel; Seiman, Andrus; Vilu, Raivo

    2012-01-01

    Steady state cultivation and multidimensional data analysis (metabolic fluxes, absolute proteome, and transcriptome) are used to identify parameters that control the increase in biomass yield of Lactococcus lactis from 0.10 to 0.12 C-mol C-mol−1 with an increase in specific growth rate by 5 times from 0.1 to 0.5 h−1. Reorganization of amino acid consumption was expressed by the inactivation of the arginine deiminase pathway at a specific growth rate of 0.35 h−1 followed by reduced over-consumption of pyruvate directed amino acids (asparagine, serine, threonine, alanine and cysteine) until almost all consumed amino acids were used only for protein synthesis at maximal specific growth rate. This balanced growth was characterized by a high glycolytic flux carrying up to 87% of the carbon flow and only amino acids that relate to nucleotide synthesis (glutamine, serine and asparagine) were consumed in higher amounts than required for cellular protein synthesis. Changes in the proteome were minor (mainly increase in the translation apparatus). Instead, the apparent catalytic activities of enzymes and ribosomes increased by 3.5 times (0.1 vs 0.5 h−1). The apparent catalytic activities of glycolytic enzymes and ribosomal proteins were seen to follow this regulation pattern while those of enzymes involved in nucleotide metabolism increased more than the specific growth rate (over 5.5 times). Nucleotide synthesis formed the most abundant biomonomer synthetic pathway in the cells with an expenditure of 6% from the total ATP required for biosynthesis. Due to the increase in apparent catalytic activity, ribosome translation was more efficient at higher growth rates as evidenced by a decrease of protein to mRNA ratios. All these effects resulted in a 30% decrease of calculated ATP spilling (0.1 vs 0.5 h−1). Our results show that bioprocesses can be made more efficient (using a balanced metabolism) by varying the growth conditions. PMID:23133574

  15. Angiotensin-converting enzyme inhibitors modulate kynurenic acid production in rat brain cortex in vitro.

    PubMed

    Zakrocka, Izabela; Turski, Waldemar A; Kocki, Tomasz

    2016-10-15

    It is well established that the renin-angiotensin system (RAS) is present in the brain and that glutamate activates the brain centers responsible for blood pressure control. An antagonist of glutamate, kynurenic acid (KYNA) was shown to decrease blood pressure after intracerebral administration. KYNA is an endogenous metabolite of tryptophan produced from the breakdown of kynurenine by kynurenine aminotransferases (KAT), mainly within astrocytes. The purpose of this study was to evaluate the influence of three angiotensin-converting enzyme inhibitors (lisinopril, perindopril and ramipril) on KYNA production and KAT activity in the rat brain cortex in vitro. The effect of the angiotensin-converting enzyme inhibitors on KYNA production was examined on rat brain cortical slices incubated for 2h in the presence of l-kynurenine and the angiotensin-converting enzyme inhibitors. To analyze KAT I and KAT II activity, brain cortical homogenates were incubated for 2h with L-kynurenine and the tested drugs. KYNA was separated by HPLC and quantified fluorometrically. Among the examined angiotensin-converting enzyme inhibitors, lisinopril increased KYNA production, perindopril was ineffective, and ramipril decreased KYNA synthesis in rat brain cortical slices. Lisinopril increased KAT I activity and perindopril did not affect it. However, ramipril lowered KAT I activity in rat brain cortex in vitro. Neither lisinopril nor perindopril affected KAT II activity, but ramipril decreased KAT II activity in the rat brain cortex in vitro. Our study reveals that angiotensin-converting enzyme inhibitors show various influences on KYNA production in rat brain cortical slices and activity of KATs.

  16. Nanostructured Membranes for Enzyme Catalysis and Green Synthesis of Nanoparticles

    EPA Science Inventory

    Macroporous membranes functionalized with ionizable macromolecules provide promising applications in toxic metal capture at high capacity, nanoparticle synthesis, and catalysis. Our low-pressure membrane approach is marked by reaction and separation selectivity and their tunabil...

  17. Nanostructured Membranes for Green Synthesis of Nanoparticles and Enzyme Catalysis

    EPA Science Inventory

    Macroporous membranes functionalized with ionizable macromolecules provide promising applications in toxic metal capture at high capacity, nanoparticle synthesis, and catalysis. Our low‐pressure membrane approach is marked by reaction and separation selectivity and their tunabili...

  18. Catalysis of the Carbonylation of Alcohols to Carboxylic Acids Including Acetic Acid Synthesis from Methanol.

    ERIC Educational Resources Information Center

    Forster, Denis; DeKleva, Thomas W.

    1986-01-01

    Monsanto's highly successful synthesis of acetic acid from methanol and carbon monoxide illustrates use of new starting materials to replace pretroleum-derived ethylene. Outlines the fundamental aspects of the acetic acid process and suggests ways of extending the synthesis to higher carboxylic acids. (JN)

  19. In Silico Phylogenetic Analysis and Molecular Modelling Study of 2-Haloalkanoic Acid Dehalogenase Enzymes from Bacterial and Fungal Origin

    PubMed Central

    Satpathy, Raghunath; Konkimalla, V. B.; Ratha, Jagnyeswar

    2016-01-01

    2-Haloalkanoic acid dehalogenase enzymes have broad range of applications, starting from bioremediation to chemical synthesis of useful compounds that are widely distributed in fungi and bacteria. In the present study, a total of 81 full-length protein sequences of 2-haloalkanoic acid dehalogenase from bacteria and fungi were retrieved from NCBI database. Sequence analysis such as multiple sequence alignment (MSA), conserved motif identification, computation of amino acid composition, and phylogenetic tree construction were performed on these primary sequences. From MSA analysis, it was observed that the sequences share conserved lysine (K) and aspartate (D) residues in them. Also, phylogenetic tree indicated a subcluster comprised of both fungal and bacterial species. Due to nonavailability of experimental 3D structure for fungal 2-haloalkanoic acid dehalogenase in the PDB, molecular modelling study was performed for both fungal and bacterial sources of enzymes present in the subcluster. Further structural analysis revealed a common evolutionary topology shared between both fungal and bacterial enzymes. Studies on the buried amino acids showed highly conserved Leu and Ser in the core, despite variation in their amino acid percentage. Additionally, a surface exposed tryptophan was conserved in all of these selected models. PMID:26880911

  20. [Effect of wood modification on lignin consumption and synthesis of lignolytic enzymes by the fungus Panus (Lentinus) tigrinus].

    PubMed

    Kadimaliev, D A; Revin, V V; Atykian, N A; Samuilov, V D

    2003-01-01

    Lignin consumption and synthesis of lignolytic enzymes by the fungus Panus (Lentinus) tigrinus cultivated on solid phase (modified and unmodified birch and pine sawdusts) were studied. The fungus grew better and consumed more readily the birch lignin than the pine wood. Peroxidase activity was higher in the case of pine sawdust; laccase and lignolytic activities, in the case of birth sawdust. Treatment with ammonia or sulfuric acid decreased lignin consumption by the fungus cultivated on either medium. Modification of sawdust by ultrasound increased lignin consumption and may be recommended for accelerating biodegradation of lignocellulose substrates. PMID:14593869

  1. Amino acids inhibit kynurenic acid formation via suppression of kynurenine uptake or kynurenic acid synthesis in rat brain in vitro.

    PubMed

    Sekine, Airi; Okamoto, Misaki; Kanatani, Yuka; Sano, Mitsue; Shibata, Katsumi; Fukuwatari, Tsutomu

    2015-01-01

    The tryptophan metabolite, kynurenic acid (KYNA), is a preferential antagonist of the α7 nicotinic acetylcholine receptor at endogenous brain concentrations. Recent studies have suggested that increase of brain KYNA levels is involved in psychiatric disorders such as schizophrenia and depression. KYNA-producing enzymes have broad substrate specificity for amino acids, and brain uptake of kynurenine (KYN), the immediate precursor of KYNA, is via large neutral amino acid transporters (LAT). In the present study, to find out amino acids with the potential to suppress KYNA production, we comprehensively investigated the effects of proteinogenic amino acids on KYNA formation and KYN uptake in rat brain in vitro. Cortical slices of rat brain were incubated for 2 h in Krebs-Ringer buffer containing a physiological concentration of KYN with individual amino acids. Ten out of 19 amino acids (specifically, leucine, isoleucine, phenylalanine, methionine, tyrosine, alanine, cysteine, glutamine, glutamate, and aspartate) significantly reduced KYNA formation at 1 mmol/L. These amino acids showed inhibitory effects in a dose-dependent manner, and partially inhibited KYNA production at physiological concentrations. Leucine, isoleucine, methionine, phenylalanine, and tyrosine, all LAT substrates, also reduced tissue KYN concentrations in a dose-dependent manner, with their inhibitory rates for KYN uptake significantly correlated with KYNA formation. These results suggest that five LAT substrates inhibit KYNA formation via blockade of KYN transport, while the other amino acids act via blockade of the KYNA synthesis reaction in brain. Amino acids can be a good tool to modulate brain function by manipulation of KYNA formation in the brain. This approach may be useful in the treatment and prevention of neurological and psychiatric diseases associated with increased KYNA levels.

  2. Enzyme-assisted target recycling (EATR) for nucleic acid detection.

    PubMed

    Gerasimova, Yulia V; Kolpashchikov, Dmitry M

    2014-09-01

    Fast, reliable and sensitive methods for nucleic acid detection are of growing practical interest with respect to molecular diagnostics of cancer, infectious and genetic diseases. Currently, PCR-based and other target amplification strategies are most extensively used in practice. At the same time, such assays have limitations that can be overcome by alternative approaches. There is a recent explosion in the design of methods that amplify the signal produced by a nucleic acid target, without changing its copy number. This review aims at systematization and critical analysis of the enzyme-assisted target recycling (EATR) signal amplification technique. The approach uses nucleases to recognize and cleave the probe-target complex. Cleavage reactions produce a detectable signal. The advantages of such techniques are potentially low sensitivity to contamination and lack of the requirement of a thermal cycler. Nucleases used for EATR include sequence-dependent restriction or nicking endonucleases or sequence independent exonuclease III, lambda exonuclease, RNase H, RNase HII, AP endonuclease, duplex-specific nuclease, DNase I, or T7 exonuclease. EATR-based assays are potentially useful for point-of-care diagnostics, single nucleotide polymorphisms genotyping and microRNA analysis. Specificity, limit of detection and the potential impact of EATR strategies on molecular diagnostics are discussed.

  3. Bacterial synthesis of polysialic acid lactosides in recombinant Escherichia coli K-12.

    PubMed

    Richard, Emeline; Buon, Laurine; Drouillard, Sophie; Fort, Sébastien; Priem, Bernard

    2016-07-01

    Bacterial polysialyltransferases (PSTs) are processive enzymes involved in the synthesis of polysialic capsular polysaccharides. They can also synthesize polysialic acid in vitro from disialylated and trisialylated lactoside acceptors, which are the carbohydrate moieties of GD3 and GT3 gangliosides, respectively. Here, we engineered a non-pathogenic Escherichia coli strain that overexpresses recombinant sialyltransferases and sialic acid synthesis genes and can convert an exogenous lactoside into polysialyl lactosides. Several PSTs were assayed for their ability to synthesize polysialyl lactosides in the recombinant strains. Fed-batch cultures produced α-2,8 polysialic acid or alternate α-2,8-2,9 polysialic acid in quantities reaching several grams per liter. Bacterial culture in the presence of propargyl-β-lactoside as the exogenous acceptor led to the production of conjugatable polysaccharides by means of copper-assisted click chemistry. PMID:26927318

  4. Enzyme

    MedlinePlus

    Enzymes are complex proteins that cause a specific chemical change in all parts of the body. For ... use them. Blood clotting is another example of enzymes at work. Enzymes are needed for all body ...

  5. STUDIES ON THE SITE OF SYNTHESIS OF SEVERAL SOLUBLE ENZYMES OF THE CELL NUCLEUS

    PubMed Central

    Kuehl, LeRoy; Sumsion, Earl N.

    1971-01-01

    Rats were given radioactive L-leucine intravenously. At various times after injection, the livers were removed and separated into nuclear and cytoplasmic fractions by a nonaqueous technique. Glyceraldehyde-3-phosphate dehydrogenase, aldolase, and lactic dehydrogenase were isolated from each cell fraction by antibody precipitation followed by gel electrophoresis, and the specific radioactivities of the isolated enzymes were determined. In all three cases, the onset of labeling and the rate of incorporation were the same for the nuclear enzyme as for the corresponding enzyme from the cytoplasm. If we assume that equilibration of the enzymes between the cytoplasmic and nuclear pools occurs slowly relative to the labeling times employed, we may conclude that the labeled nuclear enzymes either were synthesized in the nucleus or moved into the nucleus from a cytoplasmic site of synthesis without first passing into the cytoplasmic pool of enzyme. Treatment with puromycin, an antibiotic which depresses incorporation into cytoplasmic proteins to a greater extent than into nuclear proteins, led to a situation in which the specific activities of the nuclear enzymes were several times as high as those of the corresponding cytoplasmic enzymes following a short period of incorporation. These data substantiate the assumption that equilibration between the cytoplasmic and nuclear enzyme pools occurs slowly and provide further evidence that the labeled nuclear enzymes do not arise from the cytoplasmic enzyme pool. PMID:5563445

  6. Application of metagenomic techniques in mining enzymes from microbial communities for biofuel synthesis.

    PubMed

    Xing, Mei-Ning; Zhang, Xue-Zhu; Huang, He

    2012-01-01

    Feedstock for biofuel synthesis is transitioning to lignocelluosic biomass to address criticism over competition between first generation biofuels and food production. As microbial catalysis is increasingly applied for the conversion of biomass to biofuels, increased import has been placed on the development of novel enzymes. With revolutionary advances in sequencer technology and metagenomic sequencing, mining enzymes from microbial communities for biofuel synthesis is becoming more and more practical. The present article highlights the latest research progress on the special characteristics of metagenomic sequencing, which has been a powerful tool for new enzyme discovery and gene functional analysis in the biomass energy field. Critical enzymes recently developed for the pretreatment and conversion of lignocellulosic materials are evaluated with respect to their activity and stability, with additional explorations into xylanase, laccase, amylase, chitinase, and lipolytic biocatalysts for other biomass feedstocks. PMID:22306331

  7. Application of metagenomic techniques in mining enzymes from microbial communities for biofuel synthesis.

    PubMed

    Xing, Mei-Ning; Zhang, Xue-Zhu; Huang, He

    2012-01-01

    Feedstock for biofuel synthesis is transitioning to lignocelluosic biomass to address criticism over competition between first generation biofuels and food production. As microbial catalysis is increasingly applied for the conversion of biomass to biofuels, increased import has been placed on the development of novel enzymes. With revolutionary advances in sequencer technology and metagenomic sequencing, mining enzymes from microbial communities for biofuel synthesis is becoming more and more practical. The present article highlights the latest research progress on the special characteristics of metagenomic sequencing, which has been a powerful tool for new enzyme discovery and gene functional analysis in the biomass energy field. Critical enzymes recently developed for the pretreatment and conversion of lignocellulosic materials are evaluated with respect to their activity and stability, with additional explorations into xylanase, laccase, amylase, chitinase, and lipolytic biocatalysts for other biomass feedstocks.

  8. Tailored fatty acid synthesis via dynamic control of fatty acid elongation

    SciTech Connect

    Torella, JP; Ford, TJ; Kim, SN; Chen, AM; Way, JC; Silver, PA

    2013-07-09

    Medium-chain fatty acids (MCFAs, 4-12 carbons) are valuable as precursors to industrial chemicals and biofuels, but are not canonical products of microbial fatty acid synthesis. We engineered microbial production of the full range of even-and odd-chain-length MCFAs and found that MCFA production is limited by rapid, irreversible elongation of their acyl-ACP precursors. To address this limitation, we programmed an essential ketoacyl synthase to degrade in response to a chemical inducer, thereby slowing acyl-ACP elongation and redirecting flux from phospholipid synthesis to MCFA production. Our results show that induced protein degradation can be used to dynamically alter metabolic flux, and thereby increase the yield of a desired compound. The strategy reported herein should be widely useful in a range of metabolic engineering applications in which essential enzymes divert flux away from a desired product, as well as in the production of polyketides, bioplastics, and other recursively synthesized hydrocarbons for which chain-length control is desired.

  9. Tailored fatty acid synthesis via dynamic control of fatty acid elongation.

    PubMed

    Torella, Joseph P; Ford, Tyler J; Kim, Scott N; Chen, Amanda M; Way, Jeffrey C; Silver, Pamela A

    2013-07-01

    Medium-chain fatty acids (MCFAs, 4-12 carbons) are valuable as precursors to industrial chemicals and biofuels, but are not canonical products of microbial fatty acid synthesis. We engineered microbial production of the full range of even- and odd-chain-length MCFAs and found that MCFA production is limited by rapid, irreversible elongation of their acyl-ACP precursors. To address this limitation, we programmed an essential ketoacyl synthase to degrade in response to a chemical inducer, thereby slowing acyl-ACP elongation and redirecting flux from phospholipid synthesis to MCFA production. Our results show that induced protein degradation can be used to dynamically alter metabolic flux, and thereby increase the yield of a desired compound. The strategy reported herein should be widely useful in a range of metabolic engineering applications in which essential enzymes divert flux away from a desired product, as well as in the production of polyketides, bioplastics, and other recursively synthesized hydrocarbons for which chain-length control is desired. PMID:23798438

  10. Recent Updates on DTD (D-Tyr-tRNATyr Deacylase): An Enzyme Essential for Fidelity and Quality of Protein Synthesis

    PubMed Central

    Bhatt, Tarun K.; Soni, Rani; Sharma, Drista

    2016-01-01

    During protein synthesis, there are several checkpoints in the cell to ensure that the information encoded within genetic material is decoded correctly. Charging of tRNA with its cognate amino acid is one of the important steps in protein synthesis and is carried out by aminoacyl-tRNA synthetase (aaRS) with great accuracy. However, due to presence of D-amino acids in the cell, sometimes aaRS charges tRNA with D-amino acids resulting in the hampering of protein translational process, which is lethal to the cell. Every species has some mechanism in order to prevent the formation of D-amino acid-tRNA complex, for instance DTD (D-Tyr-tRNA deacylase) is an enzyme responsible for the cleavage of ester bond formed between D-amino acid and tRNA leading to error free translation process. In this review, structure, function, and enzymatic mechanism of DTD are discussed. The role of DTD as a drug target is also considered. PMID:27200345

  11. QUANTITATIVE CONTRIBUTIONS OF DIET AND LIVER SYNTHESIS TO DOCOSAHEXAENOIC ACID HOMEOSTASIS

    PubMed Central

    Rapoport, Stanley I.; Igarashi, Miki; Gao, Fei

    2010-01-01

    Dietary requirements for maintaining brain and heart docosahexaenoic acid (DHA, 22:6n-3) homeostasis are not agreed on, in part because rates of liver DHA synthesis from circulating α-linolenic acid (α-LNA, 18:2n-3) have not been quantified. These rates can be estimated in vivo using intravenous radiotracer- or heavy isotope-labeled α-LNA infusion. In adult unanesthetized male rats, such infusion shows that liver synthesis-secretion rates of DHA from α-LNA markedly exceed brain and heart DHA synthesis rates and brain DHA consumption rate, and that liver but not heart or brain synthesis is upregulated as dietary n-3 PUFA content is reduced. These differences in rate reflect much higher expression of DHA-synthesizing enzymes in liver, and upregulation of liver but not heart or brain enzyme expression by reduced dietary n-3 PUFA content. A noninvasive intravenous [U-13C]α-LNA infusion method that produces steady-state liver tracer metabolism gives exact liver DHA synthesis-secretion rates and could be extended for human studies. PMID:20226642

  12. Gallic acid and gallic acid derivatives: effects on drug metabolizing enzymes.

    PubMed

    Ow, Yin-Yin; Stupans, Ieva

    2003-06-01

    Gallic acid and its structurally related compounds are found widely distributed in fruits and plants. Gallic acid, and its catechin derivatives are also present as one of the main phenolic components of both black and green tea. Esters of gallic acid have a diverse range of industrial uses, as antioxidants in food, in cosmetics and in the pharmaceutical industry. In addition, gallic acid is employed as a source material for inks, paints and colour developers. Studies utilising these compounds have found them to possess many potential therapeutic properties including anti-cancer and antimicrobial properties. In this review, studies of the effects of gallic acid, its esters, and gallic acid catechin derivatives on Phase I and Phase II enzymes are examined. Many published reports of the effects of the in vitro effects of gallic acid and its derivatives on drug metabolising enzymes concern effects directly on substrate (generally drug or mutagen) metabolism or indirectly through observed effects in Ames tests. In the case of the Ames test an antimutagenic effect may be observed through inhibition of CYP activation of indirectly acting mutagens and/or by scavenging of metabolically generated mutagenic electrophiles. There has been considerable interest in the in vivo effects of the gallate esters because of their incorporation into foodstuffs as antioxidants and in the catechin gallates with their potential role as chemoprotective agents. Principally an induction of Phase II enzymes has been observed however more recent studies using HepG2 cells and primary cultures of human hepatocytes provide evidence for the overall complexity of actions of individual components versus complex mixtures, such as those in food. Further systematic studies of mechanisms of induction and inhibition of drug metabolising enzymes by this group of compounds are warranted in the light of their distribution and consequent ingestion, current uses and suggested therapeutic potential. However, it

  13. AcalPred: a sequence-based tool for discriminating between acidic and alkaline enzymes.

    PubMed

    Lin, Hao; Chen, Wei; Ding, Hui

    2013-01-01

    The structure and activity of enzymes are influenced by pH value of their surroundings. Although many enzymes work well in the pH range from 6 to 8, some specific enzymes have good efficiencies only in acidic (pH<5) or alkaline (pH>9) solution. Studies have demonstrated that the activities of enzymes correlate with their primary sequences. It is crucial to judge enzyme adaptation to acidic or alkaline environment from its amino acid sequence in molecular mechanism clarification and the design of high efficient enzymes. In this study, we developed a sequence-based method to discriminate acidic enzymes from alkaline enzymes. The analysis of variance was used to choose the optimized discriminating features derived from g-gap dipeptide compositions. And support vector machine was utilized to establish the prediction model. In the rigorous jackknife cross-validation, the overall accuracy of 96.7% was achieved. The method can correctly predict 96.3% acidic and 97.1% alkaline enzymes. Through the comparison between the proposed method and previous methods, it is demonstrated that the proposed method is more accurate. On the basis of this proposed method, we have built an online web-server called AcalPred which can be freely accessed from the website (http://lin.uestc.edu.cn/server/AcalPred). We believe that the AcalPred will become a powerful tool to study enzyme adaptation to acidic or alkaline environment.

  14. AcalPred: A Sequence-Based Tool for Discriminating between Acidic and Alkaline Enzymes

    PubMed Central

    Lin, Hao; Chen, Wei; Ding, Hui

    2013-01-01

    The structure and activity of enzymes are influenced by pH value of their surroundings. Although many enzymes work well in the pH range from 6 to 8, some specific enzymes have good efficiencies only in acidic (pH<5) or alkaline (pH>9) solution. Studies have demonstrated that the activities of enzymes correlate with their primary sequences. It is crucial to judge enzyme adaptation to acidic or alkaline environment from its amino acid sequence in molecular mechanism clarification and the design of high efficient enzymes. In this study, we developed a sequence-based method to discriminate acidic enzymes from alkaline enzymes. The analysis of variance was used to choose the optimized discriminating features derived from g-gap dipeptide compositions. And support vector machine was utilized to establish the prediction model. In the rigorous jackknife cross-validation, the overall accuracy of 96.7% was achieved. The method can correctly predict 96.3% acidic and 97.1% alkaline enzymes. Through the comparison between the proposed method and previous methods, it is demonstrated that the proposed method is more accurate. On the basis of this proposed method, we have built an online web-server called AcalPred which can be freely accessed from the website (http://lin.uestc.edu.cn/server/AcalPred). We believe that the AcalPred will become a powerful tool to study enzyme adaptation to acidic or alkaline environment. PMID:24130738

  15. Towards efficient chemical synthesis via engineering enzyme catalysis in biomimetic nanoreactors.

    PubMed

    Liu, Jia; Yang, Qihua; Li, Can

    2015-09-18

    Biocatalysis with immobilized enzymes as catalysts holds enormous promise in developing more efficient and sustainable processes for the synthesis of fine chemicals, chiral pharmaceuticals and biomass feedstocks. Despite the appealing potentials, nowadays the industrial-scale application of biocatalysts is still quite modest in comparison with that of traditional chemical catalysts. A critical issue is that the catalytic performance of enzymes, the sophisticated and vulnerable catalytic machineries, strongly depends on their intracellular working environment; however the working circumstances provided by the support matrix are radically different from those in cells. This often leads to various adverse consequences on enzyme conformation and dynamic properties, consequently decreasing the overall performance of immobilized enzymes with regard to their activity, selectivity and stability. Engineering enzyme catalysis in support nanopores by mimicking the physiological milieu of enzymes in vivo and investigating how the interior microenvironment of nanopores imposes an influence on enzyme behaviors in vitro are of paramount significance to modify and improve the catalytic functions of immobilized enzymes. In this feature article, we have summarized the recent advances in mimicking the working environment and working patterns of intracellular enzymes in nanopores of mesoporous silica-based supports. Especially, we have demonstrated that incorporation of polymers into silica nanopores could be a valuable approach to create the biomimetic microenvironment for enzymes in the immobilized state.

  16. Propyl gallate synthesis using acidophilic tannase and simultaneous production of tannase and gallic acid by marine Aspergillus awamori BTMFW032.

    PubMed

    Beena, P S; Basheer, Soorej M; Bhat, Sarita G; Bahkali, Ali H; Chandrasekaran, M

    2011-07-01

    Marine Aspergillus awamori BTMFW032, recently reported by us, produce acidophilic tannase as extracellular enzyme. Here, we report the application of this enzyme for synthesis of propyl gallate by direct transesterification of tannic acid and in tea cream solubilisation besides the simultaneous production of gallic acid along with tannase under submerged fermentation by this fungus. This acidophilic tannase enabled synthesis of propyl gallate by direct transesterification of tannic acid using propanol as organic reaction media under low water conditions. The identity of the product was confirmed with thin layer chromatography and Fourier transform infrared spectroscopy. It was noted that 699 U/ml of enzyme could give 60% solubilisation of tea cream within 1 h. Enzyme production medium was optimized adopting Box-Behnken design for simultaneous synthesis of tannase and gallic acid. Process variables including tannic acid, sodium chloride, ferrous sulphate, dipotassium hydrogen phosphate, incubation period and agitation were recognized as the critical factors that influenced tannase and gallic acid production. The model obtained predicted 4,824.61 U/ml of tannase and 136.206 μg/ml gallic acid after 48 h of incubation, whereas optimized medium supported 5,085 U/ml tannase and 372.6 μg/ml of gallic acid production after 36 and 84 h of incubation, respectively, with a 15-fold increase in both enzyme and gallic acid production. Results indicated scope for utilization of this acidophilic tannase for transesterification of tannic acid into propyl gallate, tea cream solubilisation and simultaneous production of gallic acid along with tannase.

  17. Restoring enzyme activity in nonfunctional low erucic acid Brassica napus fatty acid elongase 1 by a single amino acid substitution.

    PubMed

    Katavic, Vesna; Mietkiewska, Elzbieta; Barton, Dennis L; Giblin, E Michael; Reed, Darwin W; Taylor, David C

    2002-11-01

    Genomic fatty acid elongation 1 (FAE1) clones from high erucic acid (HEA) Brassica napus, Brassica rapa and Brassica oleracea, and low erucic acid (LEA) B. napus cv. Westar, were amplified by PCR and expressed in yeast cells under the control of the strong galactose-inducible promoter. As expected, yeast cells expressing the FAE1 genes from HEA Brassica spp. synthesized very long chain monounsaturated fatty acids that are not normally found in yeast, while fatty acid profiles of yeast cells expressing the FAE1 gene from LEA B. napus were identical to control yeast samples. In agreement with published findings regarding different HEA and LEA B. napus cultivars, comparison of FAE1 protein sequences from HEA and LEA Brassicaceae revealed one crucial amino acid difference: the serine residue at position 282 of the HEA FAE1 sequences is substituted by phenylalanine in LEA B. napus cv. Westar. Using site directed mutagenesis, the phenylalanine 282 residue was substituted with a serine residue in the FAE1 polypeptide from B. napus cv. Westar, the mutated gene was expressed in yeast and GC analysis revealed the presence of very long chain monounsaturated fatty acids (VLCMFAs), indicating that the elongase activity was restored in the LEA FAE1 enzyme by the single amino acid substitution. Thus, for the first time, the low erucic acid trait in canola B. napus can be attributed to a single amino acid substitution which prevents the biosynthesis of the eicosenoic and erucic acids.

  18. In vitro effects of selected environmental toxicants on two heme synthesis enzymes

    SciTech Connect

    Johnson, D.J.; Williams, H.L.; Slater, S.; Haut, M.J.; Altstatt, L.B.

    1985-11-01

    Benzene and some of its substitution products become environmental toxicants due to improper disposal procedures. Benzene has been found to alter heme and globin synthesis in anucleate rabbit reticulocytes (Forte et al., 1976; Wildman et al., 1976) and based on these findings we felt it would be useful to determine what, if any, effect these derivatives would have on heme synthesis in vitro by studying their influence on delta-aminolevulinic acid synthetase (ALAS) and ferrochelatase (FC) activities in rat liver homogenates. ALAS was measured according to Ebert et al. (1970). FC was measured after Williams et al. (1980). Final concentrations of each added compound to the reaction mixture were 10(-3) to 10(-6) M. Normal values for rat liver ALAS were 250-350 nmol ALA/g protein/30 min, mean 290 +/- 40, and for FC were 12-40 mumol heme/g protein/45 min, mean 20 +/- 7. At 10(-3) M and lower concentrations these compounds inhibited ALAS and stimulated FC activities. Their effect on ALAS activity expressed as percentage of control of three analyses performed in triplicate +/- SEM was: o- and p-dinitrobenzenes-46 +/- 2; trinitrotoluenes-55 +/- 2; dinitrotoluenes-70 +/- 2; and amino-dinitrotoluenes-171 +/- 4. The stimulatory effect of these compounds expressed as percentage of control +/- SEM on FC was: dinitrotoluenes-171 +/- 3; dinitrobenzenes-152 +/- 3; trinitrotoluenes-142 +/- 4; and amino-dinitrotoluenes-130 +/- 4. Other classes of compounds tested did not significantly affect these enzymes at the same concentrations. These in vitro techniques may prove useful for predicting in vivo toxicologic effects of pollutants on species of interest.

  19. MAFG is a transcriptional repressor of bile acid synthesis and metabolism.

    PubMed

    de Aguiar Vallim, Thomas Q; Tarling, Elizabeth J; Ahn, Hannah; Hagey, Lee R; Romanoski, Casey E; Lee, Richard G; Graham, Mark J; Motohashi, Hozumi; Yamamoto, Masayuki; Edwards, Peter A

    2015-02-01

    Specific bile acids are potent signaling molecules that modulate metabolic pathways affecting lipid, glucose and bile acid homeostasis, and the microbiota. Bile acids are synthesized from cholesterol in the liver, and the key enzymes involved in bile acid synthesis (Cyp7a1, Cyp8b1) are regulated transcriptionally by the nuclear receptor FXR. We have identified an FXR-regulated pathway upstream of a transcriptional repressor that controls multiple bile acid metabolism genes. We identify MafG as an FXR target gene and show that hepatic MAFG overexpression represses genes of the bile acid synthetic pathway and modifies the biliary bile acid composition. In contrast, loss-of-function studies using MafG(+/-) mice causes de-repression of the same genes with concordant changes in biliary bile acid levels. Finally, we identify functional MafG response elements in bile acid metabolism genes using ChIP-seq analysis. Our studies identify a molecular mechanism for the complex feedback regulation of bile acid synthesis controlled by FXR.

  20. MAFG Is a Transcriptional Repressor of Bile Acid Synthesis and Metabolism

    PubMed Central

    de Aguiar Vallim, Thomas Q.; Tarling, Elizabeth J.; Ahn, Hannah; Hagey, Lee R.; Romanoski, Casey E.; Lee, Richard G.; Graham, Mark J.; Motohashi, Hozumi; Yamamoto, Masayuki; Edwards, Peter A.

    2015-01-01

    Summary Specific bile acids are potent signaling molecules that modulate metabolic pathways affecting lipid, glucose and bile acid homeostasis and the microbiota. Bile acids are synthesized from cholesterol in the liver, and the key enzymes involved in bile acid synthesis (Cyp7a1, Cyp8b1) are regulated transcriptionally by the nuclear receptor FXR. We have identified an FXR-regulated pathway upstream of a transcriptional repressor that controls multiple bile acid metabolism genes. We identify MafG as an FXR target gene and show that hepatic MAFG overexpression represses genes of the bile acid synthetic pathway, and modifies the biliary bile acid composition. In contrast, loss-of-function studies using MafG+/− mice causes de-repression of the same genes with concordant changes in biliary bile acid levels. Finally, we identify functional MafG response elements in bile acid metabolism genes using ChIP-Seq analysis. Our studies identify a molecular mechanism for the complex feedback regulation of bile acid synthesis controlled by FXR. PMID:25651182

  1. Inhibition of plant fatty acid synthesis by nitroimidazoles.

    PubMed Central

    Jones, A V; Harwood, J L; Stratford, M R; Stumpf, P K

    1981-01-01

    1. The effect of the addition of a number of nitroimidazoles was tested on fatty acid synthesis by germinating pea seeds, isolated lettuce chloroplasts and a soluble fraction from pea seeds. 2. All the compounds tested had a marked inhibition on stearate desaturation by lettuce chloroplasts and on the synthesis of very-long-chain fatty acids by pea seeds. 3. In contrast, the effect of the drugs on total fatty acid synthesis from [14C]acetate in chloroplasts was related to the compound's electron reduction potentials. 4. Of the compounds used, only metronidazole had a marked inhibition on palmitate elongation in the systems tested. 5. The mechanism of inhibition of plant fatty acid synthesis by nitroimidazoles is discussed and the possible relevance of these findings to their neurotoxicity is suggested. PMID:7325993

  2. Direct Catalytic Asymmetric Synthesis of β-Hydroxy Acids from Malonic Acid.

    PubMed

    Gao, Hang; Luo, Zhenli; Ge, Pingjin; He, Junqian; Zhou, Feng; Zheng, Peipei; Jiang, Jun

    2015-12-18

    A nickel(II) catalyzed asymmetric synthesis of β-hydroxy acids from malonic acid and ketones was developed, revealing for the first time the synthetic utility of malonic acid in the construction of chiral carboxyl acids; importantly, the synthetic potential of this strategy was further demonstrated by the rapid construction of cephalanthrin A, phaitanthrin B, cruciferane, and rice metabolites.

  3. Amino Acid Synthesis in Seafloor Environments on Icy Worlds

    NASA Astrophysics Data System (ADS)

    Flores, Erika; Barge, Laura; VanderVelde, David; Kallas, Kayo; Baum, Marc M.; Russell, Michael J.; Kanik, Isik

    2016-10-01

    In 2005, the Cassini mission detected plumes erupting from Enceladus' surface, containing carbon dioxide, methane, silica, and possibly ammonia. Subsequent laboratory experiments indicated that the silica particles in the plumes were generated under alkaline conditions and at moderate temperatures of ~90°C (Hsu et al., 2015); one scenario for such conditions would be the existence of alkaline (serpentinization-driven) hydrothermal activity within Enceladus. Alkaline vents are significant since they have been proposed as a likely environment for the emergence of metabolism on the early Earth (Russell et al. 2014) and thus could also provide a mechanism for origin of life on ocean worlds with a water-rock interface. Alkaline vents in an acidic, iron-containing ocean could produce mineral precipitates that could act as primitive enzymes or catalysts mediating organic reactions; for example, metal sulfides can catalyze the reductive amination of pyruvate to alanine (Novikov and Copley 2013). We have conducted experiments testing the synthesis of amino acids catalyzed by other iron minerals that might be expected to precipitate on the seafloor of early Earth or Enceladus. Preliminary results indicate that amino acids as well as other organic products can be synthesized in 1-3 days under alkaline hydrothermal conditions. We also find that the yield and type of organic products is highly dependent on pH and temperature, implying that understanding the specifics of the geochemical hydrothermal gradients on Enceladus (or other ocean worlds) will be significant in determining their potential for synthesizing building blocks for life.Hsu, H.-W. et al. (2015), Nature 519, 207-210.Russell, M. J. et al. (2014), Astrobiology, 14, 308-43.Novikov Y. and Copley S. D. (2013) PNAS 110, 33, 13283-13288.

  4. The Unusual Acid-Accumulating Behavior during Ripening of Cherimoya (Annona cherimola Mill.) is Linked to Changes in Transcription and Enzyme Activity Related to Citric and Malic Acid Metabolism.

    PubMed

    González-Agüero, Mauricio; Tejerina Pardo, Luis; Zamudio, María Sofía; Contreras, Carolina; Undurraga, Pedro; Defilippi, Bruno G

    2016-04-25

    Cherimoya (Annona cherimola Mill.) is a subtropical fruit characterized by a significant increase in organic acid levels during ripening, making it an interesting model for studying the relationship between acidity and fruit flavor. In this work, we focused on understanding the balance between the concentration of organic acids and the gene expression and activity of enzymes involved in the synthesis and degradation of these metabolites during the development and ripening of cherimoya cv. "Concha Lisa". Our results showed an early accumulation of citric acid and other changes associated with the accumulation of transcripts encoding citrate catabolism enzymes. During ripening, a 2-fold increase in malic acid and a 6-fold increase in citric acid were detected. By comparing the contents of these compounds with gene expression and enzymatic activity levels, we determined that cytoplasmic NAD-dependent malate dehydrogenase (cyNAD-MDH) and mitochondrial citrate synthase (mCS) play important regulatory roles in the malic and citric acid biosynthetic pathways.

  5. Prebiotic Amino Acid Thioester Synthesis: Thiol-Dependent Amino Acid Synthesis from Formose substrates (Formaldehyde and Glycolaldehyde) and Ammonia

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1998-01-01

    Formaldehyde and glycolaldehyde (substrates of the formose autocatalytic cycle) were shown to react with ammonia yielding alanine and homoserine under mild aqueous conditions in the presence of thiol catalysts. Since similar reactions carried out without ammonia yielded alpha-hydroxy acid thioesters, the thiol-dependent synthesis of alanine and homoserine is presumed to occur via amino acid thioesters-intermediates capable of forming peptides. A pH 5.2 solution of 20 mM formaldehyde, 20 mM glycolaldehyde, 20 mM ammonium chloride, 23 mM 3-mercaptopropionic acid, and 23 mM acetic acid that reacted for 35 days at 40 C yielded (based on initial formaldehyde) 1.8% alanine and 0.08% homoserine. In the absence of thiol catalyst, the synthesis of alanine and homoserine was negligible. Alanine synthesis required both formaldehyde and glycolaldehyde, but homoserine synthesis required only glycolaldehyde. At 25 days the efficiency of alanine synthesis calculated from the ratio of alanine synthesized to formaldehyde reacted was 2.1%, and the yield (based on initial formaldehyde) of triose and tetrose intermediates involved in alanine and homoserine synthesis was 0.3 and 2.1%, respectively. Alanine synthesis was also seen in similar reactions containing only 10 mM each of aldehyde substrates, ammonia, and thiol. The prebiotic significance of these reactions that use the formose reaction to generate sugar intermediates that are converted to reactive amino acid thioesters is discussed.

  6. Synthesis of L-ascorbic acid in the phloem

    PubMed Central

    Hancock, Robert D; McRae, Diane; Haupt, Sophie; Viola, Roberto

    2003-01-01

    Background Although plants are the main source of vitamin C in the human diet, we still have a limited understanding of how plants synthesise L-ascorbic acid (AsA) and what regulates its concentration in different plant tissues. In particular, the enormous variability in the vitamin C content of storage organs from different plants remains unexplained. Possible sources of AsA in plant storage organs include in situ synthesis and long-distance transport of AsA synthesised in other tissues via the phloem. In this paper we examine a third possibility, that of synthesis within the phloem. Results We provide evidence for the presence of AsA in the phloem sap of a wide range of crop species using aphid stylectomy and histochemical approaches. The activity of almost all the enzymes of the primary AsA biosynthetic pathway were detected in phloem-rich vascular exudates from Cucurbita pepo fruits and AsA biosynthesis was demonstrated in isolated phloem strands from Apium graveolens petioles incubated with a range of precursors (D-glucose, D-mannose, L-galactose and L-galactono-1,4-lactone). Phloem uptake of D-[U-14C]mannose and L-[1-14C]galactose (intermediates of the AsA biosynthetic pathway) as well as L-[1-14C]AsA and L-[1-14C]DHA, was observed in Nicotiana benthamiana leaf discs. Conclusions We present the novel finding that active AsA biosynthesis occurs in the phloem. This process must now be considered in the context of mechanisms implicated in whole plant AsA distribution. This work should provoke studies aimed at elucidation of the in vivo substrates for phloem AsA biosynthesis and its contribution to AsA accumulation in plant storage organs. PMID:14633288

  7. Evolution of Abscisic Acid Synthesis and Signaling Mechanisms

    PubMed Central

    Hauser, Felix; Waadt, Rainer; Schroeder, Julian I.

    2011-01-01

    The plant hormone abscisic acid (ABA) mediates seed dormancy, controls seedling development and triggers tolerance to abiotic stresses, including drought. Core ABA signaling components consist of a recently identified group of ABA receptor proteins of the PYRABACTIN RESISTANCE (PYR)/REGULATORY COMPONENT OF ABA RECEPTOR (RCAR) family that act as negative regulators of members of the PROTEIN PHOSPHATASE 2C (PP2C) family. Inhibition of PP2C activity enables activation of SNF1-RELATED KINASE 2 (SnRK2) protein kinases, which target downstream components, including transcription factors, ion channels and NADPH oxidases. These and other components form a complex ABA signaling network. Here, an in depth analysis of the evolution of components in this ABA signaling network shows that (i) PYR/RCAR ABA receptor and ABF-type transcription factor families arose during land colonization of plants and are not found in algae and other species, (ii) ABA biosynthesis enzymes have evolved to plant- and fungal-specific forms, leading to different ABA synthesis pathways, (iii) existing stress signaling components, including PP2C phosphatases and SnRK kinases, were adapted for novel roles in this plant-specific network to respond to water limitation. In addition, evolutionarily conserved secondary structures in the PYR/RCAR ABA receptor family are visualized. PMID:21549957

  8. Human fibroblast collagenase: glycosylation and tissue-specific levels of enzyme synthesis.

    PubMed Central

    Wilhelm, S M; Eisen, A Z; Teter, M; Clark, S D; Kronberger, A; Goldberg, G

    1986-01-01

    Human skin fibroblasts secrete collagenase as two proenzyme forms (57 and 52 kDa). The minor (57-kDa) proenzyme form is the result of a partial posttranslational modification of the major (52-kDa) proenzyme through the addition of N-linked complex oligosaccharides. Human endothelial cells as well as fibroblasts from human colon, cornea, gingiva, and lung also secrete collagenase in two forms indistinguishable from those of the skin fibroblast enzyme. In vitro tissue culture studies have shown that the level of constitutive synthesis of this fibroblast-type interstitial collagenase is tissue specific, varies widely, and correlates with the steady-state level of a single collagenase-specific mRNA of 2.5 kilobases. The tumor promoter, phorbol 12-myristate 13-acetate, apparently blocks the control of collagenase synthesis resulting in a similarly high level of collagenase expression (approximately equal to 3-7 micrograms of collagenase per 10(6) cells per 24 hr) in all examined cells. The constitutive level of synthesis of a 28-kDa collagenase inhibitor does not correlate with that of the enzyme. Phorbol 12-myristate 13-acetate stimulates the production of this inhibitor that in turn modulates the activity of collagenase in the conditioned media. As a result, the apparent activity of the enzyme present in the medium does not accurately reflect the rate of its synthesis and secretion. Images PMID:3012533

  9. Non-enzymic beta-decarboxylation of aspartic acid.

    NASA Technical Reports Server (NTRS)

    Doctor, V. M.; Oro, J.

    1972-01-01

    Study of the mechanism of nonenzymic beta-decarboxylation of aspartic acid in the presence of metal ions and pyridoxal. The results suggest that aspartic acid is first converted to oxalacetic acid by transamination with pyridoxal which in turn is converted to pyridoxamine. This is followed by decarboxylation of oxalacetic acid to form pyruvic acid which transaminates with pyridoxamine to form alanine. The possible significance of these results to prebiotic molecular evolution is briefly discussed.

  10. Use of immobilized enzymes in automated clinical analysis: determination of uric acid and glucose using immobilized enzymes in column form.

    PubMed

    Endo, J; Tabata, M; Okada, S; Murachi, T

    1979-07-16

    We studied the use of immobilized enzymes, covalently bound to alkylaminosilane derivative of porous glass, to automated clinical analysis on uric acid and glucose in blood, serum and urine. A microcolumn with an immobilized enzyme was prepared and used in an AutoAnalyzer I continuous flow system. Uricase (EC 1.7.3.3) from Candida utilis and glucose oxidase (EC 1.1.3.4) from Aspergillus niger were immobilized for the determination of uric acid and glucose, respectively. Hydrogen peroxide produced by these oxidases was colorimetrically determined using horse-radish peroxidase (EC 1.11.1.7) and a hydrogen acceptor in solution. Sensitivity and wash charactertistics of a column with immobilized enzyme, 1.5 mm of inner diameter and up to 40 mm in length, were satisfactory at an assay speed of 50 samples per hour. The results correlated well with those obtained by other well established methods utilizing the AutoAnalyzer system. The immobilized enzymes were sufficiently stable for at least two months of 2000 tests when used repeatedly. Clinical trials proved that this method is capable of replacing the soluble enzyme method, giving reliable and reproducible results at lower cost.

  11. A photocatalyst-enzyme coupled artificial photosynthesis system for solar energy in production of formic acid from CO2.

    PubMed

    Yadav, Rajesh K; Baeg, Jin-Ook; Oh, Gyu Hwan; Park, No-Joong; Kong, Ki-jeong; Kim, Jinheung; Hwang, Dong Won; Biswas, Soumya K

    2012-07-18

    The photocatalyst-enzyme coupled system for artificial photosynthesis process is one of the most promising methods of solar energy conversion for the synthesis of organic chemicals or fuel. Here we report the synthesis of a novel graphene-based visible light active photocatalyst which covalently bonded the chromophore, such as multianthraquinone substituted porphyrin with the chemically converted graphene as a photocatalyst of the artificial photosynthesis system for an efficient photosynthetic production of formic acid from CO(2). The results not only show a benchmark example of the graphene-based material used as a photocatalyst in general artificial photosynthesis but also the benchmark example of the selective production system of solar chemicals/solar fuel directly from CO(2).

  12. The shikimate pathway: review of amino acid sequence, function and three-dimensional structures of the enzymes.

    PubMed

    Mir, Rafia; Jallu, Shais; Singh, T P

    2015-06-01

    The aromatic compounds such as aromatic amino acids, vitamin K and ubiquinone are important prerequisites for the metabolism of an organism. All organisms can synthesize these aromatic metabolites through shikimate pathway, except for mammals which are dependent on their diet for these compounds. The pathway converts phosphoenolpyruvate and erythrose 4-phosphate to chorismate through seven enzymatically catalyzed steps and chorismate serves as a precursor for the synthesis of variety of aromatic compounds. These enzymes have shown to play a vital role for the viability of microorganisms and thus are suggested to present attractive molecular targets for the design of novel antimicrobial drugs. This review focuses on the seven enzymes of the shikimate pathway, highlighting their primary sequences, functions and three-dimensional structures. The understanding of their active site amino acid maps, functions and three-dimensional structures will provide a framework on which the rational design of antimicrobial drugs would be based. Comparing the full length amino acid sequences and the X-ray crystal structures of these enzymes from bacteria, fungi and plant sources would contribute in designing a specific drug and/or in developing broad-spectrum compounds with efficacy against a variety of pathogens.

  13. Increased Production of Fatty Acids and Triglycerides in Aspergillus oryzae by Enhancing Expressions of Fatty Acid Synthesis-Related Genes

    SciTech Connect

    Tamano, Koichi; Bruno, Kenneth S.; Karagiosis, Sue A.; Culley, David E.; Deng, Shuang; Collett, James R.; Umemura, Myco; Koike, Hideaki; Baker, Scott E.; Machida, Masa

    2013-01-01

    Microbial production of fats and oils is being developedas a means of converting biomass to biofuels. Here we investigate enhancing expression of enzymes involved in the production of fatty acids and triglycerides as a means to increase production of these compounds in Aspergillusoryzae. Examination of the A.oryzaegenome demonstrates that it contains twofatty acid synthases and several other genes that are predicted to be part of this biosynthetic pathway. We enhancedthe expressionof fatty acid synthesis-related genes by replacing their promoters with thepromoter fromthe constitutively highly expressedgene tef1. We demonstrate that by simply increasing the expression of the fatty acid synthasegenes we successfullyincreasedtheproduction of fatty acids and triglyceridesby more than two fold. Enhancement of expression of the fatty acid pathway genes ATP-citrate lyase and palmitoyl-ACP thioesteraseincreasedproductivity to a lesser extent.Increasing expression ofacetyl-CoA carboxylase caused no detectable change in fatty acid levels. Increases in message level for each gene were monitored usingquantitative real-time RT-PCR. Our data demonstrates that a simple increase in the abundance of fatty acid synthase genes can increase the detectable amount of fatty acids.

  14. Oleochemical synthesis of an acid cleavable hydrophobe for surfactant use

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The synthesis of a series of branched hydroxy stearates from commercially available methyl oleate and common organic acids is reported. A variety of different acids, with 3 to 8 carbon atoms, and also varying in their branching and functionality, were used. The kinetics of the ring opening reactio...

  15. Nucleic acid arrays and methods of synthesis

    DOEpatents

    Sabanayagam, Chandran R.; Sano, Takeshi; Misasi, John; Hatch, Anson; Cantor, Charles

    2001-01-01

    The present invention generally relates to high density nucleic acid arrays and methods of synthesizing nucleic acid sequences on a solid surface. Specifically, the present invention contemplates the use of stabilized nucleic acid primer sequences immobilized on solid surfaces, and circular nucleic acid sequence templates combined with the use of isothermal rolling circle amplification to thereby increase nucleic acid sequence concentrations in a sample or on an array of nucleic acid sequences.

  16. Cloning-independent expression and screening of enzymes using cell-free protein synthesis systems.

    PubMed

    Kwon, Yong-Chan; Song, Jae-Kwang; Kim, Dong-Myung

    2014-01-01

    We present a strategy for expression and screening of microbial enzymes without involving cloning procedures. Libraries of putative ω-transaminases (ω-TA) and mutated Candida antarctica lipase B (CalB) are PCR-amplified from bacterial colonies and directly expressed in an Escherichia coli-based cell-free protein synthesis system. The open nature of cell-free protein synthesis system also allows streamlined analysis of the enzymatic activity of the expressed enzymes, which greatly shortens the time required for enzyme screening. We expect that the proposed strategy will provide a universal platform for bridging the information gap between nucleotide sequence and protein function, in order to accelerate the discovery of novel enzymes. The proposed strategy can also serve as a viable option for the rapid and precise tuning of enzyme molecules, not only for analytical purposes, but also for industrial applications. This is accomplished via large-scale production using microbial cells transformed with variant genes selected from the cell-free expression screening. PMID:24395411

  17. Cloning-independent expression and screening of enzymes using cell-free protein synthesis systems.

    PubMed

    Kwon, Yong-Chan; Song, Jae-Kwang; Kim, Dong-Myung

    2014-01-01

    We present a strategy for expression and screening of microbial enzymes without involving cloning procedures. Libraries of putative ω-transaminases (ω-TA) and mutated Candida antarctica lipase B (CalB) are PCR-amplified from bacterial colonies and directly expressed in an Escherichia coli-based cell-free protein synthesis system. The open nature of cell-free protein synthesis system also allows streamlined analysis of the enzymatic activity of the expressed enzymes, which greatly shortens the time required for enzyme screening. We expect that the proposed strategy will provide a universal platform for bridging the information gap between nucleotide sequence and protein function, in order to accelerate the discovery of novel enzymes. The proposed strategy can also serve as a viable option for the rapid and precise tuning of enzyme molecules, not only for analytical purposes, but also for industrial applications. This is accomplished via large-scale production using microbial cells transformed with variant genes selected from the cell-free expression screening.

  18. Stereoselective Synthesis of α-Amino-C-phosphinic Acids and Derivatives.

    PubMed

    Viveros-Ceballos, José Luis; Ordóñez, Mario; Sayago, Francisco J; Cativiela, Carlos

    2016-01-01

    α-Amino-C-phosphinic acids and derivatives are an important group of compounds of synthetic and medicinal interest and particular attention has been dedicated to their stereoselective synthesis in recent years. Among these, phosphinic pseudopeptides have acquired pharmacological importance in influencing physiologic and pathologic processes, primarily acting as inhibitors for proteolytic enzymes where molecular stereochemistry has proven to be critical. This review summarizes the latest developments in the asymmetric synthesis of acyclic and phosphacyclic α-amino-C-phosphinic acids and derivatives, following in the first case an order according to the strategy used, whereas for cyclic compounds the nitrogen embedding in the heterocyclic core is considered. In addition selected examples of pharmacological implications of title compounds are also disclosed. PMID:27589703

  19. Evolution of an Enzyme from a Noncatalytic Nucleic Acid Sequence.

    PubMed

    Gysbers, Rachel; Tram, Kha; Gu, Jimmy; Li, Yingfu

    2015-01-01

    The mechanism by which enzymes arose from both abiotic and biological worlds remains an unsolved natural mystery. We postulate that an enzyme can emerge from any sequence of any functional polymer under permissive evolutionary conditions. To support this premise, we have arbitrarily chosen a 50-nucleotide DNA fragment encoding for the Bos taurus (cattle) albumin mRNA and subjected it to test-tube evolution to derive a catalytic DNA (DNAzyme) with RNA-cleavage activity. After only a few weeks, a DNAzyme with significant catalytic activity has surfaced. Sequence comparison reveals that seven nucleotides are responsible for the conversion of the noncatalytic sequence into the enzyme. Deep sequencing analysis of DNA pools along the evolution trajectory has identified individual mutations as the progressive drivers of the molecular evolution. Our findings demonstrate that an enzyme can indeed arise from a sequence of a functional polymer via permissive molecular evolution, a mechanism that may have been exploited by nature for the creation of the enormous repertoire of enzymes in the biological world today. PMID:26091540

  20. Concise total synthesis of (±)-actinophyllic acid

    PubMed Central

    Granger, Brett A.; Jewett, Ivan T.; Butler, Jeffrey D.; Martin, Stephen F.

    2014-01-01

    A concise total synthesis of the complex indole alkaloid (±)-actinophyllic acid was accomplished by a sequence of reactions requiring only 10 steps from readily-available, known starting materials. The approach featured a Lewis acid-catalyzed cascade of reactions involving stabilized carbocations that delivered the tetracyclic core of the natural product in a single chemical operation. Optimal conversion of this key intermediate into (±)-actinophyllic acid required judicious selection of a protecting group strategy. PMID:24882888

  1. Enzymatic synthesis of enantiopure alpha- and beta-amino acids by phenylalanine aminomutase-catalysed amination of cinnamic acid derivatives.

    PubMed

    Wu, Bian; Szymanski, Wiktor; Wietzes, Piet; de Wildeman, Stefaan; Poelarends, Gerrit J; Feringa, Ben L; Janssen, Dick B

    2009-01-26

    The phenylalanine aminomutase (PAM) from Taxus chinensis catalyses the conversion of alpha-phenylalanine to beta-phenylalanine, an important step in the biosynthesis of the N-benzoyl phenylisoserinoyl side-chain of the anticancer drug taxol. Mechanistic studies on PAM have suggested that (E)-cinnamic acid is an intermediate in the mutase reaction and that it can be released from the enzyme's active site. Here we describe a novel synthetic strategy that is based on the finding that ring-substituted (E)-cinnamic acids can serve as a substrate in PAM-catalysed ammonia addition reactions for the biocatalytic production of several important beta-amino acids. The enzyme has a broad substrate range and a high enantioselectivity with cinnamic acid derivatives; this allows the synthesis of several non-natural aromatic alpha- and beta-amino acids in excellent enantiomeric excess (ee >99 %). The internal 5-methylene-3,5-dihydroimidazol-4-one (MIO) cofactor is essential for the PAM-catalysed amination reactions. The regioselectivity of amination reactions was influenced by the nature of the ring substituent.

  2. Kinetic characteristics of polygalacturonase enzymes hydrolyzing galacturonic acid oligomers using isothermal titration calorimetry

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polygalacturonase enzymes hydrolyze the polygalacturonic acid chains found in pectin. Interest in polygalacturonase enzymes continues as they are useful in a number of industrial processes and conversely, detrimental, as they are involved in maceration of economically important crops. While a good...

  3. Fatty acid synthesis is inhibited by inefficient utilization of unusual fatty acids for glycerolipid assembly.

    PubMed

    Bates, Philip D; Johnson, Sean R; Cao, Xia; Li, Jia; Nam, Jeong-Won; Jaworski, Jan G; Ohlrogge, John B; Browse, John

    2014-01-21

    Degradation of unusual fatty acids through β-oxidation within transgenic plants has long been hypothesized as a major factor limiting the production of industrially useful unusual fatty acids in seed oils. Arabidopsis seeds expressing the castor fatty acid hydroxylase accumulate hydroxylated fatty acids up to 17% of total fatty acids in seed triacylglycerols; however, total seed oil is also reduced up to 50%. Investigations into the cause of the reduced oil phenotype through in vivo [(14)C]acetate and [(3)H]2O metabolic labeling of developing seeds surprisingly revealed that the rate of de novo fatty acid synthesis within the transgenic seeds was approximately half that of control seeds. RNAseq analysis indicated no changes in expression of fatty acid synthesis genes in hydroxylase-expressing plants. However, differential [(14)C]acetate and [(14)C]malonate metabolic labeling of hydroxylase-expressing seeds indicated the in vivo acetyl-CoA carboxylase activity was reduced to approximately half that of control seeds. Therefore, the reduction of oil content in the transgenic seeds is consistent with reduced de novo fatty acid synthesis in the plastid rather than fatty acid degradation. Intriguingly, the coexpression of triacylglycerol synthesis isozymes from castor along with the fatty acid hydroxylase alleviated the reduced acetyl-CoA carboxylase activity, restored the rate of fatty acid synthesis, and the accumulation of seed oil was substantially recovered. Together these results suggest a previously unidentified mechanism that detects inefficient utilization of unusual fatty acids within the endoplasmic reticulum and activates an endogenous pathway for posttranslational reduction of fatty acid synthesis within the plastid.

