Science.gov

Sample records for acid synthesis enzymes

  1. Role of malic enzyme during fatty acid synthesis in the oleaginous fungus Mortierella alpina.

    PubMed

    Hao, Guangfei; Chen, Haiqin; Wang, Lei; Gu, Zhennan; Song, Yuanda; Zhang, Hao; Chen, Wei; Chen, Yong Q

    2014-05-01

    The generation of NADPH by malic enzyme (ME) was postulated to be a rate-limiting step during fatty acid synthesis in oleaginous fungi, based primarily on the results from research focusing on ME in Mucor circinelloides. This hypothesis is challenged by a recent study showing that leucine metabolism, rather than ME, is critical for fatty acid synthesis in M. circinelloides. To clarify this, the gene encoding ME isoform E from Mortierella alpina was homologously expressed. ME overexpression increased the fatty acid content by 30% compared to that for a control. Our results suggest that ME may not be the sole rate-limiting enzyme, but does play a role, during fatty acid synthesis in oleaginous fungi.

  2. Relationship of lipogenic enzyme activities to the rate of rat liver fatty acid synthesis

    SciTech Connect

    Nelson, G.; Kelley, D.; Schmidt, P.; Virk, S.; Serrato, C.

    1986-05-01

    The mechanism by which diet regulates liver lipogenesis is unclear. Here the authors report how dietary alterations effect the activities of key enzymes of fatty acid (FA) synthesis. Male Sprague-Dawley rats, 400-500 g, were fasted for 48h and then refed a fat-free, high carbohydrate (HC) diet (75% cal. from sucrose) for 0,3,9,24 and 48h, or refed a HC diet for 48h, then fed a high-fat (HF) diet (44% cal. from corn oil) for 3,9,24 and 48h. The FA synthesis rate and the activities of acetyl CoA carboxylase (AC), fatty acid synthase (FAS), ATP citrate lyase (CL), and glucose 6-phosphate dehydrogenase (G6PDH) were determined in the livers. FA synthesis was assayed with /sup 3/H/sub 2/O, enzyme activities were measured spectrophotometrically except for AC which was assayed with /sup 14/C-bicarbonate. There was no change in the activity of AC during fasting or on the HC diet. Fasting decreased the rate of FA synthesis by 25% and the activities of FAS and CL by 50%; refeeding the HC diet induced parallel changes in FA synthesis and the activities of FAS, CL, and G6PDH. After 9h on the HF diet, FA synthesis had decreased sharply, AC activity increased significantly while no changes were detected in the other activities. Subsequently FA synthesis did not change while the activities of the enzymes decreased slowly. These enzymes did not appear to regulate FA synthesis during inhibition of lipogenesis, but FAS, CL or G6PDH may be rate limiting in the induction phase. Other key factors may regulate FA synthesis during dietary alterations.

  3. Synthesis of repressible acid phosphatase in Saccharomyces cerevisiae under conditions of enzyme instability.

    PubMed Central

    Bostian, K A; Lemire, J M; Halvorson, H O

    1982-01-01

    The synthesis of repressible acid phosphatase in Saccharomyces cerevisiae was examined under conditions of blocked derepression as described by Toh-e et al. (Mol. Gen. Genet. 162:139-149, 1978). Based on a genetic and biochemical analysis of the phenomenon these authors proposed a new regulatory model for acid phosphatase expression involving a simultaneous interaction of regulatory factors in the control of structural gene transcription. We demonstrate here that under growth conditions that fail to produce acid phosphatase the enzyme is readily inactivated. Furthermore, we demonstrate under these conditions the production of acid phosphatase mRNA which is active both in vitro and in vivo in the synthesis of enzyme. This eliminates any step prior to translation of acid phosphatase polypeptide as an explanation for the phenomenon. We interpret our results for the block in appearance of acid phosphatase as a result of both deaccelerated growth and cellular biosynthesis during derepression, accompanied by an enhanced instability of the enzyme. Images PMID:7050664

  4. The synthesis of glutamic acid in the absence of enzymes: Implications for biogenesis

    NASA Technical Reports Server (NTRS)

    Morowitz, Harold; Peterson, Eta; Chang, Sherwood

    1995-01-01

    This paper reports on the non-enzymatic aqueous phase synthesis of amino acids from keto acids, ammonia and reducing agents. The facile synthesis of key metabolic intermediates, particularly in the glycolytic pathway, the citric acid cycle, and the first step of amino acid synthesis, lead to new ways of looking at the problem of biogenesis.

  5. Structural and Mechanistic Insight into the Listeria monocytogenes Two-enzyme Lipoteichoic Acid Synthesis System*

    PubMed Central

    Campeotto, Ivan; Percy, Matthew G.; MacDonald, James T.; Förster, Andreas; Freemont, Paul S.; Gründling, Angelika

    2014-01-01

    Lipoteichoic acid (LTA) is an important cell wall component required for proper cell growth in many Gram-positive bacteria. In Listeria monocytogenes, two enzymes are required for the synthesis of this polyglycerolphosphate polymer. The LTA primase LtaPLm initiates LTA synthesis by transferring the first glycerolphosphate (GroP) subunit onto the glycolipid anchor and the LTA synthase LtaSLm extends the polymer by the repeated addition of GroP subunits to the tip of the growing chain. Here, we present the crystal structures of the enzymatic domains of LtaPLm and LtaSLm. Although the enzymes share the same fold, substantial differences in the cavity of the catalytic site and surface charge distribution contribute to enzyme specialization. The eLtaSLm structure was also determined in complex with GroP revealing a second GroP binding site. Mutational analysis confirmed an essential function for this binding site and allowed us to propose a model for the binding of the growing chain. PMID:25128528

  6. Loss of glycogen debranching enzyme AGL drives bladder tumor growth via induction of hyaluronic acid synthesis

    PubMed Central

    Guin, Sunny; Ru, Yuanbin; Agarwal, Neeraj; Lew, Carolyn R.; Owens, Charles; Comi, Giacomo P.; Theodorescu, Dan

    2015-01-01

    Purpose We demonstrated that Amylo-alpha-1-6-glucosidase-4-alpha-glucanotransferase (AGL) is a tumor growth suppressor and prognostic marker in human bladder cancer. Here we determine how AGL loss enhances tumor growth, hoping to find therapeutically tractable targets/pathways that could be used in patients with low AGL expressing tumors. Experimental Design We transcriptionally profiled bladder cell lines with different AGL expression. By focusing on transcripts overexpressed as a function of low AGL and associated with adverse clinicopathologic variables in human bladder tumors, we sought to increase the chances of discovering novel therapeutic opportunities. Results One such transcript was hyaluronic acid synthase 2 (HAS2), an enzyme responsible for hyaluronic acid (HA) synthesis. HAS2 expression was inversely proportional to that of AGL in bladder cancer cells and immortalized and normal urothelium. HAS2 driven HA synthesis was enhanced in bladder cancer cells with low AGL and this drove anchorage dependent and independent growth. siRNA mediated depletion of HAS2 or inhibition of HA synthesis by 4-Methylumbelliferone (4MU) abrogated in vitro and xenograft growth of bladder cancer cells with low AGL. AGL and HAS2 mRNA expression in human tumors was inversely correlated in patient datasets. Patients with high HAS2 and low AGL tumor mRNA expression had poor survival lending clinical support to xenograft findings that HAS2 drives growth of tumors with low AGL. Conclusion Our study establishes HAS2 mediated HA synthesis as a driver of growth of bladder cancer with low AGL and provides preclinical rationale for personalized targeting of HAS2/HA signaling in patients with low AGL expressing tumors. PMID:26490312

  7. Changes in the Enzymes for Fatty Acid Synthesis and Desaturation during Acclimation of Developing Soybean Seeds to Altered Growth Temperature

    PubMed Central

    Cheesbrough, Thomas M.

    1989-01-01

    Temperature-induced changes in the enzymes for fatty acid synthesis and desaturation were studied in developing soybean seeds (Glycine max L. var Williams 82). Changes were induced by culture of the seed pods for 20 hours in liquid media at 20, 25, or 35°C. Linoleoyl and oleoyl desaturases were 94 and 10 times as active, respectively, in seeds cultured at 20°C as those cultured at 25°C. Both desaturases had negligible activity in seeds cultured at 35°C compared to seeds cultured at 20°C. Though less dramatic, other enzymes also showed differences in activity after 20 hours in culture at 20, 25, or 35°C. Stearoyl-acyl carrier protein (ACP) desaturase and CDP-choline:diacylglycerol phosphorylcholine transferase were most active in preparations from 20°C cultures. Activities were twofold lower at 25°C and a further threefold lower in 35°C cultures. Cultures from 25 and 35°C had 60 and 40%, respectively, of the phosphorylcholine:CTP cytidylyl transferase activity present in cultures grown at 20°C. Fatty acid synthetase, malonyl-coenzyme A:ACP transacylase, palmitoyl-ACP elongation, and choline kinase were not significantly altered by culture temperature. These data suggest that the enzymes for fatty acid desaturation and phosphatidylcholine synthesis can be rapidly modulated in response to altered growth temperatures, while the enzymes for fatty acid synthesis and elongation are not. PMID:16666840

  8. Genipin Cross-Linked Glucose Oxidase and Catalase Multi-enzyme for Gluconic Acid Synthesis.

    PubMed

    Cui, Caixia; Chen, Haibin; Chen, Biqiang; Tan, Tianwei

    2017-02-01

    In this work, glucose oxidase (GOD) and catalase (CAT) were used simultaneously to produce gluconic acid from glucose. In order to reduce the distance between the two enzymes, and therefore improve efficiency, GOD and CAT were cross-linked together using genipin. Improvements in gluconic acid production were due to quick removal of harmful intermediate hydrogen peroxide by CAT. GOD activity was significantly affected by the proportion of CAT in the system, with GOD activity in the cross-linked multi-enzyme (CLME) being 10 times higher than that in an un-cross-linked GOD/CAT mixture. The glucose conversion rate after 15 h using 15 % glucose was also 10 % higher using the CLME than was measured using a GOD/CAT mixture.

  9. Analysis of ATP-citrate lyase and malic enzyme mutants of Yarrowia lipolytica points out the importance of mannitol metabolism in fatty acid synthesis.

    PubMed

    Dulermo, Thierry; Lazar, Zbigniew; Dulermo, Rémi; Rakicka, Magdalena; Haddouche, Ramedane; Nicaud, Jean-Marc

    2015-09-01

    The role of the two key enzymes of fatty acid (FA) synthesis, ATP-citrate lyase (Acl) and malic enzyme (Mae), was analyzed in the oleaginous yeast Yarrowia lipolytica. In most oleaginous yeasts, Acl and Mae are proposed to provide, respectively, acetyl-CoA and NADPH for FA synthesis. Acl was mainly studied at the biochemical level but no strain depleted for this enzyme was analyzed in oleaginous microorganisms. On the other hand the role of Mae in FA synthesis in Y. lipolytica remains unclear since it was proposed to be a mitochondrial NAD(H)-dependent enzyme and not a cytosolic NADP(H)-dependent enzyme. In this study, we analyzed for the first time strains inactivated for corresponding genes. Inactivation of ACL1 decreases FA synthesis by 60 to 80%, confirming its essential role in FA synthesis in Y. lipolytica. Conversely, inactivation of MAE1 has no effects on FA synthesis, except in a FA overaccumulating strain where it improves FA synthesis by 35%. This result definitively excludes Mae as a major key enzyme for FA synthesis in Y. lipolytica. During the analysis of both mutants, we observed a negative correlation between FA and mannitol level. As mannitol and FA pathways may compete for carbon storage, we inactivated YlSDR, encoding a mannitol dehydrogenase converting fructose and NADPH into mannitol and NADP+. The FA content of the resulting mutant was improved by 60% during growth on fructose, demonstrating that mannitol metabolism may modulate FA synthesis in Y. lipolytica.

  10. Regulation of ascorbic acid and of xylulose synthesis in rat-liver extracts. The effect of starvation on the enzymes of the glucuronic acid pathway

    PubMed Central

    Stirpe, F.; Comporti, M.

    1965-01-01

    1. The synthesis of ascorbic acid in rat-liver extracts is impaired during starvation, and more from glucuronolactone and glucuronate than from gulonate and gulonolactone. 2. The formation of xylulose from gulonate and from gulonolactone is greatly enhanced during starvation, whereas it is decreased from glucuronolactone and from glucuronate. 3. The activity of the enzymes of the glucuronic acid pathway during starvation has been determined in rat-liver preparations. Gulonolactone oxidase is decreased, NAD-linked gulonate dehydrogenase is enhanced, and uronolactonase, aldonolactonase and NADP-linked hexonate dehydrogenase are unchanged. 4. The impairment of ascorbic acid synthesis from gulonate observed during starvation can be accounted for by the depressed activity of gulonolactone oxidase. 5. The cause of the enhanced formation of xylulose has been located in the sedimentable fraction of liver homogenate. 6. The hypothesis is formulated of an increased utilization of the glucuronic acid pathway during starvation. PMID:14340084

  11. Effect of Different Nutritional Conditions on the Synthesis of Tricarboxylic Acid Cycle Enzymes

    PubMed Central

    Hanson, Richard S.; Cox, Donald P.

    1967-01-01

    The effect of various nutritional conditions on the levels of Krebs cycle enzymes in Bacillus subtilis, B. licheniformis, and Escherichia coli was determined. The addition of glutamate, α-ketoglutarate, or compounds capable of being catabolized to glutamate, to a minimal glucose medium resulted in complete repression of aconitase in B. subtilis and B. licheniformis. The synthesis of fumarase, succinic dehydrogenase, malic dehydrogenase, and isocitric dehydrogenase was not repressed by these compounds. It is postulated that glutamate or α-ketoglutarate is the true corepressor for the repression of aconitase. A rapidly catabolizable carbon source and α-ketoglutarate or glutamate must be simultaneously present for complete repression of the formation of aconitase. Conditions which repress the synthesis of aconitase in B. subtilis restrict the flow of carbon in the sequence of reactions leading to α-ketoglutarate but do not prevent glutamate oxidation in vivo. The data indicate that separate and independent mechanisms regulate the activity of the anabolic and catabolic reactions of the Krebs cycle in B. subtilis and B. licheniformis. The addition of glutamate to the minimal glucose medium results in the repression of aconitase, isocitric dehydrogenase, and fumarase, but not malic dehydrogenase in E. coli K-38. PMID:4960893

  12. Synthesis of 2-monoacylglycerols and structured triacylglycerols rich in polyunsaturated fatty acids by enzyme catalyzed reactions.

    PubMed

    Rodríguez, Alicia; Esteban, Luis; Martín, Lorena; Jiménez, María José; Hita, Estrella; Castillo, Beatriz; González, Pedro A; Robles, Alfonso

    2012-08-10

    This paper studies the synthesis of structured triacylglycerols (STAGs) by a four-step process: (i) obtaining 2-monoacylglycerols (2-MAGs) by alcoholysis of cod liver oil with several alcohols, catalyzed by lipases Novozym 435, from Candida antartica and DF, from Rhizopus oryzae, (ii) purification of 2-MAGs, (iii) formation of STAGs by esterification of 2-MAGs with caprylic acid catalyzed by lipase DF, from R. oryzae, and (iv) purification of these STAGs. For the alcoholysis of cod liver oil, absolute ethanol, ethanol 96% (v/v) and 1-butanol were compared; the conditions with ethanol 96% were then optimized and 2-MAG yields of around 54-57% were attained using Novozym 435. In these 2-MAGs, DHA accounted for 24-31% of total fatty acids. In the operational conditions this lipase maintained a stable level of activity over at least 11 uses. These results were compared with those obtained with lipase DF, which deactivated after only three uses. The alcoholysis of cod liver oil and ethanol 96% catalyzed by Novozym 435 was scaled up by multiplying the reactant amounts 100-fold and maintaining the intensity of treatment constant (IOT=3g lipase h/g oil). In these conditions, the 2-MAG yield attained was about 67%; these 2-MAGs contained 36.6% DHA. The synthesized 2-MAGs were separated and purified from the alcoholysis reaction products by solvent extraction using solvents of low toxicity (ethanol and hexane); 2-MAG recovery yield and purity of the target product were approximately 96.4% and 83.9%, respectively. These 2-MAGs were transformed to STAGs using the optimal conditions obtained in a previous work. After synthesis and purification, 93% pure STAGs were obtained, containing 38% DHA at sn-2 position and 60% caprylic acid (CA) at sn-1,3 positions (of total fatty acids at these positions), i.e. the major TAG is the STAG with the structure CA-DHA-CA.

  13. RALDH2, the enzyme for retinoic acid synthesis, mediates meiosis initiation in germ cells of the female embryonic chickens.

    PubMed

    Yu, Minli; Yu, Ping; Leghari, Imdad H; Ge, Chutian; Mi, Yuling; Zhang, Caiqiao

    2013-02-01

    Meiosis is a process unique to the differentiation of germ cells and exhibits sex-specific in timing. Previous studies showed that retinoic acid (RA) as the vitamin A metabolite is crucial for controlling Stra8 (Stimulated by retinoic acid gene 8) expression in the gonad and to initiate meiosis; however, the mechanism by which retinoid-signaling acts has remained unclear. In the present study, we investigated the role of the enzyme retinaldehyde dehydrogenase 2 (RALDH2) which catalyzes RA synthesizes by initiating meiosis in chicken ovarian germ cells. Meiotic germ cells were first detected at day 15.5 in chicken embryo ovary when the expression of synaptonemal complex protein 3 (Scp3) and disrupted meiotic cDNA 1 homologue (Dmc1) became elevated, while Stra8 expression was specifically up-regulated at day 12.5 before meiosis onset. It was observed from the increase in Raldh2 mRNA expression levels and decreases in Cyp26b1 (the enzyme for RA catabolism) expression levels during meiosis that requirement for RA accumulation is essential to sustain meiosis. This was also revealed by RA stimulation of the cultured ovaries with the initiation of meiosis response, and the knocking down of the Raldh2 expression during meiosis, leading to abolishment of RA-dependent action. Altogether, these studies indicate that RA synthesis by the enzyme RALDH2 and signaling through its receptor is crucial for meiosis initiation in chicken embryonic ovary.

  14. Recent advances in inhibitors of bacterial fatty acid synthesis type II (FASII) system enzymes as potential antibacterial agents.

    PubMed

    Wang, Yi; Ma, Shutao

    2013-10-01

    Bacterial infections are a constant and serious threat to human health. With the increase of multidrug resistance of clinically pathogenic bacteria, common antibiotic therapies have been less effective. Fatty acid synthesis type II (FASII) system enzymes are essential for bacterial membrane lipid biosynthesis and represent increasingly promising targets for the discovery of antibacterial agents with new mechanisms of action. This review highlights recent advances in inhibitors of bacterial FASII as potential antibacterial agents, paying special attention to the activities, mechanisms, and structure-activity relationships of those inhibitors that mainly target β-ketoacyl-ACP synthase, β-ketoacyl-ACP reductase, β-hydroxyacyl-ACP dehydratase, and enoyl-ACP reductase. Although inhibitors with low nanomolar and selective activity against various bacterial FASII have entered clinical trials, further research is needed to expand upon both available and yet unknown scaffolds to identify new FASII inhibitors that may have antibacterial potential, particularly against resistant bacterial strains.

  15. Recent Studies of the Enzymic Synthesis of Ricinoleic Acid by Developing Castor Beans 1

    PubMed Central

    Moreau, Robert A.; Stumpf, Paul K.

    1981-01-01

    Oleate Δ12-hydroxylase activity was measured in extracts of developing castor bean seeds. Most of the hydroxylase activity is associated with microsomes. However, when microsomes are washed, the activity is completely lost. Some (50%) of the activity can be restored by addition of the 100,000g supernatant to the washed microsomes. Supernatant extracts (100,000g) of developing safflower seeds are able to restore all (100%) of the hydroxylase activity to the washed castor bean microsomes. In addition, purified mammalian catalase can restore some (25%) of the activity to the microsomes but is not as effective as either castor bean or safflower 100,000g supernatants. The Km of the hydroxylase for oxygen is 4 micromolar. Inasmuch as the activity was not inhibited by high concentrations of either carbon monoxide or cyanide, neither the involvement of cytochrome P450 nor other cytochrome systems is suggested. The enzyme system was not saturated by oleoyl-CoA, even at concentrations as high as 200 micromolar. When [14C]oleoyl-CoA is supplied as a substrate, the acyl component is rapidly transferred to phosphatidylcholine (PC). Hydroxylation may occur on PC or on a lipid which receives its acyl component from PC. However, exogeneously added 2-[1-14C]oleoyl-PC was hydroxylated at a much lower rate than was [1-14C]oleoyl-CoA added as the primary substrate. PMID:16661734

  16. Design, synthesis, and biological evaluation of α-hydroxyacyl-AMS inhibitors of amino acid adenylation enzymes.

    PubMed

    Davis, Tony D; Mohandas, Poornima; Chiriac, Maria I; Bythrow, Glennon V; Quadri, Luis E N; Tan, Derek S

    2016-11-01

    Biosynthesis of bacterial natural-product virulence factors is emerging as a promising antibiotic target. Many such natural products are produced by nonribosomal peptide synthetases (NRPS) from amino acid precursors. To develop selective inhibitors of these pathways, we have previously described aminoacyl-AMS (sulfamoyladenosine) macrocycles that inhibit NRPS amino acid adenylation domains but not mechanistically-related aminoacyl-tRNA synthetases. To improve the cell permeability of these inhibitors, we explore herein replacement of the α-amino group with an α-hydroxy group. In both macrocycles and corresponding linear congeners, this leads to decreased biochemical inhibition of the cysteine adenylation domain of the Yersina pestis siderophore synthetase HMWP2, which we attribute to loss of an electrostatic interaction with a conserved active-site aspartate. However, inhibitory activity can be regained by installing a cognate β-thiol moiety in the linear series. This provides a path forward to develop selective, cell-penetrant inhibitors of the biosynthesis of virulence factors to probe their biological functions and potential as therapeutic targets.

  17. Structural and Functional Characterization of BaiA, An Enzyme Involved in Secondary Bile Acid Synthesis in Human Gut Microbe

    PubMed Central

    Bhowmik, Shiva; Jones, David H.; Chiu, Hsien-Po; Park, In-Hee; Chiu, Hsiu-Ju; Axelrod, Herbert L.; Farr, Carol L.; Tien, Henry J.; Agarwalla, Sanjay; Lesley, Scott A.

    2014-01-01

    Despite significant influence of secondary bile acids on human health and disease, limited structural and biochemical information is available for the key gut microbial enzymes catalyzing its synthesis. Herein, we report apo- and co-factor bound crystal structures of BaiA2, a short chain dehydrogenase/reductase from Clostridium scindens VPI 12708 that represent the first protein structure of this pathway. The structures elucidated the basis of co-factor specificity and mechanism of proton relay. A conformational restriction involving Glu42 located in the co-factor binding site seems crucial in determining co-factor specificity. Limited flexibility of Glu42 results in imminent steric and electrostatic hindrance with 2′-phosphate group of NADP(H). Consistent with crystal structures, steady-state kinetic characterization performed with both BaiA2 and BaiA1, a close homolog with 92% sequence identity, revealed specificity constant (kcat/KM) of NADP+ at least an order of magnitude lower than NAD+. Substitution of Glu42 with Ala improved specificity towards NADP+ by 10- fold compared to wild type. The co-factor bound structure uncovered a novel nicotinamide-hydroxyl ion (NAD+-OH−) adduct contraposing previously reported adducts. The OH− of the adduct in BaiA2 is distal to C4 atom of nicotinamide and proximal to 2′-hydroxyl group of the ribose moiety. Moreover, it is located at intermediary distances between terminal functional groups of active site residues Tyr157 (2.7 Å) and Lys161 (4.5 Å). Based on these observations we propose an involvement of NAD+-OH− adduct in proton relay instead of hydride transfer as noted for previous adducts. PMID:23836456

  18. Insolubilized enzymes for food synthesis

    NASA Technical Reports Server (NTRS)

    Marshall, D. L.

    1972-01-01

    Cellulose matrix with numerous enzyme-coated silica particles of colloidal size permanently bound at various sites within matrix was produced that has high activity and possesses requisite physical characteristics for filtration or column operations. Product also allows coupling step in synthesis of edible food to proceed under mild conditions.

  19. [1-butanol synthesis by Escherichia coli cells through butyryl-CoA formation by heterologous enzymes of clostridia and native enzymes of fatty acid beta-oxidation].

    PubMed

    Gulevich, A Iu; Skorokhodova, A Iu; Morzhakova, A A; Antonova, S V; Sukhozhenko, A V; Shakulov, R S; Debabov, V G

    2012-01-01

    Anaerobic biosynthesis of 1-butanol from glucose is investigated in recombinant Escherichia coli strains which form butyryl-CoA using the heterologous enzyme complex of clostridia or as a result of a reversal in the action of native enzymes of the fatty acid beta-oxidation pathway. It was revealed that when the basic pathways of acetic and lactic acid formation are inactivated due to deletions in the ackA, pta, poxB, and ldhA genes, the efficiency of butyryl-CoA biosynthesis and its reduced product, i.e., 1-butanol, by two types of recombinant stains is comparable. The limiting factor for 1-butanol production by the obtained strains is the low substrate specificity of the basic CoA-dependent alcohol/aldehyde AdhE dehydrogenase from E. coli to butyryl-CoA. It was concluded that, in order to construct an efficient 1-butanol producer based on a model strain synthesizing butyryl-CoA as a result of a reversal in fatty acid beta-oxidation enzymes, it is necessary to provide intensive formation of acetyl-CoA and enhanced activity of alternative alcohol and aldehyde dehydrogenases in the cells of a strain.

  20. Effect of grazing fresh legumes or feeding silage on fatty acids and enzymes involved in the synthesis of milk fat in dairy cows.

    PubMed

    Wiking, Lars; Theil, Peter K; Nielsen, Jacob H; Sørensen, Martin T

    2010-08-01

    The impact of fresh legume types or silage on the composition of milk fatty acids and transcription of enzymes involved in the synthesis of milk fat in cows was studied. Three groups of cows grazed high proportions of white clover, red clover and lucerne, respectively. A fourth group of cows was fed maize/grass silage. The cows grazing high proportions of legumes produced significantly more 18:1 trans-11, 18:2 cis9-trans11, 18:2 trans10-cis12 and 18:3 fatty acids than cows fed silage. White clover and lucerne grazing resulted in significantly lower output of 18:1 trans9 in milk than red clover grazing and maize/grass silages. Transcription of stearoyl-CoA desaturase (SCD) in mammary tissue was significantly increased by grazing high proportions of legume whereas fatty acid synthase and acetyl-CoA carboxylase were not affected by type of feeding. Furthermore, average milk fat globule diameter was correlated to daily milk fat yield but was not affected by feeding. Although the fresh forage affected the transcription of SCD in mammary tissue, the largest effects were on the trans11-based fatty acids. It is concluded that type of forage, i.e. fresh or silage, had a greater impact on rumen fermentation pattern than on transcription of enzymes involved in the synthesis of milk fat.

  1. The effects of a low protein diet on amino acids and enzymes in the serine synthesis pathway in mice.

    PubMed

    Antflick, Jordan E; Baker, Glen B; Hampson, David Richard

    2010-06-01

    L-serine is required for cellular and tissue growth and is particularly important in the immature brain where it acts as a crucial neurotrophic factor. In this study, the levels of amino acids and enzymes in the L-serine biosynthetic pathway were examined in the forebrain, cerebellum, liver, and kidney after the exposure of mice to protein-restricted diets. The levels of L-serine, D-serine, and L-serine-O-phosphate were quantified by HPLC and quantitative Western blotting was used to measure changes in protein levels of five enzymes in the pathway. The L-serine biosynthetic enzyme phosphoserine phosphatase was strongly upregulated, while the serine degradative enzymes serine racemase and serine dehydratase were downregulated in the livers and kidneys of mice fed low (6%) or very low (2%) protein diets for 2 weeks compared with mice fed a normal diet (18% protein). No changes in these enzymes were seen in the brain. The levels of L-serine increased in the livers of mice fed 2% protein; in contrast, D-serine levels were reduced below the limit of detection in the livers of mice given either the 6 or 2% diets. D-Serine is a co-agonist at the NMDA class of glutamate receptors; no alterations in NMDA-R1 subunit expression were observed in liver or brain after protein restriction. These findings demonstrate that the expression of L-serine synthetic and degradative enzymes display reciprocal changes in the liver and kidney to increase L-serine and decrease D-serine levels under conditions of protein restriction, and that the brain is insulated from such changes.

  2. Fatty acid composition of muscle fat and enzymes of storage lipid synthesis in whole muscle from beef cattle.

    PubMed

    Kazala, E Chris; Lozeman, Fred J; Mir, Priya S; Aalhus, Jennifer L; Schmutz, Sheila M; Weselake, Randall J

    2006-11-01

    Enhanced intramuscular fat content (i.e., marbling) in beef is a desirable trait, which can result in increased product value. This study was undertaken with the aim of revealing biochemical factors associated with the marbling trait in beef cattle. Samples of longissimus lumborum (LL) and pars costalis diaphragmatis (PCD) were taken from a group of intact crossbred males and females at slaughter, lipids extracted, and the resulting FAME examined for relationships with marbling fat deposition. For LL, significant associations were found between degree of marbling and myristic (14:0, r = 0.55, P < 0.01), palmitic (16:0, r = 0.80, P < 0.001), stearic (18:0, r = -0.58, P < 0.01), and oleic (18:1c-9, r = 0.79, P < 0.001) acids. For PCD, significant relationships were found between marbling and palmitic (r = 0.71, P < 0.001) and oleic (r = 0.74, P < 0.001) acids. Microsomal fractions prepared from PCD muscle were assayed for diacylglycerol acyltransferase (DGAT), lysophosphatidic acid acyltransferase (LPAAT), and phosphatidic acid phosphatase-1 (PAP-1) activity, and the results examined for relationships with degree of intramuscular fat deposition. None of the enzyme activities from PCD displayed an association with marbling fat content, but DGAT specific activity showed significant positive associations with LPAAT (r = 0.54, P < 0.01), total PAP (r = 0.66, P < 0.001), and PAP-1 (r = 0.63, P < 0.01) specific activities. The results on FA compositions of whole muscle tissues provide insight into possible enzyme action associated with the production of specific FA. The increased proportion of oleic acid associated with enhanced lipid content of whole muscle is noteworthy given the known health benefits of this FA.

  3. Δ9-Tetrahydrocannabinolic acid synthase: The application of a plant secondary metabolite enzyme in biocatalytic chemical synthesis.

    PubMed

    Lange, Kerstin; Schmid, Andreas; Julsing, Mattijs K

    2016-09-10

    Δ(9)-Tetrahydrocannabinolic acid synthase (THCAS) from the secondary metabolism of Cannabis sativa L. catalyzes the oxidative formation of an intramolecular CC bond in cannabigerolic acid (CBGA) to synthesize Δ(9)-tetrahydrocannabinolic acid (THCA), which is the direct precursor of Δ(9)-tetrahydrocannabinol (Δ(9)-THC). Aiming on a biotechnological production of cannabinoids, we investigated the potential of the heterologously produced plant oxidase in a cell-free system on preparative scale. THCAS was characterized in an aqueous/organic two-liquid phase setup in order to solubilize the hydrophobic substrate and to allow in situ product removal. Compared to the single phase aqueous setup the specific activity decreased by a factor of approximately 2 pointing to a substrate limitation of CBGA in the two-liquid phase system. However, the specific activity remained stable for at least 3h illustrating the benefit of the two-liquid phase setup. In a repeated-batch setup, THCAS showed only a minor loss of specific activity in the third batch pointing to a high intrinsic stability and high solvent tolerance of the enzyme. Maximal space-time-yields of 0.121gL(-1)h(-1) were reached proving the two-liquid phase concept suitable for biotechnological production of cannabinoids.

  4. Fumarate and cytosolic pH as modulators of the synthesis or consumption of C(4) organic acids through NADP-malic enzyme in Arabidopsis thaliana.

    PubMed

    Arias, Cintia Lucía; Andreo, Carlos Santiago; Drincovich, María Fabiana; Gerrard Wheeler, Mariel Claudia

    2013-02-01

    Arabidopsis thaliana is a plant species that accumulates high levels of organic acids and uses them as carbon, energy and reducing power sources. Among the enzymes that metabolize these compounds, one of the most important ones is malic enzyme (ME). A. thaliana contains four malic enzymes (NADP-ME 1-4) to catalyze the reversible oxidative decarboxylation of malate in the presence of NADP. NADP-ME2 is the only one located in the cell cytosol of all Arabidopsis organs providing most of the total NADP-ME activity. In the present work, the regulation of this key enzyme by fumarate was investigated by kinetic assays, structural analysis and a site-directed mutagenesis approach. The final effect of this metabolite on NADP-ME2 forward activity not only depends on fumarate and substrate concentrations but also on the pH of the reaction medium. Fumarate produced an increase in NADP-ME2 activity by binding to an allosteric site. However at higher concentrations, fumarate caused a competitive inhibition, excluding the substrate malate from binding to the active site. The characterization of ME2-R115A mutant, which is not activated by fumarate, confirms this hypothesis. In addition, the reverse reaction (reductive carboxylation of pyruvate) is also modulated by fumarate, but in a different way. The results indicate pH-dependence of the fumarate modulation with opposite behavior on the two activities analyzed. Thereby, the coordinated action of fumarate over the direct and reverse reactions would allow a precise and specific modulation of the metabolic flux through this enzyme, leading to the synthesis or degradation of C(4) compounds under certain conditions. Thus, the physiological context might be exerting an accurate control of ME activity in planta, through changes in metabolite and substrate concentrations and cytosolic pH.

  5. Coexisting role of fasting or feeding and dietary lipids in the control of gene expression of enzymes involved in the synthesis of saturated, monounsaturated and polyunsaturated fatty acids.

    PubMed

    Rodríguez-Cruz, Maricela; Sánchez González, Raúl; Sánchez García, Apolos M; Lòpez-Alarcòn, Mardia

    2012-03-15

    In the liver, maintaining lipid homeostasis is regulated by physiological and exogenous factors. These lipids are synthesized by Fasn, elongases and desaturases. Interactions in an organism among these factors are quite complex and, to date, relatively little is known about them. The aim of this study was to evaluate the coexisting role of physiological (insulin, fasting and feeding) and exogenous (dietary lipids) factors in the control of gene expression of Fasn, elongases and desaturases via Srebf-1c in liver from rats. Gene expression of encoding enzymes for fatty acid synthesis and fatty acid composition was evaluated in liver from rats in fasting and feeding (at 30, 60, 90 and 120 min after feeding) when food intake (adequate or high-lipid diet) was synchronized to a restricted period of 7h. Fasn, Scd and Fads2 were induced during 120 min after initial feeding in both dietary groups. This induction may be activated in part by insulin via Srebf-1c. Also, we showed for the first time that Elovl7 may be regulated by insulin and dietary lipids. The failure to synthesize saturated and monounsaturated fatty acids is consistent with a downregulation of Fasn and Scd, respectively, by dietary lipids. A higher content of LC-PUFAs was observed due to a high expression of Elovl2 and Elovl5, although Fads2 was suppressed by dietary lipids. Therefore, elongases may have a mechanism that is Srebf-1c-independent. This study suggests that a high-lipid diet triggers, during 120 min after initial feeding, a tight coordination among de novo lipogenesis, elongation, and desaturation and may not always be regulated by Srebf-1c. Finally, upregulation by feeding (insulin) of Fasn, Scd, Fads2 and Srebf-1c is insufficient to compensate for the inhibitory effect of dietary lipids.

  6. Synthesis of amino acids

    DOEpatents

    Davis, J.W. Jr.

    1979-09-21

    A method is described for synthesizing amino acids preceding through novel intermediates of the formulas: R/sub 1/R/sub 2/C(OSOC1)CN, R/sub 1/R/sub 2/C(C1)CN and (R/sub 1/R/sub 2/C(CN)O)/sub 2/SO wherein R/sub 1/ and R/sub 2/ are each selected from hydrogen and monovalent hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  7. Activity and mRNA Levels of Enzymes Involved in Hepatic Fatty Acid Synthesis in Rats Fed Naringenin.

    PubMed

    Hashimoto, Toru; Ide, Takashi

    2015-11-04

    We investigated the physiological activity of naringenin in affecting hepatic lipogenesis and serum and liver lipid levels in rats. Rats were fed diets containing 0, 1, or 2.5 g/kg naringenin for 15 d. Naringenin at a dietary level of 2.5 g/kg significantly decreased the activities and the mRNA levels of various lipogenic enzymes and sterol regulatory element binding protein-1c (SREBP-1c) mRNA level. The activities and the mRNA levels were also 9-22% and 12-38% lower, respectively, in rats fed a 1 g/kg naringenin diet than in the animals fed a naringenin-free diet, although the differences were not significant in many cases. Naringenin at 2.5 g/kg significantly lowered serum triacylglycerol, cholesterol, and phospholipid and hepatic triacylglycerol and cholesterol. This flavonoid at 1.0 g/kg also significantly lowered these parameters except for serum triacylglycerol. Naringenin levels in serum and liver dose-dependently increased, and hepatic concentrations reached levels that can affect various signaling pathways.

  8. Phosphatidic Acid Synthesis in Bacteria

    PubMed Central

    Yao, Jiangwei; Rock, Charles O.

    2012-01-01

    Membrane phospholipid synthesis is a vital facet of bacterial physiology. Although the spectrum of phospholipid headgroup structures produced by bacteria is large, the key precursor to all of these molecules is phosphatidic acid (PtdOH). Glycerol-3-phosphate derived from the glycolysis via glycerol-phosphate synthase is the universal source for the glycerol backbone of PtdOH. There are two distinct families of enzymes responsible for the acylation of the 1-position of glycerol-3-phosphate. The PlsB acyltransferase was discovered in Escherichia coli, and homologs are present in many eukaryotes. This protein family primarily uses acyl-acyl carrier protein (ACP) endproducts of fatty acid synthesis as acyl donors, but may also use acyl-CoA derived from exogenous fatty acids. The second protein family, PlsY, is more widely distributed in bacteria and utilizes the unique acyl donor, acyl-phosphate, which is produced from acyl-ACP by the enzyme PlsX. The acylation of the 2-position is carried out by members of the PlsC protein family. All PlsCs use acyl-ACP as the acyl donor, although the PlsCs of the γ-proteobacteria also may use acyl-CoA. Phospholipid headgroups are precursors in the biosynthesis of other membrane-associated molecules and the diacylglycerol product of these reactions is converted to PtdOH by one of two distinct families of lipid kinases. The central importance of the de novo and recycling pathways to PtdOH in cell physiology suggest these enzymes are suitable targets for the development of antibacterial therapeutics in Gram-positive pathogens. This article is part of a Special Issue entitled Phospholipids and Phospholipid Metabolism. PMID:22981714

  9. Enzymatic synthesis of cinnamic acid derivatives.

    PubMed

    Lee, Gia-Sheu; Widjaja, Arief; Ju, Yi-Hsu

    2006-04-01

    Using Novozym 435 as catalyst, the syntheses of ethyl ferulate (EF) from ferulic acid (4-hydroxy 3-methoxy cinnamic acid) and ethanol, and octyl methoxycinnamate (OMC) from p-methoxycinnamic acid and 2-ethyl hexanol were successfully carried out in this study. A conversion of 87% was obtained within 2 days at 75 degrees C for the synthesis of EF. For the synthesis of OMC at 80 degrees C, 90% conversion can be obtained within 1 day. The use of solvent and high reaction temperature resulted in better conversion for the synthesis of cinnamic acid derivatives. Some cinnamic acid esters could also be obtained with higher conversion and shorter reaction times in comparison to other methods reported in the literature. The enzyme can be reused several times before significant activity loss was observed.

  10. Abscisic Acid Synthesis and Response

    PubMed Central

    Finkelstein, Ruth

    2013-01-01

    Abscisic acid (ABA) is one of the “classical” plant hormones, i.e. discovered at least 50 years ago, that regulates many aspects of plant growth and development. This chapter reviews our current understanding of ABA synthesis, metabolism, transport, and signal transduction, emphasizing knowledge gained from studies of Arabidopsis. A combination of genetic, molecular and biochemical studies has identified nearly all of the enzymes involved in ABA metabolism, almost 200 loci regulating ABA response, and thousands of genes regulated by ABA in various contexts. Some of these regulators are implicated in cross-talk with other developmental, environmental or hormonal signals. Specific details of the ABA signaling mechanisms vary among tissues or developmental stages; these are discussed in the context of ABA effects on seed maturation, germination, seedling growth, vegetative stress responses, stomatal regulation, pathogen response, flowering, and senescence. PMID:24273463

  11. Genome-Wide Identification of BAHD Acyltransferases and In vivo Characterization of HQT-like Enzymes Involved in Caffeoylquinic Acid Synthesis in Globe Artichoke

    PubMed Central

    Moglia, Andrea; Acquadro, Alberto; Eljounaidi, Kaouthar; Milani, Anna M.; Cagliero, Cecilia; Rubiolo, Patrizia; Genre, Andrea; Cankar, Katarina; Beekwilder, Jules; Comino, Cinzia

    2016-01-01

    Globe artichoke (Cynara cardunculus L. var. scolymus) is a rich source of compounds promoting human health (phytonutrients), among them caffeoylquinic acids (CQAs), mainly represented by chlorogenic acid (CGA), and dicaffeoylquinic acids (diCQAs). The enzymes involved in their biosynthesis belong to the large family of BAHD acyltransferases. Following a survey of the globe artichoke genome, we identified 69 BAHD proteins carrying the catalytic site (HXXXD). Their phylogenetic analysis together with another 43 proteins, from 21 species, representative of the BAHD family, highlighted their grouping in seven major clades. Nine globe artichoke acyltransferases clustered in a sub-group of Clade V, with 3 belonging to hydroxycinnamoyl-CoA:quinate hydroxycinnamoyl transferase (HQT) and 2 to hydroxycinnamoyl-CoA:shikimate/quinate hydroxycinnamoyl transferase (HCT) like proteins. We focused our attention on the former, HQT1, HQT2, and HQT3, as they are known to play a key role in CGA biosynthesis. The expression of genes coding for the three HQTs and correlation of expression with the CQA content is reported for different globe artichoke tissues. For the first time in the globe artichoke, we developed and applied the virus-induced gene silencing approach with the goal of assessing in vivo the effect of HQT1 silencing, which resulted in a marked reduction of both CGA and diCQAs. On the other hand, when the role of the three HQTs was assessed in leaves of Nicotiana benthamiana through their transient overexpression, significant increases in mono- and diCQAs content were observed. Using transient GFP fusion proteins expressed in N. benthamiana leaves we also established the sub-cellular localization of these three enzymes. PMID:27721818

  12. Genome-Wide Identification of BAHD Acyltransferases and In vivo Characterization of HQT-like Enzymes Involved in Caffeoylquinic Acid Synthesis in Globe Artichoke.

    PubMed

    Moglia, Andrea; Acquadro, Alberto; Eljounaidi, Kaouthar; Milani, Anna M; Cagliero, Cecilia; Rubiolo, Patrizia; Genre, Andrea; Cankar, Katarina; Beekwilder, Jules; Comino, Cinzia

    2016-01-01

    Globe artichoke (Cynara cardunculus L. var. scolymus) is a rich source of compounds promoting human health (phytonutrients), among them caffeoylquinic acids (CQAs), mainly represented by chlorogenic acid (CGA), and dicaffeoylquinic acids (diCQAs). The enzymes involved in their biosynthesis belong to the large family of BAHD acyltransferases. Following a survey of the globe artichoke genome, we identified 69 BAHD proteins carrying the catalytic site (HXXXD). Their phylogenetic analysis together with another 43 proteins, from 21 species, representative of the BAHD family, highlighted their grouping in seven major clades. Nine globe artichoke acyltransferases clustered in a sub-group of Clade V, with 3 belonging to hydroxycinnamoyl-CoA:quinate hydroxycinnamoyl transferase (HQT) and 2 to hydroxycinnamoyl-CoA:shikimate/quinate hydroxycinnamoyl transferase (HCT) like proteins. We focused our attention on the former, HQT1, HQT2, and HQT3, as they are known to play a key role in CGA biosynthesis. The expression of genes coding for the three HQTs and correlation of expression with the CQA content is reported for different globe artichoke tissues. For the first time in the globe artichoke, we developed and applied the virus-induced gene silencing approach with the goal of assessing in vivo the effect of HQT1 silencing, which resulted in a marked reduction of both CGA and diCQAs. On the other hand, when the role of the three HQTs was assessed in leaves of Nicotiana benthamiana through their transient overexpression, significant increases in mono- and diCQAs content were observed. Using transient GFP fusion proteins expressed in N. benthamiana leaves we also established the sub-cellular localization of these three enzymes.

  13. Rhodotorula glutinis Phenylalanine/Tyrosine Ammonia Lyase Enzyme Catalyzed Synthesis of the Methyl Ester of para-Hydroxycinnamic Acid and its Potential Antibacterial Activity

    PubMed Central

    MacDonald, Marybeth C.; Arivalagan, Pugazhendhi; Barre, Douglas E.; MacInnis, Judith A.; D’Cunha, Godwin B.

    2016-01-01

    Biotransformation of L-tyrosine methyl ester (L-TM) to the methyl ester of para- hydroxycinnamic acid (p-HCAM) using Rhodotorula glutinis yeast phenylalanine/tyrosine ammonia lyase (PTAL; EC 4.3.1.26) enzyme was successfully demonstrated for the first time; progress of the reaction was followed by spectrophotometric determination at 315 nm. The following conditions were optimized for maximal formation of p-HCAM: pH (8.5), temperature (37°C), speed of agitation (50 rpm), enzyme concentration (0.080 μM), and substrate concentration (0.50 mM). Under these conditions, the yield of the reaction was ∼15% in 1 h incubation period and ∼63% after an overnight (∼18 h) incubation period. The product (p-HCAM) of the reaction of PTAL with L-TM was confirmed using Nuclear Magnetic Resonance spectroscopy (NMR). Fourier Transform Infra-Red spectroscopy (FTIR) was carried out to rule out potential hydrolysis of p-HCAM during overnight incubation. Potential antibacterial activity of p-HCAM was tested against several strains of Gram-positive and Gram-negative bacteria. This study describes a synthetically useful transformation, and could have future clinical and industrial applications. PMID:27014206

  14. Enzymic synthesis of indole-3-acetyl-1-O-beta-d-glucose. II. Metabolic characteristics of the enzyme

    NASA Technical Reports Server (NTRS)

    Leznicki, A. J.; Bandurski, R. S.

    1988-01-01

    The synthesis of indole-3-acetyl-1-O-beta-D-glucose from indole-3-acetic acid (IAA) and uridine diphosphoglucose (UDPG) has been shown to be a reversible reaction with the equilibrium away from ester formation and toward formation of IAA. The enzyme occurs primarily in the liquid endosperm of the corn kernel but some activity occurs in the embryo. It is relatively specific showing no glucose ester formation with oxindole-3-acetic acid or 7-hydroxy-oxindole-3-acetic acid, and low activity with phenylpropene acids, such as rho-coumaric acid. The enzyme is also specific for the nucleotide sugar showing no activity with UDPGalactose or UDPXylose. The enzyme is inhibited by inorganic pyrophosphate, by phosphate esters and by phospholipids, particularly phosphatidyl ethanolamine. The enzyme is inhibited by zeatin, by 2,4-dichlorophenoxy-acetic acid, by IAA-myo-inositol and IAA-glucan, but not by zeatin riboside, and only weakly by gibberellic acid, abscisic acid and kinetin. The reaction is slightly stimulated by both calcium and calmodulin and, in some cases, by thiol compounds. The role of this enzyme in the homeostatic control of indole-3-acetic acid levels in Zea mays is discussed.

  15. Borinic acid catalysed peptide synthesis.

    PubMed

    El Dine, Tharwat Mohy; Rouden, Jacques; Blanchet, Jérôme

    2015-11-18

    The catalytic synthesis of peptides is a major challenge in the modern organic chemistry hindered by the well-established use of stoichiometric coupling reagents. Herein, we describe for the first time that borinic acid is able to catalyse this reaction under mild conditions with an improved activity compared to our recently developed thiophene-based boronic acid. This catalyst is particularly efficient for peptide bond synthesis affording dipeptides in good yields without detectable racemization.

  16. Dual Enzyme-Responsive Capsules of Hyaluronic Acid-block-Poly(Lactic Acid) for Sensing Bacterial Enzymes.

    PubMed

    Tücking, Katrin-Stephanie; Grützner, Verena; Unger, Ronald E; Schönherr, Holger

    2015-07-01

    The synthesis of novel amphiphilic hyaluronic acid (HYA) and poly(lactic acid) (PLA) block copolymers is reported as the key element of a strategy to detect the presence of pathogenic bacterial enzymes. In addition to the formation of defined HYA-block-PLA assemblies, the encapsulation of fluorescent reporter dyes and the selective enzymatic degradation of the capsules by hyaluronidase and proteinase K are studied. The synthesis of the dual enzyme-responsive HYA-b-PLA is carried out by copper-catalyzed Huisgen 1,3-dipolar cycloaddition. The resulting copolymers are assembled in water to form vesicular structures, which are characterized by scanning electron microscopy, transmission electron microscopy, dynamic light scattering (DLS), and fluorescence lifetime imaging microscopy (FLIM). DLS measurements show that both enzymes cause a rapid decrease in the hydrodynamic diameter of the nanocapsules. Fluorescence spectroscopy data confirm the liberation of encapsulated dye, which indicates the disintegration of the capsules and validates the concept of enzymatically triggered payload release. Finally, cytotoxicity assays confirm that the HYA-b-PLA nanocapsules are biocompatible with primary human dermal microvascular endothelial cells.

  17. Bile acids: regulation of synthesis.

    PubMed

    Chiang, John Y L

    2009-10-01

    Bile acids are physiological detergents that generate bile flow and facilitate intestinal absorption and transport of lipids, nutrients, and vitamins. Bile acids also are signaling molecules and inflammatory agents that rapidly activate nuclear receptors and cell signaling pathways that regulate lipid, glucose, and energy metabolism. The enterohepatic circulation of bile acids exerts important physiological functions not only in feedback inhibition of bile acid synthesis but also in control of whole-body lipid homeostasis. In the liver, bile acids activate a nuclear receptor, farnesoid X receptor (FXR), that induces an atypical nuclear receptor small heterodimer partner, which subsequently inhibits nuclear receptors, liver-related homolog-1, and hepatocyte nuclear factor 4alpha and results in inhibiting transcription of the critical regulatory gene in bile acid synthesis, cholesterol 7alpha-hydroxylase (CYP7A1). In the intestine, FXR induces an intestinal hormone, fibroblast growth factor 15 (FGF15; or FGF19 in human), which activates hepatic FGF receptor 4 (FGFR4) signaling to inhibit bile acid synthesis. However, the mechanism by which FXR/FGF19/FGFR4 signaling inhibits CYP7A1 remains unknown. Bile acids are able to induce FGF19 in human hepatocytes, and the FGF19 autocrine pathway may exist in the human livers. Bile acids and bile acid receptors are therapeutic targets for development of drugs for treatment of cholestatic liver diseases, fatty liver diseases, diabetes, obesity, and metabolic syndrome.

  18. Final Step of Phosphatidic Acid Synthesis in Pea Chloroplasts Occurs in the Inner Envelope Membrane 1

    PubMed Central

    Andrews, Jaen; Ohlrogge, John B.; Keegstra, Kenneth

    1985-01-01

    The second enzyme of phosphatidic acid synthesis from glycerol-3-phosphate, 1-acylglycerophospate acyltransferase, was localized to the inner envelope membrane of pea chloroplasts. The activity of this enzyme was measured by both a coupled enzyme assay and a direct enzyme assay. Using the coupled enzyme assay, phosphatidic acid phosphatase was also localized to the inner envelope membrane, although this enzyme has very low activity in pea chloroplasts. The addition of UDP-galactose to unfractionated pea chloroplast envelope preparations did not result in significant conversion of newly synthesized diacylglycerol to monogalactosyldiacylglycerol. Thus, the envelope synthesized phosphatidic acid may not be involved in galactolipid synthesis in pea chloroplasts. PMID:16664266

  19. Pyrophosphate-condensing activity linked to nucleic acid synthesis.

    PubMed Central

    Volloch, V Z; Rits, S; Tumerman, L

    1979-01-01

    In some preparations of DNA dependent RNA polymerase a new enzymatic activity has been found which catalyzes the condensation of two pyrophosphate molecules, liberated in the process of RNA synthesis, to one molecule of orthophosphate and one molecule of Mg (or Mn) - chelate complex with trimetaphosphate. This activity can also cooperate with DNA-polymerase, on condition that both enzymes originate from the same cells. These results point to two general conclusions. First, energy is conserved in the overall process of nucleic acid synthesis and turnover, so that the process does not require an energy influx from the cell's general resources. Second, the synthesis of nucleic acids is catalyzed by a complex enzyme system which contains at least two separate enzymes, one responsible for nucleic acid polymerization and the other for energy conservation via pyrophosphate condensation. Images PMID:88040

  20. Potent inhibition of retinoic acid metabolism enzyme(s) by novel azolyl retinoids.

    PubMed

    Njar, V C; Nnane, I P; Brodie, A M

    2000-09-04

    Novel (+/-)-4-azolyl retinoic acid analogues 4, 5, 7 and 8 have been designed and synthesized and have been shown to be powerful inhibitors of hamster microsomal all-trans-retinoic acid 4-hydroxylase enzyme(s). (+/-)-4-(1H-Imidazol-1-yl)retinoic acid (4) is the most potent inhibitor of this enzyme reported to date.

  1. Oligogalacturonide-mediated induction of a gene involved in jasmonic acid synthesis in response to the cell-wall-degrading enzymes of the plant pathogen Erwinia carotovora.

    PubMed

    Norman, C; Vidal, S; Palva, E T

    1999-07-01

    Identification of Arabidopsis thaliana genes responsive to plant cell-wall-degrading enzymes of Erwinia carotovora subsp. carotovora led to the isolation of a cDNA clone with high sequence homology to the gene for allene oxide synthase, an enzyme involved in the biosynthesis of jasmonates. Expression of the corresponding gene was induced by the extracellular enzymes from this pathogen as well as by treatment with methyl jasmonate and short oligogalacturonides (OGAs). This suggests that OGAs are involved in the induction of the jasmonate pathway during plant defense response to E. carotovora subsp. carotovora attack.

  2. Synthesis and Testing of Polymers Susceptible to Hydrolysis by Proteolytic Enzymes

    DTIC Science & Technology

    1974-08-01

    Polycaprolactone 4. Polyteirs containing • hydroxy acids II. METHODS UEVELOPMIENT A. Exposure of Materials to Enzymes After the synthesis and purification of d...to our benzylated nylon samples. A 6 day test with therinolysin, chyniotrypsin, and subtilisin showed that the mere presence of the polymer caused...and subtilisin . C. Analytical Procedures for Measurinq Degradation 1. Weight Loss By weighing the solid polymer before and after exposure to enzyme

  3. Benzene-free synthesis of adipic acid.

    PubMed

    Niu, Wei; Draths, K M; Frost, J W

    2002-01-01

    Strains of Escherichia coli were constructed and evaluated that synthesized cis,cis-muconic acid from D-glucose under fed-batch fermentor conditions. Chemical hydrogenation of the cis,cis-muconic acid in the resulting fermentation broth has also been examined. Biocatalytic synthesis of adipic acid from glucose eliminates two environmental concerns characteristic of industrial adipic acid manufacture: use of carcinogenic benzene and benzene-derived chemicals as feedstocks and generation of nitrous oxide as a byproduct of a nitric acid catalyzed oxidation. While alternative catalytic syntheses that eliminate the use of nitric acid have been developed, most continue to rely on petroleum-derived benzene as the ultimate feedstock. In this study, E. coli WN1/pWN2.248 was developed that synthesized 36.8 g/L of cis,cis-muconic acid in 22% (mol/mol) yield from glucose after 48 h of culturing under fed-batch fermentor conditions. Optimization of microbial cis,cis-muconic acid synthesis required expression of three enzymes not typically found in E. coli. Two copies of the Klebsiella pneumoniae aroZ gene encoding DHS dehydratase were inserted into the E. coli chromosome, while the K. pneumoniae aroY gene encoding PCA decarboxylase and the Acinetobacter calcoaceticus catA gene encoding catechol 1,2-dioxygenase were expressed from an extrachromosomal plasmid. After fed-batch culturing of WN1/pWN2.248 was complete, the cells were removed from the broth, which was treated with activated charcoal and subsequently filtered to remove soluble protein. Hydrogenation of the resulting solution with 10% Pt on carbon (5% mol/mol) at 3400 kPa of H2 pressure for 2.5 h at ambient temperature afforded a 97% (mol/mol) conversion of cis,cis-muconic acid into adipic acid.

  4. Energetics of amino acid synthesis in hydrothermal ecosystems

    NASA Technical Reports Server (NTRS)

    Amend, J. P.; Shock, E. L.

    1998-01-01

    Thermodynamic calculations showed that the autotrophic synthesis of all 20 protein-forming amino acids was energetically favored in hot (100 degrees C), moderately reduced, submarine hydrothermal solutions relative to the synthesis in cold (18 degrees C), oxidized, surface seawater. The net synthesis reactions of 11 amino acids were exergonic in the hydrothermal solution, but all were endergonic in surface seawater. The synthesis of the requisite amino acids of nine thermophilic and hyperthermophilic proteins in a 100 degreesC hydrothermal solution yielded between 600 and 8000 kilojoules per mole of protein, which is energy that is available to drive the intracellular synthesis of enzymes and other biopolymers in hyperthermophiles thriving in these ecosystems.

  5. Site-specific immobilization of enzymes on magnetic nanoparticles and their use in organic synthesis.

    PubMed

    Yu, Ching-Ching; Kuo, Yu-Ying; Liang, Chien-Fu; Chien, Wei-Ting; Wu, Huan-Ting; Chang, Tsung-Che; Jan, Fan-Dan; Lin, Chun-Cheng

    2012-04-18

    Magnetic nanoparticles (MNPs) are attractive materials that serve as a support for enzyme immobilization and facilitate separations by applying an external magnetic field; this could facilitate the recycling of enzymes and broaden their applications in organic synthesis. Herein, we report the methods for the immobilization of water-soluble and membrane-bound enzymes, and the activity difference between free and immobilized enzymes is discussed. Sialyltransferase (PmST1, from Pasteurella multocida ) and cytidine monophosphate (CMP)-sialic acid synthetase (CSS, from Neisseria meningitides ) were chosen as water-soluble enzymes and expressed using an intein expression system. The enzymes were site-specifically and covalently immobilized on PEGylated-N-terminal cysteine MNPs through native chemical ligation (NCL). Increasing the length of the PEG linker between the enzyme and the MNP surface increased the activity of the immobilized enzymes relative to the free parent enzymes. In addition, the use of a fluorescent acceptor tag for PmST1 affected enzyme kinetics. In contrast, sialyltransferase from Neisseria gonorrheae (NgST, a membrane-bound enzyme) was modified with a biotin-labeled cysteine at the C-terminus using NCL, and the enzyme was then assembled on streptavidin-functionalized MNPs. Using a streptavidin-biotin interaction, it was possible to immobilize NgST on a solid support under mild ligation conditions, which prevented the enzyme from high-temperature decomposition and provided an approximately 2-fold increase in activity compared to other immobilization methods on MNPs. Finally, the ganglioside GM3-derivative (sialyl-lactose derivative) was synthesized in a one-pot system by combining the use of immobilized PmST1 and CSS. The enzymes retained 50% activity after being reused ten times. Furthermore, the results obtained using the one-pot two-immobilized-enzyme system demonstrated that it can be applied to large-scale reactions with acceptable yields and

  6. Temperature Features of Enzymes Affecting Crassulacean acid Metabolism

    PubMed Central

    Brandon, P. C.

    1967-01-01

    Enzymes involved in malic acid production via a pathway with 2 carboxylation reactions and in malic acid conversion via total oxidation have been demonstrated in mitochondria of Bryophyllum tubiflorum Harv. Activation of the mitochondria by Tween 40 was necessary to reveal part of the enzyme activities. The temperature behavior of the enzymes has been investigated, revealing optimal activity of acid-producing enzymes at 35°. Even at 53° the optimum for acid-converting enzymes was not yet reached. From the simultaneous action of acid-producing and acid-converting enzyme systems the overall result at different temperatures was established. Up to 15° the net result was a malic acid production. Moderate temperatures brought about a decrease in this accumulation, which was partly accompanied by a shift to isocitrate production, while at higher temperatures total oxidation of the acids exceeded the production. PMID:16656606

  7. Transaminases for the synthesis of enantiopure beta-amino acids

    PubMed Central

    2012-01-01

    Optically pure β-amino acids constitute interesting building blocks for peptidomimetics and a great variety of pharmaceutically important compounds. Their efficient synthesis still poses a major challenge. Transaminases (also known as aminotransferases) possess a great potential for the synthesis of optically pure β-amino acids. These pyridoxal 5'-dependent enzymes catalyze the transfer of an amino group from a donor substrate to an acceptor, thus enabling the synthesis of a wide variety of chiral amines and amino acids. Transaminases can be applied either for the kinetic resolution of racemic compounds or the asymmetric synthesis starting from a prochiral substrate. This review gives an overview over microbial transaminases with activity towards β-amino acids and their substrate spectra. It also outlines current strategies for the screening of new biocatalysts. Particular emphasis is placed on activity assays which are applicable to high-throughput screening. PMID:22293122

  8. Key Building Blocks via Enzyme-Mediated Synthesis

    NASA Astrophysics Data System (ADS)

    Fischer, Thomas; Pietruszka, Jörg

    Biocatalytic approaches to valuable building blocks in organic synthesis have emerged as an important tool in the last few years. While first applications were mainly based on hydrolases, other enzyme classes such as oxidoreductases or lyases moved into the focus of research. Nowadays, a vast number of biotransformations can be found in the chemical and pharmaceutical industries delivering fine chemicals or drugs. The mild reaction conditions, high stereo-, regio-, and chemoselectivities, and the often shortened reaction pathways lead to economical and ecological advantages of enzymatic conversions. Due to the enormous number of enzyme-mediated syntheses, the present chapter is not meant to be a complete review, but to deliver comprehensive insights into well established enzymatic systems and recent advances in the application of enzymes in natural product synthesis. Furthermore, it is focused on the most frequently used enzymes or enzyme classes not covered elsewhere in the present volume.

  9. Integrated microdroplet-based system for enzyme synthesis and sampling

    NASA Astrophysics Data System (ADS)

    Lapierre, Florian; Best, Michel; Stewart, Robert; Oakeshott, John; Peat, Thomas; Zhu, Yonggang

    2013-12-01

    Microdroplet-based microfluidic devices are emerging as powerful tools for a wide range of biochemical screenings and analyses. Monodispersed aqueous microdroplets from picoliters to nanoliters in volume are generated inside microfluidic channels within an immiscible oil phase. This results in the formation of emulsions which can contain various reagents for chemical reactions and can be considered as discrete bioreactors. In this paper an integrated microfluidic platform for the synthesis, screening and sorting of libraries of an organophosphate degrading enzyme is presented. The variants of the selected enzyme are synthesized from a DNA source using in-vitro transcription and translation method. The synthesis occurs inside water-in-oil emulsion droplets, acting as bioreactors. Through a fluorescence based detection system, only the most efficient enzymes are selected. All the necessary steps from the enzyme synthesis to selection of the best genes (producing the highest enzyme activity) are thus integrated inside a single and unique device. In the second part of the paper, an innovative design of the microfluidic platform is presented, integrating an electronic prototyping board for ensuring the communication between the various components of the platform (camera, syringe pumps and high voltage power supply), resulting in a future handheld, user-friendly, fully automated device for enzyme synthesis, screening and selection. An overview on the capabilities as well as future perspectives of this new microfluidic platform is provided.

  10. Effects of pyrazinamide on fatty acid synthesis by whole mycobacterial cells and purified fatty acid synthase I.

    PubMed

    Boshoff, Helena I; Mizrahi, Valerie; Barry, Clifton E

    2002-04-01

    The effects of low extracellular pH and intracellular accumulation of weak organic acids were compared with respect to fatty acid synthesis by whole cells of Mycobacterium tuberculosis and Mycobacterium smegmatis. The profile of fatty acids synthesized during exposure to benzoic, nicotinic, or pyrazinoic acids, as well as that observed during intracellular hydrolysis of the corresponding amides, was not a direct consequence of modulation of fatty acid synthesis by these compounds but reflected the response to inorganic acid stress. Analysis of fatty acid synthesis in crude mycobacterial cell extracts demonstrated that pyrazinoic acid failed to directly modulate the fatty acid synthase activity catalyzed by fatty acid synthase I (FAS-I). However, fatty acid synthesis was irreversibly inhibited by 5-chloro-pyrazinamide in a time-dependent fashion. Moreover, we demonstrate that pyrazinoic acid does not inhibit purified mycobacterial FAS-I, suggesting that this enzyme is not the immediate target of pyrazinamide.

  11. Abiotic synthesis of fatty acids

    NASA Technical Reports Server (NTRS)

    Leach, W. W.; Nooner, D. W.; Oro, J.

    1978-01-01

    The formation of fatty acids by Fischer-Tropsch-type synthesis was investigated with ferric oxide, ammonium carbonate, potassium carbonate, powdered Pueblito de Allende carbonaceous chondrite, and filings from the Canyon Diablo meteorite used as catalysts. Products were separated and identified by gas chromatography and mass spectrometry. Iron oxide, Pueblito de Allende chondrite, and Canyon Diablo filings in an oxidized catalyst form yielded no fatty acids. Canyon Diablo filings heated overnight at 500 C while undergoing slow purging by deuterium produced fatty acids only when potassium carbonate was admixed; potassium carbonate alone also produced these compounds. The active catalytic combinations gave relatively high yields of aliphatic and aromatic hydrocarbons; substantial amounts of n-alkenes were almost invariably observed when fatty acids were produced; the latter were in the range C6 to C18, with maximum yield in C9 or 10.

  12. Proof of de novo synthesis of the qa enzymes of Neurospora crassa during induction

    PubMed Central

    Reinert, William R.; Giles, Norman H.

    1977-01-01

    In Neurospora crassa three inducible enzymes are necessary to catabolize quinic acid to protocatechuic acid. The three genes encoding these enzymes are tightly linked on chromosome VII near methionine-7 (me-7). This qa cluster includes a fourth gene, qa-1, which encodes a regulatory protein apparently exerting positive control over transcription of the other three qa genes. However, an alternative hypothesis is that the qa-1 protein simply activates preformed polypeptides derived from the three structural genes. The use of density labeling with D2O demonstrated conclusively that the qa enzymes are synthesized de novo only during induction on quinic acid. Native catabolic dehydroquinase (5-dehydroquinate dehydratase; 5-dehydroquinate hydro-lyase, EC 4.2.1.10) (a homopolymer of ca 22 identical subunits) has a density of 1.2790 g/cm3 as determined by centrifugation in a modified cesium chloride density gradient. Growth in H2O followed by induction in 95% D2O shifts the density of the enzyme to 1.3130 g/cm3, indicating de novo synthesis during induction. In the reciprocal experiment, i.e., growth in 80% D2O followed by induction in either 95% D2O or H2O, the densities of catabolic dehydroquinase were 1.3135 and 1.2800 g/cm3, respectively. Because growth on D2O does not affect the density of the H2O-induced enzyme, there can be no significant synthesis of catabolic dehydroquinase prior to induction. Similar results were obtained for a second qa enzyme, quinate dehydrogenase (quinate:NAD+ oxidoreductase, EC 1.1.1.24). Thus, induction of two qa enzymes involves de novo protein synthesis, not enzyme activation or assembly. PMID:144915

  13. Cell Wall Polymers of Bacillus sphaericus 9602 II. Synthesis of the First Enzyme Unique to Cortex Synthesis During Sporulation

    PubMed Central

    Tipper, Donald J.; Pratt, Iona

    1970-01-01

    The cell wall peptidoglycan of vegetative cells of Bacillus sphaericus 9602 contains l-lysine and d-isoasparagine and is devoid of diaminopimelic acid (Dap), whereas the peptidoglycan of its spore cortex is devoid of l-lysine and d-isoasparagine and contains meso-Dap. These two structures have a common biosynthetic precursor, uridine-diphospho-N-acetylmuramyl-l- alanyl-d-glutamic acid, which accepts either l-lysine or meso-Dap, the latter reaction being the first unique to the synthesis of the spore cortex peptidoglycan. l-lysine-adding activity decays at the end of vegetative growth to a level which is maintained until Dap-adding activity appears, when it declines rapidly again. Dap-adding activity is not detectable in refractile spores, in vegetative cells, or in sporulating cells until about 4 hr after the end of vegetative growth, when it increases rapidly for about 1.5 hr in a process dependent on continued protein and ribonucleic acid (RNA) synthesis. This process apparently involves transcription and translation during this period of a “sporulation-specific” gene whose product is essential for and unique to sporulation. It is closely followed by the acquirement of refractility. Another sporulation-specific gene, that for dipicolinate synthase, is apparently transcribed and translated in an overlapping period commencing about 0.5 hr later, although dipicolinate does not accumulate rapidly until 1.5 hr later, when about 75% of the cells are already refractile. Inhibition of protein synthesis with chloramphenicol or of RNA synthesis with streptolydigin inhibited accumulation of these enzymes in sporulating cells; this inhibition could be reversed by washing out the antibiotics after 1.5 hr. Sporulation recommenced with an unaltered sequence of events but with poorer synchrony. There was no evidence for a messenger RNA for either enzyme of lifetime greater than a small fraction of the period of enzyme accumulation, although dilution with 10 volumes of fresh

  14. Novel 2-oxoimidazolidine-4-carboxylic acid derivatives as Hepatitis C virus NS3-4A serine protease inhibitors: synthesis, activity, and X-ray crystal structure of an enzyme inhibitor complex

    SciTech Connect

    Arasappan, Ashok; Njoroge, F. George; Parekh, Tejal N.; Yang, Xiaozheng; Pichardo, John; Butkiewicz, Nancy; Prongay, Andrew; Yao, Nanhua; Girijavallabhan, Viyyoor

    2008-06-30

    Synthesis and HCV NS3 serine protease inhibitory activity of some novel 2-oxoimidazolidine-4-carboxylic acid derivatives are reported. Inhibitors derived from this new P2 core exhibited activity in the low {micro}M range. X-ray structure of an inhibitor, 15c bound to the protease is presented.

  15. Genetics Home Reference: congenital bile acid synthesis defect type 1

    MedlinePlus

    ... bile acid synthesis defect type 1 congenital bile acid synthesis defect type 1 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 1 is a disorder characterized ...

  16. Genetics Home Reference: congenital bile acid synthesis defect type 2

    MedlinePlus

    ... bile acid synthesis defect type 2 congenital bile acid synthesis defect type 2 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 2 is a disorder characterized ...

  17. Hydroxamic Acids in Asymmetric Synthesis

    PubMed Central

    Li, Zhi; Yamamoto, Hisashi

    2012-01-01

    Metal-catalyzed stereoselective reactions are a central theme in organic chemistry research. In these reactions, the stereoselection is achieved predominantly by introducing chiral ligands at the metal catalyst’s center. For decades, researchers have sought better chiral ligands for asymmetric catalysis and have made great progress. Nevertheless, to achieve optimal stereoselectivity and to catalyze new reactions, new chiral ligands are needed. Due to their high metal affinity, hydroxamic acids play major roles across a broad spectrum of fields from biochemistry to metal extraction. Dr. K. Barry Sharpless first revealed their potential as chiral ligands for asymmetric synthesis in 1977: He published the chiral vanadium-hydroxamic-acid-catalyzed, enantioselective epoxidation of allylic alcohols before his discovery of Sharpless Asymmetric Epoxidation, which uses titanium-tartrate complex as the chiral reagent. However, researchers have reported few highly enantioselective reactions using metal-hydroxamic acid as catalysts since then. This Account summarizes our research on metal-catalyzed asymmetric epoxidation using hydroxamic acids as chiral ligands. We designed and synthesized a series of new hydroxamic acids, most notably the C2-symmetric bis-hydroxamic acid (BHA) family. V-BHA-catalyzed epoxidation of allylic and homoallylic alcohols achieved higher activity and stereoselectivity than Sharpless Asymmetric Epoxidation in many cases. Changing the metal species led to a series of unprecedented asymmetric epoxidation reactions, such as (i) single olefins and sulfides with Mo-BHA, (ii) homoallylic and bishomoallylic alcohols with Zr- and Hf-BHA, and (iii) N-alkenyl sulfonamides and N-sulfonyl imines with Hf-BHA. These reactions produce uniquely functionalized chiral epoxides with good yields and enantioselectivities. PMID:23157425

  18. Extending enzyme molecular recognition with an expanded amino acid alphabet

    PubMed Central

    Windle, Claire L.; Simmons, Katie J.; Ault, James R.; Trinh, Chi H.; Nelson, Adam

    2017-01-01

    Natural enzymes are constructed from the 20 proteogenic amino acids, which may then require posttranslational modification or the recruitment of coenzymes or metal ions to achieve catalytic function. Here, we demonstrate that expansion of the alphabet of amino acids can also enable the properties of enzymes to be extended. A chemical mutagenesis strategy allowed a wide range of noncanonical amino acids to be systematically incorporated throughout an active site to alter enzymic substrate specificity. Specifically, 13 different noncanonical side chains were incorporated at 12 different positions within the active site of N-acetylneuraminic acid lyase (NAL), and the resulting chemically modified enzymes were screened for activity with a range of aldehyde substrates. A modified enzyme containing a 2,3-dihydroxypropyl cysteine at position 190 was identified that had significantly increased activity for the aldol reaction of erythrose with pyruvate compared with the wild-type enzyme. Kinetic investigation of a saturation library of the canonical amino acids at the same position showed that this increased activity was not achievable with any of the 20 proteogenic amino acids. Structural and modeling studies revealed that the unique shape and functionality of the noncanonical side chain enabled the active site to be remodeled to enable more efficient stabilization of the transition state of the reaction. The ability to exploit an expanded amino acid alphabet can thus heighten the ambitions of protein engineers wishing to develop enzymes with new catalytic properties. PMID:28196894

  19. Escherichia coli Unsaturated Fatty Acid Synthesis

    PubMed Central

    Feng, Youjun; Cronan, John E.

    2009-01-01

    Although the unsaturated fatty acid (UFA) synthetic pathway of Escherichia coli is the prototype of such pathways, several unresolved issues have accumulated over the years. The key players are the fabA and fabB genes. Earlier studies of fabA transcription showed that the gene was transcribed from two promoters, with one being positively regulated by the FadR protein. The other weaker promoter (which could not be mapped with the technology then available) was considered constitutive because its function was independent of FadR. However, the FabR negative regulator was recently shown to represses fabA transcription. We report that the weak promoter overlaps the FadR-dependent promoter and is regulated by FabR. This promoter is strictly conserved in all E. coli and Salmonella enterica genomes sequenced to date and is thought to provide insurance against inappropriate regulation of fabA transcription by exogenous saturated fatty acids. Also, the fabAup promoter, a mutant promoter previously isolated by selection for increased FabA activity, was shown to be a promoter created de novo by a four-base deletion within the gene located immediately upstream of fabA. Demonstration of the key UFA synthetic reaction catalyzed by FabB has been elusive, although it was known to catalyze an elongation reaction. Strains lacking FabB are UFA auxotrophs indicating that the enzyme catalyzes an essential step in UFA synthesis. Using thioesterases specific for hydrolysis of short chain acyl-ACPs, the intermediates of the UFA synthetic pathway have been followed in vivo for the first time. These experiments showed that a fabB mutant strain accumulated less cis-5-dodecenoic acid than the parental wild-type strain. These data indicate that the key reaction in UFA synthesis catalyzed by FabB is elongation of the cis-3-decenoyl-ACP produced by FabA. PMID:19679654

  20. Enzymic synthesis of indole-3-acetyl-1-O-beta-d-glucose. I. Partial purification and characterization of the enzyme from Zea mays

    NASA Technical Reports Server (NTRS)

    Leznicki, A. J.; Bandurski, R. S.

