Hashimoto, F; Taira, S; Hayashi, H
1998-11-01
We studied whether the peroxisomal proliferation, induction of 3-hydroxy-3-methylglutaryl-CoA reductase (HMG-CoA reductase) and activation of cholesterol synthesis by gemfibrozil shown in whole body (Hashimoto F., Ishikawa T., Hamada S. and Hayashi H., Biochemical. Pharm., 49, 1213-1221 (1995)) is also detected at a culture cell level, and we made a comparative analysis of the effects of clofibric acid. Gemfibrozil at 0.25 mM increased the activity of some peroxisomal enzymes (catalase and the cyanide-insensitive fatty acyl-CoA oxidizing system) after incubation for 72 h. However, contrary to whole body experiments, gemfibrozil decreased the activity of HMG-CoA reductase and cholesterol synthesis from [14C]acetate. At 1 mM, gemfibrozil decreased not only the activity of HMG-CoA reductase and cholesterol synthesis, but also the protein content of the cells and peroxisomal enzyme activity, indicating nonspecific inhibition at this concentration. Clofibric acid (0.25 and 1 mM) increased the activity of peroxisomal enzymes, but decreased the activity of HMG-CoA reductase and cholesterol synthesis. With respect to the direct effect on HMG-CoA reductase in the cell homogenate, gemfibrozil at 0.25 mm did not affect the activity, but it clearly inhibited the activity at 2 mM and above. Clofibric acid at 2 mM hardly affected the activity, but it clearly decreased the activity at 5 mM and over. That is, gemfibrozil directly inhibited the activity more strongly than clofibric acid. The direct inhibition of the enzyme itself required higher concentrations of both agents than did inhibition at the culture cell level. These results suggest that the cytotoxicity of gemfibrozil is greater than that of clofibric acid, and that gemfibrozil, as well as clofibric acid, can induce peroxisomal enzymes in the culture cell level. In contrast to whole body results, gemfibrozil may suppress cholesterol synthesis from [14C]acetate through the inhibition of HMG-CoA reductase at the culture
Lindner, Scott E.; Sartain, Mark J.; Hayes, Kiera; Harupa, Anke; Moritz, Robert L.; Kappe, Stefan H. I.; Vaughan, Ashley M.
2014-01-01
SUMMARY Malaria parasites scavenge nutrients from their host but also harbor enzymatic pathways for de novo macromolecule synthesis. One such pathway is apicoplast-targeted type II fatty acid synthesis, which is essential for late liver stage development in rodent malaria. It is likely that fatty acids synthesized in the apicoplast are ultimately incorporated into membrane phospholipids necessary for exoerythrocytic merozoite formation. We hypothesized that these synthesized fatty acids are being utilized for apicoplast-targeted phosphatidic acid synthesis, the phospholipid precursor. Phosphatidic acid is typically synthesized in a three-step reaction utilizing three enzymes: glycerol 3-phosphate dehydrogenase, glycerol 3-phosphate acyltransferase and lysophosphatidic acid acyltransferase. The Plasmodium genome is predicted to harbor genes for both apicoplast- and cytosol/endoplasmic reticulum-targeted phosphatidic synthesis. Our research shows that apicoplast-targeted P. yoelii glycerol 3-phosphate dehydrogenase and glycerol 3-phosphate acyltransferase are expressed only during liver stage development and deletion of the encoding genes resulted in late liver stage growth arrest and lack of merozoite differentiation. However, the predicted apicoplast-targeted lysophosphatidic acid acyltransferase gene was refractory to deletion and was expressed solely in the endoplasmic reticulum throughout the parasite lifecycle. Our results suggest that P. yoelii has an incomplete apicoplast-targeted phosphatidic acid synthesis pathway that is essential for liver stage maturation. PMID:24330260
Lindner, Scott E; Sartain, Mark J; Hayes, Kiera; Harupa, Anke; Moritz, Robert L; Kappe, Stefan H I; Vaughan, Ashley M
2014-02-01
Malaria parasites scavenge nutrients from their host but also harbour enzymatic pathways for de novo macromolecule synthesis. One such pathway is apicoplast-targeted type II fatty acid synthesis, which is essential for late liver-stage development in rodent malaria. It is likely that fatty acids synthesized in the apicoplast are ultimately incorporated into membrane phospholipids necessary for exoerythrocytic merozoite formation. We hypothesized that these synthesized fatty acids are being utilized for apicoplast-targeted phosphatidic acid synthesis, the phospholipid precursor. Phosphatidic acid is typically synthesized in a three-step reaction utilizing three enzymes: glycerol 3-phosphate dehydrogenase, glycerol 3-phosphate acyltransferase and lysophosphatidic acid acyltransferase. The Plasmodium genome is predicted to harbour genes for both apicoplast- and cytosol/endoplasmic reticulum-targeted phosphatidic acid synthesis. Our research shows that apicoplast-targeted Plasmodium yoelii glycerol 3-phosphate dehydrogenase and glycerol 3-phosphate acyltransferase are expressed only during liver-stage development and deletion of the encoding genes resulted in late liver-stage growth arrest and lack of merozoite differentiation. However, the predicted apicoplast-targeted lysophosphatidic acid acyltransferase gene was refractory to deletion and was expressed solely in the endoplasmic reticulum throughout the parasite life cycle. Our results suggest that P. yoelii has an incomplete apicoplast-targeted phosphatidic acid synthesis pathway that is essential for liver-stage maturation. © 2013 John Wiley & Sons Ltd.
Campeotto, Ivan; Percy, Matthew G.; MacDonald, James T.; Förster, Andreas; Freemont, Paul S.; Gründling, Angelika
2014-01-01
Lipoteichoic acid (LTA) is an important cell wall component required for proper cell growth in many Gram-positive bacteria. In Listeria monocytogenes, two enzymes are required for the synthesis of this polyglycerolphosphate polymer. The LTA primase LtaPLm initiates LTA synthesis by transferring the first glycerolphosphate (GroP) subunit onto the glycolipid anchor and the LTA synthase LtaSLm extends the polymer by the repeated addition of GroP subunits to the tip of the growing chain. Here, we present the crystal structures of the enzymatic domains of LtaPLm and LtaSLm. Although the enzymes share the same fold, substantial differences in the cavity of the catalytic site and surface charge distribution contribute to enzyme specialization. The eLtaSLm structure was also determined in complex with GroP revealing a second GroP binding site. Mutational analysis confirmed an essential function for this binding site and allowed us to propose a model for the binding of the growing chain. PMID:25128528
Tücking, Katrin-Stephanie; Grützner, Verena; Unger, Ronald E; Schönherr, Holger
2015-07-01
The synthesis of novel amphiphilic hyaluronic acid (HYA) and poly(lactic acid) (PLA) block copolymers is reported as the key element of a strategy to detect the presence of pathogenic bacterial enzymes. In addition to the formation of defined HYA-block-PLA assemblies, the encapsulation of fluorescent reporter dyes and the selective enzymatic degradation of the capsules by hyaluronidase and proteinase K are studied. The synthesis of the dual enzyme-responsive HYA-b-PLA is carried out by copper-catalyzed Huisgen 1,3-dipolar cycloaddition. The resulting copolymers are assembled in water to form vesicular structures, which are characterized by scanning electron microscopy, transmission electron microscopy, dynamic light scattering (DLS), and fluorescence lifetime imaging microscopy (FLIM). DLS measurements show that both enzymes cause a rapid decrease in the hydrodynamic diameter of the nanocapsules. Fluorescence spectroscopy data confirm the liberation of encapsulated dye, which indicates the disintegration of the capsules and validates the concept of enzymatically triggered payload release. Finally, cytotoxicity assays confirm that the HYA-b-PLA nanocapsules are biocompatible with primary human dermal microvascular endothelial cells. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Dulermo, Thierry; Lazar, Zbigniew; Dulermo, Rémi; Rakicka, Magdalena; Haddouche, Ramedane; Nicaud, Jean-Marc
2015-09-01
The role of the two key enzymes of fatty acid (FA) synthesis, ATP-citrate lyase (Acl) and malic enzyme (Mae), was analyzed in the oleaginous yeast Yarrowia lipolytica. In most oleaginous yeasts, Acl and Mae are proposed to provide, respectively, acetyl-CoA and NADPH for FA synthesis. Acl was mainly studied at the biochemical level but no strain depleted for this enzyme was analyzed in oleaginous microorganisms. On the other hand the role of Mae in FA synthesis in Y. lipolytica remains unclear since it was proposed to be a mitochondrial NAD(H)-dependent enzyme and not a cytosolic NADP(H)-dependent enzyme. In this study, we analyzed for the first time strains inactivated for corresponding genes. Inactivation of ACL1 decreases FA synthesis by 60 to 80%, confirming its essential role in FA synthesis in Y. lipolytica. Conversely, inactivation of MAE1 has no effects on FA synthesis, except in a FA overaccumulating strain where it improves FA synthesis by 35%. This result definitively excludes Mae as a major key enzyme for FA synthesis in Y. lipolytica. During the analysis of both mutants, we observed a negative correlation between FA and mannitol level. As mannitol and FA pathways may compete for carbon storage, we inactivated YlSDR, encoding a mannitol dehydrogenase converting fructose and NADPH into mannitol and NADP+. The FA content of the resulting mutant was improved by 60% during growth on fructose, demonstrating that mannitol metabolism may modulate FA synthesis in Y. lipolytica. Copyright © 2015. Published by Elsevier B.V.
Autio, Kaija J; Schmitz, Werner; Nair, Remya R; Selkälä, Eija M; Sormunen, Raija T; Miinalainen, Ilkka J; Crick, Peter J; Wang, Yuqin; Griffiths, William J; Reddy, Janardan K; Baes, Myriam; Hiltunen, J Kalervo
2014-07-01
Cholesterol is catabolized to bile acids by peroxisomal β-oxidation in which the side chain of C27-bile acid intermediates is shortened by three carbon atoms to form mature C24-bile acids. Knockout mouse models deficient in AMACR (α-methylacyl-CoA racemase) or MFE-2 (peroxisomal multifunctional enzyme type 2), in which this β-oxidation pathway is prevented, display a residual C24-bile acid pool which, although greatly reduced, implies the existence of alternative pathways of bile acid synthesis. One alternative pathway could involve Mfe-1 (peroxisomal multifunctional enzyme type 1) either with or without Amacr. To test this hypothesis, we generated a double knockout mouse model lacking both Amacr and Mfe-1 activities and studied the bile acid profiles in wild-type, Mfe-1 and Amacr single knockout mouse line and Mfe-1 and Amacr double knockout mouse lines. The total bile acid pool was decreased in Mfe-1-/- mice compared with wild-type and the levels of mature C24-bile acids were reduced in the double knockout mice when compared with Amacr-deficient mice. These results indicate that Mfe-1 can contribute to the synthesis of mature bile acids in both Amacr-dependent and Amacr-independent pathways.
Enzymic synthesis of indole-3-acetyl-1-O-beta-d-glucose. II. Metabolic characteristics of the enzyme
NASA Technical Reports Server (NTRS)
Leznicki, A. J.; Bandurski, R. S.
1988-01-01
The synthesis of indole-3-acetyl-1-O-beta-D-glucose from indole-3-acetic acid (IAA) and uridine diphosphoglucose (UDPG) has been shown to be a reversible reaction with the equilibrium away from ester formation and toward formation of IAA. The enzyme occurs primarily in the liquid endosperm of the corn kernel but some activity occurs in the embryo. It is relatively specific showing no glucose ester formation with oxindole-3-acetic acid or 7-hydroxy-oxindole-3-acetic acid, and low activity with phenylpropene acids, such as rho-coumaric acid. The enzyme is also specific for the nucleotide sugar showing no activity with UDPGalactose or UDPXylose. The enzyme is inhibited by inorganic pyrophosphate, by phosphate esters and by phospholipids, particularly phosphatidyl ethanolamine. The enzyme is inhibited by zeatin, by 2,4-dichlorophenoxy-acetic acid, by IAA-myo-inositol and IAA-glucan, but not by zeatin riboside, and only weakly by gibberellic acid, abscisic acid and kinetin. The reaction is slightly stimulated by both calcium and calmodulin and, in some cases, by thiol compounds. The role of this enzyme in the homeostatic control of indole-3-acetic acid levels in Zea mays is discussed.
The synthesis of glutamic acid in the absence of enzymes: Implications for biogenesis
NASA Technical Reports Server (NTRS)
Morowitz, Harold; Peterson, Eta; Chang, Sherwood
1995-01-01
This paper reports on the non-enzymatic aqueous phase synthesis of amino acids from keto acids, ammonia and reducing agents. The facile synthesis of key metabolic intermediates, particularly in the glycolytic pathway, the citric acid cycle, and the first step of amino acid synthesis, lead to new ways of looking at the problem of biogenesis.
Energetics of amino acid synthesis in hydrothermal ecosystems
NASA Technical Reports Server (NTRS)
Amend, J. P.; Shock, E. L.
1998-01-01
Thermodynamic calculations showed that the autotrophic synthesis of all 20 protein-forming amino acids was energetically favored in hot (100 degrees C), moderately reduced, submarine hydrothermal solutions relative to the synthesis in cold (18 degrees C), oxidized, surface seawater. The net synthesis reactions of 11 amino acids were exergonic in the hydrothermal solution, but all were endergonic in surface seawater. The synthesis of the requisite amino acids of nine thermophilic and hyperthermophilic proteins in a 100 degreesC hydrothermal solution yielded between 600 and 8000 kilojoules per mole of protein, which is energy that is available to drive the intracellular synthesis of enzymes and other biopolymers in hyperthermophiles thriving in these ecosystems.
Enzymic Synthesis of Indole-3-Acetyl-1-O-β-d-Glucose 1
Leznicki, Antoni J.; Bandurski, Robert S.
1988-01-01
The synthesis of indole-3-acetyl-1-O-β-d-glucose from indole-3-acetic acid (IAA) and uridine diphosphoglucose (UDPG) has been shown to be a reversible reaction with the equilibrium away from ester formation and toward formation of IAA. The enzyme occurs primarily in the liquid endosperm of the corn kernel but some activity occurs in the embryo. It is relatively specific showing no glucose ester formation with oxindole-3-acetic acid or 7-hydroxy-oxindole-3-acetic acid, and low activity with phenylpropene acids, such as ρ-coumaric acid. The enzyme is also specific for the nucleotide sugar showing no activity with UDPGalactose or UDPXylose. The enzyme is inhibited by inorganic pyrophosphate, by phosphate esters and by phospholipids, particularly phosphatidyl ethanolamine. The enzyme is inhibited by zeatin, by 2,4-dichlorophenoxy-acetic acid, by IAA-myo-inositol and IAA-glucan, but not by zeatin riboside, and only weakly by gibberellic acid, abscisic acid, and kinetin. The reaction is slightly stimulated by both calcium and calmodulin and, in some cases, by thiol compounds. The role of this enzyme in the homeostatic control of indole-3-acetic acid levels in Zea mays is discussed. PMID:11537439
Manandhar, Miglena; Cronan, John E
2017-05-01
Biotin synthetic pathways are readily separated into two stages, synthesis of the seven carbon α, ω-dicarboxylic acid pimelate moiety and assembly of the fused heterocyclic rings. The biotin pathway genes responsible for pimelate moiety synthesis vary widely among bacteria whereas the ring synthesis genes are highly conserved. Bacillus subtilis seems to have redundant genes, bioI and bioW, for generation of the pimelate intermediate. Largely consistent with previous genetic studies it was found that deletion of bioW caused a biotin auxotrophic phenotype whereas deletion of bioI did not. BioW is a pimeloyl-CoA synthetase that converts pimelic acid to pimeloyl-CoA. The essentiality of BioW for biotin synthesis indicates that the free form of pimelic acid is an intermediate in biotin synthesis although this is not the case in E. coli. Since the origin of pimelic acid in Bacillus subtilis is unknown, 13 C-NMR studies were carried out to decipher the pathway for its generation. The data provided evidence for the role of free pimelate in biotin synthesis and the involvement of fatty acid synthesis in pimelate production. Cerulenin, an inhibitor of the key fatty acid elongation enzyme, FabF, markedly decreased biotin production by B. subtilis resting cells whereas a strain having a cerulenin-resistant FabF mutant produced more biotin. In addition, supplementation with pimelic acid fully restored biotin production in cerulenin-treated cells. These results indicate that pimelic acid originating from fatty acid synthesis pathway is a bona fide precursor of biotin in B. subtilis. © 2017 John Wiley & Sons Ltd.
Production of 5-aminolevulinic acid by cell free multi-enzyme catalysis.
Meng, Qinglong; Zhang, Yanfei; Ju, Xiaozhi; Ma, Chunling; Ma, Hongwu; Chen, Jiuzhou; Zheng, Ping; Sun, Jibin; Zhu, Jun; Ma, Yanhe; Zhao, Xueming; Chen, Tao
2016-05-20
5-Aminolevulinic acid (ALA) is the precursor for the biosynthesis of tetrapyrroles and has broad agricultural and medical applications. Currently ALA is mainly produced by chemical synthesis and microbial fermentation. Cell free multi-enzyme catalysis is a promising method for producing high value chemicals. Here we reported our work on developing a cell free process for ALA production using thermostable enzymes. Cheap substrates (succinate and glycine) were used for ALA synthesis by two enzymes: 5-aminolevulinic acid synthase (ALAS) from Laceyella sacchari (LS-ALAS) and succinyl-CoA synthase (Suc) from Escherichia coli. ATP was regenerated by polyphosphate kinase (Ppk) using polyphosphate as the substrate. Succinate was added into the reaction system in a fed-batch mode to avoid its inhibition effect on Suc. After reaction for 160min, ALA concentration was increased to 5.4mM. This is the first reported work on developing the cell free process for ALA production. Through further process and enzyme optimization the cell free process could be an effective and economic way for ALA production. Copyright © 2016 Elsevier B.V. All rights reserved.
Transaminases for the synthesis of enantiopure beta-amino acids
2012-01-01
Optically pure β-amino acids constitute interesting building blocks for peptidomimetics and a great variety of pharmaceutically important compounds. Their efficient synthesis still poses a major challenge. Transaminases (also known as aminotransferases) possess a great potential for the synthesis of optically pure β-amino acids. These pyridoxal 5'-dependent enzymes catalyze the transfer of an amino group from a donor substrate to an acceptor, thus enabling the synthesis of a wide variety of chiral amines and amino acids. Transaminases can be applied either for the kinetic resolution of racemic compounds or the asymmetric synthesis starting from a prochiral substrate. This review gives an overview over microbial transaminases with activity towards β-amino acids and their substrate spectra. It also outlines current strategies for the screening of new biocatalysts. Particular emphasis is placed on activity assays which are applicable to high-throughput screening. PMID:22293122
Mostafa, N; Everett, D C; Chou, S C; Kong, P A; Florant, G L; Coleman, R A
1993-01-01
Fatty acid metabolism and triacylglycerol synthesis are critical processes for the survival of hibernating mammals that undergo a prolonged fasting period. Fatty acid synthase, fatty-acid-CoA ligase, diacylglycerol acyltransferase, and monoacylglycerol acyltransferase activities were measured in liver and in white and brown adipose tissue, in order to determine whether enzymes of lipogenesis and triacylglycerol synthesis vary seasonally during hibernation in the yellow-bellied marmot (Marmota flaviventris). Compared with mid-winter hibernation, fatty acid synthase activity was higher in all three tissues during early spring when marmots emerged from hibernation and in mid-summer when they were feeding, consistent with the synthesis of fatty acids from the carbohydrate-rich summer diet. Fatty-acid-CoA ligase and diacylglycerol acyltransferase activities were highest in summer in white adipose tissue when triacylglycerol synthesis would be expected to be high; diacylglycerol acyltransferase activity was also high in brown adipose tissue during spring and summer. In liver, however, diacylglycerol acyltransferase specific activity was highest during hibernation, suggesting that triacylglycerol synthesis may be prominent in liver in winter. Monoacylglycerol acyltransferase activity, which may aid in the retention of essential fatty-acids, was 80-fold higher in liver than in white or brown adipose tissue, but did not vary seasonally. Its dependence on palmitoyl-CoA suggests that a divalent cation might play a role in enzyme activation. The high hepatic diacylglycerol acyltransferase activity during hibernation suggests that the metabolism of very low density lipoprotein may be important in the movement of adipose fatty acids to brown adipose tissue and muscle during the rewarming that occurs periodically during hibernation.(ABSTRACT TRUNCATED AT 250 WORDS)
Phosphatidic Acid Synthesis in Bacteria
Yao, Jiangwei; Rock, Charles O.
2012-01-01
Membrane phospholipid synthesis is a vital facet of bacterial physiology. Although the spectrum of phospholipid headgroup structures produced by bacteria is large, the key precursor to all of these molecules is phosphatidic acid (PtdOH). Glycerol-3-phosphate derived from the glycolysis via glycerol-phosphate synthase is the universal source for the glycerol backbone of PtdOH. There are two distinct families of enzymes responsible for the acylation of the 1-position of glycerol-3-phosphate. The PlsB acyltransferase was discovered in Escherichia coli, and homologs are present in many eukaryotes. This protein family primarily uses acyl-acyl carrier protein (ACP) endproducts of fatty acid synthesis as acyl donors, but may also use acyl-CoA derived from exogenous fatty acids. The second protein family, PlsY, is more widely distributed in bacteria and utilizes the unique acyl donor, acyl-phosphate, which is produced from acyl-ACP by the enzyme PlsX. The acylation of the 2-position is carried out by members of the PlsC protein family. All PlsCs use acyl-ACP as the acyl donor, although the PlsCs of the γ-proteobacteria also may use acyl-CoA. Phospholipid headgroups are precursors in the biosynthesis of other membrane-associated molecules and the diacylglycerol product of these reactions is converted to PtdOH by one of two distinct families of lipid kinases. The central importance of the de novo and recycling pathways to PtdOH in cell physiology suggest these enzymes are suitable targets for the development of antibacterial therapeutics in Gram-positive pathogens. This article is part of a Special Issue entitled Phospholipids and Phospholipid Metabolism. PMID:22981714
Schütt, Burkhardt Siegfried; Abbadi, Amine; Loddenkötter, Brigitte; Brummel, Monika; Spener, Friedrich
2002-09-01
With the aim of elucidating the mechanisms involved in the biosynthesis of medium-chain fatty acids in Cuphea lanceolata Ait., a crop accumulating up to 90% decanoic acid in seed triacylglycerols, cDNA clones of a beta-ketoacyl-acyl carrier protein (ACP) synthase IV (clKAS IV, EC 2.3.1.41) were isolated from C. lanceolata seed embryos. The amino acid sequence deduced from clKAS IV cDNA showed 80% identity to other plant KAS II-type enzymes, 55% identity towards plant KAS I and over 90% towards other Cuphea KAS IV-type sequences. Recombinant clKAS IV was functionally overexpressed in Escherichia coli, and substrate specificity of purified enzyme showed strong preference for elongation of short-chain and medium-chain acyl-ACPs (C4- to C10-ACP) with nearly equal activity. Further elongation steps were catalysed with distinctly less activity. Moreover, short- and medium-chain acyl-ACPs exerted a chain-length-specific and concentration-dependent substrate inhibition of clKAS IV. Based on these findings a regulatory mechanism for medium-chain fatty acid synthesis in C. lanceolata is presented.
Chronic ethanol feeding modulates the synthesis of digestive enzymes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ponnappa, B.C.; Hoek, J.B.; Rubin, E.
1987-05-01
The effects of chronic ethanol feeding on pancreatic protein synthesis were investigated. Protein synthesis was assessed by studying the rate of incorporation of /sup 3/H-leucine into TCA-precipitable proteins in isolated pancreatic acini from rats. Chronic ethanol ingestion increased the rate of pancreatic protein synthesis by 2-4 fold. The onset of the increase in protein synthesis was detectable two days after ethanol feeding, reached a maximum after 7 days and remained unchanged after 4 months on the ethanol-containing diet. The rate of synthesis of individual digestive enzymes was studied by SDS-PAGE on extracts obtained from purified zymogen granules. Ethanol feeding inducedmore » an increase in the rate of synthesis of most of the digestive enzymes; chymotrypsinogen, trypsinogen and an unidentified protein were increased to a greater extent than other digestive enzymes. By contrast, the synthesis of amylase was selectively decreased after ethanol feeding. These results suggest that chronic ethanol ingestion has specific effects on the rate of synthesis of individual digestive enzymes in the exocrine pancreas.« less
Biotin and Lipoic Acid: Synthesis, Attachment and Regulation
Cronan, John E.
2014-01-01
Summary Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as “swinging arms” that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well-described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like “arm” of biotin were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise and the BioH esterase for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl-ACP of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyl transferase followed by sulfur insertion at carbons C6 and C8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized and thus there is no transcriptional control of the synthetic genes. In contrast transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system, exerted through BirA a dual function protein that both represses
Distribution, industrial applications, and enzymatic synthesis of D-amino acids.
Gao, Xiuzhen; Ma, Qinyuan; Zhu, Hailiang
2015-04-01
D-Amino acids exist widely in microbes, plants, animals, and food and can be applied in pharmaceutical, food, and cosmetics. Because of their widespread applications in industry, D-amino acids have recently received more and more attention. Enzymes including D-hydantoinase, N-acyl-D-amino acid amidohydrolase, D-amino acid amidase, D-aminopeptidase, D-peptidase, L-amino acid oxidase, D-amino acid aminotransferase, and D-amino acid dehydrogenase can be used for D-amino acids synthesis by kinetic resolution or asymmetric amination. In this review, the distribution, industrial applications, and enzymatic synthesis methods are summarized. And, among all the current enzymatic methods, D-amino acid dehydrogenase method not only produces D-amino acid by a one-step reaction but also takes environment and atom economics into consideration; therefore, it is deserved to be paid more attention.
Carballeira, Néstor M.; Sanabria, David; Oyola, Delise
2006-01-01
An improved synthesis for the (Z)-14-methyl-9-pentadecenoic acid was developed based on the appropriate use of (trimethylsilyl)acetylene as the key reagent in the synthesis. The reported synthesis started with commercially available 8-bromo-1-octanol and furnished the desired acid in seven steps and in a 16% overall yield, a significant improvement over the previous reported synthesis for this fatty acid. The synthesis reported herein afforded sufficient amounts to study the acid topoisomerase I inhibitory potential and it was found that the title acid inhibits the human placenta DNA topoisomerase I enzyme at concentrations of 500 μM. PMID:17680032
Maeda-Sano, Katsura; Gotoh, Mari; Morohoshi, Toshiro; Someya, Takao; Murofushi, Hiromu; Murakami-Murofushi, Kimiko
2014-09-01
Cyclic phosphatidic acid (cPA) is a naturally occurring phospholipid mediator and an analog of the growth factor-like phospholipid lysophosphatidic acid (LPA). cPA has a unique cyclic phosphate ring at the sn-2 and sn-3 positions of its glycerol backbone. We showed before that a metabolically stabilized cPA derivative, 2-carba-cPA, relieved osteoarthritis pathogenesis in vivo and induced hyaluronic acid synthesis in human osteoarthritis synoviocytes in vitro. This study focused on hyaluronic acid synthesis in human fibroblasts, which retain moisture and maintain health in the dermis. We investigated the effects of cPA and LPA on hyaluronic acid synthesis in human fibroblasts (NB1RGB cells). Using particle exclusion and enzyme-linked immunosorbent assays, we found that both cPA and LPA dose-dependently induced hyaluronic acid synthesis. We revealed that the expression of hyaluronan synthase 2 messenger RNA and protein is up-regulated by cPA and LPA treatment time dependently. We then characterized the signaling pathways up-regulating hyaluronic acid synthesis mediated by cPA and LPA in NB1RGB cells. Pharmacological inhibition and reporter gene assays revealed that the activation of the LPA receptor LPAR1, Gi/o protein, phosphatidylinositol-3 kinase (PI3K), extracellular-signal-regulated kinase (ERK), and cyclic adenosine monophosphate response element-binding protein (CREB) but not nuclear factor κB induced hyaluronic acid synthesis by the treatment with cPA and LPA in NB1RGB cells. These results demonstrate for the first time that cPA and LPA induce hyaluronic acid synthesis in human skin fibroblasts mainly through the activation of LPAR1-Gi/o followed by the PI3K, ERK, and CREB signaling pathway. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.
Cobessi, David; Dumas, Renaud; Pautre, Virginie; Meinguet, Céline; Ferrer, Jean-Luc; Alban, Claude
2012-01-01
Diaminopelargonic acid aminotransferase (DAPA-AT) and dethiobiotin synthetase (DTBS) catalyze the antepenultimate and the penultimate steps, respectively, of biotin synthesis. Whereas DAPA-AT and DTBS are encoded by distinct genes in bacteria, in biotin-synthesizing eukaryotes (plants and most fungi), both activities are carried out by a single enzyme encoded by a bifunctional gene originating from the fusion of prokaryotic monofunctional ancestor genes. In few angiosperms, including Arabidopsis thaliana, this chimeric gene (named BIO3-BIO1) also produces a bicistronic transcript potentially encoding separate monofunctional proteins that can be produced following an alternative splicing mechanism. The functional significance of the occurrence of a bifunctional enzyme in biotin synthesis pathway in eukaryotes and the relative implication of each of the potential enzyme forms (bifunctional versus monofunctional) in the plant biotin pathway are unknown. In this study, we demonstrate that the BIO3-BIO1 fusion protein is the sole protein form produced by the BIO3-BIO1 locus in Arabidopsis. The enzyme catalyzes both DAPA-AT and DTBS reactions in vitro and is targeted to mitochondria in vivo. Our biochemical and kinetic characterizations of the pure recombinant enzyme show that in the course of the reaction, the DAPA intermediate is directly transferred from the DAPA-AT active site to the DTBS active site. Analysis of several structures of the enzyme crystallized in complex with and without its ligands reveals key structural elements involved for acquisition of bifunctionality and brings, together with mutagenesis experiments, additional evidences for substrate channeling. PMID:22547782
Key Building Blocks via Enzyme-Mediated Synthesis
NASA Astrophysics Data System (ADS)
Fischer, Thomas; Pietruszka, Jörg
Biocatalytic approaches to valuable building blocks in organic synthesis have emerged as an important tool in the last few years. While first applications were mainly based on hydrolases, other enzyme classes such as oxidoreductases or lyases moved into the focus of research. Nowadays, a vast number of biotransformations can be found in the chemical and pharmaceutical industries delivering fine chemicals or drugs. The mild reaction conditions, high stereo-, regio-, and chemoselectivities, and the often shortened reaction pathways lead to economical and ecological advantages of enzymatic conversions. Due to the enormous number of enzyme-mediated syntheses, the present chapter is not meant to be a complete review, but to deliver comprehensive insights into well established enzymatic systems and recent advances in the application of enzymes in natural product synthesis. Furthermore, it is focused on the most frequently used enzymes or enzyme classes not covered elsewhere in the present volume.
Inhibition of rotavirus replication by downregulation of fatty acid synthesis.
Gaunt, Eleanor R; Cheung, Winsome; Richards, James E; Lever, Andrew; Desselberger, Ulrich
2013-06-01
Recently the recruitment of lipid droplets (LDs) to sites of rotavirus (RV) replication was reported. LDs are polymorphic organelles that store triacylglycerols, cholesterol and cholesterol esters. The neutral fats are derived from palmitoyl-CoA, synthesized via the fatty acid biosynthetic pathway. RV-infected cells were treated with chemical inhibitors of the fatty acid biosynthetic pathway, and the effects on viral replication kinetics were assessed. Treatment with compound C75, an inhibitor of the fatty acid synthase enzyme complex (FASN), reduced RV infectivity 3.2-fold (P = 0.07) and modestly reduced viral RNA synthesis (1.2-fold). Acting earlier in the fatty acid synthesis pathway, TOFA [5-(Tetradecyloxy)-2-furoic acid] inhibits the enzyme acetyl-CoA carboxylase 1 (ACC1). TOFA reduced the infectivity of progeny RV 31-fold and viral RNA production 6-fold. The effect of TOFA on RV infectivity and RNA replication was dose-dependent, and infectivity was reduced by administering TOFA up to 4 h post-infection. Co-treatment of RV-infected cells with C75 and TOFA synergistically reduced viral infectivity. Knockdown by siRNA of FASN and ACC1 produced findings similar to those observed by inhibiting these proteins with the chemical compounds. Inhibition of fatty acid synthesis using a range of approaches uniformly had a more marked impact on viral infectivity than on viral RNA yield, inferring a role for LDs in virus assembly and/or egress. Specific inhibitors of fatty acid metabolism may help pinpoint the critical structural and biochemical features of LDs that are essential for RV replication, and facilitate the development of antiviral therapies.
Is Bacterial Fatty Acid Synthesis a Valid Target for Antibacterial Drug Discovery?
Parsons, Joshua B.; Rock, Charles O.
2011-01-01
The emergence of resistance against most current drugs emphasizes the need to develop new approaches to control bacterial pathogens, particularly Staphylococcus aureus. Bacterial fatty acid synthesis is one such target that is being actively pursued by several research groups to develop anti-Staphylococcal agents. Recently, the wisdom of this approach has been challenged based on the ability of a Gram-positive bacterium to incorporate extracellular fatty acids and thus circumvent the inhibition of de novo fatty acid synthesis. The generality of this conclusion has been challenged, and there is enough diversity in the enzymes and regulation of fatty acid synthesis in bacteria to conclude that there isn’t a single organism that can be considered typical and representative of bacteria as a whole. We are left without a clear resolution to this ongoing debate and await new basic research to define the pathways for fatty acid uptake and that determine the biochemical and genetic mechanisms for the regulation of fatty acid synthesis in Gram-positive bacteria. These crucial experiments will determine whether diversity in the control of this important pathway accounts for the apparently different responses of Gram-positive bacteria to the inhibition of de novo fatty acid synthesis in presence of extracellular fatty acid supplements. PMID:21862391
Lipase-catalyzed synthesis of fattythioic acids from palm oil.
Al-Mulla, Emad A Jaffar
2011-01-01
The present work focuses on the synthesis of fattythioic acids (FTAs) by a one-step lipase catalyzed reaction of palm oil with carbonothioic S,S-acid using Lipozyme. The product was characterized using Fourier transform infrared (FTIR) spectroscopy, proton nuclear magnetic resonance ((1)H NMR) technique and elemental analysis. The effects of various reaction parameters such as reaction time, temperature, amount of enzyme, molar ratio of substrates, and various organic solvents of the reaction system were investigated. The optimum conditions to produce FTAs were respectively, incubation time, 20 h, temperature, 40°C, amount of enzyme, 0.05 g and molar ratio of carbonothioic S,S-acid to palm oil, 5.0:1.0. Hexane was the best solvent for this reaction. The conversion of the products at optimum conditions was around 91%.
Synthesis of glyceryl ferulate by immobilized ferulic acid esterase.
Matsuo, Takemasa; Kobayashi, Takashi; Kimura, Yukitaka; Tsuchiyama, Moriyasu; Oh, Tadanobu; Sakamoto, Tatsuji; Adachi, Shuji
2008-12-01
Glyceryl ferulate was synthesized by the condensation of ferulic acid with glycerol using Pectinase PL "Amano" from Aspergillus niger, which contained ferulic acid esterase, to improve the water-solubility of ferulic acid. The optimum reaction medium was glycerol/0.1 M acetate buffer, pH 4.0, (98:2 v/v). The enzyme immobilized onto Chitopearl BCW3003 exhibited the highest activity among the those immobilized onto various kinds of Chitopearl BCW resins. The optimum temperature for the immobilized enzyme was 50 degrees C, and it could be reused at least five times without a significant loss in activity for the synthesis of glyceryl ferulate in batch reaction. Storage of the reaction mixture at 25 degrees C improved the molar fraction of glyceryl ferulate relative to the dissolved ferulic residues.
Oxidation of d-Amino Acids by a Particulate Enzyme from Pseudomonas aeruginosa
Marshall, Vincent P.; Sokatch, John R.
1968-01-01
A particulate d-amino acid dehydrogenase has been partially purified from cell free extracts of Pseudomonas aeruginosa grown on dl-valine as the source of carbon and energy. A standard assay was developed which utilized 2,6-dichlorophenol-indophenol as the electron acceptor. The pH optimum for enzyme activity ranged from 6.0 to 8.0, depending on the amino acid assayed. The enzyme was most active with monoamino-monocarboxylic amino acids and histidine. The Michaelis constant for d-phenylalanine was found to be 1.3 × 10-3m d-phenylalanine. Constants could not be calculated for the other amino acids oxidized because anomalous plots of V as a function of V/S were obtained. Spectra of enzyme preparations reduced with d-valine or sodium hydrosulfite exhibited adsorption bands typical of the α, β, and γ bands of cytochromes as well as bleaching in the flavin region of the spectrum. When dl-valine was added to a medium with glycerol as the energy source, d-amino acid dehydrogenase was detected after the addition of valine and was produced at a rate directly proportional to the synthesis of total protein. The enzyme was formed when d-valine, l-valine, or dl-alanine was the source of carbon and energy, but not when glucose, glycerol, or succinate was the energy source. PMID:4384679
Enzymic Synthesis of Indole-3-Acetyl-1-O-β-d-Glucose 1
Leznicki, Antoni J.; Bandurski, Robert S.
1988-01-01
The first enzyme-catalyzed reaction leading from indole-3-acetic acid (IAA) to the myo-inositol esters of IAA is the synthesis of indole-3-acetyl-1-O-β-d-glucose from uridine-5′-diphosphoglucose (UDPG) and IAA. The reaction is catalyzed by the enzyme, UDPG-indol-3-ylacetyl glucosyl transferase (IAA-glucose-synthase). This work reports methods for the assay of the enzyme and for the extraction and partial purification of the enzyme from kernels of Zea mays sweet corn. The enzyme has an apparent molecular weight of 46,500 an isoelectric point of 5.5, and its pH optimum lies between 7.3 and 7.6. The enzyme is stable to storage at zero degrees but loses activity during column chromatographic procedures which can be restored only fractionally by addition of column eluates. The data suggest either multiple unknown cofactors or conformational changes leading to activity loss. Images Fig. 4 PMID:11537438
Beena, P S; Basheer, Soorej M; Bhat, Sarita G; Bahkali, Ali H; Chandrasekaran, M
2011-07-01
Marine Aspergillus awamori BTMFW032, recently reported by us, produce acidophilic tannase as extracellular enzyme. Here, we report the application of this enzyme for synthesis of propyl gallate by direct transesterification of tannic acid and in tea cream solubilisation besides the simultaneous production of gallic acid along with tannase under submerged fermentation by this fungus. This acidophilic tannase enabled synthesis of propyl gallate by direct transesterification of tannic acid using propanol as organic reaction media under low water conditions. The identity of the product was confirmed with thin layer chromatography and Fourier transform infrared spectroscopy. It was noted that 699 U/ml of enzyme could give 60% solubilisation of tea cream within 1 h. Enzyme production medium was optimized adopting Box-Behnken design for simultaneous synthesis of tannase and gallic acid. Process variables including tannic acid, sodium chloride, ferrous sulphate, dipotassium hydrogen phosphate, incubation period and agitation were recognized as the critical factors that influenced tannase and gallic acid production. The model obtained predicted 4,824.61 U/ml of tannase and 136.206 μg/ml gallic acid after 48 h of incubation, whereas optimized medium supported 5,085 U/ml tannase and 372.6 μg/ml of gallic acid production after 36 and 84 h of incubation, respectively, with a 15-fold increase in both enzyme and gallic acid production. Results indicated scope for utilization of this acidophilic tannase for transesterification of tannic acid into propyl gallate, tea cream solubilisation and simultaneous production of gallic acid along with tannase.
Microwave-Assisted Rapid Enzymatic Synthesis of Nucleic Acids.
Hari Das, Rakha; Ahirwar, Rajesh; Kumar, Saroj; Nahar, Pradip
2016-07-02
Herein we report microwave-induced enhancement of the reactions catalyzed by Escherichia coli DNA polymerase I and avian myeloblastosis virus-reverse transcriptase. The reactions induced by microwaves result in a highly selective synthesis of nucleic acids in 10-50 seconds. In contrast, same reactions failed to give desired reaction products when carried out in the same time periods, but without microwave irradiation. Each of the reactions was carried out for different duration of microwave exposure time to find the optimum reaction time. The products produced by the respective enzyme upon microwave irradiation of the reaction mixtures were identical to that produced by the conventional procedures. As the microwave-assisted reactions are rapid, microwave could be a useful alternative to the conventional and time consuming procedures of enzymatic synthesis of nucleic acids.
Advances in the synthesis of α-quaternary α-ethynyl α-amino acids.
Boibessot, Thibaut; Bénimélis, David; Meffre, Patrick; Benfodda, Zohra
2016-09-01
α-Quaternary α-ethynyl α-amino acids are an important class of non-proteinogenic amino acids that play an important role in the development of peptides and peptidomimetics as therapeutic agents and in the inhibition of enzyme activities. This review provides an overview of the literature concerning synthesis and applications of α-quaternary α-ethynyl α-amino acids covering the period from 1977 to 2015.
Genipin Cross-Linked Glucose Oxidase and Catalase Multi-enzyme for Gluconic Acid Synthesis.
Cui, Caixia; Chen, Haibin; Chen, Biqiang; Tan, Tianwei
2017-02-01
In this work, glucose oxidase (GOD) and catalase (CAT) were used simultaneously to produce gluconic acid from glucose. In order to reduce the distance between the two enzymes, and therefore improve efficiency, GOD and CAT were cross-linked together using genipin. Improvements in gluconic acid production were due to quick removal of harmful intermediate hydrogen peroxide by CAT. GOD activity was significantly affected by the proportion of CAT in the system, with GOD activity in the cross-linked multi-enzyme (CLME) being 10 times higher than that in an un-cross-linked GOD/CAT mixture. The glucose conversion rate after 15 h using 15 % glucose was also 10 % higher using the CLME than was measured using a GOD/CAT mixture.
Yu, Dan; Hornung, Ellen; Iven, Tim; Feussner, Ivo
2018-01-01
overall yields and the compositions of wax esters can be strongly affected by the availability of acyl-CoA substrates and to a lesser extent, by the characteristics of wax ester synthesis enzymes. For synthesis of oleyl oleate in plant seed oil, appropriate wax ester synthesis enzymes with high catalytic efficiency and desired substrate specificity should be expressed in plant cells; meanwhile, high levels of oleic acid-derived substrates need to be supplied to these enzymes by modifying the fatty acid profile of developing seeds.
Integrated microdroplet-based system for enzyme synthesis and sampling
NASA Astrophysics Data System (ADS)
Lapierre, Florian; Best, Michel; Stewart, Robert; Oakeshott, John; Peat, Thomas; Zhu, Yonggang
2013-12-01
Microdroplet-based microfluidic devices are emerging as powerful tools for a wide range of biochemical screenings and analyses. Monodispersed aqueous microdroplets from picoliters to nanoliters in volume are generated inside microfluidic channels within an immiscible oil phase. This results in the formation of emulsions which can contain various reagents for chemical reactions and can be considered as discrete bioreactors. In this paper an integrated microfluidic platform for the synthesis, screening and sorting of libraries of an organophosphate degrading enzyme is presented. The variants of the selected enzyme are synthesized from a DNA source using in-vitro transcription and translation method. The synthesis occurs inside water-in-oil emulsion droplets, acting as bioreactors. Through a fluorescence based detection system, only the most efficient enzymes are selected. All the necessary steps from the enzyme synthesis to selection of the best genes (producing the highest enzyme activity) are thus integrated inside a single and unique device. In the second part of the paper, an innovative design of the microfluidic platform is presented, integrating an electronic prototyping board for ensuring the communication between the various components of the platform (camera, syringe pumps and high voltage power supply), resulting in a future handheld, user-friendly, fully automated device for enzyme synthesis, screening and selection. An overview on the capabilities as well as future perspectives of this new microfluidic platform is provided.
EFFECTS OF X IRRADIATION ON ENZYME SYNTHESIS DURING LIVER REGENERATION
DOE Office of Scientific and Technical Information (OSTI.GOV)
Myers, D.K.
1962-05-01
Twenty-four different enzymes or enzyme systems were assayed in regenerating rat liver from control and irradiated animals at various times after partial hepatectomy. X irradiation, either of the whole liver region or of an exteriorized liver lobule, interfered with the accumulation of only three of these enzymes: deoxycytidylate deaminase, thymidine phosphorylase, and NAD pyrophosphorylase. Irradiation did not affect the synthesis of related enzymes such as adenosine and guanine deaminases, and inosine and uridine phosphorylases. The effects of irradiation on enzyme synthesis in regenerating liver would appear to be highly selective. (auth)
One-pot synthesis of bioactive cyclopentenones from α-linolenic acid and docosahexaenoic acid.
Maynard, Daniel; Müller, Sara Mareike; Hahmeier, Monika; Löwe, Jana; Feussner, Ivo; Gröger, Harald; Viehhauser, Andrea; Dietz, Karl-Josef
2018-04-01
Oxidation products of the poly-unsaturated fatty acids (PUFAs) arachidonic acid, α-linolenic acid and docosahexaenoic acid are bioactive in plants and animals as shown for the cyclopentenones prostaglandin 15d-PGJ 2 and PGA 2 , cis-(+)-12-oxophytodienoic acid (12-OPDA), and 14-A-4 neuroprostane. In this study an inexpensive and simple enzymatic multi-step one-pot synthesis is presented for 12-OPDA, which is derived from α-linolenic acid, and the analogous docosahexaenoic acid (DHA)-derived cyclopentenone [(4Z,7Z,10Z)-12-[[-(1S,5S)-4-oxo-5-(2Z)-pent-2-en-1yl]-cyclopent-2-en-1yl] dodeca-4,7,10-trienoic acid, OCPD]. The three enzymes utilized in this multi-step cascade were crude soybean lipoxygenase or a recombinant lipoxygenase, allene oxide synthase and allene oxide cyclase from Arabidopsis thaliana. The DHA-derived 12-OPDA analog OCPD is predicted to have medicinal potential and signaling properties in planta. With OCPD in hand, it is shown that this compound interacts with chloroplast cyclophilin 20-3 and can be metabolized by 12-oxophytodienoic acid reductase (OPR3) which is an enzyme relevant for substrate bioactivity modulation in planta. Copyright © 2017 Elsevier Ltd. All rights reserved.
Enzymatic routes for the synthesis of ursodeoxycholic acid.
Eggert, Thorsten; Bakonyi, Daniel; Hummel, Werner
2014-12-10
Ursodeoxycholic acid, a secondary bile acid, is used as a drug for the treatment of various liver diseases, the optimal dose comprises the range of 8-10mg/kg/day. For industrial syntheses, the structural complexity of this bile acid requires the use of an appropriate starting material as well as the application of regio- and enantio-selective enzymes for its derivatization. Most strategies for the synthesis start from cholic acid or chenodeoxycholic acid. The latter requires the conversion of the hydroxyl group at C-7 from α- into β-position in order to obtain ursodeoxycholic acid. Cholic acid on the other hand does not only require the same epimerization reaction at C-7 but the removal of the hydroxyl group at C-12 as well. There are several bacterial regio- and enantio-selective hydroxysteroid dehydrogenases (HSDHs) to carry out the desired reactions, for example 7α-HSDHs from strains of Clostridium, Bacteroides or Xanthomonas, 7β-HSDHs from Clostridium, Collinsella, or Ruminococcus, or 12α-HSDH from Clostridium or from Eggerthella. However, all these bioconversion reactions need additional steps for the regeneration of the coenzymes. Selected multi-step reaction systems for the synthesis of ursodeoxycholic acid are presented in this review. Copyright © 2014 Elsevier B.V. All rights reserved.
Physiological effects of γ-linolenic acid and sesamin on hepatic fatty acid synthesis and oxidation.
Ide, Takashi; Iwase, Haruka; Amano, Saaya; Sunahara, Saki; Tachihara, Ayuka; Yagi, Minako; Watanabe, Tsuyoshi
2017-03-01
Interrelated effects of γ-linolenic acid (GLA) and sesamin, a sesame lignan, on hepatic fatty acid synthesis and oxidation were examined. Rats were fed experimental diets supplemented with 0 or 2 g/kg sesamin (1:1 mixture of sesamin and episesamin) and containing 100 g/kg of palm oil (saturated fat), safflower oil rich in linoleic acid, or oil of evening primrose origin containing 43% GLA (GLA oil) for 18 days. In rats fed sesamin-free diets, GLA oil, compared with other oils, increased the activity and mRNA levels of various enzymes involved in fatty acid oxidation, except for some instances. Sesamin greatly increased these parameters, and the enhancing effects of sesamin on peroxisomal fatty acid oxidation rate and acyl-CoA oxidase, enoyl-CoA hydratase and acyl-CoA thioesterase activities were more exaggerated in rats fed GLA oil than in the animals fed other oils. The combination of sesamin and GLA oil also synergistically increased the mRNA levels of some peroxisomal fatty acid oxidation enzymes and of several enzymes involved in fatty acid metabolism located in other cell organelles. In the groups fed sesamin-free diets, GLA oil, compared with other oils, markedly reduced the activity and mRNA levels of various lipogenic enzymes. Sesamin reduced all these parameters, except for malic enzyme, in rats fed palm and safflower oils, but the effects were attenuated in the animals fed GLA oil. These changes by sesamin and fat type accompanied profound alterations in serum lipid levels. This may be ascribable to the changes in apolipoprotein-B-containing lipoproteins. Copyright © 2016 Elsevier Inc. All rights reserved.
Stereoselective Synthesis of α-Amino-C-phosphinic Acids and Derivatives.
Viveros-Ceballos, José Luis; Ordóñez, Mario; Sayago, Francisco J; Cativiela, Carlos
2016-08-29
α-Amino-C-phosphinic acids and derivatives are an important group of compounds of synthetic and medicinal interest and particular attention has been dedicated to their stereoselective synthesis in recent years. Among these, phosphinic pseudopeptides have acquired pharmacological importance in influencing physiologic and pathologic processes, primarily acting as inhibitors for proteolytic enzymes where molecular stereochemistry has proven to be critical. This review summarizes the latest developments in the asymmetric synthesis of acyclic and phosphacyclic α-amino-C-phosphinic acids and derivatives, following in the first case an order according to the strategy used, whereas for cyclic compounds the nitrogen embedding in the heterocyclic core is considered. In addition selected examples of pharmacological implications of title compounds are also disclosed.
NASA Technical Reports Server (NTRS)
Leznicki, A. J.; Bandurski, R. S.
1988-01-01
The first enzyme-catalyzed reaction leading from indole-3-acetic acid (IAA) to the myo-inositol esters of IAA is the synthesis of indole-3-acetyl-1-O-beta-D-glucose from uridine-5'-diphosphoglucose (UDPG) and IAA. The reaction is catalyzed by the enzyme, UDPG-indol-3-ylacetyl glucosyl transferase (IAA-glucose-synthase). This work reports methods for the assay of the enzyme and for the extraction and partial purification of the enzyme from kernels of Zea mays sweet corn. The enzyme has an apparent molecular weight of 46,500 an isoelectric point of 5.5, and its pH optimum lies between 7.3 and 7.6. The enzyme is stable to storage at zero degrees but loses activity during column chromatographic procedures which can be restored only fractionally by addition of column eluates. The data suggest either multiple unknown cofactors or conformational changes leading to activity loss.
Trivedi, Jayati; Aila, Mounika; Sharma, Chandra Dutt; Gupta, Piyush; Kaul, Savita
2015-01-01
In view of the rising global problems of environment pollution and degradation, the present process provides a 'green solution' to the synthesis of higher esters of lubricant range, more specifically in the range C12-C36, using different combinations of acids and alcohols, in a single step reaction. The esters produced are biodegradable in nature and have a plethora of uses, such as in additives, as lubricating oils and other hydraulic fluids. The enzymatic esterification was performed using liquid (non-immobilized or free) lipase enzyme, without any additional organic solvent. Soluble lipase proves to be superior to immobilized enzymes as it is more cost effective and provides a faster process for the production of higher esters of lubricant range. An interesting finding was, that the lipase enzyme showed higher conversion rates with increasing carbon number of straight chain alcohols and acids. Reactions were carried out for the optimization of initial water concentration, temperature, pH of the substrate mixture and the chain length of the substrates. Under optimized conditions, the method was suitable to achieve ~ 99% conversion. Thus, the process provides an environment friendly, enzymatic alternative to the chemical route which is currently used in the industrial synthesis of lubricant components.
Insolubilized enzymes for food synthesis
NASA Technical Reports Server (NTRS)
Marshall, D. L.
1972-01-01
Cellulose matrix with numerous enzyme-coated silica particles of colloidal size permanently bound at various sites within matrix was produced that has high activity and possesses requisite physical characteristics for filtration or column operations. Product also allows coupling step in synthesis of edible food to proceed under mild conditions.
In vitro synthesis of 9,10-dihydroxyhexadecanoic acid using recombinant Escherichia coli.
Kaprakkaden, Anees; Srivastava, Preeti; Bisaria, Virendra Swarup
2017-05-18
Hydroxy fatty acids are widely used in food, chemical and cosmetic industries. A variety of dihydroxy fatty acids have been synthesized so far; however, no studies have been done on the synthesis of 9,10-dihydroxyhexadecanoic acid. In the present study recombinant E. coli has been used for the heterologous expression of fatty acid hydroxylating enzymes and the whole cell lysate of the induced culture was used for in vitro production of 9,10-dihydroxyhexadecanoic acid. A first of its kind proof of principle has been successfully demonstrated for the production of 9,10-dihydroxyhexadecanoic acid using three different enzymes viz. fatty acid desaturase (FAD) from Saccharomyces cerevisiae, epoxide hydrolase (EH) from Caenorhabditis elegance and epoxygenase (EPOX) from Stokasia laevis. The genes for these proteins were codon-optimised, synthesised and cloned in pET 28a (+) vector. The culture conditions for induction of these three proteins in E. coli were optimised in shake flask. The induced cell lysates were used both singly and in combination along with the trans-supply of hexadecanoic acid and 9-hexadecenoic acid, followed by product profiling by GC-MS. Formation of 9,10-dihydroxyhexadecanoic acid was successfully achieved when combination of induced cell lysates of recombinant E. coli containing FAD, EH, and EPOX were incubated with 9-hexadecenoic acid. The in vitro production of 9,10-dihydroxyhexadecanoic acid synthesis using three fatty acid modification genes from different sources has been successfully demonstrated. The strategy adopted can be used for the production of similar compounds.
Hydrocortisone Stimulation of RNA Synthesis in Induction of Hepatic Enzymes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kenney, Francis T.; Wicks, Wesley D.; Greenman, David L.
Increased synthesis of hepatic enzymes due to hydrocortisone is preceded by an increase in the rate of synthesis of nuclear RNA. Pulse-labeled RNA from liver nuclei was fractionated by a differential thermal phenol procedures, and the labeled RNA of each fraction was characterized by sucrose gradient centrifugation and base composition analysis. Hormone treatment increases the rate of synthesis of three types of RNA: (1) the nuclear precursor to ribosomal RNA, (2) a rapid turnover component with base composition similar to the tissue DNA, and (3) transfer RNA. Much of the total isotope incorporation into transfer RNA can be traced tomore » turnover of the terminal adenylate residue, but this type of labeling is insensitive to the hormone. The steroid also stimulates isotope incorporation into tissue precursor pools. The effect is abolished by actinomycin and thus is secondary to the hormonal stimulation of RNA synthesis. Growth hormone stimulates RNA synthesis in both intact and adrenalectomized rats, but induces the rapid turnover enzymes (tyrosine transaminase and tryptophan pyrrolase) only in the presence of functional adrenals. It therefore seems that glucocorticoids initiate both a generalized increase in synthesis of RNA and a selective induction of specific enzymes.« less
Greenough, Lucia; Schermerhorn, Kelly M.; Mazzola, Laurie; Bybee, Joanna; Rivizzigno, Danielle; Cantin, Elizabeth; Slatko, Barton E.; Gardner, Andrew F.
2016-01-01
Detailed biochemical characterization of nucleic acid enzymes is fundamental to understanding nucleic acid metabolism, genome replication and repair. We report the development of a rapid, high-throughput fluorescence capillary gel electrophoresis method as an alternative to traditional polyacrylamide gel electrophoresis to characterize nucleic acid metabolic enzymes. The principles of assay design described here can be applied to nearly any enzyme system that acts on a fluorescently labeled oligonucleotide substrate. Herein, we describe several assays using this core capillary gel electrophoresis methodology to accelerate study of nucleic acid enzymes. First, assays were designed to examine DNA polymerase activities including nucleotide incorporation kinetics, strand displacement synthesis and 3′-5′ exonuclease activity. Next, DNA repair activities of DNA ligase, flap endonuclease and RNase H2 were monitored. In addition, a multicolor assay that uses four different fluorescently labeled substrates in a single reaction was implemented to characterize GAN nuclease specificity. Finally, a dual-color fluorescence assay to monitor coupled enzyme reactions during Okazaki fragment maturation is described. These assays serve as a template to guide further technical development for enzyme characterization or nucleoside and non-nucleoside inhibitor screening in a high-throughput manner. PMID:26365239
Cahoon, E B; Ripp, K G; Hall, S E; Kinney, A J
2001-01-26
Divergent forms of the plant Delta(12)-oleic-acid desaturase (FAD2) have previously been shown to catalyze the formation of acetylenic bonds, epoxy groups, and conjugated Delta(11),Delta(13)-double bonds by modification of an existing Delta(12)-double bond in C(18) fatty acids. Here, we report a class of FAD2-related enzymes that modifies a Delta(9)-double bond to produce the conjugated trans-Delta(8),trans-Delta(10)-double bonds found in calendic acid (18:3Delta(8trans,10trans,12cis)), the major component of the seed oil of Calendula officinalis. Using an expressed sequence tag approach, cDNAs for two closely related FAD2-like enzymes, designated CoFADX-1 and CoFADX-2, were identified from a C. officinalis developing seed cDNA library. The deduced amino acid sequences of these polypeptides share 40-50% identity with those of other FAD2 and FAD2-related enzymes. Expression of either CoFADX-1 or CoFADX-2 in somatic soybean embryos resulted in the production of calendic acid. In embryos expressing CoFADX-2, calendic acid accumulated to as high as 22% (w/w) of the total fatty acids. In addition, expression of CoFADX-1 and CoFADX-2 in Saccharomyces cerevisiae was accompanied by calendic acid accumulation when induced cells were supplied exogenous linoleic acid (18:2Delta(9cis,12cis)). These results are thus consistent with a route of calendic acid synthesis involving modification of the Delta(9)-double bond of linoleic acid. Regiospecificity for Delta(9)-double bonds is unprecedented among FAD2-related enzymes and further expands the functional diversity found in this family of enzymes.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lake, April D.; Novak, Petr; Shipkova, Petia
2013-04-15
Bile acids (BAs) have many physiological roles and exhibit both toxic and protective influences within the liver. Alterations in the BA profile may be the result of disease induced liver injury. Nonalcoholic fatty liver disease (NAFLD) is a prevalent form of chronic liver disease characterized by the pathophysiological progression from simple steatosis to nonalcoholic steatohepatitis (NASH). The hypothesis of this study is that the ‘classical’ (neutral) and ‘alternative’ (acidic) BA synthesis pathways are altered together with hepatic BA composition during progression of human NAFLD. This study employed the use of transcriptomic and metabolomic assays to study the hepatic toxicologic BAmore » profile in progressive human NAFLD. Individual human liver samples diagnosed as normal, steatosis, and NASH were utilized in the assays. The transcriptomic analysis of 70 BA genes revealed an enrichment of downregulated BA metabolism and transcription factor/receptor genes in livers diagnosed as NASH. Increased mRNA expression of BAAT and CYP7B1 was observed in contrast to decreased CYP8B1 expression in NASH samples. The BA metabolomic profile of NASH livers exhibited an increase in taurine together with elevated levels of conjugated BA species, taurocholic acid (TCA) and taurodeoxycholic acid (TDCA). Conversely, cholic acid (CA) and glycodeoxycholic acid (GDCA) were decreased in NASH liver. These findings reveal a potential shift toward the alternative pathway of BA synthesis during NASH, mediated by increased mRNA and protein expression of CYP7B1. Overall, the transcriptomic changes of BA synthesis pathway enzymes together with altered hepatic BA composition signify an attempt by the liver to reduce hepatotoxicity during disease progression to NASH. - Highlights: ► Altered hepatic bile acid composition is observed in progressive NAFLD. ► Bile acid synthesis enzymes are transcriptionally altered in NASH livers. ► Increased levels of taurine and conjugated bile
Greenough, Lucia; Schermerhorn, Kelly M; Mazzola, Laurie; Bybee, Joanna; Rivizzigno, Danielle; Cantin, Elizabeth; Slatko, Barton E; Gardner, Andrew F
2016-01-29
Detailed biochemical characterization of nucleic acid enzymes is fundamental to understanding nucleic acid metabolism, genome replication and repair. We report the development of a rapid, high-throughput fluorescence capillary gel electrophoresis method as an alternative to traditional polyacrylamide gel electrophoresis to characterize nucleic acid metabolic enzymes. The principles of assay design described here can be applied to nearly any enzyme system that acts on a fluorescently labeled oligonucleotide substrate. Herein, we describe several assays using this core capillary gel electrophoresis methodology to accelerate study of nucleic acid enzymes. First, assays were designed to examine DNA polymerase activities including nucleotide incorporation kinetics, strand displacement synthesis and 3'-5' exonuclease activity. Next, DNA repair activities of DNA ligase, flap endonuclease and RNase H2 were monitored. In addition, a multicolor assay that uses four different fluorescently labeled substrates in a single reaction was implemented to characterize GAN nuclease specificity. Finally, a dual-color fluorescence assay to monitor coupled enzyme reactions during Okazaki fragment maturation is described. These assays serve as a template to guide further technical development for enzyme characterization or nucleoside and non-nucleoside inhibitor screening in a high-throughput manner. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Effect of the quality of dietary amino acids composition on the urea synthesis in rats.
Tujioka, Kazuyo; Ohsumi, Miho; Hayase, Kazutoshi; Yokogoshi, Hidehiko
2011-01-01
We have shown that urinary urea excretion increased in rats given a lower quality protein. The purpose of present study was to determine whether the composition of dietary amino acids affects urea synthesis. Experiments were done on three groups of rats given diets containing a 10% gluten amino acid mix diet or 10% casein amino acid mix diet or 10% whole egg protein amino acids mix diet for 10 d. The urinary excretion of urea, the liver concentration of N-acetylglutamate, and the liver concentration of free serine, glutamic acids and alanine were greater in the group given the amino acid mix diet of lower quality. The fractional and absolute rates of protein synthesis in tissues declined with a decrease in quality of dietary amino acids. The hepatic concentration of ornithine and the activities of hepatic urea-cycle enzymes were not related to the urea excretion. These results suggest that the increased concentrations of amino acids and N-acetylglutamate seen in the liver of rats given the amino acid mix diets of lower quality are likely among the factors stimulating urea synthesis. The protein synthesis in tissues is at least partly related to hepatic concentrations of amino acids. The composition of dietary amino acids is likely to be one of the factors regulating urea synthesis when the quality of dietary protein is manipulated.
DGAT enzymes are required for triacylglycerol synthesis and lipid droplets in adipocytes.
Harris, Charles A; Haas, Joel T; Streeper, Ryan S; Stone, Scot J; Kumari, Manju; Yang, Kui; Han, Xianlin; Brownell, Nicholas; Gross, Richard W; Zechner, Rudolf; Farese, Robert V
2011-04-01
The total contribution of the acyl CoA:diacylglycerol acyltransferase (DGAT) enzymes, DGAT1 and DGAT2, to mammalian triacylglycerol (TG) synthesis has not been determined. Similarly, whether DGAT enzymes are required for lipid droplet (LD) formation is unknown. In this study, we examined the requirement for DGAT enzymes in TG synthesis and LDs in differentiated adipocytes with genetic deletions of DGAT1 and DGAT2. Adipocytes with a single deletion of either enzyme were capable of TG synthesis and LD formation. In contrast, adipocytes with deletions of both DGATs were severely lacking in TG and did not have LDs, indicating that DGAT1 and DGAT2 account for nearly all TG synthesis in adipocytes and appear to be required for LD formation during adipogenesis. DGAT enzymes were not absolutely required for LD formation in mammalian cells, however; macrophages deficient in both DGAT enzymes were able to form LDs when incubated with cholesterol-rich lipoproteins. Although adipocytes lacking both DGATs had no TG or LDs, they were fully differentiated by multiple criteria. Our findings show that DGAT1 and DGAT2 account for the vast majority of TG synthesis in mice, and DGAT function is required for LDs in adipocytes, but not in all cell types.
Synthesis of guanidinoacetate and creatine from amino acids by rat pancreas.
da Silva, Robin P; Clow, Kathy; Brosnan, John T; Brosnan, Margaret E
2014-02-01
Creatine is an important molecule involved in cellular energy metabolism. Creatine is spontaneously converted to creatinine at a rate of 1·7% per d; creatinine is lost in the urine. Creatine can be obtained from the diet or synthesised from endogenous amino acids via the enzymes arginine:glycine amidinotransferase (AGAT) and guanidinoacetate N-methyltransferase (GAMT). The liver has high GAMT activity and the kidney has high AGAT activity. Although the pancreas has both AGAT and GAMT activities, its possible role in creatine synthesis has not been characterised. In the present study, we examined the enzymes involved in creatine synthesis in the pancreas as well as the synthesis of guanidinoacetate (GAA) and creatine by isolated pancreatic acini. We found significant AGAT activity and somewhat lower GAMT activity in the pancreas and that pancreatic acini had measurable activities of both AGAT and GAMT and the capacity to synthesise GAA and creatine from amino acids. Creatine supplementation led to a decrease in AGAT activity in the pancreas, though it did not affect its mRNA or protein abundance. This was in contrast with the reduction of AGAT activity and mRNA and protein abundance in the kidney, suggesting that the regulatory mechanisms that control the expression of this enzyme in the pancreas are different from those in the kidney. Dietary creatine increased the concentrations of GAA, creatine and phosphocreatine in the pancreas. Unexpectedly, creatine supplementation decreased the concentrations of S-adenosylmethionine, while those of S-adenosylhomocysteine were not altered significantly.
NAP enzyme recruitment in simultaneous bioremediation and nanoparticles synthesis.
Eltarahony, Marwa; Zaki, Sahar; Kheiralla, Zeinab; Abd-El-Haleem, Desouky
2018-06-01
The periplasmic nitrate reductase enzyme (NAP) has become attractive catalyst, whose exploitation has emerged as one of the indispensable strategies toward environmentally benign applications. To achieve them efficiently and overcome the sensitivity of NAP in harsh environmental circumstances, the immobilization for denitrifying bacteria and NAP enzyme for simultaneous bioremediation and bionanoparticles synthesis was studied. NAP catalyzed NO 3 - reduction at V max of 0.811 μM/min and K m of 14.02 mM. Concurrently, the immobilized MMT cells completely removed NO 3 - upon 192 h with AgNPs synthesis ranging from 23.26 to 58.14 nm as indicated by SEM. Wherase, immobilized NAP exhibited lower efficiency with 28.6% of NO 3 - elimination within 288 h and large aggregated AgNPs ranging from 94.44 nm to 172.22 nm. To the best of author knowledge, the immobilization for denitrifying bacteria and NAP enzyme for simultaneous bioremediation and bionanoparticles synthesis was not studied before.
Novel Enzyme Family Found in Filamentous Fungi Catalyzing trans-4-Hydroxylation of l-Pipecolic Acid
Hibi, Makoto; Mori, Ryosuke; Miyake, Ryoma; Kawabata, Hiroshi; Kozono, Shoko; Takahashi, Satomi
2016-01-01
Hydroxypipecolic acids are bioactive compounds widely distributed in nature and are valuable building blocks for the organic synthesis of pharmaceuticals. We have found a novel hydroxylating enzyme with activity toward l-pipecolic acid (l-Pip) in a filamentous fungus, Fusarium oxysporum c8D. The enzyme l-Pip trans-4-hydroxylase (Pip4H) of F. oxysporum (FoPip4H) belongs to the Fe(II)/α-ketoglutarate-dependent dioxygenase superfamily, catalyzes the regio- and stereoselective hydroxylation of l-Pip, and produces optically pure trans-4-hydroxy-l-pipecolic acid (trans-4-l-HyPip). Amino acid sequence analysis revealed several fungal enzymes homologous with FoPip4H, and five of these also had l-Pip trans-4-hydroxylation activity. In particular, the homologous Pip4H enzyme derived from Aspergillus nidulans FGSC A4 (AnPip4H) had a broader substrate specificity spectrum than other homologues and reacted with the l and d forms of various cyclic and aliphatic amino acids. Using FoPip4H as a biocatalyst, a system for the preparative-scale production of chiral trans-4-l-HyPip was successfully developed. Thus, we report a fungal family of l-Pip hydroxylases and the enzymatic preparation of trans-4-l-HyPip, a bioactive compound and a constituent of secondary metabolites with useful physiological activities. PMID:26801577
Varty, Keith; Arreguín, Barbarín L.; Gómez, Miguel T.; López, Pablo Jaime T.; Gómez, Miguel Angel L.
1983-01-01
Gibberellic acid-induced α-amylase synthesis in wheat aleurone layers (Triticum aestivum L. var Potam S-70) escaped from transcriptional control 30 h after addition of the hormone, as evidenced by the tissue's loss of susceptibility to cordycepin. Abscisic acid inhibited the accumulation of α-amylase activity when added to the tissue during this cordycepin-insensitive phase of enzyme induction. α-Amylase synthesis was not restored by the addition of cordycepin, indicating that the response to abscisic acid was not dependent upon the continuous synthesis of a short lived RNA. When ethylene was added simultaneously or some time after abscisic acid, the accumulation of α-amylase activity was sustained or quickly restored. The loss of susceptibility to cordycepin was completely prevented when aleurone layers were incubated with a combination of gibberellic and abscisic acids from the start of the induction period. This effect of abscisic acid was not reversed by ethylene. On the basis of these observations, it is suggested that abscisic acid inhibits both the transcription and translation of α-amylase mRNA, and that only the latter site of action is susceptible to reversal by ethylene. The rate of incorporation of [methyl-14C]choline into phospholipids was also inhibited by abscisic acid. Ethylene reversed this effect. The effects of abscisic acid and ethylene on phospholipid synthesis were not dependent upon the presence of gibberellic acid. No direct relationship was found between the control of α-amylase synthesis and membrane formation by abscisic acid and ethylene. PMID:16663284
A new regulatory mechanism for bacterial lipoic acid synthesis
Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun
2015-01-01
Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID
A new regulatory mechanism for bacterial lipoic acid synthesis.
Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun
2015-01-22
Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. © 2015
Synthesis and preliminary biological evaluations of (+)-isocampholenic acid-derived amides.
Grošelj, Uroš; Golobič, Amalija; Knez, Damijan; Hrast, Martina; Gobec, Stanislav; Ričko, Sebastijan; Svete, Jurij
2016-08-01
The synthesis of two novel (+)-isocampholenic acid-derived amines has been realized starting from commercially available (1S)-(+)-10-camphorsulfonic acid. The novel amines as well as (+)-isocampholenic acid have been used as building blocks in the construction of a library of amides using various aliphatic, aromatic, and amino acid-derived coupling partners using BPC and CDI as activating agents. Amide derivatives have been assayed against several enzymes that hold potential for the development of new drugs to battle bacterial infections and Alzheimer's disease. Compounds 20c and 20e showed promising selective sub-micromolar inhibition of human butyrylcholinesterase [Formula: see text] ([Formula: see text] values [Formula: see text] and [Formula: see text], respectively).
Hashim, Puziah
2014-03-01
Centella asiatica (Linn.) Urban is well known in promoting wound healing and provides significant benefits in skin care and therapeutic products formulation. Glycolic acid and vitamins also play a role in the enhancement of collagen and fibronectin synthesis. Here, we evaluate the specific effect of Centella asiatica (CA), vitamins, glycolic acid and their mixture preparations to stimulate collagen and fibronectin synthesis in cultured human fibroblast cells. The fibroblast cells are incubated with CA, glycolic acid, vitamins and their mixture preparations for 48 h. The cell lysates were analyzed for protein content and collagen synthesis by direct binding enzyme immunoassay. The fibronectin of the cultured supernatant was measured by sandwich enzyme immunoassay. The results showed that CA, glycolic acid, vitamins A, E and C significantly stimulate collagen and fibronectin synthesis in the fibroblast. Addition of glycolic acid and vitamins to CA further increased the levels of collagen and fibronectin synthesis to 8.55 and 23.75 μg/100 μg, respectively. CA, glycolic acid, vitamins A, E, and C, and their mixtures demonstrated stimulatory effect on both extra-cellular matrix synthesis of collagen and fibronectin in in vitro studies on human foreskin fibroblasts, which is beneficial to skin care and therapeutic products formulation.
Muto, Masaki; Kubota, Chihiro; Tanaka, Masayoshi; Satoh, Akira; Matsumoto, Mitsufumi; Yoshino, Tomoko; Tanaka, Tsuyoshi
2013-01-01
Oleaginous microalgae are one of the promising resource of nonedible biodiesel fuel (BDF) feed stock alternatives. Now a challenge task is the decrease of the long-chain polyunsaturated fatty acids (PUFAs) content affecting on the BDF oxidative stability by using gene manipulation techniques. However, only the limited knowledge has been available concerning the fatty acid and PUFA synthesis pathways in microalgae. Especially, the function of Δ9 desaturase, which is a key enzyme in PUFA synthesis pathway, has not been determined in diatom. In this study, 4 Δ(9) desaturase genes (fD9desA, fD9desB, fD9desC and fD9desD) from the oleaginous diatom Fistulifera were newly isolated and functionally characterized. The putative Δ(9) acyl-CoA desaturases in the endoplasmic reticulum (ER) showed 3 histidine clusters that are well-conserved motifs in the typical Δ(9) desaturase. Furthermore, the function of these Δ(9) desaturases was confirmed in the Saccharomyces cerevisiae ole1 gene deletion mutant (Δole1). All the putative Δ(9) acyl-CoA desaturases showed Δ(9) desaturation activity for C16∶0 fatty acids; fD9desA and fD9desB also showed desaturation activity for C18∶0 fatty acids. This study represents the first functional analysis of Δ(9) desaturases from oleaginous microalgae and from diatoms as the first enzyme to introduce a double bond in saturated fatty acids during PUFA synthesis. The findings will provide beneficial insights into applying metabolic engineering processes to suppressing PUFA synthesis in this oleaginous microalgal strain.
Huang, Huan; McIntosh, Avery L.; Martin, Gregory G.; Petrescu, Anca D.; Landrock, Kerstin K.; Landrock, Danilo; Kier, Ann B.; Schroeder, Friedhelm
2013-01-01
While TOFA (acetyl CoA carboxylase inhibitor) and C75 (fatty acid synthase inhibitor) prevent lipid accumulation by inhibiting fatty acid synthesis, the mechanism of action is not simply accounted for by inhibition of the enzymes alone. Liver fatty acid binding protein (L-FABP), a mediator of long chain fatty acid signaling to peroxisome proliferator-activated receptor-α (PPARα) in the nucleus, was found to bind TOFA and its activated CoA thioester, TOFyl-CoA, with high affinity while binding C75 and C75-CoA with lower affinity. Binding of TOFA and C75-CoA significantly altered L-FABP secondary structure. High (20 mM) but not physiological (6 mM) glucose conferred on both TOFA and C75 the ability to induce PPARα transcription of the fatty acid β-oxidative enzymes CPT1A, CPT2, and ACOX1 in cultured primary hepatocytes from wild-type (WT) mice. However, L-FABP gene ablation abolished the effects of TOFA and C75 in the context of high glucose. These effects were not associated with an increased cellular level of unesterified fatty acids but rather by increased intracellular glucose. These findings suggested that L-FABP may function as an intracellular fatty acid synthesis inhibitor binding protein facilitating TOFA and C75-mediated induction of PPARα in the context of high glucose at levels similar to those in uncontrolled diabetes. PMID:23533380
DGAT enzymes are required for triacylglycerol synthesis and lipid droplets in adipocytes[S
Harris, Charles A.; Haas, Joel T.; Streeper, Ryan S.; Stone, Scot J.; Kumari, Manju; Yang, Kui; Han, Xianlin; Brownell, Nicholas; Gross, Richard W.; Zechner, Rudolf; Farese, Robert V.
2011-01-01
The total contribution of the acyl CoA:diacylglycerol acyltransferase (DGAT) enzymes, DGAT1 and DGAT2, to mammalian triacylglycerol (TG) synthesis has not been determined. Similarly, whether DGAT enzymes are required for lipid droplet (LD) formation is unknown. In this study, we examined the requirement for DGAT enzymes in TG synthesis and LDs in differentiated adipocytes with genetic deletions of DGAT1 and DGAT2. Adipocytes with a single deletion of either enzyme were capable of TG synthesis and LD formation. In contrast, adipocytes with deletions of both DGATs were severely lacking in TG and did not have LDs, indicating that DGAT1 and DGAT2 account for nearly all TG synthesis in adipocytes and appear to be required for LD formation during adipogenesis. DGAT enzymes were not absolutely required for LD formation in mammalian cells, however; macrophages deficient in both DGAT enzymes were able to form LDs when incubated with cholesterol-rich lipoproteins. Although adipocytes lacking both DGATs had no TG or LDs, they were fully differentiated by multiple criteria. Our findings show that DGAT1 and DGAT2 account for the vast majority of TG synthesis in mice, and DGAT function is required for LDs in adipocytes, but not in all cell types. PMID:21317108
PROTEASOME INHIBITOR TREATMENT REDUCED FATTY ACID, TRIACYLGLYCEROL AND CHOLESTEROL SYNTHESIS
Oliva, Joan; French, Samuel W.; Li, Jun; Bardag-Gorce, Fawzia
2014-01-01
In the present study, the beneficial effects of proteasome inhibitor treatment in reducing ethanol-induced steatosis were investigated. A microarray analysis was performed on the liver of rats injected with PS-341 (Bortezomib, Velcade®), and the results showed that proteasome inhibitor treatment significantly reduced the mRNA expression of SREBP-1c, and the downstream lipogenic enzymes, such as fatty acid synthase (FAS) and acetyl-CoA carboxylase (ACC), which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ELOVL6, which is responsible for fatty acids long chain elongation, was also significantly down regulated by proteasome inhibitor treatment. Moreover, PS-341 administration significantly reduced the expression of acyl-glycerol-3-phosphate acyltransferase (AGPAT), and diacylglycerol acyltransferase (DGAT), enzyme involved in triacylglycerol (TAG) synthesis. Finally, PS-341 was found to down regulate the enzymes 3-hydroxy-3-methylglutaryl-CoenzymeA synthase (HMG-CoA synthase) that is responsible for cholesterol synthesis. Proteasome inhibitor was also found to play a role in intestinal lipid adsorption because apolipoproteins A (apoA-I, apoAII, apoA-IV and ApoCIII) were down regulated by proteasome inhibitor treatment, especially ApoA-II that is known to be a marker of alcohol consumption. Proteasome inhibitor treatment also decreased apobec-1 complementation factor (ACF) leading to lower level of editing and production of ApoB protein. Moreover apolipoprotein C-III, a major component of chylomicrons was significantly down regulated. However, lipoprotein lipase (Lpl) and High density lipoprotein binding protein (Hdlbp) mRNA levels were increased by proteasome inhibitor treatment. These results suggested that proteasome inhibitor treatment could be used to reduce the alcohol-enhanced lipogenesis and alcohol-induced liver steatosis. A morphologic analysis, performed on the liver of rats fed ethanol for one
Peng, Yingyun; Zhang, Tao; Mu, Wanmeng; Miao, Ming; Jiang, Bo
2016-01-15
Bacillus methylotrophicus SK19.001 is a glutamate-independent strain that produces poly(γ-glutamic acid) (γ-PGA), a polymer of D- and L-glutamic acids that possesses applications in food, the environment, agriculture, etc. This study was undertaken to explore the synthetic pathway of intracellular L- and D-glutamic acid in SK19.001 by investigating the effects of tricarboxylic acid cycle intermediates and different amino acids as metabolic precursors on the production of γ-PGA and analyzing the activities of the enzymes involved in the synthesis of L- and D-glutamate. Tricarboxylic acid cycle intermediates and amino acids could participate in the synthesis of γ-PGA via independent pathways in SK19.001. L-Aspartate aminotransferase, L-glutaminase and L-glutamate synthase were the enzymatic sources of L-glutamate. Glutamate racemase was responsible for the formation of D-glutamate for the synthesis of γ-PGA, and the synthetase had stereoselectivity for glutamate substrate. The enzymatic sources of L-glutamate were investigated for the first time in the glutamate-independent γ-PGA-producing strain, and multiple enzymatic sources of L-glutamate were verified in SK19.001, which will benefit efforts to improve production of γ-PGA with metabolic engineering strategies. © 2015 Society of Chemical Industry.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gu, Huiya; Jinkerson, Robert E.; Davies, Fiona K.