  4. Effects of Non-Natural Amino Acid Incorporation into the Enzyme Core Region on Enzyme Structure and Function

    PubMed Central

    Wong, H. Edward; Kwon, Inchan

    2015-01-01

    Techniques to incorporate non-natural amino acids (NNAAs) have enabled biosynthesis of proteins containing new building blocks with unique structures, chemistry, and reactivity that are not found in natural amino acids. It is crucial to understand how incorporation of NNAAs affects protein function because NNAA incorporation may perturb critical function of a target protein. This study investigates how the site-specific incorporation of NNAAs affects catalytic properties of an enzyme. A NNAA with a hydrophobic and bulky sidechain, 3-(2-naphthyl)-alanine (2Nal), was site-specifically incorporated at six different positions in the hydrophobic core of a model enzyme, murine dihydrofolate reductase (mDHFR). The mDHFR variants with a greater change in van der Waals volume upon 2Nal incorporation exhibited a greater reduction in the catalytic efficiency. Similarly, the steric incompatibility calculated using RosettaDesign, a protein stability calculation program, correlated with the changes in the catalytic efficiency. PMID:26402667

  5. Effects of bile acid administration on bile acid synthesis and its circadian rhythm in man

    SciTech Connect

    Pooler, P.A.; Duane, W.C.

    1988-09-01

    In man bile acid synthesis has a distinct circadian rhythm but the relationship of this rhythm to feedback inhibition by bile acid is unknown. We measured bile acid synthesis as release of 14CO2 from (26-14C)cholesterol every 2 hr in three normal volunteers during five separate 24-hr periods. Data were fitted by computer to a cosine curve to estimate amplitude and acrophase of the circadian rhythm. In an additional six volunteers, we measured synthesis every 2 hr from 8:00 a.m. to 4:00 p.m. only. During the control period, amplitude (expressed as percentage of mean synthesis) averaged 52% and acrophase averaged 6:49 a.m. During administration of ursodeoxycholic acid (15 mg per kg per day), synthesis averaged 126% of baseline (p less than 0.1), amplitude averaged 43% and acrophase averaged 6:20 a.m. During administration of chenodeoxycholic acid (15 mg per kg per day), synthesis averaged 43% of baseline (p less than 0.001), amplitude averaged 53% and acrophase averaged 9:04 a.m. Addition of prednisone to this regimen of chenodeoxycholic acid to eliminate release of 14CO2 from corticosteroid hormone synthesis resulted in a mean amplitude of 62% and a mean acrophase of 6:50 a.m., values very similar to those in the baseline period. Administration of prednisone alone also did not significantly alter the baseline amplitude (40%) or acrophase (6:28 a.m.). We conclude that neither chenodeoxycholic acid nor ursodeoxycholic acid significantly alters the circadian rhythm of bile acid synthesis in man.

  6. Synthesis and preliminary biological evaluations of (+)-isocampholenic acid-derived amides.

    PubMed

    Grošelj, Uroš; Golobič, Amalija; Knez, Damijan; Hrast, Martina; Gobec, Stanislav; Ričko, Sebastijan; Svete, Jurij

    2016-08-01

    The synthesis of two novel (+)-isocampholenic acid-derived amines has been realized starting from commercially available (1S)-(+)-10-camphorsulfonic acid. The novel amines as well as (+)-isocampholenic acid have been used as building blocks in the construction of a library of amides using various aliphatic, aromatic, and amino acid-derived coupling partners using BPC and CDI as activating agents. Amide derivatives have been assayed against several enzymes that hold potential for the development of new drugs to battle bacterial infections and Alzheimer's disease. Compounds 20c and 20e showed promising selective sub-micromolar inhibition of human butyrylcholinesterase [Formula: see text] ([Formula: see text] values [Formula: see text] and [Formula: see text], respectively). PMID:27017352

  7. Repression of Escherichia coli carbamoylphosphate synthase: relationships with enzyme synthesis in the arginine and pyrimidine pathways.

    PubMed Central

    Piérard, A; Glansdorff, N; Gigot, D; Crabeel, M; Halleux, P; Thiry, L

    1976-01-01

    Cumulative repression of Escherichia coli carbamoylphosphate synthase (CPSase; EC 2.7.2.9) by arginine and pyrimidine was analyzed in relation to control enzyme synthesis in the arginine and pyrimidine pathways. The expression of carA and carB, the adjacent genes that specify the two subunits of the enzyme, was estimated by means of an in vitro complementation assay. The synthesis of each gene product was found to be under repression control. Coordinate expression of the two genes was observed under most conditions investigated. They might thus form an operon. The preparation of strains blocked in the degradation of cytidine and harboring leaky mutations affecting several steps of pyrimidine nucleotide synthesis made it possible to distinguish between the effects of cytidine and uridine compounds in the repression of the pyrimidine pathway enzymes. The data obtained suggest that derivatives of both cytidine and uridine participate in the repression of CPSase. In addition, repression of CPSase by arginine did not appear to occur unless pyrimidines were present at a significant intracellular concentration. This observation, together with our previous report that argR mutations impair the cumulative repression of CPSase, suggests that this control is mediated through the concerted effects of regulatory elements specific for the arginine and pyrimidine pathways. PMID:179975

  8. Polymerase Synthesis and Restriction Enzyme Cleavage of DNA Containing 7-Substituted 7-Deazaguanine Nucleobases.

    PubMed

    Mačková, Michaela; Boháčová, Soňa; Perlíková, Pavla; Poštová Slavětínská, Lenka; Hocek, Michal

    2015-10-12

    Previous studies of polymerase synthesis of base-modified DNAs and their cleavage by restriction enzymes have mostly related only to 5-substituted pyrimidine and 7-substituted 7-deazaadenine nucleotides. Here we report the synthesis of a series of 7-substituted 7-deazaguanine 2'-deoxyribonucleoside 5'-O-triphosphates (dG(R) TPs), their use as substrates for polymerase synthesis of modified DNA and the influence of the modification on their cleavage by type II restriction endonucleases (REs). The dG(R) TPs were generally good substrates for polymerases but the PCR products could not be visualised on agarose gels by intercalator staining, due to fluorescence quenching. The presence of 7-substituted 7-deazaguanine residues in recognition sequences of REs in most cases completely blocked the cleavage.

  9. Kinetic investigation of erucamide synthesis using fatty acid and urea.

    PubMed

    Awasthi, Neeraj Praphulla; Upadhayay, Santosh K; Singh, R P

    2008-01-01

    Fatty acid amides like erucamide are mainly used for lubrication and as slip agent to decrease friction in polymer and plastic industry. Erucamide is normally synthesized by ammonolysis of triglycerides or fatty acids at 200 degrees C and at high pressure (345-690 kPa.). However using urea in place of ammonia the economic synthesis of erucamide is possible at atmospheric pressure at approx 190 degrees C. In present investigation, the kinetics of synthesis of erucamide by ammonolysis of erucic acid has been investigated. The optimum conditions for the synthesis of erucamide have also been determined. 1:4 molar ratio of erucic acid to urea, 190 degrees C temperature and catalyst [P2O5 with (NH4)2H PO4, {(1:1) w/w }] concentration 3% (by wt. of erucic acid) were the optimum condition for synthesis of erucamide from erucic acid and can obtain a maximum yield of 92% of pure erucamide. Some other catalysts as titanium-iso -propoxide, phosphorus pent oxide were also tried but these catalysts were not economical. PMID:18685229

  10. Translational regulation of mammalian and Drosophila citric acid cycle enzymes via iron-responsive elements.

    PubMed Central

    Gray, N K; Pantopoulos, K; Dandekar, T; Ackrell, B A; Hentze, M W

    1996-01-01

    The posttranscriptional control of iron uptake, storage, and utilization by iron-responsive elements (IREs) and iron regulatory proteins (IRPs) provides a molecular framework for the regulation of iron homeostasis in many animals. We have identified and characterized IREs in the mRNAs for two different mitochondrial citric acid cycle enzymes. Drosophila melanogaster IRP binds to an IRE in the 5' untranslated region of the mRNA encoding the iron-sulfur protein (Ip) subunit of succinate dehydrogenase (SDH). This interaction is developmentally regulated during Drosophila embryogenesis. In a cell-free translation system, recombinant IRP-1 imposes highly specific translational repression on a reporter mRNA bearing the SDH IRE, and the translation of SDH-Ip mRNA is iron regulated in D. melanogaster Schneider cells. In mammals, an IRE was identified in the 5' untranslated regions of mitochondrial aconitase mRNAs from two species. Recombinant IRP-1 represses aconitase synthesis with similar efficiency as ferritin IRE-controlled translation. The interaction between mammalian IRPs and the aconitase IRE is regulated by iron, nitric oxide, and oxidative stress (H2O2), indicating that these three signals can control the expression of mitochondrial aconitase mRNA. Our results identify a regulatory link between energy and iron metabolism in vertebrates and invertebrates, and suggest biological functions for the IRE/IRP regulatory system in addition to the maintenance of iron homeostasis. Images Fig. 2 Fig. 3 Fig. 4 Fig. 5 PMID:8643505

  11. Upregulated mRNA expression of desaturase and elongase, two enzymes involved in highly unsaturated fatty acids biosynthesis pathways during follicle maturation in zebrafish

    PubMed Central

    Ishak, Sairatul D; Tan, Sze-Huey; Khong, Hou-Keat; Jaya-Ram, Annette; Enyu, Yee-Ling; Kuah, Meng-Kiat; Shu-Chien, Alexander Chong

    2008-01-01

    Background Although unsaturated fatty acids such as eicosapentaenoic acid (EPA, C20:5n-3), docosahexaenoic acid (DHA, C22:6n-3) and arachidonic acid (ARA, C20:4n-6), collectively known as the highly unsaturated fatty acids (HUFA), play pivotal roles in vertebrate reproduction, very little is known about their synthesis in the ovary. The zebrafish (Danio rerio) display capability to synthesize all three HUFA via pathways involving desaturation and elongation of two precursors, the linoleic acid (LA, C18:2n-6) and linolenic acid (LNA, C18:3n-3). As a prerequisite to gain full understanding on the importance and regulation of ovarian HUFA synthesis, we described here the mRNA expression pattern of two enzymes; desaturase (fadsd6) and elongase (elovl5), involved in HUFA biosynthesis pathway, in different zebrafish ovarian follicle stages. Concurrently, the fatty acid profile of each follicle stage was also analyzed. Methods mRNA levels of fadsd6 and elovl5 in different ovarian follicle stages were determined by semi-quantitative reverse transcription-polymerase chain reaction (RT-PCR) assays. For analysis of the ovarian follicular fatty acid composition, gas chromatography was used. Results Our results have shown that desaturase displayed significant upregulation in expression during the oocyte maturation stage. Expression of elongase was significantly highest in pre-vitellogenic follicles, followed by maturation stage. Fatty acid composition analysis of different ovarian follicle stages also showed that ARA level was significantly highest in pre-vitellogenic and matured follicles. DHA level was highest in both late vitellogenic and maturation stage. Conclusion Collectively, our findings seem to suggest the existence of a HUFA synthesis system, which could be responsible for the synthesis of HUFA to promote oocyte maturation and possibly ovulation processes. The many advantages of zebrafish as model system to understand folliculogenesis will be useful platform to

  12. Alginic acid synthesis in Pseudomonas aeruginosa mutants defective in carbohydrate metabolism.

    PubMed Central

    Banerjee, P C; Vanags, R I; Chakrabarty, A M; Maitra, P K

    1983-01-01

    Mutant cells of mucoid Pseudomonas aeruginosa isolated from cystic fibrosis patients were examined for their ability to synthesize alginic acid in resting cell suspensions. Unlike the wild-type strain which synthesizes alginic acid from glycerol, fructose, mannitol, glucose, gluconate, glutamate, or succinate, mutants lacking specific enzymes of carbohydrate metabolism are uniquely impaired. A phosphoglucose isomerase mutant did not synthesize the polysaccharide from mannitol, nor did a glucose 6-phosphate dehydrogenase mutant synthesize the polysaccharide from mannitol or glucose. Mutants lacking the Entner-Doudoroff pathway dehydrase or aldolase failed to produce alginate from mannitol, glucose, or gluconate, as a 3-phosphoglycerate kinase or glyceraldehyde 3-phosphate dehydrogenase mutant failed to produce from glutamate or succinate. These results demonstrate the primary role of the Entner-Doudoroff pathway enzymes in the synthesis of alginate from glucose, mannitol, or gluconate and the role of glyceraldehyde 3-phosphate dehydrogenase reaction for the synthesis from gluconeogenic precursors such as glutamate. The virtual absence of any activity of phosphomannose isomerase in cell extracts of several independent mucoid bacteria and the impairment of alginate synthesis from mannitol in mutants lacking phosphoglucose isomerase or glucose 6-phosphate dehydrogenase rule out free mannose 6-phosphate as an intermediate in alginate biosynthesis. PMID:6408061

  13. Synthesis of fatty acid ethyl esters in mammalian tissues after ethanol exposure: a systematic review of the literature.

    PubMed

    Zelner, Irene; Matlow, Jeremy N; Natekar, Aniket; Koren, Gideon

    2013-08-01

    The ability to undergo non-oxidative metabolism from ethanol to fatty acid ethyl esters (FAEEs) varies greatly among tissues and organs. To gain a greater understanding of non-oxidative ethanol metabolism to FAEE, we aimed to collect all published data on FAEE synthesis in mammalian organs and tissues to identify all tissues, organs, and enzymes that are known to, or likely possess FAEE-synthetic activity. A systematic search for relevant papers was performed and two independent reviewers examined potentially relevant abstracts (articles on FAEEs that pertain to ethanol exposure) to determine whether they met the inclusion criteria. Information on FAEE synthesis was retrieved from papers meeting the inclusion/exclusion criteria and summarized by organ/tissue/matrix examined. The systematic search through four databases yielded 78 articles that investigated FAEE synthesis by tissues, tissue fractions and cell lines, and 29 articles that attempted to purify and/or characterize the enzymes involved in FAEE synthesis. Two enzyme activities have been studied: FAEE synthase (FAEES, which conjugates ethanol and free fatty acid) and acyl-CoA: ethanol O-acyltransferase (AEAT, which conjugates ethanol and fatty acyl-CoA). Both activities are expressed by a variety of different enzymes. FAEES activity is the most widely studied and has been purified from several tissues and shown to be associated with several well-known enzymes, while the identity of enzymes possessing AEAT activity remains unknown. The organs and tissues that have been shown to synthesize FAEEs are discussed, with special emphasis on the studies that attempted to elucidate the enzymology of FAEE synthesis in those tissues.

  14. Synthesis of fatty acid ethyl esters in mammalian tissues after ethanol exposure: a systematic review of the literature.

    PubMed

    Zelner, Irene; Matlow, Jeremy N; Natekar, Aniket; Koren, Gideon

    2013-08-01

    The ability to undergo non-oxidative metabolism from ethanol to fatty acid ethyl esters (FAEEs) varies greatly among tissues and organs. To gain a greater understanding of non-oxidative ethanol metabolism to FAEE, we aimed to collect all published data on FAEE synthesis in mammalian organs and tissues to identify all tissues, organs, and enzymes that are known to, or likely possess FAEE-synthetic activity. A systematic search for relevant papers was performed and two independent reviewers examined potentially relevant abstracts (articles on FAEEs that pertain to ethanol exposure) to determine whether they met the inclusion criteria. Information on FAEE synthesis was retrieved from papers meeting the inclusion/exclusion criteria and summarized by organ/tissue/matrix examined. The systematic search through four databases yielded 78 articles that investigated FAEE synthesis by tissues, tissue fractions and cell lines, and 29 articles that attempted to purify and/or characterize the enzymes involved in FAEE synthesis. Two enzyme activities have been studied: FAEE synthase (FAEES, which conjugates ethanol and free fatty acid) and acyl-CoA: ethanol O-acyltransferase (AEAT, which conjugates ethanol and fatty acyl-CoA). Both activities are expressed by a variety of different enzymes. FAEES activity is the most widely studied and has been purified from several tissues and shown to be associated with several well-known enzymes, while the identity of enzymes possessing AEAT activity remains unknown. The organs and tissues that have been shown to synthesize FAEEs are discussed, with special emphasis on the studies that attempted to elucidate the enzymology of FAEE synthesis in those tissues. PMID:23713893

  15. Synthesis of α-aminoboronic acids.

    PubMed

    Andrés, Patricia; Ballano, Gema; Calaza, M Isabel; Cativiela, Carlos

    2016-04-21

    This review describes available methods for the preparation of α-aminoboronic acids in their racemic or in their enantiopure form. Both, highly stereoselective syntheses and asymmetric procedures leading to the stereocontrolled generation of α-aminoboronic acid derivatives are included. The preparation of acyclic, carbocyclic and azacyclic α-aminoboronic acid derivatives is covered. Within each section, the different synthetic approaches have been classified according to the key bond which is formed to complete the α-aminoboronic acid skeleton.

  16. [Asymmetric synthesis of aromatic L-amino acids catalyzed by transaminase].

    PubMed

    Xia, Wenna; Sun, Yu; Min, Cong; Han, Wei; Wu, Sheng

    2012-11-01

    Aromatic L-Amino acids are important chiral building blocks for the synthesis of many drugs, pesticides, fine chemicals and food additives. Due to the high activity and steroselectivity, enzymatic synthesis of chiral building blocks has become the main research direction in asymmetric synthesis field. Guided by the phylogenetic analysis of transaminases from different sources, two representative aromatic transaminases TyrB and Aro8 in type I subfamily, from the prokaryote Escherichia coli and eukaryote Saccharomyces cerevisia, respectively, were applied for the comparative study of asymmetric transamination reaction process and catalytic efficiency of reversely converting keto acids to the corresponding aromatic L-amino acid. Both TyrB and Aro8 could efficiently synthesize the natural aromatic amino acids phenylalanine and tyrosine as well as non-natural amino acid phenylglycine. The chiral HPLC analysis showed the produced amino acids were L-configuration and the e.e value was 100%. L-alanine was the optimal amino donor, and the transaminase TyrB and Aro8 could not use D-amino acids as amino donor. The optimal molar ratio of amino donor (L-alanine) and amino acceptor (aromatic alpha-keto acids) was 4:1. Both of the substituted group on the aromatic ring and the length of fatty acid carbon chain part in the molecular structure of aromatic substrate alpha-keto acid have the significant impact on the enzyme-catalyzed transamination efficiency. In the experiments of preparative-scale transamination synthesis of L-phenylglycine, L-phenylalanine and L-tyrosine, the specific production rate catalyzed by TryB were 0.28 g/(g x h), 0.31 g/(g x h) and 0.60 g/(g x h) and the specific production rate catalyzed by Aro8 were 0.61 g/(g x h), 0.48 g/(g x h) and 0.59 g/(g x h). The results obtained here were useful for applying the transaminases to asymmetric synthesis of L-amino acids by reversing the reaction balance in industry.

  17. Inhibitors of the Hydrolytic Enzyme Dimethylarginine Dimethylaminohydrolase (DDAH): Discovery, Synthesis and Development.

    PubMed

    Murphy, Rhys B; Tommasi, Sara; Lewis, Benjamin C; Mangoni, Arduino A

    2016-01-01

    Dimethylarginine dimethylaminohydrolase (DDAH) is a highly conserved hydrolytic enzyme found in numerous species, including bacteria, rodents, and humans. In humans, the DDAH-1 isoform is known to metabolize endogenous asymmetric dimethylarginine (ADMA) and monomethyl arginine (l-NMMA), with ADMA proposed to be a putative marker of cardiovascular disease. Current literature reports identify the DDAH family of enzymes as a potential therapeutic target in the regulation of nitric oxide (NO) production, mediated via its biochemical interaction with the nitric oxide synthase (NOS) family of enzymes. Increased DDAH expression and NO production have been linked to multiple pathological conditions, specifically, cancer, neurodegenerative disorders, and septic shock. As such, the discovery, chemical synthesis, and development of DDAH inhibitors as potential drug candidates represent a growing field of interest. This review article summarizes the current knowledge on DDAH inhibition and the derived pharmacokinetic parameters of the main DDAH inhibitors reported in the literature. Furthermore, current methods of development and chemical synthetic pathways are discussed. PMID:27187323

  18. Inhibitors of the Hydrolytic Enzyme Dimethylarginine Dimethylaminohydrolase (DDAH): Discovery, Synthesis and Development.

    PubMed

    Murphy, Rhys B; Tommasi, Sara; Lewis, Benjamin C; Mangoni, Arduino A

    2016-01-01

    Dimethylarginine dimethylaminohydrolase (DDAH) is a highly conserved hydrolytic enzyme found in numerous species, including bacteria, rodents, and humans. In humans, the DDAH-1 isoform is known to metabolize endogenous asymmetric dimethylarginine (ADMA) and monomethyl arginine (l-NMMA), with ADMA proposed to be a putative marker of cardiovascular disease. Current literature reports identify the DDAH family of enzymes as a potential therapeutic target in the regulation of nitric oxide (NO) production, mediated via its biochemical interaction with the nitric oxide synthase (NOS) family of enzymes. Increased DDAH expression and NO production have been linked to multiple pathological conditions, specifically, cancer, neurodegenerative disorders, and septic shock. As such, the discovery, chemical synthesis, and development of DDAH inhibitors as potential drug candidates represent a growing field of interest. This review article summarizes the current knowledge on DDAH inhibition and the derived pharmacokinetic parameters of the main DDAH inhibitors reported in the literature. Furthermore, current methods of development and chemical synthetic pathways are discussed.

  19. Enzyme-catalyzed synthesis of heptyl-β-glycosides: effect of water coalescence at high temperature.

    PubMed

    Montiel, Carmina; Bustos-Jaimes, Ismael; Bárzana, Eduardo

    2013-09-01

    Alkyl glycosides can be synthesized by glycosidases in organic media with limited amounts of water. These systems, however, limit the solubility of the sugar substrates and decrease reaction yields. Herein we report the enzymatic synthesis of heptyl-β-glycosides in heptanol catalyzed by a hyperthermophilic β-glycosidase at 90°C. Our results indicate that dispersion of water in heptanol changes with time producing coalescence of water at the bottom of the reactor, playing a key role in the reaction yield. Water-soluble substrate, enzyme and products are concentrated in the aqueous phase, according to their partition coefficients, promoting side reactions that inactivate the enzyme. Reaction yield of heptyl-β-glycosides was 35% relative to lactose, at 7% water. The increase in the water phase to 12% diminished the enzyme inactivation and increased the heptyl-β-glycosides yield to 52%. Surface-active compounds, SDS and octyl glucoside, increased water dispersion but were unable to prevent coalescence.

  20. Effects of Abscisic Acid and Ethylene on the Gibberellic Acid-Induced Synthesis of α-Amylase by Isolated Wheat Aleurone Layers 1

    PubMed Central

    Varty, Keith; Arreguín, Barbarín L.; Gómez, Miguel T.; López, Pablo Jaime T.; Gómez, Miguel Angel L.

    1983-01-01

    Gibberellic acid-induced α-amylase synthesis in wheat aleurone layers (Triticum aestivum L. var Potam S-70) escaped from transcriptional control 30 h after addition of the hormone, as evidenced by the tissue's loss of susceptibility to cordycepin. Abscisic acid inhibited the accumulation of α-amylase activity when added to the tissue during this cordycepin-insensitive phase of enzyme induction. α-Amylase synthesis was not restored by the addition of cordycepin, indicating that the response to abscisic acid was not dependent upon the continuous synthesis of a short lived RNA. When ethylene was added simultaneously or some time after abscisic acid, the accumulation of α-amylase activity was sustained or quickly restored. The loss of susceptibility to cordycepin was completely prevented when aleurone layers were incubated with a combination of gibberellic and abscisic acids from the start of the induction period. This effect of abscisic acid was not reversed by ethylene. On the basis of these observations, it is suggested that abscisic acid inhibits both the transcription and translation of α-amylase mRNA, and that only the latter site of action is susceptible to reversal by ethylene. The rate of incorporation of [methyl-14C]choline into phospholipids was also inhibited by abscisic acid. Ethylene reversed this effect. The effects of abscisic acid and ethylene on phospholipid synthesis were not dependent upon the presence of gibberellic acid. No direct relationship was found between the control of α-amylase synthesis and membrane formation by abscisic acid and ethylene. PMID:16663284

  1. Structure and function of ∆1-tetrahydrocannabinolic acid (THCA) synthase, the enzyme controlling the psychoactivity of Cannabis sativa.

    PubMed

    Shoyama, Yoshinari; Tamada, Taro; Kurihara, Kazuo; Takeuchi, Ayako; Taura, Futoshi; Arai, Shigeki; Blaber, Michael; Shoyama, Yukihiro; Morimoto, Satoshi; Kuroki, Ryota

    2012-10-12

    ∆1-Tetrahydrocannabinolic acid (THCA) synthase catalyzes the oxidative cyclization of cannabigerolic acid (CBGA) into THCA, the precursor of the primary psychoactive agent ∆1-tetrahydrocannabinol in Cannabis sativa. The enzyme was overproduced in insect cells, purified, and crystallized in order to investigate the structure-function relationship of THCA synthase, and the tertiary structure was determined to 2.75Å resolution by X-ray crystallography (R(cryst)=19.9%). The THCA synthase enzyme is a member of the p-cresol methyl-hydroxylase superfamily, and the tertiary structure is divided into two domains (domains I and II), with a flavin adenine dinucleotide coenzyme positioned between each domain and covalently bound to His114 and Cys176 (located in domain I). The catalysis of THCA synthesis involves a hydride transfer from C3 of CBGA to N5 of flavin adenine dinucleotide and the deprotonation of O6' of CBGA. The ionized residues in the active site of THCA synthase were investigated by mutational analysis and X-ray structure. Mutational analysis indicates that the reaction does not involve the carboxyl group of Glu442 that was identified as the catalytic base in the related berberine bridge enzyme but instead involves the hydroxyl group of Tyr484. Mutations at the active-site residues His292 and Tyr417 resulted in a decrease in, but not elimination of, the enzymatic activity of THCA synthase, suggesting a key role for these residues in substrate binding and not direct catalysis.

  2. Antitumor effects of a drug combination targeting glycolysis, glutaminolysis and de novo synthesis of fatty acids.

    PubMed

    Cervantes-Madrid, Diana; Dueñas-González, Alfonso

    2015-09-01

    There is a strong rationale for targeting the metabolic alterations of cancer cells. The most studied of these are the higher rates of glycolysis, glutaminolysis and de novo synthesis of fatty acids (FAs). Despite the availability of pharmacological inhibitors of these pathways, no preclinical studies targeting them simultaneously have been performed. In the present study it was determined whether three key enzymes for glycolysis, glutaminolysis and de novo synthesis of FAs, hexokinase-2, glutaminase and fatty acid synthase, respectively, were overexpressed as compared to primary fibroblasts. In addition, we showed that at clinically relevant concentrations lonidamine, 6-diazo-5-oxo-L-norleucine and orlistat, known inhibitors of the mentioned enzymes, exerted a cell viability inhibitory effect. Genetic downregulation of the three enzymes also reduced cell viability. The three drugs were highly synergistic when administered as a triple combination. Of note, the cytotoxicity of the triple combination was low in primary fibroblasts and was well tolerated when administered into healthy BALB/c mice. The results suggest the feasibility and potential clinical utility of the triple metabolic targeting which merits to be further studied by using either repositioned old drugs or newer, more selective inhibitors. PMID:26134042

  3. Type II fatty acid synthesis is essential only for malaria parasite late liver stage development

    PubMed Central

    Vaughan, Ashley M; O'Neill, Matthew T; Tarun, Alice S; Camargo, Nelly; Phuong, Thuan M; Aly, Ahmed S I; Cowman, Alan F; Kappe, Stefan H I

    2009-01-01

    Intracellular malaria parasites require lipids for growth and replication. They possess a prokaryotic type II fatty acid synthesis (FAS II) pathway that localizes to the apicoplast plastid organelle and is assumed to be necessary for pathogenic blood stage replication. However, the importance of FAS II throughout the complex parasite life cycle remains unknown. We show in a rodent malaria model that FAS II enzymes localize to the sporozoite and liver stage apicoplast. Targeted deletion of FabB/F, a critical enzyme in fatty acid synthesis, did not affect parasite blood stage replication, mosquito stage development and initial infection in the liver. This was confirmed by knockout of FabZ, another critical FAS II enzyme. However, FAS II-deficient Plasmodium yoelii liver stages failed to form exo-erythrocytic merozoites, the invasive stage that first initiates blood stage infection. Furthermore, deletion of FabI in the human malaria parasite Plasmodium falciparum did not show a reduction in asexual blood stage replication in vitro. Malaria parasites therefore depend on the intrinsic FAS II pathway only at one specific life cycle transition point, from liver to blood. PMID:19068099

  4. Regulation of collagen synthesis by ascorbic acid.

    PubMed Central

    Murad, S; Grove, D; Lindberg, K A; Reynolds, G; Sivarajah, A; Pinnell, S R

    1981-01-01

    After prolonged exposure to ascorbate, collagen synthesis in cultured human skin fibroblasts increased approximately 8-fold with no significant change in synthesis of noncollagen protein. This effect of ascorbate appears to be unrelated to its cofactor function in collagen hydroxylation. The collagenous protein secreted in the absence of added ascorbate was normal in hydroxylysine but was mildly deficient in hydroxyproline. In parallel experiments, lysine hydroxylase (peptidyllysine, 2-oxoglutarate:oxygen 5-oxidoreductase, EC 1.14.11.4) activity increased 3-fold in response to ascorbate administration whereas proline hydroxylase (prolyl-glycyl-peptide, 2-oxoglutarate:oxygen oxidoreductase, EC 1.14.11.2) activity decreased considerably. These results suggest that collage polypeptide synthesis, posttranslational hydroxylations, and activities of the two hydroxylases are independently regulated by ascorbate. PMID:6265920

  5. Synthesis of Triamino Acid Building Blocks with Different Lipophilicities

    PubMed Central

    Maity, Jyotirmoy; Honcharenko, Dmytro; Strömberg, Roger

    2015-01-01

    To obtain different amino acids with varying lipophilicity and that can carry up to three positive charges we have developed a number of new triamino acid building blocks. One set of building blocks was achieved by aminoethyl extension, via reductive amination, of the side chain of ortnithine, diaminopropanoic and diaminobutanoic acid. A second set of triamino acids with the aminoethyl extension having hydrocarbon side chains was synthesized from diaminobutanoic acid. The aldehydes needed for the extension by reductive amination were synthesized from the corresponding Fmoc-L-2-amino fatty acids in two steps. Reductive amination of these compounds with Boc-L-Dab-OH gave the C4-C8 alkyl-branched triamino acids. All triamino acids were subsequently Boc-protected at the formed secondary amine to make the monomers appropriate for the N-terminus position when performing Fmoc-based solid-phase peptide synthesis. PMID:25876040

  6. The "manganese(III)-containing" purple acid phosphatase from sweet potatoes is an iron enzyme.

    PubMed

    Hefler, S K; Averill, B A

    1987-08-14

    An improved purification of the purple acid phosphatase from sweet potatoes has been developed, and the properties of the enzyme have been reexamined. Contrary to previous reports, (e.g., Y. Sugiura, et al., J. Biol. Chem., 256, 10664-10670 (1981) ), the enzyme contains two moles of iron and insignificant amounts of manganese. The specific activity of the iron-containing preparations is ca. 14 times higher than that reported previously for the purported "Mn(III)" enzyme. The sweet potato purple acid phosphatase does indeed bind manganese, but it can be removed by dialysis with no changes in specific activity or spectral properties.

  7. Fatty Acid Phytyl Ester Synthesis in Chloroplasts of Arabidopsis[W

    PubMed Central

    Lippold, Felix; vom Dorp, Katharina; Abraham, Marion; Hölzl, Georg; Wewer, Vera; Yilmaz, Jenny Lindberg; Lager, Ida; Montandon, Cyrille; Besagni, Céline; Kessler, Felix; Stymne, Sten; Dörmann, Peter

    2012-01-01

    During stress or senescence, thylakoid membranes in chloroplasts are disintegrated, and chlorophyll and galactolipid are broken down, resulting in the accumulation of toxic intermediates, i.e., tetrapyrroles, free phytol, and free fatty acids. Chlorophyll degradation has been studied in detail, but the catabolic pathways for phytol and fatty acids remain unclear. A large proportion of phytol and fatty acids is converted into fatty acid phytyl esters and triacylglycerol during stress or senescence in chloroplasts. We isolated two genes (PHYTYL ESTER SYNTHASE1 [PES1] and PES2) of the esterase/lipase/thioesterase family of acyltransferases from Arabidopsis thaliana that are involved in fatty acid phytyl ester synthesis in chloroplasts. The two proteins are highly expressed during senescence and nitrogen deprivation. Heterologous expression in yeast revealed that PES1 and PES2 have phytyl ester synthesis and diacylglycerol acyltransferase activities. The enzymes show broad substrate specificities and can employ acyl-CoAs, acyl carrier proteins, and galactolipids as acyl donors. Double mutant plants (pes1 pes2) grow normally but show reduced phytyl ester and triacylglycerol accumulation. These results demonstrate that PES1 and PES2 are involved in the deposition of free phytol and free fatty acids in the form of phytyl esters in chloroplasts, a process involved in maintaining the integrity of the photosynthetic membrane during abiotic stress and senescence. PMID:22623494

  8. In vitro and in silico studies of the inhibitory effects of some novel kojic acid derivatives on tyrosinase enzyme

    PubMed Central

    Asadzadeh, Azizeh; Sirous, Hajar; Pourfarzam, Morteza; Yaghmaei, Parichehreh; Afshin, Fassihi

    2016-01-01

    Objective(s): Tyrosinase is a key enzyme in pigment synthesis. Overproduction of melanin in parts of the skin results in hyperpigmentation diseases. This enzyme is also responsible for the enzymatic browning in fruits and vegetables. Thus, its inhibitors are of great importance in the medical, cosmetic and agricultural fields. Materials and Methods: A series of twelve kojic acid derivatives were designed to be evaluated as tyrosinase activity inhibitors. The potential inhibitory activity of these compounds was investigated in silico using molecular docking simulation method. Four compounds with a range of predicted tyrosinase inhibitory activities were prepared and their inhibitory effect on tyrosinase activity was evaluated. The antioxidant properties of these compounds were also investigated by in vitro DPPH (2,2-diphenyl-1-picrylhydrazyl) and hydrogen peroxide scavenging assays. Results: Compound IIId exhibited the highest tyrosinase inhibitory activity with an IC50 value of 0.216 ± 0.009 mM which was in accordance with the in silico ΔGbind results (-13.24 Kcal/mol). Conclusion: Based on the docking studies, from the twelve compounds studied, one (IIId) appeared to have the highest inhibition on tyrosinase activity. This was confirmed by enzyme activity measurements. Compound IIId has an NO2 group which binds to both of Cu2+ ions located inside the active site of the enzyme. This compound appeared to be even stronger than kojic acid in inhibiting tyrosinase activity. The DPPH free radical scavenging ability of all the studied compounds was more than that of BHT. However, they were not as strong as BHT or gallic acid in scavenging hydrogen peroxide. PMID:27081457

  9. Intersection of RNA Processing and the Type II Fatty Acid Synthesis Pathway in Yeast Mitochondria▿

    PubMed Central

    Schonauer, Melissa S.; Kastaniotis, Alexander J.; Hiltunen, J. Kalervo; Dieckmann, Carol L.

    2008-01-01

    Distinct metabolic pathways can intersect in ways that allow hierarchical or reciprocal regulation. In a screen of respiration-deficient Saccharomyces cerevisiae gene deletion strains for defects in mitochondrial RNA processing, we found that lack of any enzyme in the mitochondrial fatty acid type II biosynthetic pathway (FAS II) led to inefficient 5′ processing of mitochondrial precursor tRNAs by RNase P. In particular, the precursor containing both RNase P RNA (RPM1) and tRNAPro accumulated dramatically. Subsequent Pet127-driven 5′ processing of RPM1 was blocked. The FAS II pathway defects resulted in the loss of lipoic acid attachment to subunits of three key mitochondrial enzymes, which suggests that the octanoic acid produced by the pathway is the sole precursor for lipoic acid synthesis and attachment. The protein component of yeast mitochondrial RNase P, Rpm2, is not modified by lipoic acid in the wild-type strain, and it is imported in FAS II mutant strains. Thus, a product of the FAS II pathway is required for RNase P RNA maturation, which positively affects RNase P activity. In addition, a product is required for lipoic acid production, which is needed for the activity of pyruvate dehydrogenase, which feeds acetyl-coenzyme A into the FAS II pathway. These two positive feedback cycles may provide switch-like control of mitochondrial gene expression in response to the metabolic state of the cell. PMID:18779316

  10. Fatty acid elongation in yeast--biochemical characteristics of the enzyme system and isolation of elongation-defective mutants.

    PubMed

    Dittrich, F; Zajonc, D; Hühne, K; Hoja, U; Ekici, A; Greiner, E; Klein, H; Hofmann, J; Bessoule, J J; Sperling, P; Schweizer, E

    1998-03-15

    homogenate. In addition, the in vivo process appears to be protected against side reactions such as hydrolysis or alpha-oxidation. Yeast mutants defective in 12:0 or 13:0 elongation were derived from fas-mutant strains according to their failure to grow on 13:0-supplemented media. In vivo, 12:0 elongation was reduced to 0-10% of the normal level, while 16:0 elongation and VLCFA synthesis were unimpaired. It is concluded that yeast contains either two different elongation systems, or that the respective mutation interferes differentially with medium-chain and long-chain fatty acid elongation. The yeast gene affected in the elongation-defective mutants was isolated and, upon sequencing, identified as the known ELO1 sequence. It encodes a putative membrane protein of 32-kDa molecular mass with no obvious similarity to any of the known FAS component enzymes. PMID:9546663

  11. Lipase-catalyzed synthesis of fatty acid amide (erucamide) using fatty acid and urea.

    PubMed

    Awasthi, Neeraj Praphulla; Singh, R P

    2007-01-01

    Ammonolysis of fatty acids to the corresponding fatty acid amides is efficiently catalysed by Candida antartica lipase (Novozym 435). In the present paper lipase-catalysed synthesis of erucamide by ammonolysis of erucic acid and urea in organic solvent medium was studied and optimal conditions for fatty amides synthesis were established. In this process erucic acid gave 88.74 % pure erucamide after 48 hour and 250 rpm at 60 degrees C with 1:4 molar ratio of erucic acid and urea, the organic solvent media is 50 ml tert-butyl alcohol (2-methyl-2-propanol). This process for synthesis is economical as we used urea in place of ammonia or other amidation reactant at atmospheric pressure. The amount of catalyst used is 3 %.

  12. Lipase-catalyzed synthesis of fatty acid amide (erucamide) using fatty acid and urea.

    PubMed

    Awasthi, Neeraj Praphulla; Singh, R P

    2007-01-01

    Ammonolysis of fatty acids to the corresponding fatty acid amides is efficiently catalysed by Candida antartica lipase (Novozym 435). In the present paper lipase-catalysed synthesis of erucamide by ammonolysis of erucic acid and urea in organic solvent medium was studied and optimal conditions for fatty amides synthesis were established. In this process erucic acid gave 88.74 % pure erucamide after 48 hour and 250 rpm at 60 degrees C with 1:4 molar ratio of erucic acid and urea, the organic solvent media is 50 ml tert-butyl alcohol (2-methyl-2-propanol). This process for synthesis is economical as we used urea in place of ammonia or other amidation reactant at atmospheric pressure. The amount of catalyst used is 3 %. PMID:17898456

  13. Synthesis and antituberculosis activity of new fatty acid amides.

    PubMed

    D'Oca, Caroline Da Ros Montes; Coelho, Tatiane; Marinho, Tamara Germani; Hack, Carolina Rosa Lopes; Duarte, Rodrigo da Costa; da Silva, Pedro Almeida; D'Oca, Marcelo Gonçalves Montes

    2010-09-01

    This work reports the synthesis of new fatty acid amides from C16:0, 18:0, 18:1, 18:1 (OH), and 18:2 fatty acids families with cyclic and acyclic amines and demonstrate for the first time the activity of these compounds as antituberculosis agents against Mycobacterium tuberculosis H(37)Rv, M. tuberculosis rifampicin resistance (ATCC 35338), and M. tuberculosis isoniazid resistance (ATCC 35822). The fatty acid amides derivate from ricinoleic acid were the most potent one among a series of tested compounds, with a MIC 6.25 microg/mL for resistance strains.

  14. Resolution of component proteins in an enzyme complex from Methanosarcina thermophila catalyzing the synthesis or cleavage of acetyl-CoA

    SciTech Connect

    Abbanat, D.R.; Ferry, J.G. )

    1991-04-15

    An enzyme complex was isolated from acetate-grown Methanosarcina thermophila that oxidized CO and catalyzed the synthesis or cleavage of acetyl-CoA. The complex consisted of five subunits ({alpha}1{beta}1{gamma}1{delta}1{epsilon}1) of 89, 71, 60, 58, and 19 kDa. The complex contained nickel, iron, acid-labile sulfide, and cobalt in a corrinoid cofactor. Two components were resolved by anion-exchange chromatography of the complex in the presence of dodecyltrimethylammonium bromide and Triton X-100: a 200-kDa nickel/iron-sulfur protein with the 89-and 19-kDa ({alpha}{sub 2}{epsilon}{sub x}) subunits and a 100-kDa corrinoid/iron-sulfur protein with the 60- and 58-kDa subunits ({gamma}1{delta}1). Both components contained iron-sulfur centers. The nickel/iron-sulfur component oxidized CO and reduced methyl viologen or a ferredoxin isolated from M. thermophila. UV-visible spectroscopy indicated that the reduced corrinoid/iron-sulfur component could be methylated with CH{sub 3}I. The results suggest that the enzyme complex from M. thermophila contained at least two enzyme components, each with a specific function. The properties of the component enzymes support a mechanism proposed for acetyl-CoA synthesis (or cleavage) by the enzyme complex.

  15. Characterization of the Branched-Chain Amino Acid Aminotransferase Enzyme Family in Tomato1[W][OA

    PubMed Central

    Maloney, Gregory S.; Kochevenko, Andrej; Tieman, Denise M.; Tohge, Takayuki; Krieger, Uri; Zamir, Dani; Taylor, Mark G.; Fernie, Alisdair R.; Klee, Harry J.

    2010-01-01

    Branched-chain amino acids (BCAAs) are synthesized in plants from branched-chain keto acids, but their metabolism is not completely understood. The interface of BCAA metabolism lies with branched-chain aminotransferases (BCAT) that catalyze both the last anabolic step and the first catabolic step. In this study, six BCAT genes from the cultivated tomato (Solanum lycopersicum) were identified and characterized. SlBCAT1, -2, -3, and -4 are expressed in multiple plant tissues, while SlBCAT5 and -6 were undetectable. SlBCAT1 and -2 are located in the mitochondria, SlBCAT3 and -4 are located in chloroplasts, while SlBCAT5 and -6 are located in the cytosol and vacuole, respectively. SlBCAT1, -2, -3, and -4 were able to restore growth of Escherichia coli BCAA auxotrophic cells, but SlBCAT1 and -2 were less effective than SlBCAT3 and -4 in growth restoration. All enzymes were active in the forward (BCAA synthesis) and reverse (branched-chain keto acid synthesis) reactions. SlBCAT3 and -4 exhibited a preference for the forward reaction, while SlBCAT1 and -2 were more active in the reverse reaction. While overexpression of SlBCAT1 or -3 in tomato fruit did not significantly alter amino acid levels, an expression quantitative trait locus on chromosome 3, associated with substantially higher expression of Solanum pennellii BCAT4, did significantly increase BCAA levels. Conversely, antisense-mediated reduction of SlBCAT1 resulted in higher levels of BCAAs. Together, these results support a model in which the mitochondrial SlBCAT1 and -2 function in BCAA catabolism while the chloroplastic SlBCAT3 and -4 function in BCAA synthesis. PMID:20435740

  16. Aliphatic amidase of Rhodococcus rhodochrous PA-34: Purification, characterization and application in synthesis of acrylic acid.

    PubMed

    Thakur, Neerja; Kumar, Vijay; Sharma, Nirmal Kant; Thakur, Shikha; Bhalla, Tek Chand

    2016-01-01

    An intracellular aliphatic amide degrading inducible amidase produced by Rhodococcus rhodochrous PA-34 was characterized and acrylic acid synthesis from acrylamide was carried out using whole cell amidase. A bioprocess was developed at 50 ml fed batch reaction using 400 mM acrylamide feeding at an interval of 30 min resulted in the production of 4 g acrylic acid with volumetric and catalytic productivity of 80 g/l and 19 g/g/h respectively. The amidase of this organism had molecular weight of 40 kDa and was purified to 8.5 fold with 8% yield. This enzyme was active within the temperature range of 30 to 60 °C, with optimum temperature 45 °C and pH 7.5. The Vmax, Km, and kcat of purified amidase were calculated as 250 U/mg protein, 4.5 mM, and 166 sec-1 for acrylamide. The enzyme showed tolerance to metal chelating agent (EDTA) and was strongly inhibited by heavy metal ions Hg2+, Ag2+, Cu2+ and Co2+. R. rhodochrous PA-34 amidase preferentially hydrolyzed small aliphatic toxic amide such as acrylamide. Thus, the amidase of R. rhodochrous PA-34 is promising biocatalyst for the synthesis of industrially important acids and biodegradation of toxic amides. PMID:26667322

  17. Synthesis of biobased succinonitrile from glutamic acid and glutamine.

    PubMed

    Lammens, Tijs M; Le Nôtre, Jérôme; Franssen, Maurice C R; Scott, Elinor L; Sanders, Johan P M

    2011-06-20

    Succinonitrile is the precursor of 1,4-diaminobutane, which is used for the industrial production of polyamides. This paper describes the synthesis of biobased succinonitrile from glutamic acid and glutamine, amino acids that are abundantly present in many plant proteins. Synthesis of the intermediate 3-cyanopropanoic amide was achieved from glutamic acid 5-methyl ester in an 86 mol% yield and from glutamine in a 56 mol % yield. 3-Cyanopropanoic acid can be converted into succinonitrile, with a selectivity close to 100% and a 62% conversion, by making use of a palladium(II)-catalyzed equilibrium reaction with acetonitrile. Thus, a new route to produce biobased 1,4-diaminobutane has been discovered. PMID:21557494

  18. Activities of Tricarboxylic Acid Cycle Enzymes, Glyoxylate Cycle Enzymes, and Fructose Diphosphatase in Bakers' Yeast During Adaptation to Acetate Oxidation

    PubMed Central

    Gosling, J. P.; Duggan, P. F.

    1971-01-01

    Bakers' yeast oxidizes acetate at a high rate only after an adaptation period during which the capacity of the glyoxylate cycle is found to increase. There was apparently no necessity for the activity of acetyl-coenzyme A synthetase, the capacity of the tricarboxylic acid cycle, or the concentrations of the cytochromes to increase for this adaptation to occur. Elevation of fructose 1,6 diphosphatase occurred only when acetate oxidation was nearly maximal. Cycloheximide almost completely inhibited adaptation as well as increases in the activities of isocitrate lyase and aconitate hydratase, the only enzymes assayed. p-Fluorophenylalanine was partially effective and chloramphenicol did not inhibit at all. The presence of ammonium, which considerably delayed adaptation of the yeast to acetate oxidation, inhibited the increases in the activities of the glyoxylate cycle enzymes to different degrees, demonstrating noncoordinate control of these enzymes. Under the various conditions, the only enzyme activity increase consistently related to the rising oxygen uptake rate was that of isocitrate lyase which apparently limited the activity of the cycle. PMID:5557595

  19. Stereoselective synthesis of unsaturated α-amino acids.

    PubMed

    Fanelli, Roberto; Jeanne-Julien, Louis; René, Adeline; Martinez, Jean; Cavelier, Florine

    2015-06-01

    Stereoselective synthesis of unsaturated α-amino acids was performed by asymmetric alkylation. Two methods were investigated and their enantiomeric excess measured and compared. The first route consisted of an enantioselective approach induced by the Corey-Lygo catalyst under chiral phase transfer conditions while the second one involved the hydroxypinanone chiral auxiliary, both implicating Schiff bases as substrate. In all cases, the use of a prochiral Schiff base gave higher enantiomeric excess and yield in the final desired amino acid.

  20. Synthesis of sulfonate analogs of bile acids.

    PubMed

    Kihira, K; Mikami, T; Ikawa, S; Okamoto, A; Yoshii, M; Miki, S; Mosbach, E H; Hoshita, T

    1992-04-01

    Sulfonate analogs of C23 and C24 bile acids were synthesized from norcholic, norchenodeoxycholic, norursodeoxycholic, nordeoxycholic, norhyodeoxycholic, cholic, deoxycholic, hyodeoxycholic, and lithocholic acids. The principal reactions used were (1) reduction of the bile acids with NaBH4 to the corresponding bile alcohols, (2) selective tosylation of the terminal hydroxyl group, (3) iodination of the tosyl esters with NaI, and (4) treatment of the iodides with Na2SO3 to form the sulfonate analogs of the bile acids. The sulfonate analogs showed polarity similar to that of taurine-conjugated bile acids on thin-layer chromatography. The carbon 13 nuclear magnetic resonance spectral data for the sulfonate analogs were tabulated.

  1. Phenylalanine ammonia lyase catalyzed synthesis of amino acids by an MIO-cofactor independent pathway.

    PubMed

    Lovelock, Sarah L; Lloyd, Richard C; Turner, Nicholas J

    2014-04-25

    Phenylalanine ammonia lyases (PALs) belong to a family of 4-methylideneimidazole-5-one (MIO) cofactor dependent enzymes which are responsible for the conversion of L-phenylalanine into trans-cinnamic acid in eukaryotic and prokaryotic organisms. Under conditions of high ammonia concentration, this deamination reaction is reversible and hence there is considerable interest in the development of PALs as biocatalysts for the enantioselective synthesis of non-natural amino acids. Herein the discovery of a previously unobserved competing MIO-independent reaction pathway, which proceeds in a non-stereoselective manner and results in the generation of both L- and D-phenylalanine derivatives, is described. The mechanism of the MIO-independent pathway is explored through isotopic-labeling studies and mutagenesis of key active-site residues. The results obtained are consistent with amino acid deamination occurring by a stepwise E1 cB elimination mechanism.

  2. The spark discharge synthesis of amino acids from various hydrocarbons

    NASA Technical Reports Server (NTRS)

    Ring, D.; Miller, S. L.

    1984-01-01

    The spark discharge synthesis of amino acids using an atmosphere of CH4+N2+H2O+NH3 has been investigated with variable pNH3. The amino acids produced using higher hydrocarbons (ethane, ethylene, acetylene, propane, butane, and isobutane) instead of CH4 were also investigated. There was considerable range in the absolute yields of amino acids, but the yields relative to glycine (or alpha-amino-n-butyric acid) were more uniform. The relative yields of the C3 to C6 aliphatic alpha-amino acids are nearly the same (with a few exceptions) with all the hydrocarbons. The glycine yields are more variable. The precursors to the C3-C6 aliphatic amino acids seem to be produced in the same process, which is separate from the synthesis of glycine precursors. It may be possible to use these relative yields as a signature for a spark discharge synthesis provided corrections can be made for subsequent decomposition events (e.g. in the Murchison meteorite).

  3. Synthesis of monomethyl 5,5'-dehydrodiferulic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Synthesis of the internal reference compound, monomethyl 5,5’-dehydrodiferulic acid, is described. The synthetic scheme relies on a selective monomethylation of the known compound 5,5-dehydrodivanillin, followed by elaboration into the dehydrodiferulic framework through a dual Horner-Emmons-Wadswort...

  4. Discrimination of acidic and alkaline enzyme using Chou's pseudo amino acid composition in conjunction with probabilistic neural network model.

    PubMed

    Khan, Zaheer Ullah; Hayat, Maqsood; Khan, Muazzam Ali

    2015-01-21

    Enzyme catalysis is one of the most essential and striking processes among of all the complex processes that have evolved in living organisms. Enzymes are biological catalysts, which play a significant role in industrial applications as well as in medical areas, due to profound specificity, selectivity and catalytic efficiency. Refining catalytic efficiency of enzymes has become the most challenging job of enzyme engineering, into acidic and alkaline. Discrimination of acidic and alkaline enzymes through experimental approaches is difficult, sometimes impossible due to lack of established structures. Therefore, it is highly desirable to develop a computational model for discriminating acidic and alkaline enzymes from primary sequences. In this study, we have developed a robust, accurate and high throughput computational model using two discrete sample representation methods Pseudo amino acid composition (PseAAC) and split amino acid composition. Various classification algorithms including probabilistic neural network (PNN), K-nearest neighbor, decision tree, multi-layer perceptron and support vector machine are applied to predict acidic and alkaline with high accuracy. 10-fold cross validation test and several statistical measures namely, accuracy, F-measure, and area under ROC are used to evaluate the performance of the proposed model. The performance of the model is examined using two benchmark datasets to demonstrate the effectiveness of the model. The empirical results show that the performance of PNN in conjunction with PseAAC is quite promising compared to existing approaches in the literature so for. It has achieved 96.3% accuracy on dataset1 and 99.2% on dataset2. It is ascertained that the proposed model might be useful for basic research and drug related application areas. PMID:25452135

  5. Creation of a Broad-Range and Highly Stereoselective d-Amino Acid Dehydrogenase for the One-Step Synthesis of d-Amino Acids

    PubMed Central

    Vedha-Peters, Kavitha; Gunawardana, Manjula; Rozzell, J. David; Novick, Scott J.

    2008-01-01

    Using both rational and random mutagenesis, we have created the first known broad substrate range, nicotinamide cofactor dependent, and highly stereoselective d-amino acid dehydrogenase. This new enzyme is capable of producing d-amino acids via the reductive amination of the corresponding 2-keto acid with ammonia. This biocatalyst was the result of three rounds of mutagenesis and screening performed on the enzyme meso-diaminopimelate d-dehydrogenase. The first round targeted the active site of the wild-type enzyme and produced mutants that were no longer strictly dependent on the native substrate. The second and third rounds produced mutants that had an increased substrate range including straight- and branched-aliphatic amino acids and aromatic amino acids. The very high selectivity towards the d-enantiomer (95 to > 99% e.e) was shown to be preserved even after the addition of the five mutations found in the three rounds of mutagenesis and screening. This new enzyme could complement and improve upon current methods for d-amino acid synthesis. PMID:16910688

  6. Metabolic switch during adipogenesis: From branched chain amino acid catabolism to lipid synthesis.

    PubMed

    Halama, Anna; Horsch, Marion; Kastenmüller, Gabriele; Möller, Gabriele; Kumar, Pankaj; Prehn, Cornelia; Laumen, Helmut; Hauner, Hans; Hrabĕ de Angelis, Martin; Beckers, Johannes; Suhre, Karsten; Adamski, Jerzy

    2016-01-01

    Fat cell metabolism has an impact on body homeostasis and its proper function. Nevertheless, the knowledge about simultaneous metabolic processes, which occur during adipogenesis and in mature adipocytes, is limited. Identification of key metabolic events associated with fat cell metabolism could be beneficial in the field of novel drug development, drug repurposing, as well as for the discovery of patterns predicting obesity risk. The main objective of our work was to provide comprehensive characterization of metabolic processes occurring during adipogenesis and in mature adipocytes. In order to globally determine crucial metabolic pathways involved in fat cell metabolism, metabolomics and transcriptomics approaches were applied. We observed significantly regulated metabolites correlating with significantly regulated genes at different stages of adipogenesis. We identified the synthesis of phosphatidylcholines, the metabolism of even and odd chain fatty acids, as well as the catabolism of branched chain amino acids (BCAA; leucine, isoleucine and valine) as key regulated pathways. Our further analysis led to identification of an enzymatic switch comprising the enzymes Hmgcs2 (3-hydroxy-3-methylglutaryl-CoA synthase) and Auh (AU RNA binding protein/enoyl-CoA hydratase) which connects leucine degradation with cholesterol synthesis. In addition, propionyl-CoA, a product of isoleucine degradation, was identified as a putative substrate for odd chain fatty acid synthesis. The uncovered crosstalks between BCAA and lipid metabolism during adipogenesis might contribute to the understanding of molecular mechanisms of obesity and have potential implications in obesity prediction. PMID:26408941

  7. The role of alpha-methylacyl-CoA racemase in bile acid synthesis.

    PubMed

    Cuebas, Dean A; Phillips, Christopher; Schmitz, Werner; Conzelmann, Ernst; Novikov, Dmitry K

    2002-05-01

    According to current views, the second peroxisomal beta-oxidation pathway is responsible for the degradation of the side chain of bile acid intermediates. Peroxisomal multifunctional enzyme type 2 [peroxisomal multifunctional 2-enoyl-CoA hydratase/(R)-3-hydroxyacyl-CoA dehydrogenase; MFE-2] catalyses the second (hydration) and third (dehydrogenation) reactions of the pathway. Deficiency of MFE-2 leads to accumulation of very-long-chain fatty acids, 2-methyl-branched fatty acids and C(27) bile acid intermediates in plasma, but bile acid synthesis is not blocked completely. In this study we describe an alternative pathway, which allows MFE-2 deficiency to be overcome. The alternative pathway consists of alpha-methylacyl-CoA racemase and peroxisomal multifunctional enzyme type 1 [peroxisomal multifunctional 2-enoyl-CoA hydratase/(S)-3-hydroxyacyl-CoA dehydrogenase; MFE-1]. (24E)-3alpha,7alpha,12alpha-Trihydroxy-5beta-cholest-24-enoyl-CoA, the presumed physiological isomer, is hydrated by MFE-1 with the formation of (24S,25S)-3alpha,7alpha,12alpha,24-tetrahydroxy-5beta-cholestanoyl-CoA [(24S,25S)-24-OH-THCA-CoA], which after conversion by a alpha-methylacyl-CoA racemase into the (24S,25R) isomer can again be dehydrogenated by MFE-1 to 24-keto-3alpha,7alpha,12alpha-trihydroxycholestanoyl-CoA, a physiological intermediate in cholic acid synthesis. The discovery of the alternative pathway of cholesterol side-chain oxidation will improve diagnosis of peroxisomal deficiencies by identification of serum 24-OH-THCA-CoA diastereomer profiles.

  8. Inhibitors of Fatty Acid Synthesis Induce PPAR α -Regulated Fatty Acid β -Oxidative Genes: Synergistic Roles of L-FABP and Glucose.