    1988-01-01

    The first enzyme-catalyzed reaction leading from indole-3-acetic acid (IAA) to the myo-inositol esters of IAA is the synthesis of indole-3-acetyl-1-O-beta-D-glucose from uridine-5'-diphosphoglucose (UDPG) and IAA. The reaction is catalyzed by the enzyme, UDPG-indol-3-ylacetyl glucosyl transferase (IAA-glucose-synthase). This work reports methods for the assay of the enzyme and for the extraction and partial purification of the enzyme from kernels of Zea mays sweet corn. The enzyme has an apparent molecular weight of 46,500 an isoelectric point of 5.5, and its pH optimum lies between 7.3 and 7.6. The enzyme is stable to storage at zero degrees but loses activity during column chromatographic procedures which can be restored only fractionally by addition of column eluates. The data suggest either multiple unknown cofactors or conformational changes leading to activity loss.

  1. The Rate-limiting Enzyme in Phosphatidylcholine Synthesis Regulates Proliferation of the Nucleoplasmic ReticulumD⃞

    PubMed Central

    Lagace, Thomas A.; Ridgway, Neale D.

    2005-01-01

    The nucleus contains a network of tubular invaginations of the nuclear envelope (NE), termed the nucleoplasmic reticulum (NR), implicated in transport, gene expression, and calcium homeostasis. Here, we show that proliferation of the NR, measured by the frequency of NE invaginations and tubules, is regulated by CTP:phosphocholine cytidylyltransferase-α (CCTα), the nuclear and rate-limiting enzyme in the CDP–choline pathway for phosphatidylcholine (PtdCho) synthesis. In Chinese hamster ovary (CHO)-K1 cells, fatty acids triggered activation and translocation of CCTα onto intranuclear tubules characteristic of the NR. This was accompanied by a twofold increase in NR tubules quantified by immunostaining for lamin A/C or the NE. CHO MT58 cells expressing a temperature-sensitive CCTα allele displayed reduced PtdCho synthesis and CCTα expression and minimal proliferation of the NR in response to oleate compared with CHO MT58 cells stably expressing CCTα. Expression of CCTα mutants in CHO58 cells revealed that both enzyme activity and membrane binding promoted NR proliferation. In support of a direct role for membrane binding in NR tubule formation, recombinant CCTα caused the deformation of liposomes into tubules in vitro. This demonstrates that a key nuclear enzyme in PtdCho synthesis coordinates lipid synthesis and membrane deformation to promote formation of a dynamic nuclear-cytoplasmic interface. PMID:15635091

  2. Affinity labelling enzymes with esters of aromatic sulfonic acids

    DOEpatents

    Wong, Show-Chu; Shaw, Elliott

    1977-01-01

    Novel esters of aromatic sulfonic acids are disclosed. The specific esters are nitrophenyl p- and m-amidinophenylmethanesulfonate. Also disclosed is a method for specific inactivation of the enzyme, thrombin, employing nitrophenyl p-amidinophenylmethanesulfonate.

  3. Stereoselective synthesis of stable-isotope-labeled amino acids

    SciTech Connect

    Unkefer, C.J.; Martinez, R.A.; Silks, L.A. III; Lodwig, S.N.

    1994-12-01

    For magnetic resonance and vibrational spectroscopies to reach their full potential, they must be used in combination with sophisticated site-specific stable isotope labeling of biological macromolecules. Labeled amino acids are required for the study of the structure and function of enzymes and proteins. Because there are 20 common amino acids, each with its own distinguishing chemistry, they remain a synthetic challenge. The Oppolzer chiral auxiliary provides a general tool with which to approach the synthesis of labeled amino acids. By using the Oppolzer auxiliary, amino acids can be constructed from several small molecules, which is ideal for stable isotope labeling. In addition to directing the stereochemistry at the {alpha}-carbon, the camphorsultam can be used for stereo-specific isotope labeling at prochiral centers in amino acids. By using the camphorsultam auxiliary we have the potential to synthesize virtually any isotopomer of all of the common amino acids.

  4. Cyclic phosphatidic acid and lysophosphatidic acid induce hyaluronic acid synthesis via CREB transcription factor regulation in human skin fibroblasts.

    PubMed

    Maeda-Sano, Katsura; Gotoh, Mari; Morohoshi, Toshiro; Someya, Takao; Murofushi, Hiromu; Murakami-Murofushi, Kimiko

    2014-09-01

    Cyclic phosphatidic acid (cPA) is a naturally occurring phospholipid mediator and an analog of the growth factor-like phospholipid lysophosphatidic acid (LPA). cPA has a unique cyclic phosphate ring at the sn-2 and sn-3 positions of its glycerol backbone. We showed before that a metabolically stabilized cPA derivative, 2-carba-cPA, relieved osteoarthritis pathogenesis in vivo and induced hyaluronic acid synthesis in human osteoarthritis synoviocytes in vitro. This study focused on hyaluronic acid synthesis in human fibroblasts, which retain moisture and maintain health in the dermis. We investigated the effects of cPA and LPA on hyaluronic acid synthesis in human fibroblasts (NB1RGB cells). Using particle exclusion and enzyme-linked immunosorbent assays, we found that both cPA and LPA dose-dependently induced hyaluronic acid synthesis. We revealed that the expression of hyaluronan synthase 2 messenger RNA and protein is up-regulated by cPA and LPA treatment time dependently. We then characterized the signaling pathways up-regulating hyaluronic acid synthesis mediated by cPA and LPA in NB1RGB cells. Pharmacological inhibition and reporter gene assays revealed that the activation of the LPA receptor LPAR1, Gi/o protein, phosphatidylinositol-3 kinase (PI3K), extracellular-signal-regulated kinase (ERK), and cyclic adenosine monophosphate response element-binding protein (CREB) but not nuclear factor κB induced hyaluronic acid synthesis by the treatment with cPA and LPA in NB1RGB cells. These results demonstrate for the first time that cPA and LPA induce hyaluronic acid synthesis in human skin fibroblasts mainly through the activation of LPAR1-Gi/o followed by the PI3K, ERK, and CREB signaling pathway.

  5. The Roles of Acids and Bases in Enzyme Catalysis

    ERIC Educational Resources Information Center

    Weiss, Hilton M.

    2007-01-01

    Many organic reactions are catalyzed by strong acids or bases that protonate or deprotonate neutral reactants leading to reactive cations or anions that proceed to products. In enzyme reactions, only weak acids and bases are available to hydrogen bond to reactants and to transfer protons in response to developing charges. Understanding this…

  6. Structure-Function Relationships of Glucansucrase and Fructansucrase Enzymes from Lactic Acid Bacteria

    PubMed Central

    van Hijum, Sacha A. F. T.; Kralj, Slavko; Ozimek, Lukasz K.; Dijkhuizen, Lubbert; van Geel-Schutten, Ineke G. H.

    2006-01-01

    Lactic acid bacteria (LAB) employ sucrase-type enzymes to convert sucrose into homopolysaccharides consisting of either glucosyl units (glucans) or fructosyl units (fructans). The enzymes involved are labeled glucansucrases (GS) and fructansucrases (FS), respectively. The available molecular, biochemical, and structural information on sucrase genes and enzymes from various LAB and their fructan and α-glucan products is reviewed. The GS and FS enzymes are both glycoside hydrolase enzymes that act on the same substrate (sucrose) and catalyze (retaining) transglycosylation reactions that result in polysaccharide formation, but they possess completely different protein structures. GS enzymes (family GH70) are large multidomain proteins that occur exclusively in LAB. Their catalytic domain displays clear secondary-structure similarity with α-amylase enzymes (family GH13), with a predicted permuted (β/α)8 barrel structure for which detailed structural and mechanistic information is available. Emphasis now is on identification of residues and regions important for GS enzyme activity and product specificity (synthesis of α-glucans differing in glycosidic linkage type, degree and type of branching, glucan molecular mass, and solubility). FS enzymes (family GH68) occur in both gram-negative and gram-positive bacteria and synthesize β-fructan polymers with either β-(2→6) (inulin) or β-(2→1) (levan) glycosidic bonds. Recently, the first high-resolution three-dimensional structures have become available for FS (levansucrase) proteins, revealing a rare five-bladed β-propeller structure with a deep, negatively charged central pocket. Although these structures have provided detailed mechanistic insights, the structural features in FS enzymes dictating the synthesis of either β-(2→6) or β-(2→1) linkages, degree and type of branching, and fructan molecular mass remain to be identified. PMID:16524921

  7. Organosoluble enzyme conjugates with poly(2-oxazoline)s via pyromellitic acid dianhydride.

    PubMed

    Konieczny, Stefan; Fik, Christoph P; Averesch, Nils J H; Tiller, Joerg C

    2012-06-15

    The use of enzymes in organic solvents offers a great opportunity for the synthesis of complex organic compounds and is therefore in focus of current research. In this work we describe the synthesis of poly(2-methyl-1,3-oxazoline) (PMOx) and poly(2-ethyl-1,3-oxazoline) (PEtOx) enzyme conjugates with hen-egg white lysozyme, RNase A and α-chymotrypsin using a new coupling technique. The POXylation was carried out reacting pyromellitic acid dianhydride subsequently with ethylenediamine terminated POx and then with the NH₂-groups of the respective enzymes. Upon conjugation with the polymers, RNase A and lysozyme became fully soluble in DMF (1.4 mg/ml). These are the first examples of fully POXylated proteins, which become organosoluble. The synthesized enzyme conjugates were characterized by SDS-PAGE, isoelectric focusing, dynamic light scattering and size exclusion chromatography, which all indicated the full POXylation of the enzymes. The modified enzymes even partly retained their activity in water. With α-chymotrypsin as example we could demonstrate that the molecular weight of the attached polymer significantly influences the activity.

  8. Propioin synthesis using thiamine diphosphate-dependent enzymes.

    PubMed

    Mikolajek, Renaud J; Spiess, Antje C; Pohl, Martina; Büchs, Jochen

    2009-01-01

    Benzaldehyde lyase (BAL, EC 4.1.2.38) from Pseudomonas fluorescens and benzoylformate decarboxylase (BFD, EC 4.1.1.7) from Pseudomonas putida are thiamine diphosphate-dependent enzymes. These enzymes share a common tetrameric structure and catalyze various C--C-bond forming and breaking reactions. Here we describe a detailed study of the asymmetric synthesis of propioin from propanal catalyzed by BAL or BFD in aqueous solution in a batch reactor. Both enzymes are deactivated in the presence of high concentration of propanal. Compared to BAL, BFD is more stable under reaction conditions as well as during storage. The kinetic studies showed a typical Michaelis-Menten kinetic for BAL with a maximal specific reaction rate of 26.2 U/mg and an unusually high K(M) of 415 mM, whereas the v/[S]-plot for BFD is almost linear in the concentration range (100-1500 mM) investigated. Both enzymes produce propioin with opposite enantiomeric excess: BAL produced the (S)-propioin (ee of 35%), whereas BFD yielded the (R)-enantiomer (ee of 67%).

  9. [Lipid synthesis by an acidic acid tolerant Rhodotorula glutinis].

    PubMed

    Lin, Zhangnan; Liu, Hongjuan; Zhang, Jian'an; Wang, Gehua

    2016-03-01

    Acetic acid, as a main by-product generated in the pretreatment process of lignocellulose hydrolysis, significantly affects cell growth and lipid synthesis of oleaginous microorganisms. Therefore, we studied the tolerance of Rhodotorula glutinis to acetic acid and its lipid synthesis from substrate containing acetic acid. In the mixed sugar medium containing 6 g/L glucose and 44 g/L xylose, and supplemented with acetic acid, the cell growth was not:inhibited when the acetic acid concentration was below 10 g/L. Compared with the control, the biomass, lipid concentration and lipid content of R. glutinis increased 21.5%, 171% and 122% respectively when acetic acid concentration was 10 g/L. Furthermore, R. glutinis could accumulate lipid with acetate as the sole carbon source. Lipid concentration and lipid yield reached 3.20 g/L and 13% respectively with the initial acetic acid concentration of 25 g/L. The lipid composition was analyzed by gas chromatograph. The main composition of lipid produced with acetic acid was palmitic acid, stearic acid, oleic acid, linoleic acid and linolenic acid, including 40.9% saturated fatty acids and 59.1% unsaturated fatty acids. The lipid composition was similar to that of plant oil, indicating that lipid from oleaginous yeast R. glutinis had potential as the feedstock of biodiesel production. These results demonstrated that a certain concentration of acetic acid need not to be removed in the detoxification process when using lignocelluloses hydrolysate to produce microbial lipid by R. glutinis.

  10. Novel Enzyme Family Found in Filamentous Fungi Catalyzing trans-4-Hydroxylation of l-Pipecolic Acid

    PubMed Central

    Hibi, Makoto; Mori, Ryosuke; Miyake, Ryoma; Kawabata, Hiroshi; Kozono, Shoko; Takahashi, Satomi

    2016-01-01

    Hydroxypipecolic acids are bioactive compounds widely distributed in nature and are valuable building blocks for the organic synthesis of pharmaceuticals. We have found a novel hydroxylating enzyme with activity toward l-pipecolic acid (l-Pip) in a filamentous fungus, Fusarium oxysporum c8D. The enzyme l-Pip trans-4-hydroxylase (Pip4H) of F. oxysporum (FoPip4H) belongs to the Fe(II)/α-ketoglutarate-dependent dioxygenase superfamily, catalyzes the regio- and stereoselective hydroxylation of l-Pip, and produces optically pure trans-4-hydroxy-l-pipecolic acid (trans-4-l-HyPip). Amino acid sequence analysis revealed several fungal enzymes homologous with FoPip4H, and five of these also had l-Pip trans-4-hydroxylation activity. In particular, the homologous Pip4H enzyme derived from Aspergillus nidulans FGSC A4 (AnPip4H) had a broader substrate specificity spectrum than other homologues and reacted with the l and d forms of various cyclic and aliphatic amino acids. Using FoPip4H as a biocatalyst, a system for the preparative-scale production of chiral trans-4-l-HyPip was successfully developed. Thus, we report a fungal family of l-Pip hydroxylases and the enzymatic preparation of trans-4-l-HyPip, a bioactive compound and a constituent of secondary metabolites with useful physiological activities. PMID:26801577

  11. Clean synthesis of biolubricant range esters using novel liquid lipase enzyme in solvent free medium.

    PubMed

    Trivedi, Jayati; Aila, Mounika; Sharma, Chandra Dutt; Gupta, Piyush; Kaul, Savita

    2015-01-01

    In view of the rising global problems of environment pollution and degradation, the present process provides a 'green solution' to the synthesis of higher esters of lubricant range, more specifically in the range C12-C36, using different combinations of acids and alcohols, in a single step reaction. The esters produced are biodegradable in nature and have a plethora of uses, such as in additives, as lubricating oils and other hydraulic fluids. The enzymatic esterification was performed using liquid (non-immobilized or free) lipase enzyme, without any additional organic solvent. Soluble lipase proves to be superior to immobilized enzymes as it is more cost effective and provides a faster process for the production of higher esters of lubricant range. An interesting finding was, that the lipase enzyme showed higher conversion rates with increasing carbon number of straight chain alcohols and acids. Reactions were carried out for the optimization of initial water concentration, temperature, pH of the substrate mixture and the chain length of the substrates. Under optimized conditions, the method was suitable to achieve ~ 99% conversion. Thus, the process provides an environment friendly, enzymatic alternative to the chemical route which is currently used in the industrial synthesis of lubricant components.

  12. In Vitro Optimization of Enzymes Involved in Precorrin-2 Synthesis Using Response Surface Methodology.

    PubMed

    Fang, Huan; Dong, Huina; Cai, Tao; Zheng, Ping; Li, Haixing; Zhang, Dawei; Sun, Jibin

    2016-01-01

    In order to maximize the production of biologically-derived chemicals, kinetic analyses are first necessary for predicting the role of enzyme components and coordinating enzymes in the same reaction system. Precorrin-2 is a key precursor of cobalamin and siroheme synthesis. In this study, we sought to optimize the concentrations of several molecules involved in precorrin-2 synthesis in vitro: porphobilinogen synthase (PBGS), porphobilinogen deaminase (PBGD), uroporphyrinogen III synthase (UROS), and S-adenosyl-l-methionine-dependent urogen III methyltransferase (SUMT). Response surface methodology was applied to develop a kinetic model designed to maximize precorrin-2 productivity. The optimal molar ratios of PBGS, PBGD, UROS, and SUMT were found to be approximately 1:7:7:34, respectively. Maximum precorrin-2 production was achieved at 0.1966 ± 0.0028 μM/min, agreeing with the kinetic model's predicted value of 0.1950 μM/min. The optimal concentrations of the cofactor S-adenosyl-L-methionine (SAM) and substrate 5-aminolevulinic acid (ALA) were also determined to be 200 μM and 5 mM, respectively, in a tandem-enzyme assay. By optimizing the relative concentrations of these enzymes, we were able to minimize the effects of substrate inhibition and feedback inhibition by S-adenosylhomocysteine on SUMT and thereby increase the production of precorrin-2 by approximately five-fold. These results demonstrate the effectiveness of kinetic modeling via response surface methodology for maximizing the production of biologically-derived chemicals.

  13. In Vitro Optimization of Enzymes Involved in Precorrin-2 Synthesis Using Response Surface Methodology

    PubMed Central

    Fang, Huan; Dong, Huina; Cai, Tao; Zheng, Ping; Li, Haixing; Zhang, Dawei; Sun, Jibin

    2016-01-01

    In order to maximize the production of biologically-derived chemicals, kinetic analyses are first necessary for predicting the role of enzyme components and coordinating enzymes in the same reaction system. Precorrin-2 is a key precursor of cobalamin and siroheme synthesis. In this study, we sought to optimize the concentrations of several molecules involved in precorrin-2 synthesis in vitro: porphobilinogen synthase (PBGS), porphobilinogen deaminase (PBGD), uroporphyrinogen III synthase (UROS), and S-adenosyl-l-methionine-dependent urogen III methyltransferase (SUMT). Response surface methodology was applied to develop a kinetic model designed to maximize precorrin-2 productivity. The optimal molar ratios of PBGS, PBGD, UROS, and SUMT were found to be approximately 1:7:7:34, respectively. Maximum precorrin-2 production was achieved at 0.1966 ± 0.0028 μM/min, agreeing with the kinetic model’s predicted value of 0.1950 μM/min. The optimal concentrations of the cofactor S-adenosyl-L-methionine (SAM) and substrate 5-aminolevulinic acid (ALA) were also determined to be 200 μM and 5 mM, respectively, in a tandem-enzyme assay. By optimizing the relative concentrations of these enzymes, we were able to minimize the effects of substrate inhibition and feedback inhibition by S-adenosylhomocysteine on SUMT and thereby increase the production of precorrin-2 by approximately five-fold. These results demonstrate the effectiveness of kinetic modeling via response surface methodology for maximizing the production of biologically-derived chemicals. PMID:26974652

  14. Production of 5-aminolevulinic acid by cell free multi-enzyme catalysis.

    PubMed

    Meng, Qinglong; Zhang, Yanfei; Ju, Xiaozhi; Ma, Chunling; Ma, Hongwu; Chen, Jiuzhou; Zheng, Ping; Sun, Jibin; Zhu, Jun; Ma, Yanhe; Zhao, Xueming; Chen, Tao

    2016-05-20

    5-Aminolevulinic acid (ALA) is the precursor for the biosynthesis of tetrapyrroles and has broad agricultural and medical applications. Currently ALA is mainly produced by chemical synthesis and microbial fermentation. Cell free multi-enzyme catalysis is a promising method for producing high value chemicals. Here we reported our work on developing a cell free process for ALA production using thermostable enzymes. Cheap substrates (succinate and glycine) were used for ALA synthesis by two enzymes: 5-aminolevulinic acid synthase (ALAS) from Laceyella sacchari (LS-ALAS) and succinyl-CoA synthase (Suc) from Escherichia coli. ATP was regenerated by polyphosphate kinase (Ppk) using polyphosphate as the substrate. Succinate was added into the reaction system in a fed-batch mode to avoid its inhibition effect on Suc. After reaction for 160min, ALA concentration was increased to 5.4mM. This is the first reported work on developing the cell free process for ALA production. Through further process and enzyme optimization the cell free process could be an effective and economic way for ALA production.

  15. Microwave-Assisted Rapid Enzymatic Synthesis of Nucleic Acids.

    PubMed

    Hari Das, Rakha; Ahirwar, Rajesh; Kumar, Saroj; Nahar, Pradip

    2016-07-02

    Herein we report microwave-induced enhancement of the reactions catalyzed by Escherichia coli DNA polymerase I and avian myeloblastosis virus-reverse transcriptase. The reactions induced by microwaves result in a highly selective synthesis of nucleic acids in 10-50 seconds. In contrast, same reactions failed to give desired reaction products when carried out in the same time periods, but without microwave irradiation. Each of the reactions was carried out for different duration of microwave exposure time to find the optimum reaction time. The products produced by the respective enzyme upon microwave irradiation of the reaction mixtures were identical to that produced by the conventional procedures. As the microwave-assisted reactions are rapid, microwave could be a useful alternative to the conventional and time consuming procedures of enzymatic synthesis of nucleic acids.

  16. Synthesis of Pulcherriminic Acid by Bacillus subtilis

    PubMed Central

    Uffen, Robert L.; Canale-Parola, E.

    1972-01-01

    The pathway of pulcherriminic acid synthesis in Bacillus subtilis strains AM and AM-L11 (a leucine-requiring auxotroph) was investigated. Determinations of radioactivity in pulcherriminic acid synthesized by cells growing in media containing 14C-labeled amino acids indicated that B. subtilis produced pulcherriminic acid from l-leucine. The organism utilized the carbon skeletons of two l-leucine molecules to synthesize one molecule of pulcherriminic acid. Similar results were obtained with starved cell suspensions. Growing cells formed significant amounts of pulcherriminic acid only in media including a carbohydrate such as starch. However, carbohydrate carbon was not required for the synthesis of pulcherriminic acid molecules. Data obtained with cell suspensions supported the hypothesis that cyclo-l-leucyl-l-leucyl is an intermediate in pulcherriminic acid biosynthesis and indicated that molecular oxygen is required for the conversion of cyclo-l-leucyl-l-leucyl to pulcherriminic acid. A pathway for the synthesis of pulcherrimin from l-leucine in B. subtilis is proposed. PMID:4204912

  17. Nitrated fatty acids: synthesis and measurement.

    PubMed

    Woodcock, Steven R; Bonacci, Gustavo; Gelhaus, Stacy L; Schopfer, Francisco J

    2013-06-01

    Nitrated fatty acids are the product of nitrogen dioxide reaction with unsaturated fatty acids. The discovery of peroxynitrite and peroxidase-induced nitration of biomolecules led to the initial reports of endogenous nitrated fatty acids. These species increase during ischemia/reperfusion, but concentrations are often at or near the limits of detection. Here, we describe multiple methods for nitrated fatty acid synthesis and sample extraction from complex biological matrices and a rigorous method of qualitative and quantitative detection of nitrated fatty acids by liquid chromatography-mass spectrometry. In addition, optimized instrument conditions and caveats regarding data interpretation are discussed.

  18. Nitrated fatty acids: Synthesis and measurement

    PubMed Central

    Woodcock, Steven R.; Bonacci, Gustavo; Gelhaus, Stacy L.; Schopfer, Francisco J.

    2012-01-01

    Nitrated fatty acids are the product of nitrogen dioxide reaction with unsaturated fatty acids. The discovery of peroxynitrite and peroxidase-induced nitration of biomolecules led to the initial reports of endogenous nitrated fatty acids. These species increase during ischemia reperfusion, but concentrations are often at or near the limits of detection. Here, we describe multiple methods for nitrated fatty acid synthesis, sample extraction from complex biological matrices, and a rigorous method of qualitative and quantitative detection of nitrated fatty acids by LC-MS. In addition, optimized instrument conditions and caveats regarding data interpretation are discussed. PMID:23200809

  19. Molecular annotation of ketol-acid reductoisomerases from Streptomyces reveals a novel amino acid biosynthesis interlock mediated by enzyme promiscuity

    PubMed Central

    Verdel-Aranda, Karina; López-Cortina, Susana T; Hodgson, David A; Barona-Gómez, Francisco

    2015-01-01

    The 6-phosphogluconate dehydrogenase superfamily oxidize and reduce a wide range of substrates, making their functional annotation challenging. Ketol-acid reductoisomerase (KARI), encoded by the ilvC gene in branched-chain amino acids biosynthesis, is a promiscuous reductase enzyme within this superfamily. Here, we obtain steady-state enzyme kinetic parameters for 10 IlvC homologues from the genera Streptomyces and Corynebacterium, upon eight selected chemically diverse substrates, including some not normally recognized by enzymes of this superfamily. This biochemical data suggested a Streptomyces biosynthetic interlock between proline and the branched-chain amino acids, mediated by enzyme substrate promiscuity, which was confirmed via mutagenesis and complementation analyses of the proC, ilvC1 and ilvC2 genes in Streptomyces coelicolor. Moreover, both ilvC orthologues and paralogues were analysed, such that the relationship between gene duplication and functional diversification could be explored. The KARI paralogues present in S. coelicolor and Streptomyces lividans, despite their conserved high sequence identity (97%), were shown to be more promiscuous, suggesting a recent functional diversification. In contrast, the KARI paralogue from Streptomyces viridifaciens showed selectivity towards the synthesis of valine precursors, explaining its recruitment within the biosynthetic gene cluster of valanimycin. These results allowed us to assess substrate promiscuity indices as a tool to annotate new molecular functions with metabolic implications. PMID:25296650

  20. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  1. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  2. Evidence of Selection for Low Cognate Amino Acid Bias in Amino Acid Biosynthetic Enzymes

    PubMed Central

    Alves, Rui; Savageau, Michael A.

    2006-01-01

    Summary If the enzymes responsible for biosynthesis of a given amino acid are repressed and the cognate amino acid pool suddenly depleted, then derepression of these enzymes and replenishment of the pool would be problematic, if the enzymes were largely composed of the cognate amino acid. In the proverbial ‘Catch 22’, cells would lack the necessary enzymes to make the amino acid, and they would lack the necessary amino acid to make the needed enzymes. Based on this scenario, we hypothesize that evolution would lead to the selection of amino acid biosynthetic enzymes that have a relatively low content of their cognate amino acid. We call this the ‘cognate bias hypothesis’. Here we test several implications of this hypothesis directly using data from the proteome of Escherichia coli. Several lines of evidence show that low cognate bias is evident in 15 of the 20 amino acid biosynthetic pathways. Comparison with closely related Salmonella typhimurium shows similar results. Comparison with more distantly related Bacillus subtilis shows general similarities as well as significant differences in the detailed profiles of cognate bias. Thus, selection for low cognate bias plays a significant role in shaping the amino acid composition for a large class of cellular proteins. PMID:15853887

  3. [Total synthesis of nordihydroguaiaretic acid].

    PubMed

    Wu, A X; Zhao, Y R; Chen, N; Pan, X F

    1997-04-01

    beta-Keto ester(5) was obtained from vanilin through etherification, oxidation and condensation with acetoacetic ester, (5) on oxidative coupling reaction by NaOEt/I2 produced dimer (6) in high yield. Acid catalyzed cyclodehydration of (6) gave the furan derivative(7), and by a series of selective hydrogenation nordihydroguaiaretic acid, furoguaiacin dimethyl ether and dihydroguaiaretic acid dimethyl ether were synthesized.

  4. Fatty acid phytyl ester synthesis in chloroplasts of Arabidopsis.

    PubMed

    Lippold, Felix; vom Dorp, Katharina; Abraham, Marion; Hölzl, Georg; Wewer, Vera; Yilmaz, Jenny Lindberg; Lager, Ida; Montandon, Cyrille; Besagni, Céline; Kessler, Felix; Stymne, Sten; Dörmann, Peter

    2012-05-01

    During stress or senescence, thylakoid membranes in chloroplasts are disintegrated, and chlorophyll and galactolipid are broken down, resulting in the accumulation of toxic intermediates, i.e., tetrapyrroles, free phytol, and free fatty acids. Chlorophyll degradation has been studied in detail, but the catabolic pathways for phytol and fatty acids remain unclear. A large proportion of phytol and fatty acids is converted into fatty acid phytyl esters and triacylglycerol during stress or senescence in chloroplasts. We isolated two genes (PHYTYL ESTER SYNTHASE1 [PES1] and PES2) of the esterase/lipase/thioesterase family of acyltransferases from Arabidopsis thaliana that are involved in fatty acid phytyl ester synthesis in chloroplasts. The two proteins are highly expressed during senescence and nitrogen deprivation. Heterologous expression in yeast revealed that PES1 and PES2 have phytyl ester synthesis and diacylglycerol acyltransferase activities. The enzymes show broad substrate specificities and can employ acyl-CoAs, acyl carrier proteins, and galactolipids as acyl donors. Double mutant plants (pes1 pes2) grow normally but show reduced phytyl ester and triacylglycerol accumulation. These results demonstrate that PES1 and PES2 are involved in the deposition of free phytol and free fatty acids in the form of phytyl esters in chloroplasts, a process involved in maintaining the integrity of the photosynthetic membrane during abiotic stress and senescence.

  5. Carboxylic acid reductase is a versatile enzyme for the conversion of fatty acids into fuels and chemical commodities.

    PubMed

    Akhtar, M Kalim; Turner, Nicholas J; Jones, Patrik R

    2013-01-02

    Aliphatic hydrocarbons such as fatty alcohols and petroleum-derived alkanes have numerous applications in the chemical industry. In recent years, the renewable synthesis of aliphatic hydrocarbons has been made possible by engineering microbes to overaccumulate fatty acids. However, to generate end products with the desired physicochemical properties (e.g., fatty aldehydes, alkanes, and alcohols), further conversion of the fatty acid is necessary. A carboxylic acid reductase (CAR) from Mycobacterium marinum was found to convert a wide range of aliphatic fatty acids (C(6)-C(18)) into corresponding aldehydes. Together with the broad-substrate specificity of an aldehyde reductase or an aldehyde decarbonylase, the catalytic conversion of fatty acids to fatty alcohols (C(8)-C(16)) or fatty alkanes (C(7)-C(15)) was reconstituted in vitro. This concept was applied in vivo, in combination with a chain-length-specific thioesterase, to engineer Escherichia coli BL21(DE3) strains that were capable of synthesizing fatty alcohols and alkanes. A fatty alcohol titer exceeding 350 mg·L(-1) was obtained in minimal media supplemented with glucose. Moreover, by combining the CAR-dependent pathway with an exogenous fatty acid-generating lipase, natural oils (coconut oil, palm oil, and algal oil bodies) were enzymatically converted into fatty alcohols across a broad chain-length range (C(8)-C(18)). Together with complementing enzymes, the broad substrate specificity and kinetic characteristics of CAR opens the road for direct and tailored enzyme-catalyzed conversion of lipids into user-ready chemical commodities.

  6. Curdlan microspheres. Synthesis, characterization and interaction with proteins (enzymes, vaccines).

    PubMed

    Mocanu, Georgeta; Mihai, Doina; Moscovici, Misu; Picton, Luc; LeCerf, Didier

    2009-04-01

    Microparticles of curdlan, synthesized through crosslinking with epichlorohydrin in organic suspension media, were chemically modified with the aim of introducing strongly and/or weakly acidic anionic and palmitoyl hydrophobic groups. Microparticles of both curdlan and curdlan derivatives were physico-chemically characterized. Study of the interaction with enzymes, such as lysozyme, and vaccines, such as tetanus anatoxin, showed a co-operative protein retention effect, induced by electrostatic and hydrophobic forces. The results of the in vitro release studies on support-protein complexes recommend them as potential controlled release systems.

  7. Inhibition of in vitro cholesterol synthesis by fatty acids.

    PubMed

    Kuroda, M; Endo, A

    1976-01-18

    Inhibitory effect of 44 species of fatty acids on cholesterol synthesis has been examined with a rat liver enzyme system. In the case of saturated fatty acids, the inhibitory activity increased with chain length to a maximum at 11 to 14 carbons, after which activity decreased rapidly. The inhibition increased with the degree of unsaturation of fatty acids. Introduction of a hydroxy group at the alpha-position of fatty acids abolished the inhibition, while the inhibition was enhanced by the presence of a hydroxy group located in an intermediate position of the chain. Branched chain fatty acids having a methyl group at the terminal showed much higher activity than the corresponding saturated straight chain fatty acids with the same number of carbons. With respect to the mechanism for inhibition, tridecanoate was found to inhibit acetoacetyl-CoA thiolase specifically without affecting the other reaction steps in the cholesterol synthetic pathway. The highly unsaturated fatty acids, arachidonate and linoleate, were specific inhibitors of 3-hydroxy-3-methyl-glutaryl-CoA synthase. On the other hand, ricinoleate (hydroxy acid) and phytanate (branched-chain acid) diminished the conversion of mevalonate to sterols by inhibiting a step or steps between squalene and lanosterol.

  8. Physiological effects of γ-linolenic acid and sesamin on hepatic fatty acid synthesis and oxidation.

    PubMed

    Ide, Takashi; Iwase, Haruka; Amano, Saaya; Sunahara, Saki; Tachihara, Ayuka; Yagi, Minako; Watanabe, Tsuyoshi

    2017-03-01

    Interrelated effects of γ-linolenic acid (GLA) and sesamin, a sesame lignan, on hepatic fatty acid synthesis and oxidation were examined. Rats were fed experimental diets supplemented with 0 or 2 g/kg sesamin (1:1 mixture of sesamin and episesamin) and containing 100 g/kg of palm oil (saturated fat), safflower oil rich in linoleic acid, or oil of evening primrose origin containing 43% GLA (GLA oil) for 18 days. In rats fed sesamin-free diets, GLA oil, compared with other oils, increased the activity and mRNA levels of various enzymes involved in fatty acid oxidation, except for some instances. Sesamin greatly increased these parameters, and the enhancing effects of sesamin on peroxisomal fatty acid oxidation rate and acyl-CoA oxidase, enoyl-CoA hydratase and acyl-CoA thioesterase activities were more exaggerated in rats fed GLA oil than in the animals fed other oils. The combination of sesamin and GLA oil also synergistically increased the mRNA levels of some peroxisomal fatty acid oxidation enzymes and of several enzymes involved in fatty acid metabolism located in other cell organelles. In the groups fed sesamin-free diets, GLA oil, compared with other oils, markedly reduced the activity and mRNA levels of various lipogenic enzymes. Sesamin reduced all these parameters, except for malic enzyme, in rats fed palm and safflower oils, but the effects were attenuated in the animals fed GLA oil. These changes by sesamin and fat type accompanied profound alterations in serum lipid levels. This may be ascribable to the changes in apolipoprotein-B-containing lipoproteins.

  9. Nitrile-hydrolyzing enzyme from Meyerozyma guilliermondii and its potential in biosynthesis of 3-hydroxypropionic acid.

    PubMed

    Zhang, Qiang; Gong, Jin-Song; Dong, Ting-Ting; Liu, Ting-Ting; Li, Heng; Dou, Wen-Fang; Lu, Zhen-Ming; Shi, Jin-Song; Xu, Zheng-Hong

    2017-03-11

    3-Hydroxypropionic acid (3-HP) is an important platform chemical in organic synthesis. Traditionally, 3-HP was produced by chemical methods and fermentation process. In this work, a novel enzymatic method was developed for green synthesis of 3-HP. A yeast strain harboring nitrile-hydrolyzing enzyme was newly isolated from environmental samples using 3-hydroxypropionitrile (3-HPN) as the sole nitrogen source. It was identified to be Meyerozyma guilliermondii CGMCC12935 by sequencing of the 18S ribosomal DNA and internal transcribed spacer, together with analysis of the morphology characteristics. The catalytic properties of M. guilliermondii CGMCC12935 resting cells were determined, and the optimum activity was achieved at 55 °C and pH 7.5. The enzyme showed broad substrate specificity towards nitriles, especially 3-HPN, aminoacetonitrile and 3-cyanopyridine. The presence of Ag(+), Pb(2+) and excess substrate inhibited the enzyme activity, whereas 5% (v/v) ethyl acetate had a positive effect on the enzyme activity. M. guilliermondii CGMCC12935 resting cells by addition of 3% glucose could thoroughly hydrolyze 500 mM 3-HPN into 3-HP within 100 h and the maximal accumulative production of 3-HP reached 216.33 mM, which was over twofolds than the control group with no additional glucose. And this work would lay the foundation for biological production of 3-HP in industry.

  10. Phenylalanine ammonia lyase from Arabidopsis thaliana (AtPAL2): a potent enzyme for the synthesis of non-canonical aromatic alpha-amino acids: Part I: Comparative characterization to the enzymes from Petroselinum crispum (PcPAL1) and Rhodosporidium toruloides (RtPAL).

    PubMed

    Dreßen, Alana; Hilberath, Thomas; Mackfeld, Ursula; Billmeier, Arne; Rudat, Jens; Pohl, Martina

    2017-04-06

    Phenylalanine ammonia lyase (PAL) from Arabidopsis thaliana (AtPAL2) was comparatively characterized to the well-studied enzyme from parsley (PcPAL1) and Rhodosporidium toruloides (RtPAL) with respect to kinetic parameters for the deamination and the amination reaction, pH- and temperature optima and the substrate range of the amination reaction. Whereas both plant enzymes are specific for phenylalanine, the bifunctional enzyme from Rhodosporidium toruloides shows KM-values for L-Phe and L-Tyr in the same order of magnitude and, compared to both plant enzymes, a 10-15-fold higher activity. At 30°C all enzymes were sufficiently stable with half-lives of 3.4days (PcPAL1), 4.6days (AtPAL2) and 9.7days (RtPAL/TAL). Very good results for the amination of various trans-cinnamic acid derivatives were obtained using E. coli cells as whole cell biocatalysts in ammonium carbonate buffer. Investigation of the substrate ranges gave interesting results for the newly tested enzymes from A. thaliana and R. toruloides. Only the latter accepts besides 4-hydroxy-CA also 3-methoxy-4-hydroxy-CA as a substrate, which is an interesting intermediate for the formation of pharmaceutically relevant L-Dopa. AtPAL2 is a very good catalyst for the formation of (S)-3-F-Phe, (S)-4-F-Phe and (S)-2-Cl-Phe. Such non-canonical amino acids are valuable building blocks for the formation of various drug molecules.

  11. Nitrile-converting enzymes as a tool to improve biocatalysis in organic synthesis: recent insights and promises.

    PubMed

    Gong, Jin-Song; Shi, Jin-Song; Lu, Zhen-Ming; Li, Heng; Zhou, Zhe-Min; Xu, Zheng-Hong

    2017-02-01

    Nitrile-converting enzymes, including nitrilase and nitrile hydratase (NHase), have received increasing attention from researchers of industrial biocatalysis because of their critical role as a tool in organic synthesis of carboxylic acids and amides from nitriles. To date, these bioconversion approaches are considered as one of the most potential industrial processes using resting cells or purified enzymes as catalysts for production of food additives, pharmaceutical, and agrochemical precursors. This review focuses on the distribution and catalytic mechanism research of nitrile-converting enzymes in recent years. Molecular biology aspects to improve the biocatalytic performance of microbial nitrilase and NHase are demonstrated. The process developments of microbial nitrilase and NHase for organic synthesis are also discussed.

  12. Synthesis of pyromellitic acid esters

    NASA Technical Reports Server (NTRS)

    Fedorova, V. A.; Donchak, V. A.; Martynyuk-Lototskaya, A. N.

    1985-01-01

    The ester acids necessary for studyng the thermochemical properties of pyromellitic acid (PMK)-based peroxides were investigated. Obtaining a tetramethyl ester of a PMK was described. The mechanism of an esterification reaction is discussed, as is the complete esterification of PMK with primary alcohol.

  13. Characterization of Enzymes Involved in Fatty Acid Elongation

    DTIC Science & Technology

    2007-04-11

    Saccharomyces cerevisiae gene involved in synthesis of 1,3- beta - glucan in vitro. J Bacteriol, 1995. 177(11): p. 3227-34. 39. Ladeveze, V...which conferred resistance to echinocandins and had defects in "- glucan synthase activities [38]. ELO2 was also reported as FEN1, a mutant...required for heterologous fatty acid elongase activity encodes a microsomal beta -keto-reductase. J Biol Chem, 2002. 277(13): p. 11481-8. 4. Chang, S.I

  14. Biotin and Lipoic Acid: Synthesis, Attachment and Regulation

    PubMed Central

    Cronan, John E.

    2014-01-01

    Summary Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as “swinging arms” that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well-described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like “arm” of biotin were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise and the BioH esterase for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl-ACP of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyl transferase followed by sulfur insertion at carbons C6 and C8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized and thus there is no transcriptional control of the synthetic genes. In contrast transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system, exerted through BirA a dual function protein that both represses

  15. Nutritional and hormonal regulation of malic enzyme synthesis in rat mammary gland.

    PubMed Central

    Lobato, M F; Ros, M; Moreno, F J; García-Ruíz, J P

    1986-01-01

    Cytosolic malic enzyme was purified from rat mammary gland by L-malate affinity chromatography. The pure enzyme obtained was used to produce a specific antiserum in a rabbit. Relative synthesis of malic enzyme in the mammary gland of mid-lactating rats was 0.097%, measured by labelling the enzyme in isolated acini. When food was removed, malic enzyme synthesis decreased to 35% and 20% of the control value at 4 and 6 h respectively. Incorporation of [3H]leucine into soluble proteins was constant during the first 6 h of starvation. When lactating rats (maintained with their pups) were starved for 24 h and then re-fed, the relative rate of enzyme synthesis increased 2.5-, 4-, and 4.5-fold at 3 h, 6 h and 18 h respectively after initiation of re-feeding. The relative rate of malic enzyme synthesis was about 50% of normal at 15 h after weaning, whereas the rate of synthesis of soluble proteins did not change. Administration of bromocriptine or adrenalectomy of lactating rats decreased the relative rate of synthesis of malic enzyme by 40% or 30% respectively; these effects were counteracted by hormone supplementation. Hormone therapy also caused an increase in the rate of incorporation of [3H]leucine into soluble proteins and in malic enzyme activity. Images Fig. 1. PMID:3753458

  16. Fluorogenic Substrates for Visualizing Acidic Organelle Enzyme Activities

    PubMed Central

    Harlan, Fiona Karen; Lusk, Jason Scott; Mohr, Breanna Michelle; Guzikowski, Anthony Peter; Batchelor, Robert Hardy; Jiang, Ying

    2016-01-01

    Lysosomes are acidic cytoplasmic organelles that are present in all nucleated mammalian cells and are involved in a variety of cellular processes including repair of the plasma membrane, defense against pathogens, cholesterol homeostasis, bone remodeling, metabolism, apoptosis and cell signaling. Defects in lysosomal enzyme activity have been associated with a variety of neurological diseases including Parkinson’s Disease, Lysosomal Storage Diseases, Alzheimer's disease and Huntington's disease. Fluorogenic lysosomal staining probes were synthesized for labeling lysosomes and other acidic organelles in a live-cell format and were shown to be capable of monitoring lysosomal metabolic activity. The new targeted substrates were prepared from fluorescent dyes having a low pKa value for optimum fluorescence at the lower physiological pH found in lysosomes. They were modified to contain targeting groups to direct their accumulation in lysosomes as well as enzyme-cleavable functions for monitoring specific enzyme activities using a live-cell staining format. Application to the staining of cells derived from blood and skin samples of patients with Metachromatic Leukodystrophy, Krabbe and Gaucher Diseases as well as healthy human fibroblast and leukocyte control cells exhibited localization to the lysosome when compared with known lysosomal stain LysoTracker® Red DND-99 as well as with anti-LAMP1 Antibody staining. When cell metabolism was inhibited with chloroquine, staining with an esterase substrate was reduced, demonstrating that the substrates can be used to measure cell metabolism. When applied to diseased cells, the intensity of staining was reflective of lysosomal enzyme levels found in diseased cells. Substrates specific to the enzyme deficiencies in Gaucher or Krabbe disease patient cell lines exhibited reduced staining compared to that in non-diseased cells. The new lysosome-targeted fluorogenic substrates should be useful for research, diagnostics and

  17. Synthesis of benzyl cinnamate by enzymatic esterification of cinnamic acid.

    PubMed

    Wang, Yun; Zhang, Dong-Hao; Chen, Na; Zhi, Gao-Ying

    2015-12-01

    In this study, lipase catalysis was successfully applied in synthesis of benzyl cinnamate through esterification of cinnamic acid with benzyl alcohol. Lipozyme TLIM was found to be more efficient for catalyzing this reaction than Novozym 435. In order to increase the yield of benzyl cinnamate, several media, including acetone, trichloromethane, methylbenzene, and isooctane, were used in this reaction. The reaction showed a high yield using isooctane as medium. Furthermore, the effects of several parameters such as water activity, reaction temperature, etc, on this reaction were analyzed. It was pointed out that too much benzyl alcohol would inhibit lipase activity. Under the optimum conditions, lipase-catalyzed synthesis of benzyl cinnamate gave a maximum yield of 97.3%. Besides, reusable experiment of enzyme demonstrated that Lipozyme TLIM retained 63% of its initial activity after three cycles. These results were of general interest for developing industrial processes for the preparation of benzyl cinnamate.

  18. A plausibly prebiotic synthesis of phosphonic acids.

    PubMed

    de Graaf, R M; Visscher, J; Schwartz, A W

    1995-11-30

    The insolubility of calcium phosphate in water is a significant stumbling block in the chemistry required for the origin of life. The discovery of alkyl phosphonic acids in the Murchison meteorite suggests the possibility of delivery of these water-soluble, phosphorus-containing molecules by meteorites or comets to the early Earth. This could have provided a supply of organic phosphorus for the earliest stages of chemical evolution; although probably not components of early genetic systems, phosphonic acids may have been precursors to the first nucleic acids. Here we report the synthesis of several phosphonic acids, including the most abundant found in the Murchison meteorite, by ultraviolet irradiation of orthophosphorous acid in the presence of formaldehyde, primary alcohols, or acetone. We argue that similar reactions might explain the presence of phosphonic acids in Murchison, and could also have occurred on the prebiotic Earth.

  19. Regulation of amino acid metabolic enzymes and transporters in plants.

    PubMed

    Pratelli, Réjane; Pilot, Guillaume

    2014-10-01

    Amino acids play several critical roles in plants, from providing the building blocks of proteins to being essential metabolites interacting with many branches of metabolism. They are also important molecules that shuttle organic nitrogen through the plant. Because of this central role in nitrogen metabolism, amino acid biosynthesis, degradation, and transport are tightly regulated to meet demand in response to nitrogen and carbon availability. While much is known about the feedback regulation of the branched biosynthesis pathways by the amino acids themselves, the regulation mechanisms at the transcriptional, post-transcriptional, and protein levels remain to be identified. This review focuses mainly on the current state of our understanding of the regulation of the enzymes and transporters at the transcript level. Current results describing the effect of transcription factors and protein modifications lead to a fragmental picture that hints at multiple, complex levels of regulation that control and coordinate transport and enzyme activities. It also appears that amino acid metabolism, amino acid transport, and stress signal integration can influence each other in a so-far unpredictable fashion.

  20. Synthesis of Alkyl Methylphosphonic Acid Esters

    SciTech Connect

    Mong, Gary M.; Harvey, Scott D.; Campbell, James A.

    2005-08-01

    This manuscript describes a simple synthesis and purification of cyclohexyl methylphosphonic and isopropyl methylphosphonic acids that provides high purity (>95% purity) product in gram quantities. Based on needs for improved analytical methods for indirect detection of nerve agent use, there is an increasing demand for these nerve agent hydrolysis products. These products are not commercially available. Synthesis is based on reaction of equimolar amounts of alcohol with methylphosphonic dichloride in toluene followed by the addition of excess water (two mole equivalents). The product was then extracted from the resulting aqueous layer into chloroform. The extraction scheme proved highly effective in removing unreacted starting materials and reaction by-products.

  1. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the snythesis methods of the prior art.

  2. Synthesis of alpha-amino acids

    DOEpatents

    Davis, J.W. Jr.

    1983-01-25

    A method is described for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R[sub 1]R[sub 2]C(OSOCl)CN, R[sub 1]R[sub 2]C(Cl)CN and [R[sub 1]R[sub 2]C(CN)O][sub 2]SO wherein R[sub 1] and R[sub 2] are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art. No Drawings

  3. The role of CYP26 enzymes in retinoic acid clearance

    PubMed Central

    Thatcher, Jayne E.; Isoherranen, Nina

    2009-01-01

    Retinoic acid (RA) is a critical signaling molecule that regulates gene transcription and the cell cycle. Understanding of RA signaling has increased dramatically over the past decades, but the connection between whole body RA homeostasis and gene regulation in individual cells is still unclear. It has been proposed that cytochrome P450 family 26 (CYP26) enzymes have a role in determining the cellular exposure to RA by inactivating RA in cells that do not need RA. The CYP26 enzymes have been shown to metabolize RA efficiently and they are also inducible by RA in selected systems. However, their expression patterns in different cell types and a mechanistic understanding of their function is still lacking. Based on preliminary kinetic data and protein expression levels, one may predict that if CYP26A1 is expressed in the liver at even very low levels, it will be the major RA hydroxylase in this tissue. As such, it is an attractive pharmacological target for drug development when one aims to increase circulating or cellular RA concentrations. To further the understanding of how CYP26 enzymes contribute to the regulation of RA homeostasis, structural information of the CYP26’s, commercially available recombinant enzymes and good specific and sensitive antibodies are needed. PMID:19519282

  4. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  5. A new regulatory mechanism for bacterial lipoic acid synthesis.

    PubMed

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-22

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis.

  6. Adapting capillary gel electrophoresis as a sensitive, high-throughput method to accelerate characterization of nucleic acid metabolic enzymes.

    PubMed

    Greenough, Lucia; Schermerhorn, Kelly M; Mazzola, Laurie; Bybee, Joanna; Rivizzigno, Danielle; Cantin, Elizabeth; Slatko, Barton E; Gardner, Andrew F

    2016-01-29

    Detailed biochemical characterization of nucleic acid enzymes is fundamental to understanding nucleic acid metabolism, genome replication and repair. We report the development of a rapid, high-throughput fluorescence capillary gel electrophoresis method as an alternative to traditional polyacrylamide gel electrophoresis to characterize nucleic acid metabolic enzymes. The principles of assay design described here can be applied to nearly any enzyme system that acts on a fluorescently labeled oligonucleotide substrate. Herein, we describe several assays using this core capillary gel electrophoresis methodology to accelerate study of nucleic acid enzymes. First, assays were designed to examine DNA polymerase activities including nucleotide incorporation kinetics, strand displacement synthesis and 3'-5' exonuclease activity. Next, DNA repair activities of DNA ligase, flap endonuclease and RNase H2 were monitored. In addition, a multicolor assay that uses four different fluorescently labeled substrates in a single reaction was implemented to characterize GAN nuclease specificity. Finally, a dual-color fluorescence assay to monitor coupled enzyme reactions during Okazaki fragment maturation is described. These assays serve as a template to guide further technical development for enzyme characterization or nucleoside and non-nucleoside inhibitor screening in a high-throughput manner.

  7. Adapting capillary gel electrophoresis as a sensitive, high-throughput method to accelerate characterization of nucleic acid metabolic enzymes

    PubMed Central

    Greenough, Lucia; Schermerhorn, Kelly M.; Mazzola, Laurie; Bybee, Joanna; Rivizzigno, Danielle; Cantin, Elizabeth; Slatko, Barton E.; Gardner, Andrew F.

    2016-01-01

    Detailed biochemical characterization of nucleic acid enzymes is fundamental to understanding nucleic acid metabolism, genome replication and repair. We report the development of a rapid, high-throughput fluorescence capillary gel electrophoresis method as an alternative to traditional polyacrylamide gel electrophoresis to characterize nucleic acid metabolic enzymes. The principles of assay design described here can be applied to nearly any enzyme system that acts on a fluorescently labeled oligonucleotide substrate. Herein, we describe several assays using this core capillary gel electrophoresis methodology to accelerate study of nucleic acid enzymes. First, assays were designed to examine DNA polymerase activities including nucleotide incorporation kinetics, strand displacement synthesis and 3′-5′ exonuclease activity. Next, DNA repair activities of DNA ligase, flap endonuclease and RNase H2 were monitored. In addition, a multicolor assay that uses four different fluorescently labeled substrates in a single reaction was implemented to characterize GAN nuclease specificity. Finally, a dual-color fluorescence assay to monitor coupled enzyme reactions during Okazaki fragment maturation is described. These assays serve as a template to guide further technical development for enzyme characterization or nucleoside and non-nucleoside inhibitor screening in a high-throughput manner. PMID:26365239

  8. Crystal structure of Spot 14, a modulator of fatty acid synthesis

    SciTech Connect

    Colbert, Christopher L.; Kim, Chai-Wan; Moon, Young-Ah; Henry, Lisa; Palnitkar, Maya; McKean, William B.; Fitzgerald, Kevin; Deisenhofer, Johann; Horton, Jay D.; Kwon, Hyock Joo

    2011-09-06

    Spot 14 (S14) is a protein that is abundantly expressed in lipogenic tissues and is regulated in a manner similar to other enzymes involved in fatty acid synthesis. Deletion of S14 in mice decreased lipid synthesis in lactating mammary tissue, but the mechanism of S14's action is unknown. Here we present the crystal structure of S14 to 2.65 {angstrom} and biochemical data showing that S14 can form heterodimers with MIG12. MIG12 modulates fatty acid synthesis by inducing the polymerization and activity of acetyl-CoA carboxylase, the first committed enzymatic reaction in the fatty acid synthesis pathway. Coexpression of S14 and MIG12 leads to heterodimers and reduced acetyl-CoA carboxylase polymerization and activity. The structure of S14 suggests a mechanism whereby heterodimer formation with MIG12 attenuates the ability of MIG12 to activate ACC.

  9. Akt Phosphorylation and Regulation of Transketolase Is a Nodal Point for Amino Acid Control of Purine Synthesis

    PubMed Central

    Saha, Arindam; Connelly, Stephen; Jiang, Jingjing; Zhuang, Shunhui; Amador, Deron T.; Phan, Tony; Pilz, Renate B.; Boss, Gerry R.

    2014-01-01

    SUMMARY The phosphatidylinositol 3-kinase (PI3K)/Akt pathway integrates environmental clues to regulate cell growth and survival. We showed previously that depriving cells of a single essential amino acid rapidly and reversibly arrests purine synthesis. Here we demonstrate that amino acids via mTORC2 and IκB kinase regulate Akt activity, and Akt association and phosphorylation of transketolase (TKT), a key enzyme of the non-oxidative pentose phosphate pathway (PPP). Akt phosphorylates TKT on Thr382, markedly enhancing enzyme activity and increasing carbon flow through the non-oxidative PPP, thereby increasing purine synthesis. Mice fed a lysine-deficient diet for two days show decreased Akt activity, TKT activity, and purine synthesis in multiple organs. These results provide a new mechanism whereby Akt coordinates amino acid availability with glucose utilization, purine synthesis, and RNA and DNA synthesis. PMID:24981175

  10. Role of Maltose Enzymes in Glycogen Synthesis by Escherichia coli▿

    PubMed Central

    Park, Jong-Tae; Shim, Jae-Hoon; Tran, Phuong Lan; Hong, In-Hee; Yong, Hwan-Ung; Oktavina, Ershita Fitria; Nguyen, Hai Dang; Kim, Jung-Wan; Lee, Tae Soo; Park, Sung-Hoon; Boos, Winfried; Park, Kwan-Hwa

    2011-01-01

    Mutants with deletion mutations in the glg and mal gene clusters of Escherichia coli MC4100 were used to gain insight into glycogen and maltodextrin metabolism. Glycogen content, molecular mass, and branch chain distribution were analyzed in the wild type and in ΔmalP (encoding maltodextrin phosphorylase), ΔmalQ (encoding amylomaltase), ΔglgA (encoding glycogen synthase), and ΔglgA ΔmalP derivatives. The wild type showed increasing amounts of glycogen when grown on glucose, maltose, or maltodextrin. When strains were grown on maltose, the glycogen content was 20 times higher in the ΔmalP strain (0.97 mg/mg protein) than in the wild type (0.05 mg/mg protein). When strains were grown on glucose, the ΔmalP strain and the wild type had similar glycogen contents (0.04 mg/mg and 0.03 mg/mg protein, respectively). The ΔmalQ mutant did not grow on maltose but showed wild-type amounts of glycogen when grown on glucose, demonstrating the exclusive function of GlgA for glycogen synthesis in the absence of maltose metabolism. No glycogen was found in the ΔglgA and ΔglgA ΔmalP strains grown on glucose, but substantial amounts (0.18 and 1.0 mg/mg protein, respectively) were found when they were grown on maltodextrin. This demonstrates that the action of MalQ on maltose or maltodextrin can lead to the formation of glycogen and that MalP controls (inhibits) this pathway. In vitro, MalQ in the presence of GlgB (a branching enzyme) was able to form glycogen from maltose or linear maltodextrins. We propose a model of maltodextrin utilization for the formation of glycogen in the absence of glycogen synthase. PMID:21421758

  11. Role of maltose enzymes in glycogen synthesis by Escherichia coli.

    PubMed

    Park, Jong-Tae; Shim, Jae-Hoon; Tran, Phuong Lan; Hong, In-Hee; Yong, Hwan-Ung; Oktavina, Ershita Fitria; Nguyen, Hai Dang; Kim, Jung-Wan; Lee, Tae Soo; Park, Sung-Hoon; Boos, Winfried; Park, Kwan-Hwa

    2011-05-01

    Mutants with deletion mutations in the glg and mal gene clusters of Escherichia coli MC4100 were used to gain insight into glycogen and maltodextrin metabolism. Glycogen content, molecular mass, and branch chain distribution were analyzed in the wild type and in ΔmalP (encoding maltodextrin phosphorylase), ΔmalQ (encoding amylomaltase), ΔglgA (encoding glycogen synthase), and ΔglgA ΔmalP derivatives. The wild type showed increasing amounts of glycogen when grown on glucose, maltose, or maltodextrin. When strains were grown on maltose, the glycogen content was 20 times higher in the ΔmalP strain (0.97 mg/mg protein) than in the wild type (0.05 mg/mg protein). When strains were grown on glucose, the ΔmalP strain and the wild type had similar glycogen contents (0.04 mg/mg and 0.03 mg/mg protein, respectively). The ΔmalQ mutant did not grow on maltose but showed wild-type amounts of glycogen when grown on glucose, demonstrating the exclusive function of GlgA for glycogen synthesis in the absence of maltose metabolism. No glycogen was found in the ΔglgA and ΔglgA ΔmalP strains grown on glucose, but substantial amounts (0.18 and 1.0 mg/mg protein, respectively) were found when they were grown on maltodextrin. This demonstrates that the action of MalQ on maltose or maltodextrin can lead to the formation of glycogen and that MalP controls (inhibits) this pathway. In vitro, MalQ in the presence of GlgB (a branching enzyme) was able to form glycogen from maltose or linear maltodextrins. We propose a model of maltodextrin utilization for the formation of glycogen in the absence of glycogen synthase.

  12. Increased fatty acid unsaturation and production of arachidonic acid by homologous over-expression of the mitochondrial malic enzyme in Mortierella alpina.

    PubMed

    Hao, Guangfei; Chen, Haiqin; Du, Kai; Huang, Xiaoyun; Song, Yuanda; Gu, Zhennan; Wang, Lei; Zhang, Hao; Chen, Wei; Chen, Yong Q

    2014-09-01

    Malic enzyme (ME) catalyses the oxidative decarboxylation of L-malate to pyruvate and provides NADPH for intracellular metabolism, such as fatty acid synthesis. Here, the mitochondrial ME (mME) gene from Mortierella alpina was homologously over-expressed. Compared with controls, fungal arachidonic acid (ARA; 20:4 n-6) content increased by 60 % without affecting the total fatty acid content. Our results suggest that enhancing mME activity may be an effective mean to increase industrial production of ARA in M. alpina.

  13. Enzyme therapy for lysosomal acid lipase deficiency in the mouse.

    PubMed

    Du, H; Schiavi, S; Levine, M; Mishra, J; Heur, M; Grabowski, G A

    2001-08-01

    Lysosomal acid lipase (LAL) is the critical enzyme for the hydrolysis of the triglycerides (TG) and cholesteryl esters (CE) delivered to lysosomes. Its deficiency produces two human phenotypes, Wolman disease (WD) and cholesteryl ester storage disease (CESD). A targeted disruption of the LAL locus produced a null (lal( -/-)) mouse model that mimics human WD/CESD. The potential for enzyme therapy was tested using mannose terminated human LAL expressed in Pichia pastoris (phLAL), purified, and administered by tail vein injections to lal( -/-) mice. Mannose receptor (MR)-dependent uptake and lysosomal targeting of phLAL were evidenced ex vivo using competitive assays with MR-positive J774E cells, a murine monocyte/macrophage line, immunofluorescence and western blots. Following (bolus) IV injection, phLAL was detected in Kupffer cells, lung macrophages and intestinal macrophages in lal( -/-) mice. Two-month-old lal( -/-) mice received phLAL (1.5 U/dose) or saline injections once every 3 days for 30 days (10 doses). The treated lal( -/-) mice showed nearly complete resolution of hepatic yellow coloration; hepatic weight decreased by approximately 36% compared to PBS-treated lal( -/-) mice. Histologic analyses of numerous tissues from phLAL-treated mice showed reductions in macrophage lipid storage. TG and cholesterol levels decreased by approximately 50% in liver, 69% in spleen and 50% in small intestine. These studies provide feasibility for LAL enzyme therapy in human WD and CESD.

  14. Oxidation of indole-3-acetic acid to oxindole-3-acetic acid by an enzyme preparation from Zea mays

    NASA Technical Reports Server (NTRS)

    Reinecke, D. M.; Bandurski, R. S.

    1988-01-01

    Indole-3-acetic acid is oxidized to oxindole-3-acetic acid by Zea mays tissue extracts. Shoot, root, and endosperm tissues have enzyme activities of 1 to 10 picomoles per hour per milligram protein. The enzyme is heat labile, is soluble, and requires oxygen for activity. Cofactors of mixed function oxygenase, peroxidase, and intermolecular dioxygenase are not stimulatory to enzymic activity. A heat-stable, detergent-extractable component from corn enhances enzyme activity 6- to 10-fold. This is the first demonstration of the in vitro enzymic oxidation of indole-3-acetic acid to oxindole-3-acetic acid in higher plants.

  15. Is bacterial fatty acid synthesis a valid target for antibacterial drug discovery?

    PubMed

    Parsons, Joshua B; Rock, Charles O

    2011-10-01

    The emergence of resistance against most current drugs emphasizes the need to develop new approaches to control bacterial pathogens, particularly Staphylococcus aureus. Bacterial fatty acid synthesis is one such target that is being actively pursued by several research groups to develop anti-Staphylococcal agents. Recently, the wisdom of this approach has been challenged based on the ability of a Gram-positive bacterium to incorporate extracellular fatty acids and thus circumvent the inhibition of de novo fatty acid synthesis. The generality of this conclusion has been challenged, and there is enough diversity in the enzymes and regulation of fatty acid synthesis in bacteria to conclude that there is not a single organism that can be considered typical and representative of bacteria as a whole. We are left without a clear resolution to this ongoing debate and await new basic research to define the pathways for fatty acid uptake and that determine the biochemical and genetic mechanisms for the regulation of fatty acid synthesis in Gram-positive bacteria. These crucial experiments will determine whether diversity in the control of this important pathway accounts for the apparently different responses of Gram-positive bacteria to the inhibition of de novo fatty acid synthesis in presence of extracellular fatty acid supplements.

  16. Indole-3-acetic Acid Synthesis in Tumorous and Nontumorous Species of Nicotiana 1

    PubMed Central

    Liu, Shih-Tung; Katz, Charles D.; Knight, C. Arthur

    1978-01-01

    The synthesis of indole-3-acetic acid (IAA) in the enzyme extracts of Nicotiana glauca, Nicotiana langsdorffii, their F1 hybrid, their amphidiploid hybrid, and the nontumorous mutant of the hybrid was investigated. Tryptamine, a possible precursor of IAA biosynthesis in Nicotiana tabacum, was not found in the callus tissue of N. glauca, N. langsdorffii, and their F1 hybrid. In petiole slices, the synthesis of IAA progressively increased during 5 hours of incubation in [14C]tryptophan. The rate of synthesis was about equal in the hybrid and N. langsdorffii but lower in N. glauca on either a cell or fresh weight basis. It was also found that tryptophan was about 25 times more efficient than tryptamine in promoting synthesis of IAA in petiole slices. It was found that indoleacetaldehyde oxidase, indoleacetaldehyde reductase, and tryptophan aminotransferase activities were present in all of the species examined; however, tryptophan decarboxylase activity was not found. The tryptophan aminotransferase activity in N. glauca, N. langsdorffii, and the nontumorous mutant required α-ketoglutaric acid and pyridoxal 5-phosphate whereas the addition of pyridoxal 5-phosphate seemed not to increase the enzyme activity in tumor plants. The tryptophan aminotransferase in the amphidiploid hybrid was partially purified by acetone precipitation. The enzyme activity had a temperature optimum at 49 C and a pH optimum at 8.9. It is suggested that there is an indolepyruvic acid pathway in the synthesis of IAA in the Nicotiana species examined. PMID:16660376

  17. Identification and Functional Analysis of Delta-9 Desaturase, a Key Enzyme in PUFA Synthesis, Isolated from the Oleaginous Diatom Fistulifera

    PubMed Central

    Muto, Masaki; Kubota, Chihiro; Tanaka, Masayoshi; Satoh, Akira; Matsumoto, Mitsufumi; Yoshino, Tomoko; Tanaka, Tsuyoshi

    2013-01-01

    Oleaginous microalgae are one of the promising resource of nonedible biodiesel fuel (BDF) feed stock alternatives. Now a challenge task is the decrease of the long-chain polyunsaturated fatty acids (PUFAs) content affecting on the BDF oxidative stability by using gene manipulation techniques. However, only the limited knowledge has been available concerning the fatty acid and PUFA synthesis pathways in microalgae. Especially, the function of Δ9 desaturase, which is a key enzyme in PUFA synthesis pathway, has not been determined in diatom. In this study, 4 Δ9 desaturase genes (fD9desA, fD9desB, fD9desC and fD9desD) from the oleaginous diatom Fistulifera were newly isolated and functionally characterized. The putative Δ9 acyl-CoA desaturases in the endoplasmic reticulum (ER) showed 3 histidine clusters that are well-conserved motifs in the typical Δ9 desaturase. Furthermore, the function of these Δ9 desaturases was confirmed in the Saccharomyces cerevisiae ole1 gene deletion mutant (Δole1). All the putative Δ9 acyl-CoA desaturases showed Δ9 desaturation activity for C16∶0 fatty acids; fD9desA and fD9desB also showed desaturation activity for C18∶0 fatty acids. This study represents the first functional analysis of Δ9 desaturases from oleaginous microalgae and from diatoms as the first enzyme to introduce a double bond in saturated fatty acids during PUFA synthesis. The findings will provide beneficial insights into applying metabolic engineering processes to suppressing PUFA synthesis in this oleaginous microalgal strain. PMID:24039966

  18. The synthesis of starch from carbon dioxide using isolubilized stabilized enzymes

    NASA Technical Reports Server (NTRS)

    Bassham, J. A.; Bearden, L.; Wilke, C.; Carroad, P.; Mitra, G.; Ige, R.

    1972-01-01

    Systems for artificial manufacture of starch and for delineation of technological areas, and the rationale for studying them are considered. A discussion of the enzyme-catalyzed routes of synthesis available and a choice as to the most promising route are presented. A discussion of the enzymes involved, of enzyme insolubilization technology, and of possible engineering approaches, with examples in the form of model calculations for both reactors and separators, are also presented.

  19. Combinatorial Effects of Fatty Acid Elongase Enzymes on Nervonic Acid Production in Camelina sativa

    PubMed Central

    Huai, Dongxin; Zhang, Yuanyuan; Zhang, Chunyu; Cahoon, Edgar B.; Zhou, Yongming

    2015-01-01

    Very long chain fatty acids (VLCFAs) with chain lengths of 20 carbons and longer provide feedstocks for various applications; therefore, improvement of VLCFA contents in seeds has become an important goal for oilseed enhancement. VLCFA biosynthesis is controlled by a multi-enzyme protein complex referred to as fatty acid elongase, which is composed of β-ketoacyl-CoA synthase (KCS), β-ketoacyl-CoA reductase (KCR), β-hydroxyacyl-CoA dehydratase (HCD) and enoyl reductase (ECR). KCS has been identified as the rate-limiting enzyme, but little is known about the involvement of other three enzymes in VLCFA production. Here, the combinatorial effects of fatty acid elongase enzymes on VLCFA production were assessed by evaluating the changes in nervonic acid content. A KCS gene from Lunaria annua (LaKCS) and the other three elongase genes from Arabidopsis thaliana were used for the assessment. Five seed-specific expressing constructs, including LaKCS alone, LaKCS with AtKCR, LaKCS with AtHCD, LaKCS with AtECR, and LaKCS with AtKCR and AtHCD, were transformed into Camelina sativa. The nervonic acid content in seed oil increased from null in wild type camelina to 6-12% in LaKCS-expressing lines. However, compared with that from the LaKCS-expressing lines, nervonic acid content in mature seeds from the co-expressing lines with one or two extra elongase genes did not show further increases. Nervonic acid content from LaKCS, AtKCR and AtHCD co-expressing line was significantly higher than that in LaKCS-expressing line during early seed development stage, while the ultimate nervonic acid content was not significantly altered. The results from this study thus provide useful information for future engineering of oilseed crops for higher VLCFA production. PMID:26121034

  20. Decreased hepatotoxic bile acid composition and altered synthesis in progressive human nonalcoholic fatty liver disease

    SciTech Connect

    Lake, April D.; Novak, Petr; Shipkova, Petia; Aranibar, Nelly; Robertson, Donald; Reily, Michael D.; Lu, Zhenqiang; Lehman-McKeeman, Lois D.; Cherrington, Nathan J.

    2013-04-15

    Bile acids (BAs) have many physiological roles and exhibit both toxic and protective influences within the liver. Alterations in the BA profile may be the result of disease induced liver injury. Nonalcoholic fatty liver disease (NAFLD) is a prevalent form of chronic liver disease characterized by the pathophysiological progression from simple steatosis to nonalcoholic steatohepatitis (NASH). The hypothesis of this study is that the ‘classical’ (neutral) and ‘alternative’ (acidic) BA synthesis pathways are altered together with hepatic BA composition during progression of human NAFLD. This study employed the use of transcriptomic and metabolomic assays to study the hepatic toxicologic BA profile in progressive human NAFLD. Individual human liver samples diagnosed as normal, steatosis, and NASH were utilized in the assays. The transcriptomic analysis of 70 BA genes revealed an enrichment of downregulated BA metabolism and transcription factor/receptor genes in livers diagnosed as NASH. Increased mRNA expression of BAAT and CYP7B1 was observed in contrast to decreased CYP8B1 expression in NASH samples. The BA metabolomic profile of NASH livers exhibited an increase in taurine together with elevated levels of conjugated BA species, taurocholic acid (TCA) and taurodeoxycholic acid (TDCA). Conversely, cholic acid (CA) and glycodeoxycholic acid (GDCA) were decreased in NASH liver. These findings reveal a potential shift toward the alternative pathway of BA synthesis during NASH, mediated by increased mRNA and protein expression of CYP7B1. Overall, the transcriptomic changes of BA synthesis pathway enzymes together with altered hepatic BA composition signify an attempt by the liver to reduce hepatotoxicity during disease progression to NASH. - Highlights: ► Altered hepatic bile acid composition is observed in progressive NAFLD. ► Bile acid synthesis enzymes are transcriptionally altered in NASH livers. ► Increased levels of taurine and conjugated bile acids

  1. Mining Enzyme Diversity of Transcriptome Libraries through DNA Synthesis for Benzylisoquinoline Alkaloid Pathway Optimization in Yeast.

    PubMed

    Narcross, Lauren; Bourgeois, Leanne; Fossati, Elena; Burton, Euan; Martin, Vincent J J

    2016-12-16

    The ever-increasing quantity of data deposited to GenBank is a valuable resource for mining new enzyme activities. Falling costs of DNA synthesis enables metabolic engineers to take advantage of this resource for identifying superior or novel enzymes for pathway optimization. Previously, we reported synthesis of the benzylisoquinoline alkaloid dihydrosanguinarine in yeast from norlaudanosoline at a molar conversion of 1.5%. Molar conversion could be improved by reduction of the side-product N-methylcheilanthifoline, a key bottleneck in dihydrosanguinarine biosynthesis. Two pathway enzymes, an N-methyltransferase and a cytochrome P450 of the CYP719A subfamily, were implicated in the synthesis of the side-product. Here, we conducted an extensive screen to identify enzyme homologues whose coexpression reduces side-product synthesis. Phylogenetic trees were generated from multiple sources of sequence data to identify a library of candidate enzymes that were purchased codon-optimized and precloned into expression vectors designed to facilitate high-throughput analysis of gene expression as well as activity assay. Simple in vivo assays were sufficient to guide the selection of superior enzyme homologues that ablated the synthesis of the side-product, and improved molar conversion of norlaudanosoline to dihydrosanguinarine to 10%.

  2. Chemical Synthesis of a Hyaluronic Acid Decasaccharide

    PubMed Central

    Lu, Xiaowei; Kamat, Medha N.; Huang, Lijun; Huang, Xuefei

    2009-01-01

    The chemical synthesis of a hyaluronic acid decasaccharide using the pre-activation based chemoselective glycosylation strategy is described. Assembly of large oligosaccharides is generally challenging due to the increased difficulties in both glycosylation and deprotection. Indeed, the same building blocks previously employed for hyaluronic acid hexasaccharide syntheses failed to yield the desired decasaccharide. After extensive experimentation, the decasaccharide backbone was successfully constructed with an overall yield of 37% from disaccharide building blocks. The trichloroacetyl group was used as the nitrogen protective group for the glucosamine units and the addition of TMSOTf was found to be crucial to suppress the formation of trichloromethyl oxazoline side-product and enable high glycosylation yield. For deprotections, the combination of a mild basic condition and the monitoring methodology using 1H-NMR allowed the removal of all base-labile protective groups, which facilitated the generation of the fully deprotected HA decasaccharide. PMID:19764799

  3. Arabidopsis FAD2 gene encodes the enzyme that is essential for polyunsaturated lipid synthesis.

    PubMed Central

    Okuley, J; Lightner, J; Feldmann, K; Yadav, N; Lark, E; Browse, J

    1994-01-01

    The polyunsaturated fatty acids linoleate and alpha-linolenate are important membrane components and are the essential fatty acids of human nutrition. The major enzyme responsible for the synthesis of these compounds is the plant oleate desaturase of the endoplasmic reticulum, and its activity is controlled in Arabidopsis by the fatty acid desaturation 2 (fad2) locus. A fad2 allele was identified in a population of Arabidopsis in which mutations had been created by T-DNA insertions. Genomic DNA flanking the T-DNA was cloned by plasmid rescue and used to isolate cDNA and genomic clones of FAD2. A cDNA containing the entire FAD2 coding sequence was expressed in fad2 mutant plants and shown to complement the mutant fatty acid phenotype. The deduced amino acid sequence from the cDNA showed homology to other plant desaturases, and this confirmed that FAD2 is the structural gene for the desaturase. Gel blot analyses of FAD2 mRNA levels showed that the gene is expressed throughout the plant and suggest that transcript levels are in excess of the amount needed to account for oleate desaturation. Sequence analysis identified histidine-rich motifs that could contribute to an iron binding site in the cytoplasmic domain of the protein. Such a position would facilitate interaction between the desaturase and cytochrome b5, which is the direct source of electrons for the desaturation reaction, but would limit interaction of the active site with the fatty acyl substrate. PMID:7907506

  4. Chemoenzymatic synthesis of surfactants from carbohydrates, amino acids, and fatty acids.

    PubMed

    Bellahouel, S; Rolland, V; Roumestant, M L; Viallefont, P; Martinez, J

    2001-02-01

    The chemoenzymatic synthesis of new surfactants is reported; they were prepared from unprotected carbohydrates, amino acids, and fatty acids. This study pointed out the factors that govern the possibility to enzymatically bind the carbohydrate to the amino acid.