The isolation or engineering of algal cells synthesizing high levels of medium-chain fatty acids (MCFAs) is attractive to mitigate the high clouding point of longer chain fatty acids in algal based biodiesel. To develop a more informed understanding of MCFA synthesis in photosynthetic microorganisms, we isolated several algae from Great Salt Lake and screened this collection for MCFA accumulation to identify strains naturally accumulating high levels of MCFA. A diatom, Chaetoceros sp. GSL56, accumulated particularly high levels of C14 (up to 40%), with the majority of C14 fatty acids allocated in triacylglycerols. Using whole cell transcriptome sequencing and de novomore » assembly, putative genes encoding fatty acid synthesis enzymes were identified. Enzymes from this Chaetoceros sp. were expressed in the cyanobacterium Synechococcus sp. PCC 7002 to validate gene function and to determine whether eukaryotic enzymes putatively lacking bacterial evolutionary control mechanisms could be used to improve MCFA production in this promising production strain. Replacement of the Synechococcus 7002 native FabH with a Chaetoceros ketoacyl-ACP synthase Ill increased MCFA synthesis up to fivefold. In conclusion, the level of increase is dependent on promoter strength and culturing conditions.« less
Gu, Huiya; Jinkerson, Robert E.; Davies, Fiona K.; ...
2016-05-26
The isolation or engineering of algal cells synthesizing high levels of medium-chain fatty acids (MCFAs) is attractive to mitigate the high clouding point of longer chain fatty acids in algal based biodiesel. To develop a more informed understanding of MCFA synthesis in photosynthetic microorganisms, we isolated several algae from Great Salt Lake and screened this collection for MCFA accumulation to identify strains naturally accumulating high levels of MCFA. A diatom, Chaetoceros sp. GSL56, accumulated particularly high levels of C14 (up to 40%), with the majority of C14 fatty acids allocated in triacylglycerols. Using whole cell transcriptome sequencing and de novomore » assembly, putative genes encoding fatty acid synthesis enzymes were identified. Enzymes from this Chaetoceros sp. were expressed in the cyanobacterium Synechococcus sp. PCC 7002 to validate gene function and to determine whether eukaryotic enzymes putatively lacking bacterial evolutionary control mechanisms could be used to improve MCFA production in this promising production strain. Replacement of the Synechococcus 7002 native FabH with a Chaetoceros ketoacyl-ACP synthase Ill increased MCFA synthesis up to fivefold. In conclusion, the level of increase is dependent on promoter strength and culturing conditions.« less
Lipid sensing by mTOR complexes via de novo synthesis of phosphatidic acid
Menon, Deepak; Salloum, Darin; Bernfeld, Elyssa; Gorodetsky, Elizabeth; Akselrod, Alla; Frias, Maria A.; Sudderth, Jessica; Chen, Pei-Hsuan; DeBerardinis, Ralph; Foster, David A.
2017-01-01
mTOR, the mammalian target of rapamycin, integrates growth factor and nutrient signals to promote a transformation from catabolic to anabolic metabolism, cell growth, and cell cycle progression. Phosphatidic acid (PA) interacts with the FK506-binding protein–12-rapamycin-binding (FRB) domain of mTOR, which stabilizes both mTOR complexes: mTORC1 and mTORC2. We report here that mTORC1 and mTORC2 are activated in response to exogenously supplied fatty acids via the de novo synthesis of PA, a central metabolite for membrane phospholipid biosynthesis. We examined the impact of exogenously supplied fatty acids on mTOR in KRas-driven cancer cells, which are programmed to utilize exogenous lipids. The induction of mTOR by oleic acid was dependent upon the enzymes responsible for de novo synthesis of PA. Suppression of the de novo synthesis of PA resulted in G1 cell cycle arrest. Although it has long been appreciated that mTOR is a sensor of amino acids and glucose, this study reveals that mTOR also senses the presence of lipids via production of PA. PMID:28223357
Lipid sensing by mTOR complexes via de novo synthesis of phosphatidic acid.
Menon, Deepak; Salloum, Darin; Bernfeld, Elyssa; Gorodetsky, Elizabeth; Akselrod, Alla; Frias, Maria A; Sudderth, Jessica; Chen, Pei-Hsuan; DeBerardinis, Ralph; Foster, David A
2017-04-14
mTOR, the mammalian target of rapamycin, integrates growth factor and nutrient signals to promote a transformation from catabolic to anabolic metabolism, cell growth, and cell cycle progression. Phosphatidic acid (PA) interacts with the FK506-binding protein-12-rapamycin-binding (FRB) domain of mTOR, which stabilizes both mTOR complexes: mTORC1 and mTORC2. We report here that mTORC1 and mTORC2 are activated in response to exogenously supplied fatty acids via the de novo synthesis of PA, a central metabolite for membrane phospholipid biosynthesis. We examined the impact of exogenously supplied fatty acids on mTOR in KRas-driven cancer cells, which are programmed to utilize exogenous lipids. The induction of mTOR by oleic acid was dependent upon the enzymes responsible for de novo synthesis of PA. Suppression of the de novo synthesis of PA resulted in G 1 cell cycle arrest. Although it has long been appreciated that mTOR is a sensor of amino acids and glucose, this study reveals that mTOR also senses the presence of lipids via production of PA. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Huang, Huan; McIntosh, Avery L; Martin, Gregory G; Petrescu, Anca D; Landrock, Kerstin K; Landrock, Danilo; Kier, Ann B; Schroeder, Friedhelm
2013-01-01
While TOFA (acetyl CoA carboxylase inhibitor) and C75 (fatty acid synthase inhibitor) prevent lipid accumulation by inhibiting fatty acid synthesis, the mechanism of action is not simply accounted for by inhibition of the enzymes alone. Liver fatty acid binding protein (L-FABP), a mediator of long chain fatty acid signaling to peroxisome proliferator-activated receptor- α (PPAR α ) in the nucleus, was found to bind TOFA and its activated CoA thioester, TOFyl-CoA, with high affinity while binding C75 and C75-CoA with lower affinity. Binding of TOFA and C75-CoA significantly altered L-FABP secondary structure. High (20 mM) but not physiological (6 mM) glucose conferred on both TOFA and C75 the ability to induce PPAR α transcription of the fatty acid β -oxidative enzymes CPT1A, CPT2, and ACOX1 in cultured primary hepatocytes from wild-type (WT) mice. However, L-FABP gene ablation abolished the effects of TOFA and C75 in the context of high glucose. These effects were not associated with an increased cellular level of unesterified fatty acids but rather by increased intracellular glucose. These findings suggested that L-FABP may function as an intracellular fatty acid synthesis inhibitor binding protein facilitating TOFA and C75-mediated induction of PPAR α in the context of high glucose at levels similar to those in uncontrolled diabetes.
Fang, Huan; Dong, Huina; Cai, Tao; Zheng, Ping; Li, Haixing; Zhang, Dawei; Sun, Jibin
2016-01-01
In order to maximize the production of biologically-derived chemicals, kinetic analyses are first necessary for predicting the role of enzyme components and coordinating enzymes in the same reaction system. Precorrin-2 is a key precursor of cobalamin and siroheme synthesis. In this study, we sought to optimize the concentrations of several molecules involved in precorrin-2 synthesis in vitro: porphobilinogen synthase (PBGS), porphobilinogen deaminase (PBGD), uroporphyrinogen III synthase (UROS), and S-adenosyl-l-methionine-dependent urogen III methyltransferase (SUMT). Response surface methodology was applied to develop a kinetic model designed to maximize precorrin-2 productivity. The optimal molar ratios of PBGS, PBGD, UROS, and SUMT were found to be approximately 1:7:7:34, respectively. Maximum precorrin-2 production was achieved at 0.1966 ± 0.0028 μM/min, agreeing with the kinetic model's predicted value of 0.1950 μM/min. The optimal concentrations of the cofactor S-adenosyl-L-methionine (SAM) and substrate 5-aminolevulinic acid (ALA) were also determined to be 200 μM and 5 mM, respectively, in a tandem-enzyme assay. By optimizing the relative concentrations of these enzymes, we were able to minimize the effects of substrate inhibition and feedback inhibition by S-adenosylhomocysteine on SUMT and thereby increase the production of precorrin-2 by approximately five-fold. These results demonstrate the effectiveness of kinetic modeling via response surface methodology for maximizing the production of biologically-derived chemicals.
Deerberg, S; von Twickel, J; Förster, H H; Cole, T; Fuhrmann, J; Heise, K P
1990-02-01
During their rapid maturation period, seeds of Cuphea wrightii A. Gray mainly accumulate medium-chain fatty acids (C8 to C14) in their storage lipids. The rate of lipid deposition (40-50 mg·d(-1)·(g fresh weight)(-1)) is fourfold higher than in seeds of Cuphea racemosa (L. f.) Spreng, which accumulate long-chain fatty acids (C16 to C18). Measurements of the key enzymes of fatty-acid synthesis in cell-free extracts of seeds of different maturities from Cuphea wrightii show that malonyl-CoA synthesis may be a triggering factor for the observed high capacity for fatty-acid synthesis. Experiments on the incorporation of [1-(14)C]acetate into fatty acids by purified plastid preparations from embryos of Cuphea wrightii have demonstrated that the biosynthesis of medium-chain fatty acids (C8 to C14) is localized in the plastid. Thus, in the presence of cofactors for lipid synthesis (ATP, NADPH, NADH, acyl carrier protein, and sn-glycerol-3-phosphate), purified plastid fractions predominantly synthesized free fatty acids, 30% of which were of medium chain length. Transesterification of the freshly synthesized fatty acids to coenzyme A and recombination with the microsomal fraction of the embryo homogenate induced triacylglycerol synthesis. It also stimulated fatty-acid synthesis by a factor 2-3 and increased the relative amount of medium-chain fatty acids bound to triacylglycerols, which corresponded to about 60-80% in this lipid fraction.
Reconstruction of Cysteine Biosynthesis Using Engineered Cysteine-Free and Methionine-Free Enzymes
NASA Technical Reports Server (NTRS)
Wang, Kendrick; Fujishima, Kosuke; Abe, Nozomi; Nakahigashi, Kenji; Endy, Drew; Rothschild, Lynn J.
2016-01-01
Ten of the proteinogenic amino acids can be generated abiotically while the remaining thirteen require biology for their synthesis. Paradoxically, the biosynthesis pathways observed in nature require enzymes that are made with the amino acids they produce. For example, Escherichia coli produces cysteine from serine via two enzymes that contain cysteine. Here, we substituted alternate amino acids for cysteine and also methionine, which is biosynthesized from cysteine, in serine acetyl transferase (CysE) and O-acetylserine sulfhydrylase (CysM). CysE function was rescued by cysteine-and-methionine-free enzymes and CysM function was rescued by cysteine-free enzymes. Structural modeling suggests that methionine stabilizes CysM and is present in the active site of CysM. Cysteine is not conserved among CysE and CysM protein orthologs, suggesting that cysteine is not functionally important for its own synthesis. Engineering biosynthetic enzymes that lack the amino acids being synthesized provides insights into the evolution of amino acid biosynthesis and pathways for bioengineering.
Abscisic Acid Synthesis and Response
Finkelstein, Ruth
2013-01-01
Abscisic acid (ABA) is one of the “classical” plant hormones, i.e. discovered at least 50 years ago, that regulates many aspects of plant growth and development. This chapter reviews our current understanding of ABA synthesis, metabolism, transport, and signal transduction, emphasizing knowledge gained from studies of Arabidopsis. A combination of genetic, molecular and biochemical studies has identified nearly all of the enzymes involved in ABA metabolism, almost 200 loci regulating ABA response, and thousands of genes regulated by ABA in various contexts. Some of these regulators are implicated in cross-talk with other developmental, environmental or hormonal signals. Specific details of the ABA signaling mechanisms vary among tissues or developmental stages; these are discussed in the context of ABA effects on seed maturation, germination, seedling growth, vegetative stress responses, stomatal regulation, pathogen response, flowering, and senescence. PMID:24273463
Mir, Rafia; Jallu, Shais; Singh, T P
2015-06-01
The aromatic compounds such as aromatic amino acids, vitamin K and ubiquinone are important prerequisites for the metabolism of an organism. All organisms can synthesize these aromatic metabolites through shikimate pathway, except for mammals which are dependent on their diet for these compounds. The pathway converts phosphoenolpyruvate and erythrose 4-phosphate to chorismate through seven enzymatically catalyzed steps and chorismate serves as a precursor for the synthesis of variety of aromatic compounds. These enzymes have shown to play a vital role for the viability of microorganisms and thus are suggested to present attractive molecular targets for the design of novel antimicrobial drugs. This review focuses on the seven enzymes of the shikimate pathway, highlighting their primary sequences, functions and three-dimensional structures. The understanding of their active site amino acid maps, functions and three-dimensional structures will provide a framework on which the rational design of antimicrobial drugs would be based. Comparing the full length amino acid sequences and the X-ray crystal structures of these enzymes from bacteria, fungi and plant sources would contribute in designing a specific drug and/or in developing broad-spectrum compounds with efficacy against a variety of pathogens.
A Cascade of Thermophilic Enzymes As an Approach to the Synthesis of Modified Nucleotides.
Esipov, R S; Abramchik, Yu A; Fateev, I V; Konstantinova, I D; Kostromina, M A; Muravyova, T I; Artemova, K G; Miroshnikov, A I
2016-01-01
We propose a new approach for the synthesis of biologically important nucleotides which includes a multi-enzymatic cascade conversion of D -pentoses into purine nucleotides. The approach exploits nucleic acid exchange enzymes from thermophilic microorganisms: ribokinase, phosphoribosylpyrophosphate synthetase, and adenine phosphoribosyltransferase. We cloned the ribokinase gene from Thermus sp . 2.9, as well as two different genes of phosphoribosylpyrophosphate synthetase (PRPP-synthetase) and the adenine phosphoribosyltransferase (APR-transferase) gene from Thermus thermophilus HB27 into the expression vectors, generated high-yield E. coli producer strains, developed methods for the purification of the enzymes, and investigated enzyme substrate specificity. The enzymes were used for the conversion of D -pentoses into 5-phosphates that were further converted into 5-phospho-α- D -pentofuranose 1-pyrophosphates by means of ribokinase and PRPP-synthetases. Target nucleotides were obtained through the condensation of the pyrophosphates with adenine and its derivatives in a reaction catalyzed by APR-transferase. 2-Chloro- and 2-fluoroadenosine monophosphates were synthesized from D -ribose and appropriate heterobases in one pot using a system of thermophilic enzymes in the presence of ATP, ribokinase, PRPP-synthetase, and APR-transferase.
Cahoon, Edgar B.; Ripp, Kevin G.; Hall, Sarah E.; McGonigle, Brian
2002-01-01
Seed oils of a number of Asteraceae and Euphorbiaceae species are enriched in 12-epoxyoctadeca-cis-9-enoic acid (vernolic acid), an unusual 18-carbon Δ12-epoxy fatty acid with potential industrial value. It has been previously demonstrated that the epoxy group of vernolic acid is synthesized by the activity of a Δ12-oleic acid desaturase-like enzyme in seeds of the Asteraceae Crepis palaestina and Vernonia galamensis. In contrast, results from metabolic studies have suggested the involvement of a cytochrome P450 enzyme in vernolic acid synthesis in seeds of the Euphorbiaceae species Euphorbia lagascae. To clarify the biosynthetic origin of vernolic acid in E. lagascae seed, an expressed sequence tag analysis was conducted. Among 1,006 randomly sequenced cDNAs from developing E. lagascae seeds, two identical expressed sequence tags were identified that encode a cytochrome P450 enzyme classified as CYP726A1. Consistent with the seed-specific occurrence of vernolic acid in E. lagascae, mRNA corresponding to the CYP726A1 gene was abundant in developing seeds, but was not detected in leaves. In addition, expression of the E. lagascae CYP726A1 cDNA in Saccharomyces cerevisiae was accompanied by production of vernolic acid in cultures supplied with linoleic acid and an epoxy fatty acid tentatively identified as 12-epoxyoctadeca-9,15-dienoic acid (12-epoxy-18:2Δ9,15) in cultures supplied with α-linolenic acid. Consistent with this, expression of CYP726A1 in transgenic tobacco (Nicotiana tabacum) callus or somatic soybean (Glycine max) embryos resulted in the accumulation of vernolic acid and 12-epoxy-18:2Δ9,15. Overall, these results conclusively demonstrate that Asteraceae species and the Euphorbiaceae E. lagascae have evolved structurally unrelated enzymes to generate the Δ12-epoxy group of vernolic acid. PMID:11842164
Ishak, Nurazwa; Lajis, Ahmad Firdaus B; Mohamad, Rosfarizan; Ariff, Arbakariya B; Mohamed, Mohd Shamzi; Halim, Murni; Wasoh, Helmi
2018-02-24
The synthesis of kojic acid derivative (KAD) from kojic and palmitic acid (C16:0) in the presence of immobilized lipase from Rhizomucor miehei (commercially known as Lipozyme RMIM), was studied using a shake flask system. Kojic acid is a polyfunctional heterocycles that acts as a source of nucleophile in this reaction allowing the formation of a lipophilic KAD. In this study, the source of biocatalyst, Lipozyme RMIM, was derived from the lipase of Rhizomucor miehei immobilized on weak anion exchange macro-porous Duolite ES 562 by the adsorption technique. The effects of solvents, enzyme loading, reaction temperature, and substrate molar ratio on the reaction rate were investigated. In one-factor-at-a-time (OFAT) experiments, a high reaction rate (30.6 × 10 -3 M·min -1 ) of KAD synthesis was recorded using acetone, enzyme loading of 1.25% ( w / v ), reaction time of 12 h, temperature of 50 °C and substrate molar ratio of 5:1. Thereafter, a yield of KAD synthesis was optimized via the response surface methodology (RSM) whereby the optimized molar ratio (fatty acid: kojic acid), enzyme loading, reaction temperature and reaction time were 6.74, 1.97% ( w / v ), 45.9 °C, and 20 h respectively, giving a high yield of KAD (64.47%). This condition was reevaluated in a 0.5 L stirred tank reactor (STR) where the agitation effects of two impellers; Rushton turbine (RT) and pitch-blade turbine (PBT), were investigated. In the STR, a very high yield of KAD synthesis (84.12%) was achieved using RT at 250 rpm, which was higher than the shake flask, thus indicating better mixing quality in STR. In a rheological study, a pseudoplastic behavior of KAD mixture was proposed for potential application in lotion formulation.
Engineering Sialic Acid Synthesis Ability in Insect Cells.
Viswanathan, Karthik; Narang, Someet; Betenbaugh, Michael J
2015-01-01
Insect cells lack the ability to synthesize the sialic acid donor molecule CMP-sialic acid or its precursor, sialic acid. In this chapter, we describe a method to engineer CMP-sialic acid synthesis capability into Spodoptera frugiperda (Sf9) cells, a prototypical insect cell line, by recombinant expression of sialic acid synthesis pathway genes using baculovirus technology. Co-expression of a sialuria mutant UDP-GlcNAc-2-epimerase/ManNAc kinase (EKR263L), wild-type sialic acid 9-phosphate synthase (SAS), and wild-type CMP-sialic acid synthetase (CSAS) in the presence of GlcNAc leads to synthesis of CMP-sialic acids synthesis to support sialylation of N-glycans on glycoproteins.
Schiebel, Johannes; Kapilashrami, Kanishk; Fekete, Agnes; Bommineni, Gopal R.; Schaefer, Christin M.; Mueller, Martin J.; Tonge, Peter J.; Kisker, Caroline
2013-01-01
The survival of Mycobacterium tuberculosis depends on mycolic acids, very long α-alkyl-β-hydroxy fatty acids comprising 60–90 carbon atoms. However, despite considerable efforts, little is known about how enzymes involved in mycolic acid biosynthesis recognize and bind their hydrophobic fatty acyl substrates. The condensing enzyme KasA is pivotal for the synthesis of very long (C38–42) fatty acids, the precursors of mycolic acids. To probe the mechanism of substrate and inhibitor recognition by KasA, we determined the structure of this protein in complex with a mycobacterial phospholipid and with several thiolactomycin derivatives that were designed as substrate analogs. Our structures provide consecutive snapshots along the reaction coordinate for the enzyme-catalyzed reaction and support an induced fit mechanism in which a wide cavity is established through the concerted opening of three gatekeeping residues and several α-helices. The stepwise characterization of the binding process provides mechanistic insights into the induced fit recognition in this system and serves as an excellent foundation for the development of high affinity KasA inhibitors. PMID:24108128
Velasco-Lozano, Susana; da Silva, Eunice S; Llop, Jordi; López-Gallego, Fernando
2018-02-16
The enzymatic synthesis of α-amino acids is a sustainable and efficient alternative to chemical processes, through which achieving enantiopure products is difficult. To more address this synthesis efficiently, a hierarchical architecture that irreversibly co-immobilises an amino acid dehydrogenase with polyethyleneimine on porous agarose beads has been designed and fabricated. The cationic polymer acts as an irreversible anchoring layer for the formate dehydrogenase. In this architecture, the two enzymes and polymer colocalise across the whole microstructure of the porous carrier. This multifunctional heterogeneous biocatalyst was kinetically characterised and applied to the enantioselective synthesis of a variety of canonical and noncanonical α-amino acids in both discontinuous (batch) and continuous modes. The co-immobilised bienzymatic system conserves more than 50 % of its initial effectiveness after five batch cycles and 8 days of continuous operation. Additionally, the environmental impact of this process has been semiquantitatively calculated and compared with the state of the art. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Extending enzyme molecular recognition with an expanded amino acid alphabet
Windle, Claire L.; Simmons, Katie J.; Ault, James R.; Trinh, Chi H.; Nelson, Adam
2017-01-01
Natural enzymes are constructed from the 20 proteogenic amino acids, which may then require posttranslational modification or the recruitment of coenzymes or metal ions to achieve catalytic function. Here, we demonstrate that expansion of the alphabet of amino acids can also enable the properties of enzymes to be extended. A chemical mutagenesis strategy allowed a wide range of noncanonical amino acids to be systematically incorporated throughout an active site to alter enzymic substrate specificity. Specifically, 13 different noncanonical side chains were incorporated at 12 different positions within the active site of N-acetylneuraminic acid lyase (NAL), and the resulting chemically modified enzymes were screened for activity with a range of aldehyde substrates. A modified enzyme containing a 2,3-dihydroxypropyl cysteine at position 190 was identified that had significantly increased activity for the aldol reaction of erythrose with pyruvate compared with the wild-type enzyme. Kinetic investigation of a saturation library of the canonical amino acids at the same position showed that this increased activity was not achievable with any of the 20 proteogenic amino acids. Structural and modeling studies revealed that the unique shape and functionality of the noncanonical side chain enabled the active site to be remodeled to enable more efficient stabilization of the transition state of the reaction. The ability to exploit an expanded amino acid alphabet can thus heighten the ambitions of protein engineers wishing to develop enzymes with new catalytic properties. PMID:28196894
Macromolecular Synthesis During the Germination of Saccharomyces cerevisiae Spores
Rousseau, Paul; Halvorson, Harlyn O.
1973-01-01
After the dormancy of Saccharomyces cerevisiae ascospores had been broken, the synthesis of proteins was observed first, followed rapidly by synthesis of ribonucleic acid (RNA) and much later by deoxyribonucleic acid (DNA) synthesis. Phosphoglucomutase activity increased in a periodic (step) fashion, whereas the activity of five other enzymes increased linearly during germination and outgrowth. The rate of synthesis of these enzymes was highest at about the period of DNA replication. The amino acid pools of dormant spores contained high levels of proline, glutamic acid, and histidine. At 2 h after onset of germination, the pools of phenylalanine and methionine had disappeared and the other components had decreased significantly. By 3.5 h, with the exception of proline and cystine, most amino acid pool components had significantly increased. PMID:4570780
Tujioka, Kazuyo; Lyou, Sunok; Sano, Atushi; Hayase, Kazutoshi; Yokogoshi, Hidehiko
2004-10-01
The purpose of present study was to determine whether the regulation of urea synthesis is mediated through changes in supply of amino acids by protein synthesis and whether the concentration of ammonia, or activities of amino acid catabolizing enzymes, regulate urea synthesis when the dietary protein quality is manipulated. Experiments were done on three groups of rats given diets containing 10 g gluten, 10 g casein or 10 g whole egg protein/100 g for 10 d. The urinary excretion of urea, and the liver concentrations of glutamate, serine and alanine increased with a decrease in quality of dietary protein. The fractional and absolute rates of protein synthesis in tissues declined with the decrease in quality of dietary protein quality. The ammonia concentration in plasma and liver, and activities of hepatic amino acid catabolizing enzymes was not related to urea excretion under these conditions. These results suggest that the lower protein synthesis seen in tissues of rats given the lower quality of protein is likely to be one of the factors to increasing the supply of amino acids and stimulating urea synthesis.
Dey, Sanghamitra; Lane, James M; Lee, Richard E; Rubin, Eric J; Sacchettini, James C
2010-08-10
Mycobacterium tuberculosis (Mtb) depends on biotin synthesis for survival during infection. In the absence of biotin, disruption of the biotin biosynthesis pathway results in cell death rather than growth arrest, an unusual phenotype for an Mtb auxotroph. Humans lack the enzymes for biotin production, making the proteins of this essential Mtb pathway promising drug targets. To this end, we have determined the crystal structures of the second and third enzymes of the Mtb biotin biosynthetic pathway, 7,8-diaminopelargonic acid synthase (DAPAS) and dethiobiotin synthetase (DTBS), at respective resolutions of 2.2 and 1.85 A. Superimposition of the DAPAS structures bound either to the SAM analogue sinefungin or to 7-keto-8-aminopelargonic acid (KAPA) allowed us to map the putative binding site for the substrates and to propose a mechanism by which the enzyme accommodates their disparate structures. Comparison of the DTBS structures bound to the substrate 7,8-diaminopelargonic acid (DAPA) or to ADP and the product dethiobiotin (DTB) permitted derivation of an enzyme mechanism. There are significant differences between the Mtb enzymes and those of other organisms; the Bacillus subtilis DAPAS, presented here at a high resolution of 2.2 A, has active site variations and the Escherichia coli and Helicobacter pylori DTBS have alterations in their overall folds. We have begun to exploit the unique characteristics of the Mtb structures to design specific inhibitors against the biotin biosynthesis pathway in Mtb.
D-lysergic acid-activating enzyme from the ergot fungus Claviceps purpurea.
Keller, U; Zocher, R; Krengel, U; Kleinkauf, H
1984-01-01
A D-lysergic acid-activating enzyme from the ergot fungus Claviceps purpurea was purified about 145-fold. The enzyme was able to catalyse both the D-lysergic acid-dependent ATP-pyrophosphate exchange and the formation of ATP from D-lysergic acid adenylate and pyrophosphate. Both reactions were also catalysed to a decreased but significant extent with respect to dihydrolysergic acid. The molecular mass of the enzyme was estimated to lie between 135 and 140 kDa. The involvement of the enzyme in the biosynthesis of ergot peptide alkaloids is discussed. Images Fig. 4. PMID:6326747
NASA Astrophysics Data System (ADS)
Wijayati, N.; Masubah, K.; Supartono
2017-02-01
Lipase is an enzyme with large biotechnology applications, such as hydrolysis in the food industry, applications in chemical industry, synthesis of polymers and surfactants. Lipase was isolated from oyster mushroom with activity 0,93 U/mg and protein content 1,1234 mg/mL. Lipase was immobilized by entrapment method in a matrix of Ca-alginate. This report describes that we have developed for the synthesis of lauryl diethanolamide The result showed that the optimum condition of lipase immobilization was achieved on 3% Na-alginate solution with protein content 0,84 mg/mL and the activity 3,33 U/mg. An amide (22.911%) formed from the amidation of lauric acid and diethanolamine.
NASA Technical Reports Server (NTRS)
Weber, Arthur L.
1998-01-01
Formaldehyde and glycolaldehyde (substrates of the formose autocatalytic cycle) were shown to react with ammonia yielding alanine and homoserine under mild aqueous conditions in the presence of thiol catalysts. Since similar reactions carried out without ammonia yielded alpha-hydroxy acid thioesters, the thiol-dependent synthesis of alanine and homoserine is presumed to occur via amino acid thioesters-intermediates capable of forming peptides. A pH 5.2 solution of 20 mM formaldehyde, 20 mM glycolaldehyde, 20 mM ammonium chloride, 23 mM 3-mercaptopropionic acid, and 23 mM acetic acid that reacted for 35 days at 40 C yielded (based on initial formaldehyde) 1.8% alanine and 0.08% homoserine. In the absence of thiol catalyst, the synthesis of alanine and homoserine was negligible. Alanine synthesis required both formaldehyde and glycolaldehyde, but homoserine synthesis required only glycolaldehyde. At 25 days the efficiency of alanine synthesis calculated from the ratio of alanine synthesized to formaldehyde reacted was 2.1%, and the yield (based on initial formaldehyde) of triose and tetrose intermediates involved in alanine and homoserine synthesis was 0.3 and 2.1%, respectively. Alanine synthesis was also seen in similar reactions containing only 10 mM each of aldehyde substrates, ammonia, and thiol. The prebiotic significance of these reactions that use the formose reaction to generate sugar intermediates that are converted to reactive amino acid thioesters is discussed.
Wang, Jingxuan; Zhao, Peng; Li, Ying; Xu, Lida; Tian, Pingfang
2018-04-05
Klebsiella pneumoniae is a promising industrial species for bioproduction of bulk chemicals such as 1,3-propanediol, 2,3-butanediol and 3-hydroxypropionic acid (3-HP). However, lactic acid is a troublesome by-product when optimizing for 3-HP production. Therefore, it is highly desirable to minimize lactic acid. Here, we show that lactic acid synthesis can be largely blocked by an engineered CRISPR interference (CRISPRi) system in K. pneumoniae. EGFP was recruited as a reporter of this CRISPRi system. Fluorescence assay of this CRISPRi system showed that enhanced green fluorescent protein (EGFP) expression level was repressed by 85-90%. To further test this CRISPRi system, guide RNAs were designed to individually or simultaneously target four lactate-producing enzyme genes. Results showed that all lactate-producing enzyme genes were significantly repressed. Notably, D-lactate dehydrogenase (ldhA) was shown to be the most influential enzyme for lactic acid formation in micro-aerobic conditions, as inhibiting ldhA alone led to lactic acid level similar to simultaneously repressing four genes. In shake flask cultivation, the strain coexpressing puuC (an aldehyde dehydrogenase catalyzing 3-hydroxypropionaldehyde to 3-HP) and dCas9-sgRNA inhibiting ldhA produced 1.37-fold 3-HP relative to the reference strain. Furthermore, in bioreactor cultivation, this CRISPRi strain inhibiting ldhA produced 36.7 g/L 3-HP, but only generated 1 g/L lactic acid. Clearly, this engineered CRISPRi system largely simplified downstream separation of 3-HP from its isomer lactic acid, an extreme challenge for 3-HP bioprocess. This study offers a deep understanding of lactic acid metabolism in diverse species, and we believe that this CRISPRi system will facilitate biomanufacturing and functional genome studies of K. pneumoniae or beyond.
Ethosuximide: liver enzyme induction and D-glucaric acid excretion.
Gilbert, J C; Scott, A K; Galloway, D B; Petrie, J C
1974-06-01
1 A study has been carried out to determine if ethosuximide induces liver enzymes. 2 Ethosuximide did not affect the urinary excretion of D-glucaric acid by healthy adult subjects nor was the mean daily D-glucaric acid excretion of three epileptic children on long term ethosuximide therapy different from that of three matched controls. 3 Ethosuximide (10 mg/kg or 50 mg/kg daily) did not influence D-glucaric acid excretion or liver microsomal protein and cytochrome P450 contents of guinea pigs but at a dose of 100 mg/kg daily in rats it increased liver microsomal protein and cytochrome P450 without altering D-glucaric acid excretion. 4 These results suggest that at anticonvulsant doses ethosuximide is unlikely to induce liver enzymes. The precise relationship between D-glucaric acid excretion and liver enzyme induction remains in doubt.
Origin of fatty acid synthesis - Thermodynamics and kinetics of reaction pathways
NASA Technical Reports Server (NTRS)
Weber, Arthur L.
1991-01-01
The primitiveness of contemporary fatty acid biosynthesis was evaluated by using the thermodynamics and kinetics of its component reactions to estimate the extent of its dependence on powerful and selective catalysis by enzymes. Since this analysis indicated that the modern pathway is not primitive because it requires sophisticated enzymatic catalysis, an alternative pathway of primitive fatty acid synthesis is proposed that uses glycolaldehyde as a substrate. In contrast to the modern pathway, this primitive pathway is not dependent on an exogenous source of phosphoanhydride energy. Furthermore, the chemical spontaneity of its reactions suggests that it could have been readily catalyzed by the rudimentary biocatalysts available at an early stage in the origin of life.
The synthesis of starch from carbon dioxide using isolubilized stabilized enzymes
NASA Technical Reports Server (NTRS)
Bassham, J. A.; Bearden, L.; Wilke, C.; Carroad, P.; Mitra, G.; Ige, R.
1972-01-01
Systems for artificial manufacture of starch and for delineation of technological areas, and the rationale for studying them are considered. A discussion of the enzyme-catalyzed routes of synthesis available and a choice as to the most promising route are presented. A discussion of the enzymes involved, of enzyme insolubilization technology, and of possible engineering approaches, with examples in the form of model calculations for both reactors and separators, are also presented.
Kelly, Daniel M; Nettleship, Joanne E; Akhtar, Samia; Muraleedharan, Vakkat; Sellers, Donna J; Brooke, Jonathan C; McLaren, David S; Channer, Kevin S; Jones, T Hugh
2014-07-30
Non-alcoholic fatty liver disease and its precursor hepatic steatosis is common in obesity and type-2 diabetes and is associated with cardiovascular disease (CVD). Men with type-2 diabetes and/or CVD have a high prevalence of testosterone deficiency. Testosterone replacement improves key cardiovascular risk factors. The effects of testosterone on hepatic steatosis are not fully understood. Testicular feminised (Tfm) mice, which have a non-functional androgen receptor (AR) and very low serum testosterone levels, were used to investigate testosterone effects on high-cholesterol diet-induced hepatic steatosis. Hepatic lipid deposition was increased in Tfm mice and orchidectomised wild-type littermates versus intact wild-type littermate controls with normal androgen physiology. Lipid deposition was reduced in Tfm mice receiving testosterone treatment compared to placebo. Oestrogen receptor blockade significantly, but only partially, reduced the beneficial effects of testosterone treatment on hepatic lipid accumulation. Expression of key regulatory enzymes of fatty acid synthesis, acetyl-CoA carboxylase alpha (ACACA) and fatty acid synthase (FASN) were elevated in placebo-treated Tfm mice versus placebo-treated littermates and Tfm mice receiving testosterone treatment. Tfm mice on normal diet had increased lipid accumulation compared to littermates but significantly less than cholesterol-fed Tfm mice and demonstrated increased gene expression of hormone sensitive lipase, stearyl-CoA desaturase-1 and peroxisome proliferator-activated receptor-gamma but FASN and ACACA were not altered. An action of testosterone on hepatic lipid deposition which is independent of the classic AR is implicated. Testosterone may act in part via an effect on the key regulatory lipogenic enzymes to protect against hepatic steatosis. Copyright © 2014 Elsevier Inc. All rights reserved.
Chen, Cong; Han, Xiao; Zou, Xuan; Li, Yuan; Yang, Liang; Cao, Ke; Xu, Jie; Long, Jiangang; Liu, Jiankang; Feng, Zhihui
2014-01-01
4-Methylene-2-octyl-5-oxotetrahydrofuran-3-carboxylic acid (C75) is a synthetic fatty-acid synthase (FASN) inhibitor with potential therapeutic effects in several cancer models. Human mitochondrial β-ketoacyl-acyl carrier protein synthase (HsmtKAS) is a key enzyme in the newly discovered mitochondrial fatty acid synthesis pathway that can produce the substrate for lipoic acid (LA) synthesis. HsmtKAS shares conserved catalytic domains with FASN, which are responsible for binding to C75. In our study, we explored the possible effect of C75 on HsmtKAS and mitochondrial function. C75 treatment decreased LA content, impaired mitochondrial function, increased reactive oxygen species content, and reduced cell viability. HsmtKAS but not FASN knockdown had an effect that was similar to C75 treatment. In addition, an LA supplement efficiently inhibited C75-induced mitochondrial dysfunction and oxidative stress. Overexpression of HsmtKAS showed cellular protection against low dose C75 addition, whereas there was no protective effect upon high dose C75 addition. In summary, the mitochondrial fatty acid synthesis pathway has a vital role in mitochondrial function. Besides FASN, C75 might also inhibit HsmtKAS, thereby reducing LA production, impairing mitochondrial function, and potentially having toxic effects. LA supplements sufficiently ameliorated the toxicity of C75, showing that a combination of C75 and LA may be a reliable cancer treatment. PMID:24784139
Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z.; Yazdani, Syed Shams
2016-01-01
Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817
Palanisamy, Kanmani; Kuppamuthu, Kumaresan; Jeyaseelan, Aravind
2015-09-01
Lipase is an enzyme with immense application potential. Ester synthesis by lipase catalysis in organic media is an area of key industrial relevance. Enzymatic preparations with traits that cater to the needs of this function are hence being intensely researched. The objectives of the study were to immobilize the lipase from Bacillus sp. PS35 by cross-linking and adsorption onto styrene-divinyl benzene (Sty-Dvb) hydrophobic resin and to comparatively characterize the free and immobilized lipase preparations. The work also aimed to apply the immobilized lipase for catalysing the fatty acid methyl ester (FAME) synthesis from palm oil and optimize the process parameters for maximizing the yield. In this study, the purified lipase from Bacillus sp. PS35 was immobilized by adsorption onto styrene-divinyl benzene hydrophobic resin with gluteraldehyde cross-linking. The immobilized enzyme showed better pH and temperature stabilities than the free lipase. Organic solvent stability was also enhanced, with the relative activity in the presence of methanol being shifted from 53% to 81%, thereby facilitating the enzyme's application in fatty acid methyl ester synthesis. It exhibited remarkable storage stability over a 30-day period and after 20 repetitive uses. Cross-linking also reduced enzyme leakage by 49%. The immobilized lipase was then applied for biodiesel production from palm oil. Methanol and oil molar ratio of 5:1, three step methanol additions, and an incubation temperature of 50°C were established to be the ideal conditions favoring the transesterification reaction, resulting in 97% methyl ester yield. These promising results offer scope for further investigation and process scale up, permitting the enzyme's commercial application in a practically feasible and economically agreeable manner.
Donini, Pierluigi
1970-01-01
Starvation for a required amino acid of normal or RCstrEscherichia coli infected with T-even phages arrests further synthesis of phage deoxyribonucleic acid (DNA). This amino acid control over phage DNA synthesis does not occur in RCrelE. coli mutants. Heat inactivation of a temperature-sensitive aminoacyl-transfer ribonucleic acid (RNA) synthetase similarly causes an arrest of phage DNA synthesis in infected cells of RCstr phenotype but not in cells of RCrel phenotype. Inhibition of phage DNA synthesis in amino acid-starved RCstr host cells can be reversed by addition of chloramphenicol to the culture. Thus, the general features of amino acid control over T-even phage DNA synthesis are entirely analogous to those known for amino acid control over net RNA synthesis of uninfected bacteria. This analogy shows that the bacterial rel locus controls a wider range of macromolecular syntheses than had been previously thought. PMID:4914067
Oxidation of indole-3-acetic acid to oxindole-3-acetic acid by an enzyme preparation from Zea mays
NASA Technical Reports Server (NTRS)
Reinecke, D. M.; Bandurski, R. S.
1988-01-01
Indole-3-acetic acid is oxidized to oxindole-3-acetic acid by Zea mays tissue extracts. Shoot, root, and endosperm tissues have enzyme activities of 1 to 10 picomoles per hour per milligram protein. The enzyme is heat labile, is soluble, and requires oxygen for activity. Cofactors of mixed function oxygenase, peroxidase, and intermolecular dioxygenase are not stimulatory to enzymic activity. A heat-stable, detergent-extractable component from corn enhances enzyme activity 6- to 10-fold. This is the first demonstration of the in vitro enzymic oxidation of indole-3-acetic acid to oxindole-3-acetic acid in higher plants.
Tuning of acyl-ACP thioesterase activity directed for tailored fatty acid synthesis.
Feng, Yanbin; Zhang, Yunxiu; Wang, Yayue; Liu, Jiao; Liu, Yinghui; Cao, Xupeng; Xue, Song
2018-04-01
Medium-chain fatty acids have attracted significant attention as sources of biofuels in recent years. Acyl-ACP thioesterase, which is considered as the key enzyme to determine the carbon chain length, catalyzes the termination of de novo fatty acid synthesis. Although recombinant medium-chain acyl-ACP thioesterase (TE) affects the fatty acid profile in heterologous cells, tailoring of the fatty acid composition merely by engineering a specific TE is still intractable. In this study, the activity of a C8-C10-specific thioesterase FatB2 from Cuphea hookeriana on C10-ACP was quantified twice as high as that on C8-ACP based on a synthetic C8-C16 acyl-ACP pool in vitro. Whereas in vivo, it was demonstrated that ChFatB2 preferred to accumulate C8 fatty acids with 84.9% composition in the ChFatB2-engineered E. coli strain. To achieve C10 fatty acid production, ChFatB2 was rationally tuned based on structural investigation and enzymatic analysis. An I198E mutant was identified to redistribute the C8-ACP flow, resulting in C10 fatty acid being produced as the principal component at 57.6% of total fatty acids in vivo. It was demonstrated that the activity of TE relative to β-ketoacyl-ACP synthases (KAS) directly determined the fatty acid composition. Our results provide a prospective strategy in tailoring fatty acid synthesis by tuning of TE activities based on TE-ACP interaction.
Molecular characterization of an enzyme that degrades neuromodulatory fatty-acid amides.
Cravatt, B F; Giang, D K; Mayfield, S P; Boger, D L; Lerner, R A; Gilula, N B
1996-11-07
Endogenous neuromodulatory molecules are commonly coupled to specific metabolic enzymes to ensure rapid signal inactivation. Thus, acetylcholine is hydrolysed by acetylcholine esterase and tryptamine neurotransmitters like serotonin are degraded by monoamine oxidases. Previously, we reported the structure and sleep-inducing properties of cis-9-octadecenamide, a lipid isolated from the cerebrospinal fluid of sleep-deprived cats. cis-9-Octadecenamide, or oleamide, has since been shown to affect serotonergic systems and block gap-junction communication in glial cells (our unpublished results). We also identified a membrane-bound enzyme activity that hydrolyses oleamide to its inactive acid, oleic acid. We now report the mechanism-based isolation, cloning and expression of this enzyme activity, originally named oleamide hydrolase, from rat liver plasma membranes. We also show that oleamide hydrolase converts anandamide, a fatty-acid amide identified as the endogenous ligand for the cannabinoid receptor, to arachidonic acid, indicating that oleamide hydrolase may serve as the general inactivating enzyme for a growing family of bioactive signalling molecules, the fatty-acid amides. Therefore we will hereafter refer to oleamide hydrolase as fatty-acid amide hydrolase, in recognition of the plurality of fatty-acid amides that the enzyme can accept as substrates.
Kinetics of leather dyeing pretreated with enzymes: role of acid protease.
Kanth, Swarna Vinodh; Venba, Rajangam; Jayakumar, Gladstone Christopher; Chandrababu, Narasimhan Kannan
2009-04-01
In the present investigation, kinetics of dyeing involving pretreatment with acid protease has been presented. Application of acid protease in dyeing process resulted in increased absorption and diffusion of dye into the leather matrix. Enzyme treatment at 1% concentration, 60 min duration and 50 degrees C resulted in maximum of 98% dye exhaustion and increased absorption rate constants. The final exhaustion (C(infinity)) for the best fit of CI Acid Black 194 dye has been 98.5% with K and r2 values from the modified Cegarra-Puente isotherm as 0.1033 and 0.0631. CI Acid Black 194 being a 2:1 metal complex acid dye exhibited higher absorption rate than the acid dye CI Acid Black 210. A reduction in 50% activation energy calculated from Arrhenius equation has been observed in enzyme assisted dyeing process of both the dyes that substantiates enhanced dye absorption. The absorption rate constant calculated with modified Cegarra-Puente equation confirm higher rate constants and faster kinetics for enzyme assisted dyeing process. Enzyme treated leather exhibited richness of color and shade when compared with control. The present study substantiates the essential role of enzyme pretreatment as an eco-friendly leather dyeing process.
Regulation of retinoic acid synthetic enzymes by WT1 and HDAC inhibitors in 293 cells.
Li, Yifan; Wang, Lei; Ai, Weipeng; He, Nianhui; Zhang, Lin; Du, Jihui; Wang, Yong; Mao, Xingjian; Ren, Junqi; Xu, Dan; Zhou, Bei; Li, Rong; Mai, Liwen
2017-09-01
All-trans retinoic acid (atRA), which is mainly generated endogenously via two steps of oxidation from vitamin A (retinol), plays an indispensible role in the development of the kidney and many other organs. Enzymes that catalyze the oxidation of retinol to generate atRA, including aldehyde dehydrogenase 1 family (ALDH1)A1, ALDH1A2 and ALDH1A3, exhibit complex expression patterns at different stages of renal development. However, molecular triggers that control these differential expression levels are poorly understood. In this study, we provide in vitro evidence to demonstrate that Wilms' tumor 1 (WT1) negatively regulates the expression of the atRA synthetic enzymes, ALDH1A1, ALDH1A2 and ALDH1A3, in the 293 cell line, leading to significant blockage of atRA production. Furthermore, we demonstrate that the suppression of ALDH1A1 by WT1 can be markedly attenuated by histone deacetylase inhibitors (HDACis). Taken together, we provide evidence to indicate that WT1 and HDACs are strong regulators of endogenous retinoic acid synthetic enzymes in 293 cells, indicating that they may be involved in the regulation of atRA synthesis.
Browne, Christopher M.; Samir, Parimal; Fites, J. Scott; Villarreal, Seth A.
2013-01-01
Using affinity purifications coupled with mass spectrometry and yeast two-hybrid assays, we show the Saccharomyces cerevisiae translation initiation factor complex eukaryotic translation initiation factor 2B (eIF2B) and the very-long-chain fatty acid (VLCFA) synthesis keto-reductase enzyme YBR159W physically interact. The data show that the interaction is specifically between YBR159W and eIF2B and not between other members of the translation initiation or VLCFA pathways. A ybr159wΔ null strain has a slow-growth phenotype and a reduced translation rate but a normal GCN4 response to amino acid starvation. Although YBR159W localizes to the endoplasmic reticulum membrane, subcellular fractionation experiments show that a fraction of eIF2B cofractionates with lipid membranes in a YBR159W-independent manner. We show that a ybr159wΔ yeast strain and other strains with null mutations in the VLCFA pathway cause eIF2B to appear as numerous foci throughout the cytoplasm. PMID:23263984
Patel, Unisha; Chauhan, Kishor; Gupte, Shilpa
2018-04-01
In the present work, magnetic nanoparticles (MNPs) were prepared by chemical precipitation of trivalent and divalent iron ions which were functionalized using citric acid. The bacterial isolate Staphylococcus epidermidis KX781317 was isolated from oil-contaminated site. The isolate produced lipase, which was purified and immobilized on magnetic nanoparticles (MNPs) for ester synthesis from waste frying oil (WFO). The characterization of MNPs employed conventional TEM, XRD and FTIR techniques. TEM analysis of MNPs showed the particle size in the range of 20-50 nm. FTIR spectra revealed the binding of citric acid to Fe 3 O 4 and lipase on citric acid-coated MNPs. The citric acid-coated MNPs and lipase-conjugated citric acid-coated MNPs had similar XRD patterns which indicate MNPs could preserve their magnetic properties. The maximum immobilization efficiency 98.21% of lipase-containing citric acid-coated MNPs was observed at ratio 10:1 of Cit-MNPs:lipase. The pH and temperature optima for lipase conjugated with Cit-MNPs were 7 and 35 °C, respectively. Isobutanol was found to be an effective solvent for ester synthesis and 1:2 ratio of oil:alcohol observed significant for ester formation. The ester formation was determined using TLC and the % yield of ester conversion was calculated. The rate of ester formation is directly proportional to the enzyme load. Formed esters were identified as isobutyl laurate ester and isobutyl myristate ester through GC-MS analysis.
Lipoic acid biosynthesis defects.
Mayr, Johannes A; Feichtinger, René G; Tort, Frederic; Ribes, Antonia; Sperl, Wolfgang
2014-07-01
Lipoate is a covalently bound cofactor essential for five redox reactions in humans: in four 2-oxoacid dehydrogenases and the glycine cleavage system (GCS). Two enzymes are from the energy metabolism, α-ketoglutarate dehydrogenase and pyruvate dehydrogenase; and three are from the amino acid metabolism, branched-chain ketoacid dehydrogenase, 2-oxoadipate dehydrogenase, and the GCS. All these enzymes consist of multiple subunits and share a similar architecture. Lipoate synthesis in mitochondria involves mitochondrial fatty acid synthesis up to octanoyl-acyl-carrier protein; and three lipoate-specific steps, including octanoic acid transfer to glycine cleavage H protein by lipoyl(octanoyl) transferase 2 (putative) (LIPT2), lipoate synthesis by lipoic acid synthetase (LIAS), and lipoate transfer by lipoyltransferase 1 (LIPT1), which is necessary to lipoylate the E2 subunits of the 2-oxoacid dehydrogenases. The reduced form dihydrolipoate is reactivated by dihydrolipoyl dehydrogenase (DLD). Mutations in LIAS have been identified that result in a variant form of nonketotic hyperglycinemia with early-onset convulsions combined with a defect in mitochondrial energy metabolism with encephalopathy and cardiomyopathy. LIPT1 deficiency spares the GCS, and resulted in a combined 2-oxoacid dehydrogenase deficiency and early death in one patient and in a less severely affected individual with a Leigh-like phenotype. As LIAS is an iron-sulphur-cluster-dependent enzyme, a number of recently identified defects in mitochondrial iron-sulphur cluster synthesis, including NFU1, BOLA3, IBA57, GLRX5 presented with deficiency of LIAS and a LIAS-like phenotype. As in DLD deficiency, a broader clinical spectrum can be anticipated for lipoate synthesis defects depending on which of the affected enzymes is most rate limiting.
Arunima, Sakunthala; Rajamohan, Thankappan
2014-05-28
The present study was carried out to evaluate the effects of virgin coconut oil (VCO) compared with copra oil, olive oil and sunflower-seed oil on the synthesis and oxidation of fatty acids and the molecular regulation of fatty acid metabolism in normal rats. Male Sprague-Dawley rats were fed the test oils at 8 % for 45 d along with a synthetic diet. Dietary supplementation of VCO decreased tissue lipid levels and reduced the activity of the enzymes involved in lipogenesis, namely acyl CoA carboxylase and fatty acid synthase (FAS) (P< 0·05). Moreover, VCO significantly (P< 0·05) reduced the de novo synthesis of fatty acids by down-regulating the mRNA expression of FAS and its transcription factor, sterol regulatory element-binding protein-1c, compared with the other oils. VCO significantly (P< 0·05) increased the mitochondrial and peroxisomal β-oxidation of fatty acids, which was evident from the increased activities of carnitine palmitoyl transferase I, acyl CoA oxidase and the enzymes involved in mitochondrial β-oxidation; this was accomplished by up-regulating the mRNA expression of PPARα and its target genes involved in fatty acid oxidation. In conclusion, the present results confirmed that supplementation of VCO has beneficial effects on lipid parameters by reducing lipogenesis and enhancing the rate of fatty acid catabolism; this effect was mediated at least in part via PPARα-dependent pathways. Thus, dietary VCO reduces the risk for CHD by beneficially modulating the synthesis and degradation of fatty acids.
Isolation of Escherichia coli mutants defective in enzymes of membrane lipid synthesis.
Raetz, C R
1975-01-01
A new method has been developed which permits the rapid screening of E. coli colonies for mutants with defective enzymes of phospholipid metabolism. In this procedure, a disc of filter paper is pressed down on an agar plate containing several hundred colonies of mutagen-treated cells, after which the paper is lifted off. In the process the colonies are transferred to the paper, giving rise to a replica print of the master plate. The few cells from each colony left on the master keep growing in the original pattern. The pattern of colonies is also retained on the filter paper, even after the cells are rendered permeable with lysozyme and EDTA. Colonies treated in this manner remain absorbed to the paper, where they can convert sn-(U-14-C)glycero-3-P to phosphatidyl(U-14-C)glycerophosphate, dependent on added CDP-diglyceride. Unrelated reactions of sn-(U-14-C)glycero-3-P that may obscure the synthesis of phosphatidyl-glycerophosphate are inhibited by the addition of reagents poisoning energy generation. The radioactive phospholipid that forms around each colony on the paper is precipitated in situ with trichloroacetic acid, and unreacted sn-(U-14-C)glycero-3-P is washed away. After autoradiography, the colonies on the filter paper are stained with Coomassie blue. When the autoradiogram is superimposed on the strained paper, mutants are identified as blue colonies lacking a black halo. With this method, 20,000 colonies were screened in several days. Four mutants were identified with low levels of CDP-diglyceride:snglycero-3-P phosphatidyl transferase (EC 2.7.8.5, GLYCEROL-PHOSPHATE PHOSPHATIDYLTRANSFERASE, PHOSPHATIDYLGLYCEROPHOSPHATE SYNTHETASE) IN EXTRACTS. With a similar assay, 10,000 additional colonies were screened for mutants with altered CDP-diglyceride:L-serine O-phosphatidyltransferase (EC 2.7.8.8, phosphatidylserine synthetase), and four strains were found in which the enzyme is thermolabile. The screening technique described here is termed replica printing
Lange, Kerstin; Schmid, Andreas; Julsing, Mattijs K
2015-10-10
Δ(9)-Tetrahydrocannabinol (THC) is of increasing interest as a pharmaceutical and bioactive compound. Chemical synthesis of THC uses a laborious procedure and does not satisfy the market demand. The implementation of biocatalysts for specific synthesis steps might be beneficial for making natural product availability independent from the plant. Δ(9)-Tetrahydrocannabinolic acid synthase (THCAS) from C. sativa L. catalyzes the cyclization of cannabigerolic acid (CBGA) to Δ(9)-tetrahydrocannabinolic acid (THCA), which is non-enzymatically decarboxylated to THC. We report the preparation of THCAS in amounts sufficient for the biocatalytic production of THC(A). Active THCAS was most efficiently obtained from Pichia pastoris. THCAS was produced on a 2L bioreactor scale and the enzyme was isolated by single-step chromatography with a specific activity of 73Ug(-1)total protein. An organic/aqueous two-liquid phase setup for continuous substrate delivery facilitated in situ product removal. In addition, THCAS activity in aqueous environments lasted for only 20min whereas the presence of hexane stabilized the activity over 3h. In conclusion, production of THCAS in P. pastoris Mut(S) KM71 KE1, subsequent isolation, and its application in a two-liquid phase setup enables the synthesis of THCA on a mg scale. Copyright © 2015 Elsevier B.V. All rights reserved.
Synthesis of Polymeric Microcapsule Arrays and Their Use for Enzyme Immobilization
1994-04-01
Polymeric Microcapsule Arrays and Their Use for Enzyme Immobilization by R. Parthasarathy and C. R. Martin Prepared for publication in Nature DTICI...REPORT TYPE AND DATES COVERED April 1994 Interim 4. TITLE AND SUBTITLE S. FUNDING NUMBERS Synthesis of Polymeric Microcapsule Arrays and Their Contract...include adsorption or covalent attachment to a support, microencapsulation and entrapment within a membrane/film or gel. The ideal enzyme
Davis, J.W. Jr.
1979-09-21
A method is described for synthesizing amino acids preceding through novel intermediates of the formulas: R/sub 1/R/sub 2/C(OSOC1)CN, R/sub 1/R/sub 2/C(C1)CN and (R/sub 1/R/sub 2/C(CN)O)/sub 2/SO wherein R/sub 1/ and R/sub 2/ are each selected from hydrogen and monovalent hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.
Xing, Mei-Ning; Zhang, Xue-Zhu; Huang, He
2012-01-01
Feedstock for biofuel synthesis is transitioning to lignocelluosic biomass to address criticism over competition between first generation biofuels and food production. As microbial catalysis is increasingly applied for the conversion of biomass to biofuels, increased import has been placed on the development of novel enzymes. With revolutionary advances in sequencer technology and metagenomic sequencing, mining enzymes from microbial communities for biofuel synthesis is becoming more and more practical. The present article highlights the latest research progress on the special characteristics of metagenomic sequencing, which has been a powerful tool for new enzyme discovery and gene functional analysis in the biomass energy field. Critical enzymes recently developed for the pretreatment and conversion of lignocellulosic materials are evaluated with respect to their activity and stability, with additional explorations into xylanase, laccase, amylase, chitinase, and lipolytic biocatalysts for other biomass feedstocks. Copyright © 2012 Elsevier Inc. All rights reserved.
Höfner, Roswitha; Vazquez-Moreno, Luz; Winter, Klaus; Bohnert, Hans J.; Schmitt, Jürgen M.
1987-01-01
Intact plants of the halophilic species Mesembryanthemum crystallinum were induced to exhibit Crassulacean acid metabolism by irrigation with nutrient solution containing 500 millimolar NaCl. During the induction period, the extractable activity of phosphoenolpyruvate carboxylase (PEPcase) increased approximately 40-fold. This increase was linearly correlated with a mass increase of PEPcase protein as measured by single radial immunodiffusion. De novo synthesis of PEPcase protein was shown by immunoprecipitation of the newly synthesized, radioactively labeled protein in leaf discs from salt-treated plants. Nontreated plants were characterized by a low level of the enzyme and low rates of PEPcase synthesis. Synthesis of this enzyme in leaf discs was correlated with the concentration of NaCl in the nutrient solution during growth. Images Fig. 1 Fig. 2 Fig. 3 PMID:16665363
Clinical Relevance of Type II Fatty Acid Synthesis Bypass in Staphylococcus aureus
Guillemet, Mélanie; Soler, Charles; Morvan, Claire; Halpern, David; Pourcel, Christine; Vu Thien, Hoang; Lamberet, Gilles
2017-01-01
ABSTRACT The need for new antimicrobials to treat bacterial infections has led to the use of type II fatty acid synthesis (FASII) enzymes as front-line targets. However, recent studies suggest that FASII inhibitors may not work against the opportunist pathogen Staphylococcus aureus, as environmental fatty acids favor emergence of multi-anti-FASII resistance. As fatty acids are abundant in the host and one FASII inhibitor, triclosan, is widespread, we investigated whether fatty acid pools impact resistance in clinical and veterinary S. aureus isolates. Simple addition of fatty acids to the screening medium led to a 50% increase in triclosan resistance, as tested in 700 isolates. Moreover, nonculturable triclosan-resistant fatty acid auxotrophs, which escape detection under routine conditions, were uncovered in primary patient samples. FASII bypass in selected isolates correlated with polymorphisms in the acc and fabD loci. We conclude that fatty-acid-dependent strategies to escape FASII inhibition are common among S. aureus isolates and correlate with anti-FASII resistance and emergence of nonculturable variants. PMID:28193654
Shimizu, Takayuki; Inoue, Ken-ichi; Hachiya, Hiroyuki; Shibuya, Norisuke; Shimoda, Mitsugi; Kubota, Keiichi
2014-09-01
Cancer cells show enhanced glycolysis and inhibition of oxidative phosphorylation, even in the presence of sufficient oxygen (aerobic glycolysis). Glycolysis is much less efficient for energy production than oxidative phosphorylation, and the reason why cancer cells selectively use glycolysis remains unclear. Biospecimens were collected from 45 hepatocellular carcinoma patients. Protein samples were prepared through subcellular localization or whole-cell lysis. Protein synthesis was measured by SDS-PAGE and immunoblotting. mRNA transcription was measured using quantitative RT-PCR. Statistical correlation among immunoblotting data and clinicolaboratory factors were analyzed using SPSS. Enzymes for oxidative phosphorylation (SDHA and SDHB) were frequently decreased (56 and 48 % of patients, respectively) in hepatocellular carcinomas. The lowered amount of the SDH protein complex was rarely accompanied by stabilization of HIF1α and subsequent activation of the hypoxia response. On the other hand, protein synthesis of G6PD and TKT, enzymes critical for pentose phosphate pathway (PPP), was increased (in 45 and 55 % of patients, respectively), while that of ALDOA, an enzyme for mainstream glycolysis, was eliminated (in 55 % of patients). Alteration of protein synthesis was correlated with gene expression for G6PD and TKT, but not for TKTL1, ALDOA, SDHA or SDHB. Augmented transcription and synthesis of PPP enzymes were accompanied by nuclear accumulation of NRF2. Hepatocellular carcinomas divert glucose metabolism to the anabolic shunt by activating transcription factor NRF2.
Frlan, Rok; Kovač, Andreja; Blanot, Didier; Gobec, Stanislav; Pečar, Slavko; Obreza, Aleš
2011-06-01
Mur ligases are essential enzymes involved in the cytoplasmic steps of peptidoglycan synthesis which remain attractive, yet unexploited targets. In order to develop new antibacterial agents, we have designed a series of new MurC and MurD inhibitors bearing amino acid sulfonohydrazide moiety. The L-Leu series of this class displayed the highest enzyme inhibition with IC50 in the concentration range between 100 and 500 µM, with L-Thr, L-Pro and L-Ala derivatives being inactive. The most promising compound of the series also expressed weak antibacterial activity against S. aureus with MIC = 128 µg/mL.
Wang, P; Walter, R D; Bhat, B G; Florant, G L; Coleman, R A
1997-10-01
In order to determine whether critical enzyme activities of glycerolipid synthesis change seasonally in the golden-mantled ground squirrel (Spermophilus lateralis), we collected summer and winter samples of liver, brown adipose tissue (BAT), and white adipose tissue (WAT). Compared with fatty acid synthase activity during hibernation, summer activities were 2.5- to 8-fold higher in adipose tissue and liver. Diacylglycerol acyltransferase (DGAT) activity was 2.6-fold higher in WAT during the summer, consistent with increased seasonal triacylglycerol storage, but the activity did not change in liver or BAT, suggesting that in these tissues, triacylglycerol synthesis is equally active in summer and winter. Lack of change in acyl-CoA synthetase in liver and BAT may reflect high synthetic rates for acyl-CoAs that are destined in the summer for glycerolipid synthesis and in the winter for beta-oxidation. Monoacylglycerol acyltransferase (MGAT) activity increased significantly in both liver and WAT during the summer but decreased in BAT. Although the changes were consistent with active year-round triacylglycerol synthesis, the higher summer MGAT activity observed in the squirrel liver and WAT suggest that MGATs function may not be limited to conserving essential fatty acids during physiological states of lipolysis. Seasonal changes observed in the ground squirrel were similar to those previously reported in the yellow-bellied marmot (Marmota flaviventris), confirming that important adjustments occur in energy metabolism necessitated by long seasonal hibernation.
Yadav, Rajesh K; Baeg, Jin-Ook; Oh, Gyu Hwan; Park, No-Joong; Kong, Ki-jeong; Kim, Jinheung; Hwang, Dong Won; Biswas, Soumya K
2012-07-18
The photocatalyst-enzyme coupled system for artificial photosynthesis process is one of the most promising methods of solar energy conversion for the synthesis of organic chemicals or fuel. Here we report the synthesis of a novel graphene-based visible light active photocatalyst which covalently bonded the chromophore, such as multianthraquinone substituted porphyrin with the chemically converted graphene as a photocatalyst of the artificial photosynthesis system for an efficient photosynthetic production of formic acid from CO(2). The results not only show a benchmark example of the graphene-based material used as a photocatalyst in general artificial photosynthesis but also the benchmark example of the selective production system of solar chemicals/solar fuel directly from CO(2).
Thermophilic archaeal enzymes and applications in biocatalysis.
Littlechild, Jennifer A
2011-01-01
Thermophilic enzymes have advantages for their use in commercial applications and particularly for the production of chiral compounds to produce optically pure pharmaceuticals. They can be used as biocatalysts in the application of 'green chemistry'. The thermophilic archaea contain enzymes that have already been used in commercial applications such as the L-aminoacylase from Thermococcus litoralis for the resolution of amino acids and amino acid analogues. This enzyme differs from bacterial L-aminoacylases and has similarities to carboxypeptidases from other archaeal species. An amidase/γ-lactamase from Sulfolobus solfataricus has been used for the production of optically pure γ-lactam, the building block for antiviral carbocyclic nucleotides. This enzyme has similarities to the bacterial signature amidase family. An alcohol dehydrogenase from Aeropyrum pernix has been used for the production of optically pure alcohols and is related to the zinc-containing eukaryotic alcohol dehydrogenases. A transaminase and a dehalogenase from Sulfolobus species have also been studied. The archaeal transaminase is found in a pathway for serine synthesis which is found only in eukaryotes and not in bacteria. It can be used for the asymmetric synthesis of homochiral amines of high enantioselective purity. The L-2-haloacid dehalogenase has applications both in biocatalysis and in bioremediation. All of these enzymes have increased thermostability over their mesophilic counterparts.
Lipase-catalyzed synthesis of fatty acid amide (erucamide) using fatty acid and urea.
Awasthi, Neeraj Praphulla; Singh, R P
2007-01-01
Ammonolysis of fatty acids to the corresponding fatty acid amides is efficiently catalysed by Candida antartica lipase (Novozym 435). In the present paper lipase-catalysed synthesis of erucamide by ammonolysis of erucic acid and urea in organic solvent medium was studied and optimal conditions for fatty amides synthesis were established. In this process erucic acid gave 88.74 % pure erucamide after 48 hour and 250 rpm at 60 degrees C with 1:4 molar ratio of erucic acid and urea, the organic solvent media is 50 ml tert-butyl alcohol (2-methyl-2-propanol). This process for synthesis is economical as we used urea in place of ammonia or other amidation reactant at atmospheric pressure. The amount of catalyst used is 3 %.
[Lipid synthesis by an acidic acid tolerant Rhodotorula glutinis].
Lin, Zhangnan; Liu, Hongjuan; Zhang, Jian'an; Wang, Gehua
2016-03-01
Acetic acid, as a main by-product generated in the pretreatment process of lignocellulose hydrolysis, significantly affects cell growth and lipid synthesis of oleaginous microorganisms. Therefore, we studied the tolerance of Rhodotorula glutinis to acetic acid and its lipid synthesis from substrate containing acetic acid. In the mixed sugar medium containing 6 g/L glucose and 44 g/L xylose, and supplemented with acetic acid, the cell growth was not:inhibited when the acetic acid concentration was below 10 g/L. Compared with the control, the biomass, lipid concentration and lipid content of R. glutinis increased 21.5%, 171% and 122% respectively when acetic acid concentration was 10 g/L. Furthermore, R. glutinis could accumulate lipid with acetate as the sole carbon source. Lipid concentration and lipid yield reached 3.20 g/L and 13% respectively with the initial acetic acid concentration of 25 g/L. The lipid composition was analyzed by gas chromatograph. The main composition of lipid produced with acetic acid was palmitic acid, stearic acid, oleic acid, linoleic acid and linolenic acid, including 40.9% saturated fatty acids and 59.1% unsaturated fatty acids. The lipid composition was similar to that of plant oil, indicating that lipid from oleaginous yeast R. glutinis had potential as the feedstock of biodiesel production. These results demonstrated that a certain concentration of acetic acid need not to be removed in the detoxification process when using lignocelluloses hydrolysate to produce microbial lipid by R. glutinis.
Fan, Jilian; Yan, Chengshi; Zhang, Xuebin; Xu, Changcheng
2013-01-01
There is growing interest in engineering green biomass to expand the production of plant oils as feed and biofuels. Here, we show that PHOSPHOLIPID:DIACYLGLYCEROL ACYLTRANSFERASE1 (PDAT1) is a critical enzyme involved in triacylglycerol (TAG) synthesis in leaves. Overexpression of PDAT1 increases leaf TAG accumulation, leading to oil droplet overexpansion through fusion. Ectopic expression of oleosin promotes the clustering of small oil droplets. Coexpression of PDAT1 with oleosin boosts leaf TAG content by up to 6.4% of the dry weight without affecting membrane lipid composition and plant growth. PDAT1 overexpression stimulates fatty acid synthesis (FAS) and increases fatty acid flux toward the prokaryotic glycerolipid pathway. In the trigalactosyldiacylglycerol1-1 mutant, which is defective in eukaryotic thylakoid lipid synthesis, the combined overexpression of PDAT1 with oleosin increases leaf TAG content to 8.6% of the dry weight and total leaf lipid by fourfold. In the plastidic glycerol-3-phosphate acyltransferase1 mutant, which is defective in the prokaryotic glycerolipid pathway, PDAT1 overexpression enhances TAG content at the expense of thylakoid membrane lipids, leading to defects in chloroplast division and thylakoid biogenesis. Collectively, these results reveal a dual role for PDAT1 in enhancing fatty acid and TAG synthesis in leaves and suggest that increasing FAS is the key to engineering high levels of TAG accumulation in green biomass. PMID:24076979
Combinatorial Effects of Fatty Acid Elongase Enzymes on Nervonic Acid Production in Camelina sativa
Huai, Dongxin; Zhang, Yuanyuan; Zhang, Chunyu; Cahoon, Edgar B.; Zhou, Yongming
2015-01-01
Very long chain fatty acids (VLCFAs) with chain lengths of 20 carbons and longer provide feedstocks for various applications; therefore, improvement of VLCFA contents in seeds has become an important goal for oilseed enhancement. VLCFA biosynthesis is controlled by a multi-enzyme protein complex referred to as fatty acid elongase, which is composed of β-ketoacyl-CoA synthase (KCS), β-ketoacyl-CoA reductase (KCR), β-hydroxyacyl-CoA dehydratase (HCD) and enoyl reductase (ECR). KCS has been identified as the rate-limiting enzyme, but little is known about the involvement of other three enzymes in VLCFA production. Here, the combinatorial effects of fatty acid elongase enzymes on VLCFA production were assessed by evaluating the changes in nervonic acid content. A KCS gene from Lunaria annua (LaKCS) and the other three elongase genes from Arabidopsis thaliana were used for the assessment. Five seed-specific expressing constructs, including LaKCS alone, LaKCS with AtKCR, LaKCS with AtHCD, LaKCS with AtECR, and LaKCS with AtKCR and AtHCD, were transformed into Camelina sativa. The nervonic acid content in seed oil increased from null in wild type camelina to 6-12% in LaKCS-expressing lines. However, compared with that from the LaKCS-expressing lines, nervonic acid content in mature seeds from the co-expressing lines with one or two extra elongase genes did not show further increases. Nervonic acid content from LaKCS, AtKCR and AtHCD co-expressing line was significantly higher than that in LaKCS-expressing line during early seed development stage, while the ultimate nervonic acid content was not significantly altered. The results from this study thus provide useful information for future engineering of oilseed crops for higher VLCFA production. PMID:26121034
Zígolo, M Antonela; Salinas, Maximiliano; Alché, Laura; Baldessari, Alicia; Liñares, Guadalupe García
2018-08-01
We present an efficient approach to the synthesis of a series of glycyrrhetinic acid derivatives. Six derivatives, five of them new compounds, were obtained through chemoenzymatic reactions in very good to excellent yield. In order to find the optimal reaction conditions, the influence of various parameters such as enzyme source, nucleophile:substrate ratio, enzyme:substrate ratio, solvent and temperature was studied. The excellent results obtained by lipase catalysis made the procedure very efficient considering their advantages such as mild reaction conditions and low environmental impact. Moreover, in order to explain the reactivity of glycyrrhetinic acid and the acetylated derivative to different nucleophiles in the enzymatic reactions, molecular docking studies were carried out. In addition, one of the synthesized compounds exhibited remarkable antiviral activity against TK + and TK- strains of Herpes simplex virus type 1 (HSV-1), sensitive and resistant to acyclovir (ACV) treatment. Copyright © 2018 Elsevier Inc. All rights reserved.
Wang, Huicong; Ma, Fangfang; Cheng, Lailiang
2010-07-01
Metabolite profiles and activities of key enzymes in the metabolism of organic acids, nitrogen and amino acids were compared between chlorotic leaves and normal leaves of 'Honeycrisp' apple to understand how accumulation of non-structural carbohydrates affects the metabolism of organic acids, nitrogen and amino acids. Excessive accumulation of non-structural carbohydrates and much lower CO(2) assimilation were found in chlorotic leaves than in normal leaves, confirming feedback inhibition of photosynthesis in chlorotic leaves. Dark respiration and activities of several key enzymes in glycolysis and tricarboxylic acid (TCA) cycle, ATP-phosphofructokinase, pyruvate kinase, citrate synthase, aconitase and isocitrate dehydrogenase were significantly higher in chlorotic leaves than in normal leaves. However, concentrations of most organic acids including phosphoenolpyruvate (PEP), pyruvate, oxaloacetate, 2-oxoglutarate, malate and fumarate, and activities of key enzymes involved in the anapleurotic pathway including PEP carboxylase, NAD-malate dehydrogenase and NAD-malic enzyme were significantly lower in chlorotic leaves than in normal leaves. Concentrations of soluble proteins and most free amino acids were significantly lower in chlorotic leaves than in normal leaves. Activities of key enzymes in nitrogen assimilation and amino acid synthesis, including nitrate reductase, glutamine synthetase, ferredoxin and NADH-dependent glutamate synthase, and glutamate pyruvate transaminase were significantly lower in chlorotic leaves than in normal leaves. It was concluded that, in response to excessive accumulation of non-structural carbohydrates, glycolysis and TCA cycle were up-regulated to "consume" the excess carbon available, whereas the anapleurotic pathway, nitrogen assimilation and amino acid synthesis were down-regulated to reduce the overall rate of amino acid and protein synthesis.
Shi, Yuguang; Cheng, Dong
2009-07-01
Monoacyglycerol acyltransferases (MGATs) and diacylglycerol acyltransferases (DGATs) catalyze two consecutive steps of enzyme reactions in the synthesis of triacylglycerols (TAGs). The metabolic complexity of TAG synthesis is reflected by the presence of multiple isoforms of MGAT and DGAT enzymes that differ in catalytic properties, subcellular localization, tissue distribution, and physiological functions. MGAT and DGAT enzymes play fundamental roles in the metabolism of monoacylglycerol (MAG), diacylglycerol (DAG), and triacylglycerol (TAG) that are involved in many aspects of physiological functions, such as intestinal fat absorption, lipoprotein assembly, adipose tissue formation, signal transduction, satiety, and lactation. The recent progress in the phenotypic characterization of mice deficient in MGAT and DGAT enzymes and the development of chemical inhibitors have revealed important roles of these enzymes in the regulation of energy homeostasis and insulin sensitivity. Consequently, selective inhibition of MGAT or DGAT enzymes by synthetic compounds may provide novel treatment for obesity and its related metabolic complications.
Shi, Yuguang; Cheng, Dong
2009-01-01
Monoacyglycerol acyltransferases (MGATs) and diacylglycerol acyltransferases (DGATs) catalyze two consecutive steps of enzyme reactions in the synthesis of triacylglycerols (TAGs). The metabolic complexity of TAG synthesis is reflected by the presence of multiple isoforms of MGAT and DGAT enzymes that differ in catalytic properties, subcellular localization, tissue distribution, and physiological functions. MGAT and DGAT enzymes play fundamental roles in the metabolism of monoacylglycerol (MAG), diacylglycerol (DAG), and triacylglycerol (TAG) that are involved in many aspects of physiological functions, such as intestinal fat absorption, lipoprotein assembly, adipose tissue formation, signal transduction, satiety, and lactation. The recent progress in the phenotypic characterization of mice deficient in MGAT and DGAT enzymes and the development of chemical inhibitors have revealed important roles of these enzymes in the regulation of energy homeostasis and insulin sensitivity. Consequently, selective inhibition of MGAT or DGAT enzymes by synthetic compounds may provide novel treatment for obesity and its related metabolic complications. PMID:19116371
Zawadzke, Laura E; Norcia, Michael; Desbonnet, Charlene R; Wang, Hong; Freeman-Cook, Kevin; Dougherty, Thomas J
2008-02-01
The pathway for synthesis of the peptidoglycan precursor UDP-N-acetylmuramyl pentapeptide is essential in Gram-positive and Gram-negative bacteria. This pathway has been exploited in the recent past to identify potential new antibiotics as inhibitors of one or more of the Mur enzymes. In the present study, a high-throughput screen was employed to identify potential inhibitors of the Escherichia coli MurC (UDP-N-acetylmuramic acid:L-alanine ligase), the first of four paralogous amino acid-adding enzymes. Inhibition of ATP consumed during the MurC reaction, using an adaptation of a kinase assay format, identified a number of potential inhibitory chemotypes. After nonspecific inhibition testing and chemical attractiveness were assessed, C-1 emerged as a compound for further characterization. The inhibition of MurC by this compound was confirmed in both a kinetic-coupled enzyme assay and a direct nuclear magnetic resonance product detection assay. C-1 was found to be a low micromolar inhibitor of the E. coli MurC reaction, with preferential inhibition by one of two enantiomeric forms. Experiments indicated that it was a competitive inhibitor of ATP binding to the MurC enzyme. Further work with MurC enzymes from several bacterial sources revealed that while the compound was equally effective at inhibiting MurC from genera (Proteus mirabilis and Klebsiella pneumoniae) closely related to E. coli, MurC enzymes from more distant Gram-negative species such as Haemophilus influenzae, Acinetobacter baylyi, and Pseudomonas aeruginosa were not inhibited.
Qing, Taiping; He, Dinggeng; He, Xiaoxiao; Wang, Kemin; Xu, Fengzhou; Wen, Li; Shangguan, Jingfang; Mao, Zhengui; Lei, Yanli
2016-04-01
Owing to their highly efficient catalytic effects and substrate specificity, the nucleic acid tool enzymes are applied as 'nano-tools' for manipulating different nucleic acid substrates both in the test-tube and in living organisms. In addition to the function as molecular scissors and molecular glue in genetic engineering, the application of nucleic acid tool enzymes in biochemical analysis has also been extensively developed in the past few decades. Used as amplifying labels for biorecognition events, the nucleic acid tool enzymes are mainly applied in nucleic acids amplification sensing, as well as the amplification sensing of biorelated variations of nucleic acids. With the introduction of aptamers, which can bind different target molecules, the nucleic acid tool enzymes-aided signal amplification strategies can also be used to sense non-nucleic targets (e.g., ions, small molecules, proteins, and cells). This review describes and discusses the amplification strategies of nucleic acid tool enzymes-aided biosensors for biochemical analysis applications. Various analytes, including nucleic acids, ions, small molecules, proteins, and cells, are reviewed briefly. This work also addresses the future trends and outlooks for signal amplification in nucleic acid tool enzymes-aided biosensors.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tamano, Koichi; Bruno, Kenneth S.; Karagiosis, Sue A.
2013-01-01
Microbial production of fats and oils is being developedas a means of converting biomass to biofuels. Here we investigate enhancing expression of enzymes involved in the production of fatty acids and triglycerides as a means to increase production of these compounds in Aspergillusoryzae. Examination of the A.oryzaegenome demonstrates that it contains twofatty acid synthases and several other genes that are predicted to be part of this biosynthetic pathway. We enhancedthe expressionof fatty acid synthesis-related genes by replacing their promoters with thepromoter fromthe constitutively highly expressedgene tef1. We demonstrate that by simply increasing the expression of the fatty acid synthasegenes wemore » successfullyincreasedtheproduction of fatty acids and triglyceridesby more than two fold. Enhancement of expression of the fatty acid pathway genes ATP-citrate lyase and palmitoyl-ACP thioesteraseincreasedproductivity to a lesser extent.Increasing expression ofacetyl-CoA carboxylase caused no detectable change in fatty acid levels. Increases in message level for each gene were monitored usingquantitative real-time RT-PCR. Our data demonstrates that a simple increase in the abundance of fatty acid synthase genes can increase the detectable amount of fatty acids.« less
Jasmonic acid-amino acid conjugation enzyme assays.