    PubMed

    Huang, Huan; McIntosh, Avery L; Martin, Gregory G; Petrescu, Anca D; Landrock, Kerstin K; Landrock, Danilo; Kier, Ann B; Schroeder, Friedhelm

    2013-01-01

    While TOFA (acetyl CoA carboxylase inhibitor) and C75 (fatty acid synthase inhibitor) prevent lipid accumulation by inhibiting fatty acid synthesis, the mechanism of action is not simply accounted for by inhibition of the enzymes alone. Liver fatty acid binding protein (L-FABP), a mediator of long chain fatty acid signaling to peroxisome proliferator-activated receptor- α (PPAR α ) in the nucleus, was found to bind TOFA and its activated CoA thioester, TOFyl-CoA, with high affinity while binding C75 and C75-CoA with lower affinity. Binding of TOFA and C75-CoA significantly altered L-FABP secondary structure. High (20 mM) but not physiological (6 mM) glucose conferred on both TOFA and C75 the ability to induce PPAR α transcription of the fatty acid β -oxidative enzymes CPT1A, CPT2, and ACOX1 in cultured primary hepatocytes from wild-type (WT) mice. However, L-FABP gene ablation abolished the effects of TOFA and C75 in the context of high glucose. These effects were not associated with an increased cellular level of unesterified fatty acids but rather by increased intracellular glucose. These findings suggested that L-FABP may function as an intracellular fatty acid synthesis inhibitor binding protein facilitating TOFA and C75-mediated induction of PPAR α in the context of high glucose at levels similar to those in uncontrolled diabetes.

  9. Resolution of component proteins in an enzyme complex from Methanosarcina thermophila catalyzing the synthesis or cleavage of acetyl-CoA.

    PubMed Central

    Abbanat, D R; Ferry, J G

    1991-01-01

    An enzyme complex was isolated from acetate-grown Methanosarcina thermophila that oxidized CO and catalyzed the synthesis or cleavage of acetyl-CoA. The complex consisted of five subunits (alpha1beta1gamma1delta1epsilon1) of 89, 71, 60, 58, and 19 kDa. The complex contained nickel, iron, acid-labile sulfide, and cobalt in a corrinoid cofactor. Two components were resolved by anion-exchange chromatography of the complex in the presence of dodecyltrimethylammonium bromide and Triton X-100: a 200-kDa nickel/iron-sulfur protein with the 89- and 19-kDa (alpha2epsilonx) subunits and a 100-kDa corrinoid/iron-sulfur protein with the 60- and 58-kDa subunits (gamma1delta1). The nickel/iron-sulfur component contained 0.21 Ni, 2.7 Zn, 7.7 Fe, and 13.2 acid-labile sulfide (per alpha1epsilon1). The corrinoid/iron-sulfur component contained 0.7 Co, 0.7 factor III [Coalpha-[alpha-(5-hydroxybenzimidazolyl)]-Cobeta-cyanocobamide], 3.0 Fe, and 2.9 acid-labile sulfide (gamma1delta1). Both components contained iron-sulfur centers. The nickel/iron-sulfur component oxidized CO and reduced methyl viologen or a ferredoxin isolated from M. thermophila. The nickel/iron-sulfur component also oxidized CO and transferred electrons to the corrinoid/iron-sulfur component, reducing the iron-sulfur and Co centers. UV-visible spectroscopy indicated that the reduced corrinoid/iron-sulfur component could be methylated with CH3I. The results suggest that the enzyme complex from M. thermophila contained at least two enzyme components, each with a specific function. The properties of the component enzymes support a mechanism proposed for acetyl-CoA synthesis (or cleavage) by the enzyme complex. Images PMID:11607176

  10. High-yield synthesis of bioactive ethyl cinnamate by enzymatic esterification of cinnamic acid.

    PubMed

    Wang, Yun; Zhang, Dong-Hao; Zhang, Jiang-Yan; Chen, Na; Zhi, Gao-Ying

    2016-01-01

    In this paper, Lipozyme TLIM-catalyzed synthesis of ethyl cinnamate through esterification of cinnamic acid with ethanol was studied. In order to increase the yield of ethyl cinnamate, several media, including acetone, isooctane, DMSO and solvent-free medium, were investigated in this reaction. The reaction showed a high yield by using isooctane as reaction medium, which was found to be much higher than the yields reported previously. Furthermore, several parameters such as shaking rate, water activity, reaction temperature, substrate molar ratio and enzyme loading had important influences on this reaction. For instance, when temperature increased from 10 to 50 °C, the initial reaction rate increased by 18 times and the yield of ethyl cinnamate increased by 6.2 times. Under the optimum conditions, lipase-catalyzed synthesis of ethyl cinnamate gave a maximum yield of 99%, which was of general interest for developing industrial processes for the preparation of ethyl cinnamate.

  11. Crystal Structure of TDP-Fucosamine Acetyl Transferase (WECD) from Escherichia Coli, an Enzyme Required for Enterobacterial Common Antigen Synthesis

    SciTech Connect

    Hung,M.; Rangarajan, E.; Munger, C.; Nadeau, G.; Sulea, T.; Matte, A.

    2006-01-01

    Enterobacterial common antigen (ECA) is a polysaccharide found on the outer membrane of virtually all gram-negative enteric bacteria and consists of three sugars, N-acetyl-D-glucosamine, N-acetyl-D-mannosaminuronic acid, and 4-acetamido-4,6-dideoxy-D-galactose, organized into trisaccharide repeating units having the sequence {yields}(3)-{alpha}-D-Fuc4NAc-(1{yields}4)-{beta}-D-ManNAcA-(1{yields}4)-{alpha}-D-GlcNAc-(1{yields}). While the precise function of ECA is unknown, it has been linked to the resistance of Shiga-toxin-producing Escherichia coli (STEC) O157:H7 to organic acids and the resistance of Salmonella enterica to bile salts. The final step in the synthesis of 4-acetamido-4,6-dideoxy-D-galactose, the acetyl-coenzyme A (CoA)-dependent acetylation of the 4-amino group, is carried out by TDP-fucosamine acetyltransferase (WecD). We have determined the crystal structure of WecD in apo form at a 1.95-Angstroms resolution and bound to acetyl-CoA at a 1.66-Angstroms resolution. WecD is a dimeric enzyme, with each monomer adopting the GNAT N-acetyltransferase fold, common to a number of enzymes involved in acetylation of histones, aminoglycoside antibiotics, serotonin, and sugars. The crystal structure of WecD, however, represents the first structure of a GNAT family member that acts on nucleotide sugars. Based on this cocrystal structure, we have used flexible docking to generate a WecD-bound model of the acetyl-CoA-TDP-fucosamine tetrahedral intermediate, representing the structure during acetyl transfer. Our structural data show that WecD does not possess a residue that directly functions as a catalytic base, although Tyr208 is well positioned to function as a general acid by protonating the thiolate anion of coenzyme A.

  12. Amino Acid Synthesis in a Supercritical Carbon Dioxide - Water System

    PubMed Central

    Fujioka, Kouki; Futamura, Yasuhiro; Shiohara, Tomoo; Hoshino, Akiyoshi; Kanaya, Fumihide; Manome, Yoshinobu; Yamamoto, Kenji

    2009-01-01

    Mars is a CO2-abundant planet, whereas early Earth is thought to be also CO2-abundant. In addition, water was also discovered on Mars in 2008. From the facts and theory, we assumed that soda fountains were present on both planets, and this affected amino acid synthesis. Here, using a supercritical CO2/liquid H2O (10:1) system which mimicked crust soda fountains, we demonstrate production of amino acids from hydroxylamine (nitrogen source) and keto acids (oxylic acid sources). In this research, several amino acids were detected with an amino acid analyzer. Moreover, alanine polymers were detected with LC-MS. Our research lights up a new pathway in the study of life’s origin. PMID:19582225

  13. Synthesis of gold nanoparticles using various amino acids.

    PubMed

    Maruyama, Tatsuo; Fujimoto, Yuhei; Maekawa, Tetsuya

    2015-06-01

    Gold nanoparticles (4-7nm) were synthesized from tetraauric acid using various amino acids as reducing and capping agents. The gold nanoparticles were produced from the incubation of a AuCl4(-) solution with an amino acid at 80°C for 20min. Among the twenty amino acids tested, several amino acids produced gold nanoparticles. The color of the nanoparticle solutions varied with the amino acids used for the reduction. We adopted l-histidine as a reducing agent and investigated the effects of the synthesis conditions on the gold nanoparticles. The His and AuCl4(-) concentrations affected the size of the gold nanoparticles and their aggregates. The pH of the reaction solution also affected the reaction yields and the shape of the gold nanoparticles.

  14. Synthesis and chirality of amino acids under interstellar conditions.

    PubMed

    Giri, Chaitanya; Goesmann, Fred; Meinert, Cornelia; Evans, Amanda C; Meierhenrich, Uwe J

    2013-01-01

    Amino acids are the fundamental building blocks of proteins, the biomolecules that provide cellular structure and function in all living organisms. A majority of amino acids utilized within living systems possess pre-specified orientation geometry (chirality); however the original source for this specific orientation remains uncertain. In order to trace the chemical evolution of life, an appreciation of the synthetic and evolutional origins of the first chiral amino acids must first be gained. Given that the amino acids in our universe are likely to have been synthesized in molecular clouds in interstellar space, it is necessary to understand where and how the first synthesis might have occurred. The asymmetry of the original amino acid synthesis was probably the result of exposure to chiral photons in the form of circularly polarized light (CPL), which has been detected in interstellar molecular clouds. This chirality transfer event, from photons to amino acids, has been successfully recreated experimentally and is likely a combination of both asymmetric synthesis and enantioselective photolysis. A series of innovative studies have reported successful simulation of these environments and afforded production of chiral amino acids under realistic circumstellar and interstellar conditions: irradiation of interstellar ice analogues (CO, CO2, NH3, CH3OH, and H2O) with circularly polarized ultraviolet photons at low temperatures does result in enantiomer enriched amino acid structures (up to 1.3% ee). This topical review summarizes current knowledge and recent discoveries about the simulated interstellar environments within which amino acids were probably formed. A synopsis of the COSAC experiment onboard the ESA cometary mission ROSETTA concludes this review: the ROSETTA mission will soft-land on the nucleus of the comet 67P/Churyumov-Gerasimenko in November 2014, anticipating the first in situ detection of asymmetric organic molecules in cometary ices.

  15. Synthesis and chirality of amino acids under interstellar conditions.

    PubMed

    Giri, Chaitanya; Goesmann, Fred; Meinert, Cornelia; Evans, Amanda C; Meierhenrich, Uwe J

    2013-01-01

    Amino acids are the fundamental building blocks of proteins, the biomolecules that provide cellular structure and function in all living organisms. A majority of amino acids utilized within living systems possess pre-specified orientation geometry (chirality); however the original source for this specific orientation remains uncertain. In order to trace the chemical evolution of life, an appreciation of the synthetic and evolutional origins of the first chiral amino acids must first be gained. Given that the amino acids in our universe are likely to have been synthesized in molecular clouds in interstellar space, it is necessary to understand where and how the first synthesis might have occurred. The asymmetry of the original amino acid synthesis was probably the result of exposure to chiral photons in the form of circularly polarized light (CPL), which has been detected in interstellar molecular clouds. This chirality transfer event, from photons to amino acids, has been successfully recreated experimentally and is likely a combination of both asymmetric synthesis and enantioselective photolysis. A series of innovative studies have reported successful simulation of these environments and afforded production of chiral amino acids under realistic circumstellar and interstellar conditions: irradiation of interstellar ice analogues (CO, CO2, NH3, CH3OH, and H2O) with circularly polarized ultraviolet photons at low temperatures does result in enantiomer enriched amino acid structures (up to 1.3% ee). This topical review summarizes current knowledge and recent discoveries about the simulated interstellar environments within which amino acids were probably formed. A synopsis of the COSAC experiment onboard the ESA cometary mission ROSETTA concludes this review: the ROSETTA mission will soft-land on the nucleus of the comet 67P/Churyumov-Gerasimenko in November 2014, anticipating the first in situ detection of asymmetric organic molecules in cometary ices. PMID:22976459

  16. The effect of Centella asiatica, vitamins, glycolic acid and their mixtures preparations in stimulating collagen and fibronectin synthesis in cultured human skin fibroblast.

    PubMed

    Hashim, Puziah

    2014-03-01

    Centella asiatica (Linn.) Urban is well known in promoting wound healing and provides significant benefits in skin care and therapeutic products formulation. Glycolic acid and vitamins also play a role in the enhancement of collagen and fibronectin synthesis. Here, we evaluate the specific effect of Centella asiatica (CA), vitamins, glycolic acid and their mixture preparations to stimulate collagen and fibronectin synthesis in cultured human fibroblast cells. The fibroblast cells are incubated with CA, glycolic acid, vitamins and their mixture preparations for 48 h. The cell lysates were analyzed for protein content and collagen synthesis by direct binding enzyme immunoassay. The fibronectin of the cultured supernatant was measured by sandwich enzyme immunoassay. The results showed that CA, glycolic acid, vitamins A, E and C significantly stimulate collagen and fibronectin synthesis in the fibroblast. Addition of glycolic acid and vitamins to CA further increased the levels of collagen and fibronectin synthesis to 8.55 and 23.75 μg/100 μg, respectively. CA, glycolic acid, vitamins A, E, and C, and their mixtures demonstrated stimulatory effect on both extra-cellular matrix synthesis of collagen and fibronectin in in vitro studies on human foreskin fibroblasts, which is beneficial to skin care and therapeutic products formulation.

  17. Characterisation and expression of fatty acid modifying enzyme produced by Staphylococcus epidermidis.

    PubMed

    Chamberlain, N R; Brueggemann, S A

    1997-08-01

    The production of fatty-acid modifying enzyme (FAME) - first identified as a possible virulence factor in Staphylococcus aureus - has also been identified in S. epidermidis. This extracellular enzyme inactivates bactericidal fatty acids by esterifying them to cholesterol. FAME may provide protection for S. epidermidis by inactivating these lipids present on the skin. Over 88% of 51 randomly collected S. epidermidis isolates produced FAME; 92.2% and 13.7% of the same strains produced lipase and slime, respectively. There appeared to be no correlation of lipase activity or slime production with FAME production. The temperature optimum for FAME was between 20 degrees C and 35 degrees C, and the pH optimum was 6.0. Optimal enzyme activity was present at NaCl concentrations of between 250 and 500 mM. FAME was not detected in culture filtrates until early stationary phase, indicating some regulatory control over enzyme production.

  18. Characterisation and expression of fatty acid modifying enzyme produced by Staphylococcus epidermidis.

    PubMed

    Chamberlain, N R; Brueggemann, S A

    1997-08-01

    The production of fatty-acid modifying enzyme (FAME) - first identified as a possible virulence factor in Staphylococcus aureus - has also been identified in S. epidermidis. This extracellular enzyme inactivates bactericidal fatty acids by esterifying them to cholesterol. FAME may provide protection for S. epidermidis by inactivating these lipids present on the skin. Over 88% of 51 randomly collected S. epidermidis isolates produced FAME; 92.2% and 13.7% of the same strains produced lipase and slime, respectively. There appeared to be no correlation of lipase activity or slime production with FAME production. The temperature optimum for FAME was between 20 degrees C and 35 degrees C, and the pH optimum was 6.0. Optimal enzyme activity was present at NaCl concentrations of between 250 and 500 mM. FAME was not detected in culture filtrates until early stationary phase, indicating some regulatory control over enzyme production. PMID:9511818

  19. The Catalytic Machinery of a Key Enzyme in Amino Acid Biosynthesis

    SciTech Connect

    Viola, Ronald E.; Faehnle, Christopher R.; Blanco, Julio; Moore, Roger A.; Liu, Xuying; Arachea, Buenafe T.; Pavlovsky, Alexander G.

    2013-02-28

    The aspartate pathway of amino acid biosynthesis is essential for all microbial life but is absent in mammals. Characterizing the enzyme-catalyzed reactions in this pathway can identify new protein targets for the development of antibiotics with unique modes of action. The enzyme aspartate {beta}-semialdehyde dehydrogenase (ASADH) catalyzes an early branch point reaction in the aspartate pathway. Kinetic, mutagenic, and structural studies of ASADH from various microbial species have been used to elucidate mechanistic details and to identify essential amino acids involved in substrate binding, catalysis, and enzyme regulation. Important structural and functional differences have been found between ASADHs isolated from these bacterial and fungal organisms, opening the possibility for developing species-specific antimicrobial agents that target this family of enzymes.

  20. Characterization of the enzyme responsible for nopaline and ornaline synthesis in sunflower crown gall tissues.

    PubMed

    Sutton, D W; Kemp, J D; Hack, E

    1978-09-01

    Extracts prepared from sunflower (Helianthus annuus L.) crown gall tissues induced by Agrobacterium tumefaciens strains C58 and T37 (nopaline utilizers) catalyze the synthesis of nopaline and ornaline. These compounds are not synthesized in extracts of crown gall tissues induced by strains B6, 15955 (octopine utilizers), and AT1 (utilizes neither octopine nor nopaline) or in extracts of habituated sunflower callus. Both synthetic activities require NADPH, alpha-ketoglutarate, and either arginine or ornithine; histidine and lysine will not substitute. Incorporation of arginine or ornithine into product is inhibited by the other substrate but not by histidine or lysine. On the basis of inhibition and K(m) data, both activities appear to be catalyzed by one enzyme and the same enzyme is apparently present in crown gall tissues induced by strains C58 and T37.

  1. [Enzyme-catalyzed synthesis of ASGPR ligand-targeted modifier in non-aqueous medium].

    PubMed

    Cheng, Yi; Wu, Wei; Zhang, Dong-qing; Mai, Yan-zhen

    2010-09-01

    The asialoglycoprotein receptor (ASGPR) was used to mediate drug carrier for hepatic targeted drug delivery, this article showed the enzyme-catalyzed esterification of galactose and vinyl stearate and a kind of ASGPR ligand-targeted which was used to insert the surface of liposome has been synthesized. The structure of product has been confirmed by TLC, ESI-MS and 1H NMR. The factors of types and quantity of enzyme, organic solvents, molar ratio of substrate, temperature and time of reaction have been studied. Results showed when using acetone as reaction medium, the quantity of Novozym 435 immobilized lipase was 30 mg mL(-1), molar ratio of galactose to vinyl stearate was 1:5, and reacted at 60 degrees C for 12 h, the transformation of vinyl stearate reached more than 70%. This study provides a novel and efficient route to the synthesis of ligand-targeted modifier.

  2. Salicylic Acid Inhibits Synthesis of Proteinase Inhibitors in Tomato Leaves Induced by Systemin and Jasmonic Acid.

    PubMed Central

    Doares, S. H.; Narvaez-Vasquez, J.; Conconi, A.; Ryan, C. A.

    1995-01-01

    Salicylic acid (SA) and acetylsalicylic acid (ASA), previously shown to inhibit proteinase inhibitor synthesis induced by wounding, oligouronides (H.M. Doherty, R.R. Selvendran, D.J. Bowles [1988] Physiol Mol Plant Pathol 33: 377-384), and linolenic acid (H. Pena-Cortes, T. Albrecht, S. Prat, E.W. Weiler, L. Willmitzer [1993] Planta 191: 123-128), are shown here to be potent inhibitors of systemin-induced and jasmonic acid (JA)-induced synthesis of proteinase inhibitor mRNAs and proteins. The inhibition by SA and ASA of proteinase inhibitor synthesis induced by systemin and JA, as well as by wounding and oligosaccharide elicitors, provides further evidence that both oligosaccharide and polypeptide inducer molecules utilize the octadecanoid pathway to signal the activation of proteinase inhibitor genes. Tomato (Lycopersicon esculentum) leaves were pulse labeled with [35S]methionine, followed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and the inhibitory effects of SA are shown to be specific for the synthesis of a small number of JA-inducible proteins that includes the proteinase inhibitors. Previous results have shown that SA inhibits the conversion of 13S-hydroperoxy linolenic acid to 12-oxo-phytodienoic acid, thereby inhibiting the signaling pathway by blocking synthesis of JA. Here we report that the inhibition of synthesis of proteinase inhibitor proteins and mRNAs by SA in both light and darkness also occurs at a step in the signal transduction pathway, after JA synthesis but preceding transcription of the inhibitor genes. PMID:12228577

  3. Impact of L-FABP and glucose on polyunsaturated fatty acid induction of PPARα-regulated β-oxidative enzymes.

    PubMed

    Petrescu, Anca D; Huang, Huan; Martin, Gregory G; McIntosh, Avery L; Storey, Stephen M; Landrock, Danilo; Kier, Ann B; Schroeder, Friedhelm

    2013-02-01

    Liver fatty acid binding protein (L-FABP) is the major soluble protein that binds very-long-chain n-3 polyunsaturated fatty acids (n-3 PUFAs) in hepatocytes. However, nothing is known about L-FABP's role in n-3 PUFA-mediated peroxisome proliferator activated receptor-α (PPARα) transcription of proteins involved in long-chain fatty acid (LCFA) β-oxidation. This issue was addressed in cultured primary hepatocytes from wild-type, L-FABP-null, and PPARα-null mice with these major findings: 1) PUFA-mediated increase in the expression of PPARα-regulated LCFA β-oxidative enzymes, LCFA/LCFA-CoA binding proteins (L-FABP, ACBP), and PPARα itself was L-FABP dependent; 2) PPARα transcription, robustly potentiated by high glucose but not maltose, a sugar not taken up, correlated with higher protein levels of these LCFA β-oxidative enzymes and with increased LCFA β-oxidation; and 3) high glucose altered the potency of n-3 relative to n-6 PUFA. This was not due to a direct effect of glucose on PPARα transcriptional activity nor indirectly through de novo fatty acid synthesis from glucose. Synergism was also not due to glucose impacting other signaling pathways, since it was observed only in hepatocytes expressing both L-FABP and PPARα. Ablation of L-FABP or PPARα as well as treatment with MK886 (PPARα inhibitor) abolished/reduced PUFA-mediated PPARα transcription of these genes, especially at high glucose. Finally, the PUFA-enhanced L-FABP distribution into nuclei with high glucose augmentation of the L-FABP/PPARα interaction reveals not only the importance of L-FABP for PUFA induction of PPARα target genes in fatty acid β-oxidation but also the significance of a high glucose enhancement effect in diabetes.

  4. Heat shock inhibits. alpha. -amylase synthesis in barley aleurone without inhibiting the activity of endoplasmic reticulum marker enzymes

    SciTech Connect

    Sticher, L.; Biswas, A.K.; Bush, D.S.; Jones, R.L. )

    1990-02-01

    The effects of heat shock on the synthesis of {alpha}-amylase and on the membranes of the endoplasmic reticulum (ER) of barley (Hordeum vulgare) aleurone were studied. Heat shock, imposed by raising the temperature of incubation from 25{degree}C to 40{degree}C for 3 hours, inhibits the accumulation of {alpha}-amylase and other proteins in the incubation medium of barley aleurone layers treated with gibberellic acid and Ca{sup 2+}. When ER is isolated from heat-shocked aleurone layers, less newly synthesized {alpha}-amylase is found associated with this membrane system. ER membranes, as indicated by the activities of NADH cytochrome c reductase and ATP-dependent Ca{sup 2+} transport, are not destroyed by heat stress, however. Although heat shock did not reduce the activity of ER membrane marker enzymes, it altered the buoyant density of these membranes. Whereas ER from control tissue showed a peak of marker enzyme activity at 27% to 28% sucrose (1.113-1.120 grams per cubic centimeter), ER from heat-shocked tissue peaked at 30% to 32% sucrose (1.127-1.137 grams per cubic centimeter). The synthesis of a group of proteins designated as heat-shock proteins (HSPs) was stimulated by heat shock. These HSPs were localized to different compartments of the aleurone cell. Several proteins ranging from 15 to 30 kilodaltons were found in the ER and the mitochondrial/plasma membrane fractions of heat-shocked cells, but none of the HSPs accumulated in the incubation medium of heat-shocked aleurone layers.

  5. Benzylidene Acetal Protecting Group as Carboxylic Acid Surrogate: Synthesis of Functionalized Uronic Acids and Sugar Amino Acids.

    PubMed

    Banerjee, Amit; Senthilkumar, Soundararasu; Baskaran, Sundarababu

    2016-01-18

    Direct oxidation of the 4,6-O-benzylidene acetal protecting group to C-6 carboxylic acid has been developed that provides an easy access to a wide range of biologically important and synthetically challenging uronic acid and sugar amino acid derivatives in good yields. The RuCl3 -NaIO4 -mediated oxidative cleavage method eliminates protection and deprotection steps and the reaction takes place under mild conditions. The dual role of the benzylidene acetal, as a protecting group and source of carboxylic acid, was exploited in the efficient synthesis of six-carbon sialic acid analogues and disaccharides bearing uronic acids, including glycosaminoglycan analogues.

  6. Effect of organic/inorganic compounds on the enzymes in soil under acid rain stress.

    PubMed

    Liu, Guang-shen; Xu, Dong-mei; Wang, Li-ming; Li, Ke-bin; Liu, Wei-ping

    2004-01-01

    The main effects of pollutions including acid rain, Cu2+, atrazine and their combined products on the activities of urease, invertin, acid phosphatase and catalase were studied by means of orthogonal test. The results showed that H+ and Cu2+ had significant influence on the activities of four enzymes and the ability of their inhibiting followed the order: H+ > Cu2+. Al3+ and atrazine only had litter effects on the activity of urease and phosphatase, respectively. Furthermore, interaction analysis revealed that Cu2+ -H+ affected on the activity of acid phosphatase significantly and antagonism on invertin and urease, Cu2+ -atrazine only exhibited the synergism on the activity of acid phosphatase. But atrazine-H+ had non-interaction within the investigated concentration range. Among four enzymes, acid phosphatase was the most sensitive one to the contaminations.

  7. Oxidase-peroxidase enzymes of Datura innoxia. Oxidation of formylphenylacetic acid ethyl ester.

    PubMed Central

    Kalyanaraman, V S; Mahadevan, S; Kumar, S A

    1975-01-01

    An enzyme system from Datura innoxia roots oxidizing formylphenylacetic acid ethyl ester was purified 38-fold by conventional methods such as (NH4)2SO4 fractionation, negative adsorption on alumina Cy gel and chromatography on DEAE-cellulose. The purified enzyme was shown to catalyse the stoicheiometric oxidation of formylphenylacetic acid ethyl ester to benzoylformic acid ethyl ester and formic acid, utilizing molecular O2. Substrate analogues such as phenylacetaldehyde and phenylpyruvate were oxidized at a very low rate, and formylphenylacetonitrile was an inhilating agents, cyanide, thiol compounds and ascorbic acid. This enzyme was identical with an oxidase-peroxidase isoenzyme. Another oxidase-peroxidase isoenzyme which separated on DEAE-chromatography also showed formylphenylacetic acid ethyl ester oxidase activity, albeit to a lesser extent. The properties of the two isoenzymes of the oxidase were compared and shown to differ in their oxidation and peroxidation properties. The oxidation of formylphenylacetic acid ethyl ester was also catalysed by horseradish peroxidase. The Datura isoenzymes exhibited typical haemoprotein spectra. The oxidation of formylphenylacetic acid ethyl ester was different from other peroxidase-catalysed reactions in not being activated by either Mn2+ or monophenols. The oxidation was inhibited by several mono- and poly-phenols and by catalase. A reaction mechanism for the oxidation is proposed. PMID:997

  8. SOLUBLE HEPATIC δ-AMINOLEVULINIC ACID SYNTHETASE: END-PRODUCT INHIBITION OF THE PARTIALLY PURIFIED ENZYME*

    PubMed Central

    Scholnick, Perry L.; Hammaker, Lydia E.; Marver, Harvey S.

    1969-01-01

    The present study confirms the existence of hepatic δ-aminolevulinic acid synthetase in the cytosol of the liver, suggests that this enzyme may be in transit to the mitochondria, and defines some of the characteristics of the partially purified enzyme. The substrate and cofactor requirements are similar to those of mitochondrial δ-aminolevulinic acid synthetase. Heme strongly inhibits the partially purified enzyme. A number of proteins that bind heme block this inhibition, which explains previous failures to demonstrate heme inhibition in crude systems. End-product inhibition of δ-aminolevulinic acid synthetase in the mitochondria may play an important role in the regulation of heme biosynthesis in eukaryotic cells. PMID:5257968

  9. Lactide Synthesis and Chirality Control for Polylactic acid Production.

    PubMed

    Van Wouwe, Pieter; Dusselier, Michiel; Vanleeuw, Evelien; Sels, Bert

    2016-05-10

    Polylactic acid (PLA) is a very promising biodegradable, renewable, and biocompatible polymer. Aside from its production, its application field is also increasing, with use not only in commodity applications but also as durables and in biomedicine. In the current PLA production scheme, the most expensive part is not the polymerization itself but obtaining the building blocks lactic acid (LA) and lactide, the actual cyclic monomer for polymerization. Although the synthesis of LA and the polymerization have been studied systematically, reports of lactide synthesis are scarce. Most lactide synthesis methods are described in patent literature, and current energy-intensive, aselective industrial processes are based on archaic scientific literature. This Review, therefore, highlights new methods with a technical comparison and description of the different approaches. Water-removal methodologies are compared, as this is a crucial factor in PLA production. Apart from the synthesis of lactide, this Review also emphasizes the use of chemically produced racemic lactic acid (esters) as a starting point in the PLA production scheme. Stereochemically tailored PLA can be produced according to such a strategy, giving access to various polymer properties.

  10. Benzoic acid derivatives with improved antifungal activity: Design, synthesis, structure-activity relationship (SAR) and CYP53 docking studies.

    PubMed

    Berne, Sabina; Kovačič, Lidija; Sova, Matej; Kraševec, Nada; Gobec, Stanislav; Križaj, Igor; Komel, Radovan

    2015-08-01

    Previously, we identified CYP53 as a fungal-specific target of natural phenolic antifungal compounds and discovered several inhibitors with antifungal properties. In this study, we performed similarity-based virtual screening and synthesis to obtain benzoic acid-derived compounds and assessed their antifungal activity against Cochliobolus lunatus, Aspergillus niger and Pleurotus ostreatus. In addition, we generated structural models of CYP53 enzyme and used them in docking trials with 40 selected compounds. Finally, we explored CYP53-ligand interactions and identified structural elements conferring increased antifungal activity to facilitate the development of potential new antifungal agents that specifically target CYP53 enzymes of animal and plant pathogenic fungi. PMID:26154240

  11. Regulation of glycolysis and fatty acid synthesis from glucose in sheep adipose tissue

    PubMed Central

    Robertson, James P.; Faulkner, Anne; Vernon, Richard G.

    1982-01-01

    1. The following were measured in adipose-tissue pieces, obtained from 7–9 month-old sheep, before or after the tissue pieces had been maintained in tissue culture for 24 h: the rates of synthesis from glucose of fatty acids, acylglycerol glycerol, pyruvate and lactate; the rate of glucose oxidation to CO2; the rate of glucose oxidation via the pentose phosphate pathway; the activities of hexokinase, glucose 6-phosphate dehydrogenase, phosphofructokinase, pyruvate kinase, pyruvate dehydrogenase and ATP citrate lyase; the intra- and extra-cellular water content; the concentration of various metabolites and ATP, ADP and AMP. 2. The proportion of glucose carbon converted into the various products in sheep adipose tissue differs markedly from that observed in rat adipose tissue. 3. There was a general increase in the rate of glucose utilization by the adipose-tissue pieces after maintenance in tissue culture; largest changes were seen in the rates of glycolysis and fatty acid synthesis from glucose. These increases are paralleled by an increase in pyruvate kinase activity. There was no change in the activities of the other enzymes as measured, although the net flux through all the enzymes increased. 4. Incubation of fresh adipose-tissue pieces for 2–6h led to an increase in the affinity of pyruvate kinase for phosphoenolpyruvate. 5. The rate of pyruvate production by glycolysis was greater than the activity of pyruvate dehydrogenase of the tissue. 6. The results suggest that both pyruvate kinase and pyruvate dehydrogenase have important roles in restricting the utilization of glucose carbon for fatty acid synthesis in sheep adipose tissue. PMID:7150263

  12. A novel approach in cinnamic acid synthesis: direct synthesis of cinnamic acids from aromatic aldehydes and aliphatic carboxylic acids in the presence of boron tribromide.

    PubMed

    Chiriac, Constantin I; Tanasa, Fulga; Onciu, Marioara

    2005-02-28

    Cinnamic acids have been prepared in moderate to high yields by a new direct synthesis using aromatic aldehydes and aliphatic carboxylic acids, in the presence of boron tribromide as reagent, 4-dimethylaminopyridine (4-DMAP) and pyridine (Py) as bases and N-methyl-2-pyrolidinone (NMP) as solvent, at reflux (180-190 degrees C) for 8-12 hours.

  13. Expression of Escherichia coli glycogen branching enzyme in an Arabidopsis mutant devoid of endogenous starch branching enzymes induces the synthesis of starch-like polyglucans.

    PubMed

    Boyer, Laura; Roussel, Xavier; Courseaux, Adeline; Ndjindji, Ofilia M; Lancelon-Pin, Christine; Putaux, Jean-Luc; Tetlow, Ian J; Emes, Michael J; Pontoire, Bruno; D' Hulst, Christophe; Wattebled, Fabrice

    2016-07-01

    Starch synthesis requires several enzymatic activities including branching enzymes (BEs) responsible for the formation of α(1 → 6) linkages. Distribution and number of these linkages are further controlled by debranching enzymes that cleave some of them, rendering the polyglucan water-insoluble and semi-crystalline. Although the activity of BEs and debranching enzymes is mandatory to sustain normal starch synthesis, the relative importance of each in the establishment of the plant storage polyglucan (i.e. water insolubility, crystallinity and presence of amylose) is still debated. Here, we have substituted the activity of BEs in Arabidopsis with that of the Escherichia coli glycogen BE (GlgB). The latter is the BE counterpart in the metabolism of glycogen, a highly branched water-soluble and amorphous storage polyglucan. GlgB was expressed in the be2 be3 double mutant of Arabidopsis, which is devoid of BE activity and consequently free of starch. The synthesis of a water-insoluble, partly crystalline, amylose-containing starch-like polyglucan was restored in GlgB-expressing plants, suggesting that BEs' origin only has a limited impact on establishing essential characteristics of starch. Moreover, the balance between branching and debranching is crucial for the synthesis of starch, as an excess of branching activity results in the formation of highly branched, water-soluble, poorly crystalline polyglucan.

  14. Steroselective synthesis and application of L-( sup 15 N) amino acids

    SciTech Connect

    Unkefer, C.J. ); Lodwig, S.N. . Div. of Science)

    1991-01-01

    We have developed two general approaches to the stereoselective synthesis of {sup 15}N- and {sup 13}C-labeled amino acids. First, labeled serine, biosynthesized using the methylotrophic bacterium M. extorquens AM1, serves as a chiral precursor for the synthesis of other amino acids. For example, pyridoxal phosphate enzymes can be used for the conversion of L-({alpha}-{sup 15}N)serine to L-({alpha}-{sup 15}N)tyrosine, L-({alpha}-{sup 15}N)tryptophan, and L-({alpha}-{sup 15}N)cysteine. In the second approach, developed by Oppolzer and Tamura, an electrophilic amination'' reagent, 1-chloro-1-nitrosocyclohexane, was used to convert chiral enolates into L-{alpha}-amino acids. We prepared 1-chloro-1-({sup 15}N) nitrosocyclohexane and used it to aminate chiral enolates to produce L-({alpha}-{sup 15}N)amino acids. The stereoselectivity of this scheme using the Oppolzer sultam chiral auxiliary is remarkable, producing enantiomer ratios of 200 to 1. 22 refs., 4 figs.

  15. Is docosahexaenoic acid synthesis from α-linolenic acid sufficient to supply the adult brain?

    PubMed

    Domenichiello, Anthony F; Kitson, Alex P; Bazinet, Richard P

    2015-07-01

    Docosahexaenoic acid (DHA) is important for brain function, and can be obtained directly from the diet or synthesized in the body from α-linolenic acid (ALA). Debate exists as to whether DHA synthesized from ALA can provide sufficient DHA for the adult brain, as measures of DHA synthesis from ingested ALA are typically <1% of the oral ALA dose. However, the primary fate of orally administered ALA is β-oxidation and long-term storage in adipose tissue, suggesting that DHA synthesis measures involving oral ALA tracer ingestion may underestimate total DHA synthesis. There is also evidence that DHA synthesized from ALA can meet brain DHA requirements, as animals fed ALA-only diets have brain DHA concentrations similar to DHA-fed animals, and the brain DHA requirement is estimated to be only 2.4-3.8 mg/day in humans. This review summarizes evidence that DHA synthesis from ALA can provide sufficient DHA for the adult brain by examining work in humans and animals involving estimates of DHA synthesis and brain DHA requirements. Also, an update on methods to measure DHA synthesis in humans is presented highlighting a novel approach involving steady-state infusion of stable isotope-labeled ALA that bypasses several limitations of oral tracer ingestion. It is shown that this method produces estimates of DHA synthesis that are at least 3-fold higher than brain uptake rates in rats.

  16. Inhibition of Vibrio harveyi bioluminescence by cerulenin: In vivo evidence for covalent modification of the reductase enzyme involved in aldehyde synthesis

    SciTech Connect

    Byers, D.M. ); Meighen, E.A. )

    1989-07-01

    Bacterial bioluminescence is very sensitive to cerulenin, a fungal antibiotic which is known to inhibit fatty acid synthesis. When Vibrio harveyi cells pretreated with cerulenin were incubated with ({sup 3}H)myristic acid in vivo, acylation of the 57-kilodalton reductase subunit of the luminescence-specific fatty acid reductase complex was specifically inhibited. Light emission of wild-type V. harveyi was 20-fold less sensitive to cerulenin at low concentrations (10{mu}g/ml) than that of the dark mutant strain M17, which requires exogenous myristic acid for luminescence because of a defective transferase subunit. The sensitivity of myristic acid-stimulated luminescence in the mutant strain M17 exceeded that of phospholipid synthesis from ({sup 14}C)acetate, whereas uptake and incorporation of exogenous ({sup 14}C)myristic acid into phospholipids was increased by cerulenin. The reductase subunit could be labeled by incubating M17 cells with ({sup 3}H)tetrahydrocerulenin; this labeling was prevented by preincubation with either unlabeled cerulenin or myristic acid. Labeling of the reductase subunit with ({sup 3}H)tetrahydrocerulenin was also noted in an aldehyde-stimulated mutant (A16) but not in wild-type cells or in another aldehyde-stimulated mutant (M42) in which ({sup 3}H)myristoyl turnover at the reductase subunit was found to be defective. These results indicate that (i) cerulenin specifically and covalently inhibits the reductase component of aldehyde synthesis, (ii) this enzyme is partially protected from cerulenin inhibition in the wild-type strain in vivo, and (iii) two dark mutants which exhibit similar luminescence phenotypes (mutants A16 and M42) are blocked at different stages of fatty acid reduction.

  17. Identification of genes and pathways involved in the synthesis of Mead acid (20:3n-9), an indicator of essential fatty acid deficiency.

    PubMed

    Ichi, Ikuyo; Kono, Nozomu; Arita, Yuka; Haga, Shizuka; Arisawa, Kotoko; Yamano, Misato; Nagase, Mana; Fujiwara, Yoko; Arai, Hiroyuki

    2014-01-01

    In mammals, 5,8,11-eicosatrienoic acid (Mead acid, 20:3n-9) is synthesized from oleic acid during a state of essential fatty acid deficiency (EFAD). Mead acid is thought to be produced by the same enzymes that synthesize arachidonic acid and eicosapentaenoic acid, but the genes and the pathways involved in the conversion of oleic acid to Mead acid have not been fully elucidated. The levels of polyunsaturated fatty acids in cultured cells are generally very low compared to those in mammalian tissues. In this study, we found that cultured cells, such as NIH3T3 and Hepa1-6 cells, have significant levels of Mead acid, indicating that cells in culture are in an EFAD state under normal culture conditions. We then examined the effect of siRNA-mediated knockdown of fatty acid desaturases and elongases on the level of Mead acid, and found that knockdown of Elovl5, Fads1, or Fads2 decreased the level of Mead acid. This and the measured levels of possible intermediate products for the synthesis of Mead acid such as 18:2n-9, 20:1n-9 and 20:2n-9 in the knocked down cells indicate two pathways for the synthesis of Mead acid: pathway 1) 18:1n-9→(Fads2)→18:2n-9→(Elovl5)→20:2n-9→(Fads1)→20:3n-9 and pathway 2) 18:1n-9→(Elovl5)→20:1n-9→(Fads2)→20:2n-9→(Fads1)→20:3n-9.

  18. Production of Cell Wall Hydrolyzing Enzymes by Barley Aleurone Layers in Response to Gibberellic Acid 1

    PubMed Central

    Taiz, Lincoln; Honigman, William A.

    1976-01-01

    The cell walls of barley (Hordeum vulgare var. Himalaya) aleurone layers undergo extensive degradation during the tissue's response to gibberellic acid. Previous work had shown that these cell walls consist almost entirely of arabinoxylan. In this study we show that gibberellic acid stimulates endo-β-1,4-xylanase activity in isolated aleurone layers. In addition, gibberellic acid enhances the activity of two glycosidases: β-xylopyranosidase and α-arabinofuranosidase. No gibberellic acid-stimulated cellulase activity was detected. Germination studies showed a similar pattern of enzyme development in intact seeds. Images PMID:16659683

  19. The role of iron in prostaglandin synthesis: ferrous iron mediated oxidation of arachidonic acid.

    PubMed

    Rao, G H; Gerrard, J M; Eaton, J W; White, J G

    1978-07-01

    Arachidonic acid (AA) is the essential substrate for production of platelet endoperoxides and thromboxanes. Iron or heme is an essential cofactor for the peroxidase, lipoxygenase and cyclo-oxygenase enzymes involved in formation of these products. The present study has examined the direct interactions between iron and arachidonic acid. Iron caused the oxidation of AA into more polar products which could be detected by UV absorbtion at 232 nM or the thiobarbituric acid (TBA) reaction. High pressure liquid chromatography, chem-ionization and electron-impact mass spectrometry and nuclear magnetic resonance spectroscopy suggest that the major product was a hydroperoxide of AA. Ferrous iron (Fe++) and oxygen were absolute requirements. Fe++ was converted to the ferric iron (Fe+++) state during oxidation of AA, but Fe+++ could not substitute for Fe++. No other enzymes, cofactors or ions were involved. Conversion of AA to a hydroperoxide by Fe++ was inhibited by the antioxidant, 2, (3)-Tert-butyl-4-hydroxyanisole, the radical scavenger, nitroblue tetrazolium, and iron chelating agents, including EDTA, imidazole and dihydroxybenzoic acid. The reaction was not affected by superoxide dismutase, catalase or aspirin. These findings and preliminary studies of the Fe++ induced oxidation product of AA as a substrate for prostaglandin synthesis and inhibitor of prostacyclin production indicate the critical role of Fe++ in AA activation.

  20. Fatty acid effects on fibroblast cholesterol synthesis

    SciTech Connect

    Shireman, R.B.; Muth, J.; Lopez, C.

    1987-05-01

    Two cell lines of normal (CRL 1475, GM5565) and of familial hypercholesterolemia (FH) (CM 486,488) fibroblasts were preincubated with medium containing the growth factor ITS, 2.5 mg/ml fatty acid-free BSA, or 35.2 ..mu..mol/ml of these fatty acids complexed with 2.5 mg BSA/ml: stearic (18:0), caprylic (8:0), oleic (18:1;9), linoleic (18:2;9,12), linolenic (18:3;9,12,15), docosahexaenoic (22:6;4,7,10,13,16,19)(DHA) or eicosapentaenoic (20:5;5,8,11,14,17)(EPA). After 20 h, cells were incubated for 2 h with 0.2 ..mu..Ci (/sup 14/C)acetate/ml. Cells were hydrolyzed; an aliquot was quantitated for radioactivity and protein. After saponification and extraction with hexane, radioactivity in the aqueous and organic phases was determined. The FH cells always incorporated 30-90% more acetate/mg protein than normal cells but the pattern of the fatty acid effects was similar in both types. When the values were normalized to 1 for the BSA-only group, cells with ITS had the greatest (/sup 14/C)acetate incorporation (1.45) followed by the caprylic group (1.14). Cells incubated with 18:3, 20:6 or 22:6 incorporated about the same amount as BSA-only. Those preincubated with 18:2, 18:1, 18:0 showed the least acetate incorporation (0.87, 0.59 and 0.52, respectively). The percentage of total /sup 14/C counts which extracted into hexane was much greater in FH cells; however, these values varied with the fatty acid, e.g., 1.31(18:0) and 0.84(8:0) relative to 1(BSA).

  1. Novel synthesis of steryl esters from phytosterols and amino Acid.

    PubMed

    Pang, Min; Jiang, Shaotong; Cao, Lili; Pan, Lijun

    2011-10-12

    The feasibility of esterification of phytosterol with the amino acid l-glutamic acid was established. The influence of various organic solvents was investigated, and n-butanol was selected as an ideal solvent for phytosteryl esters synthesis with l-glutamic acid. The reaction conditions were further optimized by orthogonal experiments, and a 92.3% degree of esterification was obtained when optimum conditions were used. FT-IR spectral, GC-MS, and NMR analyses were adopted to determine the steryl esters of l-glutamic acid. The FT-IR spectrum indicated the presence of ester bonds in the phytosteryl esters with l-glutamic acid, and on the basis of the detailed mass spectrography analysis, GC-MS and NMR offered an efficient and reliable way to confirm the steryl esters. This novel synthesis approach of phytosteryl esters with amino acid supplied a promising alternative to the substrate on esterification of phytosterols and thus can be readily applied to further studies of functional food ingredients of phytosteryl esters.

  2. Taurine homeostasis requires de novo synthesis via cysteine sulfinic acid decarboxylase during zebrafish early embryogenesis.

    PubMed

    Chang, Yen-Chia; Ding, Shih-Torng; Lee, Yen-Hua; Wang, Ya-Ching; Huang, Ming-Feng; Liu, I-Hsuan

    2013-02-01

    Cysteine sulfinic acid decarboxylase (Csad) is the rate-limiting enzyme in the de novo biosynthesis of taurine. There are a number of physiological roles of taurine, such as bile salt synthesis, osmoregulation, lipid metabolism, and oxidative stress inhibition. To investigate the role of de novo synthesis of taurine during embryonic development, zebrafish csad was cloned and functionally analyzed. Semi-quantitative RT-PCR showed that csad transcripts are maternally deposited, while whole-mount in situ hybridization demonstrated that csad is expressed in yolk syncytial layer and various embryonic tissues such as notochord, brain, retina, pronephric duct, liver, and pancreas. Knockdown of csad significantly reduced the embryonic taurine level, and the affected embryos had increased early mortality and cardiac anomalies. mRNA coinjection and taurine supplementation rescued the cardiac phenotypes suggesting that taurine originating from the de novo synthesis pathway plays a role in cardiac development. Our findings indicated that the de novo synthesis pathway via Csad plays a critical role in taurine homeostasis and cardiac development in zebrafish early embryos. PMID:22907836

  3. Ribosomal Synthesis of Peptides with Multiple β-Amino Acids.

    PubMed

    Fujino, Tomoshige; Goto, Yuki; Suga, Hiroaki; Murakami, Hiroshi

    2016-02-17

    The compatibility of β-amino acids with ribosomal translation was studied for decades, but it has been still unclear whether the ribosome can accept various β-amino acids, and whether the ribosome can introduce multiple β-amino acids in a peptide. In the present study, by using the Escherichia coli reconstituted cell-free translation system with a reprogramed genetic code, we screened β-amino acids that give high single incorporation efficiency and used them to synthesize peptides containing multiple β-amino acids. The experiments of single β-amino acid incorporation into a peptide revealed that 13 β-amino acids are compatible with ribosomal translation. Six of the tested β-amino acids (βhGly, l-βhAla, l-βhGln, l-βhPhg, l-βhMet, and d-βhPhg) showed high incorporation efficiencies, and seven (l-βhLeu, l-βhIle, l-βhAsn, l-βhPhe, l-βhLys, d-βhAla, and d-βhLeu) showed moderate incorporation efficiencies; whereas no full-length peptide was produced using other β-amino acids (l-βhPro, l-βhTrp, and l-βhGlu). Subsequent double-incorporation experiments using β-amino acids with high single incorporation efficiency revealed that elongation of peptides with successive β-amino acids is prohibited. Efficiency of the double-incorporation of the β-amino acids was restored by the insertion of Tyr or Ile between the two β-amino acids. On the basis of these experiments, we also designed mRNA sequences of peptides, and demonstrated the ribosomal synthesis of peptides containing different types of β-amino acids at multiple positions.

  4. Synthesis of some glucose-fatty acid esters by lipase from Candida antarctica and their emulsion functions.

    PubMed

    Ren, Kangzi; Lamsal, Buddhi P

    2017-01-01

    The synthesis of glucose esters with palmitic acid, lauric acid and hexanoic acid using lipase enzyme was studied and their emulsion functionality in oil-in-water system were compared. Reactions at 3:1M ratio of fatty acids-to-glucose had the highest conversion percentages (over 90% for each of the fatty acid). Initial conversion rate increased as substrate solubility increased. Ester bond formation was confirmed by nuclear magnetic resonance technique that the chemical shifts of glucose H-6 and α-carbon protons of fatty acids in the ester molecules shifted to the higher fields. Contact angle of water on esters' pelleted surface increased as the hydrophobicity increased. Glucose esters' and commercial sucrose esters' functionality as emulsifiers were compared. Glucose esters delayed, but did not prevent coalescence, because the oil droplets diameter doubled during 7days. Sucrose esters prevented coalescence during 7days since the droplets diameter did not have significant change. PMID:27507510

  5. Origin of fatty acid synthesis - Thermodynamics and kinetics of reaction pathways

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1991-01-01

    The primitiveness of contemporary fatty acid biosynthesis was evaluated by using the thermodynamics and kinetics of its component reactions to estimate the extent of its dependence on powerful and selective catalysis by enzymes. Since this analysis indicated that the modern pathway is not primitive because it requires sophisticated enzymatic catalysis, an alternative pathway of primitive fatty acid synthesis is proposed that uses glycolaldehyde as a substrate. In contrast to the modern pathway, this primitive pathway is not dependent on an exogenous source of phosphoanhydride energy. Furthermore, the chemical spontaneity of its reactions suggests that it could have been readily catalyzed by the rudimentary biocatalysts available at an early stage in the origin of life.

  6. Effect of the bile-acid sequestrant colestipol on postprandial serum bile-acid concentration: evaluation by bioluminescent enzymic analysis.

    PubMed

    Rossi, S S; Wayne, M L; Smith, R B; Wright, C E; Andreadis, N A; Hofmann, A F

    1989-02-01

    Chronic ingestion of bile-acid sequestrants has been shown to decrease the serum cholesterol concentration and coronary events in hypercholesterolaemic patients. To develop improved sequestrants, a rapid, convenient method for testing the bile-acid binding efficacy of sequestrants is needed. Serum bile-acid concentrations could be used to detect bile-acid binding by an administered sequestrant, since the serum bile-acid concentration is determined largely by the rate of intestinal absorption in healthy individuals. To test this, serum bile-acid concentrations were measured at frequent intervals over 24 h in five otherwise healthy hypercholesterolaemic subjects during the ingestion of three standard meals, with or without the addition of 5 g colestipol granules administered 30 min before each meal. Total serum bile-acid concentration was measured with a previously reported bioluminescent enzymic assay, that uses a 3 alpha-hydroxysteroid dehydrogenase, an oxido-reductase, and a bacterial luciferase co-immobilized on to Sepharose beads. Bile acids in 1 ml of serum were isolated by solid-phase extraction chromatography with reversed-phase C18 cartridges. Colestipol lowered the postprandial elevation of serum bile acids by one half, with a subsequent decrease in the cumulative area under the curve. The data suggest that measurement of serum bile-acid concentrations by bioluminescence is a rapid, simple way to document the efficacy of bile-acid sequestrants.

  7. Gene-Enzyme Relationships of Aromatic Amino Acid Biosynthesis in Higher Plants

    SciTech Connect

    2002-08-12

    Inhibition studies of amino acids in Nicotiana silvestris suspension cells gave clues to the difficulties for obtaining mutants deficient in post prephenate pathway proteins of aromatic amino acid biosynthesis (prephenate aminotransferase, arogenate dehydrogenase and arogenate dehydratase). Such mutants, if successfully obtained, would allow gene-enzyme relationships of aromatic amino acid proteins to be studied. We found that amino acids were inhibitory toward plant cell growth, and thus were unable to rescue analog resistant mutants. Toxicity of all amino acids toward exponentially dividing Nicotiana silvestris suspension cultured cells was monitored by following growth rates. Except for L-glutamine, all 19 protein amino acids inhibited cell growth. Inhibition of growth progressed to cell deterioration. Electron microscopy showed that amino acids triggered a state of cell shrinkage that eventually degenerated to total cellular disorganization. L-glutamine was not only an effective agent for prevention of amino acid toxicity, but enhanced the final growth yield. L-glutamine also was able to completely reverse inhibition effects in cells that had been in the slowed exponential phase. Two types of inhibition occurred and we have proposed that any amino acid inhibition that can be completely antagonized by L-glutamine be called ''general amino acid inhibition''. ''Specific amino acid inhibition'' resulting from particular pathway imbalances caused by certain exogenous amino acids, can be recognized and studied in the presence of L-glutamine which can abolishes the complication effects of general amino acid inhibition.

  8. Cinnamic acid 4-hydroxylase of sorghum [Sorghum biocolor (L.) Moench] gene SbC4H1 restricts lignin synthesis in Arabidopsis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cinnamic acid 4-hydroxylase (C4H) is the first hydroxylase enzyme of the phenylpropanoid pathway, and its content and activity affects the lignin synthesis. In this study, we isolated a C4H gene SbC4H1 from the suppression subtractive hybridization library of brown midrib (bmr) mutants of Sorghum b...

  9. Stimulation of protein synthesis by phosphatidic acid in rat cardiomyocytes.

    PubMed

    Xu, Y J; Yau, L; Yu, L P; Elimban, V; Zahradka, P; Dhalla, N S

    1996-12-13

    Phosphatidic acid (PA) was observed to stimulate protein synthesis in adult cardiomyocytes in a time- and concentration-dependent manner. The maximal stimulation in protein synthesis (142 +/- 12% vs 100% as the control) was achieved at 10 microM PA within 60 min and was inhibited by actinomycin D (107 +/- 4% of the control) or cycloheximide (105 +/- 6% of the control). The increase in protein synthesis due to PA was attenuated or abolished by preincubation of cardiomyocytes with a tyrosine kinase inhibitor, genistein (94 +/- 9% of the control), phospholipase C inhibitors 2-nitro-4-carboxyphenyl N,N-diphenyl carbamate or carbon-odithioic acid O-(octahydro-4,7-methanol-1H-inden-5-yl (101 +/- 6 and 95 +/- 5% of the control, respectively), protein kinase C inhibitors staurosporine or polymyxin B (109 +/- 3 and 93 +/- 3% of the control), and chelators of extracellular and intracellular free Ca2+ EGTA or BAPTA/AM (103 +/- 6 and 95 +/- 6% of the control, respectively). PA at different concentrations (0.1 to 100 microM) also caused phosphorylation of a cell surface protein of approximately 24 kDa. In addition, mitogen-activated protein kinase was stimulated by PA in a concentration-dependent manner; maximal stimulation (217 +/- 6% of the control) was seen at 10 microM PA. These data suggest that PA increases protein synthesis in adult rat cardiomyocytes and thus may play an important role in the development of cardiac hypertrophy.

  10. Production of Glucaric Acid from Hemicellulose Substrate by Rosettasome Enzyme Assemblies.

    PubMed

    Lee, Charles C; Kibblewhite, Rena E; Paavola, Chad D; Orts, William J; Wagschal, Kurt

    2016-07-01

    Hemicellulose biomass is a complex polymer with many different chemical constituents that can be utilized as industrial feedstocks. These molecules can be released from the polymer and transformed into value-added chemicals through multistep enzymatic pathways. Some bacteria produce cellulosomes which are assemblies composed of lignocellulolytic enzymes tethered to a large protein scaffold. Rosettasomes are artificial engineered ring scaffolds designed to mimic the bacterial cellulosome. Both cellulosomes and rosettasomes have been shown to facilitate much higher rates of biomass hydrolysis compared to the same enzymes free in solution. We investigated whether tethering enzymes involved in both biomass hydrolysis and oxidative transformation to glucaric acid onto a rosettasome scaffold would result in an analogous production enhancement in a combined hydrolysis and bioconversion metabolic pathway. Three different enzymes were used to hydrolyze birchwood hemicellulose and convert the substituents to glucaric acid, a top-12 DOE value added chemical feedstock derived from biomass. It was demonstrated that colocalizing the three different enzymes to the synthetic scaffold resulted in up to 40 % higher levels of product compared to uncomplexed enzymes. PMID:27198564

  11. The enzymic oxidation of chlorogenic acid and some reactions of the quinone produced

    PubMed Central

    Pierpoint, W. S.

    1966-01-01

    1. Partially purified preparations of tobacco-leaf o-diphenol oxidase (o-quinol–oxygen oxidoreductase; EC 1.10.3.1) oxidize chlorogenic acid to brown products, absorbing, on average, 1·6atoms of oxygen/mol. oxidized, and evolving a little carbon dioxide. 2. The effect of benzenesulphinic acid on the oxidation suggests that the first stage is the formation of a quinone; the solution does not go brown, oxygen uptake is restricted to 1 atom/mol. oxidized, and a compound is produced whose composition corresponds to that of a sulphone of the quinone derived from chlorogenic acid. 3. Several other compounds that react with quinones affect the oxidation of chlorogenic acid. The colour of the products formed and the oxygen absorbed in their formation suggest that the quinone formed in the oxidation reacts with these compounds in the same way as do simpler quinones. 4. Some compounds that are often used to prevent the oxidation of polyphenols were tested to see if they act by inhibiting o-diphenol oxidase, by reacting with quinone intermediates, or both. 5. Ascorbate inhibits the enzyme and also reduces the quinone. 6. Potassium ethyl xanthate, diethyldithiocarbamate and cysteine inhibit the enzyme to different extents, and also react with the quinone. The nature of the reaction depends on the relative concentrations of inhibitor and chlorogenic acid. Excess of inhibitor prevents the solution from turning brown and restricts oxygen uptake to 1 atom/mol. of chlorogenic acid oxidized; smaller amounts do not prevent browning and slightly increase oxygen uptake. 7. 2-Mercaptobenzothiazole inhibits the enzyme, and also probably reacts with the quinone; inhibited enzyme is reactivated as if the inhibitor is removed as traces of quinone are produced. 8. Thioglycollate and polyvinylpyrrolidone inhibit the enzyme. Thioglycollate probably reduces the quinone to a small extent. PMID:5941350

  12. A New Process for Acrylic Acid Synthesis by Fermentative Process

    NASA Astrophysics Data System (ADS)

    Lunelli, B. H.; Duarte, E. R.; de Toledo, E. C. Vasco; Wolf Maciel, M. R.; Maciel Filho, R.