  5. Distribution of a Fatty Acid Cyclase Enzyme System in Plants 1

    PubMed Central

    Vick, Brady A.; Zimmermann, Don C.

    1979-01-01

    Extracts from tissues of 24 plant species were tested for the enzyme that catalyzes the conversion of 13-l-hydroperoxy-cis-9,15-trans-11-octadecatrienoic acid to the cyclic fatty acid 12-oxo-cis-10,15-phytodienoic acid. The enzyme was detected in 15 of the 24 tissues examined, and was demonstrated in seedlings, leaves, and fruits. PMID:16660932

  6. Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway

    PubMed Central

    Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z.; Yazdani, Syed Shams

    2016-01-01

    Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817

  7. Nanostructured Membranes for Green Synthesis of Nanoparticles and Enzyme Catalysis

    EPA Science Inventory

    Macroporous membranes functionalized with ionizable macromolecules provide promising applications in toxic metal capture at high capacity, nanoparticle synthesis, and catalysis. Our low‐pressure membrane approach is marked by reaction and separation selectivity and their tunabili...

  8. Nanostructured Membranes for Enzyme Catalysis and Green Synthesis of Nanoparticles

    EPA Science Inventory

    Macroporous membranes functionalized with ionizable macromolecules provide promising applications in toxic metal capture at high capacity, nanoparticle synthesis, and catalysis. Our low-pressure membrane approach is marked by reaction and separation selectivity and their tunabil...

  9. Structural Characterization of the Mycobacterium tuberculosis Biotin Biosynthesis Enzymes 7,8-Diaminopelargonic Acid Synthase and Dethiobiotin Synthetase†,‡

    PubMed Central

    Dey, Sanghamitra; Lane, James M.; Lee, Richard E.; Rubin, Eric J.; Sacchettini, James C.

    2010-01-01

    Mycobacterium tuberculosis (Mtb) depends on biotin synthesis for survival during infection. In the absence of biotin, disruption of the biotin biosynthesis pathway results in cell death rather than growth arrest, an unusual phenotype for an Mtb auxotroph. Humans lack the enzymes for biotin production, making the proteins of this essential Mtb pathway promising drug targets. To this end, we have determined the crystal structures of the second and third enzymes of the Mtb biotin biosynthetic pathway, 7,8-diaminopelargonic acid synthase (DAPAS) and dethiobiotin synthetase (DTBS), at respective resolutions of 2.2 Å and 1.85 Å. Superimposition of the DAPAS structures bound either to the SAM analog sinefungin or to 7-keto-8-aminopelargonic acid (KAPA) allowed us to map the putative binding site for the substrates and to propose a mechanism by which the enzyme accommodates their disparate structures. Comparison of the DTBS structures bound to the substrate 7,8-diaminopelargonic acid (DAPA) or to ADP and the product dethiobiotin (DTB) permitted derivation of an enzyme mechanism. There are significant differences between the Mtb enzymes and those of other organisms; the Bacillus subtilis DAPAS, presented here at a high resolution of 2.2 Å, has active site variations and the Escherichia coli and Helicobacter pylori DTBS have alterations in their overall folds. We have begun to exploit the unique characteristics of the Mtb structures to design specific inhibitors against the biotin biosynthesis pathway in Mtb. PMID:20565114

  10. Synthesis of novel acid electrolytes for phosphoric acid fuel cells

    NASA Astrophysics Data System (ADS)

    Adcock, James L.

    1988-11-01

    A 40 millimole per hour scale aerosol direct fluorination reactor was constructed. F-Methyl F-4-methoxybutanoate and F-4-methoxybutanoyl fluoride were synthesized by aerosol direct fluorination of methyl 4-methoxybutanoate. Basic hydrolysis of the perfluorinated derivatives produce sodium F-4 methoxybutanoate which was pyrolyzed to F-3-methoxy-1-propene. Purification and shipment of 33 grams of F-3-methoxy-1-propene followed. Syntheses by analogous methods allowed production and shipment of 5 grams of F-3-ethoxy 1-propene, 18 grams of F-3-(2-methoxy.ethoxy) 1-propene, and 37 grams of F-3,3-dimethyl 1-butene. Eighteen grams of F-2,2-dimethyl 1-chloropropane was produced directly and shipped. As suggested by other contractors, 5 grams of F-3-methoxy 1-iodopropane, and 5 grams of F-3-(2-methoxy.ethoxy) 1-iodopropane were produced by converting the respective precursor acid sodium salts produced for olefin synthesis to the silver salts and pyrolyzing them with iodine. Each of these compounds was prepared for the first time by the aerosol fluorination process during the course of the contract. These samples were provided to other Gas Research Institute (GRI) contractors for synthesis of perfluorinated sulfur (VI) and phosphorous (V) acids.

  11. Two-step immobilized enzyme conversion of cephalosporin C to 7-aminocephalosporanic acid.

    PubMed

    Conlon, H D; Baqai, J; Baker, K; Shen, Y Q; Wong, B L; Noiles, R; Rausch, C W

    1995-06-20

    The first large-scale production of 7-aminocephalosporanic acid (7ACA) from cephalosporin C (CPC) using a wholly enzymatic synthesis method is reported here. We produced 7ACA from CPC in as high a molar yield as 85% using the immobilized enzymes D-amino acid oxidase (D-AOD) and glutaryl-7-ACA acylase (GL-acylase). In the first reactor, CPC is converted to keto-adipyl-7-aminocephalosporanic acid (keto-7ACA) using an immobilized D-AOD isolated from a yeast, Trigonopsis variabilis. The keto-7ACA is then spontaneously converted to glutaryl-7-aminocephalosporanic acid (GL-7ACA) via a chemical reaction with hydrogen peroxide. The hydrogen peroxide is also a product of the D-AOD reaction. Near quantitative conversion of the keto-7ACA to GL-7ACA was observed. The second reactor converts GL-7ACA to 7ACA using an immobilized GL-acylase, which was isolated from a recombinant Escherichia coli. The final 7ACA crystalline product is a high quality product. The reactions are conducted under very mild aqueous conditions: pH 8.0 and 20 degrees to 25 degrees C. The production of desacetyl side products is minimal. This process is currently being implemented on an industrial scale to produce 7ACA.

  12. Ionic liquids as novel solvents for the synthesis of sugar fatty acid ester.

    PubMed

    Mai, Ngoc Lan; Ahn, Kihun; Bae, Sang Woo; Shin, Dong Woo; Morya, Vivek Kumar; Koo, Yoon-Mo

    2014-12-01

    Sugar fatty acid esters are bio-surfactants known for their non-toxic, non-ionic, and high biodegradability . With great emulsifying and conditioning effects, sugar fatty acids are widely used in the food, pharmaceutical, and cosmetic industries. Biosynthesis of sugar fatty acid esters has attracted growing attention in recent decades. In this study, the enzymatic synthesis of sugar fatty acid esters in ionic liquids was developed, optimized, and scaled up. Reaction parameters affecting the conversion yield of lipase-catalyzed synthesis of glucose laurate from glucose and vinyl laurate (i.e. temperature, vinyl laurate/glucose molar ratio, and enzyme loads) were optimized by response surface methodology (RSM). In addition, production was scaled up to 2.5 L, and recycling of enzyme and ionic liquids was investigated. The results showed that under optimal reaction conditions (66.86 °C, vinyl laurate/glucose molar ratio of 7.63, enzyme load of 73.33 g/L), an experimental conversion yield of 96.4% was obtained which is close to the optimal value predicted by RSM (97.16%). A similar conversion yield was maintained when the reaction was carried out at 2.5 L. Moreover, the enzymes and ionic liquids could be recycled and reused effectively for up to 10 cycles. The results indicate the feasibility of ionic liquids as novel solvents for the biosynthesis of sugar fatty acid esters.

  13. Enzyme-assisted target recycling (EATR) for nucleic acid detection.

    PubMed

    Gerasimova, Yulia V; Kolpashchikov, Dmitry M

    2014-09-07

    Fast, reliable and sensitive methods for nucleic acid detection are of growing practical interest with respect to molecular diagnostics of cancer, infectious and genetic diseases. Currently, PCR-based and other target amplification strategies are most extensively used in practice. At the same time, such assays have limitations that can be overcome by alternative approaches. There is a recent explosion in the design of methods that amplify the signal produced by a nucleic acid target, without changing its copy number. This review aims at systematization and critical analysis of the enzyme-assisted target recycling (EATR) signal amplification technique. The approach uses nucleases to recognize and cleave the probe-target complex. Cleavage reactions produce a detectable signal. The advantages of such techniques are potentially low sensitivity to contamination and lack of the requirement of a thermal cycler. Nucleases used for EATR include sequence-dependent restriction or nicking endonucleases or sequence independent exonuclease III, lambda exonuclease, RNase H, RNase HII, AP endonuclease, duplex-specific nuclease, DNase I, or T7 exonuclease. EATR-based assays are potentially useful for point-of-care diagnostics, single nucleotide polymorphisms genotyping and microRNA analysis. Specificity, limit of detection and the potential impact of EATR strategies on molecular diagnostics are discussed.

  14. Determination of pyruvic acid by using enzymic fluorescence capillary analysis.

    PubMed

    Zhao, Yuan-Yuan; Gao, Xiu-Feng; Li, Yong-Sheng; Ju, Xiang; Zhang, Jia; Zheng, Jia

    2008-07-15

    A new method (P-LE-FCA) for the determination of pyruvic acid was proposed based on liquid enzyme method (LE) and fluorescence capillary analysis (FCA). The optimum experimental conditions were as follows: the excitation and emission wavelengths were 350 and 460 nm, respectively; the reaction time and temperature were 20 min and 38 degrees C, respectively; the pH of phosphate buffer solution was 7.5; the concentrations of nicotinamide adenine dinucleotide and lactate dehydrogenase were 1.0 mmol L(-1) and 5.0 k UL(-1), respectively. The linear range of this method was 0.2-1.2 mmol L(-1) (Delta F=327.13C-10.018, r=0.9942). Its detection limit was 0.012 mmol L(-1). And its relative standard deviation was 0.86%. Only 18 microL of total reaction solution is enough for the detection. P-LE-FCA has some merits such as lower cost, simple operation procedure and micro determination. It has been used for the determination of pyruvic acid content in human urine samples.

  15. Enzyme

    MedlinePlus

    Enzymes are complex proteins that cause a specific chemical change in all parts of the body. For ... use them. Blood clotting is another example of enzymes at work. Enzymes are needed for all body ...

  16. Short communication: Measuring the angiotensin-converting enzyme inhibitory activity of an 8-amino acid (8mer) fragment of the C12 antihypertensive peptide

    Technology Transfer Automated Retrieval System (TEKTRAN)

    An eight amino acid fragment (PFPEVFGK) of a known milk protein-derived antihypertensive peptide was synthesized by microwave-assisted solid phase peptide synthesis and purified by reverse phase HPLC. Its ability to inhibit the angiotensin-converting enzyme was assessed and compared to that of the ...

  17. A tailor-made chimeric thiamine diphosphate dependent enzyme for the direct asymmetric synthesis of (S)-benzoins.

    PubMed

    Westphal, Robert; Vogel, Constantin; Schmitz, Carlo; Pleiss, Jürgen; Müller, Michael; Pohl, Martina; Rother, Dörte

    2014-08-25

    Thiamine diphosphate dependent enzymes are well known for catalyzing the asymmetric synthesis of chiral α-hydroxy ketones from simple prochiral substrates. The steric and chemical properties of the enzyme active site define the product spectrum. Enzymes catalyzing the carboligation of aromatic aldehydes to (S)-benzoins have not so far been identified. We were able to close this gap by constructing a chimeric enzyme, which catalyzes the synthesis of various (S)-benzoins with excellent enantiomeric excess (>99%) and very good conversion.

  18. Synthesis of new kojic acid based unnatural α-amino acid derivatives.

    PubMed

    Balakrishna, C; Payili, Nagaraju; Yennam, Satyanarayana; Devi, P Uma; Behera, Manoranjan

    2015-11-01

    An efficient method for the preparation of kojic acid based α-amino acid derivatives by alkylation of glycinate schiff base with bromokojic acids have been described. Using this method, mono as well as di alkylated kojic acid-amino acid conjugates have been prepared. This is the first synthesis of C-linked kojic acid-amino acid conjugate where kojic acid is directly linked to amino acid through a C-C bond.

  19. Catalysis of the Carbonylation of Alcohols to Carboxylic Acids Including Acetic Acid Synthesis from Methanol.

    ERIC Educational Resources Information Center

    Forster, Denis; DeKleva, Thomas W.

    1986-01-01

    Monsanto's highly successful synthesis of acetic acid from methanol and carbon monoxide illustrates use of new starting materials to replace pretroleum-derived ethylene. Outlines the fundamental aspects of the acetic acid process and suggests ways of extending the synthesis to higher carboxylic acids. (JN)

  20. Amino acids inhibit kynurenic acid formation via suppression of kynurenine uptake or kynurenic acid synthesis in rat brain in vitro.

    PubMed

    Sekine, Airi; Okamoto, Misaki; Kanatani, Yuka; Sano, Mitsue; Shibata, Katsumi; Fukuwatari, Tsutomu

    2015-01-01

    The tryptophan metabolite, kynurenic acid (KYNA), is a preferential antagonist of the α7 nicotinic acetylcholine receptor at endogenous brain concentrations. Recent studies have suggested that increase of brain KYNA levels is involved in psychiatric disorders such as schizophrenia and depression. KYNA-producing enzymes have broad substrate specificity for amino acids, and brain uptake of kynurenine (KYN), the immediate precursor of KYNA, is via large neutral amino acid transporters (LAT). In the present study, to find out amino acids with the potential to suppress KYNA production, we comprehensively investigated the effects of proteinogenic amino acids on KYNA formation and KYN uptake in rat brain in vitro. Cortical slices of rat brain were incubated for 2 h in Krebs-Ringer buffer containing a physiological concentration of KYN with individual amino acids. Ten out of 19 amino acids (specifically, leucine, isoleucine, phenylalanine, methionine, tyrosine, alanine, cysteine, glutamine, glutamate, and aspartate) significantly reduced KYNA formation at 1 mmol/L. These amino acids showed inhibitory effects in a dose-dependent manner, and partially inhibited KYNA production at physiological concentrations. Leucine, isoleucine, methionine, phenylalanine, and tyrosine, all LAT substrates, also reduced tissue KYN concentrations in a dose-dependent manner, with their inhibitory rates for KYN uptake significantly correlated with KYNA formation. These results suggest that five LAT substrates inhibit KYNA formation via blockade of KYN transport, while the other amino acids act via blockade of the KYNA synthesis reaction in brain. Amino acids can be a good tool to modulate brain function by manipulation of KYNA formation in the brain. This approach may be useful in the treatment and prevention of neurological and psychiatric diseases associated with increased KYNA levels.

  1. Application of metagenomic techniques in mining enzymes from microbial communities for biofuel synthesis.

    PubMed

    Xing, Mei-Ning; Zhang, Xue-Zhu; Huang, He

    2012-01-01

    Feedstock for biofuel synthesis is transitioning to lignocelluosic biomass to address criticism over competition between first generation biofuels and food production. As microbial catalysis is increasingly applied for the conversion of biomass to biofuels, increased import has been placed on the development of novel enzymes. With revolutionary advances in sequencer technology and metagenomic sequencing, mining enzymes from microbial communities for biofuel synthesis is becoming more and more practical. The present article highlights the latest research progress on the special characteristics of metagenomic sequencing, which has been a powerful tool for new enzyme discovery and gene functional analysis in the biomass energy field. Critical enzymes recently developed for the pretreatment and conversion of lignocellulosic materials are evaluated with respect to their activity and stability, with additional explorations into xylanase, laccase, amylase, chitinase, and lipolytic biocatalysts for other biomass feedstocks.

  2. Synthesis of Polymeric Microcapsule Arrays and Their Use for Enzyme Immobilization

    DTIC Science & Technology

    1994-04-01

    Polymeric Microcapsule Arrays and Their Use for Enzyme Immobilization by R. Parthasarathy and C. R. Martin Prepared for publication in Nature DTICI...REPORT TYPE AND DATES COVERED April 1994 Interim 4. TITLE AND SUBTITLE S. FUNDING NUMBERS Synthesis of Polymeric Microcapsule Arrays and Their Contract...include adsorption or covalent attachment to a support, microencapsulation and entrapment within a membrane/film or gel. The ideal enzyme

  3. Gibberellic Acid-Induced Synthesis of Protease by Isolated Aleurone Layers of Barley 1

    PubMed Central

    Jacobsen, John V.; Varner, J. E.

    1967-01-01

    The production of protease by isolated aleurone layers of barley in response to gibberellic acid has been examined. The protease arises in the aleurone layer and is mostly released from the aleurone cells. The courses of release of amylase and protease from aleurone layers, the dose responses to gibberellic acid and the effects of inhibitors on the production of both enzymes are parallel. As is the case for amylase, protease is made de novo in response to the hormone. These data give some credence to the hypothesis that the effect of gibberellic acid is to promote the simultaneous synthesis and secretion of a group of hydrolases. PMID:16656695

  4. Recent advances in the synthesis and application of fluorescent α-amino acids.

    PubMed

    Harkiss, Alexander H; Sutherland, Andrew

    2016-09-26

    Fluorescence spectroscopy has become a powerful technique for probing a range of complex biological processes including enzyme mechanisms and protein-protein interactions. While the application of this technique uses a number of strategies, many of these rely on the use of fluorescent α-amino acids. This review highlights the recent synthetic methods developed for the incorporation of highly conjugated chromophores into the side-chain of α-amino acids and the application of these compounds as probes for imaging in medicine and biology. In particular, the design and synthesis of α-amino acids bearing coumarin, flavone and polyaromatic derived chromophores is described.

  5. Oyster mushroom’s lipase enzyme entrapment on calcium alginate as biocatalyst in the synthesis of lauryl diethanolamide

    NASA Astrophysics Data System (ADS)

    Wijayati, N.; Masubah, K.; Supartono

    2017-02-01

    Lipase is an enzyme with large biotechnology applications, such as hydrolysis in the food industry, applications in chemical industry, synthesis of polymers and surfactants. Lipase was isolated from oyster mushroom with activity 0,93 U/mg and protein content 1,1234 mg/mL. Lipase was immobilized by entrapment method in a matrix of Ca-alginate. This report describes that we have developed for the synthesis of lauryl diethanolamide The result showed that the optimum condition of lipase immobilization was achieved on 3% Na-alginate solution with protein content 0,84 mg/mL and the activity 3,33 U/mg. An amide (22.911%) formed from the amidation of lauric acid and diethanolamine.

  6. Gallic acid and gallic acid derivatives: effects on drug metabolizing enzymes.

    PubMed

    Ow, Yin-Yin; Stupans, Ieva

    2003-06-01

    Gallic acid and its structurally related compounds are found widely distributed in fruits and plants. Gallic acid, and its catechin derivatives are also present as one of the main phenolic components of both black and green tea. Esters of gallic acid have a diverse range of industrial uses, as antioxidants in food, in cosmetics and in the pharmaceutical industry. In addition, gallic acid is employed as a source material for inks, paints and colour developers. Studies utilising these compounds have found them to possess many potential therapeutic properties including anti-cancer and antimicrobial properties. In this review, studies of the effects of gallic acid, its esters, and gallic acid catechin derivatives on Phase I and Phase II enzymes are examined. Many published reports of the effects of the in vitro effects of gallic acid and its derivatives on drug metabolising enzymes concern effects directly on substrate (generally drug or mutagen) metabolism or indirectly through observed effects in Ames tests. In the case of the Ames test an antimutagenic effect may be observed through inhibition of CYP activation of indirectly acting mutagens and/or by scavenging of metabolically generated mutagenic electrophiles. There has been considerable interest in the in vivo effects of the gallate esters because of their incorporation into foodstuffs as antioxidants and in the catechin gallates with their potential role as chemoprotective agents. Principally an induction of Phase II enzymes has been observed however more recent studies using HepG2 cells and primary cultures of human hepatocytes provide evidence for the overall complexity of actions of individual components versus complex mixtures, such as those in food. Further systematic studies of mechanisms of induction and inhibition of drug metabolising enzymes by this group of compounds are warranted in the light of their distribution and consequent ingestion, current uses and suggested therapeutic potential. However, it

  7. The inhibitory effect of glycolic acid and lactic acid on melanin synthesis in melanoma cells.

    PubMed

    Usuki, Akiko; Ohashi, Akiko; Sato, Hirofumi; Ochiai, Yasunobu; Ichihashi, Masamitsu; Funasaka, Yoko

    2003-01-01

    Alpha-hydroxy acids (AHAs) such as glycolic acid (GA) and lactic acid (LA) have been reported to be effective in treating pigmentary lesions such as melasma, solar lentigines, and postinflammatory hyperpigmentation. The mechanism of this effect might be due to epidermal remodeling and accelerated desquamation, which would result in quick pigment dispersion. However, the direct effect of AHAs on melanin synthesis has not yet been well studied. To elucidate such a direct effect of AHAs on melanogenesis, we performed melanin assays, growth curve determinations, Northern and Western blotting for melanogenic proteins [tyrosinase, tyrosinase related protein (TRP)-1 and TRP-2], and tyrosinase and, 4-dihydroxyphenylalaninechrome tautomerase enzyme activity assays using mouse B16 and human melanoma cells. GA or LA (at doses of 300 or 500 microg/ml) inhibited melanin formation in similar dose-dependent manner, without affecting cell growth. Although the mRNA and protein expression or molecular size of tyrosinase, TRP-1 and TRP-2 were not affected, tyrosinase activity was inhibited. To see whether GA and/or LA directly inhibit tyrosinase catalytic function, the effect of GA and LA on human tyrosinase purified from the melanosome-rich large granule fraction of human melanoma cells was performed. GA or LA were shown to inhibit tyrosinase enzyme activity directly, but this effect was not due to the acidity of GA or LA, because adjusting the pH to 5.6 (the pH of GA and LA at concentrations of 2500 microg/ml), did not affect tyrosinase activity. Taken together, these results show that GA and LA suppress melanin formation by directly inhibiting tyrosinase activity, an effect independent of their acidic nature. GA and LA might work on pigmentary lesions not only by accelerating the turnover of the epidermis but also by directly inhibiting melanin formation in melanocytes.

  8. [Activity of heme synthesis enzymes in the bone marrow cells of rats with alimentary iron-deficient anemia].

    PubMed

    Inoiatova, F Kh; Oripov, N N

    2004-12-01

    An intensification of aminolevulinic acid (ALA)-synthase on the day of experiment and its tend to its further gradual inhibition noted to be in the bone marrow cells of rats with alimentary iron-deficient anemia (IDA). An activity of porfobilinogen (PB)-synthase was increasing in all the terms of the trial, that of ferrochelatase--on the day 10, and it was inhibited later on. Such changes in an activity of heme synthesis key enzymes result in an accumulation of intermittent products. An increase in MDA level, an inhibition of antioxidant defense enzymes found to be in all the terms of trial, SOD--in all the terms of studies, catalase--in late terms.

  9. Tailored fatty acid synthesis via dynamic control of fatty acid elongation

    SciTech Connect

    Torella, JP; Ford, TJ; Kim, SN; Chen, AM; Way, JC; Silver, PA

    2013-07-09

    Medium-chain fatty acids (MCFAs, 4-12 carbons) are valuable as precursors to industrial chemicals and biofuels, but are not canonical products of microbial fatty acid synthesis. We engineered microbial production of the full range of even-and odd-chain-length MCFAs and found that MCFA production is limited by rapid, irreversible elongation of their acyl-ACP precursors. To address this limitation, we programmed an essential ketoacyl synthase to degrade in response to a chemical inducer, thereby slowing acyl-ACP elongation and redirecting flux from phospholipid synthesis to MCFA production. Our results show that induced protein degradation can be used to dynamically alter metabolic flux, and thereby increase the yield of a desired compound. The strategy reported herein should be widely useful in a range of metabolic engineering applications in which essential enzymes divert flux away from a desired product, as well as in the production of polyketides, bioplastics, and other recursively synthesized hydrocarbons for which chain-length control is desired.

  10. Towards efficient chemical synthesis via engineering enzyme catalysis in biomimetic nanoreactors.

    PubMed

    Liu, Jia; Yang, Qihua; Li, Can

    2015-09-18

    Biocatalysis with immobilized enzymes as catalysts holds enormous promise in developing more efficient and sustainable processes for the synthesis of fine chemicals, chiral pharmaceuticals and biomass feedstocks. Despite the appealing potentials, nowadays the industrial-scale application of biocatalysts is still quite modest in comparison with that of traditional chemical catalysts. A critical issue is that the catalytic performance of enzymes, the sophisticated and vulnerable catalytic machineries, strongly depends on their intracellular working environment; however the working circumstances provided by the support matrix are radically different from those in cells. This often leads to various adverse consequences on enzyme conformation and dynamic properties, consequently decreasing the overall performance of immobilized enzymes with regard to their activity, selectivity and stability. Engineering enzyme catalysis in support nanopores by mimicking the physiological milieu of enzymes in vivo and investigating how the interior microenvironment of nanopores imposes an influence on enzyme behaviors in vitro are of paramount significance to modify and improve the catalytic functions of immobilized enzymes. In this feature article, we have summarized the recent advances in mimicking the working environment and working patterns of intracellular enzymes in nanopores of mesoporous silica-based supports. Especially, we have demonstrated that incorporation of polymers into silica nanopores could be a valuable approach to create the biomimetic microenvironment for enzymes in the immobilized state.

  11. Loss of Nuclear Receptor SHP Impairs but Does Not Eliminate Negative Feedback Regulation of Bile Acid Synthesis

    PubMed Central

    Kerr, Thomas A.; Saeki, Shigeru; Schneider, Manfred; Schaefer, Karen; Berdy, Sara; Redder, Thadd; Shan, Bei; Russell, David W.; Schwarz, Margrit

    2014-01-01

    Summary The in vivo role of the nuclear receptor SHP in feedback regulation of bile acid synthesis was examined. Loss of SHP in mice caused abnormal accumulation and increased synthesis of bile acids due to derepression of rate-limiting CYP7A1 and CYP8B1 hydroxylase enzymes in the biosynthetic pathway. Dietary bile acids induced liver damage and restored feedback regulation. A synthetic agonist of the nuclear receptor FXR was not hepatotoxic and had no regulatory effects. Reduction of the bile acid pool with cholestyramine enhanced CYP7A1 and CYP8B1 expression. We conclude that input from three negative regulatory pathways controls bile acid synthesis. One is mediated by SHP, and two are SHP independent and invoked by liver damage and changes in bile acid pool size. PMID:12062084

  12. Bioengineering of bacterial polymer inclusions catalyzing the synthesis of N-acetylneuraminic acid.

    PubMed

    Hooks, David O; Blatchford, Paul A; Rehm, Bernd H A

    2013-05-01

    N-Acetylneuraminic acid is produced by alkaline epimerization of N-acetylglucosamine to N-acetylmannosamine and then subsequent condensation with pyruvate catalyzed by free N-acetylneuraminic acid aldolase. The high-alkaline conditions of this process result in the degradation of reactants and products, while the purification of free enzymes to be used for the synthesis reaction is a costly process. The use of N-acetylglucosamine 2-epimerase has been seen as an alternative to the alkaline epimerization process. In this study, these two enzymes involved in N-acetylneuraminic acid production were immobilized to biopolyester beads in vivo in a one-step, cost-efficient process of production and isolation. Beads with epimerase-only, aldolase-only, and combined epimerase/aldolase activity were recombinantly produced in Escherichia coli. The enzymatic activities were 32 U, 590 U, and 2.2 U/420 U per gram dry bead weight, respectively. Individual beads could convert 18% and 77% of initial GlcNAc and ManNAc, respectively, at high substrate concentrations and near-neutral pH, demonstrating the application of this biobead technology to fine-chemical synthesis. Beads establishing the entire N-acetylneuraminic acid synthesis pathway were able to convert up to 22% of the initial N-acetylglucosamine after a 50-h reaction time into N-acetylneuraminic acid.

  13. Production of cellulolytic enzymes containing cinnamic acid esterase from Schizophyllum commune.

    PubMed

    Tsujiyama, Sho-ichi; Ueno, Hitomi

    2011-01-01

    To develop enzyme preparations capable of digesting plant biomass, we examined the production of cinnamic acid esterase as well as cellulolytic and xylanolytic enzymes in cultures of Schizophyllum commune. The cinnamic acid esterase was produced in the cultures containing solid cellulosic substrates, with production being enhanced by delignifying the wood powder. This indicates that these esterases are produced by cellulose, despite their substrates being phenolic compounds. Cellulolytic and xylanolytic enzymes, with the exception of α-arabinofuranosidase, were also produced in cultures containing cellulosic substances. These results show that enzyme preparation can have high activity of cinnamic acid esterase and cellulolytic and xylanolytic enzymes when S. commune is incubated in the presence of cellulose. These enzyme preparations will be useful for digesting plant biomass and for releasing cinnamic acid derivatives from plant cell walls.

  14. Mutation of L-2,3-diaminopropionic acid synthase genes blocks staphyloferrin B synthesis in Staphylococcus aureus

    PubMed Central

    2011-01-01

    Background Staphylococcus aureus synthesizes two siderophores, staphyloferrin A and staphyloferrin B, that promote iron-restricted growth. Previous work on the biosynthesis of staphyloferrin B has focused on the role of the synthetase enzymes, encoded from within the sbnA-I operon, which build the siderophore from the precursor molecules citrate, alpha-ketoglutarate and L-2,3-diaminopropionic acid. However, no information yet exists on several other enzymes, expressed from the biosynthetic cluster, that are thought to be involved in the synthesis of the precursors (or synthetase substrates) themselves. Results Using mutants carrying insertions in sbnA and sbnB, we show that these two genes are essential for the synthesis of staphyloferrin B, and that supplementation of the growth medium with L-2,3-diaminopropionic acid can bypass the block in staphyloferrin B synthesis displayed by the mutants. Several mechanisms are proposed for how the enzymes SbnA, with similarity to cysteine synthase enzymes, and SbnB, with similarity to amino acid dehydrogenases and ornithine cyclodeaminases, function together in the synthesis of this unusual nonproteinogenic amino acid L-2,3-diaminopropionic acid. Conclusions Mutation of either sbnA or sbnB result in abrogation of synthesis of staphyloferrin B, a siderophore that contributes to iron-restricted growth of S. aureus. The loss of staphyloferrin B synthesis is due to an inability to synthesize the unusual amino acid L-2,3-diaminopropionic acid which is an important, iron-liganding component of the siderophore structure. It is proposed that SbnA and SbnB function together as an L-Dap synthase in the S. aureus cell. PMID:21906287

  15. Synthesis of magnetic thermosensitive microcontainers for enzyme immobilization

    NASA Astrophysics Data System (ADS)

    Wang, Jianzhi; Zhao, Guanghui; Wang, Xinyu; Peng, Xiaomen; Li, Yanfeng

    2015-05-01

    We present a new approach for the fabrication of magnetic thermoresponsive polymer microcapsules with mobile magnetic spherical cores. The microcontainers form fried-egg-like structures with a polymer shell layer of 50 nm due to the existence of hollow cavities. The microcontainers undergo a temperature-induced volume phase transition upon changing the temperature and present an impressive magnetic response. The magnetic saturation of these smart microcontainers (42 emu/g) is high enough to meet most requirements of bioapplications. To further investigate the potential application of these smart microcontainers in biotechnology, Candida rugosa lipase was selected for the enzyme immobilization process. The immobilized lipase exhibited excellent thermal stability and reusability in comparison with the free enzyme. The adsorption/release of the lipase from the microcontainers can be controlled by the environmental temperature and magnetic force, thus, offering new potential applications such as in controlled drug delivery, bioseparation, and catalysis.

  16. Characterization of a novel N-acetylneuraminic acid lyase favoring N-acetylneuraminic acid synthesis

    PubMed Central

    Ji, Wenyan; Sun, Wujin; Feng, Jinmei; Song, Tianshun; Zhang, Dalu; Ouyang, Pingkai; Gu, Zhen; Xie, Jingjing

    2015-01-01

    N-Acetylneuraminic acid lyase (NAL, E.C. number 4.1.3.3) is a Class I aldolase that catalyzes the reversible aldol cleavage of N-acetylneuraminic acid (Neu5Ac) from pyruvate and N-acetyl-D-mannosamine (ManNAc). Due to the equilibrium favoring Neu5Ac cleavage, the enzyme catalyzes the rate-limiting step of two biocatalytic reactions producing Neu5Ac in industry. We report the biochemical characterization of a novel NAL from a “GRAS” (General recognized as safe) strain C. glutamicum ATCC 13032 (CgNal). Compared to all previously reported NALs, CgNal exhibited the lowest kcat/Km value for Neu5Ac and highest kcat/Km values for ManNAc and pyruvate, which makes CgNal favor Neu5Ac synthesis the most. The recombinant CgNal reached the highest expression level (480 mg/L culture), and the highest reported yield of Neu5Ac was achieved (194 g/L, 0.63 M). All these unique properties make CgNal a promising biocatalyst for industrial Neu5Ac biosynthesis. Additionally, although showing the best Neu5Ac synthesis activity among the NAL family, CgNal is more related to dihydrodipicolinate synthase (DHDPS) by phylogenetic analysis. The activities of CgNal towards both NAL's and DHDPS' substrates are fairly high, which indicates CgNal a bi-functional enzyme. The sequence analysis suggests that CgNal might have adopted a unique set of residues for substrates recognition. PMID:25799411

  17. Hepatic cannabinoid receptor type 1 mediates alcohol-induced regulation of bile acid enzyme genes expression via CREBH.

    PubMed

    Chanda, Dipanjan; Kim, Yong-Hoon; Li, Tiangang; Misra, Jagannath; Kim, Don-Kyu; Kim, Jung Ran; Kwon, Joseph; Jeong, Won-Il; Ahn, Sung-Hoon; Park, Tae-Sik; Koo, Seung-Hoi; Chiang, John Y L; Lee, Chul-Ho; Choi, Hueng-Sik

    2013-01-01

    Bile acids concentration in liver is tightly regulated to prevent cell damage. Previous studies have demonstrated that deregulation of bile acid homeostasis can lead to cholestatic liver disease. Recently, we have shown that ER-bound transcription factor Crebh is a downstream effector of hepatic Cb1r signaling pathway. In this study, we have investigated the effect of alcohol exposure on hepatic bile acid homeostasis and elucidated the mediatory roles of Cb1r and Crebh in this process. We found that alcohol exposure or Cb1r-agonist 2-AG treatment increases hepatic bile acid synthesis and serum ALT, AST levels in vivo alongwith significant increase in Crebh gene expression and activation. Alcohol exposure activated Cb1r, Crebh, and perturbed bile acid homeostasis. Overexpression of Crebh increased the expression of key bile acid synthesis enzyme genes via direct binding of Crebh to their promoters, whereas Cb1r knockout and Crebh-knockdown mice were protected against alcohol-induced perturbation of bile acid homeostasis. Interestingly, insulin treatment protected against Cb1r-mediated Crebh-induced disruption of bile acid homeostasis. Furthermore, Crebh expression and activation was found to be markedly increased in insulin resistance conditions and Crebh knockdown in diabetic mice model (db/db) significantly reversed alcohol-induced disruption of bile acid homeostasis. Overall, our study demonstrates a novel regulatory mechanism of hepatic bile acid metabolism by alcohol via Cb1r-mediated activation of Crebh, and suggests that targeting Crebh can be of therapeutic potential in ameliorating alcohol-induced perturbation of bile acid homeostasis.

  18. Motualevic Acids and Analogs: Synthesis and Antimicrobial Structure Activity Relationships

    PubMed Central

    Cheruku, Pradeep; Keffer, Jessica L.; Dogo-Isonagie, Cajetan; Bewley, Carole A.

    2010-01-01

    Synthesis of the marine natural products motualevic acids A, E, and analogs in which modifications have been made to the ω-brominated lipid (E)-14,14-dibromotetra-deca-2,13-dienoic acid or amino acid unit are reported, together with antimicrobial activities against Staphylococcus aureus, methicillin-resistant S. aureus, Enterococcus faecium, and vancomycin-resistant Enterococcus. PMID:20538459

  19. Propyl gallate synthesis using acidophilic tannase and simultaneous production of tannase and gallic acid by marine Aspergillus awamori BTMFW032.

    PubMed

    Beena, P S; Basheer, Soorej M; Bhat, Sarita G; Bahkali, Ali H; Chandrasekaran, M

    2011-07-01

    Marine Aspergillus awamori BTMFW032, recently reported by us, produce acidophilic tannase as extracellular enzyme. Here, we report the application of this enzyme for synthesis of propyl gallate by direct transesterification of tannic acid and in tea cream solubilisation besides the simultaneous production of gallic acid along with tannase under submerged fermentation by this fungus. This acidophilic tannase enabled synthesis of propyl gallate by direct transesterification of tannic acid using propanol as organic reaction media under low water conditions. The identity of the product was confirmed with thin layer chromatography and Fourier transform infrared spectroscopy. It was noted that 699 U/ml of enzyme could give 60% solubilisation of tea cream within 1 h. Enzyme production medium was optimized adopting Box-Behnken design for simultaneous synthesis of tannase and gallic acid. Process variables including tannic acid, sodium chloride, ferrous sulphate, dipotassium hydrogen phosphate, incubation period and agitation were recognized as the critical factors that influenced tannase and gallic acid production. The model obtained predicted 4,824.61 U/ml of tannase and 136.206 μg/ml gallic acid after 48 h of incubation, whereas optimized medium supported 5,085 U/ml tannase and 372.6 μg/ml of gallic acid production after 36 and 84 h of incubation, respectively, with a 15-fold increase in both enzyme and gallic acid production. Results indicated scope for utilization of this acidophilic tannase for transesterification of tannic acid into propyl gallate, tea cream solubilisation and simultaneous production of gallic acid along with tannase.

  20. Nucleic acid tool enzymes-aided signal amplification strategy for biochemical analysis: status and challenges.

    PubMed

    Qing, Taiping; He, Dinggeng; He, Xiaoxiao; Wang, Kemin; Xu, Fengzhou; Wen, Li; Shangguan, Jingfang; Mao, Zhengui; Lei, Yanli

    2016-04-01

    Owing to their highly efficient catalytic effects and substrate specificity, the nucleic acid tool enzymes are applied as 'nano-tools' for manipulating different nucleic acid substrates both in the test-tube and in living organisms. In addition to the function as molecular scissors and molecular glue in genetic engineering, the application of nucleic acid tool enzymes in biochemical analysis has also been extensively developed in the past few decades. Used as amplifying labels for biorecognition events, the nucleic acid tool enzymes are mainly applied in nucleic acids amplification sensing, as well as the amplification sensing of biorelated variations of nucleic acids. With the introduction of aptamers, which can bind different target molecules, the nucleic acid tool enzymes-aided signal amplification strategies can also be used to sense non-nucleic targets (e.g., ions, small molecules, proteins, and cells). This review describes and discusses the amplification strategies of nucleic acid tool enzymes-aided biosensors for biochemical analysis applications. Various analytes, including nucleic acids, ions, small molecules, proteins, and cells, are reviewed briefly. This work also addresses the future trends and outlooks for signal amplification in nucleic acid tool enzymes-aided biosensors.

  1. Thermodynamic parameters monitoring the equilibrium shift of enzyme-catalyzed hydrolysis/synthesis reactions in favor of synthesis in mixtures of water and organic solvent.

    PubMed

    Deschrevel, Brigitte; Vincent, Jean-Claude; Ripoll, Camille; Thellier, Michel

    2003-01-20

    The main strategy developed to shift the equilibrium state of a hydrolase-catalyzed hydrolysis/synthesis reaction consists in reducing water activity by addition of organic solvents in the reaction medium. We have used several mixtures of water and 1,4-butanediol, ranging from pure water to pure 1,4-butanediol, to study the hydrolysis/synthesis reaction of the N-Cbz-L-tryptophanyl-glycineamide dipeptide, catalyzed by alpha-chymotrypsin. In the presence of 1,4-butanediol, alpha-chymotrypsin also catalyzed the esterification reaction between this diol and N-Cbz-L-tryptophan; this ester hydrolysis/synthesis reaction has thus also been examined. The dipeptide and ester equilibrium concentrations increase when the water content of the reaction medium is decreased. Using our experimental data, we have determined the equilibrium constants of the hydrolysis/synthesis equilibria involving the nonionized forms of the protected amino acids, the estimated values of which are Ksp = 8 10(5) for the dipeptide and Kse = 78 for the ester respectively. They are true thermodynamic equilibrium constants, each related to a single, well-defined reaction equilibrium and with water activity being taken into account. If an organic solvent is added to the reaction medium these equilibria can be shifted towards synthesis by decreasing the water activity but also by modifying the ionization/neutralization equilibrium constant of the ionizable groups. These two effects depend both on the water content and on the nature of the organic solvent used, and, in particular, on its dielectric constant. Because of the importance of this parameter in our study, we discuss using it as an indicator to select an appropriate organic solvent to perform an enzyme-catalyzed synthesis.

  2. Bioactive enzyme-metal composites: the entrapment of acid phosphatase within gold and silver.

    PubMed

    Ben-Knaz, Racheli; Avnir, David

    2009-03-01

    This paper is concerned with the entrapment of an enzyme within an aggregated metallic matrix and the development of a bioactive enzyme-metal composite. Whereas the use of organic polymers and metal oxides for the preparation of enzymatically active materials is well developed, the third principle enzyme-material combination, namely protein-metal bulk, has not yet been reported. A new methodology for the entrapment of organic molecules and polymers within metals has been employed for the preparation of bioactive acid phosphatase@gold and acid phosphatase@silver, according to which room temperature reduction of the metal cation is carried out in the presence of the enzyme to be entrapped. Protectability of the entrapped enzyme against harsh conditions is shown: the acidic enzyme is kept alive under basic conditions.

  3. Derivatives of diphosphonic acids: synthesis and biological activity

    NASA Astrophysics Data System (ADS)

    Zolotukhina, M. M.; Krutikov, V. I.; Lavrent'ev, A. N.

    1993-07-01

    The scientific-technical and patent literature on the synthesis of derivatives of diphosphonic acids is surveyed. Various methods of synthesis of diphosphonate, phosphonylphosphinyl, and phosphonophosphate compounds are described. The principal aspects of the use of the above compounds in medicine, biochemistry, and agriculture are examined. The bibliography includes 174 references.

  4. The Unusual Acid-Accumulating Behavior during Ripening of Cherimoya (Annona cherimola Mill.) is Linked to Changes in Transcription and Enzyme Activity Related to Citric and Malic Acid Metabolism.

    PubMed

    González-Agüero, Mauricio; Tejerina Pardo, Luis; Zamudio, María Sofía; Contreras, Carolina; Undurraga, Pedro; Defilippi, Bruno G

    2016-04-25

    Cherimoya (Annona cherimola Mill.) is a subtropical fruit characterized by a significant increase in organic acid levels during ripening, making it an interesting model for studying the relationship between acidity and fruit flavor. In this work, we focused on understanding the balance between the concentration of organic acids and the gene expression and activity of enzymes involved in the synthesis and degradation of these metabolites during the development and ripening of cherimoya cv. "Concha Lisa". Our results showed an early accumulation of citric acid and other changes associated with the accumulation of transcripts encoding citrate catabolism enzymes. During ripening, a 2-fold increase in malic acid and a 6-fold increase in citric acid were detected. By comparing the contents of these compounds with gene expression and enzymatic activity levels, we determined that cytoplasmic NAD-dependent malate dehydrogenase (cyNAD-MDH) and mitochondrial citrate synthase (mCS) play important regulatory roles in the malic and citric acid biosynthetic pathways.

  5. SYNTHESIS OF RIBONUCLEIC ACID BY X-IRRADIATED BACTERIA1

    PubMed Central

    Frampton, E. W.

    1964-01-01

    Frampton, E. W. (The University of Texas M. D. Anderson Hospital and Tumor Institute, Houston). Synthesis of ribonucleic acid by X-irradiated bacteria. J. Bacteriol. 87:1369–1376. 1964.—Postirradiation synthesis of total ribonucleic acid (RNA) and of RNA components was measured after exposure of Escherichia coli B/r to X rays. Net synthesis of RNA measured by the orcinol reaction and by the incorporation of uridine-2-C14 was depressed in irradiated cells, but paralleled the period of postirradiation growth (30 to 40 min). Incorporation of uridine-2-C14, added after net synthesis of RNA had ceased, detected an apparent turnover in a portion of the RNA. Irradiated cells retained their ability to adjust RNA synthesis to growth rate. After a shift-down in growth rate, irradiated cells incorporated radioactive uridine, while the net synthesis of RNA ceased—presumptive evidence for a continued synthesis of messenger RNA. Chloramphenicol addition (100 μg/ml) did not influence the total amount of RNA synthesized. Synthesis of ribosomes and transfer RNA preceded by 0, 5, 10, and 15 min of postirradiation incubation was observed by the resolution of cell-free extracts on sucrose density gradients. Little immediate influence of irradiation could be detected on the synthesis of 50S and 30S ribosomes. A decline was observed in the synthesis of 50S ribosomes with continued postirradiation incubation; 30S ribosomes, ribosomal precursors, and 4S RNA continued to be synthesized. PMID:14188715

  6. Non-enzymic beta-decarboxylation of aspartic acid.

    NASA Technical Reports Server (NTRS)

    Doctor, V. M.; Oro, J.

    1972-01-01

    Study of the mechanism of nonenzymic beta-decarboxylation of aspartic acid in the presence of metal ions and pyridoxal. The results suggest that aspartic acid is first converted to oxalacetic acid by transamination with pyridoxal which in turn is converted to pyridoxamine. This is followed by decarboxylation of oxalacetic acid to form pyruvic acid which transaminates with pyridoxamine to form alanine. The possible significance of these results to prebiotic molecular evolution is briefly discussed.

  7. Direct Catalytic Asymmetric Synthesis of β-Hydroxy Acids from Malonic Acid.

    PubMed

    Gao, Hang; Luo, Zhenli; Ge, Pingjin; He, Junqian; Zhou, Feng; Zheng, Peipei; Jiang, Jun

    2015-12-18

    A nickel(II) catalyzed asymmetric synthesis of β-hydroxy acids from malonic acid and ketones was developed, revealing for the first time the synthetic utility of malonic acid in the construction of chiral carboxyl acids; importantly, the synthetic potential of this strategy was further demonstrated by the rapid construction of cephalanthrin A, phaitanthrin B, cruciferane, and rice metabolites.

  8. Amino Acid Synthesis in Seafloor Environments on Icy Worlds

    NASA Astrophysics Data System (ADS)

    Flores, Erika; Barge, Laura; VanderVelde, David; Kallas, Kayo; Baum, Marc M.; Russell, Michael J.; Kanik, Isik

    2016-10-01

    In 2005, the Cassini mission detected plumes erupting from Enceladus' surface, containing carbon dioxide, methane, silica, and possibly ammonia. Subsequent laboratory experiments indicated that the silica particles in the plumes were generated under alkaline conditions and at moderate temperatures of ~90°C (Hsu et al., 2015); one scenario for such conditions would be the existence of alkaline (serpentinization-driven) hydrothermal activity within Enceladus. Alkaline vents are significant since they have been proposed as a likely environment for the emergence of metabolism on the early Earth (Russell et al. 2014) and thus could also provide a mechanism for origin of life on ocean worlds with a water-rock interface. Alkaline vents in an acidic, iron-containing ocean could produce mineral precipitates that could act as primitive enzymes or catalysts mediating organic reactions; for example, metal sulfides can catalyze the reductive amination of pyruvate to alanine (Novikov and Copley 2013). We have conducted experiments testing the synthesis of amino acids catalyzed by other iron minerals that might be expected to precipitate on the seafloor of early Earth or Enceladus. Preliminary results indicate that amino acids as well as other organic products can be synthesized in 1-3 days under alkaline hydrothermal conditions. We also find that the yield and type of organic products is highly dependent on pH and temperature, implying that understanding the specifics of the geochemical hydrothermal gradients on Enceladus (or other ocean worlds) will be significant in determining their potential for synthesizing building blocks for life.Hsu, H.-W. et al. (2015), Nature 519, 207-210.Russell, M. J. et al. (2014), Astrobiology, 14, 308-43.Novikov Y. and Copley S. D. (2013) PNAS 110, 33, 13283-13288.

  9. Effect of glucagon on digestive enzyme synthesis, transport and secretion in mouse pancreatic acinar cells.

    PubMed Central

    Singh, M

    1980-01-01

    ). 7. It is concluded that glucagon increased digestive enzyme secretion from pancreatic acinar cells by a direct action (in contrast to its reported indirect effect in vivo) and decreased digestive enzyme synthesis. The data on transport and secretion do not support the suggested role of glucagon as an inhibitor in the intact animal. PMID:6162027

  10. A photocatalyst-enzyme coupled artificial photosynthesis system for solar energy in production of formic acid from CO2.

    PubMed

    Yadav, Rajesh K; Baeg, Jin-Ook; Oh, Gyu Hwan; Park, No-Joong; Kong, Ki-jeong; Kim, Jinheung; Hwang, Dong Won; Biswas, Soumya K

    2012-07-18

    The photocatalyst-enzyme coupled system for artificial photosynthesis process is one of the most promising methods of solar energy conversion for the synthesis of organic chemicals or fuel. Here we report the synthesis of a novel graphene-based visible light active photocatalyst which covalently bonded the chromophore, such as multianthraquinone substituted porphyrin with the chemically converted graphene as a photocatalyst of the artificial photosynthesis system for an efficient photosynthetic production of formic acid from CO(2). The results not only show a benchmark example of the graphene-based material used as a photocatalyst in general artificial photosynthesis but also the benchmark example of the selective production system of solar chemicals/solar fuel directly from CO(2).

  11. Synthesis of mixed-chain phosphatidylcholines including coumarin fluorophores for FRET-based kinetic studies of phospholipase A(2) enzymes.

    PubMed

    Wang, Manlin; Pinnamaraju, Susmitha; Ranganathan, Radha; Hajdu, Joseph

    2013-01-01

    Phospholipase A2 (PLA2) enzymes catalyze the hydrolysis of the sn-2 ester linkage of glycerophospholipids to produce fatty acids and lysophospholipids. A significant number of mammalian phospholipases comprise a family of secreted PLA2 enzymes, found in specific tissues and cellular locations, exhibiting unique enzymatic properties and distinct biological functions. Development of new real-time spectrofluorimetric PLA2 assays should facilitate the kinetic characterization and mechanistic elucidation of the isozymes in vitro, with the potential applicability to detect and measure catalytic PLA2 activity in tissues and cellular locations. Here we report a new synthesis of double-labeled phosphatidylcholine analogs with chain-terminal reporter groups including coumarin fluorophores for fluorescence resonance energy transfer (FRET)-based kinetic studies of PLA2 enzymes. The use of coumarin derivatives as fluorescent labels provides reporter groups with substantially decreased size compared to the first generation of donor-acceptor pairs of fluorescent phospholipids. The key advantage of the design is to interfere less with the physicochemical properties of the acyl chains, thereby improving the substrate quality of the synthetic probes. In order to assess the impact of the fluorophore substituents on the catalytic hydrolysis and on the phospholipid packing in the lipid-water interface of the assay, we used the experimentally determined specific activity of bee-venom phospholipase A2 as a model for the secretory PLA2 enzymes. Specifically, the rate of PLA2 hydrolysis of the coumarin labeled phosphatidylcholine analogs was less than three times slower than the natural substrate dipalmitoyl phosphatidylcholine (DPPC) under the same experimental conditions. Furthermore, variation of the mole fraction of the synthetic phosphatidylcholine vs. that of the natural DPPC substrate showed nearly ideal mixing behavior in the phospholipid-surfactant aggregates of the assay. The

  12. Inadequacy of prebiotic synthesis as origin of proteinous amino acids.

    PubMed

    Wong, J T; Bronskill, P M

    1979-07-18

    The production of some nonproteinous, and lack of production of other proteinous, amino acids in model prebiotic synthesis, along with the instability of glutamine and asparagine, suggest that not all of the 20 present day proteinous amino acids gained entry into proteins directly from the primordial soup. Instead, a process of active co-evolution of the genetic code and its constituent amino acids would have to precede the final selection of these proteinous amono acids.

  13. The shikimate pathway: review of amino acid sequence, function and three-dimensional structures of the enzymes.

    PubMed

    Mir, Rafia; Jallu, Shais; Singh, T P

    2015-06-01

    The aromatic compounds such as aromatic amino acids, vitamin K and ubiquinone are important prerequisites for the metabolism of an organism. All organisms can synthesize these aromatic metabolites through shikimate pathway, except for mammals which are dependent on their diet for these compounds. The pathway converts phosphoenolpyruvate and erythrose 4-phosphate to chorismate through seven enzymatically catalyzed steps and chorismate serves as a precursor for the synthesis of variety of aromatic compounds. These enzymes have shown to play a vital role for the viability of microorganisms and thus are suggested to present attractive molecular targets for the design of novel antimicrobial drugs. This review focuses on the seven enzymes of the shikimate pathway, highlighting their primary sequences, functions and three-dimensional structures. The understanding of their active site amino acid maps, functions and three-dimensional structures will provide a framework on which the rational design of antimicrobial drugs would be based. Comparing the full length amino acid sequences and the X-ray crystal structures of these enzymes from bacteria, fungi and plant sources would contribute in designing a specific drug and/or in developing broad-spectrum compounds with efficacy against a variety of pathogens.

  14. Prebiotic Amino Acid Thioester Synthesis: Thiol-Dependent Amino Acid Synthesis from Formose substrates (Formaldehyde and Glycolaldehyde) and Ammonia

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1998-01-01

    Formaldehyde and glycolaldehyde (substrates of the formose autocatalytic cycle) were shown to react with ammonia yielding alanine and homoserine under mild aqueous conditions in the presence of thiol catalysts. Since similar reactions carried out without ammonia yielded alpha-hydroxy acid thioesters, the thiol-dependent synthesis of alanine and homoserine is presumed to occur via amino acid thioesters-intermediates capable of forming peptides. A pH 5.2 solution of 20 mM formaldehyde, 20 mM glycolaldehyde, 20 mM ammonium chloride, 23 mM 3-mercaptopropionic acid, and 23 mM acetic acid that reacted for 35 days at 40 C yielded (based on initial formaldehyde) 1.8% alanine and 0.08% homoserine. In the absence of thiol catalyst, the synthesis of alanine and homoserine was negligible. Alanine synthesis required both formaldehyde and glycolaldehyde, but homoserine synthesis required only glycolaldehyde. At 25 days the efficiency of alanine synthesis calculated from the ratio of alanine synthesized to formaldehyde reacted was 2.1%, and the yield (based on initial formaldehyde) of triose and tetrose intermediates involved in alanine and homoserine synthesis was 0.3 and 2.1%, respectively. Alanine synthesis was also seen in similar reactions containing only 10 mM each of aldehyde substrates, ammonia, and thiol. The prebiotic significance of these reactions that use the formose reaction to generate sugar intermediates that are converted to reactive amino acid thioesters is discussed.

  15. Inhibition of fatty acid and cholesterol synthesis by stimulation of AMP-activated protein kinase.

    PubMed

    Henin, N; Vincent, M F; Gruber, H E; Van den Berghe, G

    1995-04-01

    AMP-activated protein kinase is a multisubstrate protein kinase that, in liver, inactivates both acetyl-CoA carboxylase, the rate-limiting enzyme of fatty acid synthesis, and 3-hydroxy-3-methyl-glutaryl-CoA reductase, the rate-limiting enzyme of cholesterol synthesis. AICAR (5-amino 4-imidazolecarboxamide ribotide, ZMP) was found to stimulate up to 10-fold rat liver AMP-activated protein kinase, with a half-maximal effect at approximately 5 mM. In accordance with previous observations, addition to suspensions of isolated rat hepatocytes of 50-500 microM AICAriboside, the nucleoside corresponding to ZMP, resulted in the accumulation of millimolar concentrations of the latter. This was accompanied by a dose-dependent inactivation of both acetyl-CoA carboxylase and 3-hydroxy-3-methylglutaryl-CoA reductase. Addition of 50-500 microM AICAriboside to hepatocyte suspensions incubated in the presence of various substrates, including glucose and lactate/pyruvate, caused a parallel inhibition of both fatty acid and cholesterol synthesis. With lactate/pyruvate (10/1 mM), half-maximal inhibition was obtained at approximately 100 microM, and near-complete inhibition at 500 microM AICAriboside. These findings open new perspectives for the simultaneous control of triglyceride and cholesterol synthesis by pharmacological stimulators of AMP-activated protein kinase.

  16. Engineering methylaspartate ammonia lyase for the asymmetric synthesis of unnatural amino acids

    NASA Astrophysics Data System (ADS)

    Raj, Hans; Szymański, Wiktor; de Villiers, Jandré; Rozeboom, Henriëtte J.; Veetil, Vinod Puthan; Reis, Carlos R.; de Villiers, Marianne; Dekker, Frank J.; de Wildeman, Stefaan; Quax, Wim J.; Thunnissen, Andy-Mark W. H.; Feringa, Ben L.; Janssen, Dick B.; Poelarends, Gerrit J.

    2012-06-01

    The redesign of enzymes to produce catalysts for a predefined transformation remains a major challenge in protein engineering. Here, we describe the structure-based engineering of methylaspartate ammonia lyase (which in nature catalyses the conversion of 3-methylaspartate to ammonia and 2-methylfumarate) to accept a variety of substituted amines and fumarates and catalyse the asymmetric synthesis of aspartic acid derivatives. We obtained two single-active-site mutants, one exhibiting a wide nucleophile scope including structurally diverse linear and cyclic alkylamines and one with broad electrophile scope including fumarate derivatives with alkyl, aryl, alkoxy, aryloxy, alkylthio and arylthio substituents at the C2 position. Both mutants have an enlarged active site that accommodates the new substrates while retaining the high stereo- and regioselectivity of the wild-type enzyme. As an example, we demonstrate a highly enantio- and diastereoselective synthesis of threo-3-benzyloxyaspartate (an important inhibitor of neuronal excitatory glutamate transporters in the brain).

  17. Unsaturated Fatty Acid Synthesis in the Gastric Pathogen Helicobacter pylori Proceeds via a Backtracking Mechanism.

    PubMed

    Bi, Hongkai; Zhu, Lei; Jia, Jia; Zeng, Liping; Cronan, John E

    2016-12-22

    Helicobacter pylori is a Gram-negative bacterium that inhabits the upper gastrointestinal tract in humans, and the presence of this pathogen in the gut microbiome increases the risk of peptic ulcers and stomach cancer. H. pylori depends on unsaturated fatty acid (UFA) biosynthesis for maintaining membrane structure and function. Although some of the H. pylori enzymes involved in UFA biosynthesis are functionally homologous with the enzymes found in Escherichia coli, we show here that an enzyme HP0773, now annotated as FabX, uses an unprecedented backtracking mechanism to not only dehydrogenate decanoyl-acyl carrier protein (ACP) in a reaction that parallels that of acyl-CoA dehydrogenase, the first enzyme of the fatty acid β-oxidation cycle, but also isomerizes trans-2-decenoyl-ACP to cis-3-decenoyl-ACP, the key UFA synthetic intermediate. Thus, FabX reverses the normal fatty acid synthesis cycle in H. pylori at the C10 stage. Overall, this unusual FabX activity may offer a broader explanation for how many bacteria that lack the canonical pathway enzymes produce UFA-containing phospholipids.

  18. Asparaginase II of Saccharomyces cerevisiae: selection of four mutations that cause derepressed enzyme synthesis.

    PubMed

    Kamerud, J Q; Roon, R J

    1986-01-01

    A positive selection method was used to isolate four Saccharomyces cerevisiae mutations that cause derepressed synthesis of asparaginase II. The four mutations (and1, and2, and3, and4) were neither closely linked to each other nor linked to previously characterized mutations (asp3, asp6) which cause the complete loss of asparaginase II activity. One of the new mutations (and4) was shown to be allelic to gdh-CR, a pleiotropic mutation which causes derepressed synthesis of a number of enzymes of nitrogen catabolism.

  19. Cloning-independent expression and screening of enzymes using cell-free protein synthesis systems.

    PubMed

    Kwon, Yong-Chan; Song, Jae-Kwang; Kim, Dong-Myung

    2014-01-01

    We present a strategy for expression and screening of microbial enzymes without involving cloning procedures. Libraries of putative ω-transaminases (ω-TA) and mutated Candida antarctica lipase B (CalB) are PCR-amplified from bacterial colonies and directly expressed in an Escherichia coli-based cell-free protein synthesis system. The open nature of cell-free protein synthesis system also allows streamlined analysis of the enzymatic activity of the expressed enzymes, which greatly shortens the time required for enzyme screening. We expect that the proposed strategy will provide a universal platform for bridging the information gap between nucleotide sequence and protein function, in order to accelerate the discovery of novel enzymes. The proposed strategy can also serve as a viable option for the rapid and precise tuning of enzyme molecules, not only for analytical purposes, but also for industrial applications. This is accomplished via large-scale production using microbial cells transformed with variant genes selected from the cell-free expression screening.

  20. Selective synthesis and labeling of the polysialic acid capsule in Escherichia coli K1 strains with mutations in nanA and neuB.

    PubMed Central

    Vimr, E R

    1992-01-01

    The enzymes required for polysialic acid capsule synthesis in Escherichia coli K1 are encoded by region 2 neu genes of the multigenic kps cluster. To facilitate analysis of capsule synthesis and translocation, an E. coli K1 strain with mutations in nanA and neuB, affecting sialic acid degradation and synthesis, respectively, was constructed by transduction. The acapsular phenotype of the mutant was corrected in vivo by exogenous addition of sialic acid. By blocking sialic acid degradation, the nanA mutation allows intracellular metabolite accumulation, while the neuB mutation prevents dilution by the endogenous sialic acid pool and allows capsule synthesis to be controlled experimentally by the exogenous addition of sialic acid to the growth medium. Complementation was detected by bacteriophage K1F adsorption or infectivity assays. Polysialic acid translocation was observed within 2 min after addition of sialic acid to the growth medium, demonstrating the rapidity in vivo of sialic acid transport, activation, and polymerization and translocation of polysaccharide to the cell surface. Phage adsorption was not inhibited by chloramphenicol, demonstrating that de novo protein synthesis was not required for polysialic acid synthesis or translocation at 37 degrees C. Exogenous radiolabeled sialic acid was incorporated exclusively into capsular polysaccharide. The polymeric nature of the labeled capsular material was confirmed by gel permeation chromatography and susceptibility of sialyl polymers to K1F endo-N-acylneuraminidase. The ability to experimentally manipulate capsule expression provides new approaches for investigating polysialic acid synthesis and membrane translocation mechanisms. PMID:1400168

  1. Evolution of Abscisic Acid Synthesis and Signaling Mechanisms

    PubMed Central

    Hauser, Felix; Waadt, Rainer; Schroeder, Julian I.

    2011-01-01

    The plant hormone abscisic acid (ABA) mediates seed dormancy, controls seedling development and triggers tolerance to abiotic stresses, including drought. Core ABA signaling components consist of a recently identified group of ABA receptor proteins of the PYRABACTIN RESISTANCE (PYR)/REGULATORY COMPONENT OF ABA RECEPTOR (RCAR) family that act as negative regulators of members of the PROTEIN PHOSPHATASE 2C (PP2C) family. Inhibition of PP2C activity enables activation of SNF1-RELATED KINASE 2 (SnRK2) protein kinases, which target downstream components, including transcription factors, ion channels and NADPH oxidases. These and other components form a complex ABA signaling network. Here, an in depth analysis of the evolution of components in this ABA signaling network shows that (i) PYR/RCAR ABA receptor and ABF-type transcription factor families arose during land colonization of plants and are not found in algae and other species, (ii) ABA biosynthesis enzymes have evolved to plant- and fungal-specific forms, leading to different ABA synthesis pathways, (iii) existing stress signaling components, including PP2C phosphatases and SnRK kinases, were adapted for novel roles in this plant-specific network to respond to water limitation. In addition, evolutionarily conserved secondary structures in the PYR/RCAR ABA receptor family are visualized. PMID:21549957

  2. Evolution of abscisic acid synthesis and signaling mechanisms.

    PubMed

    Hauser, Felix; Waadt, Rainer; Schroeder, Julian I

    2011-05-10

    The plant hormone abscisic acid (ABA) mediates seed dormancy, controls seedling development and triggers tolerance to abiotic stresses, including drought. Core ABA signaling components consist of a recently identified group of ABA receptor proteins of the PYRABACTIN RESISTANCE (PYR)/REGULATORY COMPONENT OF ABA RECEPTOR (RCAR) family that act as negative regulators of members of the PROTEIN PHOSPHATASE 2C (PP2C) family. Inhibition of PP2C activity enables activation of SNF1-RELATED KINASE 2 (SnRK2) protein kinases, which target downstream components, including transcription factors, ion channels and NADPH oxidases. These and other components form a complex ABA signaling network. Here, an in depth analysis of the evolution of components in this ABA signaling network shows that (i) PYR/RCAR ABA receptor and ABF-type transcription factor families arose during land colonization of plants and are not found in algae and other species, (ii) ABA biosynthesis enzymes have evolved to plant- and fungal-specific forms, leading to different ABA synthesis pathways, (iii) existing stress signaling components, including PP2C phosphatases and SnRK kinases, were adapted for novel roles in this plant-specific network to respond to water limitation. In addition, evolutionarily conserved secondary structures in the PYR/RCAR ABA receptor family are visualized.

  3. Modification of bactericidal fatty acids by an enzyme of Staphylococcus aureus.

    PubMed

    Mortensen, J E; Shryock, T R; Kapral, F A

    1992-04-01

    Certain strains of Staphylococcus aureus produce an enzyme capable of inactivating the bactericidal fatty acids produced in staphylococcal abscesses by esterification to various alcohols. The enzyme, called FAME (fatty acid modifying enzyme), has a pH optimum between 5.5 and 6.0 and a temperature optimum of about 40 degrees C. Enzyme activity is not affected by edetic acid or by the presence or absence of sodium and potassium ions. Although FAME can utilise methanol, ethanol, 1-propanol, 2-propanol, 1-butanol or cholesterol as substrates, cholesterol appears to be the preferred substrate. FAME esterifies without being an esterase operating in reverse. Strains capable of producing the enzyme can synthesise it in trypticase soy broth and in a chemically defined medium, but not necessarily in equal amounts. FAME production is correlated with the ability of a strain to grow and survive within the tissues.

  4. New hydroxamate inhibitors of neurotensin-degrading enzymes. Synthesis and enzyme active-site recognition.

    PubMed

    Bourdel, E; Doulut, S; Jarretou, G; Labbe-Jullie, C; Fehrentz, J A; Doumbia, O; Kitabgi, P; Martinez, J

    1996-08-01

    Selective and mixed inhibitors of the three zinc metallopeptidases that degrade neurotensin (NT), e.g. endopeptidase 24-16 (EC 3.4.24.16), endopeptidase 24-11 (EC 3.4.24.11 or neutral endopeptidase, NEP) and endopeptidase 24-15 (EC 3.4.24.15), and leucine-aminopeptidase (type IV-S), that degrades the NT-related peptides, Neuromedin N (NN), are of great interest. On the structural basis of compound JMV 390-1 (N-[3-[(hydroxyamino)carbonyl]-1-oxo-2(R)-benzylpropyl]-L- isoleucyl-L-leucine), which was a full inhibitor of the major NT degrading enzymes, several hydroxamate inhibitors corresponding to the general formula HONHCO-CH2-CH(CH2-C6H5)CO-X-Y-OH (with X-Y = dipeptide) have been synthesized. Compound 7a (X-Y = Ile-Ala) was nearly 40-times more potent in inhibiting EC 24-16 than NEP and more than 800-times more potent than EC 24-15, with an IC50 (12 nM) almost equivalent to that of compound JMV 390-1. Therefore, this compound is an interesting selective inhibitor of EC 24-16, and should be an interesting probe to explore the physiological involvement of EC 24-16 in the metabolism of neurotensin.

  5. Opaque7 Encodes an Acyl-Activating Enzyme-Like Protein That Affects Storage Protein Synthesis in Maize Endosperm

    PubMed Central

    Wang, Gang; Sun, Xiaoliang; Wang, Guifeng; Wang, Fei; Gao, Qiang; Sun, Xin; Tang, Yuanping; Chang, Chong; Lai, Jinsheng; Zhu, Lihuang; Xu, Zhengkai; Song, Rentao

    2011-01-01

    In maize, a series of seed mutants with starchy endosperm could increase the lysine content by decreased amount of zeins, the main storage proteins in endosperm. Cloning and characterization of these mutants could reveal regulatory mechanisms for zeins accumulation in maize endosperm. Opaque7 (o7) is a classic maize starchy endosperm mutant with large effects on zeins accumulation and high lysine content. In this study, the O7 gene was cloned by map-based cloning and confirmed by transgenic functional complementation and RNAi. The o7-ref allele has a 12-bp in-frame deletion. The four-amino-acid deletion caused low accumulation of o7 protein in vivo. The O7 gene encodes an acyl-activating enzyme with high similarity to AAE3. The opaque phenotype of the o7 mutant was produced by the reduction of protein body size and number caused by a decrease in the α-zeins concentrations. Analysis of amino acids and metabolites suggested that the O7 gene might affect amino acid biosynthesis by affecting α-ketoglutaric acid and oxaloacetic acid. Transgenic rice seeds containing RNAi constructs targeting the rice ortholog of maize O7 also produced lower amounts of seed proteins and displayed an opaque endosperm phenotype, indicating a conserved biological function of O7 in cereal crops. The cloning of O7 revealed a novel regulatory mechanism for storage protein synthesis and highlighted an effective target for the genetic manipulation of storage protein contents in cereal seeds. PMID:21954158

  6. Lysophosphatidic acid synthesis and phospholipid metabolism in rat mast cells

    SciTech Connect

    Fagan, D.L.

    1986-01-01

    The role of lysophosphatidic acid in mast cell response to antigen was investigated using an isolated rat serosal mast cell model. The cells were incubated with monoclonal murine immunoglobulin E to the dinitrophenyl hapten and prelabeled with /sup 32/P-orthophosphate or /sup 3/H-fatty acids. Lysophosphatidic acid was isolated form cell extracts by 2-dimensional thin-layer chromatography, and the incorporated radioactivity was assessed by liquid scintillation counting. Lysophosphatidic acid labeling with /sup 32/P was increased 2-4 fold within 5 minutes after the addition of antigen or three other mast cell agonists. Functional group analyses unequivocally showed that the labeled compound was lysophosphatidic acid. Lysophosphatidic acid synthesis was dependent on the activity of diacylglycerol lipase, suggesting formation from monoacylglycerol. In addition, the studies of lysophosphatidic acid synthesis suggest that the addition of antigen to mast cells may initiate more than one route of phospholipid degradation and resynthesis. Whatever the origin of lysophosphatidic acid, the results of this study demonstrated that lysophosphatidic acid synthesis is stimulated by a variety of mast cell agonists. Dose-response, kinetic, and pharmacologic studies showed close concordance between histamine release and lysophosphatidic acid labeling responses. These observations provide strong evidence that lysophosphatidic acid plays an important role in mast cell activation.

  7. Increased Production of Fatty Acids and Triglycerides in Aspergillus oryzae by Enhancing Expressions of Fatty Acid Synthesis-Related Genes

    SciTech Connect

    Tamano, Koichi; Bruno, Kenneth S.; Karagiosis, Sue A.; Culley, David E.; Deng, Shuang; Collett, James R.; Umemura, Myco; Koike, Hideaki; Baker, Scott E.; Machida, Masa

    2013-01-01

    Microbial production of fats and oils is being developedas a means of converting biomass to biofuels. Here we investigate enhancing expression of enzymes involved in the production of fatty acids and triglycerides as a means to increase production of these compounds in Aspergillusoryzae. Examination of the A.oryzaegenome demonstrates that it contains twofatty acid synthases and several other genes that are predicted to be part of this biosynthetic pathway. We enhancedthe expressionof fatty acid synthesis-related genes by replacing their promoters with thepromoter fromthe constitutively highly expressedgene tef1. We demonstrate that by simply increasing the expression of the fatty acid synthasegenes we successfullyincreasedtheproduction of fatty acids and triglyceridesby more than two fold. Enhancement of expression of the fatty acid pathway genes ATP-citrate lyase and palmitoyl-ACP thioesteraseincreasedproductivity to a lesser extent.Increasing expression ofacetyl-CoA carboxylase caused no detectable change in fatty acid levels. Increases in message level for each gene were monitored usingquantitative real-time RT-PCR. Our data demonstrates that a simple increase in the abundance of fatty acid synthase genes can increase the detectable amount of fatty acids.

  8. Oleochemical synthesis of an acid cleavable hydrophobe for surfactant use

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The synthesis of a series of branched hydroxy stearates from commercially available methyl oleate and common organic acids is reported. A variety of different acids, with 3 to 8 carbon atoms, and also varying in their branching and functionality, were used. The kinetics of the ring opening reactio...

  9. The enxymatic synthesis and characterization of disolketal iminodiacetic acid (DSIDA)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Esterifications between iminodiacetic acid and its methyl and ethyl derivatives with glycerol or solketal have been studied. The synthesis of IDA with solketal was unsuccessful under experimental conditions of 70 degrees C and 200 torr for 24h. However, using dimethyl iminodiacetic acid with solke...

  10. Divergence in enzyme regulation between Caenorhabditis elegans and human tyrosine hydroxylase, the key enzyme in the synthesis of dopamine.

    PubMed

    Calvo, Ana C; Pey, Angel L; Miranda-Vizuete, Antonio; Døskeland, Anne P; Martinez, Aurora

    2011-02-15

    TH (tyrosine hydroxylase) is the rate-limiting enzyme in the synthesis of catecholamines. The cat-2 gene of the nematode Caenorhabditis elegans is expressed in mechanosensory dopaminergic neurons and has been proposed to encode a putative TH. In the present paper, we report the cloning of C. elegans full-length cat-2 cDNA and a detailed biochemical characterization of the encoded CAT-2 protein. Similar to other THs, C. elegans CAT-2 is composed of an N-terminal regulatory domain followed by a catalytic domain and a C-terminal oligomerization domain and shows high substrate specificity for L-tyrosine. Like hTH (human TH), CAT-2 is tetrameric and is phosphorylated at Ser35 (equivalent to Ser40 in hTH) by PKA (cAMP-dependent protein kinase). However, CAT-2 is devoid of characteristic regulatory mechanisms present in hTH, such as negative co-operativity for the cofactor, substrate inhibition or feedback inhibition exerted by catecholamines, end-products of the pathway. Thus TH activity in C. elegans displays a weaker regulation in comparison with the human orthologue, resembling a constitutively active enzyme. Overall, our data suggest that the intricate regulation characteristic of mammalian TH might have evolved from more simple models to adjust to the increasing complexity of the higher eukaryotes neuroendocrine systems.

  11. Kinetic characteristics of polygalacturonase enzymes hydrolyzing galacturonic acid oligomers using isothermal titration calorimetry

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polygalacturonase enzymes hydrolyze the polygalacturonic acid chains found in pectin. Interest in polygalacturonase enzymes continues as they are useful in a number of industrial processes and conversely, detrimental, as they are involved in maceration of economically important crops. While a good...