Rowe, Martha L; Staswick, Paul E
2013-01-01
Jasmonic acid (JA) is activated for signaling by its conjugation to isoleucine (Ile) through an amide linkage. The Arabidopsis thaliana JASMONIC ACID RESISTANT1 (JAR1) enzyme carries out this Mg-ATP-dependent reaction in two steps, adenylation of the free carboxyl of JA, followed by condensation of the activated group to Ile. This chapter details the protocols used to detect and quantify the enzymatic activity obtained from a glutathione-S-transferase:JAR1 fusion protein produced in Escherichia coli, including an isotope exchange assay for the adenylation step and assays for the complete reaction that involve the high-performance liquid chromatography quantitation of adenosine monophosphate, a stoichiometric by-product of the reaction, and detection of the conjugation product by thin-layer chromatography or gas -chromatography/mass spectrometry.
Liu, Jun; Pu, Huimin; Liu, Shuang; Kan, Juan; Jin, Changhai
2017-10-15
In recent years, increasing attention has been paid to the grafting of phenolic acid onto chitosan in order to enhance the bioactivity and widen the application of chitosan. Here, we present a comprehensive overview on the recent advances of phenolic acid grafted chitosan (phenolic acid-g-chitosan) in many aspects, including the synthetic method, structural characterization, biological activity, physicochemical property and potential application. In general, four kinds of techniques including carbodiimide based coupling, enzyme catalyzed grafting, free radical mediated grafting and electrochemical methods are frequently used for the synthesis of phenolic acid-g-chitosan. The structural characterization of phenolic acid-g-chitosan can be determined by several instrumental methods. The physicochemical properties of chitosan are greatly altered after grafting. As compared with chitosan, phenolic acid-g-chitosan exhibits enhanced antioxidant, antimicrobial, antitumor, anti-allergic, anti-inflammatory, anti-diabetic and acetylcholinesterase inhibitory activities. Notably, phenolic acid-g-chitosan shows potential applications in many fields as coating agent, packing material, encapsulation agent and bioadsorbent. Copyright © 2017 Elsevier Ltd. All rights reserved.
Rodríguez, Alicia; Esteban, Luis; Martín, Lorena; Jiménez, María José; Hita, Estrella; Castillo, Beatriz; González, Pedro A; Robles, Alfonso
2012-08-10
This paper studies the synthesis of structured triacylglycerols (STAGs) by a four-step process: (i) obtaining 2-monoacylglycerols (2-MAGs) by alcoholysis of cod liver oil with several alcohols, catalyzed by lipases Novozym 435, from Candida antartica and DF, from Rhizopus oryzae, (ii) purification of 2-MAGs, (iii) formation of STAGs by esterification of 2-MAGs with caprylic acid catalyzed by lipase DF, from R. oryzae, and (iv) purification of these STAGs. For the alcoholysis of cod liver oil, absolute ethanol, ethanol 96% (v/v) and 1-butanol were compared; the conditions with ethanol 96% were then optimized and 2-MAG yields of around 54-57% were attained using Novozym 435. In these 2-MAGs, DHA accounted for 24-31% of total fatty acids. In the operational conditions this lipase maintained a stable level of activity over at least 11 uses. These results were compared with those obtained with lipase DF, which deactivated after only three uses. The alcoholysis of cod liver oil and ethanol 96% catalyzed by Novozym 435 was scaled up by multiplying the reactant amounts 100-fold and maintaining the intensity of treatment constant (IOT=3g lipase h/g oil). In these conditions, the 2-MAG yield attained was about 67%; these 2-MAGs contained 36.6% DHA. The synthesized 2-MAGs were separated and purified from the alcoholysis reaction products by solvent extraction using solvents of low toxicity (ethanol and hexane); 2-MAG recovery yield and purity of the target product were approximately 96.4% and 83.9%, respectively. These 2-MAGs were transformed to STAGs using the optimal conditions obtained in a previous work. After synthesis and purification, 93% pure STAGs were obtained, containing 38% DHA at sn-2 position and 60% caprylic acid (CA) at sn-1,3 positions (of total fatty acids at these positions), i.e. the major TAG is the STAG with the structure CA-DHA-CA. Copyright © 2012 Elsevier Inc. All rights reserved.
Characterization of Enzymes Involved in Fatty Acid Elongation
2007-04-11
dihydroxyacetone reductase involved in phosphatidic acid biosynthesis [111]. Therefore, altered glycerophospholipid metabolism, along with reduced...2007 Title of Dissertation: "Characterization of Enzymes Involved in Fatty Acid Elongation" APPROVAL SHEET Ernest Maynard, P .D. Department of...Fatty Acid Elongation" is appropriately acknowledged and, beyond brief excerpts, is with the permission of the copyright owner. , /1:1 IJA"" 1< .IIVCf
One-pot synthesis of GDP-l-fucose by a four-enzyme cascade expressed in Lactococcus lactis.
Li, Ling; Kim, Seul-Ah; Heo, Ji Eun; Kim, Tae-Jip; Seo, Jin-Ho; Han, Nam Soo
2017-12-20
GDP-l-fucose is an l-fucose donor to synthesize fucosylated compounds such as human milk oligosaccharides or Lewis antigen. In this study, we used Lactococcus lactis subsp. cremoris NZ9000 to express 4 enzymes, ManB, ManC, Gmd, and WcaG and produced GDP-l-fucose by using one-pot synthesis method with mannose-6-phosphate as substrate and the enzymes as biocatalyst. For preparation of enzyme mixture, 4 genes (manB, manC, gmd, and wcaG) cloned from Escherichia coli were transformed into L. lactis strains using pNZ8008 and the recombinant cell lysates were obtained after cultivation. When mannose-6-phosphate was used as the substrate, the consecutive reactions with ManB, ManC, Gmd, and WcaG resulted in the successful production of GDP-l-fucose (0.13mM). When GDP-d-mannose was used as the substrate, it was entirely converted to GDP-l-fucose (0.2mM; 0.12g/L) via 2 enzymatic reactions mediated by Gmd and WcaG. This is the first report of GDP-l-fucose production by using multiple enzymes expressed in lactic acid bacteria. Copyright © 2017 Elsevier B.V. All rights reserved.
Ammonium Metabolism Enzymes Aid Helicobacter pylori Acid Resistance
Miller, Erica F.
2014-01-01
The gastric pathogen Helicobacter pylori possesses a highly active urease to support acid tolerance. Urea hydrolysis occurs inside the cytoplasm, resulting in the production of NH3 that is immediately protonated to form NH4+. This ammonium must be metabolized or effluxed because its presence within the cell is counterproductive to the goal of raising pH while maintaining a viable proton motive force (PMF). Two compatible hypotheses for mitigating intracellular ammonium toxicity include (i) the exit of protonated ammonium outward via the UreI permease, which was shown to facilitate diffusion of both urea and ammonium, and/or (ii) the assimilation of this ammonium, which is supported by evidence that H. pylori assimilates urea nitrogen into its amino acid pools. We investigated the second hypothesis by constructing strains with altered expression of the ammonium-assimilating enzymes glutamine synthetase (GS) and glutamate dehydrogenase (GDH) and the ammonium-evolving periplasmic enzymes glutaminase (Ggt) and asparaginase (AsnB). H. pylori strains expressing elevated levels of either GS or GDH are more acid tolerant than the wild type, exhibit enhanced ammonium production, and are able to alkalize the medium faster than the wild type. Strains lacking the genes for either Ggt or AsnB are acid sensitive, have 8-fold-lower urea-dependent ammonium production, and are more acid sensitive than the parent. Additionally, we found that purified H. pylori GS produces glutamine in the presence of Mg2+ at a rate similar to that of unadenylated Escherichia coli GS. These data reveal that all four enzymes contribute to whole-cell acid resistance in H. pylori and are likely important for assimilation and/or efflux of urea-derived ammonium. PMID:24936052
ERIC Educational Resources Information Center
Forster, Denis; DeKleva, Thomas W.
1986-01-01
Monsanto's highly successful synthesis of acetic acid from methanol and carbon monoxide illustrates use of new starting materials to replace pretroleum-derived ethylene. Outlines the fundamental aspects of the acetic acid process and suggests ways of extending the synthesis to higher carboxylic acids. (JN)
Enzyme and microbial technology for synthesis of bioactive oligosaccharides: an update.
Chen, Rachel
2018-04-01
Oligosaccharides, in either free or bound forms, play crucial roles in a wide range of biological processes. Increasing appreciation of their roles in cellular communication, interaction, pathogenesis, and prebiotic functions has stimulated tremendous interests in their synthesis. Pure and structurally defined oligosaccharides are essential for fundamental studies. On the other hand, for those with near term medical and nutraceutical applications, their large-scale synthesis is necessary. Unfortunately, oligosaccharides are notoriously difficult in their synthesis, and their enormous diverse structures leave a vast gap between what have been synthesized in laboratory and those present in various biological systems. While enzymes and microbes are nature's catalysts for oligosaccharides, their effective use is not without challenges. Using examples of galactose-containing oligosaccharides, this review analyzes the pros and cons of these two forms of biocatalysts and provides an updated view on the status of biocatalysis in this important field. Over the past few years, a large number of novel galactosidases were discovered and/or engineered for improved synthesis via transglycosylation. The use of salvage pathway for regeneration of uridine diphosphate (UDP)-galactose has made the use of Leloir glycosyltransferases simpler and more efficient. The recent success of large-scale synthesis of 2' fucosyllactose heralded the power of whole-cell biocatalysis as a scalable technology. While it still lags behind enzyme catalysis in terms of the number of oligosaccharides synthesized, an acceleration in the use of this form of biocatalyst is expected as rapid advances in synthetic biology have made the engineering of whole cell biocatalysts less arduous and less time consuming.
Bukhari, S N A; Butt, A M; Amjad, M W B; Ahmad, W; Shah, V H; Trivedi, A R
2013-11-01
Hypertension is a widespread and frequently progressive ailment that imparts a foremost threat for cardiovascular and renal disorders. Mammoth efforts are needed for the synthesis of innovative antihypertensive agents to combat this lethal disease. Chalcones have shown antihypertensive activity through inhibition of Angiotensin Converting Enzyme (ACE). Hence, a series of chalcone analogues is synthesized and used as precursor for the synthesis of novel series of pyrimidines. Precursor chalcones were prepared by reacting aldehydes and ketones in presence of sodium hydroxide followed by synthesis of corresponding pyrimidines by reaction with urea in presence of potassium hydroxide. Both groups were then evaluated for their effects on ACE. The results depicted that pyrimidines were more active than chalcones with methoxy (C5 and P5) substitution showing best results to inhibit ACE. Given that chalcone analogues and pyrimidines show a potential as the angiotensin converting enzyme inhibitors.
Grimm, Marcus O W; Mett, Janine; Stahlmann, Christoph P; Haupenthal, Viola J; Blümel, Tamara; Stötzel, Hannah; Grimm, Heike S; Hartmann, Tobias
2016-12-01
Omega-3 polyunsaturated fatty acids (PUFAs) have been proposed to be highly beneficial in Alzheimer's disease (AD). AD pathology is closely linked to an overproduction and accumulation of amyloid-β (Aβ) peptides as extracellular senile plaques in the brain. Total Aβ levels are not only dependent on its production by proteolytic processing of the amyloid precursor protein (APP), but also on Aβ-clearance mechanisms, including Aβ-degrading enzymes. Here we show that the omega-3 PUFAs eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) increase Aβ-degradation by affecting insulin-degrading enzyme (IDE), the major Aβ-degrading enzyme secreted into the extracellular space of neuronal and microglial cells. The identification of the molecular mechanisms revealed that EPA directly increases IDE enzyme activity and elevates gene expression of IDE. DHA also directly stimulates IDE enzyme activity and affects IDE sorting by increasing exosome release of IDE, resulting in enhanced Aβ-degradation in the extracellular milieu. Apart from the known positive effect of DHA in reducing Aβ production, EPA and DHA might ameliorate AD pathology by increasing Aβ turnover.
Oxysterol biosynthetic enzymes.
Russell, D W
2000-12-15
Oxysterols, herein defined as derivatives of cholesterol with a hydroxyl group on the side chain, play several roles in lipid metabolism. Members of this class regulate the expression of genes that participate in both sterol and fat metabolism, serve as substrates for the synthesis of bile acids, and are intermediates in the transfer of sterols from the periphery to the liver. Three abundant naturally occurring oxysterols are 24-hydroxycholesterol, 25-hydroxycholesterol, and 27-hydroxycholesterol. The cholesterol hydroxylase enzymes that synthesize each of these have been isolated over the last several years and their study has produced insight into the biology of oxysterols. This article focuses on the properties of these enzymes.
Bacterial fatty acid metabolism in modern antibiotic discovery.
Yao, Jiangwei; Rock, Charles O
2017-11-01
Bacterial fatty acid synthesis is essential for many pathogens and different from the mammalian counterpart. These features make bacterial fatty acid synthesis a desirable target for antibiotic discovery. The structural divergence of the conserved enzymes and the presence of different isozymes catalyzing the same reactions in the pathway make bacterial fatty acid synthesis a narrow spectrum target rather than the traditional broad spectrum target. Furthermore, bacterial fatty acid synthesis inhibitors are single-targeting, rather than multi-targeting like traditional monotherapeutic, broad-spectrum antibiotics. The single-targeting nature of bacterial fatty acid synthesis inhibitors makes overcoming fast-developing, target-based resistance a necessary consideration for antibiotic development. Target-based resistance can be overcome through multi-targeting inhibitors, a cocktail of single-targeting inhibitors, or by making the single targeting inhibitor sufficiently high affinity through a pathogen selective approach such that target-based mutants are still susceptible to therapeutic concentrations of drug. Many of the pathogens requiring new antibiotic treatment options encode for essential bacterial fatty acid synthesis enzymes. This review will evaluate the most promising targets in bacterial fatty acid metabolism for antibiotic therapeutics development and review the potential and challenges in advancing each of these targets to the clinic and circumventing target-based resistance. This article is part of a Special Issue entitled: Bacterial Lipids edited by Russell E. Bishop. Copyright © 2016 Elsevier B.V. All rights reserved.
Role of fatty-acid synthesis in dendritic cell generation and function.
Rehman, Adeel; Hemmert, Keith C; Ochi, Atsuo; Jamal, Mohsin; Henning, Justin R; Barilla, Rocky; Quesada, Juan P; Zambirinis, Constantinos P; Tang, Kerry; Ego-Osuala, Melvin; Rao, Raghavendra S; Greco, Stephanie; Deutsch, Michael; Narayan, Suchithra; Pachter, H Leon; Graffeo, Christopher S; Acehan, Devrim; Miller, George
2013-05-01
Dendritic cells (DC) are professional APCs that regulate innate and adaptive immunity. The role of fatty-acid synthesis in DC development and function is uncertain. We found that blockade of fatty-acid synthesis markedly decreases dendropoiesis in the liver and in primary and secondary lymphoid organs in mice. Human DC development from PBMC precursors was also diminished by blockade of fatty-acid synthesis. This was associated with higher rates of apoptosis in precursor cells and increased expression of cleaved caspase-3 and BCL-xL and downregulation of cyclin B1. Further, blockade of fatty-acid synthesis decreased DC expression of MHC class II, ICAM-1, B7-1, and B7-2 but increased their production of selected proinflammatory cytokines including IL-12 and MCP-1. Accordingly, inhibition of fatty-acid synthesis enhanced DC capacity to activate allogeneic as well as Ag-restricted CD4(+) and CD8(+) T cells and induce CTL responses. Further, blockade of fatty-acid synthesis increased DC expression of Notch ligands and enhanced their ability to activate NK cell immune phenotype and IFN-γ production. Because endoplasmic reticulum (ER) stress can augment the immunogenic function of APC, we postulated that this may account for the higher DC immunogenicity. We found that inhibition of fatty-acid synthesis resulted in elevated expression of numerous markers of ER stress in humans and mice and was associated with increased MAPK and Akt signaling. Further, lowering ER stress by 4-phenylbutyrate mitigated the enhanced immune stimulation associated with fatty-acid synthesis blockade. Our findings elucidate the role of fatty-acid synthesis in DC development and function and have implications to the design of DC vaccines for immunotherapy.
Regulation of protein synthesis by amino acids in muscle of neonates
Suryawan, Agus; Davis, Teresa A.
2011-01-01
The marked increase in skeletal muscle mass during the neonatal period is largely due to a high rate of postprandial protein synthesis that is modulated by an enhanced sensitivity to insulin and amino acids. The amino acid signaling pathway leading to the stimulation of protein synthesis has not been fully elucidated. Among the amino acids, leucine is considered to be a principal anabolic agent that regulates protein synthesis. mTORC1, which controls protein synthesis, has been implicated as a target for leucine. Until recently, there have been few studies exploring the role of amino acids in enhancing muscle protein synthesis in vivo. In this review, we discuss amino acid-induced protein synthesis in muscle in the neonate, focusing on current knowledge of the role of amino acids in the activation of mTORC1 leading to mRNA translation. The role of the amino acid transporters, SNAT2, LAT1, and PAT, in the modulation of mTORC1 activation and the role of amino acids in the activation of putative regulators of mTORC1, i.e., raptor, Rheb, MAP4K3, Vps34, and Rag GTPases, are discussed. PMID:21196241
Narnoliya, Lokesh K; Sangwan, Rajender S; Singh, Sudhir P
2018-06-01
Rose-scented geranium (Pelargonium sp.) is widely known as aromatic and medicinal herb, accumulating specialized metabolites of high economic importance, such as essential oils, ascorbic acid, and tartaric acid. Ascorbic acid and tartaric acid are multifunctional metabolites of human value to be used as vital antioxidants and flavor enhancing agents in food products. No information is available related to the structural and functional properties of the enzymes involved in ascorbic acid and tartaric acid biosynthesis in rose-scented geranium. In the present study, transcriptome mining was done to identify full-length genes, followed by their bioinformatic and molecular modeling investigations and understanding of in silico structural and functional properties of these enzymes. Evolutionary conserved domains were identified in the pathway enzymes. In silico physicochemical characterization of the catalytic enzymes revealed isoelectric point (pI), instability index, aliphatic index, and grand average hydropathy (GRAVY) values of the enzymes. Secondary structural prediction revealed abundant proportion of alpha helix and random coil confirmations in the pathway enzymes. Three-dimensional homology models were developed for these enzymes. The predicted structures showed significant structural similarity with their respective templates in root mean square deviation analysis. Ramachandran plot analysis of the modeled enzymes revealed that more than 84% of the amino acid residues were within the favored regions. Further, functionally important residues were identified corresponding to catalytic sites located in the enzymes. To, our best knowledge, this is the first report which provides a foundation on functional annotation and structural determination of ascorbic acid and tartaric acid pathway enzymes in rose-scanted geranium.
Leurs, Melanie; Tiller, Joerg C
2017-01-01
The properties of enzymes can be altered significantly by modification with polymers. Numerous different methods are known to obtain such polymer-enzyme conjugates (PECs). However, there is no universal method to render enzymes into PECs that are fully soluble in organic solvents. Here, we present a method, which achieves such high degree of modification of proteins that the majority of modified enzymes will be soluble in organic solvents. This is achieved by preparing poly(2-alkyloxazoline)s (POx) with an NH 2 end group and coupling this functional polymer via pyromellitic acid dianhydride onto the amino groups of the respective protein. The resulting PECs are capable of serving as surfactants for unmodified proteins, rendering the whole mixture organosoluble. Depending on the nature of the POx and the molecular weight and the nature of the enzyme, the PECs are soluble in chloroform or even toluene. Another advantage of this method is that the poly(2-alkyloxazoline) can be activated with the coupling agent and used for the enzyme conjugation without further purification. The POx-enzyme conjugates generated by this modification strategy show modulated catalytic activity in both, aqueous and organic, systems. © 2017 Elsevier Inc. All rights reserved.
Numata, Satoshi; Katakami, Hideki; Inoue, Shinobu; Sawada, Hirotake; Hashida, Seiichi
2016-07-01
We developed a novel, ultrasensitive enzyme immunoassay (immune complex transfer enzyme immunoassay) for determination of glutamic acid decarboxylase autoantibody concentrations in serum samples from patients with type 2 diabetes. We developed an immune complex transfer enzyme immunoassay for glutamic acid decarboxylase autoantibody and measured glutamic acid decarboxylase autoantibody from 22 patients with type 1 diabetes, 29 patients with type 2 diabetes, and 32 healthy controls. A conventional ELISA kit identified 10 patients with type 1 diabetes and one patient with type 2 diabetes as glutamic acid decarboxylase autoantibody positive, whereas 15 patients with type 1 diabetes and six patients with type 2 diabetes were identified as glutamic acid decarboxylase autoantibody positive using immune complex transfer enzyme immunoassay. Immune complex transfer enzyme immunoassay is a highly sensitive and specific assay for glutamic acid decarboxylase autoantibody and might be clinically useful for diabetic onset prediction and early diagnosis. © The Author(s) 2016.
Synthesis of alpha-amino acids
Davis, Jr., Jefferson W.
1983-01-01
A method for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.
Synthesis of alpha-amino acids
Davis, Jr., Jefferson W.
1983-01-01
A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.
My, L.; Ghandour Achkar, N.; Viala, J. P.
2015-01-01
ABSTRACT In Escherichia coli, the FadR transcriptional regulator represses the expression of fatty acid degradation (fad) genes. However, FadR is also an activator of the expression of fabA and fabB, two genes involved in unsaturated fatty acid synthesis. Therefore, FadR plays an important role in maintaining the balance between saturated and unsaturated fatty acids in the membrane. We recently showed that FadR also activates the promoter upstream of the fabH gene (L. My, B. Rekoske, J. J. Lemke, J. P. Viala, R. L. Gourse, and E. Bouveret, J Bacteriol 195:3784–3795, 2013, doi:10.1128/JB.00384-13). Furthermore, recent transcriptomic and proteomic data suggested that FadR activates the majority of fatty acid (FA) synthesis genes. In the present study, we tested the role of FadR in the expression of all genes involved in FA synthesis. We found that FadR activates the transcription of all tested FA synthesis genes, and we identified the FadR binding site for each of these genes. This necessitated the reassessment of the transcription start sites for accA and accB genes described previously, and we provide evidence for the presence of multiple promoters driving the expression of these genes. We showed further that regulation by FadR impacts the amount of FA synthesis enzymes in the cell. Our results show that FadR is a global regulator of FA metabolism in E. coli, acting both as a repressor of catabolism and an activator of anabolism, two directly opposing pathways. IMPORTANCE In most bacteria, a transcriptional regulator tunes the level of FA synthesis enzymes. Oddly, such a global regulator still was missing for E. coli, which nonetheless is one of the prominent model bacteria used for engineering biofuel production using the FA synthesis pathway. Our work identifies the FadR functional dual regulator as a global activator of almost all FA synthesis genes in E. coli. Because FadR also is the repressor of FA degradation, FadR acts both as a repressor and an activator
Synthesis of new kojic acid based unnatural α-amino acid derivatives.
Balakrishna, C; Payili, Nagaraju; Yennam, Satyanarayana; Uma Devi, P; Behera, Manoranjan
2015-11-01
An efficient method for the preparation of kojic acid based α-amino acid derivatives by alkylation of glycinate schiff base with bromokojic acids have been described. Using this method, mono as well as di alkylated kojic acid-amino acid conjugates have been prepared. This is the first synthesis of C-linked kojic acid-amino acid conjugate where kojic acid is directly linked to amino acid through a C-C bond. Copyright © 2015 Elsevier Ltd. All rights reserved.
Role of Fatty-acid Synthesis in Dendritic Cell Generation and Function
Rehman, Adeel; Hemmert, Keith C.; Ochi, Atsuo; Jamal, Mohsin; Henning, Justin R.; Barilla, Rocky; Quesada, Juan P.; Zambirinis, Constantinos P.; Tang, Kerry; Ego-Osuala, Melvin; Rao, Raghavendra S.; Greco, Stephanie; Deutsch, Michael; Narayan, Suchithra; Pachter, H. Leon; Graffeo, Christopher S.; Acehan, Devrim; Miller, George
2013-01-01
Dendritic cells (DC) are professional antigen presenting cells that regulate innate and adaptive immunity. The role of fatty-acid synthesis in DC development and function is uncertain. We found that blockade of fatty-acid synthesis markedly decreases dendropoiesis in the liver and in primary and secondary lymphoid organs in mice. Human DC development from PBMC precursors was also diminished by blockade of fatty-acid synthesis. This was associated with higher rates of apoptosis in precursor cells and increased expression of Cleaved Caspase 3 and BCL-xL, and down-regulation of Cyclin B1. Further, blockade of fatty-acid synthesis decreased DC expression of MHCII, ICAM-1, B7-1, B7-2 but increased their production of selected pro-inflammatory cytokines including IL-12 and MCP-1. Accordingly, inhibition of fatty-acid synthesis enhanced DC capacityto activate allogeneic as well as antigen-restricted CD4+ and CD8+ T cells and induce CTL responses. Further, blockade of fatty-acid synthesis increased DC expression of Notch ligands and enhanced their ability to activate NK cell immune-phenotype and IFN-γ production. Since endoplasmic reticular (ER)-stress can augment the immunogenic function of APC, we postulated that this may account for the higher DC immunogenicity. We found that inhibition of fatty-acid synthesis resulted in elevated expression of numerous markers of ER stress in humans and mice and was associated with increased MAP kinase and Akt signaling. Further, lowering ER-stress by 4-phenylbutyrate mitigated the enhanced immune-stimulation associated with fatty-acid synthesis blockade. Our findings elucidate the role of fatty-acid synthesis in DC development and function and have implications to the design of DC vaccines for immunotherapy. PMID:23536633
Rewiring protein synthesis: From natural to synthetic amino acids.
Fan, Yongqiang; Evans, Christopher R; Ling, Jiqiang
2017-11-01
The protein synthesis machinery uses 22 natural amino acids as building blocks that faithfully decode the genetic information. Such fidelity is controlled at multiple steps and can be compromised in nature and in the laboratory to rewire protein synthesis with natural and synthetic amino acids. This review summarizes the major quality control mechanisms during protein synthesis, including aminoacyl-tRNA synthetases, elongation factors, and the ribosome. We will discuss evolution and engineering of such components that allow incorporation of natural and synthetic amino acids at positions that deviate from the standard genetic code. The protein synthesis machinery is highly selective, yet not fixed, for the correct amino acids that match the mRNA codons. Ambiguous translation of a codon with multiple amino acids or complete reassignment of a codon with a synthetic amino acid diversifies the proteome. Expanding the genetic code with synthetic amino acids through rewiring protein synthesis has broad applications in synthetic biology and chemical biology. Biochemical, structural, and genetic studies of the translational quality control mechanisms are not only crucial to understand the physiological role of translational fidelity and evolution of the genetic code, but also enable us to better design biological parts to expand the proteomes of synthetic organisms. This article is part of a Special Issue entitled "Biochemistry of Synthetic Biology - Recent Developments" Guest Editor: Dr. Ilka Heinemann and Dr. Patrick O'Donoghue. Copyright © 2017 Elsevier B.V. All rights reserved.
Bolivar, Juan M; Tribulato, Marco A; Petrasek, Zdenek; Nidetzky, Bernd
2016-11-01
Exploiting enzymes for chemical synthesis in flow microreactors necessitates their reuse for multiple rounds of conversion. To achieve this goal, immobilizing the enzymes on microchannel walls is a promising approach, but practical methods for it are lacking. Using fusion to a silica-binding module to engineer enzyme adsorption to glass surfaces, we show convenient immobilization of d-amino acid oxidase on borosilicate microchannel plates. In confocal laser scanning microscopy, channel walls appeared uniformly coated with target protein. The immobilized enzyme activity was in the range expected for monolayer coverage of the plain surface with oxidase (2.37 × 10(-5) nmol/mm(2) ). Surface attachment of the enzyme was completely stable under flow. The operational half-life of the immobilized oxidase (25°C, pH 8.0; soluble catalase added) was 40 h. Enzymatic oxidation of d-Met into α-keto-γ-(methylthio)butyric acid was characterized in single-pass and recycle reactor configurations, employing in-line measurement of dissolved O2 , and off-line determination of the keto-acid product. Reaction-diffusion time-scale analysis for different flow conditions showed that the heterogeneously catalyzed reaction was always slower than diffusion of O2 to the solid surface (DaII ≤ 0.3). Potential of the microreactor for intensifying O2 -dependent biotransformations restricted by mass transfer in conventional reactors is thus revealed. Biotechnol. Bioeng. 2016;113: 2342-2349. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Enzymes involved in branched-chain amino acid metabolism in humans.
Adeva-Andany, María M; López-Maside, Laura; Donapetry-García, Cristóbal; Fernández-Fernández, Carlos; Sixto-Leal, Cristina
2017-06-01
Branched-chain amino acids (leucine, isoleucine and valine) are structurally related to branched-chain fatty acids. Leucine is 2-amino-4-methyl-pentanoic acid, isoleucine is 2-amino-3-methyl-pentanoic acid, and valine is 2-amino-3-methyl-butanoic acid. Similar to fatty acid oxidation, leucine and isoleucine produce acetyl-coA. Additionally, leucine generates acetoacetate and isoleucine yields propionyl-coA. Valine oxidation produces propionyl-coA, which is converted into methylmalonyl-coA and succinyl-coA. Branched-chain aminotransferase catalyzes the first reaction in the catabolic pathway of branched-chain amino acids, a reversible transamination that converts branched-chain amino acids into branched-chain ketoacids. Simultaneously, glutamate is converted in 2-ketoglutarate. The branched-chain ketoacid dehydrogenase complex catalyzes the irreversible oxidative decarboxylation of branched-chain ketoacids to produce branched-chain acyl-coA intermediates, which then follow separate catabolic pathways. Human tissue distribution and function of most of the enzymes involved in branched-chain amino acid catabolism is unknown. Congenital deficiencies of the enzymes involved in branched-chain amino acid metabolism are generally rare disorders. Some of them are associated with reduced pyruvate dehydrogenase complex activity and respiratory chain dysfunction that may contribute to their clinical phenotype. The biochemical phenotype is characterized by accumulation of the substrate to the deficient enzyme and its carnitine and/or glycine derivatives. It was established at the beginning of the twentieth century that the plasma level of the branched-chain amino acids is increased in conditions associated with insulin resistance such as obesity and diabetes mellitus. However, the potential clinical relevance of this elevation is uncertain.
Genetics Home Reference: congenital bile acid synthesis defect type 1
... type 1 Congenital bile acid synthesis defect type 1 Printable PDF Open All Close All Enable Javascript to view the expand/collapse boxes. Description Congenital bile acid synthesis defect type 1 ...
USDA-ARS?s Scientific Manuscript database
Cinnamic acid 4-hydroxylase (C4H) is the first hydroxylase enzyme of the phenylpropanoid pathway, and its content and activity affects the lignin synthesis. In this study, we isolated a C4H gene SbC4H1 from the suppression subtractive hybridization library of brown midrib (bmr) mutants of Sorghum b...
Synthesis of alpha-amino acids
Davis, J.W. Jr.
1983-01-25
A method is described for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R[sub 1]R[sub 2]C(OSOCl)CN, R[sub 1]R[sub 2]C(Cl)CN and [R[sub 1]R[sub 2]C(CN)O][sub 2]SO wherein R[sub 1] and R[sub 2] are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art. No Drawings
Antimycobacterial action of thiolactomycin: an inhibitor of fatty acid and mycolic acid synthesis.
Slayden, R A; Lee, R E; Armour, J W; Cooper, A M; Orme, I M; Brennan, P J; Besra, G S
1996-01-01
Thiolactomycin (TLM) possesses in vivo antimycobacterial activity against the saprophytic strain Mycobacterium smegmatis mc2155 and the virulent strain M. tuberculosis Erdman, resulting in complete inhibition of growth on solid media at 75 and 25 micrograms/ml, respectively. Use of an in vitro murine macrophage model also demonstrated the killing of viable intracellular M. tuberculosis in a dose-dependent manner. Through the use of in vivo [1,2-14C]acetate labeling of M. smegmatis, TLM was shown to inhibit the synthesis of both fatty acids and mycolic acids. However, synthesis of the shorter-chain alpha'-mycolates of M. smegmatis was not inhibited by TLM, whereas synthesis of the characteristic longer-chain alpha-mycolates and epoxymycolates was almost completely inhibited at 75 micrograms/ml. The use of M. smegmatis cell extracts demonstrated that TLM specifically inhibited the mycobacterial acyl carrier protein-dependent type II fatty acid synthase (FAS-II) but not the multifunctional type I fatty acid synthase (FAS-I). In addition, selective inhibition of long-chain mycolate synthesis by TLM was demonstrated in a dose-response manner in purified, cell wall-containing extracts of M. smegmatis cells. The in vivo and in vitro data and knowledge of the mechanism of TLM resistance in Escherichia coli suggest that two distinct TLM targets exist in mycobacteria, the beta-ketoacyl-acyl carrier protein synthases involved in FAS-II and the elongation steps leading to the synthesis of the alpha-mycolates and oxygenated mycolates. The efficacy of TLM against M. smegmatis and M. tuberculosis provides the prospects of identifying fatty acid and mycolic acid biosynthetic genes and revealing a novel range of chemotherapeutic agents directed against M. tuberculosis. PMID:9124847
Plaga, W; Frank, R; Knappe, J
1988-12-15
Pyruvate formate-lyase of Escherichia coli cells, a homodimeric protein of 2 x 85 kDa, is distinguished by the property of containing a stable organic free radical (g = 2.0037) in its resting state. The enzyme (E-SH) achieves pyruvate conversion to acetyl-CoA via two distinct half-reactions (E-SH + pyruvate in equilibrium E-S-acetyl + formate; E-S-acetyl + CoA in equilibrium E-SH + acetyl-CoA), the first of which has been proposed to involve reversible homolytic carbon-carbon bond cleavage [J. Knappe et al. (1984) Proc. Natl Acad. Sci. USA 81, 1332-1335]. Present studies identified Cys-419 as the covalent-catalytic cysteinyl residue via CNBr fragmentation of E-S-[14C]acetyl and radio-sequencing of the isolated peptide CB-Ac (amino acid residues 406-423). Reaction of the formate analogue hypophosphite with E-S-acetyl was investigated and found to produce 1-hydroxyethylphosphonate with a thioester linkage to the adjacent Cys-418. The structure was determined from the chymotryptic peptide CH-P (amino acid residues 415-425), using 31P-NMR spectroscopy (delta = 44 ppm) and by chemical characterisation through degradation into 1-hydroxyethylphosphonate with phosphodiesterase or bromine. This novel P-C-bond synthesis involves the enzyme-based free radical and is proposed to resemble the physiological C-C-bond synthesis (pyruvate production) from formate and E-S-acetyl. These findings are interpreted as proof of a radical mechanism for the action of pyruvate formate-lyase. The central Cys-418/Cys-419 pair of the active site shows a distinctive thiolate property even in the inactive (nonradical) form of the enzyme, as determined using an iodoacetate probe.
Roles of Fe-S proteins: from cofactor synthesis to iron homeostasis to protein synthesis.
Pain, Debkumar; Dancis, Andrew
2016-06-01
Fe-S cluster assembly is an essential process for all cells. Impairment of Fe-S cluster assembly creates diseases in diverse and surprising ways. In one scenario, the loss of function of lipoic acid synthase, an enzyme with Fe-S cluster cofactor in mitochondria, impairs activity of various lipoamide-dependent enzymes with drastic consequences for metabolism. In a second scenario, the heme biosynthetic pathway in red cell precursors is specifically targeted, and iron homeostasis is perturbed, but lipoic acid synthesis is unaffected. In a third scenario, tRNA modifications arising from action of the cysteine desulfurase and/or Fe-S cluster proteins are lost, which may lead to impaired protein synthesis. These defects can then result in cancer, neurologic dysfunction or type 2 diabetes. Copyright © 2016 Elsevier Ltd. All rights reserved.
Smith, Stuart; Witkowski, Andrzej; Moghul, Ayesha; Yoshinaga, Yuko; Nefedov, Michael; de Jong, Pieter; Feng, Dejiang; Fong, Loren; Tu, Yiping; Hu, Yan; Young, Stephen G.; Pham, Thomas; Cheung, Carling; Katzman, Shana M.; Brand, Martin D.; Quinlan, Casey L.; Fens, Marcel; Kuypers, Frans; Misquitta, Stephanie; Griffey, Stephen M.; Tran, Son; Gharib, Afshin; Knudsen, Jens; Hannibal-Bach, Hans Kristian; Wang, Grace; Larkin, Sandra; Thweatt, Jennifer; Pasta, Saloni
2012-01-01
A mouse model with compromised mitochondrial fatty acid synthesis has been engineered in order to assess the role of this pathway in mitochondrial function and overall health. Reduction in the expression of mitochondrial malonyl CoA-acyl carrier protein transacylase, a key enzyme in the pathway encoded by the nuclear Mcat gene, was achieved to varying extents in all examined tissues employing tamoxifen-inducible Cre-lox technology. Although affected mice consumed more food than control animals, they failed to gain weight, were less physically active, suffered from loss of white adipose tissue, reduced muscle strength, kyphosis, alopecia, hypothermia and shortened lifespan. The Mcat-deficient phenotype is attributed primarily to reduced synthesis, in several tissues, of the octanoyl precursors required for the posttranslational lipoylation of pyruvate and α-ketoglutarate dehydrogenase complexes, resulting in diminished capacity of the citric acid cycle and disruption of energy metabolism. The presence of an alternative lipoylation pathway that utilizes exogenous free lipoate appears restricted to liver and alone is insufficient for preservation of normal energy metabolism. Thus, de novo synthesis of precursors for the protein lipoylation pathway plays a vital role in maintenance of mitochondrial function and overall vigor. PMID:23077570
A Seven-Gene Locus for Synthesis of Phenazine-1-Carboxylic Acid by Pseudomonas fluorescens 2-79
Mavrodi, Dmitri V.; Ksenzenko, Vladimir N.; Bonsall, Robert F.; Cook, R. James; Boronin, Alexander M.; Thomashow, Linda S.
1998-01-01
Pseudomonas fluorescens 2-79 produces the broad-spectrum antibiotic phenazine-1-carboxylic acid (PCA), which is active against a variety of fungal root pathogens. In this study, seven genes designated phzABCDEFG that are sufficient for synthesis of PCA were localized within a 6.8-kb BglII-XbaI fragment from the phenazine biosynthesis locus of strain 2-79. Polypeptides corresponding to all phz genes were identified by analysis of recombinant plasmids in a T7 promoter/polymerase expression system. Products of the phzC, phzD, and phzE genes have similarities to enzymes of shikimic acid and chorismic acid metabolism and, together with PhzF, are absolutely necessary for PCA production. PhzG is similar to pyridoxamine-5′-phosphate oxidases and probably is a source of cofactor for the PCA-synthesizing enzyme(s). Products of the phzA and phzB genes are highly homologous to each other and may be involved in stabilization of a putative PCA-synthesizing multienzyme complex. Two new genes, phzX and phzY, that are homologous to phzA and phzB, respectively, were cloned and sequenced from P. aureofaciens 30-84, which produces PCA, 2-hydroxyphenazine-1-carboxylic acid, and 2-hydroxyphenazine. Based on functional analysis of the phz genes from strains 2-79 and 30-84, we postulate that different species of fluorescent pseudomonads have similar genetic systems that confer the ability to synthesize PCA. PMID:9573209
An efficient synthesis of tetramic acid derivatives with extended conjugation from L-Ascorbic Acid
Singh, Biswajit K; Bisht, Surendra S; Tripathi, Rama P
2006-01-01
Background Tetramic acids with polyenyl substituents are an important class of compounds in medicinal chemistry. Both solid and solution phase syntheses of such molecules have been reported recently. Thiolactomycin, a clinical candidate for treatment of tuberculosis has led to further explorations in this class. We have recently developed an efficient synthesis of tetramic acids derivatives from L- ascorbic acid. In continuation of this work, we have synthesised dienyl tetramic acid derivatives. Results 5,6-O-Isopropylidene-ascorbic acid on reaction with DBU led to the formation of tetronolactonyl allyl alcohol, which on oxidation with pyridinium chlorochromate gave the respective tetranolactonyl allylic aldehydes. Wittig olefination followed by reaction of the resulting tetranolactonyl dienyl esters with different amines resulted in the respective 5-hydroxy lactams. Subsequent dehydration of the hydroxy lactams with p-toluene sulphonic acid afforded the dienyl tetramic acid derivatives. All reactions were performed at ambient temperature and the yields are good. Conclusion An efficient and practical method for the synthesis of dienyl tetramic acid derivatives from inexpensive and easily accessible ascorbic acid has been developed. The compounds bear structural similarities to the tetramic acid based polyenic antibiotics and thus this method offers a new and short route for the synthesis of tetramic acid derivatives of biological significance. PMID:17147830
An efficient synthesis of tetramic acid derivatives with extended conjugation from L-ascorbic acid.
Singh, Biswajit K; Bisht, Surendra S; Tripathi, Rama P
2006-12-06
Tetramic acids with polyenyl substituents are an important class of compounds in medicinal chemistry. Both solid and solution phase syntheses of such molecules have been reported recently. Thiolactomycin, a clinical candidate for treatment of tuberculosis has led to further explorations in this class. We have recently developed an efficient synthesis of tetramic acids derivatives from L-ascorbic acid. In continuation of this work, we have synthesised dienyl tetramic acid derivatives. 5,6-O-isopropylidene-ascorbic acid on reaction with DBU led to the formation of tetronolactonyl allyl alcohol, which on oxidation with pyridinium chlorochromate gave the respective tetranolactonyl allylic aldehydes. Wittig olefination followed by reaction of the resulting tetranolactonyl dienyl esters with different amines resulted in the respective 5-hydroxy lactams. Subsequent dehydration of the hydroxy lactams with p-toluene sulphonic acid afforded the dienyl tetramic acid derivatives. All reactions were performed at ambient temperature and the yields are good. An efficient and practical method for the synthesis of dienyl tetramic acid derivatives from inexpensive and easily accessible ascorbic acid has been developed. The compounds bear structural similarities to the tetramic acid based polyenic antibiotics and thus this method offers a new and short route for the synthesis of tetramic acid derivatives of biological significance.
Nanson, Jeffrey D; Forwood, Jade K
2015-01-01
Ketoacyl-acyl carrier protein reductases (FabG) are ubiquitously expressed enzymes that catalyse the reduction of acyl carrier protein (ACP) linked thioesters within the bacterial type II fatty acid synthesis (FASII) pathway. The products of these enzymes, saturated and unsaturated fatty acids, are essential components of the bacterial cell envelope. The FASII reductase enoyl-ACP reductase (FabI) has been the focus of numerous drug discovery efforts, some of which have led to clinical trials, yet few studies have focused on FabG. Like FabI, FabG appears to be essential for survival in many bacteria, similarly indicating the potential of this enzyme as a drug target. FabG enzymes are members of the short-chain alcohol dehydrogenase/reductase (SDR) family, and like other SDRs, exhibit highly conserved secondary and tertiary structures, and contain a number of conserved sequence motifs. Here we describe the crystal structures of FabG from Yersinia pestis (YpFabG), the causative agent of bubonic, pneumonic, and septicaemic plague, and three human pandemics. Y. pestis remains endemic in many parts of North America, South America, Southeast Asia, and Africa, and a threat to human health. YpFabG shares a high degree of structural similarity with bacterial homologues, and the ketoreductase domain of the mammalian fatty acid synthase from both Homo sapiens and Sus scrofa. Structural characterisation of YpFabG, and comparison with other bacterial FabGs and the mammalian fatty acid synthase, provides a strong platform for virtual screening of potential inhibitors, rational drug design, and the development of new antimicrobial agents to combat Y. pestis infections.
Kent, R S; Diedrich, S L; Whorton, A R
1983-01-01
To address the hypothesis that metabolites of arachidonic acid are important regulators of prostaglandin (PG) synthesis in intact vascular tissue, we studied arachidonate metabolism in rabbit aortas in response to a continuous infusion of arachidonic acid, 10 micrograms/ml. Prostacyclin (PGI2; measured as 6-keto-PGF1 alpha) production rate accelerated during the first 2 min, reached peak velocity at 2 min, and then progressively decelerated. The velocity profile of PGI2 production was similar to that previously reported for cyclooxygenase holoenzyme assayed in vitro, and was consistent with progressive inactivation of the enzymes leading to PGI2 synthesis. We determined the specific inhibition of cyclooxygenase and prostacyclin synthetase by measuring PGI2 and PGE2 production rates and by infusing cyclic endoperoxides. Our results indicate preferential inactivation of cyclooxygenase during arachidonate metabolism, most likely due to cyclooxygenase-derived oxidative intermediates. This was a dose-dependent response and resulted in a progressive decrease in the 6-keto-PGF1 alpha/PGE2 ratio. Exogenously added 15-hydroperoxy eicosatetraenoic acid, on the other hand, actually stimulated cyclooxygenase activity at low doses, while markedly inhibiting prostacyclin synthetase. This finding, along with the accelerating nature of arachidonate metabolism, is consistent with the concept of "peroxide tone" as a mediator of cyclooxygenase activity in this system. These results demonstrate that arachidonate metabolites regulate PG synthesis in intact blood vessels. The progressive enzymatic inhibition intrinsic to arachidonate metabolism may be a model for similar changes occurring in states of enhanced lipid peroxidation. These metabolic alterations might greatly influence the numerous vascular functions known to involve arachidonic acid metabolism. PMID:6409932
Towards efficient chemical synthesis via engineering enzyme catalysis in biomimetic nanoreactors.
Liu, Jia; Yang, Qihua; Li, Can
2015-09-18
Biocatalysis with immobilized enzymes as catalysts holds enormous promise in developing more efficient and sustainable processes for the synthesis of fine chemicals, chiral pharmaceuticals and biomass feedstocks. Despite the appealing potentials, nowadays the industrial-scale application of biocatalysts is still quite modest in comparison with that of traditional chemical catalysts. A critical issue is that the catalytic performance of enzymes, the sophisticated and vulnerable catalytic machineries, strongly depends on their intracellular working environment; however the working circumstances provided by the support matrix are radically different from those in cells. This often leads to various adverse consequences on enzyme conformation and dynamic properties, consequently decreasing the overall performance of immobilized enzymes with regard to their activity, selectivity and stability. Engineering enzyme catalysis in support nanopores by mimicking the physiological milieu of enzymes in vivo and investigating how the interior microenvironment of nanopores imposes an influence on enzyme behaviors in vitro are of paramount significance to modify and improve the catalytic functions of immobilized enzymes. In this feature article, we have summarized the recent advances in mimicking the working environment and working patterns of intracellular enzymes in nanopores of mesoporous silica-based supports. Especially, we have demonstrated that incorporation of polymers into silica nanopores could be a valuable approach to create the biomimetic microenvironment for enzymes in the immobilized state.
Lynch, Caitlin; Pan, Yongmei; Li, Linhao; Heyward, Scott; Moeller, Timothy; Swaan, Peter W.; Wang, Hongbing
2014-01-01
Objective Accumulating evidence suggests that activation of mouse constitutive androstane receptor (mCAR) alleviates type 2 diabetes and obesity by inhibiting hepatic gluconeogenesis, lipogenesis, and fatty acid synthesis. However, the role of human (h) CAR in energy metabolism is largely unknown. The present study aims to investigate the effects of selective hCAR activators on hepatic energy metabolism in human primary hepatocytes (HPH). Methods Ligand-based structure-activity models were used for virtual screening of the Specs database (www.specs.net) followed by biological validation in cell-based luciferase assays. The effects of two novel hCAR activators (UM104 and UM145) on hepatic energy metabolism were evaluated in HPH. Results Real-time PCR and Western blotting analyses reveal that activation of hCAR by UM104 and UM145 significantly repressed the expression of glucose-6-phosphatase and phosphoenolpyruvate carboxykinase, two pivotal gluconeogenic enzymes, while exerting negligible effects on the expression of genes associated with lipogenesis and fatty acid synthesis. Functional experiments show that UM104 and UM145 markedly inhibit hepatic synthesis of glucose but not triglycerides in HPH. In contrast, activation of mCAR by 1,4-bis[2-(3,5-dichloropyridyloxy)]benzene, a selective mCAR activator, repressed the expression of genes associated with gluconeogenesis, lipogenesis, and fatty acid synthesis in mouse primary hepatocytes, which were consistent with previous observations in mouse model in vivo. Conclusion Our findings uncover an important species difference between hCAR and mCAR in hepatic energy metabolism, where hCAR selectively inhibits gluconeogenesis without suppressing fatty acid synthesis. Implications Such species selectivity should be considered when exploring CAR as a potential therapeutic target for metabolic disorders. PMID:24878338
Alpha-lipoic acid supplementation protects enzymes from damage by nitrosative and oxidative stress.
Hiller, Sylvia; DeKroon, Robert; Hamlett, Eric D; Xu, Longquan; Osorio, Cristina; Robinette, Jennifer; Winnik, Witold; Simington, Stephen; Maeda, Nobuyo; Alzate, Oscar; Yi, Xianwen
2016-01-01
S-nitrosylation of mitochondrial enzymes involved in energy transfer under nitrosative stress may result in ATP deficiency. We investigated whether α-lipoic acid, a powerful antioxidant, could alleviate nitrosative stress by regulating S-nitrosylation, which could result in retaining the mitochondrial enzyme activity. In this study, we have identified the S-nitrosylated forms of subunit 1 of dihydrolipoyllysine succinyltransferase (complex III), and subunit 2 of the α-ketoglutarate dehydrogenase complex by implementing a fluorescence-based differential quantitative proteomics method. We found that the activities of these two mitochondrial enzymes were partially but reversibly inhibited by S-nitrosylation in cultured endothelial cells, and that their activities were partially restored by supplementation of α-lipoic acid. We show that protein S-nitrosylation affects the activity of mitochondrial enzymes that are central to energy supply, and that α-lipoic acid protects mitochondrial enzymes by altering S-nitrosylation levels. Inhibiting protein S-nitrosylation with α-lipoic acid seems to be a protective mechanism against nitrosative stress. Identification and characterization of these new protein targets should contribute to expanding the therapeutic power of α-lipoic acid and to a better understanding of the underlying antioxidant mechanisms.
Chlubnova, Ilona; Legentil, Laurent; Dureau, Rémy; Pennec, Alizé; Almendros, Mélanie; Daniellou, Richard; Nugier-Chauvin, Caroline; Ferrières, Vincent
2012-07-15
There is no doubt now that the synthesis of compounds of varying complexity such as saccharides and derivatives thereof continuously grows with enzymatic methods. This review focuses on recent basic knowledge on enzymes specifically involved in the biosynthesis and degradation of furanosyl-containing polysaccharides and conjugates. Moreover, and when possible, biocatalyzed approaches, alternative to standard synthesis, will be detailed in order to strengthen the high potential of these biocatalysts to go further with the preparation of rare furanosides. Interesting results will be also proposed with chemo-enzymatic processes based on nonfuranosyl-specific enzymes. Copyright © 2012 Elsevier Ltd. All rights reserved.
Dysregulation of fatty acid synthesis and glycolysis in non-Hodgkin lymphoma
Bhatt, Aadra P.; Jacobs, Sarah R.; Freemerman, Alex J.; Makowski, Liza; Rathmell, Jeffrey C.; Dittmer, Dirk P.; Damania, Blossom
2012-01-01
The metabolic differences between B-NHL and primary human B cells are poorly understood. Among human B-cell non-Hodgkin lymphomas (B-NHL), primary effusion lymphoma (PEL) is a unique subset that is linked to infection with Kaposi's sarcoma-associated herpesvirus (KSHV). We report that the metabolic profiles of primary B cells are significantly different from that of PEL. Compared with primary B cells, both aerobic glycolysis and fatty acid synthesis (FAS) are up-regulated in PEL and other types of nonviral B-NHL. We found that aerobic glycolysis and FAS occur in a PI3K-dependent manner and appear to be interdependent. PEL overexpress the fatty acid synthesizing enzyme, FASN, and both PEL and other B-NHL were much more sensitive to the FAS inhibitor, C75, than primary B cells. Our findings suggest that FASN may be a unique candidate for molecular targeted therapy against PEL and other B-NHL. PMID:22752304
Amano, Satoshi; Ogura, Yuki; Akutsu, Nobuko; Nishiyama, Toshio
2007-02-01
Type VII collagen is the major component of anchoring fibrils in the epidermal basement membrane. Its expression has been analyzed by immunostaining or Northern blotting, but rarely at the protein level. In this study, we have quantitatively examined the effects of ascorbic acid and various cytokines/growth factors on the protein synthesis and secretion of type VII collagen by human dermal fibroblasts in culture, using a developed, highly sensitive sandwich enzyme-linked immunoassay with two kinds of specific monoclonal antibodies against the non-collagenous domain-1. Ascorbic acid and its derivative induced a twofold increase in type VII collagen synthesis, and markedly increased the secretion of type VII collagen into the medium when compared with the control culture. This effect was not influenced by the presence of transforming growth factor-beta1 (TGF-beta1). The synthesis of type VII collagen was elevated by TGF-beta1, platelet-derived growth factor, tumor necrosis factor-alpha, and interleukin-1beta, but not by TGF-alpha. Thus, our data indicate that the synthesis and secretion of type VII collagen in human dermal fibroblasts are regulated by ascorbate and the enhancement of type VII collagen gene expression by cytokines/growth factors is accompanied with elevated production of type VII collagen at the protein level.
Boyer, Laura; Roussel, Xavier; Courseaux, Adeline; Ndjindji, Ofilia M; Lancelon-Pin, Christine; Putaux, Jean-Luc; Tetlow, Ian J; Emes, Michael J; Pontoire, Bruno; D' Hulst, Christophe; Wattebled, Fabrice
2016-07-01
Starch synthesis requires several enzymatic activities including branching enzymes (BEs) responsible for the formation of α(1 → 6) linkages. Distribution and number of these linkages are further controlled by debranching enzymes that cleave some of them, rendering the polyglucan water-insoluble and semi-crystalline. Although the activity of BEs and debranching enzymes is mandatory to sustain normal starch synthesis, the relative importance of each in the establishment of the plant storage polyglucan (i.e. water insolubility, crystallinity and presence of amylose) is still debated. Here, we have substituted the activity of BEs in Arabidopsis with that of the Escherichia coli glycogen BE (GlgB). The latter is the BE counterpart in the metabolism of glycogen, a highly branched water-soluble and amorphous storage polyglucan. GlgB was expressed in the be2 be3 double mutant of Arabidopsis, which is devoid of BE activity and consequently free of starch. The synthesis of a water-insoluble, partly crystalline, amylose-containing starch-like polyglucan was restored in GlgB-expressing plants, suggesting that BEs' origin only has a limited impact on establishing essential characteristics of starch. Moreover, the balance between branching and debranching is crucial for the synthesis of starch, as an excess of branching activity results in the formation of highly branched, water-soluble, poorly crystalline polyglucan. © 2015 John Wiley & Sons Ltd.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lynch, Caitlin; Pan, Yongmei; Li, Linhao
Objective: Accumulating evidence suggests that activation of mouse constitutive androstane receptor (mCAR) alleviates type 2 diabetes and obesity by inhibiting hepatic gluconeogenesis, lipogenesis, and fatty acid synthesis. However, the role of human (h) CAR in energy metabolism is largely unknown. The present study aims to investigate the effects of selective hCAR activators on hepatic energy metabolism in human primary hepatocytes (HPH). Methods: Ligand-based structure–activity models were used for virtual screening of the Specs database ( (www.specs.net)) followed by biological validation in cell-based luciferase assays. The effects of two novel hCAR activators (UM104 and UM145) on hepatic energy metabolism were evaluatedmore » in HPH. Results: Real-time PCR and Western blotting analyses reveal that activation of hCAR by UM104 and UM145 significantly repressed the expression of glucose-6-phosphatase and phosphoenolpyruvate carboxykinase, two pivotal gluconeogenic enzymes, while exerting negligible effects on the expression of genes associated with lipogenesis and fatty acid synthesis. Functional experiments show that UM104 and UM145 markedly inhibit hepatic synthesis of glucose but not triglycerides in HPH. In contrast, activation of mCAR by 1,4-bis[2-(3,5-dichloropyridyloxy)]benzene, a selective mCAR activator, repressed the expression of genes associated with gluconeogenesis, lipogenesis, and fatty acid synthesis in mouse primary hepatocytes, which were consistent with previous observations in mouse model in vivo. Conclusion: Our findings uncover an important species difference between hCAR and mCAR in hepatic energy metabolism, where hCAR selectively inhibits gluconeogenesis without suppressing fatty acid synthesis. Implications: Such species selectivity should be considered when exploring CAR as a potential therapeutic target for metabolic disorders. - Highlights: • Novel hCAR activators were identified by computational and biological approaches.
Synthesis and degradation of phenylalanine ammonia-lyase of Rhodosporidium toruloides.
Gilbert, H J; Tully, M
1982-01-01
The regulation of the enzyme phenylalanine ammonia-lyase (PAL), which is of potential use in oral treatment of phenylketonuria, was investigated. Antiserum against PAL was prepared and was shown to be monospecific for the enzyme by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The native enzyme and two inactive mutant forms of the enzyme were purified to homogeneity by immunoaffinity chromatography, using anti-PAL immunoglobulin G-Sepharose 4B. Both mutant enzymes contained intact prosthetic groups. The formation of PAL catalytic activity after phenylalanine was added to yeast cultures was paralleled by the appearance of enzyme antigen. During induction, uptake of [3H]leucine into the enzyme was higher than uptake into total protein. Our results are consistent with de novo synthesis of an enzyme induced by phenylalanine, rather than activation of a proenzyme. The half-lives of PAL and total protein were similar in both exponential and stationary phase cultures. No metabolite tested affected the rate of enzyme degradation. Glucose repressed enzyme synthesis, whereas ammonia reduced phenylalanine uptake and pool size and so may repress enzyme synthesis through inducer exclusion. The synthesis of enzyme antigen by a mutant unable to metabolize phenylalanine indicated that this amino acid is the physiological inducer of the enzyme. PMID:7068528
Synthesis and degradation of phenylalanine ammonia-lyase of Rhodosporidium toruloides.
Gilbert, H J; Tully, M
1982-05-01
The regulation of the enzyme phenylalanine ammonia-lyase (PAL), which is of potential use in oral treatment of phenylketonuria, was investigated. Antiserum against PAL was prepared and was shown to be monospecific for the enzyme by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The native enzyme and two inactive mutant forms of the enzyme were purified to homogeneity by immunoaffinity chromatography, using anti-PAL immunoglobulin G-Sepharose 4B. Both mutant enzymes contained intact prosthetic groups. The formation of PAL catalytic activity after phenylalanine was added to yeast cultures was paralleled by the appearance of enzyme antigen. During induction, uptake of [3H]leucine into the enzyme was higher than uptake into total protein. Our results are consistent with de novo synthesis of an enzyme induced by phenylalanine, rather than activation of a proenzyme. The half-lives of PAL and total protein were similar in both exponential and stationary phase cultures. No metabolite tested affected the rate of enzyme degradation. Glucose repressed enzyme synthesis, whereas ammonia reduced phenylalanine uptake and pool size and so may repress enzyme synthesis through inducer exclusion. The synthesis of enzyme antigen by a mutant unable to metabolize phenylalanine indicated that this amino acid is the physiological inducer of the enzyme.
Purification and Characterization of the Crown Gall-specific Enzyme, Octopine Synthase 1
Hack, Ethan; Kemp, John D.
1980-01-01
A single enzyme catalyzes the synthesis of all four N2-(1-carboxyethyl)-amino acid derivatives found in a crown gall tumor tissue induced by Agrobacterium tumefaciens (E. F. Sm. and Town.) Conn strain B6 on sunflower (Helianthus annuus L.). This enzyme, octopine synthase, has been purified by ammonium sulfate fractionation and chromatography on diethylaminoethylcellulose, blue agarose, and hydroxylapatite. The purified enzyme has all the N2-(1-carboxyethyl)-amino acid synthesizing activities found in crude preparations, and the relative activities with six amino acids remain nearly constant during purification. Although the maximum velocities (V) and Michaelis constants (Km) differ, the ratio V/Km is the same for all amino acid substrates. Thus an equimolar mixture of amino acids will give rise to an equimolar mixture of products. The kinetic properties of the enzyme are consistent with a partially ordered mechanism with arginine (NADPH, then arginine or pyruvate). Octopine synthase is a monomeric enzyme with a molecular weight of 39,000 by gel filtration and 38,000 by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Images PMID:16661312
Effect of tannic acid on the synthesis of protein and nucleic acid by rat liver
Badawy, A. A.-B.; White, Audrey E.; Lathe, G. H.
1969-01-01
1. As early as 1hr. after the intraperitoneal administration of tannic acid to rats, it could be demonstrated in the liver. At 3hr. the nuclear fraction contained the largest amount of tannic acid. 2. Nuclear RNA synthesis was inhibited in vivo 2hr. after the administration of tannic acid. Induction by cortisol of tryptophan pyrrolase was 90% inhibited at 24hr. 3. Incorporation of [1-14C]leucine into protein by liver slices from treated rats was decreased by 50% after 24hr. Its incorporation into postmitochondrial supernatant from treated animals was not inhibited. Incorporation into slices and postmitochondrial supernatants were inhibited in vitro by tannic acid. 4. The sequence of events: concentration of tannic acid in nuclei, inhibition of nuclear RNA synthesis, inhibition of protein synthesis and production of necrosis, is discussed. PMID:5808319
Farooqui, A A; Adams, D D; Hanson, W L; Prestwood, A K
1987-08-01
Percoll density gradient centrifugation was used for isolating large quantities of bradyzoites of Sarcocystis suicanis, which were used for enzymatic analysis. Crude extracts of bradyzoites contained activities suggestive of several acid hydrolases. Levels of acid and alkaline phosphatase were higher than those of beta-N-acetylhexosaminidase and beta-galactosidase. Acid phosphatase was purified 156-fold with an overall recovery of 54% using DEAE-Sepharose 4B and Sephadex G-200 chromatography. The partially purified enzyme was not a glycoprotein and had a molecular weight of approximately 170,000. The enzyme was markedly inhibited by Cu++, Hg++, and iodoacetamide, suggesting the presence of a sulfhydryl group. Sodium tartrate caused strong inhibition of the enzyme. The acid phosphatase of S. suicanis appears to be a unique enzyme that cannot be classified under high or low molecular weight acid phosphatases of widely diverse origin.
Chalabaev, Sabina; Turlin, Evelyne; Bay, Sylvie; Ganneau, Christelle; Brito-Fravallo, Emma; Charles, Jean-François; Danchin, Antoine; Biville, Francis
2008-01-01
Photorhabdus luminescens, an entomopathogenic bacterium and nematode symbiont, has homologues of the Hca and Mhp enzymes. In Escherichia coli, these enzymes catalyze the degradation of the aromatic compounds 3-phenylpropionate (3PP) and cinnamic acid (CA) and allow the use of 3PP as sole carbon source. P. luminescens is not able to use 3PP and CA as sole carbon sources but can degrade them. Hca dioxygenase is involved in this degradation pathway. P. luminescens synthesizes CA from phenylalanine via a phenylalanine ammonia-lyase (PAL) and degrades it via the not-yet-characterized biosynthetic pathway of 3,5-dihydroxy-4-isopropylstilbene (ST) antibiotic. CA induces its own synthesis by enhancing the expression of the stlA gene that codes for PAL. P. luminescens bacteria release endogenous CA into the medium at the end of exponential growth and then consume it. Hca dioxygenase is involved in the consumption of endogenous CA but is not required for ST production. This suggests that CA is consumed via at least two separate pathways in P. luminescens: the biosynthesis of ST and a pathway involving the Hca and Mhp enzymes. PMID:18245247
Lovelock, Sarah L; Lloyd, Richard C; Turner, Nicholas J
2014-04-25
Phenylalanine ammonia lyases (PALs) belong to a family of 4-methylideneimidazole-5-one (MIO) cofactor dependent enzymes which are responsible for the conversion of L-phenylalanine into trans-cinnamic acid in eukaryotic and prokaryotic organisms. Under conditions of high ammonia concentration, this deamination reaction is reversible and hence there is considerable interest in the development of PALs as biocatalysts for the enantioselective synthesis of non-natural amino acids. Herein the discovery of a previously unobserved competing MIO-independent reaction pathway, which proceeds in a non-stereoselective manner and results in the generation of both L- and D-phenylalanine derivatives, is described. The mechanism of the MIO-independent pathway is explored through isotopic-labeling studies and mutagenesis of key active-site residues. The results obtained are consistent with amino acid deamination occurring by a stepwise E1 cB elimination mechanism. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Chen, Nanhua; LaCrue, Alexis N.; Teuscher, Franka; Waters, Norman C.; Gatton, Michelle L.; Kyle, Dennis E.
2014-01-01
Artemisinin (ART)-based combination therapy (ACT) is used as the first-line treatment of uncomplicated falciparum malaria worldwide. However, despite high potency and rapid action, there is a high rate of recrudescence associated with ART monotherapy or ACT long before the recent emergence of ART resistance. ART-induced ring-stage dormancy and recovery have been implicated as possible causes of recrudescence; however, little is known about the characteristics of dormant parasites, including whether dormant parasites are metabolically active. We investigated the transcription of 12 genes encoding key enzymes in various metabolic pathways in P. falciparum during dihydroartemisinin (DHA)-induced dormancy and recovery. Transcription analysis showed an immediate downregulation for 10 genes following exposure to DHA but continued transcription of 2 genes encoding apicoplast and mitochondrial proteins. Transcription of several additional genes encoding apicoplast and mitochondrial proteins, particularly of genes encoding enzymes in pyruvate metabolism and fatty acid synthesis pathways, was also maintained. Additions of inhibitors for biotin acetyl-coenzyme A (CoA) carboxylase and enoyl-acyl carrier reductase of the fatty acid synthesis pathways delayed the recovery of dormant parasites by 6 and 4 days, respectively, following DHA treatment. Our results demonstrate that most metabolic pathways are downregulated in DHA-induced dormant parasites. In contrast, fatty acid and pyruvate metabolic pathways remain active. These findings highlight new targets to interrupt recovery of parasites from ART-induced dormancy and to reduce the rate of recrudescence following ART treatment. PMID:24913167
Chen, Nanhua; LaCrue, Alexis N; Teuscher, Franka; Waters, Norman C; Gatton, Michelle L; Kyle, Dennis E; Cheng, Qin
2014-08-01
Artemisinin (ART)-based combination therapy (ACT) is used as the first-line treatment of uncomplicated falciparum malaria worldwide. However, despite high potency and rapid action, there is a high rate of recrudescence associated with ART monotherapy or ACT long before the recent emergence of ART resistance. ART-induced ring-stage dormancy and recovery have been implicated as possible causes of recrudescence; however, little is known about the characteristics of dormant parasites, including whether dormant parasites are metabolically active. We investigated the transcription of 12 genes encoding key enzymes in various metabolic pathways in P. falciparum during dihydroartemisinin (DHA)-induced dormancy and recovery. Transcription analysis showed an immediate downregulation for 10 genes following exposure to DHA but continued transcription of 2 genes encoding apicoplast and mitochondrial proteins. Transcription of several additional genes encoding apicoplast and mitochondrial proteins, particularly of genes encoding enzymes in pyruvate metabolism and fatty acid synthesis pathways, was also maintained. Additions of inhibitors for biotin acetyl-coenzyme A (CoA) carboxylase and enoyl-acyl carrier reductase of the fatty acid synthesis pathways delayed the recovery of dormant parasites by 6 and 4 days, respectively, following DHA treatment. Our results demonstrate that most metabolic pathways are downregulated in DHA-induced dormant parasites. In contrast, fatty acid and pyruvate metabolic pathways remain active. These findings highlight new targets to interrupt recovery of parasites from ART-induced dormancy and to reduce the rate of recrudescence following ART treatment. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
Cadmium Phytoavailability and Enzyme Activity under Humic Acid Treatment in Fluvo-aquic Soil
NASA Astrophysics Data System (ADS)
Liu, Borui; Huang, Qing; Su, Yuefeng
2018-01-01
A pot experiment was conducted to investigate the cadmium (Cd) availability to pakchois (Brassica chinensis L.) as well as the enzyme activities in fluvo-aquic soil under humic acid treatment. The results showed that the phytoavailability of Cd in soil decreased gradually as humic acid concentration rose (0 to 12 g·kg-1), while the activities of urease (UE), alkaline phosphatase (ALP) and catalase (CAT) kept increasing (P < 0.05). The correlation analysis indicated that humic acid was effective for reducing the devastation to soil enzymes due to the Cd pollution. In conclusion, humic acid is effective for the reduction of both Cd phytoavailability and the damage to enzyme activities due to Cd pollution in fluvo-aquic soil
The Roles of Acids and Bases in Enzyme Catalysis
ERIC Educational Resources Information Center
Weiss, Hilton M.
2007-01-01
Many organic reactions are catalyzed by strong acids or bases that protonate or deprotonate neutral reactants leading to reactive cations or anions that proceed to products. In enzyme reactions, only weak acids and bases are available to hydrogen bond to reactants and to transfer protons in response to developing charges. Understanding this…
Production of Glucaric Acid from Hemicellulose Substrate by Rosettasome Enzyme Assemblies.
Lee, Charles C; Kibblewhite, Rena E; Paavola, Chad D; Orts, William J; Wagschal, Kurt
2016-07-01
Hemicellulose biomass is a complex polymer with many different chemical constituents that can be utilized as industrial feedstocks. These molecules can be released from the polymer and transformed into value-added chemicals through multistep enzymatic pathways. Some bacteria produce cellulosomes which are assemblies composed of lignocellulolytic enzymes tethered to a large protein scaffold. Rosettasomes are artificial engineered ring scaffolds designed to mimic the bacterial cellulosome. Both cellulosomes and rosettasomes have been shown to facilitate much higher rates of biomass hydrolysis compared to the same enzymes free in solution. We investigated whether tethering enzymes involved in both biomass hydrolysis and oxidative transformation to glucaric acid onto a rosettasome scaffold would result in an analogous production enhancement in a combined hydrolysis and bioconversion metabolic pathway. Three different enzymes were used to hydrolyze birchwood hemicellulose and convert the substituents to glucaric acid, a top-12 DOE value added chemical feedstock derived from biomass. It was demonstrated that colocalizing the three different enzymes to the synthetic scaffold resulted in up to 40 % higher levels of product compared to uncomplexed enzymes.
Palanisamy, Kanmani; Kuppamuthu, Kumaresan; Jeyaseelan, Aravind
2015-01-01
Background Lipase is an enzyme with immense application potential. Ester synthesis by lipase catalysis in organic media is an area of key industrial relevance. Enzymatic preparations with traits that cater to the needs of this function are hence being intensely researched. Objective The objectives of the study were to immobilize the lipase from Bacillus sp. PS35 by cross-linking and adsorption onto styrene-divinyl benzene (Sty-Dvb) hydrophobic resin and to comparatively characterize the free and immobilized lipase preparations. The work also aimed to apply the immobilized lipase for catalysing the fatty acid methyl ester (FAME) synthesis from palm oil and optimize the process parameters for maximizing the yield. Materials and Methods In this study, the purified lipase from Bacillus sp. PS35 was immobilized by adsorption onto styrene-divinyl benzene hydrophobic resin with gluteraldehyde cross-linking. Results The immobilized enzyme showed better pH and temperature stabilities than the free lipase. Organic solvent stability was also enhanced, with the relative activity in the presence of methanol being shifted from 53% to 81%, thereby facilitating the enzyme’s application in fatty acid methyl ester synthesis. It exhibited remarkable storage stability over a 30-day period and after 20 repetitive uses. Cross-linking also reduced enzyme leakage by 49%. The immobilized lipase was then applied for biodiesel production from palm oil. Methanol and oil molar ratio of 5:1, three step methanol additions, and an incubation temperature of 50°C were established to be the ideal conditions favoring the transesterification reaction, resulting in 97% methyl ester yield. Conclusions These promising results offer scope for further investigation and process scale up, permitting the enzyme’s commercial application in a practically feasible and economically agreeable manner. PMID:28959298
Nucleic acid and nucleotide-mediated synthesis of inorganic nanoparticles
NASA Astrophysics Data System (ADS)
Berti, Lorenzo; Burley, Glenn A.
2008-02-01
Since the advent of practical methods for achieving DNA metallization, the use of nucleic acids as templates for the synthesis of inorganic nanoparticles (NPs) has become an active area of study. It is now widely recognized that nucleic acids have the ability to control the growth and morphology of inorganic NPs. These biopolymers are particularly appealing as templating agents as their ease of synthesis in conjunction with the possibility of screening nucleotide composition, sequence and length, provides the means to modulate the physico-chemical properties of the resulting NPs. Several synthetic procedures leading to NPs with interesting photophysical properties as well as studies aimed at rationalizing the mechanism of nucleic acid-templated NP synthesis are now being reported. This progress article will outline the current understanding of the nucleic acid-templated process and provides an up to date reference in this nascent field.
The BRG1 chromatin remodeling enzyme links cancer cell metabolism and proliferation
Wu, Qiong; Madany, Pasil; Dobson, Jason R.; Schnabl, Jake M.; Sharma, Soni; Smith, Tara C.; van Wijnen, Andre J.; Stein, Janet L.; Lian, Jane B.; Stein, Gary S.; Muthuswami, Rohini; Imbalzano, Anthony N.; Nickerson, Jeffrey A.
2016-01-01
Cancer cells reprogram cellular metabolism to meet the demands of growth. Identification of the regulatory machinery that regulates cancer-specific metabolic changes may open new avenues for anti-cancer therapeutics. The epigenetic regulator BRG1 is a catalytic ATPase for some mammalian SWI/SNF chromatin remodeling enzymes. BRG1 is a well-characterized tumor suppressor in some human cancers, but is frequently overexpressed without mutation in other cancers, including breast cancer. Here we demonstrate that BRG1 upregulates de novo lipogenesis and that this is crucial for cancer cell proliferation. Knockdown of BRG1 attenuates lipid synthesis by impairing the transcription of enzymes catalyzing fatty acid and lipid synthesis. Remarkably, exogenous addition of palmitate, the key intermediate in fatty acid synthesis, rescued the cancer cell proliferation defect caused by BRG1 knockdown. Our work suggests that targeting BRG1 to reduce lipid metabolism and, thereby, to reduce proliferation, has promise for epigenetic therapy in triple negative breast cancer. PMID:27223259
Kato, Hiroyuki; Suzuki, Hiromi; Inoue, Yoshiko; Suzuki, Katsuya; Kobayashi, Hisamine
2016-01-01
Mixed and collagen protein synthesis is elevated for as many as 3 days following exercise. Immediately after exercise, enhanced amino acid availability increases synthesis of mixed muscle protein, but not muscle collagen protein. However, the potential for synergic effects of amino acid ingestion with exercise on both mixed and collagen protein synthesis remains unclear. We investigated muscle collagen protein synthesis in rats following post-exercise ingestion of leucine-enriched essential amino acids. We determined fractional protein synthesis rates (FSR) at different time points following exercise. Mixed protein and collagen protein FSRs in skeletal muscle were determined by measuring protein-bound enrichments of hydroxyproline and proline, and by measuring the intracellular enrichment of proline, using injections of flooding d3-proline doses. A leucine-enriched mixture of essential amino acids (or distilled water as a control) was administrated 30 min or 1 day post-exercise. The collagen protein synthesis in the vastus lateralis was elevated for 2 days after exercise. Although amino acid administration did not increase muscle collagen protein synthesis, it did lead to augmented mixed muscle protein synthesis 1 day following exercise. Thus, contrary to the regulation of mixed muscle protein synthesis, muscle collagen protein synthesis is not affected by amino acid availability after damage-inducing exercise. PMID:27367725
Guseva, Natalya V; Rokhlin, Oskar W; Glover, Rebecca A; Cohen, Michael B
2011-07-01
A key player in prostate cancer development and progression is the androgen receptor (AR). Tumor-associated lipogenesis can protect cancer cells from carcinogenic- and therapeutic-associated treatments. Increased synthesis of fatty acids and cholesterol is regulated by androgens through induction of several genes in androgen-responsive cancer cells. Acetyl-CoA-carboxylase-α (ACCA) is a key enzyme in the regulation of fatty acids synthesis. Here we show that AR binds in vivo to intron regions of human ACCA gene. We also show that the level of ACCA protein in LNCaP depends on AR expression and that DHT treatment increases ACCA expression and fatty acid synthesis. Inhibition of ACCA by TOFA (5-tetradecyl-oxy-2-furoic acid) decreases fatty acid synthesis and induces caspase activation and cell death in most PCa cell lines. Our data suggest that TOFA can kill cells via the mitochondrial pathway since we found cytochrome c release after TOFA treatment in androgen sensitive cell lines. The results also imply that the pro-apoptotic effect of TOFA may be mediated via a decrease of neuropilin-1(NRP1) and Mcl-1expression. We have previously reported that Mcl-1 is under AR regulation and plays an important role in resistance to drug-induced apoptosis in prostate cancer cells, and NRP1 is known to regulate Mcl-1 expression. Here, we show for the first time that NRP1 expression is under AR control. Taken together, our data suggest that TOFA is a potent cell death inducing agent in prostate cancer cells.
Khan, Zaheer Ullah; Hayat, Maqsood; Khan, Muazzam Ali
2015-01-21
Enzyme catalysis is one of the most essential and striking processes among of all the complex processes that have evolved in living organisms. Enzymes are biological catalysts, which play a significant role in industrial applications as well as in medical areas, due to profound specificity, selectivity and catalytic efficiency. Refining catalytic efficiency of enzymes has become the most challenging job of enzyme engineering, into acidic and alkaline. Discrimination of acidic and alkaline enzymes through experimental approaches is difficult, sometimes impossible due to lack of established structures. Therefore, it is highly desirable to develop a computational model for discriminating acidic and alkaline enzymes from primary sequences. In this study, we have developed a robust, accurate and high throughput computational model using two discrete sample representation methods Pseudo amino acid composition (PseAAC) and split amino acid composition. Various classification algorithms including probabilistic neural network (PNN), K-nearest neighbor, decision tree, multi-layer perceptron and support vector machine are applied to predict acidic and alkaline with high accuracy. 10-fold cross validation test and several statistical measures namely, accuracy, F-measure, and area under ROC are used to evaluate the performance of the proposed model. The performance of the model is examined using two benchmark datasets to demonstrate the effectiveness of the model. The empirical results show that the performance of PNN in conjunction with PseAAC is quite promising compared to existing approaches in the literature so for. It has achieved 96.3% accuracy on dataset1 and 99.2% on dataset2. It is ascertained that the proposed model might be useful for basic research and drug related application areas. Copyright © 2014 Elsevier Ltd. All rights reserved.
Adenylating Enzymes in Mycobacterium tuberculosis as Drug Targets
Duckworth, Benjamin P.; Nelson, Kathryn M.; Aldrich, Courtney C.
2013-01-01
Adenylation or adenylate-forming enzymes (AEs) are widely found in nature and are responsible for the activation of carboxylic acids to intermediate acyladenylates, which are mixed anhydrides of AMP. In a second reaction, AEs catalyze the transfer of the acyl group of the acyladenylate onto a nucleophilic amino, alcohol, or thiol group of an acceptor molecule leading to amide, ester, and thioester products, respectively. Mycobacterium tuberculosis encodes for more than 60 adenylating enzymes, many of which represent potential drug targets due to their confirmed essentiality or requirement for virulence. Several strategies have been used to develop potent and selective AE inhibitors including high-throughput screening, fragment-based screening, and the rationale design of bisubstrate inhibitors that mimic the acyladenylate. In this review, a comprehensive analysis of the mycobacterial adenylating enzymes will be presented with a focus on the identification of small molecule inhibitors. Specifically, this review will cover the aminoacyl tRNA-synthetases (aaRSs), MenE required for menaquinone synthesis, the FadD family of enzymes including the fatty acyl-AMP ligases (FAAL) and the fatty acyl-CoA ligases (FACLs) involved in lipid metabolism, and the nonribosomal peptide synthetase adenylation enzyme MbtA that is necessary for mycobactin synthesis. Additionally, the enzymes NadE, GuaA, PanC, and MshC involved in the respective synthesis of NAD, guanine, pantothenate, and mycothiol will be discussed as well as BirA that is responsible for biotinylation of the acyl CoA-carboxylases. PMID:22283817
Combined effect of sesamin and α-lipoic acid on hepatic fatty acid metabolism in rats.