    With the synthesis of chemical products through biotechnological processes, it is possible to discover and to explore innumerable routes that can be used to obtain products of high addes value. Each route may have particular advantages in obtaining a desired product, compared with others, especially in terms of yield, productivity, easiness to separate the product, economy, and environmental impact. The purpose of this work is the development of a deterministic model for the biochemical synthesis of acrylic acid in order to explore an alternative process. The model is built-up with the tubular reactor equations together with the kinetic representation based on the structured model. The proposed process makes possible to obtain acrylic acid continuously from the sugar cane fermentation.

  13. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1987-01-01

    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20 percent for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  14. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, A. L.

    1986-01-01

    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20% for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  15. Synthesis of aliphatic esters of cinnamic acid as potential lipophilic antioxidants catalyzed by lipase B from Candida antarctica.

    PubMed

    Jakovetić, Sonja M; Jugović, Branimir Z; Gvozdenović, Milica M; Bezbradica, Dejan I; Antov, Mirjana G; Mijin, Dušan Z; Knežević-Jugović, Zorica D

    2013-08-01

    Immobilized lipase from Candida antarctica (Novozyme 435) was tested for the synthesis of various phenolic acid esters (ethyl and n-butyl cinnamate, ethyl p-coumarate and n-butyl p-methoxycinnamate). The second-order kinetic model was used to mathematically describe the reaction kinetics and to compare present processes quantitatively. It was found that the model agreed well with the experimental data. Further, the effect of alcohol type on the esterification of cinnamic acid was investigated. The immobilized lipase showed more ability to catalyze the synthesis of butyl cinnamate. Therefore, the process was optimized for the synthesis of butyl cinnamate as a function of solvent polarity (logP) and amount of biocatalyst. The highest ester yield of 60.7 % was obtained for the highest enzyme concentration tested (3 % w/w), but the productivity was for 34 % lower than the corresponding value obtained for the enzyme concentration of 1 % (w/w). The synthesized esters were purified, identified, and screened for antioxidant activities. Both DPPH assay and cyclic voltammetry measurement have shown that cinnamic acid esters have better antioxidant properties than cinnamic acid itself.

  16. Synthesis and bioactivities of silver nanoparticles capped with 5-Amino-?-resorcylic acid hydrochloride dihydrate

    PubMed Central

    2014-01-01

    Background Conjugated and drug loaded silver nanoparticles are getting an increased attention for various biomedical applications. Nanoconjugates showed significant enhancement in biological activity in comparison to free drug molecules. In this perspective, we report the synthesis of bioactive silver capped with 5-Amino-?-resorcylic acid hydrochloride dihydrate (AR). The in vitro antimicrobial (antibacterial, antifungal), enzyme inhibition (xanthine oxidase, urease, carbonic anhydrase, ?-chymotrypsin, cholinesterase) and antioxidant activities of the developed nanostructures was investigated before and after conjugation to silver metal. Results The conjugation of AR to silver was confirmed through FTIR, UV¿vis and TEM techniques. The amount of AR conjugated with silver was characterized through UV¿vis spectroscopy and found to be 9% by weight. The stability of synthesized nanoconjugates against temperature, high salt concentration and pH was found to be good. Nanoconjugates, showed significant synergic enzyme inhibition effect against xanthine and urease enzymes in comparison to standard drugs, pure ligand and silver. Conclusions Our synthesized nanoconjugate was found be to efficient selective xanthine and urease inhibitors in comparison to Ag and AR. On a per weight basis, our nanoconjugates required less amount of AR (about 11 times) for inhibition of these enzymes. PMID:25201390

  17. Daily rhythms of glycerophospholipid synthesis in fibroblast cultures involve differential enzyme contributions[S

    PubMed Central

    Acosta-Rodríguez, Victoria A.; Márquez, Sebastián; Salvador, Gabriela A.; Pasquaré, Susana J.; Gorné, Lucas D.; Garbarino-Pico, Eduardo; Giusto, Norma M.; Guido, Mario Eduardo

    2013-01-01

    Circadian clocks regulate the temporal organization of several biochemical processes, including lipid metabolism, and their disruption leads to severe metabolic disorders. Immortalized cell lines acting as circadian clocks display daily variations in [32P]phospholipid labeling; however, the regulation of glycerophospholipid (GPL) synthesis by internal clocks remains unknown. Here we found that arrested NIH 3T3 cells synchronized with a 2 h-serum shock exhibited temporal oscillations in a) the labeling of total [3H] GPLs, with lowest levels around 28 and 56 h, and b) the activity of GPL-synthesizing and GPL-remodeling enzymes, such as phosphatidate phosphohydrolase 1 (PAP-1) and lysophospholipid acyltransferases (LPLAT), respectively, with antiphase profiles. In addition, we investigated the temporal regulation of phosphatidylcholine (PC) biosynthesis. PC is mainly synthesized through the Kennedy pathway with choline kinase (ChoK) and CTP:phosphocholine cytidylyltranferase (CCT) as key regulatory enzymes. We observed that the PC labeling exhibited daily changes, with the lowest levels every ∼28 h, that were accompanied by brief increases in CCT activity and the oscillation in ChoK mRNA expression and activity. Results demonstrate that the metabolisms of GPLs and particularly of PC in synchronized fibroblasts are subject to a complex temporal control involving concerted changes in the expression and/or activities of specific synthesizing enzymes. PMID:23641021

  18. Mycolic acid biosynthesis and enzymic characterization of the beta-ketoacyl-ACP synthase A-condensing enzyme from Mycobacterium tuberculosis.

    PubMed

    Kremer, Laurent; Dover, Lynn G; Carrère, Séverine; Nampoothiri, K Madhavan; Lesjean, Sarah; Brown, Alistair K; Brennan, Patrick J; Minnikin, David E; Locht, Camille; Besra, Gurdyal S

    2002-06-01

    Mycolic acids consist of long-chain alpha-alkyl-beta-hydroxy fatty acids that are produced by successive rounds of elongation catalysed by a type II fatty acid synthase (FAS-II). A key feature in the elongation process is the condensation of a two-carbon unit from malonyl-acyl-carrier protein (ACP) to a growing acyl-ACP chain catalysed by a beta-ketoacyl-ACP synthase (Kas). In the present study, we provide evidence that kasA from Mycobacterium tuberculosis encodes an enzyme that elongates in vivo the meromycolate chain, in both Mycobacterium smegmatis and Mycobacterium chelonae. We demonstrate that KasA belongs to the FAS-II system, which utilizes primarily palmitoyl-ACP rather than short-chain acyl-ACP primers. Furthermore, in an in vitro condensing assay using purified recombinant KasA, palmitoyl-AcpM and malonyl-AcpM, KasA was found to express Kas activity. Also, mutated KasA proteins, with mutation of Cys(171), His(311), Lys(340) and His(345) to Ala abrogated the condensation activity of KasA in vitro completely. Finally, purified KasA was highly sensitive to cerulenin, a well-known inhibitor of Kas, which may lead to the development of novel anti-mycobacterial drugs targeting KasA. PMID:12023885

  19. Is Acetylcarnitine a Substrate for Fatty Acid Synthesis in Plants?

    PubMed

    Roughan, G.; Post-Beittenmiller, D.; Ohlrogge, J.; Browse, J.

    1993-04-01

    Long-chain fatty acid synthesis from [1-14C]acetylcarnitine by chloroplasts isolated from spinach (Spinacia oleracea), pea (Pisum sativum), amaranthus (Amaranthus lividus), or maize (Zea mays) occurred at less than 2% of the rate of fatty acid synthesis from [1-14C]acetate irrespective of the maturity of the leaves or whether the plastids were purified using sucrose or Percoll medium. [1-14C]-Acetylcarnitine was not significantly utilized by highly active chloroplasts rapidly prepared from pea and spinach using methods not involving density gradient centrifugation. [1-14C]Acetylcarnitine was recovered quantitatively from chloroplast incubations following 10 min in the light. Unlabeled acetyl-L-carnitine (0.4 mM) did not compete with [1-14C]acetate (0.2 mM) as a substrate for fatty acid synthesis by any of the more than 70 chloroplast preparations tested in this study. Carnitine acetyltransferase activity was not detected in any chloroplast preparation and was present in whole leaf homogenates at about 0.1% of the level of acetyl-coenzyme A synthetase activity. When supplied to detached pea shoots and detached spinach, amaranthus, and maize leaves via the transpiration stream, 1 to 4% of the [1-14C]acetylcarnitine and 47 to 57% of the [1-14C]acetate taken up was incorporated into lipids. Most (78-82%) of the [1-14C]acetylcarnitine taken up was recovered intact. It is concluded that acetylcarnitine is not a major precursor for fatty acid synthesis in plants.

  20. Is acetylcarnitine a substrate for fatty acid synthesis in plants

    SciTech Connect

    Roughan, G. ); Post-Beittenmiller, D.; Ohlrogge, J. ); Browse, J. )

    1993-04-01

    Long-chain fatty acid synthesis from [1-[sup 14]C]acetylcarnitine by chloroplasts isolated from spinach (Spinacia oleracea), pea (Pisum sativum), amaranthus (Amaranthus lividus), or maize (Zea mays) occurred at less than 2% of the rate of fatty acid synthesis from [1-[sup 14]C]acetate irrespective of the maturity of the leaves or whether the plastids were purified using sucrose or Percoll medium. [1-[sup 14]C]Acetylcarnitine was not significantly utilized by highly active chloroplasts rapidly prepared from pea and spinach using methods not involving density gradient centrifugation. [1-[sup 14]C]Acetylcarnitine was recovered quantitatively from chloroplast incubations following 10 min in the light. Unlabeled acetyl-L-carnitine (0.4 mM) did not compete with [1-[sup 14]C]acetate (0.2 mM) as a substrate for fatty acid synthesis by any of the more than 70 chloroplast preparations tested in this study. Carnitine acetyltransferase activity was not detected in any chloroplast preparation and was present in whole leaf homogenates at about 0.1% of the level of acetyl-coenzyme A synthetase activity. When supplied to detached pea shoots and detached spinach, amaranthus, and maize leaves via the transpiration stream, 1 to 4% of the [1-[sup 14]C]acetylcarnitine and 47 to 57% of the [1-[sup 14]C]acetate taken up was incorporated into lipids. Most (78--82%) of the [1-[sup 14]C]acetylcarnitine taken up was recovered intact. It is concluded that acetylcarnitine is not a major precursor for fatty acid synthesis in plants. 29 refs., 5 tabs.

  1. Fatty acid synthesis: from CO2 to functional genomics.

    PubMed

    Ohlrogge, J; Pollard, M; Bao, X; Focke, M; Girke, T; Ruuska, S; Mekhedov, S; Benning, C

    2000-12-01

    For over 25 years there has been uncertainty over the pathway from CO(2) to acetyl-CoA in chloroplasts. On the one hand, free acetate is the most effective substrate for fatty acid synthesis by isolated chloroplasts, and free acetate concentrations reported in leaf tissue (0.1-1 mM) appear adequate to saturate fatty acid synthase. On the other hand, a clear mechanism to generate sufficient free acetate for fatty acid synthesis is not established and direct production of acetyl-CoA from pyruvate by a plastid pyruvate dehydrogenase seems a more simple and direct path. We have re-examined this question and attempted to distinguish between the alternatives. The kinetics of (13)CO(2) and (14)CO(2) movement into fatty acids and the absolute rate of fatty acid synthesis in leaves was determined in light and dark. Because administered (14)C appears in fatty acids within < 2-3 min our results are inconsistent with a large pool of free acetate as an intermediate in leaf fatty acid synthesis. In addition, these studies provide an estimate of the turnover rate of fatty acid in leaves. Studies similar to the above are more complex in seeds, and some questions about the regulation of plant lipid metabolism seem difficult to solve using conventional biochemical or molecular approaches. For example, we have little understanding of why or how some seeds produce >50% oil whereas other seeds store largely carbohydrate or protein. Major control over complex plant biochemical pathways may only become possible by understanding regulatory networks which provide 'global' control over these pathways. To begin to discover such networks and provide a broad analysis of gene expression in developing oilseeds, we have produced microarrays that display approx. 5000 seed-expressed Arabidopsis genes. Sensitivity of the arrays was 1-2 copies of mRNA/cell. The arrays have been hybridized with probes derived from seeds, leaves and roots, and analysis of expression ratios between the different tissues

  2. A direct method for the synthesis of orthogonally protected furyl- and thienyl- amino acids.

    PubMed

    Hudson, Alex S; Caron, Laurent; Colgin, Neil; Cobb, Steven L

    2015-04-01

    The synthesis of unnatural amino acids plays a key part in expanding the potential application of peptide-based drugs and in the total synthesis of peptide natural products. Herein, we report a direct method for the synthesis of orthogonally protected 5-membered heteroaromatic amino acids.

  3. Occurrence of Arginine Deiminase Pathway Enzymes in Arginine Catabolism by Wine Lactic Acid Bacteria

    PubMed Central

    Liu, S.; Pritchard, G. G.; Hardman, M. J.; Pilone, G. J.

    1995-01-01

    l-Arginine, an amino acid found in significant quantities in grape juice and wine, is known to be catabolized by some wine lactic acid bacteria. The correlation between the occurrence of arginine deiminase pathway enzymes and the ability to catabolize arginine was examined in this study. The activities of the three arginine deiminase pathway enzymes, arginine deiminase, ornithine transcarbamylase, and carbamate kinase, were measured in cell extracts of 35 strains of wine lactic acid bacteria. These enzymes were present in all heterofermentative lactobacilli and most leuconostocs but were absent in all the homofermentative lactobacilli and pediococci examined. There was a good correlation among arginine degradation, formation of ammonia and citrulline, and the occurrence of arginine deiminase pathway enzymes. Urea was not detected during arginine degradation, suggesting that the catabolism of arginine did not proceed via the arginase-catalyzed reaction, as has been suggested in some earlier studies. Detection of ammonia with Nessler's reagent was shown to be a simple, rapid test to assess the ability of wine lactic acid bacteria to degrade arginine, although in media containing relatively high concentrations (>0.5%) of fructose, ammonia formation is inhibited. PMID:16534912

  4. Biological Monitoring of 3-Phenoxybenzoic Acid in Urine by an Enzyme -Linked Immunosorbent Assay

    EPA Science Inventory

    An enzyme-linked immunosorbent assay (ELISA) method was employed for determination of the pyrethroid biomarker, 3-phenoxybenzoic acid (3-PBA) in human urine samples. The optimized coating antigen concentration was 0.5 ng/mL with a dilution of 1:4000 for the 3-PBA antibody and 1:6...

  5. Zeolite molecular sieves have dramatic acid-base effects on enzymes in nonaqueous media.

    PubMed

    Fontes, Nuno; Partridge, Johann; Halling, Peter J; Barreiros, Susana

    2002-02-01

    Zeolite molecular sieves very commonly are used as in situ drying agents in reaction mixtures of enzymes in nonaqueous media. They often affect enzyme behavior, and this has been interpreted in terms of altered hydration. Here, we show that zeolites can also have dramatic acid-base effects on enzymes in low water media, resulting from their cation-exchange ability. Initial rates of transesterification catalyzed by cross-linked crystals of subtilisin were compared in supercritical ethane, hexane, and acetonitrile with water activity fixed by pre-equilibration. Addition of zeolite NaA (4 A powder) still caused remarkable rate enhancements (up to 20-fold), despite the separate control of hydration. In the presence of excess of an alternative solid-state acid-base buffer, however, zeolite addition had no effect. The more commonly used Merck molecular sieves (type 3 A beads) had similar but somewhat smaller effects. All zeolites have ion-exchange ability and can exchange H+ for cations such as Na+ and K+. These exchanges will tend to affect the protonation state of acidic groups in the protein and, hence, enzymatic activity. Zeolites pre-equilibrated in aqueous suspensions of varying pH-pNa gave very different enzyme activities. Their differing basicities were demonstrated directly by equilibration with an indicator dissolved in toluene. The potential of zeolites as acid-base buffers for low-water media is discussed, and their ability to overcome pH memory is demonstrated.

  6. Synthesis of rosin acid starch catalyzed by lipase.

    PubMed

    Lin, Rihui; Li, He; Long, Han; Su, Jiating; Huang, Wenqin

    2014-01-01

    Rosin, an abundant raw material from pine trees, was used as a starting material directly for the synthesis of rosin acid starch. The esterification reaction was catalyzed by lipase (Novozym 435) under mild conditions. Based on single factor experimentation, the optimal esterification conditions were obtained as follows: rosin acid/anhydrous glucose unit in the molar ratio 2:1, reaction time 4 h at 45°C, and 15% of lipase dosage. The degree of substitution (DS) reaches 0.098. Product from esterification of cassava starch with rosin acid was confirmed by FTIR spectroscopy and iodine coloration analysis. Scanning electron microscopy and X-ray diffraction analysis showed that the morphology and crystallinity of the cassava starch were largely destroyed. Thermogravimetric analysis indicated that thermal stability of rosin acid starch decreased compared with native starch.

  7. Pterandric acid--its isolation, synthesis and stereochemistry.

    PubMed

    Haleem, Muhammad A; Capellari, Simone C; Sympson, Beryl B; Marsaioli, Anita J

    2015-01-01

    Some plant families have a specialized type of pollination system, with floral lipid rewards for pollinators, which is common. In neotropical Malpighiaceae species like Pterandra pyroidea, this specialized type of pollination system is apparently shifting from floral oils/lipids to pollen reward. Mass spectrometric analysis (GC/MS-EI) indicated that P. pyroidea floral oil has a unique chemical composition, i.e., few fatty acid constituents possessing acetoxy groups at positions 5 and 7, which is distinct from the other floral oils of sympatric Malpighiaceae species. The structure of the major floral oil constituent, a novel fatty acid, anti-5,7-diacetoxydocosanoic acid, was confirmed based on synthesis, mass fragmentation, and 1H and 13C NMR analyses; the compound is herein named pterandric acid.

  8. Structural basis for the recognition of mycolic acid precursors by KasA, a condensing enzyme and drug target from Mycobacterium tuberculosis.

    PubMed

    Schiebel, Johannes; Kapilashrami, Kanishk; Fekete, Agnes; Bommineni, Gopal R; Schaefer, Christin M; Mueller, Martin J; Tonge, Peter J; Kisker, Caroline

    2013-11-22

    The survival of Mycobacterium tuberculosis depends on mycolic acids, very long α-alkyl-β-hydroxy fatty acids comprising 60-90 carbon atoms. However, despite considerable efforts, little is known about how enzymes involved in mycolic acid biosynthesis recognize and bind their hydrophobic fatty acyl substrates. The condensing enzyme KasA is pivotal for the synthesis of very long (C38-42) fatty acids, the precursors of mycolic acids. To probe the mechanism of substrate and inhibitor recognition by KasA, we determined the structure of this protein in complex with a mycobacterial phospholipid and with several thiolactomycin derivatives that were designed as substrate analogs. Our structures provide consecutive snapshots along the reaction coordinate for the enzyme-catalyzed reaction and support an induced fit mechanism in which a wide cavity is established through the concerted opening of three gatekeeping residues and several α-helices. The stepwise characterization of the binding process provides mechanistic insights into the induced fit recognition in this system and serves as an excellent foundation for the development of high affinity KasA inhibitors. PMID:24108128

  9. Structural Basis for the Recognition of Mycolic Acid Precursors by KasA, a Condensing Enzyme and Drug Target from Mycobacterium Tuberculosis *

    PubMed Central

    Schiebel, Johannes; Kapilashrami, Kanishk; Fekete, Agnes; Bommineni, Gopal R.; Schaefer, Christin M.; Mueller, Martin J.; Tonge, Peter J.; Kisker, Caroline

    2013-01-01

    The survival of Mycobacterium tuberculosis depends on mycolic acids, very long α-alkyl-β-hydroxy fatty acids comprising 60–90 carbon atoms. However, despite considerable efforts, little is known about how enzymes involved in mycolic acid biosynthesis recognize and bind their hydrophobic fatty acyl substrates. The condensing enzyme KasA is pivotal for the synthesis of very long (C38–42) fatty acids, the precursors of mycolic acids. To probe the mechanism of substrate and inhibitor recognition by KasA, we determined the structure of this protein in complex with a mycobacterial phospholipid and with several thiolactomycin derivatives that were designed as substrate analogs. Our structures provide consecutive snapshots along the reaction coordinate for the enzyme-catalyzed reaction and support an induced fit mechanism in which a wide cavity is established through the concerted opening of three gatekeeping residues and several α-helices. The stepwise characterization of the binding process provides mechanistic insights into the induced fit recognition in this system and serves as an excellent foundation for the development of high affinity KasA inhibitors. PMID:24108128

  10. Application of ionic liquids based enzyme-assisted extraction of chlorogenic acid from Eucommia ulmoides leaves.

    PubMed

    Liu, Tingting; Sui, Xiaoyu; Li, Li; Zhang, Jie; Liang, Xin; Li, Wenjing; Zhang, Honglian; Fu, Shuang

    2016-01-15

    A new approach for ionic liquid based enzyme-assisted extraction (ILEAE) of chlorogenic acid (CGA) from Eucommia ulmoides is presented in which enzyme pretreatment was used in ionic liquids aqueous media to enhance extraction yield. For this purpose, the solubility of CGA and the activity of cellulase were investigated in eight 1-alkyl-3-methylimidazolium ionic liquids. Cellulase in 0.5 M [C6mim]Br aqueous solution was found to provide better performance in extraction. The factors of ILEAE procedures including extraction time, extraction phase pH, extraction temperatures and enzyme concentrations were investigated. Moreover, the novel developed approach offered advantages in term of yield and efficiency compared with other conventional extraction techniques. Scanning electronic microscopy of plant samples indicated that cellulase treated cell wall in ionic liquid solution was subjected to extract, which led to more efficient extraction by reducing mass transfer barrier. The proposed ILEAE method would develope a continuous process for enzyme-assisted extraction including enzyme incubation and solvent extraction process. In this research, we propose a novel view for enzyme-assisted extraction of plant active component, besides concentrating on enzyme facilitated cell wall degradation, focusing on improvement of bad permeability of ionic liquids solutions. PMID:26709302

  11. Application of ionic liquids based enzyme-assisted extraction of chlorogenic acid from Eucommia ulmoides leaves.

    PubMed

    Liu, Tingting; Sui, Xiaoyu; Li, Li; Zhang, Jie; Liang, Xin; Li, Wenjing; Zhang, Honglian; Fu, Shuang

    2016-01-15

    A new approach for ionic liquid based enzyme-assisted extraction (ILEAE) of chlorogenic acid (CGA) from Eucommia ulmoides is presented in which enzyme pretreatment was used in ionic liquids aqueous media to enhance extraction yield. For this purpose, the solubility of CGA and the activity of cellulase were investigated in eight 1-alkyl-3-methylimidazolium ionic liquids. Cellulase in 0.5 M [C6mim]Br aqueous solution was found to provide better performance in extraction. The factors of ILEAE procedures including extraction time, extraction phase pH, extraction temperatures and enzyme concentrations were investigated. Moreover, the novel developed approach offered advantages in term of yield and efficiency compared with other conventional extraction techniques. Scanning electronic microscopy of plant samples indicated that cellulase treated cell wall in ionic liquid solution was subjected to extract, which led to more efficient extraction by reducing mass transfer barrier. The proposed ILEAE method would develope a continuous process for enzyme-assisted extraction including enzyme incubation and solvent extraction process. In this research, we propose a novel view for enzyme-assisted extraction of plant active component, besides concentrating on enzyme facilitated cell wall degradation, focusing on improvement of bad permeability of ionic liquids solutions.

  12. Chemical modification of an alpha 3-fucosyltransferase; definition of amino acid residues essential for enzyme activity.

    PubMed

    Britten, C J; Bird, M I

    1997-02-11

    The biosynthesis of the carbohydrate antigen sialyl Lewis X (sLe(x)) is dependent on the activity of an alpha 3-fucosyltransferase (EC 2.4.1.152, GDP-fucose:Gal beta (1-4)GlcNAc-R alpha (1-3)fucosyltransferase). This enzyme catalyses the transfer of fucose from GDP-beta-fucose to the 3-OH of N-acetylglucosamine present in lactosamine acceptors. In this report, we have investigated the amino acids essential for the activity of a recombinant alpha 3-fucosyltransferase (FucT-VI) through chemical modification of the enzyme with group-selective reagents. FucT-VI activity was found to be particularly sensitive to the histidine-selective reagent diethylpyrocarbonate and the cysteine reagent N-ethylmaleimide, with IC50 values of less than 200 microM. Reagents selective for arginine and lysine had no effect on enzyme activity. The inclusion of GDP-beta-fucose during preincubation with NEM reduces the rate of inactivation whereas inclusion of an acceptor saccharide for the enzyme, Gal beta (1-4)GlcNAc, had no effect. No protective effect with either GDP-beta-fucose or Gal beta (1-4)GlcNAc was observed on treatment of the enzyme with diethylpyrocarbonate. These data suggest that in addition to an NEM-reactive cysteine in, or adjacent to, the substrate-binding site of the enzyme, FucT-VI possesses histidine residue(s) that are essential for enzyme activity.

  13. Controlling enzyme inhibition using an expanded set of genetically encoded amino acids.

    PubMed

    Zheng, Shun; Kwon, Inchan

    2013-09-01

    Enzyme inhibition plays an important role in drug development, metabolic pathway regulation, and biocatalysis with product inhibition. When an inhibitor has high structural similarities to the substrate of an enzyme, controlling inhibitor binding without affecting enzyme substrate binding is often challenging and requires fine-tuning of the active site. We hypothesize that an extended set of genetically encoded amino acids can be used to design an enzyme active site that reduces enzyme inhibitor binding without compromising substrate binding. As a model case, we chose murine dihydrofolate reductase (mDHFR), substrate dihydrofolate, and inhibitor methotrexate. Structural models of mDHFR variants containing non-natural amino acids complexed with each ligand were constructed to identify a key residue for inhibitor binding and non-natural amino acids to replace the key residue. Then, we discovered that replacing the key phenylalanine residue with two phenylalanine analogs (p-bromophenylalanine (pBrF) and L-2-naphthylalanine (2Nal)) enhances binding affinity toward the substrate dihydrofolate over the inhibitor by 4.0 and 5.8-fold, respectively. Such an enhanced selectivity is mainly due to a reduced inhibitor binding affinity by 2.1 and 4.3-fold, respectively. The catalytic efficiency of the mDHFR variant containing pBrF is comparable to that of wild-type mDHFR, whereas the mDHFR variant containing 2Nal exhibits a moderate decrease in the catalytic efficiency. The work described here clearly demonstrates the feasibility of selectively controlling enzyme inhibition using an expanded set of genetically encoded amino acids.

  14. Specific and non-specific enzymes for furanosyl-containing conjugates: biosynthesis, metabolism, and chemo-enzymatic synthesis.

    PubMed

    Chlubnova, Ilona; Legentil, Laurent; Dureau, Rémy; Pennec, Alizé; Almendros, Mélanie; Daniellou, Richard; Nugier-Chauvin, Caroline; Ferrières, Vincent

    2012-07-15

    There is no doubt now that the synthesis of compounds of varying complexity such as saccharides and derivatives thereof continuously grows with enzymatic methods. This review focuses on recent basic knowledge on enzymes specifically involved in the biosynthesis and degradation of furanosyl-containing polysaccharides and conjugates. Moreover, and when possible, biocatalyzed approaches, alternative to standard synthesis, will be detailed in order to strengthen the high potential of these biocatalysts to go further with the preparation of rare furanosides. Interesting results will be also proposed with chemo-enzymatic processes based on nonfuranosyl-specific enzymes.

  15. Purification and characterization of an aminopeptidase A from Staphylococcus chromogenes and its use for the synthesis of amino-acid derivatives and dipeptides.

    PubMed

    Yoshpe-Besançon, I; Auriol, D; Paul, F; Monsan, P; Gripon, J C; Ribadeau-Dumas, B

    1993-01-15

    An aminopeptidase with original specificity was purified 3800-fold to homogeneity from a cellular extract of Staphylococcus chromogenes. The enzyme was specific for acidic amino acids (Asp and Glu) at the N-terminus of peptides and thus can be classified as an aminopeptidase A. However, its specificity was not restricted to acidic amino acids: alpha-hydroxy acids such as L-malic and L-lactic acids were also accepted in position P1. The enzyme had a broad specificity for the residue at position P' 1, accepting all types of amino acids, including Pro, in this position. The optimal conditions for the hydrolysis of Asp-Phe-NH2 were pH 9.5 and 60 degrees C. The enzyme was inhibited by chelating agents and serine-protease inhibitors. The activity lost by treatment with chelating agents could be restored by Mn2+ or Zn2+ which also stimulated the native enzyme. This suggests that it is a metalloprotease with a serine residue essential for the activity. The native enzyme had an apparent molecular mass of 430 kDa on gradient-gel electrophoresis and subunits of 43 kDa as determined by SDS/PAGE. The enzyme catalyzed the synthesis of peptide and amino acid derivatives such as Asp-Phe-OMe (Aspartame) and malyl-Tyr-OEt from L-Asp and L-malic acid as acyl donors and L-Phe-OMe and L-Tyr-OEt as nucleophiles, respectively. The use of the enzyme as a reagent in protease-catalyzed peptide synthesis, N-terminal protection and subsequent deprotection, is described.

  16. Chemical synthesis and enzymatic, stereoselective hydrolysis of a functionalized dihydropyrimidine for the synthesis of β-amino acids.

    PubMed

    Slomka, Christin; Zhong, Sabilla; Fellinger, Anna; Engel, Ulrike; Syldatk, Christoph; Bräse, Stefan; Rudat, Jens

    2015-12-01

    A novel substrate, 6-(4-nitrophenyl)dihydropyrimidine-2,4(1H,3H)-dione (pNO2PheDU), was chemically synthesized and analytically verified for the potential biocatalytic synthesis of enantiopure β-amino acids. The hydantoinase (EC 3.5.2.2) from Arthrobacter crystallopoietes DSM20117 was chosen to prove the enzymatic hydrolysis of this substrate, since previous investigations showed activities of this enzyme toward 6-monosubstituted dihydrouracils. Whole cell biotransformations with recombinant Escherichia coli expressing the hydantoinase showed degradation of pNO2PheDU. Additionally, the corresponding N-carbamoyl-β-amino acid (NCarbpNO2 βPhe) was chemically synthesized, an HPLC-method with chiral stationary phases for detection of this product was established and thus (S)-enantioselectivity toward pNO2PheDU has been shown. Consequently this novel substrate is a potential precursor for the enantiopure β-amino acid para-nitro-β-phenylalanine (pNO2 βPhe). PMID:26705241

  17. [Synthesis of D-ribulose-1,5-diphosphate with immobilized enzymes of Thiobacillus].

    PubMed

    Khaga, M E; Mikel'saar, P Ch; Liaene, A E; Aaviksaar, A A; Peenema, E V

    1979-01-01

    Preparative synthesis of D-ribulose-1,5-diphosphate (RuDP) from ribose-5-phosphate and ATP was carried out, using as a catalyst a crude extract of Thiobacillus thiooxidans 58 R immobilized on porous glass. The methods for immobiliztion of crude bacterial extracts, synthesis of RuDP and purification of the resultant product by means of column chromatography on activated charcoal and anionites were developed. The structure of RuDP was identified by 13C-NMR spectroscopy. Stability of two phosphate groups of RuDP during acid and alkaline hydrolysis proved to be different: both phosphate groups were completely removed in 1 N H2SO4 at 100 degrees C whereas only one phosphate group was hydrolysed in 1 N NaOH at 25 degrees C. This finding is at variance with the earlier results of Horecker et al. (1956).

  18. PlsX deletion impacts fatty acid synthesis and acid adaptation in Streptococcus mutans.

    PubMed

    Cross, Benjamin; Garcia, Ariana; Faustoferri, Roberta; Quivey, Robert G

    2016-04-01

    Streptococcus mutans, one of the primary causative agents of dental caries in humans, ferments dietary sugars in the mouth to produce organic acids. These acids lower local pH values, resulting in demineralization of the tooth enamel, leading to caries. To survive acidic environments, Strep. mutans employs several adaptive mechanisms, including a shift from saturated to unsaturated fatty acids in membrane phospholipids. PlsX is an acyl-ACP : phosphate transacylase that links the fatty acid synthase II (FASII) pathway to the phospholipid synthesis pathway, and is therefore central to the movement of unsaturated fatty acids into the membrane. Recently, we discovered that plsX is not essential in Strep. mutans. A plsX deletion mutant was not a fatty acid or phospholipid auxotroph. Gas chromatography of fatty acid methyl esters indicated that membrane fatty acid chain length in the plsX deletion strain differed from those detected in the parent strain, UA159. The deletion strain displayed a fatty acid shift similar to WT, but had a higher percentage of unsaturated fatty acids at low pH. The deletion strain survived significantly longer than the parent strain when cultures were subjected to an acid challenge of pH 2.5.The ΔplsX strain also exhibited elevated F-ATPase activity at pH 5.2, compared with the parent. These results indicate that the loss of plsX affects both the fatty acid synthesis pathway and the acid-adaptive response of Strep. mutans. PMID:26850107

  19. West Nile virus replication requires fatty acid synthesis but is independent on phosphatidylinositol-4-phosphate lipids.

    PubMed

    Martín-Acebes, Miguel A; Blázquez, Ana-Belén; Jiménez de Oya, Nereida; Escribano-Romero, Estela; Saiz, Juan-Carlos

    2011-01-01

    West Nile virus (WNV) is a neurovirulent mosquito-borne flavivirus, which main natural hosts are birds but it also infects equines and humans, among other mammals. As in the case of other plus-stranded RNA viruses, WNV replication is associated to intracellular membrane rearrangements. Based on results obtained with a variety of viruses, different cellular processes have been shown to play important roles on these membrane rearrangements for efficient viral replication. As these processes are related to lipid metabolism, fatty acid synthesis, as well as generation of a specific lipid microenvironment enriched in phosphatidylinositol-4-phosphate (PI4P), has been associated to it in other viral models. In this study, intracellular membrane rearrangements following infection with a highly neurovirulent strain of WNV were addressed by means of electron and confocal microscopy. Infection of WNV, and specifically viral RNA replication, were dependent on fatty acid synthesis, as revealed by the inhibitory effect of cerulenin and C75, two pharmacological inhibitors of fatty acid synthase, a key enzyme of this process. However, WNV infection did not induce redistribution of PI4P lipids, and PI4P did not localize at viral replication complex. Even more, WNV multiplication was not inhibited by the use of the phosphatidylinositol-4-kinase inhibitor PIK93, while infection by the enterovirus Coxsackievirus B5 was reduced. Similar features were found when infection by other flavivirus, the Usutu virus (USUV), was analyzed. These features of WNV replication could help to design specific antiviral approaches against WNV and other related flaviviruses.

  20. A Study on Amino Acids: Synthesis of Alpha-Aminophenylacetic Acid (Phenylglycine) and Determination of its Isoelectric Point.

    ERIC Educational Resources Information Center

    Barrelle, M.; And Others

    1983-01-01

    Background information and procedures are provided for an experimental study on aminophenylacetic acid (phenylglycine). These include physical chemistry (determination of isoelectric point by pH measurement) and organic chemistry (synthesis of an amino acid in racemic form) experiments. (JN)

  1. Effect of Infection with Ribonucleic Acid Bacteriophage R23 on the Inducible Synthesis of β-Galactosidase in Escherichia coli

    PubMed Central

    Watanabe, Hiroko; Watanabe, Mamoru

    1968-01-01

    Infection by ribonucleic acid (RNA) bacteriophage R23 inhibited the synthesis of β-galactosidase in Escherichia coli. The inhibition, although not complete, was apparent shortly after infection and was maximal after the first 20 min of infection. R23 diminished the β-galactosidase-synthesizing capacity when inducer was added after phage infection, but not when infection followed inducer removal. These findings suggested that the primary effect of R23 on enzyme-forming capacity was limitation of synthesis of enzyme-specific messenger RNA. Studies with ultraviolet irradiated phage and amber mutants of R23 indicated that the inhibitory process could be separated into two phases. Early inhibition did not require the expression of the viral genome, whereas late inhibition required the expression of the viral RNA synthetase cistron. PMID:4910818

  2. Comparative genomics of citric-acid producing Aspergillus niger ATCC 1015 versus enzyme-producing CBS 513.88

    SciTech Connect

    Andersen, Mikael R.; Salazar, Margarita; Schaap, Peter; van de Vondervoort, Peter; Culley, David E.; Thykaer, Jette; Frisvad, Jens C.; Nielsen, Kristian F.; Albang, Richard; Albermann, Kaj; Berka, Randy; Braus, Gerhard; Braus-Stromeyer, Susanna A.; Corrochano, Luis; Dai, Ziyu; van Dijck, Piet; Hofmann, Gerald; Lasure, Linda L.; Magnuson, Jon K.; Menke, Hildegard; Meijer, Martin; Meijer, Susan; Nielsen, Jakob B.; Nielsen, Michael L.; van Ooyen, Albert; Pel, Herman J.; Poulsen, Lars; Samson, Rob; Stam, Hein; Tsang, Adrian; van den Brink, Johannes M.; ATkins, Alex; Aerts, Andrea; Shapiro, Harris; Pangilinan, Jasmyn; Salamov, Asaf; Lou, Yigong; Lindquist, Erika; Lucas, Susan; Grimwood, Jane; Grigoriev, Igor V.; Kubicek, Christian P.; Martinez, Diego; van Peij, Noel; Roubos, Johannes A.; Nielsen, Jens B.; Baker, Scott E.

    2011-06-01

    The filamentous fungus Aspergillus niger exhibits great diversity in its phenotype. It is found globally, both as marine and terrestrial strains, produces both organic acids and hydrolytic enzymes in high amounts, and some isolates exhibit pathogenicity. Although the genome of an industrial enzyme-producing A. niger strain (CBS 513.88) has already been sequenced, the versatility and diversity of this species compels additional exploration. We therefore undertook whole genome sequencing of the acidogenic A. niger wild type strain (ATCC 1015), and produced a genome sequence of very high quality. Only 15 gaps are present in the sequence and half the telomeric regions have been elucidated. Moreover, sequence information from ATCC 1015 was utilized to improve the genome sequence of CBS 513.88. Chromosome-level comparisons uncovered several genome rearrangements, deletions, a clear case of strain-specific horizontal gene transfer, and identification of 0.8 megabase of novel sequence. Single nucleotide polymorphisms per kilobase (SNPs/kb) between the two strains were found to be exceptionally high (average: 7.8, maximum: 160 SNPs/kb). High variation within the species was confirmed with exo-metabolite profiling and phylogenetics. Detailed lists of alleles were generated, and genotypic differences were observed to accumulate in metabolic pathways essential to acid production and protein synthesis. A transcriptome analysis revealed up-regulation of the electron transport chain, specifically the alternative oxidative pathway in ATCC 1015, while CBS 513.88 showed significant up regulation of genes associated with biosynthesis of amino acids that are abundant in glucoamylase A, tRNA-synthases and protein transporters.

  3. Impacts of simulated acid rain on soil enzyme activities in a latosol.

    PubMed

    Ling, Da-Jiong; Huang, Qian-Chun; Ouyang, Ying

    2010-11-01

    Acid rain pollution is a serious environmental problem in the world. This study investigated impacts of simulated acid rain (SAR) upon four types of soil enzymes, namely the catalase, acid phosphatase, urease, and amylase, in a latosol. Latosol is an acidic red soil and forms in the tropical rainforest biome. Laboratory experiments were performed by spraying the soil columns with the SAR at pH levels of 2.5, 3.0, 3.5., 4.0, 4.5, 5.0, and 7.0 (control) over a 20-day period. Mixed results were obtained in enzyme activities for different kinds of enzymes under the influences of the SAR. The catalase activities increased rapidly from day 0 to 5, then decreased slightly from day 5 to 15, and finally decreased sharply to the end of the experiments, whereas the acid phosphatase activities decreased rapidly from day 0 to 5, then increased slightly from day 5 to 15, and finally decreased dramatically to the end of the experiments. A decrease in urease activities was observed at all of the SAR pH levels for the entire experimental period, while an increase from day 0 to 5 and then a decrease from day 5 to 20 in amylase activities were observed at all of the SAR pH levels. In general, the catalase, acid phosphatase, and urease activities increased with the SAR pH levels. However, the maximum amylase activity was found at pH 4.0 and decreased as the SAR pH increased from 4.0 to 5.0 or decreased from 4.0 to 2.5. It is apparent that acid rain had adverse environmental impacts on soil enzyme activities in the latosol. Our study further revealed that impacts of the SAR upon soil enzyme activities were in the following order: amylase>catalase>acid phosphatase>urease. These findings provide useful information on better understanding and managing soil biological processes in the nature under the influence of acid rains.

  4. Synthesis and Characterization of Fatty Acid Conjugates of Niacin and Salicylic Acid.

    PubMed

    Vu, Chi B; Bemis, Jean E; Benson, Ericka; Bista, Pradeep; Carney, David; Fahrner, Richard; Lee, Diana; Liu, Feng; Lonkar, Pallavi; Milne, Jill C; Nichols, Andrew J; Picarella, Dominic; Shoelson, Adam; Smith, Jesse; Ting, Amal; Wensley, Allison; Yeager, Maisy; Zimmer, Michael; Jirousek, Michael R

    2016-02-11

    This report describes the synthesis and preliminary biological characterization of novel fatty acid niacin conjugates and fatty acid salicylate conjugates. These molecular entities were created by covalently linking two bioactive molecules, either niacin or salicylic acid, to an omega-3 fatty acid. This methodology allows the simultaneous intracellular delivery of two bioactives in order to elicit a pharmacological response that could not be replicated by administering the bioactives individually or in combination. The fatty acid niacin conjugate 5 has been shown to be an inhibitor of the sterol regulatory element binding protein (SREBP), a key regulator of cholesterol metabolism proteins such as PCSK9, HMG-CoA reductase, ATP citrate lyase, and NPC1L1. On the other hand, the fatty acid salicylate conjugate 11 has been shown to have a unique anti-inflammatory profile based on its ability to modulate the NF-κB pathway through the intracellular release of the two bioactives.

  5. Synthesis of a Comprehensive Polyprenol Library for Evaluation of Bacterial Enzyme Lipid Substrate Specificity

    PubMed Central

    Wu, Baolin; Woodward, Robert; Wen, Liuqing; Wang, Xuan; Zhao, Guohui

    2013-01-01

    Polyprenols, a type of universal glycan lipid carrier, play important roles for glycan bio-assembly in wide variety of living systems. Chemical synthesis of natural polyisoprenols such as undecaprenol and dolichols, but especially their homologs, could serves as a powerful molecular tool to dissect and define the functions of enzymes involved in glycan biosynthesis. In this paper, we report an efficient and reliable method to construct this type of hydrophoic molecule through a base-mediated iterative coupling approach using a key bifunctional (Z, Z)-diisoprenyl building block. The ligation with N-acetyl-D-glactosamine (GalNAc) with a set of the synthesized lipid analogs forming polyprenol pyrophosphate linked GalNAc (GalNAc-PP-lipid) conjugates is also demonstrated. PMID:24511260

  6. Isolation of a mutation resulting in constitutive synthesis of L-fucose catabolic enzymes.

    PubMed Central

    Bartkus, J M; Mortlock, R P

    1986-01-01

    A ribitol-positive transductant of Escherichia coli K-12, JM2112, was used to facilitate the isolation and identification of mutations affecting the L-fucose catabolic pathway. Analysis of L-fucose-negative mutants of JM2112 enabled us to confirm that L-fucose-1-phosphate is the apparent inducer of the fucose catabolic enzymes. Plating of an L-fuculokinase-negative mutant of JM2112 on D-arabinose yielded an isolate containing a second fucose mutation which resulted in the constitutive synthesis of L-fucose permease, isomerase, and kinase. This constitutive mutation differs from the constitutive mutation described by Chen et al. (J. Bacteriol. 159:725-729, 1984) in that it is tightly linked to the fucose genes and appears to be located in the gene believed to code for the positive activator of the L-fucose genes. PMID:3005235

  7. Ammonia lyases and aminomutases as biocatalysts for the synthesis of α-amino and β-amino acids.

    PubMed

    Turner, Nicholas J

    2011-04-01

    Ammonia lyases catalyse the reversible addition of ammonia to cinnamic acid (1: R=H) and p-hydroxycinnamic (1: R=OH) to generate L-phenylalanine (2: R=H) and L-tyrosine (2: R=OH) respectively (Figure 1a). Both phenylalanine ammonia lyase (PAL) and tyrosine ammonia lyase (TAL) are widely distributed in plants, fungi and prokaryotes. Recently there has been interest in the use of these enzymes for the synthesis of a broader range of L-arylalanines. Aminomutases catalyse a related reaction, namely the interconversion of α-amino acids to β-amino acids (Figure 1b). In the case of L-phenylalanine, this reaction is catalysed by phenylalanine aminomutase (PAM) and proceeds stereospecifically via the intermediate cinnamic acid to generate β-Phe 3. Ammonia lyases and aminomutases are related in sequence and structure and share the same active site cofactor 4-methylideneimidazole-5-one (MIO). There is currently interest in the possibility of using these biocatalysts to prepare a wide range of enantiomerically pure l-configured α-amino and β-amino acids. Recent reviews have focused on the mechanism of these MIO containing enzymes. The aim of this review is to review recent progress in the application of ammonia lyase and aminomutase enzymes to prepare enantiomerically pure α-amino and β-amino acids.

  8. Ribonucleic Acid Regulation in Permeabilized Cells of Escherichia coli Capable of Ribonucleic Acid and Protein Synthesis1

    PubMed Central

    Atherly, Alan G.

    1974-01-01

    A cell permeabilization procedure is described that reduces viability less than 10% and does not significantly reduce the rates of ribonucleic acid and protein synthesis when appropriately supplemented. Permeabilization abolishes the normal stringent coupling of protein and ribonucleic acid synthesis. PMID:4364330

  9. The Impact of Enzyme Characteristics on Corn Stover Fiber Degradation and Acid Production During Ensiled Storage

    NASA Astrophysics Data System (ADS)

    Ren, Haiyu; Richard, Tom L.; Moore, Kenneth J.

    Ensilage can be used to store lignocellulosic biomass before industrial bioprocessing. This study investigated the impacts of seven commerical enzyme mixtures derived from Aspergillus niger, Trichoderma reesei, and T. longibrachiatum. Treatments included three size grades of corn stover, two enzyme levels (1.67 and 5 IU/g dry matter based on hemicellulase), and various ratios of cellulase to hemicellulase (C ∶ H). The highest C ∶ H ratio tested, 2.38, derived from T. reesei, resulted in the most effective fermentation, with lactic acid as the dominant product. Enzymatic activity during storage may complement industrial pretreatment; creating synergies that could reduce total bioconversion costs.

  10. Novel inhibitors of Rad6 ubiquitin conjugating enzyme: design, synthesis, identification, and functional characterization.

    PubMed

    Sanders, Matthew A; Brahemi, Ghali; Nangia-Makker, Pratima; Balan, Vitaly; Morelli, Matteo; Kothayer, Hend; Westwell, Andrew D; Shekhar, Malathy P V

    2013-04-01

    Protein ubiquitination is important for cell signaling, DNA repair, and proteasomal degradation, and it is not surprising that alterations in ubiquitination occur frequently in cancer. Ubiquitin-conjugating enzymes (E2) mediate ubiquitination by selective interactions with ubiquitin-activating (E1) and ubiquitin ligase (E3) enzymes, and thus selective E2 small molecule inhibitor (SMI) will provide specificity unattainable with proteasome inhibitors. Here we describe synthesis and functional characterization of the first SMIs of human E2 Rad6B, a fundamental component of translesion synthesis DNA repair. A pharmacophore model for consensus E2 ubiquitin-binding sites was generated for virtual screening to identify E2 inhibitor candidates. Twelve triazine (TZ) analogs screened in silico by molecular docking to the Rad6B X-ray structure were verified by their effect on Rad6B ubiquitination of histone H2A. TZs #8 and 9 docked to the Rad6B catalytic site with highest complementarity. TZs #1, 2, 8, and 9 inhibited Rad6B-ubiquitin thioester formation and subsequent ubiquitin transfer to histone H2A. SMI #9 inhibition of Rad6 was selective as BCA2 ubiquitination by E2 UbcH5 was unaffected by SMI #9. SMI #9 more potently inhibited proliferation, colony formation, and migration than SMI #8, and induced MDA-MB-231 breast cancer cell G2-M arrest and apoptosis. Ubiquitination assays using Rad6 immunoprecipitated from SMI #8- or 9-treated cells confirmed inhibition of endogenous Rad6 activity. Consistent with our previous data showing Rad6B-mediated polyubiquitination stabilizes β-catenin, MDA-MB-231 treatment with SMIs #8 or 9 decreased β-catenin protein levels. Together these results describe identification of the first Rad6 SMIs.

  11. Enzyme-catalyzed synthesis of saccharide acrylate monomers from nonedible biomass.

    PubMed

    Kloosterman, Wouter M J; Brouwer, Sander G M; Loos, Katja

    2014-08-01

    Various cellulase preparations were found to catalyze the transglycosidation between cotton linters and 2-hydroxyethyl acrylate. The conversion and enzyme activity were found to be optimal in reaction mixtures that contained 5 vol % of the acrylate. The structures of the products were revealed by using TLC and (1) H and (13) C NMR spectroscopy. The enzyme-catalyzed reaction resulted in two products. The minor product originated from transglycosidation to hemicellulose and was found to be 2-(β-xylosyloxy)-ethyl acrylate. The major product was identified as 2-(β-glucosyloxy)-ethyl acrylate and the yield of the product was 5 wt % based on the amount of consumed cellulose. Glycosidation products with oligosaccharide moieties could not be detected in the reaction mixture. This result can be explained by the hydrolytic activities of the used cellulase preparation. Cellulase from Trichoderma reesei was found to possess, in addition to endoglucanase activity, cellobiosidase and β-glucosidase activities. Five other cellulase preparations from different origins were tested as well for catalysis of oligosaccharide acrylate synthesis. For most cellulase preparations the major transglycosidation product appeared to be 2-(β-glucosyloxy)-ethyl acrylate. Nevertheless, the endo-β-(1,4)-glucanase from Trichoderma longibrachiatum was found to catalyze the synthesis of 2-(β-cellobiosyloxy)-ethyl acrylate. Unlike the other cellulase preparations, endo-β-(1,4)-glucanase from T. longibrachiatum showed no detectable β-glucosidase activity and therefore oligosaccharide acrylate monomers were not further hydrolyzed into the monosaccharide acrylate 2-(β-glucosyloxy)-ethyl acrylate. PMID:24866837

  12. Medium chain fatty acid ethyl esters - activation of antimicrobial effects by Malassezia enzymes.

    PubMed

    Mayser, Peter

    2015-04-01

    Free medium and short chain fatty acids are known to have broad antimicrobial activity. However, their practical use in topical therapy is limited by their intensive smell and acidity. Surprisingly, a nearly identical antimicrobial effect was found with the ethyl ester derivatives of these fatty acids, but only against Malassezia (M.) yeast, not against Candida spp. Obviously, these esters are hydrolysed by M. enzymes, thus generating a selective activation of antimicrobial activity especially in areas well populated with these yeast ('targeting'). Octanoic acid ethyl ester (CAS 106-32-1) was found to be most suitable. In an agar dilution test, the minimal inhibitory concentrations against M. globosa, M. pachydermatis and M. sympodialis, respectively, ranged between ~5 and 10 mmol l(-1) after 10 days of incubation. The effect started immediately and was not delayed by other lipid sources applied simultaneously. Based on these data, fatty acid monoesters may represent a new therapeutic concept in M.-associated diseases. PMID:25676074

  13. Combinatorial mutagenesis to restrict amino acid usage in an enzyme to a reduced set

    PubMed Central

    Akanuma, Satoshi; Kigawa, Takanori; Yokoyama, Shigeyuki

    2002-01-01

    We developed an effective strategy to restrict the amino acid usage in a relatively large protein to a reduced set with conservation of its in vivo function. The 213-residue Escherichia coli orotate phosphoribosyltransferase was subjected to 22 cycles of segment-wise combinatorial mutagenesis followed by 6 cycles of site-directed random mutagenesis, both coupled with a growth-related phenotype selection. The enzyme eventually tolerated 73 amino acid substitutions: In the final variant, 9 amino acid types (A, D, G, L, P, R, T, V, and Y) occupied 188 positions (88%), and none of 7 amino acid types (C, H, I, M, N, Q, and W) appeared. Therefore, the catalytic function associated with a relatively large protein may be achieved with a subset of the 20 amino acid. The converged sequence also implies simpler constituents for proteins in the early stage of evolution. PMID:12361984

  14. Morphological characteristics, oxidative stability and enzymic hydrolysis of amylose-fatty acid complexes.

    PubMed

    Marinopoulou, Anna; Papastergiadis, Efthimios; Raphaelides, Stylianos N; Kontominas, Michael G

    2016-05-01

    Complexes of amylose with fatty acids varying in carbon chain length and degree of unsaturation were prepared at 30, 50 or 70°C by dissolving amylose in 0.1N KOH and mixing with fatty acid potassium soap solution. The complexes were obtained in solid form as precipitates after neutralization. SEM microscopy revealed that the morphology of the complexes was that of ordered lamellae separated from amorphous regions whereas confocal laser scanning microscopy showed images of the topography of the guest molecules in the complex matrix. FTIR spectroscopy revealed that the absorption peak attributed to carbonyl group of free fatty acid was shifted when the fatty acid was in the form of amylose complex. Thermo-gravimetry showed that the unsaturated fatty acids were effectively protected from oxidation when they were complexed with amylose whereas enzymic hydrolysis experiments showed that the guest molecules were quantitatively released from the amylose complexes. PMID:26877002

  15. Morphological characteristics, oxidative stability and enzymic hydrolysis of amylose-fatty acid complexes.

    PubMed

    Marinopoulou, Anna; Papastergiadis, Efthimios; Raphaelides, Stylianos N; Kontominas, Michael G

    2016-05-01

    Complexes of amylose with fatty acids varying in carbon chain length and degree of unsaturation were prepared at 30, 50 or 70°C by dissolving amylose in 0.1N KOH and mixing with fatty acid potassium soap solution. The complexes were obtained in solid form as precipitates after neutralization. SEM microscopy revealed that the morphology of the complexes was that of ordered lamellae separated from amorphous regions whereas confocal laser scanning microscopy showed images of the topography of the guest molecules in the complex matrix. FTIR spectroscopy revealed that the absorption peak attributed to carbonyl group of free fatty acid was shifted when the fatty acid was in the form of amylose complex. Thermo-gravimetry showed that the unsaturated fatty acids were effectively protected from oxidation when they were complexed with amylose whereas enzymic hydrolysis experiments showed that the guest molecules were quantitatively released from the amylose complexes.

  16. Synthesis and characterization of magnetite nanoparticles coated with lauric acid

    SciTech Connect

    Mamani, J.B.; Costa-Filho, A.J.; Cornejo, D.R.; Vieira, E.D.; Gamarra, L.F.

    2013-07-15

    Understanding the process of synthesis of magnetic nanoparticles is important for its implementation in in vitro and in vivo studies. In this work we report the synthesis of magnetic nanoparticles made from ferrous oxide through coprecipitation chemical process. The nanostructured material was coated with lauric acid and dispersed in aqueous medium containing surfactant that yielded a stable colloidal suspension. The characterization of magnetic nanoparticles with distinct physico-chemical configurations is fundamental for biomedical applications. Therefore magnetic nanoparticles were characterized in terms of their morphology by means of TEM and DLS, which showed a polydispersed set of spherical nanoparticles (average diameter of ca. 9 nm) as a result of the protocol. The structural properties were characterized by using X-ray diffraction (XRD). XRD pattern showed the presence of peaks corresponding to the spinel phase of magnetite (Fe{sub 3}O{sub 4}). The relaxivities r{sub 2} and r{sub 2}* values were determined from the transverse relaxation times T{sub 2} and T{sub 2}* at 3 T. Magnetic characterization was performed using SQUID and FMR, which evidenced the superparamagnetic properties of the nanoparticles. Thermal characterization using DSC showed exothermic events associated with the oxidation of magnetite to maghemite. - Highlights: • Synthesis of magnetic nanoparticles coated with lauric acid • Characterization of magnetic nanoparticles • Morphological, structural, magnetic, calorimetric and relaxometric characterization.

  17. Synthesis and evaluation of 2,5-dihydrochorismate analogues as inhibitors of the chorismate-utilising enzymes.

    PubMed

    Payne, Richard J; Bulloch, Esther M M; Toscano, Miguel M; Jones, Michelle A; Kerbarh, Olivier; Abell, Chris

    2009-06-01

    A library of 2,5-dihydrochorismate analogues were designed as inhibitors of the chorismate-utilising enzymes including anthranilate synthase, isochorismate synthase, salicylate synthase and 4-amino-4-deoxychorismate synthase. The inhibitors were synthesised in seven or eight steps from shikimic acid, sourced from star anise. The compounds exhibited moderate but differential inhibition against the four chorismate-utilising enzymes.

  18. Ravynic acid, an antibiotic polyeneyne tetramic acid from Penicillium sp. elucidated through synthesis.

    PubMed

    Myrtle, J D; Beekman, A M; Barrow, R A

    2016-09-21

    A new antibiotic natural product, ravynic acid, has been isolated from a Penicillium sp. of fungus, collected from Ravensbourne National Park. The 3-acylpolyenyne tetramic acid structure was definitively elucidated via synthesis. Highlights of the synthetic method include the heat induced formation of the 3-acylphosphorane tetramic acid and a selective Wittig cross-coupling to efficiently prepare the natural compounds carbon skeleton. The natural compound was shown to inhibit the growth of Staphylococcus aureus down to concentrations of 2.5 µg mL(-1). PMID:27519121

  19. Production of L-lactic Acid from Biomass Wastes Using Scallop Crude Enzymes and Novel Lactic Acid Bacterium

    NASA Astrophysics Data System (ADS)

    Yanagisawa, Mitsunori; Nakamura, Kanami; Nakasaki, Kiyohiko

    In the present study, biomass waste raw materials including paper mill sludge, bamboo, sea lettuce, and shochu residue (from a distiller) and crude enzymes derived from inedible and discarded scallop parts were used to produce L-lactic acid for the raw material of biodegradable plastic poly-lactic acid. The activities of cellulase and amylase in the crude enzymes were 22 and 170units/L, respectively, and L-lactic acid was produced from every of the above mentioned biomass wastes, by the method of liquid-state simultaneous saccharification and fermentation (SSF) . The L-lactic acid concentrations produced from sea lettuce and shochu residue, which contain high concentration of starch were 3.6 and 9.3g/L, respectively, and corresponded to greater than 25% of the conversion of glucans contained in these biomass wastes. Furthermore, using the solid state SSF method, concentrations as high as 13g/L of L-lactic acid were obtained from sea lettuce and 26g/L were obtained from shochu residue.