  12. Nucleic acid arrays and methods of synthesis

    DOEpatents

    Sabanayagam, Chandran R.; Sano, Takeshi; Misasi, John; Hatch, Anson; Cantor, Charles

    2001-01-01

    The present invention generally relates to high density nucleic acid arrays and methods of synthesizing nucleic acid sequences on a solid surface. Specifically, the present invention contemplates the use of stabilized nucleic acid primer sequences immobilized on solid surfaces, and circular nucleic acid sequence templates combined with the use of isothermal rolling circle amplification to thereby increase nucleic acid sequence concentrations in a sample or on an array of nucleic acid sequences.

  13. Phosphoric Acid-Mediated Synthesis of Vinyl Sulfones through Decarboxylative Coupling Reactions of Sodium Sulfinates with Phenylpropiolic Acids.

    PubMed

    Rong, Guangwei; Mao, Jincheng; Yan, Hong; Zheng, Yang; Zhang, Guoqi

    2015-08-07

    A novel phosphoric acid -mediated synthesis of vinyl sulfones through decarboxylative coupling reactions of sodium sulfinates with phenylpropiolic acids is described. This transformation is efficient and environmentally friendly.

  14. The initiation of eukaryotic and prokaryotic protein synthesis: a selective accessibility and multisubstrate enzyme reaction.

    PubMed

    Nakamoto, Tokumasa

    2007-11-15

    An extension of our unique accessibility hypothesis for the initiation of protein synthesis is proposed following a review of the initiation of protein synthesis. The E. coli model initiation sequence generated by computer from 68 initiation sequences and the eukaryotic consensus initiation sequence derived by non-computer analysis of 211 initiation sequences do not contain a specific base in any position; they are only assigned preferred bases. The initiation site, in other words, is a varied sequence of preferred bases and its sequence is non-unique. This indicates that the ribosomal recognition of the initiation site may be the result of multiple interactions that are cooperative and cumulative and typical of multisubstrate enzymes. Because of this characteristic, the model of multisubstrate enzymes with broad substrate specificity is proposed as a paradigm for the initiation of protein synthesis. As predicted by this model, changes in the leader and downstream sequences that improve the agreement with the preferred base sequence do indeed enhance the rate of protein synthesis. The eukaryotic/prokaryotic hybrid studies show a considerable overlap in the specificities of the two groups of ribosomes. The scanning of the mRNA from the 5'-end postulated by the scanning hypothesis is not a necessary step since eukaryotic ribosomes are able to bind to internal mRNA sites and initiate synthesis. Our unique accessibility hypothesis, which is extended by coupling cooperative and cumulative specificity in ribosomal function, is referred to for brevity as the cumulative specificity hypothesis. The hypothesis actually postulates a selective accessibility and cooperative-cumulative specificity mechanism; it is able to account for the behavior of both eukaryotic and prokaryotic initiation of protein synthesis. From another perspective, the hypothesis can be regarded as providing a mechanism that enables ribosomes to recognize the IS in the absence of a unique initiation

  15. Multiplexed Capillary Electrophoresis as Analytical Tool for Fast Optimization of Multi-Enzyme Cascade Reactions - Synthesis of Nucleotide Sugars: Dedicated to Prof. Dr. Vladimir Křen on the occasion of his 60(th) birthday.

    PubMed

    Wahl, Claudia; Hirtz, Dennis; Elling, Lothar

    2016-10-01

    Nucleotide sugars are considered as bottleneck and expensive substrates for enzymatic glycan synthesis using Leloir-glycosyltransferases. Synthesis from cheap substrates such as monosaccharides is accomplished by multi-enzyme cascade reactions. Optimization of product yields in such enzyme modules is dependent on the interplay of multiple parameters of the individual enzymes and governed by a considerable time effort when convential analytic methods like capillary electrophoresis (CE) or HPLC are applied. We here demonstrate for the first time multiplexed CE (MP-CE) as fast analytical tool for the optimization of nucleotide sugar synthesis with multi-enzyme cascade reactions. We introduce a universal separation method for nucleotides and nucleotide sugars enabling us to analyze the composition of six different enzyme modules in a high-throughput format. Optimization of parameters (T, pH, inhibitors, kinetics, cofactors and enzyme amount) employing MP-CE analysis is demonstrated for enzyme modules for the synthesis of UDP-α-D-glucuronic acid (UDP-GlcA) and UDP-α-D-galactose (UDP-Gal). In this way we achieve high space-time-yields: 1.8 g/L⋆h for UDP-GlcA and 17 g/L⋆h for UDP-Gal. The presented MP-CE methodology has the impact to be used as general analytical tool for fast optimization of multi-enzyme cascade reactions.

  16. Structure and function of ∆1-tetrahydrocannabinolic acid (THCA) synthase, the enzyme controlling the psychoactivity of Cannabis sativa.

    PubMed

    Shoyama, Yoshinari; Tamada, Taro; Kurihara, Kazuo; Takeuchi, Ayako; Taura, Futoshi; Arai, Shigeki; Blaber, Michael; Shoyama, Yukihiro; Morimoto, Satoshi; Kuroki, Ryota

    2012-10-12

    ∆1-Tetrahydrocannabinolic acid (THCA) synthase catalyzes the oxidative cyclization of cannabigerolic acid (CBGA) into THCA, the precursor of the primary psychoactive agent ∆1-tetrahydrocannabinol in Cannabis sativa. The enzyme was overproduced in insect cells, purified, and crystallized in order to investigate the structure-function relationship of THCA synthase, and the tertiary structure was determined to 2.75Å resolution by X-ray crystallography (R(cryst)=19.9%). The THCA synthase enzyme is a member of the p-cresol methyl-hydroxylase superfamily, and the tertiary structure is divided into two domains (domains I and II), with a flavin adenine dinucleotide coenzyme positioned between each domain and covalently bound to His114 and Cys176 (located in domain I). The catalysis of THCA synthesis involves a hydride transfer from C3 of CBGA to N5 of flavin adenine dinucleotide and the deprotonation of O6' of CBGA. The ionized residues in the active site of THCA synthase were investigated by mutational analysis and X-ray structure. Mutational analysis indicates that the reaction does not involve the carboxyl group of Glu442 that was identified as the catalytic base in the related berberine bridge enzyme but instead involves the hydroxyl group of Tyr484. Mutations at the active-site residues His292 and Tyr417 resulted in a decrease in, but not elimination of, the enzymatic activity of THCA synthase, suggesting a key role for these residues in substrate binding and not direct catalysis.

  17. Liquid chromatographic determination of hippuric acid for the evaluation of ethacrynic acid as angiotensin converting enzyme inhibitor.

    PubMed

    Mehanna, A S; Dowling, M

    1999-05-01

    A rapid, simple and interference-free method is described to evaluate the inhibitory effects of organic compounds on the activity of angiotensin converting enzyme irrespective of their acid-base properties. The assay is based on the high performance liquid chromatographic separation of the synthetic substrate hippuryl-L-histidyl-L-leucine, the hydrolysis product hippuric acid and the test compound. Using the new method, the diuretic drug ethacrynic acid was found to act as an inhibitor for the enzyme in a non competitive mode.

  18. Impact of phosphate concentration on docosahexaenoic acid production and related enzyme activities in fermentation of Schizochytrium sp.

    PubMed

    Ren, Lu-Jing; Feng, Yun; Li, Juan; Qu, Liang; Huang, He

    2013-09-01

    Docosahexaenoic acid (DHA) is an important and widely used infant food additive. In this study, the effects of phosphate concentration on lipid and especially DHA synthesis in the oleaginous fungi Schizochytrium sp. HX-308 have been investigated in batch cultures. The maximum DHA yield (8.9 g/L) and DHA productivity (148.3 mg/L h) in 0.1 g/L KH2PO4 concentration were higher than the DHA yield (6.2 g/L) and DHA productivity (86.1 mg/L h) in 4 g/L KH2PO4 concentration. Furthermore, differences in related enzyme activities (malic enzyme, glucose-6-phosphate dehydrogenase and NAD(+)-isocitrate dehydrogenase) between phosphate-sufficient and phosphate-limitation conditions were assayed. The results showed that the phosphate-limitation condition could maintain higher activities of malic enzyme and glucose-6-phosphate dehydrogenase in addition to lower activity of NAD(+)-isocitrate dehydrogenase. In addition, glucose-6-phosphate dehydrogenase might be the main supplier of NADPH at the early stage of fermentation while malic enzyme might be the provider at the late stage. This information might explain the regulation mechanism of phosphate limitation for lipid production and be useful for further DHA production enhancement.

  19. Fatty acid synthesis is inhibited by inefficient utilization of unusual fatty acids for glycerolipid assembly

    PubMed Central

    Bates, Philip D.; Johnson, Sean R.; Cao, Xia; Li, Jia; Nam, Jeong-Won; Jaworski, Jan G.; Ohlrogge, John B.; Browse, John

    2014-01-01

    Degradation of unusual fatty acids through β-oxidation within transgenic plants has long been hypothesized as a major factor limiting the production of industrially useful unusual fatty acids in seed oils. Arabidopsis seeds expressing the castor fatty acid hydroxylase accumulate hydroxylated fatty acids up to 17% of total fatty acids in seed triacylglycerols; however, total seed oil is also reduced up to 50%. Investigations into the cause of the reduced oil phenotype through in vivo [14C]acetate and [3H]2O metabolic labeling of developing seeds surprisingly revealed that the rate of de novo fatty acid synthesis within the transgenic seeds was approximately half that of control seeds. RNAseq analysis indicated no changes in expression of fatty acid synthesis genes in hydroxylase-expressing plants. However, differential [14C]acetate and [14C]malonate metabolic labeling of hydroxylase-expressing seeds indicated the in vivo acetyl–CoA carboxylase activity was reduced to approximately half that of control seeds. Therefore, the reduction of oil content in the transgenic seeds is consistent with reduced de novo fatty acid synthesis in the plastid rather than fatty acid degradation. Intriguingly, the coexpression of triacylglycerol synthesis isozymes from castor along with the fatty acid hydroxylase alleviated the reduced acetyl–CoA carboxylase activity, restored the rate of fatty acid synthesis, and the accumulation of seed oil was substantially recovered. Together these results suggest a previously unidentified mechanism that detects inefficient utilization of unusual fatty acids within the endoplasmic reticulum and activates an endogenous pathway for posttranslational reduction of fatty acid synthesis within the plastid. PMID:24398521

  20. Effects of bile acid administration on bile acid synthesis and its circadian rhythm in man

    SciTech Connect

    Pooler, P.A.; Duane, W.C.

    1988-09-01

    In man bile acid synthesis has a distinct circadian rhythm but the relationship of this rhythm to feedback inhibition by bile acid is unknown. We measured bile acid synthesis as release of 14CO2 from (26-14C)cholesterol every 2 hr in three normal volunteers during five separate 24-hr periods. Data were fitted by computer to a cosine curve to estimate amplitude and acrophase of the circadian rhythm. In an additional six volunteers, we measured synthesis every 2 hr from 8:00 a.m. to 4:00 p.m. only. During the control period, amplitude (expressed as percentage of mean synthesis) averaged 52% and acrophase averaged 6:49 a.m. During administration of ursodeoxycholic acid (15 mg per kg per day), synthesis averaged 126% of baseline (p less than 0.1), amplitude averaged 43% and acrophase averaged 6:20 a.m. During administration of chenodeoxycholic acid (15 mg per kg per day), synthesis averaged 43% of baseline (p less than 0.001), amplitude averaged 53% and acrophase averaged 9:04 a.m. Addition of prednisone to this regimen of chenodeoxycholic acid to eliminate release of 14CO2 from corticosteroid hormone synthesis resulted in a mean amplitude of 62% and a mean acrophase of 6:50 a.m., values very similar to those in the baseline period. Administration of prednisone alone also did not significantly alter the baseline amplitude (40%) or acrophase (6:28 a.m.). We conclude that neither chenodeoxycholic acid nor ursodeoxycholic acid significantly alters the circadian rhythm of bile acid synthesis in man.

  1. Synthesis and preliminary biological evaluations of (+)-isocampholenic acid-derived amides.

    PubMed

    Grošelj, Uroš; Golobič, Amalija; Knez, Damijan; Hrast, Martina; Gobec, Stanislav; Ričko, Sebastijan; Svete, Jurij

    2016-08-01

    The synthesis of two novel (+)-isocampholenic acid-derived amines has been realized starting from commercially available (1S)-(+)-10-camphorsulfonic acid. The novel amines as well as (+)-isocampholenic acid have been used as building blocks in the construction of a library of amides using various aliphatic, aromatic, and amino acid-derived coupling partners using BPC and CDI as activating agents. Amide derivatives have been assayed against several enzymes that hold potential for the development of new drugs to battle bacterial infections and Alzheimer's disease. Compounds 20c and 20e showed promising selective sub-micromolar inhibition of human butyrylcholinesterase [Formula: see text] ([Formula: see text] values [Formula: see text] and [Formula: see text], respectively).

  2. Total Synthesis of (±)- and (−)-Actinophyllic Acid

    PubMed Central

    Martin, Connor L.; Overman, Larry E.; Rohde, Jason M.

    2010-01-01

    Development of efficient sequences for the total syntheses of (±)-actinophyllic acid (rac-1) and (−)-actinophyllic acid (1) are described. The central step in these syntheses is the aza-Cope/Mannich reaction, which constructs the previously unknown hexacyclic ring system of actinophyllic acid in one step from much simpler tetracyclic precursors. The tetracyclic hexahydro-1,5-methano-1H-azocino[4,3-b]indole ketone rac-37 is assembled from o-nitrophenylacetic acid in four steps, with oxidative cyclization of a dienolate derivative of tricyclic precursor rac-35 being the central step. In the first-generation synthesis, this intermediate is transformed in two steps to homoallyl amine rac-43, whose formaldiminium derivative undergoes efficient aza-Cope/Mannich reaction to give pentacyclic ketone rac-44. In four additional steps, this intermediate is advanced to (±)-actinophyllic acid. The synthesis is streamlined by elaborating ketone rac-37 to β-hydroxyester intermediate rac-53, which is directly transformed to (±)-actinophyllic acid upon exposure to HCl and paraformaldehyde. This concise second-generation total synthesis of (±)-actinophyllic acid is realized in 22% overall yield from commercially available di-tert-butylmalonate and o-nitrophenylacetic acid by a sequence that proceeds by way of only six isolated intermediates. The first enantioselective total synthesis of (−)-actinophyllic acid (1) is accomplished by this direct sequence from tricyclic keto malonate (S)-35. Catalytic enantioselective reduction of α,β-unsaturated ketone 66 is the key step in the preparation of intermediate (S)-35 from the commercially available Boc-amino acid 65. Discussed also is the possibility that the aza-Cope/Mannich reaction might be involved in the biosynthesis of (−)-actinophyllic acid. PMID:20218696

  3. Induction of collagen synthesis by ascorbic acid. A possible mechanism.

    PubMed

    Pinnel, S R; Murad, S; Darr, D

    1987-12-01

    L-Ascorbic acid stimulates procollagen synthesis in cultured human skin fibroblasts without appreciably altering noncollagen protein synthesis. The effect is unrelated to intracellular degradation of newly synthesized procollagen. Levels of mRNA for pro alpha 1(I), pro alpha 2(I), and pro alpha 1(III), measured by hybridization with the corresponding cDNA probes, are elevated in the presence of ascorbic acid, whereas the level of mRNA for fibronectin is unchanged. Levels of functional mRNA for procollagen, measured in a cell-free translation assay, are specifically increased in the presence of ascorbic acid. Thus, ascorbic acid appears to control the expression of three different procollagen genes, each of which is located on a separate chromosome. It is proposed that intracellularly accumulated procollagen in ascorbate deficiency may lead to a translational repression of procollagen synthesis. Ascorbic acid may relieve this block by promoting hydroxyproline formation and, consequently, secretion of procollagen from the cell. The increased level of procollagen mRNA under the influence of ascorbic acid may be secondary to increased synthesis of procollagen polypeptides; the control point may be gene transcription or mRNA degradation.

  4. Characterization of the Branched-Chain Amino Acid Aminotransferase Enzyme Family in Tomato1[W][OA

    PubMed Central

    Maloney, Gregory S.; Kochevenko, Andrej; Tieman, Denise M.; Tohge, Takayuki; Krieger, Uri; Zamir, Dani; Taylor, Mark G.; Fernie, Alisdair R.; Klee, Harry J.

    2010-01-01

    Branched-chain amino acids (BCAAs) are synthesized in plants from branched-chain keto acids, but their metabolism is not completely understood. The interface of BCAA metabolism lies with branched-chain aminotransferases (BCAT) that catalyze both the last anabolic step and the first catabolic step. In this study, six BCAT genes from the cultivated tomato (Solanum lycopersicum) were identified and characterized. SlBCAT1, -2, -3, and -4 are expressed in multiple plant tissues, while SlBCAT5 and -6 were undetectable. SlBCAT1 and -2 are located in the mitochondria, SlBCAT3 and -4 are located in chloroplasts, while SlBCAT5 and -6 are located in the cytosol and vacuole, respectively. SlBCAT1, -2, -3, and -4 were able to restore growth of Escherichia coli BCAA auxotrophic cells, but SlBCAT1 and -2 were less effective than SlBCAT3 and -4 in growth restoration. All enzymes were active in the forward (BCAA synthesis) and reverse (branched-chain keto acid synthesis) reactions. SlBCAT3 and -4 exhibited a preference for the forward reaction, while SlBCAT1 and -2 were more active in the reverse reaction. While overexpression of SlBCAT1 or -3 in tomato fruit did not significantly alter amino acid levels, an expression quantitative trait locus on chromosome 3, associated with substantially higher expression of Solanum pennellii BCAT4, did significantly increase BCAA levels. Conversely, antisense-mediated reduction of SlBCAT1 resulted in higher levels of BCAAs. Together, these results support a model in which the mitochondrial SlBCAT1 and -2 function in BCAA catabolism while the chloroplastic SlBCAT3 and -4 function in BCAA synthesis. PMID:20435740

  5. Effects of Abscisic Acid and Ethylene on the Gibberellic Acid-Induced Synthesis of α-Amylase by Isolated Wheat Aleurone Layers 1

    PubMed Central

    Varty, Keith; Arreguín, Barbarín L.; Gómez, Miguel T.; López, Pablo Jaime T.; Gómez, Miguel Angel L.

    1983-01-01

    Gibberellic acid-induced α-amylase synthesis in wheat aleurone layers (Triticum aestivum L. var Potam S-70) escaped from transcriptional control 30 h after addition of the hormone, as evidenced by the tissue's loss of susceptibility to cordycepin. Abscisic acid inhibited the accumulation of α-amylase activity when added to the tissue during this cordycepin-insensitive phase of enzyme induction. α-Amylase synthesis was not restored by the addition of cordycepin, indicating that the response to abscisic acid was not dependent upon the continuous synthesis of a short lived RNA. When ethylene was added simultaneously or some time after abscisic acid, the accumulation of α-amylase activity was sustained or quickly restored. The loss of susceptibility to cordycepin was completely prevented when aleurone layers were incubated with a combination of gibberellic and abscisic acids from the start of the induction period. This effect of abscisic acid was not reversed by ethylene. On the basis of these observations, it is suggested that abscisic acid inhibits both the transcription and translation of α-amylase mRNA, and that only the latter site of action is susceptible to reversal by ethylene. The rate of incorporation of [methyl-14C]choline into phospholipids was also inhibited by abscisic acid. Ethylene reversed this effect. The effects of abscisic acid and ethylene on phospholipid synthesis were not dependent upon the presence of gibberellic acid. No direct relationship was found between the control of α-amylase synthesis and membrane formation by abscisic acid and ethylene. PMID:16663284

  6. Synthesis of fatty acid ethyl esters in mammalian tissues after ethanol exposure: a systematic review of the literature.

    PubMed

    Zelner, Irene; Matlow, Jeremy N; Natekar, Aniket; Koren, Gideon

    2013-08-01

    The ability to undergo non-oxidative metabolism from ethanol to fatty acid ethyl esters (FAEEs) varies greatly among tissues and organs. To gain a greater understanding of non-oxidative ethanol metabolism to FAEE, we aimed to collect all published data on FAEE synthesis in mammalian organs and tissues to identify all tissues, organs, and enzymes that are known to, or likely possess FAEE-synthetic activity. A systematic search for relevant papers was performed and two independent reviewers examined potentially relevant abstracts (articles on FAEEs that pertain to ethanol exposure) to determine whether they met the inclusion criteria. Information on FAEE synthesis was retrieved from papers meeting the inclusion/exclusion criteria and summarized by organ/tissue/matrix examined. The systematic search through four databases yielded 78 articles that investigated FAEE synthesis by tissues, tissue fractions and cell lines, and 29 articles that attempted to purify and/or characterize the enzymes involved in FAEE synthesis. Two enzyme activities have been studied: FAEE synthase (FAEES, which conjugates ethanol and free fatty acid) and acyl-CoA: ethanol O-acyltransferase (AEAT, which conjugates ethanol and fatty acyl-CoA). Both activities are expressed by a variety of different enzymes. FAEES activity is the most widely studied and has been purified from several tissues and shown to be associated with several well-known enzymes, while the identity of enzymes possessing AEAT activity remains unknown. The organs and tissues that have been shown to synthesize FAEEs are discussed, with special emphasis on the studies that attempted to elucidate the enzymology of FAEE synthesis in those tissues.

  7. Hydrogen sulfide synthesis enzymes reduced in lower esophageal sphincter of patients with achalasia.

    PubMed

    Zhang, L; Zhao, W; Zheng, Z; Wang, T; Zhao, C; Zhou, G; Jin, H; Wang, B

    2016-10-01

    The etiology of achalasia remains largely unknown. Considerable evidence reveals that the lower esophageal sphincter dysfunction is due to the lack of inhibitory neurotransmitter, secondary to esophageal neuronal inflammation or loss. Recent studies suggest hydrogen sulfide may act as an inhibitory transmitter in gastrointestinal tract, but study about hydrogen sulfide in human esophagus still lack. The aim of the study was to investigate if hydrogen sulfide synthesis enzymes could be detected in human esophagus and if the synthesis of the endogenous hydrogen sulfide could be affected in achalasia patients. Tissue samples in cardia, lower esophageal sphincter, 2 cm and 4 cm above lower esophageal sphincter were obtained from achalasia patients undergoing peroral endoscopic myotomy. Control tissues in lower esophageal sphincter were obtained from esophageal carcinoma patients. Expression of cystathionine-β-synthase and cystathionine-γ-lyase in lower esophageal sphincter of achalasia patients and control were detected by immunohistochemical staining. In addition, expression of cystathionine-β-synthase and cystathionine-γ-lyase were compared among different parts of esophagus in achalasia patients. Compared with control, the expression of cystathionine-β-synthase and cystathionine-γ-lyase in lower esophageal sphincter of achalasia patients was significantly reduced (χ(2) = 11.429, P = 0.010). The expression of cystathionine-β-synthase and cystathionine-γ-lyase were lower in lower esophageal sphincter than that in 2 cm and 4 cm above lower esophageal sphincter, respectively (all P < 0.05). In conclusion, the expression of hydrogen sulfide synthesis enzymes, cystathionine-β-synthase and cystathionine-γ-lyase, can be detected in human esophagus and is reduced in patients with achalasia, which implicates the involvement of the two hydrogen sulfide synthesis enzymes in the pathophysiology of achalasia.

  8. Protective effect of p-methoxycinnamic acid, an active phenolic acid against 1,2-dimethylhydrazine-induced colon carcinogenesis: modulating biotransforming bacterial enzymes and xenobiotic metabolizing enzymes.

    PubMed

    Gunasekaran, Sivagami; Venkatachalam, Karthikkumar; Jeyavel, Kabalimoorthy; Namasivayam, Nalini

    2014-09-01

    Objective of the study is to evaluate the modifying potential of p-methoxycinnamic acid (p-MCA), an active rice bran phenolic acid on biotransforming bacterial enzymes and xenobiotic metabolizing enzymes in 1,2-dimethylhydrazine-induced rat colon carcinogenesis. 48 male albino wistar rats were divided into six groups. Group1 (control) received modified pellet diet and 0.1 % carboxymethylcellulose; group2 received modified pellet diet along with p-MCA (80 mg/kg b.wt. p.o.) everyday for 16 weeks; groups 3-6 received 1,2-dimethylhydrazine (DMH) (20 mg/kg b.wt.) subcutaneous injection once a week for the first 4 weeks, while groups 4-6 received p-MCA at three different doses of 20, 40 and 80 mg/kg b.wt. p.o. everyday for 16 weeks. A significant increase in carcinogen-activating enzymes (cytochrome P450, cytochrome b5, cytochrome P4502E1, NADH-cytochrome-b5-reductase and NADPH-cytochrome-P450 reductase) with concomitant decrease in phaseII enzymes, DT-Diaphorase, glutathione S-transferase, UDP-glucuronyl-transferase and gamma glutamyltransferase were observed in group3 compared to control. DMH treatment significantly increased the activities of feacal and colonic bacterial enzymes (β-glucosidase, β-galactosidase, β-glucuronidase, nitroreductase, sulphatase and mucinase). p-MCA supplementation (40 mg/kg b.wt) to carcinogen exposed rats inhibited these enzymes, which were near those of control rats. The formation of dysplastic aberrant crypt foci in the colon and the histopathological observations of the liver also supports our biochemical findings. p-MCA (40 mg/kg b.wt.) offers remarkable modulating efficacy of biotransforming bacterial and xenobiotic metabolizing enzymes in colon carcinogenesis.

  9. Antitumor effects of a drug combination targeting glycolysis, glutaminolysis and de novo synthesis of fatty acids.

    PubMed

    Cervantes-Madrid, Diana; Dueñas-González, Alfonso

    2015-09-01

    There is a strong rationale for targeting the metabolic alterations of cancer cells. The most studied of these are the higher rates of glycolysis, glutaminolysis and de novo synthesis of fatty acids (FAs). Despite the availability of pharmacological inhibitors of these pathways, no preclinical studies targeting them simultaneously have been performed. In the present study it was determined whether three key enzymes for glycolysis, glutaminolysis and de novo synthesis of FAs, hexokinase-2, glutaminase and fatty acid synthase, respectively, were overexpressed as compared to primary fibroblasts. In addition, we showed that at clinically relevant concentrations lonidamine, 6-diazo-5-oxo-L-norleucine and orlistat, known inhibitors of the mentioned enzymes, exerted a cell viability inhibitory effect. Genetic downregulation of the three enzymes also reduced cell viability. The three drugs were highly synergistic when administered as a triple combination. Of note, the cytotoxicity of the triple combination was low in primary fibroblasts and was well tolerated when administered into healthy BALB/c mice. The results suggest the feasibility and potential clinical utility of the triple metabolic targeting which merits to be further studied by using either repositioned old drugs or newer, more selective inhibitors.

  10. Synthesis of α-aminoboronic acids.

    PubMed

    Andrés, Patricia; Ballano, Gema; Calaza, M Isabel; Cativiela, Carlos

    2016-04-21

    This review describes available methods for the preparation of α-aminoboronic acids in their racemic or in their enantiopure form. Both, highly stereoselective syntheses and asymmetric procedures leading to the stereocontrolled generation of α-aminoboronic acid derivatives are included. The preparation of acyclic, carbocyclic and azacyclic α-aminoboronic acid derivatives is covered. Within each section, the different synthetic approaches have been classified according to the key bond which is formed to complete the α-aminoboronic acid skeleton.

  11. Production of Delta(1)-tetrahydrocannabinolic acid by the biosynthetic enzyme secreted from transgenic Pichia pastoris.

    PubMed

    Taura, Futoshi; Dono, Emi; Sirikantaramas, Supaart; Yoshimura, Kohji; Shoyama, Yukihiro; Morimoto, Satoshi

    2007-09-28

    Delta(1)-Tetrahydrocannabinolic acid (THCA) synthase is the enzyme that catalyzes the oxidative cyclization of cannabigerolic acid into THCA, the acidic precursor of Delta(1)-tetrahydrocannabinol. We developed a novel expression system for THCA synthase using a methylotrophic yeast Pichia pastoris as a host. Under optimized conditions, the transgenic P. pastoris secreted approximately 1.32nkat/l of THCA synthase activity, and the culture medium, from which the cells were removed, effectively synthesized THCA from cannabigerolic acid with a approximately 98% conversion rate. The secreted THCA synthase was readily purified to homogeneity. Interestingly, endoglycosidase treatment afforded a deglycosylated THCA synthase with more catalytic activity than that of the glycosylated form. The non-glycosylated THCA synthase should be suitable for structure-function studies because it displayed much more activity than the previously reported native enzyme from Cannabis sativa as well as the recombinant enzyme from insect cell cultures.

  12. Synthesis of monoacylglycerol containing pinolenic acid via stepwise esterification using a cold active lipase.

    PubMed

    Pyo, Young-Gil; Hong, Seung In; Kim, Yangha; Kim, Byung Hee; Kim, In-Hwan

    2012-01-01

    High purity monoacylglycerol (MAG) containing pinolenic acid was synthesized via stepwise esterification of glycerol and fatty acids from pine nut oil using a cold active lipase from Penicillium camembertii as a biocatalyst. Effects of temperature, molar ratio, water content, enzyme loading, and vacuum on the synthesis of MAG by lipase-catalyzed esterification of glycerol and fatty acid from pine nut oil were investigated. Diacylglycerol (DAG) as well as MAG increased significantly when temperature was increased from 20 to 40 °C. At a molar ratio of 1:1, MAG content decreased because of the significant increase in DAG content. Water has a profound influence on both MAG and DAG content through the entire course of reaction. The reaction rate increased significantly as enzyme loading increased up to 600 units. Vacuum was an effective method to reduce DAG content. The optimum temperature, molar ratio, water content, enzyme loading, vacuum, and reaction time were 20 °C, 1:5 (fatty acid to glycerol), 2%, 600 units, 5 torr, and 24 h, respectively. MAG content further increased via lipase-catalyzed second step esterification at subzero temperature. P. camembertii lipase exhibited esterification activity up to -30 °C.

  13. Functional diversification of two UGT80 enzymes required for steryl glucoside synthesis in Arabidopsis

    PubMed Central

    Stucky, Daniel F.; Arpin, James C.

    2015-01-01

    Steryl glucosides (SG) are abundant steroid conjugates in plant membranes. Beyond structural roles in lipid bilayers, functions in sugar transport, storage, and/or signalling are predicted. UDP-glucose:sterol glucosyltransferase 80A2 (UGT80A2) and UGT80B1, which share similarity to fungal counterparts, are implicated in SG synthesis in Arabidopsis thaliana. A third related enzyme, which seems specific to the plant lineage, is encoded by UGT713B1/At5g24750. Genetic and biochemical approaches were employed to determine the role of each UGT gene in the production of specific SGs and acyl SGs (ASGs). Using direct infusion electrospray ionization tandem mass spectrometry (ESI-MS/MS), SG and acyl SG (ASG) contents of ugt80 and ugt713 mutants, and triple and double mutants were profiled in seeds. In vitro enzyme assays were performed to assay substrate preferences. Both UGT80A2 and UGT80B1, but not UGT713B1 were shown to be coordinately down-regulated during seed imbibition when SG levels decline, consistent with similar functions as UGT80 enzymes. UGT80A2 was found to be required for normal levels of major SGs in seeds, whereas UGT80B1 is involved in accumulation of minor SG and ASG compounds. Although the results demonstrate specific activities for UGT80A2 and UGT80B1, a role for UGT713B1 in SG synthesis was not supported. The data show that UGT80A2, the more highly conserved enzyme, is responsible for the bulk production of SGs in seeds, whereas UGT80B1 plays a critical accessory role. This study extends our knowledge of UGT80 enzymes and provides evidence for specialized functions for distinct classes of SG and ASG molecules in plants. PMID:25316063

  14. Lipase-catalyzed synthesis of fatty acid amide (erucamide) using fatty acid and urea.

    PubMed

    Awasthi, Neeraj Praphulla; Singh, R P

    2007-01-01

    Ammonolysis of fatty acids to the corresponding fatty acid amides is efficiently catalysed by Candida antartica lipase (Novozym 435). In the present paper lipase-catalysed synthesis of erucamide by ammonolysis of erucic acid and urea in organic solvent medium was studied and optimal conditions for fatty amides synthesis were established. In this process erucic acid gave 88.74 % pure erucamide after 48 hour and 250 rpm at 60 degrees C with 1:4 molar ratio of erucic acid and urea, the organic solvent media is 50 ml tert-butyl alcohol (2-methyl-2-propanol). This process for synthesis is economical as we used urea in place of ammonia or other amidation reactant at atmospheric pressure. The amount of catalyst used is 3 %.

  15. The Catalytic Machinery of a Key Enzyme in Amino Acid Biosynthesis

    SciTech Connect

    Viola, Ronald E.; Faehnle, Christopher R.; Blanco, Julio; Moore, Roger A.; Liu, Xuying; Arachea, Buenafe T.; Pavlovsky, Alexander G.

    2013-02-28

    The aspartate pathway of amino acid biosynthesis is essential for all microbial life but is absent in mammals. Characterizing the enzyme-catalyzed reactions in this pathway can identify new protein targets for the development of antibiotics with unique modes of action. The enzyme aspartate {beta}-semialdehyde dehydrogenase (ASADH) catalyzes an early branch point reaction in the aspartate pathway. Kinetic, mutagenic, and structural studies of ASADH from various microbial species have been used to elucidate mechanistic details and to identify essential amino acids involved in substrate binding, catalysis, and enzyme regulation. Important structural and functional differences have been found between ASADHs isolated from these bacterial and fungal organisms, opening the possibility for developing species-specific antimicrobial agents that target this family of enzymes.

  16. By-products of electrochemical synthesis of suberic acid

    SciTech Connect

    Shirobokova, O.I.; Adamov, A.A.; Freidlin, G.N.; Antonenko, N.S.; Grudtsyn, Yu.D.

    1988-05-10

    By-products of the electrochemical synthesis of dimethyl suberate from glutaric anhydride were studied. This is isolated by thermal dehydration of a mixture of lower dicarboxylic acids that are wastes from the production of adipic acid. To isolate the by-products, they used the methods of vacuum rectification and preparative gas-liquid chromatography, and for their identification, PMR, IR spectroscopy, gas-liquid chromatography, and other known physicochemical methods of investigation.

  17. Developmental aspects and factors influencing the synthesis and status of ascorbic Acid in the pig.

    PubMed

    Mahan, D C; Ching, S; Dabrowski, K

    2004-01-01

    Ascorbic acid synthesis in the pig occurs at mid-pregnancy, but activity of the enzyme l-gulono-gamma-lactone oxidase (GLO) declines thereafter during gestation and remains low when the pig nurses the sow. During late gestation the ascorbic acid concentration in the fetus increases, but serum and liver ascorbic acid concentration in the sow declines without affecting the dam's liver GLO activity. It is presumed that as gestation progresses an increased amount of maternal ascorbic acid is transferred to the fetus and to the mammary gland. Colostrum and milk are rich sources of the vitamin and supply the nursing pig with ascorbic acid. The available data suggest that high amounts of ascorbic acid appear to suppress liver GLO activity in the pig. Upon weaning, when exogenous vitamin C is generally not provided, liver GLO activity and serum ascorbic acid increases. During the initial periods postweaning, some reports have indicated growth benefits of supplemental vitamin C. Body tissues differ in their concentrations of ascorbic acid, but tissues of high metabolic need generally have greater concentrations. The corpus luteum in the female, the testis in the male, and the adrenal glands in all pigs contain greater concentrations of the vitamin. Knockout genes preventing ascorbic acid synthesis in pigs have demonstrated poor skeletal and collagen formation and poor antioxidant protection. Under periods of stress ascorbic acid declines in the adrenal, but the pig rapidly recovers to its resting state once the stressor agent is removed. Although there are periods when supplemental vitamin C has been shown to promote pig performance (e.g., during high environmental stress and early postweaning), supplemental vitamin C has not been shown to routinely enhance pig performance.

  18. Crystal Structure of TDP-Fucosamine Acetyl Transferase (WECD) from Escherichia Coli, an Enzyme Required for Enterobacterial Common Antigen Synthesis

    SciTech Connect

    Hung,M.; Rangarajan, E.; Munger, C.; Nadeau, G.; Sulea, T.; Matte, A.

    2006-01-01

    Enterobacterial common antigen (ECA) is a polysaccharide found on the outer membrane of virtually all gram-negative enteric bacteria and consists of three sugars, N-acetyl-D-glucosamine, N-acetyl-D-mannosaminuronic acid, and 4-acetamido-4,6-dideoxy-D-galactose, organized into trisaccharide repeating units having the sequence {yields}(3)-{alpha}-D-Fuc4NAc-(1{yields}4)-{beta}-D-ManNAcA-(1{yields}4)-{alpha}-D-GlcNAc-(1{yields}). While the precise function of ECA is unknown, it has been linked to the resistance of Shiga-toxin-producing Escherichia coli (STEC) O157:H7 to organic acids and the resistance of Salmonella enterica to bile salts. The final step in the synthesis of 4-acetamido-4,6-dideoxy-D-galactose, the acetyl-coenzyme A (CoA)-dependent acetylation of the 4-amino group, is carried out by TDP-fucosamine acetyltransferase (WecD). We have determined the crystal structure of WecD in apo form at a 1.95-Angstroms resolution and bound to acetyl-CoA at a 1.66-Angstroms resolution. WecD is a dimeric enzyme, with each monomer adopting the GNAT N-acetyltransferase fold, common to a number of enzymes involved in acetylation of histones, aminoglycoside antibiotics, serotonin, and sugars. The crystal structure of WecD, however, represents the first structure of a GNAT family member that acts on nucleotide sugars. Based on this cocrystal structure, we have used flexible docking to generate a WecD-bound model of the acetyl-CoA-TDP-fucosamine tetrahedral intermediate, representing the structure during acetyl transfer. Our structural data show that WecD does not possess a residue that directly functions as a catalytic base, although Tyr208 is well positioned to function as a general acid by protonating the thiolate anion of coenzyme A.

  19. ATP Recycling with Cell Lysate for Enzyme-Catalyzed Chemical Synthesis, Protein Expression and PCR.

    PubMed

    Alissandratos, Apostolos; Caron, Karine; Loan, Thomas D; Hennessy, James E; Easton, Christopher J

    2016-12-16

    E. coli lysate efficiently catalyzes acetyl phosphate-driven ATP regeneration in several important biotechnological applications. The utility of this ATP recycling strategy in enzyme-catalyzed chemical synthesis is illustrated through the conversion of uridine to UMP by the lysate from recombinant overexpression of uridine kinase with the E. coli. The UMP is further transformed into UTP through sequential phosphorylations by kinases naturally present in the lysate, in high yield. Cytidine and 5-fluorouridine also give the corresponding NMPs and NTPs with this system. Cell-free protein expression with a processed extract of lysate also proceeds readily when, instead of adding the required NTPs, all four are produced in situ from the NMPs, using acetyl phosphate and relying on endogenous kinase activity. Similarly, dNMPs can be used to produce the dNTPs necessary for DNA synthesis in PCR. These cheap alternative protocols showcase the potential of acetyl phosphate and ATP recycling with readily available cell lysate.

  20. Acetohydroxyacid synthase: a new enzyme for chiral synthesis of R-phenylacetylcarbinol.

    PubMed

    Engel, Stanislav; Vyazmensky, Maria; Geresh, Shimona; Barak, Ze'ev; Chipman, David M

    2003-09-30

    We have found that acetohydroxyacid synthase (AHAS) is an efficient catalyst for the enantiospecific (> or =98% enantiomeric excess) synthesis of (R)-phenylacetylcarbinol (R-PAC) from pyruvate and benzaldehyde, despite the fact that its normal physiological role is synthesis of (S)-acetohydroxyacids from pyruvate and a second ketoacid. (R)-phenylacetylcarbinol is the precursor of important drugs having alpha and beta adrenergic properties, such as L-ephedrine, pseudoephedrine, and norephedrin. It is currently produced by whole-cell fermentations, but the use of the isolated enzyme pyruvate decarboxylase (PDC) for this purpose is the subject of active research and development efforts. Some of the AHAS isozymes of Escherichia coli have important advantages compared to PDC, including negligible acetaldehyde formation and high conversion of substrates (both pyruvate and benzaldehyde) to PAC. Acetohydroxyacid synthase isozyme I is particularly efficient. The reaction is not limited to condensation of pyruvate with benzaldehyde and other aromatic aldehydes may be used.

  1. Phenylalanine ammonia lyase catalyzed synthesis of amino acids by an MIO-cofactor independent pathway.

    PubMed

    Lovelock, Sarah L; Lloyd, Richard C; Turner, Nicholas J

    2014-04-25

    Phenylalanine ammonia lyases (PALs) belong to a family of 4-methylideneimidazole-5-one (MIO) cofactor dependent enzymes which are responsible for the conversion of L-phenylalanine into trans-cinnamic acid in eukaryotic and prokaryotic organisms. Under conditions of high ammonia concentration, this deamination reaction is reversible and hence there is considerable interest in the development of PALs as biocatalysts for the enantioselective synthesis of non-natural amino acids. Herein the discovery of a previously unobserved competing MIO-independent reaction pathway, which proceeds in a non-stereoselective manner and results in the generation of both L- and D-phenylalanine derivatives, is described. The mechanism of the MIO-independent pathway is explored through isotopic-labeling studies and mutagenesis of key active-site residues. The results obtained are consistent with amino acid deamination occurring by a stepwise E1 cB elimination mechanism.

  2. Effect of organic/inorganic compounds on the enzymes in soil under acid rain stress.

    PubMed

    Liu, Guang-shen; Xu, Dong-mei; Wang, Li-ming; Li, Ke-bin; Liu, Wei-ping

    2004-01-01

    The main effects of pollutions including acid rain, Cu2+, atrazine and their combined products on the activities of urease, invertin, acid phosphatase and catalase were studied by means of orthogonal test. The results showed that H+ and Cu2+ had significant influence on the activities of four enzymes and the ability of their inhibiting followed the order: H+ > Cu2+. Al3+ and atrazine only had litter effects on the activity of urease and phosphatase, respectively. Furthermore, interaction analysis revealed that Cu2+ -H+ affected on the activity of acid phosphatase significantly and antagonism on invertin and urease, Cu2+ -atrazine only exhibited the synergism on the activity of acid phosphatase. But atrazine-H+ had non-interaction within the investigated concentration range. Among four enzymes, acid phosphatase was the most sensitive one to the contaminations.

  3. The spark discharge synthesis of amino acids from various hydrocarbons

    NASA Technical Reports Server (NTRS)

    Ring, D.; Miller, S. L.

    1984-01-01

    The spark discharge synthesis of amino acids using an atmosphere of CH4+N2+H2O+NH3 has been investigated with variable pNH3. The amino acids produced using higher hydrocarbons (ethane, ethylene, acetylene, propane, butane, and isobutane) instead of CH4 were also investigated. There was considerable range in the absolute yields of amino acids, but the yields relative to glycine (or alpha-amino-n-butyric acid) were more uniform. The relative yields of the C3 to C6 aliphatic alpha-amino acids are nearly the same (with a few exceptions) with all the hydrocarbons. The glycine yields are more variable. The precursors to the C3-C6 aliphatic amino acids seem to be produced in the same process, which is separate from the synthesis of glycine precursors. It may be possible to use these relative yields as a signature for a spark discharge synthesis provided corrections can be made for subsequent decomposition events (e.g. in the Murchison meteorite).

  4. Synthesis of the milk oligosaccharide 2'-fucosyllactose using recombinant bacterial enzymes.

    PubMed

    Albermann, C; Piepersberg, W; Wehmeier, U F

    2001-08-23

    The enzymatic synthesis of GDP-beta-L-fucose and its enzymatic transfer reaction using recombinant enzymes from bacterial sources was examined. The GDP-D-mannose 4,6-dehydratase and the GDP-4-keto-6-deoxy-D-mannose 3,5-epimerase-4-reductase from Escherichia coli K-12, respectively, were used to catalyse the conversion of GDP-alpha-D-mannose to GDP-beta-L-fucose with 78% yield. For the transfer of the L-fucose to an acceptor, we cloned and overproduced the alpha-(1-->2)-fucosyltransferase (FucT2) protein from Helicobacter pylori. We were able to synthesise 2'-fucosyllactose using the overproduced FucT2 enzyme, enzymatically synthesised GDP-L-fucose and lactose. The isolation of 2'-fucosyllactose was accomplished by anion-exchange chromatography and gel filtration to give 65% yield.

  5. Synthesis of monomethyl 5,5'-dehydrodiferulic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Synthesis of the internal reference compound, monomethyl 5,5’-dehydrodiferulic acid, is described. The synthetic scheme relies on a selective monomethylation of the known compound 5,5-dehydrodivanillin, followed by elaboration into the dehydrodiferulic framework through a dual Horner-Emmons-Wadswort...

  6. Salicylic acid and ascorbic acid retrieve activity of antioxidative enzymes and structure of Caralluma tuberculata calli on PEG stress.

    PubMed

    Rehman, Riaz U; Zia, Muhammad; Chaudhary, Muhammad F

    2017-02-02

    Biochemical adaptations and morphological changes are cellular aptitude originated on biotic and abiotic stresses. Polyethylene glycol (PEG) induces drought stress in the nutrient solution. In the present investigation, Caralluma tuberculata calli is exposed to PEG and antioxidative molecules. By increasing the level of antioxidative enzymes (SOD, POD, CAT, APX, and GR), the PEG-stressed calli falls off upon exposure to non-enzymatic antioxidants (ascorbic acid and salicylic acid). Under PEG-stress, several cellular and sub-cellular changes such as alteration in plasma membrane thickness, change in nucleus shape, increase in nucleoli, deformation of thylakoid membranes, and increase in plastoglobuli are observed through electron microscopic images. From our results we conclude that application of PEG (a drought causative agent) leads to an increase in the level of antioxidative enzymes and also deformation of cellular organelles. However, application of ascorbic acid and salicylic acid eradicate drought effect induced by PEG.

  7. A study on the electrochemical synthesis of L-DOPA using oxidoreductase enzymes: optimization of an electrochemical process.

    PubMed

    Rahman, Siti Fauziyah; Gobikrishnan, Sriramulu; Indrawan, Natarianto; Park, Seok-Hwan; Park, Jae-Hee; Min, Kyoungseon; Yoo, Young Je; Park, Don-Hee

    2012-10-01

    Levodopa or L-3,4-dihydroxyphenylalanine (L-DOPA) is the precursor of the neurotransmitter dopamine. L-DOPA is a famous treatment for Parkinson's disease symptoms. In this study, electroenzymatic synthesis of L-DOPA was performed in a three-electrode cell, comprising a Ag/AgCl reference electrode, a platinum wire auxiliary electrode, and a glassy carbon working electrode. L-DOPA had an oxidation peak at 376 mV and a reduction peak at -550 mV. The optimum conditions of pH, temperature, and amount of free tyrosinase enzyme were pH 7, 30 degrees C, and 250 IU, respectively. The kinetic constant of the free tyrosinase enzyme was found for both cresolase and catacholase activity to be 0.25 and 0.4 mM, respectively. A cyclic voltammogram was used to investigate the electron transfer rate constant. The mean heterogeneous electron transfer rate (ke) was 5.8 × 10(-4) cm/s. The results suggest that the electroenzymatic method could be an alternative way to produce L-DOPA without the use of a reducing agent such as ascorbic acid.

  8. Δ(9)-Tetrahydrocannabinolic acid synthase production in Pichia pastoris enables chemical synthesis of cannabinoids.

    PubMed

    Lange, Kerstin; Schmid, Andreas; Julsing, Mattijs K

    2015-10-10

    Δ(9)-Tetrahydrocannabinol (THC) is of increasing interest as a pharmaceutical and bioactive compound. Chemical synthesis of THC uses a laborious procedure and does not satisfy the market demand. The implementation of biocatalysts for specific synthesis steps might be beneficial for making natural product availability independent from the plant. Δ(9)-Tetrahydrocannabinolic acid synthase (THCAS) from C. sativa L. catalyzes the cyclization of cannabigerolic acid (CBGA) to Δ(9)-tetrahydrocannabinolic acid (THCA), which is non-enzymatically decarboxylated to THC. We report the preparation of THCAS in amounts sufficient for the biocatalytic production of THC(A). Active THCAS was most efficiently obtained from Pichia pastoris. THCAS was produced on a 2L bioreactor scale and the enzyme was isolated by single-step chromatography with a specific activity of 73Ug(-1)total protein. An organic/aqueous two-liquid phase setup for continuous substrate delivery facilitated in situ product removal. In addition, THCAS activity in aqueous environments lasted for only 20min whereas the presence of hexane stabilized the activity over 3h. In conclusion, production of THCAS in P. pastoris Mut(S) KM71 KE1, subsequent isolation, and its application in a two-liquid phase setup enables the synthesis of THCA on a mg scale.

  9. Enzyme-entrapped mesoporous silica for treatment of uric acid disorders.

    PubMed

    Muthukoori, Shanthini; Narayanan, Naagarajan; Chandra, Manuguri Sesha Sarath; Sethuraman, Swaminathan; Krishnan, Uma Maheswari

    2013-05-01

    Gout is an abnormality in the body resulting in the accumulation of uric acid mainly in joints. Dissolution of uric acid crystals into soluble allantoin by the enzyme uricase might provide a better alternative for the treatment of gout. This work aims to investigate the feasibility of a transdermal patch loaded with uricase for better patient compliance. Mesoporous silica (SBA-15) was chosen as the matrix for immobilisation of uricase. Highly oriented mesoporous SBA-15 was synthesized, characterized and uricase was physisorbed in the mesoporous material. The percentage adsorption and release of enzyme in borate buffer was monitored. The release followed linear kinetics and greater than 80% enzyme activity was retained indicating the potential of this system as an effective enzyme immobilization matrix. The enzyme permeability was studied with Wistar rat skin and human cadaver skin. It was found that in case of untreated rat skin 10% of enzyme permeated through skin in 100 h. The permeation increased by adding permeation enhancer (combination of oleic acid in propylene glycol (OA in PG)). The permeation enhancement was studied under two concentrations of OA in PG (1%, 5%) in both rat and human cadaver skin and it was found that 1% OA in PG showed better result in rat skin and 5% OA in PG showed good results in human cadaver skin.

  10. Heat shock inhibits. alpha. -amylase synthesis in barley aleurone without inhibiting the activity of endoplasmic reticulum marker enzymes

    SciTech Connect

    Sticher, L.; Biswas, A.K.; Bush, D.S.; Jones, R.L. )

    1990-02-01

    The effects of heat shock on the synthesis of {alpha}-amylase and on the membranes of the endoplasmic reticulum (ER) of barley (Hordeum vulgare) aleurone were studied. Heat shock, imposed by raising the temperature of incubation from 25{degree}C to 40{degree}C for 3 hours, inhibits the accumulation of {alpha}-amylase and other proteins in the incubation medium of barley aleurone layers treated with gibberellic acid and Ca{sup 2+}. When ER is isolated from heat-shocked aleurone layers, less newly synthesized {alpha}-amylase is found associated with this membrane system. ER membranes, as indicated by the activities of NADH cytochrome c reductase and ATP-dependent Ca{sup 2+} transport, are not destroyed by heat stress, however. Although heat shock did not reduce the activity of ER membrane marker enzymes, it altered the buoyant density of these membranes. Whereas ER from control tissue showed a peak of marker enzyme activity at 27% to 28% sucrose (1.113-1.120 grams per cubic centimeter), ER from heat-shocked tissue peaked at 30% to 32% sucrose (1.127-1.137 grams per cubic centimeter). The synthesis of a group of proteins designated as heat-shock proteins (HSPs) was stimulated by heat shock. These HSPs were localized to different compartments of the aleurone cell. Several proteins ranging from 15 to 30 kilodaltons were found in the ER and the mitochondrial/plasma membrane fractions of heat-shocked cells, but none of the HSPs accumulated in the incubation medium of heat-shocked aleurone layers.

  11. Amino acid metabolism and protein synthesis in malarial parasites*

    PubMed Central

    Sherman, I. W.

    1977-01-01

    Malaria-infected red cells and free parasites have limited capabilities for the biosynthesis of amino acids. Therefore, the principal amino acid sources for parasite protein synthesis are the plasma free amino acids and host cell haemoglobin. Infected cells and plasmodia incorporate exogenously supplied amino acids into protein. However, the hypothesis that amino acid utilization (from an external source) is related to availability of that amino acid in haemoglobin is without universal support: it is true for isoleucine and for Plasmodium knowlesi and P. falciparum, but not for methionine, cysteine, and other amino acids, and it does not apply to P. lophurae. More by default than by direct evidence, haemoglobin is believed to be the main amino acid reservoir available to the intraerythrocytic plasmodium. Haemoglobin, ingested via the cytostome, is held in food vacuoles where auto-oxidation takes place. As a consequence, haem is released and accumulates in the vacuole as particulate haemozoin (= malaria pigment). Current evidence favours the view that haemozoin is mainly haematin. Acid and alkaline proteases (identified in crude extracts from mammalian and avian malarias) are presumably secreted directly into the food vacuole. They then digest the denatured globin and the resulting amino acids are incorporated into parasite protein. Cell-free protein synthesizing systems have been developed using P. knowlesi and P. lophurae ribosomes. In the main these systems are typically eukaryotic. Studies of amino acid metabolism are exceedingly limited. Arginine, lysine, methionine, and proline are incorporated into protein, whereas glutamic acid is metabolized via an NADP-specific glutamic dehydrogenase. Glutamate oxidation generates NADPH and auxiliary energy (in the form of α-ketoglutarate). The role of red cell glutathione in the economy of the parasite remains obscure. Important goals for future research should be: quantitative assessment of the relative importance of

  12. Orthogonal Synthesis of Xeno Nucleic Acids.

    PubMed

    Fiers, Guillaume; Chouikhi, Dalila; Oswald, Laurence; Al Ouahabi, Abdelaziz; Chan-Seng, Delphine; Charles, Laurence; Lutz, Jean-François

    2016-12-12

    Sequence-defined peptide triazole nucleic acids (PTzNA) were synthesized by means of a solid-phase orthogonal "AB+CD" iterative strategy. In this approach, AB and CD building blocks containing carboxylic acid (A), azide (B), alkyne (C), and primary amine (D) functions are assembled together by successive copper-catalyzed azide-alkyne cycloaddition (CuAAC) and acid-amine coupling steps. Different PTzNA genetic sequences were prepared using a library of eight building blocks (i.e., four AB and four CD building blocks).

  13. High-yield synthesis of bioactive ethyl cinnamate by enzymatic esterification of cinnamic acid.

    PubMed

    Wang, Yun; Zhang, Dong-Hao; Zhang, Jiang-Yan; Chen, Na; Zhi, Gao-Ying

    2016-01-01

    In this paper, Lipozyme TLIM-catalyzed synthesis of ethyl cinnamate through esterification of cinnamic acid with ethanol was studied. In order to increase the yield of ethyl cinnamate, several media, including acetone, isooctane, DMSO and solvent-free medium, were investigated in this reaction. The reaction showed a high yield by using isooctane as reaction medium, which was found to be much higher than the yields reported previously. Furthermore, several parameters such as shaking rate, water activity, reaction temperature, substrate molar ratio and enzyme loading had important influences on this reaction. For instance, when temperature increased from 10 to 50 °C, the initial reaction rate increased by 18 times and the yield of ethyl cinnamate increased by 6.2 times. Under the optimum conditions, lipase-catalyzed synthesis of ethyl cinnamate gave a maximum yield of 99%, which was of general interest for developing industrial processes for the preparation of ethyl cinnamate.

  14. Sialic acid C-glycosides with aromatic residues: investigating enzyme binding and inhibition of Trypanosoma cruzi trans-sialidase.

    PubMed

    Meinke, Sebastian; Schroven, Andreas; Thiem, Joachim

    2011-06-21

    Several α-configured C-sialosides were synthesised by cross metathesis and further synthetic derivatisation to obtain ligands for Trypanosoma cruzi trans-sialidase (TcTS), a key enzyme in Chagas disease. Affinities of these compounds to immobilised TcTS were measured by surface plasmon resonance (SPR). The K(D) values thus obtained are in the lower millimolar range and will be discussed. The results show the importance of addressing Tyr(119) and Trp(312) side chains of TcTS in target oriented ligand synthesis, since these amino acids constitute the acceptor binding region in the active site of TcTS. The best ligand showed a significant decrease of TcTS activity in a preliminary NMR based inhibition assay.

  15. The effect of Centella asiatica, vitamins, glycolic acid and their mixtures preparations in stimulating collagen and fibronectin synthesis in cultured human skin fibroblast.

    PubMed

    Hashim, Puziah

    2014-03-01

    Centella asiatica (Linn.) Urban is well known in promoting wound healing and provides significant benefits in skin care and therapeutic products formulation. Glycolic acid and vitamins also play a role in the enhancement of collagen and fibronectin synthesis. Here, we evaluate the specific effect of Centella asiatica (CA), vitamins, glycolic acid and their mixture preparations to stimulate collagen and fibronectin synthesis in cultured human fibroblast cells. The fibroblast cells are incubated with CA, glycolic acid, vitamins and their mixture preparations for 48 h. The cell lysates were analyzed for protein content and collagen synthesis by direct binding enzyme immunoassay. The fibronectin of the cultured supernatant was measured by sandwich enzyme immunoassay. The results showed that CA, glycolic acid, vitamins A, E and C significantly stimulate collagen and fibronectin synthesis in the fibroblast. Addition of glycolic acid and vitamins to CA further increased the levels of collagen and fibronectin synthesis to 8.55 and 23.75 μg/100 μg, respectively. CA, glycolic acid, vitamins A, E, and C, and their mixtures demonstrated stimulatory effect on both extra-cellular matrix synthesis of collagen and fibronectin in in vitro studies on human foreskin fibroblasts, which is beneficial to skin care and therapeutic products formulation.

  16. Amino acid synthesis in a supercritical carbon dioxide - water system.

    PubMed

    Fujioka, Kouki; Futamura, Yasuhiro; Shiohara, Tomoo; Hoshino, Akiyoshi; Kanaya, Fumihide; Manome, Yoshinobu; Yamamoto, Kenji

    2009-06-15

    Mars is a CO(2)-abundant planet, whereas early Earth is thought to be also CO(2)-abundant. In addition, water was also discovered on Mars in 2008. From the facts and theory, we assumed that soda fountains were present on both planets, and this affected amino acid synthesis. Here, using a supercritical CO(2)/liquid H(2)O (10:1) system which mimicked crust soda fountains, we demonstrate production of amino acids from hydroxylamine (nitrogen source) and keto acids (oxylic acid sources). In this research, several amino acids were detected with an amino acid analyzer. Moreover, alanine polymers were detected with LC-MS. Our research lights up a new pathway in the study of life's origin.

  17. Amino Acid Synthesis in a Supercritical Carbon Dioxide - Water System

    PubMed Central

    Fujioka, Kouki; Futamura, Yasuhiro; Shiohara, Tomoo; Hoshino, Akiyoshi; Kanaya, Fumihide; Manome, Yoshinobu; Yamamoto, Kenji

    2009-01-01

    Mars is a CO2-abundant planet, whereas early Earth is thought to be also CO2-abundant. In addition, water was also discovered on Mars in 2008. From the facts and theory, we assumed that soda fountains were present on both planets, and this affected amino acid synthesis. Here, using a supercritical CO2/liquid H2O (10:1) system which mimicked crust soda fountains, we demonstrate production of amino acids from hydroxylamine (nitrogen source) and keto acids (oxylic acid sources). In this research, several amino acids were detected with an amino acid analyzer. Moreover, alanine polymers were detected with LC-MS. Our research lights up a new pathway in the study of life’s origin. PMID:19582225

  18. [Possible route for thiamine participation in fatty acid synthesis].

    PubMed

    Buko, V U; Larin, F S

    1976-01-01

    The possibility of thiamine partaking in the synthesis of fatty acids through the functions unrelated to the catalytic properties of thiamine-diphosphate was studied. Rats kept on a fat-free ration devoid of thiamine were given thiamine of thiochrome with no vitaminic properties. The total fatty acids content in different tissues and incorporation therein of tagged acetate and pyruvate was determined, while the fatty acids composition of the liver was investigated by using gas chromatography. Thiamine and thiochrome produced a similar effect on a number of the study factors, i.e. they forced down the total acids level in the spleen, intensified incorporation of tagged acetate and pyruvate in fatty acids of the heart and uniformly changed the fatty acids composition in the liver. It is suggested that the unindirectional effects of thiamine and thiochrome is due to the oxidative transformation of thiamine into thiochrome.

  19. Synthesis of gold nanoparticles using various amino acids.

    PubMed

    Maruyama, Tatsuo; Fujimoto, Yuhei; Maekawa, Tetsuya

    2015-06-01

    Gold nanoparticles (4-7nm) were synthesized from tetraauric acid using various amino acids as reducing and capping agents. The gold nanoparticles were produced from the incubation of a AuCl4(-) solution with an amino acid at 80°C for 20min. Among the twenty amino acids tested, several amino acids produced gold nanoparticles. The color of the nanoparticle solutions varied with the amino acids used for the reduction. We adopted l-histidine as a reducing agent and investigated the effects of the synthesis conditions on the gold nanoparticles. The His and AuCl4(-) concentrations affected the size of the gold nanoparticles and their aggregates. The pH of the reaction solution also affected the reaction yields and the shape of the gold nanoparticles.

  20. Interrelated effects of dihomo-γ-linolenic and arachidonic acids, and sesamin on hepatic fatty acid synthesis and oxidation in rats.

    PubMed

    Ide, Takashi; Ono, Yoshiko; Kawashima, Hiroshi; Kiso, Yoshinobu

    2012-12-14

    Interrelated effects of dihomo-γ-linolenic acid (DGLA) and arachidonic acid (ARA), and sesamin, a sesame lignan, on hepatic fatty acid synthesis and oxidation were examined in rats. Rats were fed experimental diets supplemented with 0 or 2 g/kg sesamin (1:1 mixture of sesamin and episesamin), containing 100 g/kg of maize oil or fungal oil rich in DGLA or ARA for 16 d. Among the groups fed sesamin-free diets, oils rich in DGLA or ARA, especially the latter, compared with maize oil strongly reduced the activity and mRNA levels of various lipogenic enzymes. Sesamin, irrespective of the type of fat, reduced the parameters of lipogenic enzymes except for malic enzyme. The type of dietary fat was rather irrelevant in affecting hepatic fatty acid oxidation among rats fed the sesamin-free diets. Sesamin increased the activities of enzymes involved in fatty acid oxidation in all groups of rats given different fats. The extent of the increase depended on the dietary fat type, and the values became much higher with a diet containing sesamin and oil rich in ARA in combination than with a diet containing lignan and maize oil. Analyses of mRNA levels revealed that the combination of sesamin and oil rich in ARA compared with the combination of lignan and maize oil markedly increased the gene expression of various peroxisomal fatty acid oxidation enzymes but not mitochondrial enzymes. The enhancement of sesamin action on hepatic fatty acid oxidation was also confirmed with oil rich in DGLA but to a lesser extent.

  1. Simple, high-yield synthesis of polyhedral carborane amino acids

    SciTech Connect

    Kahl, S.B.; Kasar, R.A.

    1996-02-07

    Boron neutron capture therapy (BNCT) is a form of binary cancer therapy that offers the potential of delivering spatially selective, high linear energy transfer radiation to the target cells while sparing surrounding normal tissue. We have demonstarted a versatile, general method for the conversion of o- ,m-, and p-carborane to their corresponding Boc-protected amino acids. Heterobifunctional polyhedral carboranes are exceedingly rare in the literature, and the amino acids prepared by this general method may prove to be valuable synthons for use in the synthesis of tumor-seeking compounds for BNCT or PDT. Morever, these conformationally constrained amino acids should be particularly interesting for use in peptide synthesis. The dihedral angle between the carbon atoms of these polyhedra increases in the order 60{degree} (ortho), 110{degree} (meta), and 180{degree} (para), allowing the peptide chemist to select a desired conformation. 11 refs.

  2. Benzylidene Acetal Protecting Group as Carboxylic Acid Surrogate: Synthesis of Functionalized Uronic Acids and Sugar Amino Acids.

    PubMed

    Banerjee, Amit; Senthilkumar, Soundararasu; Baskaran, Sundarababu

    2016-01-18

    Direct oxidation of the 4,6-O-benzylidene acetal protecting group to C-6 carboxylic acid has been developed that provides an easy access to a wide range of biologically important and synthetically challenging uronic acid and sugar amino acid derivatives in good yields. The RuCl3 -NaIO4 -mediated oxidative cleavage method eliminates protection and deprotection steps and the reaction takes place under mild conditions. The dual role of the benzylidene acetal, as a protecting group and source of carboxylic acid, was exploited in the efficient synthesis of six-carbon sialic acid analogues and disaccharides bearing uronic acids, including glycosaminoglycan analogues.

  3. Lipid metabolism during bacterial growth, sporulation, and germination: differential synthesis of individual branched- and normal-chain fatty acids during spore germination and outgrowth of Bacillus thuringiensis.

    PubMed

    Nickerson, K W; Bulla, L A; Mounts, T L

    1975-12-01

    The biosynthesis of individual branched- and normal-chain fatty acids during Bacillus thuringiensis spore germination and outgrowth was studied by comparing pulsed and continuous labeling of these fatty acids with [U-14C]acetate. The relative specific activity of each fatty acid varies with time as the cell progresses through outgrowth. However, fatty acid synthesis does occur in two distinct phases. Upon germination, acetate is incorporated only into the iso-isomers i-C13, i-C14, and i-C16; no normal or anteiso synthesis occurs. Subsequent to T30, the full complement of branched- and normal-chain homologues is formed and there is a dramatic enhancement in the overall rate of fatty acid synthesis. Significantly, this rate increase coincides with a marked shift from the synthesis of short-chain to long-chain fatty acids. These findings illustrate a dichotomy in synthesis that may result from initial fatty acid formation by preexisting spore fatty acid biosynthetic enzymes in the absence of de novo protein synthesis. Elucidation of the timing and kinetics of individual fatty acid formation provides a biochemical profile of activities directly related to membrane differentiation and cellular development.

  4. Inhibition of Vibrio harveyi bioluminescence by cerulenin: In vivo evidence for covalent modification of the reductase enzyme involved in aldehyde synthesis

    SciTech Connect

    Byers, D.M. ); Meighen, E.A. )

    1989-07-01

    Bacterial bioluminescence is very sensitive to cerulenin, a fungal antibiotic which is known to inhibit fatty acid synthesis. When Vibrio harveyi cells pretreated with cerulenin were incubated with ({sup 3}H)myristic acid in vivo, acylation of the 57-kilodalton reductase subunit of the luminescence-specific fatty acid reductase complex was specifically inhibited. Light emission of wild-type V. harveyi was 20-fold less sensitive to cerulenin at low concentrations (10{mu}g/ml) than that of the dark mutant strain M17, which requires exogenous myristic acid for luminescence because of a defective transferase subunit. The sensitivity of myristic acid-stimulated luminescence in the mutant strain M17 exceeded that of phospholipid synthesis from ({sup 14}C)acetate, whereas uptake and incorporation of exogenous ({sup 14}C)myristic acid into phospholipids was increased by cerulenin. The reductase subunit could be labeled by incubating M17 cells with ({sup 3}H)tetrahydrocerulenin; this labeling was prevented by preincubation with either unlabeled cerulenin or myristic acid. Labeling of the reductase subunit with ({sup 3}H)tetrahydrocerulenin was also noted in an aldehyde-stimulated mutant (A16) but not in wild-type cells or in another aldehyde-stimulated mutant (M42) in which ({sup 3}H)myristoyl turnover at the reductase subunit was found to be defective. These results indicate that (i) cerulenin specifically and covalently inhibits the reductase component of aldehyde synthesis, (ii) this enzyme is partially protected from cerulenin inhibition in the wild-type strain in vivo, and (iii) two dark mutants which exhibit similar luminescence phenotypes (mutants A16 and M42) are blocked at different stages of fatty acid reduction.

  5. Lactide Synthesis and Chirality Control for Polylactic acid Production.

    PubMed

    Van Wouwe, Pieter; Dusselier, Michiel; Vanleeuw, Evelien; Sels, Bert

    2016-05-10

    Polylactic acid (PLA) is a very promising biodegradable, renewable, and biocompatible polymer. Aside from its production, its application field is also increasing, with use not only in commodity applications but also as durables and in biomedicine. In the current PLA production scheme, the most expensive part is not the polymerization itself but obtaining the building blocks lactic acid (LA) and lactide, the actual cyclic monomer for polymerization. Although the synthesis of LA and the polymerization have been studied systematically, reports of lactide synthesis are scarce. Most lactide synthesis methods are described in patent literature, and current energy-intensive, aselective industrial processes are based on archaic scientific literature. This Review, therefore, highlights new methods with a technical comparison and description of the different approaches. Water-removal methodologies are compared, as this is a crucial factor in PLA production. Apart from the synthesis of lactide, this Review also emphasizes the use of chemically produced racemic lactic acid (esters) as a starting point in the PLA production scheme. Stereochemically tailored PLA can be produced according to such a strategy, giving access to various polymer properties.

  6. Steroselective synthesis and application of L-( sup 15 N) amino acids

    SciTech Connect

    Unkefer, C.J. ); Lodwig, S.N. . Div. of Science)

    1991-01-01

    We have developed two general approaches to the stereoselective synthesis of {sup 15}N- and {sup 13}C-labeled amino acids. First, labeled serine, biosynthesized using the methylotrophic bacterium M. extorquens AM1, serves as a chiral precursor for the synthesis of other amino acids. For example, pyridoxal phosphate enzymes can be used for the conversion of L-({alpha}-{sup 15}N)serine to L-({alpha}-{sup 15}N)tyrosine, L-({alpha}-{sup 15}N)tryptophan, and L-({alpha}-{sup 15}N)cysteine. In the second approach, developed by Oppolzer and Tamura, an electrophilic amination'' reagent, 1-chloro-1-nitrosocyclohexane, was used to convert chiral enolates into L-{alpha}-amino acids. We prepared 1-chloro-1-({sup 15}N) nitrosocyclohexane and used it to aminate chiral enolates to produce L-({alpha}-{sup 15}N)amino acids. The stereoselectivity of this scheme using the Oppolzer sultam chiral auxiliary is remarkable, producing enantiomer ratios of 200 to 1. 22 refs., 4 figs.

  7. Identification of genes and pathways involved in the synthesis of Mead acid (20:3n-9), an indicator of essential fatty acid deficiency.

    PubMed

    Ichi, Ikuyo; Kono, Nozomu; Arita, Yuka; Haga, Shizuka; Arisawa, Kotoko; Yamano, Misato; Nagase, Mana; Fujiwara, Yoko; Arai, Hiroyuki

    2014-01-01

    In mammals, 5,8,11-eicosatrienoic acid (Mead acid, 20:3n-9) is synthesized from oleic acid during a state of essential fatty acid deficiency (EFAD). Mead acid is thought to be produced by the same enzymes that synthesize arachidonic acid and eicosapentaenoic acid, but the genes and the pathways involved in the conversion of oleic acid to Mead acid have not been fully elucidated. The levels of polyunsaturated fatty acids in cultured cells are generally very low compared to those in mammalian tissues. In this study, we found that cultured cells, such as NIH3T3 and Hepa1-6 cells, have significant levels of Mead acid, indicating that cells in culture are in an EFAD state under normal culture conditions. We then examined the effect of siRNA-mediated knockdown of fatty acid desaturases and elongases on the level of Mead acid, and found that knockdown of Elovl5, Fads1, or Fads2 decreased the level of Mead acid. This and the measured levels of possible intermediate products for the synthesis of Mead acid such as 18:2n-9, 20:1n-9 and 20:2n-9 in the knocked down cells indicate two pathways for the synthesis of Mead acid: pathway 1) 18:1n-9→(Fads2)→18:2n-9→(Elovl5)→20:2n-9→(Fads1)→20:3n-9 and pathway 2) 18:1n-9→(Elovl5)→20:1n-9→(Fads2)→20:2n-9→(Fads1)→20:3n-9.

  8. Occurrence of Arginine Deiminase Pathway Enzymes in Arginine Catabolism by Wine Lactic Acid Bacteria

    PubMed Central

    Liu, S.; Pritchard, G. G.; Hardman, M. J.; Pilone, G. J.

    1995-01-01

    l-Arginine, an amino acid found in significant quantities in grape juice and wine, is known to be catabolized by some wine lactic acid bacteria. The correlation between the occurrence of arginine deiminase pathway enzymes and the ability to catabolize arginine was examined in this study. The activities of the three arginine deiminase pathway enzymes, arginine deiminase, ornithine transcarbamylase, and carbamate kinase, were measured in cell extracts of 35 strains of wine lactic acid bacteria. These enzymes were present in all heterofermentative lactobacilli and most leuconostocs but were absent in all the homofermentative lactobacilli and pediococci examined. There was a good correlation among arginine degradation, formation of ammonia and citrulline, and the occurrence of arginine deiminase pathway enzymes. Urea was not detected during arginine degradation, suggesting that the catabolism of arginine did not proceed via the arginase-catalyzed reaction, as has been suggested in some earlier studies. Detection of ammonia with Nessler's reagent was shown to be a simple, rapid test to assess the ability of wine lactic acid bacteria to degrade arginine, although in media containing relatively high concentrations (>0.5%) of fructose, ammonia formation is inhibited. PMID:16534912

  9. Biological Monitoring of 3-Phenoxybenzoic Acid in Urine by an Enzyme -Linked Immunosorbent Assay

    EPA Science Inventory

    An enzyme-linked immunosorbent assay (ELISA) method was employed for determination of the pyrethroid biomarker, 3-phenoxybenzoic acid (3-PBA) in human urine samples. The optimized coating antigen concentration was 0.5 ng/mL with a dilution of 1:4000 for the 3-PBA antibody and 1:6...

  10. Zeolite molecular sieves have dramatic acid-base effects on enzymes in nonaqueous media.

    PubMed

    Fontes, Nuno; Partridge, Johann; Halling, Peter J; Barreiros, Susana

    2002-02-05

    Zeolite molecular sieves very commonly are used as in situ drying agents in reaction mixtures of enzymes in nonaqueous media. They often affect enzyme behavior, and this has been interpreted in terms of altered hydration. Here, we show that zeolites can also have dramatic acid-base effects on enzymes in low water media, resulting from their cation-exchange ability. Initial rates of transesterification catalyzed by cross-linked crystals of subtilisin were compared in supercritical ethane, hexane, and acetonitrile with water activity fixed by pre-equilibration. Addition of zeolite NaA (4 A powder) still caused remarkable rate enhancements (up to 20-fold), despite the separate control of hydration. In the presence of excess of an alternative solid-state acid-base buffer, however, zeolite addition had no effect. The more commonly used Merck molecular sieves (type 3 A beads) had similar but somewhat smaller effects. All zeolites have ion-exchange ability and can exchange H+ for cations such as Na+ and K+. These exchanges will tend to affect the protonation state of acidic groups in the protein and, hence, enzymatic activity. Zeolites pre-equilibrated in aqueous suspensions of varying pH-pNa gave very different enzyme activities. Their differing basicities were demonstrated directly by equilibration with an indicator dissolved in toluene. The potential of zeolites as acid-base buffers for low-water media is discussed, and their ability to overcome pH memory is demonstrated.

  11. Cell organelles from crassulacean acid metabolism (CAM) plants : II. Compartmentation of enzymes of the crassulacean acid metabolism.