Ide, Takashi; Azechi, Ayana; Kitade, Sayaka; Kunimatsu, Yoko; Suzuki, Natsuko; Nakajima, Chihiro
2013-04-01
Dietary sesamin (1:1 mixture of sesamin and episesamin) decreases fatty acid synthesis but increases fatty acid oxidation in rat liver. Dietary α-lipoic acid lowers hepatic fatty acid synthesis. These changes can account for the serum lipid-lowering effect of sesamin and α-lipoic acid. It is expected that the combination of these compounds in the diet potentially ameliorates lipid metabolism more than the individual compounds. We therefore studied the combined effect of sesamin and α-lipoic acid on lipid metabolism in rats. Male Sprague-Dawley rats were fed diets supplemented with 0 or 2 g/kg sesamin and containing 0 or 2.5 g/kg α-lipoic acid for 22 days. Sesamin and α-lipoic acid decreased serum lipid concentrations and the combination of these compounds further decreased the parameters in an additive fashion. These compounds reduced the hepatic concentration of triacylglycerol, the lignan being less effective in decreasing this value. The combination failed to cause a stronger decrease in hepatic triacylglycerol concentration. The combination of sesamin and α-lipoic acid decreased the activity and mRNA levels of hepatic lipogenic enzymes in an additive fashion. Sesamin strongly increased the parameters of hepatic fatty acid oxidation enzymes. α-Lipoic acid antagonized the stimulating effect of sesamin of fatty acid oxidation through reductions in the activity of some fatty acid oxidation enzymes and carnitine concentration in the liver. This may account for the failure to observe strong reductions in hepatic triacylglycerol concentration in rats given a diet containing both sesamin and α-lipoic acid.
Hydrogen sulfide synthesis enzymes reduced in lower esophageal sphincter of patients with achalasia.
Zhang, L; Zhao, W; Zheng, Z; Wang, T; Zhao, C; Zhou, G; Jin, H; Wang, B
2016-10-01
The etiology of achalasia remains largely unknown. Considerable evidence reveals that the lower esophageal sphincter dysfunction is due to the lack of inhibitory neurotransmitter, secondary to esophageal neuronal inflammation or loss. Recent studies suggest hydrogen sulfide may act as an inhibitory transmitter in gastrointestinal tract, but study about hydrogen sulfide in human esophagus still lack. The aim of the study was to investigate if hydrogen sulfide synthesis enzymes could be detected in human esophagus and if the synthesis of the endogenous hydrogen sulfide could be affected in achalasia patients. Tissue samples in cardia, lower esophageal sphincter, 2 cm and 4 cm above lower esophageal sphincter were obtained from achalasia patients undergoing peroral endoscopic myotomy. Control tissues in lower esophageal sphincter were obtained from esophageal carcinoma patients. Expression of cystathionine-β-synthase and cystathionine-γ-lyase in lower esophageal sphincter of achalasia patients and control were detected by immunohistochemical staining. In addition, expression of cystathionine-β-synthase and cystathionine-γ-lyase were compared among different parts of esophagus in achalasia patients. Compared with control, the expression of cystathionine-β-synthase and cystathionine-γ-lyase in lower esophageal sphincter of achalasia patients was significantly reduced (χ 2 = 11.429, P = 0.010). The expression of cystathionine-β-synthase and cystathionine-γ-lyase were lower in lower esophageal sphincter than that in 2 cm and 4 cm above lower esophageal sphincter, respectively (all P < 0.05). In conclusion, the expression of hydrogen sulfide synthesis enzymes, cystathionine-β-synthase and cystathionine-γ-lyase, can be detected in human esophagus and is reduced in patients with achalasia, which implicates the involvement of the two hydrogen sulfide synthesis enzymes in the pathophysiology of achalasia. © 2015 International Society for Diseases of the
Aurintricarboxylic acid is a potent inhibitor of phosphofructokinase.
McCune, S A; Foe, L G; Kemp, R G; Jurin, R R
1989-01-01
Aurintricarboxylic acid (ATA) was found to be a very potent inhibitor of purified rabbit liver phosphofructokinase (PFK), giving 50% inhibition at 0.2 microM. The inhibition was in a manner consistent with interaction at the citrate-inhibitory site of the enzyme. The data suggest that inhibition of PFK by ATA was not due to denaturation of the enzyme or the irreversible binding of inhibitor, since the inhibition could be reversed by addition of allosteric activators of PFK, i.e. fructose 2,6-bisphosphate or AMP. Two other tricarboxylic acids, agaric acid and (-)-hydroxycitrate, were found to inhibit PFK. ATA at much higher concentrations (500 microM) was shown to inhibit fatty acid synthesis from endogenous glycogen in rat hepatocytes; however, protein synthesis was not altered. PMID:2525029
Determination Hypoiodous Acid (HIO) By Peroxidase System Using Peroxidase Enzyme
NASA Astrophysics Data System (ADS)
Al-Baarri, A. N.; Legowo, A. M.; Widayat; Abduh, S. B. M.; Hadipernata, M.; Wisnubroto; Ardianti, D. K.; Susanto, M. N.; Yusuf, M.; Demasta, E. K.
2018-02-01
It has been understood that peroxidase enzyme including peroxidase serves as catalyzer to enzymatic reaction among hydrogen peroxide and halides, therefore this research was done for generating hypoiodous acid (HIO) from peroxidase system using peroxidase enzyme. Hydrogen peroxide, potassium iodide, and peroxidase enzyme were used to produce HIO. Determination the amount of formed HIO was done using 2,2'-azino-bis(3- ethylbenzothiazoline-6-sulphonic acid) or ABTS as substrate through the colorimetric measurement of hydrogen peroxide residue during reaction process using at 412 nm. The result indicated that residual hydrogen peroxide showed the minimum concentration after 60 minutes reaction time. Because the reaction started at the beginning time of mixing, hydrogen peroxide was unable to be eliminated totally to produce HIO. The reaction of peroxidase system was able to determine the beginning of mixing process but the reaction process could not eliminate the initial concentration of hydrogen peroxide indicating the maximum amount of production of HIO could be determined. In conclusion, the less of H2O2, higher HIO obtained and peroxidase enzymes can accelerate the formation of HIO.
The spark discharge synthesis of amino acids from various hydrocarbons
NASA Technical Reports Server (NTRS)
Ring, D.; Miller, S. L.
1984-01-01
The spark discharge synthesis of amino acids using an atmosphere of CH4+N2+H2O+NH3 has been investigated with variable pNH3. The amino acids produced using higher hydrocarbons (ethane, ethylene, acetylene, propane, butane, and isobutane) instead of CH4 were also investigated. There was considerable range in the absolute yields of amino acids, but the yields relative to glycine (or alpha-amino-n-butyric acid) were more uniform. The relative yields of the C3 to C6 aliphatic alpha-amino acids are nearly the same (with a few exceptions) with all the hydrocarbons. The glycine yields are more variable. The precursors to the C3-C6 aliphatic amino acids seem to be produced in the same process, which is separate from the synthesis of glycine precursors. It may be possible to use these relative yields as a signature for a spark discharge synthesis provided corrections can be made for subsequent decomposition events (e.g. in the Murchison meteorite).
Fatty acid carbon is essential for dNTP synthesis in endothelial cells
Missiaen, Rindert; Queiroz, Karla CS; Borgers, Gitte; Elia, Ilaria; Zecchin, Annalisa; Cantelmo, Anna Rita; Christen, Stefan; Goveia, Jermaine; Heggermont, Ward; Goddé, Lucica; Vinckier, Stefan; Van Veldhoven, Paul P.; Eelen, Guy; Schoonjans, Luc; Gerhardt, Holger; Dewerchin, Mieke; Baes, Myriam; De Bock, Katrien; Ghesquière, Bart; Lunt, Sophia Y.; Fendt, Sarah-Maria; Carmeliet, Peter
2015-01-01
The metabolism of endothelial cells (ECs) during vessel sprouting remains poorly studied. Here, we report that endothelial loss of CPT1a, a rate-limiting enzyme of fatty acid oxidation (FAO), caused vascular sprouting defects due to impaired proliferation, not migration of ECs. Reduction of FAO in ECs did not cause energy depletion or disturb redox homeostasis, but impaired de novo nucleotide synthesis for DNA replication. Isotope labeling studies in control ECs showed that fatty acid carbons substantially replenished the Krebs cycle, and were incorporated into aspartate (a nucleotide precursor), uridine monophosphate (a precursor of pyrimidine nucleoside triphosphates) and DNA. CPT1a silencing reduced these processes and depleted EC stores of aspartate and deoxyribonucleoside triphosphates. Acetate (metabolized to acetyl-CoA, thereby substituting for the depleted FAO-derived acetyl-CoA) or a nucleoside mix rescued the phenotype of CPT1a-silenced ECs. Finally, CPT1 blockade inhibited pathological ocular angiogenesis, suggesting a novel strategy for blocking angiogenesis. PMID:25830893
Phosphatase synthesis in Klebsiella (Aerobacter) aerogenes growing in continuous culture
Bolton, P. G.; Dean, A. C. R.
1972-01-01
1. Phosphatase synthesis was studied in Klebsiella aerogenes grown in a wide range of continuous-culture systems. 2. Maximum acid phosphatase synthesis was associated with nutrient-limited, particularly carbohydrate-limited, growth at a relatively low rate, glucose-limited cells exhibiting the highest activity. Compared with glucose as the carbon-limiting growth material, other sugars not only altered the activity but also changed the pH–activity profile of the enzyme(s). 3. The affinity of the acid phosphatase in glucose-limited cells towards p-nitrophenyl phosphate (Km 0.25–0.43mm) was similar to that of staphylococcal acid phosphatase but was ten times greater than that of the Escherichia coli enzyme. 4. PO43−-limitation derepressed alkaline phosphatase synthesis but the amounts of activity were largely independent of the carbon source used for growth. 5. The enzymes were further differentiated by the effect of adding inhibitors (F−, PO43−) and sugars to the reaction mixture during the assays. In particular, it was shown that adding glucose, but not other sugars, stimulated the rate of hydrolysis of p-nitrophenyl phosphate by the acid phosphatase in carbohydrate-limited cells at low pH values (<4.6) but inhibited it at high pH values (>4.6). Alkaline phosphatase activity was unaffected. 6. The function of phosphatases in general is discussed and possible mechanisms for the glucose effect are outlined. PMID:4342213
Mulchandani, A; Bassi, A S
1996-01-01
Tetrathiafulvalene (TTF) mediated amperometric enzyme electrodes have been developed for the monitoring of L-glutamine and L-glutamic acid in growing mammalian cell cultures. The detection of glutamine was accomplished by a coupled enzyme system comprised of glutaminase plus glutamate oxidase, while the detection of glutamic acid was carried out by a single enzyme, glutamate oxidase. The appropriate enzyme(s) were immoblized on the Triton-X treated surface of tetrathiafulvalene modified carbon paste electrodes by adsorption, in conjunction with entrapment by an electrochemically deposited copolymer film of 1,3-phenylenediamine and resorcinol. Operating conditions for the glutamine enzyme electrode were optimized with respect to the amount of enzymes immoblized, pH, temperature and mobile phase flow rate for operation in a flow injection (FIA) system. When applied to glutamine and glutamic acid measurements in mammalian cell culture in FIA, the results obtained with enzyme electrodes were in excellent agreement with those determined by enzymatic analysis.
Tween 80 effect on glucosyltransferase synthesis by Streptococcus salivarius.
Wittenberger, C L; Beaman, A J; Lee, L N
1978-01-01
Streptococcus salivarius (ATCC 25975) produced very low or nondetectable amounts of the extracellular enzyme glucosyltransferase (GTase) when grown in a chemically defined medium. The addition of Tween 80 to this medium resulted in the production of markedly enhanced levels of the enzyme. Oleic acid, the methyl ester of oleic acid, and sucrose each could not substitute for Tween 80 in this regard. The surfactant had no direct activating effect on performed enzyme activity. Tween 80 also stimulated the production of GTase by concentrated cells suspended in defined medium during a time when no measurable growth occurred. Under these conditions, the stimulatory effect of Tween 80 was blocked by chloramphenicol. It was further found that the surfactant dramatically stimulated the differential rate of GTase synthesis. These and other data strongly suggest that Tween 80 stimulates the production of extracellular GTase by acting either directly or indirectly at the level of enzyme synthesis. PMID:618839
Impheng, Hathaichanok; Richert, Lysiane; Pekthong, Dumrongsak; Scholfield, C Norman; Pongcharoen, Sutatip; Pungpetchara, Ittipon; Srisawang, Piyarat
2015-01-01
The de novo fatty acid synthesis catalyzed by key lipogenic enzymes, including fatty acid synthase (FASN) has emerged as one of the novel targets of anti-cancer approaches. The present study explored the possible inhibitory efficacy of [6]-gingerol on de novo fatty acid synthesis associated with mitochondrial-dependent apoptotic induction in HepG2 cells. We observed a dissipation of mitochondrial membrane potential accompanied by a reduction of fatty acid levels. [6]-gingerol administration manifested inhibition of FASN expression, indicating FASN is a major target of [6]-gingerol inducing apoptosis in HepG2 cells. Indeed, we found that increased ROS generation could likely be a mediator of the anti-cancer effect of [6]-gingerol. A reduction of fatty acid levels and induction of apoptosis were restored by inhibition of acetyl-CoA carboxylase (ACC) activity, suggesting an accumulation of malonyl-CoA level could be the major cause of apoptotic induction of [6]-gingerol in HepG2 cells. The present study also showed that depletion of fatty acid following [6]-gingerol treatment caused an inhibitory effect on carnitine palmitoyltransferase-1 activity (CPT-1), whereas C75 augmented CPT-1 activity, indicating that [6]-gingerol exhibits the therapeutic benefit on suppression of fatty acid β-oxidation.
Fox, Simon R.; Rawsthorne, Stephen; Hills, Matthew J.
2001-01-01
The uptake in vitro of glucose (Glc)-6-phosphate (Glc-6-P) into plastids from the roots of 10- to 14-d-old pea (Pisum sativum L. cv Puget) plants was inhibited by oleoyl-coenzyme A (CoA) concentrations in the low micromolar range (1–2 μm). The IC50 (the concentration of inhibitor that reduces enzyme activity by 50%) for the inhibition of Glc-6-P uptake was approximately 750 nm; inhibition was reversed by recombinant rapeseed (Brassica napus) acyl-CoA binding protein. In the presence of ATP (3 mm) and CoASH (coenzyme A; 0.3 mm), Glc-6-P uptake was inhibited by 60%, due to long-chain acyl-CoA synthesis, presumably from endogenous sources of fatty acids present in the preparations. Addition of oleoyl-CoA (1 μm) decreased carbon flux from Glc-6-P into the synthesis of starch and through the oxidative pentose phosphate (OPP) pathway by up to 73% and 40%, respectively. The incorporation of carbon from Glc-6-P into fatty acids was not detected under any conditions. Oleoyl-CoA inhibited the incorporation of acetate into fatty acids by 67%, a decrease similar to that when ATP was excluded from incubations. The oleoyl-CoA-dependent inhibition of fatty acid synthesis was attributable to a direct inhibition of the adenine nucleotide translocator by oleoyl-CoA, which indirectly reduced fatty acid synthesis by ATP deprivation. The Glc-6-P-dependent stimulation of acetate incorporation into fatty acids was reversed by the addition of oleoyl-CoA. PMID:11457976
Changes in isoprenoid lipid synthesis by gemfibrozil and clofibric acid in rat hepatocytes.
Hashimoto, F; Taira, S; Hayashi, H
2000-05-15
We studied whether gemfibrozil and clofibric acid alter isoprenoid lipid synthesis in rat hepatocytes. After incubation of the cells with the agent for 74 hr, [(14)C]acetate or [(3)H]mevalonate was added, and the cells were further incubated for 4 hr. Gemfibrozil and clofibric acid increased ubiquinone synthesis from [(14)C]acetate and [(3)H]mevalonate. The effect of gemfibrozil was greater than that of clofibric acid. Also, gemfibrozil decreased dolichol synthesis from [(14)C]acetate and [(3)H]mevalonate. However, clofibric acid increased dolichol synthesis from [(3)H]mevalonate. Gemfibrozil decreased cholesterol synthesis from [(14)C]acetate and [(3)H]mevalonate. Clofibric acid decreased cholesterol synthesis from [(14)C]acetate, but did not affect synthesis from [(3)H]mevalonate. These results suggest that both agents, at different rates, activate the synthetic pathway of ubiquinone, at least from mevalonate. Gemfibrozil may inhibit the synthetic pathway of dolichol, at least from mevalonate. Contrary to gemfibrozil, clofibric acid may activate the synthetic pathway of dolichol from mevalonate. Gemfibrozil may inhibit the synthetic pathway of cholesterol from mevalonate in addition to the pathway from acetate to mevalonate inhibited by both agents.
Bouaziz, Mehdi; Bejaoui, Safa; Rabeh, Imen; Besbes, Raouf; El Cafsi, M 'Hamed; Falcon, Jack
2017-06-01
Teleost fish are ectothermic vertebrates. Their metabolism, physiology and behavior rely on the external temperature. This study, on the retina of the sea bass Dicentrarchus labrax, reports on the impact of temperature on the fatty acid composition and mRNA abundance of key enzymes of lipid metabolism: fatty acid desaturase-2 (FADS2), fatty acid elongase-5 (ELOVL5), sterol regulatory element-binding protein-1 (SREBP-1), triglyceride lipase and phospholipase A2 (PLA2). We also report on the effects on the photopigment molecule rhodopsin and on enzymes of the melatonin synthesis pathway, namely arylalkylamine N-acetyltransferases 1a and 1b and acetylserotonin methyltransferase. Juvenile fish were placed for 30 days at 18, 23 or 28 °C. At 23 °C, the fatty acid composition of D. labrax retina showed, as generally reported for the retina of other fish species, particularly high amounts of docosahexaenoic (DHA), palmitic and oleic acids. The fatty acids composition was not significantly (P > 0.05) altered between 23 and 28 °C, but did increase at 18 °C compared to 23 and 28 °C. At 18 °C there were noticeable increases in total DHA, ecosapentaenoic, arachidonic, oleic, linoleic, palmitoleic and stearic acids. A negative correlation was found in the abundance of neutral (NL) vs. polar (PL) lipids: 18 °C induced an increase in NL and a decrease in PL, while 28 °C induced higher PL with decreased NL. In NL the changes affected mainly triglycerides. FADS2 and ELOVL5 mRNA abundance decreased from 18° to 28 °C while SREBP-1 and triglyceride lipase mRNA remained stable. Conversely PLA2 mRNA was more abundant at 23 than at 18 and 28 °C. Temperature increased and decreased rhodopsin mRNA abundance, at 28 °C and 18 °C respectively, while there was no effect on mRNA from the melatonin synthesis enzymes. In conclusion the data indicate a temperature induced redistribution of fatty acids among the lipid classes that might affect the physical properties of
Induction of phytic acid synthesis by abscisic acid in suspension-cultured cells of rice.
Matsuno, Koya; Fujimura, Tatsuhito
2014-03-01
A pathway of phytic acid (PA) synthesis in plants has been revealed via investigations of low phytic acid mutants. However, the regulation of this pathway is not well understood because it is difficult to control the environments of cells in the seeds, where PA is mainly synthesized. We modified a rice suspension culture system in order to study the regulation of PA synthesis. Rice cells cultured with abscisic acid (ABA) accumulate PA at higher levels than cells cultured without ABA, and PA accumulation levels increase with ABA concentration. On the other hand, higher concentrations of sucrose or inorganic phosphorus do not affect PA accumulation. Mutations in the genes RINO1, OsMIK, OsIPK1 and OsLPA1 have each been reported to confer low phytic acid phenotypes in seeds. Each of these genes is upregulated in cells cultured with ABA. OsITPK4 and OsITPK6 are upregulated in cells cultured with ABA and in developing seeds. These results suggest that the regulation of PA synthesis is similar between developing seeds and cells in this suspension culture system. This system will be a powerful tool for elucidating the regulation of PA synthesis. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Enzyme-catalyzed cationic epoxide rearrangements in quinolone alkaloid biosynthesis.
Zou, Yi; Garcia-Borràs, Marc; Tang, Mancheng C; Hirayama, Yuichiro; Li, Dehai H; Li, Li; Watanabe, Kenji; Houk, K N; Tang, Yi
2017-03-01
Epoxides are highly useful synthons and biosynthons for the construction of complex natural products during total synthesis and biosynthesis, respectively. Among enzyme-catalyzed epoxide transformations, a reaction that is notably missing, in regard to the synthetic toolbox, is cationic rearrangement that takes place under strong acid. This is a challenging transformation for enzyme catalysis, as stabilization of the carbocation intermediate upon epoxide cleavage is required. Here, we discovered two Brønsted acid enzymes that can catalyze two unprecedented epoxide transformations in biology. PenF from the penigequinolone pathway catalyzes a cationic epoxide rearrangement under physiological conditions to generate a quaternary carbon center, while AsqO from the aspoquinolone pathway catalyzes a 3-exo-tet cyclization to forge a cyclopropane-tetrahydrofuran ring system. The discovery of these new epoxide-modifying enzymes further highlights the versatility of epoxides in complexity generation during natural product biosynthesis.
Synthesis of alpha-amino acids
Davis, Jr., Jefferson W.
1983-01-01
A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the snythesis methods of the prior art.
Wei, Tianling; Geijer, Sophia; Lindberg, Magnus; Berne, Berit; Törmä, Hans
2006-12-01
The knowledge how detergents with different chemical properties influence epidermal keratinocytes is sparse. In the present study, the effects of five detergents were examined with respect to cell-toxicity and mRNA expression of key-enzymes in barrier lipid production and keratinocyte differentiation markers. First, the LD(50) for each detergent were determined. Secondly, keratinocytes were exposed to sub-toxic concentrations and the mRNA expression was analysed by real-time PCR after 24 h exposure to the detergents. SLS and CAPB induced a concentration-dependent increase in the expression of enzymes producing cholesterol and ceramides, while transcripts of enzymes producing fatty acids were unaffected. SLES and cocoglucoside increased the expression of certain enzymes involved in cholesterol and fatty acid synthesis while sodium cocoamphoacetate (SCAA) stimulated expression of transcripts involved in fatty acid synthesis. The expression of differentiation markers were increased by SLS, SLES and CAPB, while SCAA and cocoglucoside exhibited no effect. The present findings show that detergents have variable effects on lipid synthesis and keratinocyte differentiation, which could partly explain their barrier destruction potential in vivo.
Individual bile acids have differential effects on bile acid signaling in mice
DOE Office of Scientific and Technical Information (OSTI.GOV)
Song, Peizhen, E-mail: songacad@gmail.com; Rockwell, Cheryl E., E-mail: rockwelc@msu.edu; Cui, Julia Yue, E-mail: juliacui@uw.edu
2015-02-15
Bile acids (BAs) are known to regulate BA synthesis and transport by the farnesoid X receptor in the liver (FXR-SHP) and intestine (FXR-Fgf15). However, the relative importance of individual BAs in regulating these processes is not known. Therefore, mice were fed various doses of five individual BAs, including cholic acid (CA), chenodeoxycholic acid (CDCA), deoxoycholic acid (DCA), lithocholic acid (LCA), and ursodeoxycholic acid (UDCA) in their diets at various concentrations for one week to increase the concentration of one BA in the enterohepatic circulation. The mRNA of BA synthesis and transporting genes in liver and ileum were quantified. In themore » liver, the mRNA of SHP, which is the prototypical target gene of FXR, increased in mice fed all concentrations of BAs. In the ileum, the mRNA of the intestinal FXR target gene Fgf15 was increased at lower doses and to a higher extent by CA and DCA than by CDCA and LCA. Cyp7a1, the rate-limiting enzyme in BA synthesis, was decreased more by CA and DCA than CDCA and LCA. Cyp8b1, the enzyme that 12-hydroxylates BAs and is thus responsible for the synthesis of CA, was decreased much more by CA and DCA than CDCA and LCA. Surprisingly, neither a decrease in the conjugated BA uptake transporter (Ntcp) nor increase in BA efflux transporter (Bsep) was observed by FXR activation, but an increase in the cholesterol efflux transporter (Abcg5/Abcg8) was observed with FXR activation. Thus in conclusion, CA and DCA are more potent FXR activators than CDCA and LCA when fed to mice, and thus they are more effective in decreasing the expression of the rate limiting gene in BA synthesis Cyp7a1 and the 12-hydroxylation of BAs Cyp8b1, and are also more effective in increasing the expression of Abcg5/Abcg8, which is responsible for biliary cholesterol excretion. However, feeding BAs do not alter the mRNA or protein levels of Ntcp or Bsep, suggesting that the uptake or efflux of BAs is not regulated by FXR at physiological and
Donepudi, Ajay C.; Ferrell, Jessica M.; Boehme, Shannon; Choi, Hueng‐Sik
2017-01-01
Alcoholic fatty liver disease (AFLD) is a major risk factor for cirrhosis‐associated liver diseases. Studies demonstrate that alcohol increases serum bile acids in humans and rodents. AFLD has been linked to cholestasis, although the physiologic relevance of increased bile acids in AFLD and the underlying mechanism of increasing the bile acid pool by alcohol feeding are still unclear. In this study, we used mouse models either deficient of or overexpressing cholesterol 7α‐hydroxylase (Cyp7a1), the rate‐limiting and key regulatory enzyme in bile acid synthesis, to study the effect of alcohol drinking in liver metabolism and inflammation. Mice were challenged with chronic ethanol feeding (10 days) plus a binge dose of alcohol by oral gavage (5 g/kg body weight). Alcohol feeding reduced bile acid synthesis gene expression but increased the bile acid pool size, hepatic triglycerides and cholesterol, and inflammation and injury in wild‐type mice and aggravated liver inflammation and injury in Cyp7a1‐deficient mice. Interestingly, alcohol‐induced hepatic inflammation and injury were ameliorated in Cyp7a1 transgenic mice. Conclusion: Alcohol feeding alters hepatic bile acid and cholesterol metabolism to cause liver inflammation and injury, while maintenance of bile acid and cholesterol homeostasis protect against alcohol‐induced hepatic inflammation and injury. Our findings indicate that CYP7A1 plays a key role in protection against alcohol‐induced steatohepatitis. (Hepatology Communications 2018;2:99–112) PMID:29404516
Lee, Ho-Joo; Choi, Mun Hwan; Kim, Tae-Un; Yoon, Sung Chul
2001-01-01
A psychrotrophic bacterium, Pseudomonas fluorescens BM07, which is able to accumulate polyhydroxyalkanoic acid (PHA) containing large amounts of 3-hydroxy-cis-5-dodecenoate unit up to 35 mol% in the cell from unrelated substrates such as fructose, succinate, etc., was isolated from an activated sludge in a municipal wastewater treatment plant. When it was grown on heptanoic acid (C7) to hexadecanoic acid (C16) as the sole carbon source, the monomer compositional characteristics of the synthesized PHA were similar to those observed in other fluorescent pseudomonads belonging to rRNA homology group I. However, growth on stearic acid (C18) led to no PHA accumulation, but instead free stearic acid was stored in the cell. The existence of the linkage between fatty acid de novo synthesis and PHA synthesis was confirmed by using inhibitors such as acrylic acid and two other compounds, 2-bromooctanoic acid and 4-pentenoic acid, which are known to inhibit β-oxidation enzymes in animal cells. Acrylic acid completely inhibited PHA synthesis at a concentration of 4 mM in 40 mM octanoate-grown cells, but no inhibition of PHA synthesis occurred in 70 mM fructose-grown cells in the presence of 1 to 5 mM acrylic acid. 2-Bromooctanoic acid and 4-pentenoic acid were found to much inhibit PHA synthesis much more strongly in fructose-grown cells than in octanoate-grown cells over concentrations ranging from 1 to 5 mM. However, 2-bromooctanoic acid and 4-pentenoic acid did not inhibit cell growth at all in the fructose media. Especially, with the cells grown on fructose, 2-bromooctanoic acid exhibited a steep rise in the percent PHA synthesis inhibition over a small range of concentrations below 100 μM, a finding indicative of a very specific inhibition, whereas 4-pentenoic acid showed a broad, featureless concentration dependence, suggesting a rather nonspecific inhibition. The apparent inhibition constant Ki (the concentration for 50% inhibition of PHA synthesis) for 2
Affinity labelling enzymes with esters of aromatic sulfonic acids
Wong, Show-Chu; Shaw, Elliott
1977-01-01
Novel esters of aromatic sulfonic acids are disclosed. The specific esters are nitrophenyl p- and m-amidinophenylmethanesulfonate. Also disclosed is a method for specific inactivation of the enzyme, thrombin, employing nitrophenyl p-amidinophenylmethanesulfonate.
Bolivar, Juan M; Nidetzky, Bernd
2012-06-01
D-amino acid oxidase from Trigonopsis variabilis (TvDAO) is applied in industry for the synthesis of pharmaceutical intermediates. Because free TvDAO is extremely sensitive to exposure to gas-liquid interfaces, biocatalytic processing is usually performed with enzyme immobilizates that offer enhanced stability under bubble aeration. We herein present an "Immobilization by Design" approach that exploits engineered charge complementarity between enzyme and carrier to optimize key features of the immobilization of TvDAO. A fusion protein between TvDAO and the positively charged module Z(basic2) was generated, and a corresponding oppositely charged carrier was obtained by derivatization of mesoporous glass with 3-(trihydroxysilyl)-1-propane-sulfonic acid. Using 250 mM NaCl for charge screening at pH 7.0, the Z(basic2) fusion of TvDAO was immobilized directly from E. coli cell extract with almost absolute selectivity and full retention of catalytic effectiveness of the isolated enzyme in solution. Attachment of the homodimeric enzyme to the carrier was quasi-permanent in low-salt buffer but fully reversible upon elution with 5 M NaCl. Immobilized TvDAO was not sensitive to bubble aeration and received substantial (≥ tenfold) stabilization of the activity at 45°C as compared to free enzyme, suggesting immobilization via multisubunit oriented interaction of enzyme with the insoluble carrier. The Z(basic2) enzyme immobilizate was demonstrated to serve as re-usable heterogeneous catalyst for D-amino acid oxidation. Z(basic2) -mediated binding on a sulfonic acid group-containing glass carrier constitutes a generally useful strategy of enzyme immobilization that supports transition from case-specific empirical development to rational design. Copyright © 2012 Wiley Periodicals, Inc.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Andersen, Mikael R.; Salazar, Margarita; Schaap, Peter
2011-06-01
The filamentous fungus Aspergillus niger exhibits great diversity in its phenotype. It is found globally, both as marine and terrestrial strains, produces both organic acids and hydrolytic enzymes in high amounts, and some isolates exhibit pathogenicity. Although the genome of an industrial enzyme-producing A. niger strain (CBS 513.88) has already been sequenced, the versatility and diversity of this species compels additional exploration. We therefore undertook whole genome sequencing of the acidogenic A. niger wild type strain (ATCC 1015), and produced a genome sequence of very high quality. Only 15 gaps are present in the sequence and half the telomeric regionsmore » have been elucidated. Moreover, sequence information from ATCC 1015 was utilized to improve the genome sequence of CBS 513.88. Chromosome-level comparisons uncovered several genome rearrangements, deletions, a clear case of strain-specific horizontal gene transfer, and identification of 0.8 megabase of novel sequence. Single nucleotide polymorphisms per kilobase (SNPs/kb) between the two strains were found to be exceptionally high (average: 7.8, maximum: 160 SNPs/kb). High variation within the species was confirmed with exo-metabolite profiling and phylogenetics. Detailed lists of alleles were generated, and genotypic differences were observed to accumulate in metabolic pathways essential to acid production and protein synthesis. A transcriptome analysis revealed up-regulation of the electron transport chain, specifically the alternative oxidative pathway in ATCC 1015, while CBS 513.88 showed significant up regulation of genes associated with biosynthesis of amino acids that are abundant in glucoamylase A, tRNA-synthases and protein transporters.« less
Sano, Katsura; Gotoh, Mari; Dodo, Kyoko; Tajima, Noriaki; Shimizu, Yoshibumi; Murakami-Murofushi, Kimiko
2018-01-01
Hyaluronic acid is a major component of the extracellular matrix, which is important for skin hydration. As aging brings skin dehydration, we aimed to clarify the mRNA expression of hyaluronic acid-related proteins in human skin fibroblasts from donors of various ages (range 0.7-69 years). Previously, we reported that cyclic phosphatidic acid (cPA), a unique phospholipid mediator, stimulated the expression of HAS2 and increased hyaluronic acid synthesis in human skin fibroblasts (donor age: 3 days). In this study, we measured the mRNA expression of hyaluronic acid-related proteins: hyaluronan synthase (HAS) 1-3, hyaluronidase-1, -2, and hyaluronic acid-binding protein (versican). In addition, we tested whether cPA could increase hyaluronic acid synthesis in skin fibroblasts derived from donors of various ages. The expression of HAS1, 3, hyaluronidase-1, and -2 did not change with aging. However, the mRNA expression of versican decreased with aging. Although it is thought that the amount of hyaluronic acid in the dermis decreases with aging, the mRNA expression of HAS2 was increased. But the amount of hyaluronic acid secreted by fibroblasts did not increase with aging. This suggests that the activity and/or protein expression of HAS2 decrease with aging. Furthermore, we observed that cPA caused the increase of hyaluronic acid synthesis at any age, and this effect was increased with aging. These results suggest that aging made the fibroblasts more sensitive to cPA treatment. Therefore, cPA represents a suitable candidate for the health maintenance and improvement of the skin by increasing the level of hyaluronic acid in the dermis.
SCD1 Inhibition Causes Cancer Cell Death by Depleting Mono-Unsaturated Fatty Acids
Mason, Paul; Liang, Beirong; Li, Lingyun; Fremgen, Trisha; Murphy, Erin; Quinn, Angela; Madden, Stephen L.; Biemann, Hans-Peter; Wang, Bing; Cohen, Aharon; Komarnitsky, Svetlana; Jancsics, Kate; Hirth, Brad; Cooper, Christopher G. F.; Lee, Edward; Wilson, Sean; Krumbholz, Roy; Schmid, Steven; Xiang, Yibin; Booker, Michael; Lillie, James; Carter, Kara
2012-01-01
Increased metabolism is a requirement for tumor cell proliferation. To understand the dependence of tumor cells on fatty acid metabolism, we evaluated various nodes of the fatty acid synthesis pathway. Using RNAi we have demonstrated that depletion of fatty-acid synthesis pathway enzymes SCD1, FASN, or ACC1 in HCT116 colon cancer cells results in cytotoxicity that is reversible by addition of exogenous fatty acids. This conditional phenotype is most pronounced when SCD1 is depleted. We used this fatty-acid rescue strategy to characterize several small-molecule inhibitors of fatty acid synthesis, including identification of TOFA as a potent SCD1 inhibitor, representing a previously undescribed activity for this compound. Reference FASN and ACC inhibitors show cytotoxicity that is less pronounced than that of TOFA, and fatty-acid rescue profiles consistent with their proposed enzyme targets. Two reference SCD1 inhibitors show low-nanomolar cytotoxicity that is offset by at least two orders of magnitude by exogenous oleate. One of these inhibitors slows growth of HCT116 xenograft tumors. Our data outline an effective strategy for interrogation of on-mechanism potency and pathway-node-specificity of fatty acid synthesis inhibitors, establish an unambiguous link between fatty acid synthesis and cancer cell survival, and point toward SCD1 as a key target in this pathway. PMID:22457791
SCD1 inhibition causes cancer cell death by depleting mono-unsaturated fatty acids.
Mason, Paul; Liang, Beirong; Li, Lingyun; Fremgen, Trisha; Murphy, Erin; Quinn, Angela; Madden, Stephen L; Biemann, Hans-Peter; Wang, Bing; Cohen, Aharon; Komarnitsky, Svetlana; Jancsics, Kate; Hirth, Brad; Cooper, Christopher G F; Lee, Edward; Wilson, Sean; Krumbholz, Roy; Schmid, Steven; Xiang, Yibin; Booker, Michael; Lillie, James; Carter, Kara
2012-01-01
Increased metabolism is a requirement for tumor cell proliferation. To understand the dependence of tumor cells on fatty acid metabolism, we evaluated various nodes of the fatty acid synthesis pathway. Using RNAi we have demonstrated that depletion of fatty-acid synthesis pathway enzymes SCD1, FASN, or ACC1 in HCT116 colon cancer cells results in cytotoxicity that is reversible by addition of exogenous fatty acids. This conditional phenotype is most pronounced when SCD1 is depleted. We used this fatty-acid rescue strategy to characterize several small-molecule inhibitors of fatty acid synthesis, including identification of TOFA as a potent SCD1 inhibitor, representing a previously undescribed activity for this compound. Reference FASN and ACC inhibitors show cytotoxicity that is less pronounced than that of TOFA, and fatty-acid rescue profiles consistent with their proposed enzyme targets. Two reference SCD1 inhibitors show low-nanomolar cytotoxicity that is offset by at least two orders of magnitude by exogenous oleate. One of these inhibitors slows growth of HCT116 xenograft tumors. Our data outline an effective strategy for interrogation of on-mechanism potency and pathway-node-specificity of fatty acid synthesis inhibitors, establish an unambiguous link between fatty acid synthesis and cancer cell survival, and point toward SCD1 as a key target in this pathway.
Derivatives of diphosphonic acids: synthesis and biological activity
NASA Astrophysics Data System (ADS)
Zolotukhina, M. M.; Krutikov, V. I.; Lavrent'ev, A. N.
1993-07-01
The scientific-technical and patent literature on the synthesis of derivatives of diphosphonic acids is surveyed. Various methods of synthesis of diphosphonate, phosphonylphosphinyl, and phosphonophosphate compounds are described. The principal aspects of the use of the above compounds in medicine, biochemistry, and agriculture are examined. The bibliography includes 174 references.
Characterization of Carboxylic Acid Reductases as Enzymes in the Toolbox for Synthetic Chemistry.
Finnigan, William; Thomas, Adam; Cromar, Holly; Gough, Ben; Snajdrova, Radka; Adams, Joseph P; Littlechild, Jennifer A; Harmer, Nicholas J
2017-03-20
Carboxylic acid reductase enzymes (CARs) meet the demand in synthetic chemistry for a green and regiospecific route to aldehydes from their respective carboxylic acids. However, relatively few of these enzymes have been characterized. A sequence alignment with members of the ANL (Acyl-CoA synthetase/ NRPS adenylation domain/Luciferase) superfamily of enzymes shed light on CAR functional dynamics. Four unstudied enzymes were selected by using a phylogenetic analysis of known and hypothetical CARs, and for the first time, a thorough biochemical characterization was performed. Kinetic analysis of these enzymes with various substrates shows that they have a broad but similar substrate specificity. Electron-rich acids are favored, which suggests that the first step in the proposed reaction mechanism, attack by the carboxylate on the α-phosphate of adenosine triphosphate (ATP), is the step that determines the substrate specificity and reaction kinetics. The effects of pH and temperature provide a clear operational window for the use of these CARs, whereas an investigation of product inhibition by NADP + , adenosine monophosphate, and pyrophosphate indicates that the binding of substrates at the adenylation domain is ordered with ATP binding first. This study consolidates CARs as important and exciting enzymes in the toolbox for sustainable chemistry and provides specifications for their use as a biocatalyst.
Chemoenzymatic synthesis of differentially protected 3-deoxysugars
NASA Astrophysics Data System (ADS)
Gillingham, Dennis G.; Stallforth, Pierre; Adibekian, Alexander; Seeberger, Peter H.; Hilvert, Donald
2010-02-01
3-Deoxysugars are important constituents of complex carbohydrates. For example, 2-keto-3-deoxy-D-manno-octulosonic acid (KDO) is an essential component of lipopolysaccharides in Gram-negative bacteria, 2-keto-3-deoxy-D-glycero-D-galacto-nonulosonic acid (KDN) is widely found in carbohydrates of the bacterial cell wall and in lower vertebrates, and sialic acid is a common cap of mammalian glycoproteins. Although ready access to such sugars would benefit the creation of vaccine candidates, antibiotics and small-molecule drugs, their chemical synthesis is difficult. Here we present a simple chemoenzymatic method for preparing differentially protected 3-deoxysugar derivatives from readily available starting materials. It exploits the promiscuous aldolase activity of the enzyme macrophomate synthase (MPS) to add pyruvate enolate diastereoselectively to a wide range of structurally complex aldehydes. A short synthesis of KDN illustrates the utility of this approach. Enzyme promiscuity, which putatively fosters large functional leaps in natural evolution, has great promise as a source of synthetically useful catalytic transformations.
Petrescu, Anca D.; Huang, Huan; Martin, Gregory G.; McIntosh, Avery L.; Storey, Stephen M.; Landrock, Danilo; Kier, Ann B.
2013-01-01
Liver fatty acid binding protein (L-FABP) is the major soluble protein that binds very-long-chain n-3 polyunsaturated fatty acids (n-3 PUFAs) in hepatocytes. However, nothing is known about L-FABP's role in n-3 PUFA-mediated peroxisome proliferator activated receptor-α (PPARα) transcription of proteins involved in long-chain fatty acid (LCFA) β-oxidation. This issue was addressed in cultured primary hepatocytes from wild-type, L-FABP-null, and PPARα-null mice with these major findings: 1) PUFA-mediated increase in the expression of PPARα-regulated LCFA β-oxidative enzymes, LCFA/LCFA-CoA binding proteins (L-FABP, ACBP), and PPARα itself was L-FABP dependent; 2) PPARα transcription, robustly potentiated by high glucose but not maltose, a sugar not taken up, correlated with higher protein levels of these LCFA β-oxidative enzymes and with increased LCFA β-oxidation; and 3) high glucose altered the potency of n-3 relative to n-6 PUFA. This was not due to a direct effect of glucose on PPARα transcriptional activity nor indirectly through de novo fatty acid synthesis from glucose. Synergism was also not due to glucose impacting other signaling pathways, since it was observed only in hepatocytes expressing both L-FABP and PPARα. Ablation of L-FABP or PPARα as well as treatment with MK886 (PPARα inhibitor) abolished/reduced PUFA-mediated PPARα transcription of these genes, especially at high glucose. Finally, the PUFA-enhanced L-FABP distribution into nuclei with high glucose augmentation of the L-FABP/PPARα interaction reveals not only the importance of L-FABP for PUFA induction of PPARα target genes in fatty acid β-oxidation but also the significance of a high glucose enhancement effect in diabetes. PMID:23238934
Leber, Christopher; Choi, Jin Wook; Polson, Brian; Da Silva, Nancy A
2016-04-01
Biologically derived fatty acids have gained tremendous interest as an alternative to petroleum-derived fuels and chemical precursors. We previously demonstrated the synthesis of short chain fatty acids in Saccharomyces cerevisiae by introduction of the Homo sapiens fatty acid synthase (hFAS) with heterologous phosphopantetheine transferases and heterologous thioesterases. In this study, short chain fatty acid production was improved by combining a variety of novel enzyme and metabolic engineering strategies. The use of a H. sapiens-derived thioesterase and phosphopantetheine transferase were evaluated. In addition, strains were engineered to disrupt either the full β-oxidation (by deleting FAA2, PXA1, and POX1) or short chain-specific β-oxidation (by deleting FAA2, ANT1, and PEX11) pathways. Prohibiting full β-oxidation increased hexanoic and octanoic acid levels by 8- and 79-fold relative to the parent strain expressing hFAS. However, by targeting only short chain β-oxidation, hexanoic and octanoic acid levels increased further to 31- and 140-fold over the parent. In addition, an optimized hFAS gene increased hexanoic, octanoic, decanoic and total short chain fatty acid levels by 2.9-, 2.0-, 2.3-, and 2.2-fold, respectively, relative to the non-optimized counterpart. By combining these unique enzyme and metabolic engineering strategies, octanoic acid was increased more than 181-fold over the parent strain expressing hFAS. © 2015 Wiley Periodicals, Inc.
Effect of various alanine analogues on the L-alanine-adding enzyme from Escherichia coli.
Liger, D; Blanot, D; van Heijenoort, J
1991-05-01
An extract from Escherichia coli containing the L-alanine-adding enzyme with a high specific activity was prepared. Several compounds structurally related to L-alanine were tested as inhibitors of this activity. Intact amino and carboxyl groups were necessary for an interaction with the enzyme. Certain halogenated (haloalanines) or unsaturated (L-vinylglycine, L-propargylglycine, 3-cyano-L-alanine) amino acids were good inhibitors. Radioactive glycine, serine and 1-aminoethylphosphonic acid were tested as substrates. Whereas glycine or L-serine gave rise to the formation of the corresponding nucleotide product, no synthesis of UDP-N-acetylmuramyl-L-1-aminoethylphosphonic acid could be detected.
RETINOIC ACID SYNTHESIS AND DEGRADATION
Kedishvili, Natalia Y.
2017-01-01
Retinoic acid was identified as the biologically active form of vitamin A almost 70 years ago, but the exact enzymes and control mechanisms that regulate its biosynthesis and degradation are yet to be fully defined. The currently accepted model postulates that RA is produced in two sequential oxidative steps: first, retinol is oxidized reversibly to retinaldehyde, and then retinaldehyde is oxidized irreversibly to RA, which is inactivated by conversion to hydroxylated derivatives. This chapter describes the history, development and recent advances in our understanding of the enzymatic pathways and mechanisms that control the rate of RA production and degradation. Gene knockout studies provided strong evidence that the members of the short chain dehydrogenase reductase superfamily of proteins play indispensable roles in retinoic acid biosynthesis during development. Furthermore, recent finding that two of these proteins regulate the rate of retinoic acid biosynthesis by mutually activating each other provided a novel insight into the mechanism of this regulation. Despite significant progress made since the middle of the 20th century many unanswered questions still remain, and there is much to be learned, especially about trafficking of the hydrophobic retinoid substrates between membrane bound and cytosolic enzymes and the roles of the retinoid binding proteins. PMID:27830503
Wang, Y D; Guo, L; Qian, S J; Meng, G Z; Zhang, S Z
2000-07-01
The colominic acid was covalently coupled to L-asparaginase molecule by reductive amination. Depending on the molar ratios of colominic acid-asparaginase (30:1, 50:1 and 100:1), a modified enzyme molecule contained 4.7, 7.2 and 12 colominic acid molecule, they retained 58%, 56% and 33.2% of the initial asparaginase activity, respectively. In comparison with the native enzyme, modified enzyme had lower immunogenicity and antigenicity, longer half-life time (in vitro), more resistance ability to trypsin proteolysis, and similar Km value for L-asparagine.
NASA Astrophysics Data System (ADS)
Yanagisawa, Mitsunori; Nakamura, Kanami; Nakasaki, Kiyohiko
In the present study, biomass waste raw materials including paper mill sludge, bamboo, sea lettuce, and shochu residue (from a distiller) and crude enzymes derived from inedible and discarded scallop parts were used to produce L-lactic acid for the raw material of biodegradable plastic poly-lactic acid. The activities of cellulase and amylase in the crude enzymes were 22 and 170units/L, respectively, and L-lactic acid was produced from every of the above mentioned biomass wastes, by the method of liquid-state simultaneous saccharification and fermentation (SSF) . The L-lactic acid concentrations produced from sea lettuce and shochu residue, which contain high concentration of starch were 3.6 and 9.3g/L, respectively, and corresponded to greater than 25% of the conversion of glucans contained in these biomass wastes. Furthermore, using the solid state SSF method, concentrations as high as 13g/L of L-lactic acid were obtained from sea lettuce and 26g/L were obtained from shochu residue.
Engineering acidic Streptomyces rubiginosus D-xylose isomerase by rational enzyme design.
Waltman, Mary Jo; Yang, Zamin Koo; Langan, Paul; Graham, David E; Kovalevsky, Andrey
2014-02-01
To maximize bioethanol production from lignocellulosic biomass, all sugars must be utilized. Yeast fermentation can be improved by introducing the d-xylose isomerase enzyme to convert the pentose sugar d-xylose, which cannot be fermented by Saccharomyces cerevisiae, into the fermentable ketose d-xylulose. The low activity of d-xylose isomerase, especially at the low pH required for optimal fermentation, limits its use. A rational enzyme engineering approach was undertaken, and seven amino acid positions were replaced to improve the activity of Streptomyces rubiginosus d-xylose isomerase towards its physiological substrate at pH values below 6. The active-site design was guided by mechanistic insights and the knowledge of amino acid protonation states at low pH obtained from previous joint X-ray/neutron crystallographic experiments. Tagging the enzyme with 6 or 12 histidine residues at the N-terminus resulted in a significant increase in the active-site affinity towards substrate at pH 5.8. Substituting an asparagine at position 215, which hydrogen bonded to the metal-bound Glu181 and Asp245, with an aspartate gave a variant with almost an order of magnitude lower KM than measured for the native enzyme, with a 4-fold increase in activity. Other studied variants showed similar (Asp57Asn, Glu186Gln/Asn215Asp), lower (Asp57His, Asn247Asp, Lys289His, Lys289Glu) or no (Gln256Asp, Asp287Asn, ΔAsp287) activity in acidic conditions relative to the native enzyme.
Lange, Kerstin; Schmid, Andreas; Julsing, Mattijs K
2016-09-10
Δ(9)-Tetrahydrocannabinolic acid synthase (THCAS) from the secondary metabolism of Cannabis sativa L. catalyzes the oxidative formation of an intramolecular CC bond in cannabigerolic acid (CBGA) to synthesize Δ(9)-tetrahydrocannabinolic acid (THCA), which is the direct precursor of Δ(9)-tetrahydrocannabinol (Δ(9)-THC). Aiming on a biotechnological production of cannabinoids, we investigated the potential of the heterologously produced plant oxidase in a cell-free system on preparative scale. THCAS was characterized in an aqueous/organic two-liquid phase setup in order to solubilize the hydrophobic substrate and to allow in situ product removal. Compared to the single phase aqueous setup the specific activity decreased by a factor of approximately 2 pointing to a substrate limitation of CBGA in the two-liquid phase system. However, the specific activity remained stable for at least 3h illustrating the benefit of the two-liquid phase setup. In a repeated-batch setup, THCAS showed only a minor loss of specific activity in the third batch pointing to a high intrinsic stability and high solvent tolerance of the enzyme. Maximal space-time-yields of 0.121gL(-1)h(-1) were reached proving the two-liquid phase concept suitable for biotechnological production of cannabinoids. Copyright © 2016 Elsevier B.V. All rights reserved.
PlsX deletion impacts fatty acid synthesis and acid adaptation in Streptococcus mutans.
Cross, Benjamin; Garcia, Ariana; Faustoferri, Roberta; Quivey, Robert G
2016-04-01
Streptococcus mutans, one of the primary causative agents of dental caries in humans, ferments dietary sugars in the mouth to produce organic acids. These acids lower local pH values, resulting in demineralization of the tooth enamel, leading to caries. To survive acidic environments, Strep. mutans employs several adaptive mechanisms, including a shift from saturated to unsaturated fatty acids in membrane phospholipids. PlsX is an acyl-ACP : phosphate transacylase that links the fatty acid synthase II (FASII) pathway to the phospholipid synthesis pathway, and is therefore central to the movement of unsaturated fatty acids into the membrane. Recently, we discovered that plsX is not essential in Strep. mutans. A plsX deletion mutant was not a fatty acid or phospholipid auxotroph. Gas chromatography of fatty acid methyl esters indicated that membrane fatty acid chain length in the plsX deletion strain differed from those detected in the parent strain, UA159. The deletion strain displayed a fatty acid shift similar to WT, but had a higher percentage of unsaturated fatty acids at low pH. The deletion strain survived significantly longer than the parent strain when cultures were subjected to an acid challenge of pH 2.5.The ΔplsX strain also exhibited elevated F-ATPase activity at pH 5.2, compared with the parent. These results indicate that the loss of plsX affects both the fatty acid synthesis pathway and the acid-adaptive response of Strep. mutans.
Abiotic synthesis of fatty acids
NASA Technical Reports Server (NTRS)
Leach, W. W.; Nooner, D. W.; Oro, J.
1978-01-01
The formation of fatty acids by Fischer-Tropsch-type synthesis was investigated with ferric oxide, ammonium carbonate, potassium carbonate, powdered Pueblito de Allende carbonaceous chondrite, and filings from the Canyon Diablo meteorite used as catalysts. Products were separated and identified by gas chromatography and mass spectrometry. Iron oxide, Pueblito de Allende chondrite, and Canyon Diablo filings in an oxidized catalyst form yielded no fatty acids. Canyon Diablo filings heated overnight at 500 C while undergoing slow purging by deuterium produced fatty acids only when potassium carbonate was admixed; potassium carbonate alone also produced these compounds. The active catalytic combinations gave relatively high yields of aliphatic and aromatic hydrocarbons; substantial amounts of n-alkenes were almost invariably observed when fatty acids were produced; the latter were in the range C6 to C18, with maximum yield in C9 or 10.
Maniscalco, W M; Finkelstein, J N; Parkhurst, A B
1989-05-01
De novo fatty acid synthesis may be an important source of saturated fatty acids for fetal lung disaturated phosphatidylcholine (DSPC) production. To investigate the roles of de novo fatty acid synthesis and exogenous fatty acids, we incubated dispersed fetal lung cells and freshly isolated adult type II cells with exogenous palmitate and oleate and measured DSPC synthesis. Unlike adult type II cells, fetal lung cells did not increase DSPC synthesis when exogenous palmitate was available; adult type II cells increased DSPC synthesis by 70% in the presence of palmitate. Exogenous oleate decreased DSPC synthesis by 48% in fetal cells but not in adult type II cells. Incubation of fetal lung cells with TOFA [2-furancarboxylate, 5-(tetradecyloxy)-sodium], a metabolic inhibitor of fatty acid synthesis, decreased fatty acid synthesis by 65%. There was a simultaneous 56% inhibition of DSPC production, but no effect on protein, DNA, or glyceride-glycerol production, measured by precursor incorporation. The inhibition of DSPC synthesis associated with TOFA was partially prevented by exogenous palmitate but not oleate. Fetal cells prepared from explants that had been cultured in dexamethasone also had TOFA-associated inhibition of DSPC synthesis that was similar to non-dexamethasone-exposed cells. These studies suggest that under baseline conditions of low fatty acid availability, such as in the fetus, de novo fatty acid synthesis in fetal cells, but not in adult type II cells, provides sufficient saturated fatty acids to support maximal DSPC production. Inhibition of de novo fatty acid synthesis resulting in decreased DSPC production in fetal lung cells in conditions of low fatty acid availability suggests that fatty acid synthesis may be central to maintain DSPC synthesis in the fetus.
Two enzyme immunoassays to screen for 2,4-dichlorophenoxyacetic acid in water.
Fleeker, J
1987-01-01
Two solid-phase enzyme immunoassays were developed to measure 2,4-dichlorophenoxyacetic acid (2,4-D), using 2 sets of structurally distinct immunogens and enzyme ligands. The 2,4-D analog, 2-methyl-4-chlorophenoxyacetic acid (MCPA), gave a similar response with both methods, whereas other phenoxy herbicides cross-reacted differently. In method A, the aromatic moiety of 2,4-D was distal from the carrier protein and labeled enzyme, whereas in method B, the acetic acid portion of the herbicide was distal. The use of both methods to screen for this herbicide in ground water and municipal and river water reduced the number of false-positive responses. Water sources having a low background response could be monitored with either method alone. When a concentration step, with disposable C18 extraction columns, was used, the limit of sensitivity was 5 micrograms/L. Method A was the more sensitive of the 2 methods with a limit of detection of 10 micrograms/L without the concentration step.
Abe, Kensuke; Ohno, Yusuke; Sassa, Takayuki; Taguchi, Ryo; Çalışkan, Minal; Ober, Carole; Kihara, Akio
2013-12-20
Very long-chain fatty acids (VLCFAs, chain length >C20) exist in tissues throughout the body and are synthesized by repetition of the fatty acid (FA) elongation cycle composed of four successive enzymatic reactions. In mammals, the TER gene is the only gene encoding trans-2-enoyl-CoA reductase, which catalyzes the fourth reaction in the FA elongation cycle. The TER P182L mutation is the pathogenic mutation for nonsyndromic mental retardation. This mutation substitutes a leucine for a proline residue at amino acid 182 in the TER enzyme. Currently, the mechanism by which the TER P182L mutation causes nonsyndromic mental retardation is unknown. To understand the effect of this mutation on the TER enzyme and VLCFA synthesis, we have biochemically characterized the TER P182L mutant enzyme using yeast and mammalian cells transfected with the TER P182L mutant gene and analyzed the FA elongation cycle in the B-lymphoblastoid cell line with the homozygous TER P182L mutation (TER(P182L/P182L) B-lymphoblastoid cell line). We have found that TER P182L mutant enzyme exhibits reduced trans-2-enoyl-CoA reductase activity and protein stability, thereby impairing VLCFA synthesis and, in turn, altering the sphingolipid profile (i.e. decreased level of C24 sphingomyelin and C24 ceramide) in the TER(P182L/P182L) B-lymphoblastoid cell line. We have also found that in addition to the TER enzyme-catalyzed fourth reaction, the third reaction in the FA elongation cycle is affected by the TER P182L mutation. These findings provide new insight into the biochemical defects associated with this genetic mutation.
Gälman, Cecilia; Miquel, Juan Francisco; Pérez, Rosa Maria; Einarsson, Curt; Ståhle, Lars; Marshall, Guillermo; Nervi, Flavio; Rudling, Mats
2004-03-01
Gallstone disease is an important, costly health-care problem in Western societies. It is still unclear whether hepatic lipid regulatory enzymes play primary or secondary roles in gallstone formation. In this study, the aim was to investigate whether the synthesis of bile acids and cholesterol is increased in gallstone disease and to test whether such a metabolic change, if present, might occur before gallstone formation. A total of 125 Chilean Hispanic women (80 without gallstones and 45 with gallstones) matched for age and body mass index were investigated, along with 40 Chilean Mapuche Indian women (20 without gallstones and 20 with gallstones), a population group in which the prevalence for gallstone disease is very high. Fasting blood plasma samples were assayed for 7 alpha-hydroxy-4-cholesten-3-one and lathosterol, 2 strong indicators for hepatic bile acid and body cholesterol synthesis, respectively. Plasma 7 alpha-hydroxy-4-cholesten-3-one levels, corrected for plasma cholesterol, were significantly increased by 50% in Hispanic women with gallstones as compared with gallstone-free Hispanics (P < 0.006). As compared with Hispanic women without gallstones, plasma 7 alpha-hydroxy-4-cholesten-3-one levels were increased by > or =100% (P < 0.002) in Mapuche Indian women, independently of whether gallstones were present. Plasma lathosterol, corrected for plasma cholesterol, was significantly increased by 22% in Hispanic women with gallstones and in Mapuche Indian women compared with Hispanic women. The results indicate that the synthesis of bile acids and cholesterol is induced in gallstone disease and precedes gallstone development. These inductions presumably occur as a response to an increased intestinal loss of bile acids.
Meng, Xiangfeng; Pijning, Tjaard; Tietema, Martin; Dobruchowska, Justyna M; Yin, Huifang; Gerwig, Gerrit J; Kralj, Slavko; Dijkhuizen, Lubbert
2017-02-15
Exopolysaccharides produced by lactic acid bacteria are extensively used for food applications. Glucansucrase enzymes of lactic acid bacteria use sucrose to catalyze the synthesis of α-glucans with different linkage compositions, size and physico-chemical properties. Crystallographic studies of GTF180-ΔN show that at the acceptor binding sites +1 and +2, residue W1065 provides stacking interactions to the glucosyl moiety. However, the detailed functional roles of W1065 have not been elucidated. We performed random mutagenesis targeting residue W1065 of GTF180-ΔN, resulting in the generation of 10 mutant enzymes that were characterized regarding activity and product specificity. Characterization of mutant enzymes showed that residue W1065 is critical for the activity of GTF180-ΔN. Using sucrose, and sucrose (donor) plus maltose (acceptor) as substrates, the mutant enzymes synthesized polysaccharides and oligosaccharides with changed linkage composition. The stacking interaction of an aromatic residue at position 1065 is essential for polysaccharide synthesis. Copyright © 2016 Elsevier Ltd. All rights reserved.
Francis, Brian R.
2015-01-01
Although analysis of the genetic code has allowed explanations for its evolution to be proposed, little evidence exists in biochemistry and molecular biology to offer an explanation for the origin of the genetic code. In particular, two features of biology make the origin of the genetic code difficult to understand. First, nucleic acids are highly complicated polymers requiring numerous enzymes for biosynthesis. Secondly, proteins have a simple backbone with a set of 20 different amino acid side chains synthesized by a highly complicated ribosomal process in which mRNA sequences are read in triplets. Apparently, both nucleic acid and protein syntheses have extensive evolutionary histories. Supporting these processes is a complex metabolism and at the hub of metabolism are the carboxylic acid cycles. This paper advances the hypothesis that the earliest predecessor of the nucleic acids was a β-linked polyester made from malic acid, a highly conserved metabolite in the carboxylic acid cycles. In the β-linked polyester, the side chains are carboxylic acid groups capable of forming interstrand double hydrogen bonds. Evolution of the nucleic acids involved changes to the backbone and side chain of poly(β-d-malic acid). Conversion of the side chain carboxylic acid into a carboxamide or a longer side chain bearing a carboxamide group, allowed information polymers to form amide pairs between polyester chains. Aminoacylation of the hydroxyl groups of malic acid and its derivatives with simple amino acids such as glycine and alanine allowed coupling of polyester synthesis and protein synthesis. Use of polypeptides containing glycine and l-alanine for activation of two different monomers with either glycine or l-alanine allowed simple coded autocatalytic synthesis of polyesters and polypeptides and established the first genetic code. A primitive cell capable of supporting electron transport, thioester synthesis, reduction reactions, and synthesis of polyesters and
Lee, Sung G.; Lipmann, Fritz
1977-01-01
Dissociation of the multienzymes of tyrocidine synthesis by prolonged incubation of crude extracts of Bacillus brevis (Dubos strain, ATCC 8185) has yielded, on Sephadex G-100 chromatography, two fractions of amino acid activating subunits, a larger one of 70,000 daltons and a smaller one of 90,000 daltons; the latter was a complex consisting of the 70,000 dalton subunit and the pantetheine-carrying protein of about 20,000 daltons. When it dissociated, the intermediate enzyme, which activates three amino acids, contained two-thirds of the subunits in the 70,000 dalton and one-third in the 90,000 dalton fraction; the heavy enzyme, which activates six amino acids, contained five-sixths of the subunits in the former fraction and one-sixth in the latter. Both fractions showed ATP-PPi exchange with all amino acids that are activated by the respective polyenzymes. With proline as an example, the 70,000 dalton subunit exhibited a single low-affinity binding site, which should correspond to the peripheral thiol acceptor site, whereas the 90,000 dalton subunit showed both a low-affinity binding site and an additional high-affinity site for proline; the high-affinity site is attributed to the pantetheine present on the pantetheine-carrying protein, and suggests that amino acids are translocated from the peripheral SH to the pantetheine-carrying moiety during chain elongation. This was confirmed by the observation that the 90,000 dalton complex, when incubated with the light enzyme in the presence of phenylalanine and proline, produced DPhe-Pro dipeptide that cyclized into DPhe-Pro diketopiperazine, but the 70,000 dalton activating subunit, when similarly incubated, did not. After subunit dissociation, however, no further elongation occurred after the transfer from phenylalanine to proline. Images PMID:196286
Nitrilase enzymes and their role in plant–microbe interactions
Howden, Andrew J. M.; Preston, Gail M.
2009-01-01
Summary Nitrilase enzymes (nitrilases) catalyse the hydrolysis of nitrile compounds to the corresponding carboxylic acid and ammonia, and have a wide range of industrial and biotechnological applications, including the synthesis of industrially important carboxylic acids and bioremediation of cyanide and toxic nitriles. Nitrilases are produced by a wide range of organisms, including plants, bacteria and fungi, but despite their biotechnological importance, the role of these enzymes in living organisms is relatively underexplored. Current research suggests that nitrilases play important roles in a range of biological processes. In the context of plant–microbe interactions they may have roles in hormone synthesis, nutrient assimilation and detoxification of exogenous and endogenous nitriles. Nitrilases are produced by both plant pathogenic and plant growth‐promoting microorganisms, and their activities may have a significant impact on the outcome of plant–microbe interactions. In this paper we review current knowledge of the role of nitriles and nitrilases in plants and plant‐associated microorganisms, and discuss how greater understanding of the natural functions of nitrilases could be applied to benefit both industry and agriculture. PMID:21255276
Meng, Xiangfeng; Gangoiti, Joana; Bai, Yuxiang; Pijning, Tjaard; Van Leeuwen, Sander S; Dijkhuizen, Lubbert
2016-07-01
Lactic acid bacteria (LAB) are known to produce large amounts of α-glucan exopolysaccharides. Family GH70 glucansucrase (GS) enzymes catalyze the synthesis of these α-glucans from sucrose. The elucidation of the crystal structures of representative GS enzymes has advanced our understanding of their reaction mechanism, especially structural features determining their linkage specificity. In addition, with the increase of genome sequencing, more and more GS enzymes are identified and characterized. Together, such knowledge may promote the synthesis of α-glucans with desired structures and properties from sucrose. In the meantime, two new GH70 subfamilies (GTFB- and GTFC-like) have been identified as 4,6-α-glucanotransferases (4,6-α-GTs) that represent novel evolutionary intermediates between the family GH13 and "classical GH70 enzymes". These enzymes are not active on sucrose; instead, they use (α1 → 4) glucans (i.e. malto-oligosaccharides and starch) as substrates to synthesize novel α-glucans by introducing linear chains of (α1 → 6) linkages. All these GH70 enzymes are very interesting biocatalysts and hold strong potential for applications in the food, medicine and cosmetic industries. In this review, we summarize the microbiological distribution and the structure-function relationships of family GH70 enzymes, introduce the two newly identified GH70 subfamilies, and discuss evolutionary relationships between family GH70 and GH13 enzymes.
Harris, R B; Wilson, I B
1983-01-25
A set of chemical reactions was used to show that one glutamic acid residue at the active site of bovine lung angiotensin I-converting enzyme is esterified with the alkylating agent p-[N,N-bis(chloroethyl)amino] phenylbutyryl-L-Pro (chlorambucyl-L-Pro), an affinity label for this enzyme (Harris, R. B., and Wilson, I. B. (1982) J. Biol. Chem. 257, 811-815). The same procedure was used to confirm that a glutamic acid residue of carboxypeptidase A alpha is esterified by reaction with bromoacetyl-N-methyl-L-phenylalanine (Haas, G. M., and Neurath, H. (1971) Biochemistry 10, 3535-3546). In the procedure described in this paper, the esterified residue at the active site is converted to the hydroxamic acid by reaction with hydroxylamine and the hydroxamic acid is subject to the Lossen rearrangement. If a glutamic acid residue was esterified, 1 eq of 2,4-diaminobutyric acid will be formed. Aspartyl esters will give 2,3-diaminopropionic acid. The diamino acids can be quantitatively measured using the short column of an amino acid analyzer if the amount of lysine and histidine is largely decreased by modification with suitable side chain protecting groups. With carboxypeptidase A, the reactions were done on the whole undigested enzyme. With the converting enzyme, we first cleaved the esterified enzyme with cyanogen bromide. Twenty-nine cleavage peptides were separated on high performance liquid chromatography and one of these contained all of the bound radioactive inhibitor. This active site peptide was then subjected to the derivatization and Lossen procedures, and 1 eq of 2,4-diaminobutyric acid was obtained.
Laurila, Minni R L; Makeyev, Eugene V; Bamford, Dennis H
2002-05-10
Like most RNA polymerases, the polymerase of double-strand RNA bacteriophage phi6 (phi6pol) is capable of primer-independent initiation. Based on the recently solved phi6pol initiation complex structure, a four-amino acid-long loop (amino acids 630-633) has been suggested to stabilize the first two incoming NTPs through stacking interactions with tyrosine, Tyr(630). A similar loop is also present in the hepatitis C virus polymerase, another enzyme capable of de novo initiation. Here, we use a series of phi6pol mutants to address the role of this element. As predicted, mutants at the Tyr(630) position are inefficient in initiation de novo. Unexpectedly, when the loop is disordered by changing Tyr(630)-Lys(631)-Trp(632) to GSG, phi6pol becomes a primer-dependent enzyme, either extending complementary oligonucleotide or, when the template 3' terminus can adopt a hairpin-like conformation, utilizing a "copy-back" initiation mechanism. In contrast to the wild-type phi6pol, the GSG mutant does not require high GTP concentration for its optimal activity. These findings suggest a general model for the initiation of de novo RNA synthesis.
Enzyme nanoparticle fabrication: magnetic nanoparticle synthesis and enzyme immobilization.
Johnson, Patrick A; Park, Hee Joon; Driscoll, Ashley J
2011-01-01
Immobilized enzymes are drawing significant attention for potential commercial applications as biocatalysts by reducing operational expenses and by increasing process utilization of the enzymes. Typically, immobilized enzymes have greater thermal and operational stability at various pH values, ionic strengths and are more resistant to denaturation that the soluble native form of the enzyme. Also, immobilized enzymes can be recycled by utilizing the physical or chemical properties of the supporting material. Magnetic nanoparticles provide advantages as the supporting material for immobilized enzymes over competing materials such as: higher surface area that allows for greater enzyme loading, lower mass transfer resistance, less fouling effect, and selective, nonchemical separation from the reaction mixture by an applied a magnetic field. Various surface modifications of magnetic nanoparticles, such as silanization, carbodiimide activation, and PEG or PVA spacing, aid in the binding of single or multienzyme systems to the particles, while cross-linking using glutaraldehyde can also stabilize the attached enzymes.
Andersen, Mikael R.; Salazar, Margarita P.; Schaap, Peter J.; van de Vondervoort, Peter J.I.; Culley, David; Thykaer, Jette; Frisvad, Jens C.; Nielsen, Kristian F.; Albang, Richard; Albermann, Kaj; Berka, Randy M.; Braus, Gerhard H.; Braus-Stromeyer, Susanna A.; Corrochano, Luis M.; Dai, Ziyu; van Dijck, Piet W.M.; Hofmann, Gerald; Lasure, Linda L.; Magnuson, Jon K.; Menke, Hildegard; Meijer, Martin; Meijer, Susan L.; Nielsen, Jakob B.; Nielsen, Michael L.; van Ooyen, Albert J.J.; Pel, Herman J.; Poulsen, Lars; Samson, Rob A.; Stam, Hein; Tsang, Adrian; van den Brink, Johannes M.; Atkins, Alex; Aerts, Andrea; Shapiro, Harris; Pangilinan, Jasmyn; Salamov, Asaf; Lou, Yigong; Lindquist, Erika; Lucas, Susan; Grimwood, Jane; Grigoriev, Igor V.; Kubicek, Christian P.; Martinez, Diego; van Peij, Noël N.M.E.; Roubos, Johannes A.; Nielsen, Jens; Baker, Scott E.
2011-01-01
The filamentous fungus Aspergillus niger exhibits great diversity in its phenotype. It is found globally, both as marine and terrestrial strains, produces both organic acids and hydrolytic enzymes in high amounts, and some isolates exhibit pathogenicity. Although the genome of an industrial enzyme-producing A. niger strain (CBS 513.88) has already been sequenced, the versatility and diversity of this species compel additional exploration. We therefore undertook whole-genome sequencing of the acidogenic A. niger wild-type strain (ATCC 1015) and produced a genome sequence of very high quality. Only 15 gaps are present in the sequence, and half the telomeric regions have been elucidated. Moreover, sequence information from ATCC 1015 was used to improve the genome sequence of CBS 513.88. Chromosome-level comparisons uncovered several genome rearrangements, deletions, a clear case of strain-specific horizontal gene transfer, and identification of 0.8 Mb of novel sequence. Single nucleotide polymorphisms per kilobase (SNPs/kb) between the two strains were found to be exceptionally high (average: 7.8, maximum: 160 SNPs/kb). High variation within the species was confirmed with exo-metabolite profiling and phylogenetics. Detailed lists of alleles were generated, and genotypic differences were observed to accumulate in metabolic pathways essential to acid production and protein synthesis. A transcriptome analysis supported up-regulation of genes associated with biosynthesis of amino acids that are abundant in glucoamylase A, tRNA-synthases, and protein transporters in the protein producing CBS 513.88 strain. Our results and data sets from this integrative systems biology analysis resulted in a snapshot of fungal evolution and will support further optimization of cell factories based on filamentous fungi. PMID:21543515
Inhibition of fatty acid synthesis in isolated adipocytes by 5-(tetradecyloxy)-2-furoic acid.
Halvorson, D L; McCune, S A
1984-11-01
The compound 5-(tetradecyloxy)-2-furoic acid (TOFA), a hypolipidemic agent, inhibits fatty acid synthesis, lactate and pyruvate accumulation and CO2 release in isolated rat adipocytes. TOFA stimulates the accumulation of citrate. ATP levels are not lowered by TOFA. In comparison with the natural fatty acid, oleate, TOFA exhibited a much greater inhibitory effect on lipogenesis. TOFyl-CoA formation within intact adipocytes was demonstrated. Although not inhibited by TOFA, acetyl-CoA carboxylase is inhibited by TOFyl-CoA. It is proposed that many of the metabolic effects of TOFA in isolated adipocytes can be explained by TOFyl-CoA inhibition of acetyl-CoA carboxylase. TOFA inhibits glycolysis as a secondary event with the primary event of inhibition of fatty acid synthesis causing an accumulation of citrate which is an inhibitor of phosphofructokinase.
Glutamic Acid as Enhancer of Protein Synthesis Kinetics in Hepatocytes from Old Rats.
Brodsky, V Y; Malchenko, L A; Butorina, N N; Lazarev Konchenko, D S; Zvezdina, N D; Dubovaya, T K
2017-08-01
Dense cultures of hepatocytes from old rats (~2 years old, body weight 530-610 g) are different from similar cultures of hepatocytes from young rats by the low amplitude of protein synthesis rhythm. Addition of glutamic acid (0.2, 0.4, or 0.6 mg/ml) into the culture medium with hepatocytes of old rats resulted in increase in the oscillation amplitudes of the protein synthesis rhythm to the level of young rats. A similar action of glutamic acid on the protein synthesis kinetics was observed in vivo after feeding old rats with glutamic acid. Inhibition of metabotropic receptors of glutamic acid with α-methyl-4-carboxyphenylglycine (0.01 mg/ml) abolished the effect of glutamic acid. The amplitude of oscillation of the protein synthesis rhythm in a cell population characterizes synchronization of individual oscillations caused by direct cell-cell communications. Hence, glutamic acid, acting as a receptor-dependent transmitter, enhanced direct cell-cell communications of hepatocytes that were decreased with aging. As differentiated from other known membrane signaling factors (gangliosides, norepinephrine, serotonin, dopamine), glutamic acid can penetrate into the brain and thus influence the communications and protein synthesis kinetics that are disturbed with aging not only in hepatocytes, but also in neurons.
Diner, Bruce A; Fan, Janine; Scotcher, Miles C; Wells, Derek H; Whited, Gregory M
2018-01-01
There is a growing interest in the use of microbial fermentation for the generation of high-demand, high-purity chemicals using cheap feedstocks in an environmentally friendly manner. One example explored here is the production of isoprene (C 5 H 8 ), a hemiterpene, which is primarily polymerized to polyisoprene in synthetic rubber in tires but which can also be converted to C 10 and C 15 biofuels. The strictly anaerobic, acetogenic bacterium Clostridium ljungdahlii , used in all of the work described here, is capable of glycolysis using the Embden-Meyerhof-Parnas pathway and of carbon fixation using the Wood-Ljungdahl pathway. Clostridium - Escherichia coli shuttle plasmids, each bearing either 2 or 3 different heterologous genes of the eukaryotic mevalonic acid (MVA) pathway or eukaryotic isopentenyl pyrophosphate isomerase (Idi) and isoprene synthase (IspS), were constructed and electroporated into C. ljungdahlii These plasmids, one or two of which were introduced into the host cells, enabled the synthesis of mevalonate and of isoprene from fructose and from syngas (H 2 , CO 2 , and CO) and the conversion of mevalonate to isoprene. All of the heterologous enzymes of the MVA pathway, as well as Idi and IspS, were shown to be synthesized at high levels in C. ljungdahlii , as demonstrated by Western blotting, and were enzymatically active, as demonstrated by in vivo product synthesis. The quantities of mevalonate and isoprene produced here are far below what would be required of a commercial production strain. However, proposals are made that could enable a substantial increase in the mass yield of product formation. IMPORTANCE This study demonstrates the ability to synthesize a heterologous metabolic pathway in C. ljungdahlii , an organism capable of metabolizing either simple sugars or syngas or both together (mixotrophy). Syngas, an inexpensive source of carbon and reducing equivalents, is produced as a major component of some industrial waste gas, and it can be
Fan, Janine; Scotcher, Miles C.; Wells, Derek H.; Whited, Gregory M.
2017-01-01
ABSTRACT There is a growing interest in the use of microbial fermentation for the generation of high-demand, high-purity chemicals using cheap feedstocks in an environmentally friendly manner. One example explored here is the production of isoprene (C5H8), a hemiterpene, which is primarily polymerized to polyisoprene in synthetic rubber in tires but which can also be converted to C10 and C15 biofuels. The strictly anaerobic, acetogenic bacterium Clostridium ljungdahlii, used in all of the work described here, is capable of glycolysis using the Embden-Meyerhof-Parnas pathway and of carbon fixation using the Wood-Ljungdahl pathway. Clostridium-Escherichia coli shuttle plasmids, each bearing either 2 or 3 different heterologous genes of the eukaryotic mevalonic acid (MVA) pathway or eukaryotic isopentenyl pyrophosphate isomerase (Idi) and isoprene synthase (IspS), were constructed and electroporated into C. ljungdahlii. These plasmids, one or two of which were introduced into the host cells, enabled the synthesis of mevalonate and of isoprene from fructose and from syngas (H2, CO2, and CO) and the conversion of mevalonate to isoprene. All of the heterologous enzymes of the MVA pathway, as well as Idi and IspS, were shown to be synthesized at high levels in C. ljungdahlii, as demonstrated by Western blotting, and were enzymatically active, as demonstrated by in vivo product synthesis. The quantities of mevalonate and isoprene produced here are far below what would be required of a commercial production strain. However, proposals are made that could enable a substantial increase in the mass yield of product formation. IMPORTANCE This study demonstrates the ability to synthesize a heterologous metabolic pathway in C. ljungdahlii, an organism capable of metabolizing either simple sugars or syngas or both together (mixotrophy). Syngas, an inexpensive source of carbon and reducing equivalents, is produced as a major component of some industrial waste gas, and it can be
Brodsky, V Y; Malchenko, L A; Konchenko, D S; Zvezdina, N D; Dubovaya, T K
2016-08-01
Primary cultures of rat hepatocytes were studied in serum-free media. Ultradian protein synthesis rhythm was used as a marker of cell synchronization in the population. Addition of glutamic acid (0.2 mg/ml) to the medium of nonsynchronous sparse cultures resulted in detection of a common protein synthesis rhythm, hence in synchronization of the cells. The antagonist of glutamic acid metabotropic receptors MCPG (0.01 mg/ml) added together with glutamic acid abolished the synchronization effect; in sparse cultures, no rhythm was detected. Feeding rats with glutamic acid (30 mg with food) resulted in protein synthesis rhythm in sparse cultures obtained from the rats. After feeding without glutamic acid, linear kinetics of protein synthesis was revealed. Thus, glutamic acid, a component of blood as a non-neural transmitter, can synchronize the activity of hepatocytes and can form common rhythm of protein synthesis in vitro and in vivo. This effect is realized via receptors. Mechanisms of cell-cell communication are discussed on analyzing effects of non-neural functions of neurotransmitters. Glutamic acid is used clinically in humans. Hence, a previously unknown function of this drug is revealed.