  20. Ribulose 1,5-Diphosphate Carboxylase Synthesis in Euglena: II. Effect of Inhibitors on Enzyme Synthesis during Regreening and Subsequent Transfer to Darkness.

    PubMed

    Lord, J M; Armitage, T L; Merrett, M J

    1975-11-01

    Dark-grown Euglena gracilis Klebs strain Z Pringsheim cells, which have been partially regreened in the light, show a striking, continued synthesis of the chloroplast enzyme ribulose 1,5-diphosphate carboxylase on transfer back into darkness. This dark synthesis of the enzyme was completely prevented by the addition of 15 mug/ml of cycloheximide to the culture medium but was unaffected, for at least 8 hours, by the addition of 1 mg/ml of d-threo-chloramphenicol. The addition of either cycloheximide or d-threo-chloramphenicol to dark-grown cultures at the onset of illumination completely inhibited the light-induced synthesis of ribulose 1,5-diphosphate carboxylase. When cells which had been illuminated in the presence of d-threo-chloramphenicol, and hence were unable to synthesize ribulose 1,5-diphosphate carboxylase, were transferred to darkness in the absence of this inhibitor, synthesis of the carboxylase then occurred. Dark-grown cells which had been illuminated in the presence of cycloheximide failed to synthesize the enzyme when placed in the dark in the absence of cycloheximide. The addition of 5-fluorouracil to regreening cultures to prevent light-induced transcriptional steps completely blocked the synthesis of ribulose 1,5-diphosphate carboxylase.

  1. Evolutionary distinctiveness of fatty acid and polyketide synthesis in eukaryotes

    PubMed Central

    Kohli, Gurjeet S; John, Uwe; Van Dolah, Frances M; Murray, Shauna A

    2016-01-01

    Fatty acids, which are essential cell membrane constituents and fuel storage molecules, are thought to share a common evolutionary origin with polyketide toxins in eukaryotes. While fatty acids are primary metabolic products, polyketide toxins are secondary metabolites that are involved in ecologically relevant processes, such as chemical defence, and produce the adverse effects of harmful algal blooms. Selection pressures on such compounds may be different, resulting in differing evolutionary histories. Surprisingly, some studies of dinoflagellates have suggested that the same enzymes may catalyse these processes. Here we show the presence and evolutionary distinctiveness of genes encoding six key enzymes essential for fatty acid production in 13 eukaryotic lineages for which no previous sequence data were available (alveolates: dinoflagellates, Vitrella, Chromera; stramenopiles: bolidophytes, chrysophytes, pelagophytes, raphidophytes, dictyochophytes, pinguiophytes, xanthophytes; Rhizaria: chlorarachniophytes, haplosporida; euglenids) and 8 other lineages (apicomplexans, bacillariophytes, synurophytes, cryptophytes, haptophytes, chlorophyceans, prasinophytes, trebouxiophytes). The phylogeny of fatty acid synthase genes reflects the evolutionary history of the organism, indicating selection to maintain conserved functionality. In contrast, polyketide synthase gene families are highly expanded in dinoflagellates and haptophytes, suggesting relaxed constraints in their evolutionary history, while completely absent from some protist lineages. This demonstrates a vast potential for the production of bioactive polyketide compounds in some lineages of microbial eukaryotes, indicating that the evolution of these compounds may have played an important role in their ecological success. PMID:26784357

  2. Evolutionary distinctiveness of fatty acid and polyketide synthesis in eukaryotes.

    PubMed

    Kohli, Gurjeet S; John, Uwe; Van Dolah, Frances M; Murray, Shauna A

    2016-08-01

    Fatty acids, which are essential cell membrane constituents and fuel storage molecules, are thought to share a common evolutionary origin with polyketide toxins in eukaryotes. While fatty acids are primary metabolic products, polyketide toxins are secondary metabolites that are involved in ecologically relevant processes, such as chemical defence, and produce the adverse effects of harmful algal blooms. Selection pressures on such compounds may be different, resulting in differing evolutionary histories. Surprisingly, some studies of dinoflagellates have suggested that the same enzymes may catalyse these processes. Here we show the presence and evolutionary distinctiveness of genes encoding six key enzymes essential for fatty acid production in 13 eukaryotic lineages for which no previous sequence data were available (alveolates: dinoflagellates, Vitrella, Chromera; stramenopiles: bolidophytes, chrysophytes, pelagophytes, raphidophytes, dictyochophytes, pinguiophytes, xanthophytes; Rhizaria: chlorarachniophytes, haplosporida; euglenids) and 8 other lineages (apicomplexans, bacillariophytes, synurophytes, cryptophytes, haptophytes, chlorophyceans, prasinophytes, trebouxiophytes). The phylogeny of fatty acid synthase genes reflects the evolutionary history of the organism, indicating selection to maintain conserved functionality. In contrast, polyketide synthase gene families are highly expanded in dinoflagellates and haptophytes, suggesting relaxed constraints in their evolutionary history, while completely absent from some protist lineages. This demonstrates a vast potential for the production of bioactive polyketide compounds in some lineages of microbial eukaryotes, indicating that the evolution of these compounds may have played an important role in their ecological success. PMID:26784357

  3. Vanillin formation from ferulic acid in Vanilla planifolia is catalysed by a single enzyme

    PubMed Central

    Gallage, Nethaji J.; Hansen, Esben H.; Kannangara, Rubini; Olsen, Carl Erik; Motawia, Mohammed Saddik; Jørgensen, Kirsten; Holme, Inger; Hebelstrup, Kim; Grisoni, Michel; Møller, Birger Lindberg

    2014-01-01

    Vanillin is a popular and valuable flavour compound. It is the key constituent of the natural vanilla flavour obtained from cured vanilla pods. Here we show that a single hydratase/lyase type enzyme designated vanillin synthase (VpVAN) catalyses direct conversion of ferulic acid and its glucoside into vanillin and its glucoside, respectively. The enzyme shows high sequence similarity to cysteine proteinases and is specific to the substitution pattern at the aromatic ring and does not metabolize caffeic acid and p-coumaric acid as demonstrated by coupled transcription/translation assays. VpVAN localizes to the inner part of the vanilla pod and high transcript levels are found in single cells located a few cell layers from the inner epidermis. Transient expression of VpVAN in tobacco and stable expression in barley in combination with the action of endogenous alcohol dehydrogenases and UDP-glucosyltransferases result in vanillyl alcohol glucoside formation from endogenous ferulic acid. A gene encoding an enzyme showing 71% sequence identity to VpVAN was identified in another vanillin-producing plant species Glechoma hederacea and was also shown to be a vanillin synthase as demonstrated by transient expression in tobacco. PMID:24941968

  4. Vanillin formation from ferulic acid in Vanilla planifolia is catalysed by a single enzyme.

    PubMed

    Gallage, Nethaji J; Hansen, Esben H; Kannangara, Rubini; Olsen, Carl Erik; Motawia, Mohammed Saddik; Jørgensen, Kirsten; Holme, Inger; Hebelstrup, Kim; Grisoni, Michel; Møller, Birger Lindberg

    2014-01-01

    Vanillin is a popular and valuable flavour compound. It is the key constituent of the natural vanilla flavour obtained from cured vanilla pods. Here we show that a single hydratase/lyase type enzyme designated vanillin synthase (VpVAN) catalyses direct conversion of ferulic acid and its glucoside into vanillin and its glucoside, respectively. The enzyme shows high sequence similarity to cysteine proteinases and is specific to the substitution pattern at the aromatic ring and does not metabolize caffeic acid and p-coumaric acid as demonstrated by coupled transcription/translation assays. VpVAN localizes to the inner part of the vanilla pod and high transcript levels are found in single cells located a few cell layers from the inner epidermis. Transient expression of VpVAN in tobacco and stable expression in barley in combination with the action of endogenous alcohol dehydrogenases and UDP-glucosyltransferases result in vanillyl alcohol glucoside formation from endogenous ferulic acid. A gene encoding an enzyme showing 71% sequence identity to VpVAN was identified in another vanillin-producing plant species Glechoma hederacea and was also shown to be a vanillin synthase as demonstrated by transient expression in tobacco. PMID:24941968

  5. Vanillin formation from ferulic acid in Vanilla planifolia is catalysed by a single enzyme.

    PubMed

    Gallage, Nethaji J; Hansen, Esben H; Kannangara, Rubini; Olsen, Carl Erik; Motawia, Mohammed Saddik; Jørgensen, Kirsten; Holme, Inger; Hebelstrup, Kim; Grisoni, Michel; Møller, Birger Lindberg

    2014-06-19

    Vanillin is a popular and valuable flavour compound. It is the key constituent of the natural vanilla flavour obtained from cured vanilla pods. Here we show that a single hydratase/lyase type enzyme designated vanillin synthase (VpVAN) catalyses direct conversion of ferulic acid and its glucoside into vanillin and its glucoside, respectively. The enzyme shows high sequence similarity to cysteine proteinases and is specific to the substitution pattern at the aromatic ring and does not metabolize caffeic acid and p-coumaric acid as demonstrated by coupled transcription/translation assays. VpVAN localizes to the inner part of the vanilla pod and high transcript levels are found in single cells located a few cell layers from the inner epidermis. Transient expression of VpVAN in tobacco and stable expression in barley in combination with the action of endogenous alcohol dehydrogenases and UDP-glucosyltransferases result in vanillyl alcohol glucoside formation from endogenous ferulic acid. A gene encoding an enzyme showing 71% sequence identity to VpVAN was identified in another vanillin-producing plant species Glechoma hederacea and was also shown to be a vanillin synthase as demonstrated by transient expression in tobacco.

  6. Inhibition profile of a series of phenolic acids on bovine lactoperoxidase enzyme.

    PubMed

    Sarikaya, S Beyza Ozturk; Sisecioglu, Melda; Cankaya, Murat; Gulcin, İlhami; Ozdemir, Hasan

    2015-06-01

    Lactoperoxidase (LPO) catalyzes the oxidation of numerous of organic and inorganic substrates by hydrogen peroxide. It has very vital activity in the innate immune system by decreasing or stopping the activation of the bacteria in milk and mucosal secretions. This study's purpose was to investigate in vitro effect of some phenolic acids (ellagic, gallic, ferulic, caffeic, quercetin, p-coumaric, syringic, catechol and epicatechin) on the purified LPO. This enzyme was purified from milk by using different methods such as Amberlite CG-50 resin, CM-Sephadex C-50 ion-exchange and Sephadex G-100 gel filtration chromatography. LPO was purified 28.7-fold with a yield of 20.03%. We found phenolic acids have inhibition effects on bovine LPO enzyme to different concentrations. Our study showed lower concentrations of caffeic acid, ferulic acid and quercetin exhibited much higher inhibitory effect on enzyme, so these three of them were clearly a more potent inhibitor than the others were. All of compounds were non-competitive inhibitors.

  7. Facile synthesis of multiple enzyme-containing metal-organic frameworks in a biomolecule-friendly environment.

    PubMed

    Wu, Xiaoling; Ge, Jun; Yang, Cheng; Hou, Miao; Liu, Zheng

    2015-09-01

    The one-step and facile synthesis of multi-enzyme-containing metal-organic framework (MOF) nanocrystals in aqueous solution at 25 °C was reported in this study. The GOx&HRP/ZIF-8 nanocomposite displayed high catalytic efficiency, high selectivity and enhanced stability due to the protecting effect of the framework.

  8. The Secreted Enzyme PM20D1 Regulates Lipidated Amino Acid Uncouplers of Mitochondria.

    PubMed

    Long, Jonathan Z; Svensson, Katrin J; Bateman, Leslie A; Lin, Hua; Kamenecka, Theodore; Lokurkar, Isha A; Lou, Jesse; Rao, Rajesh R; Chang, Mi Ra; Jedrychowski, Mark P; Paulo, Joao A; Gygi, Steven P; Griffin, Patrick R; Nomura, Daniel K; Spiegelman, Bruce M

    2016-07-14

    Brown and beige adipocytes are specialized cells that express uncoupling protein 1 (UCP1) and dissipate chemical energy as heat. These cells likely possess alternative UCP1-independent thermogenic mechanisms. Here, we identify a secreted enzyme, peptidase M20 domain containing 1 (PM20D1), that is enriched in UCP1(+) versus UCP1(-) adipocytes. We demonstrate that PM20D1 is a bidirectional enzyme in vitro, catalyzing both the condensation of fatty acids and amino acids to generate N-acyl amino acids and also the reverse hydrolytic reaction. N-acyl amino acids directly bind mitochondria and function as endogenous uncouplers of UCP1-independent respiration. Mice with increased circulating PM20D1 have augmented respiration and increased N-acyl amino acids in blood. Lastly, administration of N-acyl amino acids to mice improves glucose homeostasis and increases energy expenditure. These data identify an enzymatic node and a family of metabolites that regulate energy homeostasis. This pathway might be useful for treating obesity and associated disorders. PMID:27374330

  9. Enzymatic synthesis of oligo- and polysaccharide fatty acid esters.

    PubMed

    van den Broek, Lambertus A M; Boeriu, Carmen G

    2013-03-01

    Amphiphilic oligo- and polysaccharides (e.g. polysaccharide alkyl or alkyl-aryl esters) form a new class of polymers with exceptional properties. They function as polymeric surfactants, whilst maintaining most of the properties of the starting polymeric material such as emulsifying, gelling, and film forming properties combined with partial water solubility or permeability. At present carbohydrate fatty acid esters are generally obtained by chemical methods using toxic solvents and organic and inorganic catalysts that leave residual traces in the final products. Enzymatic reactions offer an attractive alternative route for the synthesis of polysaccharide esters. In this review the state of the art of enzymatic synthesis of oligo- and polysaccharides fatty esters has been described.

  10. CYP4 Enzymes as potential drug targets: focus on enzyme multiplicity, inducers and inhibitors, and therapeutic modulation of 20-hydroxyeicosatetraenoic acid (20-HETE) synthase and fatty acid ω-hydroxylase activities

    PubMed Central

    Edson, Katheryne Z.; Rettie, Allan E.

    2014-01-01

    The Cytochrome P450 4 (CYP4) family of enzymes in humans is comprised of thirteen isozymes that typically catalyze the ω-oxidation of endogenous fatty acids and eicosanoids. Several CYP4 enzymes can biosynthesize 20-hydroxyeicosatetraenoic acid or 20-HETE, an important signaling eicosanoid involved in regulation of vascular tone and kidney reabsorption. Additionally, accumulation of certain fatty acids is a hallmark of the rare genetic disorders, Refsum disease and X-ALD. Therefore, modulation of CYP4 enzyme activity, either by inhibition or induction, is a potential strategy for drug discovery. Here we review the substrate specificities, sites of expression, genetic regulation, and inhibition by exogenous chemicals of the human CYP4 enzymes, and discuss the targeting of CYP4 enzymes in the development of new treatments for hypertension, stroke, certain cancers and the fatty acid-linked orphan diseases. PMID:23688133

  11. CYP4 enzymes as potential drug targets: focus on enzyme multiplicity, inducers and inhibitors, and therapeutic modulation of 20-hydroxyeicosatetraenoic acid (20-HETE) synthase and fatty acid ω-hydroxylase activities.

    PubMed

    Edson, Katheryne Z; Rettie, Allan E

    2013-01-01

    The Cytochrome P450 4 (CYP4) family of enzymes in humans is comprised of thirteen isozymes that typically catalyze the ω-oxidation of endogenous fatty acids and eicosanoids. Several CYP4 enzymes can biosynthesize 20- hydroxyeicosatetraenoic acid, or 20-HETE, an important signaling eicosanoid involved in regulation of vascular tone and kidney reabsorption. Additionally, accumulation of certain fatty acids is a hallmark of the rare genetic disorders, Refsum disease and X-ALD. Therefore, modulation of CYP4 enzyme activity, either by inhibition or induction, is a potential strategy for drug discovery. Here we review the substrate specificities, sites of expression, genetic regulation, and inhibition by exogenous chemicals of the human CYP4 enzymes, and discuss the targeting of CYP4 enzymes in the development of new treatments for hypertension, stroke, certain cancers and the fatty acid-linked orphan diseases.

  12. [Synthesis of new mandelic acid derivatives with preservative action. Synthesis and acute toxicity study].

    PubMed

    Stan, Cătălina; Năstase, V; Pavelescu, M; Vasile, Cornelia; Dumitrache, M; Gherase, Florenţa; Năstasă, Veronica

    2004-01-01

    Starting from the antiseptic action of DL mandelic acid, there were synthesized a series of esters of the mandelic acid, esters which could have preservative action. This study present the synthesis, structure validation and the acute toxicity study, for the new synthesized compounds. The esters were obtained by acylating 4-hydroxybenzoic acid propyl, ethyl, methyl esters and salicylic acid with the DL mandelic chloride (that was protected initially by the hydroxylic group). The structure of the synthesized compounds was confirmed by quantitative elemental analysis and RMN 1H spectral measurements. The acute toxicity was determined for two of the esters, who proved to had a preservative action (previously studied) and indicated that these esters have a small toxicity.

  13. Amino acid network for prediction of catalytic residues in enzymes: a comparison survey.

    PubMed

    Zhou, Jianhong; Yan, Wenying; Hu, Guang; Shen, Bairong

    2016-01-01

    Catalytic residues play a significant role in enzyme functions. With the recent accumulation of experimentally determined enzyme 3D structures and network theory on protein structures, the prediction of catalytic residues by amino acid network (AAN, where nodes are residues and links are residue interactions) has gained much interest. Computational methods of identifying catalytic residues are traditionally divided into two groups: sequence-based and structure-based methods. Two new structure- based methods are proposed in current advances: AAN and Elastic Network Model (ENM) of enzyme structures. By concentrating on AAN-based approach, we herein summarized network properties for predictions of catalytic residues. AAN attributes were showed responsible for performance improvement, and therefore the combination of AAN with previous sequence and structural information will be a promising direction for further improvement. Advantages and limitations of AAN-based methods, future perspectives on the application of AAN to the study of protein structure-function relationships are discussed.

  14. Efficient production of optically pure L-lactic acid from food waste at ambient temperature by regulating key enzyme activity.

    PubMed

    Li, Xiang; Chen, Yinguang; Zhao, Shu; Chen, Hong; Zheng, Xiong; Luo, Jinyang; Liu, Yanan

    2015-03-01

    Bio-production of optically pure L-lactic acid from food waste has attracted much interest as it can treat organic wastes with simultaneous recovery of valuable by-products. However, the yield of L-lactic acid was very low and no optically pure L-lactic acid was produced in the literature due to (1) the lower activity of enzymes involved in hydrolysis and L-lactic acid generation, and (2) the participation of other enzymes related to D-lactic acid and acetic and propionic acids production. In this paper, a new strategy was reported for effective production of optically pure L-lactic acid from food waste at ambient temperature, i.e. via regulating key enzyme activity by sewage sludge supplement and intermittent alkaline fermentation. It was found that not only optically pure L-lactic acid was produced, but the yield was enhanced by 2.89-fold. The mechanism study showed that the activities of enzymes relevant to food waste hydrolysis and lactic acid production were enhanced, and the key enzymes related to volatile fatty acids and D-lactic acid generations were severally decreased or inhibited. Also, the microbes responsible for L-lactic acid production were selectively proliferated. Finally, the pilot-scale continuous experiment was conducted to testify the feasibility of this new technique.

  15. Enzymes useful for chiral compound synthesis: structural biology, directed evolution, and protein engineering for industrial use.

    PubMed

    Kataoka, Michihiko; Miyakawa, Takuya; Shimizu, Sakayu; Tanokura, Masaru

    2016-07-01

    Biocatalysts (enzymes) have many advantages as catalysts for the production of useful compounds as compared to chemical catalysts. The stereoselectivity of the enzymes is one advantage, and thus the stereoselective production of chiral compounds using enzymes is a promising approach. Importantly, industrial application of the enzymes for chiral compound production requires the discovery of a novel useful enzyme or enzyme function; furthermore, improving the enzyme properties through protein engineering and directed evolution approaches is significant. In this review, the significance of several enzymes showing stereoselectivity (quinuclidinone reductase, aminoalcohol dehydrogenase, old yellow enzyme, and threonine aldolase) in chiral compound production is described, and the improvement of these enzymes using protein engineering and directed evolution approaches for further usability is discussed. Currently, enzymes are widely used as catalysts for the production of chiral compounds; however, for further use of enzymes in chiral compound production, improvement of enzymes should be more essential, as well as discovery of novel enzymes and enzyme functions.

  16. Enzymes useful for chiral compound synthesis: structural biology, directed evolution, and protein engineering for industrial use.

    PubMed

    Kataoka, Michihiko; Miyakawa, Takuya; Shimizu, Sakayu; Tanokura, Masaru

    2016-07-01

    Biocatalysts (enzymes) have many advantages as catalysts for the production of useful compounds as compared to chemical catalysts. The stereoselectivity of the enzymes is one advantage, and thus the stereoselective production of chiral compounds using enzymes is a promising approach. Importantly, industrial application of the enzymes for chiral compound production requires the discovery of a novel useful enzyme or enzyme function; furthermore, improving the enzyme properties through protein engineering and directed evolution approaches is significant. In this review, the significance of several enzymes showing stereoselectivity (quinuclidinone reductase, aminoalcohol dehydrogenase, old yellow enzyme, and threonine aldolase) in chiral compound production is described, and the improvement of these enzymes using protein engineering and directed evolution approaches for further usability is discussed. Currently, enzymes are widely used as catalysts for the production of chiral compounds; however, for further use of enzymes in chiral compound production, improvement of enzymes should be more essential, as well as discovery of novel enzymes and enzyme functions. PMID:27188776

  17. Calcineurin mediates homeostatic synaptic plasticity by regulating retinoic acid synthesis

    PubMed Central

    Arendt, Kristin L.; Zhang, Zhenjie; Ganesan, Subhashree; Hintze, Maik; Shin, Maggie M.; Tang, Yitai; Cho, Ahryon; Graef, Isabella A.; Chen, Lu

    2015-01-01

    Homeostatic synaptic plasticity is a form of non-Hebbian plasticity that maintains stability of the network and fidelity for information processing in response to prolonged perturbation of network and synaptic activity. Prolonged blockade of synaptic activity decreases resting Ca2+ levels in neurons, thereby inducing retinoic acid (RA) synthesis and RA-dependent homeostatic synaptic plasticity; however, the signal transduction pathway that links reduced Ca2+-levels to RA synthesis remains unknown. Here we identify the Ca2+-dependent protein phosphatase calcineurin (CaN) as a key regulator for RA synthesis and homeostatic synaptic plasticity. Prolonged inhibition of CaN activity promotes RA synthesis in neurons, and leads to increased excitatory and decreased inhibitory synaptic transmission. These effects of CaN inhibitors on synaptic transmission are blocked by pharmacological inhibitors of RA synthesis or acute genetic deletion of the RA receptor RARα. Thus, CaN, acting upstream of RA, plays a critical role in gating RA signaling pathway in response to synaptic activity. Moreover, activity blockade-induced homeostatic synaptic plasticity is absent in CaN knockout neurons, demonstrating the essential role of CaN in RA-dependent homeostatic synaptic plasticity. Interestingly, in GluA1 S831A and S845A knockin mice, CaN inhibitor- and RA-induced regulation of synaptic transmission is intact, suggesting that phosphorylation of GluA1 C-terminal serine residues S831 and S845 is not required for CaN inhibitor- or RA-induced homeostatic synaptic plasticity. Thus, our study uncovers an unforeseen role of CaN in postsynaptic signaling, and defines CaN as the Ca2+-sensing signaling molecule that mediates RA-dependent homeostatic synaptic plasticity. PMID:26443861

  18. Limiting amino acid for protein synthesis with mammary cells in tissue culture.

    PubMed

    Park, C S; Chandler, P T; Norman, A W

    1976-05-01

    To identify the limiting amino acid in the minimal essential medium as published by Eagle (Science 130:432, 1959) for milk protein synthesis in rat mammary cells in tissue culture, two different experimental approaches were used. The first study involved the reduction of amino acids singly from the total amino acid complement of the medium for milk protein synthesis. The second study was to investigate the effect on milk protein synthesis of single amino acid addition to the basic complement of amino acids. Order of limiting amino acids was lysine (first) and possible methionine, valine, or arginine (second).

  19. The influence of metal ions on malic enzyme activity and lipid synthesis in Aspergillus niger.

    PubMed

    Jernejc, Katarina; Legisa, Matic

    2002-12-17

    In the presence of copper significant induction of citric acid overflow was observed, while concomitantly lower levels of total lipids were detected in the cells. Its effect was more obvious in a medium with magnesium as sole divalent metal ions, while in a medium with magnesium and manganese the addition of copper had a less pronounced effect. Since the malic enzyme was recognised as a supplier of reducing power in the form of reduced nicotinamide adenine dinucleotide phosphate for lipid biosynthesis, its kinetic parameters with regard to different concentrations of metal ions were investigated. Some inhibition was found with Fe(2+) and Zn(2+), while Cu(2+) ions in a concentration of 0.1 mM completely abolished malic enzyme activity. The same metal ions proportionally reduced the levels of total lipids in Aspergillus niger cells. A strong competitive inhibition of the enzyme by Cu(2+) was observed. It seemed that copper competes with Mg(2+) and Mn(2+) for the same binding site on the protein.

  20. Early lignin pathway enzymes and routes to chlorogenic acid in switchgrass (Panicum virgatum L.).

    PubMed

    Escamilla-Treviño, Luis L; Shen, Hui; Hernandez, Timothy; Yin, Yanbin; Xu, Ying; Dixon, Richard A

    2014-03-01

    Studying lignin biosynthesis in Panicum virgatum (switchgrass) has provided a basis for generating plants with reduced lignin content and increased saccharification efficiency. Chlorogenic acid (CGA, caffeoyl quinate) is the major soluble phenolic compound in switchgrass, and the lignin and CGA biosynthetic pathways potentially share intermediates and enzymes. The enzyme hydroxycinnamoyl-CoA: quinate hydroxycinnamoyltransferase (HQT) is responsible for CGA biosynthesis in tobacco, tomato and globe artichoke, but there are no close orthologs of HQT in switchgrass or in other monocotyledonous plants with complete genome sequences. We examined available transcriptomic databases for genes encoding enzymes potentially involved in CGA biosynthesis in switchgrass. The protein products of two hydroxycinnamoyl-CoA shikimate/quinate hydroxycinnamoyltransferase (HCT) genes (PvHCT1a and PvHCT2a), closely related to lignin pathway HCTs from other species, were characterized biochemically and exhibited the expected HCT activity, preferring shikimic acid as acyl acceptor. We also characterized two switchgrass coumaroyl shikimate 3'-hydroxylase (C3'H) enzymes (PvC3'H1 and PvC3'H2); both of these cytochrome P450s had the capacity to hydroxylate 4-coumaroyl shikimate or 4-coumaroyl quinate to generate caffeoyl shikimate or CGA. Another switchgrass hydroxycinnamoyl transferase, PvHCT-Like1, is phylogenetically distant from HCTs or HQTs, but exhibits HQT activity, preferring quinic acid as acyl acceptor, and could therefore function in CGA biosynthesis. The biochemical features of the recombinant enzymes, the presence of the corresponding activities in plant protein extracts, and the expression patterns of the corresponding genes, suggest preferred routes to CGA in switchgrass.

  1. Assembly of Lipoic Acid on Its Cognate Enzymes: an Extraordinary and Essential Biosynthetic Pathway.

    PubMed

    Cronan, John E

    2016-06-01

    Although the structure of lipoic acid and its role in bacterial metabolism were clear over 50 years ago, it is only in the past decade that the pathways of biosynthesis of this universally conserved cofactor have become understood. Unlike most cofactors, lipoic acid must be covalently bound to its cognate enzyme proteins (the 2-oxoacid dehydrogenases and the glycine cleavage system) in order to function in central metabolism. Indeed, the cofactor is assembled on its cognate proteins rather than being assembled and subsequently attached as in the typical pathway, like that of biotin attachment. The first lipoate biosynthetic pathway determined was that of Escherichia coli, which utilizes two enzymes to form the active lipoylated protein from a fatty acid biosynthetic intermediate. Recently, a more complex pathway requiring four proteins was discovered in Bacillus subtilis, which is probably an evolutionary relic. This pathway requires the H protein of the glycine cleavage system of single-carbon metabolism to form active (lipoyl) 2-oxoacid dehydrogenases. The bacterial pathways inform the lipoate pathways of eukaryotic organisms. Plants use the E. coli pathway, whereas mammals and fungi probably use the B. subtilis pathway. The lipoate metabolism enzymes (except those of sulfur insertion) are members of PFAM family PF03099 (the cofactor transferase family). Although these enzymes share some sequence similarity, they catalyze three markedly distinct enzyme reactions, making the usual assignment of function based on alignments prone to frequent mistaken annotations. This state of affairs has possibly clouded the interpretation of one of the disorders of human lipoate metabolism. PMID:27074917

  2. Interference of L-α-aminoocy-β-phenylpropionic acid with cold-induced sphagnorubin synthesis in Sphagnum magellanicum BRID.

    PubMed

    Tutschek, R

    1982-08-01

    The ability of the phenylalanine ammonia-lyase (PAL)-inhibitor L-α-aminooxy-β-phenyl-propionic acid (AOPP) to suppress the synthesis of the main reddish-violet wall pigment of Sphagnum magellanicum (sphagnorubin) was investigated. Fifty percent inhibition is achieved with 14 μM AOPP in mosses stimulated to intensive coloring by sugar feeding. AOPP does not affect the content of free amino acids, except for phenylalanine, during cold-induced sphagnorubin synthesis. AOPP dramatically amplifies the increase in extractable PAL activity in response to cold treatment. Phenylalanine applied in vivo causes an eminent increase in PAL activity, above the level of the cold-treated mosses. The results from the feeding experiments are discussed in connection with a possible end-product repression in PAL activity with sphagnorubin-synthesizing mosses. These results are correspond best to the theory that the enzyme level is regulated independently from a mechanism of feedback repression. PMID:24271864

  3. (-)-Hydroxycitric Acid Nourishes Protein Synthesis via Altering Metabolic Directions of Amino Acids in Male Rats.

    PubMed

    Han, Ningning; Li, Longlong; Peng, Mengling; Ma, Haitian

    2016-08-01

    (-)-Hydroxycitric acid (HCA), a major active ingredient of Garcinia Cambogia extracts, had shown to suppress body weight gain and fat accumulation in animals and humans. While, the underlying mechanism of (-)-HCA has not fully understood. Thus, this study was aimed to investigate the effects of long-term supplement with (-)-HCA on body weight gain and variances of amino acid content in rats. Results showed that (-)-HCA treatment reduced body weight gain and increased feed conversion ratio in rats. The content of hepatic glycogen, muscle glycogen, and serum T4 , T3 , insulin, and Leptin were increased in (-)-HCA treatment groups. Protein content in liver and muscle were significantly increased in (-)-HCA treatment groups. Amino acid profile analysis indicated that most of amino acid contents in serum and liver, especially aromatic amino acid and branched amino acid, were higher in (-)-HCA treatment groups. However, most of the amino acid contents in muscle, especially aromatic amino acid and branched amino acid, were reduced in (-)-HCA treatment groups. These results indicated that (-)-HCA treatment could reduce body weight gain through promoting energy expenditure via regulation of thyroid hormone levels. In addition, (-)-HCA treatment could promote protein synthesis by altering the metabolic directions of amino acids. Copyright © 2016 John Wiley & Sons, Ltd. PMID:27145492

  4. Effect of mevalonic acid on cholesterol synthesis in bovine intramuscular and subcutaneous adipocytes.

    PubMed

    Liu, Xiaomu; You, Wei; Cheng, Haijian; Zhang, Qingfeng; Song, Enliang; Wan, Fachun; Han, Hong; Liu, Guifen

    2016-02-01

    Mevalonic acid (MVA) is a key material in the synthesis of cholesterol; indeed, intracellular cholesterol synthesis is also called the mevalonic acid pathway. 3-Hydroxy-3-methylglutaryl-CoA reductase (HMGR) is an essential enzyme in cholesterol biosynthesis. This study suggests that MVA may play an important role in the differentiation of bovine adipose tissue in vivo. We investigated differential mRNA expression in bovine intramuscular preadipocytes (BIPs) and bovine subcutaneous preadipocytes (BSPs) by culturing cells from the longissimus dorsi muscle and subcutaneous fat tissues of Luxi yellow cattle. The morphology of lipid accumulation of bovine preadipocytes was detected by Oil Red O staining, and total cholesterol (TC), low-density lipoprotein cholesterol (LDLC), and high-density lipoprotein cholesterol (HDLC) levels were measured. Temporospatial expression of HMGR was investigated by real-time quantitative polymerase chain reaction (PCR). The TC, LDLC, and HDLC content did not significantly differ over time but increased slowly with increasing MVA concentration. HMGR expression increased over time and with increasing concentrations of MVA. MVA increased adipose cell proliferation in a dose-dependent and time-dependent manner. MVA stimulated HMGR expression in two cell types and its influence on adipocyte differentiation.

  5. Plastid-localized amino acid biosynthetic pathways of Plantae are predominantly composed of non-cyanobacterial enzymes

    PubMed Central

    Reyes-Prieto, Adrian; Moustafa, Ahmed

    2012-01-01

    Studies of photosynthetic eukaryotes have revealed that the evolution of plastids from cyanobacteria involved the recruitment of non-cyanobacterial proteins. Our phylogenetic survey of >100 Arabidopsis nuclear-encoded plastid enzymes involved in amino acid biosynthesis identified only 21 unambiguous cyanobacterial-derived proteins. Some of the several non-cyanobacterial plastid enzymes have a shared phylogenetic origin in the three Plantae lineages. We hypothesize that during the evolution of plastids some enzymes encoded in the host nuclear genome were mistargeted into the plastid. Then, the activity of those foreign enzymes was sustained by both the plastid metabolites and interactions with the native cyanobacterial enzymes. Some of the novel enzymatic activities were favored by selective compartmentation of additional complementary enzymes. The mosaic phylogenetic composition of the plastid amino acid biosynthetic pathways and the reduced number of plastid-encoded proteins of non-cyanobacterial origin suggest that enzyme recruitment underlies the recompartmentation of metabolic routes during the evolution of plastids. PMID:23233874

  6. Synthesis and biological activity of novel deoxycholic acid derivatives.

    PubMed

    Popadyuk, Irina I; Markov, Andrey V; Salomatina, Oksana V; Logashenko, Evgeniya B; Shernyukov, Andrey V; Zenkova, Marina A; Salakhutdinov, Nariman F

    2015-08-01

    We report the synthesis and biological activity of new semi-synthetic derivatives of naturally occurring deoxycholic acid (DCA) bearing 2-cyano-3-oxo-1-ene, 3-oxo-1(2)-ene or 3-oxo-4(5)-ene moieties in ring A and 12-oxo or 12-oxo-9(11)-ene moieties in ring C. Bioassays using murine macrophage-like cells and tumour cells show that the presence of the 9(11)-double bond associated with the increased polarity of ring A or with isoxazole ring joined to ring A, improves the ability of the compounds to inhibit cancer cell growth. PMID:26037611

  7. Synthesis and biological activity of novel deoxycholic acid derivatives.

    PubMed

    Popadyuk, Irina I; Markov, Andrey V; Salomatina, Oksana V; Logashenko, Evgeniya B; Shernyukov, Andrey V; Zenkova, Marina A; Salakhutdinov, Nariman F

    2015-08-01

    We report the synthesis and biological activity of new semi-synthetic derivatives of naturally occurring deoxycholic acid (DCA) bearing 2-cyano-3-oxo-1-ene, 3-oxo-1(2)-ene or 3-oxo-4(5)-ene moieties in ring A and 12-oxo or 12-oxo-9(11)-ene moieties in ring C. Bioassays using murine macrophage-like cells and tumour cells show that the presence of the 9(11)-double bond associated with the increased polarity of ring A or with isoxazole ring joined to ring A, improves the ability of the compounds to inhibit cancer cell growth.

  8. Antimicrobial polyurethane thermosets based on undecylenic acid: synthesis and evaluation.

    PubMed

    Lluch, Cristina; Esteve-Zarzoso, Braulio; Bordons, Albert; Lligadas, Gerard; Ronda, Juan C; Galià, Marina; Cádiz, Virginia

    2014-08-01

    In the present study, plant oil-derived surface-modifiable polyurethane thermosets are presented. Polyol synthesis is carried out taking advantage of thiol-yne photopolymerization of undecylenic acid derivatives containing methyl ester or hydroxyl moieties. The prepared methyl ester-containing polyurethanes allow surface modification treatment to enhance their hydrophilicity and impart antimicrobial activity through the following two steps: i) grafting poly(propylene glycol) monoamine (Jeffamine M-600) via aminolysis and ii) Jeffamine M-600 layer complexation with iodine. The antimicrobial activity of the iodine-containing polyurethanes is demonstrated by its capacity to inhibit the growth of Staphylococcus aureus, and Candida albicans in agar media.

  9. Design and synthesis of boronic acid inhibitors of endothelial lipase.

    PubMed

    O'Connell, Daniel P; LeBlanc, Daniel F; Cromley, Debra; Billheimer, Jeffrey; Rader, Daniel J; Bachovchin, William W

    2012-02-01

    Endothelial lipase (EL) and lipoprotein lipase (LPL) are homologous lipases that act on plasma lipoproteins. EL is predominantly a phospholipase and appears to be a key regulator of plasma HDL-C. LPL is mainly a triglyceride lipase regulating (V)LDL levels. The existing biological data indicate that inhibitors selective for EL over LPL should have anti-atherogenic activity, mainly through increasing plasma HDL-C levels. We report here the synthesis of alkyl, aryl, or acyl-substituted phenylboronic acids that inhibit EL. Many of the inhibitors evaluated proved to be nearly equally potent against both EL and LPL, but several exhibited moderate to good selectivity for EL. PMID:22225633

  10. Synthesis of Nanoporous Iminodiacetic Acid Sorbents for Binding Transition Metals

    PubMed Central

    Busche, Brad; Wiacek, Robert; Davidson, Joseph; Koonsiripaiboon, View; Yantasee, Wassana; Addleman, R. Shane; Fryxell, Glen E.

    2009-01-01

    Iminodiacetic acid (IDAA) forms strong complexes with a wide variety of metal ions. Using self-assembled monolayers in mesoporous supports (SAMMS) to present the IDAA ligand potentially allows for multiple metal-ligand interactions to enhance the metal binding affinity relative to that of randomly oriented polymer-based supports. This manuscript describes the synthesis of a novel nanostructured sorbent material built using self-assembly of a IDAA ligand inside a nanoporous silica, and demonstrates its use for capturing transition metal cations, and anionic metal complexes, such as PdCl4−2. PMID:22068901

  11. Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments

    NASA Astrophysics Data System (ADS)

    Kitadai, Norio

    2015-12-01

    Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids.

  12. The intracellular parasite Toxoplasma gondii depends on the synthesis of long chain and very long-chain unsaturated fatty acids not supplied by the host cell

    PubMed Central

    Ramakrishnan, Srinivasan; Docampo, Melissa D.; MacRae, James I.; Ralton, Julie E.; Rupasinghe, Thusitha; McConville, Malcolm J.; Striepen, Boris

    2015-01-01

    SUMMARY Apicomplexa are parasitic protozoa that cause important human diseases including malaria, cryptosporidiosis and toxoplasmosis. The replication of these parasites within their target host cell is dependent on both salvage as well as de novo synthesis of fatty acids. In T. gondii, fatty acid synthesis via the apicoplast-localized FASII is essential for pathogenesis, while the role of two other fatty acid biosynthetic complexes remains unclear. Here we demonstrate that the ER-localized fatty acid elongation (ELO) is essential for parasite growth. Conditional knock-down of the non-redundant hydroxyacyl-CoA dehydratase and enoyl-CoA reductase enzymes in the ELO pathway severely repressed intracellular parasite growth. 13C-glucose and 13C-acetate labeling and comprehensive lipidomic analyses of these mutants showed a selective defect in synthesis of unsaturated long and very long chain fatty acids (LCFAs and VLCFAs) and depletion of phosphatidylinositol and phosphatidylethanolamine species containing unsaturated LCFAs and VLCFAs. This requirement for ELO pathway was by-passed by supplementing the media with specific fatty acids, indicating active, but inefficient import of host fatty acids. Our experiments highlight a gap between the fatty acid needs of the parasite and availability of specific fatty acids in the host cell that the parasite has to close using a dedicated synthesis and modification pathway. PMID:25825226

  13. Promoter strength of folic acid synthesis genes affects sulfa drug resistance in Saccharomyces cerevisiae.

    PubMed

    Iliades, Peter; Berglez, Janette; Meshnick, Steven; Macreadie, Ian

    2003-01-01

    The enzyme dihydropteroate synthase (DHPS) is an important target for sulfa drugs in both prokaryotic and eukaryotic microbes. However, the understanding of DHPS function and the action of antifolates in eukaryotes has been limited due to technical difficulties and the complexity of DHPS being a part of a bifunctional or trifunctional protein that comprises the upstream enzymes involved in folic acid synthesis (FAS). Here, yeast strains have been constructed to study the effects of FOL1 expression on growth and sulfa drug resistance. A DHPS knockout yeast strain was complemented by yeast vectors expressing the FOL1 gene under the control of promoters of different strengths. An inverse relationship was observed between the growth rate of the strains and FOL1 expression levels. The use of stronger promoters to drive FOL1 expression led to increased sulfamethoxazole resistance when para-aminobenzoic acid (pABA) levels were elevated. However, high FOL1 expression levels resulted in increased susceptibility to sulfamethoxazole in pABA free media. These data suggest that up-regulation of FOL1 expression can lead to sulfa drug resistance in Saccharomyces cerevisiae.

  14. Alternative Routes for the Synthesis of 5-Aminolevulinic Acid in Maize Leaves 1

    PubMed Central

    Harel, Eitan; Ne'Eman, Emma

    1983-01-01

    Intact plastids from greening maize (Zea mays L.) leaves converted [14C]glutamate and [14C]2-ketoglutarate (KG) to [14C]5-aminolevulinic acid (ALA). Glutamate appeared to be the immediate precursor of ALA, while KG was first converted to glutamate, as shown by the effect of various inhibitors of amino acid metabolism. Plastids from greening leaves contained markedly higher activity as compared with etioplasts or chloroplasts. The synthesis of ALA by intact plastids was light dependent. The enzyme system resides in the stroma of plastids or may be lightly bound to membranes. The solubilized system showed maximal activity around pH 7.9 and required Mg2+, ATP, and NADPH although dependence on the latter was not clear-cut. A relatively high level of activity could be extracted from etioplasts. Maximal activity was obtained from plastids of leaves which had been illuminated for 90 minutes, after which activity declined sharply. The enzyme system solubilized from plastids also catalyzed the conversion of putative glutamate 1-semialdehyde to ALA in a reaction which was not dependent on the addition of an amino donor. The system in maize greatly resembled the one which had been reported from barley. It is suggested that this system is the one responsible for the biosynthesis of ALA destined for chlorophyll formation. PMID:16663121

  15. Multi-enzyme co-embedded organic-inorganic hybrid nanoflowers: synthesis and application as a colorimetric sensor

    NASA Astrophysics Data System (ADS)

    Sun, Jiayu; Ge, Jiechao; Liu, Weimin; Lan, Minhua; Zhang, Hongyan; Wang, Pengfei; Wang, Yanming; Niu, Zhongwei

    2013-12-01

    This study reports a facile method for the synthesis of multi-enzyme co-embedded organic-inorganic hybrid nanoflowers, using glucose oxidase (GOx) and horseradish peroxidase (HRP) as the organic components, and Cu3(PO4)2.3H2O as the inorganic component. The synthesized nanoflowers enable the combination of a two-enzyme cascade reaction in one step, in which the GOx component of the nanoflowers oxidizes glucose to generate H2O2, which then reacts with the adjacent HRP component on the nanoflowers to oxidize the chromogenic substrates, resulting in an apparent color change. Given the close proximity of the two enzyme components in a single nanoflower, this novel sensor greatly reduces the diffusion and decomposition of H2O2, and greatly enhances the sensitivity of glucose detection. Thus, the obtained multi-enzyme co-embedded organic-inorganic hybrid nanoflowers can be unquestionably used as highly sensitive colorimetric sensors for the detection of glucose. Notably, this work presents a very facile route for the synthesis of multi-enzyme co-embedded nanomaterials for the simultaneous catalysis of multi-step cascade enzymatic reactions. Furthermore, it has great potential for application in biotechnology, and biomedical and environmental chemistry.This study reports a facile method for the synthesis of multi-enzyme co-embedded organic-inorganic hybrid nanoflowers, using glucose oxidase (GOx) and horseradish peroxidase (HRP) as the organic components, and Cu3(PO4)2.3H2O as the inorganic component. The synthesized nanoflowers enable the combination of a two-enzyme cascade reaction in one step, in which the GOx component of the nanoflowers oxidizes glucose to generate H2O2, which then reacts with the adjacent HRP component on the nanoflowers to oxidize the chromogenic substrates, resulting in an apparent color change. Given the close proximity of the two enzyme components in a single nanoflower, this novel sensor greatly reduces the diffusion and decomposition of H2O2

  16. Enhanced production of polyunsaturated fatty acids by enzyme engineering of tandem acyl carrier proteins

    PubMed Central

    Hayashi, Shohei; Satoh, Yasuharu; Ujihara, Tetsuro; Takata, Yusuke; Dairi, Tohru

    2016-01-01

    In some microorganisms, polyunsaturated fatty acids (PUFAs) are biosynthesized by PUFA synthases characterized by tandem acyl carrier proteins (ACPs) in subunit A. These ACPs were previously shown to be important for PUFA productivity. In this study, we examined their function in more detail. PUFA productivities increased depending on the number of ACPs without profile changes in each subunit A of eukaryotic and prokaryotic PUFA synthases. We also constructed derivative enzymes from subunit A with 5 × ACPs. Enzymes possessing one inactive ACP at any position produced ~30% PUFAs compared with the parental enzyme but unexpectedly had ~250% productivity compared with subunit A with 4 × ACPs. Enzymes constructed by replacing the 3rd ACP with an inactive ACP from another subunit A or ACP-unrelated sequences produced ~100% and ~3% PUFAs compared with the parental 3rd ACP-inactive enzyme, respectively. These results suggest that both the structure and number of ACP domains are important for PUFA productivity. PMID:27752094

  17. Human prostatic acid phosphatase directly stimulates collagen synthesis and alkaline phosphatase content of isolated bone cells

    SciTech Connect

    Ishibe, M.; Rosier, R.N.; Puzas, J.E. )

    1991-10-01

    Human prostatic acid phosphatase (hPAP) directly enhances the differentiated characteristics of isolated bone cells in vitro. This enzyme, when added to cell cultures for 24 h in vitro stimulates collagen synthesis and the production of alkaline phosphatase. The effects are dose dependent, with statistically significant effects occurring from 0.1-100 nM hPAP. Concentrations higher than 100 nM do not evoke greater effects. The maximal effect of hPAP occurs between 12 and 24 h of exposure. The cells stimulated to the greatest degree are osteoprogenitor cells and osteoblasts. Fibroblasts isolated from the same tissue show a lesser sensitivity to hPAP. hPAP has no detectable effect on cell proliferation, as measured by radiolabeled thymidine incorporation or total DNA synthesis. None of the observations reported in this work can be attributed to contaminating proteins in the hPAP preparation. hPAP was radiolabeled with 125I and was used for affinity binding and cross-linking studies. Scatchard analysis of specific binding indicated the presence of 1.0 X 10(5) high affinity binding sites/cell, with a Kd of 6.5 nM. Cross-linking studies demonstrated the presence of one 320-kDa binding complex. The pH profile and kinetic determinations of Km and maximum velocity for hPAP were similar to those previously reported, except for the finding of positive cooperativity of the substrate with the enzyme under the conditions of our assay. We believe that the direct stimulation of bone-forming cells by hPAP may contribute to the sclerotic nature of skeletal bone around sites of neoplastic prostatic metastases and that the effect of the enzyme is probably mediated by a plasma membrane receptor.

  18. Circadian control of bile acid synthesis by a KLF15-Fgf15 axis

    PubMed Central

    Han, Sean (Shuxin); Zhang, Rongli; Jain, Rajan; Shi, Hong; Zhang, Lilei; Zhou, Guangjin; Sangwung, Panjamaporn; Tugal, Derin; Atkins, G. Brandon; Prosdocimo, Domenick A.; Lu, Yuan; Han, Xiaonan; Tso, Patrick; Liao, Xudong; Epstein, Jonathan A.; Jain, Mukesh K.

    2015-01-01

    Circadian control of nutrient availability is critical to efficiently meet the energetic demands of an organism. Production of bile acids (BAs), which facilitate digestion and absorption of nutrients, is a major regulator of this process. Here we identify a KLF15-Fgf15 signalling axis that regulates circadian BA production. Systemic Klf15 deficiency disrupted circadian expression of key BA synthetic enzymes, tissue BA levels and triglyceride/cholesterol absorption. Studies in liver-specific Klf15-knockout mice suggested a non-hepatic basis for regulation of BA production. Ileal Fgf15 is a potent inhibitor of BA synthesis. Using a combination of biochemical, molecular and functional assays (including ileectomy and bile duct catheterization), we identify KLF15 as the first endogenous negative regulator of circadian Fgf15 expression. Elucidation of this novel pathway controlling circadian BA production has important implications for physiologic control of nutrient availability and metabolic homeostasis. PMID:26040986

  19. Plasmid control of 6-aminohexanoic acid cyclic dimer degradation enzymes of Flavobacterium sp. KI72.

    PubMed

    Negoro, S; Shinagawa, H; Nakata, A; Kinoshita, S; Hatozaki, T; Okada, H

    1980-07-01

    Flavobacterium sp. K172, which is able to grow on 6-aminohexanoic acid cyclic dimer as the sole source of carbon and nitrogen, and plasmid control of the responsible enzymes, 6-aminohexanoic acid cyclic dimer hydrolase and 6-aminohexanoic acid linear oligomer hydrolase, were studied. The wild strain of K172 harbors three kinds of plasmid, pOAD1 (26.2 megadaltons), pOAD2 (28.8 megadaltons), and pOAD3 (37.2 megadaltons). The wild strain K172 was readily cured of its ability to grow on the cyclic dimer by mitomycin C, and the cyclic dimer hydrolase could not be detected either as catalytic activity or by antibody precipitation. No reversion of the cured strains was detected. pOAD2 was not detected in every cured strain tested but was restored in a transformant. The transformant recovered both of the enzyme activities, and the cyclic dimer hydrolase of the transformant was immunologically identical with that of the wild strain. All of the strains tested, including the wild, cured, and transformant ones, possessed identical pOAD3 irrespective of the metabolizing activity. Some of the cured strains possessed pOAD1 identical with the wild strain, but the others harbored plasmids with partially altered structures which were likely to be derived from pOAD1 by genetic rearrangements such as deletion, insertion, or substitution. These results suggested that the genes of the enzymes were borne on pOAD2.

  20. Plasmid Control of 6-Aminohexanoic Acid Cyclic Dimer Degradation Enzymes of Flavobacterium sp. K172

    PubMed Central

    Negoro, Seiji; Shinagawa, Hideo; Nakata, Atsuo; Kinoshita, Shinichi; Hatozaki, Tomoya; Okada, Hirosuke

    1980-01-01

    Flavobacterium sp. K172, which is able to grow on 6-aminohexanoic acid cyclic dimer as the sole source of carbon and nitrogen, and plasmid control of the responsible enzymes, 6-aminohexanoic acid cyclic dimer hydrolase and 6-aminohexanoic acid linear oligomer hydrolase, were studied. The wild strain of K172 harbors three kinds of plasmid, pOAD1 (26.2 megadaltons), pOAD2 (28.8 megadaltons), and pOAD3 (37.2 megadaltons). The wild strain K172 was readily cured of its ability to grow on the cyclic dimer by mitomycin C, and the cyclic dimer hydrolase could not be detected either as catalytic activity or by antibody precipitation. No reversion of the cured strains was detected. pOAD2 was not detected in every cured strain tested but was restored in a transformant. The transformant recovered both of the enzyme activities, and the cyclic dimer hydrolase of the transformant was immunologically identical with that of the wild strain. All of the strains tested, including the wild, cured, and transformant ones, possessed identical pOAD3 irrespective of the metabolizing activity. Some of the cured strains possessed pOAD1 identical with the wild strain, but the others harbored plasmids with partially altered structures which were likely to be derived from pOAD1 by genetic rearrangements such as deletion, insertion, or substitution. These results suggested that the genes of the enzymes were borne on pOAD2. Images PMID:7400094

  1. Catalytic nucleic acid enzymes for the study and development of therapies in the central nervous system

    PubMed Central

    Tritz, Richard; Habita, Cellia; Robbins, Joan M.; Gomez, German G.; Kruse, Carol A.

    2005-01-01

    Summary Nucleic acid enzymes have been used with great success for studying natural processes in the central nervous system (CNS). We first provide information on the structural and enzymatic differences of various ribozymes and DNAzymes. We then discuss how they have been used to explore new therapeutic approaches for treating diseases of the CNS. They have been tested in various systems modeling retinitis pigmentosum, proliferative vitreoretinopathy, Alzheimer's disease, and malignant brain tumors. For these models, effective targets for nucleic acid enzymes have been readily identified and the rules for selecting cleavage sites have been well established. The bulk of studies, including those from our laboratory, have emphasized their use for gliomas. With the availability of multiple excellent animal models to test glioma treatments, good progress has been made in the initial testing of nucleic acid enzymes for brain tumor therapy. However, opportunities still exist to significantly improve the delivery and efficacy of ribozymes to achieve effective treatment. The future holds significant potential for the molecular targeting and therapy of eye diseases, neurodegenerative disorders, and brain tumors with these unique treatment agents. PMID:16467915

  2. Arabidopsis Bax inhibitor-1 promotes sphingolipid synthesis during cold stress by interacting with ceramide-modifying enzymes.

    PubMed

    Nagano, Minoru; Ishikawa, Toshiki; Ogawa, Yoshie; Iwabuchi, Mitsuru; Nakasone, Akari; Shimamoto, Ko; Uchimiya, Hirofumi; Kawai-Yamada, Maki

    2014-07-01

    Bax inhibitor-1 (BI-1) is a widely conserved cell death suppressor localized in the endoplasmic reticulum membrane. Our previous results revealed that Arabidopsis BI-1 (AtBI-1) interacts with not only Arabidopsis cytochrome b 5 (Cb5), an electron transfer protein, but also a Cb5-like domain (Cb5LD)-containing protein, Saccharomyces cerevisiae fatty acid 2-hydroxylase 1, which 2-hydroxylates sphingolipid fatty acids. We have now found that AtBI-1 binds Arabidopsis sphingolipid Δ8 long-chain base (LCB) desaturases AtSLD1 and AtSLD2, which are Cb5LD-containing proteins. The expression of both AtBI-1 and AtSLD1 was increased by cold exposure. However, different phenotypes were observed in response to cold treatment between an atbi-1 mutant and a sld1sld2 double mutant. To elucidate the reasons behind the difference, we analyzed sphingolipids and found that unsaturated LCBs in atbi-1 were not altered compared to wild type, whereas almost all LCBs in sld1sld2 were saturated, suggesting that AtBI-1 may not be necessary for the desaturation of LCBs. On the other hand, the sphingolipid content in wild type increased in response to low temperature, whereas total sphingolipid levels in atbi-1 were unaltered. In addition, the ceramide-modifying enzymes AtFAH1, sphingolipid base hydroxylase 2 (AtSBH2), acyl lipid desaturase 2 (AtADS2) and AtSLD1 were highly expressed under cold stress, and all are likely to be related to AtBI-1 function. These findings suggest that AtBI-1 contributes to synthesis of sphingolipids during cold stress by interacting with AtSLD1, AtFAH1, AtSBH2 and AtADS2.

  3. Toward "stable-on-the-table" enzymes: improving key properties of catalase by covalent conjugation with poly(acrylic acid).

    PubMed

    Riccardi, Caterina M; Cole, Kyle S; Benson, Kyle R; Ward, Jessamyn R; Bassett, Kayla M; Zhang, Yiren; Zore, Omkar V; Stromer, Bobbi; Kasi, Rajeswari M; Kumar, Challa V

    2014-08-20

    Several key properties of catalase such as thermal stability, resistance to protease degradation, and resistance to ascorbate inhibition were improved, while retaining its structure and activity, by conjugation to poly(acrylic acid) (PAA, Mw 8000) via carbodiimide chemistry where the amine groups on the protein are appended to the carboxyl groups of the polymer. Catalase conjugation was examined at three different pH values (pH 5.0, 6.0, and 7.0) and at three distinct mole ratios (1:100, 1:500, and 1:1000) of catalase to PAA at each reaction pH. The corresponding products are labeled as Cat-PAA(x)-y, where x is the protein to polymer mole ratio and y is the pH used for the synthesis. The coupling reaction consumed about 60-70% of the primary amines on the catalase; all samples were completely water-soluble and formed nanogels, as evidenced by gel electrophoresis and electron microscopy. The UV circular dichroism (CD) spectra indicated substantial retention of protein secondary structure for all samples, which increased to 100% with increasing pH of the synthesis and polymer mole fraction. Soret CD bands of all samples indicated loss of ∼50% of band intensities, independent of the reaction pH. Catalytic activities of the conjugates increased with increasing synthesis pH, where 55-80% and 90-100% activity was retained for all samples synthesized at pH 5.0 and pH 7.0, respectively, and the Km or Vmax values of Cat-PAA(100)-7 did not differ significantly from those of the free enzyme. All conjugates synthesized at pH 7.0 were thermally stable even when heated to ∼85-90 °C, while native catalase denatured between 55 and 65 °C. All conjugates retained 40-90% of their original activities even after storing for 10 weeks at 8 °C, while unmodified catalase lost all of its activity within 2 weeks, under similar storage conditions. Interestingly, PAA surrounding catalase limited access to the enzyme from large molecules like proteases and significantly increased

  4. Isocholic acid formation from 7 alpha,12 alpha-dihydroxy-3-keto-5 beta-cholanoic acid with human liver enzyme.

    PubMed

    Amuro, Y; Yamade, W; Yamamoto, T; Kudo, K; Fujikura, M; Maebo, A; Hada, T; Higashino, K

    1986-12-01

    The formation of isocholic acid from 7 alpha, 12 alpha-dihydroxy-3-keto-5 beta-cholanoic acid by human liver preparations was examined in vitro. Liver preparations were incubated with 7 alpha, 12 alpha-dihydroxy-3-keto-5 beta-cholanoic acid at pH 7.4 in a phosphate buffer containing NADPH or NADH. The products formed were analyzed by gas chromatography and gas chromatography/mass spectrometry. Results showed that 7 alpha,12 alpha-dihydroxy-3-keto-5 beta-cholanoic acid was reduced mainly to isocholic acid and to cholic acid in a smaller amount in the presence of NADPH, while it was reduced only to cholic acid in the presence of NADH. The reducing enzyme participating in the formation of isocholic acid was localized largely in the cytosol and had more specificity to the unconjugated form as substrate than to the conjugated forms. 3-Keto bile acid analogues, 3-keto-5 beta-cholanoic and 7 alpha-hydroxy-3-keto-5 beta-cholanoic acids were not reduced to the corresponding iso-bile acids by the cytosol in the same conditions used in the isocholic acid formation and the activity of the enzyme catalyzing the reduction of 7 alpha,12 alpha-dihydroxy-3-keto-5 beta-cholanoic acid to isocholic acid was not inhibited by the addition of 3-keto-5 beta-cholanoic acid or 7 alpha-hydroxy-3-keto-5 beta-cholanoic acid to the reaction mixture. Furthermore, on column chromatography of Affi-Gel Blue, the peak of the enzyme catalyzing the reduction of 7 alpha,12 alpha-dihydroxy-3-keto-5 beta-cholanoic acid to isocholic acid was clearly distinguished from that of the enzyme catalyzing the reduction of 3-keto-5 beta-cholanoic acid to isolithocholic acid and that of alcohol dehydrogenase. These results indicate that this enzyme catalyzing the reduction of 7 alpha,12 alpha-dihydroxy-3-keto-5 beta-cholanoic acid to isocholic acid is different from the enzyme(s) catalyzing the reduction 3-keto-5 beta-cholanoic and 7 alpha-hydroxy-3-keto-5 beta-cholanoic acids to the corresponding iso-bile acids

  5. Identification of key functional residues in the active site of human {beta}1,4-galactosyltransferase 7: a major enzyme in the glycosaminoglycan synthesis pathway.