    PubMed

    Schnarrenberger, C; Groß, D; Burkhard, C; Herbert, M

    1980-02-01

    The intracellular distribution of enzymes involved in the Crassulacean acid metabolism (CAM) has been studied in Bryophyllum calycinum Salisb. and Crassula lycopodioides Lam. After separation of cell organelles by isopycnic centrifugation, enzymes of the Crassulacean acid metabolism were found in the following cell fractions: Phosphoenolpyruvate carboxylase in the chloroplasts; NAD-dependent malate dehydrogenase in the mitochondria and in the supernatant; NADP-dependent malate dehydrogenase and phosphoenolpyruvate carboxykinase in the chloroplasts; NADP-dependent malic enzyme in the supernatant and to a minor extent in the chloroplasts; NAD-dependent malic enzyme in the supernatant and to some degree in the mitochondria; and pyruvate; orthophosphate dikinase in the chloroplasts. The activity of the NAD-dependent malate dehydrogenase was due to three isoenzymes separated by (NH4)2SO4 gradient solubilization. These isoenzymes represented 17, 78, and 5% of the activity recovered, respectively, in the order of elution. The isoenzyme eluting first was associated with the mitochondria and the second isoenzyme was of cytosolic origin, while the intracellular location of the third isoenzyme was probably the peroxisome. Based on these findings, the metabolic path of Crassulacean acid metabolism within cells of CAM plants is discussed.

  12. Influence of pancreatic hormones on enzymes concerned with urea synthesis in rat liver

    PubMed Central

    McLean, Patricia; Novello, F.

    1965-01-01

    1. The activities of enzymes of the urea cycle [carbamoyl phosphate synthetase, ornithine transcarbamoylase, argininosuccinate synthetase, argininosuccinase (these last two comprising the arginine-synthetase system) and arginase] have been measured in control, alloxan-diabetic and glucagon-treated rats. In addition, measurements were made on alloxan-diabetic rats treated with protamine–zinc–insulin. 2. Treatment of rats with glucagon for 3 days results in a marked increase in the activities of three enzymes of the urea cycle (carbamoyl phosphate synthetase, argininosuccinate synthetase and argininosuccinase). The pattern of change in the alloxan-diabetic group is very similar to that of the glucagon-treated group, although the magnitude of the change was much greater. 3. Comparison was made of the actual and potential rate of urea synthesis in normal and diabetic rats. In both groups the potential rate of urea production, as measured by the activity of the rate-limiting enzyme, argininosuccinate synthetase, slightly exceeds the actual rate of synthesis by liver slices in the presence of substrates. The relative activities of the actual and potential rates were similar in the two groups of animals, this ratio being 1:0·70. 4. In the alloxan-diabetic rats treated with protamine–zinc–insulin for 2·5 or 4 days there was a marked increase in liver weight. This was associated with a rise in the total hepatic activity of the urea-cycle enzymes located in the soluble fraction of the cell (the arginine-synthetase system and arginase) after 2·5 days of treatment. After 4 days of treatment the concentration of these enzymes/g. of liver decreased, and the total hepatic content then reverted to the untreated alloxan-diabetic value. 5. No effects of glucagon or of insulin in vitro could be found on the rate of urea production by liver slices. 6. The present results are discussed in relation to how far this pattern of change is typical of conditions resulting in a high

  13. Daily rhythms of glycerophospholipid synthesis in fibroblast cultures involve differential enzyme contributions[S

    PubMed Central

    Acosta-Rodríguez, Victoria A.; Márquez, Sebastián; Salvador, Gabriela A.; Pasquaré, Susana J.; Gorné, Lucas D.; Garbarino-Pico, Eduardo; Giusto, Norma M.; Guido, Mario Eduardo

    2013-01-01

    Circadian clocks regulate the temporal organization of several biochemical processes, including lipid metabolism, and their disruption leads to severe metabolic disorders. Immortalized cell lines acting as circadian clocks display daily variations in [32P]phospholipid labeling; however, the regulation of glycerophospholipid (GPL) synthesis by internal clocks remains unknown. Here we found that arrested NIH 3T3 cells synchronized with a 2 h-serum shock exhibited temporal oscillations in a) the labeling of total [3H] GPLs, with lowest levels around 28 and 56 h, and b) the activity of GPL-synthesizing and GPL-remodeling enzymes, such as phosphatidate phosphohydrolase 1 (PAP-1) and lysophospholipid acyltransferases (LPLAT), respectively, with antiphase profiles. In addition, we investigated the temporal regulation of phosphatidylcholine (PC) biosynthesis. PC is mainly synthesized through the Kennedy pathway with choline kinase (ChoK) and CTP:phosphocholine cytidylyltranferase (CCT) as key regulatory enzymes. We observed that the PC labeling exhibited daily changes, with the lowest levels every ∼28 h, that were accompanied by brief increases in CCT activity and the oscillation in ChoK mRNA expression and activity. Results demonstrate that the metabolisms of GPLs and particularly of PC in synchronized fibroblasts are subject to a complex temporal control involving concerted changes in the expression and/or activities of specific synthesizing enzymes. PMID:23641021

  14. Application of ionic liquids based enzyme-assisted extraction of chlorogenic acid from Eucommia ulmoides leaves.

    PubMed

    Liu, Tingting; Sui, Xiaoyu; Li, Li; Zhang, Jie; Liang, Xin; Li, Wenjing; Zhang, Honglian; Fu, Shuang

    2016-01-15

    A new approach for ionic liquid based enzyme-assisted extraction (ILEAE) of chlorogenic acid (CGA) from Eucommia ulmoides is presented in which enzyme pretreatment was used in ionic liquids aqueous media to enhance extraction yield. For this purpose, the solubility of CGA and the activity of cellulase were investigated in eight 1-alkyl-3-methylimidazolium ionic liquids. Cellulase in 0.5 M [C6mim]Br aqueous solution was found to provide better performance in extraction. The factors of ILEAE procedures including extraction time, extraction phase pH, extraction temperatures and enzyme concentrations were investigated. Moreover, the novel developed approach offered advantages in term of yield and efficiency compared with other conventional extraction techniques. Scanning electronic microscopy of plant samples indicated that cellulase treated cell wall in ionic liquid solution was subjected to extract, which led to more efficient extraction by reducing mass transfer barrier. The proposed ILEAE method would develope a continuous process for enzyme-assisted extraction including enzyme incubation and solvent extraction process. In this research, we propose a novel view for enzyme-assisted extraction of plant active component, besides concentrating on enzyme facilitated cell wall degradation, focusing on improvement of bad permeability of ionic liquids solutions.

  15. Amino acid metabolism and protein synthesis in lactating rats fed on a liquid diet.

    PubMed Central

    Barber, T; García de la Asunción, J; Puertes, I R; Viña, J R

    1990-01-01

    1. Amino acid metabolism was studied in control virgin rats, lactating rats and virgin rats protein-pair-fed with the lactating rats (high-protein virgin rats). 2. Urinary excretion of nitrogen and urea was higher in lactating than in control virgin rats, and in high-protein virgin rats it was higher than in lactating rats. 3. The activities of urea-cycle enzymes (units/g) were higher in high-protein virgin than in lactating rats, except for arginase. In lactating rats the activities of carbamoyl-phosphate synthase, ornithine carbamoyltransferase and argininosuccinate synthase were lower than in control virgin rats. When the liver size is considered, the activities in lactating rats were similar to those in high-protein virgin rats, except for arginase. 4. N-Acetylglutamate content was higher in high-protein virgin rats than in the other two groups. 5. The rate of urea synthesis from precursors by isolated hepatocytes was higher in high-protein virgin rats than in the other two groups. 6. The flooding-dose method (L-[4-3H]phenylalanine) for measuring protein synthesis was used. The absolute synthesis rates of mammary gland, liver and small-intestinal mucosa were higher in lactating rats than in the other two groups, and in high-protein virgin rats than in control virgin rats 7. These results show that the increased needs for amino acids during lactation are met by hyperphagia and by a nitrogen-sparing mechanism. PMID:2396994

  16. Fatty acid effects on fibroblast cholesterol synthesis

    SciTech Connect

    Shireman, R.B.; Muth, J.; Lopez, C.

    1987-05-01

    Two cell lines of normal (CRL 1475, GM5565) and of familial hypercholesterolemia (FH) (CM 486,488) fibroblasts were preincubated with medium containing the growth factor ITS, 2.5 mg/ml fatty acid-free BSA, or 35.2 ..mu..mol/ml of these fatty acids complexed with 2.5 mg BSA/ml: stearic (18:0), caprylic (8:0), oleic (18:1;9), linoleic (18:2;9,12), linolenic (18:3;9,12,15), docosahexaenoic (22:6;4,7,10,13,16,19)(DHA) or eicosapentaenoic (20:5;5,8,11,14,17)(EPA). After 20 h, cells were incubated for 2 h with 0.2 ..mu..Ci (/sup 14/C)acetate/ml. Cells were hydrolyzed; an aliquot was quantitated for radioactivity and protein. After saponification and extraction with hexane, radioactivity in the aqueous and organic phases was determined. The FH cells always incorporated 30-90% more acetate/mg protein than normal cells but the pattern of the fatty acid effects was similar in both types. When the values were normalized to 1 for the BSA-only group, cells with ITS had the greatest (/sup 14/C)acetate incorporation (1.45) followed by the caprylic group (1.14). Cells incubated with 18:3, 20:6 or 22:6 incorporated about the same amount as BSA-only. Those preincubated with 18:2, 18:1, 18:0 showed the least acetate incorporation (0.87, 0.59 and 0.52, respectively). The percentage of total /sup 14/C counts which extracted into hexane was much greater in FH cells; however, these values varied with the fatty acid, e.g., 1.31(18:0) and 0.84(8:0) relative to 1(BSA).

  17. Synthesis of some glucose-fatty acid esters by lipase from Candida antarctica and their emulsion functions.

    PubMed

    Ren, Kangzi; Lamsal, Buddhi P

    2017-01-01

    The synthesis of glucose esters with palmitic acid, lauric acid and hexanoic acid using lipase enzyme was studied and their emulsion functionality in oil-in-water system were compared. Reactions at 3:1M ratio of fatty acids-to-glucose had the highest conversion percentages (over 90% for each of the fatty acid). Initial conversion rate increased as substrate solubility increased. Ester bond formation was confirmed by nuclear magnetic resonance technique that the chemical shifts of glucose H-6 and α-carbon protons of fatty acids in the ester molecules shifted to the higher fields. Contact angle of water on esters' pelleted surface increased as the hydrophobicity increased. Glucose esters' and commercial sucrose esters' functionality as emulsifiers were compared. Glucose esters delayed, but did not prevent coalescence, because the oil droplets diameter doubled during 7days. Sucrose esters prevented coalescence during 7days since the droplets diameter did not have significant change.

  18. Synthesis of (2S)-2-amino-7,8-epoxyoctanoic Acid and Structure of its Metal-Bridging Complex with Human Arginase I

    SciTech Connect

    Zakharian, T.; Di Costanzo, L; Christianson, D

    2008-01-01

    The synthesis of (2S)-2-amino-7,8-epoxyoctanoic acid is reported along with the X-ray crystal structure of its complex with human arginase I, revealing unique coordination interactions with two manganese ions in the enzyme active site.

  19. Cinnamic acid 4-hydroxylase of sorghum [Sorghum biocolor (L.) Moench] gene SbC4H1 restricts lignin synthesis in Arabidopsis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cinnamic acid 4-hydroxylase (C4H) is the first hydroxylase enzyme of the phenylpropanoid pathway, and its content and activity affects the lignin synthesis. In this study, we isolated a C4H gene SbC4H1 from the suppression subtractive hybridization library of brown midrib (bmr) mutants of Sorghum b...

  20. Origin of fatty acid synthesis - Thermodynamics and kinetics of reaction pathways

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1991-01-01

    The primitiveness of contemporary fatty acid biosynthesis was evaluated by using the thermodynamics and kinetics of its component reactions to estimate the extent of its dependence on powerful and selective catalysis by enzymes. Since this analysis indicated that the modern pathway is not primitive because it requires sophisticated enzymatic catalysis, an alternative pathway of primitive fatty acid synthesis is proposed that uses glycolaldehyde as a substrate. In contrast to the modern pathway, this primitive pathway is not dependent on an exogenous source of phosphoanhydride energy. Furthermore, the chemical spontaneity of its reactions suggests that it could have been readily catalyzed by the rudimentary biocatalysts available at an early stage in the origin of life.

  1. Innovative use of a bacterial enzyme involved in sialic acid degradation to initiate sialic acid biosynthesis in glycoengineered insect cells

    PubMed Central

    Geisler, Christoph; Jarvis, Donald L.

    2012-01-01

    The baculovirus/insect cell system is widely used for recombinant protein production, but it is suboptimal for recombinant glycoprotein production because it does not provide sialylation, which is an essential feature of many glycoprotein biologics. This problem has been addressed by metabolic engineering, which has extended endogenous insect cell N-glycosylation pathways and enabled glycoprotein sialylation by baculovirus/insect cell systems. However, further improvement is needed because even the most extensively engineered baculovirus/insect cell systems require media supplementation with N-acetylmannosamine, an expensive sialic acid precursor, for efficient recombinant glycoprotein sialylation. Our solution to this problem focused on E. coli N-acetylglucosamine-6-phosphate 2′-epimerase (GNPE), which normally functions in bacterial sialic acid degradation. Considering that insect cells have the product, but not the substrate for this enzyme, we hypothesized that GNPE might drive the reverse reaction in these cells, thereby initiating sialic acid biosynthesis in the absence of media supplementation. We tested this hypothesis by isolating transgenic insect cells expressing E. coli GNPE together with a suite of mammalian genes needed for N-glycoprotein sialylation. Various assays showed that these cells efficiently produced sialic acid, CMP-sialic acid, and sialylated recombinant N-glycoproteins even in growth media without N-acetylmannosamine. Thus, this study demonstrated that a eukaryotic recombinant protein production platform can be glycoengineered with a bacterial gene, that a bacterial enzyme which normally functions in sialic acid degradation can be used to initiate sialic acid biosynthesis, and that insect cells expressing this enzyme can produce sialylated N-glycoproteins without N-acetylmannosamine supplementation, which will reduce production costs in glycoengineered baculovirus/insect cell systems. PMID:23022569

  2. A Concise Synthesis of Berkelic Acid Inspired by Combining the Natural Products Spicifernin and Pulvilloric Acid

    PubMed Central

    Bender, Christopher F.; Yoshimoto, Francis K.; Paradise, Christopher L.; De Brabander, Jef K.

    2009-01-01

    We describe a concise synthesis of the structurally novel fungal extremophile metabolite berkelic acid – an effort leading to an unambiguous assignment of C22 stereochemistry. Our synthetic approach was inspired by the recognition that berkelic acid displays structural characteristics reminiscent of two other fungal metabolites, spicifernin and pulvilloric acid. Based on this notion, we executed a synthesis that features a Ag-catalyzed cascade dearomatization-cycloisomerization-cycloaddition sequence to couple two natural product inspired fragments. Notably, a spicifernin-like synthon was prepared with defined C22 stereochemistry in seven steps and three purifications (24–28% overall yield). A potentially useful anti-selective conjugate propargylation reaction was developed to introduce the vicinal stereodiad. An enantioconvergent synthesis of the other coupling partner, the aromatic precursor to pulvilloric acid methyl ester, was achieved in eight steps and 48% overall yield. The total synthesis of berkelic acid and its C22 epimer was thus completed in 10 steps longest linear sequence and 11–27% overall yield. PMID:19722648

  3. Steroid synthesis by Taenia crassiceps WFU cysticerci is regulated by enzyme inhibitors.

    PubMed

    Aceves-Ramos, A; Valdez, R A; Gaona, B; Willms, K; Romano, M C

    2013-07-01

    Cysticerci and tapeworms from Taenia crassiceps WFU, ORF and Taenia solium synthesize sex-steroid hormones in vitro. Corticosteroids increase the 17β-estradiol synthesis by T. crassiceps cysticerci. T. crassiceps WFU cysticerci synthesize corticosteroids, mainly 11-deoxycorticosterone (DOC). The aim of this work was to investigate whether classical steroidogenic inhibitors modify the capacity of T. crassiceps WFU cysticerci to synthesize corticosteroids and sex steroid hormones. For this purpose, T. crassiceps WFU cysticerci were obtained from the abdominal cavity of mice, pre-cultured for 24h in DMEM+antibiotics/antimycotics and cultured in the presence of tritiated progesterone ((3)H-P4), androstendione ((3)H-A4), or dehydroepiandrosterone ((3)H-DHEA) plus different doses of the corresponding inhibitors, for different periods. Blanks with the culture media adding the tritiated precursors were simultaneously incubated. At the end of the incubation period, parasites were separated and media extracted with ether. The resulting steroids were separated by thin layer chromatography (TLC). Data were expressed as percent transformation of the tritiated precursors. Results showed that after 2h of exposure of the cysticerci to 100 μM formestane, the (3)H-17β-estradiol synthesis from tritiated androstenedione was significantly inhibited. The incubation of cysticerci in the presence of (3)H-DHEA and danazol (100 nM) resulted in (3)H-androstenediol accumulation and a significant reduction of the 17β-estradiol synthesis. The cysticerci (3)H-DOC synthesis was significantly inhibited when the parasites were cultured in the presence of different ketoconazole dosis. The drug treatments did not affect parasite's viability. The results of this study showed that corticosteroid and sex steroid synthesis in T. crassiceps WFU cysticerci can be modified by steroidogenic enzyme inhibitors. As was shown previously by our laboratory and others, parasite survival and development depends

  4. Stimulation of protein synthesis by phosphatidic acid in rat cardiomyocytes.

    PubMed

    Xu, Y J; Yau, L; Yu, L P; Elimban, V; Zahradka, P; Dhalla, N S

    1996-12-13

    Phosphatidic acid (PA) was observed to stimulate protein synthesis in adult cardiomyocytes in a time- and concentration-dependent manner. The maximal stimulation in protein synthesis (142 +/- 12% vs 100% as the control) was achieved at 10 microM PA within 60 min and was inhibited by actinomycin D (107 +/- 4% of the control) or cycloheximide (105 +/- 6% of the control). The increase in protein synthesis due to PA was attenuated or abolished by preincubation of cardiomyocytes with a tyrosine kinase inhibitor, genistein (94 +/- 9% of the control), phospholipase C inhibitors 2-nitro-4-carboxyphenyl N,N-diphenyl carbamate or carbon-odithioic acid O-(octahydro-4,7-methanol-1H-inden-5-yl (101 +/- 6 and 95 +/- 5% of the control, respectively), protein kinase C inhibitors staurosporine or polymyxin B (109 +/- 3 and 93 +/- 3% of the control), and chelators of extracellular and intracellular free Ca2+ EGTA or BAPTA/AM (103 +/- 6 and 95 +/- 6% of the control, respectively). PA at different concentrations (0.1 to 100 microM) also caused phosphorylation of a cell surface protein of approximately 24 kDa. In addition, mitogen-activated protein kinase was stimulated by PA in a concentration-dependent manner; maximal stimulation (217 +/- 6% of the control) was seen at 10 microM PA. These data suggest that PA increases protein synthesis in adult rat cardiomyocytes and thus may play an important role in the development of cardiac hypertrophy.

  5. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, A. L.

    1986-01-01

    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20% for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  6. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1987-01-01

    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20 percent for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  7. The effect of conjugated linoleic acids (CLA) supplementation on the activity of enzymes participating in the formation of arachidonic acid in liver microsomes of rats--probable mechanism of CLA anticancer activity.

    PubMed

    Stawarska, Agnieszka; Białek, Agnieszka; Stanimirova, Ivana; Stawarski, Tomasz; Tokarz, Andrzej

    2015-01-01

    The aim of the present research was to examine the effect of conjugated linoleic acids (CLA) supplementation on the activity of enzymes that take part in the synthesis of arachidonic acid (AA) and also to investigate the relation between their activity and the neoplastic process. The enzyme activities were established indirectly, because their measure was the amount of AA formed in vitro, being developed from linoleic acid as determined in liver microsomes of Spraque-Dawley rats. In addition, the indices of Δ⁶-desaturase (D6D) and Δ⁵-desaturase (D5D) were determined. To this aim, the method of high per-formance liquid chromatography with UV/VIS detection was used. Between the examined groups, statistically significant differences were observed in the activities of enzymes as well as D6D. The carcinogenic agent applied (DMBA) was found to significantly increase the activity of the examined enzymes. Negative correlation was found between the activities of desaturases and CLA supplementation, whereas the activity of those enzymes was a little higher in the group of rats with chemically induced cancer process. The neoplastic process has a stimulating effect on the activity of D6D. The decrease of D6D activity, resulting from the presence of CLA in the animals' diet, may confirm the anticancer properties of these isomers.

  8. Primary structure of a key enzyme in plant tetrapyrrole synthesis: glutamate 1-semialdehyde aminotransferase.

    PubMed Central

    Grimm, B

    1990-01-01

    The formation of delta-aminolevulinate from glutamate 1-semialdehyde (GSA) is catalyzed by glutamate 1-semialdehyde aminotransferase (EC 5.4.3.8). The active form of the barley enzyme appears to be a dimer of identical subunits with a molecular mass of 46 kDa. From the purified enzyme, amino acid sequences of the N-terminal ends of the mature protein as well as an internal peptide were determined. DNA primers deduced from these peptide sequences were used to amplify with the polymerase chain reaction a cDNA sequence encoding part of the enzyme. Screening a cDNA library with this DNA fragment identified a full-length clone encoding the 49,540-Da precursor of the GSA aminotransferase. The transit peptide for chloroplast import consists of 34 amino acids. GSA aminotransferase and a precursor form were expressed on a multicopy plasmid in Escherichia coli. Both recombinant gene products reacted with an antibody against the barley GSA aminotransferase. Active barley GSA aminotransferase expressed in E. coli was shown to be active in assays of bacterial cell extracts. As a gene symbol for barley GSA aminotransferase, Gsa is proposed. Images PMID:2349227

  9. Tannic acid-mediated green synthesis of antibacterial silver nanoparticles.

    PubMed

    Kim, Tae Yoon; Cha, Song-Hyun; Cho, Seonho; Park, Youmie

    2016-04-01

    The search for novel antibacterial agents is necessary to combat microbial resistance to current antibiotics. Silver nanoparticles (AgNPs) have been reported to be effective antibacterial agents. Tannic acid is a polyphenol compound from plants with antioxidant and antibacterial activities. In this report, AgNPs were prepared from silver ions by tannic acid-mediated green synthesis (TA-AgNPs). The reaction process was facile and involved mixing both silver ions and tannic acid. The absorbance at 423 nm in the UV-Visible spectra demonstrated that tannic acid underwent a reduction reaction to produce TA-AgNPs from silver ions. The synthetic yield of TA-AgNPs was 90.5% based on inductively coupled plasma mass spectrometry analysis. High-resolution transmission electron microscopy and atomic force microscopy images indicated that spherical-shaped TA-AgNPs with a mean particle size of 27.7-46.7 nm were obtained. Powder high-resolution X-ray diffraction analysis indicated that the TA-AgNP structure was face-centered cubic with a zeta potential of -27.56 mV. The hydroxyl functional groups of tannic acid contributed to the synthesis of TA-AgNPs, which was confirmed by Fourier transform infrared spectroscopy. The in vitro antibacterial activity was measured using the minimum inhibitory concentration (MIC) method. The TA-AgNPs were more effective against Gram-negative bacteria than Gram-positive bacteria. The MIC for the TA-AgNPs in all of the tested strains was in a silver concentration range of 6.74-13.48 μg/mL. The tannic acid-mediated synthesis of AgNPs afforded biocompatible nanocomposites for antibacterial applications.

  10. Is acetylcarnitine a substrate for fatty acid synthesis in plants

    SciTech Connect

    Roughan, G. ); Post-Beittenmiller, D.; Ohlrogge, J. ); Browse, J. )

    1993-04-01

    Long-chain fatty acid synthesis from [1-[sup 14]C]acetylcarnitine by chloroplasts isolated from spinach (Spinacia oleracea), pea (Pisum sativum), amaranthus (Amaranthus lividus), or maize (Zea mays) occurred at less than 2% of the rate of fatty acid synthesis from [1-[sup 14]C]acetate irrespective of the maturity of the leaves or whether the plastids were purified using sucrose or Percoll medium. [1-[sup 14]C]Acetylcarnitine was not significantly utilized by highly active chloroplasts rapidly prepared from pea and spinach using methods not involving density gradient centrifugation. [1-[sup 14]C]Acetylcarnitine was recovered quantitatively from chloroplast incubations following 10 min in the light. Unlabeled acetyl-L-carnitine (0.4 mM) did not compete with [1-[sup 14]C]acetate (0.2 mM) as a substrate for fatty acid synthesis by any of the more than 70 chloroplast preparations tested in this study. Carnitine acetyltransferase activity was not detected in any chloroplast preparation and was present in whole leaf homogenates at about 0.1% of the level of acetyl-coenzyme A synthetase activity. When supplied to detached pea shoots and detached spinach, amaranthus, and maize leaves via the transpiration stream, 1 to 4% of the [1-[sup 14]C]acetylcarnitine and 47 to 57% of the [1-[sup 14]C]acetate taken up was incorporated into lipids. Most (78--82%) of the [1-[sup 14]C]acetylcarnitine taken up was recovered intact. It is concluded that acetylcarnitine is not a major precursor for fatty acid synthesis in plants. 29 refs., 5 tabs.

  11. Application of quantitative targeted absolute proteomics to profile protein expression changes of hepatic transporters and metabolizing enzymes during cholic acid-promoted liver regeneration.

    PubMed

    Miura, Takayuki; Tachikawa, Masanori; Ohtsuka, Hideo; Fukase, Koji; Nakayama, Shun; Sakata, Naoaki; Motoi, Fuyuhiko; Naitoh, Takeshi; Katayose, Yu; Uchida, Yasuo; Ohtsuki, Sumio; Terasaki, Tetsuya; Unno, Michiaki

    2017-02-26

    Preoperative administration of cholic acid (CA) may be an option to increase the liver volume before elective liver resection surgery, so it is important to understand its effects on liver functionality for drug transport and metabolism. The purpose of this study was to clarify the absolute protein expression dynamics of transporters and metabolizing enzymes in the liver of mice fed CA-containing diet for 5 days (CA1) and mice fed CA-containing diet for 5 days followed by diet without CA for 7 days (CA2), in comparison with non CA-fed control mice. The CA1 group showed the increased liver weight, cell proliferation index, and oxidative stress, but no increase of apoptosis. Quantitative targeted absolute proteomics revealed (i) decreases in basolateral bile acid transporters ntcp, oatp1a1, oatp1b2, bile acid synthesis-related enzymes cyp7a1 and cyp8b1, and drug transporters bcrp, mrp6, ent1, oatp2b1, and (ii) increases in glutathione biosynthetic enzymes and drug-metabolizing enzyme cyp3a11. Liver concentrations of reduced and oxidized glutathione were both increased. In the CA2 group, the increased liver weight was maintained, while the biochemical features and protein profiles were restored to the non-CA-fed control levels. These findings suggest that CA administration alters liver functionality per body during liver regeneration and restoration.

  12. Impacts of simulated acid rain on soil enzyme activities in a latosol.

    PubMed

    Ling, Da-Jiong; Huang, Qian-Chun; Ouyang, Ying

    2010-11-01

    Acid rain pollution is a serious environmental problem in the world. This study investigated impacts of simulated acid rain (SAR) upon four types of soil enzymes, namely the catalase, acid phosphatase, urease, and amylase, in a latosol. Latosol is an acidic red soil and forms in the tropical rainforest biome. Laboratory experiments were performed by spraying the soil columns with the SAR at pH levels of 2.5, 3.0, 3.5., 4.0, 4.5, 5.0, and 7.0 (control) over a 20-day period. Mixed results were obtained in enzyme activities for different kinds of enzymes under the influences of the SAR. The catalase activities increased rapidly from day 0 to 5, then decreased slightly from day 5 to 15, and finally decreased sharply to the end of the experiments, whereas the acid phosphatase activities decreased rapidly from day 0 to 5, then increased slightly from day 5 to 15, and finally decreased dramatically to the end of the experiments. A decrease in urease activities was observed at all of the SAR pH levels for the entire experimental period, while an increase from day 0 to 5 and then a decrease from day 5 to 20 in amylase activities were observed at all of the SAR pH levels. In general, the catalase, acid phosphatase, and urease activities increased with the SAR pH levels. However, the maximum amylase activity was found at pH 4.0 and decreased as the SAR pH increased from 4.0 to 5.0 or decreased from 4.0 to 2.5. It is apparent that acid rain had adverse environmental impacts on soil enzyme activities in the latosol. Our study further revealed that impacts of the SAR upon soil enzyme activities were in the following order: amylase>catalase>acid phosphatase>urease. These findings provide useful information on better understanding and managing soil biological processes in the nature under the influence of acid rains.

  13. Influence of various concentrations of selenic acid (IV) on the activity of soil enzymes.

    PubMed

    Nowak, J; Kaklewski, K; Klódka, D

    2002-05-27

    The aim of this experiment was the assessment of the influence of various concentrations of H2SeO3 (0.05, 0.5 and 5 mM) on the activity of soil enzymes over 112 days. The lab experiment was performed using soil samples (dust-silt black soil of 1.92% organic C content, pH 7.7), 60% maximal water capacity. The soil samples were treated with a selenic acid water solution at the concentrations mentioned above. As a reference, natural soil was used (without the selenic acid). The activity of the following enzymes was tested: beta-glucosidase, nitrate reductase, urease, dehydrogenase, acid and alkaline phosphatases. The soil was sampled at days 0, 1, 3, 7, 14, 28, 56 and 112. The results of the study have shown that the selenic acid had no effect on the activity of the beta-glucosidase in soil. In the course of the whole experiment, the applied selenic acid inhibited activity of the nitrate reductase up to 70% at 5 mM, and the activity of dehydrogenase was also decreased--by up to 85% at 5 mM, similarly to urease (with the exception of days 14 and 28), and acid phosphatase (until day 56). The activity of alkaline phosphatase was increased by the lowest concentration of selenic acid and decreased by the highest, which was found in the course of the whole experiment. The 5-mM concentration of selenic acid inhibited the activity of all the enzymes tested in this experiment.

  14. In the aging housefly aconitase is the only citric acid cycle enzyme to decline significantly.

    PubMed

    Yarian, Connie S; Sohal, Rajindar S

    2005-04-01

    The main objective of this study was to determine if the activities of the mitochondrial citric acid cycle enzymes are altered during the normal aging process. Flight muscle mitochondria of houseflies of different ages were used as a model system because of their apparent age-related decline in bioenergetic efficiency, evident as a failure of flying ability. The maximal activities of each of the citric acid cycle enzymes were determined in preparations of mitochondria from flies of relatively young, middle, and old age. Aconitase was the only enzyme exhibiting altered activity during aging. The maximal activity of aconitase from old flies was decreased by 44% compared to that from young flies while the other citric acid cycle enzymes showed no change in activity with age. It is suggested that the selective age-related decrease in aconitase activity is likely to contribute to a decline in the efficiency of mitochondrial bioenergetics, as well as result in secondary effects associated with accumulation of citrate and redox-active iron.

  15. Purification and characterization of cannabidiolic-acid synthase from Cannabis sativa L.. Biochemical analysis of a novel enzyme that catalyzes the oxidocyclization of cannabigerolic acid to cannabidiolic acid.

    PubMed

    Taura, F; Morimoto, S; Shoyama, Y

    1996-07-19

    We identified a unique enzyme that catalyzes the oxidocyclization of cannabigerolic acid to cannabidiolic acid (CBDA) in Cannabis sativa L. (CBDA strain). The enzyme, named CBDA synthase, was purified to apparent homogeneity by a four-step procedure: ammonium sulfate precipitation followed by chromatography on DEAE-cellulose, phenyl-Sepharose CL-4B, and hydroxylapatite. The active enzyme consists of a single polypeptide with a molecular mass of 74 kDa and a pI of 6.1. The NH2-terminal amino acid sequence of CBDA synthase is similar to that of Delta1-tetrahydrocannabinolic-acid synthase. CBDA synthase does not require coenzymes, molecular oxygen, hydrogen peroxide, and metal ion cofactors for the oxidocyclization reaction. These results indicate that CBDA synthase is neither an oxygenase nor a peroxidase and that the enzymatic cyclization does not proceed via oxygenated intermediates. CBDA synthase catalyzes the formation of CBDA from cannabinerolic acid as well as cannabigerolic acid, although the kcat for the former (0.03 s-1) is lower than that for the latter (0.19 s-1). Therefore, we conclude that CBDA is predominantly biosynthesized from cannabigerolic acid rather than cannabinerolic acid.

  16. Total chemical synthesis of a thermostable enzyme capable of polymerase chain reaction.

    PubMed

    Xu, Weiliang; Jiang, Wenjun; Wang, Jiaxing; Yu, Linping; Chen, Ji; Liu, Xianyu; Liu, Lei; Zhu, Ting F

    2017-01-01

    Polymerase chain reaction (PCR) has been a defining tool in modern biology. Towards realizing mirror-image PCR, we have designed and chemically synthesized a mutant version of the 352-residue thermostable Sulfolobus solfataricus P2 DNA polymerase IV with l-amino acids and tested its PCR activity biochemically. To the best of our knowledge, this enzyme is the largest chemically synthesized protein reported to date. We show that with optimization of PCR conditions, the fully synthetic polymerase is capable of amplifying template sequences of up to 1.5 kb. The establishment of this synthetic route for chemically synthesizing DNA polymerase IV is a stepping stone towards building a d-enzyme system for mirror-image PCR, which may open up an avenue for the creation of many mirror-image molecular tools such as mirror-image systematic evolution of ligands by exponential enrichment.

  17. Total chemical synthesis of a thermostable enzyme capable of polymerase chain reaction

    PubMed Central

    Xu, Weiliang; Jiang, Wenjun; Wang, Jiaxing; Yu, Linping; Chen, Ji; Liu, Xianyu; Liu, Lei; Zhu, Ting F

    2017-01-01

    Polymerase chain reaction (PCR) has been a defining tool in modern biology. Towards realizing mirror-image PCR, we have designed and chemically synthesized a mutant version of the 352-residue thermostable Sulfolobus solfataricus P2 DNA polymerase IV with l-amino acids and tested its PCR activity biochemically. To the best of our knowledge, this enzyme is the largest chemically synthesized protein reported to date. We show that with optimization of PCR conditions, the fully synthetic polymerase is capable of amplifying template sequences of up to 1.5 kb. The establishment of this synthetic route for chemically synthesizing DNA polymerase IV is a stepping stone towards building a d-enzyme system for mirror-image PCR, which may open up an avenue for the creation of many mirror-image molecular tools such as mirror-image systematic evolution of ligands by exponential enrichment. PMID:28265464

  18. The Impact of Enzyme Characteristics on Corn Stover Fiber Degradation and Acid Production During Ensiled Storage

    NASA Astrophysics Data System (ADS)

    Ren, Haiyu; Richard, Tom L.; Moore, Kenneth J.

    Ensilage can be used to store lignocellulosic biomass before industrial bioprocessing. This study investigated the impacts of seven commerical enzyme mixtures derived from Aspergillus niger, Trichoderma reesei, and T. longibrachiatum. Treatments included three size grades of corn stover, two enzyme levels (1.67 and 5 IU/g dry matter based on hemicellulase), and various ratios of cellulase to hemicellulase (C ∶ H). The highest C ∶ H ratio tested, 2.38, derived from T. reesei, resulted in the most effective fermentation, with lactic acid as the dominant product. Enzymatic activity during storage may complement industrial pretreatment; creating synergies that could reduce total bioconversion costs.

  19. The impact of enzyme characteristics on corn stover fiber degradation and acid production during ensiled storage.

    PubMed

    Ren, Haiyu; Richard, Tom L; Moore, Kenneth J

    2007-04-01

    Ensilage can be used to store lignocellulosic biomass before industrial bioprocessing. This study investigated the impacts of seven commercial enzyme mixtures derived from Aspergillus niger, Trichoderma reesei, and T. longibrachiatum. Treatments included three size grades of corn stover, two enzyme levels (1.67 and 5 IU/g dry matter based on hemicellulase), and various ratios of cellulase to hemicellulase (C:H). The highest C:H ratio tested, 2.38, derived from T. reesei, resulted in the most effective fermentation, with lactic acid as the dominant product. Enzymatic activity during storage may complement industrial pretreatment; creating synergies that could reduce total bioconversion costs.

  20. A Study on Amino Acids: Synthesis of Alpha-Aminophenylacetic Acid (Phenylglycine) and Determination of its Isoelectric Point.

    ERIC Educational Resources Information Center

    Barrelle, M.; And Others

    1983-01-01

    Background information and procedures are provided for an experimental study on aminophenylacetic acid (phenylglycine). These include physical chemistry (determination of isoelectric point by pH measurement) and organic chemistry (synthesis of an amino acid in racemic form) experiments. (JN)

  1. [Radiation disorder of enzyme synthesis in the perinatal period of ontogeny].

    PubMed

    Slozhenikina, L V; Fialkovskaia, L A; Mikhaĭlets, L P; Ushakova, T E; Kuzin, A M

    1983-01-01

    A change of enzymatic differentiation in the rat liver during the perinatal developmental period after gamma-irradiation on the 7-9th and 19th days of embryogenesis in doses 0.5, 2 and 6 Gr has been shown on the example of glucose-6-phosphatase (G-6-P-ase) and tyrosine aminotransferase (TAT). The protein-synthesizing machinery was not damaged at these doses. The radiation inhibition of G-6-P-ase synthesis was relieved by the injection of thyroxine. A dependence was shown between the radiation increase of TAT activity and changes in cAMP system (increase of cAMP level, decrease of phosphodiesterase activity, intensification of response of adenylate cyclase complex to biogenic amines). A suggestion is put forward that the radiation damage of the enzymes under study is mediated by a change in the number of hormonal inductors.

  2. Synthesis of a Comprehensive Polyprenol Library for Evaluation of Bacterial Enzyme Lipid Substrate Specificity.

    PubMed

    Wu, Baolin; Woodward, Robert; Wen, Liuqing; Wang, Xuan; Zhao, Guohui; Wang, Peng George

    2013-12-01

    Polyprenols, a type of universal glycan lipid carrier, play important roles for glycan bio-assembly in wide variety of living systems. Chemical synthesis of natural polyisoprenols such as undecaprenol and dolichols, but especially their homologs, could serves as a powerful molecular tool to dissect and define the functions of enzymes involved in glycan biosynthesis. In this paper, we report an efficient and reliable method to construct this type of hydrophoic molecule through a base-mediated iterative coupling approach using a key bifunctional (Z, Z)-diisoprenyl building block. The ligation with N-acetyl-D-glactosamine (GalNAc) with a set of the synthesized lipid analogs forming polyprenol pyrophosphate linked GalNAc (GalNAc-PP-lipid) conjugates is also demonstrated.

  3. Production of L-lactic Acid from Biomass Wastes Using Scallop Crude Enzymes and Novel Lactic Acid Bacterium

    NASA Astrophysics Data System (ADS)

    Yanagisawa, Mitsunori; Nakamura, Kanami; Nakasaki, Kiyohiko

    In the present study, biomass waste raw materials including paper mill sludge, bamboo, sea lettuce, and shochu residue (from a distiller) and crude enzymes derived from inedible and discarded scallop parts were used to produce L-lactic acid for the raw material of biodegradable plastic poly-lactic acid. The activities of cellulase and amylase in the crude enzymes were 22 and 170units/L, respectively, and L-lactic acid was produced from every of the above mentioned biomass wastes, by the method of liquid-state simultaneous saccharification and fermentation (SSF) . The L-lactic acid concentrations produced from sea lettuce and shochu residue, which contain high concentration of starch were 3.6 and 9.3g/L, respectively, and corresponded to greater than 25% of the conversion of glucans contained in these biomass wastes. Furthermore, using the solid state SSF method, concentrations as high as 13g/L of L-lactic acid were obtained from sea lettuce and 26g/L were obtained from shochu residue.

  4. Significant role of bacterial undecaprenyl diphosphate (C55-UPP) for rubber synthesis by Hevea latex enzymes.

    PubMed

    Rattanapittayaporn, Atiya; Wititsuwannakul, Dhirayos; Wititsuwannakul, Rapepun

    2004-11-20

    Washed bottom fraction (BF) membrane-bound particles of centrifuged fresh Hevea latex were found to be very active in rubber biosynthesis (RB). The washed BF membrane (WBM) showed higher RB activity and is strongly stimulated by anionic surfactants--more by DOC than SDS. WBM enzymes system can synthesize rubber either with allylic isoprenes (higher RB) or without (lower RB). Washed rubber particles (WRP), used generally in RB assays, had very low RB activity compared to the much higher activity observed for WBM. Bacterial undecaprenyl diphoshate (C(55)-UPP) was very active allylic initiator for rubber synthesis by WBM. Comparisons of allylic UPP with the shorter ones (C(15)-FPP, C(20)-GGPP) showed that UPP was the most effective. WBM activity orders were UPP > GGPP > FPP. The DOC activated WBM synthesized less polyprenyl intermediates (butanol extractable) but more final rubber product (toluene/hexane extract), different than FPP and GGPP. WBM enzymes were highly versatile in using diverse different allylics, but UPP was most preferable. WRP was found a little active for UPP with DOC, but still much lower than WBM. Rubber product analysis by RP-TLC with acetone/hexane solvent system showed that WBM was mostly rubber, but WRP was mainly the intermediates. Quantitative analysis showed that WBM labeled rubber was confined to the origin spot, different than WRP as mainly labeled intermediates. It was thus confirmed that the WBM plays the key role in RB functions, and not WRP as mostly reported. WBM served as the actual rubber synthesis site, and bacterial UPP was very good RB initiator.

  5. Novel Inhibitors of Rad6 Ubiquitin Conjugating Enzyme: Design, Synthesis, Identification, and Functional Characterization

    PubMed Central

    Nangia-Makker, Pratima; Balan, Vitaly; Morelli, Matteo; Kothayer, Hend; Westwell, Andrew D.; Shekhar, Malathy P.V.

    2013-01-01

    Protein ubiquitination is important for cell signaling, DNA repair, and proteasomal degradation, and it is not surprising that alterations in ubiquitination occur frequently in cancer. Ubiquitin-conjugating enzymes (E2) mediate ubiquitination by selective interactions with ubiquitin-activating (E1) and ubiquitin ligase (E3) enzymes, and thus selective E2 small molecule inhibitor (SMI) will provide specificity unattainable with proteasome inhibitors. Here we describe synthesis and functional characterization of the first SMIs of human E2 Rad6B, a fundamental component of translesion synthesis DNA repair. A pharmacophore model for consensus E2 ubiquitin-binding sites was generated for virtual screening to identify E2 inhibitor candidates. Twelve triazine (TZ) analogs screened in silico by molecular docking to the Rad6B X-ray structure were verified by their effect on Rad6B ubiquitination of histone H2A. TZs #8 and 9 docked to the Rad6B catalytic site with highest complementarity. TZs #1, 2, 8, and 9 inhibited Rad6B-ubiquitin thioester formation and subsequent ubiquitin transfer to histone H2A. SMI #9 inhibition of Rad6 was selective as BCA2 ubiquitination by E2 UbcH5 was unaffected by SMI #9. SMI #9 more potently inhibited proliferation, colony formation, and migration than SMI #8, and induced MDA-MB-231 breast cancer cell G2–M arrest and apoptosis. Ubiquitination assays using Rad6 immunoprecipitated from SMI #8- or 9-treated cells confirmed inhibition of endogenous Rad6 activity. Consistent with our previous data showing Rad6B-mediated polyubiquitination stabilizes β-catenin, MDAMB-231 treatment with SMIs #8 or 9 decreased β-catenin protein levels. Together these results describe identification of the first Rad6 SMIs. PMID:23339190

  6. Novel inhibitors of Rad6 ubiquitin conjugating enzyme: design, synthesis, identification, and functional characterization.

    PubMed

    Sanders, Matthew A; Brahemi, Ghali; Nangia-Makker, Pratima; Balan, Vitaly; Morelli, Matteo; Kothayer, Hend; Westwell, Andrew D; Shekhar, Malathy P V

    2013-04-01

    Protein ubiquitination is important for cell signaling, DNA repair, and proteasomal degradation, and it is not surprising that alterations in ubiquitination occur frequently in cancer. Ubiquitin-conjugating enzymes (E2) mediate ubiquitination by selective interactions with ubiquitin-activating (E1) and ubiquitin ligase (E3) enzymes, and thus selective E2 small molecule inhibitor (SMI) will provide specificity unattainable with proteasome inhibitors. Here we describe synthesis and functional characterization of the first SMIs of human E2 Rad6B, a fundamental component of translesion synthesis DNA repair. A pharmacophore model for consensus E2 ubiquitin-binding sites was generated for virtual screening to identify E2 inhibitor candidates. Twelve triazine (TZ) analogs screened in silico by molecular docking to the Rad6B X-ray structure were verified by their effect on Rad6B ubiquitination of histone H2A. TZs #8 and 9 docked to the Rad6B catalytic site with highest complementarity. TZs #1, 2, 8, and 9 inhibited Rad6B-ubiquitin thioester formation and subsequent ubiquitin transfer to histone H2A. SMI #9 inhibition of Rad6 was selective as BCA2 ubiquitination by E2 UbcH5 was unaffected by SMI #9. SMI #9 more potently inhibited proliferation, colony formation, and migration than SMI #8, and induced MDA-MB-231 breast cancer cell G2-M arrest and apoptosis. Ubiquitination assays using Rad6 immunoprecipitated from SMI #8- or 9-treated cells confirmed inhibition of endogenous Rad6 activity. Consistent with our previous data showing Rad6B-mediated polyubiquitination stabilizes β-catenin, MDA-MB-231 treatment with SMIs #8 or 9 decreased β-catenin protein levels. Together these results describe identification of the first Rad6 SMIs.

  7. Induction of phytic acid synthesis by abscisic acid in suspension-cultured cells of rice.

    PubMed

    Matsuno, Koya; Fujimura, Tatsuhito

    2014-03-01

    A pathway of phytic acid (PA) synthesis in plants has been revealed via investigations of low phytic acid mutants. However, the regulation of this pathway is not well understood because it is difficult to control the environments of cells in the seeds, where PA is mainly synthesized. We modified a rice suspension culture system in order to study the regulation of PA synthesis. Rice cells cultured with abscisic acid (ABA) accumulate PA at higher levels than cells cultured without ABA, and PA accumulation levels increase with ABA concentration. On the other hand, higher concentrations of sucrose or inorganic phosphorus do not affect PA accumulation. Mutations in the genes RINO1, OsMIK, OsIPK1 and OsLPA1 have each been reported to confer low phytic acid phenotypes in seeds. Each of these genes is upregulated in cells cultured with ABA. OsITPK4 and OsITPK6 are upregulated in cells cultured with ABA and in developing seeds. These results suggest that the regulation of PA synthesis is similar between developing seeds and cells in this suspension culture system. This system will be a powerful tool for elucidating the regulation of PA synthesis.

  8. Synthesis of Site-Specifically (13)C Labeled Linoleic Acids.

    PubMed

    Offenbacher, Adam R; Zhu, Hui; Klinman, Judith P

    2016-10-12

    Soybean lipoxygenase-1 (SLO-1) catalyzes the C-H abstraction from the reactive carbon (C-11) in linoleic acid as the first and rate-determining step in the formation of alkylhydroperoxides. While previous labeling strategies have focused on deuterium labeling to ascertain the primary and secondary kinetic isotope effects for this reaction, there is an emerging interest and need for selectively enriched (13)C isotopologues. In this report, we present synthetic strategies for site-specific (13)C labeled linoleic acid substrates. We take advantage of a Corey-Fuchs formyl to terminal (13)C-labeled alkyne conversion, using (13)CBr4 as the labeling source, to reduce the number of steps from a previous fatty acid (13)C synthetic labeling approach. The labeled linoleic acid substrates are useful as nuclear tunneling markers and for extracting active site geometries of the enzyme-substrate complex in lipoxygenase.

  9. An approach for the synthesis of nakamuric acid

    PubMed Central

    Wang, Xiaolei; Chen, Chuo

    2014-01-01

    The biosynthesis of dimeric pyrrole–imidazole alkaloids is likely mediated by enzyme-catalyzed reversible single-electron transfer (SET) cycloaddition. We now show that Ir(ppy)3 can promote SET-mediated formal [2+2] and [4+2] cycloaddition reactions of pyrrole–imidazole alkaloids-related substrates under photolytic conditions. This biomimetic approach is useful for the construction of the core skeleton of nakamuric acid and sceptrin. PMID:25983349

  10. Vanillin formation from ferulic acid in Vanilla planifolia is catalysed by a single enzyme

    PubMed Central

    Gallage, Nethaji J.; Hansen, Esben H.; Kannangara, Rubini; Olsen, Carl Erik; Motawia, Mohammed Saddik; Jørgensen, Kirsten; Holme, Inger; Hebelstrup, Kim; Grisoni, Michel; Møller, Birger Lindberg

    2014-01-01

    Vanillin is a popular and valuable flavour compound. It is the key constituent of the natural vanilla flavour obtained from cured vanilla pods. Here we show that a single hydratase/lyase type enzyme designated vanillin synthase (VpVAN) catalyses direct conversion of ferulic acid and its glucoside into vanillin and its glucoside, respectively. The enzyme shows high sequence similarity to cysteine proteinases and is specific to the substitution pattern at the aromatic ring and does not metabolize caffeic acid and p-coumaric acid as demonstrated by coupled transcription/translation assays. VpVAN localizes to the inner part of the vanilla pod and high transcript levels are found in single cells located a few cell layers from the inner epidermis. Transient expression of VpVAN in tobacco and stable expression in barley in combination with the action of endogenous alcohol dehydrogenases and UDP-glucosyltransferases result in vanillyl alcohol glucoside formation from endogenous ferulic acid. A gene encoding an enzyme showing 71% sequence identity to VpVAN was identified in another vanillin-producing plant species Glechoma hederacea and was also shown to be a vanillin synthase as demonstrated by transient expression in tobacco. PMID:24941968

  11. Vanillin formation from ferulic acid in Vanilla planifolia is catalysed by a single enzyme.

    PubMed

    Gallage, Nethaji J; Hansen, Esben H; Kannangara, Rubini; Olsen, Carl Erik; Motawia, Mohammed Saddik; Jørgensen, Kirsten; Holme, Inger; Hebelstrup, Kim; Grisoni, Michel; Møller, Birger Lindberg

    2014-06-19

    Vanillin is a popular and valuable flavour compound. It is the key constituent of the natural vanilla flavour obtained from cured vanilla pods. Here we show that a single hydratase/lyase type enzyme designated vanillin synthase (VpVAN) catalyses direct conversion of ferulic acid and its glucoside into vanillin and its glucoside, respectively. The enzyme shows high sequence similarity to cysteine proteinases and is specific to the substitution pattern at the aromatic ring and does not metabolize caffeic acid and p-coumaric acid as demonstrated by coupled transcription/translation assays. VpVAN localizes to the inner part of the vanilla pod and high transcript levels are found in single cells located a few cell layers from the inner epidermis. Transient expression of VpVAN in tobacco and stable expression in barley in combination with the action of endogenous alcohol dehydrogenases and UDP-glucosyltransferases result in vanillyl alcohol glucoside formation from endogenous ferulic acid. A gene encoding an enzyme showing 71% sequence identity to VpVAN was identified in another vanillin-producing plant species Glechoma hederacea and was also shown to be a vanillin synthase as demonstrated by transient expression in tobacco.

  12. Mutation of Host Δ9 Fatty Acid Desaturase Inhibits Brome Mosaic Virus RNA Replication between Template Recognition and RNA Synthesis

    PubMed Central

    Lee, Wai-Ming; Ishikawa, Masayuki; Ahlquist, Paul

    2001-01-01

    All positive-strand RNA viruses assemble their RNA replication complexes on intracellular membranes. Brome mosaic virus (BMV) replicates its RNA in endoplasmic reticulum (ER)-associated complexes in plant cells and the yeast Saccharomyces cerevisiae. BMV encodes RNA replication factors 1a, with domains implicated in RNA capping and helicase functions, and 2a, with a central polymerase-like domain. Factor 1a interacts independently with the ER membrane, viral RNA templates, and factor 2a to form RNA replication complexes on the perinuclear ER. We show that BMV RNA replication is severely inhibited by a mutation in OLE1, an essential yeast chromosomal gene encoding Δ9 fatty acid desaturase, an integral ER membrane protein and the first enzyme in unsaturated fatty acid synthesis. OLE1 deletion and medium supplementation show that BMV RNA replication requires unsaturated fatty acids, not the Ole1 protein, and that viral RNA replication is much more sensitive than yeast growth to reduced unsaturated fatty acid levels. In ole1 mutant yeast, 1a still becomes membrane associated, recruits 2a to the membrane, and recognizes and stabilizes viral RNA templates normally. However, RNA replication is blocked prior to initiation of negative-strand RNA synthesis. The results show that viral RNA synthesis is highly sensitive to lipid composition and suggest that proper membrane fluidity or plasticity is essential for an early step in RNA replication. The strong unsaturated fatty acid dependence also demonstrates that modulating fatty acid balance can be an effective antiviral strategy. PMID:11160714

  13. Synthesis and evaluation of 2,5-dihydrochorismate analogues as inhibitors of the chorismate-utilising enzymes.

    PubMed

    Payne, Richard J; Bulloch, Esther M M; Toscano, Miguel M; Jones, Michelle A; Kerbarh, Olivier; Abell, Chris

    2009-06-07

    A library of 2,5-dihydrochorismate analogues were designed as inhibitors of the chorismate-utilising enzymes including anthranilate synthase, isochorismate synthase, salicylate synthase and 4-amino-4-deoxychorismate synthase. The inhibitors were synthesised in seven or eight steps from shikimic acid, sourced from star anise. The compounds exhibited moderate but differential inhibition against the four chorismate-utilising enzymes.

  14. Synthesis and folding of a mirror-image enzyme reveals ambidextrous chaperone activity

    PubMed Central

    Weinstock, Matthew T.; Jacobsen, Michael T.; Kay, Michael S.

    2014-01-01

    Mirror-image proteins (composed of d-amino acids) are promising therapeutic agents and drug discovery tools, but as synthesis of larger d-proteins becomes feasible, a major anticipated challenge is the folding of these proteins into their active conformations. In vivo, many large and/or complex proteins require chaperones like GroEL/ES to prevent misfolding and produce functional protein. The ability of chaperones to fold d-proteins is unknown. Here we examine the ability of GroEL/ES to fold a synthetic d-protein. We report the total chemical synthesis of a 312-residue GroEL/ES-dependent protein, DapA, in both l- and d-chiralities, the longest fully synthetic proteins yet reported. Impressively, GroEL/ES folds both l- and d-DapA. This work extends the limits of chemical protein synthesis, reveals ambidextrous GroEL/ES folding activity, and provides a valuable tool to fold d-proteins for drug development and mirror-image synthetic biology applications. PMID:25071217

  15. Enzymes as modular catalysts for redox half-reactions in H2-powered chemical synthesis: from biology to technology

    PubMed Central

    Reeve, Holly A.; Ash, Philip A.; Park, HyunSeo; Huang, Ailun; Posidias, Michalis; Tomlinson, Chloe; Lenz, Oliver

    2017-01-01

    The present study considers the ways in which redox enzyme modules are coupled in living cells for linking reductive and oxidative half-reactions, and then reviews examples in which this concept can be exploited technologically in applications of coupled enzyme pairs. We discuss many examples in which enzymes are interfaced with electronically conductive particles to build up heterogeneous catalytic systems in an approach which could be termed synthetic biochemistry. We focus on reactions involving the H+/H2 redox couple catalysed by NiFe hydrogenase moieties in conjunction with other biocatalysed reactions to assemble systems directed towards synthesis of specialised chemicals, chemical building blocks or bio-derived fuel molecules. We review our work in which this approach is applied in designing enzyme-modified particles for H2-driven recycling of the nicotinamide cofactor NADH to provide a clean cofactor source for applications of NADH-dependent enzymes in chemical synthesis, presenting a combination of published and new work on these systems. We also consider related photobiocatalytic approaches for light-driven production of chemicals or H2 as a fuel. We emphasise the techniques available for understanding detailed catalytic properties of the enzymes responsible for individual redox half-reactions, and the importance of a fundamental understanding of the enzyme characteristics in enabling effective applications of redox biocatalysis. PMID:28062838

  16. Enzymes as modular catalysts for redox half-reactions in H2-powered chemical synthesis: from biology to technology.

    PubMed

    Reeve, Holly A; Ash, Philip A; Park, HyunSeo; Huang, Ailun; Posidias, Michalis; Tomlinson, Chloe; Lenz, Oliver; Vincent, Kylie A

    2017-01-15

    The present study considers the ways in which redox enzyme modules are coupled in living cells for linking reductive and oxidative half-reactions, and then reviews examples in which this concept can be exploited technologically in applications of coupled enzyme pairs. We discuss many examples in which enzymes are interfaced with electronically conductive particles to build up heterogeneous catalytic systems in an approach which could be termed synthetic biochemistry We focus on reactions involving the H(+)/H2 redox couple catalysed by NiFe hydrogenase moieties in conjunction with other biocatalysed reactions to assemble systems directed towards synthesis of specialised chemicals, chemical building blocks or bio-derived fuel molecules. We review our work in which this approach is applied in designing enzyme-modified particles for H2-driven recycling of the nicotinamide cofactor NADH to provide a clean cofactor source for applications of NADH-dependent enzymes in chemical synthesis, presenting a combination of published and new work on these systems. We also consider related photobiocatalytic approaches for light-driven production of chemicals or H2 as a fuel. We emphasise the techniques available for understanding detailed catalytic properties of the enzymes responsible for individual redox half-reactions, and the importance of a fundamental understanding of the enzyme characteristics in enabling effective applications of redox biocatalysis.

  17. Synthesis of carboxylated poly(NIPAAm) oligomers and their application to form thermo-reversible polymer-enzyme conjugates.

    PubMed

    Chen, G; Hoffman, A S

    1994-01-01

    A thermo-reversible poly(N-isopropylacrylamide) poly(NIPAAm) oligomer with a carboxyl functional end group has been synthesized by radical polymerization using beta-mercaptopropionic acid as a chain transfer reagent. This polymer has been conjugated to an enzyme, beta-D-glucosidase, to form a thermo-reversible water soluble-insoluble polymer-enzyme conjugate. This conjugate can be used for separation, recovery and recycle of an enzyme simply by applying small temperature changes to the reaction medium. In contrast to the random polymer-enzyme conjugates reported in the literature, in this study the enzyme is coupled to each polymer chain by a single end attachment. These preliminary studies show that the conjugated enzyme exhibits very high retention of activity (> 90%) compared to the native enzyme and shows improved thermal stability.

  18. Inhibition of Thymidine Kinase Activity and Deoxyribonucleic Acid Synthesis in L Cells Infected with the Meningopneumonitis Agent

    PubMed Central

    Lin, Hsiu-San

    1968-01-01

    The activities of enzymes related to deoxyribonucleic acid (DNA) synthesis were studied in uninfected L cells and in L cells infected with Chlamydia psittaci (strain meningopneumonitis). The meningopneumonitis agent multiplied normally but failed to induce the synthesis of thymidine kinase in LM (TK−) cells which contain no thymidine kinase in the uninfected state. It was concluded that this microorganism has no thymidine kinase of its own and that it does not depend on the functioning of the host enzyme for synthesizing its DNA. Exposure of clone 5b L cells to the meningopneumonitis agent was followed by a decline in their thymidine kinase activity to nearly zero levels, whereas the levels of uridine kinase and thymidylate synthetase remained unchanged. Inhibition of thymidine kinase activity in L cells occurred soon after infection and required new protein synthesis by the meningopneumonitis agent. This inhibition occurred before inhibition of host DNA synthesis, but it was not an essential prelude to the latter inhibition. On the basis of this and previous investigations and in light of present knowledge of the mammalian cell cycle, it was postulated that the meningopneumonitis agent inhibits macromolecular synthesis in L cells by preventing the initiation of a new cell cycle. PMID:5724972

  19. Facile synthesis of multiple enzyme-containing metal-organic frameworks in a biomolecule-friendly environment.

    PubMed

    Wu, Xiaoling; Ge, Jun; Yang, Cheng; Hou, Miao; Liu, Zheng

    2015-09-07

    The one-step and facile synthesis of multi-enzyme-containing metal-organic framework (MOF) nanocrystals in aqueous solution at 25 °C was reported in this study. The GOx&HRP/ZIF-8 nanocomposite displayed high catalytic efficiency, high selectivity and enhanced stability due to the protecting effect of the framework.

  20. Regulation of the synthesis of pulp degrading enzymes in Bacillus isolated from cocoa fermentation.

    PubMed

    Ouattara, Honoré G; Reverchon, Sylvie; Niamke, Sébastien L; Nasser, William

    2017-05-01

    Pectin degrading enzymes are essential for quality of product from cocoa fermentation. Previously, we studied purified pectate lyases (Pel) produced by Bacillus strains from fermenting cocoa and characterized the cloned pel genes. This study aims to search for biological signals that modulates Pel production and regulators that influence pel gene expression. Strains were grown to the end of exponential phase in media containing various carbon sources. Pel enzymes production in Bacillus was unaffected by simple sugar content variation up to 2%. Additionally, it appeared that pel gene is not under the control of the most common carbon and pectin catabolism regulators ccpA and kdgR, which could explain the insensitivity of Pel production to carbon source variation. However, a 6-fold decrease in Pel production was observed when bacteria were grown in LB rich medium as opposed to basal mineral medium. Subsequently, bioinformatics analysis of cloned pel gene promoter region revealed the presence of DegU binding site. Furthermore, the deletion of degU gene dramatically reduces the pel gene expression, as revealed by real time quantitative PCR, showing an activation effect of DegU on Pel synthesis in Bacillus strains studied. We assumed that, during the latter stage of cocoa fermentation when simple sugars are depleted, production of Pel in Bacillus is stimulated by DegU to supply microbial cells with carbon source from polymeric pectic compounds.

  1. Synthesis and Characterization of Polymer Nanocarriers for the Targeted Delivery of Therapeutic Enzymes

    PubMed Central

    Simone, Eric; Dziubla, Thomas; Shuvaev, Vladimir; Muzykantov, Vladimir R.

    2011-01-01

    Protein drugs, such as recombinant enzymes useful for detoxification and replacement therapies, have extraordinary specificity and potency. However, inherently inadequate delivery to target sites and rapid inactivation limit their medical utility. Using chaperone polymeric particles designed within an injectible size range (sub-micron) may help solve these shortcomings. Such nanocarriers would (i) prevent premature inactivation of encapsulated therapeutic protein cargoes, (ii) provide a carrier that can be surface decorated by targeting ligands, and (iii) optimize sub-cellular localization of the drug. This chapter describes the techniques successfully employed for the preparation of polymer nanocarriers (PNC) loaded with the antioxidant enzyme, catalase, and targeted to endothelial cells. Methods of PNC synthesis, loading with catalase, characterization, coupling of a targeting moiety, and in vitro testing of the enzymatic and targeting activities are provided here. Advantages and disadvantages of specific designs are discussed. Due to the modular nature of the targeting methodology employed, it is believed that these protocols will provide a solid foundation for the formulation of a wide variety of enzymatic drug targeting strategies. PMID:20013177

  2. Molecular design and synthesis of novel peptides from amphibians skin acting as inhibitors of cholinesterase enzymes.

    PubMed

    Siano, Alvaro; Garibotto, Francisco F; Andujar, Sebastian A; Baldoni, Hector A; Tonarelli, Georgina G; Enriz, Ricardo D

    2017-03-01

    Cholinesterases are a family of enzymes that catalyze the hydrolysis of neurotransmitter acetylcholine. There are two types of cholinesterases, acetylcholinesterase (AChE) and butyrylcholinesterase (BChE), which differ in their distribution in the body. Currently, cholinesterase inhibitors (ChEI) represent the treatment of choice for Alzheimer's disease (AD). In this paper, we report the synthesis and inhibitory effect on both enzymes of four new peptides structurally related to P1-Hp-1971 (amphibian skin peptide found in our previous work. Sequence: TKPTLLGLPLGAGPAAGPGKR-NH2 ). The bioassay data and cytotoxicity test show that some of the compounds possess a significant AChE and BChE inhibition and no toxic effect. The present work demonstrates that diminution of the size of the original peptide could potentially result in new compounds with significant cholinesterase inhibition activity, although it appears that there is an optimal size for the sequence. We also conducted an exhaustive molecular modeling study to better understand the mechanism of action of these compounds by combining docking techniques with molecular dynamics simulations on BChE. This is the first report about amphibian peptides and the second one of natural peptides with ChE inhibitory activity. Copyright © 2017 European Peptide Society and John Wiley & Sons, Ltd.

  3. CYP4 enzymes as potential drug targets: focus on enzyme multiplicity, inducers and inhibitors, and therapeutic modulation of 20-hydroxyeicosatetraenoic acid (20-HETE) synthase and fatty acid ω-hydroxylase activities.

    PubMed

    Edson, Katheryne Z; Rettie, Allan E

    2013-01-01

    The Cytochrome P450 4 (CYP4) family of enzymes in humans is comprised of thirteen isozymes that typically catalyze the ω-oxidation of endogenous fatty acids and eicosanoids. Several CYP4 enzymes can biosynthesize 20- hydroxyeicosatetraenoic acid, or 20-HETE, an important signaling eicosanoid involved in regulation of vascular tone and kidney reabsorption. Additionally, accumulation of certain fatty acids is a hallmark of the rare genetic disorders, Refsum disease and X-ALD. Therefore, modulation of CYP4 enzyme activity, either by inhibition or induction, is a potential strategy for drug discovery. Here we review the substrate specificities, sites of expression, genetic regulation, and inhibition by exogenous chemicals of the human CYP4 enzymes, and discuss the targeting of CYP4 enzymes in the development of new treatments for hypertension, stroke, certain cancers and the fatty acid-linked orphan diseases.

  4. Effect of abscisic acid and hydrogen peroxide on antioxidant enzymes in Syzygium cumini plant.

    PubMed

    Choudhary, Ramkishan; Saroha, Ajaya Eesha; Swarnkar, P L

    2012-10-01

    The present study was undertaken to study the effect of abscisic acid and hydrogen peroxide on the activities of antioxidant enzymes namely superoxide dismutase (SOD; E.C. 1.15.1.1), catalase (CAT; E.C. 1.11.1.6) and ascorbate peroxidase (APX; E.C. 1.11.1.11) in Syzygium cumini plant. The varying concentrations of ABA (2-8 mM/l) and H2O2 (2-8 mM/l) modulated enzyme activities differently. In general, some concentrations of the ABA and H2O2 stimulated the activities of all the three enzymes except that there was a dose dependent reduction in catalase activity in the plants treated with ABA.

  5. Dual Role for Phospholipid:Diacylglycerol Acyltransferase: Enhancing Fatty Acid Synthesis and Diverting Fatty Acids from Membrane Lipids to Triacylglycerol in Arabidopsis Leaves[C][W

    PubMed Central

    Fan, Jilian; Yan, Chengshi; Zhang, Xuebin; Xu, Changcheng

    2013-01-01

    There is growing interest in engineering green biomass to expand the production of plant oils as feed and biofuels. Here, we show that PHOSPHOLIPID:DIACYLGLYCEROL ACYLTRANSFERASE1 (PDAT1) is a critical enzyme involved in triacylglycerol (TAG) synthesis in leaves. Overexpression of PDAT1 increases leaf TAG accumulation, leading to oil droplet overexpansion through fusion. Ectopic expression of oleosin promotes the clustering of small oil droplets. Coexpression of PDAT1 with oleosin boosts leaf TAG content by up to 6.4% of the dry weight without affecting membrane lipid composition and plant growth. PDAT1 overexpression stimulates fatty acid synthesis (FAS) and increases fatty acid flux toward the prokaryotic glycerolipid pathway. In the trigalactosyldiacylglycerol1-1 mutant, which is defective in eukaryotic thylakoid lipid synthesis, the combined overexpression of PDAT1 with oleosin increases leaf TAG content to 8.6% of the dry weight and total leaf lipid by fourfold. In the plastidic glycerol-3-phosphate acyltransferase1 mutant, which is defective in the prokaryotic glycerolipid pathway, PDAT1 overexpression enhances TAG content at the expense of thylakoid membrane lipids, leading to defects in chloroplast division and thylakoid biogenesis. Collectively, these results reveal a dual role for PDAT1 in enhancing fatty acid and TAG synthesis in leaves and suggest that increasing FAS is the key to engineering high levels of TAG accumulation in green biomass. PMID:24076979

  6. Synthesis and Characterization of Fatty Acid Conjugates of Niacin and Salicylic Acid.

    PubMed

    Vu, Chi B; Bemis, Jean E; Benson, Ericka; Bista, Pradeep; Carney, David; Fahrner, Richard; Lee, Diana; Liu, Feng; Lonkar, Pallavi; Milne, Jill C; Nichols, Andrew J; Picarella, Dominic; Shoelson, Adam; Smith, Jesse; Ting, Amal; Wensley, Allison; Yeager, Maisy; Zimmer, Michael; Jirousek, Michael R

    2016-02-11

    This report describes the synthesis and preliminary biological characterization of novel fatty acid niacin conjugates and fatty acid salicylate conjugates. These molecular entities were created by covalently linking two bioactive molecules, either niacin or salicylic acid, to an omega-3 fatty acid. This methodology allows the simultaneous intracellular delivery of two bioactives in order to elicit a pharmacological response that could not be replicated by administering the bioactives individually or in combination. The fatty acid niacin conjugate 5 has been shown to be an inhibitor of the sterol regulatory element binding protein (SREBP), a key regulator of cholesterol metabolism proteins such as PCSK9, HMG-CoA reductase, ATP citrate lyase, and NPC1L1. On the other hand, the fatty acid salicylate conjugate 11 has been shown to have a unique anti-inflammatory profile based on its ability to modulate the NF-κB pathway through the intracellular release of the two bioactives.

  7. Ribonucleic Acid Regulation in Permeabilized Cells of Escherichia coli Capable of Ribonucleic Acid and Protein Synthesis1

    PubMed Central

    Atherly, Alan G.

    1974-01-01

    A cell permeabilization procedure is described that reduces viability less than 10% and does not significantly reduce the rates of ribonucleic acid and protein synthesis when appropriately supplemented. Permeabilization abolishes the normal stringent coupling of protein and ribonucleic acid synthesis. PMID:4364330

  8. Ammonia lyases and aminomutases as biocatalysts for the synthesis of α-amino and β-amino acids.

    PubMed

    Turner, Nicholas J

    2011-04-01

    Ammonia lyases catalyse the reversible addition of ammonia to cinnamic acid (1: R=H) and p-hydroxycinnamic (1: R=OH) to generate L-phenylalanine (2: R=H) and L-tyrosine (2: R=OH) respectively (Figure 1a). Both phenylalanine ammonia lyase (PAL) and tyrosine ammonia lyase (TAL) are widely distributed in plants, fungi and prokaryotes. Recently there has been interest in the use of these enzymes for the synthesis of a broader range of L-arylalanines. Aminomutases catalyse a related reaction, namely the interconversion of α-amino acids to β-amino acids (Figure 1b). In the case of L-phenylalanine, this reaction is catalysed by phenylalanine aminomutase (PAM) and proceeds stereospecifically via the intermediate cinnamic acid to generate β-Phe 3. Ammonia lyases and aminomutases are related in sequence and structure and share the same active site cofactor 4-methylideneimidazole-5-one (MIO). There is currently interest in the possibility of using these biocatalysts to prepare a wide range of enantiomerically pure l-configured α-amino and β-amino acids. Recent reviews have focused on the mechanism of these MIO containing enzymes. The aim of this review is to review recent progress in the application of ammonia lyase and aminomutase enzymes to prepare enantiomerically pure α-amino and β-amino acids.

  9. Efficient production of optically pure L-lactic acid from food waste at ambient temperature by regulating key enzyme activity.

    PubMed

    Li, Xiang; Chen, Yinguang; Zhao, Shu; Chen, Hong; Zheng, Xiong; Luo, Jinyang; Liu, Yanan

    2015-03-01

    Bio-production of optically pure L-lactic acid from food waste has attracted much interest as it can treat organic wastes with simultaneous recovery of valuable by-products. However, the yield of L-lactic acid was very low and no optically pure L-lactic acid was produced in the literature due to (1) the lower activity of enzymes involved in hydrolysis and L-lactic acid generation, and (2) the participation of other enzymes related to D-lactic acid and acetic and propionic acids production. In this paper, a new strategy was reported for effective production of optically pure L-lactic acid from food waste at ambient temperature, i.e. via regulating key enzyme activity by sewage sludge supplement and intermittent alkaline fermentation. It was found that not only optically pure L-lactic acid was produced, but the yield was enhanced by 2.89-fold. The mechanism study showed that the activities of enzymes relevant to food waste hydrolysis and lactic acid production were enhanced, and the key enzymes related to volatile fatty acids and D-lactic acid generations were severally decreased or inhibited. Also, the microbes responsible for L-lactic acid production were selectively proliferated. Finally, the pilot-scale continuous experiment was conducted to testify the feasibility of this new technique.

  10. Early lignin pathway enzymes and routes to chlorogenic acid in switchgrass (Panicum virgatum L.).

    PubMed

    Escamilla-Treviño, Luis L; Shen, Hui; Hernandez, Timothy; Yin, Yanbin; Xu, Ying; Dixon, Richard A

    2014-03-01

    Studying lignin biosynthesis in Panicum virgatum (switchgrass) has provided a basis for generating plants with reduced lignin content and increased saccharification efficiency. Chlorogenic acid (CGA, caffeoyl quinate) is the major soluble phenolic compound in switchgrass, and the lignin and CGA biosynthetic pathways potentially share intermediates and enzymes. The enzyme hydroxycinnamoyl-CoA: quinate hydroxycinnamoyltransferase (HQT) is responsible for CGA biosynthesis in tobacco, tomato and globe artichoke, but there are no close orthologs of HQT in switchgrass or in other monocotyledonous plants with complete genome sequences. We examined available transcriptomic databases for genes encoding enzymes potentially involved in CGA biosynthesis in switchgrass. The protein products of two hydroxycinnamoyl-CoA shikimate/quinate hydroxycinnamoyltransferase (HCT) genes (PvHCT1a and PvHCT2a), closely related to lignin pathway HCTs from other species, were characterized biochemically and exhibited the expected HCT activity, preferring shikimic acid as acyl acceptor. We also characterized two switchgrass coumaroyl shikimate 3'-hydroxylase (C3'H) enzymes (PvC3'H1 and PvC3'H2); both of these cytochrome P450s had the capacity to hydroxylate 4-coumaroyl shikimate or 4-coumaroyl quinate to generate caffeoyl shikimate or CGA. Another switchgrass hydroxycinnamoyl transferase, PvHCT-Like1, is phylogenetically distant from HCTs or HQTs, but exhibits HQT activity, preferring quinic acid as acyl acceptor, and could therefore function in CGA biosynthesis. The biochemical features of the recombinant enzymes, the presence of the corresponding activities in plant protein extracts, and the expression patterns of the corresponding genes, suggest preferred routes to CGA in switchgrass.