Góngora-Benítez, Miriam; Basso, Alessandra; Bruckdorfer, Thomas; Royo, Miriam; Tulla-Puche, Judit; Albericio, Fernando
2012-12-07
Enzyme-labile protecting groups have emerged as a green alternative to conventional protecting groups. These groups introduce a further orthogonal dimension and eco-friendliness into protection schemes for the synthesis of complex polyfunctional organic molecules. S-Phacm, a Cys-protecting group, can be easily removed by the action of a covalently immobilized PGA enzyme under very mild conditions. Herein, the versatility and reliability of an eco-friendly combination of the immobilized PGA enzyme and the S-Phacm protecting group has been evaluated for the synthesis of diverse Cys-containing peptides. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Hesse, Lars; Bostock, Julieanne; Dementin, Sebastien; Blanot, Didier; Mengin-Lecreulx, Dominique; Chopra, Ian
2003-01-01
Chlamydiae are unusual obligate intracellular bacteria that cause serious infections in humans. Chlamydiae contain genes that appear to encode products with peptidoglycan biosynthetic activity. The organisms are also susceptible to antibiotics that inhibit peptidoglycan synthesis. However, chlamydiae do not synthesize detectable peptidoglycan. The paradox created by these observations is known as the chlamydial anomaly. The MurC enzyme of chlamydiae, which is synthesized as a bifunctional MurC-Ddl product, is expected to possess UDP-N-acetylmuramate (UDP-MurNAc):l-alanine ligase activity. In this paper we demonstrate that the MurC domain of the Chlamydia trachomatis bifunctional protein is functionally expressed in Escherichia coli, since it complements a conditional lethal E. coli mutant possessing a temperature-sensitive lesion in MurC. The recombinant MurC domain was overexpressed in and purified from E. coli. It displayed in vitro ATP-dependent UDP-MurNAc:l-alanine ligase activity, with a pH optimum of 8.0 and dependence upon magnesium ions (optimum concentration, 20 mM). Its substrate specificity was studied with three amino acids (l-alanine, l-serine, and glycine); comparable Vmax/Km values were obtained. Our results are consistent with the synthesis of a muramic acid-containing polymer in chlamydiae with UDP-MurNAc-pentapeptide as a precursor molecule. However, due to the lack of specificity of MurC activity in vitro, it is not obvious which amino acid is present in the first position of the pentapeptide. PMID:14594822
Hesse, Lars; Bostock, Julieanne; Dementin, Sebastien; Blanot, Didier; Mengin-Lecreulx, Dominique; Chopra, Ian
2003-11-01
Chlamydiae are unusual obligate intracellular bacteria that cause serious infections in humans. Chlamydiae contain genes that appear to encode products with peptidoglycan biosynthetic activity. The organisms are also susceptible to antibiotics that inhibit peptidoglycan synthesis. However, chlamydiae do not synthesize detectable peptidoglycan. The paradox created by these observations is known as the chlamydial anomaly. The MurC enzyme of chlamydiae, which is synthesized as a bifunctional MurC-Ddl product, is expected to possess UDP-N-acetylmuramate (UDP-MurNAc):L-alanine ligase activity. In this paper we demonstrate that the MurC domain of the Chlamydia trachomatis bifunctional protein is functionally expressed in Escherichia coli, since it complements a conditional lethal E. coli mutant possessing a temperature-sensitive lesion in MurC. The recombinant MurC domain was overexpressed in and purified from E. coli. It displayed in vitro ATP-dependent UDP-MurNAc:L-alanine ligase activity, with a pH optimum of 8.0 and dependence upon magnesium ions (optimum concentration, 20 mM). Its substrate specificity was studied with three amino acids (L-alanine, L-serine, and glycine); comparable Vmax/Km values were obtained. Our results are consistent with the synthesis of a muramic acid-containing polymer in chlamydiae with UDP-MurNAc-pentapeptide as a precursor molecule. However, due to the lack of specificity of MurC activity in vitro, it is not obvious which amino acid is present in the first position of the pentapeptide.
Manandhar, Miglena; Cronan, John E
2018-01-01
BioF (8-amino-7-oxononanoate synthase) is a strictly conserved enzyme that catalyzes the first step in assembly of the fused heterocyclic rings of biotin. The BioF acyl chain donor has long been thought to be pimeloyl-CoA. Indeed, in vitro the Escherichia coli and Bacillus sphaericus enzymes have been shown to condense pimeloyl-CoA with l-alanine in a pyridoxal 5'-phosphate-dependent reaction with concomitant CoA release and decarboxylation of l-alanine. However, recent in vivo studies of E. coli and Bacillus subtilis suggested that the BioF proteins of the two bacteria could have different specificities for pimelate thioesters in that E. coli BioF may utilize either pimeloyl coenzyme A (CoA) or the pimelate thioester of the acyl carrier protein (ACP) of fatty acid synthesis. In contrast, B. subtilis BioF seemed likely to be specific for pimeloyl-CoA and unable to utilize pimeloyl-ACP. We now report genetic and in vitro data demonstrating that B. subtilis BioF specifically utilizes pimeloyl-CoA. IMPORTANCE Biotin is an essential vitamin required by mammals and birds because, unlike bacteria, plants, and some fungi, these organisms cannot make biotin. Currently, the biotin included in vitamin tablets and animal feeds is made by chemical synthesis. This is partly because the biosynthetic pathways in bacteria are incompletely understood. This paper defines an enzyme of the Bacillus subtilis pathway and shows that it differs from that of Escherichia coli in the ability to utilize specific precursors. These bacteria have been used in biotin production and these data may aid in making biotin produced by biotechnology commercially competitive with that produced by chemical synthesis. Copyright © 2017 American Society for Microbiology.
Bentz, Emilie L; Goswami, Rajesh; Moloney, Mark G; Westaway, Susan M
2005-08-07
Bicyclic lactams derived from pyroglutamic acid provide a useful scaffold for synthesis of conformationally restricted analogues of lysine, ornithine and glutamine, as well as an Ala-Ala dipeptide analogue. Amino alcohol and carboxylic acid derivatives are accessible from a common intermediate. In this strategy, the bicyclic lactam system not only controls, but also facilitates the determination of the stereochemistry of the synthetic intermediates.
Ribonucleic Acid Synthesis and Glutamate Excretion in Escherichia coli
Broda, Paul
1968-01-01
Cultures of Escherichia coli excreted glutamate into the medium when protein synthesis was blocked in RCrel strains or when it was blocked with chloramphenicol in either RCstr or RCrel strains. Both of these conditions resulted in continued ribonucleic acid (RNA) synthesis in the absence of protein synthesis. Glutamate was also excreted by both RCstr and RCrel strains when RNA synthesis was inhibited by uracil starvation or by treatment with actinomycin D. It is proposed that, in each of these cases, glutamate excretion resulted from an increase in the permeability of the cell membrane. PMID:4973126
Shi, Ying; Liu, Li; Yu, Yuanyuan; Long, Yijuan; Zheng, Huzhi
2018-08-05
Nanomaterials have triggered tremendous interest to mimick peroxidase but rarely attention has been paid to small molecules. Herein we first found that acidic amino acids including l-glutamic acid (L-Glu) and l-aspartic acid (L-Asp) exhibited an intrinsic peroxidase-like activity, endowing acidic amino acids with the capability of catalysing the oxidation of the peroxidase substrates 3,3',5,5'-tetramethylbenzidine (TMB) to produce color reaction in the presence of H 2 O 2 . Reaction mechanism was further investigated by means of electron spin resonance spectroscopy (ESR), enzyme kinetics assay and quantum theoretical calculations, to verify and provide a good deal of insight into the catalytic process. Based on the above discovery, a colorimetric platform was successfully developed for sensing glucose in the range of 0.10 μM to 10 μM with a detection limit of 40 nM, as well as evaluating the inhibitory effect of antioxidants on reactive oxygen species. This extraordinary finding not only extends the new biological function of acidic amino acids, but also opens new opportunities to deepen the knowledge of the new class of small molecule enzymes. Copyright © 2018 Elsevier B.V. All rights reserved.
A direct method for the synthesis of orthogonally protected furyl- and thienyl- amino acids.
Hudson, Alex S; Caron, Laurent; Colgin, Neil; Cobb, Steven L
2015-04-01
The synthesis of unnatural amino acids plays a key part in expanding the potential application of peptide-based drugs and in the total synthesis of peptide natural products. Herein, we report a direct method for the synthesis of orthogonally protected 5-membered heteroaromatic amino acids.
Fatty acid regulation of hepatic lipid metabolism
Jump, Donald B.
2012-01-01
Purpose of review To discuss transcriptional mechanisms regulating hepatic lipid metabolism. Recent findings Humans who are obese or have diabetes (NIDDM) or metabolic syndrome (MetS) have low blood and tissue levels of C20–22 polyunsaturated fatty acids (PUFAs). Although the impact of low C20–22 PUFAs on disease progression in humans is not fully understood, studies with mice have provided clues suggesting that impaired PUFA metabolism may contribute to the severity of risk factors associated with NIDDM and MetS. High fat diets promote hyperglycemia, insulin resistance and fatty liver in C57BL/6J mice, an effect that correlates with suppressed expression of enzymes involved in PUFA synthesis and decreased hepatic C20–22 PUFA content. A/J mice, in contrast, are resistant to diet-induced obesity and diabetes; these mice have elevated expression of hepatic enzymes involved in PUFA synthesis and C20–22 PUFA content. Moreover, loss-of-function and gain-of-function studies have identified fatty acid elongase (Elovl5), a key enzyme involved in PUFA synthesis, as a regulator of hepatic lipid and carbohydrate metabolism. Elovl5 activity regulates hepatic C20–22 PUFA content, signaling pathways (Akt and PP2A) and transcription factors (SREBP-1, PPARα, FoxO1 and PGC1α) that control fatty acid synthesis and gluconeogenesis. Summary These studies may help define novel strategies to control fatty liver and hyperglycemia associated with NIDDM and MetS. PMID:21178610
Synthesis and chirality of amino acids under interstellar conditions.
Giri, Chaitanya; Goesmann, Fred; Meinert, Cornelia; Evans, Amanda C; Meierhenrich, Uwe J
2013-01-01
Amino acids are the fundamental building blocks of proteins, the biomolecules that provide cellular structure and function in all living organisms. A majority of amino acids utilized within living systems possess pre-specified orientation geometry (chirality); however the original source for this specific orientation remains uncertain. In order to trace the chemical evolution of life, an appreciation of the synthetic and evolutional origins of the first chiral amino acids must first be gained. Given that the amino acids in our universe are likely to have been synthesized in molecular clouds in interstellar space, it is necessary to understand where and how the first synthesis might have occurred. The asymmetry of the original amino acid synthesis was probably the result of exposure to chiral photons in the form of circularly polarized light (CPL), which has been detected in interstellar molecular clouds. This chirality transfer event, from photons to amino acids, has been successfully recreated experimentally and is likely a combination of both asymmetric synthesis and enantioselective photolysis. A series of innovative studies have reported successful simulation of these environments and afforded production of chiral amino acids under realistic circumstellar and interstellar conditions: irradiation of interstellar ice analogues (CO, CO2, NH3, CH3OH, and H2O) with circularly polarized ultraviolet photons at low temperatures does result in enantiomer enriched amino acid structures (up to 1.3% ee). This topical review summarizes current knowledge and recent discoveries about the simulated interstellar environments within which amino acids were probably formed. A synopsis of the COSAC experiment onboard the ESA cometary mission ROSETTA concludes this review: the ROSETTA mission will soft-land on the nucleus of the comet 67P/Churyumov-Gerasimenko in November 2014, anticipating the first in situ detection of asymmetric organic molecules in cometary ices.
Bile salt kinetics in cystic fibrosis: influence of pancreatic enzyme replacement
DOE Office of Scientific and Technical Information (OSTI.GOV)
Watkins, J.B.; Tercyak, A.M.; Szczepanik, P.
1977-01-01
Bile acid kinetics was investigated by stable isotope dilution technique in 6 children (ages 3/sup 1///sub 2/ months to 4/sup 1///sub 2/ years) with previously untreated cystic fibrosis. All of the patients had clinical and laboratory evidence of malabsorption, normal intestinal mucosal function, as judged by glucose absorption, intestinal histology, disaccharidase levels, and normally functioning gallbladders. The children were maintained on a constant diet throughout the study period; fat intake averaged 4.2 g per kg per day. Before administration of pancreatic enzyme replacement, fat excretion equalled 50 +- 4% (mean +- SE) of intake and was reduced to 20 +-more » 1.0% of intake after therapy. Total bile acid pool size nearly doubled during enzyme replacement from 379 +- 32 ..mu..moles per kg to 620 +- 36 ..mu..moles per kg with secondary bile acids comprising 57% of the total pool before therapy and 40% after therapy. The data indicate that both primary and secondary bile acids are conserved within the enterohepatic circulation during enzyme therapy, and that the mechanism for the regulation of hepatic bile acid synthesis is intact in cystic fibrosis. However, the demonstration that large amounts of bile acid continue to be excreted during therapy suggests that interruption of the enterohepatic circulation continues and that deficiencies of the intraluminal phase may persist during enzyme therapy in this disease.« less
Reeve, Holly A; Ash, Philip A; Park, HyunSeo; Huang, Ailun; Posidias, Michalis; Tomlinson, Chloe; Lenz, Oliver; Vincent, Kylie A
2017-01-15
The present study considers the ways in which redox enzyme modules are coupled in living cells for linking reductive and oxidative half-reactions, and then reviews examples in which this concept can be exploited technologically in applications of coupled enzyme pairs. We discuss many examples in which enzymes are interfaced with electronically conductive particles to build up heterogeneous catalytic systems in an approach which could be termed synthetic biochemistry We focus on reactions involving the H + /H 2 redox couple catalysed by NiFe hydrogenase moieties in conjunction with other biocatalysed reactions to assemble systems directed towards synthesis of specialised chemicals, chemical building blocks or bio-derived fuel molecules. We review our work in which this approach is applied in designing enzyme-modified particles for H 2 -driven recycling of the nicotinamide cofactor NADH to provide a clean cofactor source for applications of NADH-dependent enzymes in chemical synthesis, presenting a combination of published and new work on these systems. We also consider related photobiocatalytic approaches for light-driven production of chemicals or H 2 as a fuel. We emphasise the techniques available for understanding detailed catalytic properties of the enzymes responsible for individual redox half-reactions, and the importance of a fundamental understanding of the enzyme characteristics in enabling effective applications of redox biocatalysis. © 2017 The Author(s).
USDA-ARS?s Scientific Manuscript database
Polygalacturonase enzymes hydrolyze the polygalacturonic acid chains found in pectin. Interest in polygalacturonase enzymes continues as they are useful in a number of industrial processes and conversely, detrimental, as they are involved in maceration of economically important crops. While a good...
Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester
NASA Technical Reports Server (NTRS)
Weber, A. L.
1986-01-01
The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20% for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.
Ma, LiWei; Steindal, Arnfinn E; Juzeniene, Asta; Iani, Vladimir; Moan, Johan
2006-08-01
5-Aminolevulinic acid (ALA) or its derivative methyl 5-aminolevulinate (MAL) combined with folic acid was applied in nude mice bearing human colon adenocarcinoma. The aim of the study is to see whether folic acid may increase biosynthesis of porphyrins in tumor tissue after systemic or topical administration of ALA or MAL. The production of porphyrins was determined by spectrofluorometric measurements with an optical fibre probe. It was found that the porphyrin production after i.p injection of 200 mg kg(-1) ALA or MAL was significantly increased by i.p injection of 100 mg kg(-1) folic acid. However, in the case of topically applied 20% ALA, folic acid had no effect. In the case of topically applied 20% MAL, folic acid (i.p or topically applied) reduced the porphyrin synthesis. This might be used for the protection of normal skin against photosensitization. The effects of folic acid were similar in tumors and normal skin. Two mechanisms may explain the results: enhancement of the efficiency of the rate-limiting enzyme porphobilinogen deaminase by folic acid or interference of folic acid with the transport of ALA and MAL to and into the cells synthesizing porphyrins in the tissues. The present data seem to favour the latter mechanism. Folic acid may have a role as an adjuvant in photodynamic therapy with systemically administered ALA and its derivatives.
Lee, Patricia J.; Bhonsle, Jayendra B.; Gaona, Heather W.; Huddler, Donald P.; Heady, Tiffany N.; Kreishman-Deitrick, Mara; Bhattacharjee, Apurba; McCalmont, William F.; Gerena, Lucia; Lopez-Sanchez, Miriam; Roncal, Norma E.; Hudson, Thomas H.; Johnson, Jacob D.; Prigge, Sean T.; Waters, Norman C.
2009-01-01
The importance of fatty acids to the human malaria parasite, Plasmodium falciparum, and differences due to a type I fatty acid synthesis (FAS) pathway in the parasite, make it an attractive drug target. In the present study, we developed and a utilized a pharmacophore to select compounds for testing against PfKASIII, the initiating enzyme of FAS. This effort identified several PfKASIII inhibitors that grouped into various chemical classes of sulfides, sulfonamides, and sulfonyls. Approximately 60% of the submicromolar inhibitors of PfKASIII inhibited in vitro growth of the malaria parasite. These compounds inhibited both drug sensitive and resistant parasites and testing against a mammalian cell line revealed an encouraging in vitro therapeutic index for the most active compounds. Docking studies into the active site of PfKASIII suggest a potential binding mode that exploits amino acid residues at the mouth of the substrate tunnel. PMID:19191586
Engineering the production of conjugated fatty acids in Arabidopsis thaliana leaves
USDA-ARS?s Scientific Manuscript database
The seeds of many non-domesticated plant species synthesize oils containing high amounts of a single unusual fatty acid, many of which have potential usage in industry. Despite the identification of enzymes for unusual oxidized fatty acid synthesis, the production of these fatty acids in engineered ...
Salicylic acid derivatives: synthesis, features and usage as therapeutic tools.
Ekinci, Deniz; Sentürk, Murat; Küfrevioğlu, Ömer İrfan
2011-12-01
In the field of medicinal chemistry, there is a growing interest in the use of small molecules. Although acetyl salicylic acid is well known for medical applications, little is known about other salicylic acid derivatives, and there is serious lack of data and information on the effects and biological evaluation that connect them. This review covers the synthesis and drug potencies of salicylic acid derivatives. After a brief overview of the information on salicylic acid and its features, a detailed review of salicylic acids as drugs and prodrugs, usage as cyclooxygenase inhibitors, properties in plants, synthesis and recent patents, is developed. Salicylic acid research is still an important area and innovations continue to arise, which offer hope for new therapeutics in related fields. It is anticipated that this review will guide the direction of long-term drug/nutraceutical safety trials and stimulate ideas for future research.
Metherel, Adam H; Domenichiello, Anthony F; Kitson, Alex P; Hopperton, Kathryn E; Bazinet, Richard P
2016-09-01
Whole body docosahexaenoic acid (DHA, 22:6n-3) synthesis from α-linolenic acid (ALA, 18:3n-3) is considered to be very low, however, the daily synthesis-secretion of DHA may be sufficient to supply the adult brain. The current study aims to assess whether whole body DHA synthesis-secretion kinetics are different when comparing plasma ALA versus eicosapentaenoic acid (EPA, 20:5n-3) as the precursor. Male Long Evans rats (n=6) were fed a 2% ALA in total fat diet for eight weeks, followed by surgery to implant a catheter into each of the jugular vein and carotid artery and 3h of steady-state infusion with a known amount of (2)H-ALA and (13)C-eicosapentaenoic acid (EPA, 20:5n3). Blood samples were collected at thirty-minute intervals and plasma enrichment of (2)H- and (13)C EPA, n-3 docosapentaenoic acid (DPAn-3, 22:5n-3) and DHA were determined for assessment of synthesis-secretion kinetic parameters. Results indicate a 13-fold higher synthesis-secretion coefficient for DHA from EPA as compared to ALA. However, after correcting for the 6.6 fold higher endogenous plasma ALA concentration, no significant differences in daily synthesis-secretion (nmol/day) of DHA (97.6±28.2 and 172±62), DPAn-3 (853±279 and 1139±484) or EPA (1587±592 and 1628±366) were observed from plasma unesterified ALA and EPA sources, respectively. These results suggest that typical diets which are significantly higher in ALA compared to EPA yield similar daily DHA synthesis-secretion despite a significantly higher synthesis-secretion coefficient from EPA. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
[Importance of the 11β-hydroxysteroid dehydrogenase enzyme in clinical disorders].
Feldman, Karolina; Likó, István; Nagy, Zsolt; Szappanos, Agnes; Grolmusz, Vince Kornél; Tóth, Miklós; Rácz, Károly; Patócs, Attila
2013-02-24
Glucocorticoids play an important role in the regulation of carbohydrate and amino acid metabolism, they modulate the function of the immune system, and contribute to stress response. Increased and decreased production of glucocorticoids causes specific diseases. In addition to systemic hypo- or hypercortisolism, alteration of local synthesis and metabolism of cortisol may result in tissue-specific hypo- or hypercortisolism. One of the key enzymes participating in the local synthesis and metabolism of cortisol is the 11β-hydroxysteroid dehydrogenase enzyme. Two isoforms, type 1 and type 2 enzymes are located in the endoplasmic reticulum and catalyze the interconversion of hormonally active cortisol and inactive cortisone. The type 1 enzyme mainly works as an activator, and it is responsible for the generation of cortisol from cortisone in liver, adipose tissue, brain and bone. The gene encoding this enzyme is located on chromosome 1. The authors review the physiological and pathophysiological processes related to the function of the type 1 11β-hydroxysteroid dehydrogenase enzyme. They summarize the potential significance of polymorphic variants of the enzyme in clinical diseases as well as knowledge related to inhibitors of enzyme activity. Although further studies are still needed, inhibition of the enzyme activity may prove to be an effective tool for the treatment of several diseases such as obesity, osteoporosis and type 2 diabetes.
In vitro enzymic hydrolysis of chlorogenic acids in coffee.
da Encarnação, Joana Amarante; Farrell, Tracy L; Ryder, Alexandra; Kraut, Nicolai U; Williamson, Gary
2015-02-01
Coffee is rich in quinic acid esters of phenolic acids (chlorogenic acids) but also contains some free phenolic acids. A proportion of phenolic acids appear in the blood rapidly after coffee consumption due to absorption in the small intestine. We investigated in vitro whether this appearance could potentially be derived from free phenolic acids in instant coffee or from hydrolysis of chlorogenic acids by pancreatic or brush border enzymes. We quantified six free phenolic acids in instant coffees using HPLC-DAD-mass spectrometry. The highest was caffeic acid, but all were present at low levels compared to the chlorogenic acids. Roasting and decaffeination significantly reduced free phenolic acid content. We estimated, using pharmacokinetic modelling with previously published data, that the contribution of these compounds to small intestinal absorption is minimal. Hydrolysis of certain chlorogenic acids was observed with human-differentiated Caco-2 cell monolayers and with porcine pancreatin, which showed maximal rates on 3- and 5-O-caffeoylquinic acids, respectively. The amounts of certain free phenolic acids in coffee could only minimally account for small intestinal absorption based on modelling. The hydrolysis of caffeoylquinic, but not feruloylquinic acids, by enterocyte and pancreatic esterases is potentially a contributing mechanism to small intestinal absorption. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
A hydrogen fuel cell for rapid, enzyme-catalysed organic synthesis with continuous monitoring.
Wan, Lei; Megarity, Clare F; Siritanaratkul, Bhavin; Armstrong, Fraser A
2018-01-23
A one-pot fuel cell for specific, enzyme-catalysed organic synthesis, with continuous monitoring of rate and reaction progress, combines an electrode catalysing rapid, reversible and diffusion-controlled interconversion of NADP + and NADPH with a Pt electrode catalysing 2H + /H 2 interconversion. This Communication demonstrates its performance and characteristics using the reductive amination of 2-oxoglutarate as a test system.
Conjugated Fatty Acid Synthesis
Rawat, Richa; Yu, Xiao-Hong; Sweet, Marie; Shanklin, John
2012-01-01
Conjugated linolenic acids (CLNs), 18:3 Δ9,11,13, lack the methylene groups found between the double bonds of linolenic acid (18:3 Δ9,12,15). CLNs are produced by conjugase enzymes that are homologs of the oleate desaturases FAD2. The goal of this study was to map the domain(s) within the Momordica charantia conjugase (FADX) responsible for CLN formation. To achieve this, a series of Momordica FADX-Arabidopsis FAD2 chimeras were expressed in the Arabidopsis fad3fae1 mutant, and the transformed seeds were analyzed for the accumulation of CLN. These experiments identified helix 2 and the first histidine box as a determinant of conjugase product partitioning into punicic acid (18:3 Δ9cis,11trans,13cis) or α-eleostearic acid (18:3 Δ9cis,11trans,13trans). This was confirmed by analysis of a FADX mutant containing six substitutions in which the sequence of helix 2 and first histidine box was converted to that of FAD2. Each of the six FAD2 substitutions was individually converted back to the FADX equivalent identifying residues 111 and 115, adjacent to the first histidine box, as key determinants of conjugase product partitioning. Additionally, expression of FADX G111V and FADX G111V/D115E resulted in an approximate doubling of eleostearic acid accumulation to 20.4% and 21.2%, respectively, compared with 9.9% upon expression of the native Momordica FADX. Like the Momordica conjugase, FADX G111V and FADX D115E produced predominantly α-eleostearic acid and little punicic acid, but the FADX G111V/D115E double mutant produced approximately equal amounts of α-eleostearic acid and its isomer, punicic acid, implicating an interactive effect of residues 111 and 115 in punicic acid formation. PMID:22451660
Abscisic acid negatively regulates elicitor-induced synthesis of capsidiol in wild tobacco.
Mialoundama, Alexis Samba; Heintz, Dimitri; Debayle, Delphine; Rahier, Alain; Camara, Bilal; Bouvier, Florence
2009-07-01
In the Solanaceae, biotic and abiotic elicitors induce de novo synthesis of sesquiterpenoid stress metabolites known as phytoalexins. Because plant hormones play critical roles in the induction of defense-responsive genes, we have explored the effect of abscisic acid (ABA) on the synthesis of capsidiol, the major wild tobacco (Nicotiana plumbaginifolia) sesquiterpenoid phytoalexin, using wild-type plants versus nonallelic mutants Npaba2 and Npaba1 that are deficient in ABA synthesis. Npaba2 and Npaba1 mutants exhibited a 2-fold higher synthesis of capsidiol than wild-type plants when elicited with either cellulase or arachidonic acid or when infected by Botrytis cinerea. The same trend was observed for the expression of the capsidiol biosynthetic genes 5-epi-aristolochene synthase and 5-epi-aristolochene hydroxylase. Treatment of wild-type plants with fluridone, an inhibitor of the upstream ABA pathway, recapitulated the behavior of Npaba2 and Npaba1 mutants, while the application of exogenous ABA reversed the enhanced synthesis of capsidiol in Npaba2 and Npaba1 mutants. Concomitant with the production of capsidiol, we observed the induction of ABA 8'-hydroxylase in elicited plants. In wild-type plants, the induction of ABA 8'-hydroxylase coincided with a decrease in ABA content and with the accumulation of ABA catabolic products such as phaseic acid and dihydrophaseic acid, suggesting a negative regulation exerted by ABA on capsidiol synthesis. Collectively, our data indicate that ABA is not required per se for the induction of capsidiol synthesis but is essentially implicated in a stress-response checkpoint to fine-tune the amplification of capsidiol synthesis in challenged plants.
Ida, Chieri; Yamashita, Sachiko; Tsukada, Masaki; Sato, Teruaki; Eguchi, Takayuki; Tanaka, Masakazu; Ogata, Shin; Fujii, Takahiro; Nishi, Yoshisuke; Ikegami, Susumu; Moss, Joel; Miwa, Masanao
2016-02-01
PolyADP-ribosylation is mediated by poly(ADP-ribose) (PAR) polymerases (PARPs) and may be involved in various cellular events, including chromosomal stability, DNA repair, transcription, cell death, and differentiation. The physiological level of PAR is difficult to determine in intact cells because of the rapid synthesis of PAR by PARPs and the breakdown of PAR by PAR-degrading enzymes, including poly(ADP-ribose) glycohydrolase (PARG) and ADP-ribosylhydrolase 3. Artifactual synthesis and/or degradation of PAR likely occurs during lysis of cells in culture. We developed a sensitive enzyme-linked immunosorbent assay (ELISA) to measure the physiological levels of PAR in cultured cells. We immediately inactivated enzymes that catalyze the synthesis and degradation of PAR. We validated that trichloroacetic acid is suitable for inactivating PARPs, PARG, and other enzymes involved in metabolizing PAR in cultured cells during cell lysis. The PAR level in cells harvested with the standard radioimmunoprecipitation assay buffer was increased by 450-fold compared with trichloroacetic acid for lysis, presumably because of activation of PARPs by DNA damage that occurred during cell lysis. This ELISA can be used to analyze the biological functions of polyADP-ribosylation under various physiological conditions in cultured cells. Copyright © 2015 Elsevier Inc. All rights reserved.
New hydrazones of ferulic acid: synthesis, characterization and biological activity.
Wolszleger, Maria; Stan, Cătălina Daniela; Apotrosoaei, Maria; Vasincu, Ioana; Pânzariu, Andreea; Profire, Lenuţa
2014-01-01
The ferulic acid (4-hydroxy-3-methoxy-cinnamic acid) is a phenolic compound with important antioxidant effects and which nowadays is being extensively studied for his potential indications in inflammatory and neurodegenerative diseases, hypertension, atherosclerosis, etc. The synthesis of new ferulic acid compounds with potential antioxidant activity. The synthesis of the designed compounds was performed in several steps: (i) the obtaining of ferulic acid chloride by reacting of ferulic acid with thionyl chloride; (ii) the reaction between the ferulic acid chloride and hydrazine hydrate 98% to obtain the ferulic acid hydrazide; (iii) the condensation of ferrulic acid hydrazide with various benzaldehydes (2-hydroxy/3-hydroxy/4-hydroxy/2-nitro/3-nitro/4-nitro/2-methoxi/ 4-chloro/4-fluoro/4-bromo-benzaldehyde) resulting the correspond- ing hydrazones. The structure of the synthesized compounds was confirmed by FT-IR spectroscopy and the evaluation of antioxidant potential was achieved by determining the total antioxidant capacity and reducing power. In this study new hydrazones of ferulic acid have been synthesized, physic-chemical and spectral characterized. The evaluation of antioxidant potential using in vitro methods showed the favorable influence of the structural modulation on the antioxidant effects of ferulic acid.
Expeditious Synthesis of Dianionic-Headed 4-Sulfoalkanoic Acid Surfactants.
Jiang, Jianghui; Xu, Jiaxi
2017-04-16
4-Sulfoalkanoic acids are a class of important dianionic-headed surfactants. Various 4-sulfoalkanoic acids with straight C8, C10, C12, C14, C16, and C18 chains were synthesized expeditiously through the radical addition of methyl 2-((ethoxycarbonothioyl)thio)acetate to linear terminal olefins and subsequent oxidation with peroxyformic acid. This is a useful and convenient strategy for the synthesis of dianionic-headed surfactants with a carboxylic acid and sulfonic acid functionalities in the head group region.
Pène, Jacques J.; Marmur, Julius
1967-01-01
The role of deoxyribonucleic acid (DNA) replication in the control of the synthesis of deoxycytidylate (dCMP) deaminase and lysozyme in Bacillus subtilis infected with bacteriophage 2C has been studied. These phage-induced enzymes are synthesized at different times during the latent period. It was shown by actinomycin inhibition that the formation of the late enzyme (lysozyme) required messenger ribonucleic acid (mRNA) synthesized de novo after the initiation of translation of mRNA which specifies the early function (dCMP deaminase). The inhibition of phage DNA synthesis by mitomycin C prevented the synthesis of lysozyme only when added before the onset of phage DNA replication, but it did not affect the synthesis or action of dCMP deaminase when added at any time during the latent period. Treatment of infected cells with mitomycin C after phage DNA synthesis had reached 8 to 10% of its maximal rate resulted in the production of normal amounts of lysozyme. These observations suggest that mRNA specifying early enzymes can be transcribed from parental (and probably also from progeny) DNA, whereas late functional messengers can be transcribed only after the formation of progeny DNA. PMID:4990039
Synthesis of monomethyl 5,5'-dehydrodiferulic acid
USDA-ARS?s Scientific Manuscript database
Synthesis of the internal reference compound, monomethyl 5,5’-dehydrodiferulic acid, is described. The synthetic scheme relies on a selective monomethylation of the known compound 5,5-dehydrodivanillin, followed by elaboration into the dehydrodiferulic framework through a dual Horner-Emmons-Wadswort...
Content and synthesis of nucleic acids in the cartilage in chondromalacia patellae.
Lund, F; Telhag, H
1978-12-01
The content and the synthesis of nucleic acids in chondromalacian, osteoarthritis and normal cartilage was compared. The chondromalacian cartilage differed from osteoarthritis in that the content of nucleic acids was less. Also, the cell density was less in chondromalacian than in normal cartilage as opposed to previous findings in osteoarthritis. The synthesis of DNA was greater in chondromalacian than in normal cartilage but less than in osteoarthritis. With regard to the RNA synthesis, however, the chondromalacian cartilage showed a higher rate than both normal and osteoarthritic cartilage.
Baresova, Veronika; Krijt, Matyas; Skopova, Vaclava; Souckova, Olga; Kmoch, Stanislav; Zikanova, Marie
2016-11-01
Purines are essential molecules for nucleic acid synthesis and are the most common carriers of chemical energy in all living organisms. The cellular pool of purines is maintained by the balance between their de novo synthesis (DNPS), recycling and degradation. DNPS includes ten reactions catalysed by six enzymes. To date, two genetically determined disorders of DNPS enzymes have been described, and the existence of other defects manifested by neurological symptoms and the accumulation of DNPS intermediates in bodily fluids is highly presumable. In the current study, we prepared specific recombinant DNPS enzymes and used them for the biochemical preparation of their commercially unavailable substrates. These compounds were used as standards for the development and validation of quantitative liquid chromatography-tandem mass spectrometry (LC-MS/MS). To simulate manifestations of known and putative defects of DNPS we prepared CRISPR-Cas9 genome-edited HeLa cells deficient for the individual steps of DNPS (CR-cells), assessed the substrates accumulation in cell lysates and growth media and tested how the mutations affect assembly of the purinosome, the multi-enzyme complex of DNPS enzymes. In all model cell lines with the exception of one, an accumulation of the substrate(s) for the knocked out enzyme was identified. The ability to form the purinosome was reduced. We conclude that LC-MS/MS analysis of the dephosphorylated substrates of DNPS enzymes in bodily fluids is applicable in the selective screening of the known and putative DNPS disorders. This approach should be considered in affected individuals with neurological and neuromuscular manifestations of unknown aetiology. Prepared in vitro human model systems can serve in various studies that aim to provide a better characterization and understanding of physiology and pathology of DNPS, to study the role of each DNPS protein in the purinosome formation and represent an interesting way for the screening of potential
Total amino acid stabilization during cell-free protein synthesis reactions.
Calhoun, Kara A; Swartz, James R
2006-05-17
Limitations in amino acid supply have been recognized as a substantial problem in cell-free protein synthesis reactions. Although enzymatic inhibitors and fed-batch techniques have been beneficial, the most robust way to stabilize amino acids is to remove the responsible enzymatic activities by genetically modifying the source strain used for cell extract preparation. Previous work showed this was possible for arginine, serine, and tryptophan, but cysteine degradation remained a major limitation in obtaining high protein synthesis yields. Through radiolabel techniques, we confirmed that cysteine degradation was caused by the activity of glutamate-cysteine ligase (gene gshA) in the cell extract. Next, we created Escherichia coli strain KC6 that combines a gshA deletion with previously described deletions for arginine, serine, and tryptophan stabilization. Strain KC6 grows well, and active cell extract can be produced from it for cell-free protein synthesis reactions. The extract from strain KC6 maintains stable amino acid concentrations of all 20 amino acids in a 3-h batch reaction. Yields for three different proteins improved 75-250% relative to cell-free expression using the control extract.
Erkel, G; Anke, T; Velten, R; Steglich, W
1991-01-01
A novel enzyme inhibitor of RNA-directed DNA-polymerases of avian myeloblastosis and murine leukemia virus was isolated from fermentations of an tasmanian Podoscypha species. Its structure was elucidated by spectroscopic methods and oxidative degradation as (E)-4,5-dioxo-2-hexadecenoic acid (1). The enzyme inhibitor, which was named podoscyphic acid, did not inhibit DNA and RNA synthesis in permeabilized L 1210 cells nor did it affect RNA synthesis in isolated nuclei of L 1210 cells. 1 inhibits protein synthesis in whole L 1210 cells and rabbit reticulocyte lysate and shows very weak antimicrobial and cytotoxic properties. The testing of ethyl (E)-4,5-dioxo-2-hexadecenoate (2) and (E)-4-oxo-2-tetradecenoic acid (11) revealed the importance of the free gamma-oxoacrylic acid unit for the biological activities of 1.
Carboxylic acid reductase enzymes (CARs).
Winkler, Margit
2018-04-01
Carboxylate reductases (CARs) are emerging as valuable catalysts for the selective one-step reduction of carboxylic acids to their corresponding aldehydes. The substrate scope of CARs is exceptionally broad and offers potential for their application in diverse synthetic processes. Two major fields of application are the preparation of aldehydes as end products for the flavor and fragrance sector and the integration of CARs in cascade reactions with aldehydes as the key intermediates. The latest applications of CARs are dominated by in vivo cascades and chemo-enzymatic reaction sequences. The challenge to fully exploit product selectivity is discussed. Recent developments in the characterization of CARs are summarized, with a focus on aspects related to the domain architecture and protein sequences of CAR enzymes. Copyright © 2017 Elsevier Ltd. All rights reserved.
Taura, Futoshi; Dono, Emi; Sirikantaramas, Supaart; Yoshimura, Kohji; Shoyama, Yukihiro; Morimoto, Satoshi
2007-09-28
Delta(1)-Tetrahydrocannabinolic acid (THCA) synthase is the enzyme that catalyzes the oxidative cyclization of cannabigerolic acid into THCA, the acidic precursor of Delta(1)-tetrahydrocannabinol. We developed a novel expression system for THCA synthase using a methylotrophic yeast Pichia pastoris as a host. Under optimized conditions, the transgenic P. pastoris secreted approximately 1.32nkat/l of THCA synthase activity, and the culture medium, from which the cells were removed, effectively synthesized THCA from cannabigerolic acid with a approximately 98% conversion rate. The secreted THCA synthase was readily purified to homogeneity. Interestingly, endoglycosidase treatment afforded a deglycosylated THCA synthase with more catalytic activity than that of the glycosylated form. The non-glycosylated THCA synthase should be suitable for structure-function studies because it displayed much more activity than the previously reported native enzyme from Cannabis sativa as well as the recombinant enzyme from insect cell cultures.
Stereoselective synthesis of unsaturated α-amino acids.
Fanelli, Roberto; Jeanne-Julien, Louis; René, Adeline; Martinez, Jean; Cavelier, Florine
2015-06-01
Stereoselective synthesis of unsaturated α-amino acids was performed by asymmetric alkylation. Two methods were investigated and their enantiomeric excess measured and compared. The first route consisted of an enantioselective approach induced by the Corey-Lygo catalyst under chiral phase transfer conditions while the second one involved the hydroxypinanone chiral auxiliary, both implicating Schiff bases as substrate. In all cases, the use of a prochiral Schiff base gave higher enantiomeric excess and yield in the final desired amino acid.
Tannic acid-mediated green synthesis of antibacterial silver nanoparticles.
Kim, Tae Yoon; Cha, Song-Hyun; Cho, Seonho; Park, Youmie
2016-04-01
The search for novel antibacterial agents is necessary to combat microbial resistance to current antibiotics. Silver nanoparticles (AgNPs) have been reported to be effective antibacterial agents. Tannic acid is a polyphenol compound from plants with antioxidant and antibacterial activities. In this report, AgNPs were prepared from silver ions by tannic acid-mediated green synthesis (TA-AgNPs). The reaction process was facile and involved mixing both silver ions and tannic acid. The absorbance at 423 nm in the UV-Visible spectra demonstrated that tannic acid underwent a reduction reaction to produce TA-AgNPs from silver ions. The synthetic yield of TA-AgNPs was 90.5% based on inductively coupled plasma mass spectrometry analysis. High-resolution transmission electron microscopy and atomic force microscopy images indicated that spherical-shaped TA-AgNPs with a mean particle size of 27.7-46.7 nm were obtained. Powder high-resolution X-ray diffraction analysis indicated that the TA-AgNP structure was face-centered cubic with a zeta potential of -27.56 mV. The hydroxyl functional groups of tannic acid contributed to the synthesis of TA-AgNPs, which was confirmed by Fourier transform infrared spectroscopy. The in vitro antibacterial activity was measured using the minimum inhibitory concentration (MIC) method. The TA-AgNPs were more effective against Gram-negative bacteria than Gram-positive bacteria. The MIC for the TA-AgNPs in all of the tested strains was in a silver concentration range of 6.74-13.48 μg/mL. The tannic acid-mediated synthesis of AgNPs afforded biocompatible nanocomposites for antibacterial applications.
Singh-Blom, Amrita; Hughes, Randall A; Ellington, Andrew D
2014-05-20
Residue-specific incorporation of non-canonical amino acids into proteins is usually performed in vivo using amino acid auxotrophic strains and replacing the natural amino acid with an unnatural amino acid analog. Herein, we present an efficient amino acid depleted cell-free protein synthesis system that can be used to study residue-specific replacement of a natural amino acid by an unnatural amino acid analog. This system combines a simple methodology and high protein expression titers with a high-efficiency analog substitution into a target protein. To demonstrate the productivity and efficacy of a cell-free synthesis system for residue-specific incorporation of unnatural amino acids in vitro, we use this system to show that 5-fluorotryptophan and 6-fluorotryptophan substituted streptavidin retain the ability to bind biotin despite protein-wide replacement of a natural amino acid for the amino acid analog. We envisage this amino acid depleted cell-free synthesis system being an economical and convenient format for the high-throughput screening of a myriad of amino acid analogs with a variety of protein targets for the study and functional characterization of proteins substituted with unnatural amino acids when compared to the currently employed in vivo methodologies. Copyright © 2014 Elsevier B.V. All rights reserved.
The evolution of the protein synthesis system. I - A model of a primitive protein synthesis system
NASA Technical Reports Server (NTRS)
Mizutani, H.; Ponnamperuma, C.
1977-01-01
A model is developed to describe the evolution of the protein synthesis system. The model is comprised of two independent autocatalytic systems, one including one gene (A-gene) and two activated amino acid polymerases (O and A-polymerases), and the other including the addition of another gene (N-gene) and a nucleotide polymerase. Simulation results have suggested that even a small enzymic activity and polymerase specificity could lead the system to the most accurate protein synthesis, as far as permitted by transitions to systems with higher accuracy.
Harris, Victoria; Ford, Christopher M; Jiranek, Vladimir; Grbin, Paul R
2009-01-01
Volatile phenols are produced by Dekkera yeasts and are of organoleptic importance in alcoholic beverages. The key compound in this respect is 4-ethylphenol, responsible for the medicinal and phenolic aromas in spoiled wines. The microbial synthesis of volatile phenols is thought to occur in two steps, beginning with naturally occurring hydroxycinnamic acids (HCAs). The enzyme phenolic acid decarboxylase (PAD) converts HCAs to vinyl derivatives, which are the substrates of a second enzyme, postulated to be a vinylphenol reductase (VPR), whose activity results in the formation of ethylphenols. Here, both steps of the pathway are investigated, using cell extracts from a number of Dekkera and Brettanomyces species. Dekkera species catabolise ferulic, caffeic and p-coumaric acids and possess inducible enzymes with similar pH and temperature optima. Brettanomyces does not decarboxylate HCAs but does metabolise vinylphenols. Dekkera species form ethylphenols but the VPR enzyme appears to be highly unstable in cell extracts. A partial protein sequence for PAD was determined from Dekkera anomala and may indicate the presence of a novel enzyme in this genus.
Hu, Q; Agarwal, U; Bequette, B J
2017-02-01
We aimed to quantify the rate of gluconeogenesis (GNG), non-essential amino-acid (NEAA) synthesis, and substrate partitioning to the Krebs cycle in embryonic (e) day e14 and e19 chicken embryos. An in ovo continuous tracer infusion approach was employed to test the hypotheses that GNG and NEAA synthesis in developing chicken embryo increases from e14 to e19. [ 13 C 6 ]Glucose or [ 13 C 3 ]glycerol was continuously infused (8 h) into the chorio-allantoic compartment of eggs on e14 and e19. Glucose entry rate, Cori cycling, and GNG were higher (P < 0.05) in e19 compared to e14 embryos, presumably to support higher glycogen deposition in liver and muscle. Whereas de novo synthesis of alanine, aspartate, and glutamate via glycolysis and the Krebs cycle was higher (P < 0.01) in e14 embryos, synthesis of these NEAA from glycerol was higher (P < 0.05) in e19 compared to e14 embryos. These patterns of glucose and glycerol utilization suggest a metabolic shift to conserve glucose for glycogen synthesis and an increased utilization of yolk glycerol (from triacylglyceride) after e14. Although the contribution of glycerol to GNG in e19 embryos was higher (P < 0.05) than that in e14 embryos, the contribution of glycerol to GNG (1.3 to 6.0%) was minor. Based on [ 13 C 6 ]glucose tracer kinetics, the activities of both pyruvate carboxylase (PC) and pyruvate dehydrogenase (PDH) in the liver were higher (P < 0.05) in e19 embryos; whereas the higher (P < 0.01) relative activity of liver PC compared to PDH in e14 embryos suggests a greater anaplerotic flux into the Krebs cycle. In summary, the in ovo continuous tracer infusion approach allowed for a measurement of chicken embryo whole body and liver metabolism over a shorter window of development. This study provided quantitative estimates of the developmental shifts in substrate utilization, GNG, and NEAA synthesis by chicken embryos, as well as qualitative estimates of the activities of enzymes central to the Krebs cycle
Kim, Eun Ju; Jin, Xing-Ji; Kim, Yeon Kyung; Oh, In Kyung; Kim, Ji Eun; Park, Chi-Hyun; Chung, Jin Ho
2010-01-01
Although fatty acids are known to be important in various skin functions, their roles on photoaging in human skin are poorly understood. We investigated the alteration of lipid metabolism in the epidermis by photoaging and acute UV irradiation in human skin. UV irradiated young volunteers (21-33 years, n=6) and elderly volunteers (70-75 years, n=7) skin samples were obtained by punch biopsy. Then the epidermis was separated from dermis and lipid metabolism was investigated. We observed that the amounts of free fatty acids (FFA) and triglycerides (TG) in the epidermis of photoaged or acutely UV irradiated human skin were significantly decreased. The expressions of genes related to lipid synthesis, including acetyl-CoA carboxylase (ACC), fatty acid synthase (FAS), stearoyl-CoA desaturase (SCD), sterol regulatory element binding proteins (SREBPs), and peroxisome proliferator-activated receptors (PPARgamma) were also markedly decreased. To elucidate the significance of these changes of epidermal lipids in human skin, we investigated the effects of TG or various inhibitors for the enzymes involved in TG synthesis on the expression of matrix metalloproteinase-1 (MMP-1) in cultured human epidermal keratinocytes. We demonstrated that triolein (TG) reduced basal and UV-induced MMP-1 mRNA expression. In addition, each inhibitor for various lipid synthesis enzymes, such as TOFA (ACC inhibitor), cerulenin (FAS inhibitor) and trans-10, cis-12-CLA (SCD inhibitor), increased the MMP-1 expression significantly in a dose-dependent manner. We also demonstrated that triolein could inhibit cerulenin-induced MMP-1 expression. Furthermore, topical application of triolein (10%) significantly prevented UV-induced MMP-13, COX-2, and IL-1beta expression in hairless mice. Our results suggest that TG and FFA may play important roles in photoaging of human skin. Copyright 2009 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.
Dezfulian, Mohammad H; Foreman, Curtis; Jalili, Espanta; Pal, Mrinal; Dhaliwal, Rajdeep K; Roberto, Don Karl A; Imre, Kathleen M; Kohalmi, Susanne E; Crosby, William L
2017-04-07
Branched-chain amino acids (BCAAs) are synthesized by plants, fungi, bacteria, and archaea with plants being the major source of these amino acids in animal diets. Acetolactate synthase (ALS) is the first enzyme in the BCAA synthesis pathway. Although the functional contribution of ALS to BCAA biosynthesis has been extensively characterized, a comprehensive understanding of the regulation of this pathway at the molecular level is still lacking. To characterize the regulatory processes governing ALS activity we utilized several complementary approaches. Using the ALS catalytic protein subunit as bait we performed a yeast two-hybrid (Y2H) screen which resulted in the identification of a set of interacting proteins, two of which (denoted as ALS-INTERACTING PROTEIN1 and 3 [AIP1 and AIP3, respectively]) were found to be evolutionarily conserved orthologues of bacterial feedback-regulatory proteins and therefore implicated in the regulation of ALS activity. To investigate the molecular role AIPs might play in BCAA synthesis in Arabidopsis thaliana, we examined the functional contribution of aip1 and aip3 knockout alleles to plant patterning and development and BCAA synthesis under various growth conditions. Loss-of-function genetic backgrounds involving these two genes exhibited differential aberrant growth responses in valine-, isoleucine-, and sodium chloride-supplemented media. While BCAA synthesis is believed to be localized to the chloroplast, both AIP1 and AIP3 were found to localize to the peroxisome in addition to the chloroplast. Analysis of free amino acid pools in the mutant backgrounds revealed that they differ in the absolute amount of individual BCAAs accumulated and exhibit elevated levels of BCAAs in leaf tissues. Despite the phenotypic differences observed in aip1 and aip3 backgrounds, functional redundancy between these loci was suggested by the finding that aip1/aip3 double knockout mutants are severely developmentally compromised. Taken together the
Accatino, L; Pizarro, M; Solís, N; Koenig, C S
1995-01-18
This study was undertaken to gain insights into the characteristics of the polymolecular association between canalicular membrane enzymes, bile acids, cholesterol and phospholipids in bile and into the celular mechanisms whereby the enzymes are secreted into bile. With this purpose, we studied the distribution of bile acids, cholesterol, phospholipids, proteins and representative canalicular membrane enzymes (alkaline phosphatase, 5'-nucleotidase and gamma-glutamyl transpeptidase), which can be considered specific marker constituents, in bile fractions enriched in phospholipid-cholesterol lamellar structures (multilamellar and unilamellar vesicles) and bile acid-mixed micelles. These fractions were isolated by ultracentrifugation from human hepatic bile, normal rat bile and bile of rats treated with diosgenin, a steroid that induces a marked increase in biliary cholesterol secretion, and were characterized by density, lipid composition and transmission electron microscopy. These studies demonstrate that alkaline phosphatase, 5'-nucleotidase and gamma-glutamyl transpeptidase are secreted into both human and rat bile where they are preferentially associated with bile acid-mixed micelles, suggesting a role for bile acids in both release of these enzymes and lipids from the canalicular membrane and solubilization in bile. In addition, heterogeneous association of these enzymes with nonmicellar, lamellar structures in human and rat bile is consistent with the hypothesis that processes independent of the detergent effects of bile acids might also result in the release of specific intrinsic membrane proteins into bile.
Riccardi, Caterina M; Cole, Kyle S; Benson, Kyle R; Ward, Jessamyn R; Bassett, Kayla M; Zhang, Yiren; Zore, Omkar V; Stromer, Bobbi; Kasi, Rajeswari M; Kumar, Challa V
2014-08-20
Several key properties of catalase such as thermal stability, resistance to protease degradation, and resistance to ascorbate inhibition were improved, while retaining its structure and activity, by conjugation to poly(acrylic acid) (PAA, Mw 8000) via carbodiimide chemistry where the amine groups on the protein are appended to the carboxyl groups of the polymer. Catalase conjugation was examined at three different pH values (pH 5.0, 6.0, and 7.0) and at three distinct mole ratios (1:100, 1:500, and 1:1000) of catalase to PAA at each reaction pH. The corresponding products are labeled as Cat-PAA(x)-y, where x is the protein to polymer mole ratio and y is the pH used for the synthesis. The coupling reaction consumed about 60-70% of the primary amines on the catalase; all samples were completely water-soluble and formed nanogels, as evidenced by gel electrophoresis and electron microscopy. The UV circular dichroism (CD) spectra indicated substantial retention of protein secondary structure for all samples, which increased to 100% with increasing pH of the synthesis and polymer mole fraction. Soret CD bands of all samples indicated loss of ∼50% of band intensities, independent of the reaction pH. Catalytic activities of the conjugates increased with increasing synthesis pH, where 55-80% and 90-100% activity was retained for all samples synthesized at pH 5.0 and pH 7.0, respectively, and the Km or Vmax values of Cat-PAA(100)-7 did not differ significantly from those of the free enzyme. All conjugates synthesized at pH 7.0 were thermally stable even when heated to ∼85-90 °C, while native catalase denatured between 55 and 65 °C. All conjugates retained 40-90% of their original activities even after storing for 10 weeks at 8 °C, while unmodified catalase lost all of its activity within 2 weeks, under similar storage conditions. Interestingly, PAA surrounding catalase limited access to the enzyme from large molecules like proteases and significantly increased
Regulation of aflatoxin biosynthesis: effect of glucose on activities of various glycolytic enzymes.
Buchanan, R L; Lewis, D F
1984-01-01
Catabolism of carbohydrates has been implicated in the regulation of aflatoxin synthesis. To characterize this effect further, the activities of various enzymes associated with glucose catabolism were determined in Aspergillus parasiticus organisms that were initially cultured in peptone-mineral salts medium and then transferred to glucose-mineral salts and peptone-mineral salts media. After an initial increase in activity, the levels of glucose 6-phosphate dehydrogenase, mannitol dehydrogenase, and malate dehydrogenase were lowered in the presence of glucose. Phosphofructokinase activity was greater in the peptone-grown mycelium, but fructose diphosphatase was largely unaffected by carbon source. Likewise, carbon source had relatively little effect on the activities of pyruvate kinase, malic enzyme, isocitrate-NADP dehydrogenase, and isocitrate-NAD dehydrogenase. The results suggest that glucose may, in part, regulate aflatoxin synthesis via a carbon catabolite repression of NADPH-generating and tricarboxylic acid cycle enzymes. PMID:6091545
Inoue, Shinjiro; Okita, Yoichi; de Toledo, Andreia; Miyazaki, Hiroyuki; Hirano, Eiichi; Morinaga, Tetsuo
2015-01-01
We purified pyroglutamic acid from human placental extract and identified it as a potent stimulator of rat primary hepatocyte DNA synthesis. Pyroglutamic acid dose-dependently stimulated DNA synthesis, and this effect was inhibited by PD98059, a dual specificity mitogen-activated protein kinase kinase 1 (MAP2K1) inhibitor. Therefore, pyroglutamic acid stimulated DNA synthesis in rat primary hepatocytes via MAPK signaling.
Martínez-Gómez, A I; Andújar-Sánchez, M; Clemente-Jiménez, J M; Neira, J L; Rodríguez-Vico, F; Martínez-Rodríguez, S; Las Heras-Vázquez, F J
2011-11-01
The availability of enzymes with a high promiscuity/specificity relationship permits the hydrolysis of several substrates with a view to obtaining a certain product or using one enzyme for several productive lines. N-Carbamoyl-β-alanine amidohydrolase from Agrobacterium tumefaciens (Atβcar) has shown high versatility to hydrolyze different N-carbamoyl-, N-acetyl- and N-formyl-amino acids to produce different α, β, γ and δ amino acids. We have calculated the promiscuity index for the enzyme, obtaining a value of 0.54, which indicates that it is a modestly promiscuous enzyme. Atβcar presented the highest probability of hydrolysis for N-carbamoyl-amino acids, being the enzyme more efficient for the production of α-amino acids. We have also demonstrated by mutagenesis, modelling, kinetic and binding experiments that W218 and A359 indirectly influence the plasticity of the enzyme due to interaction with the environment of R291, the key residue for catalytic activity. Copyright © 2011 Elsevier B.V. All rights reserved.
Myrtle, J D; Beekman, A M; Barrow, R A
2016-09-21
A new antibiotic natural product, ravynic acid, has been isolated from a Penicillium sp. of fungus, collected from Ravensbourne National Park. The 3-acylpolyenyne tetramic acid structure was definitively elucidated via synthesis. Highlights of the synthetic method include the heat induced formation of the 3-acylphosphorane tetramic acid and a selective Wittig cross-coupling to efficiently prepare the natural compounds carbon skeleton. The natural compound was shown to inhibit the growth of Staphylococcus aureus down to concentrations of 2.5 µg mL(-1).
Huber, Donald J.; Lee, James H.
1988-01-01
Isolated cell wall from tomato (Lycopersicon esculentum Mill. cv Rutgers) fruit released polymeric (degree of polymerization [DP] > 8), oligomeric, and monomeric uronic acids in a reaction mediated by bound polygalacturonase (PG) (EC 3.2.1.15). Wall autolytic capacity increased with ripening, reflecting increased levels of bound PG; however, characteristic oligomeric and monomeric products were recovered from all wall isolates exhibiting net pectin release. The capacity of wall from fruit at early ripening (breaker, turning) to generate oligomeric and monomeric uronic acids was attributed to the nonuniform ripening pattern of the tomato fruit and, consequently, a locally dense distribution of enzyme in wall originating from those fruit portions at more temporally advanced stages of ripening. Artificial autolytically active wall, prepared by permitting solubilized PG to bind to enzymically inactive wall from maturegreen fruit, released products which were similar in size characteristics to those recovered from active wall isolates. Extraction of wall-bound PG using high concentrations of NaCl (1.2 molar) did not attenuate subsequent autolytic activity but greatly suppressed the production of oligomeric and monomeric products. An examination of water-soluble uronic acids recovered from ripe pericarp tissue disclosed the presence of polymeric and monomeric uronic acids but only trace quantities of oligomers. The significance in autolytic reactions of enzyme quantity and distribution and their possible relevance to in vivo pectin degradation will be discussed. PMID:16666191
Duodenal prostaglandin synthesis and acid load in health and in duodenal ulcer disease
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ahlquist, D.A.; Dozois, R.R.; Zinsmeister, A.R.
1983-09-01
We sought to test the hypothesis that duodenal ulcer disease results from an imbalance between duodenal acid load, an injurious force, and mucosal prostaglandin generation, a protective factor. Ten patients with duodenal ulcer and 8 healthy controls were studied. The duodenal acid load after an amino acid soup was quantified by a double-marker technique. Mucosal biopsy specimens were taken endoscopically from the duodenal bulb before and after the test meal. Prostaglandin synthesis activity was measured by incubating biopsy homogenates in excess (/sup 14/C)arachidonic acid. Although mean duodenal acid load was higher in duodenal ulcer, ranges overlapped. Neither the qualitative normore » quantitative profile of mucosal prostaglandin synthesis activities differed significantly between test groups. Prostaglandin synthesis activities, however, tended to increase post cibum in controls, but change little or decrease in duodenal ulcer. Only by comparing the responses with a meal of both parameters together (duodenal acid load and the change in prostaglandin synthesis activities) was there complete or nearly complete separation of duodenal ulcer from controls. Greatest discrimination was observed with prostacyclin (6-keto-PGF1 alpha). We conclude that in health, mucosal prostaglandin generation in the duodenum is induced post cibum in relation to duodenal acid load; this may be a physiologic example of adaptive cytoprotection. In duodenal ulcer there may be a defect in such a mechanism.« less
Microbial degradation of poly(amino acid)s.
Obst, Martin; Steinbüchel, Alexander
2004-01-01
Natural poly(amino acid)s are a group of poly(ionic) molecules (ionomers) with various biological functions and putative technical applications and play, therefore, an important role both in nature and in human life. Because of their biocompatibility and their synthesis from renewable resources, poly(amino acid)s may be employed for many different purposes covering a broad spectrum of medical, pharmaceutical, and personal care applications as well as the domains of agriculture and of environmental applications. Biodegradability is one important advantage of naturally occurring poly(amino acid)s over many synthetic polymers. The intention of this review is to give an overview about the enzyme systems catalyzing the initial steps in poly(amino acid) degradation. The focus is on the naturally occurring poly(amino acid)s cyanophycin, poly(epsilon-L-lysine) and poly(gamma-glutamic acid); but biodegradation of structurally related synthetic polyamides such as poly(aspartic acid) and nylons, which are known from various technical applications, is also included.
Fukuda, N; Ontko, J A
1984-08-01
In a series of experiments with male rat livers perfused with or without 5-tetradecyloxy-2-furoic acid (TOFA) in the presence and absence of oleate, the relationships between fatty acid synthesis, oxidation, and esterification from newly synthesized and exogenous fatty acid substrates have been examined. When livers from fed rats were perfused without exogenous fatty acid substrate, 20% of the triglyceride secreted was derived from de novo fatty acid synthesis. Addition of TOFA caused immediate and nearly complete inhibition of fatty acid synthesis, measured by incorporation of 3H2O into fatty acids. Concurrently, ketone body production increased 140% and triglyceride secretion decreased 84%. These marked reciprocal alterations in fatty acid synthesis and oxidation in the liver almost completely abolished the production of very low density lipoproteins (VLDL). Cholesterol synthesis was also depressed by TOFA, suggesting that this drug also inhibited lipid synthesis at a site other than acetyl-CoA carboxylase. When livers from fed rats were supplied with a continuous infusion of [1-14C]oleate as exogenous substrate, similar proportions, about 45-47%, of both ketone bodies and triglyceride in the perfusate were derived from the infused [1-14C]oleate. The production of ketone bodies was markedly increased by TOFA; the secretion of triglyceride and cholesterol were decreased. Altered conversion of [1-14C]oleate into these products occurred in parallel. While TOFA decreased esterification of oleate into triglyceride, incorporation of [1-14C]oleate into liver phospholipid was increased, indicating that TOFA also affected glycerolipid synthesis at the stage of diglyceride processing. The decreased secretion of triglyceride and cholesterol following TOFA treatment was localized almost exclusively in VLDL. The specific activities of 3H and of 14C fatty acids in triglyceride of the perfusate were greater than those of liver triglyceride, indicating preferential secretion of
Evolution of Abscisic Acid Synthesis and Signaling Mechanisms
Hauser, Felix; Waadt, Rainer; Schroeder, Julian I.
2011-01-01
The plant hormone abscisic acid (ABA) mediates seed dormancy, controls seedling development and triggers tolerance to abiotic stresses, including drought. Core ABA signaling components consist of a recently identified group of ABA receptor proteins of the PYRABACTIN RESISTANCE (PYR)/REGULATORY COMPONENT OF ABA RECEPTOR (RCAR) family that act as negative regulators of members of the PROTEIN PHOSPHATASE 2C (PP2C) family. Inhibition of PP2C activity enables activation of SNF1-RELATED KINASE 2 (SnRK2) protein kinases, which target downstream components, including transcription factors, ion channels and NADPH oxidases. These and other components form a complex ABA signaling network. Here, an in depth analysis of the evolution of components in this ABA signaling network shows that (i) PYR/RCAR ABA receptor and ABF-type transcription factor families arose during land colonization of plants and are not found in algae and other species, (ii) ABA biosynthesis enzymes have evolved to plant- and fungal-specific forms, leading to different ABA synthesis pathways, (iii) existing stress signaling components, including PP2C phosphatases and SnRK kinases, were adapted for novel roles in this plant-specific network to respond to water limitation. In addition, evolutionarily conserved secondary structures in the PYR/RCAR ABA receptor family are visualized. PMID:21549957
Suryawan, Agus; O’Connor, Pamela M. J.; Bush, Jill A.; Nguyen, Hanh V.
2009-01-01
The high efficiency of protein deposition during the neonatal period is driven by high rates of protein synthesis, which are maximally stimulated after feeding. In the current study, we examined the individual roles of amino acids and insulin in the regulation of protein synthesis in peripheral and visceral tissues of the neonate by performing pancreatic glucose–amino acid clamps in overnight-fasted 7-day-old pigs. We infused pigs (n = 8–12/group) with insulin at 0, 10, 22, and 110 ng kg−0.66 min−1 to achieve ~0, 2, 6 and 30 μU ml−1 insulin so as to simulate below fasting, fasting, intermediate, and fed insulin levels, respectively. At each insulin dose, amino acids were maintained at the fasting or fed level. In conjunction with the highest insulin dose, amino acids were also allowed to fall below the fasting level. Tissue protein synthesis was measured using a flooding dose of L-[4-3H] phenylalanine. Both insulin and amino acids increased fractional rates of protein synthesis in longissimus dorsi, gastrocnemius, masseter, and diaphragm muscles. Insulin, but not amino acids, increased protein synthesis in the skin. Amino acids, but not insulin, increased protein synthesis in the liver, pancreas, spleen, and lung and tended to increase protein synthesis in the jejunum and kidney. Neither insulin nor amino acids altered protein synthesis in the stomach. The results suggest that the stimulation of protein synthesis by feeding in most tissues of the neonate is regulated by the post-prandial rise in amino acids. However, the feeding-induced stimulation of protein synthesis in skeletal muscles is independently mediated by insulin as well as amino acids. PMID:18683020
By-products of electrochemical synthesis of suberic acid
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shirobokova, O.I.; Adamov, A.A.; Freidlin, G.N.
By-products of the electrochemical synthesis of dimethyl suberate from glutaric anhydride were studied. This is isolated by thermal dehydration of a mixture of lower dicarboxylic acids that are wastes from the production of adipic acid. To isolate the by-products, they used the methods of vacuum rectification and preparative gas-liquid chromatography, and for their identification, PMR, IR spectroscopy, gas-liquid chromatography, and other known physicochemical methods of investigation.
Orellana, Renán A; Jeyapalan, Asumthia; Escobar, Jeffery; Frank, Jason W; Nguyen, Hanh V; Suryawan, Agus; Davis, Teresa A
2007-11-01
In skeletal muscle of adults, sepsis reduces protein synthesis by depressing translation initiation and induces resistance to branched-chain amino acid stimulation. Normal neonates maintain a high basal muscle protein synthesis rate that is sensitive to amino acid stimulation. In the present study, we determined the effect of amino acids on protein synthesis in skeletal muscle and other tissues in septic neonates. Overnight-fasted neonatal pigs were infused with endotoxin (LPS, 0 and 10 microg.kg(-1).h(-1)), whereas glucose and insulin were maintained at fasting levels; amino acids were clamped at fasting or fed levels. In the presence of fasting insulin and amino acids, LPS reduced protein synthesis in longissimus dorsi (LD) and gastrocnemius muscles and increased protein synthesis in the diaphragm, but had no effect in masseter and heart muscles. Increasing amino acids to fed levels accelerated muscle protein synthesis in LD, gastrocnemius, masseter, and diaphragm. LPS stimulated protein synthesis in liver, lung, spleen, pancreas, and kidney in fasted animals. Raising amino acids to fed levels increased protein synthesis in liver of controls, but not LPS-treated animals. The increase in muscle protein synthesis in response to amino acids was associated with increased mTOR, 4E-BP1, and S6K1 phosphorylation and eIF4G-eIF4E association in control and LPS-infused animals. These findings suggest that amino acids stimulate skeletal muscle protein synthesis during acute endotoxemia via mTOR-dependent ribosomal assembly despite reduced basal protein synthesis rates in neonatal pigs. However, provision of amino acids does not further enhance the LPS-induced increase in liver protein synthesis.
Lipoic acid metabolism and mitochondrial redox regulation.
Solmonson, Ashley D; DeBerardinis, Ralph J
2017-11-30
Lipoic acid is an essential cofactor for mitochondrial metabolism and is synthesized de novo using intermediates from mitochondrial fatty acid synthesis type II, S-adenosylmethionine and iron-sulfur clusters. This cofactor is required for catalysis by multiple mitochondrial 2-ketoacid dehydrogenase complexes, including pyruvate dehydrogenase, alpha-ketoglutarate dehydrogenase, and branched-chain ketoacid dehydrogenase. Lipoic acid also plays a critical role in stabilizing and regulating these multi-enzyme complexes. Many of these dehydrogenases are regulated by reactive oxygen species, mediated through the disulfide bond of the prosthetic lipoyl moiety. Collectively, its functions explain why lipoic acid is required for cell growth, mitochondrial activity and coordination of fuel metabolism. Lipoic acid is an essential cofactor for mitochondrial metabolism and is synthesized de novo using intermediates from mitochondrial fatty acid synthesis type II, S-adenosylmethionine and iron-sulfur clusters. This cofactor is required for catalysis by multiple mitochondrial 2-ketoacid dehydrogenase complexes, including pyruvate dehydrogenase, alpha-ketoglutarate dehydrogenase, and branched-chain ketoacid dehydrogenase. Lipoic acid also plays a critical role in stabilizing and regulating these multi-enzyme complexes. Many of these dehydrogenases are regulated by reactive oxygen species, mediated through the disulfide bond of the prosthetic lipoyl moiety. Collectively, its functions explain why lipoic acid is required for cell growth, mitochondrial activity and coordination of fuel metabolism. Copyright © 2017, The American Society for Biochemistry and Molecular Biology.
Fatty acid synthesis in Escherichia coli
Knivett, V. A.; Cullen, Julia
1967-01-01
1. Fatty acid formation by cells of a strain of Escherichia coli has been studied in the exponential, post-exponential and stationary phases of growth. 2. During the exponential phase of growth, the metabolic quotient (mμmoles of fatty acid synthesized/mg. dry wt. of cells/hr.) for each fatty acid in the extractable lipid was constant. 3. The newly synthesized fatty acid mixtures produced during this phase contained hexadecanoic acid (41%), hexadecenoic acid (31%), octadecenoic acid (21%) and the C17-cyclopropane acid, methylenehexadecanoic acid (4%). 4. As the proportion of newly synthesized material increased, changes in the fatty acid composition of the cells during this period were towards this constant composition. 5. Abrupt changes in fatty acid synthesis occurred when exponential growth ceased. 6. In media in which glycerol, or SO42− or Mg2+, was growth-limiting there was a small accumulation of C17-cyclopropane acid in cells growing in the post-exponential phase of growth. 7. Where either NH4+ or PO43− was growth-limiting and there were adequate supplies of glycerol, Mg2+ and SO42−, there was a marked accumulation of C17-cyclopropane acid and C19-cyclopropane acid appeared. 8. Under appropriate conditions the metabolic quotient for C17-cyclopropane acid increased up to sevenfold at the end of exponential growth. Simultaneously the metabolic quotients of the other acids fell. 9. A mixture of glycerol, Mg2+ and SO42− stimulated cyclopropane acid formation in resting cells. PMID:5340364
Pelà, M; Del Zoppo, L; Allegri, L; Marzola, E; Ruzza, C; Calo, G; Perissutti, E; Frecentese, F; Salvadori, S; Guerrini, R
2014-07-01
The synthesis of non natural amino acid 2-amino-3,3,4-trimethyl-pentanoic acid (Ipv) ready for solid phase peptide synthesis has been developed. Copper (I) chloride Michael addition, followed by a Curtius rearrangement are the key steps for the lpv synthesis. The racemic valine/leucine chimeric amino acid was then successfully inserted in position 5 of neuropeptide S (NPS) and the diastereomeric mixture separated by reverse phase HPLC. The two diastereomeric NPS derivatives were tested for intracellular calcium mobilization using HEK293 cells stably expressing the mouse NPS receptor where they behaved as partial agonist and pure antagonist.
Vanillin formation from ferulic acid in Vanilla planifolia is catalysed by a single enzyme.
Gallage, Nethaji J; Hansen, Esben H; Kannangara, Rubini; Olsen, Carl Erik; Motawia, Mohammed Saddik; Jørgensen, Kirsten; Holme, Inger; Hebelstrup, Kim; Grisoni, Michel; Møller, Birger Lindberg
2014-06-19
Vanillin is a popular and valuable flavour compound. It is the key constituent of the natural vanilla flavour obtained from cured vanilla pods. Here we show that a single hydratase/lyase type enzyme designated vanillin synthase (VpVAN) catalyses direct conversion of ferulic acid and its glucoside into vanillin and its glucoside, respectively. The enzyme shows high sequence similarity to cysteine proteinases and is specific to the substitution pattern at the aromatic ring and does not metabolize caffeic acid and p-coumaric acid as demonstrated by coupled transcription/translation assays. VpVAN localizes to the inner part of the vanilla pod and high transcript levels are found in single cells located a few cell layers from the inner epidermis. Transient expression of VpVAN in tobacco and stable expression in barley in combination with the action of endogenous alcohol dehydrogenases and UDP-glucosyltransferases result in vanillyl alcohol glucoside formation from endogenous ferulic acid. A gene encoding an enzyme showing 71% sequence identity to VpVAN was identified in another vanillin-producing plant species Glechoma hederacea and was also shown to be a vanillin synthase as demonstrated by transient expression in tobacco.
Vanillin formation from ferulic acid in Vanilla planifolia is catalysed by a single enzyme
Gallage, Nethaji J.; Hansen, Esben H.; Kannangara, Rubini; Olsen, Carl Erik; Motawia, Mohammed Saddik; Jørgensen, Kirsten; Holme, Inger; Hebelstrup, Kim; Grisoni, Michel; Møller, Birger Lindberg
2014-01-01
Vanillin is a popular and valuable flavour compound. It is the key constituent of the natural vanilla flavour obtained from cured vanilla pods. Here we show that a single hydratase/lyase type enzyme designated vanillin synthase (VpVAN) catalyses direct conversion of ferulic acid and its glucoside into vanillin and its glucoside, respectively. The enzyme shows high sequence similarity to cysteine proteinases and is specific to the substitution pattern at the aromatic ring and does not metabolize caffeic acid and p-coumaric acid as demonstrated by coupled transcription/translation assays. VpVAN localizes to the inner part of the vanilla pod and high transcript levels are found in single cells located a few cell layers from the inner epidermis. Transient expression of VpVAN in tobacco and stable expression in barley in combination with the action of endogenous alcohol dehydrogenases and UDP-glucosyltransferases result in vanillyl alcohol glucoside formation from endogenous ferulic acid. A gene encoding an enzyme showing 71% sequence identity to VpVAN was identified in another vanillin-producing plant species Glechoma hederacea and was also shown to be a vanillin synthase as demonstrated by transient expression in tobacco. PMID:24941968
Ryan, Veronica H; Primiani, Christopher T; Rao, Jagadeesh S; Ahn, Kwangmi; Rapoport, Stanley I; Blanchard, Helene
2014-01-01
The polyunsaturated arachidonic and docosahexaenoic acids (AA and DHA) participate in cell membrane synthesis during neurodevelopment, neuroplasticity, and neurotransmission throughout life. Each is metabolized via coupled enzymatic reactions within separate but interacting metabolic cascades. AA and DHA pathway genes are coordinately expressed and underlie cascade interactions during human brain development and aging. The BrainCloud database for human non-pathological prefrontal cortex gene expression was used to quantify postnatal age changes in mRNA expression of 34 genes involved in AA and DHA metabolism. Expression patterns were split into Development (0 to 20 years) and Aging (21 to 78 years) intervals. Expression of genes for cytosolic phospholipases A2 (cPLA2), cyclooxygenases (COX)-1 and -2, and other AA cascade enzymes, correlated closely with age during Development, less so during Aging. Expression of DHA cascade enzymes was less inter-correlated in each period, but often changed in the opposite direction to expression of AA cascade genes. Except for the PLA2G4A (cPLA2 IVA) and PTGS2 (COX-2) genes at 1q25, highly inter-correlated genes were at distant chromosomal loci. Coordinated age-related gene expression during the brain Development and Aging intervals likely underlies coupled changes in enzymes of the AA and DHA cascades and largely occur through distant transcriptional regulation. Healthy brain aging does not show upregulation of PLA2G4 or PTGS2 expression, which was found in Alzheimer's disease.
Agrawal, A; Pandey, V C; Kumar, S; Sagar, P
1989-01-01
Entamoeba histolytica (NIH-200) secreted large amounts of acid phosphatase in its external environment when grown axenically in modified TPS-II medium. Fractionation by DEAE-cellulose chromatography of the precipitate obtained from the cell-free medium at 60% ammonium sulfate saturation yielded 3 distinct peaks of enzyme activity. The enzyme in all the peaks showed resistance to tartrate but was inhibited by fluoride, cupric chloride, ethylene diamine-tetra acetic acid, ammonium molybdate and cysteine; however, enzyme associated with different peaks differed in its polyacrylamide gel electrophoretic profiles and behavior towards concanavalin A.
Synthesis of L-ascorbic acid in the phloem
Hancock, Robert D; McRae, Diane; Haupt, Sophie; Viola, Roberto
2003-01-01
Background Although plants are the main source of vitamin C in the human diet, we still have a limited understanding of how plants synthesise L-ascorbic acid (AsA) and what regulates its concentration in different plant tissues. In particular, the enormous variability in the vitamin C content of storage organs from different plants remains unexplained. Possible sources of AsA in plant storage organs include in situ synthesis and long-distance transport of AsA synthesised in other tissues via the phloem. In this paper we examine a third possibility, that of synthesis within the phloem. Results We provide evidence for the presence of AsA in the phloem sap of a wide range of crop species using aphid stylectomy and histochemical approaches. The activity of almost all the enzymes of the primary AsA biosynthetic pathway were detected in phloem-rich vascular exudates from Cucurbita pepo fruits and AsA biosynthesis was demonstrated in isolated phloem strands from Apium graveolens petioles incubated with a range of precursors (D-glucose, D-mannose, L-galactose and L-galactono-1,4-lactone). Phloem uptake of D-[U-14C]mannose and L-[1-14C]galactose (intermediates of the AsA biosynthetic pathway) as well as L-[1-14C]AsA and L-[1-14C]DHA, was observed in Nicotiana benthamiana leaf discs. Conclusions We present the novel finding that active AsA biosynthesis occurs in the phloem. This process must now be considered in the context of mechanisms implicated in whole plant AsA distribution. This work should provoke studies aimed at elucidation of the in vivo substrates for phloem AsA biosynthesis and its contribution to AsA accumulation in plant storage organs. PMID:14633288
Zdraljevic, Stefan; Wagner, Drew; Cheng, Kevin; Ruohonen, Laura; Jäntti, Jussi; Penttilä, Merja; Resnekov, Orna
2013-01-01
Organic acids derived from engineered microbes can replace fossil-derived chemicals in many applications. Fungal hosts are preferred for organic acid production because they tolerate lignocellulosic hydrolysates and low pH, allowing economic production and recovery of the free acid. However, cell death caused by cytosolic acidification constrains productivity. Cytosolic acidification affects cells asynchronously, suggesting that there is an underlying cell-to-cell heterogeneity in acid productivity and/or in resistance to toxicity. We used fluorescence microscopy to investigate the relationship between enzyme concentration, cytosolic pH, and viability at the single-cell level in Saccharomyces cerevisiae engineered to synthesize xylonic acid. We found that cultures producing xylonic acid accumulate cells with cytosolic pH below 5 (referred to here as “acidified”). Using live-cell time courses, we found that the probability of acidification was related to the initial levels of xylose dehydrogenase and sharply increased from 0.2 to 0.8 with just a 60% increase in enzyme abundance (Hill coefficient, >6). This “switch-like” relationship likely results from an enzyme level threshold above which the produced acid overwhelms the cell's pH buffering capacity. Consistent with this hypothesis, we showed that expression of xylose dehydrogenase from a chromosomal locus yields ∼20 times fewer acidified cells and ∼2-fold more xylonic acid relative to expression of the enzyme from a plasmid with variable copy number. These results suggest that strategies that further reduce cell-to-cell heterogeneity in enzyme levels could result in additional gains in xylonic acid productivity. Our results demonstrate a generalizable approach that takes advantage of the cell-to-cell variation of a clonal population to uncover causal relationships in the toxicity of engineered pathways. PMID:24038690
Fang, B; Zhang, M; Ge, K S; Xing, H Z; Ren, F Z
2018-06-01
Previous studies have demonstrated that the anti-tumor α-lactalbumin-oleic acid complex (α-LA-OA) may target the glycolysis of tumor cells. However, few data are available regarding the effects of α-LA-OA on energy metabolism. In this study, we measured glycolysis and mitochondrial functions in HeLa cells in response to α-LA-OA using the XF flux analyzer (Seahorse Bioscience, North Billerica, MA). The gene expression of enzymes involved in glycolysis, tricarboxylic acid cycle, electron transfer chain, and ATP synthesis were also evaluated. Our results show that α-LA-OA significantly enhanced the basal glycolysis and glycolytic capacity. Mitochondrial oxidative phosphorylation, including the basal respiration, maximal respiration, spare respiratory capacity and ATP production were also improved in response to α-LA-OA. The enhanced mitochondrial functions maybe partly due to the increased capacity of utilizing fatty acids and glutamine as the substrate. However, the gene expressions of pyruvate kinase M2, lactate dehydrogenase A, aconitate hydratase, and isocitrate dehydrogenase 1 were inhibited, suggesting an insufficient ability for the glycolysis process and the tricarboxylic acid cycle. The increased expression of acetyl-coenzyme A acyltransferase 2, a central enzyme involved in the β-oxidation of fatty acids, would enhance the unbalance due to the decreased expression of electron transfer flavoprotein β subunit, which acts as the electron acceptor. These results indicated that α-LA-OA may induce oxidative stress due to conditions in which the ATP production is exceeding the energy demand. Our results may help clarify the mechanism of apoptosis induced by reactive oxygen species and mitochondrial destruction. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Persson, H; Pelto-Huikko, M; Metsis, M; Söder, O; Brene, S; Skog, S; Hökfelt, T; Ritzén, E M
1990-09-01
The gene encoding glutamic acid decarboxylase (GAD), the key enzyme in the synthesis of the inhibitory neurotransmitter gamma-aminobutyric acid, is shown to be expressed in the testis of several different species. Nucleotide sequence analysis of a cDNA clone isolated from the human testis confirmed the presence of GAD mRNA in the testis. The major GAD mRNA in the testis was 2.5 kilobases. Smaller amounts of a 3.7-kilobase mRNA with the same size as GAD mRNA in the brain was also detected in the testis. In situ hybridization using a GAD-specific probe revealed GAD mRNA expressing spermatocytes and spermatids located in the middle part of rat seminiferous tubules. Studies on the ontogeny of GAD mRNA expression showed low levels of GAD mRNA in testes of prepubertal rats, with increasing levels as sexual maturation is reached, compatible with GAD mRNA expression in germ cells. In agreement with this, fractionation of cells from the rat seminiferous epithelium followed by Northern (RNA) blot analysis showed the highest levels of GAD mRNA associated with spermatocytes and spermatids. Evidence for the presence of GAD protein in the rat testis was obtained from the demonstration of GAD-like immunoreactivity in seminiferous tubules, predominantly at a position where spermatids and spermatozoa are found. Furthermore, GAD-like immunoreactivity was seen in the midpiece of ejaculated human spermatozoa, the part that is responsible for generating energy for spermatozoan motility.