    PubMed

    Talhaoui, Ibtissam; Bui, Catherine; Oriol, Rafael; Mulliert, Guillermo; Gulberti, Sandrine; Netter, Patrick; Coughtrie, Michael W H; Ouzzine, Mohamed; Fournel-Gigleux, Sylvie

    2010-11-26

    Glycosaminoglycans (GAGs) play a central role in many pathophysiological events, and exogenous xyloside substrates of β1,4-galactosyltransferase 7 (β4GalT7), a major enzyme of GAG biosynthesis, have interesting biomedical applications. To predict functional peptide regions important for substrate binding and activity of human β4GalT7, we conducted a phylogenetic analysis of the β1,4-galactosyltransferase family and generated a molecular model using the x-ray structure of Drosophila β4GalT7-UDP as template. Two evolutionary conserved motifs, (163)DVD(165) and (221)FWGWGREDDE(230), are central in the organization of the enzyme active site. This model was challenged by systematic engineering of point mutations, combined with in vitro and ex vivo functional assays. Investigation of the kinetic properties of purified recombinant wild-type β4GalT7 and selected mutants identified Trp(224) as a key residue governing both donor and acceptor substrate binding. Our results also suggested the involvement of the canonical carboxylate residue Asp(228) acting as general base in the reaction catalyzed by human β4GalT7. Importantly, ex vivo functional tests demonstrated that regulation of GAG synthesis is highly responsive to modification of these key active site amino acids. Interestingly, engineering mutants at position 224 allowed us to modify the affinity and to modulate the specificity of human β4GalT7 toward UDP-sugars and xyloside acceptors. Furthermore, the W224H mutant was able to sustain decorin GAG chain substitution but not GAG synthesis from exogenously added xyloside. Altogether, this study provides novel insight into human β4GalT7 active site functional domains, allowing manipulation of this enzyme critical for the regulation of GAG synthesis. A better understanding of the mechanism underlying GAG assembly paves the way toward GAG-based therapeutics.

  6. [Recombinant cephalosporin-acid synthesase: optimisation of expression in E.coli cells, immobilisation and application for biocatalytic cefazolin synthesis].

    PubMed

    Eldarov, M A; Sklyarenko, A V; Dumina, M V; Medvedeva, N V; Jgoun, A A; Satarova, J E; Sidorenko, A I; Emperian, A S; Yarotsky, S V

    2015-01-01

    Cephalosporin acid synthetase (CASA) is responsible for specific to synthesis of cephalosporin-acids, its expression in Escherichia coli cells is accompanied by accumulation of unprocessed insoluble precursor. In order to optimize conditions of recombinant CASA production we have studied the effects of several parameters of strain cultivation, including growth media composition, temperature, and inoculation dose. Also plasmids for production of CASA variants with the signal sequence of Erwinia carotovora L-asparaginase (ansCASA) and "leaderless" CASA were created in search of more efficient expression constructs. Removal of the N-terminal secretion signal sequence reduced the production of functionally active CASA more than 10-fold and inhibited strain growth. Insertion of the L-asparaginase signal sequence increased the specific enzyme activity in the resultant recombinant strain. The ansCASA producing strain was used to develop the method of immobilization of the recombinant enzyme on an epoxy-activated macroporous acrylic support. The resultant biocatalyst performed effective synthesis of cefazolin from 3-[(5-methyl-1,3,4-thiadiazol-2-il)-thiomethyl]-7- aminocephalosporanic acid (MMTD-7-ACA) and methyl ester of 1(H)-tetrazolilacetic acid (МETzAA), under mild conditions a transformation level of MMTD-7-ACA to cefazolin of 95% is reached. PMID:26539875

  7. [Recombinant cephalosporin-acid synthesase: optimisation of expression in E.coli cells, immobilisation and application for biocatalytic cefazolin synthesis].

    PubMed

    Eldarov, M A; Sklyarenko, A V; Dumina, M V; Medvedeva, N V; Jgoun, A A; Satarova, J E; Sidorenko, A I; Emperian, A S; Yarotsky, S V

    2015-01-01

    Cephalosporin acid synthetase (CASA) is responsible for specific to synthesis of cephalosporin-acids, its expression in Escherichia coli cells is accompanied by accumulation of unprocessed insoluble precursor. In order to optimize conditions of recombinant CASA production we have studied the effects of several parameters of strain cultivation, including growth media composition, temperature, and inoculation dose. Also plasmids for production of CASA variants with the signal sequence of Erwinia carotovora L-asparaginase (ansCASA) and "leaderless" CASA were created in search of more efficient expression constructs. Removal of the N-terminal secretion signal sequence reduced the production of functionally active CASA more than 10-fold and inhibited strain growth. Insertion of the L-asparaginase signal sequence increased the specific enzyme activity in the resultant recombinant strain. The ansCASA producing strain was used to develop the method of immobilization of the recombinant enzyme on an epoxy-activated macroporous acrylic support. The resultant biocatalyst performed effective synthesis of cefazolin from 3-[(5-methyl-1,3,4-thiadiazol-2-il)-thiomethyl]-7- aminocephalosporanic acid (MMTD-7-ACA) and methyl ester of 1(H)-tetrazolilacetic acid (МETzAA), under mild conditions a transformation level of MMTD-7-ACA to cefazolin of 95% is reached.

  8. Green Synthesis and Urease Inhibitory Activity of Spiro-Pyrimidinethiones/Spiro-Pyrimidinones-Barbituric Acid Derivatives

    PubMed Central

    Mohammadi Ziarani, Ghodsi; Asadi, Shima; Faramarzi, Sakineh; Amanlou, Massoud

    2015-01-01

    Sulfonic acid functionalized SBA-15 (SBA-Pr-SO3H) with pore size 6 nm as an efficient heterogeneous nanoporous solid acid catalyst exhibited good catalytic activity in the Biginelli-like reaction in the synthesis of spiroheterobicyclic rings with good yield and good recyclability. Spiro-pyrimidinethiones/spiro-pyrimidinones-barbituric acid derivatives were synthesized in a simple and efficient method using the one-pot three-component reaction of a cyclic 1,3- dicarbonyl compounds (barbituric acid), an aromatic aldehyde and urea or thiourea in the presence of nanoporous silica SBA-Pr-SO3H under solvent free conditions. Urease inhibitory activity of spiro compounds were tested against Jack bean urease using Berthelot alkaline phenol–hypochlorite method. Five of 13 compounds were inhibitor and two of them were enzyme activators. Analysis of the docking results showed that, in most of the spiro molecules, one of the carbonyl groups is coordinated with both nickel atoms, while the other one is involved in the formation of hydrogen bonds with important active-site residues. The effect of inserting two methyl groups on N atoms of barbiturate ring, S substituted, ortho, meta and para substituted compounds were investigated too. PMID:26664377

  9. A yeast acetyl coenzyme A carboxylase mutant links very-long-chain fatty acid synthesis to the structure and function of the nuclear membrane-pore complex.

    PubMed Central

    Schneiter, R; Hitomi, M; Ivessa, A S; Fasch, E V; Kohlwein, S D; Tartakoff, A M

    1996-01-01

    The conditional mRNA transport mutant of Saccharomyces cerevisiae, acc1-7-1 (mtr7-1), displays a unique alteration of the nuclear envelope. Unlike nucleoporin mutants and other RNA transport mutants, the intermembrane space expands, protuberances extend from the inner membrane into the intermembrane space, and vesicles accumulate in the intermembrane space. MTR7 is the same gene as ACC1, encoding acetyl coenzyme A (CoA) carboxylase (Acc1p), the rate-limiting enzyme of de novo fatty acid synthesis. Genetic and biochemical analyses of fatty acid synthesis mutants and acc1-7-1 indicate that the continued synthesis of malonyl-CoA, the enzymatic product of acetyl-CoA carboxylase, is required for an essential pathway which is independent from de novo synthesis of fatty acids. We provide evidence that synthesis of very-long-chain fatty acids (C26 atoms) is inhibited in acc1-7-1, suggesting that very-long-chain fatty acid synthesis is required to maintain a functional nuclear envelope. PMID:8943372

  10. Integrated engineering of β-oxidation reversal and ω-oxidation pathways for the synthesis of medium chain ω-functionalized carboxylic acids.

    PubMed

    Clomburg, James M; Blankschien, Matthew D; Vick, Jacob E; Chou, Alexander; Kim, Seohyoung; Gonzalez, Ramon

    2015-03-01

    An engineered reversal of the β-oxidation cycle was exploited to demonstrate its utility for the synthesis of medium chain (6-10-carbons) ω-hydroxyacids and dicarboxylic acids from glycerol as the only carbon source. A redesigned β-oxidation reversal facilitated the production of medium chain carboxylic acids, which were converted to ω-hydroxyacids and dicarboxylic acids by the action of an engineered ω-oxidation pathway. The selection of a key thiolase (bktB) and thioesterase (ydiI) in combination with previously established core β-oxidation reversal enzymes, as well as the development of chromosomal expression systems for the independent control of pathway enzymes, enabled the generation of C6-C10 carboxylic acids and provided a platform for vector based independent expression of ω-functionalization enzymes. Using this approach, the expression of the Pseudomonas putida alkane monooxygenase system, encoded by alkBGT, in combination with all β-oxidation reversal enzymes resulted in the production of 6-hydroxyhexanoic acid, 8-hydroxyoctanoic acid, and 10-hydroxydecanoic acid. Following identification and characterization of potential alcohol and aldehyde dehydrogenases, chnD and chnE from Acinetobacter sp. strain SE19 were expressed in conjunction with alkBGT to demonstrate the synthesis of the C6-C10 dicarboxylic acids, adipic acid, suberic acid, and sebacic acid. The potential of a β-oxidation cycle with ω-oxidation termination pathways was further demonstrated through the production of greater than 0.8 g/L C6-C10 ω-hydroxyacids or about 0.5 g/L dicarboxylic acids of the same chain lengths from glycerol (an unrelated carbon source) using minimal media.

  11. Evidence for defective transfer ribonucleic acid in polymyopathic hamsters and its inhibitory effect on protein synthesis

    PubMed Central

    Bester, André J.; Gevers, Wieland

    1973-01-01

    1. Different reaction steps involved in protein synthesis were studied in skeletal muscles from control and myopathic hamsters. 2. There was no difference between partially purified aminoacyl-tRNA synthetases from myopathic and control animals in yield or catalytic activity, as tested with exogenous deacylated tRNA. 3. However, isolated deacylated tRNA from myopathic muscle was aminoacylated by these synthetases to a lesser extent than that derived from control muscle. 4. Addition of deacylated tRNA isolated from control muscle improved the performance of pH5 enzymes from myopathic muscle in polypeptide synthesis on homologous polyribosomes; tRNA isolated from myopathic animals did not. 5. Preparation of extracts from both types of animals in the presence of the ribonuclease-absorbent bentonite led to an increased capacity of endogenous tRNA to accept amino acids in pH5 enzymes prepared from normal and abnormal tissue, but the difference between the two systems remained the same. 6. Total tRNA nucleotidyltransferase activity, tested with twice-pyrophosphorolysed rat liver tRNA, was identical in both extracts. 7. Added tRNA nucleotidyltransferase incorporated more AMP and CMP into endogenous tRNA with the pH5 enzyme from myopathic muscle than with that from control muscle. 8. Preincubation of deacylated tRNA from myopathic muscle with ATP, CTP and tRNA nucleotidyltransferase more than doubled its subsequent aminoacyl-acceptor activity, and halved the extent of the defect relative to aminoacylation of control tRNA similarly treated. Endogenous tRNA in pH5 enzyme preparations behaved likewise. 9. It is suggested that a 3′-exonuclease in myopathic muscles attacks tRNA molecules in such a way that some of them remain substrates for tRNA nucleotidyltransferase, which may incorporate into RNA not only AMP and CMP, but also GMP. 10. Cell-free protein synthesis in preparations from myopathic hamster muscles is limited by the supply of intact tRNA molecules. PMID:4725037

  12. Electrocarboxylation: towards sustainable and efficient synthesis of valuable carboxylic acids

    PubMed Central

    Matthessen, Roman; Fransaer, Jan; Binnemans, Koen

    2014-01-01

    Summary The near-unlimited availability of CO2 has stimulated a growing research effort in creating value-added products from this greenhouse gas. This paper presents the trends on the most important methods used in the electrochemical synthesis of carboxylic acids from carbon dioxide. An overview is given of different substrate groups which form carboxylic acids upon CO2 fixation, including mechanistic considerations. While most work focuses on the electrocarboxylation of substrates with sacrificial anodes, this review considers the possibilities and challenges of implementing other synthetic methodologies. In view of potential industrial application, the choice of reactor setup, electrode type and reaction pathway has a large influence on the sustainability and efficiency of the process. PMID:25383120

  13. Effect of mitochondrial ascorbic acid synthesis on photosynthesis.

    PubMed

    Senn, M E; Gergoff Grozeff, G E; Alegre, M L; Barrile, F; De Tullio, M C; Bartoli, C G

    2016-07-01

    Ascorbic acid (AA) is synthesized in plant mitochondria through the oxidation of l-galactono-1,4-lactone (l-GalL) and then distributed to different cell compartments. AA-deficient Arabidopsis thaliana mutants (vtc2) and exogenous applications of l-GalL were used to generate plants with different AA content in their leaves. This experimental approach allows determining specific AA-dependent effects on carbon metabolism. No differences in O2 uptake, malic and citric acid and NADH content suggest that AA synthesis or accumulation did not affect mitochondrial activity; however, l-GalL treatment increased CO2 assimilation and photosynthetic electron transport rate in vtc2 (but not wt) leaves demonstrating a stimulation of photosynthesis after l-GalL treatment. Increased CO2 assimilation correlated with increased leaf stomatal conductance observed in l-GalL-treated vtc2 plants.

  14. Synthesis and characterization of acidic mesoporous borosilicate thin films.

    PubMed

    Xiu, Tongping; Liu, Qian; Wang, Jiacheng

    2009-02-01

    Work on the synthesis and characterization of acidic wormhole-like ordered mesoporous borosilicate thin films (MBSTFs) on silicon wafers is described in this paper. The MBSTFs coated by the dip-coating method were prepared through an evaporation-induced self-assembly (EISA) process using nonionic block copolymers as structure-directing agents. Fourier transform infrared (FT-IR) spectroscopy confirmed the formation of borosiloxane bonds (Si-O-B). High-resolution transmission electron microscopy (HRTEM) and N2 sorption evidenced a wormhole-like mesoporous structure in the MBSTFs obtained. Scanning electron microscopy (SEM) images of the cross sections and surfaces of the samples showed that MBSTFs on silicon wafers were continuous, homogeneous and did not crack. The acidic properties of the MBSTFs were characterized by FT-IR spectra of chemisorbed pyridine. The MBSTFs thus prepared may find their future applications in many fields including chemical sensors, catalysis, optical coating, molecule separation, etc.

  15. Effect of mitochondrial ascorbic acid synthesis on photosynthesis.

    PubMed

    Senn, M E; Gergoff Grozeff, G E; Alegre, M L; Barrile, F; De Tullio, M C; Bartoli, C G

    2016-07-01

    Ascorbic acid (AA) is synthesized in plant mitochondria through the oxidation of l-galactono-1,4-lactone (l-GalL) and then distributed to different cell compartments. AA-deficient Arabidopsis thaliana mutants (vtc2) and exogenous applications of l-GalL were used to generate plants with different AA content in their leaves. This experimental approach allows determining specific AA-dependent effects on carbon metabolism. No differences in O2 uptake, malic and citric acid and NADH content suggest that AA synthesis or accumulation did not affect mitochondrial activity; however, l-GalL treatment increased CO2 assimilation and photosynthetic electron transport rate in vtc2 (but not wt) leaves demonstrating a stimulation of photosynthesis after l-GalL treatment. Increased CO2 assimilation correlated with increased leaf stomatal conductance observed in l-GalL-treated vtc2 plants. PMID:27010742

  16. The crystal structure of the adenylation enzyme VinN reveals a unique β-amino acid recognition mechanism.

    PubMed

    Miyanaga, Akimasa; Cieślak, Jolanta; Shinohara, Yuji; Kudo, Fumitaka; Eguchi, Tadashi

    2014-11-01

    Adenylation enzymes play important roles in the biosynthesis and degradation of primary and secondary metabolites. Mechanistic insights into the recognition of α-amino acid substrates have been obtained for α-amino acid adenylation enzymes. The Asp residue is invariant and is essential for the stabilization of the α-amino group of the substrate. In contrast, the β-amino acid recognition mechanism of adenylation enzymes is still unclear despite the importance of β-amino acid activation for the biosynthesis of various natural products. Herein, we report the crystal structure of the stand-alone adenylation enzyme VinN, which specifically activates (2S,3S)-3-methylaspartate (3-MeAsp) in vicenistatin biosynthesis. VinN has an overall structure similar to that of other adenylation enzymes. The structure of the complex with 3-MeAsp revealed that a conserved Asp(230) residue is used in the recognition of the β-amino group of 3-MeAsp similar to α-amino acid adenylation enzymes. A mutational analysis and structural comparison with α-amino acid adenylation enzymes showed that the substrate-binding pocket of VinN has a unique architecture to accommodate 3-MeAsp as a β-amino acid substrate. Thus, the VinN structure allows the first visualization of the interaction of an adenylation enzyme with a β-amino acid and provides new mechanistic insights into the selective recognition of β-amino acids in this family of enzymes. PMID:25246523

  17. The Crystal Structure of the Adenylation Enzyme VinN Reveals a Unique β-Amino Acid Recognition Mechanism*

    PubMed Central

    Miyanaga, Akimasa; Cieślak, Jolanta; Shinohara, Yuji; Kudo, Fumitaka; Eguchi, Tadashi

    2014-01-01

    Adenylation enzymes play important roles in the biosynthesis and degradation of primary and secondary metabolites. Mechanistic insights into the recognition of α-amino acid substrates have been obtained for α-amino acid adenylation enzymes. The Asp residue is invariant and is essential for the stabilization of the α-amino group of the substrate. In contrast, the β-amino acid recognition mechanism of adenylation enzymes is still unclear despite the importance of β-amino acid activation for the biosynthesis of various natural products. Herein, we report the crystal structure of the stand-alone adenylation enzyme VinN, which specifically activates (2S,3S)-3-methylaspartate (3-MeAsp) in vicenistatin biosynthesis. VinN has an overall structure similar to that of other adenylation enzymes. The structure of the complex with 3-MeAsp revealed that a conserved Asp230 residue is used in the recognition of the β-amino group of 3-MeAsp similar to α-amino acid adenylation enzymes. A mutational analysis and structural comparison with α-amino acid adenylation enzymes showed that the substrate-binding pocket of VinN has a unique architecture to accommodate 3-MeAsp as a β-amino acid substrate. Thus, the VinN structure allows the first visualization of the interaction of an adenylation enzyme with a β-amino acid and provides new mechanistic insights into the selective recognition of β-amino acids in this family of enzymes. PMID:25246523

  18. Effects of inhibitors of key enzymes of sphingolipid metabolism on insulin-induced glucose uptake and glycogen synthesis in liver cells of old rats.

    PubMed

    Babenko, N A; Kharchenko, V S

    2015-01-01

    Sphingolipids play an important role in the development of insulin resistance. Ceramides are the most potent inhibitors of insulin signal transduction. Ceramides are generated in response to stress stimuli and in old age. In this work, we studied the possible contribution of different pathways of sphingolipid metabolism in age-dependent insulin resistance development in liver cells. Inhibition of key enzymes of sphingolipid synthesis (serine palmitoyl transferase, ceramide synthase) and degradation (neutral and acidic SMases) by means of specific inhibitors (myriocin, fumonisin B1, imipramine, and GW4869) was followed with the reduction of ceramide level and partly improved insulin regulation of glucose metabolism in "old" hepatocytes. Imipramine and GW4869 decreased significantly the acidic and neutral SMase activities, respectively. Treatment of "old" cells with myriocin or fumonisin B1 reduced the elevated in old age ceramide and SM synthesis. Ceramide and SM levels and glucose metabolism regulation by insulin could be improved with concerted action of all tested inhibitors of sphingolipid turnover on hepatocytes. The data demonstrate that not only newly synthesized ceramide and SM but also neutral and acidic SMase-dependent ceramide accumulation plays an important role in development of age-dependent insulin resistance.

  19. Spatial organisation of four enzymes from Stevia rebaudiana that are involved in steviol glycoside synthesis.

    PubMed

    Humphrey, Tania V; Richman, Alex S; Menassa, Rima; Brandle, Jim E

    2006-05-01

    The sweet steviol glycosides found in the leaves of Stevia rebaudiana Bert. are derived from the diterpene steviol which is produced from a branch of the gibberellic acid (GA) biosynthetic pathway. An understanding of the spatial organisation of the two pathways including subcellular compartmentation provides important insight for the metabolic engineering of steviol glycosides as well as other secondary metabolites in plants. The final step of GA biosynthesis, before the branch point for steviol production, is the formation of (-)-kaurenoic acid from (-)-kaurene, catalysed by kaurene oxidase (KO). Downstream of this, the first committed step in steviol glycoside synthesis is the hydroxylation of kaurenoic acid to form steviol which is then sequentially glucosylated by a series of UDP-glucosyltransferases (UGTs) to produce the variety of steviol glycosides. The subcellular location of KO and three of the UGTs involved in steviol glycoside biosynthesis was investigated by expression of GFP fusions and cell fractionation which revealed KO to be associated with the endoplasmic reticulum and the UGTs in the cytoplasm. It has also been shown by expressing the Stevia UGTs in Arabidopsis that the pathway can be partially reconstituted by recruitment of a native Arabidopsis glucosyltransferase. PMID:16786291

  20. Alternative kynurenic acid synthesis routes studied in the rat cerebellum

    PubMed Central

    Blanco Ayala, Tonali; Lugo Huitrón, Rafael; Carmona Aparicio, Liliana; Ramírez Ortega, Daniela; González Esquivel, Dinora; Pedraza Chaverrí, José; Pérez de la Cruz, Gonzalo; Ríos, Camilo; Schwarcz, Robert; Pérez de la Cruz, Verónica

    2015-01-01

    Kynurenic acid (KYNA), an astrocyte-derived, endogenous antagonist of α7 nicotinic acetylcholine and excitatory amino acid receptors, regulates glutamatergic, GABAergic, cholinergic and dopaminergic neurotransmission in several regions of the rodent brain. Synthesis of KYNA in the brain and elsewhere is generally attributed to the enzymatic conversion of L-kynurenine (L-KYN) by kynurenine aminotransferases (KATs). However, alternative routes, including KYNA formation from D-kynurenine (D-KYN) by D-amino acid oxidase (DAAO) and the direct transformation of kynurenine to KYNA by reactive oxygen species (ROS), have been demonstrated in the rat brain. Using the rat cerebellum, a region of low KAT activity and high DAAO activity, the present experiments were designed to examine KYNA production from L-KYN or D-KYN by KAT and DAAO, respectively, and to investigate the effect of ROS on KYNA synthesis. In chemical combinatorial systems, both L-KYN and D-KYN interacted directly with peroxynitrite (ONOO−) and hydroxyl radicals (OH•), resulting in the formation of KYNA. In tissue homogenates, the non-specific KAT inhibitor aminooxyacetic acid (AOAA; 1 mM) reduced KYNA production from L-KYN and D-KYN by 85.1 ± 1.7% and 27.1 ± 4.5%, respectively. Addition of DAAO inhibitors (benzoic acid, kojic acid or 3-methylpyrazole-5-carboxylic acid; 5 μM each) attenuated KYNA formation from L-KYN and D-KYN by ~35% and ~66%, respectively. ONOO− (25 μM) potentiated KYNA production from both L-KYN and D-KYN, and these effects were reduced by DAAO inhibition. AOAA attenuated KYNA production from L-KYN + ONOO− but not from D-KYN + ONOO−. In vivo, extracellular KYNA levels increased rapidly after perfusion of ONOO− and, more prominently, after subsequent perfusion with L-KYN or D-KYN (100 μM). Taken together, these results suggest that different mechanisms are involved in KYNA production in the rat cerebellum, and that, specifically, DAAO and ROS can function as alternative

  1. Alternative kynurenic acid synthesis routes studied in the rat cerebellum.

    PubMed

    Blanco Ayala, Tonali; Lugo Huitrón, Rafael; Carmona Aparicio, Liliana; Ramírez Ortega, Daniela; González Esquivel, Dinora; Pedraza Chaverrí, José; Pérez de la Cruz, Gonzalo; Ríos, Camilo; Schwarcz, Robert; Pérez de la Cruz, Verónica

    2015-01-01

    Kynurenic acid (KYNA), an astrocyte-derived, endogenous antagonist of α7 nicotinic acetylcholine and excitatory amino acid receptors, regulates glutamatergic, GABAergic, cholinergic and dopaminergic neurotransmission in several regions of the rodent brain. Synthesis of KYNA in the brain and elsewhere is generally attributed to the enzymatic conversion of L-kynurenine (L-KYN) by kynurenine aminotransferases (KATs). However, alternative routes, including KYNA formation from D-kynurenine (D-KYN) by D-amino acid oxidase (DAAO) and the direct transformation of kynurenine to KYNA by reactive oxygen species (ROS), have been demonstrated in the rat brain. Using the rat cerebellum, a region of low KAT activity and high DAAO activity, the present experiments were designed to examine KYNA production from L-KYN or D-KYN by KAT and DAAO, respectively, and to investigate the effect of ROS on KYNA synthesis. In chemical combinatorial systems, both L-KYN and D-KYN interacted directly with peroxynitrite (ONOO(-)) and hydroxyl radicals (OH•), resulting in the formation of KYNA. In tissue homogenates, the non-specific KAT inhibitor aminooxyacetic acid (AOAA; 1 mM) reduced KYNA production from L-KYN and D-KYN by 85.1 ± 1.7% and 27.1 ± 4.5%, respectively. Addition of DAAO inhibitors (benzoic acid, kojic acid or 3-methylpyrazole-5-carboxylic acid; 5 μM each) attenuated KYNA formation from L-KYN and D-KYN by ~35% and ~66%, respectively. ONOO(-) (25 μM) potentiated KYNA production from both L-KYN and D-KYN, and these effects were reduced by DAAO inhibition. AOAA attenuated KYNA production from L-KYN + ONOO(-) but not from D-KYN + ONOO(-). In vivo, extracellular KYNA levels increased rapidly after perfusion of ONOO(-) and, more prominently, after subsequent perfusion with L-KYN or D-KYN (100 μM). Taken together, these results suggest that different mechanisms are involved in KYNA production in the rat cerebellum, and that, specifically, DAAO and ROS can function as alternative

  2. Retinoic acid signalling centres in the avian embryo identified by sites of expression of synthesising and catabolising enzymes.

    PubMed

    Blentic, Aida; Gale, Emily; Maden, Malcolm

    2003-05-01

    Retinoic acid is an important signalling molecule in the developing embryo, but its precise distribution throughout development is very difficult to determine by available techniques. Examining the distribution of the enzymes by which it is synthesised by using in situ hybridisation is an alternative strategy. Here, we describe the distribution of three retinoic acid synthesising enzymes and one retinoic acid catabolic enzyme during the early stages of chick embryogenesis with the intention of identifying localized retinoic acid signalling regions. The enzymes involved are Raldh1, Raldh2, Raldh3, and Cyp26A1. Although some of these distributions have been described before, here we assemble them all in one species and several novel sites of enzyme expression are identified, including Hensen's node, the cardiac endoderm, the presumptive pancreatic endoderm, and the dorsal lens. This study emphasizes the dynamic pattern of expression of the enzymes that control the availability of retinoic acid as well as the role that retinoic acid plays in the development of many regions of the embryo throughout embryogenesis. This strategy provides a basis for understanding the phenotypes of retinoic acid teratology and retinoic acid-deficiency syndromes.

  3. Study and comparison of two enzyme membrane reactors for fatty acids and glycerol production

    SciTech Connect

    Molinari, R.; Santoro, M.E.; Drioli, E. . Dept. of Chemical Engineering and Materials Inst. on Membranes and Chemical Reactors-CNR, Arcavacata di Rende )

    1994-11-01

    Two enzyme membrane reactors (EMR), (1) with one substrate (olive oil) in an oil-in-water emulsion (E-EMR) and (2) with two separated liquid phases (oil and water) (TSLP-EMR), have been studied for the conversion of the triglycerides to fatty acids and glycerol. The enzyme was Candida cylindracea lipase confined on the pressurized face or entrapped in the sponge side of capillary ultrafiltration membranes. Two methods for immobilizing the enzyme in the TSLP-EMR were used: ultrafiltration on a virgin membrane and ultrafiltration on glutaraldehyde pretreated membranes. A multiple use of the reactor was obtained immobilizing the enzyme on the membrane preactivated with glutaraldehyde. The TSLP-EMR showed a specific activity of 0.529 mmol/(mg[center dot]h) versus a specific activity of 0.170 mmol/(mg[center dot]h) of the E-EMR. The rate of fatty acid production in the TSLP-EMR was linear with time showing no enzyme deactivation in an operating time of 80 h. The kinetics observed in the two reactors was different: an equilibrium reaction product-inhibited for the E-EMR and an apparent irreversible reaction of zero order for the TSLP-EMR. Taking into account that in the TSLP-EMR, compared to the E-EMR, (1) the specific activity was higher, (2) the specific rate was constant with the time, and (3) the two products were already separated after the reaction, the TSLP-EMR configuration seems the more convenient.

  4. On the Light Dependence of Fatty Acid Synthesis in Spinach Chloroplasts

    PubMed Central

    Sauer, Andreas; Heise, Klaus-Peter

    1983-01-01

    The capacity of intact chloroplasts to synthesize long chain fatty acids from acetate depends on the stroma pH in Spinacia oleracea, U. S. hybrid 424. The pH optimum is close to 8.5. Lowering of the stroma pH leads to a reduction of acetate incorporation but does not suffice to eliminate fatty acid synthesis completely. Chain elongation from palmitic to oleic acid shows the same pH dependence. Fatty acid synthesis is activated in the dark upon the simultaneous addition of dihydroxyacetone phosphate and orthophosphate supplying ATP and oxaloacetate for reoxidation of NADPH in the stroma. Under these conditions both dark fatty acid synthesis and synthesis of oleate from palmitate show the same pH dependence as in the light. Dark fatty acid synthesis is further stimulated by increasing the stromal Mg2+ concentration with the ionophore A 23187. In contrast to CO2 fixation, dark fatty acid synthesis is considerably reduced by dithiothreitol (DTT). This observation may be due to an acetyl-CoA deficiency, caused by a nonenzymic acylation of DTT, and a competition for ATP between DTT-activated CO2 fixation and fatty acid synthesis. Because d,l-glyceraldehyde as inhibitor of CO2 fixation compensates the DTT effect on dark fatty acid synthesis, reducing equivalents may be involved in the light dependence of acetate activation. PMID:16663156

  5. Dihydroasparagusic acid: antioxidant and tyrosinase inhibitory activities and improved synthesis.

    PubMed

    Venditti, Alessandro; Mandrone, Manuela; Serrilli, Anna Maria; Bianco, Armandodoriano; Iannello, Carmelina; Poli, Ferruccio; Antognoni, Fabiana

    2013-07-17

    Dihydroasparagusic acid (DHAA) is the reduced form of asparagusic acid, a sulfur-containing flavor component produced by Asparagus plants. In this work, DHAA was synthetically produced by modifying some published protocols, and the synthesized molecule was tested in several in vitro assays (DPPH, ABTS, FRAP-ferrozine, BCB, deoxyribose assays) to evaluate its radical scavenging activity. Results show that DHAA is endowed with a significant in vitro antioxidant activity, comparable to that of Trolox. DHAA was also evaluated for its inhibitory activity toward tyrosinase, an enzyme involved, among others, in melanogenesis and in browning processes of plant-derived foods. DHAA was shown to exert an inhibitory effect on tyrosinase activity, and the inhibitor kinetics, analyzed by a Lineweaver-Burk plot, exhibited a competitive mechanism. Taken together, these results suggest that DHAA may be considered as a potentially active molecule for use in various fields of application, such as pharmaceutical, cosmetics, agronomic and food. PMID:23790134

  6. Nuclear synthesis of cytoplasmic ribonucleic acid in Amoeba proteus.

    PubMed

    PRESCOTT, D M

    1959-10-01

    The enucleation technique has been applied to Amoeba proteus by several laboratories in attempts to determine whether the cytoplasm is capable of nucleus-independent ribonucleic acid synthesis. This cell is very convenient for micrurgy, but its use requires a thorough starvation period to eliminate the possibility of metabolic influence by food vacuoles and frequent washings and medium renewal to maintain asepsis. In the experiments described here, amoebae were starved for periods of 24 to 96 hours, cut into nucleated and enucleated halves, and exposed to either C-14 uracil, C-14 adenine, C-14 orotic acid, or a mixture of all three. When the starvation period was short (less than 72 hours), organisms (especially yeast cells) contained within amoeba food vacuoles frequently showed RNA synthesis in both nucleated and enucleated amoebae. When the preperiod of starvation was longer than 72 hours, food vacuole influence was apparently negligible, and a more meaningful comparison between enucleated and nucleated amoebae was possible. Nucleated cells incorporated all three precursors into RNA; enucleated cells were incapable of such incorporation. The experiments indicate a complete dependence on the nucleus for RNA synthesis. The conflict with the experimental results of others on this problem could possibly stem from differences in culture conditions, starvation treatment, or experimental conditions. For an unequivocal answer in experiments of this design, ideally the cells should be capable of growth on an entirely synthetic medium under aseptic conditions. The use of a synthetic medium (experiments with A. proteus are done under starvation conditions) would permit, moreover, a more realistic comparison of metabolic capacities of nucleated and enucleated cells.

  7. Biochemical and Molecular Characterization of Phenylacetate-Coenzyme A Ligase, an Enzyme Catalyzing the First Step in Aerobic Metabolism of Phenylacetic Acid in Azoarcus evansii

    PubMed Central

    El-Said Mohamed, Magdy

    2000-01-01

    Phenylacetate-coenzyme A ligase (PA-CoA ligase; AMP forming, EC 6.2.1.30), the enzyme catalyzing the first step in the aerobic degradation of phenylacetate (PA) in Azoarcus evansii, has been purified and characterized. The gene (paaK) coding for this enzyme was cloned and sequenced. The enzyme catalyzes the reaction of PA with CoA and MgATP to yield phenylacetyl-CoA (PACoA) plus AMP plus PPi. The enzyme was specifically induced after aerobic growth in a chemically defined medium containing PA or phenylalanine (Phe) as the sole carbon source. Growth with 4-hydroxyphenylacetate, benzoate, adipate, or acetate did not induce the synthesis of this enzyme. This enzymatic activity was detected very early in the exponential phase of growth, and a maximal specific activity of 76 nmol min−1 mg of cell protein−1 was measured. After 117-fold purification to homogeneity, a specific activity of 48 μmol min−1 mg of protein−1 was achieved with a turnover number (catalytic constant) of 40 s−1. The protein is a monomer of 52 kDa and shows high specificity towards PA; other aromatic or aliphatic acids were not used as substrates. The apparent Km values for PA, ATP, and CoA were 14, 60, and 45 μM, respectively. The PA-CoA ligase has an optimum pH of 8 to 8.5 and a pI of 6.3. The enzyme is labile and requires the presence of glycerol for stabilization. The N-terminal amino acid sequence of the purified protein showed no homology with other reported PA-CoA ligases. The gene encoding this enzyme is 1,320 bp long and codes for a protein of 48.75 kDa (440 amino acids) which shows high similarity with other reported PA-CoA ligases. An amino acid consensus for an AMP binding motif (VX2SSGTTGXP) was identified. The biochemical and molecular characteristics of this enzyme are quite different from those of the isoenzyme catalyzing the same reaction under anaerobic conditions in the same bacterium. PMID:10629172

  8. Effects of Omega-3 Fatty Acids Supplement on Antioxidant Enzymes Activity in Type 2 Diabetic Patients

    PubMed Central

    TOORANG, Fatemeh; DJAZAYERY, Abolghassem; DJALALI, Mahmoud

    2016-01-01

    Background: Diabetes is a major cause of death. Oxidative stress mainly caused by hyperglycemia is the primary reason of related complications. Omega-3 fatty acids are prescribed in diabetes but the effect on antioxidant defense is controversial. This study investigated effects of omega-3 supplementation on antioxidant enzymes activity in type 2 diabetic patients. Methods: A randomized, placebo controlled, double blind clinical trial was performed on 90 type2 diabetic patients. The treatment group took, daily, three capsules of omega-3 for two mo, which totally provided 2714mg omega-3 (EPA=1548 mg, DHA=828 mg and 338 mg of other omega=3 fatty acids). Placebo contained 2100 mg sunflower oil (12% SFA, 65% linoleic acid, 23% MUFA), which is the main oil used in the study population. Food intakes, anthropometric and demographic characteristics, and therapeutic regimen data were recorded before and after the intervention. Fasting blood samples were taken before and after the intervention to measure super oxide dismutase, glutathione peroxidase, glutathione reductase, catalase and total antioxidant capacity in erythrocytes. Results: A total of 81 subjects completed the study. Two study groups were similar as regards duration of diabetes, age and the enzymes at baseline. Energy and macro- and micronutrients intakes, weight and hypoglycemic agent consumption were similar in the two groups at baseline and did not change. Supplementation had no effect on antioxidant enzyme status. Glycated hemoglobin showed a significant reduction by supplementation. Conclusion: Daily supplementation of 2714 mg mega-3 for two mo results in a significant reduction in HbA1c level in type2 diabetic patients with no effects on antioxidant enzymes activity. PMID:27141496

  9. Experiment K-7-21: Effect of Microgravity on 1: Metabolic Enzymes of Type 1 and Type 2 Muscle Fibers, and on 2: Metabolic Enzymes, Neurotransmitter Amino Acids, and Neurotransmitter Associated Enzymes in Selected Regions of the Central Nervous System. Part 2; The Distribution of Selected Enzymes and Amino Acids in the Hippocampal Formation

    NASA Technical Reports Server (NTRS)

    Lowry, O. H.; Krasnov, I.; Ilyina-Kakueva, E. I.; Nemeth, P. M.; McDougal, D. B., Jr.; Choksi, R.; Carter, J. G.; Chi, M. M. Y.; Manchester, J. K.; Pusateri, M. E.

    1994-01-01

    Six key metabolic enzymes plus glutaminase and glutamate decarboxylase, as well as glutamate, aspartate and GABA, were measured in 11 regions of the hippocampal formation of synchronous, flight and tail suspension rats. Major differences were observed in the normal distribution patterns of each enzyme and amino acid, but no substantive effects of either microgravity or tail suspension on these patterns were clearly demonstrated.

  10. Dissecting Proton Delocalization in an Enzyme's Hydrogen Bond Network with Unnatural Amino Acids.

    PubMed

    Wu, Yufan; Fried, Stephen D; Boxer, Steven G

    2015-12-01

    Extended hydrogen bond networks are a common structural motif of enzymes. A recent analysis proposed quantum delocalization of protons as a feature present in the hydrogen bond network spanning a triad of tyrosines (Y(16), Y(32), and Y(57)) in the active site of ketosteroid isomerase (KSI), contributing to its unusual acidity and large isotope shift. In this study, we utilized amber suppression to substitute each tyrosine residue with 3-chlorotyrosine to test the delocalization model and the proton affinity balance in the triad. X-ray crystal structures of each variant demonstrated that the structure, notably the O-O distances within the triad, was unaffected by 3-chlorotyrosine substitutions. The changes in the cluster's acidity and the acidity's isotope dependence in these variants were assessed via UV-vis spectroscopy and the proton sharing pattern among individual residues with (13)C nuclear magnetic resonance. Our data show pKa detuning at each triad residue alters the proton delocalization behavior in the H-bond network. The extra stabilization energy necessary for the unusual acidity mainly comes from the strong interactions between Y(57) and Y(16). This is further enabled by Y(32), which maintains the right geometry and matched proton affinity in the triad. This study provides a rich picture of the energetics of the hydrogen bond network in enzymes for further model refinement. PMID:26571340

  11. Dissecting Proton Delocalization in an Enzyme's Hydrogen Bond Network with Unnatural Amino Acids.

    PubMed

    Wu, Yufan; Fried, Stephen D; Boxer, Steven G

    2015-12-01

    Extended hydrogen bond networks are a common structural motif of enzymes. A recent analysis proposed quantum delocalization of protons as a feature present in the hydrogen bond network spanning a triad of tyrosines (Y(16), Y(32), and Y(57)) in the active site of ketosteroid isomerase (KSI), contributing to its unusual acidity and large isotope shift. In this study, we utilized amber suppression to substitute each tyrosine residue with 3-chlorotyrosine to test the delocalization model and the proton affinity balance in the triad. X-ray crystal structures of each variant demonstrated that the structure, notably the O-O distances within the triad, was unaffected by 3-chlorotyrosine substitutions. The changes in the cluster's acidity and the acidity's isotope dependence in these variants were assessed via UV-vis spectroscopy and the proton sharing pattern among individual residues with (13)C nuclear magnetic resonance. Our data show pKa detuning at each triad residue alters the proton delocalization behavior in the H-bond network. The extra stabilization energy necessary for the unusual acidity mainly comes from the strong interactions between Y(57) and Y(16). This is further enabled by Y(32), which maintains the right geometry and matched proton affinity in the triad. This study provides a rich picture of the energetics of the hydrogen bond network in enzymes for further model refinement.

  12. Effects of caffeine and paracetamol alone or in combination with acetylsalicylic acid on prostaglandin E(2) synthesis in rat microglial cells.

    PubMed

    Fiebich, B L; Lieb, K; Hüll, M; Aicher, B; van Ryn, J; Pairet, M; Engelhardt, G

    2000-08-23

    Paracetamol has mild analgesic and antipyretic properties and is, along with acetylsalicylic acid, one of the most popular "over the counter" analgesic agents. However, the mechanism underlying its clinical effects is unknown. Another drug whose mechanism of action is unknown is caffeine, which is often used in combination with other analgesics, augmenting their effect. We investigated the inhibitory effect of paracetamol and caffeine on lipopolysaccharide (LPS)-induced cyclooxygenase (COX)- and prostaglandin (PG)E(2)-synthesis in primary rat microglial cells and compared it with the effect of acetylsalicylic acid, salicylic acid, and dipyrone. Furthermore, combinations of these drugs were used to investigate a possible synergistic inhibitory effect on PGE(2)-synthesis. Both paracetamol (IC(50)=7.45 microM) and caffeine (IC(50)=42.5 microM) dose-dependently inhibited microglial PGE(2) synthesis. In combination with acetylsalicylic acid (IC(50)=3.12 microM), both substances augmented the inhibitory effect of acetylsalicylic acid on LPS-induced PGE(2)-synthesis. Whereas paracetamol inhibited only COX enzyme activity, caffeine also inhibited COX-2 protein synthesis. These results are compatible with the view that the clinical activity of paracetamol and caffeine is due to inhibition of COX. Furthermore, these results may help explain the clinical experience of an adjuvant analgesic effect of caffeine and paracetamol when combined with acetylsalicylic acid.

  13. Antioxidant enzymes and fatty acid composition as related to disease resistance in postharvest loquat fruit.

    PubMed

    Cao, Shifeng; Yang, Zhenfeng; Cai, Yuting; Zheng, Yonghua

    2014-11-15

    Two cultivars of loquat fruit were stored at 20°C for 10days to investigate the relationship between disease resistance, and fatty acid composition and activities of endogenous antioxidant enzymes. The results showed that decay incidence increased with storage time in both cultivars. A significantly lower disease incidence was observed in 'Qingzhong' fruit than in 'Fuyang', suggesting 'Qingzhong' had increased disease resistance. Meanwhile, 'Qingzhong' fruit also had lower levels of superoxide radical and hydrogen peroxide, and lower lipoxygenase activity, but higher levels of linolenic and linoleic acids and higher activities of catalase (CAT) and ascorbate peroxidase (APX) compared with 'Fuyang'. These results suggest that the higher levels of linolenic and linoleic acids and the higher activity of CAT and APX have a role in disease resistance of postharvest loquat fruit.

  14. Regulation of bile acid synthesis in rat hepatocyte monolayer cultures

    SciTech Connect

    Kubaska, W.M.

    1986-01-01

    Primary hepatocyte monolayer cultures (PHC) were prepared and incubated in serum free media. Cells from a cholestyramine fed rat converted exogenous (/sup 14/C)-cholesterol into (/sup 14/C)-bile acids at a 3-fold greater rate than rats fed a normal diet. PHC synthesize bile acids (BA) at a rate of approximately 0.06 ..mu..g/mg protein/h. The major bile acid composition, as determined by GLC, was ..beta..-muricholic acid (BMC) and cholic acid (CA) in a 3:1 ratio, respectively. PHC rapidly converted free BA and BA intermediates into taurine conjugated trihydroxy-BA up to 87h after plating. 3-Hydroxy-3-methylglutaryl-coenzyme A-reductase activity assayed in microsomes prepared from PHC, decreased during the initial 48h, then remained constant. Cholesterol 7..cap alpha..-hydroxylase activity decreased during the initial 48h, then increased during the next 48h. This occurred while whole cells produced BA at a linear rate. The effect of individual BA on bile acid synthesis (BAS) was also studied. Relative rates of BAS were measured as the conversion of (/sup 14/C)-cholesterol into (/sup 14/C)-BA. BA combinations were tested in order to simulate the composition of the enterohepatic circulation. The addition of TCA (525 ..mu..M) plus TCDCA (80..mu..M), in concentrations which greatly exceed the concentration of BA (60..mu..M) in rate portal blood, failed to inhibit BAS. BA plus phospholipid and/or cholesterol also did not inhibit BAS. Surprisingly, crude rat bile with a final concentration comparable to those in the synthetic mix inhibited (/sup 14/C)-cholesterol conversion into (/sup 14/C)-BA.

  15. Combined Effects of Lanthanum (III) and Acid Rain on Antioxidant Enzyme System in Soybean Roots.

    PubMed

    Zhang, Xuanbo; Du, Yuping; Wang, Lihong; Zhou, Qing; Huang, Xiaohua; Sun, Zhaoguo

    2015-01-01

    Rare earth element pollution (REEs) and acid rain (AR) pollution simultaneously occur in many regions, which resulted in a new environmental issue, the combined pollution of REEs and AR. The effects of the combined pollution on the antioxidant enzyme system of plant roots have not been reported. Here, the combined effects of lanthanum ion (La3+), one type of REE, and AR on the antioxidant enzyme system of soybean roots were investigated. In the combined treatment of La3+ (0.08 mM) and AR, the cell membrane permeability and the peroxidation of cell membrane lipid of soybean roots increased, and the superoxide dismutase, catalase, peroxidase and reduced ascorbic acid served as scavengers of reactive oxygen species. In other combined treatments of La3+ (0.40 mM, 1.20 mM) and AR, the membrane permeability, malonyldialdehyde content, superoxide dismutase activity, peroxidase activity and reduced ascorbic acid content increased, while the catalase activity decreased. The increased superoxide dismutase activity, peroxidase activity and reduced ascorbic acid content were inadequate to scavenge the excess hydrogen peroxide and superoxide, leading to the damage of the cell membrane, which was aggravated with the increase in the concentration of La3+ and the level of AR. The deleterious effects of the combined treatment of La3+ and AR were stronger than those of the single treatment of La3+ or AR. Moreover, the activity of antioxidant enzyme system in the combined treatment group was affected directly and indirectly by mineral element content in soybean plants. PMID:26230263

  16. Combined Effects of Lanthanum (III) and Acid Rain on Antioxidant Enzyme System in Soybean Roots.

    PubMed

    Zhang, Xuanbo; Du, Yuping; Wang, Lihong; Zhou, Qing; Huang, Xiaohua; Sun, Zhaoguo

    2015-01-01

    Rare earth element pollution (REEs) and acid rain (AR) pollution simultaneously occur in many regions, which resulted in a new environmental issue, the combined pollution of REEs and AR. The effects of the combined pollution on the antioxidant enzyme system of plant roots have not been reported. Here, the combined effects of lanthanum ion (La3+), one type of REE, and AR on the antioxidant enzyme system of soybean roots were investigated. In the combined treatment of La3+ (0.08 mM) and AR, the cell membrane permeability and the peroxidation of cell membrane lipid of soybean roots increased, and the superoxide dismutase, catalase, peroxidase and reduced ascorbic acid served as scavengers of reactive oxygen species. In other combined treatments of La3+ (0.40 mM, 1.20 mM) and AR, the membrane permeability, malonyldialdehyde content, superoxide dismutase activity, peroxidase activity and reduced ascorbic acid content increased, while the catalase activity decreased. The increased superoxide dismutase activity, peroxidase activity and reduced ascorbic acid content were inadequate to scavenge the excess hydrogen peroxide and superoxide, leading to the damage of the cell membrane, which was aggravated with the increase in the concentration of La3+ and the level of AR. The deleterious effects of the combined treatment of La3+ and AR were stronger than those of the single treatment of La3+ or AR. Moreover, the activity of antioxidant enzyme system in the combined treatment group was affected directly and indirectly by mineral element content in soybean plants.

  17. Combined Effects of Lanthanum (III) and Acid Rain on Antioxidant Enzyme System in Soybean Roots

    PubMed Central

    Zhang, Xuanbo; Du, Yuping; Wang, Lihong; Zhou, Qing; Huang, Xiaohua; Sun, Zhaoguo

    2015-01-01

    Rare earth element pollution (REEs) and acid rain (AR) pollution simultaneously occur in many regions, which resulted in a new environmental issue, the combined pollution of REEs and AR. The effects of the combined pollution on the antioxidant enzyme system of plant roots have not been reported. Here, the combined effects of lanthanum ion (La3+), one type of REE, and AR on the antioxidant enzyme system of soybean roots were investigated. In the combined treatment of La3+ (0.08 mM) and AR, the cell membrane permeability and the peroxidation of cell membrane lipid of soybean roots increased, and the superoxide dismutase, catalase, peroxidase and reduced ascorbic acid served as scavengers of reactive oxygen species. In other combined treatments of La3+ (0.40 mM, 1.20 mM) and AR, the membrane permeability, malonyldialdehyde content, superoxide dismutase activity, peroxidase activity and reduced ascorbic acid content increased, while the catalase activity decreased. The increased superoxide dismutase activity, peroxidase activity and reduced ascorbic acid content were inadequate to scavenge the excess hydrogen peroxide and superoxide, leading to the damage of the cell membrane, which was aggravated with the increase in the concentration of La3+ and the level of AR. The deleterious effects of the combined treatment of La3+ and AR were stronger than those of the single treatment of La3+ or AR. Moreover, the activity of antioxidant enzyme system in the combined treatment group was affected directly and indirectly by mineral element content in soybean plants. PMID:26230263

  18. Multi-enzyme co-embedded organic-inorganic hybrid nanoflowers: synthesis and application as a colorimetric sensor.

    PubMed

    Sun, Jiayu; Ge, Jiechao; Liu, Weimin; Lan, Minhua; Zhang, Hongyan; Wang, Pengfei; Wang, Yanming; Niu, Zhongwei

    2014-01-01

    This study reports a facile method for the synthesis of multi-enzyme co-embedded organic-inorganic hybrid nanoflowers, using glucose oxidase (GOx) and horseradish peroxidase (HRP) as the organic components, and Cu3(PO4)2 · 3H2O as the inorganic component. The synthesized nanoflowers enable the combination of a two-enzyme cascade reaction in one step, in which the GOx component of the nanoflowers oxidizes glucose to generate H2O2, which then reacts with the adjacent HRP component on the nanoflowers to oxidize the chromogenic substrates, resulting in an apparent color change. Given the close proximity of the two enzyme components in a single nanoflower, this novel sensor greatly reduces the diffusion and decomposition of H2O2, and greatly enhances the sensitivity of glucose detection. Thus, the obtained multi-enzyme co-embedded organic-inorganic hybrid nanoflowers can be unquestionably used as highly sensitive colorimetric sensors for the detection of glucose. Notably, this work presents a very facile route for the synthesis of multi-enzyme co-embedded nanomaterials for the simultaneous catalysis of multi-step cascade enzymatic reactions. Furthermore, it has great potential for application in biotechnology, and biomedical and environmental chemistry.

  19. Activation of the Constitutive Androstane Receptor Inhibits Gluconeogenesis without Affecting Lipogenesis or Fatty Acid Synthesis in Human Hepatocytes

    PubMed Central

    Lynch, Caitlin; Pan, Yongmei; Li, Linhao; Heyward, Scott; Moeller, Timothy; Swaan, Peter W.; Wang, Hongbing

    2014-01-01

    Objective Accumulating evidence suggests that activation of mouse constitutive androstane receptor (mCAR) alleviates type 2 diabetes and obesity by inhibiting hepatic gluconeogenesis, lipogenesis, and fatty acid synthesis. However, the role of human (h) CAR in energy metabolism is largely unknown. The present study aims to investigate the effects of selective hCAR activators on hepatic energy metabolism in human primary hepatocytes (HPH). Methods Ligand-based structure-activity models were used for virtual screening of the Specs database (www.specs.net) followed by biological validation in cell-based luciferase assays. The effects of two novel hCAR activators (UM104 and UM145) on hepatic energy metabolism were evaluated in HPH. Results Real-time PCR and Western blotting analyses reveal that activation of hCAR by UM104 and UM145 significantly repressed the expression of glucose-6-phosphatase and phosphoenolpyruvate carboxykinase, two pivotal gluconeogenic enzymes, while exerting negligible effects on the expression of genes associated with lipogenesis and fatty acid synthesis. Functional experiments show that UM104 and UM145 markedly inhibit hepatic synthesis of glucose but not triglycerides in HPH. In contrast, activation of mCAR by 1,4-bis[2-(3,5-dichloropyridyloxy)]benzene, a selective mCAR activator, repressed the expression of genes associated with gluconeogenesis, lipogenesis, and fatty acid synthesis in mouse primary hepatocytes, which were consistent with previous observations in mouse model in vivo. Conclusion Our findings uncover an important species difference between hCAR and mCAR in hepatic energy metabolism, where hCAR selectively inhibits gluconeogenesis without suppressing fatty acid synthesis. Implications Such species selectivity should be considered when exploring CAR as a potential therapeutic target for metabolic disorders. PMID:24878338

  20. Synthesis of 9-oxononanoic acid, a precursor for biopolymers.

    PubMed

    Otte, Konrad B; Kirtz, Marko; Nestl, Bettina M; Hauer, Bernhard

    2013-11-01

    Polymers based on renewable resources have become increasingly important. The natural functionalization of fats and oils enables an easy access to interesting monomeric building blocks, which in turn transform the derivative biopolymers into high-performance materials. Unfortunately, interesting building blocks of medium-chain length are difficult to obtain by traditional chemical means. Herein, a biotechnological pathway is established that could provide an environmentally suitable and sustainable alternative. A multiple enzyme two-step one-pot process efficiently catalyzed by a coupled 9S-lipoxygenase (St-LOX1, Solanum tuberosum) and 9/13-hydroperoxide lyase (Cm-9/13HPL, Cucumis melo) cascade reaction is proposed as a potential route for the conversion of linoleic acid into 9-oxononanoic acid, which is a precursor for biopolymers. Lipoxygenase catalyzes the insertion of oxygen into linoleic acid through a radical mechanism to give 9S-hydroperoxy-octadecadienoic acid (9S-HPODE) as a cascade intermediate, which is subsequently cleaved by the action of Cm-9/13HPL. This one-pot process afforded a yield of 73 % combined with high selectivity. The best reaction performance was achieved when lipoxygenase and hydroperoxide lyase were applied in a successive rather than a simultaneous manner. Green leaf volatiles, which are desired flavor and fragrance products, are formed as by-products in this reaction cascade. Furthermore, we have investigated the enantioselectivity of 9/13-HPLs, which exhibited a strong preference for 9S-HPODE over 9R-HPODE.