  11. Dynamic expression of retinoic acid synthesizing and metabolizing enzymes in the developing mouse inner ear

    PubMed Central

    Romand, Raymond; Kondo, Takako; Fraulob, Valérie; Petkovich, Martin; Dollé, Pascal; Hashino, Eri

    2008-01-01

    Retinoic acid signaling plays essential roles in morphogenesis and neural development through transcriptional regulation of downstream target genes. It is believed that the balance between the activities of synthesizing and metabolizing enzymes determines the amount of active retinoic acid to which a developing tissue is exposed. In this study, we investigated spatio-temporal expression patterns of four synthesizing enzymes, the retinaldehyde dehydrogenases 1, 2, 3 and 4 (Raldh1, Raldh2, Raldh3 and Raldh4) and two metabolizing enzymes (Cyp26A1 and Cyp26B1) in the embryonic and postnatal mouse inner ear using quantitative RT-PCR, in situ hybridization and Western blot analysis. Quantitative RT-PCR analysis and Western blot data revealed that the expression of CYP26s was much higher than that of Raldhs at early embryonic ages, but that Cyp26 expression was down-regulated during embryonic development. Conversely, the expression levels of Raldh2 and -3 increased during development and were significantly higher than the Cyp26 levels at postnatal day 20. At this age, Raldh3 was expressed predominantly in the cochlea, while Raldh2 was present in the vestibular end organ. At early embryonic stages as observed by in situ hybridization, the synthesizing enzymes were expressed only in the dorsoventral epithelium of the otocyst, while the metabolizing enzymes were present mainly in mesenchymal cells surrounding the otic epithelium. At later stages, Raldh2, Raldh3 and Cyp26B1 were confined to the stria vascularis, spiral ganglion and supporting cells in the cochlear and vestibular epithelia, respectively. The downregulation of Cyp26s and the upregulation of Raldhs after birth during inner ear maturation suggests tissue changes in the sensitivity to retinoic acid concentrations. PMID:16615129

  12. Efficient production of free fatty acids from ionic liquid-based acid- or enzyme-catalyzed bamboo hydrolysate.

    PubMed

    Mi, Le; Qin, Dandan; Cheng, Jie; Wang, Dan; Li, Sha; Wei, Xuetuan

    2017-03-01

    Two engineered Escherichia coli strains, DQ101 (MG1655 fadD (-))/pDQTES and DQ101 (MG1655 fadD (-))/pDQTESZ were constructed to investigate the free fatty acid production using ionic liquid-based acid- or enzyme-catalyzed bamboo hydrolysate as carbon source in this study. The plasmid, pDQTES, carrying an acyl-ACP thioesterase 'TesA of E. coli in pTrc99A was constructed firstly, and then (3R)-hydroxyacyl-ACP dehydratase was ligated after the TesA to give the plasmid pDQTESZ. These two strains exhibited efficient fatty acid production when glucose was used as the sole carbon source, with a final concentration of 2.45 and 3.32 g/L, respectively. The free fatty acid production of the two strains on xylose is not as efficient as that on glucose, which was 2.32 and 2.96 g/L, respectively. For mixed sugars, DQ101 (MG1655 fadD (-))-based strains utilized glucose and pentose sequentially under the carbon catabolite repression (CCR) regulation. The highest total FFAs concentration from the mixed sugar culture reached 2.81 g/L by DQ101 (MG1655 fadD (-))/pDQTESZ. Furthermore, when ionic liquid-based enzyme-catalyzed bamboo hydrolysate was used as the carbon source, the strain DQ101 (MG1655 fadD (-))/pDQTESZ could produce 1.23 g/L FFAs with a yield of 0.13 g/g, and while it just produced 0.65 g/L free fatty acid with the ionic liquid-based acid-catalyzed bamboo hydrolysate as the feedstock. The results suggested that enzymatic catalyzed bamboo hydrolysate with ionic liquid pretreatment could serve as an efficient feedstock for free fatty acid production.

  13. [Controlling arachidonic acid metabolic network: from single- to multi-target inhibitors of key enzymes].

    PubMed

    Liu, Ying; Chen, Zheng; Shang, Er-chang; Yang, Kun; Wei, Deng-guo; Zhou, Lu; Jiang, Xiao-lu; He, Chong; Lai, Lu-hua

    2009-03-01

    Inflammatory diseases are common medical conditions seen in disorders of human immune system. There is a great demand for anti-inflammatory drugs. There are major inflammatory mediators in arachidonic acid metabolic network. Several enzymes in this network have been used as key targets for the development of anti-inflammatory drugs. However, specific single-target inhibitors can not sufficiently control the network balance and may cause side effects at the same time. Most inflammation induced diseases come from the complicated coupling of inflammatory cascades involving multiple targets. In order to treat these complicated diseases, drugs that can intervene multi-targets at the same time attracted much attention. The goal of this review is mainly focused on the key enzymes in arachidonic acid metabolic network, such as phospholipase A2, cyclooxygenase, 5-lipoxygenase and eukotriene A4 hydrolase. Advance in single target and multi-targe inhibitors is summarized.

  14. Enzymes useful for chiral compound synthesis: structural biology, directed evolution, and protein engineering for industrial use.

    PubMed

    Kataoka, Michihiko; Miyakawa, Takuya; Shimizu, Sakayu; Tanokura, Masaru

    2016-07-01

    Biocatalysts (enzymes) have many advantages as catalysts for the production of useful compounds as compared to chemical catalysts. The stereoselectivity of the enzymes is one advantage, and thus the stereoselective production of chiral compounds using enzymes is a promising approach. Importantly, industrial application of the enzymes for chiral compound production requires the discovery of a novel useful enzyme or enzyme function; furthermore, improving the enzyme properties through protein engineering and directed evolution approaches is significant. In this review, the significance of several enzymes showing stereoselectivity (quinuclidinone reductase, aminoalcohol dehydrogenase, old yellow enzyme, and threonine aldolase) in chiral compound production is described, and the improvement of these enzymes using protein engineering and directed evolution approaches for further usability is discussed. Currently, enzymes are widely used as catalysts for the production of chiral compounds; however, for further use of enzymes in chiral compound production, improvement of enzymes should be more essential, as well as discovery of novel enzymes and enzyme functions.

  15. Synthesis and characterization of magnetite nanoparticles coated with lauric acid

    SciTech Connect

    Mamani, J.B.; Costa-Filho, A.J.; Cornejo, D.R.; Vieira, E.D.; Gamarra, L.F.

    2013-07-15

    Understanding the process of synthesis of magnetic nanoparticles is important for its implementation in in vitro and in vivo studies. In this work we report the synthesis of magnetic nanoparticles made from ferrous oxide through coprecipitation chemical process. The nanostructured material was coated with lauric acid and dispersed in aqueous medium containing surfactant that yielded a stable colloidal suspension. The characterization of magnetic nanoparticles with distinct physico-chemical configurations is fundamental for biomedical applications. Therefore magnetic nanoparticles were characterized in terms of their morphology by means of TEM and DLS, which showed a polydispersed set of spherical nanoparticles (average diameter of ca. 9 nm) as a result of the protocol. The structural properties were characterized by using X-ray diffraction (XRD). XRD pattern showed the presence of peaks corresponding to the spinel phase of magnetite (Fe{sub 3}O{sub 4}). The relaxivities r{sub 2} and r{sub 2}* values were determined from the transverse relaxation times T{sub 2} and T{sub 2}* at 3 T. Magnetic characterization was performed using SQUID and FMR, which evidenced the superparamagnetic properties of the nanoparticles. Thermal characterization using DSC showed exothermic events associated with the oxidation of magnetite to maghemite. - Highlights: • Synthesis of magnetic nanoparticles coated with lauric acid • Characterization of magnetic nanoparticles • Morphological, structural, magnetic, calorimetric and relaxometric characterization.

  16. Plastid-localized amino acid biosynthetic pathways of Plantae are predominantly composed of non-cyanobacterial enzymes

    PubMed Central

    Reyes-Prieto, Adrian; Moustafa, Ahmed

    2012-01-01

    Studies of photosynthetic eukaryotes have revealed that the evolution of plastids from cyanobacteria involved the recruitment of non-cyanobacterial proteins. Our phylogenetic survey of >100 Arabidopsis nuclear-encoded plastid enzymes involved in amino acid biosynthesis identified only 21 unambiguous cyanobacterial-derived proteins. Some of the several non-cyanobacterial plastid enzymes have a shared phylogenetic origin in the three Plantae lineages. We hypothesize that during the evolution of plastids some enzymes encoded in the host nuclear genome were mistargeted into the plastid. Then, the activity of those foreign enzymes was sustained by both the plastid metabolites and interactions with the native cyanobacterial enzymes. Some of the novel enzymatic activities were favored by selective compartmentation of additional complementary enzymes. The mosaic phylogenetic composition of the plastid amino acid biosynthetic pathways and the reduced number of plastid-encoded proteins of non-cyanobacterial origin suggest that enzyme recruitment underlies the recompartmentation of metabolic routes during the evolution of plastids. PMID:23233874

  17. Evolutionary distinctiveness of fatty acid and polyketide synthesis in eukaryotes

    PubMed Central

    Kohli, Gurjeet S; John, Uwe; Van Dolah, Frances M; Murray, Shauna A

    2016-01-01

    Fatty acids, which are essential cell membrane constituents and fuel storage molecules, are thought to share a common evolutionary origin with polyketide toxins in eukaryotes. While fatty acids are primary metabolic products, polyketide toxins are secondary metabolites that are involved in ecologically relevant processes, such as chemical defence, and produce the adverse effects of harmful algal blooms. Selection pressures on such compounds may be different, resulting in differing evolutionary histories. Surprisingly, some studies of dinoflagellates have suggested that the same enzymes may catalyse these processes. Here we show the presence and evolutionary distinctiveness of genes encoding six key enzymes essential for fatty acid production in 13 eukaryotic lineages for which no previous sequence data were available (alveolates: dinoflagellates, Vitrella, Chromera; stramenopiles: bolidophytes, chrysophytes, pelagophytes, raphidophytes, dictyochophytes, pinguiophytes, xanthophytes; Rhizaria: chlorarachniophytes, haplosporida; euglenids) and 8 other lineages (apicomplexans, bacillariophytes, synurophytes, cryptophytes, haptophytes, chlorophyceans, prasinophytes, trebouxiophytes). The phylogeny of fatty acid synthase genes reflects the evolutionary history of the organism, indicating selection to maintain conserved functionality. In contrast, polyketide synthase gene families are highly expanded in dinoflagellates and haptophytes, suggesting relaxed constraints in their evolutionary history, while completely absent from some protist lineages. This demonstrates a vast potential for the production of bioactive polyketide compounds in some lineages of microbial eukaryotes, indicating that the evolution of these compounds may have played an important role in their ecological success. PMID:26784357

  18. Enhanced production of polyunsaturated fatty acids by enzyme engineering of tandem acyl carrier proteins

    PubMed Central

    Hayashi, Shohei; Satoh, Yasuharu; Ujihara, Tetsuro; Takata, Yusuke; Dairi, Tohru

    2016-01-01

    In some microorganisms, polyunsaturated fatty acids (PUFAs) are biosynthesized by PUFA synthases characterized by tandem acyl carrier proteins (ACPs) in subunit A. These ACPs were previously shown to be important for PUFA productivity. In this study, we examined their function in more detail. PUFA productivities increased depending on the number of ACPs without profile changes in each subunit A of eukaryotic and prokaryotic PUFA synthases. We also constructed derivative enzymes from subunit A with 5 × ACPs. Enzymes possessing one inactive ACP at any position produced ~30% PUFAs compared with the parental enzyme but unexpectedly had ~250% productivity compared with subunit A with 4 × ACPs. Enzymes constructed by replacing the 3rd ACP with an inactive ACP from another subunit A or ACP-unrelated sequences produced ~100% and ~3% PUFAs compared with the parental 3rd ACP-inactive enzyme, respectively. These results suggest that both the structure and number of ACP domains are important for PUFA productivity. PMID:27752094

  19. Effects of an exogenous enzyme preparation on microbial protein synthesis, enzyme activity and attachment to feed in the Rumen Simulation Technique (Rusitec).

    PubMed

    Wang, Y; McAllister, T A; Rode, L M; Beauchemin, K A; Morgavi, D P; Nsereko, V L; Iwaasa, A D; Yang, W

    2001-03-01

    The effects of an exogenous enzyme preparation, the application method and feed type on ruminal fermentation and microbial protein synthesis were investigated using the rumen simulation technique (Rusitec). Steam-rolled barley grain and chopped alfalfa hay were sprayed with water (control, C), an enzyme preparation with a predominant xylanase activity (EF), or autoclaved enzyme (AEF) 24 h prior to feeding, or the enzyme was supplied in the buffer infused into the Rusitec (EI). Microbial N incorporation was measured using (15NH4)2SO4 in the buffer. Spent feed bags were pummelled mechanically in buffer to segregate the feed particle-associated (FPA) and feed particle-bound (FPB) bacterial fractions. Enzymes applied to feed reduced neutral-detergent fibre content, and increased the concentration of reducing sugars in barley grain, but not alfalfa hay. Ruminal cellulolytic bacteria were more numerous with EF than with C. Disappearance of DM from barley grain was higher with EF than with C, but alfalfa was unaffected by EF. Treatment EF increased incorporation of 15N into FPA and FPB fractions at 24 and 48 h. In contrast, AEF reduced the 24 h values, relative to C; AEF and C were similar at 48 h. Infused enzyme (EI) did not affect 15N incorporation. Xylanase activity in effluent was increased by EF and EI, compared to C, but not by AEF. Xylanase activity in FPA was higher at 48 h than at 24 h with all treatments; it was higher with EF than C at 24 and 48 h, but was not altered by AEF or EI. Applying enzymes onto feeds before feeding was more effective than dosing directly into the artificial rumen for increasing ruminal fibrolytic activity.

  20. Another unusual type of citric acid cycle enzyme in Helicobacter pylori: the malate:quinone oxidoreductase.

    PubMed

    Kather, B; Stingl, K; van der Rest, M E; Altendorf, K; Molenaar, D

    2000-06-01

    The only enzyme of the citric acid cycle for which no open reading frame (ORF) was found in the Helicobacter pylori genome is the NAD-dependent malate dehydrogenase. Here, it is shown that in this organism the oxidation of malate to oxaloacetate is catalyzed by a malate:quinone oxidoreductase (MQO). This flavin adenine dinucleotide-dependent membrane-associated enzyme donates electrons to quinones of the electron transfer chain. Similar to succinate dehydrogenase, it is part of both the electron transfer chain and the citric acid cycle. MQO activity was demonstrated in isolated membranes of H. pylori. The enzyme is encoded by the ORF HP0086, which is shown by the fact that expression of the HP0086 sequence from a plasmid induces high MQO activity in mqo deletion mutants of Escherichia coli or Corynebacterium glutamicum. Furthermore, this plasmid was able to complement the phenotype of the C. glutamicum mqo deletion mutant. Interestingly, the protein predicted to be encoded by this ORF is only distantly related to known or postulated MQO sequences from other bacteria. The presence of an MQO shown here and the previously demonstrated presence of a 2-ketoglutarate:ferredoxin oxidoreductase and a succinyl-coenzyme A (CoA):acetoacetyl-CoA transferase indicate that H. pylori possesses a complete citric acid cycle, but one which deviates from the standard textbook example in three steps.

  1. Crystal structure of FadD32, an enzyme essential for mycolic acid biosynthesis in mycobacteria.

    PubMed

    Li, Wenjuan; Gu, Shoujin; Fleming, Joy; Bi, Lijun

    2015-12-02

    Fatty acid degradation protein D32 (FadD32), an enzyme required for mycolic acid biosynthesis and essential for mycobacterial growth, has recently been identified as a valid and promising target for anti-tuberculosis drug development. Here we report the crystal structures of Mycobacterium smegmatis FadD32 in the apo and ATP-bound states at 2.4 Å and 2.25 Å resolution, respectively. FadD32 consists of two globular domains connected by a flexible linker. ATP binds in a cleft at the interface between the N- and C-terminal domains and its binding induces significant local conformational changes in FadD32. The binding sites of meromycolic acid and phosphopantetheine are identified by structural comparison with other members of the adenylating enzyme superfamily. These results will improve our understanding of the catalytic mechanism of FadD32 and help in the design of inhibitors of this essential enzyme.

  2. Toward "stable-on-the-table" enzymes: improving key properties of catalase by covalent conjugation with poly(acrylic acid).

    PubMed

    Riccardi, Caterina M; Cole, Kyle S; Benson, Kyle R; Ward, Jessamyn R; Bassett, Kayla M; Zhang, Yiren; Zore, Omkar V; Stromer, Bobbi; Kasi, Rajeswari M; Kumar, Challa V

    2014-08-20

    Several key properties of catalase such as thermal stability, resistance to protease degradation, and resistance to ascorbate inhibition were improved, while retaining its structure and activity, by conjugation to poly(acrylic acid) (PAA, Mw 8000) via carbodiimide chemistry where the amine groups on the protein are appended to the carboxyl groups of the polymer. Catalase conjugation was examined at three different pH values (pH 5.0, 6.0, and 7.0) and at three distinct mole ratios (1:100, 1:500, and 1:1000) of catalase to PAA at each reaction pH. The corresponding products are labeled as Cat-PAA(x)-y, where x is the protein to polymer mole ratio and y is the pH used for the synthesis. The coupling reaction consumed about 60-70% of the primary amines on the catalase; all samples were completely water-soluble and formed nanogels, as evidenced by gel electrophoresis and electron microscopy. The UV circular dichroism (CD) spectra indicated substantial retention of protein secondary structure for all samples, which increased to 100% with increasing pH of the synthesis and polymer mole fraction. Soret CD bands of all samples indicated loss of ∼50% of band intensities, independent of the reaction pH. Catalytic activities of the conjugates increased with increasing synthesis pH, where 55-80% and 90-100% activity was retained for all samples synthesized at pH 5.0 and pH 7.0, respectively, and the Km or Vmax values of Cat-PAA(100)-7 did not differ significantly from those of the free enzyme. All conjugates synthesized at pH 7.0 were thermally stable even when heated to ∼85-90 °C, while native catalase denatured between 55 and 65 °C. All conjugates retained 40-90% of their original activities even after storing for 10 weeks at 8 °C, while unmodified catalase lost all of its activity within 2 weeks, under similar storage conditions. Interestingly, PAA surrounding catalase limited access to the enzyme from large molecules like proteases and significantly increased

  3. Study of the serum levels of polyunsaturated fatty acids and the expression of related liver metabolic enzymes in a rat valproate-induced autism model.

    PubMed

    Zhao, Gang; Gao, Jingquan; Liang, Shuang; Wang, Xuelai; Sun, Caihong; Xia, Wei; Hao, Yanqiu; Li, Xiang; Cao, Yonggang; Wu, Lijie

    2015-08-01

    To investigate whether the decreased level of serum polyunsaturated fatty acids (PUFAs) in patients with autism is associated with the expression of related liver metabolic enzymes, we selected rats that were exposed to valproic acid (VPA) on embryonic day 12.5 (E12.5) as a model of autism. We observed the serum levels of PUFAs and the expression of related liver metabolic enzymes, including Δ5-desaturase, Δ6-desaturase and elongase (Elovl2), in VPA-exposed and control rats on postnatal day 35 (PND35) and conducted sex dimorphic analysis. We found that the levels of serum PUFAs and related liver metabolic enzymes in the VPA rats were significantly reduced, in association with autism-like behavioral changes, the abnormal expression of apoptosis-related proteins and hippocampal neuronal injury, compared to the control rats and showed sex difference in VPA group. This finding indicated that rats exposed to VPA at the embryonic stage may exhibit reduced synthesis of serum PUFAs due to the down-regulation of liver metabolic enzymes, thereby inducing nervous system injury and behavioral changes, which is affected by sex in the meantime.

  4. Xenograft Studies of Fatty Acid Synthesis Inhibition as Novel Therapy for Breast Cancer

    DTIC Science & Technology

    2000-08-01

    Studies of Fatty Acid Synthesis Inhibition as Novel Therapy for Breast Cancer PRINCIPAL INVESTIGATOR: Francis P. Kuhajda, M.D. CONTRACTING ORGANIZATION...SUBTITLE 5. FUNDING NUMBERS Xenograft Studies of Fatty Acid Synthesis DAMD17-96-1-6235 Inhibition as Novel Therapy for Breast Cancer 6. AUTHOR(S...5012. 13. ABSTRACT (Maximum 200 Words) This grant proposed to study the effect of fatty acid synthesis inhibition in human breast cancer xenografts

  5. Synthesis of amino Derivatives of Dithio Acids as Potential Radiation Protective Agents

    DTIC Science & Technology

    1984-08-01

    ation Management S SI ____ K> AD Synthesis of Amino Derivatives of Dithio Acids as Potential Radiation Protective Agents * 0 Annual Report "TIi: o DTIC...Sftcuntiy Clatuftcatio") Synthesis of Amino Derivatives of Dithio Acids as PotentitI- Radiation Protective Agents 12l PERISONAL. Ak.TI4OR(S) * William...methyl- picoline derivatives was accomplished. Use of N-mthyl-2,6-dimethylpyridine also allowed the synthesis of a bis(dithioacetic acid) function not

  6. Multi-enzyme co-embedded organic-inorganic hybrid nanoflowers: synthesis and application as a colorimetric sensor

    NASA Astrophysics Data System (ADS)

    Sun, Jiayu; Ge, Jiechao; Liu, Weimin; Lan, Minhua; Zhang, Hongyan; Wang, Pengfei; Wang, Yanming; Niu, Zhongwei

    2013-12-01

    This study reports a facile method for the synthesis of multi-enzyme co-embedded organic-inorganic hybrid nanoflowers, using glucose oxidase (GOx) and horseradish peroxidase (HRP) as the organic components, and Cu3(PO4)2.3H2O as the inorganic component. The synthesized nanoflowers enable the combination of a two-enzyme cascade reaction in one step, in which the GOx component of the nanoflowers oxidizes glucose to generate H2O2, which then reacts with the adjacent HRP component on the nanoflowers to oxidize the chromogenic substrates, resulting in an apparent color change. Given the close proximity of the two enzyme components in a single nanoflower, this novel sensor greatly reduces the diffusion and decomposition of H2O2, and greatly enhances the sensitivity of glucose detection. Thus, the obtained multi-enzyme co-embedded organic-inorganic hybrid nanoflowers can be unquestionably used as highly sensitive colorimetric sensors for the detection of glucose. Notably, this work presents a very facile route for the synthesis of multi-enzyme co-embedded nanomaterials for the simultaneous catalysis of multi-step cascade enzymatic reactions. Furthermore, it has great potential for application in biotechnology, and biomedical and environmental chemistry.This study reports a facile method for the synthesis of multi-enzyme co-embedded organic-inorganic hybrid nanoflowers, using glucose oxidase (GOx) and horseradish peroxidase (HRP) as the organic components, and Cu3(PO4)2.3H2O as the inorganic component. The synthesized nanoflowers enable the combination of a two-enzyme cascade reaction in one step, in which the GOx component of the nanoflowers oxidizes glucose to generate H2O2, which then reacts with the adjacent HRP component on the nanoflowers to oxidize the chromogenic substrates, resulting in an apparent color change. Given the close proximity of the two enzyme components in a single nanoflower, this novel sensor greatly reduces the diffusion and decomposition of H2O2

  7. Peroxidase activity of bacterial cytochrome P450 enzymes: modulation by fatty acids and organic solvents.

    PubMed

    Rabe, Kersten S; Erkelenz, Michael; Kiko, Kathrin; Niemeyer, Christof M

    2010-08-01

    The modulation of peroxidase activity by fatty acid additives and organic cosolvents was determined and compared for four bacterial cytochrome P450 enzymes, thermostable P450 CYP119A1, the P450 domain of CYP102A1 (BMP), CYP152A1 (P450(bsbeta)), and CYP101A1 (P450(cam)). Utilizing a high-throughput microplate assay, we were able to readily screen more than 100 combinations of enzymes, additives and cosolvents in a convenient and highly reproducible assay format. We found that, in general, CYP119A1 and BMP showed an increase in peroxidative activity in the presence of fatty acids, whereas CYP152A1 revealed a decrease in activity and CYP101A1 was only slightly affected. In particular, we observed that the conversion of the fluorogenic peroxidase substrate Amplex Red by CYP119A1 and BMP was increased by a factor of 38 or 11, respectively, when isopropanol and lauric acid were present in the reaction mixture. The activity of CYP119A1 could thus be modulated to reach more than 90% of the activity of CYP152A1 without effectors, which is the system with the highest peroxidative activity. For all P450s investigated we found distinctive reactivity patterns, which suggest similarities in the binding site of CYP119A1 and BMP in contrast with the other two proteins studied. Therefore, this study points towards a role of fatty acids as activators for CYP enzymes in addition to being mere substrates. In general, our detailed description of fatty acid- and organic solvent-effects is of practical interest because it illustrates that optimization of modulators and cosolvents can lead to significantly increased yields in biocatalysis.

  8. Calcineurin mediates homeostatic synaptic plasticity by regulating retinoic acid synthesis

    PubMed Central

    Arendt, Kristin L.; Zhang, Zhenjie; Ganesan, Subhashree; Hintze, Maik; Shin, Maggie M.; Tang, Yitai; Cho, Ahryon; Graef, Isabella A.; Chen, Lu

    2015-01-01

    Homeostatic synaptic plasticity is a form of non-Hebbian plasticity that maintains stability of the network and fidelity for information processing in response to prolonged perturbation of network and synaptic activity. Prolonged blockade of synaptic activity decreases resting Ca2+ levels in neurons, thereby inducing retinoic acid (RA) synthesis and RA-dependent homeostatic synaptic plasticity; however, the signal transduction pathway that links reduced Ca2+-levels to RA synthesis remains unknown. Here we identify the Ca2+-dependent protein phosphatase calcineurin (CaN) as a key regulator for RA synthesis and homeostatic synaptic plasticity. Prolonged inhibition of CaN activity promotes RA synthesis in neurons, and leads to increased excitatory and decreased inhibitory synaptic transmission. These effects of CaN inhibitors on synaptic transmission are blocked by pharmacological inhibitors of RA synthesis or acute genetic deletion of the RA receptor RARα. Thus, CaN, acting upstream of RA, plays a critical role in gating RA signaling pathway in response to synaptic activity. Moreover, activity blockade-induced homeostatic synaptic plasticity is absent in CaN knockout neurons, demonstrating the essential role of CaN in RA-dependent homeostatic synaptic plasticity. Interestingly, in GluA1 S831A and S845A knockin mice, CaN inhibitor- and RA-induced regulation of synaptic transmission is intact, suggesting that phosphorylation of GluA1 C-terminal serine residues S831 and S845 is not required for CaN inhibitor- or RA-induced homeostatic synaptic plasticity. Thus, our study uncovers an unforeseen role of CaN in postsynaptic signaling, and defines CaN as the Ca2+-sensing signaling molecule that mediates RA-dependent homeostatic synaptic plasticity. PMID:26443861

  9. Identification of key functional residues in the active site of human {beta}1,4-galactosyltransferase 7: a major enzyme in the glycosaminoglycan synthesis pathway.

    PubMed

    Talhaoui, Ibtissam; Bui, Catherine; Oriol, Rafael; Mulliert, Guillermo; Gulberti, Sandrine; Netter, Patrick; Coughtrie, Michael W H; Ouzzine, Mohamed; Fournel-Gigleux, Sylvie

    2010-11-26

    Glycosaminoglycans (GAGs) play a central role in many pathophysiological events, and exogenous xyloside substrates of β1,4-galactosyltransferase 7 (β4GalT7), a major enzyme of GAG biosynthesis, have interesting biomedical applications. To predict functional peptide regions important for substrate binding and activity of human β4GalT7, we conducted a phylogenetic analysis of the β1,4-galactosyltransferase family and generated a molecular model using the x-ray structure of Drosophila β4GalT7-UDP as template. Two evolutionary conserved motifs, (163)DVD(165) and (221)FWGWGREDDE(230), are central in the organization of the enzyme active site. This model was challenged by systematic engineering of point mutations, combined with in vitro and ex vivo functional assays. Investigation of the kinetic properties of purified recombinant wild-type β4GalT7 and selected mutants identified Trp(224) as a key residue governing both donor and acceptor substrate binding. Our results also suggested the involvement of the canonical carboxylate residue Asp(228) acting as general base in the reaction catalyzed by human β4GalT7. Importantly, ex vivo functional tests demonstrated that regulation of GAG synthesis is highly responsive to modification of these key active site amino acids. Interestingly, engineering mutants at position 224 allowed us to modify the affinity and to modulate the specificity of human β4GalT7 toward UDP-sugars and xyloside acceptors. Furthermore, the W224H mutant was able to sustain decorin GAG chain substitution but not GAG synthesis from exogenously added xyloside. Altogether, this study provides novel insight into human β4GalT7 active site functional domains, allowing manipulation of this enzyme critical for the regulation of GAG synthesis. A better understanding of the mechanism underlying GAG assembly paves the way toward GAG-based therapeutics.

  10. The Crystal Structure of the Adenylation Enzyme VinN Reveals a Unique β-Amino Acid Recognition Mechanism*

    PubMed Central

    Miyanaga, Akimasa; Cieślak, Jolanta; Shinohara, Yuji; Kudo, Fumitaka; Eguchi, Tadashi

    2014-01-01

    Adenylation enzymes play important roles in the biosynthesis and degradation of primary and secondary metabolites. Mechanistic insights into the recognition of α-amino acid substrates have been obtained for α-amino acid adenylation enzymes. The Asp residue is invariant and is essential for the stabilization of the α-amino group of the substrate. In contrast, the β-amino acid recognition mechanism of adenylation enzymes is still unclear despite the importance of β-amino acid activation for the biosynthesis of various natural products. Herein, we report the crystal structure of the stand-alone adenylation enzyme VinN, which specifically activates (2S,3S)-3-methylaspartate (3-MeAsp) in vicenistatin biosynthesis. VinN has an overall structure similar to that of other adenylation enzymes. The structure of the complex with 3-MeAsp revealed that a conserved Asp230 residue is used in the recognition of the β-amino group of 3-MeAsp similar to α-amino acid adenylation enzymes. A mutational analysis and structural comparison with α-amino acid adenylation enzymes showed that the substrate-binding pocket of VinN has a unique architecture to accommodate 3-MeAsp as a β-amino acid substrate. Thus, the VinN structure allows the first visualization of the interaction of an adenylation enzyme with a β-amino acid and provides new mechanistic insights into the selective recognition of β-amino acids in this family of enzymes. PMID:25246523

  11. The crystal structure of the adenylation enzyme VinN reveals a unique β-amino acid recognition mechanism.

    PubMed

    Miyanaga, Akimasa; Cieślak, Jolanta; Shinohara, Yuji; Kudo, Fumitaka; Eguchi, Tadashi

    2014-11-07

    Adenylation enzymes play important roles in the biosynthesis and degradation of primary and secondary metabolites. Mechanistic insights into the recognition of α-amino acid substrates have been obtained for α-amino acid adenylation enzymes. The Asp residue is invariant and is essential for the stabilization of the α-amino group of the substrate. In contrast, the β-amino acid recognition mechanism of adenylation enzymes is still unclear despite the importance of β-amino acid activation for the biosynthesis of various natural products. Herein, we report the crystal structure of the stand-alone adenylation enzyme VinN, which specifically activates (2S,3S)-3-methylaspartate (3-MeAsp) in vicenistatin biosynthesis. VinN has an overall structure similar to that of other adenylation enzymes. The structure of the complex with 3-MeAsp revealed that a conserved Asp(230) residue is used in the recognition of the β-amino group of 3-MeAsp similar to α-amino acid adenylation enzymes. A mutational analysis and structural comparison with α-amino acid adenylation enzymes showed that the substrate-binding pocket of VinN has a unique architecture to accommodate 3-MeAsp as a β-amino acid substrate. Thus, the VinN structure allows the first visualization of the interaction of an adenylation enzyme with a β-amino acid and provides new mechanistic insights into the selective recognition of β-amino acids in this family of enzymes.

  12. Synthesis and characterization of copolyanhydrides of carbohydrate-based galactaric acid and adipic acid.

    PubMed

    Mehtiö, Tuomas; Nurmi, Leena; Rämö, Virpi; Mikkonen, Hannu; Harlin, Ali

    2015-01-30

    A series of copolyanhydrides, consisting of 2,3,4,5-tetra-O-acetylgalactaric acid (AGA) and adipic acid (AA) as monomer units, was polymerized. Synthesis of AGA monomer consisted of two steps. First, O-acetylation of galactaric acid secondary hydroxyl groups was performed using acetic anhydride as a reagent. Acetic anhydride was then further used as a reagent in the synthesis of diacetyl mixed anhydride of AGA. Polymerizations were conducted as bulk condensation polymerization at 150 °C. Thermal properties of the copolymers varied depending on monomer composition. Increase in the AGA content had a clear increasing effect on the Tg. A similar increasing effect was observed in Tm. The degree of crystallinity decreased as AGA content increased. There was a slightly lowering tendency in the molecular weights of the obtained polymers when the AGA content in the polymerization mixtures increased. The described synthesis route shows that bio-based aldaric acid monomers are potential candidates for the adjustment of thermal properties of polyanhydrides.

  13. Study and comparison of two enzyme membrane reactors for fatty acids and glycerol production

    SciTech Connect

    Molinari, R.; Santoro, M.E.; Drioli, E. . Dept. of Chemical Engineering and Materials Inst. on Membranes and Chemical Reactors-CNR, Arcavacata di Rende )

    1994-11-01

    Two enzyme membrane reactors (EMR), (1) with one substrate (olive oil) in an oil-in-water emulsion (E-EMR) and (2) with two separated liquid phases (oil and water) (TSLP-EMR), have been studied for the conversion of the triglycerides to fatty acids and glycerol. The enzyme was Candida cylindracea lipase confined on the pressurized face or entrapped in the sponge side of capillary ultrafiltration membranes. Two methods for immobilizing the enzyme in the TSLP-EMR were used: ultrafiltration on a virgin membrane and ultrafiltration on glutaraldehyde pretreated membranes. A multiple use of the reactor was obtained immobilizing the enzyme on the membrane preactivated with glutaraldehyde. The TSLP-EMR showed a specific activity of 0.529 mmol/(mg[center dot]h) versus a specific activity of 0.170 mmol/(mg[center dot]h) of the E-EMR. The rate of fatty acid production in the TSLP-EMR was linear with time showing no enzyme deactivation in an operating time of 80 h. The kinetics observed in the two reactors was different: an equilibrium reaction product-inhibited for the E-EMR and an apparent irreversible reaction of zero order for the TSLP-EMR. Taking into account that in the TSLP-EMR, compared to the E-EMR, (1) the specific activity was higher, (2) the specific rate was constant with the time, and (3) the two products were already separated after the reaction, the TSLP-EMR configuration seems the more convenient.

  14. Effect of mevalonic acid on cholesterol synthesis in bovine intramuscular and subcutaneous adipocytes.

    PubMed

    Liu, Xiaomu; You, Wei; Cheng, Haijian; Zhang, Qingfeng; Song, Enliang; Wan, Fachun; Han, Hong; Liu, Guifen

    2016-02-01

    Mevalonic acid (MVA) is a key material in the synthesis of cholesterol; indeed, intracellular cholesterol synthesis is also called the mevalonic acid pathway. 3-Hydroxy-3-methylglutaryl-CoA reductase (HMGR) is an essential enzyme in cholesterol biosynthesis. This study suggests that MVA may play an important role in the differentiation of bovine adipose tissue in vivo. We investigated differential mRNA expression in bovine intramuscular preadipocytes (BIPs) and bovine subcutaneous preadipocytes (BSPs) by culturing cells from the longissimus dorsi muscle and subcutaneous fat tissues of Luxi yellow cattle. The morphology of lipid accumulation of bovine preadipocytes was detected by Oil Red O staining, and total cholesterol (TC), low-density lipoprotein cholesterol (LDLC), and high-density lipoprotein cholesterol (HDLC) levels were measured. Temporospatial expression of HMGR was investigated by real-time quantitative polymerase chain reaction (PCR). The TC, LDLC, and HDLC content did not significantly differ over time but increased slowly with increasing MVA concentration. HMGR expression increased over time and with increasing concentrations of MVA. MVA increased adipose cell proliferation in a dose-dependent and time-dependent manner. MVA stimulated HMGR expression in two cell types and its influence on adipocyte differentiation.

  15. Retinoic acid signalling centres in the avian embryo identified by sites of expression of synthesising and catabolising enzymes.

    PubMed

    Blentic, Aida; Gale, Emily; Maden, Malcolm

    2003-05-01

    Retinoic acid is an important signalling molecule in the developing embryo, but its precise distribution throughout development is very difficult to determine by available techniques. Examining the distribution of the enzymes by which it is synthesised by using in situ hybridisation is an alternative strategy. Here, we describe the distribution of three retinoic acid synthesising enzymes and one retinoic acid catabolic enzyme during the early stages of chick embryogenesis with the intention of identifying localized retinoic acid signalling regions. The enzymes involved are Raldh1, Raldh2, Raldh3, and Cyp26A1. Although some of these distributions have been described before, here we assemble them all in one species and several novel sites of enzyme expression are identified, including Hensen's node, the cardiac endoderm, the presumptive pancreatic endoderm, and the dorsal lens. This study emphasizes the dynamic pattern of expression of the enzymes that control the availability of retinoic acid as well as the role that retinoic acid plays in the development of many regions of the embryo throughout embryogenesis. This strategy provides a basis for understanding the phenotypes of retinoic acid teratology and retinoic acid-deficiency syndromes.

  16. Spatial organisation of four enzymes from Stevia rebaudiana that are involved in steviol glycoside synthesis.

    PubMed

    Humphrey, Tania V; Richman, Alex S; Menassa, Rima; Brandle, Jim E

    2006-05-01

    The sweet steviol glycosides found in the leaves of Stevia rebaudiana Bert. are derived from the diterpene steviol which is produced from a branch of the gibberellic acid (GA) biosynthetic pathway. An understanding of the spatial organisation of the two pathways including subcellular compartmentation provides important insight for the metabolic engineering of steviol glycosides as well as other secondary metabolites in plants. The final step of GA biosynthesis, before the branch point for steviol production, is the formation of (-)-kaurenoic acid from (-)-kaurene, catalysed by kaurene oxidase (KO). Downstream of this, the first committed step in steviol glycoside synthesis is the hydroxylation of kaurenoic acid to form steviol which is then sequentially glucosylated by a series of UDP-glucosyltransferases (UGTs) to produce the variety of steviol glycosides. The subcellular location of KO and three of the UGTs involved in steviol glycoside biosynthesis was investigated by expression of GFP fusions and cell fractionation which revealed KO to be associated with the endoplasmic reticulum and the UGTs in the cytoplasm. It has also been shown by expressing the Stevia UGTs in Arabidopsis that the pathway can be partially reconstituted by recruitment of a native Arabidopsis glucosyltransferase.

  17. Synthesis and biological activity of novel deoxycholic acid derivatives.

    PubMed

    Popadyuk, Irina I; Markov, Andrey V; Salomatina, Oksana V; Logashenko, Evgeniya B; Shernyukov, Andrey V; Zenkova, Marina A; Salakhutdinov, Nariman F

    2015-08-01

    We report the synthesis and biological activity of new semi-synthetic derivatives of naturally occurring deoxycholic acid (DCA) bearing 2-cyano-3-oxo-1-ene, 3-oxo-1(2)-ene or 3-oxo-4(5)-ene moieties in ring A and 12-oxo or 12-oxo-9(11)-ene moieties in ring C. Bioassays using murine macrophage-like cells and tumour cells show that the presence of the 9(11)-double bond associated with the increased polarity of ring A or with isoxazole ring joined to ring A, improves the ability of the compounds to inhibit cancer cell growth.

  18. Antimicrobial polyurethane thermosets based on undecylenic acid: synthesis and evaluation.

    PubMed

    Lluch, Cristina; Esteve-Zarzoso, Braulio; Bordons, Albert; Lligadas, Gerard; Ronda, Juan C; Galià, Marina; Cádiz, Virginia

    2014-08-01

    In the present study, plant oil-derived surface-modifiable polyurethane thermosets are presented. Polyol synthesis is carried out taking advantage of thiol-yne photopolymerization of undecylenic acid derivatives containing methyl ester or hydroxyl moieties. The prepared methyl ester-containing polyurethanes allow surface modification treatment to enhance their hydrophilicity and impart antimicrobial activity through the following two steps: i) grafting poly(propylene glycol) monoamine (Jeffamine M-600) via aminolysis and ii) Jeffamine M-600 layer complexation with iodine. The antimicrobial activity of the iodine-containing polyurethanes is demonstrated by its capacity to inhibit the growth of Staphylococcus aureus, and Candida albicans in agar media.

  19. Structural analysis of Bacillus pumilus phenolic acid decarboxylase, a lipocalin-fold enzyme

    SciTech Connect

    Matte, Allan; Grosse, Stephan; Bergeron, Hélène; Abokitse, Kofi; Lau, Peter C.K.

    2012-04-30

    The decarboxylation of phenolic acids, including ferulic and p-coumaric acids, to their corresponding vinyl derivatives is of importance in the flavoring and polymer industries. Here, the crystal structure of phenolic acid decarboxylase (PAD) from Bacillus pumilus strain UI-670 is reported. The enzyme is a 161-residue polypeptide that forms dimers both in the crystal and in solution. The structure of PAD as determined by X-ray crystallography revealed a -barrel structure and two -helices, with a cleft formed at one edge of the barrel. The PAD structure resembles those of the lipocalin-fold proteins, which often bind hydrophobic ligands. Superposition of structurally related proteins bound to their cognate ligands shows that they and PAD bind their ligands in a conserved location within the -barrel. Analysis of the residue-conservation pattern for PAD-related sequences mapped onto the PAD structure reveals that the conservation mainly includes residues found within the hydrophobic core of the protein, defining a common lipocalin-like fold for this enzyme family. A narrow cleft containing several conserved amino acids was observed as a structural feature and a potential ligand-binding site.

  20. Experiment K-7-21: Effect of Microgravity on 1: Metabolic Enzymes of Type 1 and Type 2 Muscle Fibers, and on 2: Metabolic Enzymes, Neurotransmitter Amino Acids, and Neurotransmitter Associated Enzymes in Selected Regions of the Central Nervous System. Part 2; The Distribution of Selected Enzymes and Amino Acids in the Hippocampal Formation

    NASA Technical Reports Server (NTRS)

    Lowry, O. H.; Krasnov, I.; Ilyina-Kakueva, E. I.; Nemeth, P. M.; McDougal, D. B., Jr.; Choksi, R.; Carter, J. G.; Chi, M. M. Y.; Manchester, J. K.; Pusateri, M. E.

    1994-01-01

    Six key metabolic enzymes plus glutaminase and glutamate decarboxylase, as well as glutamate, aspartate and GABA, were measured in 11 regions of the hippocampal formation of synchronous, flight and tail suspension rats. Major differences were observed in the normal distribution patterns of each enzyme and amino acid, but no substantive effects of either microgravity or tail suspension on these patterns were clearly demonstrated.

  1. Effects of inhibitors of key enzymes of sphingolipid metabolism on insulin-induced glucose uptake and glycogen synthesis in liver cells of old rats.

    PubMed

    Babenko, N A; Kharchenko, V S

    2015-01-01

    Sphingolipids play an important role in the development of insulin resistance. Ceramides are the most potent inhibitors of insulin signal transduction. Ceramides are generated in response to stress stimuli and in old age. In this work, we studied the possible contribution of different pathways of sphingolipid metabolism in age-dependent insulin resistance development in liver cells. Inhibition of key enzymes of sphingolipid synthesis (serine palmitoyl transferase, ceramide synthase) and degradation (neutral and acidic SMases) by means of specific inhibitors (myriocin, fumonisin B1, imipramine, and GW4869) was followed with the reduction of ceramide level and partly improved insulin regulation of glucose metabolism in "old" hepatocytes. Imipramine and GW4869 decreased significantly the acidic and neutral SMase activities, respectively. Treatment of "old" cells with myriocin or fumonisin B1 reduced the elevated in old age ceramide and SM synthesis. Ceramide and SM levels and glucose metabolism regulation by insulin could be improved with concerted action of all tested inhibitors of sphingolipid turnover on hepatocytes. The data demonstrate that not only newly synthesized ceramide and SM but also neutral and acidic SMase-dependent ceramide accumulation plays an important role in development of age-dependent insulin resistance.

  2. Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments.

    PubMed

    Kitadai, Norio

    2015-12-01

    Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids.

  3. Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments

    NASA Astrophysics Data System (ADS)

    Kitadai, Norio

    2015-12-01

    Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids.

  4. Promoter strength of folic acid synthesis genes affects sulfa drug resistance in Saccharomyces cerevisiae.

    PubMed

    Iliades, Peter; Berglez, Janette; Meshnick, Steven; Macreadie, Ian

    2003-01-01

    The enzyme dihydropteroate synthase (DHPS) is an important target for sulfa drugs in both prokaryotic and eukaryotic microbes. However, the understanding of DHPS function and the action of antifolates in eukaryotes has been limited due to technical difficulties and the complexity of DHPS being a part of a bifunctional or trifunctional protein that comprises the upstream enzymes involved in folic acid synthesis (FAS). Here, yeast strains have been constructed to study the effects of FOL1 expression on growth and sulfa drug resistance. A DHPS knockout yeast strain was complemented by yeast vectors expressing the FOL1 gene under the control of promoters of different strengths. An inverse relationship was observed between the growth rate of the strains and FOL1 expression levels. The use of stronger promoters to drive FOL1 expression led to increased sulfamethoxazole resistance when para-aminobenzoic acid (pABA) levels were elevated. However, high FOL1 expression levels resulted in increased susceptibility to sulfamethoxazole in pABA free media. These data suggest that up-regulation of FOL1 expression can lead to sulfa drug resistance in Saccharomyces cerevisiae.

  5. Human prostatic acid phosphatase directly stimulates collagen synthesis and alkaline phosphatase content of isolated bone cells

    SciTech Connect

    Ishibe, M.; Rosier, R.N.; Puzas, J.E. )

    1991-10-01

    Human prostatic acid phosphatase (hPAP) directly enhances the differentiated characteristics of isolated bone cells in vitro. This enzyme, when added to cell cultures for 24 h in vitro stimulates collagen synthesis and the production of alkaline phosphatase. The effects are dose dependent, with statistically significant effects occurring from 0.1-100 nM hPAP. Concentrations higher than 100 nM do not evoke greater effects. The maximal effect of hPAP occurs between 12 and 24 h of exposure. The cells stimulated to the greatest degree are osteoprogenitor cells and osteoblasts. Fibroblasts isolated from the same tissue show a lesser sensitivity to hPAP. hPAP has no detectable effect on cell proliferation, as measured by radiolabeled thymidine incorporation or total DNA synthesis. None of the observations reported in this work can be attributed to contaminating proteins in the hPAP preparation. hPAP was radiolabeled with 125I and was used for affinity binding and cross-linking studies. Scatchard analysis of specific binding indicated the presence of 1.0 X 10(5) high affinity binding sites/cell, with a Kd of 6.5 nM. Cross-linking studies demonstrated the presence of one 320-kDa binding complex. The pH profile and kinetic determinations of Km and maximum velocity for hPAP were similar to those previously reported, except for the finding of positive cooperativity of the substrate with the enzyme under the conditions of our assay. We believe that the direct stimulation of bone-forming cells by hPAP may contribute to the sclerotic nature of skeletal bone around sites of neoplastic prostatic metastases and that the effect of the enzyme is probably mediated by a plasma membrane receptor.

  6. Circadian control of bile acid synthesis by a KLF15-Fgf15 axis

    PubMed Central

    Han, Sean (Shuxin); Zhang, Rongli; Jain, Rajan; Shi, Hong; Zhang, Lilei; Zhou, Guangjin; Sangwung, Panjamaporn; Tugal, Derin; Atkins, G. Brandon; Prosdocimo, Domenick A.; Lu, Yuan; Han, Xiaonan; Tso, Patrick; Liao, Xudong; Epstein, Jonathan A.; Jain, Mukesh K.

    2015-01-01

    Circadian control of nutrient availability is critical to efficiently meet the energetic demands of an organism. Production of bile acids (BAs), which facilitate digestion and absorption of nutrients, is a major regulator of this process. Here we identify a KLF15-Fgf15 signalling axis that regulates circadian BA production. Systemic Klf15 deficiency disrupted circadian expression of key BA synthetic enzymes, tissue BA levels and triglyceride/cholesterol absorption. Studies in liver-specific Klf15-knockout mice suggested a non-hepatic basis for regulation of BA production. Ileal Fgf15 is a potent inhibitor of BA synthesis. Using a combination of biochemical, molecular and functional assays (including ileectomy and bile duct catheterization), we identify KLF15 as the first endogenous negative regulator of circadian Fgf15 expression. Elucidation of this novel pathway controlling circadian BA production has important implications for physiologic control of nutrient availability and metabolic homeostasis. PMID:26040986

  7. [Recombinant cephalosporin-acid synthesase: optimisation of expression in E.coli cells, immobilisation and application for biocatalytic cefazolin synthesis].

    PubMed

    Eldarov, M A; Sklyarenko, A V; Dumina, M V; Medvedeva, N V; Jgoun, A A; Satarova, J E; Sidorenko, A I; Emperian, A S; Yarotsky, S V

    2015-01-01

    Cephalosporin acid synthetase (CASA) is responsible for specific to synthesis of cephalosporin-acids, its expression in Escherichia coli cells is accompanied by accumulation of unprocessed insoluble precursor. In order to optimize conditions of recombinant CASA production we have studied the effects of several parameters of strain cultivation, including growth media composition, temperature, and inoculation dose. Also plasmids for production of CASA variants with the signal sequence of Erwinia carotovora L-asparaginase (ansCASA) and "leaderless" CASA were created in search of more efficient expression constructs. Removal of the N-terminal secretion signal sequence reduced the production of functionally active CASA more than 10-fold and inhibited strain growth. Insertion of the L-asparaginase signal sequence increased the specific enzyme activity in the resultant recombinant strain. The ansCASA producing strain was used to develop the method of immobilization of the recombinant enzyme on an epoxy-activated macroporous acrylic support. The resultant biocatalyst performed effective synthesis of cefazolin from 3-[(5-methyl-1,3,4-thiadiazol-2-il)-thiomethyl]-7- aminocephalosporanic acid (MMTD-7-ACA) and methyl ester of 1(H)-tetrazolilacetic acid (МETzAA), under mild conditions a transformation level of MMTD-7-ACA to cefazolin of 95% is reached.

  8. Green Synthesis and Urease Inhibitory Activity of Spiro-Pyrimidinethiones/Spiro-Pyrimidinones-Barbituric Acid Derivatives

    PubMed Central

    Mohammadi Ziarani, Ghodsi; Asadi, Shima; Faramarzi, Sakineh; Amanlou, Massoud

    2015-01-01

    Sulfonic acid functionalized SBA-15 (SBA-Pr-SO3H) with pore size 6 nm as an efficient heterogeneous nanoporous solid acid catalyst exhibited good catalytic activity in the Biginelli-like reaction in the synthesis of spiroheterobicyclic rings with good yield and good recyclability. Spiro-pyrimidinethiones/spiro-pyrimidinones-barbituric acid derivatives were synthesized in a simple and efficient method using the one-pot three-component reaction of a cyclic 1,3- dicarbonyl compounds (barbituric acid), an aromatic aldehyde and urea or thiourea in the presence of nanoporous silica SBA-Pr-SO3H under solvent free conditions. Urease inhibitory activity of spiro compounds were tested against Jack bean urease using Berthelot alkaline phenol–hypochlorite method. Five of 13 compounds were inhibitor and two of them were enzyme activators. Analysis of the docking results showed that, in most of the spiro molecules, one of the carbonyl groups is coordinated with both nickel atoms, while the other one is involved in the formation of hydrogen bonds with important active-site residues. The effect of inserting two methyl groups on N atoms of barbiturate ring, S substituted, ortho, meta and para substituted compounds were investigated too. PMID:26664377

  9. Synthesis and characterization of carboxylic acid functionalized silicon nanoparticles

    NASA Astrophysics Data System (ADS)

    Shaner, Ted V.

    Silicon nanoparticles are of great interest in a great number of fields. Silicon nanoparticles show great promise particularly in the field of bioimaging. Carboxylic acid functionalized silicon nanoparticles have the ability to covalently bond to biomolecules through the conjugation of the carboxylic acid to an amine functionalized biomolecule. This thesis explores the synthesis of silicon nanoparticles functionalized by both carboxylic acids and alkenes and their carboxylic acid functionality. Also discussed is the characterization of the silicon nanoparticles by the use of x-ray spectroscopy. Finally, the nature of the Si-H bond that is observed on the surface of the silicon nanoparticles will be investigated using photoassisted exciton mediated hydrosilation reactions. The silicon nanoparticles are synthesized from both carboxylic acids and alkenes. However, the lack of solubility of diacids is a significant barrier to carboxylic acid functionalization by a mixture of monoacids and diacids. A synthesis route to overcome this obstacle is to synthesize silicon nanoparticles with terminal vinyl group. This terminal vinyl group is distal to the surface of the silicon nanoparticle. The conversion of the vinyl group to a carboxylic acid is accomplished by oxidative cleavage using ozonolysis. The carboxylic acid functionalized silicon nanoparticles were then successfully conjugated to amine functionalized DNA strand through an n-hydroxy succinimide ester activation step, which promotes the formation of the amide bond. Conjugation was characterized by TEM and polyacrylamide gel electrophoresis (PAGE). The PAGE results show that the silicon nanoparticle conjugates move slower through the polyacrylamide gel, resulting in a significant separation from the nonconjugated DNA. The silicon nanoparticles were then characterized by the use of x-ray absorption near edge spectroscopy (Xanes) and x-ray photoelectron spectroscopy (XPS) to investigate the bonding and chemical

  10. Lignification and related enzymes in Glycine max root growth-inhibition by ferulic acid.

    PubMed

    dos Santos, Wanderley Dantas; Ferrarese, Maria de Lourdes L; Finger, Aline; Teixeira, Aline C N; Ferrarese-Filho, Osvaldo

    2004-06-01

    Changes in soluble and cell wall bound peroxidase (POD, EC 1.11.1.7) activity, phenylalanine ammonia-lyase (PAL, EC 4.3.1.5) activity, and lignin content in roots of ferulic acid-stressed soybean (Glycine max (L.) Merr.) seedlings and their relationships with root growth were investigated. Three-day-old soybean seedlings were cultivated in half-strength Hoagland nutrient solution containing 1.0 mM ferulic acid for 24-72 hr. Length, fresh weight, and dry weight of roots decreased, while soluble and cell wall bound POD activity, PAL activity, and lignin content increased after ferulic acid treatment. These enzymes probably participate in root growth reduction in association with cell wall stiffening related to the formation of cross-linking among cell wall polymers and lignin production.

  11. Integrated engineering of β-oxidation reversal and ω-oxidation pathways for the synthesis of medium chain ω-functionalized carboxylic acids.

    PubMed

    Clomburg, James M; Blankschien, Matthew D; Vick, Jacob E; Chou, Alexander; Kim, Seohyoung; Gonzalez, Ramon

    2015-03-01

    An engineered reversal of the β-oxidation cycle was exploited to demonstrate its utility for the synthesis of medium chain (6-10-carbons) ω-hydroxyacids and dicarboxylic acids from glycerol as the only carbon source. A redesigned β-oxidation reversal facilitated the production of medium chain carboxylic acids, which were converted to ω-hydroxyacids and dicarboxylic acids by the action of an engineered ω-oxidation pathway. The selection of a key thiolase (bktB) and thioesterase (ydiI) in combination with previously established core β-oxidation reversal enzymes, as well as the development of chromosomal expression systems for the independent control of pathway enzymes, enabled the generation of C6-C10 carboxylic acids and provided a platform for vector based independent expression of ω-functionalization enzymes. Using this approach, the expression of the Pseudomonas putida alkane monooxygenase system, encoded by alkBGT, in combination with all β-oxidation reversal enzymes resulted in the production of 6-hydroxyhexanoic acid, 8-hydroxyoctanoic acid, and 10-hydroxydecanoic acid. Following identification and characterization of potential alcohol and aldehyde dehydrogenases, chnD and chnE from Acinetobacter sp. strain SE19 were expressed in conjunction with alkBGT to demonstrate the synthesis of the C6-C10 dicarboxylic acids, adipic acid, suberic acid, and sebacic acid. The potential of a β-oxidation cycle with ω-oxidation termination pathways was further demonstrated through the production of greater than 0.8 g/L C6-C10 ω-hydroxyacids or about 0.5 g/L dicarboxylic acids of the same chain lengths from glycerol (an unrelated carbon source) using minimal media.

  12. Combined Effects of Lanthanum (III) and Acid Rain on Antioxidant Enzyme System in Soybean Roots.

    PubMed

    Zhang, Xuanbo; Du, Yuping; Wang, Lihong; Zhou, Qing; Huang, Xiaohua; Sun, Zhaoguo

    2015-01-01

    Rare earth element pollution (REEs) and acid rain (AR) pollution simultaneously occur in many regions, which resulted in a new environmental issue, the combined pollution of REEs and AR. The effects of the combined pollution on the antioxidant enzyme system of plant roots have not been reported. Here, the combined effects of lanthanum ion (La3+), one type of REE, and AR on the antioxidant enzyme system of soybean roots were investigated. In the combined treatment of La3+ (0.08 mM) and AR, the cell membrane permeability and the peroxidation of cell membrane lipid of soybean roots increased, and the superoxide dismutase, catalase, peroxidase and reduced ascorbic acid served as scavengers of reactive oxygen species. In other combined treatments of La3+ (0.40 mM, 1.20 mM) and AR, the membrane permeability, malonyldialdehyde content, superoxide dismutase activity, peroxidase activity and reduced ascorbic acid content increased, while the catalase activity decreased. The increased superoxide dismutase activity, peroxidase activity and reduced ascorbic acid content were inadequate to scavenge the excess hydrogen peroxide and superoxide, leading to the damage of the cell membrane, which was aggravated with the increase in the concentration of La3+ and the level of AR. The deleterious effects of the combined treatment of La3+ and AR were stronger than those of the single treatment of La3+ or AR. Moreover, the activity of antioxidant enzyme system in the combined treatment group was affected directly and indirectly by mineral element content in soybean plants.

  13. Combined Effects of Lanthanum (III) and Acid Rain on Antioxidant Enzyme System in Soybean Roots

    PubMed Central

    Zhang, Xuanbo; Du, Yuping; Wang, Lihong; Zhou, Qing; Huang, Xiaohua; Sun, Zhaoguo

    2015-01-01

    Rare earth element pollution (REEs) and acid rain (AR) pollution simultaneously occur in many regions, which resulted in a new environmental issue, the combined pollution of REEs and AR. The effects of the combined pollution on the antioxidant enzyme system of plant roots have not been reported. Here, the combined effects of lanthanum ion (La3+), one type of REE, and AR on the antioxidant enzyme system of soybean roots were investigated. In the combined treatment of La3+ (0.08 mM) and AR, the cell membrane permeability and the peroxidation of cell membrane lipid of soybean roots increased, and the superoxide dismutase, catalase, peroxidase and reduced ascorbic acid served as scavengers of reactive oxygen species. In other combined treatments of La3+ (0.40 mM, 1.20 mM) and AR, the membrane permeability, malonyldialdehyde content, superoxide dismutase activity, peroxidase activity and reduced ascorbic acid content increased, while the catalase activity decreased. The increased superoxide dismutase activity, peroxidase activity and reduced ascorbic acid content were inadequate to scavenge the excess hydrogen peroxide and superoxide, leading to the damage of the cell membrane, which was aggravated with the increase in the concentration of La3+ and the level of AR. The deleterious effects of the combined treatment of La3+ and AR were stronger than those of the single treatment of La3+ or AR. Moreover, the activity of antioxidant enzyme system in the combined treatment group was affected directly and indirectly by mineral element content in soybean plants. PMID:26230263

  14. Hyaluronan tetrasaccharides stimulate ceramide production through upregulated mRNA expression of ceramide synthesis-associated enzymes.

    PubMed

    Kage, Madoka; Tokudome, Yoshihiro

    2016-03-01

    It has been reported that hyaluronan has different physiological functions as suggested by variation in molecular weight. In addition, it has also been reported that CD44, the major hyaluronan receptor, was demonstrated to induce keratinocyte differentiation and lipid synthesis of cholesterol. We focus attention on the hyaluronan tetrasaccharides (HA4) which is the smallest unit of hyaluronan. We previously reported that HA4 induced keratinocyte differentiation and that CD44 may be involved. For the purpose of clarifying the influence of HA4 on ceramide synthesis, we evaluated both of these factors in keratinocytes in vitro and in vivo. The mRNA expression of ceramide synthesis-associated enzymes and intracellular ceramide content were evaluated after HA4 treatment in normal human epidermal keratinocytes. In addition, the ceramide increasing effect of HA4 on skin in UVA-irradiated hairless mice was assessed by water content of stratum corneum (SC) and transepidermal water loss (TEWL) methods. The mRNA expression of ceramide synthesis-associated enzymes and intracellular ceramide content after HA4 treatment were increased compared with the control. Furthermore, HA4 treatment increased water content of SC and decreased TEWL. These findings suggest that HA4 affected ceramide synthesis and is involved in the improvement of UV-induced skin damage.

  15. Stagewise dilute-acid pretreatment and enzyme hydrolysis of distillers' grains and corn fiber.

    PubMed

    Noureddini, Hossein; Byun, Jongwon; Yu, Ta-Jen

    2009-11-01

    Distillers' grains and corn fiber are the coproducts of the corn dry grind and wet milling industries, respectively. Availability of distillers' grains and corn fiber at the ethanol plant and their high levels of lignocellulosic material make these coproducts attractive feedstocks for conversion to ethanol. In this study, dilute sulfuric acid hydrolysis of these coproducts was investigated in a multistage scheme. After the completion of each pretreatment stage, the liquid substrate was separated and reused in the succeeding pretreatment stage with a fresh substrate. The substrate from each stage was also subjected to enzyme hydrolysis in a separate experiment. The sulfuric acid concentration and the substrate loading were maintained at 1.0 vol% and 15.0 wt.%, respectively, and the temperature was maintained at 120 degrees C in all the experiments. Experiments were also performed to study the effect of removing oil from the samples prior to the pretreatment. The highest concentration of monomeric sugars (MS) was observed when three stages of pretreatment were followed by the enzyme reaction. The enzyme hydrolysis of the three-stage pretreated dried distillers' grains and corn fiber yielded 122.6 +/- 5.8 and 184.5 +/- 4.1 mg/mL of MS, respectively. The formation of inhibitory products was also monitored.

  16. A novel enzyme-based acidizing system: Matrix acidizing and drilling fluid damage removal

    SciTech Connect

    Harris, R.E.; McKay, D.M.; Moses, V.

    1995-12-31

    A novel acidizing process is used to increase the permeability of carbonate rock cores in the laboratory and to remove drilling fluid damage from cores and wafers. Field results show the benefits of the technology as applied both to injector and producer wells.

  17. Effect of mitochondrial ascorbic acid synthesis on photosynthesis.

    PubMed

    Senn, M E; Gergoff Grozeff, G E; Alegre, M L; Barrile, F; De Tullio, M C; Bartoli, C G

    2016-07-01

    Ascorbic acid (AA) is synthesized in plant mitochondria through the oxidation of l-galactono-1,4-lactone (l-GalL) and then distributed to different cell compartments. AA-deficient Arabidopsis thaliana mutants (vtc2) and exogenous applications of l-GalL were used to generate plants with different AA content in their leaves. This experimental approach allows determining specific AA-dependent effects on carbon metabolism. No differences in O2 uptake, malic and citric acid and NADH content suggest that AA synthesis or accumulation did not affect mitochondrial activity; however, l-GalL treatment increased CO2 assimilation and photosynthetic electron transport rate in vtc2 (but not wt) leaves demonstrating a stimulation of photosynthesis after l-GalL treatment. Increased CO2 assimilation correlated with increased leaf stomatal conductance observed in l-GalL-treated vtc2 plants.

  18. Electrocarboxylation: towards sustainable and efficient synthesis of valuable carboxylic acids

    PubMed Central

    Matthessen, Roman; Fransaer, Jan; Binnemans, Koen

    2014-01-01

    Summary The near-unlimited availability of CO2 has stimulated a growing research effort in creating value-added products from this greenhouse gas. This paper presents the trends on the most important methods used in the electrochemical synthesis of carboxylic acids from carbon dioxide. An overview is given of different substrate groups which form carboxylic acids upon CO2 fixation, including mechanistic considerations. While most work focuses on the electrocarboxylation of substrates with sacrificial anodes, this review considers the possibilities and challenges of implementing other synthetic methodologies. In view of potential industrial application, the choice of reactor setup, electrode type and reaction pathway has a large influence on the sustainability and efficiency of the process. PMID:25383120

  19. Importance of ALDH1A enzymes in determining human testicular retinoic acid concentrations

    PubMed Central

    Arnold, Samuel L.; Kent, Travis; Hogarth, Cathryn A.; Schlatt, Stefan; Prasad, Bhagwat; Haenisch, Michael; Walsh, Thomas; Muller, Charles H.; Griswold, Michael D.; Amory, John K.; Isoherranen, Nina

    2015-01-01

    Retinoic acid (RA), the active metabolite of vitamin A, is required for spermatogenesis and many other biological processes. RA formation requires irreversible oxidation of retinal to RA by aldehyde dehydrogenase enzymes of the 1A family (ALDH1A). While ALDH1A1, ALDH1A2, and ALDH1A3 all form RA, the expression pattern and relative contribution of these enzymes to RA formation in the testis is unknown. In this study, novel methods to measure ALDH1A protein levels and intrinsic RA formation were used to accurately predict RA formation velocities in individual human testis samples and an association between RA formation and intratesticular RA concentrations was observed. The distinct localization of ALDH1A in the testis suggests a specific role for each enzyme in controlling RA formation. ALDH1A1 was found in Sertoli cells, while only ALDH1A2 was found in spermatogonia, spermatids, and spermatocytes. In the absence of cellular retinol binding protein (CRBP)1, ALDH1A1 was predicted to be the main contributor to intratesticular RA formation, but when CRBP1 was present, ALDH1A2 was predicted to be equally important in RA formation as ALDH1A1. This study provides a comprehensive novel methodology to evaluate RA homeostasis in human tissues and provides insight to how the individual ALDH1A enzymes mediate RA concentrations in specific cell types. PMID:25502770

  20. Adenosine deaminase deficiency with normal immune function. An acidic enzyme mutation.

    PubMed Central

    Daddona, P E; Mitchell, B S; Meuwissen, H J; Davidson, B L; Wilson, J M; Koller, C A

    1983-01-01

    In most instances, marked deficiency of the purine catabolic enzyme adenosine deaminase results in lymphopenia and severe combined immunodeficiency disease. Over a 2-yr period, we studied a white male child with markedly deficient erythrocyte and lymphocyte adenosine deaminase activity and normal immune function. We have documented that (a) adenosine deaminase activity and immunoreactive protein are undetectable in erythrocytes, 0.9% of normal in lymphocytes, 4% in cultured lymphoblasts, and 14% in skin fibroblasts; (b) plasma adenosine and deoxyadenosine levels are undetectable and deoxy ATP levels are only slightly elevated in lymphocytes and in erythrocytes; (c) no defect in deoxyadenosine metabolism is present in the proband's cultured lymphoblasts; (d) lymphoblast adenosine deaminase has normal enzyme kinetics, absolute specific activity, S20,w, pH optimum, and heat stability; and (e) the proband's adenosine deaminase exhibits a normal apparent subunit molecular weight but an abnormal isoelectric pH. In contrast to the three other adenosine deaminase-deficient healthy subjects who have been described, the proband is unique in demonstrating an acidic, heat-stable protein mutation of the enzyme that is associated with less than 1% lymphocyte adenosine deaminase activity. Residual adenosine deaminase activity in tissues other than lymphocytes may suffice to metabolize the otherwise lymphotoxic enzyme substrate(s) and account for the preservation of normal immune function. Images FIGURE 1 FIGURE 2 FIGURE 3 PMID:6603477

  1. Synthesis of green note aroma compounds by biotransformation of fatty acids using yeast cells coexpressing lipoxygenase and hydroperoxide lyase.

    PubMed

    Buchhaupt, Markus; Guder, Jan Christopher; Etschmann, Maria Magdalena Walburga; Schrader, Jens

    2012-01-01

    Green notes are substances that characterize the aroma of freshly cut grass, cucumbers, green apples, and foliage. In plants, they are synthesized by conversion of linolenic or linoleic acid via the enzymes lipoxygenase (LOX) and hydroperoxide lyase (HPL) to short-chained aldehydes. Current processes for production of natural green notes rely on plant homogenates as enzyme sources but are limited by low enzyme concentration and low specificity. In an alternative approach, soybean LOX2 and watermelon HPL were overexpressed in Saccharomyces cerevisiae. After optimization of the expression constructs, a yeast strain coexpressing LOX and HPL was applied in whole cell biotransformation experiments. Whereas addition of linolenic acid to growing cultures of this strain yielded no products, we were able to identify high green note concentrations when resting cells were used. The primary biotransformation product was 3(Z)-hexenal, a small amount of which isomerized to 2(E)-hexenal. Furthermore, both aldehydes were reduced to the corresponding green note alcohols by endogenous yeast alcohol dehydrogenase to some extent. As the cosolvent ethanol was the source of reducing equivalents for green note alcohol formation, the hexenal/hexenol ratio could be influenced by the use of alternative cosolvents. Further investigations to identify the underlying mechanism of the rather low biocatalyst stability revealed a high toxicity of linolenic acid to yeast cells. The whole cell catalyst containing LOX and HPL enzyme activity described here can be a promising approach towards a highly efficient microbial green note synthesis process.

  2. Oligomeric structure of proclavaminic acid amidino hydrolase: evolution of a hydrolytic enzyme in clavulanic acid biosynthesis.

    PubMed Central

    Elkins, Jonathan M; Clifton, Ian J; Hernández, Helena; Doan, Linh X; Robinson, Carol V; Schofield, Christopher J; Hewitson, Kirsty S

    2002-01-01

    During biosynthesis of the clinically used beta-lactamase inhibitor clavulanic acid, one of the three steps catalysed by clavaminic acid synthase is separated from the other two by a step catalysed by proclavaminic acid amidino hydrolase (PAH), in which the guanidino group of an intermediate is hydrolysed to give proclavaminic acid and urea. PAH shows considerable sequence homology with the primary metabolic arginases, which hydrolyse arginine to ornithine and urea, but does not accept arginine as a substrate. Like other members of the bacterial sub-family of arginases, PAH is hexameric in solution and requires Mn2+ ions for activity. Other metal ions, including Co2+, can substitute for Mn2+. Two new substrates for PAH were identified, N-acetyl-(L)-arginine and (3R)-hydroxy-N-acetyl-(L)-arginine. Crystal structures of PAH from Streptomyces clavuligerus (at 1.75 A and 2.45 A resolution, where 1 A=0.1 nm) imply how it binds beta-lactams rather than the amino acid substrate of the arginases from which it evolved. The structures also suggest how PAH selects for a particular alcohol intermediate in the clavam biosynthesis pathway. As observed for the arginases, each PAH monomer consists of a core of beta-strands surrounded by alpha-helices, and its active site contains a di-Mn2+ centre with a bridging water molecule responsible for hydrolytic attack on to the guanidino group of the substrate. Comparison of structures obtained under different conditions reveals different conformations of a flexible loop, which must move to allow substrate binding. PMID:12020346

  3. PHOSPHATIDIC ACID PHOSPHOHYDROLASE1 and 2 Regulate Phospholipid Synthesis at the Endoplasmic Reticulum in Arabidopsis[W

    PubMed Central

    Eastmond, Peter J.; Quettier, Anne-Laure; Kroon, Johan T.M.; Craddock, Christian; Adams, Nicolette; Slabas, Antoni R.

    2010-01-01

    Phospholipid biosynthesis is essential for the construction of most eukaryotic cell membranes, but how this process is regulated in plants remains poorly understood. Here, we show that in Arabidopsis thaliana, two Mg2+-dependent phosphatidic acid phosphohydrolases called PAH1 and PAH2 act redundantly to repress phospholipid biosynthesis at the endoplasmic reticulum (ER). Leaves from pah1 pah2 double mutants contain ~1.8-fold more phospholipid than the wild type and exhibit gross changes in ER morphology, which are consistent with massive membrane overexpansion. The net rate of incorporation of [methyl-14C]choline into phosphatidylcholine (PC) is ~1.8-fold greater in the double mutant, and the transcript abundance of several key genes that encode enzymes involved in phospholipid synthesis is increased. In particular, we show that PHOSPHORYLETHANOLAMINE N-METHYLTRANSFERASE1 (PEAMT1) is upregulated at the level of transcription in pah1 pah2 leaves. PEAMT catalyzes the first committed step of choline synthesis in Arabidopsis and defines a variant pathway for PC synthesis not found in yeasts or mammals. Our data suggest that PAH1/2 play a regulatory role in phospholipid synthesis that is analogous to that described in Saccharomyces cerevisiae. However, the target enzymes differ, and key components of the signal transduction pathway do not appear to be conserved. PMID:20699392

  4. Induction of chalcone isomerase in elicitor-treated bean cells. Comparison of rates of synthesis and appearance of immunodetectable enzyme.

    PubMed

    Robbins, M P; Dixon, R A

    1984-11-15

    Chalcone isomerase, an enzyme involved in the formation of flavonoid-derived compounds in plants, has been purified nearly 600-fold from cell suspension cultures of dwarf French bean (Phaseolus vulgaris L.). Chromatofocussing yielded a single form of the enzyme of apparent pI 5.0. This preparation was used to raise rabbit anti-(chalcone isomerase) serum. Changes in the rate of synthesis of chalcone isomerase have been investigated by indirect immunoprecipitation of enzyme labelled in vivo with [35S]methionine in elicitor-treated cultures of P. vulgaris. Elicitor, heat-released from cell walls of the phytopathogenic fungus Colletotrichum lindemuthianum, the causal agent of anthracnose disease of bean, causes increased synthesis of the isomerase, with maximum synthetic rate occurring 11-12 h after exposure to elicitor. Immune blotting studies indicate that the elicitor-mediated increase in extractable activity of the isomerase is associated with increased appearance of immunodetactable isomerase protein of Mr 27 000. However, the maximum level of immunodetectable isomerase was attained approximately 6 h earlier than maximum extractable activity. Furthermore, a 2.8-fold increase in enzyme activity above basal levels at 12 h after elicitor-treatment was associated with a corresponding 5.8-fold increase in immunodetectable enzyme. It is concluded that elicitor induces the synthesis of both active and inactive chalcone isomerase of Mr 27 000, and that some activation of inactive enzyme occurs during the elicitor-mediated increase in isomerase activity. The presence of a pool of inactive chalcone isomerase in bean cell cultures has recently been suggested on the basis of density labelling experiments utilising 2H from 2H2O [Dixon et al. (1983) Planta (Berl.) 159, 561-569].

  5. Synthesis of 6-phosphofructose aspartic acid and some related Amadori compounds.

    PubMed

    Hansen, Alexandar L; Behrman, Edward J

    2016-08-05

    We describe the synthesis and characterization of 6-phosphofructose-aspartic acid, an intermediate in the metabolism of fructose-asparagine by Salmonella. We also report improved syntheses of fructose-asparagine itself and of fructose-aspartic acid.

  6. Design, Synthesis, and Properties of Phosphoramidate 2',5'-Linked Branched RNA: Toward the Rational Design of Inhibitors of the RNA Lariat Debranching Enzyme.

    PubMed

    Tago, Nobuhiro; Katolik, Adam; Clark, Nathaniel E; Montemayor, Eric J; Seio, Kohji; Sekine, Mitsuo; Hart, P John; Damha, Masad J

    2015-10-16

    Two RNA fragments linked by means of a 2',5' phosphodiester bridge (2' hydroxyl of one fragment connected to the 5' hydroxyl of the other) constitute a class of nucleic acids known as 2'-5' branched RNAs (bRNAs). In this report we show that bRNA analogues containing 2'-5' phosphoramidate linkages (bN-RNAs) inhibit the lariat debranching enzyme, a 2',5'-phosphodiesterase that has recently been implicated in neurodegenerative diseases associated with aging. bN-RNAs were efficiently generated using automated solid-phase synthesis and suitably protected branchpoint building blocks. Two orthogonally removable groups, namely the 4-monomethoxytrityl (MMTr) group and the fluorenylmethyl-oxycarbonyl (Fmoc) groups, were evaluated as protecting groups of the 2' amino functionality. The 2'-N-Fmoc methodology was found to successfully produce bN-RNAs on solid-phase oligonucleotide synthesis. The synthesized bN-RNAs resisted hydrolysis by the lariat debranching enzyme (Dbr1) and, in addition, were shown to attenuate the Dbr1-mediated hydrolysis of native bRNA.