Persson, H; Pelto-Huikko, M; Metsis, M; Söder, O; Brene, S; Skog, S; Hökfelt, T; Ritzén, E M
1990-01-01
The gene encoding glutamic acid decarboxylase (GAD), the key enzyme in the synthesis of the inhibitory neurotransmitter gamma-aminobutyric acid, is shown to be expressed in the testis of several different species. Nucleotide sequence analysis of a cDNA clone isolated from the human testis confirmed the presence of GAD mRNA in the testis. The major GAD mRNA in the testis was 2.5 kilobases. Smaller amounts of a 3.7-kilobase mRNA with the same size as GAD mRNA in the brain was also detected in the testis. In situ hybridization using a GAD-specific probe revealed GAD mRNA expressing spermatocytes and spermatids located in the middle part of rat seminiferous tubules. Studies on the ontogeny of GAD mRNA expression showed low levels of GAD mRNA in testes of prepubertal rats, with increasing levels as sexual maturation is reached, compatible with GAD mRNA expression in germ cells. In agreement with this, fractionation of cells from the rat seminiferous epithelium followed by Northern (RNA) blot analysis showed the highest levels of GAD mRNA associated with spermatocytes and spermatids. Evidence for the presence of GAD protein in the rat testis was obtained from the demonstration of GAD-like immunoreactivity in seminiferous tubules, predominantly at a position where spermatids and spermatozoa are found. Furthermore, GAD-like immunoreactivity was seen in the midpiece of ejaculated human spermatozoa, the part that is responsible for generating energy for spermatozoan motility. Images PMID:1697032
Pore-expanded SBA-15 sulfonic acid silicas for biodiesel synthesis.
Dacquin, J P; Lee, A F; Pirez, C; Wilson, K
2012-01-07
Here we present the first application of pore-expanded SBA-15 in heterogeneous catalysis. Pore expansion over the range 6-14 nm confers a striking activity enhancement towards fatty acid methyl ester (FAME) synthesis from triglycerides (TAG), and free fatty acid (FFA), attributed to improved mass transport and acid site accessibility. This journal is © The Royal Society of Chemistry 2012
Synthesis of acid-soluble spore proteins by Bacillus subtilis.
Leventhal, J M; Chambliss, G H
1982-12-01
The major acid-soluble spore proteins (ASSPs) of Bacillus subtilis were detected by immunoprecipitation of radioactively labeled in vitro- and in vivo-synthesized proteins. ASSP synthesis in vivo began 2 h after the initiation of sporulation (t2) and reached its maximum rate at t7. This corresponded to the time of synthesis of mRNA that stimulated the maximum rate of ASSP synthesis in vitro. Under the set of conditions used in these experiments, protease synthesis began near t0, alkaline phosphatase synthesis began at about t2, and refractile spores were first observed between t7 and t8. In vivo- and in vitro-synthesized ASSPs comigrated in sodium dodecyl sulfate-polyacrylamide gels. Their molecular weights were 4,600 (alpha and beta) and 11,000 (gamma). The average half-life of the ASSP messages was 11 min when either rifampin (10 micrograms/ml) or actinomycin D (1 microgram/ml) was used to inhibit RNA synthesis.
NASA Astrophysics Data System (ADS)
Botta, Lorenzo; Mattia Bizzarri, Bruno; Piccinino, Davide; Fornaro, Teresa; Robert Brucato, John; Saladino, Raffaele
2017-07-01
The photochemical transformation of formamide in the presence of a mixture of TiO2 and ZnO metal oxides as catalysts afforded a large panel of molecules of biological relevance, including carboxylic acids, amino acids and nucleic acid bases. The reaction was less effective when performed in the presence of only one mineral, highlighting the role of synergic effects between the photoactive catalysts. Taken together, these results suggest that the synthesis of chemical precursors for both the genetic and the metabolic apparatuses might have occurred in a simple environment, consisting of formamide, photoactive metal oxides and UV-radiation.
mRNA levels of enzymes and receptors implicated in arachidonic acid metabolism in gliomas.
De Armas, Rafael; Durand, Karine; Guillaudeau, Angélique; Weinbreck, Nicolas; Robert, Sandrine; Moreau, Jean-Jacques; Caire, François; Acosta, Gisela; Pebet, Matias; Chaunavel, Alain; Marin, Benoît; Labrousse, François; Denizot, Yves
2010-07-01
Gliomas are tumors of the central nervous system derived from glial cells. They show cellular heterogeneity and lack specific diagnostic markers. Although a possible role for the eicosanoid cascade has been suggested in glioma tumorigenesis, the relationship between enzymes and receptors implicated in arachidonic acid metabolism, with histological tumor type has not yet been determined. Quantitative real-time reverse transcription-polymerase chain reaction was performed to measure and compare transcript levels of enzymes and receptors implicated in both lipoxygenase and cyclooxygenase pathways between oligodendrogliomas, astrocytomas, glioblastomas and mixed oligoastrocytomas. Arachidonic acid metabolism-related enzymes and receptor transcripts (i) were underexpressed in classical oligodendrogliomas compared to astrocytomas and/or glioblastomas, (ii) differed between astrocytomas and glioblastomas and (iii) had an intermediate expression in mixed oligoastrocytomas. mRNA levels of enzymes and receptors implicated both in lipoxygenase and cyclooxygenase pathways differed significantly in gliomas according to the histological type. Copyright 2010 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hung,M.; Rangarajan, E.; Munger, C.
2006-01-01
Enterobacterial common antigen (ECA) is a polysaccharide found on the outer membrane of virtually all gram-negative enteric bacteria and consists of three sugars, N-acetyl-D-glucosamine, N-acetyl-D-mannosaminuronic acid, and 4-acetamido-4,6-dideoxy-D-galactose, organized into trisaccharide repeating units having the sequence {yields}(3)-{alpha}-D-Fuc4NAc-(1{yields}4)-{beta}-D-ManNAcA-(1{yields}4)-{alpha}-D-GlcNAc-(1{yields}). While the precise function of ECA is unknown, it has been linked to the resistance of Shiga-toxin-producing Escherichia coli (STEC) O157:H7 to organic acids and the resistance of Salmonella enterica to bile salts. The final step in the synthesis of 4-acetamido-4,6-dideoxy-D-galactose, the acetyl-coenzyme A (CoA)-dependent acetylation of the 4-amino group, is carried out by TDP-fucosamine acetyltransferase (WecD). We have determined the crystal structuremore » of WecD in apo form at a 1.95-Angstroms resolution and bound to acetyl-CoA at a 1.66-Angstroms resolution. WecD is a dimeric enzyme, with each monomer adopting the GNAT N-acetyltransferase fold, common to a number of enzymes involved in acetylation of histones, aminoglycoside antibiotics, serotonin, and sugars. The crystal structure of WecD, however, represents the first structure of a GNAT family member that acts on nucleotide sugars. Based on this cocrystal structure, we have used flexible docking to generate a WecD-bound model of the acetyl-CoA-TDP-fucosamine tetrahedral intermediate, representing the structure during acetyl transfer. Our structural data show that WecD does not possess a residue that directly functions as a catalytic base, although Tyr208 is well positioned to function as a general acid by protonating the thiolate anion of coenzyme A.« less
MurD enzymes: some recent developments.
Šink, Roman; Barreteau, Hélène; Patin, Delphine; Mengin-Lecreulx, Dominique; Gobec, Stanislav; Blanot, Didier
2013-12-01
The synthesis of the peptide stem of bacterial peptidoglycan involves four enzymes, the Mur ligases (MurC, D, E and F). Among them, MurD is responsible for the ATP-dependent addition of d-glutamic acid to UDP-MurNAc-l-Ala, a reaction which involves acyl-phosphate and tetrahedral intermediates. Like most enzymes of peptidoglycan biosynthesis, MurD constitutes an attractive target for the design and synthesis of new antibacterial agents. Escherichia coli MurD has been the first Mur ligase for which the tridimensional (3D) structure was solved. Thereafter, several co-crystal structures with different ligands or inhibitors were released. In the present review, we will deal with work performed on substrate specificity, reaction mechanism and 3D structure of E. coli MurD. Then, a part of the review will be devoted to recent work on MurD orthologs from species other than E. coli and to cellular organization of Mur ligases and in vivo regulation of the MurD activity. Finally, we will review the different classes of MurD inhibitors that have been designed and assayed to date with the hope of obtaining new antibacterial compounds.
Amino Acid Synthesis in Seafloor Environments on Icy Worlds
NASA Astrophysics Data System (ADS)
Flores, Erika; Barge, Laura; VanderVelde, David; Kallas, Kayo; Baum, Marc M.; Russell, Michael J.; Kanik, Isik
2016-10-01
In 2005, the Cassini mission detected plumes erupting from Enceladus' surface, containing carbon dioxide, methane, silica, and possibly ammonia. Subsequent laboratory experiments indicated that the silica particles in the plumes were generated under alkaline conditions and at moderate temperatures of ~90°C (Hsu et al., 2015); one scenario for such conditions would be the existence of alkaline (serpentinization-driven) hydrothermal activity within Enceladus. Alkaline vents are significant since they have been proposed as a likely environment for the emergence of metabolism on the early Earth (Russell et al. 2014) and thus could also provide a mechanism for origin of life on ocean worlds with a water-rock interface. Alkaline vents in an acidic, iron-containing ocean could produce mineral precipitates that could act as primitive enzymes or catalysts mediating organic reactions; for example, metal sulfides can catalyze the reductive amination of pyruvate to alanine (Novikov and Copley 2013). We have conducted experiments testing the synthesis of amino acids catalyzed by other iron minerals that might be expected to precipitate on the seafloor of early Earth or Enceladus. Preliminary results indicate that amino acids as well as other organic products can be synthesized in 1-3 days under alkaline hydrothermal conditions. We also find that the yield and type of organic products is highly dependent on pH and temperature, implying that understanding the specifics of the geochemical hydrothermal gradients on Enceladus (or other ocean worlds) will be significant in determining their potential for synthesizing building blocks for life.Hsu, H.-W. et al. (2015), Nature 519, 207-210.Russell, M. J. et al. (2014), Astrobiology, 14, 308-43.Novikov Y. and Copley S. D. (2013) PNAS 110, 33, 13283-13288.
Regulation of Intestinal Mucosal Growth by Amino Acids
Ray, Ramesh M.; Johnson, Leonard R.
2013-01-01
Amino acids, especially glutamine (GLN) have been known for many years to stimulate the growth of small intestinal mucosa. Polyamines are also required for optimal mucosal growth, and the inhibition of ornithine decarboxylase (ODC), the first rate-limiting enzyme in polyamine synthesis, blocks growth. Certain amino acids, primarily asparagine (ASN) and GLN stimulate ODC activity in a solution of physiological salts. More importantly, their presence is also required before growth factors and hormones such as EGF and insulin are able to increase ODC activity. ODC activity is inhibited by antizyme-1 (AZ) whose synthesis is stimulated by polyamines, thus, providing a negative feedback regulation of the enzyme. In the absence of amino acids mammalian target of rapamycin complex 1 (mTORC1) is inhibited, whereas, mTORC2 is stimulated leading to the inhibition of global protein synthesis but increasing the synthesis of AZ via a cap-independent mechanism. These data, therefore, explain why ASN or GLN is essential for the activation of ODC. Interestingly, in a number of papers, AZ has been shown to inhibit cell proliferation, stimulate apoptosis or increase autophagy. Each of these activities results in decreased cellular growth. AZ binds to and accelerates the degradation of ODC and other proteins shown to regulate proliferation and cell death, such as Aurora-A, Cyclin D1 and Smad1. The correlation between the stimulation of ODC activity and the absence of AZ as influenced by amino acids is high. Not only do amino acids such as ASN and GLN stimulate ODC while inhibiting AZ synthesis, but also amino acids such as lysine, valine and ornithine, which inhibit ODC activity, increase the synthesis of AZ. The question remaining to be answered is whether AZ inhibits growth directly or whether it acts by decreasing the availability of polyamines to the dividing cells. In either case, evidence strongly suggests that the regulation of AZ synthesis is the mechanism through which amino
Regulation of intestinal mucosal growth by amino acids.
Ray, Ramesh M; Johnson, Leonard R
2014-03-01
Amino acids, especially glutamine (GLN) have been known for many years to stimulate the growth of small intestinal mucosa. Polyamines are also required for optimal mucosal growth, and the inhibition of ornithine decarboxylase (ODC), the first rate-limiting enzyme in polyamine synthesis, blocks growth. Certain amino acids, primarily asparagine (ASN) and GLN stimulate ODC activity in a solution of physiological salts. More importantly, their presence is also required before growth factors and hormones such as epidermal growth factor and insulin are able to increase ODC activity. ODC activity is inhibited by antizyme-1 (AZ) whose synthesis is stimulated by polyamines, thus, providing a negative feedback regulation of the enzyme. In the absence of amino acids mammalian target of rapamycin complex 1 (mTORC1) is inhibited, whereas, mTORC2 is stimulated leading to the inhibition of global protein synthesis but increasing the synthesis of AZ via a cap-independent mechanism. These data, therefore, explain why ASN or GLN is essential for the activation of ODC. Interestingly, in a number of papers, AZ has been shown to inhibit cell proliferation, stimulate apoptosis, or increase autophagy. Each of these activities results in decreased cellular growth. AZ binds to and accelerates the degradation of ODC and other proteins shown to regulate proliferation and cell death, such as Aurora-A, Cyclin D1, and Smad1. The correlation between the stimulation of ODC activity and the absence of AZ as influenced by amino acids is high. Not only do amino acids such as ASN and GLN stimulate ODC while inhibiting AZ synthesis, but also amino acids such as lysine, valine, and ornithine, which inhibit ODC activity, increase the synthesis of AZ. The question remaining to be answered is whether AZ inhibits growth directly or whether it acts by decreasing the availability of polyamines to the dividing cells. In either case, evidence strongly suggests that the regulation of AZ synthesis is the
Effect of alpha lipoic acid on leukotriene A4 hydrolase.
Torres, María José; Fierro, Angélica; Pessoa-Mahana, C David; Romero-Parra, Javier; Cabrera, Gonzalo; Faúndez, Mario
2017-03-15
Leukotriene A 4 hydrolase is a soluble enzyme with epoxide hydrolase and aminopeptidase activities catalysing the conversion of leukotriene A 4 to leukotriene B 4 and the hydrolysis of the peptide proline-glycine-proline. Imbalances in leukotriene B 4 synthesis are related to several pathologic conditions. Currently there are no available drugs capable to modulate the synthesis of leukotriene B 4 or to block its receptors. Here we show the inhibitory profile of alpha lipoic acid on the activity of leukotriene A 4 Hydrolase. Alpha lipoic acid inhibited both activities of the enzyme at concentrations lower than 10μM. The 5-lipoxygenase inhibitor zileuton, or the 5-lipoxygenase activating protein inhibitor MK-886, were unable to inhibit the activity of the enzyme. Acute promyelocytic leukaemia HL-60 cells were differentiated to leukotriene A 4 hydrolase expressing neutrophil-like cells. Alpha lipoic acid inhibited the aminopeptidase activity of the cytosolic fraction from neutrophil-like cells but had no effect on the cytosolic fraction from undifferentiated cells. Docking and molecular dynamic approximations revealed that alpha lipoic acid participates in electrostatic interactions with K-565 and R-563, which are key residues for the carboxylate group recognition of endogenous substrates by the enzyme. Alpha lipoic acid is a compound widely used in clinical practice, most of its therapeutic effects are associated with its antioxidants properties, however, antioxidant effect alone is unable to explain all clinical effects observed with alpha lipoic acid. Our results invite to evaluate the significance of the inhibitory effect of alpha lipoic acid on the catalytic activity of leukotriene A 4 hydrolase using in vivo models. Copyright © 2017 Elsevier B.V. All rights reserved.
WRINKLED1 Rescues Feedback Inhibition of Fatty Acid Synthesis in Hydroxylase-Expressing Seeds1[OPEN
Browse, John
2016-01-01
Previous attempts at engineering Arabidopsis (Arabidopsis thaliana) to produce seed oils containing hydroxy fatty acids (HFA) have resulted in low yields of HFA compared with the native castor (Ricinus communis) plant and caused undesirable effects, including reduced total oil content. Recent studies have led to an understanding of problems involved in the accumulation of HFA in oils of transgenic plants, which include metabolic bottlenecks and a decrease in the rate of fatty acid synthesis. Focusing on engineering the triacylglycerol assembly mechanisms led to modest increases in the HFA content of seed oil, but much room for improvement still remains. We hypothesized that engineering fatty acid synthesis in the plastids to increase flux would facilitate enhanced total incorporation of fatty acids, including HFA, into seed oil. The transcription factor WRINKLED1 (WRI1) positively regulates the expression of genes involved in fatty acid synthesis and controls seed oil levels. We overexpressed Arabidopsis WRI1 in seeds of a transgenic line expressing the castor fatty acid hydroxylase. The proportion of HFA in the oil, the total HFA per seed, and the total oil content of seeds increased to an average of 20.9%, 1.26 µg, and 32.2%, respectively, across five independent lines, compared with 17.6%, 0.83 µg, and 27.9%, respectively, for isogenic segregants. WRI1 and WRI1-regulated genes involved in fatty acid synthesis were up-regulated, providing for a corresponding increase in the rate of fatty acid synthesis. PMID:27208047
Wilson, Fiona A; Suryawan, Agus; Orellana, Renán A; Nguyen, Hanh V; Jeyapalan, Asumthia S; Gazzaneo, Maria C; Davis, Teresa A
2008-10-01
Chronic somatotropin (pST) treatment in pigs increases muscle protein synthesis and circulating insulin, a known promoter of protein synthesis. Previously, we showed that the pST-mediated rise in insulin could not account for the pST-induced increase in muscle protein synthesis when amino acids were maintained at fasting levels. This study aimed to determine whether the pST-induced increase in insulin promotes skeletal muscle protein synthesis when amino acids are provided at fed levels and whether the response is associated with enhanced translation initiation factor activation. Growing pigs were treated with pST (0 or 180 microg x kg(-1) x day(-1)) for 7 days, and then pancreatic-glucose-amino acid clamps were performed. Amino acids were raised to fed levels in the presence of either fasted or fed insulin concentrations; glucose was maintained at fasting throughout. Muscle protein synthesis was increased by pST treatment and by amino acids (with or without insulin) (P<0.001). In pST-treated pigs, fed, but not fasting, amino acid concentrations further increased muscle protein synthesis rates irrespective of insulin level (P<0.02). Fed amino acids, with or without raised insulin concentrations, increased the phosphorylation of S6 kinase (S6K1) and eukaryotic initiation factor (eIF) 4E-binding protein 1 (4EBP1), decreased inactive 4EBP1.eIF4E complex association, and increased active eIF4E.eIF4G complex formation (P<0.02). pST treatment did not alter translation initiation factor activation. We conclude that the pST-induced stimulation of muscle protein synthesis requires fed amino acid levels, but not fed insulin levels. However, under the current conditions, the response to amino acids is not mediated by the activation of translation initiation factors that regulate mRNA binding to the ribosomal complex.
Latest development in the synthesis of ursodeoxycholic acid (UDCA): a critical review
Tonin, Fabio
2018-01-01
Ursodeoxycholic acid (UDCA) is a pharmaceutical ingredient widely used in clinics. As bile acid it solubilizes cholesterol gallstones and improves the liver function in case of cholestatic diseases. UDCA can be obtained from cholic acid (CA), which is the most abundant and least expensive bile acid available. The now available chemical routes for the obtainment of UDCA yield about 30% of final product. For these syntheses several protection and deprotection steps requiring toxic and dangerous reagents have to be performed, leading to the production of a series of waste products. In many cases the cholic acid itself first needs to be prepared from its taurinated and glycilated derivatives in the bile, thus adding to the complexity and multitude of steps involved of the synthetic process. For these reasons, several studies have been performed towards the development of microbial transformations or chemoenzymatic procedures for the synthesis of UDCA starting from CA or chenodeoxycholic acid (CDCA). This promising approach led several research groups to focus their attention on the development of biotransformations with non-pathogenic, easy-to-manage microorganisms, and their enzymes. In particular, the enzymatic reactions involved are selective hydrolysis, epimerization of the hydroxy functions (by oxidation and subsequent reduction) and the specific hydroxylation and dehydroxylation of suitable positions in the steroid rings. In this minireview, we critically analyze the state of the art of the production of UDCA by several chemical, chemoenzymatic and enzymatic routes reported, highlighting the bottlenecks of each production step. Particular attention is placed on the precursors availability as well as the substrate loading in the process. Potential new routes and recent developments are discussed, in particular on the employment of flow-reactors. The latter technology allows to develop processes with shorter reaction times and lower costs for the chemical and
Mi, Le; Qin, Dandan; Cheng, Jie; Wang, Dan; Li, Sha; Wei, Xuetuan
2017-03-01
Two engineered Escherichia coli strains, DQ101 (MG1655 fadD - )/pDQTES and DQ101 (MG1655 fadD - )/pDQTESZ were constructed to investigate the free fatty acid production using ionic liquid-based acid- or enzyme-catalyzed bamboo hydrolysate as carbon source in this study. The plasmid, pDQTES, carrying an acyl-ACP thioesterase 'TesA of E. coli in pTrc99A was constructed firstly, and then (3R)-hydroxyacyl-ACP dehydratase was ligated after the TesA to give the plasmid pDQTESZ. These two strains exhibited efficient fatty acid production when glucose was used as the sole carbon source, with a final concentration of 2.45 and 3.32 g/L, respectively. The free fatty acid production of the two strains on xylose is not as efficient as that on glucose, which was 2.32 and 2.96 g/L, respectively. For mixed sugars, DQ101 (MG1655 fadD - )-based strains utilized glucose and pentose sequentially under the carbon catabolite repression (CCR) regulation. The highest total FFAs concentration from the mixed sugar culture reached 2.81 g/L by DQ101 (MG1655 fadD - )/pDQTESZ. Furthermore, when ionic liquid-based enzyme-catalyzed bamboo hydrolysate was used as the carbon source, the strain DQ101 (MG1655 fadD - )/pDQTESZ could produce 1.23 g/L FFAs with a yield of 0.13 g/g, and while it just produced 0.65 g/L free fatty acid with the ionic liquid-based acid-catalyzed bamboo hydrolysate as the feedstock. The results suggested that enzymatic catalyzed bamboo hydrolysate with ionic liquid pretreatment could serve as an efficient feedstock for free fatty acid production.
Green synthesis of gold-chitosan nanocomposites for caffeic acid sensing.
Di Carlo, Gabriella; Curulli, Antonella; Toro, Roberta G; Bianchini, Chiara; De Caro, Tilde; Padeletti, Giuseppina; Zane, Daniela; Ingo, Gabriel M
2012-03-27
In this work, colloidal gold nanoparticles (AuNPs) stabilized into a chitosan matrix were prepared using a green route. The synthesis was carried out by reducing Au(III) to Au(0) in an aqueous solution of chitosan and different organic acids (i.e., acetic, malonic, or oxalic acid). We have demonstrated that by varying the nature of the acid it is possible to tune the reduction rate of the gold precursor (HAuCl(4)) and to modify the morphology of the resulting metal nanoparticles. The use of chitosan, a biocompatible and biodegradable polymer with a large number of amino and hydroxyl functional groups, enables the simultaneous synthesis and surface modification of AuNPs in one pot. Because of the excellent film-forming capability of this polymer, AuNPs-chitosan solutions were used to obtain hybrid nanocomposite films that combine highly conductive AuNPs with a large number of organic functional groups. Herein, Au-chitosan nanocomposites are successfully proposed as sensitive and selective electrochemical sensors for the determination of caffeic acid, an antioxidant that has recently attracted much attention because of its benefits to human health. A linear response was obtained over a wide range of concentration from 5.00 × 10(-8) M to 2.00 × 10(-3) M, and the limit of detection (LOD) was estimated to be 2.50 × 10(-8) M. Moreover, further analyses have demonstrated that a high selectivity toward caffeic acid can be achieved without interference from catechin or ascorbic acid (flavonoid and nonphenolic antioxidants, respectively). This novel synthesis approach and the high performances of Au-chitosan hybrid materials in the determination of caffeic acid open up new routes in the design of highly efficient sensors, which are of great interest for the analysis of complex matrices such as wine, soft drinks, and fruit beverages. © 2012 American Chemical Society
Structural analysis of Bacillus pumilus phenolic acid decarboxylase, a lipocalin-fold enzyme
DOE Office of Scientific and Technical Information (OSTI.GOV)
Matte, Allan; Grosse, Stephan; Bergeron, Hélène
The decarboxylation of phenolic acids, including ferulic and p-coumaric acids, to their corresponding vinyl derivatives is of importance in the flavoring and polymer industries. Here, the crystal structure of phenolic acid decarboxylase (PAD) from Bacillus pumilus strain UI-670 is reported. The enzyme is a 161-residue polypeptide that forms dimers both in the crystal and in solution. The structure of PAD as determined by X-ray crystallography revealed a -barrel structure and two -helices, with a cleft formed at one edge of the barrel. The PAD structure resembles those of the lipocalin-fold proteins, which often bind hydrophobic ligands. Superposition of structurally relatedmore » proteins bound to their cognate ligands shows that they and PAD bind their ligands in a conserved location within the -barrel. Analysis of the residue-conservation pattern for PAD-related sequences mapped onto the PAD structure reveals that the conservation mainly includes residues found within the hydrophobic core of the protein, defining a common lipocalin-like fold for this enzyme family. A narrow cleft containing several conserved amino acids was observed as a structural feature and a potential ligand-binding site.« less
Johansson, Annika; Möller, Christer; Fogh, Jens; Harper, Pauline
2003-01-01
Acute intermittent porphyria (AIP) is a genetic disorder caused by a deficiency of porphobilinogen deaminase (PBGD), the 3rd enzyme in heme synthesis. It is clinically characterized by acute attacks of neuropsychiatric symptoms and biochemically by increased urinary excretion of the porphyrin precursors porphobilinogen (PBG) and 5-aminolevulinic acid (ALA). A mouse model that is partially deficient in PBGD and biochemically mimics AIP after induction of the hepatic ALA synthase by phenobarbital was used in this study to identify the site of formation of the presumably toxic porphyrin precursors and study the effect of enzyme-replacement therapy by using recombinant human PBGD (rhPBGD). After 4 d of phenobarbital administration, high levels of PBG and ALA were found in liver, kidney, plasma, and urine of the PBGD-deficient mice. The administration of rhPBGD intravenously or subcutaneously after a 4-d phenobarbital induction was shown to lower the PBG level in plasma in a dose-dependent manner with maximal effect seen after 30 min and 2 h, respectively. Injection of rhPBGD subcutaneously twice daily during a 4-d phenobarbital induction reduced urinary PBG excretion to 25% of the levels found in PBGD-deficient mice administered with only phenobarbital. This study points to the liver as the main producer of PBG and ALA in the phenobarbital-induced PBGD-deficient mice and demonstrates efficient removal of accumulated PBG in plasma and urine by enzyme-replacement therapy. PMID:15208740
Synthesis of new Cα-tetrasubstituted α-amino acids
Grauer, Andreas A
2009-01-01
Summary Cα-Tetrasubstituted α-amino acids are important building blocks for the synthesis of peptidemimetics with stabilized secondary structure, because of their ability to rigidify the peptide backbone. Recently our group reported a new class of cyclic Cα-tetrasubstituted tetrahydrofuran α-amino acids prepared from methionine and aromatic aldehydes. We now report the extension of this methodology to aliphatic aldehydes. Although such aldehydes are prone to give aldol products under the reaction conditions used, we were able to obtain the target cyclic amino acids in low to moderate yields and in some cases with good diastereoselectivity. PMID:19259341
ERIC Educational Resources Information Center
Barrelle, M.; And Others
1983-01-01
Background information and procedures are provided for an experimental study on aminophenylacetic acid (phenylglycine). These include physical chemistry (determination of isoelectric point by pH measurement) and organic chemistry (synthesis of an amino acid in racemic form) experiments. (JN)
Zhang, Rui-Qin; Zhu, Hong-Hui; Zhao, Hai-Quan; Yao, Qing
2013-01-01
Arbuscular mycorrhizal fungi can increase the host resistance to pathogens via promoted phenolic synthesis, however, the signaling pathway responsible for it still remains unclear. In this study, in order to reveal the signaling molecules involved in this process, we inoculated Trifolium repense L. with an arbuscular mycorrhizal fungus (AMF), Glomus mosseae, and monitored the contents of phenolics and signaling molecules (hydrogen peroxide (H(2)O(2)), salicylic acid (SA), and nitric oxide (NO)) in roots, measured the activities of l-phenylalanine ammonia-lyase (PAL) and nitric oxide synthase (NOS), and the expression of pal and chs genes. Results demonstrated that AMF colonization promoted the phenolic synthesis, in parallel with the increase in related enzyme activity and gene expression. Meanwhile, the accumulation of all three signaling molecules was also up-regulated by AMF. This study suggested that AMF increased the phenolic synthesis in roots probably via signaling pathways of H(2)O(2), SA and NO in a signaling cascade. Copyright © 2012 Elsevier GmbH. All rights reserved.
Synthesis of Amino Acid Precursors with Organic Solids in Planetesimals with Liquid Water
NASA Technical Reports Server (NTRS)
Kebukawa, Y; Misawa, S.; Matsukuma, J.; Chan, Q. H. S.; Kobayashi, J.; Tachibana, S.; Zolensky, M. E.
2017-01-01
Amino acids are important ingredients of life that would have been delivered to Earth by extraterrestrial sources, e.g., comets and meteorites. Amino acids are found in aqueously altered carbonaceous chondrites in good part in the form of precursors that release amino acids after acid hydrolysis. Meanwhile, most of the organic carbon (greater than 70 weight %) in carbonaceous chondrites exists in the form of solvent insoluble organic matter (IOM) with complex macromolecular structures. Complex macromolecular organic matter can be produced by either photolysis of interstellar ices or aqueous chemistry in planetesimals. We focused on the synthesis of amino acids during aqueous alteration, and demonstrated one-pot synthesis of a complex suite of amino acids simultaneously with IOM via hydrothermal experiments simulating the aqueous processing
Dhar, Gautam; Sen, Suvajit; Chaudhuri, Gautam
2015-01-01
Aggressive cancers exhibit an efficient conversion of high amounts of glucose to lactate accompanied by acid secretion, a phenomenon popularly known as the Warburg effect. The acidic microenvironment and the alkaline cytosol create a proton-gradient (acid gradient) across the plasma membrane that represents proton-motive energy. Increasing experimental data from physiological relevant models suggest that acid gradient stimulates tumor proliferation, and can also support its energy needs. However, direct biochemical evidence linking extracellular acid gradient to generation of intracellular ATP are missing. In this work, we demonstrate that cancer cells can synthesize significant amounts of phosphate-bonds from phosphate in response to acid gradient across plasma membrane. The noted phenomenon exists in absence of glycolysis and mitochondrial ATP synthesis, and is unique to cancer. Biochemical assays using viable cancer cells, and purified plasma membrane vesicles utilizing radioactive phosphate, confirmed phosphate-bond synthesis from free phosphate (Pi), and also localization of this activity to the plasma membrane. In addition to ATP, predominant formation of pyrophosphate (PPi) from Pi was also observed when plasma membrane vesicles from cancer cells were subjected to trans-membrane acid gradient. Cancer cytosols were found capable of converting PPi to ATP, and also stimulate ATP synthesis from Pi from the vesicles. Acid gradient created through glucose metabolism by cancer cells, as observed in tumors, also proved critical for phosphate-bond synthesis. In brief, these observations reveal a role of acidic tumor milieu as a potential energy source and may offer a novel therapeutic target. PMID:25874623
Synthesis of novel acid electrolytes for phosphoric acid fuel cells
NASA Astrophysics Data System (ADS)
Adcock, James L.
1988-11-01
A 40 millimole per hour scale aerosol direct fluorination reactor was constructed. F-Methyl F-4-methoxybutanoate and F-4-methoxybutanoyl fluoride were synthesized by aerosol direct fluorination of methyl 4-methoxybutanoate. Basic hydrolysis of the perfluorinated derivatives produce sodium F-4 methoxybutanoate which was pyrolyzed to F-3-methoxy-1-propene. Purification and shipment of 33 grams of F-3-methoxy-1-propene followed. Syntheses by analogous methods allowed production and shipment of 5 grams of F-3-ethoxy 1-propene, 18 grams of F-3-(2-methoxy.ethoxy) 1-propene, and 37 grams of F-3,3-dimethyl 1-butene. Eighteen grams of F-2,2-dimethyl 1-chloropropane was produced directly and shipped. As suggested by other contractors, 5 grams of F-3-methoxy 1-iodopropane, and 5 grams of F-3-(2-methoxy.ethoxy) 1-iodopropane were produced by converting the respective precursor acid sodium salts produced for olefin synthesis to the silver salts and pyrolyzing them with iodine. Each of these compounds was prepared for the first time by the aerosol fluorination process during the course of the contract. These samples were provided to other Gas Research Institute (GRI) contractors for synthesis of perfluorinated sulfur (VI) and phosphorous (V) acids.
Channar, Pervaiz Ali; Saeed, Aamer; Larik, Fayaz Ali; Rafiq, Muhammad; Ashraf, Zaman; Jabeen, Farukh; Fattah, Tanzeela Abdul
2017-11-01
The present article describes the synthesis and enzyme inhibitory kinetics of methyl[2-(arylmethylene-hydrazono)-4-oxo-thiazolidin-5-ylidene]acetates 5a-j as mushroom tyrosinase inhibitors. The title compounds were synthesized via cyclocondensation of thiosemicarbazones 3a-j with dimethyl but-2-ynedioate (DMAD) 4 in good yields under solvent-free conditions. The synthesized compounds were evaluated for their potential to inhibit the activity of mushroom tyrosinase. It was unveiled that compounds 5i showed excellent enzyme inhibitory activity with IC 50 3.17µM while IC 50 of standard kojic acid is 15.91µM. The presence of heterocyclic pyridine ring in compound 5i play important role in enzyme inhibitory activity as rest of the functional groups are common in all synthesized compounds. The enzyme inhibitory kinetics of the most potent derivative 5i determined by Lineweaver-Burk plots and Dixon plots showed that it is non-competitive inhibitor with Ki value 1.5µM. It was further investigated that the wet lab results are in good agreement with the computational results. The molecular docking of the synthesized compounds was performed against tyrosinase protein (PDBID 2Y9X) to delineate ligand-protein interactions at molecular level. The docking results showed that the major interacting residues are His244, His85, His263, Val 283, His 296, Asn260, Val248, His260, His261 and Phe264 which are located in active binding site of the protein. The molecular modeling demonstrates that the oxygen atom of the compound 5i coordinated with the key residues in the active site of mushroom tyrosinase contribute significantly against inhibitory ability and diminishing the human melanin synthesis. These results evident that compound 5i is a lead structure in developing most potent mushroom tyrosinase inhibitors. Copyright © 2017 Elsevier Ltd. All rights reserved.
USDA-ARS?s Scientific Manuscript database
Lipoxygenases (LOX) constitute a family of lipid-peroxidizing enzymes catalyzing the oxidation of unsaturated fatty acid with (1Z,4Z)-pentadiene structural unit, leading to formation of the conjugated (Z,E)-hydroperoxydienoic acid. LOXs have been known to be widely distributed in plants and animals...
Intestinal triacylglycerol synthesis in fat absorption and systemic energy metabolism
Yen, Chi-Liang Eric; Nelson, David W.; Yen, Mei-I
2015-01-01
The intestine plays a prominent role in the biosynthesis of triacylglycerol (triglyceride; TAG). Digested dietary TAG is repackaged in the intestine to form the hydrophobic core of chylomicrons, which deliver metabolic fuels, essential fatty acids, and other lipid-soluble nutrients to the peripheral tissues. By controlling the flux of dietary fat into the circulation, intestinal TAG synthesis can greatly impact systemic metabolism. Genes encoding many of the enzymes involved in TAG synthesis have been identified. Among TAG synthesis enzymes, acyl-CoA:monoacylglycerol acyltransferase 2 and acyl-CoA:diacylglycerol acyltransferase (DGAT)1 are highly expressed in the intestine. Their physiological functions have been examined in the context of whole organisms using genetically engineered mice and, in the case of DGAT1, specific inhibitors. An emerging theme from recent findings is that limiting the rate of TAG synthesis in the intestine can modulate gut hormone secretion, lipid metabolism, and systemic energy balance. The underlying mechanisms and their implications for humans are yet to be explored. Pharmacological inhibition of TAG hydrolysis in the intestinal lumen has been employed to combat obesity and associated disorders with modest efficacy and unwanted side effects. The therapeutic potential of inhibiting specific enzymes involved in intestinal TAG synthesis warrants further investigation. PMID:25231105
Differential signatures of bacterial and mammalian IMP dehydrogenase enzymes.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, R.; Evans, G.; Rotella, F.
1999-06-01
IMP dehydrogenase (IMPDH) is an essential enzyme of de novo guanine nucleotide synthesis. IMPDH inhibitors have clinical utility as antiviral, anticancer or immunosuppressive agents. The essential nature of this enzyme suggests its therapeutic applications may be extended to the development of antimicrobial agents. Bacterial IMPDH enzymes show bio- chemical and kinetic characteristics that are different than the mammalian IMPDH enzymes, suggesting IMPDH may be an attractive target for the development of antimicrobial agents. We suggest that the biochemical and kinetic differences between bacterial and mammalian enzymes are a consequence of the variance of specific, identifiable amino acid residues. Identification ofmore » these residues or combination of residues that impart this mammalian or bacterial enzyme signature is a prerequisite for the rational identification of agents that specifically target the bacterial enzyme. We used sequence alignments of IMPDH proteins to identify sequence signatures associated with bacterial or eukaryotic IMPDH enzymes. These selections were further refined to discern those likely to have a role in catalysis using information derived from the bacterial and mammalian IMPDH crystal structures and site-specific mutagenesis. Candidate bacterial sequence signatures identified by this process include regions involved in subunit interactions, the active site flap and the NAD binding region. Analysis of sequence alignments in these regions indicates a pattern of catalytic residues conserved in all enzymes and a secondary pattern of amino acid conservation associated with the major phylogenetic groups. Elucidation of the basis for this mammalian/bacterial IMPDH signature will provide insight into the catalytic mechanism of this enzyme and the foundation for the development of highly specific inhibitors.« less
Jin, Junfei; Lu, Zhongyang; Li, Yanchun; Cowart, L. Ashley; Lopes-Virella, Maria F.
2018-01-01
It is well known that saturated fatty acids (SFAs) and unsaturated fatty acid, in particular omega-3 polyunsaturated fatty acids (n-3 PUFAs), have different effects on inflammatory signaling: SFAs are pro-inflammatory but n-3 PUFAs have strong anti-inflammatory properties. We have reported that palmitic acid (PA), a saturated fatty acid, robustly amplifies lipopolysaccharide (LPS) signaling to upregulate proinflammatory gene expression in macrophages. We also reported that the increased production of ceramide (CER) via sphingomyelin (SM) hydrolysis and CER de novo synthesis plays a key role in the synergistic effect of LPS and PA on proinflammatory gene expression. However, it remains unclear if n-3 PUFAs are capable of antagonizing the synergistic effect of LPS and PA on gene expression and CER production. In this study, we employed the above macrophage culture system and lipidomical analysis to assess the effect of n-3 PUFAs on proinflammatory gene expression and CER production stimulated by LPS and PA. Results showed that DHA strongly inhibited the synergistic effect of LPS and PA on proinflammatory gene expression by targeting nuclear factor kappa B (NFκB)-dependent gene transcription. Results also showed that DHA inhibited the cooperative effect of LPS and PA on CER production by targeting CER de novo synthesis, but not SM hydrolysis. Furthermore, results showed that myriocin, a specific inhibitor of serine palmitoyltransferase, strongly inhibited both LPS-PA-stimulated CER synthesis and proinflammatory gene expression, indicating that CER synthesis is associated with proinflammatory gene expression and that inhibition of CER synthesis contributes to DHA-inhibited proinflammatory gene expression. Taken together, this study demonstrates that DHA antagonizes the boosting effect of PA on LPS signaling on proinflammatory gene expression by targeting both NFκB-dependent transcription and CER de novo synthesis in macrophages. PMID:29474492
Jin, Junfei; Lu, Zhongyang; Li, Yanchun; Cowart, L Ashley; Lopes-Virella, Maria F; Huang, Yan
2018-01-01
It is well known that saturated fatty acids (SFAs) and unsaturated fatty acid, in particular omega-3 polyunsaturated fatty acids (n-3 PUFAs), have different effects on inflammatory signaling: SFAs are pro-inflammatory but n-3 PUFAs have strong anti-inflammatory properties. We have reported that palmitic acid (PA), a saturated fatty acid, robustly amplifies lipopolysaccharide (LPS) signaling to upregulate proinflammatory gene expression in macrophages. We also reported that the increased production of ceramide (CER) via sphingomyelin (SM) hydrolysis and CER de novo synthesis plays a key role in the synergistic effect of LPS and PA on proinflammatory gene expression. However, it remains unclear if n-3 PUFAs are capable of antagonizing the synergistic effect of LPS and PA on gene expression and CER production. In this study, we employed the above macrophage culture system and lipidomical analysis to assess the effect of n-3 PUFAs on proinflammatory gene expression and CER production stimulated by LPS and PA. Results showed that DHA strongly inhibited the synergistic effect of LPS and PA on proinflammatory gene expression by targeting nuclear factor kappa B (NFκB)-dependent gene transcription. Results also showed that DHA inhibited the cooperative effect of LPS and PA on CER production by targeting CER de novo synthesis, but not SM hydrolysis. Furthermore, results showed that myriocin, a specific inhibitor of serine palmitoyltransferase, strongly inhibited both LPS-PA-stimulated CER synthesis and proinflammatory gene expression, indicating that CER synthesis is associated with proinflammatory gene expression and that inhibition of CER synthesis contributes to DHA-inhibited proinflammatory gene expression. Taken together, this study demonstrates that DHA antagonizes the boosting effect of PA on LPS signaling on proinflammatory gene expression by targeting both NFκB-dependent transcription and CER de novo synthesis in macrophages.
Activation of olefins via asymmetric Bronsted acid catalysis
Tsuji, Nobuya; Kennemur, Jennifer L.; Buyck, Thomas; ...
2018-03-30
The activation of olefins for asymmetric chemical synthesis traditionally relies on transition metal catalysts. In contrast, biological enzymes with Bronsted acidic sites of appropriate strength can protonate olefins and thereby generate carbocations that ultimately react to form natural products. Although chemists have recently designed chiral Bronsted acid catalysts to activate imines and carbonyl compounds, mimicking these enzymes to protonate simple olefins that then engage in asymmetric catalytic reactions has remained a substantial synthetic challenge. Here, we show that a class of confined and strong chiral Bronsted acids enables the catalytic asymmetric intramolecular hydroalkoxylation of unbiased olefins. In conclusion, the methodologymore » gives rapid access to biologically active 1,1-disubstituted tetrahydrofurans, including (–)-Boivinianin A.« less
Activation of olefins via asymmetric Bronsted acid catalysis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tsuji, Nobuya; Kennemur, Jennifer L.; Buyck, Thomas
The activation of olefins for asymmetric chemical synthesis traditionally relies on transition metal catalysts. In contrast, biological enzymes with Bronsted acidic sites of appropriate strength can protonate olefins and thereby generate carbocations that ultimately react to form natural products. Although chemists have recently designed chiral Bronsted acid catalysts to activate imines and carbonyl compounds, mimicking these enzymes to protonate simple olefins that then engage in asymmetric catalytic reactions has remained a substantial synthetic challenge. Here, we show that a class of confined and strong chiral Bronsted acids enables the catalytic asymmetric intramolecular hydroalkoxylation of unbiased olefins. In conclusion, the methodologymore » gives rapid access to biologically active 1,1-disubstituted tetrahydrofurans, including (–)-Boivinianin A.« less
Moglia, Andrea; Acquadro, Alberto; Eljounaidi, Kaouthar; Milani, Anna M.; Cagliero, Cecilia; Rubiolo, Patrizia; Genre, Andrea; Cankar, Katarina; Beekwilder, Jules; Comino, Cinzia
2016-01-01
Globe artichoke (Cynara cardunculus L. var. scolymus) is a rich source of compounds promoting human health (phytonutrients), among them caffeoylquinic acids (CQAs), mainly represented by chlorogenic acid (CGA), and dicaffeoylquinic acids (diCQAs). The enzymes involved in their biosynthesis belong to the large family of BAHD acyltransferases. Following a survey of the globe artichoke genome, we identified 69 BAHD proteins carrying the catalytic site (HXXXD). Their phylogenetic analysis together with another 43 proteins, from 21 species, representative of the BAHD family, highlighted their grouping in seven major clades. Nine globe artichoke acyltransferases clustered in a sub-group of Clade V, with 3 belonging to hydroxycinnamoyl-CoA:quinate hydroxycinnamoyl transferase (HQT) and 2 to hydroxycinnamoyl-CoA:shikimate/quinate hydroxycinnamoyl transferase (HCT) like proteins. We focused our attention on the former, HQT1, HQT2, and HQT3, as they are known to play a key role in CGA biosynthesis. The expression of genes coding for the three HQTs and correlation of expression with the CQA content is reported for different globe artichoke tissues. For the first time in the globe artichoke, we developed and applied the virus-induced gene silencing approach with the goal of assessing in vivo the effect of HQT1 silencing, which resulted in a marked reduction of both CGA and diCQAs. On the other hand, when the role of the three HQTs was assessed in leaves of Nicotiana benthamiana through their transient overexpression, significant increases in mono- and diCQAs content were observed. Using transient GFP fusion proteins expressed in N. benthamiana leaves we also established the sub-cellular localization of these three enzymes. PMID:27721818
Synthesis and biological properties of enzyme-resistant analogues of substance P.
Sandberg, B E; Lee, C M; Hanley, M R; Iversen, L L
1981-02-01
Six analogues of substance P were synthesized with the aim of developing a metabolically stable peptide that would retain the biological activity of substance P. A recently isolated and characterized substance-P-degrading enzyme from human brain with a high specificity for substance P described in the preceding paper in this journal was used as a model for the enzymatic inactivation of substance P. The synthetic analogues were designed to protect the peptide bonds on the carboxyl side of residues 6, 7 and 8 of substance P, which represent the sites of cleavage by substance-P-degrading enzyme. To test for increased enzymatic resistance, the analogues were incubated with the enzyme, the digests were separated on a high-performance liquid chromatography reverse-phase column and the peptide fragments were collected and identified by amino acid analysis. Of the analogues described, an heptapeptide analogue of residues 5-11, less than Glu-Gln-Phe-MePhe-MeGly-Leu-MetNH2, showed almost complete resistance both towards substance-P-degrading enzyme and to degradation on exposure to rat hypothalamic slices. This analogue was about a third as potent as substance P in competing for binding to receptor sites for this peptide in rat brain membranes and a tenth as potent in eliciting contractions of the guinea pig ileum. The peptides were synthesized using the solid-phase technique with polydimethylacrylamide as a solid support and the coupling was achieved with pre-formed symmetrical anhydrides in dimethylacetamide. Fluorenylmethyloxycarbonyl was used as an alpha-amino protecting group in conjunction with t-butyloxycarbonyl as an epsilon-amino protecting group. Ammoniolytic cleavage from the resin was followed by stepwise elution from an SP-Sephadex column, deprotection with trifluoroacetic acid and chromatography on a Bio-Rex 70 ion-exchanger. The peptides were finally purified on a semi-preparative reverse-phase column.
Fernández-Escalada, Manuel; Zulet-González, Ainhoa; Gil-Monreal, Miriam; Zabalza, Ana; Ravet, Karl; Gaines, Todd; Royuela, Mercedes
2017-01-01
A key enzyme of the shikimate pathway, 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS; EC 2.5.1.19), is the known target of the widely used herbicide glyphosate. Glyphosate resistance in Amaranthus palmeri, one of the most troublesome weeds in agriculture, has evolved through increased EPSPS gene copy number. The aim of this work was to study the pleiotropic effects of (i) EPSPS increased transcript abundance due to gene copy number variation (CNV) and of (ii) glyphosate application on the aromatic amino acid (AAA) and branched chain amino acid (BCAA) synthesis pathways. Hydroponically grown glyphosate sensitive (GS) and glyphosate resistant (GR) plants were treated with glyphosate 3 days after treatment. In absence of glyphosate treatment, high EPSPS gene copy number had only a subtle effect on transcriptional regulation of AAA and BCAA pathway genes. In contrast, glyphosate treatment provoked a general accumulation of the transcripts corresponding to genes of the AAA pathway leading to synthesis of chorismate in both GS and GR. After chorismate, anthranilate synthase transcript abundance was higher while chorismate mutase transcription showed a small decrease in GR and remained stable in GS, suggesting a regulatory branch point in the pathway that favors synthesis toward tryptophan over phenylalanine and tyrosine after glyphosate treatment. This was confirmed by studying enzyme activities in vitro and amino acid analysis. Importantly, this upregulation was glyphosate dose dependent and was observed similarly in both GS and GR populations. Glyphosate treatment also had a slight effect on the expression of BCAA genes but no general effect on the pathway could be observed. Taken together, our observations suggest that the high CNV of EPSPS in A. palmeri GR populations has no major pleiotropic effect on the expression of AAA biosynthetic genes, even in response to glyphosate treatment. This finding supports the idea that the fitness cost associated with EPSPS CNV
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chander, A.; Gullo, J.; Reicherter, J.
1987-05-01
Regulation of phosphatidylcholine (PC) synthesis in rat granular pneumocytes isolated by tryptic digestion of lungs and maintained in primary culture for 24 h was investigated by following effects of exogenous fatty acids on (/sup 3/H-methyl)choline incorporation into PC and disaturated PC (DSPC). At 0.1 mM choline, the rate of choline incorporation into PC and DSPC was 440 +/- and 380 +/- 50 pmol/h/ug Pi (mean +/- SE, n=3-5), respectively, and was linear for up to 3 h. PC synthesis was significantly increased by 0.1 mM each of palmitic, oleic, linoleic, or linolenic acid. However, synthesis of DSPC was increased onlymore » by palmitic acid and this increase was prevented by addition of oleic acid suggesting lack of effect on the remodeling pathway. Pulse-chase experiments with choline in absence or presence of palmitic or oleic acid showed that the label declined in choline phosphate and increased in PC more rapidly in presence of either of the fatty acids, suggesting rapid conversion of choline phosphate to PC. Microsomal choline phosphate cytidyltransferase activity in cells preincubated without or with palmitic acid for 3 h was 0.81 +/- 0.07 and 1.81 +/- 0.09 nmol choline phosphate converted/min/mg protein (n=4). These results suggest that in granular pneumocytes, exogenous fatty acids modulate PC synthesis by increasing choline phosphate cytidyltransferase activity.« less
Savjani, Jignasa K; Mulamkattil, Suja; Variya, Bhavesh; Patel, Snehal
2017-04-15
Drug induced gastrointestinal ulceration, renal side effects and hepatotoxicity are the main causes of numerous Non-Steroidal Anti-inflammatory Drugs (NSAIDs). Cyclooxygenase-2 (COX-2) inhibitors discovered to decrease the gastrointestinal issues, but unfortunately, most of them are associated with major cardiovascular adverse effects. Along these lines, various new strategies and frameworks were developed wherein basic alterations of the present medications were accounted for. The aim of the study was to prepare derivatives of mefenamic acid to evaluate anti-inflammatory activity with fewer adverse reactions. In this study, molecular docking investigations of outlined derivatives were done utilizing Protein Data Bank (PDB ID-4PH9). Synthesis of heterocyclic compounds was carried out utilizing Dicyclohexylcarbodiimide/4-Dimethylaminopyridine (DCC/DMAP) coupling. Acute toxicity prediction was performed using free online GUSAR (General Unrestricted Structure-Activity Relationships) software. The study indicated most of the compounds under safe category. In-vitro pharmacological assessment of heterocyclic compounds was done for COX-1 and COX-2 enzymes for the determination of selectivity. In vivo pharmacological screening for anti-inflammatory activity and ED 50 value were determined utilizing carrageenan induced rat paw edema. Gastro intestinal safety study was carried out on selected compounds and found to be devoid of any gastric ulcer toxicity. Most of the compounds indicated high scores as compared to standard during molecular modelling, analysis and displayed interactions with active amino acids of a COX-2 enzyme. The pharmacological screening uncovered that compound substituted with p-bromophenyl indicated maximum potency. Copyright © 2017 Elsevier B.V. All rights reserved.
Li, Qing Kai; Liu, Ping; Tang, Zhao Hui; Zhao, Hai Jun; Wang, Jiang Tao; Song, Xiao Zong; Yang, Li; Wan, Shu Bo
2016-04-22
In order to investigate the relationship between the accumulation of phenolic acids in peanut continuous cropping soil and the continuous cropping obstacle of peanut, the effects of p-hydroxy benzoic acid and cinnamic acid on peanut root zone soil nutrients, soil enzyme activities and yield of peanut were studied by pot experiment at three stages of peanut, i.e. the pegging stage of peanut (45 days after seedling), the early podding (75 days after seedling) and the end of podding (105 days after seedling) stages. The results showed that the peanut root zone soil nutrients and enzyme activities changed obviously under the two phenolic acids treatment, especially at the pegging stage of peanut. The soil alkali-hydrolyzable nitrogen, available phosphorus, available potassium, and soil enzyme activities (urease, sucrose, neutral phosphatase) were decreased significantly. At the early and end of podding stages of peanut, the effects of the two phenolic acids on peanut root zone soil nutrients and soil enzyme activities were under a weakening trend. The allelopathy of cinnamic acid was stronger than that of p-hydroxy benzoic acid at the same initial content. The pod yield per pot was reduced by 45.9% and 52.8%, while the pod number of per plant was reduced by 46.2% and 48.9% at higher concentration (80 mg·kg -1 dry soil) of p-hydroxy benzoic acid and cinnamic acid treatments, respectively.
Assembly of Lipoic Acid on Its Cognate Enzymes: an Extraordinary and Essential Biosynthetic Pathway
2016-01-01
SUMMARY Although the structure of lipoic acid and its role in bacterial metabolism were clear over 50 years ago, it is only in the past decade that the pathways of biosynthesis of this universally conserved cofactor have become understood. Unlike most cofactors, lipoic acid must be covalently bound to its cognate enzyme proteins (the 2-oxoacid dehydrogenases and the glycine cleavage system) in order to function in central metabolism. Indeed, the cofactor is assembled on its cognate proteins rather than being assembled and subsequently attached as in the typical pathway, like that of biotin attachment. The first lipoate biosynthetic pathway determined was that of Escherichia coli, which utilizes two enzymes to form the active lipoylated protein from a fatty acid biosynthetic intermediate. Recently, a more complex pathway requiring four proteins was discovered in Bacillus subtilis, which is probably an evolutionary relic. This pathway requires the H protein of the glycine cleavage system of single-carbon metabolism to form active (lipoyl) 2-oxoacid dehydrogenases. The bacterial pathways inform the lipoate pathways of eukaryotic organisms. Plants use the E. coli pathway, whereas mammals and fungi probably use the B. subtilis pathway. The lipoate metabolism enzymes (except those of sulfur insertion) are members of PFAM family PF03099 (the cofactor transferase family). Although these enzymes share some sequence similarity, they catalyze three markedly distinct enzyme reactions, making the usual assignment of function based on alignments prone to frequent mistaken annotations. This state of affairs has possibly clouded the interpretation of one of the disorders of human lipoate metabolism. PMID:27074917
Early lignin pathway enzymes and routes to chlorogenic acid in switchgrass (Panicum virgatum L.).
Escamilla-Treviño, Luis L; Shen, Hui; Hernandez, Timothy; Yin, Yanbin; Xu, Ying; Dixon, Richard A
2014-03-01
Studying lignin biosynthesis in Panicum virgatum (switchgrass) has provided a basis for generating plants with reduced lignin content and increased saccharification efficiency. Chlorogenic acid (CGA, caffeoyl quinate) is the major soluble phenolic compound in switchgrass, and the lignin and CGA biosynthetic pathways potentially share intermediates and enzymes. The enzyme hydroxycinnamoyl-CoA: quinate hydroxycinnamoyltransferase (HQT) is responsible for CGA biosynthesis in tobacco, tomato and globe artichoke, but there are no close orthologs of HQT in switchgrass or in other monocotyledonous plants with complete genome sequences. We examined available transcriptomic databases for genes encoding enzymes potentially involved in CGA biosynthesis in switchgrass. The protein products of two hydroxycinnamoyl-CoA shikimate/quinate hydroxycinnamoyltransferase (HCT) genes (PvHCT1a and PvHCT2a), closely related to lignin pathway HCTs from other species, were characterized biochemically and exhibited the expected HCT activity, preferring shikimic acid as acyl acceptor. We also characterized two switchgrass coumaroyl shikimate 3'-hydroxylase (C3'H) enzymes (PvC3'H1 and PvC3'H2); both of these cytochrome P450s had the capacity to hydroxylate 4-coumaroyl shikimate or 4-coumaroyl quinate to generate caffeoyl shikimate or CGA. Another switchgrass hydroxycinnamoyl transferase, PvHCT-Like1, is phylogenetically distant from HCTs or HQTs, but exhibits HQT activity, preferring quinic acid as acyl acceptor, and could therefore function in CGA biosynthesis. The biochemical features of the recombinant enzymes, the presence of the corresponding activities in plant protein extracts, and the expression patterns of the corresponding genes, suggest preferred routes to CGA in switchgrass.
Synthesis and antituberculosis activity of new fatty acid amides.
D'Oca, Caroline Da Ros Montes; Coelho, Tatiane; Marinho, Tamara Germani; Hack, Carolina Rosa Lopes; Duarte, Rodrigo da Costa; da Silva, Pedro Almeida; D'Oca, Marcelo Gonçalves Montes
2010-09-01
This work reports the synthesis of new fatty acid amides from C16:0, 18:0, 18:1, 18:1 (OH), and 18:2 fatty acids families with cyclic and acyclic amines and demonstrate for the first time the activity of these compounds as antituberculosis agents against Mycobacterium tuberculosis H(37)Rv, M. tuberculosis rifampicin resistance (ATCC 35338), and M. tuberculosis isoniazid resistance (ATCC 35822). The fatty acid amides derivate from ricinoleic acid were the most potent one among a series of tested compounds, with a MIC 6.25 microg/mL for resistance strains. Copyright 2010 Elsevier Ltd. All rights reserved.
Dipeptide derivative synthesis catalyzed by Pseudomonas aeruginosa elastase.
Rival, S; Besson, C; Saulnier, J; Wallach, J
1999-02-01
Pseudomonas aeruginosa elastase was used to synthesize various N-protected dipeptide amides. The identity of the products was confirmed by FAB(+)-MS. After recrystallization, the yield of their synthesis was calculated, their purity was checked by RP-HPLC and their melting point was measured. With regard to the hydrolysis, it is well-established that the enzyme prefers hydrophobic amino acids in P'1 position and it has a wide specificity for the P1 position. This specificity was demonstrated to be quite unchanged when comparing the initial rates of peptide bond formation between different carboxyl donors (Z-aa) and nucleophiles (aa-NH2). The elastase, but not the thermolysin, was notably able to incorporate tyrosine and tryptophan in P'1 position. Furthermore, synthesis initial rates were at least 100 times faster with the elastase. To overcome the problematic condensation of some amino acids during chemical peptide synthesis, it has been previously suggested that enzymatic steps can combine with a chemical strategy. We demonstrated that the elastase readily synthesizes dipeptide derivatives containing various usual N-protecting groups. It was especially able to condense phenylalaninamide to Fmoc- and Boc-alanine. Increasing interest in peptides containing unnatural amino acids led us to try the elastase-catalyzed synthesis of Z-dipeptide amides including those amino acids in the P1 position. A synthesis was demonstrated with alphaAbu, Nle, Nva and Phg.
Tips on the analysis of phosphatidic acid by the fluorometric coupled enzyme assay.
Hassaninasab, Azam; Han, Gil-Soo; Carman, George M
2017-06-01
The fluorometric coupled enzyme assay to measure phosphatidic acid (PA) involves the solubilization of extracted lipids in Triton X-100, deacylation, and the oxidation of PA-derived glycerol-3-phosphate to produce hydrogen peroxide for conversion of Amplex Red to resorufin. The enzyme assay is sensitive, but plagued by high background fluorescence from the peroxide-containing detergent and incomplete heat inactivation of lipoprotein lipase. These problems affecting the assay reproducibility were obviated by the use of highly pure Triton X-100 and by sufficient heat inactivation of the lipase enzyme. The enzyme assay could accurately measure the PA content from the subcellular fractions of yeast cells. Copyright © 2017 Elsevier Inc. All rights reserved.
Pulmonary fatty acid synthesis. I. Mitochondrial acetyl transfer by rat lung in vitro.
Evans, R M; Scholz, R W
1977-04-01
Incorporation of tritiated water into fatty acids by rat adipose tissue and lung tissue slices incubated with 5 mM glucose indicated a level of fatty acid synthesis in rat lung approximately 15% that observed in adipose tissue in vitro. (-)-Hydroxycitrate, and inhibitor of ATP citrate lyase, markedly reduced tritiated water incorporation into fatty acids by lung tissue slices. The effects of (-)-hydroxycitrate and n-butymalonate on the incorporation of 14C-labeled glucose, pyruvate, acetate, and citrate suggested that citrate is a major acetyl carrier for de novo fatty acid synthesis in lung tissue. Alternative mechanisms to citrate as an acetyl carrier were also considered. Lung mitochondrial preparations formed significant levels of acetylcarnitine in the presence of pyruvate and carnitine. However, the effect of carnitine on the incorporation of 14C-labeled glucose, pyruvate, acetate, and citrate into fatty acids by lung tissue slices indicated that acetylcarnitine may not be a significant acetyl carrier for fatty acid synthesis but may serve as an acetyl "buffer" in the control of mitochondrial acetyl-CoA levels. Additionally, it appears unlikely that either acetylaspartate or acetoacetate are of major importance in acetyl transfer in lung tissue.
Synthesis of the sulfur amino acids: cysteine and methionine.
Wirtz, Markus; Droux, Michel
2005-12-01
This review will assess new features reported for the molecular and biochemical aspects of cysteine and methionine biosynthesis in Arabidopsis thaliana with regards to early published data from other taxa including crop plants and bacteria (Escherichia coli as a model). By contrast to bacteria and fungi, plant cells present a complex organization, in which the sulfur network takes place in multiple sites. Particularly, the impact of sulfur amino-acid biosynthesis compartmentalization will be addressed in respect to localization of sulfur reduction. To this end, the review will focus on regulation of sulfate reduction by synthesis of cysteine through the cysteine synthase complex and the synthesis of methionine and its derivatives. Finally, regulatory aspects of sulfur amino-acid biosynthesis will be explored with regards to interlacing processes such as photosynthesis, carbon and nitrogen assimilation.
Abscisic Acid Negatively Regulates Elicitor-Induced Synthesis of Capsidiol in Wild Tobacco1[W
Mialoundama, Alexis Samba; Heintz, Dimitri; Debayle, Delphine; Rahier, Alain; Camara, Bilal; Bouvier, Florence
2009-01-01
In the Solanaceae, biotic and abiotic elicitors induce de novo synthesis of sesquiterpenoid stress metabolites known as phytoalexins. Because plant hormones play critical roles in the induction of defense-responsive genes, we have explored the effect of abscisic acid (ABA) on the synthesis of capsidiol, the major wild tobacco (Nicotiana plumbaginifolia) sesquiterpenoid phytoalexin, using wild-type plants versus nonallelic mutants Npaba2 and Npaba1 that are deficient in ABA synthesis. Npaba2 and Npaba1 mutants exhibited a 2-fold higher synthesis of capsidiol than wild-type plants when elicited with either cellulase or arachidonic acid or when infected by Botrytis cinerea. The same trend was observed for the expression of the capsidiol biosynthetic genes 5-epi-aristolochene synthase and 5-epi-aristolochene hydroxylase. Treatment of wild-type plants with fluridone, an inhibitor of the upstream ABA pathway, recapitulated the behavior of Npaba2 and Npaba1 mutants, while the application of exogenous ABA reversed the enhanced synthesis of capsidiol in Npaba2 and Npaba1 mutants. Concomitant with the production of capsidiol, we observed the induction of ABA 8′-hydroxylase in elicited plants. In wild-type plants, the induction of ABA 8′-hydroxylase coincided with a decrease in ABA content and with the accumulation of ABA catabolic products such as phaseic acid and dihydrophaseic acid, suggesting a negative regulation exerted by ABA on capsidiol synthesis. Collectively, our data indicate that ABA is not required per se for the induction of capsidiol synthesis but is essentially implicated in a stress-response checkpoint to fine-tune the amplification of capsidiol synthesis in challenged plants. PMID:19420326
Synthesis of 6-phosphofructose aspartic acid and some related Amadori compounds.
Hansen, Alexandar L; Behrman, Edward J
2016-08-05
We describe the synthesis and characterization of 6-phosphofructose-aspartic acid, an intermediate in the metabolism of fructose-asparagine by Salmonella. We also report improved syntheses of fructose-asparagine itself and of fructose-aspartic acid. Copyright © 2016 Elsevier Ltd. All rights reserved.
Ryan, Veronica H.; Primiani, Christopher T.; Rao, Jagadeesh S.; Ahn, Kwangmi; Rapoport, Stanley I.; Blanchard, Helene
2014-01-01
Background The polyunsaturated arachidonic and docosahexaenoic acids (AA and DHA) participate in cell membrane synthesis during neurodevelopment, neuroplasticity, and neurotransmission throughout life. Each is metabolized via coupled enzymatic reactions within separate but interacting metabolic cascades. Hypothesis AA and DHA pathway genes are coordinately expressed and underlie cascade interactions during human brain development and aging. Methods The BrainCloud database for human non-pathological prefrontal cortex gene expression was used to quantify postnatal age changes in mRNA expression of 34 genes involved in AA and DHA metabolism. Results Expression patterns were split into Development (0 to 20 years) and Aging (21 to 78 years) intervals. Expression of genes for cytosolic phospholipases A2 (cPLA2), cyclooxygenases (COX)-1 and -2, and other AA cascade enzymes, correlated closely with age during Development, less so during Aging. Expression of DHA cascade enzymes was less inter-correlated in each period, but often changed in the opposite direction to expression of AA cascade genes. Except for the PLA2G4A (cPLA2 IVA) and PTGS2 (COX-2) genes at 1q25, highly inter-correlated genes were at distant chromosomal loci. Conclusions Coordinated age-related gene expression during the brain Development and Aging intervals likely underlies coupled changes in enzymes of the AA and DHA cascades and largely occur through distant transcriptional regulation. Healthy brain aging does not show upregulation of PLA2G4 or PTGS2 expression, which was found in Alzheimer's disease. PMID:24963629
Characterization of two Streptomyces enzymes that convert ferulic acid to vanillin.
Yang, Wenwen; Tang, Hongzhi; Ni, Jun; Wu, Qiulin; Hua, Dongliang; Tao, Fei; Xu, Ping
2013-01-01
Production of flavors from natural substrates by microbial transformation has become a growing and expanding field of study over the past decades. Vanillin, a major component of vanilla flavor, is a principal flavoring compound used worldwide. Streptomyces sp. strain V-1 is known to be one of the most promising microbial producers of natural vanillin from ferulic acid. Although identification of the microbial genes involved in the biotransformation of ferulic acid to vanillin has been previously reported, purification and detailed characterization of the corresponding enzymes with important functions have rarely been studied. In this study, we isolated and identified 2 critical genes, fcs and ech, encoding feruloyl-CoA synthetase and enoyl-CoA hydratase/aldolase, respectively, which are involved in the vanillin production from ferulic acid. Both genes were heterologously expressed in Escherichia coli, and the resting cell reactions for converting ferulic acid to vanillin were performed. The corresponding crucial enzymes, Fcs and Ech, were purified for the first time and the enzymatic activity of each purified protein was studied. Furthermore, Fcs was comprehensively characterized, at an optimal pH of 7.0 and temperature of 30°C. Kinetic constants for Fcs revealed the apparent Km, kcat, and Vmax values to be 0.35 mM, 67.7 s(-1), and 78.2 U mg(-1), respectively. The catalytic efficiency (kcat/Km) value of Fcs was 193.4 mM(-1) s(-1) for ferulic acid. The characterization of Fcs and Ech may be helpful for further research in the field of enzymatic engineering and metabolic regulation.
Jones, J A; Blecher, M
1966-05-01
The chemical synthesis and characterization of three intermediates in the Beta oxidation of palmitic acid-1-(14)C by rat liver mitochondria, namely, 3-ketohexadecanoic acid-1-(14)C, DL-3-hydroxyhexadecanoic acid-1-(14)C, and trans-2-hexadecenoic acid-1-(14)C, are described.
Inhibition of Fatty Acid Synthesis Induces Apoptosis of Human Pancreatic Cancer Cells.
Nishi, Koji; Suzuki, Kenta; Sawamoto, Junpei; Tokizawa, Yuma; Iwase, Yumiko; Yumita, Nagahiko; Ikeda, Toshihiko
2016-09-01
Cancer cells tend to have a high requirement for lipids, including fatty acids, cholesterol and triglyceride, because of their rapid proliferative rate compared to normal cells. In this study, we investigated the effects of inhibition of lipid synthesis on the proliferation and viability of human pancreatic cancer cells. Of the inhibitors of lipid synthesis that were tested, 5-(tetradecyloxy)-2-furoic acid (TOFA), which is an inhibitor of acetyl-CoA carboxylase, and the fatty acid synthase (FAS) inhibitors cerulenin and irgasan, significantly suppressed the proliferation of MiaPaCa-2 and AsPC-1 cells. Treatment of MiaPaCa-2 cells with these inhibitors significantly increased the number of apoptotic cells. In addition, TOFA increased caspase-3 activity and induced cleavage of poly (ADP-ribose) polymerase in MiaPaCa-2 cells. Moreover, addition of palmitate to MiaPaCa-2 cells treated with TOFA rescued cells from apoptotic cell death. These results suggest that TOFA induces apoptosis via depletion of fatty acids and that, among the various aspects of lipid metabolism, inhibition of fatty acid synthesis may be a notable target for the treatment of human pancreatic cancer cells. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.
α-Ketophosphonic Acid Esters — Synthesis, Structure, and Reactions
NASA Astrophysics Data System (ADS)
Zhdanov, Yu A.; Uzlova, L. A.; Glebova, Z. I.
1980-09-01
Studies on the synthesis and properties of α-ketophosphonic acid esters (KPE) — a class of highly reactive organophosphorus compounds — are surveyed. Data are presented concerning instances of the anomalous course of the process in the synthesis of KPE by the Arbuzov reaction. The reactions of KPE with nucleophiles, including those which lead to the rupture of the phosphorus-carbon bond, are examined in detail. The problems of the stereochemistry of KPE are dealt with briefly. The bibliography includes 162 references.
Dreßen, Alana; Hilberath, Thomas; Mackfeld, Ursula; Billmeier, Arne; Rudat, Jens; Pohl, Martina
2017-09-20
Phenylalanine ammonia lyase (PAL) from Arabidopsis thaliana (AtPAL2) was comparatively characterized to the well-studied enzyme from parsley (PcPAL1) and Rhodosporidium toruloides (RtPAL) with respect to kinetic parameters for the deamination and the amination reaction, pH- and temperature optima and the substrate range of the amination reaction. Whereas both plant enzymes are specific for phenylalanine, the bifunctional enzyme from Rhodosporidium toruloides shows K M -values for L-Phe and L-Tyr in the same order of magnitude and, compared to both plant enzymes, a 10-15-fold higher activity. At 30°C all enzymes were sufficiently stable with half-lives of 3.4days (PcPAL1), 4.6days (AtPAL2) and 9.7days (RtPAL/TAL). Very good results for the amination of various trans-cinnamic acid derivatives were obtained using E. coli cells as whole cell biocatalysts in ammonium carbonate buffer. Investigation of the substrate ranges gave interesting results for the newly tested enzymes from A. thaliana and R. toruloides. Only the latter accepts besides 4-hydroxy-CA also 3-methoxy-4-hydroxy-CA as a substrate, which is an interesting intermediate for the formation of pharmaceutically relevant L-Dopa. AtPAL2 is a very good catalyst for the formation of (S)-3-F-Phe, (S)-4-F-Phe and (S)-2-Cl-Phe. Such non-canonical amino acids are valuable building blocks for the formation of various drug molecules. Copyright © 2017 Elsevier B.V. All rights reserved.
Wilson, Fiona A.; Suryawan, Agus; Orellana, Renán A.; Nguyen, Hanh V.; Jeyapalan, Asumthia S.; Gazzaneo, Maria C.; Davis, Teresa A.
2008-01-01
Chronic somatotropin (pST) treatment in pigs increases muscle protein synthesis and circulating insulin, a known promoter of protein synthesis. Previously, we showed that the pST-mediated rise in insulin could not account for the pST-induced increase in muscle protein synthesis when amino acids were maintained at fasting levels. This study aimed to determine whether the pST-induced increase in insulin promotes skeletal muscle protein synthesis when amino acids are provided at fed levels and whether the response is associated with enhanced translation initiation factor activation. Growing pigs were treated with pST (0 or 180 μg·kg−1·day−1) for 7 days, and then pancreatic-glucose-amino acid clamps were performed. Amino acids were raised to fed levels in the presence of either fasted or fed insulin concentrations; glucose was maintained at fasting throughout. Muscle protein synthesis was increased by pST treatment and by amino acids (with or without insulin) (P < 0.001). In pST-treated pigs, fed, but not fasting, amino acid concentrations further increased muscle protein synthesis rates irrespective of insulin level (P < 0.02). Fed amino acids, with or without raised insulin concentrations, increased the phosphorylation of S6 kinase (S6K1) and eukaryotic initiation factor (eIF) 4E-binding protein 1 (4EBP1), decreased inactive 4EBP1·eIF4E complex association, and increased active eIF4E·eIF4G complex formation (P < 0.02). pST treatment did not alter translation initiation factor activation. We conclude that the pST-induced stimulation of muscle protein synthesis requires fed amino acid levels, but not fed insulin levels. However, under the current conditions, the response to amino acids is not mediated by the activation of translation initiation factors that regulate mRNA binding to the ribosomal complex. PMID:18682537
Synthesis, characterization and reactivity of 3-mercaptopyruvic acid.
Galardon, Erwan; Lec, Jean-Chrstophe
2018-05-20
A synthesis of the sulfur metabolic compound 3-mercaptopyruvic acid (3-MPH) is reported and allowed its isolation and characterization for the first time. Detailed kinetic, thermodynamic and spectroscopic studies of its complex behaviour in solution are discussed. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
The metabolic burden of creatine synthesis.
Brosnan, John T; da Silva, Robin P; Brosnan, Margaret E
2011-05-01
Creatine synthesis is required in adult animals to replace creatine that is spontaneously converted to creatinine and excreted in the urine. Additionally, in growing animals it is necessary to provide creatine to the expanding tissue mass. Creatine synthesis requires three amino acids: glycine, methionine and arginine, and three enzymes: L-arginine:glycine amidinotransferase (AGAT), methionine adenosyltransferase (MAT) and guanidinoacetate methyltransferase (GAMT). The entire glycine molecule is consumed in creatine synthesis but only the methyl and amidino groups, respectively, from methionine and arginine. Creatinine loss averages approximately 2 g (14.6 mmol) for 70 kg males in the 20- to 39-year age group. Creatinine loss is lower in females and in older age groups because of lower muscle mass. Approximately half of this creatine lost to creatinine can be replaced, in omnivorous individuals, by dietary creatine. However, since dietary creatine is only provided in animal products, principally in meat and fish, virtually all of the creatine loss in vegetarians must be replaced via endogenous synthesis. Creatine synthesis does not appear to place a major burden on glycine metabolism in adults since this amino acid is readily synthesized. However, creatine synthesis does account for approximately 40% of all of the labile methyl groups provided by S-adenosylmethionine (SAM) and, as such, places an appreciable burden on the provision of such methyl groups, either from the diet or via de novo methylneogenesis. Creatine synthesis consumes some 20-30% of arginine's amidino groups, whether provided in the diet or synthesized within the body. Creatine synthesis is, therefore, a quantitatively major pathway in amino acid metabolism and imposes an appreciable burden on the metabolism of methionine and of arginine.
Cui, Jian-Dong; Zhang, Si; Sun, Li-Mei
2012-06-01
Cross-linked enzyme aggregates of phenylalanine ammonia lyase (PAL-CLEAs) from Rhodotorula glutinis were prepared. The effects of the type of aggregating agent, its concentration, and that of cross-linking agent were studied. PAL-CLEAs production was most effective using ammonium sulfate (40 % saturation), followed by cross-linking for 1 h with 0.2 % (v/v) glutaraldehyde. Moreover, the storage and operational stability of the resulting PAL-CLEAs were also investigated. Compared to the free enzyme, the PAL-CLEAs exhibited the expected increased stability of the enzyme against various deactivating conditions such as pH, temperature, denaturants, and organic solvents and showed higher storage stability than its soluble counterpart. Additionally, the reusability of PAL-CLEAs with respect to the biotransformation of L-phenylalanine was evaluated. PAL-CLEAs could be recycled at least for 12 consecutive batch reactions without dramatic activity loss, which should dramatically increase the commercial potential of PAL for synthesis of L: -phenylalanine. To the best of our knowledge, this is the first report of immobilization of PAL as cross-linked enzyme aggregates.
Glass-ionomer cement formulations. II. The synthesis of novel polycarobxylic acids.