  1. Importance of ALDH1A enzymes in determining human testicular retinoic acid concentrations

    PubMed Central

    Arnold, Samuel L.; Kent, Travis; Hogarth, Cathryn A.; Schlatt, Stefan; Prasad, Bhagwat; Haenisch, Michael; Walsh, Thomas; Muller, Charles H.; Griswold, Michael D.; Amory, John K.; Isoherranen, Nina

    2015-01-01

    Retinoic acid (RA), the active metabolite of vitamin A, is required for spermatogenesis and many other biological processes. RA formation requires irreversible oxidation of retinal to RA by aldehyde dehydrogenase enzymes of the 1A family (ALDH1A). While ALDH1A1, ALDH1A2, and ALDH1A3 all form RA, the expression pattern and relative contribution of these enzymes to RA formation in the testis is unknown. In this study, novel methods to measure ALDH1A protein levels and intrinsic RA formation were used to accurately predict RA formation velocities in individual human testis samples and an association between RA formation and intratesticular RA concentrations was observed. The distinct localization of ALDH1A in the testis suggests a specific role for each enzyme in controlling RA formation. ALDH1A1 was found in Sertoli cells, while only ALDH1A2 was found in spermatogonia, spermatids, and spermatocytes. In the absence of cellular retinol binding protein (CRBP)1, ALDH1A1 was predicted to be the main contributor to intratesticular RA formation, but when CRBP1 was present, ALDH1A2 was predicted to be equally important in RA formation as ALDH1A1. This study provides a comprehensive novel methodology to evaluate RA homeostasis in human tissues and provides insight to how the individual ALDH1A enzymes mediate RA concentrations in specific cell types. PMID:25502770

  2. A novel enzyme-based acidizing system: Matrix acidizing and drilling fluid damage removal

    SciTech Connect

    Harris, R.E.; McKay, D.M.; Moses, V.

    1995-12-31

    A novel acidizing process is used to increase the permeability of carbonate rock cores in the laboratory and to remove drilling fluid damage from cores and wafers. Field results show the benefits of the technology as applied both to injector and producer wells.

  3. Synthesis of Sol-Gel Matrices for Encapsulation of Enzymes Using an Aqueous Route

    SciTech Connect

    Ashley, C.S.; Bhatia, R.B.; Brinker, C.J.; Harris, T.M.

    1998-11-23

    Sol-gel matrices are promising host materials for potential chemical and biosensor applications. Previous studies have focused on modified sol-gel routes using alkoxides for encapsulation of enzymes. However the formation of alcohol as a byproduct during hydrolysis and condensation reactions poses limitations. We report the immobilization of glucose oxidase and peroxidase in silica prepared by an aqueous route which may provide a more favorable environment for the biomolecules. A two step aqueous sol-gel procedure using sodium silicate as the precursor was developed to encapsulate the enzymes and the dye precursor, o-dianisidine. Glucose oxidase catalyzes the oxidation of glucose to give gluconic acid and hydrogen peroxide. Peroxidase then catalyzes the reaction of the dye precursor with hydrogen peroxide to produce a colored product. The kinetics of the coupled enzymatic reactions were monitored by optical spectroscopy and compared to those occurring in tetramethyl orthosilicate (TMOS) derived silica matrices developed by Yamanaka. Enhanced kinetics in the aqueous silicate matrices were related to differences in the host microstructure as elucidated by microstructural comparisons of the corresponding aerogels.

  4. Oligomeric structure of proclavaminic acid amidino hydrolase: evolution of a hydrolytic enzyme in clavulanic acid biosynthesis.

    PubMed Central

    Elkins, Jonathan M; Clifton, Ian J; Hernández, Helena; Doan, Linh X; Robinson, Carol V; Schofield, Christopher J; Hewitson, Kirsty S

    2002-01-01

    During biosynthesis of the clinically used beta-lactamase inhibitor clavulanic acid, one of the three steps catalysed by clavaminic acid synthase is separated from the other two by a step catalysed by proclavaminic acid amidino hydrolase (PAH), in which the guanidino group of an intermediate is hydrolysed to give proclavaminic acid and urea. PAH shows considerable sequence homology with the primary metabolic arginases, which hydrolyse arginine to ornithine and urea, but does not accept arginine as a substrate. Like other members of the bacterial sub-family of arginases, PAH is hexameric in solution and requires Mn2+ ions for activity. Other metal ions, including Co2+, can substitute for Mn2+. Two new substrates for PAH were identified, N-acetyl-(L)-arginine and (3R)-hydroxy-N-acetyl-(L)-arginine. Crystal structures of PAH from Streptomyces clavuligerus (at 1.75 A and 2.45 A resolution, where 1 A=0.1 nm) imply how it binds beta-lactams rather than the amino acid substrate of the arginases from which it evolved. The structures also suggest how PAH selects for a particular alcohol intermediate in the clavam biosynthesis pathway. As observed for the arginases, each PAH monomer consists of a core of beta-strands surrounded by alpha-helices, and its active site contains a di-Mn2+ centre with a bridging water molecule responsible for hydrolytic attack on to the guanidino group of the substrate. Comparison of structures obtained under different conditions reveals different conformations of a flexible loop, which must move to allow substrate binding. PMID:12020346

  5. Human Milk Oligosaccharides (HMOS): Structure, Function, and Enzyme-Catalyzed Synthesis.

    PubMed

    Chen, Xi

    2015-01-01

    The important roles played by human milk oligosaccharides (HMOS), the third major component of human milk, in the health of breast-fed infants have been increasingly recognized, as the structures of more than 100 different HMOS have now been elucidated. Despite the recognition of the various functions of HMOS as prebiotics, antiadhesive antimicrobials, and immunomodulators, the roles and the applications of individual HMOS species are less clear. This is mainly due to the limited accessibility to large amounts of individual HMOS in their pure forms. Current advances in the development of enzymatic, chemoenzymatic, whole-cell, and living-cell systems allow for the production of a growing number of HMOS in increasing amounts. This effort will greatly facilitate the elucidation of the important roles of HMOS and allow exploration into the applications of HMOS both as individual compounds and as mixtures of defined structures with desired functions. The structures, functions, and enzyme-catalyzed synthesis of HMOS are briefly surveyed to provide a general picture about the current progress on these aspects. Future efforts should be devoted to elucidating the structures of more complex HMOS, synthesizing more complex HMOS including those with branched structures, and developing HMOS-based or HMOS-inspired prebiotics, additives, and therapeutics. PMID:26613816

  6. Heparin and related polysaccharides: Synthesis using recombinant enzymes and metabolic engineering

    PubMed Central

    Suflita, Matthew; Fu, Li; He, Wenqin; Koffas, Mattheos; Linhardt, Robert J.

    2015-01-01

    Glycosaminoglycans are linear anionic polysaccharides that exhibit a number of important biological and pharmacological activities. The two most prominent members of this class of polysaccharides are heparin/heparan sulfate and the chondroitin sulfates (including dermatan sulfate). These polysaccharides, having complex structures and polydispersity, are biosynthesized in the Golgi of most animal cells. The chemical synthesis of these glycosaminoglycans is precluded by their structural complexity. Today, we depend on food animal tissues for their isolation and commercial production. Ton quantities of these glycosaminoglycans are used annually as pharmaceuticals and nutraceuticals. The variability of animal-sourced glycosaminoglycans, their inherent impurities, the limited availability of source tissues, the poor control of these source materials, and their manufacturing processes, suggest a need for new approaches for their production. Over the past decade there have been major efforts in the biotechnological production of these glycosaminoglycans. This mini-review focuses on the use of recombinant enzymes and metabolic engineering for the production of heparin and chondroitin sulfates. PMID:26219501

  7. [Correlation between the synthesis of extracellular proteases and the synthesis of the red pigment prodigiosin in Serratia marcescens].

    PubMed

    Loriia, Zh K; Briukner, B; Egorov, N S

    1977-01-01

    A correlation has been established between synthesis of exocellular protease and synthesis of a red pigment prodigiosine by Serratia marcescens. Chloramphenicol, an inhibitor of protein synthesis, inhibits also synthesis of the pigment. Leucine, an inductor of synthesis of the exocellular protease by Serratia marcescens VI, induces also synthesis of the pigment. A mixture of 18 natural amino acids, asparagine and ammonium ions represses both synthesis of the enzyme and the pigment.

  8. Synthesis of acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters

    DOEpatents

    Moens, Luc

    2003-06-24

    A process of preparing an acid addition salt of delta-aminolevulinc acid comprising: a) dissolving a lower alkyl 5-bromolevulinate and hexamethylenetetramine in a solvent selected from the group consisting of water, ethyl acetate, chloroform, acetone, ethanol, tetrahydrofuran and acetonitrile, to form a quaternary ammonium salt of the lower alkyl 5-bromolevulinate; and b) hydrolyzing the quaternary ammonium salt with an inorganic acid to form an acid addition salt of delta-aminolevulinic acid.

  9. Fatty acid synthesis and pyruvate metabolism pathways remain active in dihydroartemisinin-induced dormant ring stages of Plasmodium falciparum.

    PubMed

    Chen, Nanhua; LaCrue, Alexis N; Teuscher, Franka; Waters, Norman C; Gatton, Michelle L; Kyle, Dennis E; Cheng, Qin

    2014-08-01

    Artemisinin (ART)-based combination therapy (ACT) is used as the first-line treatment of uncomplicated falciparum malaria worldwide. However, despite high potency and rapid action, there is a high rate of recrudescence associated with ART monotherapy or ACT long before the recent emergence of ART resistance. ART-induced ring-stage dormancy and recovery have been implicated as possible causes of recrudescence; however, little is known about the characteristics of dormant parasites, including whether dormant parasites are metabolically active. We investigated the transcription of 12 genes encoding key enzymes in various metabolic pathways in P. falciparum during dihydroartemisinin (DHA)-induced dormancy and recovery. Transcription analysis showed an immediate downregulation for 10 genes following exposure to DHA but continued transcription of 2 genes encoding apicoplast and mitochondrial proteins. Transcription of several additional genes encoding apicoplast and mitochondrial proteins, particularly of genes encoding enzymes in pyruvate metabolism and fatty acid synthesis pathways, was also maintained. Additions of inhibitors for biotin acetyl-coenzyme A (CoA) carboxylase and enoyl-acyl carrier reductase of the fatty acid synthesis pathways delayed the recovery of dormant parasites by 6 and 4 days, respectively, following DHA treatment. Our results demonstrate that most metabolic pathways are downregulated in DHA-induced dormant parasites. In contrast, fatty acid and pyruvate metabolic pathways remain active. These findings highlight new targets to interrupt recovery of parasites from ART-induced dormancy and to reduce the rate of recrudescence following ART treatment.

  10. Synthesis and biological evaluation of enantiomerically pure glyceric acid derivatives as LpxC inhibitors.

    PubMed

    Tangherlini, Giovanni; Torregrossa, Tullio; Agoglitta, Oriana; Köhler, Jens; Melesina, Jelena; Sippl, Wolfgang; Holl, Ralph

    2016-03-01

    Inhibitors of the UDP-3-O-[(R)-3-hydroxymyristoyl]-N-acetylglucosamine deacetylase (LpxC) represent a promising class of novel antibiotics, selectively combating Gram-negative bacteria. In order to elucidate the impact of the hydroxymethyl groups of diol (S,S)-4 on the inhibitory activity against LpxC, glyceric acid ethers (R)-7a, (S)-7a, (R)-7b, and (S)-7b, lacking the hydroxymethyl group in benzylic position, were synthesized. The compounds were obtained in enantiomerically pure form by a chiral pool synthesis and a lipase-catalyzed enantioselective desymmetrization, respectively. The enantiomeric hydroxamic acids (R)-7b (Ki=230nM) and (S)-7b (Ki=390nM) show promising enzyme inhibition. However, their inhibitory activities do not substantially differ from each other leading to a low eudismic ratio. Generally, the synthesized glyceric acid derivatives 7 show antibacterial activities against two Escherichia coli strains exceeding the ones of their respective regioisomes 6.

  11. Modulation of medium-chain fatty acid synthesis in Synechococcus sp. PCC 7002 by replacing FabH with a Chaetoceros Ketoacyl-ACP synthase

    DOE PAGES

    Gu, Huiya; Jinkerson, Robert E.; Davies, Fiona K.; Sisson, Lyle A.; Schneider, Philip E.; Posewitz, Matthew C.

    2016-05-26

    The isolation or engineering of algal cells synthesizing high levels of medium-chain fatty acids (MCFAs) is attractive to mitigate the high clouding point of longer chain fatty acids in algal based biodiesel. To develop a more informed understanding of MCFA synthesis in photosynthetic microorganisms, we isolated several algae from Great Salt Lake and screened this collection for MCFA accumulation to identify strains naturally accumulating high levels of MCFA. A diatom, Chaetoceros sp. GSL56, accumulated particularly high levels of C14 (up to 40%), with the majority of C14 fatty acids allocated in triacylglycerols. Using whole cell transcriptome sequencing and de novomore » assembly, putative genes encoding fatty acid synthesis enzymes were identified. Enzymes from this Chaetoceros sp. were expressed in the cyanobacterium Synechococcus sp. PCC 7002 to validate gene function and to determine whether eukaryotic enzymes putatively lacking bacterial evolutionary control mechanisms could be used to improve MCFA production in this promising production strain. Replacement of the Synechococcus 7002 native FabH with a Chaetoceros ketoacyl-ACP synthase Ill increased MCFA synthesis up to fivefold. In conclusion, the level of increase is dependent on promoter strength and culturing conditions.« less

  12. Modulation of Medium-Chain Fatty Acid Synthesis in Synechococcus sp. PCC 7002 by Replacing FabH with a Chaetoceros Ketoacyl-ACP Synthase

    PubMed Central

    Gu, Huiya; Jinkerson, Robert E.; Davies, Fiona K.; Sisson, Lyle A.; Schneider, Philip E.; Posewitz, Matthew C.

    2016-01-01

    The isolation or engineering of algal cells synthesizing high levels of medium-chain fatty acids (MCFAs) is attractive to mitigate the high clouding point of longer chain fatty acids in algal based biodiesel. To develop a more informed understanding of MCFA synthesis in photosynthetic microorganisms, we isolated several algae from Great Salt Lake and screened this collection for MCFA accumulation to identify strains naturally accumulating high levels of MCFA. A diatom, Chaetoceros sp. GSL56, accumulated particularly high levels of C14 (up to 40%), with the majority of C14 fatty acids allocated in triacylglycerols. Using whole cell transcriptome sequencing and de novo assembly, putative genes encoding fatty acid synthesis enzymes were identified. Enzymes from this Chaetoceros sp. were expressed in the cyanobacterium Synechococcus sp. PCC 7002 to validate gene function and to determine whether eukaryotic enzymes putatively lacking bacterial evolutionary control mechanisms could be used to improve MCFA production in this promising production strain. Replacement of the Synechococcus 7002 native FabH with a Chaetoceros ketoacyl-ACP synthase III increased MCFA synthesis up to fivefold. The level of increase is dependent on promoter strength and culturing conditions. PMID:27303412

  13. Modulation of Medium-Chain Fatty Acid Synthesis in Synechococcus sp. PCC 7002 by Replacing FabH with a Chaetoceros Ketoacyl-ACP Synthase.

    PubMed

    Gu, Huiya; Jinkerson, Robert E; Davies, Fiona K; Sisson, Lyle A; Schneider, Philip E; Posewitz, Matthew C

    2016-01-01

    The isolation or engineering of algal cells synthesizing high levels of medium-chain fatty acids (MCFAs) is attractive to mitigate the high clouding point of longer chain fatty acids in algal based biodiesel. To develop a more informed understanding of MCFA synthesis in photosynthetic microorganisms, we isolated several algae from Great Salt Lake and screened this collection for MCFA accumulation to identify strains naturally accumulating high levels of MCFA. A diatom, Chaetoceros sp. GSL56, accumulated particularly high levels of C14 (up to 40%), with the majority of C14 fatty acids allocated in triacylglycerols. Using whole cell transcriptome sequencing and de novo assembly, putative genes encoding fatty acid synthesis enzymes were identified. Enzymes from this Chaetoceros sp. were expressed in the cyanobacterium Synechococcus sp. PCC 7002 to validate gene function and to determine whether eukaryotic enzymes putatively lacking bacterial evolutionary control mechanisms could be used to improve MCFA production in this promising production strain. Replacement of the Synechococcus 7002 native FabH with a Chaetoceros ketoacyl-ACP synthase III increased MCFA synthesis up to fivefold. The level of increase is dependent on promoter strength and culturing conditions. PMID:27303412

  14. Enzyme-digestible swelling hydrogels as platforms for long-term oral drug delivery: synthesis and characterization.

    PubMed

    Park, K

    1988-09-01

    A method was developed for synthesizing enzyme-digestible swelling hydrogels. Albumin molecules were modified using glycidyl acrylate to introduce vinyl groups. The functionalized albumin molecules participated as cross-linkers in the polymerization of vinyl monomers, such as acrylic acid or acrylamide. The extent of chemical modification of albumin was an important variable in controlling the cross-linking ability. The albumin in the synthesized hydrogels retained its property of enzymatic digestion by proteolytic enzymes. The kinetics of swelling and enzymatic digestion of the hydrogels were examined using various enzyme concentrations. It was observed that the digestion kinetics were largely determined by the relative concentrations of albumin and enzyme. The potential application of the enzyme-digestible swelling hydrogels as platforms for long-term oral drug delivery is discussed. PMID:3146993

  15. West Nile Virus Replication Requires Fatty Acid Synthesis but Is Independent on Phosphatidylinositol-4-Phosphate Lipids

    PubMed Central

    Martín-Acebes, Miguel A.; Blázquez, Ana-Belén; Jiménez de Oya, Nereida; Escribano-Romero, Estela; Saiz, Juan-Carlos

    2011-01-01

    West Nile virus (WNV) is a neurovirulent mosquito-borne flavivirus, which main natural hosts are birds but it also infects equines and humans, among other mammals. As in the case of other plus-stranded RNA viruses, WNV replication is associated to intracellular membrane rearrangements. Based on results obtained with a variety of viruses, different cellular processes have been shown to play important roles on these membrane rearrangements for efficient viral replication. As these processes are related to lipid metabolism, fatty acid synthesis, as well as generation of a specific lipid microenvironment enriched in phosphatidylinositol-4-phosphate (PI4P), has been associated to it in other viral models. In this study, intracellular membrane rearrangements following infection with a highly neurovirulent strain of WNV were addressed by means of electron and confocal microscopy. Infection of WNV, and specifically viral RNA replication, were dependent on fatty acid synthesis, as revealed by the inhibitory effect of cerulenin and C75, two pharmacological inhibitors of fatty acid synthase, a key enzyme of this process. However, WNV infection did not induce redistribution of PI4P lipids, and PI4P did not localize at viral replication complex. Even more, WNV multiplication was not inhibited by the use of the phosphatidylinositol-4-kinase inhibitor PIK93, while infection by the enterovirus Coxsackievirus B5 was reduced. Similar features were found when infection by other flavivirus, the Usutu virus (USUV), was analyzed. These features of WNV replication could help to design specific antiviral approaches against WNV and other related flaviviruses. PMID:21949814

  16. Reengineering Rate-Limiting, Millisecond Enzyme Motions by Introduction of an Unnatural Amino Acid

    PubMed Central

    Watt, Eric D.; Rivalta, Ivan; Whittier, Sean K.; Batista, Victor S.; Loria, J. Patrick

    2011-01-01

    Rate-limiting millisecond motions in wild-type (WT) Ribonuclease A (RNase A) are modulated by histidine 48. Here, we incorporate an unnatural amino acid, thia-methylimidazole, at this site (H48C-4MI) to investigate the effects of a single residue on protein motions over multiple timescales and on enzyme catalytic turnover. Molecular dynamics simulations reveal that H48C-4MI retains some crucial WT-like hydrogen bonding interactions but the extent of protein-wide correlated motions in the nanosecond regime is decreased relative to WT. NMR Carr-Purcell-Meiboom-Gill relaxation dispersion experiments demonstrate that millisecond conformational motions in H48C-4MI are present over a similar pH range compared to WT. Furthermore, incorporation of this nonnatural amino acid allows retention of WT-like catalytic activity over the full pH range. These studies demonstrate that the complexity of the protein energy landscape during the catalytic cycle can be maintained using unnatural amino acids, which may prove useful in enzyme design efforts. PMID:21767494

  17. Batch reactor performance for the enzymatic synthesis of cephalexin: influence of catalyst enzyme loading and particle size.

    PubMed

    Valencia, Pedro; Flores, Sebastián; Wilson, Lorena; Illanes, Andrés

    2012-01-15

    A mathematical model is presented for the kinetically controlled synthesis of cephalexin that describes the heterogeneous reaction-diffusion process involved in a batch reactor with glyoxyl-agarose immobilized penicillin acylase. The model is based on equations considering reaction and diffusion components. Reaction kinetics was considered according to the mechanism proposed by Schroën, while diffusion of the reacting species was described according to Fick's law. Intrinsic kinetic and diffusion parameters were experimentally determined in independent experiments. It was found that from the four kinetic constants, the one corresponding to the acyl-enzyme complex hydrolysis step had the greatest value, as previously reported by other authors. The effective diffusion coefficients of all substances were about 5×10(-10)m(2)/s, being 10% lower than free diffusion coefficients and therefore agreed with the highly porous structure of glyoxyl-agarose particles. Simulations made from the reaction-diffusion model equations were used to evaluate and analyze the impact of internal diffusional restrictions in function of catalyst enzyme loading and particle size. Increasing internal diffusional restrictions decreases the Cex synthesis/hydrolysis ratio, the conversion yield and the specific productivity. A nonlinear relationship between catalyst enzyme loading and specific productivity of Cex was obtained with the implication that an increase in catalyst enzyme loading will not increase the volumetric productivity by the same magnitude as it occurs with the free enzyme. Optimization of catalyst and reactor design should be done considering catalyst enzyme loading and particle size as the most important variables. The approach presented can be extended to other processes catalyzed by immobilized enzymes.

  18. Is RK-682 a promiscuous enzyme inhibitor? Synthesis and in vitro evaluation of protein tyrosine phosphatase inhibition of racemic RK-682 and analogues.

    PubMed

    Carneiro, Vânia M T; Trivella, Daniela B B; Scorsato, Valéria; Beraldo, Viviane L; Dias, Mariana P; Sobreira, Tiago J P; Aparicio, Ricardo; Pilli, Ronaldo A

    2015-06-01

    RK-682 (1) is a natural product known to selectively inhibit protein tyrosine phosphatases (PTPases) and is used commercially as a positive control for phosphatase inhibition in in vitro assays. Protein phosphatases are involved in several human diseases including diabetes, cancer and inflammation, and are considered important targets for pharmaceutical development. Here we report the synthesis of racemic RK-682 (rac-1) and a focused set of compounds, including racemic analogues of 1, dihydropyranones and C-acylated Meldrum's acid derivatives, the later obtained in one synthetic step from commercially available starting material. We further characterized the behavior of some representative compounds in aqueous solution and evaluated their in vitro PTPase binding and inhibition. Our data reveal that rac-1 and some derivatives are able to form large aggregates in solution, in which the aggregation capacity is dependent on the acyl side chain size. However, compound aggregation per se is not able to promote PTPase inhibition. Our data disclose a novel family of PTPase inhibitors (C-acylated Meldrum's acid derivatives) and that rac-1 and derivatives with an exposed latent negatively charged substructure (e.g.: the tetronic acid core of 1) can bind to the PTPase binding site, as well promiscuously to protein surfaces. The combined capacity of compounds to bind to proteins together with their intrinsic capacity to aggregate in solution seems essential to promote enzyme aggregation and thus, its inhibition. We also observed that divalent cations, such as magnesium frequently used in enzyme buffer solutions, can deplete the inhibitory activity of rac-1, thus influencing the enzyme inhibition experiment. Overall, these data help to characterize the mechanism of PTPase inhibition by rac-1 and derivatives, revealing that enzyme inhibition is not solely dependent on compound binding to the PTPase catalytic site as generally accepted in the literature. In addition, our

  19. Interactive effect of salicylic acid on some physiological features and antioxidant enzymes activity in ginger (Zingiber officinale Roscoe).

    PubMed

    Ghasemzadeh, Ali; Jaafar, Hawa Z E

    2013-01-01

    The effect of foliar salicylic acid (SA) applications (10⁻³ and 10⁻⁵ M) on activities of nitrate reductase, guaiacol peroxidase (POD), superoxide dismutases (SOD), catalase (CAT) and proline enzymes and physiological parameters was evaluated in two ginger varieties (Halia Bentong and Halia Bara) under greenhouse conditions. In both varieties, tested treatments generally enhanced photosynthetic rate and total dry weight. Photosynthetic rate increases were generally accompanied by increased or unchanged stomatal conductance levels, although intercellular CO₂ concentrations of treated plants were typically lower than in controls. Lower SA concentrations were generally more effective in enhancing photosynthetic rate and plant growth. Exogenous application of SA increased antioxidant enzyme activities and proline content; the greatest responses were obtained in plants sprayed with 10⁻⁵ M SA, with significant increases observed in CAT (20.1%), POD (45.2%), SOD (44.1%) and proline (43.1%) activities. Increased CAT activity in leaves is naturally expected to increase photosynthetic efficiency and thus net photosynthesis by maintaining a constant CO₂ supply. Our results support the idea that low SA concentrations (10⁻⁵ M) may induce nitrite reductase synthesis by mobilizing intracellular NO³⁻ and can provide protection to nitrite reductase degradation in vivo in the absence of NO³⁻. Observed positive correlations among proline, SOD, CAT and POD activities in the studied varieties suggest that increased SOD activity was accompanied by increases in CAT and POD activities because of the high demands of H₂O₂ quenching. PMID:23698049

  20. Expression of fatty acid synthesis genes and fatty acid accumulation in haematococcus pluvialis under different stressors

    PubMed Central

    2012-01-01

    Background Biofuel has been the focus of intensive global research over the past few years. The development of 4th generation biofuel production (algae-to-biofuels) based on metabolic engineering of algae is still in its infancy, one of the main barriers is our lacking of understanding of microalgal growth, metabolism and biofuel production. Although fatty acid (FA) biosynthesis pathway genes have been all cloned and biosynthesis pathway was built up in some higher plants, the molecular mechanism for its regulation in microalgae is far away from elucidation. Results We cloned main key genes for FA biosynthesis in Haematococcus pluvialis, a green microalga as a potential biodiesel feedstock, and investigated the correlations between their expression alternation and FA composition and content detected by GC-MS under different stress treatments, such as nitrogen depletion, salinity, high or low temperature. Our results showed that high temperature, high salinity, and nitrogen depletion treatments played significant roles in promoting microalgal FA synthesis, while FA qualities were not changed much. Correlation analysis showed that acyl carrier protein (ACP), 3-ketoacyl-ACP-synthase (KAS), and acyl-ACP thioesterase (FATA) gene expression had significant correlations with monounsaturated FA (MUFA) synthesis and polyunsaturated FA (PUFA) synthesis. Conclusions We proposed that ACP, KAS, and FATA in H. pluvialis may play an important role in FA synthesis and may be rate limiting genes, which probably could be modified for the further study of metabolic engineering to improve microalgal biofuel quality and production. PMID:22448811

  1. Fructose utilization for nucleic acid synthesis in the fetal pig.

    PubMed

    White, C E; Piper, E L; Noland, P R; Daniels, L B

    1982-07-01

    Eight fetal pigs, in utero, were injected ip with 20 microCi/fetus [U14C]-fructose between d 55 and 65 pregnancy. The isotope was allowed to equilibrate between blood and tissues within injected fetuses for a period of 240 min. Fetal pigs were then sacrificed and nucleic acids were extracted from cold tissue homogenates of skeletal muscle and liver. Nuclide disintegrations per minute recovered in extracted DNA and RNA were used to calculate incorporation of labeled C from fructose. The recovery of labeled C per mmol of nucleic acids from skeletal muscle was greater (P less than .05) than that from liver. Relative incorporation of labeled C into skeletal muscle RNA (395.9 pmol/mmol) was greater (P less than .05) than for DNA (189.5 pmol/mmol). The same trend was observed for liver RNA (78.0 pmol/mmol) and DNA (55.6 pmol/mmol), but differences were nonsignificant. These data suggest that at least part of the high concentration of endogenous fructose measured in fetal pigs in utero is involved in synthesis of nucleic acids, thereby providing substrate for anabolic functions necessary for fetal growth and development. PMID:6181047

  2. Characterization of two Streptomyces enzymes that convert ferulic acid to vanillin.

    PubMed

    Yang, Wenwen; Tang, Hongzhi; Ni, Jun; Wu, Qiulin; Hua, Dongliang; Tao, Fei; Xu, Ping

    2013-01-01

    Production of flavors from natural substrates by microbial transformation has become a growing and expanding field of study over the past decades. Vanillin, a major component of vanilla flavor, is a principal flavoring compound used worldwide. Streptomyces sp. strain V-1 is known to be one of the most promising microbial producers of natural vanillin from ferulic acid. Although identification of the microbial genes involved in the biotransformation of ferulic acid to vanillin has been previously reported, purification and detailed characterization of the corresponding enzymes with important functions have rarely been studied. In this study, we isolated and identified 2 critical genes, fcs and ech, encoding feruloyl-CoA synthetase and enoyl-CoA hydratase/aldolase, respectively, which are involved in the vanillin production from ferulic acid. Both genes were heterologously expressed in Escherichia coli, and the resting cell reactions for converting ferulic acid to vanillin were performed. The corresponding crucial enzymes, Fcs and Ech, were purified for the first time and the enzymatic activity of each purified protein was studied. Furthermore, Fcs was comprehensively characterized, at an optimal pH of 7.0 and temperature of 30°C. Kinetic constants for Fcs revealed the apparent Km, kcat, and Vmax values to be 0.35 mM, 67.7 s(-1), and 78.2 U mg(-1), respectively. The catalytic efficiency (kcat/Km) value of Fcs was 193.4 mM(-1) s(-1) for ferulic acid. The characterization of Fcs and Ech may be helpful for further research in the field of enzymatic engineering and metabolic regulation.

  3. Characterization of Two Streptomyces Enzymes That Convert Ferulic Acid to Vanillin

    PubMed Central

    Yang, Wenwen; Tang, Hongzhi; Ni, Jun; Wu, Qiulin; Hua, Dongliang; Tao, Fei; Xu, Ping

    2013-01-01

    Production of flavors from natural substrates by microbial transformation has become a growing and expanding field of study over the past decades. Vanillin, a major component of vanilla flavor, is a principal flavoring compound used worldwide. Streptomyces sp. strain V-1 is known to be one of the most promising microbial producers of natural vanillin from ferulic acid. Although identification of the microbial genes involved in the biotransformation of ferulic acid to vanillin has been previously reported, purification and detailed characterization of the corresponding enzymes with important functions have rarely been studied. In this study, we isolated and identified 2 critical genes, fcs and ech, encoding feruloyl-CoA synthetase and enoyl-CoA hydratase/aldolase, respectively, which are involved in the vanillin production from ferulic acid. Both genes were heterologously expressed in Escherichia coli, and the resting cell reactions for converting ferulic acid to vanillin were performed. The corresponding crucial enzymes, Fcs and Ech, were purified for the first time and the enzymatic activity of each purified protein was studied. Furthermore, Fcs was comprehensively characterized, at an optimal pH of 7.0 and temperature of 30°C. Kinetic constants for Fcs revealed the apparent Km, kcat, and Vmax values to be 0.35 mM, 67.7 s−1, and 78.2 U mg−1, respectively. The catalytic efficiency (kcat/Km) value of Fcs was 193.4 mM−1 s−1 for ferulic acid. The characterization of Fcs and Ech may be helpful for further research in the field of enzymatic engineering and metabolic regulation. PMID:23840666

  4. Molecular modeling and simulation of FabG, an enzyme involved in the fatty acid pathway of Streptococcus pyogenes.

    PubMed

    Shafreen, Rajamohmed Beema; Pandian, Shunmugiah Karutha

    2013-09-01

    Streptococcus pyogenes (SP) is the major cause of pharyngitis accompanied by strep throat infections in humans. 3-keto acyl reductase (FabG), an important enzyme involved in the elongation cycle of the fatty acid pathway of S. pyogenes, is essential for synthesis of the cell-membrane, virulence factors and quorum sensing-related mechanisms. Targeting SPFabG may provide an important aid for the development of drugs against S. pyogenes. However, the absence of a crystal structure for FabG of S. pyogenes limits the development of structure-based drug designs. Hence, in the present study, a homology model of FabG was generated using the X-ray crystallographic structure of Aquifex aeolicus (PDB ID: 2PNF). The modeled structure was refined using energy minimization. Furthermore, active sites were predicted, and a large dataset of compounds was screened against SPFabG. The ligands were docked using the LigandFit module that is available from Discovery Studio version 2.5. From this list, 13 best hit ligands were chosen based on the docking score and binding energy. All of the 13 ligands were screened for Absorption, Distribution, Metabolism, Excretion and Toxicity (ADMET) properties. From this, the two best descriptors, along with one descriptor that lay outside the ADMET plot, were selected for molecular dynamic (MD) simulation. In vitro testing of the ligands using biological assays further substantiated the efficacy of the ligands that were screened based on the in silico methods.

  5. Embryonic retinoic acid synthesis is essential for early mouse post-implantation development.

    PubMed

    Niederreither, K; Subbarayan, V; Dollé, P; Chambon, P

    1999-04-01

    A number of studies have suggested that the active derivative of vitamin A, retinoic acid (RA), may be important for early development of mammalian embryos. Severe vitamin A deprivation in rodents results in maternal infertility, precluding a thorough investigation of the role of RA during embryogenesis. Here we show that production of RA by the retinaldehyde dehydrogenase-2 (Raldh2) enzyme is required for mouse embryo survival and early morphogenesis. Raldh2 is an NAD-dependent aldehyde dehydrogenase with high substrate specificity for retinaldehyde. Its pattern of expression during mouse development has suggested that it may be responsible for embryonic RA synthesis. We generated a targeted disruption of the mouse Raldh2 gene and found that Raldh2-/- embryos, which die at midgestation without undergoing axial rotation (body turning), exhibit shortening along the anterioposterior axis and do not form limb buds. Their heart consists of a single, medial, dilated cavity. Their frontonasal region is truncated and their otocysts are severely reduced. These defects result from a block in embryonic RA synthesis, as shown by the lack of activity of RA-responsive transgenes, the altered expression of an RA-target homeobox gene and the near full rescue of the mutant phenotype by maternal RA administration. Our data establish that RA synthesized by the post-implantation mammalian embryo is an essential developmental hormone whose lack leads to early embryo death. PMID:10192400

  6. Expression of Vitis amurensis NAC26 in Arabidopsis enhances drought tolerance by modulating jasmonic acid synthesis.

    PubMed

    Fang, Linchuan; Su, Lingye; Sun, Xiaoming; Li, Xinbo; Sun, Mengxiang; Karungo, Sospeter Karanja; Fang, Shuang; Chu, Jinfang; Li, Shaohua; Xin, Haiping

    2016-04-01

    The growth and fruit quality of grapevines are widely affected by abnormal climatic conditions such as water deficits, but many of the precise mechanisms by which grapevines respond to drought stress are still largely unknown. Here, we report that VaNAC26, a member of the NAC transcription factor family, was upregulated dramatically during cold, drought and salinity treatments in Vitis amurensis, a cold and drought-hardy wild Vitis species. Heterologous overexpression of VaNAC26 enhanced drought and salt tolerance in transgenic Arabidopsis. Higher activities of antioxidant enzymes and lower concentrations of H2O2 and O2 (-) were found in VaNAC26-OE lines than in wild type plants under drought stress. These results indicated that scavenging by reactive oxygen species (ROS) was enhanced by VaNAC26 in transgenic lines. Microarray-based transcriptome analysis revealed that genes related to jasmonic acid (JA) synthesis and signaling were upregulated in VaNAC26-OE lines under both normal and drought conditions. VaNAC26 showed a specific binding ability on the NAC recognition sequence (NACRS) motif, which broadly exists in the promoter regions of upregulated genes in transgenic lines. Endogenous JA content significantly increased in the VaNAC26-OE lines 2 and 3. Our data suggest that VaNAC26 responds to abiotic stresses and may enhance drought tolerance by transcriptional regulation of JA synthesis in Arabidopsis.

  7. Expression of Vitis amurensis NAC26 in Arabidopsis enhances drought tolerance by modulating jasmonic acid synthesis

    PubMed Central

    Fang, Linchuan; Su, Lingye; Sun, Xiaoming; Li, Xinbo; Sun, Mengxiang; Karungo, Sospeter Karanja; Fang, Shuang; Chu, Jinfang; Li, Shaohua; Xin, Haiping

    2016-01-01

    The growth and fruit quality of grapevines are widely affected by abnormal climatic conditions such as water deficits, but many of the precise mechanisms by which grapevines respond to drought stress are still largely unknown. Here, we report that VaNAC26, a member of the NAC transcription factor family, was upregulated dramatically during cold, drought and salinity treatments in Vitis amurensis, a cold and drought-hardy wild Vitis species. Heterologous overexpression of VaNAC26 enhanced drought and salt tolerance in transgenic Arabidopsis. Higher activities of antioxidant enzymes and lower concentrations of H2O2 and O2 − were found in VaNAC26-OE lines than in wild type plants under drought stress. These results indicated that scavenging by reactive oxygen species (ROS) was enhanced by VaNAC26 in transgenic lines. Microarray-based transcriptome analysis revealed that genes related to jasmonic acid (JA) synthesis and signaling were upregulated in VaNAC26-OE lines under both normal and drought conditions. VaNAC26 showed a specific binding ability on the NAC recognition sequence (NACRS) motif, which broadly exists in the promoter regions of upregulated genes in transgenic lines. Endogenous JA content significantly increased in the VaNAC26-OE lines 2 and 3. Our data suggest that VaNAC26 responds to abiotic stresses and may enhance drought tolerance by transcriptional regulation of JA synthesis in Arabidopsis. PMID:27162276

  8. Enzyme-assisted synthesis and structural characterization of the 3-, 8-, and 15-glucuronides of deoxynivalenol.

    PubMed

    Uhlig, Silvio; Ivanova, Lada; Fæste, Christiane Kruse

    2013-02-27

    4-Deoxynivalenol is one of the most prevalent mycotoxins in grain-based food and feed products worldwide. Conjugation of deoxynivalenol to glucuronic acid and elimination via the urine appears to be the major metabolism pathway, although with differing efficiency in different species. In order to make pure deoxynivalenol glucuronides for analytical methodologies available we intended to enzymatically synthesize glucuronides of deoxynivalenol using rat and human liver microsomes supplemented with uridine 5'-diphosphoglucuronic acid and alamethicin as detergent. Three glucuronides were isolated and purified using solid-phase extraction of microsomal incubations and subsequent semipreparative hydrophilic interaction chromatography. NMR spectra were obtained for all three compounds from solutions in methanol, showing that deoxynivalenol 3-O-β-D-glucuronide and deoxynivalenol 15-O-β-D-glucuronide were the major products from incubations of deoxynivalenol with rat and human liver microsomes, respectively. The NMR spectra of a third glucuronide showed replacement of the C-8 carbonyl by a ketal carbon. This glucuronide was finally identified as deoxynivalenol 8-O-β-D-glucuronide. The present study provides unequivocal structural evidence for three glucuronides of deoxynivalenol formed by liver enzymes.

  9. Cloning and bacterial expression of sesquiterpene cyclase, a key branch point enzyme for the synthesis of sesquiterpenoid phytoalexin capsidiol in UV-challenged leaves of Capsicum annuum.

    PubMed

    Back, K; He, S; Kim, K U; Shin, D H

    1998-09-01

    Sesquiterpene cyclase, a branch point enzyme in the general isoprenoid pathway for the synthesis of phytoalexin capsidiol, was induced in detached leaves of Capsicum annuum (pepper) by UV treatment. The inducibility of cyclase enzyme activities paralleled the absolute amount of cyclase protein(s) of pepper immunodetected by monoclonal antibodies raised against tobacco sesquiterpene cyclase. A cDNA library was constructed with poly(A)+ RNA isolated from 24 h UV-challenged leaves of pepper. A cDNA clone for sesquiterpene cyclase in pepper was isolated by using a tobacco 5-epi aristolochene synthase gene as a heterologous probe. The predicted protein encoded by this cDNA was comprised of 559 amino acids and had a relative molecular mass of 65,095. The primary structural information from the cDNA clone revealed that it shared 77%, 72% and 49% identity with 5-epi aristolochene, vetispiradiene, and cadinene synthase, respectively. The enzymatic product catalyzed by the cDNA clone in bacteria was identified as 5-epi aristolochene, as judged by argentation TLC. RNA blot hybridization demonstrated the induction of an mRNA consistent with the induction of cyclase enzyme activity in UV-treated pepper. PMID:9816674

  10. Isolation of a multi-enzyme complex of fatty acid oxidation from Escherichia coli.

    PubMed Central

    Binstock, J F; Pramanik, A; Schulz, H

    1977-01-01

    A multi-enzyme complex of fatty acid oxidation has been isolated from E. coli B cells and has been purified to near homogeneity by a simple two-step procedure. The complex exhibits thiolase (EC 2.3.1.9), enoyl-CoA hydratase (EC 4.2.1.17), and 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) activities towards short-, medium-, and long-chain substrates. The complex has been estimated to have a molecular weight of approximately 300,000 and is apparently composed of two types of subunits with molecular weights of 78,000 and 42,000. Images PMID:322129

  11. [Effect of gibberellic acid on RNA synthesis in dwarf peas].

    PubMed

    Kilev, S N; Kholodar', A V; Chekurov, V M; Mertvetsov, N P

    1982-04-01

    The effect of gibberellic acid (GA) on total RNA and polysomal poly-[A]+-RNA synthesis in epicotylia and embryos of dwarf pea of two varieties differing in their physiological sensitivity to GA was studied. It was found that incubation with GA increases the accumulation of total RNA in pea epicotylia, var. "Pioner" and "Polzunok". The maximal stimulation of RNA accumulation makes up to 40% for the low sensitivity variety "Polzunok" and 150% for the highly sensitive variety "Pioner". GA increases the synthesis of polysomal poly (A)+-mRNA in 5-year-old pea sprouts and that of newly synthesized poly (A)+-mRNA in epicotylian polysomes of both varieties 5, 24, 48 and 72 hrs after incubation with GA. GA at concentrations of 10(-6) and 10(-5) stimulates the incorporation of [3H]uridine into polysomal mRNA during the first 1--3 hours after treatment and enhances the accumulation of newly synthesized mRNA in pea embryonic polyribosomes. The stimulating effect is directly proportional to the dose of the hormone. The mechanisms of GA effect on the transcription and translation in pea plant cells are discussed. PMID:6177351

  12. Effect of Ammonia on the Synthesis and Function of the N2-Fixing Enzyme System in Clostridium pasteurianum

    PubMed Central

    Daesch, Geraldine; Mortenson, Leonard E.

    1972-01-01

    The N2-fixing system of Clostridium pasteurianum operates under regulatory controls; no activity is found in cultures growing on excess NH3. The conditions which are necessary for the synthesis and function of this system were studied in whole cells by using acetylene reduction as a sensitive assay for the presence of the N2-fixing system. Nitrogenase of N2-fixing cultures normally can fix twice as much N2 as is needed to maintain the growth rate. When cultures that have grown for four or more generations on NH3 exhaust NH3 from the medium, a diauxic lag of about 90 min ensues before growth is resumed on N2. Neither N2-fixing nor acetylene reduction activity can be detected before growth is resumed on N2. N2 is not a necessary requirement for this synthesis since under argon that contains less than 10−8m N2, the N2-fixing system is made. If NH3 is added to N2-dependent cultures, synthesis of the enzyme system is abruptly stopped, but the enzyme already present remains stable and functional for at least 6 hr (over three generations). Cultures grown under argon in a chemostat controlled by limiting ammonia have derepressed nitrogenase synthesis. If the argon is removed and replaced by N2, partial repression of nitrogenase occurs. PMID:5018019

  13. The induction of two biosynthetic enzymes helps Escherichia coli sustain heme synthesis and activate catalase during hydrogen peroxide stress.

    PubMed

    Mancini, Stefano; Imlay, James A

    2015-05-01

    Hydrogen peroxide pervades many natural environments, including the phagosomes that mediate cell-based immunity. Transcriptomic analysis showed that during protracted low-grade H(2)O(2) stress, Escherichia coli responds by activating both the OxyR defensive regulon and the Fur iron-starvation response. OxyR induced synthesis of two members of the nine-step heme biosynthetic pathway: ferrochelatase (HemH) and an isozyme of coproporphyrinogen III oxidase (HemF). Mutations that blocked either adaptation caused the accumulation of porphyrin intermediates, inadequate activation of heme enzymes, low catalase activity, defective clearance of H(2)O(2) and a failure to grow. Genetic analysis indicated that HemH induction is needed to compensate for iron sequestration by the mini-ferritin Dps. Dps activity protects DNA and proteins by limiting Fenton chemistry, but it interferes with the ability of HemH to acquire the iron that it needs to complete heme synthesis. HemF is a manganoprotein that displaces HemN, an iron-sulfur enzyme whose synthesis and/or stability is apparently problematic during H(2)O(2) stress. Thus, the primary responses to H(2)O(2), including the sequestration of iron, require compensatory adjustments in the mechanisms of iron-cofactor synthesis. The results support the growing evidence that oxidative stress is primarily an iron pathology.

  14. Kinetic analysis for synthesis of a dipeptide precursor using an immobilized enzyme in water-immiscible organic solvents.

    PubMed

    Miyanaga, M; Imamura, K; Sakiyama, T; Nakanishi, K

    2000-01-01

    N-(Benzyloxycarbonyl)-L-aspartyl-L-phenylalanine methyl ester (Z-AspPheOMe), a precursor of the synthetic sweetener aspartame, was synthesized, using thermolysin immobilized onto Amberlite XAD-7, both in ethyl acetate and in tert-amyl alcohol. The initial rates for synthesis of Z-AspPheOMe in the organic solvents were predicted on the basis of a model proposed for an aqueous/organic biphasic reaction and compared with the experimentally observed substrate concentration dependencies. The experimental synthetic rates using the enzyme immobilized at a high enzyme concentration were lower than the calculated ones over a wide range of the substrate concentration. It was suggested as a reason for this discrepancy that the enzyme molecules form compact aggregates and those existing inside the aggregates cannot be utilized for reaction. The experimental results with the enzyme immobilized at a low concentration in ethyl acetate coincided well with the calculated ones. On the other hand, when tert-amyl alcohol was used, the experimental results were different in tendency irrespective of the amount of enzyme loaded, probably due to the fact that a distinct water phase does not exist around the enzyme aggregates inside the support.

  15. Chemoenzymatic synthesis of GD3 oligosaccharides and other disialyl glycans containing natural and non-natural sialic acids

    PubMed Central

    Yu, Hai; Cheng, Jiansong; Ding, Li; Khedri, Zahra; Chen, Yi; Chin, Sharlene; Lau, Kam; Tiwari, Vinod Kumar; Chen, Xi

    2009-01-01

    In order to understand the biological importance of naturally occurring sialic acid variations on disialyl structures in nature, we developed an efficient two-step multi-enzyme approach for the synthesis of a series of GD3 ganglioside oligosaccharides and other disialyl glycans containing a terminal Siaα2–8Sia component with different natural and non-natural sialic acids. In the first step, α2–3- or α2–6-linked monosialylated oligosaccharides were obtained using a one-pot three-enzyme approach. These compounds were then used as acceptors for the α2–8-sialyltransferase activity of a recombinant truncated multi-functional Campylobacter jejuni sialyltransferase CstII mutant, CstIIΔ32I53S, to produce disialyl oligosaccharides. The α2–8-sialyltransferase activity of CstIIΔ32I53S has promiscuous donor substrate specificity and can tolerate various substitutions at C-5 or C-9 of the sialic acid in CMP-sialic acid, while its acceptor substrate specificity is relatively restricted. The terminal sialic acid residues in the acceptable monosialylated oligosaccharide acceptors are restricted to Neu5Ac, Neu5Gc, KDN, and some of their C-9 modified forms but not their C-5 derivatives. The disialyl oligosaccharides obtained are valuable probes for their biological studies. PMID:19947630

  16. Elevation of the Yields of Very Long Chain Polyunsaturated Fatty Acids via Minimal Codon Optimization of Two Key Biosynthetic Enzymes

    PubMed Central

    Zheng, Desong; Sun, Quanxi; Liu, Jiang; Li, Yaxiao; Hua, Jinping

    2016-01-01

    Eicosapentaenoic acid (EPA, 20:5Δ5,8,11,14,17) and Docosahexaenoic acid (DHA, 22:6Δ4,7,10,13,16,19) are nutritionally beneficial to human health. Transgenic production of EPA and DHA in oilseed crops by transferring genes originating from lower eukaryotes, such as microalgae and fungi, has been attempted in recent years. However, the low yield of EPA and DHA produced in these transgenic crops is a major hurdle for the commercialization of these transgenics. Many factors can negatively affect transgene expression, leading to a low level of converted fatty acid products. Among these the codon bias between the transgene donor and the host crop is one of the major contributing factors. Therefore, we carried out codon optimization of a fatty acid delta-6 desaturase gene PinD6 from the fungus Phytophthora infestans, and a delta-9 elongase gene, IgASE1 from the microalga Isochrysis galbana for expression in Saccharomyces cerevisiae and Arabidopsis respectively. These are the two key genes encoding enzymes for driving the first catalytic steps in the Δ6 desaturation/Δ6 elongation and the Δ9 elongation/Δ8 desaturation pathways for EPA/DHA biosynthesis. Hence expression levels of these two genes are important in determining the final yield of EPA/DHA. Via PCR-based mutagenesis we optimized the least preferred codons within the first 16 codons at their N-termini, as well as the most biased CGC codons (coding for arginine) within the entire sequences of both genes. An expression study showed that transgenic Arabidopsis plants harbouring the codon-optimized IgASE1 contained 64% more elongated fatty acid products than plants expressing the native IgASE1 sequence, whilst Saccharomyces cerevisiae expressing the codon optimized PinD6 yielded 20 times more desaturated products than yeast expressing wild-type (WT) PinD6. Thus the codon optimization strategy we developed here offers a simple, effective and low-cost alternative to whole gene synthesis for high expression of

  17. Elevation of the Yields of Very Long Chain Polyunsaturated Fatty Acids via Minimal Codon Optimization of Two Key Biosynthetic Enzymes.

    PubMed

    Xia, Fei; Li, Xueying; Li, Xinzheng; Zheng, Desong; Sun, Quanxi; Liu, Jiang; Li, Yaxiao; Hua, Jinping; Qi, Baoxiu

    2016-01-01

    Eicosapentaenoic acid (EPA, 20:5Δ5,8,11,14,17) and Docosahexaenoic acid (DHA, 22:6Δ4,7,10,13,16,19) are nutritionally beneficial to human health. Transgenic production of EPA and DHA in oilseed crops by transferring genes originating from lower eukaryotes, such as microalgae and fungi, has been attempted in recent years. However, the low yield of EPA and DHA produced in these transgenic crops is a major hurdle for the commercialization of these transgenics. Many factors can negatively affect transgene expression, leading to a low level of converted fatty acid products. Among these the codon bias between the transgene donor and the host crop is one of the major contributing factors. Therefore, we carried out codon optimization of a fatty acid delta-6 desaturase gene PinD6 from the fungus Phytophthora infestans, and a delta-9 elongase gene, IgASE1 from the microalga Isochrysis galbana for expression in Saccharomyces cerevisiae and Arabidopsis respectively. These are the two key genes encoding enzymes for driving the first catalytic steps in the Δ6 desaturation/Δ6 elongation and the Δ9 elongation/Δ8 desaturation pathways for EPA/DHA biosynthesis. Hence expression levels of these two genes are important in determining the final yield of EPA/DHA. Via PCR-based mutagenesis we optimized the least preferred codons within the first 16 codons at their N-termini, as well as the most biased CGC codons (coding for arginine) within the entire sequences of both genes. An expression study showed that transgenic Arabidopsis plants harbouring the codon-optimized IgASE1 contained 64% more elongated fatty acid products than plants expressing the native IgASE1 sequence, whilst Saccharomyces cerevisiae expressing the codon optimized PinD6 yielded 20 times more desaturated products than yeast expressing wild-type (WT) PinD6. Thus the codon optimization strategy we developed here offers a simple, effective and low-cost alternative to whole gene synthesis for high expression of

  18. Inhibitory activities of 2-pyridinecarboxylic acid analogs on phytogrowth and enzymes.

    PubMed

    Sakagami, Y; Tsujibo, H; Hirai, Y; Yamada, T; Numata, A; Inamori, Y

    1999-11-01

    Five 2-pyridinecarboxylic acid-related compounds (1, 2 and 5-7) showed germination inhibition against the seed of Brassica campestris L. subsp. rapa HOOK fil et ANDERS at a concentration of 5.0 x 10(-4) M. These compounds also demonstrated inhibitory activity on the growth of the root of this plant at a concentration of 3.0 x 10(-4) M; among these compounds, 2-pyridylacetic acid (5) showed the strongest inhibitory activity, and the effect was slightly stronger than that of sodium 2,4-dichlorophenoxyacetate (2,4-D) used as a positive control. The amounts of chlorophyll in the cotyledons of this plant treated with these active compounds was lower than that of the control group. Four compounds (1 and 5-7) with germination inhibition also showed inhibitory activities against alpha-amylase and carboxypeptidase A, and 5 was the strongest inhibitor toward both enzymes.

  19. Guanine nanowire based amplification strategy: Enzyme-free biosensing of nucleic acids and proteins.

    PubMed

    Gao, Zhong Feng; Huang, Yan Li; Ren, Wang; Luo, Hong Qun; Li, Nian Bing

    2016-04-15

    Sensitive and specific detection of nucleic acids and proteins plays a vital role in food, forensic screening, clinical and environmental monitoring. There remains a great challenge in the development of signal amplification method for biomolecules detection. Herein, we describe a novel signal amplification strategy based on the formation of guanine nanowire for quantitative detection of nucleic acids and proteins (thrombin) at room temperature. In the presence of analytes and magnesium ions, the guanine nanowire could be formed within 10 min. Compared to the widely used single G-quadruplex biocatalytic label unit, the detection limits are improved by two orders of magnitude in our assay. The proposed enzyme-free method avoids fussy chemical label-ling process, complex programming task, and sophisticated equipment, which might provide an ideal candidate for the fabrication of selective and sensitive biosensing platform.

  20. The citric acid-modified, enzyme-resistant dextrin from potato starch as a potential prebiotic.

    PubMed

    Sliżewska, Katarzyna

    2013-01-01

    In the present study, enzyme-resistant dextrin, prepared by heating of potato starch in the presence of hydrochloric (0.1% dsb) and citric (0.1% dsb) acid at 130ºC for 3 h (CA-dextrin), was tested as a source of carbon for probiotic lactobacilli and bifidobacteria cultured with intestinal bacteria isolated from feces of three healthy 70-year old volunteers. The dynamics of growth of bacterial monocultures in broth containing citric acid (CA)-modified dextrin were estimated. It was also investigated whether lactobacilli and bifidobacteria cultured with intestinal bacteria in the presence of resistant dextrin would be able to dominate the intestinal isolates. Prebiotic fermentation of resistant dextrin was analyzed using prebiotic index (PI). In co-cultures of intestinal and probiotic bacteria, the environment was found to be dominated by the probiotic strains of Bifidobacterium and Lactobacillus, which is a beneficial effect.

  1. Efficient ytterbium triflate catalyzed microwave-assisted synthesis of 3-acylacrylic acid building blocks.

    PubMed

    Tolstoluzhsky, Nikita V; Gorobets, Nikolay Yu; Kolos, Nadezhda N; Desenko, Sergey M

    2008-01-01

    The derivatives of 4-(hetero)aryl-4-oxobut-2-enoic acid are useful as building blocks in the synthesis of biologically active compounds. An efficient general protocol for the synthesis of these building blocks was developed. This method combines microwave assistance and ytterbium triflate catalyst and allows the fast preparation of the target acids starting from different (hetero)aromatic ketones and glyoxylic acid monohydrate giving pure products in 52-75% isolated yields.

  2. Characterization of inulin hydrolyzing enzyme(s) in commercial glucoamylases and its application in lactic acid production from Jerusalem artichoke tubers (Jat).

    PubMed

    Dao, Thai Ha; Zhang, Jian; Bao, Jie

    2013-11-01

    A high inulinase activity was found in three commercially available glucoamylase enzymes. Its origin was investigated and two proteins in the commercial glucoamylases were identified as the potential enzymes showing inulinase activity. One of the commercial glucoamylases, GA-L New from Genencor, was used for Jerusalem artichoke tubers (Jat) hydrolysis and a high hydrolysis yield of fructose was obtained. The simultaneous saccharification and lactic acid fermentation (SSF) of Jat was carried out using GA-L New as the inulinase and Pediococcus acidilactici DQ2 as the fermenting strain. A high lactic acid titer, yield, and productivity of 111.5 g/L, 0.46 g/g DM, and 1.55 g/L/h, respectively, were obtained within 72 h. The enzyme cost using the commercial glucoamylase as inulinase was compared to that using the typical inulinase and a large profit margin was identified. The results provided a practical way of Jat application for lactic acid production using cheap commercial glucoamylase enzyme.

  3. Ontogenetic changes in digestive enzyme activities and the amino acid profile of starry flounder Platichthys stellatus

    NASA Astrophysics Data System (ADS)

    Song, Zhidong; Wang, Jiying; Qiao, Hongjin; Li, Peiyu; Zhang, Limin; Xia, Bin

    2016-09-01

    Ontogenetic changes in digestive enzyme activities and the amino acid (AA) profile of starry flounder, Platichthys stellatus, were investigated and limiting amino acids were estimated compared with the essential AA profile between larvae and live food to clarify starry flounder larval nutritional requirements. Larvae were collected at the egg stage and 0, 2, 4, 7, 12, 17, 24 days after hatching (DAH) for analysis. Larvae grew from 1.91 mm at hatching to 12.13 mm at 24 DAH. Trypsin and chymotrypsin activities changed slightly by 4 DAH and then increased significantly 4 DAH. Pepsin activity increased sharply beginning 17 DAH. Lipase activity increased significantly 4 DAH and increased progressively with larval growth. Amylase activity was also detected in newly hatched larvae and increased 7 DAH followed by a gradual decrease. High free amino acid (FAA) content was detected in starry flounder eggs (110.72 mg/g dry weight). Total FAA content dropped to 43.29 mg/g in 4-DAH larvae and then decreased gradually to 13.74 mg/g in 24-DAH larvae. Most FAAs (except lysine and methionine) decreased >50% in 4-DAH larvae compared with those in eggs and then decreased to the lowest values in 24-DAH larvae. Changes in the protein amino acid (PAA) profile were much milder than those observed for FAAs. Most PAAs increased gradually during larval development, except lysine and phenylalanine. The percentages of free threonine, valine, isoleucine, and leucine decreased until the end of the trial, whereas the protein forms of these four AAs followed the opposite trend. A comparison of the essential AA composition of live food (rotifers, Artemia nauplii, and Artemia metanauplii) and larvae suggested that methionine was potentially the first limiting AA. These results may help develop starry flounder larviculture methods by solving the AA imbalance in live food. Moreover, the increased digestive enzyme activities indicate the possibility of introducing artificial compound feed.