  7. Multi-enzyme co-embedded organic-inorganic hybrid nanoflowers: synthesis and application as a colorimetric sensor.

    PubMed

    Sun, Jiayu; Ge, Jiechao; Liu, Weimin; Lan, Minhua; Zhang, Hongyan; Wang, Pengfei; Wang, Yanming; Niu, Zhongwei

    2014-01-07

    This study reports a facile method for the synthesis of multi-enzyme co-embedded organic-inorganic hybrid nanoflowers, using glucose oxidase (GOx) and horseradish peroxidase (HRP) as the organic components, and Cu3(PO4)2 · 3H2O as the inorganic component. The synthesized nanoflowers enable the combination of a two-enzyme cascade reaction in one step, in which the GOx component of the nanoflowers oxidizes glucose to generate H2O2, which then reacts with the adjacent HRP component on the nanoflowers to oxidize the chromogenic substrates, resulting in an apparent color change. Given the close proximity of the two enzyme components in a single nanoflower, this novel sensor greatly reduces the diffusion and decomposition of H2O2, and greatly enhances the sensitivity of glucose detection. Thus, the obtained multi-enzyme co-embedded organic-inorganic hybrid nanoflowers can be unquestionably used as highly sensitive colorimetric sensors for the detection of glucose. Notably, this work presents a very facile route for the synthesis of multi-enzyme co-embedded nanomaterials for the simultaneous catalysis of multi-step cascade enzymatic reactions. Furthermore, it has great potential for application in biotechnology, and biomedical and environmental chemistry.

  8. Synthesis and characterization of acetic acid and ethanoic acid (based)-maleimide

    NASA Astrophysics Data System (ADS)

    Poad, Siti Nashwa Mohd; Hassan, Nurul Izzaty; Hassan, Nur Hasyareeda

    2016-11-01

    A new route to the synthesis of maleimide is described. 2-(2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)acetic acid maleimide (1) and 2-(4-(2,5-Dioxo-2,5-dihydro- 1H-pyrrol-1-yl)phenyl)ethanoic acid maleimide (2) have been synthesized by the reaction of maleic anhydride with glycine and 4-aminophenyl acetic aicd. Maleimide (1) was synthesized by conventional technique while maleimide (2) was synthesized by microwave method. The compounds were characterized using FT-Infrared (FT-IR), 1H and 13C Nuclear Magnetic Resonance (NMR) spectroscopies and Mass Spectrometry.

  9. Alternative kynurenic acid synthesis routes studied in the rat cerebellum

    PubMed Central

    Blanco Ayala, Tonali; Lugo Huitrón, Rafael; Carmona Aparicio, Liliana; Ramírez Ortega, Daniela; González Esquivel, Dinora; Pedraza Chaverrí, José; Pérez de la Cruz, Gonzalo; Ríos, Camilo; Schwarcz, Robert; Pérez de la Cruz, Verónica

    2015-01-01

    Kynurenic acid (KYNA), an astrocyte-derived, endogenous antagonist of α7 nicotinic acetylcholine and excitatory amino acid receptors, regulates glutamatergic, GABAergic, cholinergic and dopaminergic neurotransmission in several regions of the rodent brain. Synthesis of KYNA in the brain and elsewhere is generally attributed to the enzymatic conversion of L-kynurenine (L-KYN) by kynurenine aminotransferases (KATs). However, alternative routes, including KYNA formation from D-kynurenine (D-KYN) by D-amino acid oxidase (DAAO) and the direct transformation of kynurenine to KYNA by reactive oxygen species (ROS), have been demonstrated in the rat brain. Using the rat cerebellum, a region of low KAT activity and high DAAO activity, the present experiments were designed to examine KYNA production from L-KYN or D-KYN by KAT and DAAO, respectively, and to investigate the effect of ROS on KYNA synthesis. In chemical combinatorial systems, both L-KYN and D-KYN interacted directly with peroxynitrite (ONOO−) and hydroxyl radicals (OH•), resulting in the formation of KYNA. In tissue homogenates, the non-specific KAT inhibitor aminooxyacetic acid (AOAA; 1 mM) reduced KYNA production from L-KYN and D-KYN by 85.1 ± 1.7% and 27.1 ± 4.5%, respectively. Addition of DAAO inhibitors (benzoic acid, kojic acid or 3-methylpyrazole-5-carboxylic acid; 5 μM each) attenuated KYNA formation from L-KYN and D-KYN by ~35% and ~66%, respectively. ONOO− (25 μM) potentiated KYNA production from both L-KYN and D-KYN, and these effects were reduced by DAAO inhibition. AOAA attenuated KYNA production from L-KYN + ONOO− but not from D-KYN + ONOO−. In vivo, extracellular KYNA levels increased rapidly after perfusion of ONOO− and, more prominently, after subsequent perfusion with L-KYN or D-KYN (100 μM). Taken together, these results suggest that different mechanisms are involved in KYNA production in the rat cerebellum, and that, specifically, DAAO and ROS can function as alternative

  10. Allosteric ACTion: the varied ACT domains regulating enzymes of amino-acid metabolism.

    PubMed

    Lang, Eric J M; Cross, Penelope J; Mittelstädt, Gerd; Jameson, Geoffrey B; Parker, Emily J

    2014-12-01

    Allosteric regulation of enzyme activity plays important metabolic roles. Here we review the allostery of enzymes of amino-acid metabolism conferred by a discrete domain known as the ACT domain. This domain of 60-70 residues has a βαββαβ topology leading to a four-stranded β4β1β3β2 antiparallel sheet with two antiparallel helices on one face. Extensive sequence variation requires a combined sequence/structure/function analysis for identification of the ACT domain. Common features include highly varied modes of self-association of ACT domains, ligand binding at domain interfaces, and transmittal of allosteric signals through conformational changes and/or the manipulation of quaternary equilibria. A recent example illustrates the relatively facile adoption of this versatile module of allostery by gene fusion.

  11. Reverse reaction of malic enzyme for HCO3- fixation into pyruvic acid to synthesize L-malic acid with enzymatic coenzyme regeneration.

    PubMed

    Ohno, Yoko; Nakamori, Toshihiko; Zheng, Haitao; Suye, Shin-ichiro

    2008-05-01

    Malic enzyme [L-malate: NAD(P)(+) oxidoreductase (EC 1.1.1.39)] catalyzes the oxidative decarboxylation of L-malic acid to produce pyruvic acid using the oxidized form of NAD(P) (NAD(P)(+)). We used a reverse reaction of the malic enzyme of Pseudomonas diminuta IFO 13182 for HCO(3)(-) fixation into pyruvic acid to produce L-malic acid with coenzyme (NADH) generation. Glucose-6-phosphate dehydrogenase (EC1.1.1.49) of Leuconostoc mesenteroides was suitable for coenzyme regeneration. Optimum conditions for the carboxylation of pyruvic acid were examined, including pyruvic acid, NAD(+), and both malic enzyme and glucose-6-phosphate dehydrogenase concentrations. Under optimal conditions, the ratio of HCO(3)(-) and pyruvic acid to malic acid was about 38% after 24 h of incubation at 30 degrees C, and the concentration of the accumulated L-malic acid in the reaction mixture was 38 mM. The malic enzyme reverse reaction was also carried out by the conjugated redox enzyme reaction with water-soluble polymer-bound NAD(+).

  12. Human Milk Oligosaccharides (HMOS): Structure, Function, and Enzyme-Catalyzed Synthesis.

    PubMed

    Chen, Xi

    2015-01-01

    The important roles played by human milk oligosaccharides (HMOS), the third major component of human milk, in the health of breast-fed infants have been increasingly recognized, as the structures of more than 100 different HMOS have now been elucidated. Despite the recognition of the various functions of HMOS as prebiotics, antiadhesive antimicrobials, and immunomodulators, the roles and the applications of individual HMOS species are less clear. This is mainly due to the limited accessibility to large amounts of individual HMOS in their pure forms. Current advances in the development of enzymatic, chemoenzymatic, whole-cell, and living-cell systems allow for the production of a growing number of HMOS in increasing amounts. This effort will greatly facilitate the elucidation of the important roles of HMOS and allow exploration into the applications of HMOS both as individual compounds and as mixtures of defined structures with desired functions. The structures, functions, and enzyme-catalyzed synthesis of HMOS are briefly surveyed to provide a general picture about the current progress on these aspects. Future efforts should be devoted to elucidating the structures of more complex HMOS, synthesizing more complex HMOS including those with branched structures, and developing HMOS-based or HMOS-inspired prebiotics, additives, and therapeutics.

  13. Heparin and related polysaccharides: Synthesis using recombinant enzymes and metabolic engineering

    PubMed Central

    Suflita, Matthew; Fu, Li; He, Wenqin; Koffas, Mattheos; Linhardt, Robert J.

    2015-01-01

    Glycosaminoglycans are linear anionic polysaccharides that exhibit a number of important biological and pharmacological activities. The two most prominent members of this class of polysaccharides are heparin/heparan sulfate and the chondroitin sulfates (including dermatan sulfate). These polysaccharides, having complex structures and polydispersity, are biosynthesized in the Golgi of most animal cells. The chemical synthesis of these glycosaminoglycans is precluded by their structural complexity. Today, we depend on food animal tissues for their isolation and commercial production. Ton quantities of these glycosaminoglycans are used annually as pharmaceuticals and nutraceuticals. The variability of animal-sourced glycosaminoglycans, their inherent impurities, the limited availability of source tissues, the poor control of these source materials, and their manufacturing processes, suggest a need for new approaches for their production. Over the past decade there have been major efforts in the biotechnological production of these glycosaminoglycans. This mini-review focuses on the use of recombinant enzymes and metabolic engineering for the production of heparin and chondroitin sulfates. PMID:26219501

  14. Fabrication of enzyme reactor utilizing magnetic porous polymer membrane for screening D-Amino acid oxidase inhibitors.

    PubMed

    Jiang, Jun Fang; Qiao, Juan; Mu, Xiao Yu; Moon, Myeong Hee; Qi, Li

    2017-04-01

    In this work, a unique D-amino acid oxidase reactor for enhanced enzymolysis efficiency is presented. A kind of magnetic polymer matrices, composed of iron oxide nanoparticles and porous polymer membrane (poly styrene-co-maleic anhydride), was prepared. With covalent bonding D-Amino acid oxidase on the surface of the matrices and characterization of scanning electron microscope and vibrating sample magnetometer, it demonstrated that the membrane enzyme reactor was successfully constructed. The enzymolysis efficiency of the enzyme reactor was evaluated and the apparent Michaelis-Menten constants of D-Amino acid oxidase were determined (Km was 1.10mM, Vmax was 23.8mMmin(-1)) by a chiral ligand exchange capillary electrophoresis protocol with methionine as the substrate. The results indicated that the enzyme reactor could exhibit good stability and excellent reusability. Importantly, because the enzyme and the substrate could be confined into the pores of the matrices, the enzyme reactor displayed the improved enzymolysis efficiency due to the confinement effect. Further, the prepared enzyme reactor was applied for D-Amino acid oxidase inhibitors screening. It has displayed that the proposed protocol could pave a new way for fabrication of novel porous polymer membrane based enzyme reactors to screen enzyme inhibitors.

  15. Enzymatic synthesis of palm olein-based fatty thiohydroxamic acids.

    PubMed

    Al-Mulla, Emad A Jaffar; Yunus, Wan Md Zin Wan; Ibrahim, Nor Azowa Bt; Rahman, Mohd Zaki Ab

    2010-01-01

    Fatty thiohydroxamic acids (FTAs) have been successfully synthesized from palm olein and thiohydroxamic acid by a one-step lipase catalyzed reaction. The use of immobilized lipase (Lipozyme RMIM) as the catalyst for the preparation reaction provides an easy isolation of the enzyme from the products and other components in the reaction mixture. The FTAs were characterized using Fourier transform infrared (FTIR) spectroscopy, proton nuclear magnetic resonance ((1)H NMR) technique and elemental analysis. The highest conversion percentage (95 %) was obtained when the process was carried out for 30 hours using urea to palm oil ratio of 6.0: 1.0 at 40 °C. The method employed offers several advantages such as renewable and abundant of the raw material, simple reaction procedure, environmentally friendly process and high yield of the product.

  16. Recovery of Phenolic Acid and Enzyme Production from Corn Silage Biologically Treated by Trametes versicolor.

    PubMed

    Bucić-Kojić, Ana; Šelo, Gordana; Zelić, Bruno; Planinić, Mirela; Tišma, Marina

    2017-03-01

    Corn silage is used as high-energy forage for dairy cows and more recently for biogas production in a process of anaerobic co-digestion with cow manure. In this work, fresh corn silage after the harvest was used as a substrate in solid-state fermentations with T. versicolor with the aim of phenolic acid recovery and enzyme (laccase and manganese peroxidase) production. During 20 days of fermentation, 10.4-, 3.4-, 3.0-, and 1.8-fold increments in extraction yield of syringic acid, vanillic acid, p-hydroxybenzoic acid, and caffeic acid, respectively, were reached when compared to biologically untreated corn silage. Maximal laccase activity was gained on the 4th day of fermentation (V.A. = 180.2 U/dm(3)), and manganese peroxidase activity was obtained after the 3rd day of fermentation (V.A. = 30.1 U/dm(3)). The addition of copper(II) sulfate as inducer during solid state fermentation resulted in 8.5- and 7-fold enhancement of laccase and manganese peroxidase activities, respectively. Furthermore, the influence of pH and temperature on enzyme activities was investigated. Maximal activity of laccase was obtained at T = 50 °C and pH = 3.0, while manganese peroxidase is active at temperature range T = 45-70 °C with the maximal activity at pH = 4.5.

  17. Modulation of digestive enzyme activities during ontogeny of Labeo rohita larvae fed ascorbic acid enriched zooplankton.

    PubMed

    Mitra, Gopa; Mukhopadhyay, P K; Ayyappan, S

    2008-04-01

    The effect of supplementation of ascorbic acid through enriched zooplankton [10%, 20% and 30% ascorbyl palmitate (AP) inclusion in diet of zooplankton] on different digestive enzyme activities during ontogeny of Labeo rohita larvae was studied from 4 day to 15 day post hatch. Ascorbic acid (AA) content in different groups of unenriched (8.6+/-0.71) and enriched zooplankton were, 750+/-29.3, 1409.1+/-45.5, 2009.21+/-199.2 mug/g respectively on dry matter basis with differences (P<0.05) between the treatments. A difference (P<0.05) was found in tissue AA level in different dietary groups. Low amylase, protease, lipase and alkaline phosphatase activities were present in rohu larvae from the mouth opening stage which showed increasing trend with the age of larvae and increasing dietary AA content. A clear dose-dependent modulation of digestive enzyme activities in response to 10%, 20% and 30% AP enriched zooplankton feeding was evidenced from positive correlations between dietary AA content with magnitude of elevation of enzyme activity in different groups. There were 57, 55, 29.2 and 2 fold increases in amylase activity; 7.35, 7.02, 4.43 and 2.73 fold increases in protease activity; 45.636, 41.50, 19.83 and 13.69 fold increases in lipase activity and 6, 5, 3, and 2 fold increases in alkaline phosphatase activity observed in the 15th day post hatch larvae fed 20%, 30%, 10%AP enriched and normal zooplankton respectively, than 4-day post hatch larvae of the respective groups. Enzyme activities were also positively correlated with specific growth rates of wet weight of rohu larvae at the 15th day post hatch. Increased AA might have played an important role in advancing morphological transformation of the digestive tract, protecting gastric mucosa and accelerating growth by the process of tissue formation, which necessitated the requirement of more nutrient thereby, increasing digestive enzyme activity. The regulatory role of AA in the modulation of different digestive

  18. Conditions influencing the synthesis of acid protease by Mucor pusillus Lindt.

    PubMed

    Somkuti, G A; Babel, F J

    1967-11-01

    Protease synthesis by Mucor pusillus Lindt, in a wheat bran medium under submerged conditions, was influenced by substrate concentration, initial pH of the medium, and temperature of incubation. A 4% wheat bran (dry weight) concentration was satisfactory for enzyme production. The initial pH of the medium had a substantial effect on enzyme synthesis; adjustment of the enzyme production medium to pH 5.0 prior to sterilization was desirable. Incubation at 35 C resulted in the best enzyme yields. Under optimal conditions of enzyme production, maximal activity was detected after 5 days of incubation. The enrichment of the medium with glucose increased the yield of mycelia but lowered the amount of enzyme produced.

  19. recA gene product is responsible for inhibition of deoxyribonucleic acid synthesis after ultraviolet irradiation.

    PubMed Central

    Trgovcević, Z; Petranović, D; Petranović, M; Salaj-Smic, E

    1980-01-01

    Deoxyribonucleic acid synthesis after ultraviolet irradiation was studied in wild-type, uvrA, recB, recA recB, and recA Escherichia coli strains. Inhibition of deoxyribonucleic acid synthesis, which occurs almost immediately after exposing the cells to ultraviolet radiation, depends on the functional gene recA. PMID:6997276

  20. Synthesis of 9-oxononanoic acid, a precursor for biopolymers.

    PubMed

    Otte, Konrad B; Kirtz, Marko; Nestl, Bettina M; Hauer, Bernhard

    2013-11-01

    Polymers based on renewable resources have become increasingly important. The natural functionalization of fats and oils enables an easy access to interesting monomeric building blocks, which in turn transform the derivative biopolymers into high-performance materials. Unfortunately, interesting building blocks of medium-chain length are difficult to obtain by traditional chemical means. Herein, a biotechnological pathway is established that could provide an environmentally suitable and sustainable alternative. A multiple enzyme two-step one-pot process efficiently catalyzed by a coupled 9S-lipoxygenase (St-LOX1, Solanum tuberosum) and 9/13-hydroperoxide lyase (Cm-9/13HPL, Cucumis melo) cascade reaction is proposed as a potential route for the conversion of linoleic acid into 9-oxononanoic acid, which is a precursor for biopolymers. Lipoxygenase catalyzes the insertion of oxygen into linoleic acid through a radical mechanism to give 9S-hydroperoxy-octadecadienoic acid (9S-HPODE) as a cascade intermediate, which is subsequently cleaved by the action of Cm-9/13HPL. This one-pot process afforded a yield of 73 % combined with high selectivity. The best reaction performance was achieved when lipoxygenase and hydroperoxide lyase were applied in a successive rather than a simultaneous manner. Green leaf volatiles, which are desired flavor and fragrance products, are formed as by-products in this reaction cascade. Furthermore, we have investigated the enantioselectivity of 9/13-HPLs, which exhibited a strong preference for 9S-HPODE over 9R-HPODE.

  1. Poly-alpha-glutamic acid synthesis using a novel catalytic activity of RimK from Escherichia coli K-12.

    PubMed

    Kino, Kuniki; Arai, Toshinobu; Arimura, Yasuhiro

    2011-03-01

    Poly-L-α-amino acids have various applications because of their biodegradable properties and biocompatibility. Microorganisms contain several enzymes that catalyze the polymerization of L-amino acids in an ATP-dependent manner, but the products from these reactions contain amide linkages at the side residues of amino acids: e.g., poly-γ-glutamic acid, poly-ε-lysine, and cyanophycin. In this study, we found a novel catalytic activity of RimK, a ribosomal protein S6-modifying enzyme derived from Escherichia coli K-12. This enzyme catalyzed poly-α-glutamic acid synthesis from unprotected L-glutamic acid (Glu) by hydrolyzing ATP to ADP and phosphate. RimK synthesized poly-α-glutamic acid of various lengths; matrix-assisted laser desorption ionization-time of flight-mass spectrometry showed that a 46-mer of Glu (maximum length) was synthesized at pH 9. Interestingly, the lengths of polymers changed with changing pH. RimK also exhibited 86% activity after incubation at 55°C for 15 min, thus showing thermal stability. Furthermore, peptide elongation seemed to be catalyzed at the C terminus in a stepwise manner. Although RimK showed strict substrate specificity toward Glu, it also used, to a small extent, other amino acids as C-terminal substrates and synthesized heteropeptides. In addition, RimK-catalyzed modification of ribosomal protein S6 was confirmed. The number of Glu residues added to the protein varied with pH and was largest at pH 9.5.

  2. Induction of fatty acid synthesis by pravastatin sodium in rat liver and primary hepatocytes.

    PubMed

    Fujioka, T; Tsujita, Y; Shimotsu, H

    1997-06-11

    We examined the effect of pravastatin sodium (pravastatin), a 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase inhibitor, on fatty acid synthesis in rat liver. The repeated administration of pravastatin to rats at 250 mg/kg for 7 days led to a 2.8-fold increase in fatty acid synthesis in the liver. The diurnal change of fatty acid synthesis was not affected by the treatment. Hepatic fatty acid synthase activity was increased 3.2-fold, while acetyl-CoA carboxylase activity was not changed by the repeated administration of pravastatin. In rat hepatocytes, the incubation with 2 microg/ml pravastatin for 24 h increased fatty acid synthase activity 1.5-fold, as well as HMG-CoA reductase activity 2.8-fold. These results suggest that HMG-CoA reductase inhibitors might increase fatty acid synthesis in vivo through the induction of hepatic fatty acid synthase.

  3. Enzyme-assisted synthesis and structural characterization of the 3-, 8-, and 15-glucuronides of deoxynivalenol.

    PubMed

    Uhlig, Silvio; Ivanova, Lada; Fæste, Christiane Kruse

    2013-02-27

    4-Deoxynivalenol is one of the most prevalent mycotoxins in grain-based food and feed products worldwide. Conjugation of deoxynivalenol to glucuronic acid and elimination via the urine appears to be the major metabolism pathway, although with differing efficiency in different species. In order to make pure deoxynivalenol glucuronides for analytical methodologies available we intended to enzymatically synthesize glucuronides of deoxynivalenol using rat and human liver microsomes supplemented with uridine 5'-diphosphoglucuronic acid and alamethicin as detergent. Three glucuronides were isolated and purified using solid-phase extraction of microsomal incubations and subsequent semipreparative hydrophilic interaction chromatography. NMR spectra were obtained for all three compounds from solutions in methanol, showing that deoxynivalenol 3-O-β-D-glucuronide and deoxynivalenol 15-O-β-D-glucuronide were the major products from incubations of deoxynivalenol with rat and human liver microsomes, respectively. The NMR spectra of a third glucuronide showed replacement of the C-8 carbonyl by a ketal carbon. This glucuronide was finally identified as deoxynivalenol 8-O-β-D-glucuronide. The present study provides unequivocal structural evidence for three glucuronides of deoxynivalenol formed by liver enzymes.

  4. Synthesis of acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters

    DOEpatents

    Moens, Luc

    2003-06-24

    A process of preparing an acid addition salt of delta-aminolevulinc acid comprising: a) dissolving a lower alkyl 5-bromolevulinate and hexamethylenetetramine in a solvent selected from the group consisting of water, ethyl acetate, chloroform, acetone, ethanol, tetrahydrofuran and acetonitrile, to form a quaternary ammonium salt of the lower alkyl 5-bromolevulinate; and b) hydrolyzing the quaternary ammonium salt with an inorganic acid to form an acid addition salt of delta-aminolevulinic acid.

  5. Fatty acid synthesis and pyruvate metabolism pathways remain active in dihydroartemisinin-induced dormant ring stages of Plasmodium falciparum.

    PubMed

    Chen, Nanhua; LaCrue, Alexis N; Teuscher, Franka; Waters, Norman C; Gatton, Michelle L; Kyle, Dennis E; Cheng, Qin

    2014-08-01

    Artemisinin (ART)-based combination therapy (ACT) is used as the first-line treatment of uncomplicated falciparum malaria worldwide. However, despite high potency and rapid action, there is a high rate of recrudescence associated with ART monotherapy or ACT long before the recent emergence of ART resistance. ART-induced ring-stage dormancy and recovery have been implicated as possible causes of recrudescence; however, little is known about the characteristics of dormant parasites, including whether dormant parasites are metabolically active. We investigated the transcription of 12 genes encoding key enzymes in various metabolic pathways in P. falciparum during dihydroartemisinin (DHA)-induced dormancy and recovery. Transcription analysis showed an immediate downregulation for 10 genes following exposure to DHA but continued transcription of 2 genes encoding apicoplast and mitochondrial proteins. Transcription of several additional genes encoding apicoplast and mitochondrial proteins, particularly of genes encoding enzymes in pyruvate metabolism and fatty acid synthesis pathways, was also maintained. Additions of inhibitors for biotin acetyl-coenzyme A (CoA) carboxylase and enoyl-acyl carrier reductase of the fatty acid synthesis pathways delayed the recovery of dormant parasites by 6 and 4 days, respectively, following DHA treatment. Our results demonstrate that most metabolic pathways are downregulated in DHA-induced dormant parasites. In contrast, fatty acid and pyruvate metabolic pathways remain active. These findings highlight new targets to interrupt recovery of parasites from ART-induced dormancy and to reduce the rate of recrudescence following ART treatment.

  6. Elevation of the Yields of Very Long Chain Polyunsaturated Fatty Acids via Minimal Codon Optimization of Two Key Biosynthetic Enzymes

    PubMed Central

    Zheng, Desong; Sun, Quanxi; Liu, Jiang; Li, Yaxiao; Hua, Jinping

    2016-01-01

    Eicosapentaenoic acid (EPA, 20:5Δ5,8,11,14,17) and Docosahexaenoic acid (DHA, 22:6Δ4,7,10,13,16,19) are nutritionally beneficial to human health. Transgenic production of EPA and DHA in oilseed crops by transferring genes originating from lower eukaryotes, such as microalgae and fungi, has been attempted in recent years. However, the low yield of EPA and DHA produced in these transgenic crops is a major hurdle for the commercialization of these transgenics. Many factors can negatively affect transgene expression, leading to a low level of converted fatty acid products. Among these the codon bias between the transgene donor and the host crop is one of the major contributing factors. Therefore, we carried out codon optimization of a fatty acid delta-6 desaturase gene PinD6 from the fungus Phytophthora infestans, and a delta-9 elongase gene, IgASE1 from the microalga Isochrysis galbana for expression in Saccharomyces cerevisiae and Arabidopsis respectively. These are the two key genes encoding enzymes for driving the first catalytic steps in the Δ6 desaturation/Δ6 elongation and the Δ9 elongation/Δ8 desaturation pathways for EPA/DHA biosynthesis. Hence expression levels of these two genes are important in determining the final yield of EPA/DHA. Via PCR-based mutagenesis we optimized the least preferred codons within the first 16 codons at their N-termini, as well as the most biased CGC codons (coding for arginine) within the entire sequences of both genes. An expression study showed that transgenic Arabidopsis plants harbouring the codon-optimized IgASE1 contained 64% more elongated fatty acid products than plants expressing the native IgASE1 sequence, whilst Saccharomyces cerevisiae expressing the codon optimized PinD6 yielded 20 times more desaturated products than yeast expressing wild-type (WT) PinD6. Thus the codon optimization strategy we developed here offers a simple, effective and low-cost alternative to whole gene synthesis for high expression of

  7. Elevation of the Yields of Very Long Chain Polyunsaturated Fatty Acids via Minimal Codon Optimization of Two Key Biosynthetic Enzymes.

    PubMed

    Xia, Fei; Li, Xueying; Li, Xinzheng; Zheng, Desong; Sun, Quanxi; Liu, Jiang; Li, Yaxiao; Hua, Jinping; Qi, Baoxiu

    2016-01-01

    Eicosapentaenoic acid (EPA, 20:5Δ5,8,11,14,17) and Docosahexaenoic acid (DHA, 22:6Δ4,7,10,13,16,19) are nutritionally beneficial to human health. Transgenic production of EPA and DHA in oilseed crops by transferring genes originating from lower eukaryotes, such as microalgae and fungi, has been attempted in recent years. However, the low yield of EPA and DHA produced in these transgenic crops is a major hurdle for the commercialization of these transgenics. Many factors can negatively affect transgene expression, leading to a low level of converted fatty acid products. Among these the codon bias between the transgene donor and the host crop is one of the major contributing factors. Therefore, we carried out codon optimization of a fatty acid delta-6 desaturase gene PinD6 from the fungus Phytophthora infestans, and a delta-9 elongase gene, IgASE1 from the microalga Isochrysis galbana for expression in Saccharomyces cerevisiae and Arabidopsis respectively. These are the two key genes encoding enzymes for driving the first catalytic steps in the Δ6 desaturation/Δ6 elongation and the Δ9 elongation/Δ8 desaturation pathways for EPA/DHA biosynthesis. Hence expression levels of these two genes are important in determining the final yield of EPA/DHA. Via PCR-based mutagenesis we optimized the least preferred codons within the first 16 codons at their N-termini, as well as the most biased CGC codons (coding for arginine) within the entire sequences of both genes. An expression study showed that transgenic Arabidopsis plants harbouring the codon-optimized IgASE1 contained 64% more elongated fatty acid products than plants expressing the native IgASE1 sequence, whilst Saccharomyces cerevisiae expressing the codon optimized PinD6 yielded 20 times more desaturated products than yeast expressing wild-type (WT) PinD6. Thus the codon optimization strategy we developed here offers a simple, effective and low-cost alternative to whole gene synthesis for high expression of

  8. Hyaluronic acid nanogels with enzyme-sensitive cross-linking group for drug delivery.

    PubMed

    Yang, Chenchen; Wang, Xin; Yao, Xikuang; Zhang, Yajun; Wu, Wei; Jiang, Xiqun

    2015-05-10

    A methacrylation strategy was employed to functionalize hyaluronic acid and prepare hyaluronic acid (HA) nanogels. Dynamic light scattering, zeta potential analyzer and electron microscopy were utilized to characterize the nanogels and their enzyme-degradability in vitro. It was found that these nanogels had a spherical morphology with the diameter of about 70nm, and negative surface potential. When doxorubicin (DOX) was loaded into the nanogels, the diameter decreased to approximately 50nm with a drug loading content of 16% and encapsulation efficiency of 62%. Cellular uptake examinations showed that HA nanogels could be preferentially internalized by two-dimensional (2D) cells and three-dimensional (3D) multicellular spheroids (MCs) which both overexpress CD44 receptor. Near-infrared fluorescence imaging, biodistribution and penetration examinations in tumor tissue indicated that the HA nanogels could efficiently accumulate and penetrate the tumor matrix. In vivo antitumor evaluation found that DOX-loaded HA nanogels exhibited a significantly superior antitumor effect.

  9. Bioconjugation of therapeutic proteins and enzymes using the expanded set of genetically encoded amino acids.

    PubMed

    Lim, Sung In; Kwon, Inchan

    2016-10-01

    The last decade has witnessed striking progress in the development of bioorthogonal reactions that are strictly directed towards intended sites in biomolecules while avoiding interference by a number of physical and chemical factors in biological environment. Efforts to exploit bioorthogonal reactions in protein conjugation have led to the evolution of protein translational machineries and the expansion of genetic codes that systematically incorporate a range of non-natural amino acids containing bioorthogonal groups into recombinant proteins in a site-specific manner. Chemoselective conjugation of proteins has begun to find valuable applications to previously inaccessible problems. In this review, we describe bioorthogonal reactions useful for protein conjugation, and biosynthetic methods that produce proteins amenable to those reactions through an expanded genetic code. We then provide key examples in which novel protein conjugates, generated by the genetic incorporation of a non-natural amino acid and the chemoselective reactions, address unmet needs in protein therapeutics and enzyme engineering.

  10. The citric acid-modified, enzyme-resistant dextrin from potato starch as a potential prebiotic.

    PubMed

    Sliżewska, Katarzyna

    2013-01-01

    In the present study, enzyme-resistant dextrin, prepared by heating of potato starch in the presence of hydrochloric (0.1% dsb) and citric (0.1% dsb) acid at 130ºC for 3 h (CA-dextrin), was tested as a source of carbon for probiotic lactobacilli and bifidobacteria cultured with intestinal bacteria isolated from feces of three healthy 70-year old volunteers. The dynamics of growth of bacterial monocultures in broth containing citric acid (CA)-modified dextrin were estimated. It was also investigated whether lactobacilli and bifidobacteria cultured with intestinal bacteria in the presence of resistant dextrin would be able to dominate the intestinal isolates. Prebiotic fermentation of resistant dextrin was analyzed using prebiotic index (PI). In co-cultures of intestinal and probiotic bacteria, the environment was found to be dominated by the probiotic strains of Bifidobacterium and Lactobacillus, which is a beneficial effect.

  11. Indole diterpene synthetic studies. Total synthesis of (+)-nodulisporic acid F and construction of the heptacyclic cores of (+)-nodulisporic acids A and B and (-)-nodulisporic acid D.

    PubMed

    Smith, Amos B; Davulcu, Akin H; Cho, Young Shin; Ohmoto, Kazuyuki; Kürti, László; Ishiyama, Haruaki

    2007-06-22

    A first-generation strategy for construction of (+)-nodulisporic acids A (1) and B (2) is described. The strategy entails union of the eastern and western hemisphere subtargets via the indole synthesis protocol developed in our laboratory. Subsequent elaboration of rings E and F, however, revealed the considerable acid instability of the C(24) hydroxyl, thereby preventing further advancement. Nonetheless, preparation of the heptacyclic core of (+)-nodulisporic acids A and B, the total synthesis of (+)-nodulisporic acid F, the simplest member of the nodulisporic acid family, and elaboration of the heptacyclic core of (-)-nodulisporic acid D were achieved.

  12. The induction of two biosynthetic enzymes helps Escherichia coli sustain heme synthesis and activate catalase during hydrogen peroxide stress.

    PubMed

    Mancini, Stefano; Imlay, James A

    2015-05-01

    Hydrogen peroxide pervades many natural environments, including the phagosomes that mediate cell-based immunity. Transcriptomic analysis showed that during protracted low-grade H(2)O(2) stress, Escherichia coli responds by activating both the OxyR defensive regulon and the Fur iron-starvation response. OxyR induced synthesis of two members of the nine-step heme biosynthetic pathway: ferrochelatase (HemH) and an isozyme of coproporphyrinogen III oxidase (HemF). Mutations that blocked either adaptation caused the accumulation of porphyrin intermediates, inadequate activation of heme enzymes, low catalase activity, defective clearance of H(2)O(2) and a failure to grow. Genetic analysis indicated that HemH induction is needed to compensate for iron sequestration by the mini-ferritin Dps. Dps activity protects DNA and proteins by limiting Fenton chemistry, but it interferes with the ability of HemH to acquire the iron that it needs to complete heme synthesis. HemF is a manganoprotein that displaces HemN, an iron-sulfur enzyme whose synthesis and/or stability is apparently problematic during H(2)O(2) stress. Thus, the primary responses to H(2)O(2), including the sequestration of iron, require compensatory adjustments in the mechanisms of iron-cofactor synthesis. The results support the growing evidence that oxidative stress is primarily an iron pathology.

  13. Modulation of Medium-Chain Fatty Acid Synthesis in Synechococcus sp. PCC 7002 by Replacing FabH with a Chaetoceros Ketoacyl-ACP Synthase

    PubMed Central

    Gu, Huiya; Jinkerson, Robert E.; Davies, Fiona K.; Sisson, Lyle A.; Schneider, Philip E.; Posewitz, Matthew C.

    2016-01-01

    The isolation or engineering of algal cells synthesizing high levels of medium-chain fatty acids (MCFAs) is attractive to mitigate the high clouding point of longer chain fatty acids in algal based biodiesel. To develop a more informed understanding of MCFA synthesis in photosynthetic microorganisms, we isolated several algae from Great Salt Lake and screened this collection for MCFA accumulation to identify strains naturally accumulating high levels of MCFA. A diatom, Chaetoceros sp. GSL56, accumulated particularly high levels of C14 (up to 40%), with the majority of C14 fatty acids allocated in triacylglycerols. Using whole cell transcriptome sequencing and de novo assembly, putative genes encoding fatty acid synthesis enzymes were identified. Enzymes from this Chaetoceros sp. were expressed in the cyanobacterium Synechococcus sp. PCC 7002 to validate gene function and to determine whether eukaryotic enzymes putatively lacking bacterial evolutionary control mechanisms could be used to improve MCFA production in this promising production strain. Replacement of the Synechococcus 7002 native FabH with a Chaetoceros ketoacyl-ACP synthase III increased MCFA synthesis up to fivefold. The level of increase is dependent on promoter strength and culturing conditions. PMID:27303412

  14. Modulation of medium-chain fatty acid synthesis in Synechococcus sp. PCC 7002 by replacing FabH with a Chaetoceros Ketoacyl-ACP synthase

    DOE PAGES

    Gu, Huiya; Jinkerson, Robert E.; Davies, Fiona K.; ...

    2016-05-26

    The isolation or engineering of algal cells synthesizing high levels of medium-chain fatty acids (MCFAs) is attractive to mitigate the high clouding point of longer chain fatty acids in algal based biodiesel. To develop a more informed understanding of MCFA synthesis in photosynthetic microorganisms, we isolated several algae from Great Salt Lake and screened this collection for MCFA accumulation to identify strains naturally accumulating high levels of MCFA. A diatom, Chaetoceros sp. GSL56, accumulated particularly high levels of C14 (up to 40%), with the majority of C14 fatty acids allocated in triacylglycerols. Using whole cell transcriptome sequencing and de novomore » assembly, putative genes encoding fatty acid synthesis enzymes were identified. Enzymes from this Chaetoceros sp. were expressed in the cyanobacterium Synechococcus sp. PCC 7002 to validate gene function and to determine whether eukaryotic enzymes putatively lacking bacterial evolutionary control mechanisms could be used to improve MCFA production in this promising production strain. Replacement of the Synechococcus 7002 native FabH with a Chaetoceros ketoacyl-ACP synthase Ill increased MCFA synthesis up to fivefold. In conclusion, the level of increase is dependent on promoter strength and culturing conditions.« less

  15. Characterization of inulin hydrolyzing enzyme(s) in commercial glucoamylases and its application in lactic acid production from Jerusalem artichoke tubers (Jat).

    PubMed

    Dao, Thai Ha; Zhang, Jian; Bao, Jie

    2013-11-01

    A high inulinase activity was found in three commercially available glucoamylase enzymes. Its origin was investigated and two proteins in the commercial glucoamylases were identified as the potential enzymes showing inulinase activity. One of the commercial glucoamylases, GA-L New from Genencor, was used for Jerusalem artichoke tubers (Jat) hydrolysis and a high hydrolysis yield of fructose was obtained. The simultaneous saccharification and lactic acid fermentation (SSF) of Jat was carried out using GA-L New as the inulinase and Pediococcus acidilactici DQ2 as the fermenting strain. A high lactic acid titer, yield, and productivity of 111.5 g/L, 0.46 g/g DM, and 1.55 g/L/h, respectively, were obtained within 72 h. The enzyme cost using the commercial glucoamylase as inulinase was compared to that using the typical inulinase and a large profit margin was identified. The results provided a practical way of Jat application for lactic acid production using cheap commercial glucoamylase enzyme.

  16. Iodide-catalyzed reductions: development of a synthesis of phenylacetic acids.

    PubMed

    Milne, Jacqueline E; Storz, Thomas; Colyer, John T; Thiel, Oliver R; Dilmeghani Seran, Mina; Larsen, Robert D; Murry, Jerry A

    2011-11-18

    A new convenient and scalable synthesis of phenylacetic acids has been developed via the iodide catalyzed reduction of mandelic acids. The procedure relies on in situ generation of hydroiodic acid from catalytic sodium iodide, employing phosphorus acid as the stoichiometric reductant.

  17. Cloning and functional characterisation of an enzyme involved in the elongation of Delta6-polyunsaturated fatty acids from the moss Physcomitrella patens.

    PubMed

    Zank, Thorsten K; Zähringer, Ulrich; Beckmann, Christoph; Pohnert, Georg; Boland, Wilhelm; Holtorf, Hauke; Reski, Ralf; Lerchl, Jens; Heinz, Ernst

    2002-08-01

    The moss Physcomitrella patens contains high proportions of polyunsaturated very-long-chain fatty acids with up to 20 carbon atoms. Starting from preformed C18 polyunsaturated fatty acids, their biosynthesis involves a sequence of Delta6-desaturation, Delta6-elongation and Delta5-desaturation. In this report we describe for the first time the characterisation of a cDNA (PSE1) of plant origin with homology to the ELO-genes from Saccharomyces cerevisiae, encoding a component of the Delta6-elongase. Functional expression of PSE1 in S. cerevisiae led to the elongation of exogenously supplied Delta6-polyunsaturated fatty acids. By feeding experiments with different trienoic fatty acids of natural and synthetic origin, both substrate specificity and substrate selectivity of the enzyme were investigated. The activity of Pse1, when expressed in yeast, was not sensitive to the antibiotic cerulenin, which is an effective inhibitor of fatty acid synthesis and elongation. Furthermore, the PSE1 gene was disrupted in the moss by homologous recombination. This led to a complete loss of all C20 polyunsaturated fatty acids providing additional evidence for the function of the cDNA as coding for a component of the Delta6-elongase. The elimination of the elongase was not accompanied by a visible alteration in the phenotype, indicating that C20-PUFAs are not essential for viability of the moss under phytotron conditions.

  18. Ontogenetic changes in digestive enzyme activities and the amino acid profile of starry flounder Platichthys stellatus

    NASA Astrophysics Data System (ADS)

    Song, Zhidong; Wang, Jiying; Qiao, Hongjin; Li, Peiyu; Zhang, Limin; Xia, Bin

    2016-09-01

    Ontogenetic changes in digestive enzyme activities and the amino acid (AA) profile of starry flounder, Platichthys stellatus, were investigated and limiting amino acids were estimated compared with the essential AA profile between larvae and live food to clarify starry flounder larval nutritional requirements. Larvae were collected at the egg stage and 0, 2, 4, 7, 12, 17, 24 days after hatching (DAH) for analysis. Larvae grew from 1.91 mm at hatching to 12.13 mm at 24 DAH. Trypsin and chymotrypsin activities changed slightly by 4 DAH and then increased significantly 4 DAH. Pepsin activity increased sharply beginning 17 DAH. Lipase activity increased significantly 4 DAH and increased progressively with larval growth. Amylase activity was also detected in newly hatched larvae and increased 7 DAH followed by a gradual decrease. High free amino acid (FAA) content was detected in starry flounder eggs (110.72 mg/g dry weight). Total FAA content dropped to 43.29 mg/g in 4-DAH larvae and then decreased gradually to 13.74 mg/g in 24-DAH larvae. Most FAAs (except lysine and methionine) decreased >50% in 4-DAH larvae compared with those in eggs and then decreased to the lowest values in 24-DAH larvae. Changes in the protein amino acid (PAA) profile were much milder than those observed for FAAs. Most PAAs increased gradually during larval development, except lysine and phenylalanine. The percentages of free threonine, valine, isoleucine, and leucine decreased until the end of the trial, whereas the protein forms of these four AAs followed the opposite trend. A comparison of the essential AA composition of live food (rotifers, Artemia nauplii, and Artemia metanauplii) and larvae suggested that methionine was potentially the first limiting AA. These results may help develop starry flounder larviculture methods by solving the AA imbalance in live food. Moreover, the increased digestive enzyme activities indicate the possibility of introducing artificial compound feed.

  19. Inhibition of the RTEM beta-lactamase from Escherichia coli. Interaction of the enzyme with derivatives of olivanic acid.

    PubMed

    Easton, C J; Knowles, J R

    1982-06-08

    From chemical and kinetic studies of the interaction of the RTEM beta-lactamase from Escherichia coli with three derivatives of olivanic acid, MM22382 (1), MM13902 (2), and MM4550 (3), a mechanism for the inhibition of the enzyme by these compounds is proposed: the interaction proceeds by formation of an acyl-enzyme, the delta 2-pyrroline, which may either deacylate or undergo tautomerization to the more tightly bound delta 1-pyrroline. The ability of olivanic acids to inhibit the enzyme thus depends on the partitioning of the acyl-enzyme to the delta 1-pyrroline ( a process that competes with the normal hydrolytic pathway) and on the rate of regeneration of free enzyme from this complex.

  20. Expression of Vitis amurensis NAC26 in Arabidopsis enhances drought tolerance by modulating jasmonic acid synthesis

    PubMed Central

    Fang, Linchuan; Su, Lingye; Sun, Xiaoming; Li, Xinbo; Sun, Mengxiang; Karungo, Sospeter Karanja; Fang, Shuang; Chu, Jinfang; Li, Shaohua; Xin, Haiping

    2016-01-01

    The growth and fruit quality of grapevines are widely affected by abnormal climatic conditions such as water deficits, but many of the precise mechanisms by which grapevines respond to drought stress are still largely unknown. Here, we report that VaNAC26, a member of the NAC transcription factor family, was upregulated dramatically during cold, drought and salinity treatments in Vitis amurensis, a cold and drought-hardy wild Vitis species. Heterologous overexpression of VaNAC26 enhanced drought and salt tolerance in transgenic Arabidopsis. Higher activities of antioxidant enzymes and lower concentrations of H2O2 and O2 − were found in VaNAC26-OE lines than in wild type plants under drought stress. These results indicated that scavenging by reactive oxygen species (ROS) was enhanced by VaNAC26 in transgenic lines. Microarray-based transcriptome analysis revealed that genes related to jasmonic acid (JA) synthesis and signaling were upregulated in VaNAC26-OE lines under both normal and drought conditions. VaNAC26 showed a specific binding ability on the NAC recognition sequence (NACRS) motif, which broadly exists in the promoter regions of upregulated genes in transgenic lines. Endogenous JA content significantly increased in the VaNAC26-OE lines 2 and 3. Our data suggest that VaNAC26 responds to abiotic stresses and may enhance drought tolerance by transcriptional regulation of JA synthesis in Arabidopsis. PMID:27162276

  1. Expression of Vitis amurensis NAC26 in Arabidopsis enhances drought tolerance by modulating jasmonic acid synthesis.

    PubMed

    Fang, Linchuan; Su, Lingye; Sun, Xiaoming; Li, Xinbo; Sun, Mengxiang; Karungo, Sospeter Karanja; Fang, Shuang; Chu, Jinfang; Li, Shaohua; Xin, Haiping

    2016-04-01

    The growth and fruit quality of grapevines are widely affected by abnormal climatic conditions such as water deficits, but many of the precise mechanisms by which grapevines respond to drought stress are still largely unknown. Here, we report that VaNAC26, a member of the NAC transcription factor family, was upregulated dramatically during cold, drought and salinity treatments in Vitis amurensis, a cold and drought-hardy wild Vitis species. Heterologous overexpression of VaNAC26 enhanced drought and salt tolerance in transgenic Arabidopsis. Higher activities of antioxidant enzymes and lower concentrations of H2O2 and O2 (-) were found in VaNAC26-OE lines than in wild type plants under drought stress. These results indicated that scavenging by reactive oxygen species (ROS) was enhanced by VaNAC26 in transgenic lines. Microarray-based transcriptome analysis revealed that genes related to jasmonic acid (JA) synthesis and signaling were upregulated in VaNAC26-OE lines under both normal and drought conditions. VaNAC26 showed a specific binding ability on the NAC recognition sequence (NACRS) motif, which broadly exists in the promoter regions of upregulated genes in transgenic lines. Endogenous JA content significantly increased in the VaNAC26-OE lines 2 and 3. Our data suggest that VaNAC26 responds to abiotic stresses and may enhance drought tolerance by transcriptional regulation of JA synthesis in Arabidopsis.

  2. The role of two families of bacterial enzymes in putrescine synthesis from agmatine via agmatine deiminase.

    PubMed

    Landete, José M; Arena, Mario E; Pardo, Isabel; Manca de Nadra, María C; Ferrer, Sergi

    2010-12-01

    Putrescine, one of the main biogenic amines associated to microbial food spoilage, can be formed by bacteria from arginine via ornithine decarboxylase (ODC), or from agmatine via agmatine deiminase (AgDI). This study aims to correlate putrescine production from agmatine to the pathway involving N-carbamoylputrescine formation via AdDI (the aguA product) and N-carbamoylputrescine amidohydrolase (the aguB product), or putrescine carbamoyltransferase (the ptcA product) in bacteria. PCR methods were developed to detect the two genes involved in putrescine production from agmatine. Putrescine production from agmatine could be linked to the aguA and ptcA genes in Lactobacillus hilgardii X1B, Enterococcus faecalis ATCC 11700, and Bacillus cereus ATCC 14579. By contrast Lactobacillus sakei 23K was unable to produce putrescine, and although a fragment of DNA corresponding to the gene aguA was amplified, no amplification was observed for the ptcA gene. Pseudomonas aeruginosa PAO1 produces putrescine and is reported to harbour aguA and aguB genes, responsible for agmatine deiminase and N-carbamoylputrescine amidohydrolase activities. The enzyme from P. aeruginosa PAO1 that converts N-carbamoylputrescine to putrescine (the aguB product) is different from other microorganisms studied (the ptcA product). Therefore, the aguB gene from P. aeruginosa PAO1 could not be amplified with ptcA-specific primers. The aguB and ptcA genes have frequently been erroneously annotated in the past, as in fact these two enzymes are neither homologous nor analogous. Furthermore, the aguA, aguB and ptcA sequences available from GenBank were subjected to phylogenetic analysis, revealing that gram-positive bacteria harboured ptcA, whereas gram-negative bacteria harbour aguB. This paper also discusses the role of the agmatine deiminase system (AgDS) in acid stress resistance.

  3. Identification and biochemical characterization of plant acylamino acid-releasing enzyme.

    PubMed

    Yamauchi, Yasuo; Ejiri, Yukinori; Toyoda, Yasuyuki; Tanaka, Kiyoshi

    2003-08-01

    Plant acylamino acid-releasing enzyme (AARE) catalyzing the N-terminal hydrolysis of N(alpha)-acylpeptides to release N(alpha)-acylated amino acids, was biochemically characterized using recombinant and native AAREs. A cDNA encoding a deduced Arabidopsis thaliana AARE (AtAARE) was cloned and sequenced. The deduced amino acid sequence encoded a 764 amino acid protein of 83.9 kDa, which was 31.8% identical with that of rat AARE. In particular, the proposed catalytic residues (Ser, Asp, and His) of AARE, called the "catalytic triad residues, " were completely conserved. Recombinant AtAARE was expressed in Escherichia coli and confirmed to be a functional AARE. Native AAREs were prepared from A. thaliana and cucumber (Cucumis sativus, L.) plants. Both native AAREs were tetrameric proteins of 350 kDa comprising four subunits of 82 kDa, and showed typical enzymological properties of other AAREs, i.e. sensitivity to diisopropyl fluorophosphate, an optimum pH of around 7.0, and an optimum temperature of 37 degrees C. Both the native and recombinant AAREs were immunochemically homologous. Intracelluar fractionation analysis showed that the AARE was mainly present in the stroma of chloroplasts. Native AARE degraded the glycated ribulose-1,5-bisphoshate carboxylase/oxygenase protein but not the native protein. Thus, plant AARE might be involved in not only catalysis of the N-terminal hydrolysis of N(alpha)-acylpeptides but also the elimination of glycated proteins.

  4. Involvement of a lipoxygenase-like enzyme in abscisic Acid biosynthesis.

    PubMed

    Creelman, R A; Bell, E; Mullet, J E

    1992-07-01

    Several lines of evidence indicate that abscisic acid (ABA) is derived from 9'-cis-neoxanthin or 9'-cis-violaxanthin with xanthoxin as an intermediate. (18)O-labeling experiments show incorporation primarily into the side chain carboxyl group of ABA, suggesting that oxidative cleavage occurs at the 11, 12 (11', 12') double bond of xanthophylls. Carbon monoxide, a strong inhibitor of heme-containing P-450 monooxygenases, did not inhibit ABA accumulation, suggesting that the oxygenase catalyzing the carotenoid cleavage step did not contain heme. This observation, plus the ability of lipoxygenase to make xanthoxin from violaxanthin, suggested that a lipoxygenase-like enzyme is involved in ABA biosynthesis. To test this idea, the ability of several soybean (Glycine max L.) lipoxygenase inhibitors (5,8,11-eicosatriynoic acid, 5,8,11,14-eicosatetraynoic acid, nordihydroguaiaretic acid, and naproxen) to inhibit stress-induced ABA accumulation in soybean cell culture and soybean seedlings was determined. All lipoxygenase inhibitors significantly inhibited ABA accumulation in response to stress. These results suggest that the in vivo oxidative cleavage reaction involved in ABA biosynthesis requires activity of a nonheme oxygenase having lipoxygenase-like properties.

  5. Effects of cigarette smoke on cell viability, linoleic acid metabolism and cholesterol synthesis, in THP-1 cells.

    PubMed

    Ghezzi, Silvia; Risé, Patrizia; Ceruti, Stefania; Galli, Claudio

    2007-07-01

    Cigarette smoke (CS) contains thousands of substances, mainly free radicals that have as a target the polyunsaturated fatty acids (PUFA). Long chain PUFA are produced through elongation and desaturation reactions from their precursors; the desaturation reactions are catalyzed by different enzymes: the conversion of 18:2n-6 (linoleic acid, LA) to 18:3n-6 by Delta6 desaturase, while that of 20:3n-6 to 20:4n-6 by Delta5 desaturase. The aim of this work is to evaluate the effect of serum exposed to cigarette smoke (SE-FBS) on (1) cell viability and proliferation, (2) [1-(14)C] LA conversion and desaturase activities in THP-1 cells, a monocytic cell line. In THP-1, CS inhibits cell proliferation dose-dependently, by producing a modification in the cell cycle with a reduced number of cells in synthesis and mitosis phases at higher concentrations. CS also decreases [1-(14)C] LA conversion to its derivatives in a concentration-dependent manner, inhibiting the activities of Delta6 and mainly Delta5 desaturase. In addition, CS does not modify the incorporation of LA into various lipid classes but it reduces cholesterol synthesis from radiolabelled acetate, and increases free fatty acid, TG and CE levels. In conclusion, CS affects lipid metabolism, inhibiting LA conversion and desaturase activities. CS also shifts the "de novo" lipid synthesis from free cholesterol to TG and CE, where LA is preferentially esterified.

  6. Prediction of enzyme function based on 3D templates of evolutionarily important amino acids

    PubMed Central

    Kristensen, David M; Ward, R Matthew; Lisewski, Andreas Martin; Erdin, Serkan; Chen, Brian Y; Fofanov, Viacheslav Y; Kimmel, Marek; Kavraki, Lydia E; Lichtarge, Olivier

    2008-01-01

    Background Structural genomics projects such as the Protein Structure Initiative (PSI) yield many new structures, but often these have no known molecular functions. One approach to recover this information is to use 3D templates – structure-function motifs that consist of a few functionally critical amino acids and may suggest functional similarity when geometrically matched to other structures. Since experimentally determined functional sites are not common enough to define 3D templates on a large scale, this work tests a computational strategy to select relevant residues for 3D templates. Results Based on evolutionary information and heuristics, an Evolutionary Trace Annotation (ETA) pipeline built templates for 98 enzymes, half taken from the PSI, and sought matches in a non-redundant structure database. On average each template matched 2.7 distinct proteins, of which 2.0 share the first three Enzyme Commission digits as the template's enzyme of origin. In many cases (61%) a single most likely function could be predicted as the annotation with the most matches, and in these cases such a plurality vote identified the correct function with 87% accuracy. ETA was also found to be complementary to sequence homology-based annotations. When matches are required to both geometrically match the 3D template and to be sequence homologs found by BLAST or PSI-BLAST, the annotation accuracy is greater than either method alone, especially in the region of lower sequence identity where homology-based annotations are least reliable. Conclusion These data suggest that knowledge of evolutionarily important residues improves functional annotation among distant enzyme homologs. Since, unlike other 3D template approaches, the ETA method bypasses the need for experimental knowledge of the catalytic mechanism, it should prove a useful, large scale, and general adjunct to combine with other methods to decipher protein function in the structural proteome. PMID:18190718

  7. First total synthesis and antileishmanial activity of (Z)-16-methyl-11-heptadecenoic acid, a new marine fatty acid from the sponge Dragmaxia undata

    PubMed Central

    Carballeira, Néstor M.; Montano, Nashbly; Cintrón, Gabriel A.; Márquez, Carmary; Rubio, Celia Fernández; Prada, Christopher Fernández; Balaña-Fouce, Rafael

    2010-01-01

    The first total synthesis for the (Z)-16-methyl-11-heptadecenoic acid, a novel fatty acid from the sponge Dragmaxia undata, was accomplished in seven steps and in a 44% overall yield. The use of (trimethylsilyl)acetylene was key in the synthesis. Based on a previous developed strategy in our laboratory the best synthetic route towards the title compound was first acetylide coupling of (trimethylsilyl)acetylene to the long-chain protected 10-bromo-1-decanol followed by a second acetylide coupling to the short-chain 1-bromo-4-methylpentane, which resulted in higher yields. Complete spectral data is also presented for the first time for this recently discovered fatty acid and the cis double bond stereochemistry of the natural acid was established. The title compound displayed antiprotozoal activity against Leishmania donovani (IC50 = 165.5 ± 23.4 µM) and inhibited the leishmania DNA topoisomerase IB enzyme (LdTopIB) with an IC50 = 62.3 ± 0.7 µM. PMID:21129369

  8. Hyaluronic acid synthesis is required for zebrafish tail fin regeneration

    PubMed Central

    Ouyang, Xiaohu; Panetta, Nicholas J.; Talbott, Maya D.; Payumo, Alexander Y.; Halluin, Caroline; Longaker, Michael T.

    2017-01-01

    Using genome-wide transcriptional profiling and whole-mount expression analyses of zebrafish larvae, we have identified hyaluronan synthase 3 (has3) as an upregulated gene during caudal fin regeneration. has3 expression is induced in the wound epithelium within hours after tail amputation, and its onset and maintenance requires fibroblast growth factor, phosphoinositide 3-kinase, and transforming growth factor-ß signaling. Inhibition of hyaluronic acid (HA) synthesis by the small molecule 4-methylumbelliferone (4-MU) impairs tail regeneration in zebrafish larvae by preventing injury-induced cell proliferation. In addition, 4-MU reduces the expression of genes associated with wound epithelium and blastema function. Treatment with glycogen synthase kinase 3 inhibitors rescues 4-MU-induced defects in cell proliferation and tail regeneration, while restoring a subset of wound epithelium and blastema markers. Our findings demonstrate a role for HA biosynthesis in zebrafish tail regeneration and delineate its epistatic relationships with other regenerative processes. PMID:28207787

  9. Total Synthesis of Five Lipoteichoic acids of Clostridium difficile.

    PubMed

    Hogendorf, Wouter F J; Gisch, Nicolas; Schwudke, Dominik; Heine, Holger; Bols, Mikael; Pedersen, Christian Marcus

    2014-10-13

    The emergence of hypervirulent resistant strains have made Clostridium difficile a notorious nosocomial pathogen and has resulted in a renewed interest in preventive strategies, such as vaccines based on (synthetic) cell wall antigens. Recently, the structure of the lipoteichoic acid (LTA) of this species has been elucidated. Additionally, this LTA was found to induce the formation of protective antibodies against C. difficile in rabbits and mice. The LTA from C. difficile is isolated as a microheterogenous mixture, differing in size and composition, impeding any structure-activity relationship studies. To ensure reliable biological results, pure and well-defined synthetic samples are required. In this work the total synthesis of LTAs from C. difficile with defined chain length is described and the initial biological results are presented.

  10. Synthesis and characterization of 2-mercaptoethanesulfonic acid albumin.

    PubMed

    Bauer, H H; Ehmig, S; Engels, J W; Voelcker, G

    1998-06-01

    Autoimmune patients treated with ifosfamide (CAS 3778-73-2) and mesna (2-mercaptoethanesulfonic acid, CAS 3375-50-6) in some cases suffered from severe allergic reactions that were proposed to be due to mesna linked to serum albumin by a disulfide bond. To prove the existence of the hypothetic mesna albumin adduct in vivo it was synthesized: The free thiol group of albumin (molecular mass determined by MALDI spectroscopy: 67009 Da) was converted to S-phenylsulfonyl albumin and reacted with mesna to albumin mesna (molecular mass: 67159 Da). In an alternative synthesis albumin was incubated with mesna at pH 8, 40 degrees C (molecular mass of the adduct: 67166 Da).

  11. In situ synthesis of porous silica nanoparticles for covalent immobilization of enzymes.

    PubMed

    Yang, Xiaowei; Cai, Zhengwei; Ye, Zhangmei; Chen, Sheng; Yang, Yu; Wang, Haifang; Liu, Yuanfang; Cao, Aoneng

    2012-01-21

    A simple method is used to covalently encapsulate enzymes in silica nanoparticles. The encapsulation is highlighted by the high enzyme loading and porous channels that provide efficient diffusion for small substrate and product molecules while preventing protease degradation.

  12. Comparative genomics of citric-acid producing Aspergillus niger ATCC 1015 versus enzyme-producing CBS 513.88

    SciTech Connect

    Grigoriev, Igor V.; Baker, Scott E.; Andersen, Mikael R.; Salazar, Margarita P.; Schaap, Peter J.; Vondervoot, Peter J.I. van de; Culley, David; Thykaer, Jette; Frisvad, Jens C.; Nielsen, Kristen F.; Albang, Richard; Albermann, Kaj; Berka, Randy M.; Braus, Gerhard H.; Braus-Stromeyer, Susanna A.; Corrochano, Luis M.; Dai, Ziyu; Dijck, Piet W.M. van; Hofmann, Gerald; Lasure, Linda L.; Magnusson, Jon K.; Meijer, Susan L.; Nielsen, Jakob B.; Nielsen, Michael L.; Ooyen, Albert J.J. van; Panther, Kathyrn S.; Pel, Herman J.; Poulsen, Lars; Samson, Rob A.; Stam, Hen; Tsang, Adrian; Brink, Johannes M. van den; Atkins, Alex; Aerts, Andrea; Shapiro, Harris; Pangilinan, Jasmyn; Salamov, Asaf; Lou, Yigong; Lindquist, Erika; Lucas, Susan; Grimwood, Jane; Kubicek, Christian P.; Martinez, Diego; Peij, Noel N.M.E. van; Roubos, Johannes A.; Nielsen, Jens

    2011-04-28

    The filamentous fungus Aspergillus niger exhibits great diversity in its phenotype. It is found globally, both as marine and terrestrial strains, produces both organic acids and hydrolytic enzymes in high amounts, and some isolates exhibit pathogenicity. Although the genome of an industrial enzyme-producing A. niger strain (CBS 513.88) has already been sequenced, the versatility and diversity of this species compels additional exploration. We therefore undertook whole genome sequencing of the acidogenic A. niger wild type strain (ATCC 1015), and produced a genome sequence of very high quality. Only 15 gaps are present in the sequence and half the telomeric regions have been elucidated. Moreover, sequence information from ATCC 1015 was utilized to improve the genome sequence of CBS 513.88. Chromosome-level comparisons uncovered several genome rearrangements, deletions, a clear case of strain-specific horizontal gene transfer, and identification of 0.8 megabase of novel sequence. Single nucleotide polymorphisms per kilobase (SNPs/kb) between the two strains were found to be exceptionally high (average: 7.8, maximum: 160 SNPs/kb). High variation within the species was confirmed with exo-metabolite profiling and phylogenetics. Detailed lists of alleles were generated, and genotypic differences were observed to accumulate in metabolic pathways essential to acid production and protein synthesis. A transcriptome analysis revealed up-regulation of the electron transport chain, specifically the alternative oxidative pathway in ATCC 1015, while CBS 513.88 showed significant up-regulation of genes relevant to glucoamylase A production, such as tRNA-synthases and protein transporters. Our results and datasets from this integrative systems biology analysis resulted in a snapshot of fungal evolution and will support further optimization of cell factories based on filamentous fungi.[Supplemental materials (10 figures, three text documents and 16 tables) have been made available

  13. Continuous multistep synthesis of perillic acid from limonene by catalytic biofilms under segmented flow.

    PubMed

    Willrodt, Christian; Halan, Babu; Karthaus, Lisa; Rehdorf, Jessica; Julsing, Mattijs K; Buehler, Katja; Schmid, Andreas

    2017-02-01

    The efficiency of biocatalytic reactions involving industrially interesting reactants is often constrained by toxification of the applied biocatalyst. Here, we evaluated the combination of biologically and technologically inspired strategies to overcome toxicity-related issues during the multistep oxyfunctionalization of (R)-(+)-limonene to (R)-(+)-perillic acid. Pseudomonas putida GS1 catalyzing selective limonene oxidation via the p-cymene degradation pathway and recombinant Pseudomonas taiwanensis VLB120 were evaluated for continuous perillic acid production. A tubular segmented-flow biofilm reactor was used in order to relieve oxygen limitations and to enable membrane mediated substrate supply as well as efficient in situ product removal. Both P. putida GS1 and P. taiwanensis VLB120 developed a catalytic biofilm in this system. The productivity of wild-type P. putida GS1 encoding the enzymes for limonene bioconversion was highly dependent on the carbon source and reached 34 g Ltube(-1)  day(-1) when glycerol was supplied. More than 10-fold lower productivities were reached irrespective of the applied carbon source when the recombinant P. taiwanensis VLB120 harboring p-cymene monooxygenase and p-cumic alcohol dehydrogenase was used as biocatalyst. The technical applicability for preparative perillic acid synthesis in the applied system was verified by purification of perillic acid from the outlet stream using an anion exchanger resin. This concept enabled the multistep production of perillic acid and which might be transferred to other reactions involving volatile reactants and toxic end-products. Biotechnol. Bioeng. 2017;114: 281-290. © 2016 Wiley Periodicals, Inc.

  14. Senescence in isolated carnation petals : effects of indoleacetic Acid and inhibitors of protein synthesis.

    PubMed

    Wulster, G; Sacalis, J; Janes, H W

    1982-10-01

    Indoleacetic acid induces senescence in isolated carnation (Dianthus caryophyllus, cv. White Sim) petals, increasing the duration and amount of ethylene production. This effect is inhibited by Actinomycin D, an inhibitor of RNA synthesis, and cycloheximide, a translational inhibitor of protein synthesis. The ability of petals to respond to indoleacetic acid appears to be a function of physiological age. Indoleacetic acid is capable of enhancing ethylene evolution and senescence only in specific portions of the petal.

  15. Efficient ytterbium triflate catalyzed microwave-assisted synthesis of 3-acylacrylic acid building blocks.

    PubMed

    Tolstoluzhsky, Nikita V; Gorobets, Nikolay Yu; Kolos, Nadezhda N; Desenko, Sergey M

    2008-01-01

    The derivatives of 4-(hetero)aryl-4-oxobut-2-enoic acid are useful as building blocks in the synthesis of biologically active compounds. An efficient general protocol for the synthesis of these building blocks was developed. This method combines microwave assistance and ytterbium triflate catalyst and allows the fast preparation of the target acids starting from different (hetero)aromatic ketones and glyoxylic acid monohydrate giving pure products in 52-75% isolated yields.

  16. Enantiospecific Synthesis of a Genetically Encodable Fluorescent Unnatural Amino Acid L-3-(6-Acetylnaphthalen-2-ylamino)-2-aminopropanoic Acid

    PubMed Central

    Xiang, Zheng; Wang, Lei

    2011-01-01

    Fluorescent unnatural amino acids (Uaas), when genetically incorporated into proteins, can provide unique advantages for imaging biological processes in vivo. Synthesis of optically pure L-enantiomer of fluorescent Uaas is crucial for their effective application in live cells. An efficient six-step synthesis of L-3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (L-Anap), a genetically encodable and polarity-sensitive fluorescent Uaa, has been developed. The synthesis takes advantage of a high-yield and enantiospecific Fukuyama-Mitsunobu reaction as the key transformation. PMID:21732687

  17. Ubiquitin-Based Probes Prepared by Total Synthesis To Profile the Activity of Deubiquitinating Enzymes

    PubMed Central

    de Jong, Annemieke; Merkx, Remco; Berlin, Ilana; Rodenko, Boris; Wijdeven, Ruud H M; El Atmioui, Dris; Yalçin, Zeliha; Robson, Craig N; Neefjes, Jacques J; Ovaa, Huib

    2012-01-01

    Epitope-tagged active-site-directed probes are widely used to visualize the activity of deubiquitinases (DUBs) in cell extracts, to investigate the specificity and potency of small-molecule DUB inhibitors, and to isolate and identify DUBs by mass spectrometry. With DUBs arising as novel potential drug targets, probes are required that can be produced in sufficient amounts and to meet the specific needs of a given experiment. The established method for the generation of DUB probes makes use of labor-intensive intein-based methods that have inherent limitations concerning the incorporation of unnatural amino acids and the amount of material that can be obtained. Here, we describe the total chemical synthesis of active-site-directed probes and their application to activity-based profiling and identification of functional DUBs. This synthetic methodology allowed the easy incorporation of desired tags for specific applications, for example, fluorescent reporters, handles for immunoprecipitation or affinity pull-down, and cleavable linkers. Additionally, the synthetic method can be scaled up to provide significant amounts of probe. Fluorescent ubiquitin probes allowed faster, in-gel detection of active DUBs, as compared to (immuno)blotting procedures. A biotinylated probe holding a photocleavable linker enabled the affinity pull-down and subsequent mild, photorelease of DUBs. Also, DUB activity levels were monitored in response to overexpression or knockdown, and to inhibition by small molecules. Furthermore, fluorescent probes revealed differential DUB activity profiles in a panel of lung and prostate cancer cells. PMID:23011887

  18. Clostridium thermocellum releases coumaric acid during degradation of untreated grasses by the action of an unknown enzyme.

    PubMed

    Herring, Christopher D; Thorne, Philip G; Lynd, Lee R

    2016-03-01

    Clostridium thermocellum is an anaerobic thermophile with the ability to digest lignocellulosic biomass that has not been pretreated with high temperatures. Thermophilic anaerobes have previously been shown to more readily degrade grasses than wood. Part of the explanation for this may be the presence of relatively large amounts of coumaric acid in grasses, with linkages to both hemicellulose and lignin. We found that C. thermocellum and cell-free cellulase preparations both release coumaric acid from bagasse and switchgrass. Cellulase preparations from a mutant strain lacking the scaffoldin cipA still showed activity, though diminished. Deletion of all three proteins in C. thermocellum with ferulic acid esterase domains, either singly or in combination, did not eliminate the activity. Further work will be needed to identify the novel enzyme(s) responsible for the release of coumaric acid from grasses and to determine whether these enzymes are important factors of microbial biomass degradation.

  19. Synthesis and photochromic property of nanosized amino acid polyoxometalate compounds

    NASA Astrophysics Data System (ADS)

    Sun, Dehui; Zhang, Jilin; Ren, Huijuan; Cui, Zhenfeng

    2009-07-01

    A series of novel nanosized amino acid-polyoxometalate compounds were successfully synthesized using a low temperature solid-state chemical reaction method. Their compositions, structures, morphologies, photochromic properties were characterized by ICP-AES/MS, TG/DTA, FTIR, XRD, SEM and UV-Vis diffuse reflectance spectra (DRS), respectively. The elemental analysis results showed that the compounds ((HThr)7PMo12O42•4H2O, (HTyr)7PMo12O42Â.5H2O, (HSer)7PMo12O42•5H2O and (HGlu)7PMo12O42•4H2O) were obtained. The analyses of the TG/DTA, XRD and FTIR confirmed that the four compounds are new phases different from the corresponding reactants and they are composed of the polyoxometalate anions and the corresponding protonated amino acids, respectively. Observation of the SEM revealed that the particle shape (e.g. (HThr)7PMo12O42Â.4H2O nanoplates, (HTyr)7PMo12O42•5H2O nanorods, (HSer)7PMo12O42•5H2O and (HGlu)7PMo12O42•4H2O nanoparticles) depended strongly on the structures of amino acids. This implied that the amino acids can play a structural template agent role in synthesis of the Silverton-type polyoxometalate compounds. After irradiated with ultraviolet light, these samples all exhibited photochromism. Their photochromic mechanism may be explained based on Yamase's photochromic model. These photochromic compounds could be applied to the field of photosensitive materials.

  20. Production and partial characterization of uric acid degrading enzyme from new source Saccharopolyspora sp. PNR11.

    PubMed

    Khucharoenphaisan, K; Sinma, K

    2011-02-01

    The strain PNR11 was isolated from gut of termite during the screening for uric acid degrading actinomyces. This strain was able to produce an intracellular uricase when cultured in fermentation medium containing uric acid as nitrogen source. Base on its morphological characters and 16S rDNA sequence analysis, this strain belong to the genus Saccharopolyspora. This is the first report ofuricase produced from the genus Saccharopolyspora. The aim of this study was to investigate the effects of different factors on uricase production by new source of Saccharopolyspora. Saccharopolyspora sp. PNR11 was cultured in production medium in order to determine the best cultivation period. The result showed that the time period required for maximum enzyme production was 24 h on a rotary shaker operating at 180 rpm. Optimized composition of the production medium consisted of 1% yeast extract, 1% maltose, 0.1% K2HPO4, 0.05% MgSO4 7H2O, 0.05% NaCl and 1% uric acid. The optimum pH and temperature for uricase production in the optimized medium were pH 7.0 and 30 degrees C, respectively. When the strain was cultured at optimized condition, the uricase activity reached to 216 mU mL(-1) in confidential level of 95%. The crude enzyme had an optimum temperature of uricase was 37 degrees C and it was stable up to 30 degrees C at pH 8.5. The optimum pH ofuricase was 8.5 and was stable in range of pH 7.0-10.0 at 4 degrees C. This strain might be considered as a candidate source for uricase production in the further studies. Present finding could be fulfill the information ofuricase produce from actinomycetes.

  1. Transcriptional profiling of canola developing embryo and identification of the important roles of BnDof5.6 in embryo development and fatty acids synthesis.

    PubMed

    Deng, Wei; Yan, Fang; Zhang, Xiaolan; Tang, Yuwei; Yuan, Yujin

    2015-08-01

    Canola is an important vegetable oil crop globally, and the understanding of the molecular mechanism underlying fatty acids biosynthesis during seed embryo development is an important research goal. Here we report the transcriptional profiling analysis of developing canola embryos using RNA-sequencing (RNA-Seq) method. RNA-Seq analysis generated 58,579,451 sequence reads aligned with 32,243 genes. It was found that a total of 55 differential expression genes (DEGs) encoding 28 enzymes function in carbon flow to fatty acids of storage TAG. Most of the DEGs encoding above enzymes showed similar expression pattern, indicating the DEGs are cooperatively involved in carbon flow into fatty acids. In addition, 41 DEGs associated with signal transductions, transport and metabolic processing of auxin, gibberellin, abscisic acid, cytokinin and salicylic acids were found in the RNA-Seq database, which indicates the important roles of the phytohormones in controlling embryo development and fatty acids synthesis. 122 DEGs encoding transcriptional factor family members were found in developing canola embryos. Furthermore, BnDOF5.6, a zinc finger transcriptional factor gene, found in RNA-Seq database was down-regulated in developing canola embryos. The transgenic plants displayed reduced embryo sizes, decreased fatty acids contents and altered seed fatty acids composition in canola. Down-regulated of BnDof5.6 also changed the expression levels of genes involved in fatty acids synthesis and desaturation. Our results indicate that BnDof5.6 is required for embryo development and fatty acids synthesis in canola. Overall this study presents new information on the global expression patterns of genes during embryo development and will expand our understanding of the complex molecular mechanism of carbon flow into fatty acids and embryo development in canola.

  2. l,l-diaminopimelate aminotransferase, a trans-kingdom enzyme shared by Chlamydia and plants for synthesis of diaminopimelate/lysine

    PubMed Central

    McCoy, Andrea J.; Adams, Nancy E.; Hudson, André O.; Gilvarg, Charles; Leustek, Thomas; Maurelli, Anthony T.