Crisp, S; Kent, B E; Lewis, B G; Ferner, A J; Wilson, A D
1980-06-01
The synthesis of many polycarboxylic acids is reported. An account is given of their stability in aqueous solution and the properties of cements formed by their reaction with ion-leachable glasses. A copolymer of acrylic and itaconic acids was found to combine several favorable characteristics.
Gomatos, Peter J.
1970-01-01
Reovirus has in its protein coat an enzyme which catalyzes the net synthesis of the three size classes of virus-specific, single-stranded ribonucleic acid (RNA). For synthesis of 24, 19, and 14S single-stranded RNA, Mn++ was the preferred divalent cation, and ammonium sulfate at an optimal concentration of 4.2% of saturation was an absolute requirement. During synthesis, the parental double-stranded RNA was conserved in the viral core and the newly synthesized completed RNA chains were released as free RNA. The viral cores synthesizing RNA had properties consistent with the presence of nascent RNA on their outer surface. The enzyme-template complex from the infected cells described in an earlier paper was comprised of viral cores already active in the in vivo synthesis of single-stranded RNA. This pool of viral cores was newly made during infection, and exponential increase in the number of particles in this pool, as detected by the increase in enzymatic activity, occurred 2 hr earlier than that in mature virus. PMID:5483438
Brenes, A; Centeno, C; Viveros, A; Arija, I
2008-11-01
Two experiments were conducted to evaluate the effects of enzyme addition in chicken diets containing high oleic acid sunflower seeds (HOASS). In the first experiment (4 to 21 d of age), enzyme addition (lipase, phospholipase, and a combination of these) was used at the inclusion level of 1 g/kg in diets containing HOASS (250 g/kg) compared with a control corn-soybean diet. Weight gain, feed consumption, relative liver weight, fat digestibility, and amylase, lipase, serum lactate dehydrogenase (LDH), and creatine phosphokinase (CPK) activities were reduced, and feed conversion, relative duodenum, jejunum, ileum, and ceca lengths, plasma uric acid, cholesterol, and glucose concentrations were increased in the unsupplemented HOASS diet compared with the control diet. The addition of enzymes to the HOASS diet increased weight gain, feed consumption, relative pancreas and liver weights, fat digestibility, amylase and lipase activities, plasma uric acid, calcium, serum LDH and CPK, and total protein concentration and reduced feed conversion, relative spleen weight, relative duodenum, jejunum, ileum, and ceca lengths, plasma cholesterol, and glucose compared with the unsupplemented HOASS diet. In the second experiment (0 to 21 d of age), the same enzymes (0.5 g/kg each) were included in diets containing 150 g/kg of HOASS compared with a conventional sunflower meal diet (150 g/kg). The HOASS diet did not affect performance but reduced relative pancreas and abdominal fat weights and relative duodenum and ceca lengths, and increased crude fat, CP, and essential and nonessential amino acid digestibilities (except Ser, which was reduced) compared with the control diet. The addition of enzymes in the HOASS diet increased weight gain, feed consumption, and relative pancreas weight and reduced feed conversion, CP, and essential and nonessential amino acid digestibilities compared with the unsupplemented HOASS diet. In conclusion, the addition of 250 g of HOASS/kg in the diets
Gumel, Ahmad Mohammed; Annuar, M S M
2016-06-01
Enzymatic catalysis is considered to be among the most environmental friendly processes for the synthesis of fine chemicals. In this study, lipase from Thermomyces lanuginosus (Lecitase Ultra™) was used to catalyze the synthesis of flavor esters, i.e., methyl butanoate and methyl benzoate by esterification of the acids with methanol in a microfluidic system. Maximum reaction rates of 195 and 115 mM min -1 corresponding to catalytic efficiencies (k cat /K M ) of 0.30 and 0.24 min -1 mM -1 as well as yield conversion of 54 and 41 % were observed in methyl butanoate and methyl benzoate synthesis, respectively. Catalytic turnover (k cat ) was higher for methyl butanoate synthesis. Rate of synthesis and yield decreased with increasing flow rates. For both esters, increase in microfluidic flow rate resulted in increased advective transport over molecular diffusion and reaction rate, thus lower conversion. In microfluidic synthesis using T. lanuginosus lipase, the following reaction conditions were 40 °C, flow rate 0.1 mL min -1 , and 123 U g -1 enzyme loading found to be the optimum operating limits. The work demonstrated the application of enzyme(s) in a microreactor system for the synthesis of industrially important esters.
Immobilised enzymes in biorenewables production.
Franssen, Maurice C R; Steunenberg, Peter; Scott, Elinor L; Zuilhof, Han; Sanders, Johan P M
2013-08-07
Oils, fats, carbohydrates, lignin, and amino acids are all important raw materials for the production of biorenewables. These compounds already play an important role in everyday life in the form of wood, fabrics, starch, paper and rubber. Enzymatic reactions do, in principle, allow the transformation of these raw materials into biorenewables under mild and sustainable conditions. There are a few examples of processes using immobilised enzymes that are already applied on an industrial scale, such as the production of High-Fructose Corn Syrup, but these are still rather rare. Fortunately, there is a rapid expansion in the research efforts that try to improve this, driven by a combination of economic and ecological reasons. This review focusses on those efforts, by looking at attempts to use fatty acids, carbohydrates, proteins and lignin (and their building blocks), as substrates in the synthesis of biorenewables using immobilised enzymes. Therefore, many examples (390 references) from the recent literature are discussed, in which we look both at the specific reactions as well as to the methods of immobilisation of the enzymes, as the latter are shown to be a crucial factor with respect to stability and reuse. The applications of the renewables produced in this way range from building blocks for the pharmaceutical and polymer industry, transport fuels, to additives for the food industry. A critical evaluation of the relevant factors that need to be improved for large-scale use of these examples is presented in the outlook of this review.
Willrodt, Christian; Halan, Babu; Karthaus, Lisa; Rehdorf, Jessica; Julsing, Mattijs K; Buehler, Katja; Schmid, Andreas
2017-02-01
The efficiency of biocatalytic reactions involving industrially interesting reactants is often constrained by toxification of the applied biocatalyst. Here, we evaluated the combination of biologically and technologically inspired strategies to overcome toxicity-related issues during the multistep oxyfunctionalization of (R)-(+)-limonene to (R)-(+)-perillic acid. Pseudomonas putida GS1 catalyzing selective limonene oxidation via the p-cymene degradation pathway and recombinant Pseudomonas taiwanensis VLB120 were evaluated for continuous perillic acid production. A tubular segmented-flow biofilm reactor was used in order to relieve oxygen limitations and to enable membrane mediated substrate supply as well as efficient in situ product removal. Both P. putida GS1 and P. taiwanensis VLB120 developed a catalytic biofilm in this system. The productivity of wild-type P. putida GS1 encoding the enzymes for limonene bioconversion was highly dependent on the carbon source and reached 34 g L tube -1 day -1 when glycerol was supplied. More than 10-fold lower productivities were reached irrespective of the applied carbon source when the recombinant P. taiwanensis VLB120 harboring p-cymene monooxygenase and p-cumic alcohol dehydrogenase was used as biocatalyst. The technical applicability for preparative perillic acid synthesis in the applied system was verified by purification of perillic acid from the outlet stream using an anion exchanger resin. This concept enabled the multistep production of perillic acid and which might be transferred to other reactions involving volatile reactants and toxic end-products. Biotechnol. Bioeng. 2017;114: 281-290. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Saludes, Jonel P; Natarajan, Arutselvan; DeNardo, Sally J; Gervay-Hague, Jacquelyn
2010-05-01
Peptides are labile toward proteolytic enzymes, and structural modifications are often required to prolong their metabolic half-life and increase resistance. One modification is the incorporation of non-alpha-amino acids into the peptide to deter recognition by hydrolytic enzymes. We previously reported the synthesis of chimeric alpha/delta-peptides from glutamic acids (Glu) and the sialic acid derivative Neu2en. Conformational analyses revealed these constructs adopt secondary structures in water and may serve as conformational surrogates of polysialic acid. Polysialic acid is a tumor-associated polysaccharide and is correlated with cancer metastasis. Soluble polysialic acid is rapidly cleared from the blood limiting its potential for vaccine development. One motivation in developing structural surrogates of polysialic acid was to create constructs with increased bioavailability. Here, we report plasma stability profiles of Glu/Neu2en alpha/delta-peptides. DOTA was conjugated at the peptide N-termini by solid phase peptide synthesis, radiolabeled with (111)In, incubated in human blood plasma at 37 degrees C, and their degradation patterns monitored by cellulose acetate electrophoresis and radioactivity counting. Results indicate that these peptides exhibit a long half-life that is two- to three-orders of magnitude higher than natural alpha-peptides. These findings provide a viable platform for the synthesis of plasma stable, sialic acid-derived peptides that may find pharmaceutical application.
2017-01-01
Summary Bionic acids are bioactive compounds demonstrating numerous interesting properties. They are widely produced by chemical or enzymatic oxidation of disaccharides. This paper focuses on the galactosyl derivative of gluconic acid as a result of a new method of bionic acid synthesis which utilises the transglycosylation properties of β-galactosidase and introduces lactose as a substrate. Products obtained in such a process are characterised by different structures (and, potentially, properties) than those resulting from traditional oxidation of disaccharides. The aim of this study is to determine the effect of selected parameters (concentration and ratio of substrates, dose of the enzyme, time, pH, presence of salts) on the course of the reaction carried out with the enzymatic preparation Lactozym, containing β-galactosidase from Kluyveromyces lactis. Research has shown that increased dry matter content in the baseline solution (up to 50%, by mass per volume) and an addition of NaCl contribute to higher yield. On the other hand, reduced content of the derivative is a result of increased pH from 7.0 to 9.0 and an addition of magnesium and manganese salts. Moreover, exceeding the β-galactosidase dose over approx. 35 000 U per 100 g of lactose also leads to reduced yield of the process. The most favourable molar ratio of sodium gluconate to lactose is 2.225:0.675. Depending on the conditions of the synthesis, the product concentration ranged between 17.3 and 118.3 g/L of the reaction mixture, which corresponded to the mass fraction of 6.64–23.7% of dry matter. The data obtained as a result of the present study may be useful for designing an industrial process. PMID:28867957
Mei, Hui; Liao, Jen-Yu; Jimenez, Randi M; Wang, Yajun; Bala, Saikat; McCloskey, Cailen; Switzer, Christopher; Chaput, John C
2018-05-02
In vitro selection experiments carried out on artificial genetic polymers require robust and faithful methods for copying genetic information back and forth between DNA and xeno-nucleic acids (XNA). Previously, we have shown that Kod-RI, an engineered polymerase developed to transcribe DNA templates into threose nucleic acid (TNA), can function with high fidelity in the absence of manganese ions. However, the transcriptional efficiency of this enzyme diminishes greatly when individual templates are replaced with libraries of DNA sequences, indicating that manganese ions are still required for in vitro selection. Unfortunately, the presence of manganese ions in the transcription mixture leads to the misincorporation of tGTP nucleotides opposite dG residues in the templating strand, which are detected as G-to-C transversions when the TNA is reverse transcribed back into DNA. Here we report the synthesis and fidelity of TNA replication using 7-deaza-7-modified guanosine base analogues in the DNA template and incoming TNA nucleoside triphosphate. Our findings reveal that tGTP misincorporation occurs via a Hoogsteen base pair in which the incoming tGTP residue adopts a syn conformation with respect to the sugar. Substitution of tGTP for 7-deaza-7-phenyl tGTP enabled the synthesis of TNA polymers with >99% overall fidelity. A TNA library containing the 7-deaza-7-phenyl guanine analogue was used to evolve a biologically stable TNA aptamer that binds to HIV reverse transcriptase with low nanomolar affinity.
Synthesis and activity of Helicobacter pylori urease and catalase at low pH.
Bauerfeind, P; Garner, R; Dunn, B E; Mobley, H L
1997-01-01
BACKGROUND: Helicobacter pylori produces large amounts of urease presumably to be prepared for the rare event of a sudden acid exposure. The hypothesis that H pylori is acid sensitive and protein production is inhibited by low pH was examined. METHODS: H pylori or its soluble enzymes were incubated buffered or unbuffered at a pH ranging from 2-7 in the presence of 5 mM urea for 30 minutes. After exposure, urease and catalase activities of whole cells, supernatants, and soluble enzyme preparations were measured at pH 6.8. Newly synthesised enzyme was quantified by immunoprecipitation of [35S]-methionine labelled protein. RESULTS: Exposure to buffer below pH 4 resulted in loss of intracellular urease activity. In soluble enzyme preparations and supernatant, no urease activity was measurable after incubation at pH < 5. In contrast, catalase in whole cells, supernatant, and soluble enzyme preparations remained active after exposure to pH > or = 3. Exposure below pH 5 inhibited synthesis of total protein including nascent urease and catalase. At pH 6 or 7, urease represented 10% of total protein, catalase 1.5%. Exposure of H pylori to unbuffered HCl (pH > 2) resulted in an immediate neutralisation; urease and catalase activities and synthesis were unchanged. CONCLUSION: Low surrounding pH reduces activity of urease and synthesis of nascent urease, catalase, and presumably of most other proteins. This suggests that H pylori is not acidophilic although it tolerates short-term exposure to low pH. PMID:9155571
Copper-catalyzed formic acid synthesis from CO2 with hydrosilanes and H2O.
Motokura, Ken; Kashiwame, Daiki; Miyaji, Akimitsu; Baba, Toshihide
2012-05-18
A copper-catalyzed formic acid synthesis from CO2 with hydrosilanes has been accomplished. The Cu(OAc)2·H2O-1,2-bis(diphenylphosphino)benzene system is highly effective for the formic acid synthesis under 1 atm of CO2. The TON value approached 8100 in 6 h. The reaction pathway was revealed by in situ NMR analysis and isotopic experiments.
Enzyme immunoassay for tenuazonic acid in apple and tomato products.
Gross, Madeleine; Curtui, Valeriu; Ackermann, Yvonne; Latif, Hadri; Usleber, Ewald
2011-12-14
The Alternaria mycotoxin tenuazonic acid was derivatized with succinic anhydride and conjugated to keyhole limpet hemocyanin (KLH) and to horseradish peroxidase (HRP), respectively. The KLH conjugate was used to produce polyclonal antibodies in rabbits. A competitive direct enzyme immunoassay (EIA) for tenuazonic acid was established, which was moderately sensitive for tenuazonic acid [50% inhibition concentration (IC(50)): 320 ± 130 ng/mL] but strongly reacted with tenuazonic acid acetate (IC(50): 23.3 ± 7.5 ng/mL). Therefore, an optimized EIA protocol was established, which employed acetylation of standard and sample extract solutions. The mean standard curve detection limit (IC(30)) for tenuazonic acid acetate was 5.4 ± 2.0 ng/mL, enabling detection limits for tenuazonic acid in apple and tomato products of 25-50 ng/g (150 ng/g in tomato paste). Recoveries in a concentration range of 50-2000 ng/g were 60-130% in apple juice and tomato juice and 40-150% in other tomato products. Tenuazonic acid was detected in apple juice and tomato products from German retail shops at levels of 50-200 ng/g. In conclusion, this novel EIA for tenuazonic acid could be useful within a screening program for Alternaria mycotoxins in food.
Waldrop, Grover L; Holden, Hazel M; Maurice, Martin St
2012-01-01
Biotin is the major cofactor involved in carbon dioxide metabolism. Indeed, biotin-dependent enzymes are ubiquitous in nature and are involved in a myriad of metabolic processes including fatty acid synthesis and gluconeogenesis. The cofactor, itself, is composed of a ureido ring, a tetrahydrothiophene ring, and a valeric acid side chain. It is the ureido ring that functions as the CO2 carrier. A complete understanding of biotin-dependent enzymes is critically important for translational research in light of the fact that some of these enzymes serve as targets for anti-obesity agents, antibiotics, and herbicides. Prior to 1990, however, there was a dearth of information regarding the molecular architectures of biotin-dependent enzymes. In recent years there has been an explosion in the number of three-dimensional structures reported for these proteins. Here we review our current understanding of the structures and functions of biotin-dependent enzymes. In addition, we provide a critical analysis of what these structures have and have not revealed about biotin-dependent catalysis. PMID:22969052
Synthesis and characterization of bis-thiourea having amino acid derivatives
NASA Astrophysics Data System (ADS)
Fakhar, Imran; Yamin, Bohari M.; Hasbullah, Siti Aishah
2016-11-01
In this article four new symmetric bis-thiourea derivatives having amino acid linkers were reported with good yield. Isophthaloyl dichloride was used as spacer and L-alanine, L-aspartic acid, L-phenylalanine and L-glutamic acid were used as linkers. Bis-thiourea derivatives were prepared from relatively stable isophthaloyl isothiocyanate intermediate. Newly synthesized bis-thiourea derivatives were characterized by FTIR, H-NMR, 13C-NMR and CHNS-O elemental analysis techniques. Characterization data was in good agreement with the expected derivatives, hence confirmed the synthesis of four new derivatives of bis-thiourea having amino acids.
Berini, Christophe; Pelloux-Léon, Nadia; Minassian, Frédéric; Denis, Jean-Noël
2009-11-07
The stereoselective synthesis of penmacric acid, an optically active C-4 substituted pyroglutamic acid, has been efficiently achieved through an unusual 11-step sequence starting from simple N-triisopropylsilylpyrrole. The key-steps are the initial addition of the pyrrole nucleus onto a chiral nitrone and the obtention of the pyroglutamic acid moiety by reductive hydrogenation of the pyrrole followed by oxidation of the corresponding pyrrolidine into pyrrolidinone.
Wei, Liujing; Yang, Xuepeng; Gao, Keliang; Lin, Jinping; Yang, Shengli; Hua, Qiang; Wei, Dongzhi
2010-09-01
Although Gluconobacter oxydans can convert 1,2-propanediol to D: -(-)-lactic acid, the enzyme(s) responsible for the conversion has remain unknown. In this study, the membrane-bound alcohol dehydrogenase (ADH) of Gluconobacter oxydans DSM 2003 was purified and confirmed to be essential for the process of D: -(-)-lactic acid production by gene knockout and complementation studies. A 25 percent decrease in D: -(-)-lactic acid production was found for the aldehyde dehydrogenase (ALDH) deficient strain of G. oxydans DSM 2003, indicating that this enzyme is involved in the reaction but not necessary. It is the first report that reveals the function of ADH and ALDH in the biooxidation of 1,2-propanediol to D: -(-)-lactic acid by G. oxydans DSM 2003.
Nanoarmoring of Enzymes by Interlocking in Cellulose Fibers With Poly(Acrylic Acid).
Riccardi, Caterina M; Kasi, Rajeswari M; Kumar, Challa V
2017-01-01
A simple method for interlocking glucose oxidase (GOx) and horseradish peroxidase (HRP) in cellulose fibers using poly(acrylic acid) (PAA) as an armor around the enzyme, without any need for activation of the cellulose support, is reported here. The resulting enzyme paper is an inexpensive, stable, simple, wearable, and washable biosensor. PAA functions as a multifunctional tether to interlock the enzyme molecules around the paper fibers so that the enzymes are protected against thermal/chemical denaturation and not released from the paper when washed with a detergent. The decreased conformational entropy of the interlocked enzyme protected by the nanoarmor is likely responsible for increased enzyme stability to heat and chemical denaturants (retained ≥70 percent enzyme activity after washing with urea or SDS for 30min), and the polymer protects the enzyme against inactivation by proteases, bacteria, inhibitors, etc. The kinetics of the interlocked enzyme were similar to that of the enzyme in solution. The V max was 6(±0.5)mM per minute before washing, then increased slightly to 9(±1.4)mM per minute after washing with water. The K m was 22(±6.4mM), which was slightly higher compared to GOx in solution (25-27mM). Because the surface area of the paper does not limit the enzyme loading, about 20% of enzyme was successfully loaded onto the paper (0.2g enzyme per gram of paper), and ≥95% of the enzyme was retained after washing. Interlocking works with other enzymes such as laccase, where ≥60% of the enzyme activity is retained. This novel methodology provides a low cost, simple, modular approach of achieving high enzyme loadings in ordinary filter paper, not limited by cellulose surface area, and there has been no need for complex methods of enzyme engineering or toxic methods of activation of the solid support to prepare highly active biocatalysts. © 2017 Elsevier Inc. All rights reserved.
Sharma, Shivika; Kanwar, Shamsher S; Dogra, Priyanka; Chauhan, Ghanshyam S
2015-01-01
Gallic acid (3, 4, 5- trihydroxybenzoic acid) is an important antioxidant, anti-inflammatory, and radical scavenging agent. In the present study, a purified thermo-tolerant extra-cellular lipase of Bacillus licheniformis SCD11501 was successfully immobilized by adsorption on Celite 545 gel matrix followed by treatment with a cross-linking agent, glutaraldehyde. The celite-bound lipase treated with glutaraldehyde showed 94.8% binding/retention of enzyme activity (36 U/g; specific activity 16.8 U/g matrix; relative increase in enzyme activity 64.7%) while untreated matrix resulted in 88.1% binding/retention (28.0 U/g matrix; specific activity 8.5 U/g matrix) of lipase. The celite-bound lipase was successfully used to synthesis methyl gallate (58.2%), ethyl gallate (66.9%), n-propyl gallate (72.1%), and n-butyl gallate (63.8%) at 55(o) C in 10 h under shaking (150 g) in a water-free system by sequentially optimizing various reaction parameters. The low conversion of more polar alcohols such as methanol and ethanol into their respective gallate esters might be due to the ability of these alcohols to severely remove water from the protein hydration shell, leading to enzyme inactivation. Molecular sieves added to the reaction mixture resulted in enhanced yield of the alkyl ester(s). The characterization of synthesised esters was done through fourier transform infrared (FTIR) spectroscopy and (1) H NMR spectrum analysis. © 2015 American Institute of Chemical Engineers.
USDA-ARS?s Scientific Manuscript database
The first synthesis of 1-O-methylchlorogenic acid is described. The short and efficient synthesis of this compound provides laboratory-scale quantities of the material to investigate its biological properties. The synthesis involved C-1 alkylation of the known (-)-4,5-cyclohexylidenequinic acid lact...
Chemoselective synthesis of sialic acid 1,7-lactones.
Allevi, Pietro; Rota, Paola; Scaringi, Raffaella; Colombo, Raffaele; Anastasia, Mario
2010-08-20
The chemoselective synthesis of the 1,7-lactones of N-acetylneuraminic acid, N-glycolylneuraminic acid, and 3-deoxy-d-glycero-d-galacto-nononic acid is accomplished in two steps: a simple treatment of the corresponding free sialic acid with benzyloxycarbonyl chloride and a successive hydrogenolysis of the formed 2-benzyloxycarbonyl 1,7-lactone. The instability of the 1,7-lactones to protic solvents has been also evidenced together with the rationalization of the mechanism of their formation under acylation conditions. The results permit to dispose of authentic 1,7-sialolactones to be used as reference standards and of a procedure useful for the preparation of their isotopologues to be used as inner standards in improved analytical procedures for the gas liquid chromatography-mass spectrometry (GLC-MS) analysis of 1,7-sialolactones in biological media.
Liu, Shaoyu; Sun, Aixia; Zhang, Zhanwen; Tang, Xiaolan; Nie, Dahong; Ma, Hui; Jiang, Shende; Tang, Ganghua
2017-06-15
N-(2-[ 18 F]Fluoropropionyl)-l-glutamic acid ([ 18 F]FPGLU) is a potential amino acid tracer for tumor imaging with positron emission tomography. However, due to the complicated multistep synthesis, the routine production of [ 18 F]FPGLU presents many challenging laboratory requirements. To simplify the synthesis process of this interesting radiopharmaceutical, an efficient automated synthesis of [ 18 F]FPGLU was performed on a modified commercial fluorodeoxyglucose synthesizer via a 2-step on-column hydrolysis procedure, including 18 F-fluorination and on-column hydrolysis reaction. [ 18 F]FPGLU was synthesized in 12 ± 2% (n = 10, uncorrected) radiochemical yield based on [ 18 F]fluoride using the tosylated precursor 2. The radiochemical purity was ≥98%, and the overall synthesis time was 35 minutes. To further optimize the radiosynthesis conditions of [ 18 F]FPGLU, a brominated precursor 3 was also used for the preparation of [ 18 F]FPGLU, and the improved radiochemical yield was up to 20 ± 3% (n = 10, uncorrected) in 35 minutes. Moreover, all these results were achieved using the similar on-column hydrolysis procedure on the modified fluorodeoxyglucose synthesis module. Copyright © 2017 John Wiley & Sons, Ltd.
Lead and PCB's in canvasback ducks: Relationship between enzyme levels and residues in blood
Dieter, M.P.; Perry, M.C.; Mulhern, B.M.
1976-01-01
Blood samples were taken for two successive years from canvasback ducks trapped in the Chesapeake Bay. The first winter (1972?1973) five plasma enzymes known to respond to organochlorine poisoning were examined. Abnormal enzyme elevations suggested that 20% of the population sampled (23/115 ducks) might contain organochlorine contaminants, but no residue analyses were performed. The second winter (1974) two of the same enzymes, aspartate aminotransferase and lactate dehydrogenase, and a third enzyme known to be specifically inhibited by lead, delta-aminolevulinic acid dehydratase, were assayed in 95 blood samples. Blood residues of organochlorine compounds and of lead were determined in representative samples, and the correlations between residue levels and enzyme changes were examined. The enzyme bioassays in 1974 indicated that lead was a more prevalent environmental contaminant than organochlorine compounds in canvasback ducks; 17% of the blood samples had less than one-half of the normal delta-aminolevulinic acid dehydratase activity, but only 11% exhibited abnormal aspartate aminotransferase or lactate dehydrogenase activities. These findings were confirmed by residue analyses that demonstrated lead concentrations four times higher than background levels, but only relatively low organochlorine concentrations. There was a highly significant inverse correlation between delta-aminolevulinic acid dehydratase activity and blood lead concentrations (P<0.01), and a weaker but significant correlation between plasma aspartate aminotransferase activity and blood PCB concentrations (P<0.05). It was apparent that delta-aminolevulinic acid dehydratase activity in the blood provided a sensitive and precise estimate of lead contamination in waterfowl. In canvasback ducks 200 ppb of lead in the blood caused a 75% decrease in delta-aminolevulinic acid dehydratase activity, a magnitude of enzyme inhibition that disturbs heme synthesis and is regarded as detrimental in humans.
Amino acid substrates impose polyamine, eIF5A, or hypusine requirement for peptide synthesis.
Shin, Byung-Sik; Katoh, Takayuki; Gutierrez, Erik; Kim, Joo-Ran; Suga, Hiroaki; Dever, Thomas E
2017-08-21
Whereas ribosomes efficiently catalyze peptide bond synthesis by most amino acids, the imino acid proline is a poor substrate for protein synthesis. Previous studies have shown that the translation factor eIF5A and its bacterial ortholog EF-P bind in the E site of the ribosome where they contact the peptidyl-tRNA in the P site and play a critical role in promoting the synthesis of polyproline peptides. Using misacylated Pro-tRNAPhe and Phe-tRNAPro, we show that the imino acid proline and not tRNAPro imposes the primary eIF5A requirement for polyproline synthesis. Though most proline analogs require eIF5A for efficient peptide synthesis, azetidine-2-caboxylic acid, a more flexible four-membered ring derivative of proline, shows relaxed eIF5A dependency, indicating that the structural rigidity of proline might contribute to the requirement for eIF5A. Finally, we examine the interplay between eIF5A and polyamines in promoting translation elongation. We show that eIF5A can obviate the polyamine requirement for general translation elongation, and that this activity is independent of the conserved hypusine modification on eIF5A. Thus, we propose that the body of eIF5A functionally substitutes for polyamines to promote general protein synthesis and that the hypusine modification on eIF5A is critically important for poor substrates like proline. Published by Oxford University Press on behalf of Nucleic Acids Research 2017.
Characterization of Two Streptomyces Enzymes That Convert Ferulic Acid to Vanillin
Yang, Wenwen; Tang, Hongzhi; Ni, Jun; Wu, Qiulin; Hua, Dongliang; Tao, Fei; Xu, Ping
2013-01-01
Production of flavors from natural substrates by microbial transformation has become a growing and expanding field of study over the past decades. Vanillin, a major component of vanilla flavor, is a principal flavoring compound used worldwide. Streptomyces sp. strain V-1 is known to be one of the most promising microbial producers of natural vanillin from ferulic acid. Although identification of the microbial genes involved in the biotransformation of ferulic acid to vanillin has been previously reported, purification and detailed characterization of the corresponding enzymes with important functions have rarely been studied. In this study, we isolated and identified 2 critical genes, fcs and ech, encoding feruloyl-CoA synthetase and enoyl-CoA hydratase/aldolase, respectively, which are involved in the vanillin production from ferulic acid. Both genes were heterologously expressed in Escherichia coli, and the resting cell reactions for converting ferulic acid to vanillin were performed. The corresponding crucial enzymes, Fcs and Ech, were purified for the first time and the enzymatic activity of each purified protein was studied. Furthermore, Fcs was comprehensively characterized, at an optimal pH of 7.0 and temperature of 30°C. Kinetic constants for Fcs revealed the apparent K m, k cat, and V max values to be 0.35 mM, 67.7 s−1, and 78.2 U mg−1, respectively. The catalytic efficiency (k cat/K m) value of Fcs was 193.4 mM−1 s−1 for ferulic acid. The characterization of Fcs and Ech may be helpful for further research in the field of enzymatic engineering and metabolic regulation. PMID:23840666
Cellini, Barbara; Montioli, Riccardo; Oppici, Elisa; Astegno, Alessandra; Voltattorni, Carla Borri
2014-02-01
The biologically active form of the B6 vitamers is pyridoxal 5'-phosphate (PLP), which plays a coenzymatic role in several distinct enzymatic activities ranging from the synthesis, interconversion and degradation of amino acids to the replenishment of one-carbon units, synthesis and degradation of biogenic amines, synthesis of tetrapyrrolic compounds and metabolism of amino-sugars. In the catalytic process of PLP-dependent enzymes, the substrate amino acid forms a Schiff base with PLP and the electrophilicity of the PLP pyridine ring plays important roles in the subsequent catalytic steps. While the essential role of PLP in the acquisition of biological activity of many proteins is long recognized, the finding that some PLP-enzymes require the coenzyme for refolding in vitro points to an additional role of PLP as a chaperone in the folding process. Mutations in the genes encoding PLP-enzymes are causative of several rare inherited diseases. Patients affected by some of these diseases (AADC deficiency, cystathionuria, homocystinuria, gyrate atrophy, primary hyperoxaluria type 1, xanthurenic aciduria, X-linked sideroblastic anaemia) can benefit, although at different degrees, from the administration of pyridoxine, a PLP precursor. The effect of the coenzyme is not limited to mutations that affect the enzyme-coenzyme interaction, but also to those that cause folding defects, reinforcing the idea that PLP could play a chaperone role and improve the folding efficiency of misfolded variants. In this review, recent biochemical and cell biology studies highlighting the chaperoning activity of the coenzyme on folding-defective variants of PLP-enzymes associated with rare diseases are presented and discussed. Copyright © 2013 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.
Intestinal triacylglycerol synthesis in fat absorption and systemic energy metabolism.
Yen, Chi-Liang Eric; Nelson, David W; Yen, Mei-I
2015-03-01
The intestine plays a prominent role in the biosynthesis of triacylglycerol (triglyceride; TAG). Digested dietary TAG is repackaged in the intestine to form the hydrophobic core of chylomicrons, which deliver metabolic fuels, essential fatty acids, and other lipid-soluble nutrients to the peripheral tissues. By controlling the flux of dietary fat into the circulation, intestinal TAG synthesis can greatly impact systemic metabolism. Genes encoding many of the enzymes involved in TAG synthesis have been identified. Among TAG synthesis enzymes, acyl-CoA:monoacylglycerol acyltransferase 2 and acyl-CoA:diacylglycerol acyltransferase (DGAT)1 are highly expressed in the intestine. Their physiological functions have been examined in the context of whole organisms using genetically engineered mice and, in the case of DGAT1, specific inhibitors. An emerging theme from recent findings is that limiting the rate of TAG synthesis in the intestine can modulate gut hormone secretion, lipid metabolism, and systemic energy balance. The underlying mechanisms and their implications for humans are yet to be explored. Pharmacological inhibition of TAG hydrolysis in the intestinal lumen has been employed to combat obesity and associated disorders with modest efficacy and unwanted side effects. The therapeutic potential of inhibiting specific enzymes involved in intestinal TAG synthesis warrants further investigation. Copyright © 2015 by the American Society for Biochemistry and Molecular Biology, Inc.
Synthesis of Triamino Acid Building Blocks with Different Lipophilicities
Maity, Jyotirmoy; Honcharenko, Dmytro; Strömberg, Roger
2015-01-01
To obtain different amino acids with varying lipophilicity and that can carry up to three positive charges we have developed a number of new triamino acid building blocks. One set of building blocks was achieved by aminoethyl extension, via reductive amination, of the side chain of ortnithine, diaminopropanoic and diaminobutanoic acid. A second set of triamino acids with the aminoethyl extension having hydrocarbon side chains was synthesized from diaminobutanoic acid. The aldehydes needed for the extension by reductive amination were synthesized from the corresponding Fmoc-L-2-amino fatty acids in two steps. Reductive amination of these compounds with Boc-L-Dab-OH gave the C4-C8 alkyl-branched triamino acids. All triamino acids were subsequently Boc-protected at the formed secondary amine to make the monomers appropriate for the N-terminus position when performing Fmoc-based solid-phase peptide synthesis. PMID:25876040
The role of CYP26 enzymes in retinoic acid clearance.
Thatcher, Jayne E; Isoherranen, Nina
2009-08-01
Retinoic acid (RA) is a critical signaling molecule that regulates gene transcription and the cell cycle. Understanding of RA signaling has increased dramatically over the past decades, but the connection between whole body RA homeostasis and gene regulation in individual cells is still unclear. It has been proposed that cytochrome P450 family 26 (CYP26) enzymes have a role in determining the cellular exposure to RA by inactivating RA in cells that do not need RA. The CYP26 enzymes have been shown to metabolize RA efficiently and they are also inducible by RA in selected systems. However, their expression patterns in different cell types and a mechanistic understanding of their function is still lacking. Based on preliminary kinetic data and protein expression levels, one may predict that if CYP26A1 is expressed in the liver at even very low levels, it will be the major RA hydroxylase in this tissue. As such, it is an attractive pharmacological target for drug development when one aims to increase circulating or cellular RA concentrations. To further the understanding of how CYP26 enzymes contribute to the regulation of RA homeostasis, structural information of the CYP26s, commercially available recombinant enzymes and good specific and sensitive antibodies are needed.
The role of CYP26 enzymes in retinoic acid clearance
Thatcher, Jayne E.; Isoherranen, Nina
2009-01-01
Retinoic acid (RA) is a critical signaling molecule that regulates gene transcription and the cell cycle. Understanding of RA signaling has increased dramatically over the past decades, but the connection between whole body RA homeostasis and gene regulation in individual cells is still unclear. It has been proposed that cytochrome P450 family 26 (CYP26) enzymes have a role in determining the cellular exposure to RA by inactivating RA in cells that do not need RA. The CYP26 enzymes have been shown to metabolize RA efficiently and they are also inducible by RA in selected systems. However, their expression patterns in different cell types and a mechanistic understanding of their function is still lacking. Based on preliminary kinetic data and protein expression levels, one may predict that if CYP26A1 is expressed in the liver at even very low levels, it will be the major RA hydroxylase in this tissue. As such, it is an attractive pharmacological target for drug development when one aims to increase circulating or cellular RA concentrations. To further the understanding of how CYP26 enzymes contribute to the regulation of RA homeostasis, structural information of the CYP26’s, commercially available recombinant enzymes and good specific and sensitive antibodies are needed. PMID:19519282
NASA Technical Reports Server (NTRS)
Lowry, O. H.; Krasnov, I.; Ilyina-Kakueva, E. I.; Nemeth, P. M.; McDougal, D. B., Jr.; Choksi, R.; Carter, J. G.; Chi, M. M. Y.; Manchester, J. K.; Pusateri, M. E.
1994-01-01
Six key metabolic enzymes plus glutaminase and glutamate decarboxylase, as well as glutamate, aspartate and GABA, were measured in 11 regions of the hippocampal formation of synchronous, flight and tail suspension rats. Major differences were observed in the normal distribution patterns of each enzyme and amino acid, but no substantive effects of either microgravity or tail suspension on these patterns were clearly demonstrated.
Enhanced Synthesis of Alkyl Amino Acids in Miller's 1958 H2S Experiment
NASA Technical Reports Server (NTRS)
Parker, Eric T.; Cleaves, H. James; Callahan, Michael P.; Dworkin, James P.; Glavin, Daniel P.; Lazcano, Antonio; Bada, Jeffrey L.
2011-01-01
Stanley Miller's 1958 H2S-containing experiment, which included a simulated prebiotic atmosphere of methane (CH4), ammonia (NH3), carbon dioxide (CO2), and hydrogen sulfide (H2S) produced several alkyl amino acids, including the alpha-, beta-, and gamma-isomers of aminobutyric acid (ABA) in greater relative yields than had previously been reported from his spark discharge experiments. In the presence of H2S, aspariic and glutamic acids could yield alkyl amino acids via the formation of thioimide intermediates. Radical chemistry initiated by passing H2S through a spark discharge could have also enhanced alkyl amino acid synthesis by generating alkyl radicals that can help form the aldehyde and ketone precursors to these amino acids. We propose mechanisms that may have influenced the synthesis of certain amino acids in localized environments rich in H2S and lightning discharges, similar to conditions near volcanic systems on the early Earth, thus contributing to the prebiotic chemical inventory of the primordial Earth.
Hermes, Fatemah A; Cronan, John E
2013-10-01
The covalent attachment of lipoate to the lipoyl domains (LDs) of the central metabolism enzymes pyruvate dehydrogenase (PDH) and oxoglutarate dehydrogenase (OGDH) is essential for their activation and thus for respiratory growth in Saccharomyces cerevisiae. A third lipoate-dependent enzyme system, the glycine cleavage system (GCV), is required for utilization of glycine as a nitrogen source. Lipoate is synthesized by extraction of its precursor, octanoyl-acyl carrier protein (ACP), from the pool of fatty acid biosynthetic intermediates. Alternatively, lipoate is salvaged from previously modified proteins or from growth medium by lipoate protein ligases (Lpls). The first Lpl to be characterized, LplA of Escherichia coli, catalyses two partial reactions: activation of the acyl chain by formation of acyl-AMP, followed by transfer of the acyl chain to lipoyl domains (LDs). There is a surprising diversity within the Lpl family of enzymes, several of which catalyse reactions other than ligation reactions. For example, the Bacillus subtilis Lpl homologue LipM is an octanoyltransferase that transfers the octanoyl moiety from octanoyl-ACP to GCV. Another B. subtilis Lpl homologue, LipL, transfers octanoate from octanoyl-GCV to other LDs in an amido-transfer reaction. Study of eukaryotic Lpls has lagged behind studies of the bacterial enzymes. We report that the Lip3 Lpl homologue of the yeast S. cerevisiae has octanoyl-CoA-protein transferase activity, and discuss implications of this activity on the physiological role of Lip3 in lipoate synthesis. Published 2013. This article is a U.S. Government work and is in the public domain in the USA.
Structure-based mechanism of lipoteichoic acid synthesis by Staphylococcus aureus LtaS
Lu, Duo; Wörmann, Mirka E.; Zhang, Xiaodong; Schneewind, Olaf; Gründling, Angelika; Freemont, Paul S.
2009-01-01
Staphylococcus aureus synthesizes polyglycerol-phosphate lipoteichoic acid (LTA) from phosphatidylglycerol. LtaS, a predicted membrane protein with 5 N-terminal transmembrane helices followed by a large extracellular part (eLtaS), is required for staphylococcal growth and LTA synthesis. Here, we report the first crystal structure of the eLtaS domain at 1.2-Å resolution and show that it assumes a sulfatase-like fold with an α/β core and a C-terminal part composed of 4 anti-parallel β-strands and a long α-helix. Overlaying eLtaS with sulfatase structures identified active site residues, which were confirmed by alanine substitution mutagenesis and in vivo enzyme function assays. The cocrystal structure with glycerol-phosphate and the coordination of a Mn2+ cation allowed us to propose a reaction mechanism, whereby the active site threonine of LtaS functions as nucleophile for phosphatidylglycerol hydrolysis and formation of a covalent threonine–glycerolphosphate intermediate. These results will aid in the development of LtaS-specific inhibitors for S. aureus and many other Gram-positive pathogens. PMID:19168632
Ma, Jun; Yan, Ruilan; Zu, Xuyu; Cheng, Ji-Ming; Rao, Krishna; Liao, Duan-Fang; Cao, Deliang
2008-02-08
Recent studies have demonstrated that aldo-keto reductase family 1 B10 (AKR1B10), a novel protein overexpressed in human hepatocellular carcinoma and non-small cell lung carcinoma, may facilitate cancer cell growth by detoxifying intracellular reactive carbonyls. This study presents a novel function of AKR1B10 in tumorigenic mammary epithelial cells (RAO-3), regulating fatty acid synthesis. In RAO-3 cells, Sephacryl-S 300 gel filtration and DEAE-Sepharose ion exchange chromatography demonstrated that AKR1B10 exists in two distinct forms, monomers (approximately 40 kDa) bound to DEAE-Sepharose column and protein complexes (approximately 300 kDa) remaining in flow-through. Co-immunoprecipitation with AKR1B10 antibody and protein mass spectrometry analysis identified that AKR1B10 associates with acetyl-CoA carboxylase-alpha (ACCA), a rate-limiting enzyme of de novo fatty acid synthesis. This association between AKR1B10 and ACCA proteins was further confirmed by co-immunoprecipitation with ACCA antibody and pulldown assays with recombinant AKR1B10 protein. Intracellular fluorescent studies showed that AKR1B10 and ACCA proteins co-localize in the cytoplasm of RAO-3 cells. More interestingly, small interfering RNA-mediated AKR1B10 knock down increased ACCA degradation through ubiquitination-proteasome pathway and resulted in >50% decrease of fatty acid synthesis in RAO-3 cells. These data suggest that AKR1B10 is a novel regulator of the biosynthesis of fatty acid, an essential component of the cell membrane, in breast cancer cells.
Fatty acid metabolism in breast cancer subtypes
Monaco, Marie E.
2017-01-01
Dysregulation of fatty acid metabolism is recognized as a component of malignant transformation in many different cancers, including breast; yet the potential for targeting this pathway for prevention and/or treatment of cancer remains unrealized. Evidence indicates that proteins involved in both synthesis and oxidation of fatty acids play a pivotal role in the proliferation, migration and invasion of breast cancer cells. The following essay summarizes data implicating specific fatty acid metabolic enzymes in the genesis and progression of breast cancer, and further categorizes the relevance of specific metabolic pathways to individual intrinsic molecular subtypes of breast cancer. Based on mRNA expression data, the less aggressive luminal subtypes appear to rely on a balance between de novo fatty acid synthesis and oxidation as sources for both biomass and energy requirements, while basal-like, receptor negative subtypes overexpress genes involved in the utilization of exogenous fatty acids. With these differences in mind, treatments may need to be tailored to individual subtypes. PMID:28412757
NASA Astrophysics Data System (ADS)
Wu, Hai-Yan; Zhang, Xiao-Li; Chen, Xi; Chen, Ya; Zheng, Xiu-Cheng
2014-03-01
MCM-48 and tungstophosphoric acid (HPW) were prepared and applied for the synthesis of HPW/MCM-48 mesoporous materials. The characterization results showed that HPW/MCM-48 obtained retained the typical mesopore structure of MCM-48, and the textural parameters decreased with the increase loading of HPW. The catalytic oxidation results of benzyl alcohol and benzaldehyde with 30% H2O2 indicated that HPW/MCM-48 was an efficient catalyst for the green synthesis of benzoic acid. Furthermore, 35 wt% HPW/MCM-48 sample showed the highest activity under the reaction conditions.
Cheng, Jie; Huang, Yuding; Mi, Le; Chen, Wujiu; Wang, Dan; Wang, Qinhong
2018-05-10
Deficiency in petroleum resources and increasing environmental concerns have pushed a bio-based economy to be built, employing a highly reproducible, metal contaminant free, sustainable and green biomanufacturing method. Here, a chiral drug intermediate L-pipecolic acid has been synthesized from biomass-derived lysine. This artificial bioconversion system involves the coexpression of four functional genes, which encode L-lysine α-oxidase from Scomber japonicus, glucose dehydrogenase from Bacillus subtilis, Δ 1 -piperideine-2-carboxylase reductase from Pseudomonas putida, and lysine permease from Escherichia coli. Besides, a lysine degradation enzyme has been knocked out to strengthen the process in this microbe. The overexpression of LysP improved the L-pipecolic acid titer about 1.6-folds compared to the control. This engineered microbial factory showed the highest L-pipecolic acid production of 46.7 g/L reported to date and a higher productivity of 2.41 g/L h and a yield of 0.89 g/g. This biotechnological L-pipecolic acid production is a simple, economic, and green technology to replace the presently used chemical synthesis.
Zanon, Nathaly C M; Oliveira, Osvaldo N; Caseli, Luciano
2012-05-01
Preserving the enzyme structure in solid films is key for producing various bioelectronic devices, including biosensors, which has normally been performed with nanostructured films that allow for control of molecular architectures. In this paper, we investigate the adsorption of uricase onto Langmuir monolayers of stearic acid (SA), and their transfer to solid supports as Langmuir-Blodgett (LB) films. Structuring of the enzyme in β-sheets was preserved in the form of 1-layer LB film, which was corroborated with a higher catalytic activity than for other uricase-containing LB film architectures where the β-sheets structuring was not preserved. The optimized architecture was also used to detect uric acid within a range covering typical concentrations in the human blood. The approach presented here not only allows for an optimized catalytic activity toward uric acid but also permits one to explain why some film architectures exhibit a superior performance. Copyright © 2011 Elsevier Inc. All rights reserved.
Thyroid hormone reduces PCSK9 and stimulates bile acid synthesis in humans[S
Bonde, Ylva; Breuer, Olof; Lütjohann, Dieter; Sjöberg, Stefan; Angelin, Bo; Rudling, Mats
2014-01-01
Reduced plasma LDL-cholesterol is a hallmark of hyperthyroidism and is caused by transcriptional stimulation of LDL receptors in the liver. Here, we investigated whether thyroid hormone (TH) actions involve other mechanisms that may also account for the reduction in LDL-cholesterol, including effects on proprotein convertase subtilisin/kexin type 9 (PCSK9) and bile acid synthesis. Twenty hyperthyroid patients were studied before and after clinical normalization, and the responses to hyperthyroidism were compared with those in 14 healthy individuals after 14 days of treatment with the liver-selective TH analog eprotirome. Both hyperthyroidism and eprotirome treatment reduced circulating PCSK9, lipoprotein cholesterol, apoB and AI, and lipoprotein(a), while cholesterol synthesis was stable. Hyperthyroidism, but not eprotirome treatment, markedly increased bile acid synthesis and reduced fibroblast growth factor (FGF) 19 and dietary cholesterol absorption. Eprotirome treatment, but not hyperthyroidism, reduced plasma triglycerides. Neither hyperthyroidism nor eprotirome treatment altered insulin, glucose, or FGF21 levels. TH reduces circulating PSCK9, thereby likely contributing to lower plasma LDL-cholesterol in hyperthyroidism. TH also stimulates bile acid synthesis, although this response is not critical for its LDL-lowering effect. PMID:25172631
Mitochondrial fatty acid synthesis, fatty acids and mitochondrial physiology.
Kastaniotis, Alexander J; Autio, Kaija J; Kerätär, Juha M; Monteuuis, Geoffray; Mäkelä, Anne M; Nair, Remya R; Pietikäinen, Laura P; Shvetsova, Antonina; Chen, Zhijun; Hiltunen, J Kalervo
2017-01-01
Mitochondria and fatty acids are tightly connected to a multiplicity of cellular processes that go far beyond mitochondrial fatty acid metabolism. In line with this view, there is hardly any common metabolic disorder that is not associated with disturbed mitochondrial lipid handling. Among other aspects of mitochondrial lipid metabolism, apparently all eukaryotes are capable of carrying out de novo fatty acid synthesis (FAS) in this cellular compartment in an acyl carrier protein (ACP)-dependent manner. The dual localization of FAS in eukaryotic cells raises the questions why eukaryotes have maintained the FAS in mitochondria in addition to the "classic" cytoplasmic FAS and what the products are that cannot be substituted by delivery of fatty acids of extramitochondrial origin. The current evidence indicates that mitochondrial FAS is essential for cellular respiration and mitochondrial biogenesis. Although both β-oxidation and FAS utilize thioester chemistry, CoA acts as acyl-group carrier in the breakdown pathway whereas ACP assumes this role in the synthetic direction. This arrangement metabolically separates these two pathways running towards opposite directions and prevents futile cycling. A role of this pathway in mitochondrial metabolic sensing has recently been proposed. This article is part of a Special Issue entitled: Lipids of Mitochondria edited by Guenther Daum. Copyright © 2016 Elsevier B.V. All rights reserved.
Optimization of the Synthesis of Structured Phosphatidylcholine with Medium Chain Fatty Acid.
Ochoa-Flores, Angélica A; Hernández-Becerra, Josafat A; Cavazos-Garduño, Adriana; Vernon-Carter, Eduardo J; García, Hugo S
2017-11-01
Structured phosphatidylcholine was successfully produced by acidolysis between phosphatidylcholine and free medium chain fatty acid, using phospholipase A 1 immobilized on Duolite A568. Response surface methodology was applied to optimize the reaction system using three process parameters: molar ratio of substrates (phosphatidylcholine to free medium chain fatty acid), enzyme loading, and reaction temperature. All parameters evaluated showed linear and quadratic significant effects on the production of modified phosphatidylcholine; molar ratio of substrates contributed positively, but temperature influenced negatively. Increased enzyme loading also led to increased production of modified phosphatidylcholine but only during the first 9 hours of the acidolysis reaction. Optimal conditions obtained from the model were a ratio of phosphatidylcholine to free medium chain fatty acid of 1:15, an enzyme loading of 12%, and a temperature of 45°C. Under these conditions a production of modified phosphatidylcholine of 52.98 % were obtained after 24 h of reaction. The prediction was confirmed from the verification experiments; the production of modified phosphatidylcholine was 53.02%, the total yield of phosphatidylcholine 64.28% and the molar incorporation of medium chain fatty acid was 42.31%. The acidolysis reaction was scaled-up in a batch reactor with a similar production of modified phosphatidylcholine, total yield of phosphatidylcholine and molar incorporation of medium chain fatty acid. Purification by column chromatography of the structured phosphatidylcholine yielded 62.53% of phosphatidylcholine enriched with 42.52% of medium chain fatty acid.
Mancini, Stefano; Imlay, James A
2015-05-01
Hydrogen peroxide pervades many natural environments, including the phagosomes that mediate cell-based immunity. Transcriptomic analysis showed that during protracted low-grade H(2)O(2) stress, Escherichia coli responds by activating both the OxyR defensive regulon and the Fur iron-starvation response. OxyR induced synthesis of two members of the nine-step heme biosynthetic pathway: ferrochelatase (HemH) and an isozyme of coproporphyrinogen III oxidase (HemF). Mutations that blocked either adaptation caused the accumulation of porphyrin intermediates, inadequate activation of heme enzymes, low catalase activity, defective clearance of H(2)O(2) and a failure to grow. Genetic analysis indicated that HemH induction is needed to compensate for iron sequestration by the mini-ferritin Dps. Dps activity protects DNA and proteins by limiting Fenton chemistry, but it interferes with the ability of HemH to acquire the iron that it needs to complete heme synthesis. HemF is a manganoprotein that displaces HemN, an iron-sulfur enzyme whose synthesis and/or stability is apparently problematic during H(2)O(2) stress. Thus, the primary responses to H(2)O(2), including the sequestration of iron, require compensatory adjustments in the mechanisms of iron-cofactor synthesis. The results support the growing evidence that oxidative stress is primarily an iron pathology. © 2015 John Wiley & Sons Ltd.
Reduction of α-oxo carboxyylic acids by pigeon liver `malic' enzyme
Tang, Chung L.; Hsu, Robert Y.
1973-01-01
1. Pigeon liver `malic' enzyme [l-malate–NADP+ oxidoreductase (decarboxylating); EC 1.1.1.40] was shown to catalyse the reductase reaction: [Formula: see text] l-Malate was identified as the reaction product, and was formed in stoicheiometric amount. 2. In addition to oxaloacetate and pyruvate, a number of other α-oxo carboxylic acids were also reduced. PMID:4764261
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hugenberg, S.T.; Myers, S.L.; Brandt, K.D.
1989-04-01
We recently found that injection of 2 mCi of yttrium 90 (90Y; approximately 23,000 rads) into normal canine knees stimulated glycosaminoglycan (GAG) synthesis by femoral condylar cartilage. The present investigation was conducted to determine whether radiation affects cartilage metabolism directly. Rates of GAG synthesis and degradation in normal canine articular cartilage were studied following irradiation. Cultured synovium from the same knees was treated similarly, to determine the effects of irradiation on hyaluronic acid synthesis. Twenty-four hours after exposure to 1,000 rads, 10,000 rads, or 50,000 rads, 35S-GAG synthesis by the cartilage was 93%, 69%, and 37%, respectively, of that inmore » control, nonirradiated cartilage. The effect was not rapidly reversible: 120 hours after exposure to 50,000 rads, GAG synthesis remained at only 28% of the control level. Autoradiography showed marked suppression of 35S uptake by chondrocytes after irradiation. Cartilage GAG degradation was also increased following irradiation: 4 hours and 8 hours after exposure to 50,000 rads, the cartilage GAG concentration was only 66% and 54%, respectively, of that at time 0, while corresponding values for control, nonirradiated cartilage were 90% and 87%. In contrast to its effects on cartilage GAG metabolism, radiation at these levels had no effect on synovial hyaluronic acid synthesis.« less
Synthesis of Rosin Acid Starch Catalyzed by Lipase
Lin, Rihui; Li, He; Long, Han; Su, Jiating; Huang, Wenqin
2014-01-01
Rosin, an abundant raw material from pine trees, was used as a starting material directly for the synthesis of rosin acid starch. The esterification reaction was catalyzed by lipase (Novozym 435) under mild conditions. Based on single factor experimentation, the optimal esterification conditions were obtained as follows: rosin acid/anhydrous glucose unit in the molar ratio 2 : 1, reaction time 4 h at 45°C, and 15% of lipase dosage. The degree of substitution (DS) reaches 0.098. Product from esterification of cassava starch with rosin acid was confirmed by FTIR spectroscopy and iodine coloration analysis. Scanning electron microscopy and X-ray diffraction analysis showed that the morphology and crystallinity of the cassava starch were largely destroyed. Thermogravimetric analysis indicated that thermal stability of rosin acid starch decreased compared with native starch. PMID:24977156
Tasdemir, Deniz; Sanabria, David; Lauinger, Ina L; Tarun, Alice; Herman, Rob; Perozzo, Remo; Zloh, Mire; Kappe, Stefan H; Brun, Reto; Carballeira, Néstor M
2010-11-01
Acetylenic fatty acids are known to display several biological activities, but their antimalarial activity has remained unexplored. In this study, we synthesized the 2-, 5-, 6-, and 9-hexadecynoic acids (HDAs) and evaluated their in vitro activity against erythrocytic (blood) stages of Plasmodium falciparum and liver stages of Plasmodium yoelii infections. Since the type II fatty acid biosynthesis pathway (PfFAS-II) has recently been shown to be indispensable for liver stage malaria parasites, the inhibitory potential of the HDAs against multiple P. falciparum FAS-II (PfFAS-II) elongation enzymes was also evaluated. The highest antiplasmodial activity against blood stages of P. falciparum was displayed by 5-HDA (IC(50) value 6.6 μg/ml), whereas the 2-HDA was the only acid arresting the growth of liver stage P. yoelii infection, in both flow cytometric assay (IC(50) value 2-HDA 15.3 μg/ml, control drug atovaquone 2.5 ng/ml) and immunofluorescence analysis (IC(50) 2-HDA 4.88 μg/ml, control drug atovaquone 0.37 ng/ml). 2-HDA showed the best inhibitory activity against the PfFAS-II enzymes PfFabI and PfFabZ with IC(50) values of 0.38 and 0.58 μg/ml (IC(50) control drugs 14 and 30 ng/ml), respectively. Enzyme kinetics and molecular modeling studies revealed valuable insights into the binding mechanism of 2-HDA on the target enzymes. All HDAs showed in vitro activity against Trypanosoma brucei rhodesiense (IC(50) values 3.7-31.7 μg/ml), Trypanosoma cruzi (only 2-HDA, IC(50) 20.2 μg/ml), and Leishmania donovani (IC(50) values 4.1-13.4 μg/ml) with generally low or no significant toxicity on mammalian cells. This is the first study to indicate therapeutic potential of HDAs against various parasitic protozoa. It also points out that the malarial liver stage growth inhibitory effect of the 2-HDA may be promoted via PfFAS-II enzymes. The lack of cytotoxicity, lipophilic nature, and calculated pharmacokinetic properties suggests that 2-HDA could be a useful compound to
Tasdemir, Deniz; Sanabria, David; Lauinger, Ina L.; Tarun, Alice; Herman, Rob; Perozzo, Remo; Zloh, Mire; Kappe, Stefan H.; Brun, Reto; Carballeira, Néstor M.
2010-01-01
Acetylenic fatty acids are known to display several biological activities, but their antimalarial activity has remained unexplored. In this study, we synthesized the 2-, 5-, 6-, and 9-hexadecynoic acids (HDAs) and evaluated their in vitro activity against erythrocytic (blood) stages of Plasmodium falciparum and liver stages of P. yoelii infections. Since the type II fatty acid biosynthesis pathway (PfFAS-II) has recently been shown to be indispensable for liver stage malaria parasites, the inhibitory potential of the HDAs against multiple P. falciparum FAS-II (PfFAS-II) elongation enzymes was also evaluated. The highest antiplasmodial activity against blood stages of P. falciparum was displayed by 5-HDA (IC50 value 6.6. μg/ml), whereas the 2-HDA was the only acid arresting the growth of liver stage P. yoelii infection, in both flow cytometric assay (IC50 value 2-HDA 15.3 μg/ml, control drug atovaquone 2.5 ng/ml) and immunofluorescense analysis (IC50 2-HDA 4.88 μg/ml, control drug atovaquone 0.37 ng/ml). 2-HDA showed the best inhibitory against the PfFAS-II enzymes PfFabI and PfFabZ with IC50 values of 0.38 and 0.58 μg/ml (IC50 control drugs 14 and 30 ng/ml) respectively. Enzyme kinetics and molecular modeling studies revealed valuable insights into the binding mechanism of 2-HDA on the target enzymes. All HDAs showed in vitro activity against Trypanosoma brucei rhodesiense (IC50 values 3.7–31.7 μg/ml), Trypanosoma cruzi (only 2-HDA, IC50 20.2 μg/ml), and Leishmania donovani (IC50 values 4.1–13.4 μg/ml) with generally low or no significant toxicity on mammalian cells. This is the first study to indicate therapeutic potential of HDAs against various parasitic protozoa. It also points out that the malarial liver stage growth inhibitory effect of the 2-HDA may be promoted via PfFAS-II enzymes. The lack of cytotoxicity, lipophilic nature and calculated pharmacokinetic properties suggest that 2-HDA could be a useful compound to study the interaction of fatty
Amino acid substrates impose polyamine, eIF5A, or hypusine requirement for peptide synthesis
Shin, Byung-Sik; Katoh, Takayuki; Gutierrez, Erik; Kim, Joo-Ran; Suga, Hiroaki
2017-01-01
Abstract Whereas ribosomes efficiently catalyze peptide bond synthesis by most amino acids, the imino acid proline is a poor substrate for protein synthesis. Previous studies have shown that the translation factor eIF5A and its bacterial ortholog EF-P bind in the E site of the ribosome where they contact the peptidyl-tRNA in the P site and play a critical role in promoting the synthesis of polyproline peptides. Using misacylated Pro-tRNAPhe and Phe-tRNAPro, we show that the imino acid proline and not tRNAPro imposes the primary eIF5A requirement for polyproline synthesis. Though most proline analogs require eIF5A for efficient peptide synthesis, azetidine-2-caboxylic acid, a more flexible four-membered ring derivative of proline, shows relaxed eIF5A dependency, indicating that the structural rigidity of proline might contribute to the requirement for eIF5A. Finally, we examine the interplay between eIF5A and polyamines in promoting translation elongation. We show that eIF5A can obviate the polyamine requirement for general translation elongation, and that this activity is independent of the conserved hypusine modification on eIF5A. Thus, we propose that the body of eIF5A functionally substitutes for polyamines to promote general protein synthesis and that the hypusine modification on eIF5A is critically important for poor substrates like proline. PMID:28637321
Synthesis and properties of fatty acid starch esters.
Winkler, Henning; Vorwerg, Waltraud; Wetzel, Hendrik
2013-10-15
Being completely bio-based, fatty acid starch esters (FASEs) are attractive materials that represent an alternative to crude oil-based plastics. In this study, two synthesis methods were compared in terms of their efficiency, toxicity and, especially, product solubility with starch laurate (C12) as model compound. Laurates (DS>2) were obtained through transesterification of fatty acid vinylesters in DMSO or reaction with fatty acid chlorides in pyridine. The latter lead to higher DS-values in a shorter reaction time. But due to the much better solubility of the products compared to lauroyl chloride esterified ones, vinylester-transesterification was preferred to optimize reaction parameters, where reaction time could be shortened to 2h. FASEs C6-C18 were also successfully prepared via transesterification. To determine the DS of the resulting starch laurates, the efficient ATR-IR method was compared with common methods (elementary analysis, (1)H NMR). Molar masses (Mw) of the highly soluble starch laurates were analyzed using SEC-MALLS (THF). High recovery rates (>80%) attest to the outstanding solubility of products obtained through transesterification, caused by a slight disintegration during synthesis. Particle size distributions (DLS) demonstrated stable dissolutions in CHCl3 of vinyl laurate esterified - contrary to lauroyl chloride esterified starch. For all highly soluble FASEs (C6-C18), formation of concentrated solutions (10 wt%) is feasible. Copyright © 2013 Elsevier Ltd. All rights reserved.
Liu, Lin; Yang, DongFeng; Liang, TongYao; Zhang, HaiHua; He, ZhiGui; Liang, ZongSuo
2016-09-01
Phosphate starvation increased the production of phenolic acids by inducing the key enzyme genes in a positive feedback pathway in Saliva miltiorrhiza hairy roots. SPX may be involved in this process. Salvia miltiorrhiza is a wildly popular traditional Chinese medicine used for the treatment of coronary heart diseases and inflammation. Phosphate is an essential plant macronutrient that is often deficient, thereby limiting crop yield. In this study, we investigated the effects of phosphate concentration on the biomass and accumulation of phenolic acid in S. miltiorrhiza. Results show that 0.124 mM phosphate was favorable for plant growth. Moreover, 0.0124 mM phosphate was beneficial for the accumulation of phenolic acids, wherein the contents of danshensu, caffeic acid, rosmarinic acid, and salvianolic acid B were, respectively, 2.33-, 1.02-, 1.68-, and 2.17-fold higher than that of the control. By contrast, 12.4 mM phosphate inhibited the accumulation of phenolic acids. The key enzyme genes in the phenolic acid biosynthesis pathway were investigated to elucidate the mechanism of phosphate starvation-induced increase of phenolic acids. The results suggest that phosphate starvation induced the gene expression from the downstream pathway to the upstream pathway, i.e., a feedback phenomenon. In addition, phosphate starvation response gene SPX (SYG1, Pho81, and XPR1) was promoted by phosphate deficiency (0.0124 mM). We inferred that SPX responded to phosphate starvation, which then affected the expression of later responsive key enzyme genes in phenolic acid biosynthesis, resulting in the accumulation of phenolic acids. Our findings provide a resource-saving and environmental protection strategy to increase the yield of active substance in herbal preparations. The relationship between SPX and key enzyme genes and the role they play in phenolic acid biosynthesis during phosphate deficiency need further studies.
Parthasarathy, P; Vivekanandan, S
2018-12-01
Uric acid biosensors for arthritis disease has been developed for the specific selection of uricase enzyme film thickness coated over the TiO 2 -CeO 2 nano-composite matrix is modelled mathematically. This model is purely based on R-diffusion conditions with irreversible first-order catalytic reactions. By arithmetical method, the impact of the thickness of enzyme layer on the current response of the biosensor was explored. This article displays a structure for choice of the enzyme layer thickness, guaranteeing the adequately stable sensitivity of a biosensor in a required extent of the maximal enzymatic rate. The numerical outcomes showed subjective and sensible quantitative information for oxidation current due to uric acid also shows the maximum change in the biosensor current response due to the change in membrane thickness, which will be more suitable for uric acid biosensor for the application of arthritis disease diagnosis.
PdhR, the pyruvate dehydrogenase repressor, does not regulate lipoic acid synthesis.
Feng, Youjun; Cronan, John E
2014-01-01
Lipoic acid is a covalently-bound enzyme cofactor required for central metabolism all three domains of life. In the last 20 years the pathway of lipoic acid synthesis and metabolism has been established in Escherichia coli. Expression of the genes of the lipoic acid biosynthesis pathway was believed to be constitutive. However, in 2010 Kaleta and coworkers (BMC Syst. Biol. 4:116) predicted a binding site for the pyruvate dehydrogenase operon repressor, PdhR (referred to lipA site 1) upstream of lipA, the gene encoding lipoic acid synthase and concluded that PdhR regulates lipA transcription. We report in vivo and in vitro evidence that lipA is not controlled by PdhR and that the putative regulatory site deduced by the prior workers is nonfunctional and physiologically irrelevant. E. coli PdhR was purified to homogeneity and used for electrophoretic mobility shift assays. The lipA site 1 of Kaleta and coworkers failed to bind PdhR. The binding detected by these workers is due to another site (lipA site 3) located far upstream of the lipA promoter. Relative to the canonical PdhR binding site lipA site 3 is a half-palindrome and as expected had only weak PdhR binding ability. Manipulation of lipA site 3 to construct a palindrome gave significantly enhanced PdhR binding affinity. The native lipA promoter and the version carrying the artificial lipA3 palindrome were transcriptionally fused to a LacZ reporter gene to directly assay lipA expression. Deletion of pdhR gave no significant change in lipA promoter-driven β-galactosidase activity with either the native or constructed palindrome upstream sequences, indicating that PdhR plays no physiological role in regulation of lipA expression. Copyright © 2014 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.
Wang, Xiao-Yun; Meng, Fan-Guo; Zhou, Hai-Meng
2004-03-01
The thermostability of an enzyme that exhibits phytase and acid phosphatase activities was studied. Kinetics of inactivation and unfolding during thermal denaturation of the enzyme were compared. The loss of phytase activity on thermal denaturation is most suggestive of a reversible process. As for acid phosphatase activities, an interesting phenomenon was observed; there are two phases in thermal inactivation: when the temperature was between 45 and 50 degrees C, the thermal inactivation could be characterized as an irreversible inactivation which had some residual activity and when the temperature was above 55 degrees C, the thermal inactivation could be characterized as an irreversible process which had no residual activity. The microscopic rate constants for the free enzyme and substrate-enzyme complex were determined by Tsou's method [Adv. Enzymol. Relat. Areas Mol. Biol. 61 (1988) 381]. Fluorescence analyses indicate that when the enzyme was treated at temperatures below 60 degrees C for 60 min, the conformation of the enzyme had no detectable change; when the temperatures were above 60 degrees C, some fluorescence red-shift could be observed with a decrease in emission intensity. The inactivation rates (k(+0)) of free enzymes were faster than those of conformational changes during thermal denaturation at the same temperature. The rapid inactivation and slow conformational changes of phytase during thermal denaturation suggest that inactivation occurs before significant conformational changes of the enzyme, and the active site of this enzyme is situated in a relatively fragile region which makes the active site more flexible than the molecule as a whole.
Repa, J J; Lund, E G; Horton, J D; Leitersdorf, E; Russell, D W; Dietschy, J M; Turley, S D
2000-12-15
Sterol 27-hydroxylase (CYP27) participates in the conversion of cholesterol to bile acids. We examined lipid metabolism in mice lacking the Cyp27 gene. On normal rodent chow, Cyp27(-/-) mice have 40% larger livers, 45% larger adrenals, 2-fold higher hepatic and plasma triacylglycerol concentrations, a 70% higher rate of hepatic fatty acid synthesis, and a 70% increase in the ratio of oleic to stearic acid in the liver versus Cyp27(+/+) controls. In Cyp27(-/-) mice, cholesterol 7alpha-hydroxylase activity is increased 5-fold, but bile acid synthesis and pool size are 47 and 27%, respectively, of those in Cyp27(+/+) mice. Intestinal cholesterol absorption decreases from 54 to 4% in knockout mice, while fecal neutral sterol excretion increases 2.5-fold. A compensatory 2.5-fold increase in whole body cholesterol synthesis occurs in Cyp27(-/-) mice, principally in liver, adrenal, small intestine, lung, and spleen. The mRNA for the cholesterogenic transcription factor sterol regulatory element-binding protein-2 (SREBP-2) and mRNAs for SREBP-2-regulated cholesterol biosynthetic genes are elevated in livers of mutant mice. In addition, the mRNAs encoding the lipogenic transcription factor SREBP-1 and SREBP-1-regulated monounsaturated fatty acid biosynthetic enzymes are also increased. Hepatic synthesis of fatty acids and accumulation of triacylglycerols increases in Cyp27(-/-) mice and is associated with hypertriglyceridemia. Cholic acid feeding reverses hepatomegaly and hypertriglyceridemia but not adrenomegaly in Cyp27(-/-) mice. These studies confirm the importance of CYP27 in bile acid synthesis and they reveal an unexpected function of the enzyme in triacylglycerol metabolism.
Tian, Guangming; Wang, Qin; Wei, Xuetuan; Ma, Xin; Chen, Shouwen
2017-04-01
Poly-γ-glutamic acid (γ-PGA), a natural biopolymer, is widely used in cosmetics, medicine, food, water treatment, and agriculture owing to its features of moisture sequestration, cation chelation, non-toxicity and biodegradability. Intracellular glutamic acid, the substrate of γ-PGA, is a limiting factor for high yield in γ-PGA production. Bacillus subtilis and Bacillus licheniformis are both important γ-PGA producing strains, and B. subtilis synthesizes glutamic acid in vivo using the unique GOGAT/GS pathway. However, little is known about the glutamate synthesis pathway in B. licheniformis. The aim of this work was to characterize the glutamate dehydrogenase (RocG) in glutamic acid synthesis from B. licheniformis with both in vivo and in vitro experiments. By re-directing the carbon flux distribution, the rocG gene deletion mutant WX-02ΔrocG produced intracellular glutamic acid with a concentration of 90ng/log(CFU), which was only 23.7% that of the wild-type WX-02 (380ng/log(CFU)). Furthermore, the γ-PGA yield of mutant WX-02ΔrocG was 5.37g/L, a decrease of 45.3% compared to the wild type (9.82g/L). In vitro enzymatic assays of RocG showed that RocG has higher affinity for 2-oxoglutarate than glutamate, and the glutamate synthesis rate was far above degradation. This is probably the first study to reveal the glutamic acid synthesis pathway and the specific functions of RocG in B. licheniformis. The results indicate that γ-PGA production can be enhanced through improving intracellular glutamic acid synthesis. Copyright © 2017 Elsevier Inc. All rights reserved.
Monosaccharides as Scaffolds for the Synthesis of Novel Compounds
NASA Astrophysics Data System (ADS)
Murphy, Paul V.; Velasco-Torrijos, Trinidad
This chapter focuses on monosaccharides and scaffolds their derivatives as scaffolds for the synthesis of primarily bioactive compounds. Such carbohydrate derivatives have been designed to modulate mainly protein-protein and peptide-protein interactions although modulators of carbohydrate-protein and carbohydrate-nucleic acid interactions have also been of interest. The multiple hydroxyl groups that are present on saccharides have made pyranose, furanose and iminosugars ideal templates or scaffolds to which recognition or pharmacophoric groups can be grafted to generate novel compounds for medicinal chemistry. The synthesis of compounds for evaluations require strategies for regioselective reactions of saccharide hydroxyl groups and use of orthogonally stable protecting groups. Syntheses have been carried out on the solid phase and in solution. Also the use of uronic acids, amino sugars and sugar amino acids has facilitated the synthesis of peptidomimetics and prospecting libraries as they enable, through presence of amino or carboxylic acid groups, chemoselective approaches to be employed in solution and on solid phase. Sugar amino acids are readily incorporated, as peptide isosteres, to generate sugar-peptide hybrids or for the synthesis of novel carbopeptoids . The synthesis of new cyclic compounds, derived in part from saccharides, and their application as scaffolds is an emerging area and recent examples include spirocyclic compounds, benzodiazepine-saccharide hybrids and macrolide-saccharide hybrids. Potent bioactive saccharide derivatives have been identified that include enzyme inhibitors , somatostatin receptor ligands, integrin ligands, anti-viral compounds, shiga toxin inhibitors and cell growth inhibitors. Some saccharide derivatives have demonstrated improved cellular permeability when compared with peptides and are in clinical trials.
Tian, Juan; He, Gen; Mai, Kangsen; Liu, Chengdong
2015-06-01
The goal of this study was to systematically evaluate the molecular activities of endocrine-, amino acid and peptide transporters-, and metabolic enzyme-related genes in 35-day-old mixed-sex zebrafish (Danio rerio) after feeding . Zebrafish with initial body weights ranging from 9 to 11 mg were fasted for 384 h in a controlled indoor environment. Fish were sampled at 0, 3, 6, 12, 24, 48, 96, 192, and 384 h after fed. Overall, the present study results show that the regulatory mechanism that insulin-like growth factor I negative feedback regulated growth hormone is conserved in zebrafish, as it is in mammals, but that regulation of growth hormone receptors is highly intricate. Leptin and cholecystokinin are time-dependent negative feedback signals, and neuropeptide Y may be an important positive neuropeptide for food intake in zebrafish. The amino acid/carnitine transporters B(0,+) (ATB(0,+)) and broad neutral (0) amino acid transporter 1(B(0)AT1) mRNA levels measured in our study suggest that protein may be utilized during 24-96 h of fasting in zebrafish. Glutamine synthetase mRNA levels were downregulated, and glutamate dehydrogenase, alanine aminotransferase, aspartate transaminase, and trypsin mRNA levels were upregulated after longtime fasting in this study. The mRNA expression levels of fatty acid synthetase decreased significantly (P < 0.05), whereas those of lipoprotein lipase rapidly increased after 96 h of fasting. Fasting activated the expression of glucose synthesis genes when fasting for short periods of time; when fasting is prolonged, the mRNA levels of glucose breakdown enzymes and pentose phosphate shunt genes decreased.
Enzyme Mimics: Advances and Applications.
Kuah, Evelyn; Toh, Seraphina; Yee, Jessica; Ma, Qian; Gao, Zhiqiang
2016-06-13
Enzyme mimics or artificial enzymes are a class of catalysts that have been actively pursued for decades and have heralded much interest as potentially viable alternatives to natural enzymes. Aside from having catalytic activities similar to their natural counterparts, enzyme mimics have the desired advantages of tunable structures and catalytic efficiencies, excellent tolerance to experimental conditions, lower cost, and purely synthetic routes to their preparation. Although still in the midst of development, impressive advances have already been made. Enzyme mimics have shown immense potential in the catalysis of a wide range of chemical and biological reactions, the development of chemical and biological sensing and anti-biofouling systems, and the production of pharmaceuticals and clean fuels. This Review concerns the development of various types of enzyme mimics, namely polymeric and dendrimeric, supramolecular, nanoparticulate and proteinic enzyme mimics, with an emphasis on their synthesis, catalytic properties and technical applications. It provides an introduction to enzyme mimics and a comprehensive summary of the advances and current standings of their applications, and seeks to inspire researchers to perfect the design and synthesis of enzyme mimics and to tailor their functionality for a much wider range of applications. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
A new mechanism for bile acid diarrhea: defective feedback inhibition of bile acid biosynthesis.
Walters, Julian R F; Tasleem, Ali M; Omer, Omer S; Brydon, W Gordon; Dew, Tracy; le Roux, Carel W
2009-11-01
Primary (idiopathic) bile acid malabsorption (BAM) is a common, yet underrecognized, chronic diarrheal syndrome. Diagnosis is difficult without selenium homocholic acid taurine (SeHCAT) testing. The diarrhea results from excess colonic bile acids, but the pathogenesis is unclear. Fibroblast growth factor 19 (FGF19), produced in the ileum in response to bile acid absorption, regulates hepatic bile acid synthesis. We proposed that FGF19 is involved in bile acid diarrhea and measured its levels in patients with BAM. Blood was collected from fasting patients with chronic diarrhea; BAM was diagnosed by SeHCAT. Serum FGF19 was measured by enzyme-linked immunosorbent assay. Serum 7alpha-hydroxy-4-cholesten-3-one (C4) was determined using high-performance liquid chromatography, to quantify bile acid synthesis. Data were compared between patients and subjects without diarrhea (controls). Samples were taken repeatedly after meals from several subjects. The median C4 level was significantly higher in patients with primary BAM than in controls (51 vs 18 ng/mL; P < .0001). The median FGF19 level was significantly lower in patients with BAM (120 vs 231 pg/mL; P < .0005). There was a significant inverse relationship between FGF19 and C4 levels (P < .0004). Low levels of FGF19 were also found in patients with postcholecystectomy and secondary bile acid diarrhea. Abnormal patterns of FGF19 levels were observed throughout the day in some patients with primary BAM. Patients with BAM have reduced serum FGF19 which may be useful in diagnosis. We propose a mechanism whereby impaired FGF19 feedback inhibition causes excessive bile acid synthesis that exceeds the normal capacity for ileal reabsorption, producing bile acid diarrhea.
Uraji, Misugi; Kimura, Masayo; Inoue, Yosikazu; Kawakami, Kayoko; Kumagai, Yuya; Harazono, Koichi; Hatanaka, Tadashi
2013-11-01
Ferulic acid (FA), which is present in the cell walls of some plants, is best known for its antioxidant property. By combining a commercial enzyme that shows FA esterase activity with several Streptomyces carbohydrate-hydrolyzing enzymes, we succeeded in enhancing the enzymatic production of FA from defatted rice bran. In particular, the combination of three xylanases, an α-L-arabinofuranosidase, and an acetyl xylan esterase from Streptomyces spp. produced the highest increase in the amount of released FAs among all the enzymes in the Streptomyces enzymes library. This enzyme combination also had an effect on FA production from other biomasses, such as raw rice bran, wheat bran, and corncob.
Matsuo, Ichiro; Kim, Sunhwa; Yamamoto, Yuichi; Ajisaka, Katsumi; Maruyama, Jun-ich; Nakajima, Harushi; Kitamoto, Katsuhiko
2003-03-01
We isolated a beta-N-acetylglucosaminidase encoding gene from the filamentous fungus Aspergillus oryzae, and designated it nagA. The nagA gene encoded a polypeptide of 600 amino acids with significant similarity to glucosaminidases and hexosaminidases of various eukaryotes. A. oryzae strain carrying the nagA gene under the control of the improved glaA promoter produced large amounts of beta-N-acetylglucosaminidase in a wheat bran solid culture. The beta-N-acetylglucosaminidase was purified from crude extracts of the solid culture by column chromatographies on Q-Sepharose and Sephacryl S-200. This enzyme was used for synthesis of lacto-N-triose II, which is contained in human milk. By reverse hydrolysis reaction, lacto-N-triose II and its positional isomer were synthesized from lactose and D-N-acetylglucosamine in 0.21% and 0.15% yield, respectively.
An update on the Enzyme Portal: an integrative approach for exploring enzyme knowledge
Onwubiko, J.; Zaru, R.; Rosanoff, S.; Antunes, R.; Bingley, M.; Watkins, X.; O'Donovan, C.; Martin, M. J.