  4. Characterization of fatty acid modifying enzyme activity in staphylococcal mastitis isolates and other bacteria

    PubMed Central

    2012-01-01

    Background Fatty acid modifying enzyme (FAME) has been shown to modify free fatty acids to alleviate their bactericidal effect by esterifying fatty acids to cholesterol or alcohols. Although it has been shown in previous studies that FAME is required for Staphylococcus aureus survival in skin abscesses, FAME is poorly studied compared to other virulence factors. FAME activity had also been detected in coagulase-negative staphylococci (CNS). However, FAME activity was only surveyed after a bacterial culture was grown for 24 h. Therefore if FAME activity was earlier in the growth phase, it would not have been detected by the assay and those strains would have been labeled as FAME negative. Results Fifty CNS bovine mastitis isolates and several S. aureus, Escherichia coli, and Streptococcus uberis strains were assayed for FAME activity over 24 h. FAME activity was detected in 54% of CNS and 80% S. aureus strains surveyed but none in E. coli or S. uberis. While some CNS strains produced FAME activity comparable to the lab strain of S. aureus, the pattern of FAME activity varied among strains and across species of staphylococci. All CNS that produced FAME activity also exhibited lipase activity. Lipase activity relative to colony forming units of these CNS decreased over the 24 h growth period. No relationship was observed between somatic cell count in the milk and FAME activity in CNS. Conclusions Some staphylococcal species surveyed produced FAME activity, but E. coli and S. uberis strains did not. All FAME producing CNS exhibited lipase activity which may indicate that both these enzymes work in concert to alter fatty acids in the bacterial environment. PMID:22726316

  5. Gluconic acid production from sucrose in an airlift reactor using a multi-enzyme system.

    PubMed

    Mafra, Agnes Cristina Oliveira; Furlan, Felipe Fernando; Badino, Alberto Colli; Tardioli, Paulo Waldir

    2015-04-01

    Sucrose from sugarcane is produced in abundance in Brazil, which provides an opportunity to manufacture other high-value products. Gluconic acid (GA) can be produced by multi-enzyme conversion of sucrose using the enzymes invertase, glucose oxidase, and catalase. In this process, one of the byproducts is fructose, which has many commercial applications. This work concerns the batch mode production of GA in an airlift reactor fed with sucrose as substrate. Evaluation was made of the influence of temperature and pH, as well as the thermal stability of the enzymes. Operational conditions of 40 °C and pH 6.0 were selected, based on the enzymatic activity profiles and the thermal stabilities. Under these conditions, the experimental data could be accurately described by kinetic models. The maximum yield of GA was achieved within 3.8 h, with total conversion of sucrose and glucose and a volumetric productivity of around 7.0 g L(-1) h(-1).

  6. Continuous Decolorization of Acid Blue 62 Solution in an Enzyme Membrane Reactor.

    PubMed

    Lewańczuk, Marcin; Bryjak, Jolanta

    2015-09-01

    This paper focuses on using an enzyme membrane reactor (EMR) for the effective continuous decolorization of Acid Blue 62 (AB62). The following factors were considered for the effective use of Cerrena unicolor laccase immobilized in the EMR volume: the enzyme was stable in six successive runs in a batch reactor; no aeration was necessary; AB62 and the oxidized products were sorbed onto the membrane but were not rejected; and the enzyme was stable in the EMR system. It is obvious that any continuous process must be predictable, and thus, the objective was to verify the process model experimentally. For this reason, a proper isoenzyme kinetic equation was selected and the parameters were evaluated. The obtained kinetic parameters were used to plan processes and to verify their applicability to long-term AB62 decolorization, and a very good agreement between the calculated and the measured data was obtained. In the main designed continuous decolorization process, the conversion reached 98 % and was stable for 4 days. The membrane reactor with C. unicolor laccase appears to be very promising for AB62 decolorization.

  7. Biosynthesis of the mycotoxin tenuazonic acid by a fungal NRPS–PKS hybrid enzyme

    PubMed Central

    Yun, Choong-Soo; Motoyama, Takayuki; Osada, Hiroyuki

    2015-01-01

    Tenuazonic acid (TeA) is a well-known mycotoxin produced by various plant pathogenic fungi. However, its biosynthetic gene has been unknown to date. Here we identify the TeA biosynthetic gene from Magnaporthe oryzae by finding two TeA-inducing conditions of a low-producing strain. We demonstrate that TeA is synthesized from isoleucine and acetoacetyl-coenzyme A by TeA synthetase 1 (TAS1). TAS1 is a unique non-ribosomal peptide synthetase and polyketide synthase (NRPS–PKS) hybrid enzyme that begins with an NRPS module. In contrast to other NRPS/PKS hybrid enzymes, the PKS portion of TAS1 has only a ketosynthase (KS) domain and this domain is indispensable for TAS1 activity. Phylogenetic analysis classifies this KS domain as an independent clade close to type I PKS KS domain. We demonstrate that the TAS1 KS domain conducts the final cyclization step for TeA release. These results indicate that TAS1 is a unique type of NRPS–PKS hybrid enzyme. PMID:26503170

  8. Transcriptional profiling of canola developing embryo and identification of the important roles of BnDof5.6 in embryo development and fatty acids synthesis.

    PubMed

    Deng, Wei; Yan, Fang; Zhang, Xiaolan; Tang, Yuwei; Yuan, Yujin

    2015-08-01

    Canola is an important vegetable oil crop globally, and the understanding of the molecular mechanism underlying fatty acids biosynthesis during seed embryo development is an important research goal. Here we report the transcriptional profiling analysis of developing canola embryos using RNA-sequencing (RNA-Seq) method. RNA-Seq analysis generated 58,579,451 sequence reads aligned with 32,243 genes. It was found that a total of 55 differential expression genes (DEGs) encoding 28 enzymes function in carbon flow to fatty acids of storage TAG. Most of the DEGs encoding above enzymes showed similar expression pattern, indicating the DEGs are cooperatively involved in carbon flow into fatty acids. In addition, 41 DEGs associated with signal transductions, transport and metabolic processing of auxin, gibberellin, abscisic acid, cytokinin and salicylic acids were found in the RNA-Seq database, which indicates the important roles of the phytohormones in controlling embryo development and fatty acids synthesis. 122 DEGs encoding transcriptional factor family members were found in developing canola embryos. Furthermore, BnDOF5.6, a zinc finger transcriptional factor gene, found in RNA-Seq database was down-regulated in developing canola embryos. The transgenic plants displayed reduced embryo sizes, decreased fatty acids contents and altered seed fatty acids composition in canola. Down-regulated of BnDof5.6 also changed the expression levels of genes involved in fatty acids synthesis and desaturation. Our results indicate that BnDof5.6 is required for embryo development and fatty acids synthesis in canola. Overall this study presents new information on the global expression patterns of genes during embryo development and will expand our understanding of the complex molecular mechanism of carbon flow into fatty acids and embryo development in canola. PMID:26092973

  9. The role of two families of bacterial enzymes in putrescine synthesis from agmatine via agmatine deiminase.

    PubMed

    Landete, José M; Arena, Mario E; Pardo, Isabel; Manca de Nadra, María C; Ferrer, Sergi

    2010-12-01

    Putrescine, one of the main biogenic amines associated to microbial food spoilage, can be formed by bacteria from arginine via ornithine decarboxylase (ODC), or from agmatine via agmatine deiminase (AgDI). This study aims to correlate putrescine production from agmatine to the pathway involving N-carbamoylputrescine formation via AdDI (the aguA product) and N-carbamoylputrescine amidohydrolase (the aguB product), or putrescine carbamoyltransferase (the ptcA product) in bacteria. PCR methods were developed to detect the two genes involved in putrescine production from agmatine. Putrescine production from agmatine could be linked to the aguA and ptcA genes in Lactobacillus hilgardii X1B, Enterococcus faecalis ATCC 11700, and Bacillus cereus ATCC 14579. By contrast Lactobacillus sakei 23K was unable to produce putrescine, and although a fragment of DNA corresponding to the gene aguA was amplified, no amplification was observed for the ptcA gene. Pseudomonas aeruginosa PAO1 produces putrescine and is reported to harbour aguA and aguB genes, responsible for agmatine deiminase and N-carbamoylputrescine amidohydrolase activities. The enzyme from P. aeruginosa PAO1 that converts N-carbamoylputrescine to putrescine (the aguB product) is different from other microorganisms studied (the ptcA product). Therefore, the aguB gene from P. aeruginosa PAO1 could not be amplified with ptcA-specific primers. The aguB and ptcA genes have frequently been erroneously annotated in the past, as in fact these two enzymes are neither homologous nor analogous. Furthermore, the aguA, aguB and ptcA sequences available from GenBank were subjected to phylogenetic analysis, revealing that gram-positive bacteria harboured ptcA, whereas gram-negative bacteria harbour aguB. This paper also discusses the role of the agmatine deiminase system (AgDS) in acid stress resistance.

  10. Effects of traditionally used anxiolytic botanicals on enzymes of the gamma-aminobutyric acid (GABA) system.

    PubMed

    Awad, R; Levac, D; Cybulska, P; Merali, Z; Trudeau, V L; Arnason, J T

    2007-09-01

    In Canada, the use of botanical natural health products (NHPs) for anxiety disorders is on the rise, and a critical evaluation of their safety and efficacy is required. The purpose of this study was to determine whether commercially available botanicals directly affect the primary brain enzymes responsible for gamma-aminobutyric acid (GABA) metabolism. Anxiolytic plants may interact with either glutamic acid decarboxylase (GAD) or GABA transaminase (GABA-T) and ultimately influence brain GABA levels and neurotransmission. Two in vitro rat brain homogenate assays were developed to determine the inhibitory concentrations (IC50) of aqueous and ethanolic plant extracts. Approximately 70% of all extracts that were tested showed little or no inhibitory effect (IC50 values greater than 1 mg/mL) and are therefore unlikely to affect GABA metabolism as tested. The aqueous extract of Melissa officinalis (lemon balm) exhibited the greatest inhibition of GABA-T activity (IC50 = 0.35 mg/mL). Extracts from Centella asiatica (gotu kola) and Valeriana officinalis (valerian) stimulated GAD activity by over 40% at a dose of 1 mg/mL. On the other hand, both Matricaria recutita (German chamomile) and Humulus lupulus (hops) showed significant inhibition of GAD activity (0.11-0.65 mg/mL). Several of these species may therefore warrant further pharmacological investigation. The relation between enzyme activity and possible in vivo mode of action is discussed. PMID:18066140

  11. Ferulsinaic Acid Modulates SOD, GSH, and Antioxidant Enzymes in Diabetic Kidney

    PubMed Central

    Sayed, Ahmed Amir Radwan

    2012-01-01

    The efficacy of Ferulsinaic acid (FA) to modulate the antioxidant enzymes and to reduce oxidative stress induced-diabetic nephropathy (DN) was studied. Rats were fed diets enriched with sucrose (50%, wt/wt), lard (30%, wt/wt), and cholesterol (2.5%, wt/wt) for 8 weeks to induce insulin resistance. After a DN model was induced by streptozotocin; 5, 50 and 500 mg/kg of FA were administrated by oral intragastric intubation for 12 weeks. In FA-treated diabetic rats, glucose, kidney/body weight ratio, creatinine, BUN, albuminurea, and creatinine clearance were significantly decreased compared with non treated diabetic rats. Diabetic rats showed decreased activities of SOD and GSH; increased concentrations of malondialdehyde and IL-6 in the serum and kidney, and increased levels of 8-hydroxy-2′-deoxyguanosine in urine and renal cortex. FA-treatment restored the altered parameters in a dose-dependent manner. The ultra morphologic abnormalities in the kidney of diabetic rats were markedly ameliorated by FA treatment. Furthermore, FA acid was found to attenuate chronic inflammation induced by both Carrageenan and dextran in rats. We conclude that FA confers protection against injuries in the kidneys of diabetic rats by increasing activities of antioxidant enzymes and inhibiting accumulation of oxidized DNA in the kidney, suggesting a potential drug for the prevention and therapy of DN. PMID:22991571

  12. Regulation of Synthesis of the Branched-Chain Amino Acids and Cognate Aminoacyl-Transfer Ribonucleic Acid Synthetases of Escherichia coli: a Common Regulatory Element

    PubMed Central

    Jackson, Julius; Williams, L. S.; Umbarger, H. E.

    1974-01-01

    Regulation of isoleucine, valine, and leucine biosynthesis and isoleucyl-, valyl-, and leucyl-transfer ribonucleic acid (tRNA) synthetase formation was examined in two mutant strains of Escherichia coli. One mutant was selected for growth resistance to the isoleucine analogue, ketomycin, and the other was selected for growth resistance to both trifluoroleucine and valine. Control of the synthesis of the branched-chain amino acids by repression was altered in both of these mutants. They also exhibited altered control of formation of isoleucyl-tRNA synthetase (EC 6.1.15, isoleucine:sRNA ligase, AMP), valyl-tRNA synthetase (EC 6.1.1.9, valine:sRNA ligase, AMP), and leucyl-tRNA synthetase (EC 6.1.1.4, leucine:sRNA ligase, AMP). These results suggest the existence of a common element for the control of these two classes of enzymes in Escherichia coli. PMID:4612020

  13. Amyloid β inhibits retinoic acid synthesis exacerbating Alzheimer disease pathology which can be attenuated by an retinoic acid receptor α agonist.

    PubMed

    Goncalves, Maria B; Clarke, Earl; Hobbs, Carl; Malmqvist, Tony; Deacon, Robert; Jack, Julian; Corcoran, Jonathan P T

    2013-04-01

    The retinoic acid receptor (RAR) α system plays a key role in the adult brain, participating in the homeostatic control of synaptic plasticity, essential for memory function. Here we show that RARα signalling is down-regulated by amyloid beta (Aβ), which inhibits the synthesis of the endogenous ligand, retinoic acid (RA). This results in the counteraction of a variety of RARα-activated pathways that are key in the aetiopathology of Alzheimer's disease (AD) but which can be reversed by an RARα agonist. RARα signalling improves cognition in the Tg2576 mice, it has an anti-inflammatory effect and promotes Aβ clearance by increasing insulin degrading enzyme and neprilysin activity in both microglia and neurons. In addition, RARα signalling prevents tau phosphorylation. Therefore, stimulation of the RARα signalling pathway using a synthetic agonist, by both clearing Aβ and counteracting some of its toxic effects, offers therapeutic potential for the treatment of AD.

  14. Amyloid β inhibits retinoic acid synthesis exacerbating Alzheimer disease pathology which can be attenuated by an retinoic acid receptor α agonist

    PubMed Central

    Goncalves, Maria B; Clarke, Earl; Hobbs, Carl; Malmqvist, Tony; Deacon, Robert; Jack, Julian; Corcoran, Jonathan P T

    2013-01-01

    The retinoic acid receptor (RAR) α system plays a key role in the adult brain, participating in the homeostatic control of synaptic plasticity, essential for memory function. Here we show that RARα signalling is down-regulated by amyloid beta (Aβ), which inhibits the synthesis of the endogenous ligand, retinoic acid (RA). This results in the counteraction of a variety of RARα-activated pathways that are key in the aetiopathology of Alzheimer's disease (AD) but which can be reversed by an RARα agonist. RARα signalling improves cognition in the Tg2576 mice, it has an anti-inflammatory effect and promotes Aβ clearance by increasing insulin degrading enzyme and neprilysin activity in both microglia and neurons. In addition, RARα signalling prevents tau phosphorylation. Therefore, stimulation of the RARα signalling pathway using a synthetic agonist, by both clearing Aβ and counteracting some of its toxic effects, offers therapeutic potential for the treatment of AD. PMID:23379615

  15. Photosynthesis in Rhodospirillum rubrum. III. Metabolic Control of Reductive Pentose Phosphate and Tricarboxylic Acid Cycle Enzymes 1

    PubMed Central

    Anderson, Louise; Fuller, R. C.

    1967-01-01

    Enzymes of the reductive pentose phosphate cycle including ribulose-diphosphate carboxylase, ribulose-5-phosphate kinase, ribose-5-phosphate isomerase, aldolase, glyceraldehyde-3-phosphate dehydrogenase and alkaline fructose-1,6-diphos-phatase were shown to be present in autotrophically grown Rhodospirillum rubrum. Enzyme levels were measured in this organism grown photo- and dark heterotrophically as well. Several, but not all, of these enzymes appeared to be under metabolic control, mediated by exogenous carbon and nitrogen compounds. Light had no effect on the presence or levels of any of these enzymes in this photosynthetic bacterium. The enzymes of the tricarboxylic acid cycle and enolase were shown to be present in R. rubrum cultured aerobically, autotrophically, or photoheterotrophically, both in cultures evolving hydrogen and under conditions where hydrogen evolution is not observed. Light had no clearly demonstrable effect on the presence or levels of any of these enzymes. PMID:6042359

  16. Xylonucleic acid: synthesis, structure, and orthogonal pairing properties

    PubMed Central

    Maiti, Mohitosh; Maiti, Munmun; Knies, Christine; Dumbre, Shrinivas; Lescrinier, Eveline; Rosemeyer, Helmut; Ceulemans, Arnout; Herdewijn, Piet

    2015-01-01

    There is a common interest for studying xeno-nucleic acid systems in the fields of synthetic biology and the origin of life, in particular, those with an engineered backbone and possessing novel properties. Along this line, we have investigated xylonucleic acid (XyloNA) containing a potentially prebiotic xylose sugar (a 3′-epimer of ribose) in its backbone. Herein, we report for the first time the synthesis of four XyloNA nucleotide building blocks and the assembly of XyloNA oligonucleotides containing all the natural nucleobases. A detailed investigation of pairing and structural properties of XyloNAs in comparison to DNA/RNA has been performed by thermal UV-melting, CD, and solution state NMR spectroscopic studies. XyloNA has been shown to be an orthogonal self-pairing system which adopts a slightly right-handed extended helical geometry. Our study on one hand, provides understanding for superior structure-function (-pairing) properties of DNA/RNA over XyloNA for selection as an informational polymer in the prebiotic context, while on the other hand, finds potential of XyloNA as an orthogonal genetic system for application in synthetic biology. PMID:26175047

  17. Decreased bile-acid synthesis in livers of hepatocyte-conditional NADPH-cytochrome P450 reductase-null mice results in increased bile acids in serum.

    PubMed

    Cheng, Xingguo; Zhang, Youcai; Klaassen, Curtis D

    2014-10-01

    NADPH-cytochrome P450 reductase (Cpr) is essential for the function of microsomal cytochrome P450 monooxygenases (P450), including those P450s involved in bile acid (BA) synthesis. Mice with hepatocyte-specific deletion of NADPH-cytochrome P450 reductase (H-Cpr-null) have been engineered to understand the in vivo function of hepatic P450s in the metabolism of xenobiotics and endogenous compounds. However, the impact of hepatic Cpr on BA homeostasis is not clear. The present study revealed that H-Cpr-null mice had a 60% decrease in total BA concentration in liver, whereas the total BA concentration in serum was almost doubled. The decreased level of cholic acid (CA) in both serum and livers of H-Cpr-null mice is likely due to diminished enzyme activity of Cyp8b1 that is essential for CA biosynthesis. Feedback mechanisms responsible for the reduced liver BA concentrations and/or increased serum BA concentrations in H-Cpr-null mice included the following: 1) enhanced alternative BA synthesis pathway, as evidenced by the fact that classic BA synthesis is diminished but chenodeoxycholic acid still increases in both serum and livers of H-Cpr-null mice; 2) inhibition of farnesoid X receptor activation, which increased the mRNA of Cyp7a1 and 8b1; 3) induction of intestinal BA transporters to facilitate BA absorption from the intestine to the circulation; 4) induction of hepatic multidrug resistance-associated protein transporters to increase BA efflux from the liver to blood; and 5) increased generation of secondary BAs. In summary, the present study reveals an important contribution of the alternative BA synthesis pathway and BA transporters in regulating BA concentrations in H-Cpr-null mice.

  18. Inhibition of Interjacent Ribonucleic Acid (26S) Synthesis in Cells Infected by Sindbis Virus

    PubMed Central

    Scheele, Christina M.; Pfefferkorn, E. R.

    1969-01-01

    The interrelationship of viral ribonucleic acid (RNA) and protein synthesis in cells infected by Sindbis virus was investigated. When cultures were treated with puromycin early in the course of infection, the synthesis of interjacent RNA (26S) was preferentially inhibited. A similar result was obtained by shifting cells infected by one temperature-sensitive mutant defective in RNA synthesis from the permissive (29 C) to the nonpermissive (41.5 C) temperature. Under both conditions, the viral RNA produced appeared to be fully active biologically. Once underway, the synthesis of viral RNA in wild-type Sindbis infections did not require concomitant protein synthesis. PMID:5817400

  19. The Mycobacterium tuberculosis FAS-II condensing enzymes: their role in mycolic acid biosynthesis, acid-fastness, pathogenesis and in future drug development.

    PubMed

    Bhatt, Apoorva; Molle, Virginie; Besra, Gurdyal S; Jacobs, William R; Kremer, Laurent

    2007-06-01

    Mycolic acids are very long-chain fatty acids representing essential components of the mycobacterial cell wall. Considering their importance, characterization of key enzymes participating in mycolic acid biosynthesis not only allows an understanding of their role in the physiology of mycobacteria, but also might lead to the identification of new drug targets. Mycolates are synthesized by at least two discrete elongation systems, the type I and type II fatty acid synthases (FAS-I and FAS-II respectively). Among the FAS-II components, the condensing enzymes that catalyse the formation of carbon-carbon bonds have received considerable interest. Four condensases participate in initiation (mtFabH), elongation (KasA and KasB) and termination (Pks13) steps, leading to full-length mycolates. We present the recent biochemical and structural data for these important enzymes. Special emphasis is given to their role in growth, intracellular survival, biofilm formation, as well as in the physiopathology of tuberculosis. Recent studies demonstrated that phosphorylation of these enzymes by mycobacterial kinases affects their activities. We propose here a model in which kinases that sense environmental changes can phosphorylate the condensing enzymes, thus representing a novel mechanism of regulating mycolic acid biosynthesis. Finally, we discuss the attractiveness of these enzymes as valid targets for future antituberculosis drug development. PMID:17555433

  20. An enzyme cascade synthesis of ε-caprolactone and its oligomers.

    PubMed

    Schmidt, Sandy; Scherkus, Christian; Muschiol, Jan; Menyes, Ulf; Winkler, Till; Hummel, Werner; Gröger, Harald; Liese, Andreas; Herz, Hans-Georg; Bornscheuer, Uwe T

    2015-02-23

    Poly-ε-caprolactone (PCL) is chemically produced on an industrial scale in spite of the need for hazardous peracetic acid as an oxidation reagent. Although Baeyer-Villiger monooxygenases (BVMO) in principle enable the enzymatic synthesis of ε-caprolactone (ε-CL) directly from cyclohexanone with molecular oxygen, current systems suffer from low productivity and are subject to substrate and product inhibition. The major limitations for such a biocatalytic route to produce this bulk chemical were overcome by combining an alcohol dehydrogenase with a BVMO to enable the efficient oxidation of cyclohexanol to ε-CL. Key to success was a subsequent direct ring-opening oligomerization of in situ formed ε-CL in the aqueous phase by using lipase A from Candida antarctica, thus efficiently solving the product inhibition problem and leading to the formation of oligo-ε-CL at more than 20 g L(-1) when starting from 200 mM cyclohexanol. This oligomer is easily chemically polymerized to PCL. PMID:25597635

  1. Enzymes Catalyzing the Early Steps of Clavulanic Acid Biosynthesis Are Encoded by Two Sets of Paralogous Genes in Streptomyces clavuligerus

    PubMed Central

    Jensen, Susan E.; Elder, Kenneth J.; Aidoo, Kwamena A.; Paradkar, Ashish S.

    2000-01-01

    Genes encoding the proteins required for clavulanic acid biosynthesis and for cephamycin biosynthesis are grouped into a “supercluster” in Streptomyces clavuligerus. Nine open reading frames (ORFs) associated with clavulanic acid biosynthesis were located in a 15-kb segment of the supercluster, including six ORFs encoding known biosynthetic enzymes or regulatory proteins, two ORFs that have been reported previously but whose involvement in clavulanic acid biosynthesis is unclear, and one ORF not previously reported. Evidence for the involvement of these ORFs in clavulanic acid production was obtained by generating mutants and showing that all were defective for clavulanic acid production when grown on starch asparagine medium. However, when five of the nine mutants, including mutants defective in known clavulanic acid biosynthetic enzymes, were grown in a soy-based medium, clavulanic acid-producing ability was restored. This ability to produce clavulanic acid when seemingly essential biosynthetic enzymes have been mutated suggests that paralogous genes encoding functionally equivalent proteins exist for each of the five genes but that these paralogues are expressed only in the soy-based medium. The five genes that have paralogues encode proteins involved in the early steps of the pathway common to the biosynthesis of both clavulanic acid and the other clavam metabolites produced by this organism. No evidence was seen for paralogues of the four remaining genes involved in late, clavulanic acid-specific steps in the pathway. PMID:10681345

  2. Comparative genomics of citric-acid producing Aspergillus niger ATCC 1015 versus enzyme-producing CBS 513.88

    SciTech Connect

    Grigoriev, Igor V.; Baker, Scott E.; Andersen, Mikael R.; Salazar, Margarita P.; Schaap, Peter J.; Vondervoot, Peter J.I. van de; Culley, David; Thykaer, Jette; Frisvad, Jens C.; Nielsen, Kristen F.; Albang, Richard; Albermann, Kaj; Berka, Randy M.; Braus, Gerhard H.; Braus-Stromeyer, Susanna A.; Corrochano, Luis M.; Dai, Ziyu; Dijck, Piet W.M. van; Hofmann, Gerald; Lasure, Linda L.; Magnusson, Jon K.; Meijer, Susan L.; Nielsen, Jakob B.; Nielsen, Michael L.; Ooyen, Albert J.J. van; Panther, Kathyrn S.; Pel, Herman J.; Poulsen, Lars; Samson, Rob A.; Stam, Hen; Tsang, Adrian; Brink, Johannes M. van den; Atkins, Alex; Aerts, Andrea; Shapiro, Harris; Pangilinan, Jasmyn; Salamov, Asaf; Lou, Yigong; Lindquist, Erika; Lucas, Susan; Grimwood, Jane; Kubicek, Christian P.; Martinez, Diego; Peij, Noel N.M.E. van; Roubos, Johannes A.; Nielsen, Jens

    2011-04-28

    The filamentous fungus Aspergillus niger exhibits great diversity in its phenotype. It is found globally, both as marine and terrestrial strains, produces both organic acids and hydrolytic enzymes in high amounts, and some isolates exhibit pathogenicity. Although the genome of an industrial enzyme-producing A. niger strain (CBS 513.88) has already been sequenced, the versatility and diversity of this species compels additional exploration. We therefore undertook whole genome sequencing of the acidogenic A. niger wild type strain (ATCC 1015), and produced a genome sequence of very high quality. Only 15 gaps are present in the sequence and half the telomeric regions have been elucidated. Moreover, sequence information from ATCC 1015 was utilized to improve the genome sequence of CBS 513.88. Chromosome-level comparisons uncovered several genome rearrangements, deletions, a clear case of strain-specific horizontal gene transfer, and identification of 0.8 megabase of novel sequence. Single nucleotide polymorphisms per kilobase (SNPs/kb) between the two strains were found to be exceptionally high (average: 7.8, maximum: 160 SNPs/kb). High variation within the species was confirmed with exo-metabolite profiling and phylogenetics. Detailed lists of alleles were generated, and genotypic differences were observed to accumulate in metabolic pathways essential to acid production and protein synthesis. A transcriptome analysis revealed up-regulation of the electron transport chain, specifically the alternative oxidative pathway in ATCC 1015, while CBS 513.88 showed significant up-regulation of genes relevant to glucoamylase A production, such as tRNA-synthases and protein transporters. Our results and datasets from this integrative systems biology analysis resulted in a snapshot of fungal evolution and will support further optimization of cell factories based on filamentous fungi.[Supplemental materials (10 figures, three text documents and 16 tables) have been made available

  3. Biodiesel synthesis via esterification of feedstock with high content of free fatty acids.

    PubMed

    Souza, Marcella S; Aguieiras, Erika C G; da Silva, Mônica A P; Langone, Marta A P

    2009-05-01

    The objective of this work was to study the synthesis of ethyl esters via esterification of soybean oil deodorizer distillate with ethanol, using solid acid catalysts and commercial immobilized lipases, in a solvent-free system. Three commercially immobilized lipases were used, namely, Lipozyme RM-IM, Lipozyme TL-IM, and Novozym 435, all from Novozymes. We aimed for optimum reaction parameters: temperature, enzyme concentration, initial amount of ethanol, and its feeding technique to the reactor (stepwise ethanolysis). Reaction was faster with Novozym 435. The highest conversion (83.5%) was obtained after 90 min using 3 wt.% of Novozym 435 and two-stage stepwise addition of ethanol at 50 degrees C. Four catalysts were also tested: zeolite CBV-780, SAPO-34, niobia, and niobic acid. The highest conversion (30%) was obtained at 100 degrees C, with 3 wt.% of CBV-780 after 2.5 h. The effects of zeolite CBV 780 concentration were studied, resulting in a conversion of 49% using 9 wt.% of catalyst. PMID:19067243

  4. Design and synthesis of inhibitors incorporating beta -amino acids of metalloendopeptidase EC 3.4.24.15.

    PubMed

    Steer, D L; Lew, R A; Perlmutter, P; Smith, A I; Aguilar, M I

    2000-09-01

    Endopeptidase EC 3.4.24.15 (EP 24.15) is a thermolysin-like metalloendopeptidase which is expressed widely throughout the body, with the highest concentrations in the brain, pituitary and testis. While the precise role of EP 24.15 remains unknown, it is thought to participate in the regulated metabolism of a number of specific neuropeptides. Of the limited number of inhibitors described for EP 24.15, N-[1-(R,S)-carboxy-3-phenylpropyl]-Ala-Ala-Tyr-p-amino benzoate (CFP) is the most widely studied. CFP is a potent and specific inhibitor, but is unstable in vivo due to its cleavage between the alanine and tyrosine residues by the enzyme neprilysin (EP 24.11). The cpp-Ala-Ala N-terminal product of this cleavage is a potent inhibitor of angiotensin converting enzyme, which further limits the use of CFP in vivo. To generate specific inhibitors of EP 24.15 that are resistant to in vivo proteolysis by EP 24.11, beta-amino acids have been incorporated into the structure of CFP. We have prepared racemic mixtures of beta-amino acids containing proteogenic side chains, which are 9-fluorenylmethoxycarbonyl (Fmoc)-protected, and several analogues of CFP containing beta-amino acids have been synthesized by solid phase peptide synthesis. The results of stability and inhibitory studies of these new analogues show that the incorporation of beta-amino acids adjacent to the scissile bond can indeed stabilize the peptides against cleavage by EP 24.11 and still inhibit EP 24.15. The results obtained in these studies demonstrate the potential of these amino acids in the synthesis of peptidomimetics and in the design of new stable and specific therapeutics. PMID:11016884

  5. Effect of Diet Supplementation on the Expression of Bovine Genes Associated with Fatty Acid Synthesis and Metabolism

    PubMed Central

    Joseph, Sandeep J.; Robbins, Kelly R.; Pavan, Enrique; Pratt, Scott L.; Duckett, Susan K.; Rekaya, Romdhane

    2010-01-01

    Conjugated linoleic acids (CLA) are of important nutritional and health benefit to human. Food products of animal origin are their major dietary source and their concentration increases with high concentrate diets fed to animals. To examine the effects of diet supplementation on the expression of genes related to lipid metabolism, 28 Angus steers were fed either pasture only, pasture with soybean hulls and corn oil, pasture with corn grain, or high concentrate diet. At slaughter, samples of subcutaneous adipose tissue were collected, from which RNA was extracted. Relative abundance of gene expression was measured using Affymetrix GeneChip Bovine Genome array. An ANOVA model nested within gene was used to analyze the background adjusted, normalized average difference of probe-level intensities. To control experiment wise error, a false discovery rate of 0.01 was imposed on all contrasts. Expression of several genes involved in the synthesis of enzymes related to fatty acid metabolism and lipogenesis such as stearoyl-CoA desaturase (SCD), fatty acid synthetase (FASN), lipoprotein lipase (LPL), fatty-acyl elongase (LCE) along with several trancription factors and co-activators involved in lipogenesis were found to be differentially expressed. Confirmatory RT-qPCR was done to validate the microarray results, which showed satisfactory correspondence between the two platforms. Results show that changes in diet by increasing dietary energy intake by supplementing high concentrate diet have effects on the transcription of genes encoding enzymes involved in fat metabolism which in turn has effects on fatty acid content in the carcass tissue as well as carcass quality. Corn supplementation either as oil or grain appeared to significantly alter the expression of genes directly associated with fatty acid synthesis. PMID:20448844

  6. Synthesis and application of acid labile anchor groups for the synthesis of peptide amides by Fmoc-solid-phase peptide synthesis.

    PubMed

    Breipohl, G; Knolle, J; Stüber, W

    1989-10-01

    The preparation and application of a new linker for the synthesis of peptide amides using a modified Fmoc-method is described. The new anchor group was developed based on our experience with 4,4'-dimethoxybenzhydryl (Mbh)-protecting group for amides. Lability towards acid treatment was increased dramatically and results in an easy cleavage procedure for the preparation of peptide amides. The synthesis of N-9-fluorenylmethoxycarbonyl- ([5-carboxylatoethyl-2.4-dimethoxyphenyl)- 4'-methoxyphenyl]-methylamin is reported in detail. This linker was coupled to a commercially available aminomethyl polystyrene resin. Peptide synthesis proceeded smoothly using HOOBt esters of Fmoc-amino acids. Release of the peptide amide and final cleavage of the side chain protecting groups was accomplished by treatment with trifluoroacetic acid-dichloromethane mixtures in the presence of scavengers. The synthesis of peptide amides such as LHRH and C-terminal hexapeptide of secretin are given as examples.

  7. Derepression of certain aromatic amino acid biosynthetic enzymes of Escherichia coli K-12 by growth in Fe3+-deficient medium.

    PubMed Central

    McCray, J W; Herrmann, K M

    1976-01-01

    3-Deoxy-arabino-heptulosonic acid 7-phosphate synthase, prephenate dehydratase, tryptophan synthase, and 2,3-dihydroxybenzoylserine synthase enzyme activities are derepressed in wild-type Escherichia coli K-12 cells grown on Fe3+-deficient medium. This derepression is reversed when FeSO4 is added to the growth medium. Addition of shikimic acid to the Fe3+-deficient growth medium caused repression of the first three enzyme activities but not of 2,3-dihydroxybenzoylserine synthase activity. Addition of 2,3-dihydroxybenzoic acid to the Fe3+-deficient growth medium has no effect on any of the above-mentioned enzyme activities. The Fe3+ deficiency-mediated derepression of 3-deoxyarabino-heptulosonic acid 7-phosphate synthase activity is due to an elevation of the tyrosine-sensitive isoenzyme; the phenylalanine-sensitive isoenzyme is not derepressed under these conditions. PMID:1383

  8. Clostridium thermocellum releases coumaric acid during degradation of untreated grasses by the action of an unknown enzyme.

    PubMed

    Herring, Christopher D; Thorne, Philip G; Lynd, Lee R

    2016-03-01

    Clostridium thermocellum is an anaerobic thermophile with the ability to digest lignocellulosic biomass that has not been pretreated with high temperatures. Thermophilic anaerobes have previously been shown to more readily degrade grasses than wood. Part of the explanation for this may be the presence of relatively large amounts of coumaric acid in grasses, with linkages to both hemicellulose and lignin. We found that C. thermocellum and cell-free cellulase preparations both release coumaric acid from bagasse and switchgrass. Cellulase preparations from a mutant strain lacking the scaffoldin cipA still showed activity, though diminished. Deletion of all three proteins in C. thermocellum with ferulic acid esterase domains, either singly or in combination, did not eliminate the activity. Further work will be needed to identify the novel enzyme(s) responsible for the release of coumaric acid from grasses and to determine whether these enzymes are important factors of microbial biomass degradation.

  9. The Hypothesis that the Genetic Code Originated in Coupled Synthesis of Proteins and the Evolutionary Predecessors of Nucleic Acids in Primitive Cells

    PubMed Central

    Francis, Brian R.

    2015-01-01

    Although analysis of the genetic code has allowed explanations for its evolution to be proposed, little evidence exists in biochemistry and molecular biology to offer an explanation for the origin of the genetic code. In particular, two features of biology make the origin of the genetic code difficult to understand. First, nucleic acids are highly complicated polymers requiring numerous enzymes for biosynthesis. Secondly, proteins have a simple backbone with a set of 20 different amino acid side chains synthesized by a highly complicated ribosomal process in which mRNA sequences are read in triplets. Apparently, both nucleic acid and protein syntheses have extensive evolutionary histories. Supporting these processes is a complex metabolism and at the hub of metabolism are the carboxylic acid cycles. This paper advances the hypothesis that the earliest predecessor of the nucleic acids was a β-linked polyester made from malic acid, a highly conserved metabolite in the carboxylic acid cycles. In the β-linked polyester, the side chains are carboxylic acid groups capable of forming interstrand double hydrogen bonds. Evolution of the nucleic acids involved changes to the backbone and side chain of poly(β-d-malic acid). Conversion of the side chain carboxylic acid into a carboxamide or a longer side chain bearing a carboxamide group, allowed information polymers to form amide pairs between polyester chains. Aminoacylation of the hydroxyl groups of malic acid and its derivatives with simple amino acids such as glycine and alanine allowed coupling of polyester synthesis and protein synthesis. Use of polypeptides containing glycine and l-alanine for activation of two different monomers with either glycine or l-alanine allowed simple coded autocatalytic synthesis of polyesters and polypeptides and established the first genetic code. A primitive cell capable of supporting electron transport, thioester synthesis, reduction reactions, and synthesis of polyesters and

  10. Structural Characterisation of FabG from Yersinia pestis, a Key Component of Bacterial Fatty Acid Synthesis

    PubMed Central

    Nanson, Jeffrey D.; Forwood, Jade K.

    2015-01-01

    Ketoacyl-acyl carrier protein reductases (FabG) are ubiquitously expressed enzymes that catalyse the reduction of acyl carrier protein (ACP) linked thioesters within the bacterial type II fatty acid synthesis (FASII) pathway. The products of these enzymes, saturated and unsaturated fatty acids, are essential components of the bacterial cell envelope. The FASII reductase enoyl-ACP reductase (FabI) has been the focus of numerous drug discovery efforts, some of which have led to clinical trials, yet few studies have focused on FabG. Like FabI, FabG appears to be essential for survival in many bacteria, similarly indicating the potential of this enzyme as a drug target. FabG enzymes are members of the short-chain alcohol dehydrogenase/reductase (SDR) family, and like other SDRs, exhibit highly conserved secondary and tertiary structures, and contain a number of conserved sequence motifs. Here we describe the crystal structures of FabG from Yersinia pestis (YpFabG), the causative agent of bubonic, pneumonic, and septicaemic plague, and three human pandemics. Y. pestis remains endemic in many parts of North America, South America, Southeast Asia, and Africa, and a threat to human health. YpFabG shares a high degree of structural similarity with bacterial homologues, and the ketoreductase domain of the mammalian fatty acid synthase from both Homo sapiens and Sus scrofa. Structural characterisation of YpFabG, and comparison with other bacterial FabGs and the mammalian fatty acid synthase, provides a strong platform for virtual screening of potential inhibitors, rational drug design, and the development of new antimicrobial agents to combat Y. pestis infections. PMID:26539719

  11. Regulation of protein synthesis by amino acids in muscle of neonates.

    PubMed

    Suryawan, Agus; Davis, Teresa A

    2011-01-01

    The marked increase in skeletal muscle mass during the neonatal period is largely due to a high rate of postprandial protein synthesis that is modulated by an enhanced sensitivity to insulin and amino acids. The amino acid signaling pathway leading to the stimulation of protein synthesis has not been fully elucidated. Among the amino acids, leucine is considered to be a principal anabolic agent that regulates protein synthesis. mTORC1, which controls protein synthesis, has been implicated as a target for leucine. Until recently, there have been few studies exploring the role of amino acids in enhancing muscle protein synthesis in vivo. In this review, we discuss amino acid-induced protein synthesis in muscle in the neonate, focusing on current knowledge of the role of amino acids in the activation of mTORC1 leading to mRNA translation. The role of the amino acid transporters, SNAT2, LAT1, and PAT, in the modulation of mTORC1 activation and the role of amino acids in the activation of putative regulators of mTORC1, i.e., raptor, Rheb, MAP4K3, Vps34, and Rag GTPases, are discussed.

  12. Structure and Evolution of the Archaeal Lipid Synthesis Enzyme sn-Glycerol-1-phosphate Dehydrogenase*

    PubMed Central

    Carbone, Vincenzo; Schofield, Linley R.; Zhang, Yanli; Sang, Carrie; Dey, Debjit; Hannus, Ingegerd M.; Martin, William F.; Sutherland-Smith, Andrew J.; Ronimus, Ron S.

    2015-01-01

    One of the most critical events in the origins of cellular life was the development of lipid membranes. Archaea use isoprenoid chains linked via ether bonds to sn-glycerol 1-phosphate (G1P), whereas bacteria and eukaryotes use fatty acids attached via ester bonds to enantiomeric sn-glycerol 3-phosphate. NAD(P)H-dependent G1P dehydrogenase (G1PDH) forms G1P and has been proposed to have played a crucial role in the speciation of the Archaea. We present here, to our knowledge, the first structures of archaeal G1PDH from the hyperthermophilic methanogen Methanocaldococcus jannaschii with bound substrate dihydroxyacetone phosphate, product G1P, NADPH, and Zn2+ cofactor. We also biochemically characterized the enzyme with respect to pH optimum, cation specificity, and kinetic parameters for dihydroxyacetone phosphate and NAD(P)H. The structures provide key evidence for the reaction mechanism in the stereospecific addition for the NAD(P)H-based pro-R hydrogen transfer and the coordination of the Zn2+ cofactor during catalysis. Structure-based phylogenetic analyses also provide insight into the origins of G1PDH. PMID:26175150

  13. Enzyme-catalysed synthesis and reactions of benzene oxide/oxepine derivatives of methyl benzoates.

    PubMed

    Boyd, Derek R; Sharma, Narain D; Harrison, John S; Malone, John F; McRoberts, W Colin; Hamilton, John T G; Harper, David B

    2008-04-01

    A series of twelve benzoate esters was metabolised, by species of the Phellinus genus of wood-rotting fungi, to yield the corresponding benzyl alcohol derivatives and eight salicylates. The isolation of a stable oxepine metabolite, from methyl benzoate, allied to evidence of the migration and retention of a carbomethoxy group (the NIH Shift), during enzyme-catalysed ortho-hydroxylation of alkyl benzoates to form salicylates, is consistent with a mechanism involving an initial arene epoxidation step. This mechanism was confirmed by the isolation of a remarkably stable, optically active, substituted benzene oxide metabolite of methyl 2-(trifluoromethyl)benzoate, which slowly converted into the racemic form. The arene oxide was found to undergo a cycloaddition reaction with 4-phenyl-1,2,4-triazoline-3,5-dione to yield a crystalline cycloadduct whose structure and racemic nature was established by X-ray crystallography. The metabolite was also found to undergo some novel benzene oxide reactions, including epoxidation to give an anti-diepoxide, base-catalysed hydrolysis to form a trans-dihydrodiol and acid-catalysed aromatisation to yield a salicylate derivative via the NIH Shift of a carbomethoxy group.

  14. Activation of the constitutive androstane receptor inhibits gluconeogenesis without affecting lipogenesis or fatty acid synthesis in human hepatocytes

    SciTech Connect

    Lynch, Caitlin; Pan, Yongmei; Li, Linhao; Heyward, Scott; Moeller, Timothy; Swaan, Peter W.; Wang, Hongbing

    2014-08-15

    Objective: Accumulating evidence suggests that activation of mouse constitutive androstane receptor (mCAR) alleviates type 2 diabetes and obesity by inhibiting hepatic gluconeogenesis, lipogenesis, and fatty acid synthesis. However, the role of human (h) CAR in energy metabolism is largely unknown. The present study aims to investigate the effects of selective hCAR activators on hepatic energy metabolism in human primary hepatocytes (HPH). Methods: Ligand-based structure–activity models were used for virtual screening of the Specs database ( (www.specs.net)) followed by biological validation in cell-based luciferase assays. The effects of two novel hCAR activators (UM104 and UM145) on hepatic energy metabolism were evaluated in HPH. Results: Real-time PCR and Western blotting analyses reveal that activation of hCAR by UM104 and UM145 significantly repressed the expression of glucose-6-phosphatase and phosphoenolpyruvate carboxykinase, two pivotal gluconeogenic enzymes, while exerting negligible effects on the expression of genes associated with lipogenesis and fatty acid synthesis. Functional experiments show that UM104 and UM145 markedly inhibit hepatic synthesis of glucose but not triglycerides in HPH. In contrast, activation of mCAR by 1,4-bis[2-(3,5-dichloropyridyloxy)]benzene, a selective mCAR activator, repressed the expression of genes associated with gluconeogenesis, lipogenesis, and fatty acid synthesis in mouse primary hepatocytes, which were consistent with previous observations in mouse model in vivo. Conclusion: Our findings uncover an important species difference between hCAR and mCAR in hepatic energy metabolism, where hCAR selectively inhibits gluconeogenesis without suppressing fatty acid synthesis. Implications: Such species selectivity should be considered when exploring CAR as a potential therapeutic target for metabolic disorders. - Highlights: • Novel hCAR activators were identified by computational and biological approaches. • The role

  15. A novel efficient enzyme-immobilization reaction on NH2 polymers by means of L-ascorbic acid.

    PubMed

    Tiller, J; Berlin, P; Klemm, D

    1999-10-01

    A new enzyme-immobilization reaction by means of L-ascorbic acid (ASA) is described using NH(2) polymers based on cellulose or poly(vinyl alcohol) with the example of oxidoreductase enzymes. In this way, enzyme proteins such as glucose oxidase (GOD), glutamate oxidase, lactate oxidase, urate oxidase and peroxidase can be covalently fixed with a high surface loading to ultrathin and transparent NH(2)-polymer films if their surfaces are previously treated with an ASA solution, in, for example, N,N-dimethyl acetamide, DMSO or methanol. ASA then obviously reacts like a diketo compound with amino groups of the NH(2)-polymer film and enzyme protein, forming dehydroascorbic acid derivatives with neighbouring Schiff's-base structures. In a subsequent fragmentation reaction, the latter presumably form stable oxalic acid diamide derivatives as coupling structures between enzyme protein and NH(2)-polymer film, as suggested by results from investigations of the ASA reaction with n-butylamine. The immobilized enzymes can be stored at 4 degrees C in bidistilled water for at least 1 month without becoming detached from the NH(2)-polymer film and without diminished enzyme activity. The apparent K(m) values of the immobilized enzymes are in part clearly smaller than those of the dissolved enzymes or those found in other immobilization processes such as the diazo coupling or the bifunctional glutardialdehyde reaction. For example, the K(m) value of the immobilized GOD with different NH(2) polymers as the matrix structure is smaller by a factor of approx. 20 than that of the dissolved enzyme. PMID:10512795

  16. Prediction of Thermostability from Amino Acid Attributes by Combination of Clustering with Attribute Weighting: A New Vista in Engineering Enzymes

    PubMed Central

    Ebrahimi, Mansour; Lakizadeh, Amir; Agha-Golzadeh, Parisa; Ebrahimie, Esmaeil; Ebrahimi, Mahdi

    2011-01-01

    The engineering of thermostable enzymes is receiving increased attention. The paper, detergent, and biofuel industries, in particular, seek to use environmentally friendly enzymes instead of toxic chlorine chemicals. Enzymes typically function at temperatures below 60°C and denature if exposed to higher temperatures. In contrast, a small portion of enzymes can withstand higher temperatures as a result of various structural adaptations. Understanding the protein attributes that are involved in this adaptation is the first step toward engineering thermostable enzymes. We employed various supervised and unsupervised machine learning algorithms as well as attribute weighting approaches to find amino acid composition attributes that contribute to enzyme thermostability. Specifically, we compared two groups of enzymes: mesostable and thermostable enzymes. Furthermore, a combination of attribute weighting with supervised and unsupervised clustering algorithms was used for prediction and modelling of protein thermostability from amino acid composition properties. Mining a large number of protein sequences (2090) through a variety of machine learning algorithms, which were based on the analysis of more than 800 amino acid attributes, increased the accuracy of this study. Moreover, these models were successful in predicting thermostability from the primary structure of proteins. The results showed that expectation maximization clustering in combination with uncertainly and correlation attribute weighting algorithms can effectively (100%) classify thermostable and mesostable proteins. Seventy per cent of the weighting methods selected Gln content and frequency of hydrophilic residues as the most important protein attributes. On the dipeptide level, the frequency of Asn-Glu was the key factor in distinguishing mesostable from thermostable enzymes. This study demonstrates the feasibility of predicting thermostability irrespective of sequence similarity and will serve as a

  17. A study of ozone-induced edema in the isolated rat lung in relation to arachidonic acid metabolism, mixed-function oxidases and angiotensin converting enzyme activities.

    PubMed

    Dutta, S; Chatterjee, M; Teknos, T N; Carlson, R W

    1990-01-01

    In order to elucidate the role of arachidonic acid in the pathogenesis of ozone-induced pulmonary edema, isolated rat lungs were exposed to 14C-arachidonic acid in the presence or absence of ozone and the incorporation of radiolabelled arachidonate into pulmonary cell lipids was studied. The perfusates from these studies were also subjected to differential extraction and thin layer chromatography (t.l.c.) to determine synthesis of both cyclo-oxygenase and lipoxygenase products. In the presence of an edemagenic concentration of ozone, isolated lungs incorporated significantly less exogenous arachidonic acid into phosphatidyl choline and phosphatidyl ethanolamine, whereas incorporation into phosphatidyl inositol or serine was not affected. The edemagenic concentration of ozone also increased production of a variety of arachidonic acid metabolites via cyclo-oxygenase and lipoxygenase pathways. In separate studies, a similar ozone exposure did not affect 14CO2 production, resulting from the metabolism of 14C-antipyrine by mixed function oxidases (MFO). Similarly, an edemagenic concentration of ozone did not affect pulmonary angiotensin converting enzyme activity (ACE) as determined by the rate of formation of 14C-hippuric acid from 14C-hippuryl-histidyl-leucine (14C-HHL). Thus, acute ozone exposure is specifically associated with a reduced incorporation of arachidonate into phospholipids and with an increased conversion of arachidonate into bio-active metabolites.

  18. Thioacetic acid/NaSH-mediated synthesis of N-protected amino thioacids and their utility in peptide synthesis.

    PubMed

    Mali, Sachitanand M; Gopi, Hosahudya N

    2014-03-21

    Thioacids are recently gaining momentum due to their versatile reactivity. The reactivity of thioacids has been widely explored in the selective amide/peptide bond formation. Thioacids are generally synthesized from the reaction between activated carboxylic acids such as acid chlorides, active esters, etc., and Na2S, H2S, or NaSH. We sought to investigate whether the versatile reactivity of the thioacids can be tuned for the conversion of carboxylic acids into corresponding thioacids in the presence of NaSH. Herein, we report that thioacetic acid- and NaSH-mediated synthesis of N-protected amino thioacids from the corresponding N-protected amino acids, oxidative dimerization of thioacids, crystal conformations of thioacid oxidative dimers, and the utility of thioacids and oxidative dimers in peptide synthesis. Our results suggest that peptides can be synthesized without using standard coupling agents.

  19. Development of a solid-phase enzyme immunoassay for ursodeoxycholic acid: application to plasma disappearance of injected ursodeoxycholic acid in the rabbit.

    PubMed

    Maeda, Y; Setoguchi, T; Katsuki, T; Ishikawa, E

    1979-11-01

    A bile acid disappearance test using an enzyme immunoassay for ursodeoxycholic acid (UDCA) is presented. The immunoassay employs an antiserum produced in rabbits with UDCA coupled by amide linkage to egg albumin. An antigen (UDCA)-enzyme (beta-D-galactosidase) complex was prepared by adding the N-hydroxy-succinimide ester of UDCA to beta-D-galactosidase in a molar ratio of 5000:1. The anti-UDCA serum was coupled to glass beads and a competitive reaction between bile acids and UDCA coupled to the enzyme on the glass beads was measured by determining enzyme activity. One bead was used for each test tube. Thus it was convenient to wash and transfer the bead to a fresh test tube after incubation. The procedure requires 2.5 hr at 30 degrees C for the competitive reaction and enzyme assay. Using a 1:100 dilution of anti-serum, the intensity of fluorescence of 4-methylumbelliferone produced from 4-methylumbelliferyl-beta-D-galactoside by the enzyme decreased linearly with a logarithmic increase of UDCA concentration over a range of from 0.1 to 10 pmnd taurine conjugates, and good recovery data were obtained. The development of the enzyme immunoassay using glass beads shortens analysis time; furthermore, the method makes it possible to detect obstructive jaundice in rabbits before the serum bilirubin level is elevated.

  20. Oriented and selective enzyme immobilization on functionalized silica carrier using the cationic binding module Z basic2: design of a heterogeneous D-amino acid oxidase catalyst on porous glass.

    PubMed

    Bolivar, Juan M; Nidetzky, Bernd

    2012-06-01

    D-amino acid oxidase from Trigonopsis variabilis (TvDAO) is applied in industry for the synthesis of pharmaceutical intermediates. Because free TvDAO is extremely sensitive to exposure to gas-liquid interfaces, biocatalytic processing is usually performed with enzyme immobilizates that offer enhanced stability under bubble aeration. We herein present an "Immobilization by Design" approach that exploits engineered charge complementarity between enzyme and carrier to optimize key features of the immobilization of TvDAO. A fusion protein between TvDAO and the positively charged module Z(basic2) was generated, and a corresponding oppositely charged carrier was obtained by derivatization of mesoporous glass with 3-(trihydroxysilyl)-1-propane-sulfonic acid. Using 250 mM NaCl for charge screening at pH 7.0, the Z(basic2) fusion of TvDAO was immobilized directly from E. coli cell extract with almost absolute selectivity and full retention of catalytic effectiveness of the isolated enzyme in solution. Attachment of the homodimeric enzyme to the carrier was quasi-permanent in low-salt buffer but fully reversible upon elution with 5 M NaCl. Immobilized TvDAO was not sensitive to bubble aeration and received substantial (≥ tenfold) stabilization of the activity at 45°C as compared to free enzyme, suggesting immobilization via multisubunit oriented interaction of enzyme with the insoluble carrier. The Z(basic2) enzyme immobilizate was demonstrated to serve as re-usable heterogeneous catalyst for D-amino acid oxidation. Z(basic2) -mediated binding on a sulfonic acid group-containing glass carrier constitutes a generally useful strategy of enzyme immobilization that supports transition from case-specific empirical development to rational design.

  1. Enzyme-mimetic effects of gold@platinum nanorods on the antioxidant activity of ascorbic acid

    NASA Astrophysics Data System (ADS)

    Zhou, Yu-Ting; He, Weiwei; Wamer, Wayne G.; Hu, Xiaona; Wu, Xiaochun; Lo, Y. Martin; Yin, Jun-Jie

    2013-01-01

    Au@Pt nanorods were prepared by growing platinum nanodots on gold nanorods. Using electron spin resonance (ESR), we determined that the mechanisms for oxidation of ascorbic acid (AA) by Au@Pt nanorods and ascorbic acid oxidase (AAO) were kinetically similar and yielded similar products. In addition we observed that Au@Pt nanorods were stable with respect to temperature and pH. Using UV-VIS spectroscopy, the apparent kinetics of enzyme-mimetic activity of Au@Pt nanorods were studied and compared with the activity of AAO. With the help of ESR, we found that Au@Pt nanorods did not scavenge hydroxyl radicals but inhibited the antioxidant ability of AA for scavenging hydroxyl radicals produced by photoirradiating solutions containing titanium dioxide and zinc oxide. Moreover, the Au@Pt nanorods reduced the ability of AA to scavenge DPPH radicals and superoxide radicals. These results demonstrate that Au@Pt nanorods can reduce the antioxidant activity of AA. Therefore, it is necessary to consider the effects of using Pt nanoparticles together with other reducing agents or antioxidants such as AA due to the oxidase-like property of Au@Pt nanorods.Au@Pt nanorods were prepared by growing platinum nanodots on gold nanorods. Using electron spin resonance (ESR), we determined that the mechanisms for oxidation of ascorbic acid (AA) by Au@Pt nanorods and ascorbic acid oxidase (AAO) were kinetically similar and yielded similar products. In addition we observed that Au@Pt nanorods were stable with respect to temperature and pH. Using UV-VIS spectroscopy, the apparent kinetics of enzyme-mimetic activity of Au@Pt nanorods were studied and compared with the activity of AAO. With the help of ESR, we found that Au@Pt nanorods did not scavenge hydroxyl radicals but inhibited the antioxidant ability of AA for scavenging hydroxyl radicals produced by photoirradiating solutions containing titanium dioxide and zinc oxide. Moreover, the Au@Pt nanorods reduced the ability of AA to scavenge

  2. Selective synthesis of 3-hydroxy acids from Meldrum's acids using SmI2-H2O.

    PubMed

    Szostak, Michal; Spain, Malcolm; Procter, David J

    2012-05-01

    The single-step synthesis of 3-hydroxy carboxylic acids from readily available Meldrum's acids involves a selective monoreduction using a SmI(2)-H(2)O complex to give products in high crude purity, and it represents a considerable advancement over other methods for the synthesis of 3-hydroxy acids. The protocol includes a detailed guide to the preparation of a single electron-reducing SmI(2)-H(2)O complex and describes two representative examples of the methodology: monoreduction of a fully saturated Meldrum's acid (5-(4-bromobenzyl)-2,2-dimethyl-1,3-dioxane-4,6-dione) and tandem conjugate reduction-selective monoreduction of α,β-unsaturated Meldrum's acid (5-(4-methoxybenzylidene)-2,2-dimethyl-1,3-dioxane-4,6-dione). The protocol for selective monoreduction of Meldrum's acids takes ∼6 h to complete. PMID:22538848

  3. Single-Cell Measurements of Enzyme Levels as a Predictive Tool for Cellular Fates during Organic Acid Production

    PubMed Central

    Zdraljevic, Stefan; Wagner, Drew; Cheng, Kevin; Ruohonen, Laura; Jäntti, Jussi; Penttilä, Merja; Resnekov, Orna

    2013-01-01

    Organic acids derived from engineered microbes can replace fossil-derived chemicals in many applications. Fungal hosts are preferred for organic acid production because they tolerate lignocellulosic hydrolysates and low pH, allowing e