    2006-01-01

    The synthesis of meso-diaminopimelic acid (m-DAP) in bacteria is essential for both peptidoglycan and lysine biosynthesis. From genome sequencing data, it was unclear how bacteria of the Chlamydiales order would synthesize m-DAP in the absence of dapD, dapC, and dapE, which are missing from the genome. Here, we assessed the biochemical capacity of Chlamydia trachomatis serovar L2 to synthesize m-DAP. Expression of the chlamydial asd, dapB, and dapF genes in the respective Escherichia coli m-DAP auxotrophic mutants restored the mutants to DAP prototrophy. Screening of a C. trachomatis genomic library in an E. coli ΔdapD DAP auxotroph identified ct390 as encoding an enzyme that restored growth to the Escherichia coli mutant. ct390 also was able to complement an E. coli ΔdapD ΔdapE, but not a ΔdapD ΔdapF mutant, providing genetic evidence that it encodes an aminotransferase that may directly convert tetrahydrodipicolinate to l,l-diaminopimelic acid. This hypothesis was supported by in vitro kinetic analysis of the CT390 protein and the fact that similar properties were demonstrated for the Protochlamydia amoebophila homologue, PC0685. In vivo, the C. trachomatis m-DAP synthesis genes are expressed as early as 8 h after infection. An aminotransferase activity analogous to CT390 recently has been characterized in plants and cyanobacteria. This previously undescribed pathway for m-DAP synthesis supports an evolutionary relationship among the chlamydiae, cyanobacteria, and plants and strengthens the argument that chlamydiae synthesize a cell wall despite the inability of efforts to date to detect peptidoglycan in these organisms. PMID:17093042

  3. Ribonucleic acid synthesis in yeast. The effect of cycloheximide on the synthesis of ribonucleic acid in Saccharomyces carlsbergensis

    PubMed Central

    de Kloet, S. R.

    1966-01-01

    1. Cycloheximide causes the release of the control amino acids have over RNA synthesis in Saccharomyces carlsbergensis N.C.T.C. 74. 2. The antibiotic causes a gradual deceleration of RNA formation. After incubation for 60min. at 30° RNA synthesis usually proceeds at a rate only a few per cent of that of the untreated control. 3. In the presence of cycloheximide two types of RNA accumulate in the cell: soluble RNA and a high-molecular-weight RNA. The latter has a base composition intermediate between those of yeast DNA and yeast ribosomal RNA, and sediments in a sucrose gradient at a rate faster than that of the 23s ribosomal RNA component. 4. Yeast ribosomal RNA contains methylated bases. Judged from the incorporation of [Me-14C]methionine, the extent of methylation of ribosomal RNA is about 20% of that of the `soluble' RNA fraction. The high-molecular-weight RNA formed in the presence of cycloheximide is less methylated than normal RNA. In this case the sucrose-density-gradient sedimentation patterns of newly methylated and newly synthesized RNA do not coincide. 5. In the presence of cycloheximide, polysomal material accumulates, indicating that messenger RNA is formed. 6. The effect of the antibiotic on protein and RNA synthesis can be abolished by washing of the cells. The RNA that has accumulated during incubation of the cells with the antibiotic is not stable on removal of cycloheximide. 7. The results presented in this study are discussed in relation to the regulation of RNA formation in yeast. PMID:5964958

  4. Ascorbic acid formation and profiling of genes expressed in its synthesis and recycling in apple leaves of different ages.

    PubMed

    Li, Mingjun; Ma, Fengwang; Guo, Chunmiao; Liu, Jun

    2010-04-01

    Ascorbic acid (AsA), as a unique antioxidant and enzyme cofactor, has multiple roles in plants. However, there is very limited information on the mechanism of AsA accumulation and controlling in leaves. In this study, we determined AsA accumulation levels, analyzed expression patterns of the genes involved in synthesizing via l-galactose pathway and recycling as well as enzyme activities in apple (Malus domestica Borkh) leaves with different age. AsA content was found to increase with leaf development, reaching the highest level in 20-day-old leaves. This level was maintained in mature leaves until the dropping in senescent leaves. Comparing with young and senescent leaves, mature leaves had higher capability for AsA synthesis with high expression levels and activity of l-galactose dehydrogenase and l-galactono-1,4-lactone dehydrogenase. The mRNA expression of genes involved in AsA synthesis also showed highest abundance in 20-day-old leaves, though GDP-mannose-3',5'-epimerase and l-galactose-1-phosphate phosphatase expression reached the highest levels before 20 days old. These results suggest that AsA accumulation in apple leaves mainly occurs during the transition phase from young to mature leaves with high rates of synthesis and recycling, and that l-galactose-1-phosphate phosphatase could play an important role in regulating AsA biosynthesis via the l-galactose pathway.

  5. Synthesis and cholinesterase inhibition of cativic acid derivatives.

    PubMed

    Alza, Natalia P; Richmond, Victoria; Baier, Carlos J; Freire, Eleonora; Baggio, Ricardo; Murray, Ana Paula

    2014-08-01

    Alzheimer's disease (AD) is a neurodegenerative disorder associated with memory impairment and cognitive deficit. Most of the drugs currently available for the treatment of AD are acetylcholinesterase (AChE) inhibitors. In a preliminary study, significant AChE inhibition was observed for the ethanolic extract of Grindelia ventanensis (IC₅₀=0.79 mg/mL). This result prompted us to isolate the active constituent, a normal labdane diterpenoid identified as 17-hydroxycativic acid (1), through a bioassay guided fractionation. Taking into account that 1 showed moderate inhibition of AChE (IC₅₀=21.1 μM), selectivity over butyrylcholinesterase (BChE) (IC₅₀=171.1 μM) and that it was easily obtained from the plant extract in a very good yield (0.15% w/w), we decided to prepare semisynthetic derivatives of this natural diterpenoid through simple structural modifications. A set of twenty new cativic acid derivatives (3-6) was prepared from 1 through transformations on the carboxylic group at C-15, introducing a C2-C6 linker and a tertiary amine group. They were tested for their inhibitory activity against AChE and BChE and some structure-activity relationships were outlined. The most active derivative was compound 3c, with an IC₅₀ value of 3.2 μM for AChE. Enzyme kinetic studies and docking modeling revealed that this inhibitor targeted both the catalytic active site and the peripheral anionic site of this enzyme. Furthermore, 3c showed significant inhibition of AChE activity in SH-SY5Y human neuroblastoma cells, and was non-cytotoxic.

  6. Endogenous Synthesis of Amino Acids Limits Growth, Lactation, and Reproduction in Animals12

    PubMed Central

    Hou, Yongqing; Yao, Kang; Yin, Yulong; Wu, Guoyao

    2016-01-01

    Amino acids (AAs) are building blocks of protein. Eight AAs (Ala, Asn, Asp, Glu, Gln, Gly, Pro, and Ser) are formed by all animals, whereas de novo synthesis of Arg occurs in a species-specific manner in most mammals (e.g., humans, pigs, and rats). Synthesizable AAs were traditionally classified as nutritionally nonessential for animals, because they were thought to be formed in sufficient amounts. However, this assumption is not supported by evidence showing that 1) rats grow slowly when their diets do not contain Arg, Glu, or Gln despite adequate provision of all other proteinogenous AAs; 2) pigs cannot achieve maximum growth, lactation, or reproduction performance when fed corn- and soybean meal-based diets meeting National Research Council–recommended requirements of protein and AAs without supplemental Arg, Glu, Gln, Gly, or Pro; 3) chickens exhibit increases in lean tissue gain and feed efficiency when their diets are supplemented with Glu, Gln, Gly, and Pro; 4) lactating cows cannot obtain maximum milk protein production without a postruminal supply of Gln or Pro; 5) fish cannot achieve maximum growth when diets do not contain Gln or Pro; and 6) men fail to sustain spermatogenesis when fed an Arg-deficient diet. Quantitative analysis of nitrogen metabolism showed that AA synthesis in animals is constrained by both precursor availability and enzyme activity. Taken together, these findings support the conclusion that the endogenous synthesis of AAs limits growth, lactation, and reproduction in animals. This new knowledge can guide the optimization of human nutrition for improving health and well-being. PMID:26980816

  7. Endogenous Synthesis of Amino Acids Limits Growth, Lactation, and Reproduction in Animals.

    PubMed

    Hou, Yongqing; Yao, Kang; Yin, Yulong; Wu, Guoyao

    2016-03-01

    Amino acids (AAs) are building blocks of protein. Eight AAs (Ala, Asn, Asp, Glu, Gln, Gly, Pro, and Ser) are formed by all animals, whereas de novo synthesis of Arg occurs in a species-specific manner in most mammals (e.g., humans, pigs, and rats). Synthesizable AAs were traditionally classified as nutritionally nonessential for animals, because they were thought to be formed in sufficient amounts. However, this assumption is not supported by evidence showing that 1) rats grow slowly when their diets do not contain Arg, Glu, or Gln despite adequate provision of all other proteinogenous AAs; 2) pigs cannot achieve maximum growth, lactation, or reproduction performance when fed corn- and soybean meal-based diets meeting National Research Council-recommended requirements of protein and AAs without supplemental Arg, Glu, Gln, Gly, or Pro; 3) chickens exhibit increases in lean tissue gain and feed efficiency when their diets are supplemented with Glu, Gln, Gly, and Pro; 4) lactating cows cannot obtain maximum milk protein production without a postruminal supply of Gln or Pro; 5) fish cannot achieve maximum growth when diets do not contain Gln or Pro; and 6) men fail to sustain spermatogenesis when fed an Arg-deficient diet. Quantitative analysis of nitrogen metabolism showed that AA synthesis in animals is constrained by both precursor availability and enzyme activity. Taken together, these findings support the conclusion that the endogenous synthesis of AAs limits growth, lactation, and reproduction in animals. This new knowledge can guide the optimization of human nutrition for improving health and well-being.

  8. Prediction of Thermostability from Amino Acid Attributes by Combination of Clustering with Attribute Weighting: A New Vista in Engineering Enzymes

    PubMed Central

    Ebrahimi, Mansour; Lakizadeh, Amir; Agha-Golzadeh, Parisa; Ebrahimie, Esmaeil; Ebrahimi, Mahdi

    2011-01-01

    The engineering of thermostable enzymes is receiving increased attention. The paper, detergent, and biofuel industries, in particular, seek to use environmentally friendly enzymes instead of toxic chlorine chemicals. Enzymes typically function at temperatures below 60°C and denature if exposed to higher temperatures. In contrast, a small portion of enzymes can withstand higher temperatures as a result of various structural adaptations. Understanding the protein attributes that are involved in this adaptation is the first step toward engineering thermostable enzymes. We employed various supervised and unsupervised machine learning algorithms as well as attribute weighting approaches to find amino acid composition attributes that contribute to enzyme thermostability. Specifically, we compared two groups of enzymes: mesostable and thermostable enzymes. Furthermore, a combination of attribute weighting with supervised and unsupervised clustering algorithms was used for prediction and modelling of protein thermostability from amino acid composition properties. Mining a large number of protein sequences (2090) through a variety of machine learning algorithms, which were based on the analysis of more than 800 amino acid attributes, increased the accuracy of this study. Moreover, these models were successful in predicting thermostability from the primary structure of proteins. The results showed that expectation maximization clustering in combination with uncertainly and correlation attribute weighting algorithms can effectively (100%) classify thermostable and mesostable proteins. Seventy per cent of the weighting methods selected Gln content and frequency of hydrophilic residues as the most important protein attributes. On the dipeptide level, the frequency of Asn-Glu was the key factor in distinguishing mesostable from thermostable enzymes. This study demonstrates the feasibility of predicting thermostability irrespective of sequence similarity and will serve as a

  9. Enzyme-responsive polymer assemblies constructed through covalent synthesis and supramolecular strategy.

    PubMed

    Ding, Yan; Kang, Yuetong; Zhang, Xi

    2015-01-21

    Enzyme-responsive polymer assemblies have proved to be promising candidates for biomaterials, biomedicine and biosensing. Traditionally, these assemblies are prepared by the self-assembly of polymer building blocks which are covalently conjugated with enzyme-responsive moieties. Moreover, a supramolecular strategy has recently been developed for the preparation of enzyme-responsive polymer assemblies where the enzyme-responsive moieties are non-covalently complexed with the polymer building blocks. In addition, kinetic studies have been conducted on the enzyme-responsive behaviour of the polymer assemblies, which paves the way for tuning the response rate of the assemblies in a controlled manner.

  10. Enzyme-catalysed synthesis and reactions of benzene oxide/oxepine derivatives of methyl benzoates.

    PubMed

    Boyd, Derek R; Sharma, Narain D; Harrison, John S; Malone, John F; McRoberts, W Colin; Hamilton, John T G; Harper, David B

    2008-04-07

    A series of twelve benzoate esters was metabolised, by species of the Phellinus genus of wood-rotting fungi, to yield the corresponding benzyl alcohol derivatives and eight salicylates. The isolation of a stable oxepine metabolite, from methyl benzoate, allied to evidence of the migration and retention of a carbomethoxy group (the NIH Shift), during enzyme-catalysed ortho-hydroxylation of alkyl benzoates to form salicylates, is consistent with a mechanism involving an initial arene epoxidation step. This mechanism was confirmed by the isolation of a remarkably stable, optically active, substituted benzene oxide metabolite of methyl 2-(trifluoromethyl)benzoate, which slowly converted into the racemic form. The arene oxide was found to undergo a cycloaddition reaction with 4-phenyl-1,2,4-triazoline-3,5-dione to yield a crystalline cycloadduct whose structure and racemic nature was established by X-ray crystallography. The metabolite was also found to undergo some novel benzene oxide reactions, including epoxidation to give an anti-diepoxide, base-catalysed hydrolysis to form a trans-dihydrodiol and acid-catalysed aromatisation to yield a salicylate derivative via the NIH Shift of a carbomethoxy group.

  11. Structure and Evolution of the Archaeal Lipid Synthesis Enzyme sn-Glycerol-1-phosphate Dehydrogenase*

    PubMed Central

    Carbone, Vincenzo; Schofield, Linley R.; Zhang, Yanli; Sang, Carrie; Dey, Debjit; Hannus, Ingegerd M.; Martin, William F.; Sutherland-Smith, Andrew J.; Ronimus, Ron S.

    2015-01-01

    One of the most critical events in the origins of cellular life was the development of lipid membranes. Archaea use isoprenoid chains linked via ether bonds to sn-glycerol 1-phosphate (G1P), whereas bacteria and eukaryotes use fatty acids attached via ester bonds to enantiomeric sn-glycerol 3-phosphate. NAD(P)H-dependent G1P dehydrogenase (G1PDH) forms G1P and has been proposed to have played a crucial role in the speciation of the Archaea. We present here, to our knowledge, the first structures of archaeal G1PDH from the hyperthermophilic methanogen Methanocaldococcus jannaschii with bound substrate dihydroxyacetone phosphate, product G1P, NADPH, and Zn2+ cofactor. We also biochemically characterized the enzyme with respect to pH optimum, cation specificity, and kinetic parameters for dihydroxyacetone phosphate and NAD(P)H. The structures provide key evidence for the reaction mechanism in the stereospecific addition for the NAD(P)H-based pro-R hydrogen transfer and the coordination of the Zn2+ cofactor during catalysis. Structure-based phylogenetic analyses also provide insight into the origins of G1PDH. PMID:26175150

  12. Decreased bile-acid synthesis in livers of hepatocyte-conditional NADPH-cytochrome P450 reductase-null mice results in increased bile acids in serum.

    PubMed

    Cheng, Xingguo; Zhang, Youcai; Klaassen, Curtis D

    2014-10-01

    NADPH-cytochrome P450 reductase (Cpr) is essential for the function of microsomal cytochrome P450 monooxygenases (P450), including those P450s involved in bile acid (BA) synthesis. Mice with hepatocyte-specific deletion of NADPH-cytochrome P450 reductase (H-Cpr-null) have been engineered to understand the in vivo function of hepatic P450s in the metabolism of xenobiotics and endogenous compounds. However, the impact of hepatic Cpr on BA homeostasis is not clear. The present study revealed that H-Cpr-null mice had a 60% decrease in total BA concentration in liver, whereas the total BA concentration in serum was almost doubled. The decreased level of cholic acid (CA) in both serum and livers of H-Cpr-null mice is likely due to diminished enzyme activity of Cyp8b1 that is essential for CA biosynthesis. Feedback mechanisms responsible for the reduced liver BA concentrations and/or increased serum BA concentrations in H-Cpr-null mice included the following: 1) enhanced alternative BA synthesis pathway, as evidenced by the fact that classic BA synthesis is diminished but chenodeoxycholic acid still increases in both serum and livers of H-Cpr-null mice; 2) inhibition of farnesoid X receptor activation, which increased the mRNA of Cyp7a1 and 8b1; 3) induction of intestinal BA transporters to facilitate BA absorption from the intestine to the circulation; 4) induction of hepatic multidrug resistance-associated protein transporters to increase BA efflux from the liver to blood; and 5) increased generation of secondary BAs. In summary, the present study reveals an important contribution of the alternative BA synthesis pathway and BA transporters in regulating BA concentrations in H-Cpr-null mice.

  13. Vanadate and selenium inhibit the triiodothyronine induced enzyme activity and mRNA level for both fatty acid synthase and malic enzyme

    SciTech Connect

    Zhu, Y.; Mirmiran, R.; Goodridge, A.G.; Stapleton, S.R. Western Michigan Univ., Kalamazoo )

    1991-03-15

    In chick-embryo hepatocytes in culture, triiodothyronine stimulates enzyme activity, mRNA level and transcription rate for both fatty acid synthase (FAS) and malic enzyme (ME). Insulin alone has no effect but amplifies the induction by T3. Recent evidence has demonstrated the insulin-mimicking action of vanadate and selenium on various physiological processes. Little information, however, is available on the affects of vanadate and selenium on the expression of genes that are regulated by insulin. These studies were initiated to test the potential of vanadate and selenium to mimic the amplification affect of insulin on the T3 induction of FAS and ME. In chick-embryo hepatocytes incubated in a chemically defined medium, addition of T3 for 48h causes an increase in the enzyme activity and mRNA level for both FAS and ME. Addition of sodium vanadate or sodium selenate (20 {mu}M) coincident with the T3 almost completely inhibited the stimulation of FAS and ME activity and accumulation of their respective mRNA's. Fifty percent maximal inhibition occurred at about 3-40{mu}M vanadate or 5-10{mu}M selenium. Vanadate and selenium similarity inhibited FAS and ME enzyme activity and mRNA level when the cells were incubated in the presence of insulin and T3. The effect of these metals was selective; isocitrate dehydrogenase activity as well as the level of glyceraldehyde 3-phosphate mRNA were not affected by any of the additions made to the cells in culture. This effect by vanadate and selenium also does not appear to be a generalized effect of metals on lipogenic enzymes as molydate under similar experimental conditions has no effect on either the enzyme activity or mRNA level of FAS or ME. Studies are continuing to determine the mechanism of action of these agents on the regulation of lipogenic enzymes.

  14. Enzymic dephosphorylation of bovine casein to improve acid clotting properties and digestibility for infant formula.

    PubMed

    Li-Chan, E; Nakai, S

    1989-01-01

    To improve acid clotting properties, enzymic dephosphorylation of caseins with calf intestinal alkaline phosphatase (CAP) or potato acid phosphatase (PAP) was investigated. Greater dephosphorylation was achieved using alpha s1- or beta-casein as substrates, compared to whole casein or skim milk. Electrophoresis of PAP-modified caseins revealed bands with lower mobility and a multibanded pattern in the beta-casein region which was similar to that of human beta-casein. On the other hand, CAP modification produced electrophoretic bands having lower mobility of the beta-casein component, but with higher mobility in the alpha s1-casein component as well as increased net negative charge in the CAP-casein. PAP-casein formed a fine dispersion upon acidification to pH 4, with a microstructure similar to that of acidified human casein. Greater initial rates of hydrolysis by pepsin at pH 4 were observed for both CAP- and PAP-modified caseins, compared to bovine and human caseins. The rate and extent of hydrolysis remained high for CAP-casein but tended to level off with PAP-casein during sequential digestion with pepsin and pancreatin. There may be advantages in the use of partial dephosphorylation to improve acid clotting and digestibility properties of bovine casein for infant feeding.

  15. Role of fatty-acid synthesis in dendritic cell generation and function.

    PubMed

    Rehman, Adeel; Hemmert, Keith C; Ochi, Atsuo; Jamal, Mohsin; Henning, Justin R; Barilla, Rocky; Quesada, Juan P; Zambirinis, Constantinos P; Tang, Kerry; Ego-Osuala, Melvin; Rao, Raghavendra S; Greco, Stephanie; Deutsch, Michael; Narayan, Suchithra; Pachter, H Leon; Graffeo, Christopher S; Acehan, Devrim; Miller, George

    2013-05-01

    Dendritic cells (DC) are professional APCs that regulate innate and adaptive immunity. The role of fatty-acid synthesis in DC development and function is uncertain. We found that blockade of fatty-acid synthesis markedly decreases dendropoiesis in the liver and in primary and secondary lymphoid organs in mice. Human DC development from PBMC precursors was also diminished by blockade of fatty-acid synthesis. This was associated with higher rates of apoptosis in precursor cells and increased expression of cleaved caspase-3 and BCL-xL and downregulation of cyclin B1. Further, blockade of fatty-acid synthesis decreased DC expression of MHC class II, ICAM-1, B7-1, and B7-2 but increased their production of selected proinflammatory cytokines including IL-12 and MCP-1. Accordingly, inhibition of fatty-acid synthesis enhanced DC capacity to activate allogeneic as well as Ag-restricted CD4(+) and CD8(+) T cells and induce CTL responses. Further, blockade of fatty-acid synthesis increased DC expression of Notch ligands and enhanced their ability to activate NK cell immune phenotype and IFN-γ production. Because endoplasmic reticulum (ER) stress can augment the immunogenic function of APC, we postulated that this may account for the higher DC immunogenicity. We found that inhibition of fatty-acid synthesis resulted in elevated expression of numerous markers of ER stress in humans and mice and was associated with increased MAPK and Akt signaling. Further, lowering ER stress by 4-phenylbutyrate mitigated the enhanced immune stimulation associated with fatty-acid synthesis blockade. Our findings elucidate the role of fatty-acid synthesis in DC development and function and have implications to the design of DC vaccines for immunotherapy.

  16. Role of Fatty-acid Synthesis in Dendritic Cell Generation and Function

    PubMed Central

    Rehman, Adeel; Hemmert, Keith C.; Ochi, Atsuo; Jamal, Mohsin; Henning, Justin R.; Barilla, Rocky; Quesada, Juan P.; Zambirinis, Constantinos P.; Tang, Kerry; Ego-Osuala, Melvin; Rao, Raghavendra S.; Greco, Stephanie; Deutsch, Michael; Narayan, Suchithra; Pachter, H. Leon; Graffeo, Christopher S.; Acehan, Devrim; Miller, George

    2013-01-01

    Dendritic cells (DC) are professional antigen presenting cells that regulate innate and adaptive immunity. The role of fatty-acid synthesis in DC development and function is uncertain. We found that blockade of fatty-acid synthesis markedly decreases dendropoiesis in the liver and in primary and secondary lymphoid organs in mice. Human DC development from PBMC precursors was also diminished by blockade of fatty-acid synthesis. This was associated with higher rates of apoptosis in precursor cells and increased expression of Cleaved Caspase 3 and BCL-xL, and down-regulation of Cyclin B1. Further, blockade of fatty-acid synthesis decreased DC expression of MHCII, ICAM-1, B7-1, B7-2 but increased their production of selected pro-inflammatory cytokines including IL-12 and MCP-1. Accordingly, inhibition of fatty-acid synthesis enhanced DC capacityto activate allogeneic as well as antigen-restricted CD4+ and CD8+ T cells and induce CTL responses. Further, blockade of fatty-acid synthesis increased DC expression of Notch ligands and enhanced their ability to activate NK cell immune-phenotype and IFN-γ production. Since endoplasmic reticular (ER)-stress can augment the immunogenic function of APC, we postulated that this may account for the higher DC immunogenicity. We found that inhibition of fatty-acid synthesis resulted in elevated expression of numerous markers of ER stress in humans and mice and was associated with increased MAP kinase and Akt signaling. Further, lowering ER-stress by 4-phenylbutyrate mitigated the enhanced immune-stimulation associated with fatty-acid synthesis blockade. Our findings elucidate the role of fatty-acid synthesis in DC development and function and have implications to the design of DC vaccines for immunotherapy. PMID:23536633

  17. Oriented and selective enzyme immobilization on functionalized silica carrier using the cationic binding module Z basic2: design of a heterogeneous D-amino acid oxidase catalyst on porous glass.

    PubMed

    Bolivar, Juan M; Nidetzky, Bernd

    2012-06-01

    D-amino acid oxidase from Trigonopsis variabilis (TvDAO) is applied in industry for the synthesis of pharmaceutical intermediates. Because free TvDAO is extremely sensitive to exposure to gas-liquid interfaces, biocatalytic processing is usually performed with enzyme immobilizates that offer enhanced stability under bubble aeration. We herein present an "Immobilization by Design" approach that exploits engineered charge complementarity between enzyme and carrier to optimize key features of the immobilization of TvDAO. A fusion protein between TvDAO and the positively charged module Z(basic2) was generated, and a corresponding oppositely charged carrier was obtained by derivatization of mesoporous glass with 3-(trihydroxysilyl)-1-propane-sulfonic acid. Using 250 mM NaCl for charge screening at pH 7.0, the Z(basic2) fusion of TvDAO was immobilized directly from E. coli cell extract with almost absolute selectivity and full retention of catalytic effectiveness of the isolated enzyme in solution. Attachment of the homodimeric enzyme to the carrier was quasi-permanent in low-salt buffer but fully reversible upon elution with 5 M NaCl. Immobilized TvDAO was not sensitive to bubble aeration and received substantial (≥ tenfold) stabilization of the activity at 45°C as compared to free enzyme, suggesting immobilization via multisubunit oriented interaction of enzyme with the insoluble carrier. The Z(basic2) enzyme immobilizate was demonstrated to serve as re-usable heterogeneous catalyst for D-amino acid oxidation. Z(basic2) -mediated binding on a sulfonic acid group-containing glass carrier constitutes a generally useful strategy of enzyme immobilization that supports transition from case-specific empirical development to rational design.

  18. The Hypothesis that the Genetic Code Originated in Coupled Synthesis of Proteins and the Evolutionary Predecessors of Nucleic Acids in Primitive Cells.

    PubMed

    Francis, Brian R

    2015-02-11

    Although analysis of the genetic code has allowed explanations for its evolution to be proposed, little evidence exists in biochemistry and molecular biology to offer an explanation for the origin of the genetic code. In particular, two features of biology make the origin of the genetic code difficult to understand. First, nucleic acids are highly complicated polymers requiring numerous enzymes for biosynthesis. Secondly, proteins have a simple backbone with a set of 20 different amino acid side chains synthesized by a highly complicated ribosomal process in which mRNA sequences are read in triplets. Apparently, both nucleic acid and protein syntheses have extensive evolutionary histories. Supporting these processes is a complex metabolism and at the hub of metabolism are the carboxylic acid cycles. This paper advances the hypothesis that the earliest predecessor of the nucleic acids was a β-linked polyester made from malic acid, a highly conserved metabolite in the carboxylic acid cycles. In the β-linked polyester, the side chains are carboxylic acid groups capable of forming interstrand double hydrogen bonds. Evolution of the nucleic acids involved changes to the backbone and side chain of poly(β-d-malic acid). Conversion of the side chain carboxylic acid into a carboxamide or a longer side chain bearing a carboxamide group, allowed information polymers to form amide pairs between polyester chains. Aminoacylation of the hydroxyl groups of malic acid and its derivatives with simple amino acids such as glycine and alanine allowed coupling of polyester synthesis and protein synthesis. Use of polypeptides containing glycine and l-alanine for activation of two different monomers with either glycine or l-alanine allowed simple coded autocatalytic synthesis of polyesters and polypeptides and established the first genetic code. A primitive cell capable of supporting electron transport, thioester synthesis, reduction reactions, and synthesis of polyesters and

  19. The Hypothesis that the Genetic Code Originated in Coupled Synthesis of Proteins and the Evolutionary Predecessors of Nucleic Acids in Primitive Cells

    PubMed Central

    Francis, Brian R.

    2015-01-01

    Although analysis of the genetic code has allowed explanations for its evolution to be proposed, little evidence exists in biochemistry and molecular biology to offer an explanation for the origin of the genetic code. In particular, two features of biology make the origin of the genetic code difficult to understand. First, nucleic acids are highly complicated polymers requiring numerous enzymes for biosynthesis. Secondly, proteins have a simple backbone with a set of 20 different amino acid side chains synthesized by a highly complicated ribosomal process in which mRNA sequences are read in triplets. Apparently, both nucleic acid and protein syntheses have extensive evolutionary histories. Supporting these processes is a complex metabolism and at the hub of metabolism are the carboxylic acid cycles. This paper advances the hypothesis that the earliest predecessor of the nucleic acids was a β-linked polyester made from malic acid, a highly conserved metabolite in the carboxylic acid cycles. In the β-linked polyester, the side chains are carboxylic acid groups capable of forming interstrand double hydrogen bonds. Evolution of the nucleic acids involved changes to the backbone and side chain of poly(β-d-malic acid). Conversion of the side chain carboxylic acid into a carboxamide or a longer side chain bearing a carboxamide group, allowed information polymers to form amide pairs between polyester chains. Aminoacylation of the hydroxyl groups of malic acid and its derivatives with simple amino acids such as glycine and alanine allowed coupling of polyester synthesis and protein synthesis. Use of polypeptides containing glycine and l-alanine for activation of two different monomers with either glycine or l-alanine allowed simple coded autocatalytic synthesis of polyesters and polypeptides and established the first genetic code. A primitive cell capable of supporting electron transport, thioester synthesis, reduction reactions, and synthesis of polyesters and

  20. Cloning and expression of zebrafish genes encoding the heme synthesis enzymes uroporphyrinogen III synthase (UROS) and protoporphyrinogen oxidase (PPO).

    PubMed

    Hanaoka, Ryuki; Dawid, Igor B; Kawahara, Atsuo

    2007-02-01

    Heme is synthesized from glycine and succinyl CoA by eight heme synthesis enzymes. Although genetic defects in any of these enzymes are known to cause severe human blood diseases, their developmental expression in mammals is unknown. In this paper, we report two zebrafish heme synthesis enzymes, uroporphyrinogen III synthase (UROS) and protoporphyrinogen oxidase (PPO) that are well conserved in comparison to their human counterparts. Both UROS and PPO formed pairs of bilateral stripes in the lateral plate mesoderm at the 15-somite stage. At 24 h post-fertilization (hpf), UROS and PPO were predominantly expressed in the intermediate cell mass (ICM) that is the major site of primitive hematopoiesis. The expression of UROS and PPO was drastically suppressed in the bloodless mutants cloche and vlad tepes/gata 1 from 15-somite to 24hpf stages, indicating that both cloche and vlad tepes/gata 1 are required for the induction and maintenance of UROS and PPO expression in the ICM.

  1. Salicylic acid treatment of pea seeds induces its de novo synthesis.

    PubMed

    Szalai, Gabriella; Horgosi, Szabina; Soós, Vilmos; Majláth, Imre; Balázs, Ervin; Janda, Tibor

    2011-02-15

    Salicylic acid (SA), which is known as a signal molecule in the induction of defense mechanisms in plants, could be a promising compound for the reduction of stress sensitivity. The aim of the present work was to investigate the distribution of SA in young pea (Pisum sativum L.) seedlings grown from seeds soaked in (3)H-labeled SA solution before sowing, and to study the physiological changes induced by this seed treatment. The most pronounced changes in SA levels occurred in the epicotyl and the seeds. Radioactivity was detected only in the bound form of SA, the majority of which was localized in the seeds, and only a very low level of radioactivity was detected in the epicotyl. SA pre-treatment increased the expression of the chorismate synthase and isochorismate synthase genes in the epicotyl. Pre-soaking the seeds in SA increased the activities of some antioxidant enzymes, namely ascorbate peroxidase (EC 1.11.1.11) and guaiacol peroxidase (EC 1.11.1.7) and the level of ortho-hydroxycinnamic acid, but decreased the level of polyamines. These results suggest that the increased level of free and bound SA detected in plants growing from seeds soaked in SA solution before sowing is the product of de novo synthesis, rather than having been taken up and mobilized by the plants.

  2. Synthesis of hybrid hydrazino peptides: protected vs unprotected chiral α-hydrazino acids.

    PubMed

    Suć, Josipa; Jerić, Ivanka

    2015-01-01

    Peptidomimetics based on hydrazino derivatives of α-amino acids represent an important class of peptidic foldamers with promising biological activities, like protease inhibition and antimicrobial activity. However, the lack of straightforward method for the synthesis of optically pure hydrazino acids and efficient incorporation of hydrazino building blocks into peptide sequence hamper wider exploitation of hydrazino peptidomimetics. Here we described the utility of N (α)-benzyl protected and unprotected hydrazino derivatives of natural α-amino acids in synthesis of peptidomimetics. While incorporation of N (α)-benzyl-hydrazino acids into peptide chain and deprotection of benzyl moiety proceeded with difficulties, unprotected hydrazino acids allowed fast and simple construction of hybrid peptidomimetics.

  3. A convenient synthesis of anthranilic acids by Pd-catalyzed direct intermolecular ortho-C-H amidation of benzoic acids.

    PubMed

    Ng, Ka-Ho; Ng, Fo-Ning; Yu, Wing-Yiu

    2012-12-11

    An efficient method for synthesis of anthranilic acids by Pd-catalyzed ortho-C-H amidation of benzoic acids is disclosed. The amidation is proposed to proceed by carboxylate-assisted ortho-C-H palladation to form an arylpalladium(II) complex, followed by nitrene insertion to the Pd-C bond.

  4. ORAL AND INTRAVENOUSLY ADMINISTERED AMINO ACIDS PRODUCE SIMILAR EFFECTS ON MUSCLE PROTEIN SYNTHESIS IN THE ELDERLY

    PubMed Central

    Rasmussen, B.B.; Wolfe, R.R.; Volpi, E.

    2011-01-01

    BACKGROUND Muscle protein synthesis is stimulated in the elderly when amino acid availability is increased. OBJECTIVE To determine which mode of delivery of amino acids (intravenous vs. oral ingestion) is more effective in stimulating the rate of muscle protein synthesis in elderly subjects. DESIGN Fourteen elderly subjects were assigned to one of two groups. Following insertion of femoral arterial and venous catheters, subjects were infused with a primed, continuous infusion of L-[ring-2H5] phenylalanine. Blood samples and muscle biopsies were obtained to measure muscle protein fractional synthesis rate (FSR) with the precursor-product model, phenylalanine kinetics across the leg with the three-pool model, and whole body phenylalanine kinetics. Protein metabolism parameters were measured in the basal period, and during the administration of oral amino acids (n=8) or a similar amount of intravenous amino acids (n=6). RESULTS Enteral and parenteral amino acid administration increased amino acid arterial concentrations and delivery to the leg to a similar extent in both groups. Muscle protein synthesis as measured by both FSR, and the three-pool model, increased during amino acid administration (P < 0.05 vs. basal) in both groups with no differences between groups. Whole body proteolysis did not change with the oral amino acids whereas it increased slightly during parenteral amino acid administration. CONCLUSIONS Increased amino acid availability stimulates the rate of muscle protein synthesis independent of the route of administration (enteral vs. parenteral). PMID:12459885

  5. DFT study of the Lewis acid mediated synthesis of 3-acyltetramic acids.

    PubMed

    Mikula, Hannes; Svatunek, Dennis; Skrinjar, Philipp; Horkel, Ernst; Hametner, Christian; Fröhlich, Johannes

    2014-05-01

    The synthesis of 3-acyltetramic acids by C-acylation of pyrrolidine-2,4-diones was studied by density functional theory (DFT). DFT was applied to the mycotoxin tenuazonic acid (TeA), an important representative of these bioactive natural compounds. Lewis acid mediated C-acylation in combination with previous pH-neutral domino N-acylation-Wittig cyclization can be used for the efficient preparation of 3-acyltetramic acids. Nevertheless, quite harsh conditions are still required to carry out this synthetic step, leading to unwanted isomerization of stereogenic centers in some cases. In the presented study, the reaction pathway for the C-acetylation of (5S,6S-5-s-butylpyrrolidine-2,4-dione was studied in terms of mechanism, solvent effects, and Lewis acid activation, in order to obtain an appropriate theoretical model for further investigations. Crucial steps were identified that showed rather high activation barriers and rationalized previously reported experimental discoveries. After in silico optimization, aluminum chlorides were found to be promising Lewis acids that promote the C-acylation of pyrrolidine-2,4-diones, whereas calculations performed in various organic solvents showed that the solvent had only a minor effect on the energy profiles of the considered mechanisms. This clearly indicates that further synthetic studies should focus on the Lewis-acidic mediator rather than other reaction parameters. Additionally, given the results obtained for different reaction routes, the stereochemistry of this C-acylation is discussed. It is assumed that the formation of Z-configured TeA is favored, in good agreement with our previous studies.

  6. Pyrazinamide and Pyrazinoic Acid Derivatives Directed to Mycobacterial Enzymes Against Tuberculosis.

    PubMed

    Corrêa, Michelle Fidelis; Fernandes, João Paulo-dos Santos

    2016-01-01

    Tuberculosis (TB) is an infectious diseases responsible for thousands of deaths worldwide. Due to the use of antimycobacterial drugs, TB prevalence seemed to be controlled, but with the appearance of resistant tuberculosis cases, the concern about the disease had become significant again, as well as the need for new alternatives to TB treatment. Since pyrazinamide (PZA) is part of the firstline agents in TB treatment, several derivatives of this drug were described, besides pyrazinoic acid (POA) derivatives, the active form of PZA. POA has been used mainly to design prodrugs to be activated by mycobacterial esterases, while PZA derivatives should be activated specifically by the nicotinamidase/ pyrazinamidase (PZAse), or other PZAse-independent pathways. The intention of this paper is to discuss the state of art of PZA and POA derivatives and their activity against Mycobacterium tuberculosis and other mycobacteria, besides the therapeutic potential. Focus was given in prodrugs and derivatives directed to mycobacterial enzymes involved in its activation or mechanism of action.

  7. Aptamer- and nucleic acid enzyme-based systems for simultaneous detection of multiple analytes

    DOEpatents

    Lu, Yi [Champaign, IL; Liu, Juewen [Albuquerque, NM

    2011-11-15

    The present invention provides aptamer- and nucleic acid enzyme-based systems for simultaneously determining the presence and optionally the concentration of multiple analytes in a sample. Methods of utilizing the system and kits that include the sensor components are also provided. The system includes a first reactive polynucleotide that reacts to a first analyte; a second reactive polynucleotide that reacts to a second analyte; a third polynucleotide; a fourth polynucleotide; a first particle, coupled to the third polynucleotide; a second particle, coupled to the fourth polynucleotide; and at least one quencher, for quenching emissions of the first and second quantum dots, coupled to the first and second reactive polynucleotides. The first particle includes a quantum dot having a first emission wavelength. The second particle includes a second quantum dot having a second emission wavelength different from the first emission wavelength. The third polynucleotide and the fourth polynucleotide are different.

  8. [Effects of different tillage methods on phospholipid fatty acids and enzyme activities in calcareous cinnamon soil].

    PubMed

    Pei, Xue-Xia; Dang, Jian-You; Zhang, Ding-Yi; Wang, Jiao-Ai; Zhang, Jing

    2014-08-01

    In order to study changes of physical and chemical characteristics and microbial activities in soil under different tillage methods, effects of four tillage methods, rotary tillage (RT), subsoil tillage (ST), conventional tillage (CT) with corn straw returned to soil, and rotary tillage with no corn straw returned to soil (CK), on phospholipid fatty acids (PLFA) characteristics and hydrolase enzymes activities in calcareous cinnamon soil were investigated. The results showed that soil hydrolase enzymes activities, nutrient contents, microbial diversity varied greatly with the different tillage methods. Returning corn straw to soil increased the kinds, amount of soil total PLFAs, bacteria PLFAs and actonomycetes PLFAs, while decreased the fungi PLFAs, indicating that fungi was more adaptable than bacteria to an infertile environment. ST and CT resulted in higher amounts of total PLFAs, which were 74.7% and 53.3% higher than that of CK, indicating they were more beneficial to the growth of plants. They could also improve soil physical and chemical properties, increase alk-phosphatase, protease and urease activities, which would provide a favorable soil condition for high and stable crop yields.

  9. Urinary D-glucaric acid and serum hepatic enzyme levels in chronic alcoholics.

    PubMed

    Tutor, J C; Alvarez-Prechous, A; Bernabeu, F; Pardiñas, M C; Paz, J M; Lareu, V

    1988-06-01

    Urinary D-glucaric acid (DGA) and the activities of gamma-glutamyl transferase (GGT) and other hepatic enzymes in serum were determined in 33 noncirrhotic male alcoholics who had continued to consume alcohol until at least 24 h prior to the taking of samples. DGA excretion was significantly greater in them than in a group of 30 healthy controls (p less than 0.001), exceeding the upper reference level in 38% of the alcoholic cases (as compared with 88% for GGT). In the alcoholic patients, there was highly significant correlation between urinary DGA and serum GGT (r = 0.613, p less than 0.001), suggesting that in both cases the increased levels are due to enzyme induction. None of the biochemical variables studied were significantly correlated with estimated daily alcohol consumption. Urinary DGA levels fell off rapidly with abstinence, and in 31 alcoholic patients who had consumed no alcohol for 5 days, there was no statistically significant correlation between DGA excretion and serum GGT (r = 0.158, p congruent to 0.4).

  10. Enzymic synthesis of 1-O-indol-3-ylacetyl-beta-D-glucose and indol-3-ylacetyl-myo-inositol.

    PubMed Central

    Michalczuk, L; Bandurski, R S

    1982-01-01

    An enzyme fraction from extracts of immature kernels of Zea mays catalyses the formation of 1-O-indol-3-ylacetyl-beta-D-glucose from indol-3-ylacetic acid and UDP-glucose. A second enzyme fraction catalyses the formation of indol-3-ylacetyl-myo-inositol from 1-O-indol-3-ylacetyl-beta-D-glucose and myo-inositol. To our knowledge, this is the first example of hydroxy-group acylation by a 1-O-acyl sugar. The following reaction sequence is proposed: Indol-3-ylacetic acid + UDP-glucose leads to indol-3-ylacetylglucose + UDP (1) Indol-3-ylacetylglucose + myo-inositol leads to indol-3-ylacetyl-myo-inositol + glucose (2) The enzyme catalysing reaction (1) is called UDP-glucose:indol-3-ylacetate glucosyl-transferase (indol-3-ylacetylglucose synthase), and that catalysing reaction (2) is indol-3-ylacetylglucose:myo-inositol indol-3-ylacetyltransferase (indol-3-ylacetyl-myo-inositol synthase). We further show that indol-3-ylacetylglucose synthase is specific for UDP-glucose and, at the stage of purity tested, the enzyme will use either indol-3-ylacetic acid or naphthalene-1-acetic acid, but not 2.4-dichlorophenoxyacetic acid, as glucose acceptor. The indol-3-ylacetyl-myo-inositol synthase is specific for indol-3-ylacetyl-glucose and will not use naphthalene-1-acetylglucose as substrate, and it is specific for myo-inositol among the alcohol acceptors tested. Thus, of the auxins tested, only indol-3-ylacetic acid forms the myo-inositol ester. PMID:6218801

  11. Activation of the constitutive androstane receptor inhibits gluconeogenesis without affecting lipogenesis or fatty acid synthesis in human hepatocytes

    SciTech Connect

    Lynch, Caitlin; Pan, Yongmei; Li, Linhao; Heyward, Scott; Moeller, Timothy; Swaan, Peter W.; Wang, Hongbing

    2014-08-15

    Objective: Accumulating evidence suggests that activation of mouse constitutive androstane receptor (mCAR) alleviates type 2 diabetes and obesity by inhibiting hepatic gluconeogenesis, lipogenesis, and fatty acid synthesis. However, the role of human (h) CAR in energy metabolism is largely unknown. The present study aims to investigate the effects of selective hCAR activators on hepatic energy metabolism in human primary hepatocytes (HPH). Methods: Ligand-based structure–activity models were used for virtual screening of the Specs database ( (www.specs.net)) followed by biological validation in cell-based luciferase assays. The effects of two novel hCAR activators (UM104 and UM145) on hepatic energy metabolism were evaluated in HPH. Results: Real-time PCR and Western blotting analyses reveal that activation of hCAR by UM104 and UM145 significantly repressed the expression of glucose-6-phosphatase and phosphoenolpyruvate carboxykinase, two pivotal gluconeogenic enzymes, while exerting negligible effects on the expression of genes associated with lipogenesis and fatty acid synthesis. Functional experiments show that UM104 and UM145 markedly inhibit hepatic synthesis of glucose but not triglycerides in HPH. In contrast, activation of mCAR by 1,4-bis[2-(3,5-dichloropyridyloxy)]benzene, a selective mCAR activator, repressed the expression of genes associated with gluconeogenesis, lipogenesis, and fatty acid synthesis in mouse primary hepatocytes, which were consistent with previous observations in mouse model in vivo. Conclusion: Our findings uncover an important species difference between hCAR and mCAR in hepatic energy metabolism, where hCAR selectively inhibits gluconeogenesis without suppressing fatty acid synthesis. Implications: Such species selectivity should be considered when exploring CAR as a potential therapeutic target for metabolic disorders. - Highlights: • Novel hCAR activators were identified by computational and biological approaches. • The role

  12. Clinical and metabolic correction of pompe disease by enzyme therapy in acid maltase-deficient quail.

    PubMed Central

    Kikuchi, T; Yang, H W; Pennybacker, M; Ichihara, N; Mizutani, M; Van Hove, J L; Chen, Y T

    1998-01-01

    Pompe disease is a fatal genetic muscle disorder caused by a deficiency of acid alpha-glucosidase (GAA), a glycogen degrading lysosomal enzyme. GAA-deficient (AMD) Japanese quails exhibit progressive myopathy and cannot lift their wings, fly, or right themselves from the supine position (flip test). Six 4-wk-old acid maltase-deficient quails, with the clinical symptoms listed, were intravenously injected with 14 or 4.2 mg/kg of precursor form of recombinant human GAA or buffer alone every 2-3 d for 18 d (seven injections). On day 18, both high dose-treated birds (14 mg/kg) scored positive flip tests and flapped their wings, and one bird flew up more than 100 cm. GAA activity increased in most of the tissues examined. In heart and liver, glycogen levels dropped to normal and histopathology was normal. In pectoralis muscle, morphology was essentially normal, except for increased glycogen granules. In sharp contrast, sham-treated quail muscle had markedly increased glycogen granules, multi-vesicular autophagosomes, and inter- and intrafascicular fatty infiltrations. Low dose-treated birds (4.2 mg/kg) improved less biochemically and histopathologically than high dose birds, indicating a dose-dependent response. Additional experiment with intermediate doses and extended treatment (four birds, 5.7-9 mg/kg for 45 d) halted the progression of the disease. Our data is the first to show that an exogenous protein can target to muscle and produce muscle improvement. These data also suggest enzyme replacement with recombinant human GAA is a promising therapy for human Pompe disease. PMID:9466978

  13. Clinical and metabolic correction of pompe disease by enzyme therapy in acid maltase-deficient quail.

    PubMed

    Kikuchi, T; Yang, H W; Pennybacker, M; Ichihara, N; Mizutani, M; Van Hove, J L; Chen, Y T

    1998-02-15

    Pompe disease is a fatal genetic muscle disorder caused by a deficiency of acid alpha-glucosidase (GAA), a glycogen degrading lysosomal enzyme. GAA-deficient (AMD) Japanese quails exhibit progressive myopathy and cannot lift their wings, fly, or right themselves from the supine position (flip test). Six 4-wk-old acid maltase-deficient quails, with the clinical symptoms listed, were intravenously injected with 14 or 4.2 mg/kg of precursor form of recombinant human GAA or buffer alone every 2-3 d for 18 d (seven injections). On day 18, both high dose-treated birds (14 mg/kg) scored positive flip tests and flapped their wings, and one bird flew up more than 100 cm. GAA activity increased in most of the tissues examined. In heart and liver, glycogen levels dropped to normal and histopathology was normal. In pectoralis muscle, morphology was essentially normal, except for increased glycogen granules. In sharp contrast, sham-treated quail muscle had markedly increased glycogen granules, multi-vesicular autophagosomes, and inter- and intrafascicular fatty infiltrations. Low dose-treated birds (4.2 mg/kg) improved less biochemically and histopathologically than high dose birds, indicating a dose-dependent response. Additional experiment with intermediate doses and extended treatment (four birds, 5.7-9 mg/kg for 45 d) halted the progression of the disease. Our data is the first to show that an exogenous protein can target to muscle and produce muscle improvement. These data also suggest enzyme replacement with recombinant human GAA is a promising therapy for human Pompe disease.

  14. Evidence for separate enzymes of pyruvate decarboxylation and pyruvate synthesis in soluble extracts of Clostridium pasteurianum.

    PubMed

    Bush, R S; Sauer, F D

    1977-04-25

    Additional evidence to that already presented (Sauer, F. D., Bush, R. S., and Stevenson, I. L. (1976) Biochim. Biophys. Acta 445, 518-520) suggests that pyruvate-ferredoxin oxidoreductase isolated from Clostridium pasteurianum consists of two separate enzymes: (a) pyruvate lyase, which catalyzes the CoA and electron acceptor-dependent decarboxylation of pyruvate, and (b) pyruvate synthase, which catalyzes the reduced ferredoxin-dependent carboxylation of acetyl-CoA to pyruvate. The enzymes separated on Sephadex G-200 and with acrylamide gel electrophoresis but complete separation of one enzyme free of the other was not achieved. Extensive purification procedures were not used because both enzymes are unstable. The results confirm published reports that pyruvate lyase contains thiamin and a chromophore which participates in electron transfer. Pyruvate synthase, however, did not appear to be a thiamin enzyme and there was no evidence to indicate participation of an enzyme chromophore in the pyruvate synthase reaction.

  15. Lectin-directed enzyme activated prodrug therapy (LEAPT): Synthesis and evaluation of rhamnose-capped prodrugs.

    PubMed

    Garnier, Philippe; Wang, Xiang-Tao; Robinson, Mark A; van Kasteren, Sander; Perkins, Alan C; Frier, Malcolm; Fairbanks, Antony J; Davis, Benjamin G

    2010-12-01

    The lectin-directed enzyme activated prodrug therapy (LEAPT) bipartite drug delivery system utilizes glycosylated enzyme, localized according to its sugar pattern, and capped prodrugs released by that enzyme. In this way, the sugar coat of a synthetic enzyme determines the site of release of a given drug. Here, prodrugs of doxorubicin and 5-fluorouracil capped by the nonmammalian l-rhamnosyl sugar unit have been efficiently synthesized and evaluated for use in the LEAPT system. Both are stable in blood, released by synthetically d-galactosylated rhamnosidase enzyme, and do not inhibit the uptake of the synthetic enzyme to its liver target. These results are consistent with their proposed mode of action and efficacy in models of liver cancer, and confirm modular flexibility in the drugs that may be used in LEAPT.

  16. Inhibition of the RTEM beta-lactamase from Escherichia coli. Interaction of enzyme with derivatives of olivanic acid.

    PubMed

    Charnas, R L; Knowles, J R

    1981-05-12

    The interaction of the RTEM beta-lactamase with two derivatives of olivanic acid has been studied. The compound MM22382 (1) behaves simply as a good substrate for the enzyme and is a relatively ineffective inhibitor. In contrast, the sulfate ester MM13902 (2) is a poor substrate and an excellent inhibitor of the enzyme. The inhibition derives from a branching of the normal hydrolytic pathway of the enzyme. At long times, all the catalytic activity of the enzyme returns. Free sulfate ion is not produced during the interaction with the enzyme, which rules out a mechanistic pathway involving beta elimination between C-6 and C-8. The validity of a number of alternative schemes is assessed.

  17. Production of succinic acid through overexpression of NAD{sup +}-dependent malic enzyme in an Escherichia coli mutant

    SciTech Connect

    Stols, L.; Donnelly, M.I.

    1997-07-01

    NAD{sup +}-dependent malic enzyme was cloned from the Escherichia coli genome by PCR based on the published partial sequence of the gene. The enzyme was overexpressed and purified to near homogeneity in two chromatographic steps and was analyzed kinetically in the forward and reverse directions. The K{sub m} values determined in the presence of saturating cofactor and manganese ion were 0.26 mM for malate (physiological direction) and 16 mM for pyruvate (reverse direction). When malic enzyme was induced under appropriate culture conditions in a strain of E. coli that was unable to ferment glucose and accumulated pyruvate, fermentative metabolism of glucose was restored. Succinic acid was the major fermentation product formed. When this fermentation was performed in the presence of hydrogen, the yield of succinic acid increased. The constructed pathway represents an alternative metabolic route for the fermentative production of dicarboxylic acids from renewable feedstocks. 27 refs., 5 figs., 4 tabs.

  18. In situ synthesis of porous silica nanoparticles for covalent immobilization of enzymes

    NASA Astrophysics Data System (ADS)

    Yang, Xiaowei; Cai, Zhengwei; Ye, Zhangmei; Chen, Sheng; Yang, Yu; Wang, Haifang; Liu, Yuanfang; Cao, Aoneng

    2012-01-01

    A simple method is used to covalently encapsulate enzymes in silica nanoparticles. The encapsulation is highlighted by the high enzyme loading and porous channels that provide efficient diffusion for small substrate and product molecules while preventing protease degradation.A simple method is used to covalently encapsulate enzymes in silica nanoparticles. The encapsulation is highlighted by the high enzyme loading and porous channels that provide efficient diffusion for small substrate and product molecules while preventing protease degradation. Electronic supplementary information (ESI) available: Experimental procedures and the result of the surface-grafted catalase control experiment. See DOI: 10.1039/c1nr11153a

  19. The Expression and Prognostic Significance of Retinoic Acid Metabolising Enzymes in Colorectal Cancer

    PubMed Central

    Brown, Gordon T.; Cash, Beatriz Gimenez; Blihoghe, Daniela; Johansson, Petronella; Alnabulsi, Ayham; Murray, Graeme I.

    2014-01-01

    Colorectal cancer is one of the most common types of cancer with over fifty percent of patients presenting at an advanced stage. Retinoic acid is a metabolite of vitamin A and is essential for normal cell growth and aberrant retinoic acid metabolism is implicated in tumourigenesis. This study has profiled the expression of retinoic acid metabolising enzymes using a well characterised colorectal cancer tissue microarray containing 650 primary colorectal cancers, 285 lymph node metastasis and 50 normal colonic mucosal samples. Immunohistochemistry was performed on the tissue microarray using monoclonal antibodies which we have developed to the retinoic acid metabolising enzymes CYP26A1, CYP26B1, CYP26C1 and lecithin retinol acyl transferase (LRAT) using a semi-quantitative scoring scheme to assess expression. Moderate or strong expression of CYP26A1was observed in 32.5% of cancers compared to 10% of normal colonic epithelium samples (p<0.001). CYP26B1 was moderately or strongly expressed in 25.2% of tumours and was significantly less expressed in normal colonic epithelium (p<0.001). CYP26C1 was not expressed in any sample. LRAT also showed significantly increased expression in primary colorectal cancers compared with normal colonic epithelium (p<0.001). Strong CYP26B1 expression was significantly associated with poor prognosis (HR = 1.239, 95%CI = 1.104–1.390, χ2 = 15.063, p = 0.002). Strong LRAT was also associated with poorer outcome (HR = 1.321, 95%CI = 1.034–1.688, χ2 = 5.039, p = 0.025). In mismatch repair proficient tumours strong CYP26B1 (HR = 1.330, 95%CI = 1.173–1.509, χ2 = 21.493, p<0.001) and strong LRAT (HR = 1.464, 95%CI = 1.110–1.930, χ2 = 7.425, p = 0.006) were also associated with poorer prognosis. This study has shown that the retinoic acid metabolising enzymes CYP26A1, CYP26B1 and LRAT are significantly overexpressed in colorectal cancer and that CYP26B1 and LRAT are

  20. Synthesis and cytotoxic activity of new betulin and betulinic acid esters with conjugated linoleic acid (CLA).

    PubMed

    Tubek, Barbara; Mituła, Paweł; Niezgoda, Natalia; Kempińska, Katarzyna; Wietrzyk, Joanna; Wawrzeńczyk, Czesław

    2013-04-01

    The synthesis of new ester derivatives of betulin (3a-c) and betulinic acid (4) with conjugated linoleic acid isomers (CLA; in a mixture of 43.4% 9c, 11t; 49.5% 10t, 12c; 7.1% other isomers) is presented. Esterification was carried out with N,N'-dicyclohexylcarbodiimide (DCC) as the coupling agent in the presence of 4-dimethylamino-pyridine (DMAP) in dichloromethane (or pyridine). The in vitro cytotoxic effect of betulin (1), betulinic acid (2), a mixture of CLA isomers and their derivatives (3a-c, 4) was examined using the MTT assay against four cancer cell lines (P388, CEM/C2, CCRF/CEM and HL-60) and the SRB assay on the HT-29 cell line. Ester 4 was the most active among the esters synthesized against the CEM/C2 cell line with an ID50 value 16.9 +/- 6.5 microg/mL. Betulin (1), betulinic acid (2) and CLA were the most active agents against the cancer cell lines studied.

  1. Depressant effects of ambroxol and erdosteine on cytokine synthesis, granule enzyme release, and free radical production in rat alveolar macrophages activated by lipopolysaccharide.

    PubMed

    Jang, Yoon Young; Song, Jin Ho; Shin, Yong Kyoo; Han, Eun Sook; Lee, Chung Soo

    2003-04-01

    The present study examined the effects of ambroxol and erdosteine, bronchial expectorants, on the cytokine synthesis, granule enzyme release, and free radical production in rat alveolar macrophages activated by lipopolysaccharide. Ambroxol and erdosteine significantly decreased the production of tumour necrosis factors-alpha, interleukin-1beta, and interleukin-6 in alveolar macrophages activated by lipopolysaccharide. These drugs significantly reduced the production of superoxide anion, hydrogen peroxide, and nitric oxide and the release of acid phosphatase and lysozyme in lipopolysaccharide-activated macrophages. Ambroxol and erdosteine showed no scavenging effect on superoxide anion and hydrogen peroxide, whereas both drugs effectively decomposed nitric oxide. The results show that ambroxol and erdosteine may inhibit the responses, including cytokine synthesis and free radical production, in rat alveolar macrophages activated by lipopolysaccharide. Unlike the production of reactive oxygen species, the inhibitory effect of ambroxol and erdosteine on the production of nitric oxide in lipopolysaccharide-activated alveolar macrophages may be accomplished by a scavenging action on the species and inhibition of the respiratory burst.

  2. Nucleic acid sensing with enzyme-DNA binding protein conjugates cascade and simple DNA nanostructures.

    PubMed

    Aktas, Gülsen Betül; Skouridou, Vasso; Masip, Lluis

    2017-03-22

    A versatile and universal DNA sensing platform is presented based on enzyme-DNA binding protein tags conjugates and simple DNA nanostructures. Two enzyme conjugates were thus prepared, with horseradish peroxidase linked to the dimeric single-chain bacteriophage Cro repressor protein (HRP-scCro) and glucose oxidase linked to the dimeric headpiece domain of Escherichia coli LacI repressor protein (GOx-dHP), and used in conjunction with a hybrid ssDNA-dsDNA detection probe. This probe served as a simple DNA nanostructure allowing first for target recognition through its target-complementary single-stranded DNA (ssDNA) part and then for signal generation after conjugate binding on the double-stranded DNA (dsDNA) containing the specific binding sites for the dHP and scCro DNA binding proteins. The DNA binding proteins chosen in this work have different sequence specificity, high affinity, and lack of cross-reactivity. The proposed sensing system was validated for the detection of model target ssDNA from high-risk human papillomavirus (HPV16) and the limits of detection of 45, 26, and 21 pM were achieved using the probes with scCro/dHP DNA binding sites ratio of 1:1, 2:1, and 1:2, respectively. The performance of the platform in terms of limit of detection was comparable to direct HRP systems using target-specific oligonucleotide-HRP conjugates. The ratio of the two enzymes can be easily manipulated by changing the number of binding sites on the detection probe, offering further optimization possibilities of the signal generation step. Moreover, since the signal is obtained in the absence of externally added hydrogen peroxide, the described platform is compatible with paper-based assays for molecular diagnostics applications. Finally, just by changing the ssDNA part of the detection probe, this versatile nucleic acid platform can be used for the detection of different ssDNA target sequences or in a multiplex detection configuration without the need to change any of the

  3. Arabidopsis thaliana VTC4 encodes L-galactose-1-P phosphatase, a plant ascorbic acid biosynthetic enzyme.

    PubMed

    Conklin, Patricia L; Gatzek, Stephan; Wheeler, Glen L; Dowdle, John; Raymond, Marjorie J; Rolinski, Susanne; Isupov, Mikhail; Littlechild, Jennifer A; Smirnoff, Nicholas

    2006-06-09

    In plants, a proposed ascorbate (vitamin C) biosynthesis pathway occurs via GDP-D-mannose (GDP-D-Man), GDP-L-galactose (GDP-L-Gal), and L-galactose. However, the steps involved in the synthesis of L-Gal from GDP-L-Gal in planta are not fully characterized. Here we present evidence for an in vivo role for L-Gal-1-P phosphatase in plant ascorbate biosynthesis. We have characterized a low ascorbate mutant (vtc4-1) of Arabidopsis thaliana, which exhibits decreased ascorbate biosynthesis. Genetic mapping and sequencing of the VTC4 locus identified a mutation (P92L) in a gene with predicted L-Gal-1-P phosphatase activity (At3g02870). Pro-92 is within a beta-bulge that is conserved in related myo-inositol monophosphatases. The mutation is predicted to disrupt the positioning of catalytic amino acid residues within the active site. Accordingly, L-Gal-1-P phosphatase activity in vtc4-1 was approximately 50% of wild-type plants. In addition, vtc4-1 plants incorporate significantly more radiolabel from [2-(3)H]Man into L-galactosyl residues suggesting that the mutation increases the availability of GDP-L-Gal for polysaccharide synthesis. Finally, a homozygous T-DNA insertion line, which lacks a functional At3g02870 gene product, is also ascorbate-deficient (50% of wild type) and deficient in L-Gal-1-P phosphatase activity. Genetic complementation tests revealed that the insertion mutant and VTC4-1 are alleles of the same genetic locus. The significantly lower ascorbate and perturbed L-Gal metabolism in vtc4-1 and the T-DNA insertion mutant indicate that L-Gal-1-P phosphatase plays a role in plant ascorbate biosynthesis. The presence of ascorbate in the T-DNA insertion mutant suggests there is a bypass to this enzyme or that other pathways also contribute to ascorbate biosynthesis.

  4. Effect of process parameters on succinic acid production in Escherichia coli W3110 and enzymes involved in the reductive tricarboxylic acid cycle.

    PubMed

    Isar, Jasmine; Agarwal, Lata; Saran, Saurabh; Gupta, Pritesh; Saxena, Rajendra Kumar

    2006-09-01

    The effect of process optimization on succinic acid production by Escherichia coli W3110 and on enzymes involved in the reverse tricarboxylic acid cycle was studied. Approximately, 7.02 g L-1 of succinic acid was produced in 60 h at pH 7.0 in 500 mL anaerobic bottles containing 300 mL of the medium, wherein the sucrose concentration was 2.5%, the ratio of tryptone to ammonium hydrogen phosphate was 1:1, and the concentration of magnesium carbon ate was 1.5%. When these optimized fermentation conditions were employed in a 10 L bioreactor, 11.2 g L-1 of succinic acid was produced in 48 h. This is a 10-fold increase in succinic acid production from the initial titer of 0.94 g L-1. This clearly indicates the importance of process optimization, where by manipulating the media composition and production conditions, a remarkable increase in the production of the desired biomolecule can be obtained. The production of succinic acid is a multi-step reaction through the reverse tricarboxylic acid cycle. A linear relationship was observed between succinic acid production and the enzyme activities. The enzyme activities were found to increase in the order phospho-enol-pyruvate carboxylaseenzyme was not a very active participant in the production of succinic acid, since it catalyzes the phosphorylation of oxaloacetic acid to yield phospho-enol-pyruvate.

  5. Long-term leucine induced stimulation of muscle protein synthesis is amino acid dependent

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Infusing leucine for 1 h increases skeletal muscle protein synthesis in the neonate, but this is not sustained for 2 h unless the corresponding fall in amino acids is prevented. This study aimed to determine whether a continuous leucine infusion can stimulate protein synthesis for a prolonged period...

  6. The plant Selaginella moellendorffii possesses enzymes for synthesis and hydrolysis of the compatible solutes mannosylglycerate and glucosylglycerate.

    PubMed

    Nobre, Ana; Empadinhas, Nuno; Nobre, Maria Fernanda; Lourenço, Eva Correia; Maycock, Christopher; Ventura, Maria Rita; Mingote, Ana; da Costa, Milton S

    2013-03-01

    A mannosylglycerate synthase (MgS) gene detected in the genome of Selaginella moellendorffii was expressed in E. coli and the recombinant enzyme was purified and characterized. A remarkable and unprecedented feature of this enzyme was the ability to efficiently synthesize mannosylglycerate (MG) and glucosylglycerate (GG) alike, with maximal activity at 50 °C, pH 8.0 and with Mg(2+) as reaction enhancer. We have also identified a novel glycoside hydrolase gene in this plant's genome, which was functionally confirmed to be highly specific for the hydrolysis of MG and GG and named MG hydrolase (MgH), due to its homology with bacterial MgHs. The recombinant enzyme was maximally active at 40 °C and at pH 6.0-6.5. The activity was independent of cations, but Mn(2+) was a strong stimulator. Regardless of these efficient enzymatic resources we could not detect MG or GG in S. moellendorffii or in the extracts of five additional Selaginella species. Herein, we describe the properties of the first eukaryotic enzymes for the synthesis and hydrolysis of the compatible solutes, MG and GG.

  7. [Comparative effects of fluoride on three enzymes, hydrolyzing pyrophosphate - acid and alkaline phosphatases and inorganic pyrophosphatase].

    PubMed

    Kasho, V N; Baĭkov, A A; Avaeva, S M

    1982-08-01

    The effects of fluoride on the activities of acid phosphatase (EC 3.1.3.2) from potato and alkaline phosphatase (EC 3.1.3.1) from E. coli during pyrophosphate and p-nitrophenylphosphate hydrolysis and on the activities of inorganic pyrophosphatase (EC 3.6.1.1) from baker's yeast during pyrophosphate hydrolysis were compared. For both phosphatases the type of interaction was found to be independent on the nature of substrate. For acid phosphatase and inorganic pyrophosphatase the inhibition was of non-competitive and uncompetitive types, respectively. In the case of alkaline phosphatase fluoride increased the rate of p-nitrophenol release during p-nitrophenylphosphate hydrolysis at pH greater than or equal to 7.9 without affecting the rate of phosphate release, which is indicative of fluorophosphate formation in the course of the transphosphorylation reaction. The data obtained suggest the existence of essential differences in the mechanisms of fluoride effects on the three enzymes under study.

  8. Integrated lipase production and in situ biodiesel synthesis in a recombinant Pichia pastoris yeast: an efficient dual biocatalytic system composed of cell free enzymes and whole cell catalysts

    PubMed Central

    2014-01-01

    Background Lipase-catalyzed biotransformation of acylglycerides or fatty acids into biodiesel via immobilized enzymes or whole cell catalysts has been considered as one of the most promising methods to produce renewable and environmentally friendly alternative liquid fuels, thus being extensively studied so far. In all previously pursued approaches, however, lipase enzymes are prepared in an independent process separated from enzymatic biodiesel production, which would unavoidably increase the cost and energy consumption during industrial manufacture of this cost-sensitive energy product. Therefore, there is an urgent need to develop novel cost-effective biocatalysts and biocatalytic processes with genuine industrial feasibility. Result Inspired by the consolidated bioprocessing of lignocellulose to generate bioethanol, an integrated process with coupled lipase production and in situ biodiesel synthesis in a recombinant P. pastoris yeast was developed in this study. The novel and efficient dual biocatalytic system based on Thermomyces lanuginosus lipase took advantage of both cell free enzymes and whole cell catalysts. The extracellular and intracellular lipases of growing yeast cells were simultaneously utilized to produce biodiesel from waste cooking oils in situ and in one pot. This integrated system effectively achieved 58% and 72% biodiesel yield via concurrent esterified-transesterified methanolysis and stepwise hydrolysis-esterification at 3:1 molar ratio between methanol and waste cooking oils, respectively. Further increasing the molar ratio of methanol to waste cooking oils to 6:1 led to an 87% biodiesel yield using the stepwise strategy. Both water tolerance and methanol tolerance of this novel system were found to be significantly improved compared to previous non-integrated biodiesel production processes using separately prepared immobilized enzymes or whole cell catalysts. Conclusion We have proposed a new concept of integrated biodiesel production

  9. The Synthesis of an Amino Acid Derivative and Spectroscopic Monitoring of Dipeptide Formation.

    ERIC Educational Resources Information Center

    Simmonds, Richard J.

    1987-01-01

    Described are experiments to give students experience in the synthesis of peptides from amino acids and to use visible spectroscopy to measure a rate of reaction. The activities were designed for undergraduate courses. (RH)

  10. [Genetic manipulation of the synthesis of fungal enzymes for use in the food industry].

    PubMed

    González, R; Pérez-González, J A; Ventura, L; Sánchez, P; Sanz, P; Fernández Espinar, M T; Vallés, S; Piñaga, F; Ramón, D

    1993-02-01

    Food industries use a great variety of enzymes as additives. The main percentage of them are produced by species of filamentous fungi. In this review we present the strategies to purify and overproduce this kind of enzymes using recombinant DNA techniques.

  11. Reassessment of the Genetic Regulation of Fatty Acid Synthesis in Escherichia coli: Global Positive Control by the Dual Functional Regulator FadR

    PubMed Central

    My, L.; Ghandour Achkar, N.; Viala, J. P.

    2015-01-01

    ABSTRACT In Escherichia coli, the FadR transcriptional regulator represses the expression of fatty acid degradation (fad) genes. However, FadR is also an activator of the expression of fabA and fabB, two genes involved in unsaturated fatty acid synthesis. Therefore, FadR plays an important role in maintaining the balance between saturated and unsaturated fatty acids in the membrane. We recently showed that FadR also activates the promoter upstream of the fabH gene (L. My, B. Rekoske, J. J. Lemke, J. P. Viala, R. L. Gourse, and E. Bouveret, J Bacteriol 195:3784–3795, 2013, doi:10.1128/JB.00384-13). Furthermore, recent transcriptomic and proteomic data suggested that FadR activates the majority of fatty acid (FA) synthesis genes. In the present study, we tested the role of FadR in the expression of all genes involved in FA synthesis. We found that FadR activates the transcription of all tested FA synthesis genes, and we identified the FadR binding site for each of these genes. This necessitated the reassessment of the transcription start sites for accA and accB genes described previously, and we provide evidence for the presence of multiple promoters driving the expression of these genes. We showed further that regulation by FadR impacts the amount of FA synthesis enzymes in the cell. Our results show that FadR is a global regulator of FA metabolism in E. coli, acting both as a repressor of catabolism and an activator of anabolism, two directly opposing pathways. IMPORTANCE In most bacteria, a transcriptional regulator tunes the level of FA synthesis enzymes. Oddly, such a global regulator still was missing for E. coli, which nonetheless is one of the prominent model bacteria used for engineering biofuel production using the FA synthesis pathway. Our work identifies the FadR functional dual regulator as a global activator of almost all FA synthesis genes in E. coli. Because FadR also is the repressor of FA degradation, FadR acts both as a repressor and an activator

  12. Synthesis of functionalized fluorescent gold nanoclusters for acid phosphatase sensing

    NASA Astrophysics Data System (ADS)

    Sun, Jian; Yang, Fan; Yang, Xiurong

    2015-10-01

    A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au+ complexes, and then a class of ~2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ~1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by introducing an alkaline aqueous solution of MUA into the GSH-Au+ complexes or AuNC@GSH solution. Subsequently, a reliable AuNC@GSH/MUA-based real-time assay of acid phosphatase (ACP) is established for the first time, inspired by the selective coordination of Fe3+ with surface ligands of AuNCs, the higher binding affinity between the pyrophosphate ion (PPi) and Fe3+, and the hydrolysis of PPi into orthophosphate by ACP. Our fluorescent chemosensor can also be applied to assay ACP in a real biological sample and, furthermore, to screen the inhibitor of ACP. This report paves a new avenue for synthesizing AuNCs based on either the bottom-up reduction or top-down etching method, establishing real-time fluorescence assays for ACP by means of PPi as the substrate, and further exploring the sensing applications of fluorescent AuNCs.A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au+ complexes, and then a class of ~2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ~1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by

  13. pH modulation of transient state kinetics of enzymes. II. Transient state kinetics of plant cell wall acid phosphatase.

    PubMed

    Crasnier, M; Ricard, J

    1984-03-01

    The pre-steady-state kinetics of plant cell wall acid phosphatase has been investigated at different pH values. The approach of the steady stale lasts about 1 or 2 s and may be fitted with two exponential terms. For certain pH values the approach to the steady state exhibits damped oscillations. Plotting the sum and the product of the two time constants of these exponentials as a function of substrate concentration yields two straight lines. From the slopes and intercepts of these lines one may determine the values of rate and ionization constants involved in the reaction scheme. The results obtained are consistent with the view that the binding of the substrate to the enzyme does not induce a 'slow' conformation change of the enzyme. The enzyme reacts with its substrate while being mostly in its ionized form. Release of p-nitrophenol is also favoured by this ionized form of the enzyme. However, the hydrolysis of the phosphoryl-enzyme complex mostly occurs from the protonated form of the enzyme. The ionization constants of the free enzyme and of the various enzyme-ligand complexes are very similar.

  14. Synthesis of 1-O-methylchlorogenic acid: reassignment of structure for MCGA3 isolated from bamboo (Phyllostachys edulis) leaves

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The first synthesis of 1-O-methylchlorogenic acid is described. The short and efficient synthesis of this compound provides laboratory-scale quantities of the material to investigate its biological properties. The synthesis involved C-1 alkylation of the known (-)-4,5-cyclohexylidenequinic acid lact...

  15. [Metabolism of Yarrowia lipolytica grown on ethanol under conditions promoting the production of alpha-ketoglutaric and citric acids: a comparative study of the central metabolism enzymes].

    PubMed

    Il'chenko, A P; Cherniavskaia, O G; Shishkanova, N V; Finogenova, T V

    2002-01-01

    A comparative study of the enzymes of the tricarboxylic acid (TCA) and glyoxylate cycles in the mutant Yarrowia lipolytica strain N1 capable of producing alpha-ketoglutaric acid (KGA) and citric acid showed that almost all enzymes of the TCA cycle are more active under conditions promoting the production of KGA. The only exception was citrate synthase, whose activity was higher in yeast cells producing citric acid. The production of both acids was accompanied by suppression of the glyoxylate cycle enzymes. The activities of malate dehydrogenase, aconitase, NADP-dependent isocitrate dehydrogenase, and fumarase were higher in cells producing KGA than in cells producing citric acid.

  16. Methods of combined bioprocessing and related microorganisms, thermophilic and/or acidophilic enzymes, and nucleic acids encoding said enzymes

    DOEpatents

    Thompson, David N; Apel, William A; Thompson, Vicki S; Ward, Thomas E

    2013-07-23

    A genetically modified organism comprising: at least one nucleic acid sequence and/or at least one recombinant nucleic