2017-01-01
Abstract Enzymes are a key part of life processes and are increasingly important for various areas of research such as medicine, biotechnology, bioprocessing and drug research. The goal of the Enzyme Portal is to provide an interface to all European Bioinformatics Institute (EMBL-EBI) data about enzymes (de Matos, P., et al., (2013), BMC Bioinformatics, 14 (1), 103). These data include enzyme function, sequence features and family classification, protein structure, reactions, pathways, small molecules, diseases and the associated literature. The sources of enzyme data are: the UniProt Knowledgebase (UniProtKB) (UniProt Consortium, 2015), the Protein Data Bank in Europe (PDBe), (Valenkar, S., et al., Nucleic Acids Res.2016; 44, D385–D395) Rhea—a database of enzyme-catalysed reactions (Morgat, A., et al., Nucleic Acids Res. 2015; 43, D459-D464), Reactome—a database of biochemical pathways (Fabregat, A., et al., Nucleic Acids Res. 2016; 44, D481–D487), IntEnz—a resource with enzyme nomenclature information (Fleischmann, A., et al., Nucleic Acids Res. 2004 32, D434–D437) and ChEBI (Hastings, J., et al., Nucleic Acids Res. 2013) and ChEMBL (Bento, A. P., et al., Nucleic Acids Res. 201442, 1083–1090)—resources which contain information about small-molecule chemistry and bioactivity. This article describes the redesign of Enzyme Portal and the increased functionality added to maximise integration and interpretation of these data. Use case examples of the Enzyme Portal and the versatile workflows its supports are illustrated. We welcome the suggestion of new resources for integration. PMID:28158609
An update on the Enzyme Portal: an integrative approach for exploring enzyme knowledge.
Pundir, S; Onwubiko, J; Zaru, R; Rosanoff, S; Antunes, R; Bingley, M; Watkins, X; O'Donovan, C; Martin, M J
2017-03-01
Enzymes are a key part of life processes and are increasingly important for various areas of research such as medicine, biotechnology, bioprocessing and drug research. The goal of the Enzyme Portal is to provide an interface to all European Bioinformatics Institute (EMBL-EBI) data about enzymes (de Matos, P., et al. , (2013), BMC Bioinformatics , (1), 103). These data include enzyme function, sequence features and family classification, protein structure, reactions, pathways, small molecules, diseases and the associated literature. The sources of enzyme data are: the UniProt Knowledgebase (UniProtKB) (UniProt Consortium, 2015), the Protein Data Bank in Europe (PDBe), (Valenkar, S., et al ., Nucleic Acids Res. 2016; , D385-D395) Rhea-a database of enzyme-catalysed reactions (Morgat, A., et al ., Nucleic Acids Res. 2015; , D459-D464), Reactome-a database of biochemical pathways (Fabregat, A., et al ., Nucleic Acids Res. 2016; , D481-D487), IntEnz-a resource with enzyme nomenclature information (Fleischmann, A., et al ., Nucleic Acids Res. 2004 , D434-D437) and ChEBI (Hastings, J., et al ., Nucleic Acids Res. 2013) and ChEMBL (Bento, A. P., et al ., Nucleic Acids Res. 2014 , 1083-1090)-resources which contain information about small-molecule chemistry and bioactivity. This article describes the redesign of Enzyme Portal and the increased functionality added to maximise integration and interpretation of these data. Use case examples of the Enzyme Portal and the versatile workflows its supports are illustrated. We welcome the suggestion of new resources for integration. © The Author 2017. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com
Effect of Thymine Starvation on Messenger Ribonucleic Acid Synthesis in Escherichia coli
Luzzati, Denise
1966-01-01
Luzzati, Denise (Institut de Biologie Physico-Chimique, Paris, France). Effect of thymine starvation on messenger ribonucleic acid synthesis in Escherichia coli. J. Bacteriol. 92:1435–1446. 1966.—During the course of thymine starvation, the rate of synthesis of messenger ribonucleic acid (mRNA, the rapidly labeled fraction of the RNA which decays in the presence of dinitrophenol or which hybridizes with deoxyribonucleic acid) decreases exponentially, in parallel with the viability of the thymine-starved bacteria. The ability of cell-free extracts of starved bacteria to incorporate ribonucleoside triphosphates into RNA was determined; it was found to be inferior to that of extracts from control cells. The analysis of the properties of cell-free extracts of starved cells shows that their decreased RNA polymerase activity is the consequence of a modification of their deoxyribonucleic acid, the ability of which to serve as a template for RNA polymerase decreases during starvation. PMID:5332402
Quittnat, Friederike; Nishikawa, Yoshifumi; Stedman, Timothy T; Voelker, Dennis R; Choi, Jae-Yeon; Zahn, Matthew M; Murphy, Robert C; Barkley, Robert M; Pypaert, Marc; Joiner, Keith A; Coppens, Isabelle
2004-11-01
In mammalian cells, the main stored neutral lipids are triacylglycerol and cholesteryl esters, which are produced by two related enzymes, acyl-CoA:diacylglycerol acyltransferase (DGAT) and acyl-CoA:cholesterol acyltransferase (ACAT), respectively. Very little is known about the metabolism, intracellular storage and function of neutral lipids in many pathogenic lower eukaryotes. In this paper, we have characterized the activity of an important triacylglycerol synthetic enzyme in the protozoan Toxoplasma gondii. A full-length cDNA and gene encoding a T. gondii DGAT1-related enzyme were identified and designated TgDGAT1. The gene is composed of 15 exons and 14 introns, and encodes a protein with a predicted M(r) 63.5kDa, containing signature motifs characteristic of the DGAT1 family. The native protein migrates at 44kDa under reducing conditions. TgDGAT1 is an integral membrane protein localized to the parasite cortical and perinuclear endoplasmic reticulum, with the C-terminus oriented to the lumen of the organelle. When a Saccharomyces cerevisiae mutant strain lacking neutral lipid production is transformed with TgDGAT1 cDNA, a significant DGAT activity is reconstituted, resulting in triacylglycerol synthesis and biogenesis of cytosolic lipid inclusions, resembling lipid bodies in T. gondii. No production of steryl esters is observed upon TgDGAT1 expression in yeast. In contrast to human DGAT1 lacking fatty acid specificity, TgDGAT1 preferentially incorporates palmitate. Our results indicate that parasitic protozoa are also neutral lipid accumulators and illustrate the first example of the existence of a functional DGAT gene in an ancient eukaryote, demonstrating that diacylglycerol esterification is evolutionarily conserved.
Gosling, J. P.; Duggan, P. F.
1971-01-01
Bakers' yeast oxidizes acetate at a high rate only after an adaptation period during which the capacity of the glyoxylate cycle is found to increase. There was apparently no necessity for the activity of acetyl-coenzyme A synthetase, the capacity of the tricarboxylic acid cycle, or the concentrations of the cytochromes to increase for this adaptation to occur. Elevation of fructose 1,6 diphosphatase occurred only when acetate oxidation was nearly maximal. Cycloheximide almost completely inhibited adaptation as well as increases in the activities of isocitrate lyase and aconitate hydratase, the only enzymes assayed. p-Fluorophenylalanine was partially effective and chloramphenicol did not inhibit at all. The presence of ammonium, which considerably delayed adaptation of the yeast to acetate oxidation, inhibited the increases in the activities of the glyoxylate cycle enzymes to different degrees, demonstrating noncoordinate control of these enzymes. Under the various conditions, the only enzyme activity increase consistently related to the rising oxygen uptake rate was that of isocitrate lyase which apparently limited the activity of the cycle. PMID:5557595
Ashton, Anna; Stoney, Patrick N; Ransom, Jemma; McCaffery, Peter
2018-03-08
Vitamin A is important for the circadian timing system; deficiency disrupts daily rhythms in activity and clock gene expression, and reduces the nocturnal peak in melatonin in the pineal gland. However, it is currently unknown how these effects are mediated. Vitamin A primarily acts via the active metabolite, retinoic acid (RA), a transcriptional regulator with emerging non-genomic activities. We investigated whether RA is subject to diurnal variation in synthesis and signaling in the rat pineal gland. Its involvement in two key molecular rhythms in this gland was also examined: kinase activation and induction of Aanat, which encodes the rhythm-generating melatonin synthetic enzyme. We found diurnal changes in expression of several genes required for RA signaling, including a RA receptor and synthetic enzymes. The RA-responsive gene Cyp26a1 was found to change between day and night, suggesting diurnal changes in RA activity. This corresponded to changes in RA synthesis, suggesting rhythmic production of RA. Long-term RA treatment in vitro upregulated Aanat transcription, while short-term treatment had no effect. RA was also found to rapidly downregulate extracellular signal-regulated kinase (ERK) 1/2 phosphorylation, suggesting a rapid non-genomic action which may be involved in driving the molecular rhythm in ERK1/2 activation in this gland. These results demonstrate that there are diurnal changes in RA synthesis and activity in the rat pineal gland which are partially under circadian control. These may be key to the effects of vitamin A on circadian rhythms, therefore providing insight into the molecular link between this nutrient and the circadian system.
Marjani, Abdoljalal; Golalipour, Mohammad J.; Gharravi, Anneh M.
2010-01-01
Objectives This study was undertaken to determine the effect of subacute exposure of peracetic acid on lipid peroxidation and hepatic enzymes in Wistar rats. Methods 48 male animals in Treatment Group I, II and III received 0.2%, 2% and 20% peracetic acid daily for 2 and 4 weeks. Results Serum malondialdehyde increased and Alanine Transaminase and Aspartate Transaminase decreased significantly in groups 2 and 3, compared to the control group. The malondialdehyde, Alanine Transaminase and Aspartate Transaminase with 0.2% and 2% doses of peracetic acid for 2 weeks do not lead to the alteration of malondialdehyde and enzyme activities. Conclusion This study demonstrated that the enhancement of malondialdehyde could provide an oxidative damage induced by disinfectant peroxidation at 20% and 2% doses at 2 and 4 weeks. The consumption of peroxidation with 20% for 2 weeks and 2% for 4 weeks can cause the increase of malondialdehyde and the decrease of enzyme activities, respectively. PMID:22043353
USDA-ARS?s Scientific Manuscript database
We report on the cloning, sequencing, characterization, 3D modeling and docking of Aedes aegypti juvenile hormone acid methyl transferase (AeaJHAMT), the enzyme that converts juvenile hormone acid (JHA) into juvenile hormone (JH). Purified recombinant AeaJHAMT was extensively characterized for enzym...
Dysregulation of hepatic fatty acid metabolism in chronic kidney disease.
Jin, Kyubok; Norris, Keith; Vaziri, Nosratola D
2013-02-01
Chronic kidney disease (CKD) results in hypertriglyceridemia which is largely due to impaired clearance of triglyceride-rich lipoproteins occasioned by downregulation of lipoprotein lipase and very low-density lipoprotein (LDL) receptor in the skeletal muscle and adipose tissue and of hepatic lipase and LDL receptor-related protein in the liver. However, data on the effect of CKD on fatty acid metabolism in the liver is limited and was investigated here. Male Sprague-Dawley rats were randomized to undergo 5/6 nephrectomy (CRF) or sham operation (control) and observed for 12 weeks. The animals were then euthanized and their liver tissue tested for nuclear translocation (activation) of carbohydrate-responsive element binding protein (ChREBP) and sterol-responsive element binding protein-1 (SREBP-1) which independently regulate the expression of key enzyme in fatty acid synthesis, i.e. fatty acid synthase (FAS) and acyl-CoA carboxylase (ACC) as well as nuclear Peroxisome proliferator-activated receptor alpha (PPARα) which regulates the expression of enzymes involved in fatty acid oxidation and transport, i.e. L-FABP and CPT1A. In addition, the expression of ATP synthase α, ATP synthase β, glycogen synthase and diglyceride acyltransferase 1 (DGAT1) and DGAT2 were determined. Compared with controls, the CKD rats exhibited hypertriglyceridemia, elevated plasma and liver tissue free fatty acids, increased nuclear ChREBP and reduced nuclear SREBP-1 and PPARα, upregulation of ACC and FAS and downregulation of L-FABP, CPT1A, ATP synthase α, glycogen synthase and DGAT in the liver tissue. Liver in animals with advanced CKD exhibits ChREBP-mediated upregulation of enzymes involved in fatty acid synthesis, downregulation of PPARα-regulated fatty acid oxidation system and reduction of DGAT resulting in reduced fatty acid incorporation in triglyceride.
Long-term leucine induced stimulation of muscle protein synthesis is amino acid dependent
USDA-ARS?s Scientific Manuscript database
Infusing leucine for 1 h increases skeletal muscle protein synthesis in the neonate, but this is not sustained for 2 h unless the corresponding fall in amino acids is prevented. This study aimed to determine whether a continuous leucine infusion can stimulate protein synthesis for a prolonged period...
SYNTHESIS OF MIXED FULL AND SEMIESTERS OF PHOSPHOROUS ACID AS ORGANIC MOTOR OIL ADDITIVES,
The synthesis of mixed full and semiesters of phosphonic acid was effected using alkylphenols produced by the chemical industry. By condensation of...industrial alkylphenol or the condensation of acid chloride of di-(alkylphenyl)-phosphorous acid with diethylamine, the corresponding mixed full and semiesters
Kanoh, H.; Lindsay, D. B.
1972-01-01
1. Mitochondrial and microsomal fractions of rat epididymal adipose tissue incorporated [1-14C]acetyl-CoA equally well into various fatty acids by a chain-elongation mechanism. C18 and C20 fatty acids were the two major products, and comprised about 80% of the total fatty acids synthesized in both particles. 2. When incubated in air, mitochondria synthesized stearic acid, octadecenoic acid and eicosamonoenoic acid in almost equal amounts (about 20% each), whereas in microsomal fractions, the synthesis of octadecenoic acid was more than fivefold the stearic acid formation. In both fractions, major components of synthesized monoenoic fatty acids were the Δ11:12 isomers. Hexadecenoic acid and octadecenoic acid from whole adipose tissue contained approx. 11 and 14% of the Δ11:12 isomer respectively. 3. When mitochondria or microsomal fractions were incubated in nitrogen, there was increased synthesis of stearic acid and palmitic acid and less of C16 and C18 monoenoic acids; synthesis of C20 acids remained predominantly of the monoenoic acids. Determination of the position of the double bond in the monoenoic acids supported the view that the synthesis of hexadecenoic acid and octadecenoic acid involves a desaturase activity, whereas eicosamonoenoic acid and eicosadienoic acid are formed only by elongation of endogenous fatty acids. 4. Most of the radioactivity was found in free fatty acids (63%) and the phospholipid (26%) fraction. In phospholipids, phosphatidylcholine and phosphatidylethanolamine were the two major components. 5. Most of the fatty acids synthesized, including those not normally found in particle lipids (arachidic acid, eicosamonoenoic acid and eicosadienoic acid) were distributed fairly evenly in the phospholipid and free fatty acid fractions. However, stearic acid was found predominantly in the phospholipid fraction. PMID:4638795
Delta-aminolevulinic acid dehydratase enzyme activity in blood, brain, and liver of lead-dosed ducks
Dieter, M.P.; Finley, M.T.
1979-01-01
Mallard ducks were dosed with a single shotgun pellet (ca. 200 mg lead). After 1 month there was about 1 ppm lead in blood, 2.5 in liver, and 0.5 in brain. Lead-induced inhibition of delta-aminolevulinic acid dehydratase enzyme in blood and cerebellum was much greater than in cerebral hemisphere or liver and was strongly correlated with the lead concentration in these tissues. The cerebellar portion of the brain was more sensitive to delta-aminolevulinic acid dehydratase enzyme inhibition by lead than were the other tissues examined. There was also a greater increase in the glial cell marker enzyme, butyrylcholinesterase, in cerebellum than in cerebral hemisphere, suggesting that nonregenerating neuronal cells were destroyed by lead and replaced by glial cells in that portion of the brain. Even partial loss of cerebellar tissue is severely debilitating in waterfowl, because functions critical to survival such as visual, auditory, motor, and reflex responses are integrated at this brain center.
Higgins, Michael L.; Daneo-Moore, Lolita
1972-01-01
The application of quantitative electron microscopy to thin sections of cells of Streptococcus faecalis specifically inhibited for deoxyribonucleic acid (DNA), ribonucleic acid, and protein synthesis shows that septal mesosomes (i) increase in size when protein synthesis is inhibited by at least 80% while DNA synthesis proceeds at no less than 50% of the control rate and (ii) decrease in size when DNA synthesis is inhibited 50% or more during the initial 10 min of treatment. This indicates that fluctuations in mesosome size are dependent on the extent of DNA synthesis. The fluctuations in mesosome areas observed on treatment do not correlate with the kinetics of glycerol incorporation per milliliter of a culture. However, when glycerol incorporation is placed on a per cell basis, a strong correlation is observed between increases in (i) the thickness of the electron-transparent layer of the cytoplasmic membrane and (ii) the amount of glycerol incorporated per cell. It seems that the electron-transparent membrane layer may thicken to accommodate changes in lipid content when protein and lipid synthesis are uncoupled. Images PMID:4110926
Kothapalli, Kumar S. D.; Ye, , Kaixiong; Gadgil, Maithili S.; Carlson, Susan E.; O’Brien, Kimberly O.; Zhang, Ji Yao; Park, Hui Gyu; Ojukwu, Kinsley; Zou, James; Hyon, Stephanie S.; Joshi, Kalpana S.; Gu, Zhenglong; Keinan, Alon; Brenna, J.Thomas
2016-01-01
Long chain polyunsaturated fatty acids (LCPUFA) are bioactive components of membrane phospholipids and serve as substrates for signaling molecules. LCPUFA can be obtained directly from animal foods or synthesized endogenously from 18 carbon precursors via the FADS2 coded enzyme. Vegans rely almost exclusively on endogenous synthesis to generate LCPUFA and we hypothesized that an adaptive genetic polymorphism would confer advantage. The rs66698963 polymorphism, a 22-bp insertion–deletion within FADS2, is associated with basal FADS1 expression, and coordinated induction of FADS1 and FADS2 in vitro. Here, we determined rs66698963 genotype frequencies from 234 individuals of a primarily vegetarian Indian population and 311 individuals from the US. A much higher I/I genotype frequency was found in Indians (68%) than in the US (18%). Analysis using 1000 Genomes Project data confirmed our observation, revealing a global I/I genotype of 70% in South Asians, 53% in Africans, 29% in East Asians, and 17% in Europeans. Tests based on population divergence, site frequency spectrum, and long-range haplotype consistently point to positive selection encompassing rs66698963 in South Asian, African, and some East Asian populations. Basal plasma phospholipid arachidonic acid (ARA) status was 8% greater in I/I compared with D/D individuals. The biochemical pathway product–precursor difference, ARA minus linoleic acid, was 31% and 13% greater for I/I and I/D compared with D/D, respectively. This study is consistent with previous in vitro data suggesting that the insertion allele enhances n-6 LCPUFA synthesis and may confer an adaptive advantage in South Asians because of the traditional plant-based diet practice. PMID:27188529
Haushalter, Robert W; Phelan, Ryan M; Hoh, Kristina M; Su, Cindy; Wang, George; Baidoo, Edward E K; Keasling, Jay D
2017-04-05
Dicarboxylic acids are commodity chemicals used in the production of plastics, polyesters, nylons, fragrances, and medications. Bio-based routes to dicarboxylic acids are gaining attention due to environmental concerns about petroleum-based production of these compounds. Some industrial applications require dicarboxylic acids with specific carbon chain lengths, including odd-carbon species. Biosynthetic pathways involving cytochrome P450-catalyzed oxidation of fatty acids in yeast and bacteria have been reported, but these systems produce almost exclusively even-carbon species. Here we report a novel pathway to odd-carbon dicarboxylic acids directly from glucose in Escherichia coli by employing an engineered pathway combining enzymes from biotin and fatty acid synthesis. Optimization of the pathway will lead to industrial strains for the production of valuable odd-carbon diacids.
Jacobson, J W; Hautala, J A; Case, M E; Giles, N H
1975-01-01
Catabolic dehydroquinase, which functions in the inducible quinic acid catabolic pathway of Neurospora crassa, has been purified from wild type (74-A) and three mutants in the qa gene cluster. The mutant strains were: 105c, a temperature-sensitive constitutive mutant in the qa-1 regulatory locus; M-16, a qa-3 mutant deficient in quinate dehydrogenase activity; and 237, a leaky qa-2 mutant which possess very low levels of catabolic dehydroquinase activity. The enzymes purified from strains 74-A, 105c, and M-16 are identical with respect to behavior during purification, specific activity, electrophoretic behavior, stability, molecular weight, subunit structure, immunological cross-reactivity, and amino acid content. The mutant enzyme from strain 237 is 1,500-fold less active and appears to have a slightly different amino acid content. It is identical by a number of the other criteria listed above and is presumed to be a mutant at or near the enzyme active site. These data demonstrate that the qa-1 gene product is not involved in the posttranslational expression of enzyme activity. The biochemical identity of catabolic dehydroquinase isolated from strains 105c and M-16 with that from wild type also demonstrates that neither the inducer, quinic acid, nor other enzymes encoded in the qa gene cluster are necessary for the expression of activity. Therefore the combined genetic and biochemical data on the qa system continue to support the hypothesis that the qa-1 regulatory protein acts as a positive initiator of qa enzyme synthesis. Images PMID:126226
Zhang, Yuanyuan; Jackson, Jonathan P; St Claire, Robert L; Freeman, Kimberly; Brouwer, Kenneth R; Edwards, Jeffrey E
2017-08-01
Farnesoid X receptor (FXR) is a master regulator of bile acid homeostasis through transcriptional regulation of genes involved in bile acid synthesis and cellular membrane transport. Impairment of bile acid efflux due to cholangiopathies results in chronic cholestasis leading to abnormal elevation of intrahepatic and systemic bile acid levels. Obeticholic acid (OCA) is a potent and selective FXR agonist that is 100-fold more potent than the endogenous ligand chenodeoxycholic acid (CDCA). The effects of OCA on genes involved in bile acid homeostasis were investigated using sandwich-cultured human hepatocytes. Gene expression was determined by measuring mRNA levels. OCA dose-dependently increased fibroblast growth factor-19 (FGF-19) and small heterodimer partner (SHP) which, in turn, suppress mRNA levels of cholesterol 7-alpha-hydroxylase (CYP7A1), the rate-limiting enzyme for de novo synthesis of bile acids. Consistent with CYP7A1 suppression, total bile acid content was decreased by OCA (1 μmol/L) to 42.7 ± 20.5% relative to control. In addition to suppressing de novo bile acids synthesis, OCA significantly increased the mRNA levels of transporters involved in bile acid homeostasis. The bile salt excretory pump (BSEP), a canalicular efflux transporter, increased by 6.4 ± 0.8-fold, and the basolateral efflux heterodimer transporters, organic solute transporter α (OST α ) and OST β increased by 6.4 ± 0.2-fold and 42.9 ± 7.9-fold, respectively. The upregulation of BSEP and OST α and OST β, by OCA reduced the intracellular concentrations of d 8 -TCA, a model bile acid, to 39.6 ± 8.9% relative to control. These data demonstrate that OCA does suppress bile acid synthesis and reduce hepatocellular bile acid levels, supporting the use of OCA to treat bile acid-induced toxicity observed in cholestatic diseases. © 2017 Intercept Pharmaceuticals. Pharmacology Research & Perspectives published by John Wiley & Sons Ltd, British Pharmacological Society and
DOE Office of Scientific and Technical Information (OSTI.GOV)
Reich, I.L.; Reich, H.J.; Menahan, L.A.
1987-01-01
Perfluorooctanoic and -decanoic acids are representative of a series of perfluorinated acids that have been used for a variety of industrial purposes primarily due to their surfactant properties. The toxicity of these compounds is being investigated in a number of laboratories. 14C-labeled materials would be useful in these studies but are not commercially available. Johncock prepared unlabeled PFOA in low yield by carbonation of the unstable perfluoroheptyllithium at -90 degrees Centigrade. We anticipated several problems in applying this procedure to the synthesis of the 14C-labeled material. Johncock's procedure was run on a fairly large scale (10 mmol) with excess CO2.
Weber, Christian; Brückner, Christine; Weinreb, Sheila; Lehr, Claudia; Essl, Christine; Boles, Eckhard
2012-12-01
Adipic acid is a high-value compound used primarily as a precursor for the synthesis of nylon, coatings, and plastics. Today it is produced mainly in chemical processes from petrochemicals like benzene. Because of the strong environmental impact of the production processes and the dependence on fossil resources, biotechnological production processes would provide an interesting alternative. Here we describe the first engineered Saccharomyces cerevisiae strain expressing a heterologous biosynthetic pathway converting the intermediate 3-dehydroshikimate of the aromatic amino acid biosynthesis pathway via protocatechuic acid and catechol into cis,cis-muconic acid, which can be chemically dehydrogenated to adipic acid. The pathway consists of three heterologous microbial enzymes, 3-dehydroshikimate dehydratase, protocatechuic acid decarboxylase composed of three different subunits, and catechol 1,2-dioxygenase. For each heterologous reaction step, we analyzed several potential candidates for their expression and activity in yeast to compose a functional cis,cis-muconic acid synthesis pathway. Carbon flow into the heterologous pathway was optimized by increasing the flux through selected steps of the common aromatic amino acid biosynthesis pathway and by blocking the conversion of 3-dehydroshikimate into shikimate. The recombinant yeast cells finally produced about 1.56 mg/liter cis,cis-muconic acid.
Synthesis oftrans-3-hexadecenoic acid and oftrans-3-hexadecenoic-1-C(14) acid.
Knipprath, W G; Stein, R A
1966-01-01
Thetrans-3-hexadecenoic acid has been synthesized. Physical properties and chemical degradation prove its identity with the acid earlier isolated from several plant lipids. In the sequence of the synthesis, the introduction of a terminal triple bond into commercially available 1-tetradecene was performed by bromination and debromination with KOH and NaNH(2). Chain elongation by a Grignard reaction with CO(2) gave a carboxylic acid with a triple bond in the 2-position. Reduction with LiAlH(4) yielded the corresponding alcohol, and reduction of the triple to thetrans double bond was accomplished with Na in ethanol. Bromination of the alcohol with PBr(3) and conversion of the bromide to the nitrile with KCN or KC(14)N elongated the carbon chain to the desired length. Methanolysis with HCl in methanol and saponification with KOH formed the acid with acceptable yields, and in the case of the C(14)-labeled carboxyl, group, with high specific activity.
Sensitivity of whole body protein synthesis to amino acid administration during short-term bed rest.
Biolo, Gianni; Ciocchi, Beniamino; Lebenstedt, Marion; Heer, Martina; Guarnieri, Gianfranco
2002-07-01
We tested the hypothesis that a reduced stimulation of whole-body protein synthesis by amino acid administration represents a major mechanism for the bed rest-induced loss of lean body mass. Healthy young subjects and matched controls were studied on the last day of a 14-day bed rest or ambulatory period, as part of the overall protocol "Short-term Bed Rest - Integrated Physiology" set up by the German Aerospace Centre (DLR) in co-operation with the European Space Agency. A balanced mixture of essential and non-essential amino acids was intravenously infused in the postabsorptive state for 3 hours at the rate of 0.1 g/kg/hour. The oxidative and non-oxidative (i.e., to protein synthesis) disposal of the infused leucine was determined by stable isotope and mass spectrometry techniques. The clearance of total infused amino acids tended to be greater (P=0.07) in the ambulatory group than in the bed rest group. When leucine clearance was partitioned between its oxidative and non-oxidative (i.e., to protein synthesis) components, the results indicated that the oxidative disposal was not statistically different in the bed rest and in the ambulatory groups. In contrast, the non-oxidative leucine disposal (i.e., to protein synthesis) was about 20% greater (P<0.01) in the ambulatory group than in the bed rest group. In conclusion, these preliminary data suggest that 14-day bed rest impairs the ability to utilise exogenous amino acids for protein synthesis.
Raj, Hans; Szymanski, Wiktor; de Villiers, Jandré; Puthan Veetil, Vinod; Quax, Wim J; Shimamoto, Keiko; Janssen, Dick B; Feringa, Ben L; Poelarends, Gerrit J
2013-08-19
Enzymatic amino acid synthesis: Kinetic resolution and asymmetric synthesis of various valuable 3-substituted aspartic acids, which were obtained in fair to good yields with diastereomeric ratio values of up to >98:2 and enantiomeric excess values of up to >99 %, by using engineered methylaspartate ammonia lyases are described. These biocatalytic methodologies for the selective preparation of aspartic acid derivatives appear to be attractive alternatives for existing chemical methods. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Bioaccessibility and inhibitory effects on digestive enzymes of carnosic acid in sage and rosemary.
Ercan, Pınar; El, Sedef Nehir
2018-04-28
In this study, the aim was to determine the bioaccessibilities of carnosic acid in sage and rosemary and in vitro inhibitory effects of these samples on lipid and starch digestive enzymes by evaluating the lipase, α-amylase and α-glucosidase enzyme inhibition activities. The content of carnosic acid in rosemary (18.72 ± 0.33 mg/g) was found to be higher than that content of that in sage (3.76 ± 0.13 mg/g) (p < 0.05). The carnosic acid bioaccessibilities were found as 45.10 ± 1.88% and 38.32 ± 0.21% in sage and rosemary, respectively. The tested sage and rosemary showed inhibitory activity against α-glucosidase (Concentration of inhibitor required to produce a 50% inhibition of the initial rate of reaction - IC 50 88.49 ± 2.35, 76.80 ± 1.68 μg/mL, respectively), α-amylase (IC 50 107.65 ± 12.64, 95.65 ± 2.73 μg/mL, respectively) and lipase (IC 50 6.20 ± 0.63, 4.31 ± 0.62 μg/mL, respectively). Furthermore, to the best of our knowledge, this is the first work that carnosic acid standard equivalent inhibition capacities (CAEIC 50 ) for these food samples were determined and these values were in agreement with the IC 50 values. These results show that sage and rosemary are potent inhibitors of lipase, α-amylase and α-glucosidase digestive enzymes. Copyright © 2018 Elsevier B.V. All rights reserved.
Spin labeled amino acid nitrosourea derivatives--synthesis and antitumour activity.
Zheleva, A; Raikov, Z; Ilarionova, M; Todorov, D
1995-01-01
The synthesis of three spin labeled derivatives of N-[N'-(chloroethyl)-N'-nitrosocarbamoyl] amino acids is reported. The new nitrosoureas are obtained by condensation of the corresponding N-[N'-(2-chloroethyl)-N'-nitrosocarbamoyl] amino acid with 2,2,6,6-tetramethyl-1-oxyl-4-aminopiperidine using dicyclohexylcarbodiimide. Their chemical structures are confirmed by elemental analysis, IR, MS, and EPR spectroscopy. All newly synthesized compounds showed high antitumour activity against the lymphoid leukemia L1210 in BDF1 mice.
Boville, Christina E; Romney, David K; Almhjell, Patrick J; Sieben, Michaela; Arnold, Frances H
2018-04-27
The use of enzymes has become increasingly widespread in synthesis as chemists strive to reduce their reliance on organic solvents in favor of more environmentally benign aqueous media. With this in mind, we previously endeavored to engineer the tryptophan synthase β-subunit (TrpB) for production of noncanonical amino acids that had previously been synthesized through multistep routes involving water-sensitive reagents. This enzymatic platform proved effective for the synthesis of analogues of the amino acid tryptophan (Trp), which are frequently used in pharmaceutical synthesis as well as chemical biology. However, certain valuable compounds, such as the blue fluorescent amino acid 4-cyanotryptophan (4-CN-Trp), could only be made in low yield, even at elevated temperature (75 °C). Here, we describe the engineering of TrpB from Thermotoga maritima that improved synthesis of 4-CN-Trp from 24% to 78% yield. Remarkably, although the final enzyme maintains high thermostability ( T 50 = 93 °C), its temperature profile is shifted such that high reactivity is observed at ∼37 °C (76% yield), creating the possibility for in vivo 4-CN-Trp production. The improvements are not specific to 4-CN-Trp; a boost in activity at lower temperature is also demonstrated for other Trp analogues.
Rossi, Franca; Valentina, Casazza; Garavaglia, Silvia; Sathyasaikumar, Korrapati V.; Schwarcz, Robert; Kojima, Shin-ichi; Okuwaki, Keisuke; Ono, Shin-ichiro; Kajii, Yasushi; Rizzi, Menico
2014-01-01
Fluctuations in the brain levels of the neuromodulator kynurenic acid may control cognitive processes and play a causative role in several catastrophic brain diseases. Elimination of the pyridoxal 5′-phosphate dependent enzyme kynurenine aminotransferase II reduces cerebral kynurenic acid synthesis and has procognitive effects. The present description of the crystal structure of human kynurenine aminotransferase II in complex with its potent and specific primary amine-bearing fluoroquinolone inhibitor (S)-(−)-9-(4-aminopiperazin-1-yl)-8-fluoro-3-methyl-6-oxo-2,3-dihydro-6H-1-oxa-3a-azaphenalene-5-carboxylic acid (BFF-122) should facilitate the structure-based development of cognition-enhancing drugs. From a medicinal chemistry perspective our results demonstrate that the issue of inhibitor specificity for highly conserved PLP-dependent enzymes could be successfully addressed. PMID:20684605
Involvement of a lipoxygenase-like enzyme in abscisic Acid biosynthesis.
Creelman, R A; Bell, E; Mullet, J E
1992-07-01
Several lines of evidence indicate that abscisic acid (ABA) is derived from 9'-cis-neoxanthin or 9'-cis-violaxanthin with xanthoxin as an intermediate. (18)O-labeling experiments show incorporation primarily into the side chain carboxyl group of ABA, suggesting that oxidative cleavage occurs at the 11, 12 (11', 12') double bond of xanthophylls. Carbon monoxide, a strong inhibitor of heme-containing P-450 monooxygenases, did not inhibit ABA accumulation, suggesting that the oxygenase catalyzing the carotenoid cleavage step did not contain heme. This observation, plus the ability of lipoxygenase to make xanthoxin from violaxanthin, suggested that a lipoxygenase-like enzyme is involved in ABA biosynthesis. To test this idea, the ability of several soybean (Glycine max L.) lipoxygenase inhibitors (5,8,11-eicosatriynoic acid, 5,8,11,14-eicosatetraynoic acid, nordihydroguaiaretic acid, and naproxen) to inhibit stress-induced ABA accumulation in soybean cell culture and soybean seedlings was determined. All lipoxygenase inhibitors significantly inhibited ABA accumulation in response to stress. These results suggest that the in vivo oxidative cleavage reaction involved in ABA biosynthesis requires activity of a nonheme oxygenase having lipoxygenase-like properties.
Wang, Shi-Fan; Guo, Chao-Lun; Cui, Ke-Ke; Zhu, Yan-Ting; Ding, Jun-Xiong; Zou, Xin-Yue; Li, Yi-Hang
2015-09-01
Lactic acid has been used as a bio-based green solvent to study the ultrasound-assisted scale-up synthesis. We report here, for the first time, on the novel and scalable process for synthesis of pyrrole derivatives in lactic acid solvent under ultrasonic radiation. Eighteen pyrrole derivatives have been synthesized in lactic acid solvent under ultrasonic radiation and characterized by (1)H NMR, IR, ESI MS. The results show, under ultrasonic radiation, lactic acid solvent can overcome the scale-up challenges and exhibited many advantages, such as bio-based origin, shorter reaction time, lower volatility, higher yields, and ease of isolating the products. Copyright © 2015 Elsevier B.V. All rights reserved.
Synthesis of peptides from amino acids and ATP with lysine-rich proteinoid
NASA Technical Reports Server (NTRS)
Nakashima, T.; Fox, S. W.
1980-01-01
The paper examines the synthesis of peptides from aminoacids and ATP with a lysine-rich protenoid. The latter in aqueous solution catalyzes the formation of peptides from free amino acids and ATP; this catalytic activity is not found in acidic protenoids, even though the latter contain a basic aminoacid. The pH optimum for the synthesis is about 11, but it is appreciable below 8 and above 13. Temperature data indicate an optimum at 20 C or above, with little increase in rate up to 60 C. Pyrophosphate can be used instead of ATP, but the yields are lower. The ATP-aided syntheses of peptides in aqueous solution occur with several types of proteinous aminoacids.
Loer, Curtis M.; Calvo, Ana C.; Watschinger, Katrin; Werner-Felmayer, Gabriele; O’Rourke, Delia; Stroud, Dave; Tong, Amy; Gotenstein, Jennifer R.; Chisholm, Andrew D.; Hodgkin, Jonathan; Werner, Ernst R.; Martinez, Aurora
2015-01-01
Tetrahydrobiopterin (BH4) is the natural cofactor of several enzymes widely distributed among eukaryotes, including aromatic amino acid hydroxylases (AAAHs), nitric oxide synthases (NOSs), and alkylglycerol monooxygenase (AGMO). We show here that the nematode Caenorhabditis elegans, which has three AAAH genes and one AGMO gene, contains BH4 and has genes that function in BH4 synthesis and regeneration. Knockout mutants for putative BH4 synthetic enzyme genes lack the predicted enzymatic activities, synthesize no BH4, and have indistinguishable behavioral and neurotransmitter phenotypes, including serotonin and dopamine deficiency. The BH4 regeneration enzymes are not required for steady-state levels of biogenic amines, but become rate limiting in conditions of reduced BH4 synthesis. BH4-deficient mutants also have a fragile cuticle and are generally hypersensitive to exogenous agents, a phenotype that is not due to AAAH deficiency, but rather to dysfunction in the lipid metabolic enzyme AGMO, which is expressed in the epidermis. Loss of AGMO or BH4 synthesis also specifically alters the sensitivity of C. elegans to bacterial pathogens, revealing a cuticular function for AGMO-dependent lipid metabolism in host–pathogen interactions. PMID:25808955
Kimura, Yoshio; Tanaka, Chihiro; Oka, Manami
2018-07-01
Myxococcus xanthus generates diadenosine tetraphosphates (Ap 4 A) and diadenosine pentaphosphates (Ap 5 A) under various stress conditions. M. xanthus lysyl-tRNA synthetase (LysS) efficiently synthesizes Ap 4 A from ATP, Ap 5 A from ATP and adenosine tetraphosphate (Ap 4 ), and Ap 4 from ATP and triphosphate. To identify other M. xanthus enzymes that can catalyze Ap 4 A and Ap 4 synthesis, 15 M. xanthus aminoacyl-tRNA synthetases (aaRSs), four acyl-CoA synthetases (Acys), three acetyl-CoA synthetases (Aces), phosphoglycerate kinase (Pgk), and adenylate kinase (Adk) were expressed in Escherichia coli and examined for Ap 4 A or Ap 4 synthetase activity using ATP or ATP and triphosphate as substrates. Among the tested enzymes, LysS had the highest Ap 4 A synthetase activity. AlaRS, SerRS, and LeuRS1 showed high ADP synthetase activity with ATP as a substrate in the presence of pyrophosphatase, and also demonstrated the ability to produce Ap 4 from ATP and triphosphate in the absence of pyrophosphatase. Ap 4 formation by AlaRS, SerRS, and LeuRS1 was approximately 4- to 13-fold higher compared with that of Ap 4 A, suggesting that these enzymes prefer triphosphate over ATP as a substrate in the second reaction. Some of the recombinant M. xanthus Acys and Aces also synthesized Ap 4 from ATP and triphosphate. However, Pgk was capable of catalyzing the production of Ap 4 from ATP and 3-phosphoglycerate in the presence of Mg 2+ and did not require triphosphate, suggesting that this enzyme is mainly responsible for Ap 4 synthesis in M. xanthus.
Maciąg-Dorszyńska, Monika; Węgrzyn, Grzegorz; Guzow-Krzemińska, Beata
2014-04-01
Usnic acid, a compound produced by various lichen species, has been demonstrated previously to inhibit growth of different bacteria and fungi; however, mechanism of its antimicrobial activity remained unknown. In this report, we demonstrate that usnic acid causes rapid and strong inhibition of RNA and DNA synthesis in Gram-positive bacteria, represented by Bacillus subtilis and Staphylococcus aureus, while it does not inhibit production of macromolecules (DNA, RNA, and proteins) in Escherichia coli, which is resistant to even high doses of this compound. However, we also observed slight inhibition of RNA synthesis in a Gram-negative bacterium, Vibrio harveyi. Inhibition of protein synthesis in B. subtilis and S. aureus was delayed, which suggest indirect action (possibly through impairment of transcription) of usnic acid on translation. Interestingly, DNA synthesis was halted rapidly in B. subtilis and S. aureus, suggesting interference of usnic acid with elongation of DNA replication. We propose that inhibition of RNA synthesis may be a general mechanism of antibacterial action of usnic acid, with additional direct mechanisms, such as impairment of DNA replication in B. subtilis and S. aureus. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.
Combined Effects of Lanthanum (III) and Acid Rain on Antioxidant Enzyme System in Soybean Roots.
Zhang, Xuanbo; Du, Yuping; Wang, Lihong; Zhou, Qing; Huang, Xiaohua; Sun, Zhaoguo
2015-01-01
Rare earth element pollution (REEs) and acid rain (AR) pollution simultaneously occur in many regions, which resulted in a new environmental issue, the combined pollution of REEs and AR. The effects of the combined pollution on the antioxidant enzyme system of plant roots have not been reported. Here, the combined effects of lanthanum ion (La3+), one type of REE, and AR on the antioxidant enzyme system of soybean roots were investigated. In the combined treatment of La3+ (0.08 mM) and AR, the cell membrane permeability and the peroxidation of cell membrane lipid of soybean roots increased, and the superoxide dismutase, catalase, peroxidase and reduced ascorbic acid served as scavengers of reactive oxygen species. In other combined treatments of La3+ (0.40 mM, 1.20 mM) and AR, the membrane permeability, malonyldialdehyde content, superoxide dismutase activity, peroxidase activity and reduced ascorbic acid content increased, while the catalase activity decreased. The increased superoxide dismutase activity, peroxidase activity and reduced ascorbic acid content were inadequate to scavenge the excess hydrogen peroxide and superoxide, leading to the damage of the cell membrane, which was aggravated with the increase in the concentration of La3+ and the level of AR. The deleterious effects of the combined treatment of La3+ and AR were stronger than those of the single treatment of La3+ or AR. Moreover, the activity of antioxidant enzyme system in the combined treatment group was affected directly and indirectly by mineral element content in soybean plants.
Combined Effects of Lanthanum (III) and Acid Rain on Antioxidant Enzyme System in Soybean Roots
Zhang, Xuanbo; Du, Yuping; Wang, Lihong; Zhou, Qing; Huang, Xiaohua; Sun, Zhaoguo
2015-01-01
Rare earth element pollution (REEs) and acid rain (AR) pollution simultaneously occur in many regions, which resulted in a new environmental issue, the combined pollution of REEs and AR. The effects of the combined pollution on the antioxidant enzyme system of plant roots have not been reported. Here, the combined effects of lanthanum ion (La3+), one type of REE, and AR on the antioxidant enzyme system of soybean roots were investigated. In the combined treatment of La3+ (0.08 mM) and AR, the cell membrane permeability and the peroxidation of cell membrane lipid of soybean roots increased, and the superoxide dismutase, catalase, peroxidase and reduced ascorbic acid served as scavengers of reactive oxygen species. In other combined treatments of La3+ (0.40 mM, 1.20 mM) and AR, the membrane permeability, malonyldialdehyde content, superoxide dismutase activity, peroxidase activity and reduced ascorbic acid content increased, while the catalase activity decreased. The increased superoxide dismutase activity, peroxidase activity and reduced ascorbic acid content were inadequate to scavenge the excess hydrogen peroxide and superoxide, leading to the damage of the cell membrane, which was aggravated with the increase in the concentration of La3+ and the level of AR. The deleterious effects of the combined treatment of La3+ and AR were stronger than those of the single treatment of La3+ or AR. Moreover, the activity of antioxidant enzyme system in the combined treatment group was affected directly and indirectly by mineral element content in soybean plants. PMID:26230263
USDA-ARS?s Scientific Manuscript database
Chronic somatotropin (pST) treatment in pigs increases muscle protein synthesis and circulating insulin, a known promoter of protein synthesis. Previously, we showed that the pST-mediated rise in insulin could not account for the pST-induced increase in muscle protein synthesis when amino acids were...
Yu, Haining; Li, Ran; Huang, Haiyong; Yao, Ru; Shen, Shengrong
2018-01-01
Short-chain fatty acids (SCFA) such as acetic acid, propionic acid, and butyric acid are produced by fermentation by gut microbiota. In this paper, we investigate the effects of SCFA on 3T3-L1 cells and the underlying molecular mechanisms. The cells were treated with acetic acid, propionic acid, or butyric acid when cells were induced to differentiate into adipocytes. MTT assay was employed to detect the viability of 3T3-L1 cells. Oil Red O staining was used to visualize the lipid content in 3T3-L1 cells. A triglyceride assay kit was used to detect the triacylglycerol content in 3T3-L1 cells. qRT-PCR and Western blot were used to evaluate the expression of metabolic enzymes. MTT results showed that safe concentrations of acetic acid, propionic acid, and butyric acid were less than 6.4, 3.2, and 0.8 mM, respectively. Oil Red O staining and triacylglycerols detection results showed that treatment with acetic acid, propionic acid, and butyric acid accelerated the 3T3-L1 adipocyte differentiation. qRT-PCR and Western blot results showed that the expressions of lipoprotein lipase (LPL), adipocyte fatty acid binding protein 4 (FABP4), fatty acid transporter protein 4 (FATP4), and fatty acid synthase (FAS) were significantly increased by acetic acid, propionic acid, and butyric acid treatment during adipose differentiation (p < 0.05). In conclusion, SCFA promoted lipid accumulation by modulating the expression of enzymes of fatty acid metabolism. © 2018 AOCS.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Beddows, C.G.; Gil, M.H.; Guthrie, J.T.
1986-01-01
Poly(maleic anhydride styrene) graft copolymers of cellulose, pectin polygalacturonic acid salt, calcium polygalacturonate, and starch were prepared and used to immobilize proteins. The cellulose grafts coupled quite appreciable quantities of acid phosphatase, glucose oxidase, and trypsin. However, the general retention of activity was somewhat disappointing. Further investigation with acid phosphatase showed that the amount of enzyme immobilized increased as the amount of anhydride in the graft copolymer increased but no such relationship existed for the enzymic activity. The cellulose graft copolymers were hydrolyzed and it appeared that the carboxyl group aided adsorption of the enzyme. Attempts to couple acid phosphatasemore » using CMC through the free carboxyl groups, created by hydrolysis, gave only a small increase in the extent of protein coupling. However, the unhydrolyzed system gave a useful degree of immobilization of cells of Bacillus stearothermophilus, as did a poly(maleic anhydride/styrene)-cocellulose system. Attempts to improve the activity by using grafts based on other polysaccharide supports met with mixed success. Pectin products were soluble. Polygalacturonic acid products were partially soluble and extremely high levels of enzymic activity were obtained. This was probably due in part to the hydrophilic nature of the system, which also encouraged absorption of the enzyme. Attempts were made to reduce the solubility by using the calcium pectinate salt. Immobilization of acid phosphatase and trypsin resulted in increased protein coupling but relatively poor activities were attained. Calcium polygalacturonate was used to prepare an insoluble graft copolymeric system containing acrylonitrile-comaleic anhydride. The resulting gels gave excellent coupling with acid phosphatase which had a very good retention of activity.« less
Li, Yongli; Florova, Galina; Reynolds, Kevin A
2005-06-01
The first elongation step of fatty acid biosynthesis by a type II dissociated fatty acid synthases is catalyzed by 3-ketoacyl-acyl carrier protein (ACP) synthase III (KASIII, FabH). This enzyme, encoded by the fabH gene, catalyzes a decarboxylative condensation between an acyl coenzyme A (CoA) primer and malonyl-ACP. In organisms such as Escherichia coli, which generate only straight-chain fatty acids (SCFAs), FabH has a substrate preference for acetyl-CoA. In streptomycetes and other organisms which produce a mixture of both SCFAs and branched-chain fatty acids (BCFAs), FabH has been shown to utilize straight- and branched-chain acyl-CoA substrates. We report herein the generation of a Streptomyces coelicolor mutant (YL/ecFabH) in which the chromosomal copy of the fabH gene has been replaced and the essential process of fatty acid biosynthesis is initiated by plasmid-based expression of the E. coli FabH (bearing only 35% amino acid identity to the Streptomyces enzyme). The YL/ecFabH mutant produces predominantly SCFAs (86%). In contrast, BCFAs predominate (approximately 70%) in both the S. coelicolor parental strain and S. coelicolor YL/sgFabH (a deltafabH mutant carrying a plasmid expressing the Streptomyces glaucescens FabH). These results provide the first unequivocal evidence that the substrate specificity of FabH observed in vitro is a determinant of the fatty acid made in an organism. The YL/ecFabH strain grows significantly slower on both solid and liquid media. The levels of FabH activity in cell extracts of YL/ecFabH were also significantly lower than those in cell extracts of YL/sgFabH, suggesting that a decreased rate of fatty acid synthesis may account for the observed decreased growth rate. The production of low levels of BCFAs in YL/ecFabH suggests either that the E. coli FabH is more tolerant of different acyl-CoAs substrates than previously thought or that there is an additional pathway for initiation of BCFA biosynthesis in Streptomyces coelicolor.
Formal synthesis of berkelic acid: a lesson in α-alkylation chemistry.
McLeod, Michael C; Wilson, Zoe E; Brimble, Margaret A
2012-01-06
The full details of our enantioselective formal synthesis of the biologically active natural product berkelic acid are described. The insertion of the C-18 methyl group proved challenging, with three different approaches investigated to install the correct stereochemistry. Our initial Horner-Wadsworth-Emmons/oxa-Michael approach to the berkelic acid core proved unsuccessful upon translation to the natural product itself. However, addition of a silyl enol ether to an oxonium ion, followed by a one-pot debenzylation/spiroketalisation/thermodynamic equilibration procedure, afforded the tetracyclic structure of the berkelic acid core as a single diastereoisomer.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Haushalter, Robert W.; Phelan, Ryan M.; Hoh, Kristina M.
Dicarboxylic acids are commodity chemicals used in the production of plastics, polyesters, nylons, fragrances, and medications. Bio-based routes to dicarboxylic acids are gaining attention due to environmental concerns about petroleum-based production of these compounds. Some industrial applications require dicarboxylic acids with specific carbon chain lengths, including odd-carbon species. Biosynthetic pathways involving cytochrome P450-catalyzed oxidation of fatty acids in yeast and bacteria have been reported, but these systems produce almost exclusively even-carbon species. Here in this paper we report a novel pathway to odd-carbon dicarboxylic acids directly from glucose in Escherichia coli by employing an engineered pathway combining enzymes from biotinmore » and fatty acid synthesis. Optimization of the pathway will lead to industrial strains for the production of valuable odd-carbon diacids.« less
Törmä, Hans; Berne, Berit
2009-12-01
Detergents irritate skin and affect skin barrier homeostasis. In this study, healthy skin was exposed to 1% sodium lauryl sulphate (SLS) in water for 24 h. Biopsies were taken 6 h to 8 days post exposure. Lipid patterns were stained in situ and real-time polymerase chain reaction (PCR) was used to examine mRNA expression of enzymes synthesizing barrier lipids, peroxisome proliferator-activated receptors (PPAR) and lipoxygenases. The lipid pattern was disorganized from 6 h to 3 days after SLS exposure. Concomitant changes in mRNA expression included: (i) reduction, followed by induction, of ceramide-generating beta-glucocerebrosidase, (ii) increase on day 1 of two other enzymes for ceramide biosynthesis and (iii) persistent reduction of acetyl-CoA carboxylase-B, a key enzyme in fatty acid synthesis. Surprisingly, the rate-limiting enzyme in cholesterol synthesis, HMG-CoA reductase, was unaltered. Among putative regulators of barrier lipids synthesis, PPARalpha and PPARgamma exhibited reduced mRNA expression, while PPARbeta/delta and LXRbeta were unaltered. Epidermal lipoxygenase-3, which may generate PPARalpha agonists, exhibited reduced expression. In conclusion, SLS induces reorganization of lipids in the stratum corneum, which play a role in detergents' destruction of the barrier. The changes in mRNA expression of enzymes involved in synthesizing barrier lipids are probably important for the restoration of the barrier.
Evolutionary distinctiveness of fatty acid and polyketide synthesis in eukaryotes
Kohli, Gurjeet S; John, Uwe; Van Dolah, Frances M; Murray, Shauna A
2016-01-01
Fatty acids, which are essential cell membrane constituents and fuel storage molecules, are thought to share a common evolutionary origin with polyketide toxins in eukaryotes. While fatty acids are primary metabolic products, polyketide toxins are secondary metabolites that are involved in ecologically relevant processes, such as chemical defence, and produce the adverse effects of harmful algal blooms. Selection pressures on such compounds may be different, resulting in differing evolutionary histories. Surprisingly, some studies of dinoflagellates have suggested that the same enzymes may catalyse these processes. Here we show the presence and evolutionary distinctiveness of genes encoding six key enzymes essential for fatty acid production in 13 eukaryotic lineages for which no previous sequence data were available (alveolates: dinoflagellates, Vitrella, Chromera; stramenopiles: bolidophytes, chrysophytes, pelagophytes, raphidophytes, dictyochophytes, pinguiophytes, xanthophytes; Rhizaria: chlorarachniophytes, haplosporida; euglenids) and 8 other lineages (apicomplexans, bacillariophytes, synurophytes, cryptophytes, haptophytes, chlorophyceans, prasinophytes, trebouxiophytes). The phylogeny of fatty acid synthase genes reflects the evolutionary history of the organism, indicating selection to maintain conserved functionality. In contrast, polyketide synthase gene families are highly expanded in dinoflagellates and haptophytes, suggesting relaxed constraints in their evolutionary history, while completely absent from some protist lineages. This demonstrates a vast potential for the production of bioactive polyketide compounds in some lineages of microbial eukaryotes, indicating that the evolution of these compounds may have played an important role in their ecological success. PMID:26784357
Valproate induced hepatic steatosis by enhanced fatty acid uptake and triglyceride synthesis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bai, Xupeng; Hong, Weipeng; Cai, Peiheng
Steatosis is the characteristic type of VPA-induced hepatotoxicity and may result in life-threatening hepatic lesion. Approximately 61% of patients treated with VPA have been diagnosed with hepatic steatosis through ultrasound examination. However, the mechanisms underlying VPA-induced intracellular fat accumulation are not yet fully understood. Here we demonstrated the involvement of fatty acid uptake and lipogenesis in VPA-induced hepatic steatosis in vitro and in vivo by using quantitative real-time PCR (qRT-PCR) analysis, western blotting analysis, fatty acid uptake assays, Nile Red staining assays, and Oil Red O staining assays. Specifically, we found that the expression of cluster of differentiation 36 (CD36),more » an important fatty acid transport, and diacylglycerol acyltransferase 2 (DGAT2) were significantly up-regulated in HepG2 cells and livers of C57B/6J mice after treatment with VPA. Furthermore, VPA treatment remarkably enhanced the efficiency of fatty acid uptake mediated by CD36, while this effect was abolished by the interference with CD36-specific siRNA. Also, VPA treatment significantly increased DGAT2 expression as a result of the inhibition of mitogen-activated protein kinase kinase (MEK) – extracellular regulated kinase (ERK) pathway; however, DGAT2 knockdown significantly alleviated VPA-induced intracellular lipid accumulation. Additionally, we also found that sterol regulatory element binding protein-1c (SREBP-1c)-mediated fatty acid synthesis may be not involved in VPA-induced hepatic steatosis. Overall, VPA-triggered over-regulation of CD36 and DGAT2 could be helpful for a better understanding of the mechanisms underlying VPA-induced hepatic steatosis and may offer novel therapeutic strategies to combat VPA-induced hepatotoxicity. - Highlights: • VPA induced hepatic steatosis and modulated genes associated with lipid metabolism. • CD36-mediated fatty acid uptake contributed to VPA-induced lipid accumulation. • PA increased the
Establishment of a Simple and Convenient Method for Folic Acid Enzyme Chemiluminescence Immunoassay
NASA Astrophysics Data System (ADS)
Liu, Ting; Zeng, Ling; Yu, Zhengwei; Yang, Yanfei; Qu, Yunhuan
2018-01-01
The enzyme chemiluminescence new immunoassay for folic acid (FA) was established by competition model. Add FA samples to a microtiter plate precoated with the goat anti-mouse IgG firstly, then add enzyme abled FA and FA monoclonal antibody (McAb). The values of CLIA were measured to reflect the quantity of FA. The limit of detection(LOD) of assay is 0.37ng/mL. The assay shows good correlation during 1∼30 ng/mL with correlation coefficient 0.9976. The intra- and inter-assay coefficients of variation are 4.8 % ∼ 7.3 % and 6.1 % ∼ 12.2 %, respectively. The recovery of folic acid in serum is 90.4 %∼113.2 %. Compared with determine value clinically in chemiluminescence immunoassay kit from Roche company, the correlative equation is y = 0.9689x + 0.0228, and correlation coefficient is 0.9780. Various components and kit overall show good stabilities. This method is simple and convenient, and has low LOD value. The method has overcome the shortcomings of the present references. It is easy to apply and has broad clinical application prospect. It lays an experimental foundation for the preparation of Mc Ab against folic acid and the development of domestic kit.
Chan, Yvonne Gar-Yun; Kim, Hwan Keun; Schneewind, Olaf; Missiakas, Dominique
2014-01-01
Envelope biogenesis in bacteria involves synthesis of intermediates that are tethered to the lipid carrier undecaprenol-phosphate. LytR-CpsA-Psr (LCP) enzymes have been proposed to catalyze the transfer of undecaprenol-linked intermediates onto the C6-hydroxyl of MurNAc in peptidoglycan, thereby promoting attachment of wall teichoic acid (WTA) in bacilli and staphylococci and capsular polysaccharides (CPS) in streptococci. S. aureus encodes three lcp enzymes, and a variant lacking all three genes (Δlcp) releases WTA from the bacterial envelope and displays a growth defect. Here, we report that the type 5 capsular polysaccharide (CP5) of Staphylococcus aureus Newman is covalently attached to the glycan strands of peptidoglycan. Cell wall attachment of CP5 is abrogated in the Δlcp variant, a defect that is best complemented via expression of lcpC in trans. CP5 synthesis and peptidoglycan attachment are not impaired in the tagO mutant, suggesting that CP5 synthesis does not involve the GlcNAc-ManNAc linkage unit of WTA and may instead utilize another Wzy-type ligase to assemble undecaprenyl-phosphate intermediates. Thus, LCP enzymes of S. aureus are promiscuous enzymes that attach secondary cell wall polymers with discrete linkage units to peptidoglycan. PMID:24753256
Schwarz, Margrit; Wright, Angelique C.; Davis, Daphne L.; Nazer, Hisham; Björkhem, Ingemar; Russell, David W.
2000-01-01
We used expression cloning to isolate cDNAs encoding a microsomal 3β-hydroxy-Δ5-C27-steroid oxidoreductase (C27 3β-HSD) that is expressed predominantly in the liver. The predicted product shares 34% sequence identity with the C19 and C21 3β-HSD enzymes, which participate in steroid hormone metabolism. When transfected into cultured cells, the cloned C27 3β-HSD cDNA encodes an enzyme that is active against four 7α-hydroxylated sterols, indicating that a single C27 3β-HSD enzyme can participate in all known pathways of bile acid synthesis. The expressed enzyme did not metabolize several different C19/21 steroids as substrates. The levels of hepatic C27 3β-HSD mRNA in the mouse are not sexually dimorphic and do not change in response to dietary cholesterol or to changes in bile acid pool size. The corresponding human gene on chromosome 16p11.2-12 contains six exons and spans 3 kb of DNA, and we identified a 2-bp deletion in the C27 3β-HSD gene of a patient with neonatal progressive intrahepatic cholestasis. This mutation eliminates the activity of the enzyme in transfected cells. These findings establish the central role of C27 3β-HSD in the biosynthesis of bile acids and provide molecular tools for the diagnosis of a third type of neonatal progressive intrahepatic cholestasis associated with impaired bile acid synthesis. PMID:11067870
dEMBF: A Comprehensive Database of Enzymes of Microalgal Biofuel Feedstock.
Misra, Namrata; Panda, Prasanna Kumar; Parida, Bikram Kumar; Mishra, Barada Kanta
2016-01-01
Microalgae have attracted wide attention as one of the most versatile renewable feedstocks for production of biofuel. To develop genetically engineered high lipid yielding algal strains, a thorough understanding of the lipid biosynthetic pathway and the underpinning enzymes is essential. In this work, we have systematically mined the genomes of fifteen diverse algal species belonging to Chlorophyta, Heterokontophyta, Rhodophyta, and Haptophyta, to identify and annotate the putative enzymes of lipid metabolic pathway. Consequently, we have also developed a database, dEMBF (Database of Enzymes of Microalgal Biofuel Feedstock), which catalogues the complete list of identified enzymes along with their computed annotation details including length, hydrophobicity, amino acid composition, subcellular location, gene ontology, KEGG pathway, orthologous group, Pfam domain, intron-exon organization, transmembrane topology, and secondary/tertiary structural data. Furthermore, to facilitate functional and evolutionary study of these enzymes, a collection of built-in applications for BLAST search, motif identification, sequence and phylogenetic analysis have been seamlessly integrated into the database. dEMBF is the first database that brings together all enzymes responsible for lipid synthesis from available algal genomes, and provides an integrative platform for enzyme inquiry and analysis. This database will be extremely useful for algal biofuel research. It can be accessed at http://bbprof.immt.res.in/embf.
dEMBF: A Comprehensive Database of Enzymes of Microalgal Biofuel Feedstock
Misra, Namrata; Panda, Prasanna Kumar; Parida, Bikram Kumar; Mishra, Barada Kanta
2016-01-01
Microalgae have attracted wide attention as one of the most versatile renewable feedstocks for production of biofuel. To develop genetically engineered high lipid yielding algal strains, a thorough understanding of the lipid biosynthetic pathway and the underpinning enzymes is essential. In this work, we have systematically mined the genomes of fifteen diverse algal species belonging to Chlorophyta, Heterokontophyta, Rhodophyta, and Haptophyta, to identify and annotate the putative enzymes of lipid metabolic pathway. Consequently, we have also developed a database, dEMBF (Database of Enzymes of Microalgal Biofuel Feedstock), which catalogues the complete list of identified enzymes along with their computed annotation details including length, hydrophobicity, amino acid composition, subcellular location, gene ontology, KEGG pathway, orthologous group, Pfam domain, intron-exon organization, transmembrane topology, and secondary/tertiary structural data. Furthermore, to facilitate functional and evolutionary study of these enzymes, a collection of built-in applications for BLAST search, motif identification, sequence and phylogenetic analysis have been seamlessly integrated into the database. dEMBF is the first database that brings together all enzymes responsible for lipid synthesis from available algal genomes, and provides an integrative platform for enzyme inquiry and analysis. This database will be extremely useful for algal biofuel research. It can be accessed at http://bbprof.immt.res.in/embf. PMID:26727469
Regulation of uric acid metabolism and excretion.
Maiuolo, Jessica; Oppedisano, Francesca; Gratteri, Santo; Muscoli, Carolina; Mollace, Vincenzo
2016-06-15
Purines perform many important functions in the cell, being the formation of the monomeric precursors of nucleic acids DNA and RNA the most relevant one. Purines which also contribute to modulate energy metabolism and signal transduction, are structural components of some coenzymes and have been shown to play important roles in the physiology of platelets, muscles and neurotransmission. All cells require a balanced quantity of purines for growth, proliferation and survival. Under physiological conditions the enzymes involved in the purine metabolism maintain in the cell a balanced ratio between their synthesis and degradation. In humans the final compound of purines catabolism is uric acid. All other mammals possess the enzyme uricase that converts uric acid to allantoin that is easily eliminated through urine. Overproduction of uric acid, generated from the metabolism of purines, has been proven to play emerging roles in human disease. In fact the increase of serum uric acid is inversely associated with disease severity and especially with cardiovascular disease states. This review describes the enzymatic pathways involved in the degradation of purines, getting into their structure and biochemistry until the uric acid formation. Copyright © 2015. Published by Elsevier Ireland Ltd.
5'to 3' nucleic acid synthesis using 3'-photoremovable protecting group
Pirrung, Michael C.; Shuey, Steven W.; Bradley, Jean-Claude
1999-01-01
The present invention relates, in general, to a method of synthesizing a nucleic acid, and, in particular, to a method of effecting 5' to 3' nucleic acid synthesis. The method can be used to prepare arrays of oligomers bound to a support via their 5' end. The invention also relates to a method of effecting mutation analysis using such arrays. The invention further relates to compounds and compositions suitable for use in such methods.
Parry, R J; Hoyt, J C
1997-02-01
Sparsomycin is an antitumor antibiotic produced by Streptomyces sparsogenes. Biosynthetic experiments have previously demonstrated that one component of sparsomycin is derived from L-tryptophan via the intermediacy of (E)-3-(4-oxo-6-methyl-5-pyrimidinyl)acrylic acid and (E)-3-(2,4-dioxo-6-methyl-5-pyrimidinyl)acrylic acid. An enzyme which catalyzes the conversion of (E)-3-(4-oxo-6-methyl-5-pyrimidinyl)acrylic acid to (E)-3-(2,4-dioxo-6-methyl-5-pyrimidinyl)acrylic acid has been purified 740-fold to homogeneity from S. sparsogenes. The molecular mass of the native and denatured enzyme was 87 kDa, indicating that the native enzyme is monomeric. The enzyme required NAD+ for activity but lacked rigid substrate specificity, since analogs of both NAD+ and 3-(4-oxo-6-methyl-5-pyrimidinyl)acrylic acid could serve as substrates. The enzyme was very weakly inhibited by mycophenolic acid. Monovalent cations were required for activity, with potassium ions being the most effective. The enzyme exhibited sensitivity toward diethylpyrocarbonate and some thiol-directed reagents, and it was irreversibly inhibited by 6-chloropurine. The properties of the enzyme suggest it is mechanistically related to inosine-5'-monophosphate dehydrogenase.
A Key Role for Lipoic Acid Synthesis During Plasmodium Liver stage Development
Falkard, Brie; Santha Kumar, T. R.; Hecht, Leonie-Sophie; Matthews, Krista A.; Henrich, Philipp P.; Gulati, Sonia; Lewis, Rebecca E.; Manary, Micah J.; Winzeler, Elizabeth A.; Sinnis, Photini; Prigge, Sean T.; Heussler, Volker; Deschermeier, Christina; Fidock, David
2013-01-01
SUMMARY The successful navigation of malaria parasites through their life cycle, which alternates between vertebrate hosts and mosquito vectors, requires a complex interplay of metabolite synthesis and salvage pathways. Using the rodent parasite Plasmodium berghei, we have explored the synthesis and scavenging pathways for lipoic acid, a short-chain fatty acid derivative that regulates the activity of α-ketoacid dehydrogenases including pyruvate dehydrogenase. In Plasmodium, lipoic acid is either synthesized de novo in the apicoplast or is scavenged from the host into the mitochondrion. Our data show that sporozoites lacking the apicoplast lipoic acid protein ligase LipB are markedly attenuated in their infectivity for mice, and in vitro studies document a very late liver stage arrest shortly before the final phase of intra-hepatic parasite maturation. LipB-deficient asexual blood stage parasites show unimpaired rates of growth in normal in vitro or in vivo conditions. However, these parasites showed reduced growth in lipid-restricted conditions induced by treatment with the lipoic acid analog 8-bromo-octanoate or with the lipid-reducing agent clofibrate. This finding has implications for understanding Plasmodium pathogenesis in malnourished children that bear the brunt of malarial disease. This study also highlights the potential of exploiting lipid metabolism pathways for the design of genetically attenuated sporozoite vaccines. PMID:23490300
USDA-ARS?s Scientific Manuscript database
In skeletal muscle of adults, sepsis reduces protein synthesis by depressing translation initiation and induces resistance to branched-chain amino acid stimulation. Normal neonates maintain a high basal muscle protein synthesis rate that is sensitive to amino acid stimulation. In the present study...
Engineering acyl carrier protein to enhance production of shortened fatty acids.
Liu, Xueliang; Hicks, Wade M; Silver, Pamela A; Way, Jeffrey C
2016-01-01
The acyl carrier protein (ACP) is an essential and ubiquitous component of microbial synthesis of fatty acids, the natural precursor to biofuels. Natural fatty acids usually contain long chains of 16 or more carbon atoms. Shorter carbon chains, with increased fuel volatility, are desired for internal combustion engines. Engineering the length specificity of key proteins in fatty acid metabolism, such as ACP, may enable microbial synthesis of these shorter chain fatty acids. We constructed a homology model of the Synechococcus elongatus ACP, showing a hydrophobic pocket harboring the growing acyl chain. Amino acids within the pocket were mutated to increase steric hindrance to the acyl chain. Certain mutant ACPs, when over-expressed in Escherichia coli, increased the proportion of shorter chain lipids; I75 W and I75Y showed the strongest effects. Expression of I75 W and I75Y mutant ACPs also increased production of lauric acid in E. coli that expressed the C12-specific acyl-ACP thioesterase from Cuphea palustris. We engineered the specificity of the ACP, an essential protein of fatty acid metabolism, to alter the E. coli lipid pool and enhance production of medium-chain fatty acids as biofuel precursors. These results indicate that modification of ACP itself could be combined with enzymes affecting length specificity in fatty acid synthesis to enhance production of commodity chemicals based on fatty acids.
Haggie, Peter M; Verkman, A S
2002-10-25
It has been proposed that enzymes in many metabolic pathways, including the tricarboxylic acid cycle in the mitochondrial matrix, are physically associated to facilitate substrate channeling and overcome diffusive barriers. We have used fluorescence recovery after photobleaching to measure the diffusional mobilities of chimeras consisting of green fluorescent protein (GFP) fused to the C terminus of four tricarboxylic acid cycle enzymes: malate dehydrogenase, citrate synthase, isocitrate dehydrogenase, and succinyl-CoA synthetase. The GFP-enzyme chimeras were localized selectively in the mitochondrial matrix in transfected Chinese hamster ovary (CHO) and COS7 cells. Laser photobleaching using a 0.7-microm diameter spot demonstrated restricted diffusion of the GFP-enzyme chimeras. Interestingly, all four chimeras had similar diffusional characteristics, approximately 45% of each chimera was mobile and had a diffusion coefficient of 4 x 10(-8) cm(2)/s. In contrast, unconjugated GFP in the mitochondrial matrix (targeted using COX8 leader sequence) diffused freely (nearly 100% mobility) with a greater diffusion coefficient of 20 x 10(-8) cm(2)/s. The mobility of the GFP-enzyme chimeras was insensitive to substrate source, ATP depletion, or inhibition of the adenine nucleotide translocase. These results indicate similar mobility characteristics of unrelated tricarboxylic acid cycle enzymes having different sizes and physical properties, providing biophysical evidence for a diffusible multienzyme complex in the mitochondrial matrix.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hempel, K.
1962-01-01
New methods for synthesis of tritium-labeled amino acids with high specific activity (1000 mc/m mole and above) are described. Changes in tritium- labeled amino acids during storage are studied. An absorbed BETA energy of 10/ sup 5/ rad results in radiochemical disintegration of 1.5%. Autoradiographic studies were made with several amino acids. It was demonstrated that protein production is 2 to 3 times higher in butter-vellux, tumors than in liver tissue. Synthesis of melanine was studied in vivo with melanineproducing tumors. (Gmelin Inst.)
Oboh, Ganiyu; Agunloye, Odunayo M; Adefegha, Stephen A; Akinyemi, Ayodele J; Ademiluyi, Adedayo O
2015-03-01
Chlorogenic acid is a major phenolic compound that forms a substantial part of plant foods and is an ester of caffeic acid and quinic acid. However, the effect of the structures of both chlorogenic and caffeic acids on their antioxidant and antidiabetic potentials have not been fully understood. Thus, this study sought to investigate and compare the interaction of caffeic acid and chlorogenic acid with α-amylase and α-glucosidase (key enzymes linked to type 2 diabetes) activities in vitro. The inhibitory effect of the phenolic acids on α-amylase and α-glucosidase activities was evaluated. Thereafter, their antioxidant activities as typified by their 1,1-diphenyl-2 picrylhydrazyl radical scavenging ability and ferric reducing antioxidant properties were determined. The results revealed that both phenolic acids inhibited α-amylase and α-glucosidase activities in a dose-dependent manner (2-8 μg/mL). However, caffeic acid had a significantly (p<0.05) higher inhibitory effect on α-amylase [IC50 (concentration of sample causing 50% enzyme inhibition)=3.68 μg/mL] and α-glucosidase (IC50=4.98 μg/mL) activities than chlorogenic acid (α-amylase IC50=9.10 μg/mL and α-glucosidase IC50=9.24 μg/mL). Furthermore, both phenolic acids exhibited high antioxidant properties, with caffeic acid showing higher effects. The esterification of caffeic acid with quinic acid, producing chlorogenic acid, reduces their ability to inhibit α-amylase and α-glucosidase activities. Thus, the inhibition of α-amylase and α-glucosidase activities by the phenolic acids could be part of the possible mechanism by which the phenolic acids exert their antidiabetic effects.
Nagashima, Takashi; Nakamura, Eri; Kato, Ryosuke; Ohshita, Masakazu; Hayashi, Mikiro; Takeno, Seiki
2017-01-01
ABSTRACT For fatty acid biosynthesis, Corynebacterium glutamicum uses two type I fatty acid synthases (FAS-I), FasA and FasB, in addition to acetyl-coenzyme A (CoA) carboxylase (ACC) consisting of AccBC, AccD1, and AccE. The in vivo roles of the enzymes in supplying precursors for biotin and α-lipoic acid remain unclear. Here, we report genetic evidence demonstrating that the biosynthesis of these cofactors is linked to fatty acid biosynthesis through the FAS-I pathway. For this study, we used wild-type C. glutamicum and its derived biotin vitamer producer BFI-5, which was engineered to express Escherichia coli bioBF and Bacillus subtilis bioI. Disruption of either fasA or fasB in strain BFI-5 led to decreased production of biotin vitamers, whereas its amplification contributed to increased production, with a larger impact of fasA in both cases. Double disruptions of fasA and fasB resulted in no biotin vitamer production. The acc genes showed a positive effect on production when amplified simultaneously. Augmented fatty acid biosynthesis was also reflected in pimelic acid production when carbon flow was blocked at the BioF reaction. These results indicate that carbon flow down the FAS-I pathway is destined for channeling into the biotin biosynthesis pathway, and that FasA in particular has a significant impact on precursor supply. In contrast, fasB disruption resulted in auxotrophy for lipoic acid or its precursor octanoic acid in both wild-type and BFI-5 strains. The phenotypes were fully complemented by plasmid-mediated expression of fasB but not fasA. These results reveal that FasB plays a specific physiological role in lipoic acid biosynthesis in C. glutamicum. IMPORTANCE For the de novo biosynthesis of fatty acids, C. glutamicum exceptionally uses a eukaryotic multifunctional type I fatty acid synthase (FAS-I) system comprising FasA and FasB, in contrast to most bacteria, such as E. coli and B. subtilis, which use an individual nonaggregating type II fatty
Zawodzinski, Thomas A.; Wilson, Mahlon S.; Rishpon, Judith; Gottesfeld, Shimshon
1993-01-01
An enzyme electrode is prepared with a composite coating on an electrical conductor. The composite coating is formed from a casting solution of a perfluorosulfonic acid polymer, an enzyme, and a carbon supported catalyst. The solution may be cast directly on the conductor surface or may be formed as a membrane and applied to the surface. The perfluorosulfonic acid ionomer formed from the casting solution provides an insoluble biocompatible protective matrix for the enzyme and acts to retain the enzyme for long term availability in the electrode structure. The carbon supported catalyst provides catalytic sites throughout the layer for the oxidation of hydrogen peroxide from the enzyme reactions. The carbon support then provides a conductive path for establishing an electrical signal to the electrical conductor. In one embodiment, the electrical conductor is a carbon cloth that permits oxygen or other gas to be introduced to the perfluorosulfonic polymer to promote the enzyme reaction independent of oxygen in the solution being tested.
Carballeira, N M; Emiliano, A; Hernández-Alonso, N; González, F A
1998-12-01
The total synthesis of the naturally occurring (Z)-2-methoxy-5-hexadecenoic acid and (Z)-2-methoxy-6-hexadecenoic acid was accomplished using as a key step Mukaiyama's trimethylsilyl cyanide addition to 4- and 5-pentadecenal, respectively. These syntheses further confirm the structures of the natural marine fatty acids and corroborate their cis double-bond stereochemistry. The title compounds were antimicrobial against the Gram-positive bacteria Staphylococcus aureus (MIC 0.35 micromol/mL) and Streptococcus faecalis (MIC 0.35 micromol/mL).
Rhodotorula glutinis-potential source of lipids, carotenoids, and enzymes for use in industries.
Kot, Anna M; Błażejak, Stanisław; Kurcz, Agnieszka; Gientka, Iwona; Kieliszek, Marek
2016-07-01
Rhodotorula glutinis is capable of synthesizing numerous valuable compounds with a wide industrial usage. Biomass of this yeast constitutes sources of microbiological oils, and the whole pool of fatty acids is dominated by oleic, linoleic, and palmitic acid. Due to its composition, the lipids may be useful as a source for the production of the so-called third-generation biodiesel. These yeasts are also capable of synthesizing carotenoids such as β-carotene, torulene, and torularhodin. Due to their health-promoting characteristics, carotenoids are commonly used in the cosmetic, pharmaceutical, and food industries. They are also used as additives in fodders for livestock, fish, and crustaceans. A significant characteristic of R. glutinis is its capability to produce numerous enzymes, in particular, phenylalanine ammonia lyase (PAL). This enzyme is used in the food industry in the production of L-phenylalanine that constitutes the substrate for the synthesis of aspartame-a sweetener commonly used in the food industry.
Synthesis of neutral ether lipid monoalkyl-diacylglycerol by lipid acyltransferases[S
Ma, Zhengping; Onorato, Joelle M.; Chen, Luping; Nelson, David W.; Yen, Chi-Liang Eric; Cheng, Dong
2017-01-01
In mammals, ether lipids exert a wide spectrum of signaling and structural functions, such as stimulation of immune responses, anti-tumor activities, and enhancement of sperm functions. Abnormal accumulation of monoalkyl-diacylglycerol (MADAG) was found in Wolman’s disease, a human genetic disorder defined by a deficiency in lysosomal acid lipase. In the current study, we found that among the nine recombinant human lipid acyltransferases examined, acyl-CoA:diacylglycerol acyltransferase (DGAT)1, DGAT2, acyl-CoA:monoacylglycerol acyltransferase (MGAT)2, MGAT3, acyl-CoA:wax-alcohol acyltransferase 2/MFAT, and DGAT candidate 3 were able to use 1-monoalkylglycerol (1-MAkG) as an acyl acceptor for the synthesis of monoalkyl-monoacylglycerol (MAMAG). These enzymes demonstrated different enzymatic turnover rates and relative efficiencies for the first and second acylation steps leading to the synthesis of MAMAG and MADAG, respectively. They also exhibited different degrees of substrate preference when presented with 1-monooleoylglycerol versus 1-MAkG. In CHO-K1 cells, treatment with DGAT1 selective inhibitor, XP-620, completely blocked the synthesis of MADAG, indicating that DGAT1 is the predominant enzyme responsible for the intracellular synthesis of MADAG in this model system. The levels of MADAG in the adrenal gland of DGAT1 KO mice were reduced as compared with those of the WT mice, suggesting that DGAT1 is a major enzyme for the synthesis of MADAG in this tissue. Our findings indicate that several of these lipid acyltransferases may be able to synthesize neutral ether lipids in mammals. PMID:28420705
Li, Yang
2011-01-01
We have accomplished an asymmetric synthesis of each enantiomer of 4,4-difluoroglutamic acid. This α-amino acid has been of interest in medicinal chemistry circles. Key features of the synthesis include highly scalable procedures, a Reformatsky-based coupling reaction, and straightforward functional group manipulations to make the parent amino acid. Enantioenrichment derives from an enzymatic resolution of the synthetic material. Conversion of the optically enriched compounds to orthogonally protected forms allows selective formation of peptide bonds. 4,4- Difluoroglutamic acid, in a suitably protected form, is also shown to exhibit enhanced catalytic activity in both an oxidation reaction and a reduction reaction, in comparison to the analogous glutamic acid derivative. PMID:22039908